U.S. patent application number 14/641261 was filed with the patent office on 2015-11-05 for signal activatable constructs and related components compositions methods and systems.
The applicant listed for this patent is CALIFORNIA INSTITUTE OF TECHNOLOGY, CITY OF HOPE. Invention is credited to William A. GODDARD, III, Si-ping HAN, John J. ROSSI, Lisa SCHERER.
Application Number | 20150315581 14/641261 |
Document ID | / |
Family ID | 54354814 |
Filed Date | 2015-11-05 |
United States Patent
Application |
20150315581 |
Kind Code |
A1 |
HAN; Si-ping ; et
al. |
November 5, 2015 |
SIGNAL ACTIVATABLE CONSTRUCTS AND RELATED COMPONENTS COMPOSITIONS
METHODS AND SYSTEMS
Abstract
Provided herein are signal activatable molecular constructs for
delivery of molecules and related components, compositions,
methods, and systems, having a 17 to 30 by targeting domain duplex
RNA, at least one protection strand having a protection segment and
linker segment and a sensor strand having a displacement segment
and a toehold segment, in which in an inactive conformation the
protection segment and the displacement segment form a sensor
domain duplex polynucleotide covalently attached to the targeting
domain and presenting the toehold segment for binding to a signal
molecule. In an active conformation the sensor strand is bound to
the signal molecule and is detached from the at least one
protection strand and from the targeting domain; and the targeting
domain attaches the at least one protection strand in a
configuration allowing processing by Dicer and/or an Argonaute
enzyme.
Inventors: |
HAN; Si-ping; (YORBA LINDA,
CA) ; GODDARD, III; William A.; (PASADENA, CA)
; SCHERER; Lisa; (MONROVIA, CA) ; ROSSI; John
J.; (ALTA LOMA, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CALIFORNIA INSTITUTE OF TECHNOLOGY
CITY OF HOPE |
Pasadena
Duarte |
CA
CA |
US
US |
|
|
Family ID: |
54354814 |
Appl. No.: |
14/641261 |
Filed: |
March 6, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61948823 |
Mar 6, 2014 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/24.5 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2320/32 20130101; C12N 2320/50 20130101; C12N 2310/14
20130101; C12N 15/111 20130101; C12N 2310/531 20130101; C12N
2320/10 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Goverment Interests
STATEMENT OF GOVERNMENT GRANT
[0002] This invention was made with government support under Grant
No. 1332411 awarded by the National Science Foundation. The
government has certain rights in the invention.
Claims
1. A signal activatable construct for signal-activated molecular
delivery, the construct comprising a 17 to 30 bp targeting domain
duplex RNA having a guide strand complementarily bound to a
passenger strand, the targeting domain duplex RNA having opposite
ends each presenting a 5'-3' terminal base pair and being in a
configuration in which a distance between centers of the 5'-3'
terminal base pairs at the opposite ends is equal to the length of
the targeting domain .+-.25%, wherein in a first inactive
conformation of the activatable construct a 5' end of the passenger
strand is covalently attached to a 3' end of at least one
protection strand and a 3' end of the passenger strand is
covalently attached to a 5' end of the at least one protection
strand, the covalent attachment independently performed by a linker
segment of the at least one protection strand having a relaxed
average end-to-end distance of up to approximately 12 nm, a
protection segment of the at least one protection strand is
complementarily bound to at least one displacement segment of a
sensor strand to form a 14 to 30 bp sensor domain duplex
polynucleotide in which the sensor strand further comprises at
least one toehold segment presented for binding to a signal
molecule, and the targeting domain is in a configuration minimizing
processing by Dicer and/or an Argonaute enzyme of the targeting
domain; and wherein in a second activated conformation of the
activatable construct: the sensor strand is bound to the signal
molecule and is detached from the at least one protection strand
and from the targeting domain; and the targeting domain is in a
configuration allowing processing by Dicer and/or an Argonaute
enzyme in which a 5' end of the passenger strand is covalently
attached to a 3' end of at least one protection strand and a 3' end
of the passenger strand is covalently attached to a 5' end of the
at least one protection strand.
2. The signal activatable construct of claim 1 wherein the at least
one protection strand is formed by a 5' terminal protection strand
and a 3' terminal protection strand, each of the 5' terminal and 3'
terminal protection strand having a 5' end and a 3' end, the 5' end
of the 5' terminal protection strand being covalently attached to
the 3' end of the passenger strand, the 3' end of the 3' terminal
protection strand being covalently attached to the 5' end of the
passenger strand, wherein in the first inactive conformation, a
protection segment of each of the 5' terminal protection strand and
the 3' terminal protection strand is complementarily bound to the
at least one displacement segment of the sensor domain, thus
forming a 5' terminal protection segment and a 3' terminal
protection segment of the sensor domain duplex polynucleotide, with
a gap between the 3' end of the 5' terminal protection segment and
the 5' end of the 3' terminal protection segment, and in the second
activated conformation the 5' terminal protection strand is
presented as an overhang of the 3' end of the passenger strand and
the 3' terminal protection strand is presented as an overhang of
the 5' end of the passenger strand.
3. The signal activatable construct of claim 2, wherein the 5'
terminal protection strand comprises a modified polynucleotide
portion, and/or a phosphorothioate portion to form ae blocker
domain providing the 5' terminal protection strand with exonuclease
resistance, and the 3' terminal protection strand comprises a
modified polynucleotide portion, and/or a phosphorothioate portion
to form a blocker domain providing the 3' terminal protection
strand with exonuclease resistance.
4. The signal activatable construct of claim 1, wherein the sensor
strand comprises a modified polynucleotide portion, a non-nucleic
acid portion, and/or a phosphorothioate portion to form a blocker
domain providing the sensor strand with exonuclease resistance.
5. The signal activatable construct of claim 1, wherein the
passenger strand comprises a modified polynucleotide portion,
and/or a phosphorothioate portion to form a blocker domain of 1 to
5 nucleotides from the 5' terminus of the passenger strand
providing the passenger strand with exonuclease resistance.
6. The signal activatable construct of claim 1 wherein the at least
one toehold segment comprises a terminal toehold segment presented
at a 5' end or at a 3' end of the sensor strand.
7. The signal activatable construct of claim 1 wherein the at least
one toehold segment comprises a 5' toehold segment presented a 5'
end the sensor strand, and/or a 3' toehold segment presented a 3'
end the sensor strand, the 5' toehold segment and the 3' toehold
segment capable of binding a same or different signal molecule.
8. The signal activatable construct of claim 7, wherein, the 5'
toehold segment and/or the 3' toehold segment comprise a modified
polynucleotide portion, a non-nucleic acid portion, and/or a
phosphorothioate portion to form a blocker domain providing the 5'
toehold segment and/or the 3' toehold segment with exonuclease
resistance.
9. The signal activatable construct of claim 1 wherein the at least
one displacement segment comprises a 3' terminal displacement
segment and a 5' terminal displacement segment, a 5' end of the 3'
terminal displacement segment covalently attached to a 3' end of a
central toehold segment, a 3' end of the 5' terminal displacement
segment covalently attached to a 5' and of the central toehold
segment.
10. The signal activatable construct of claim 1, wherein the
distance between centers of the 5'-3' terminal base pairs at the
opposite ends is equal to the length of the targeting domain
.+-.5%.
11. The signal activatable construct of claim 1, wherein the
distance between centers of the 5'-3' terminal base pairs at the
opposite ends is equal to the length of the targeting domain
.+-.1%.
12. The signal activatable construct of claim 1, wherein the linker
segment of the at least one protection strand having a relaxed
average end-to-end distance of approximately less than 5 nm
13. The signal activatable construct of claim 1, wherein the linker
segment of the at least one protection strand having a relaxed
average end-to-end distance of between approximately 0.3 nm and
approximately 2 nm.
14. The signal activatable construct of claim 1, wherein the
targeting domain and the sensor domain duplex polynucleotide have
approximately a same length.
15. The signal activatable construct of claim 1, wherein the
targeting domain has a length of approximately 23 to 25 bp.
16. The signal activatable construct of claim 1, wherein the
targeting domain configured to interfere with a target
intracellular process of the cells through RNAi in presence of the
signal polynucleotide.
17. The signal activatable construct of claim 16, wherein the
targeting domain comprises an siRNA, microRNA, and/or additional
duplex structure suitable to be used in connection with RNA
interfering.
18. A method for signal-activated molecular delivery, the method
comprising: contacting the signal activatable construct of claim 1
with the signal molecule for a time and under condition to allow
release of the targeting domain from the molecular complex.
19. A system for signal-activated molecular delivery, the system
comprising: at least two of one or more signal activatable
constructs of claim 1 and a signal polynucleotide complementary to
the at least one toehold segment of the signal activatable
construct, for simultaneous, combined, or sequential use to control
release of the targeting domain from the one or more of the signal
activatable constructs of claim 1.
20. A composition comprising one or more of the signal activatable
construct of claim 1 together with a suitable vehicle.
21. A method for treating a disease in an individual through
enzyme-assisted signal activated molecular delivery in cells, the
method comprising: administering to the individual an effective
amount of one or more of the signal activatable construct of claim
1.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Provisional
Application No. 61/948,823, filed on Mar. 6, 2014 with docket
number CIT6834-P, which is incorporated herein by reference in its
entirety. This application is also related to U.S. application Ser.
No. 13/848,687 entitled "Targeting Domain and Related Signal
Activated Molecular Delivery" filed on Mar. 21, 2013 with Docket
No. P1210-US, which claims priority to U.S. Provisional Application
entitled "Pseudoknot construct for signal activated RNA
interference" Ser. No. 61/613,617, filed on Mar. 21, 2012, Docket
No. CIT6141-P, the disclosure of which is incorporated herein by
reference in its entirety. The Application is also related to U.S.
Provisional Application entitled "Controlled Release of Therapeutic
Cargo by Exonucleases" Ser. No. 61/731,420, filed on Nov. 29, 2012,
Docket No. CIT6397-P, the disclosure of which is incorporated
herein by reference in its entirety. This application is also
related to U.S. application Ser. No. 14/093,387 entitled
"Exonuclease Resistant Polynucleotide and Related Duplex
Polynucleotides, Constructs, Compositions, Methods and Systems"
filed on Nov. 29, 2013 with Docket No. P1210-USCIP, which claims
priority to U.S. Provisional No. 61/613,617, and U.S. Provisional
Application No. 61/731,420, filed on Nov. 29, 2012, Docket No.
CIT6397-P, the disclosure of which is incorporated herein by
reference in its entirety. The present application might also be
related to U.S. application entitled "Signal Activated Molecular
Delivery" Ser. No. 13/167,672 filed on Jun. 23, 2011 with Docket
No. P823-US, and to International Application "Signal Activated
Molecular Delivery" Serial No. PCT/US 11/41703 filed on Jun. 23,
2011 with Docket No. P823-PCT, the disclosure of each of which is
also incorporated by reference in its entirety.
BACKGROUND
[0003] Molecular delivery has been a challenge in the field of
biological molecule analysis, in particular when aimed at obtaining
controlled delivery of analytes of interest to specific
environments. Whether for medical applications or for fundamental
biology studies, several methods are commonly used for the delivery
of various classes of biomaterials and biomolecules.
[0004] Controlled delivery of targets to specific environments,
e.g., specific cell types and/or tissues of individuals in vitro
and/or in vivo, is currently still challenging, especially when
directed at providing controlled release of the target in a
controllable conformation, typically associated to a biological
activity.
SUMMARY
[0005] Provided herein, are signal activatable constructs for
molecular delivery, and related components, compositions, methods
and systems and in particular tile-like pseudoknot structures for
signal activated molecular delivery and related components
compositions methods and systems. In several embodiments, signal
activatable constructs herein described comprise activatable
molecular complexes and activated complexes suitable for controlled
release of a targeting domain, which can comprise molecules of
various chemical natures.
[0006] According to a first aspect described herein are signal
activatable constructs for signal-activated molecular delivery,
comprising a 17 to 30 bp targeting domain duplex RNA having a guide
strand complementarily bound to a passenger strand, the targeting
domain duplex RNA also having opposite ends and being in a
configuration where the opposite ends, each presenting a 5'-3'
terminal base pair and being in a configuration in which a distance
between centers of the 5'-3' terminal base pairs at the opposite
ends is equal to the length of the targeting domain .+-.25%. In a
first inactive conformation of the activatable construct, a 5' end
of the passenger strand is covalently attached to a 3' end of at
least one protection strand and a 3' end of the passenger strand is
covalently attached to a 5' end of the at least one protection
strand, the covalent attachment independently performed by a linker
segment of the at least one protection strand having a relaxed
average end-to-end distance of up to approximately 12 nm. In the
first inactive conformation of the activatable construct, a
protection segment of the at least one protection strand is
complementarily bound to at least one displacement segment of a
sensor strand to form a 12 to 30 bp sensor domain duplex
polynucleotide in which the sensor strand further comprises at
least one toehold segment presented for binding to a signal
molecule. In the first inactive conformation of the activatable
construct herein described, the targeting domain is in a
configuration minimizing processing by Dicer and/or an Argonaute
enzyme of the targeting domain. In a second activated conformation
of the activatable construct the sensor strand is bound to the
signal molecule and is detached from the at least one protection
strand and from the targeting domain and the targeting domain is in
a configuration allowing processing by Dicer and/or an Argonaute
enzyme in which a 5' end of the passenger strand is covalently
attached to a 3' end of at least one protection strand and a 3' end
of the passenger strand is covalently attached to a 5' end of the
at least one protection strand.
[0007] According to a second aspect, a molecular complex for
signal-activated molecular delivery, and related compositions,
methods, and systems, are described. The molecular complex
comprises a targeting domain and a sensor domain. In the molecular
complex, the targeting domain comprises a targeting domain duplex
RNA having a length of about 17 to about 30 bp and comprising a
guide strand complementarily bound to a passenger strand, each of
the guide strand and the passenger strand having a 5' end and a 3'
end. In the molecular complex, the sensor domain comprises a sensor
domain duplex polynucleotide having a length of about 12 to about
30 bp and comprising a sensor strand complementarily bound to a
first, 5' terminal protection strand, and to a second 3' terminal
protection strand. In the sensor domain, the sensor strand
comprises a displacement segment and a toehold segment each having
a 5' end and a 3' end. In the sensor domain, the first 5' terminal
protection strand comprise a 5' terminal protection segment 5'
terminal linker segment each having a 5'end and a 3' end the 5'
terminal linker segment covalently attached at the 5' end of the
first 5' terminal protection segment. In the sensor domain, the
second 3' terminal protection strand comprise a 3' terminal
protection segment and a 3' terminal linker segment each having a
5'end and a 3' end, the second 3' terminal linker segment
covalently attached at the 3' end of the second 3' terminal
protection segment. In the first 5' terminal protection strand and
the second 3' terminal protection strand, each of the 5' terminal
linker segment and 3' terminal linker segment having independently
a relaxed average end-to-end distance of up to approximately 12
nm.
[0008] In the sensor strand, the displacement segment is bound to a
same toehold segment through covalent attachment of the 5' end of
the displacement segment to the 3' end of the same toehold segment,
or through covalent attachment of the 5' end of the displacement
segment to the 3' end of the same toehold segment, with the toehold
segment presented for binding to a signal molecule. In the first 5'
terminal protection strand the first, 5' terminal protection
segment is covalently attached to the 3' end of the passenger
strand through covalent direct attachment of the 5' linker segment,
and the 3' terminal protection strand is covalently attached to the
5' end of the passenger strand through covalent direct attachment
of the 3' linker segment. In the sensor domain, each of the first
5' terminal protection segment and the second 3' terminal
protection segment is complementary bound to the displacement
segment of the sensor strand, with a gap between the 3' end of the
first 5' terminal protection segment and the 5' end of the second
3' terminal protection segment.
[0009] In the molecular complex, the targeting domain, the first 5'
terminal protection segment, the second 3' terminal protection
segment, the displacement segment, and the toehold segment are in a
configuration minimizing processing by Dicer and/or an Argonaute
enzyme of the targeting domain. In the molecular complex, the
targeting domain, the first 5' terminal protection segment, the
second 3' terminal protection segment, the displacement segment,
and the toehold segment are configured so that upon binding of the
signal molecule to the toehold segment, the displacement segment is
displaced from the protection segment, the sensor strand forms a
sensor strand-signal molecule complex detached from the targeting
domain, and the targeting domain is in a configuration allowing
processing by Dicer and/or an Argonaute enzyme of the targeting
domain presents in which the first 5' terminal protection strand as
an overhang of the 3' end of the passenger strand and the second 3'
terminal protection strand as an overhang of the 5' end of the
passenger strand.
[0010] The composition comprises one or more molecular complexes
herein described together with a suitable vehicle. The method
comprises: contacting the molecular complex with the signal
molecule for a time and under condition to allow release of the
targeting domain from the molecular complex. The system comprises:
at least two of a molecular complex and a signal molecule
complementary to the toehold segment of the molecular complex, for
simultaneous combined or sequential use to control release of the
targeting domain from the molecular complex according to the
methods herein described.
[0011] According to a third aspect, an activatable molecular
complex and related, activated complexes, compositions, methods,
and systems are described. The activatable molecular complex
comprises a targeting domain, a first 5' terminal protection
strand, a second 3' terminal protection strand and a sensor strand.
In the activatable molecular complex, the targeting domain
comprises a targeting domain duplex RNA having a length of about 17
to about 30 bp and comprising a guide strand complementarily bound
to a passenger strand, each of the guide strand and passenger
strand having a 5' end and a 3' end. In the activatable molecular
complex, the first 5' terminal protection strand comprise a 5'
terminal protection segment 5' terminal linker segment each having
a 5'end and a 3' end the 5' terminal linker segment covalently
attached at the 5' end of the first 5' terminal protection segment.
In the activatable construct, the second 3' terminal protection
strand comprise a 3' terminal protection segment and a 3' terminal
linker segment each having a 5'end and a 3' end, the second 3'
terminal linker segment covalently attached at the 3' end of the
second 3' terminal protection segment. In the first 5' terminal
protection strand and the second 3' terminal protection strand,
each of the 5' terminal linker segment and 3' terminal linker
segment having independently a relaxed average end-to-end distance
of up to approximately 12 nm.
[0012] In the first 5' terminal protection strand the first, 5'
terminal protection segment is covalently attached to the 3' end of
the passenger strand through covalent direct attachment of the 5'
linker segment, and the 3' terminal protection strand is covalently
attached to the 5' end of the passenger strand through covalent
direct attachment of the 3' linker segment.
[0013] In the activatable molecule complex the sensor strand
comprises a displacement segment having a 5' end and a 3' end; and
at least one toehold segment having a 5' end and a 3' end. In the
sensor strand, the displacement segment is bound to a same toehold
segment through covalent attachment of the 5' end of the
displacement segment to the 3' end of the toehold segment, or
through covalent attachment of the 5' end of the displacement
segment to the 3' end of the toehold segment.
[0014] The activatable molecular complex is configured to exhibit a
first conformation and a second, activated, conformation, wherein,
in the first conformation, each of the first 5' terminal protection
segment and the second 3' terminal protection segment is
complementarily bound to the displacement segment, thus forming a
sensor domain duplex polynucleotide having a length of about 12 to
about 30 bp and with a gap between the 3' end of the first 5'
terminal protection segment and the 5' end of the second 3'
terminal protection segment, and the at least toehold segment is
presented for binding to the signal molecule. In the first
conformation of the activatable complex, the sensor domain is bound
to the targeting domain through covalent attachment of the 5' end
of the first 5' terminal linker segment to the 3' end of passenger
strand, and through covalent attachment of the 3' end of the second
3' terminal linker segment to the 5' end of passenger strand. In
the first conformation of the activatable complex the targeting
domain is in a conformation configured to minimize processing by
Dicer and/or an Argonaute enzyme.
[0015] In the activatable molecular complex, in the second,
activated conformation the sensor strand complementarily binds the
signal molecule, forming a sensor strand-signal molecule complex
detached from the targeting domain, and the targeting domain
presents the first 5' terminal protection strand as an overhang of
the 3' end of the passenger strand and the second 3' terminal
protection strand as an overhang of the 5' end of the passenger
strand. In the activatable molecular complex, in the second
activated conformation, the targeting domain is in a conformation
configured to allow processing by Dicer and/or an Argonaute
enzyme.
[0016] The composition comprises one or more activatable complexes
and a suitable vehicle. The method comprises contacting an
activatable molecular complex with a signal molecule capable of
binding to the toehold segment of the activatable molecular complex
for a time and under condition to allow release of the targeting
domain from the molecular complex. The system comprises at least
two of one or more activatable molecular complexes and a signal
molecule capable of binding to the toehold segment of the molecular
complexes, for simultaneous combined or sequential use to control
release of the targeting domain from the molecular complex.
[0017] According to fourth aspect, an activated molecular complex
and related compositions, methods, and systems are described. The
activated molecular complex comprises a targeting domain presenting
a first 5' terminal overhang and a second 3' terminal overhang. In
the activated molecular complex, the targeting domain comprises a
targeting domain duplex RNA having a length of about 17 to about 30
bp and comprising a guide strand complementarily bound to a
passenger strand, each of the guide strand and passenger strand
having a 5' end and a 3' end. In the activated molecular complex,
the first 5' terminal overhang is attached to the 3' end of the
passenger strand through covalent attachment of a 5' linker
segment, the second 3' terminal overhang is attached to the 5' end
of the passenger strand through covalent attachment of a 3' linker
segment. In the activated molecular complex, the targeting domain
is in a conformation configured to allow processing by Dicer and/or
an Argonaute enzyme.
[0018] The related composition comprises one or more activated
molecular complexes and a suitable vehicle. The related method to
provide the activated molecular complex comprises contacting the
activatable molecular complex herein described in the first
condition, with a signal molecule capable of binding the toehold
segment to allow switching of the molecular complex from the first
condition to the second activated condition of the molecular
complex. The related method for controlled release of a targeting
domain from an activated complex comprises: contacting the
activated molecular complex with a signal molecule capable of
binding to the toehold segment for a time and under condition to
allow release of the targeting domain from the activated molecular
complex.
[0019] According to a fifth aspect, an exonuclease-resistant
molecular complex for enzyme-assisted molecular delivery, and
related compositions, methods, and systems, are described. The
exonuclease resistant molecular complex comprises a targeting
domain and a sensor domain. In the exonuclease-resistant molecular
complex, the targeting domain comprises a targeting domain duplex
RNA having a length of about 17 to about 30 bp and comprising a
guide strand complementarily bound to a passenger strand, each of
the guide strand and passenger strand having a 5' end and a 3' end,
the guide strand and/or passenger strand possibly comprising a
modified polynucleotide portion, a non-nucleic acid portion, and/or
a phosphorothioate portion. In the exonuclease-resistant molecular
complex, the sensor domain comprises a sensor domain duplex
polynucleotide having a length of about 14 to about 30 bp and
comprising a sensor strand complementarily bound to a first 5'
terminal protection segment and a second 3' terminal protection
segment each having a 5' end and a 3' end, each of the first 5'
terminal protection segment and the second 3' terminal protection
segments comprising a modified polynucleotide portion, a
non-nucleic acid portion, and/or a phosphorothioate portion. In the
sensor domain, each of the first 5' terminal protection segment and
the second 3' terminal protection segment is complementary bound to
a displacement segment of the sensor strand, with a gap between the
3' end of the first 5' terminal protection segment and the 5' end
of the second 3' terminal protection segment.
[0020] In the sensor domain, the sensor strand comprises the
displacement segment and a toehold segment each having a 5' end and
a 3' end, the displacement segment comprising a modified
polynucleotide portion, and/or a phosphorothioate portion and/or
the toehold segment comprising a modified polynucleotide portion, a
non-nucleic acid portion, and/or a phosphorothioate portion. In the
sensor strand, the displacement segment is bound to a same toehold
segment through covalent attachment of the 5' end of the
displacement segment to the 3' end of the toehold segment, or
through covalent attachment of the 5' end of the displacement
segment to the 3' end of the toehold segment, with the toehold
segment presented for binding to a signal molecule. In the sensor
domain, each of the first 5' terminal protection segment and the 3'
terminal second protection segment is complementary bound to the
displacement segment of the sensor strand, with a gap between the
3' end of the protection segment and the 5' end of the second
protection segment. In the exonuclease-resistant molecular complex,
the sensor domain is bound to the targeting domain through covalent
attachment of the 5' end of the first 5' terminal protection
segment to the 3' end of passenger strand via a 5' terminal linker
segment having a relaxed average end-to-end distance of up to
approximately 12 nm, the sensor domain further bound to the
targeting domain, and through covalent attachment of the 3' end of
the second 3' terminal protection segment to the 5' end of
passenger strand via a 5' terminal linker segment having a relaxed
average end-to-end distance of up to approximately 12 nm.
[0021] In the exonuclease-resistant molecular complex, the
targeting domain, the first 5' terminal protection segment, the
second 3' terminal protection segment, the displacement segment,
and the toehold segment are configured so that upon binding of the
signal molecule to the toehold segment, the displacement segment is
displaced from the first 5' terminal protection segment and the
second 3' terminal protection segment, the sensor strand forms a
sensor strand-signal molecule complex detached from the targeting
domain, and the targeting domain presents the first 5' terminal
protection segment as an overhang of the 3' end of the passenger
strand and the second 3' terminal protection segment as an overhang
of the 5' end of the passenger strand
[0022] The composition comprises one or more exonuclease-resistant
molecular complexes herein described together with a suitable
vehicle. The method comprises: contacting the molecular complex
with the signal molecule for a time and under condition to allow
release of the targeting domain from the molecular complex. The
system comprises: at least two of a molecular complex and a signal
molecule capable of binding to the toehold segment of the molecular
complex, for simultaneous combined or sequential use to control
release of the targeting domain from the molecular complex
according to the methods herein described.
[0023] According to sixth aspect, a method for treating a disease
in an individual through signal activated molecular delivery in
cells, and related compositions and systems, are described. The
method comprises administering to the individual an effective
amount of one or more of the signal activatable constructs herein
described and in particular one or more of the molecular complexes,
activatable molecular complex, activated complexes and/or
exonuclease resistant complexes herein described. The related
pharmaceutical composition comprises one or more signal activatable
constructs herein described, and in particular one or more of the
molecular complexes, activatable molecular complex, activated
complexes and/or exonuclease resistant complexes herein described,
with a pharmaceutical acceptable vehicle.
[0024] According to a seventh aspect, complexes herein described
can be provided by a method comprising providing a first
polynucleotide strand, a second polynucleotide strand and a third
polynucleotide strand. The first polynucleotide strand comprises
the guide strand of the complexes herein described. The second
polynucleotide strand comprises from the 5' end to 3' end the first
5' terminal protection segment, the passenger strand, and the
second 3' terminal protection segment. The third polynucleotide
strand comprises a displacement segment and a toehold segment in
any one of the configuration of the complexes herein described. The
method further comprises contacting the first polynucleotide
strand, the second polynucleotide strand, and the third
polynucleotide strand for a time and under condition to allow
annealing of the strands to form the signal-activatable molecular
complex of herein disclosed.
[0025] The constructs, systems, compositions, and methods herein
described allow in several embodiments to perform cell type
specific molecular delivery.
[0026] The constructs, systems, compositions, and methods herein
described also allow in several embodiments integration of signal
detection, signal transduction, and targeting in a single compact
molecular construct with easier delivery and/or administration as
well as enhanced efficiency of signal transduction with respect to
some approaches of the art.
[0027] The constructs, systems, compositions, and methods herein
described also allow in several embodiments intracellular
information processing and controlling, in which the presence of
one set of biomolecules (e.g., protein or nucleic acid) is coupled
with inhibition or activation of another set of biomolecules in the
cells.
[0028] The methods and systems herein described can be used in
connection with applications wherein cell-type specific modulation
of cells is desired, including but not limited to medical
application, biological analysis, research and diagnostics
including but not limited to clinical, therapeutic, and
pharmaceutical applications, such as cell type specific drug
delivery, cell type specific modeling or therapy, including but not
limited to gene therapy and RNAi.
[0029] The details of one or more embodiments of the disclosure are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages will be apparent from the
description and drawings, and from the claims.
BRIEF DESCRIPTION OF DRAWINGS
[0030] The accompanying drawings, which are incorporated into and
constitute a part of this specification, illustrate one or more
embodiments of the present disclosure and, together with the
description of example embodiments, serve to explain the principles
and implementations of the disclosure.
[0031] FIGS. 1A-1C illustrate a three-dimensional model of an
exemplary model 22 base-pair targeting domain FIG. 1A illustrates
the front view of the three-dimensional model. FIG. 1B shows a zoom
in of the 5'-3' base pair of Atom 1 of FIG. 1A, and FIG. 1C shows a
zoom in of the 5'-3' base pair of Atom 2 of FIG. 1A.
[0032] FIGS. 2A-2B illustrate a three-dimensional model of an
exemplary 22 base-pair targeting domain that is bent in the middle
into two 11 base-pair segments. FIG. 2A shows measurement of
distances between several pairs of atoms to estimate a true center
to center distance, FIG. 2B shows a bottom up view of both
base-pairs used for the measurement.
[0033] FIGS. 3A-B show a schematic illustration of signal-activated
molecular constructs according to embodiments herein described
showing the OFF inactive conformation (FIG. 3A) and the ON active
conformation (FIG. 3B). The exemplary construct illustrated in
FIGS. 3A and 3B (AB-CDE) comprises a guide strand A (SEQ ID NO. 1),
a passenger strand B (SEQ ID NO. 3) which further comprises a
first, 5' protection segment C (SEQ ID NO: 4) and a second, 3'
protection segment D (SEQ ID NO: 2) connected to the passenger
strand B (SEQ ID NO: 3) by C3 linkers L5' and L3' (indicated by
black lines), and a sensor strand E (SEQ ID NO. 5) that comprises
the displacement segment ED (SEQ ID NO: 7) and a 5' toehold segment
ET (SEQ ID NO: 6). The 5' ends of the guide strand and the toehold
further comprise PEG linkers, indicated by black lines with black
circles on the ends.
[0034] FIG. 4 shows a diagram schematically illustrating the angle
between termini on RNA helices in RNA duplexes, which have helical
twists of .about.11 base pairs per 360 degrees.
[0035] FIGS. 5A-B show a three-dimensional model of a targeting
duplex and a sensor duplex of an exemplary signal-activated
molecular construct comprising a tile saRNA. FIG. 5A illustrates
the front view of the three-dimensional model, showing that the two
duplexes are configured so that the Dicer cleavage sites of the
targeting duplex and the sensor duplex are oriented towards the
interior of the two duplexes. FIG. 5B illustrates the top view of
the three-dimensional model.
[0036] FIGS. 6A-C show a three-dimensional model of a 23 base pair
targeting duplex and a 23 base pair sensor duplex of an exemplary
signal-activated molecular construct comprising a tile saRNA as
shown in FIGS. 3A and 3B. FIG. 6A illustrates the front view of the
three-dimensional model. FIG. 6B shows the right side view of the
same three-dimensional model, and FIG. 6C illustrates the top view
of the three dimensional model shown in FIG. 6B and FIG. 6C.
[0037] FIGS. 7A-C illustrate a three-dimensional model of an
exemplary signal-activated tile saRNA comprising a targeting and
sensor duplexes as in FIGS. 6A-C, wherein the targeting and sensor
duplexes are each 25 base pairs long. FIG. 7A illustrates the front
view of the three-dimensional model. FIG. 7B shows the right side
view of the same three-dimensional model, and FIG. 7C illustrates
the top view of the three dimensional model shown in FIG. 7B and
FIG. 7C.
[0038] FIGS. 8A-C illustrate a three-dimensional model of an
exemplary signal-activated tile saRNA comprising a targeting and
sensor duplexes as in FIGS. 6A-C, wherein the targeting and sensor
duplexes are each 27 base pairs long. FIG. 8A illustrates the front
view of the three-dimensional model. FIG. 8B shows the right side
view of the same three-dimensional model, and FIG. 8C illustrates
the top view of the three dimensional model shown in FIG. 8B and
FIG. 8C.
[0039] FIG. 9 (panels A-D) shows a schematic representation of an
exemplary method to release a targeting domain from the exemplary
molecular construct AB-CDE of FIGS. 3A and 3B having a guide strand
A (SEQ ID NO. 1), a passenger strand B (SEQ ID NO. 3) attaching at
the 5' terminus a first, 5' protection segment C (SEQ ID NO: 4) and
attaching at the 3' terminus a second, 3' protection segment D (SEQ
ID NO: 2) connected to the passenger strand B (SEQ ID NO: 3) by C3
linkers L5' and L3' (indicated by black lines), and a sensor strand
E (SEQ ID NO. 5) (FIG. 9, panel A). Following binding of an
activating RNA transcript to the toehold of the sensor strand E
(FIG. 9, panel B), the activation RNA transcript displaces the base
pairing between the 5' protection segment D and the 3' protection
segment C and the sensor strand E (FIG. 9, panel C), leading to
dissociation of the targeting duplex from the sensor duplex in an
active state (FIG. 9, panel D).
[0040] FIGS. 10A-B illustrate a schematic representation of an
exemplary signal activated molecular construct ABCDE comprising
A(SEQ ID NO: 1) B(SEQ ID NO: 3) -C(SEQ ID NO: 4) D(SEQ ID NO: X2)
E(SEQ ID NO: 5) L5' and L3' of FIGS. 3A and 3B (FIG. 10A) compared
to exemplary signal-activated molecular construct G3A8B12 of
related application No. 61/613,617 (FIG. 10B) in which A indicates
the guide strand (SEQ ID NO: 113) B1 (SEQ ID NO:114) and B2 (SEQ ID
NO:118) indicate the two portion of a nicked passenger strand, D
indicates an element comprising a toehold (SEQ ID NO: 116) and a
displacement segment Ds (SEQ ID NO: 115) attached by a C3 linker.
In FIG. 10B, element C indicates an activation segment (SEQ ID NO:
117).
[0041] FIGS. 11A-B show the line drawing illustrations of
structures of exemplary chemical groups comprised in the exemplary
signal activated molecular constructs of the present disclosure.
FIG. 11A illustrates the chemical structure of the C6 amino
chemical group modification from GE Dharmacon. FIG. 11B illustrates
the chemical structure of the 3AmMO 3' amino chemical group
modification from IDT.
[0042] FIGS. 12A-B show a schematic illustration of an exemplary
signal-activated molecular construct G6L1M according to embodiments
herein described showing the OFF inactive conformation (FIG. 12A)
and the ON active conformation (FIG. 12B). The construct G6L1M1
comprises a guide strand G6 (SEQ ID NO. 8), a passenger strand L1Ps
(SEQ ID NO. 10) which attaches a first (5') protection segment
L1P5'' (SEQ ID NO: 11) and a second (3') protection segment L1P3'
(SEQ ID NO: 9) through C3 linkers L1L5' and L1L3' (indicated by
black lines). The construct G6L1M1 further includes a sensor strand
M1 (SEQ ID NO. X12 which includes a displacement segment M1D and a
5' toehold segment M1T. The 5' ends of the guide strand and the
toehold further comprise 3.times.EG linkers, indicated by dashed
lines with black unfilled circles on the ends.
[0043] FIGS. 13A-B show a schematic illustration of an exemplary
signal-activated molecular construct G6L1X1 according to
embodiments herein described in the OFF inactive conformation (FIG.
13A) and in the ON active conformation (FIG. 13B). The exemplary
construct G6L1X1 comprises a guide strand G6 (SEQ ID NO.8),
passenger strand L1PS (SEQ ID NO. 10) 5' protection segment L1P5''
(SEQ ID NO: 11) and a 3' protection segment L1P3'' (SEQ ID NO: 9)
attached to the passenger strand L1PS (SEQ ID NO: 10) by C3 linkers
L1L5' and L1L3' (indicated by black lines) and a sensor strand X1
(SEQ ID NO. 13) comprising a displacement segmentX1D (SEQ ID NO:
15) and a 5' toehold segment X1T (SEQ ID NO: 14). The various
strands of the signal-activated constructs comprise unmodified RNA
bases, 2'-O-methyl RNA bases (indicated by mN, wherein N is any of
the four bases), LNA (indicated by +), phosphorothioate linkages
(indicated by an asterisk *), primary amine groups (indicated by
NH2), PEG linkers (indicated by black lines with black circles on
ends), C3 linkers (indicated by black lines), 3.times. or
6.times.EG linkers (indicated by dashed lines with black unfilled
circles on ends), and inverted dT exonuclease blockers (indicated
by idT). The switching from one conformation to another is
performed through displacement of the sensor strand from the 5' and
3' protection segments following binding of a signal strand S1 (SEQ
ID NO. 41); labeled Tat 28 bp Signal) to the toehold and
displacement segment of signal strand X1.
[0044] FIGS. 14A-B show a schematic illustration of an exemplary
signal-activated molecular complex, G6L2X2, comprising a guide
strand G6 (SEQ ID NO. 8), a passenger strand L2PS (SEQ ID NO. 17) a
5' protection segment L2P5' (SEQ ID NO: 18) and a 3' protection
segment L2P3' (SEQ ID NO: 16) attached to the passenger strand L2PS
(SEQ ID NO. 17) by C3 linkers L2L5' and L2L3' (indicated by black
lines), and a sensor strand X2 (SEQ ID NO. 19) comprising a toehold
segment X2T (SEQ ID NO:20) and a displacement segment X2D (SEQ ID
NO: 21). In particular, FIG. 14A shows the inactive OFF
conformation of the molecular construct and FIG. 14B shows the
active ON conformation of the molecular construct after binding of
signal strand S1 (SEQ ID NO. 41).
[0045] FIGS. 15A-B show a schematic illustration of an exemplary
signal-activated molecular complex, G6L2X3, comprising a guide
strand G6 (SEQ ID NO. 8), a passenger strand L2PS (SEQ ID NO. 17)
which further comprises a 5' protection segment L2P5' (SEQ ID NO:
18) and a 3' protection segment L2P3' (SEQ ID NO: 16) connected to
the passenger strand L2PS (SEQ ID NO. 17) by C3 linkers L2L5' and
L2L3' (indicated by black lines), and a sensor strand X3 (SEQ ID
NO. 22) comprising a toehold segment X3T (SEQ ID NO:23) and a
displacement segment X2D (SEQ ID NO: 24). In particular, FIG. 15A
shows the inactive OFF conformation and FIG. 15B shows the active
ON conformation of the molecular construct after binding of signal
strand S1 (SEQ ID NO. 41).
[0046] FIGS. 16A-B show a schematic illustration of an exemplary
signal-activated molecular complex, G6L2X5, comprising a guide
strand G6 (SEQ ID NO. 8), a passenger strand L2Ps (SEQ ID NO. 17)
which attaches 5' protection segment L2P5' (SEQ ID NO: 18) and a 3'
protection segment L2P3' (SEQ ID NO: 16) modified to include
phosphorothioate linkages as indicated in the figure and connected
to the passenger strand L2PS (SEQ ID NO: 17) by C3 linkers L2L5'
and L2L3' (indicated by black lines), and a sensor strand X5 (SEQ
ID NO. 25) comprising a toehold segment X5T (SEQ ID NO:26) and a
displacement segment X5D (SEQ ID NO: 27) also modified to include
phosphorothioate linkages as indicated in the figure. In
particular, FIG. 16A shows the inactive OFF conformation and FIG.
16B shows the active ON conformation of the molecular construct
after binding of signal strand S2 (SEQ ID NO. 42).
[0047] FIGS. 17A-B show a schematic illustration of an exemplary
signal-activated molecular complex, G6L2X6, comprising a guide
strand G6 (SEQ ID NO. 8), a passenger strand L2PS (SEQ ID NO. 17)
which attaches a 5' protection segment L2P5' (SEQ ID NO: 18) and a
3' protection segment L2P3' (SEQ ID NO: 16) modified to include
phosphorothioate linkages as indicated in the figure and connected
to the passenger strand L1P6 (SEQ ID NO: 17) by C3 linkers L2L5'
and L2L3' (indicated by black lines), and a sensor strand X6 (SEQ
ID NO. 28) comprising a toehold segment X6T (SEQ ID NO:29) and a
displacement segment X6D (SEQ ID NO: 30) also modified to include
phosphorothioate linkages as indicated in the figure. In
particular, FIG. 17A shows the inactive OFF conformation and FIG.
17B shows the active ON conformation of the molecular construct
after binding of signal strand S2 (SEQ ID NO. 42).
[0048] FIGS. 18A-C show a schematic illustration of exemplary 5'
sensor strand toeholds of an exemplary signal-activated molecular
construct according to embodiments herein described. FIG. 18A shows
the 5' toehold X3T (SEQ ID NO: 23) of construct G6L2X3 (FIG. 15A
and FIG. 15B), which comprises six base pairs complementary to a
signal strand and a mismatch to said strand at position 7 of the
toehold. FIG. 18B illustrates the 5' toehold X5T (SEQ ID NO: 26) of
construct G6L2X5 (FIG. 16A and FIG. 16B), which comprises eight
base pairs complementary to a signal strand and has no mismatches.
FIG. 18C illustrates the 5' toehold X6T (SEQ ID NO: 29) of
construct G6L2X6 (FIG. 17A and FIG. 17B), which comprises eight
base pairs complementary to a signal strand, has no mismatches, and
further comprises an LNA modified base.
[0049] FIG. 19 shows the exemplary molecular construct AB1-C1D1E1
having a guide strand A (SEQ ID NO. 1), a passenger strand B1 (SEQ
ID NO.45) attaching at the 5' terminus a second, 5' protection
segment C1 (SEQ ID NO: 46) and attaching at the 3' terminus a
first, 3' protection segment D1 (SEQ ID NO: 44) connected to the
passenger strand B1 (SEQ ID NO:45) by C3 linkers L15' and L13'
(indicated by black lines), and a sensor strand E1 (SEQ ID NO. X).
Sensor E1 comprises displacement segment E1D (SEQ ID NO: 47) a
first toehold segment E1T1 (SEQ ID NO:48) attached at the 5'
terminus of the displacement segment E1D (SEQ ID NO: 49) and an
additional toehold E1T2.(SEQ ID NO: 50)attached at the 3' terminus
of the displacement segment E1D (SEQ ID NO: 49).
[0050] FIG. 20 shows the exemplary molecular construct A-B2C2D2-E2
having a guide strand A (SEQ ID NO. 1), a passenger strand B2 (SEQ
ID NO.53) attaching at the 5' terminus a second, 5' protection
segment C2 (SEQ ID NO: 54) and at the 3' terminus a first, 3'
protection segment D2 (SEQ ID NO: 52) attached to the passenger
strand B2 (SEQ ID NO: 53) by C3 linkers L2-5' and L2-3' (indicated
by black lines), and a sensor strand E2 (SEQ ID NO. 55). Sensor E2
comprises two displacement segments E2D1 (SEQ ID NO: 57) and E2D2
(SEQ ID NO:58) and an internal toehold segment E2T (SEQ ID
NO:56).
[0051] FIGS. 21A and FIG. 21B show the exemplary molecular
construct A-B3C3D3-E3 having a guide strand A (SEQ ID NO. 1), a
passenger strand B3 (SEQ ID NO.61) attaching at the 5' terminus a
second, 5' protection segment C3 (SEQ ID NO: 62) and attaching at
the 3' terminus a first, 3' protection segment D3 (SEQ ID NO: 60)
connected to the passenger strand B3 (SEQ ID NO: 61) by C3 linkers
L3-5' and L3-3' (indicated by black lines), and a sensor strand E3
(SEQ ID NO. 63). Sensor E3 comprises two displacement segments E3D1
(SEQ ID NO: 65) and E3D2 (SEQ ID NO:66), an internal toehold
segment E3T1 (SEQ ID NO:64) and a second toehold at the 3; terminus
E3T2 (SEQ ID NO: 67). FIG. 21A shows a schematic of the interaction
of a first activation sequence with 3' terminal toehold E3T2 (SEQ
ID NO:67). FIG. 21B shows a schematic of the interaction of a first
activation sequence with 3' terminal toehold E3T1 (SEQ ID
NO:64).
[0052] FIG. 22A and FIG. 22B shows the exemplary molecular
construct A-B4C4D4-E4 having a guide strand A (SEQ ID NO. 1), a
passenger strand B4 (SEQ ID NO.71) attaching at the 5' terminus the
3' terminus of a second, 3' protection segment D4 (SEQ ID NO: 72)
through a C3 linker L4-3', B4 (SEQ ID NO: 71) also attaching at the
3' terminus the 5' terminus a first 5' protection segment C4 (SEQ
ID NO: 70) through a C3 linker L4-5' to form a circular B4C4D4
segment. The construct A-B4C4D4-E4, also comprise a sensor strand
E4 (SEQ ID NO. 73). Sensor E4 comprises a displacement segment E4D
(SEQ ID NO: 75) and a 5' terminal toehold E4T (SEQ ID NO: 74). FIG.
22A shows a schematic of the construct A-B4C4D4-E4 in an OFF
position (in absence of a signal molecule). FIG. 22B of the
construct A-B4C4D4-E4 in an ON position (in presence of activation
sequence (SEQ ID NO:76).
[0053] FIG. 23A and FIG. 23B shows the exemplary molecular
construct A B5.sub.1C5D5 B5.sub.2-E5 having a guide strand A (SEQ
ID NO. 1), a passenger strand B5 nicked in two segments B5.sub.1
(SEQ ID NO: 77) and B5.sub.2 (SEQ ID NO: 79) which complementarily
binding the guide strand with a gap between the 5' terminus of
B5.sub.1 and the 3' terminus of the segment B5.sub.2 as shown. In
the construct A B5.sub.1C5D5 B5.sub.2-E5 segment B5.sub.1 (SEQ ID
NO: 77) attaches the 5' terminus of a, 5' protection segment C5 (C5
portion of protection sequence SEQ ID NO: 78) through a C3 linker
L5-5'and segment B5.sub.2 (SEQ ID NO: 79) attaches the 3' terminus
of a 3' protection segment D5 (D5 portion of protection sequence
SEQ ID NO: 78) through a C3 linker L5-3' to form a
B5.sub.1C5D5B5.sub.2 segment. The construct A B5.sub.1C5D5
B5.sub.2-E5 also comprise a sensor strand E5 (SEQ ID NO. 80),
comprising a displacement segment E5D (SEQ ID NO: 82) and a 5'
terminal toehold E5T (SEQ ID NO: 81). FIG. 23A shows a schematic of
the construct A B5.sub.1C5D5 B5.sub.2-E5in an OFF position (in
absence of a signal molecule). FIG. 23B of the construct A
B5.sub.1C5D5 B5.sub.2-E5 in an ON position (in presence of
activation sequence (SEQ ID NO:83).
[0054] FIG. 24 shows the exemplary molecular construct
G6-L2-X3-Inosine having a guide strand G6 (SEQ ID NO. 8), a segment
L2 comprising a passenger strand L2PSs (SEQ ID NO.17) attaching at
the 5' terminus a second, 5' protection segment L2P5' (SEQ ID NO:
18) and attaching at the 3' terminus a 3' terminal protection
segment L2P3' (SEQ ID NO: 16) both connected to the passenger
strand B2 (SEQ ID NO: 17) by C3 linkers L2-5' and L2-3' (indicated
by black lines), and a sensor strand X3-inosine (SEQ ID NO. 84).
Sensor X3-inosine comprises a displacement segment X3D (SEQ ID
NO:86) and an inosine toehold segment X3T-Inosine (SEQ ID
NO:85).
[0055] FIG. 25 shows the exemplary molecular construct
G6-L2-X3-Inosine-HMW-PEG having a guide strand G6 (SEQ ID NO. 8),
and a segment L2 comprising a passenger strand L2PSs (SEQ ID NO:
17) attaching a 5' terminal protection segment L2P5' (SEQ ID NO:
18) and a 3' terminal protection segment L2P3' (SEQ ID NO: 16) both
connected to the passenger strand L2Ps (SEQ ID NO: 17) by C3
linkers L2-5' and L2-3'(indicated by black lines), and a sensor
strand X3-inosine-HMW-PEG (SEQ ID NO. 87). Sensor
X3-inosine-HMW-PEG comprises a displacement segment X3D (SEQ ID
NO:89) directly attaching at the related 5' terminus, the 3'
terminus of an inosine toehold segment X3T-Inosine-HMW-PEG (SEQ ID
NO:88).
[0056] FIG. 26 shows the exemplary molecular construct
A-B6C6D6-E6having a guide strand A (SEQ ID NO. 1), and a segment
B6C6D6 comprising a passenger strand B6 (SEQ ID NO.91) attaching at
a 5' protection segment C6 (SEQ ID NO: 92) and a 3' terminal
protection segment D6 (SEQ ID NO: 90) both connected to the
passenger strand B6 (SEQ ID NO:91) by C3 linkers L6-5' and L6-3'
(indicated by black lines), and a sensor strand E6 (SEQ ID NO. 93).
Sensor E6 comprises a displacement segment E6D (SEQ ID NO:95)
directly attaching a 5' terminal toehold segment E6T (SEQ ID NO:94)
which comprise an aptamer presented for binding.
[0057] FIGS. 27A and FIG. 27B show the exemplary molecular
construct G6 L2 X5-Loop having a guide strand G6 (SEQ ID NO. 8) a
segment L2 comprising a passenger strand L2PSs (SEQ ID NO:17)
attaching at the 5' terminus a second, 5' protection segment L2P5'
(SEQ ID NO: 18) and attaching at the 3' terminus a 3' terminal
protection segment L2P3' (SEQ ID NO: 16) both connected to the
passenger strand B2 (SEQ ID NO: 17) by C3 linkers L2L5' and L2L3'
(indicated by black lines), and a sensor strand X5-loop (SEQ ID NO.
96). Sensor X5-Loop comprises a displacement segment X5D (SEQ ID
NO: 98) directly attaching at its 5' terminus the 3' terminus of a
5' terminal toehold X5T-Loop (SEQ ID NO: 97). FIG. 27A shows a
schematic of the construct G6 L2 X5-Loop in an OFF position (in
absence of a signal molecule). FIG. 27B of the construct G6 L2
X5-Loop in an ON position (in presence of activation sequence (SEQ
ID NO:99).
[0058] FIG. 28 shows a representation of a PAGE gel performed on
exemplary constructs G6L2X3 (FIGS. 15A-B), G6L2X5 (FIGS. 16A-B),
and G6L2X6 (FIGS. 17A-B). In particular, in the illustration of
FIG. 28, lane 1, contains construct G6L2X3 on the OFF state; lane
2, G6L2X3 in the ON state; lane 3, G6L2X3 incubated with synthetic
signal strand to test for conversion of OFF state construct to ON
state construct by isothermal strand displacement; lane 4,
construct G6L2X5 on the OFF state; lane 5, G6L2X5 in the ON state;
lane 6, G6L2X6 incubated with synthetic signal strand to test for
conversion of OFF state construct to ON state construct by
isothermal strand displacement; lane 7, construct G6L2X6 on the OFF
state; lane 8, G6L2X6 in the ON state; lane 9, G6L2X6 incubated
with synthetic signal strand to test for conversion of OFF state
construct to ON state construct by isothermal strand displacement.
Arrows indicate the OFF state assembled construct, the dissociated
signal-sensor strand duplex, and the activated Dicer substrate
targeting duplex.
[0059] FIG. 29 shows a diagram illustrating the results of a
luciferase assay of exemplary constructs herein described where the
y-axis represents relative luciferase unit ratio and the x-axis
represents the exemplary complexes used in the assay, with the rows
below the x axis indicating the relative luciferase ratio for each
final nanomolar concentration of each molecular construct used. In
particular, FIG. 29 shows the result for targeting domain
polynucleotides G6L1 and G6L2 and for double duplex polynucleotides
G6L2X1, G6L2X2, and G6L2X3 in the OFF state.
[0060] FIG. 30 shows a diagram illustrating the results of the
luciferase assay of FIG. 29. In particular, FIG. 30 illustrates the
level of luciferase protein remaining on the y axis versus the
final nanomolar concentration of two of the polynucleotide
constructs used in the assay (G6L2 and G6L2X3) on the x axis.
[0061] FIG. 31 shows a diagram illustrating the results of a
luciferase assay of exemplary constructs herein described where the
y-axis represents relative luciferase unit ratio and the x-axis
represents the exemplary complexes used in the assay, with the rows
below the x axis indicating the relative luciferase ratio for each
final nanomolar concentration of each molecular construct used. In
particular, FIG. 31 shows the result for the targeting domain
polynucleotide G6L2, for double duplex polynucleotide G6L2X3 in the
OFF and in the ON state (together with signal strand S1), for
individual strands G6, L2, S1, X3, and for duplex polynucleotides
G6X3, L2X3, and X3S1.
[0062] FIG. 32 shows a diagram illustrating the results of the
luciferase assay of FIG. 31. In particular, FIG. 32 illustrates the
normalized relative luciferase unit ratio on the y axis versus the
final nanomolar concentration of two of the polynucleotide
constructs used in the assay (G6L2X3 in the OFF state and G6L2X3 in
the ON state) on the x axis.
[0063] FIG. 33 shows a diagram illustrating the results of a
luciferase assay of exemplary constructs herein described where the
y-axis represents relative luciferase unit ratio and the x-axis
represents the exemplary complexes used in the assay, with the rows
below the x axis indicating the relative luciferase ratio for each
final nanomolar concentration of each molecular construct used. In
particular, FIG. 33 shows the result for double duplex
polynucleotide constructs G6L2X3, G6L2X5, and G6L2X6 in the OFF and
in the ON state (together with signal strand S1).
DETAILED DESCRIPTION
[0064] Herein described are signal activatable constructs for
molecular delivery and related components, compositions, methods
and systems.
[0065] The term "signal activatable construct" as used herein
indicates a molecular complex that can have more than one
conformation, and at least one of the conformations results from
the binding of a signal molecule to the molecular complex.
Typically, the conformation associated with the binding of a signal
molecule to the molecular complex is also associated with a
chemical and/or biological activity that characterizes the
conformation as active with respect to the identified activity.
Accordingly, signal activatable constructs herein described can
have at least one active conformation and at least one inactive
conformation with respect to the enzymatic activity of the enzyme
assisted molecular delivery. Switching between an inactive
conformation to an active conformation is triggered by binding of
the signal molecule to the construct.
[0066] Signal activatable constructs and related components herein
described comprise one or more polynucleotides. The term
"polynucleotide" as used herein indicates an organic polymer
composed of two or more monomers including nucleotides, nucleosides
or analogs thereof. The term "nucleotide" refers to any of several
compounds that consist of a ribose or deoxyribose sugar joined to a
purine or pyrimidine base and to a phosphate group and that is the
basic structural unit of nucleic acids. The term "nucleoside"
refers to a compound (such as guanosine or adenosine) that consists
of a purine or pyrimidine base combined with deoxyribose or ribose
and is found especially in nucleic acids. The term "nucleotide
analog" or "nucleoside analog" refers respectively to a nucleotide
or nucleoside in which one or more individual atoms have been
replaced with a different atom or a with a different functional
group. Exemplary functional groups that can be comprised in an
analog include methyl groups and hydroxyl groups and additional
groups identifiable by a skilled person.
[0067] Exemplary monomers of a polynucleotide comprise
deoxyribonucleotide, ribonucleotides, LNA nucleotides and PNA
nucleotides. The term "deoxyribonucleotide" refers to the monomer,
or single unit, of DNA, or deoxyribonucleic acid. Each
deoxyribonucleotide comprises three parts: a nitrogenous base, a
deoxyribose sugar, and one or more phosphate groups. The
nitrogenous base is typically bonded to the 1' carbon of the
deoxyribose, which is distinguished from ribose by the presence of
a proton on the 2' carbon rather than an --OH group. The phosphate
group is typically bound to the 5' carbon of the sugar.
[0068] The term "ribonucleotide" refers to the monomer, or single
unit, of RNA, or ribonucleic acid. Ribonucleotides have one, two,
or three phosphate groups attached to the ribose sugar.
[0069] The term "locked nucleic acids" (LNA) as used herein
indicates a modified RNA nucleotide. The ribose moiety of an LNA
nucleotide is modified with an extra bridge connecting the 2' and
4' carbons. The bridge "locks" the ribose in the 3'-endo structural
conformation, which is often found in the A-form of DNA or RNA. LNA
nucleotides can be mixed with DNA or RNA bases in the
oligonucleotide whenever desired. The locked ribose conformation
enhances base stacking and backbone pre-organization. This
significantly increases the thermal stability (melting temperature)
of oligonucleotides. LNA oligonucleotides display unprecedented
hybridization affinity toward complementary single-stranded RNA and
complementary single- or double-stranded DNA. Structural studies
have shown that LNA oligonucleotides induce A-type (RNA-like)
duplex conformations as will be understood by a skilled person.
[0070] The term "polyamide polynucleotide", "peptide nucleic acid"
or "PNA" as used herein indicates a type of artificially
synthesized polymer composed of monomers linked to form a backbone
composed of repeating N-(2-aminoethyl)-glycine units linked by
peptide bonds. The various purine and pyrimidine bases are linked
to the backbone by methylene carbonyl bonds. Since the backbone of
PNA contains no charged phosphate groups, the binding between
PNA/DNA strands is stronger than between DNA/DNA strands due to the
lack of electrostatic repulsion. PNA oligomers also show greater
specificity in binding to complementary DNAs, with a PNA/DNA base
mismatch being more destabilizing than a similar mismatch in a
DNA/DNA duplex. This binding strength and specificity also applies
to PNA/RNA duplexes. PNAs are not easily recognized by either
nucleases or proteases, making them resistant to enzyme
degradation. PNAs are also stable over a wide pH range. In some
embodiments, polynucleotides can comprise one or more
non-nucleotidic or non nucleosidic monomers identifiable by a
skilled person.
[0071] Accordingly, the term "polynucleotide" includes nucleic
acids of any length, and in particular DNA, RNA, analogs thereof,
such as LNA and PNA, and fragments thereof, possibly including
non-nucleotidic or non-nucleosidic monomers, each of which can be
isolated from natural sources, recombinantly produced, or
artificially synthesized. Polynucleotides can typically be provided
in single-stranded form or double-stranded form (herein also duplex
form, or duplex).
[0072] A "single-stranded polynucleotide" refers to an individual
string of monomers linked together through an alternating sugar
phosphate backbone. In particular, the sugar of one nucleotide is
bond to the phosphate of the next adjacent nucleotide by a
phosphodiester bond. Depending on the sequence of the nucleotides,
a single-stranded polynucleotide can have various secondary
structures, such as the stem-loop or hairpin structure, through
intramolecular self-base-paring. A hairpin loop or stem loop
structure occurs when two regions of the same strand, usually
complementary in nucleotide sequence when read in opposite
directions, base-pairs to form a double helix that ends in an
unpaired loop. The resulting lollipop-shaped structure is a key
building block of many RNA secondary structures as will be
understood by a skilled person. The term "small hairpin RNA" or
"short hairpin RNA" or "shRNA" as used herein indicate a sequence
of RNA that makes a tight hairpin turn and can be used to silence
gene expression via RNAi. A single strand polynucleotide has a 5'
end and a 3' end The terms "5' end" and "3' end" of a single
stranded polynucleotide indicate the terminal residues of the
single strand polynucleotide and are distinguished based on the
nature of the free group on each extremity. The 5'-end of a single
strand polynucleotide designates the terminal residue of the single
strand polynucleotide that has the fifth carbon in the sugar-ring
of the deoxyribose or ribose at its terminus (5' terminus). The
3'-end of a single strand polynucleotide designates the residue
terminating at the hydroxyl group of the third carbon in the
sugar-ring of the nucleotide or nucleoside at its terminus (3'
terminus). The 5' end and 3' end terminus in various cases can be
modified chemically or biologically e.g. by the addition of
functional groups or other compounds as will be understood by the
skilled person.
[0073] A "double-stranded polynucleotide" or "duplex
polynucleotide" refers to two single-stranded polynucleotides bound
to each other through complementarily binding. The duplex typically
has a helical structure, such as a double-stranded DNA (dsDNA)
molecule or a double stranded RNA, which is maintained largely by
non-covalent bonding of base pairs between the strands and by base
stacking interactions. The term "5'-3' terminal base pair" with
reference to a duplex polynucleotide refers to the base pair
positioned at an end of the duplex polynucleotide that is formed by
the `5 end of one single strand of the two single strand forming
the duplex polynucleotide base-paired with the 3` end of the single
strand forming the duplex polynucleotide complementary to the one
single strand. Accordingly a duplex polynucleotide formed by a
first single strand complementarily bound to a second single
strand, has two opposite ends: a first end of the duplex
polynucleotide having a "5'-3' terminal base pair" formed by the 5'
end of the first single strand and the 3' end of the second single
strand, and a second end of the duplex polynucleotide opposite to
the first formed by the 5' end of the first single strand and the
3' end of the second single strand.
[0074] The constructs and components herein described are suitable
in some embodiments for enzyme assisted molecular delivery. The
term "molecular delivery" as used herein indicates any process by
which controlled activation of molecular complexes regulates the
release of a chemical compound for various purposes.
[0075] The term "enzyme-assisted" as used herein is defined to mean
any chemical process where a protein or other chemical entity is
used to catalyze or increase the rate of a chemical reaction. The
protein used for this purpose can include, but is not limited to,
chains of amino acids (natural or unnatural), that may or may not
contain other chemical variations and can have a defined secondary
structure. The chemical reaction can include, but is not limited
to, reactions of RNA or portions of RNA, DNA or portions of DNA,
and/or any nucleotide or derivative thereof. Typically, enzymes
catalyze reactions through binding to specific or non-specific
target molecular portions usually indicated as binding sites.
[0076] In several embodiments, the enzyme-assisted molecular
delivery herein described is an XRN1 assisted molecular delivery.
The term "XRN1" as used herein refers to an exoribonuclease enzyme
that is capable of degrading ribopolynucleotides by removing
terminal nucleotides from the 5' terminus of the
ribopolynucleotide. As used herein, the term "XRN1" comprises any
enzyme, whether naturally occurring or synthetically modified and
including any enzyme modified in one or more residues, which
substantially retain an exoribonuclease activity such as the one
herein described. Naturally occurring XRN1 enzymes which are
members of the XRN1 family can be found in many organisms including
yeast, nematode, fruit fly, and human. XRN1 is also referred as
Pacman, KEM1, SEP1, DST2, RAR5, SKI1, and DST2 to one skilled in
the art.
[0077] In several embodiments, the enzyme-assisted molecular
delivery herein described is an exosome complex assisted molecular
delivery. The term "exosome complex" as used herein refers to a
multi-protein enzyme complex that is capable of degrading
ribopolynucleotides by removing terminal nucleotides from the 3'
terminus of the ribopolynucleotide, as, for example, described in H
Houseley, J., LaCava, J. & Tollervey, D. RNA-quality control by
the exosome. Nat Rev Mol Cell Biol 7, 529-539 (2006) (herein
incorporated by reference in its entirety). As used herein, the
term "exosome complex" comprises any enzyme complex, whether
naturally occurring or synthetically modified and including any
enzyme modified in one or more residues, which substantially retain
a ribopolynucleotide-degrading activity such as the one herein
described. Naturally occurring exosome complexes can be found in
many organisms including yeast, nematode, fruit fly, and human. The
exosome complex is also referred as the PM/Scl complex or the
exosome to one skilled in the art.
[0078] In particular in some embodiments, the enzyme assisted
molecular delivery is directed to release a targeting domain within
a desired environment, such as a biological environment and in
particular within a cell, and the release of the targeting domain
can be catalyzed by XRN1 and/or the exosome complex in combination
with Dicer and/or an Argonaute enzyme.
[0079] A "domain" in the sense of the present disclosure indicates
a part of a given polynucleotide having a structure specifically
associated with a function and that exist independently of the rest
of the polynucleotide. The structure/function association in a
domain is typically conserved during the chemical and/or biological
reaction associated with the polynucleotide.
[0080] A "targeting domain" as used herein indicates a domain of a
polynucleotide associated with the function of binding or reacting
with a predetermined target within a biological environment and in
particular within a cell.
[0081] The term "target" as used herein indicates an analyte of
interest. The term "analyte" refers to a substance, compound,
moiety, or component whose presence or absence in a sample is to be
detected. Analytes include but are not limited to biomolecules and
in particular biomarkers. The term "biomolecule" as used herein
indicates a substance, compound or component associated with a
biological environment including but not limited to sugars, amino
acids, peptides, proteins, oligonucleotides, polynucleotides,
polypeptides, organic molecules, haptens, epitopes, biological
cells, parts of biological cells, vitamins, hormones and the like.
The term "biomarker" indicates a biomolecule that is associated
with a specific state of a biological environment including but not
limited to a phase of cellular cycle, health and disease state. The
presence, absence, reduction, upregulation of the biomarker is
associated with and is indicative of a particular state. The
"biological environment" refers to any biological setting,
including, for example, ecosystems, orders, families, genera,
species, subspecies, organisms, tissues, cells, viruses,
organelles, cellular substructures, prions, and samples of
biological origin.
[0082] Exemplary targeting domains in the sense of the present
disclosure comprise siRNA, saRNA, microRNA, and additional
polynucleotides identifiable by a skilled person.
[0083] In some embodiments herein described, the targeting domain
of the disclosure is a duplex RNA of about 17 to about 30 bp in
length and having a first end and a second end, the duplex RNA
comprising a guide strand complementary bound to a passenger
strand, each of the guide and passenger strands having a 5' end and
a 3' end. In some embodiments, the duplex RNA is 19 to 27 base
pairs in length. In some embodiments, the duplex RNA is 23 to 27
base pairs in length. In some embodiments, the duplex RNA is 23 to
25 base pairs in length. In some embodiments, the duplex RNA is
approximately 23 base pairs or 25 base pairs in length.
[0084] In embodiments herein described, the two opposite ends of
the targeting domain each present a 5'-3' terminal base pair. In
particular in the targeting domain a first 5'-3' terminal base pair
is formed by the 5' end of the guide strand based paired with the
3' end of the passenger strand and a second 5'-3' terminal base
pair is formed by the 5' end of the passenger strand based paired
with the 3' end of the guide strand. In the targeting domain the
first and second terminal base pair define opposite ends of the
targeting domain.
[0085] In some embodiments herein described, the two opposite ends
of the targeting domain are in a configuration in which a distance
between centers of the 5'-3' terminal base pairs at the opposite
ends is equal to the length of the targeting domain .+-.25%, where
the "length" of the targeting domain RNA duplex is the distance
defined by the number of nucleotides of the guide strand involved
in the base pairs forming the duplex polynucleotide. Calculation of
the length of a duplex polynucleotide can be performed with
techniques identifiable by a skilled person. For example estimating
the end to end length of a duplex segment formed by RNA base pairs
can be performed considering such length to be approximately 0.25
nm per base-pair, wherein approximately with reference to by
distances indicates a variation of .+-.0.05 nm. In a solution,
targeting domains herein described are expected to change in
accordance with temperature, length of linkage between the opposite
ends presence of a nicks in a strand, of the duplex and additional
parameters identifiable by a skilled person. Therefore the in
activatable construct herein described, the length of the targeting
domain and a distance between centers of the 5'-3' terminal base
pairs at the opposite ends of the targeting domain can differ of a
.+-.25%.
[0086] In some embodiments the distance between centers of the
5'-3' terminal base pairs at the opposite ends of the targeting
domain is preferably equal to the length of the targeting domain
preferably .+-.10%, more preferably .+-.5%. In some more preferred
embodiments the targeting domain duplex RNA is substantially
straight with a distance between centers of the 5'-3' terminal base
pairs at the opposite ends is equal to the length of the targeting
domain.
[0087] The distance between centers of the 5'-3' terminal base
pairs at the opposite ends of the targeting domain can be measured
with various techniques such as Fluorescence resonance energy
transfer (FRET) nuclear magnetic resonance (NMR) small angle X-ray
scattering (SAXS) and additional techniques identifiable by a
skilled person.
[0088] Fluorescence resonance energy transfer (also called Forster
resonance energy transfer) is a well-established experimental
technique used by those skilled in the art to determine the
structure and conformation of both DNA (see e.g. Mizukoshi, T., et
al. Nucleic Acids Research 29, 4948-4954 (2001). Dragan, A. I.
& Privalov, P. L. in Methods in Enzymology Vol. Volume 450 (eds
Brand Ludwig & L. Johnson Michael) 185-199 (Academic Press,
2008) and RNA structures (see e.g. Lilley, D. M. J. & Wilson,
T. J. in. Current Opinion in Chemical Biology 4, 507-517, (2000)
and Gohlke, C and atl in. Proceedings of the National Academy of
Sciences 91, 11660-11664 (1994), especially duplexes. In an
exemplary method to measure the end-to-end distance of a duplex
polynucleotide, a pair of fluorophores known to have FRET activity
is attached to the two ends of the duplex polynucleotide via 3',
5', or internal covalent linkers attached to the constituent
strands of the duplex. Parameters such as the steady state FRET
efficiency and the fluorescence lifetime can be measured. These
measurements allow calculation of the exact distance between the
donor and acceptor fluorophores using mathematical formulas known
to those skilled in the art (see e.g. Mizukoshi, T., et al in
Nucleic Acids Research 29, 4948-4954 (2001).; Lilley, D. M. J.
& Wilson, T. J. in Current Opinion in Chemical Biology 4,
507-517, (2000), G. S., Murchie, et al. The EMBO Journal 16,
7481-7489, (1997)). For example, it is known that the efficiency of
the FRET varies as the sixth power of the distance. To improve the
accuracy of the distance extrapolation, geometric standards, for
example, perfectly base-paired duplexes of a known length can be
prepared for FRET measurements under identical experimental
conditions to help obtain accurate parameters for the extrapolation
equations. The extrapolated distance between the donor and acceptor
fluorophores can then be used to determine a geometrically accurate
model of the RNA or DNA structure (see e.g Lilley, D. M. J. &
Wilson, T. J. in Current Opinion in Chemical Biology 4, 507-517,
(2000). If necessary, the attachment positions of the donor or
acceptor fluorophores can be varied to acquire additional geometric
constraints for the modeling processing.
[0089] In addition to FRET technique, nuclear magnetic resonance
(NMR) is a well-established technique for providing detailed atomic
structure of smaller RNA domains (see e.g. Furtig, B., et al in.
Biopolymers 86, 360-383, (2007). Varani, G., et al in. Progress in
Nuclear Magnetic Resonance Spectroscopy 29, 51-127, (1996) Lu, K.,
et al in J Biomol NMR 46, 113-125, (2010)),_while small angle X-ray
scattering (SAXS) can provide size estimates for the overall
physical dimensions of the construct (see e.g. Russell, R., in Nat
Struct Mol Biol 7, 367-370 (2000) Lipfert, J. & Doniach, S. in.
Annual Review of Biophysics and Biomolecular Structure 36, 307-327,
(2007)) NMR and SAXS techniques are well known to those skilled in
the art. The combination of FRET, NMR and SAXS with
well-established computational techniques to model nucleic acids in
solution (see e.g. Takada, S. in Current Opinion in Structural
Biology 22, 130-137, (2012) Pascal, T. A., et als in The Journal of
Physical Chemistry B 116, 12159-12167, (2012), Sim, A. Y. L., et al
in Current Opinion in Structural Biology 22, 273-278, (2012)), can
give accurate models of the end to end distance of the targeting
domain and the overall structure of the construct.
[0090] In an exemplary application of these techniques to the
signal activated targeting domain, the donor and acceptor
fluorophore pairs can be attached to the 3' and 5' termini of the
guide strand or at various internal positions on the guide strand
and the passenger strand. Steady state measurements of the FRET
efficiency and fluorescence life time can be used to determine the
distance between the pairs. To increase the accuracy of the
measurement, multiple end labeled RNA duplexes of known number of
base-pairs and known structure can be measured to improve the
parameters for extrapolation of the distance. The extrapolated
distances can then used to provide geometric constraints to build
an accurate model of the structure of the targeting domain. The end
to end distance is then measured using this model.
[0091] To simplify the construction of the model an internal Cy3
(see webpage dtdna.com/site/catalog/modifications/product/1476) and
Cy5 (see webpage
idtdna.com/site/catalog/modifications/product/1476) donor/acceptor
pair can be attached on the guide strand at positions directly
flanking the two base-paired ends of the targeting duplex. The
distance between the two fluorophores provide a close approximation
of the center to center distance between the end base-pairs.
Similarly, in a second measurement, a C3 and C5 donor acceptor pair
can be attached to flanking positions on the passenger strand and
provide a second measurement for the distance. The average of the
two measurements provides a measurement of the end to end distance
after subtracting .about.0.5 nm for the extra length introduced by
the attachment of the fluorophores. Further refinement of the
measured distance can be obtained after a molecular model is
constructed. FRET measurements are preferably used to determine
distances between 2.0 nm to 8.0 nm. NMR and SAXS measurement can be
used to augment distance measurements outside this range as will be
understood by a skilled person.
[0092] An exemplary illustration of the end to end distance and
related measurement is provided in FIGS. 1A to 1C which illustrate
the measurement of the end to end distance for a model 22 base-pair
targeting domain using the molecular modeling program UCSF Chimera
(Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S.,
Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. "UCSF Chimera--A
Visualization System for Exploratory Research and Analysis." J.
Comput. Chem. 25:1605-1612 (2004)). As shown in FIG. 1A, the end to
end distance is the distance between the centers for the terminal
base-pairs on the two ends of the duplex RNA domain. Unpaired bases
on the two ends are ignored. In many molecular modeling programs,
it is more convenient to measure the distance between two
particular atoms. In this case, several distance measurements can
be made between different pairs of atoms in the two pertinent pairs
of bases to obtain a good estimate of the "true" end to end
distance. FIG. 1B shows a top down view of the upper base-pair
measured in FIG. 1A. The dashed ellipse shows the area around the
center of the base-pair. For this particular pair of bases, Atom 1
is near the center and chosen as one of the atoms. FIG. 1C shows
the bottom base-pair. Here, Atom 2 is close to the center and used
as the second atom for the distance measurement. For a model 22
base-pair RNA:RNA duplex, this measurement gives a distance of 5.7
nm.
[0093] In comparison FIGS. 2A and 2B illustrate the measurement of
the end to end distance for a model 22 base-pair targeting domain
that is bent in the middle into two 11 base-pair segments. The
measurement is performed using the molecular modeling program UCSF
Chimera (Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G.
S., Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. "UCSF
Chimera--A Visualization System for Exploratory Research and
Analysis." J. Comput. Chem. 25:1605-1612 (2004)). Once again, the
distances between several pairs of atoms are measured to estimate a
true center to center distance, as shown in FIG. 2A. FIG. 2B shows
a bottom up view of both base-pairs used for the measurement.
Several atoms around the center of each base-pair are used in
different distance measurements to give an estimate of the center
to center distance. In this case, the measured distances are
between 3.15 nm and 3.30 nm.
[0094] In some embodiments, complexes herein described are signal
activatable complexes that comprise a sensor domain duplex
polynucleotide and targeting domain duplex RNA configured for
providing different conformations upon binding of a signal
molecule. The wording "signal molecule" as used herein indicates a
molecule capable of binding a segment of a signal activatable
construct herein described in a configuration triggering a switch
between an inactive conformation and an active conformation of the
signal activated molecular construct upon said binding.
[0095] In some embodiments herein described, the signal molecule is
a signal polynucleotide. The term "signal polynucleotide" as used
herein indicates a polynucleotide that is capable of acting as a
signal molecule for the signal activated constructs and related
components herein described. Accordingly, a signal polynucleotide
herein described is capable of triggering a switch between an
inactive conformation and an active conformation of the signal
activated molecular construct upon binding to a segment of the
signal activated construct.
[0096] The term "segment" as used herein indicates a portion of a
polynucleotide or construct having chemical and/or biological
properties that are functional to the chemical and/or biological
properties of the entire polynucleotide or construct as a whole.
The term "segment" as used herein in connection with a signal
activated construct indicates a portion of a signal activated
construct having chemical and/or biological properties that are
functional to changes in conformation of the signal activated
construct or components thereof, and/or to a related ability to
perform the enzyme assisted release herein described.
[0097] In some embodiments, the sensor domain duplex polynucleotide
comprises a first 5' terminal and a second 3' terminal protection
segment, each of the first and second segments comprising a 5' end
and a 3' end. The sensor domain duplex polynucleotide further
comprises a sensor strand having a 5' end and a 3' end and
comprising a displacement segment and a toehold segment presented
for binding to a signal molecule.
[0098] In embodiments herein described the sensor domain duplex
polynucleotide has a length which is the distance defined by the
number of nucleotides of the sensor strand involved in the base
pairs forming the sensor domain duplex polynucleotide. Calculation
of the length of the sensor domain duplex polynucleotide can be
performed with similar techniques indicated with reference to the
targeting domain duplex RNA as will be understood by a skilled
person. Also a distance between centers of the 5'-3' terminal base
pairs at the opposite ends of the sensor domain duplex
polynucleotide can be determined with similar techniques indicated
with reference to the targeting domain as will be understood by a
skilled person.
[0099] In a sensor domain duplex polynucleotide the protection
segments, displacement segment and toehold segment comprise at
least one polynucleotide portion and are configured so that: i) the
toehold segment is presented for binding to a signal molecule; ii)
the 5' end of the first 5' terminal protection segment is
covalently attached to the 3' end of the passenger strand of the
targeting duplex in, and the 3' end of second 3' terminal
protection segment is covalently attached to the 5' end of the
passenger strand of the targeting duplex RNA; and iii) the first 5'
terminal and second 3' terminal protection segments are
complementary to the displacement segment, with a gap between the
3' end of the first 5' terminal protection segment and the 5' end
of the second 3' terminal protection segment. In some embodiments
each protection segment in the sensor duplex polynucleotide has a
minimum length of 4 consecutive base pairs with a gap between the
3' end of the first 5' terminal protection segment and the 5' end
of the second 3' terminal protection segment.
[0100] The term "gap" as used herein indicates a separation in
space between two molecules, or a break in continuity between two
molecules. As used herein, a gap between the 3' end of the first 5'
terminal protection segment and the 5' end of the second 3'
terminal protection segment indicates a separation between the
indicated ends of the two polynucleotide segments, or an
intervening space between the segment. In some embodiments herein
described, a gap between the 3' end of the first 5' terminal
protection segment and the 5' end of the second 3' terminal
protection segment indicates a lack of covalent attachment,
complementary binding, or other direct attachment between the 3'
end of the first 5' terminal protection segment and the 5' end of
the second 3' terminal protection segment. In some embodiments the
gap can be absent and the 3' terminus of 5' terminal protection
segment can be covalently linked to the 5' terminus of the 3'
terminal protection segment.
[0101] The term "covalent binding" or "covalently linked" as used
herein indicates connection between two segments through formation
of a chemical bonding that is characterized by sharing of pairs of
electrons between atoms, known as the covalent bond. Examples of
covalent binding can include, but are not limited to, covalent
bonds formed between any two of the following: RNA or portions RNA,
DNA or portions of DNA, any nucleotide or derivative thereof,
and/or enzyme.
[0102] In embodiments herein described attachment of the first 5'
terminal protection segment to the 3' end of the passenger strand
of the targeting duplex is performed through a 5' linker segment
having a relaxed average length up to approximately 12 nm and
attachment of the second 3' terminal protection segment to the 5'
end of the passenger strand of the targeting duplex is performed
through a 3' linker segment having a relaxed average length up to
approximately 12 nm.
[0103] Measurement of the relaxed end to end average length of a
polymer can be performed with methods identifiable by a skilled
person. In particular the end to end distance of a polymer in
solvent can be estimated by well known models for the statistical
behavior of polymers in solvent.
[0104] For example, more rigid polymers such as single stranded RNA
or certain poly peptides are sometimes described using the Worm
Like Chain model (see webpage
en.wikipedia.org/wiki/Worm-like_chain). This model envisions the
polymer as an isotropic rod that is continuously flexible. The
square of the relaxed end to end distance of polymers in this
regime is:
R 2 = 2 P l [ 1 - P l ( 1 - - l P ) ] ##EQU00001##
where R is the mean end to end distance, P is the persistence
length, and 1 is the fully extended length of the polymer.
[0105] In other examples more flexible polymers such as poly
ethylene glycol are typically described by the Freely Jointed Chain
model (Boyd, R. H. & Phillips, P. j. The Science of Polymer
Molecules. (Cambridge University Press, 1993). In this case the end
to end distance scales as .about.N (3/5) where N is the number of
freely jointed segments. N.about.1/(2 P) where 1 is the overall
maximum length of the polymer and P is the persistence length.
[0106] The persistence length of many polymers such as single
stranded RNA (see e.g. Chen, H., et al in. Proceedings of the
National Academy of Sciences 109, 799-804, (2012),), DNA (see e.g
Tinland, B., et al in. Macromolecules 30, 5763-5765, (1997 and
polyethylene glycol (see e.g. Kienberger, F et al in Single
Molecules 1, 123-128, (2000)) are known to those skilled in the
art. To experimentally measure the average end to end distance of
the polymer linkers for the signal activated construct, donor and
acceptor fluorophore pairs can be attached covalently to the two
ends of the linker attachment points. A steady state FRET
efficiency and the fluorescence lifetimes can be measured under
normal experimental conditions (e.g., 1.times. PBS buffer, room
temperature, pH .about.7.0). This data can then be used to directly
extrapolate the average end to end distance of the linker. FRET
works well for distances in solution in the range of 2 nm to 8 nm
Lilley, D. M. J. & Wilson, T. J. Fluorescence resonance energy
transfer as a structural tool for nucleic acids. Current Opinion in
Chemical Biology 4, 507-517, (2000). For shorter distances, the
average end to end distance of the polymer can be estimated by
molecular dynamics simulations (Rapaport, D. C. The art of
molecular dynamics simulation. (Cambridge university press,
2004)).
[0107] In several embodiments of the signal activatable constructs
herein described, in absence of a signal polynucleotide, the first
and second protection segments and the at least one displacement
segment form a sensor duplex through complementarily binding, and
the toehold segment is presented for binding of a complementary
signal polynucleotide. In the presence of the signal
polynucleotide, the toehold and displacement segments are
complementarily bound to the signal polynucleotide.
[0108] The term "complementary" as used herein indicates a property
of single stranded polynucleotides in which the sequence of the
constituent monomers on one strand chemically matches the sequence
on another other strand to form a double stranded polynucleotide.
Chemical matching indicates that the base pairs between the
monomers of the single strand can be non-covalently connected via
two or three hydrogen bonds with corresponding monomers in the
another strand. In particular, in this application, when two
polynucleotide strands, sequences or segments are noted to be
complementary, this indicates that they have a sufficient number of
complementary bases to form a thermodynamically stable
double-stranded duplex. Double stranded of complementary single
stranded polynucleotides include dsDNA, dsRNA, DNA: RNA duplexes as
well as intramolecular base paring duplexes formed by complementary
sequences of a single polynucleotide strand (e.g., hairpin
loop).
[0109] The terms "complementary bind", "base pair", and
"complementary base pair" as used herein with respect to nucleic
acids indicates the two nucleotides on opposite polynucleotide
strands or sequences that are connected via hydrogen bonds. For
example, in the canonical Watson-Crick DNA base pairing, adenine
(A) forms a base pair with thymine (T) and guanine (G) forms a base
pair with cytosine (C). In RNA base paring, adenine (A) forms a
base pair with uracil (U) and guanine (G) forms a base pair with
cytosine (C). Accordingly, the term "base pairing" as used herein
indicates formation of hydrogen bonds between base pairs on
opposite complementary polynucleotide strands or sequences
following the Watson-Crick base pairing rule as will be applied by
a skilled person to provide duplex polynucleotides. Accordingly,
when two polynucleotide strands, sequences or segments are noted to
be binding to each other through complementarily binding or
complementarily bind to each other, this indicate that a sufficient
number of bases pairs forms between the two strands, sequences or
segments to form a thermodynamically stable double-stranded duplex,
although the duplex can contain mismatches, bulges and/or wobble
base pairs as will be understood by a skilled person.
[0110] The term "attach" or "attached" as used herein, refers to
connecting or uniting by a bond, link, force, or tie in order to
keep two or more components together, which encompasses either
direct or indirect attachment. For example, "direct attachment"
refers to a first molecule directly bound to a second molecule or
material, while "indirect attachment" in refers to one or more
intermediate molecules being disposed between the first molecule
and the second molecule or material.
[0111] In an inactive conformation signal activatable constructs
herein described the targeting domain is covalently attached to the
sensor domain duplex polynucleotide in a configuration minimizing
processing by Dicer and/or Argonaute enzyme.
[0112] In some embodiments, the inactive conformation of the
signal-activated molecular complexes herein disclosed is converted
into the active conformation following binding of signal molecule
to the toehold segment and the displacement segment to displace the
first and second protection segments, which in the active
conformation are presented as overhangs of the 3' and 5' ends of
the passenger strand, respectively.
[0113] The term "overhang" as described herein, refers to a stretch
of unpaired nucleotides at one of the ends of a double stranded
polynucleotide. In particular, in an overhang the unpaired
nucleotides can be on either strand of the polynucleotide, and can
be included at either the 3' end of the strand (`3' overhangs) or
at the 5' end of the strand (5' overhangs).
[0114] In several embodiments, the inactivated conformation of the
sensor domain is more thermodynamically stable than the
conformation of the targeting duplex. In some embodiments, the
meting temperature of double-stranded duplex portion formed by the
first 5' terminal protection segment and the displacement segment
is at least about 37.degree. C. and the meting temperature of the
double-stranded duplex portion formed by the second 3' terminal
protection segment and the displacement segment is also at least
about 37.degree. C., so that the entire double-stranded duplex
formed by the first and second protection segments and the
displacement segment has a predicted melting temperature of
approximately 50.degree. C. or greater to maximize the constructs
that in the absence of the signal polynucleotide adopt the inactive
conformation, with the first and second protection segments
complementarily binding to the displacement segment. The strand
melting temperature (Tm) of the double-stranded duplex formed by
the first and second protection segments and the displacement
segment can be experimentally tested or measured.
[0115] The term "thermodynamic stability" as used herein indicates
a lowest energy state of a chemical system. Thermodynamic stability
can be used in connection with description of two chemical entities
(e.g., two molecules or portions thereof) to compare the relative
energies of the chemical entities. For example, when a chemical
entity is a polynucleotide, thermodynamic stability can be used in
absolute terms to indicate a conformation that is at a lowest
energy state, or in relative terms to describe conformations of the
polynucleotide or portions thereof to identify the prevailing
conformation as a result of the prevailing conformation being in a
lower energy state. Thermodynamic stability can be detected using
methods and techniques identifiable by a skilled person. For
example, for polynucleotides thermodynamic stability can be
determined based on measurement of melting temperature T.sub.m,
among other methods, wherein a higher T.sub.m can be associated
with a more thermodynamically stable chemical entity as will be
understood by a skilled person. Contributors to thermodynamic
stability can include, but are not limited to, chemical
compositions, base compositions, neighboring chemical compositions,
and geometry of the chemical entity.
[0116] The configurations of the first 5' terminal and second 3'
terminal protection segments, the toehold segment, and the
displacement segment in an inactive conformation suitable to
transform to an activated conformation in presence of signal
polynucleotide are such that the binding of the signal
polynucleotide to the toehold segment has a melting temperature
(Tm) of at least about 15.degree. C.
[0117] In some embodiments, the preferred melting temperature is
approximately 37.degree. C. In some embodiments, the minimum length
of the toehold segment is two polynucleotides. In some of those
embodiments, sequence length and composition of the toehold segment
and displacement segment is such that binding of the signal
polynucleotide to the toehold segment and displacement segment is
at least as stable as the binding between the first and second
protection segments and the displacement segment to minimize
partial displacement of the protection segments from the
displacement segment upon binding of the signal polynucleotide. For
example, in some embodiments the toehold segment and the signal
polynucleotide can have at least 3 consecutive base pairs to
initiate binding to the signal polynucleotide and the strand
displacement process, and the toehold typically comprises at least
4 consecutive base pairs to allow functioning at the human body
temperature of 37.degree. C.
[0118] Additionally, in some embodiments, sequences of the
displacement segment and the first 5' terminal and second 3'
terminal protection segments can be configured with respect to the
complementarity of the displacement segment and signal
polynucleotide so that up to every base-pair exchange is at least
equal-energy, to minimize incomplete displacement process. For
example, according to some embodiments, if at certain position of
the sensor duplex, the displacement segment and the first or second
protection segments have a GC base-pair, then the signal
polynucleotide can also have a GC base pair with the displacement
segment at the corresponding position; if the displacement segment
and the first or second protection segments have a 2'-O-methyl G
base pairs with a C at certain position, also the signal
polynucleotide can base pair to the displacement segment with a
2'-O-methyl G base pairs with a C.
[0119] In some embodiments, the complementary binding between the
displacement segment with the signal polynucleotide can be at least
as stable, and possible more stable, than the complementarily
binding between the displacement segment and the first and second
protection segment. Accordingly, mismatches between the
displacement segment and the protection segment at certain
position, can correspond to mismatches between the signal
polynucleotide and the displacement segment. In some embodiments
stabilizing modifications such as 2'-O-methyls can be localized in
the displacement segment, since that displacement segment of the
construct base pairs with both the signal polynucleotide and the
first and second protection segments. In determining the
configuration, length, and sequence, the delivery conditions can
also be considered (e.g., temperature and salts
concentrations).
[0120] Reference is made to the schematic illustration of FIGS.
3A-B, which show exemplary signal activatable constructs according
to an embodiment herein described, in a depiction schematically
illustrating the inactive conformation of the exemplary signal
activatable constructs in FIG. 3A, and the active conformation of
the exemplary signal activatable constructs in FIG. 3B.
[0121] In the illustration of FIGS. 3A-B, the exemplary molecular
complexes AB-CDE and G6L1M1 in inactive form comprise a targeting
domain and a sensor domain. The targeting domain of construct
AB-CDE shown in FIGS. 3A-3B comprises a guide strand (A) and a
passenger strand (B), each comprising a 5' end and a 3' end, with
the guide strand (A) complementary and complementarily binding to
passenger strand (B) to form an RNA duplex targeting domain. The
passenger strand of the targeting domain RNA duplex is covalently
attached to a first 5' terminal and second 3' terminal RNA
protection segments C and D, each having a 5' end and a 3' end,
with a gap between the 3' end of the first 5' terminal protection
segment C and the 5' end of the second 3' terminal protection
segment D. In particular, the 5' end of the passenger strand B is
covalently linked to the 3' end of the 3' terminal protection
segment D, through the linker segment L3' and the 3' end of the
passenger strand B is covalently linked to the 5' end of the 5'
terminal protection segment C through the linker segment L5'. In
the illustrations of FIGS. 3A-B, the protection segment C and D and
the linker segments L5' and L3' form a protection strand and in
particular the protection segment C the linker segments L5' form a
first 5' terminal protection strand the protection D and the linker
segments L3' form a second 3' terminal protection strand. In the
illustrations of FIGS. 3A-B, the protection segments C and D are
not directly attached to each other and a gap is defined between
the 3' terminus of D and the 5' terminus of C. In particular, the
5' end of protection segment D is not attached to the 3' end of
protection segment C. In other embodiments herein described the gap
can be removed and the 3' terminus of the 5' terminal protection
segment is covalently linked to the 5' terminus of the 3' terminal
protection segment (see FIGS. 22A and 22B).
[0122] The sensor domain of construct AB-CDE shown in FIGS. 3A-3B
comprises a sensor strand (E) that comprises a displacement segment
(ED) and a toehold segment (ET). In the illustration of FIGS. 3A-3B
the displacement segment (ED) of sensor strand E is complementary
to the protection segments C and D, and the toehold segment (ET) is
complementary to the signal molecule. In the inactive conformation
of the exemplary molecular complex illustrated in FIG. 3A, the
displacement segment is complementarily bound to the protection
segments C and D to form a polynucleotide duplex, a with a gap
between the 3' end of first the protection segment C and the 5' end
of the second protection segment D, and the toehold is presented
for binding to a signal molecule. In the illustration of FIGS.
3A-3B the gap is positioned approximately in the middle of the
sensor domain and is a 1 bp gap. In other embodiments the gap can
be more than 1 bp and/or can be positioned at different distances
from the opposite ends of the sensor domain according to
thermodynamically stable configurations which are identifiable by a
skilled person upon reading of the present disclosure.
[0123] In the active conformation illustrated in FIG. 3B, the
sensor strand is complementarily bound to the signal strand (in the
illustrated case, an activating RNA transcript) to form and is
detached from the targeting domain. The protection segments remain
covalently attached to the 5' and 3' ends of the passenger strand
through their respective linker segment L5' and L3' as shown, and
form single-stranded overhangs on said 5' and 3' ends. In
particular the first 5' terminal protection strand forms an
overhang at the 3' end of the passenger strand and the second 3'
terminal protection strand forms an n overhang at the 3' end of the
passenger strand as shown in FIG. 3B.
[0124] In particular the exemplary illustrations of FIGS. 3A-B, the
guide strand A is the guide strand of an RNAi trigger, which in the
illustration of FIGS. 3A-B is a siRNA, but can be other RNAai
triggers such as a Dicer substrate siRNA, a miRNA, or another Dicer
substrates as will be understood by a skilled person.
[0125] The configuration of the guide strand passenger strand,
protection segment displacement segment and toehold segments in
activatable constructs herein described is also affected by the
angle of helical twist in RNA helices which varies in in different
construct in view of various factors as will be understood by a
skilled person.
[0126] FIG. 4 shows a diagram illustrating the angle between
termini on RNA helices in exemplary RNA duplexes according to some
embodiments of the present disclosure. RNA:RNA duplexes have
helical twists of approximately 11 base pairs per 360.degree.
wherein approximately with reference to angles indicates a
variation of .+-.2.degree.. According to some embodiments herein
described, the angle, .alpha., between termini on the RNA helices
of an exemplary targeting domain RNA duplex is determined by
factors such as duplex length, and is not greater than 100.degree..
Preferably, the angle is close to zero, which occurs when the
duplex is approximately 22 base pairs long. Dimensions shorter or
longer than 22 base pairs result in an angular difference of
.about.32.7.degree. per base pair, which leads to strain. Maximum
strain occurs at a duplex length of .about.16 base pairs and
.about.28 base pairs--this leads to a .about.180.degree. between
the two ends of the passenger strand. To minimize strain and
maintain an .alpha. of not greater than 100.degree., the RNA
targeting duplex is preferably a 19 to 25 base pairs in length.
[0127] The exemplary sensor domain illustrated in FIG. 3A is an
RNA:RNA duplex that is 23 base pairs in length. In other
embodiments, the sensor domain can be an RNA:RNA duplex, an RNA:DNA
duplex, or a DNA:DNA duplex, with varying inclusions of chemical
modifications such as LNA bases, and can range from 14 or 16 to 30
base pairs in length. In some embodiments, the sensor duplex can be
19 to 25 base pairs in length; preferably, the sensor duplex can be
21 to 23 base pairs in length. In the exemplary sensor domain of
FIG. 3A, protection segment D is 12 base pairs in length, and
protection segment C is 11 base pairs in length; in other
embodiments, protection segments D and C can each be 8 base pairs
in length or longer.
[0128] In the exemplary embodiment shown in FIG. 3A, the portion of
the sensor duplex formed by complementary binding of protection
segment D and the complementary portion of the displacement
segment, and the portion of the sensor duplex formed by
complementary binding of protection segment C and the complementary
portion of the displacement segment displacement, are bound with
100% complementarity and contain no mismatches or bulges. In other
embodiments, each of the two portions of the sensor duplex can
comprise up to three mismatches, as long as the melting temperature
Tm of each portion of the duplex is 37.degree. C. or greater.
Advantageously, the melting temperature Tm of each portion of the
sensor duplex is 50.degree. C. or greater. In a preferred
embodiment, the angle between the ends of protection segments C and
D that connect the protection segments to the passenger strand of
the targeting duplex, .beta., is 40.degree. or less. However, in
alternate embodiments, the angle is 100.degree. or less.
[0129] As illustrated in FIGS. 3A-B, in the exemplary molecular
complexes according to some embodiments of the present disclosure,
in an inactive conformation the targeting and sensor domains are
positioned adjacently to each other and are substantially straight
In accordance with the illustration of FIGS. 3A-B the length of the
linker segments L5' and L3' is approximately 0.5 Additional
positioning of the targeting domain and sensor domain one with
respect to the other are expected to result in functional
activatable constructs as long as the length of the linker L5' and
L3' is up to 12 nm preferably less than approximately 5 nm
preferably between approximately 0.3 nm and 2 nm. In some
embodiments herein described in the inactive conformation the
relative position of the targeting duplex and the sensor duplex is
such that the Dicer cleavage sites of the targeting duplex and the
sensor duplex are oriented towards the interior of the two
duplexes. In embodiments herein described, this positioning hinders
the binding of Dicer to the targeting duplex and processing of the
targeting duplex by Dicer to produce an activated targeting duplex
by preventing Dicer from accessing canonical binding sites of
Dicer's RNA binding domain and Dicer's RNAse cleavage domain. The
ability of Dicer to bind and process the targeting domain is
further hindered by the presence of displacement segment D attached
to the 5' of the passenger strand B, which prevents binding of the
PAZ domain of Dicer to the 5' terminal phosphate of the passenger
strand, and by the complementary binding of the protection segments
C and D to the displacement segment of strand E, which further
hinders Dicer's ability to bind and cleave the targeting domain. An
exemplary illustration of such positioning is provided in FIGS.
5A-B, where the targeting domain and the sensor domain are shown in
a substantially parallel configuration one with respect to the
other.
[0130] Additional configurations are encompassed by the present
disclosure some of which are illustrated in the exemplary
embodiments of FIGS. 3A to 5B.
[0131] FIGS. 6A, 6B and 6C provide a three dimensional illustration
of an exemplary tile saRNA with 23 bp targeting duplex and 23 bp
sensor duplex. As shown in the illustration of FIGS. 6A, 6B and 6C,
the duplex lengths lead to a very small distance of .about.0.5 nm
between the two duplexes at the B-C and B-D termini, allowing a
small linker such as a C3. In the illustration of FIGS. 6A, 6B and
6C, the Dicer cleavage sites of both duplexes are oriented towards
the center of the two duplexes, thereby making those cleavage sites
more protected from Dicer processing. In the preferred design shown
in FIGS. 6A, 6B and 6C, the nick between the D-E and C-E duplexes
is also oriented towards the center, making the structure
geometrically more rigid and protecting the C and D overhangs from
processing in an inactive conformation in absence of the signal
molecule.
[0132] FIGS. 7A, 7B and 7C provide a three dimensional illustration
of the structure of an exemplary tile saRNA with 25 bp targeting
domain and a 25 bp sensor domain. In this structure the gap
distance between B-C and B-D is near 1 nm and can be bridged by a
longer linker, such as a tri- or hex-ethylene glycol.
[0133] FIGS. 8A, 8B and 8C illustrate the three dimensional
structure of an exemplary tile saRNA composed of a 27 bp targeting
domain and a 27 bp RNA sensor domain. In this embodiment, the 5'
and the 3' of strand B are arrayed on the opposing sides of the
targeting duplex (see top view of FIG. 8C), as the termini of the
corresponding D and C domains. The configuration of the targeting
domain and sensor domain illustrated in FIGS. 8A, 8B and 8C leads
to a structure with .about.2.3 nm of separation between the termini
of the sensor and targeting duplexes. Thus, in this case, the
linker is set usually to be approximately 2.5 nm long or longer. An
exemplary linker within this length range can be provided by two
segments of hex-ethylene glycol connected by a phosphate backbone
group (commercially available spacer chemistry for incorporation
into oligonucleotides, see, for example, IDT Inc. product page). In
the configuration of the targeting domain and sensor domain
illustrated in FIGS. 8A, 8B and 8C, the Dicer cleavage sites at
distant from the center of the two duplexes and the nick is also on
the side of the sensor duplex at a distance from the center of the
targeting domain and sensor duplexes.
[0134] Additional length combinations of the targeting duplex RNA
and sensor duplex polynucleotide can be identified by a skilled
person upon reading of the present disclosure.
[0135] In the exemplary embodiments of FIGS. 3A-B the signal
activatable constructs adopts thermodynamically stable inactive and
active conformations depending on binding presence of a signal
polynucleotide. In particular, the signal activatable construct
adopts an inactive conformation in absence of the signal molecule
(FIG. 3A), and switch to an active conformation upon binding of the
signal molecule (FIG. 3B).
[0136] FIG. 9 (panels A-D) illustrates the process of activation
for an exemplary molecular complex AB-CDE of FIG. 3A according to
embodiments herein described. In particular, FIG. 9 (panel A)
illustrates construct AB-CDE in the inactive configuration, wherein
the guide strand A is complementarily bound to the passenger strand
B to form a targeting duplex, the displacement segment of sensor
strand E is complementarily bound to the protection segments C and
D to form a sensor duplex, and the toehold of sensor strand E is
presented for binding to a signal molecule. As illustrated in FIG.
9 (panel B), the complementary binding of an activating RNA
transcript signal molecule to the toehold on strand E initiates the
strand displacement process further binding of the RNA transcript
signal molecule to the sensor E from toehold segment ET into at
least part of the displacement segment ED, displaces base pairing
of ED:C and ED:D duplexes and release the protection segments C and
D from the complementary binding to the displacement segment ED
(FIG. 9, panel C). This process is commonly known as a strand
displacement or branch migration reaction. Due to partial or
complete displacement of the protection segment, the protection
segments disassociate with the displacement segment. In particular
To activate the construct, a signal molecule can displace all or
part of the base pairs in the sensor strand strand E to the extent
that the displacement is sufficient to alter the thermodynamic
stability of the double strand resulting in a decouplement of the
strand from the rest of the structure in the environment where the
reaction is performed.
[0137] Following the strand displacement, the exemplary molecular
complex of FIG. 9 (panels A-D) assumes an active configuration as
illustrated in FIG. 9 (panel D), wherein the displacement segment
and toehold segment of sensor strand E are complementarily bound to
the signal strand to form a sensor strand-signal strand complex and
are detached from the targeting duplex, the protection segments C
and D are single-stranded overhangs of the passenger strand and are
not complementarily bound to the displacement segment, and the
targeting duplex is associable for processing by Dicer and/or
Argonaut enzyme. As shown in the exemplary illustration of FIG. 9
(panel D), completion of the activation leaves E bound to the
activation strand. E is completely decoupled from A, B, C and D.
The targeting domain A:B with C and D overhangs of FIG. 9 (panel D)
can efficiently induce RNAi targeting. In some cases in the
construct of FIG. 9 (panels A-D), overhang D is first removed by
cellular exonucleases before Dicer processes A:B. In the
illustration of FIG. 9, panels A to D, the toehold is at the 5'
terminus of the sensor strand E. In additional variations of FIG.
9, panels A to D, according to configuration herein described, a
toehold can be placed on either the 5' or the 3' side of E, or
both. In those variations, the signal molecule can be an activating
RNA transcript of one strand or two strands displacing sensor
strand E from both sides.
[0138] The term "displacement", "strand displacement reaction", or
"branch migration reaction" as used herein generally indicates the
process in which two polynucleotide strands with partially or full
complementarity hybridize, displacing in the process one or more
pre-hybridized strand or sequence. The strand displacement process
can be experimentally tested or measured according to techniques
that are identifiable by a skilled person.
[0139] A comparison between the activatable constructs of the
disclosure and other constructs also activated through displacement
is provided in FIGS. 10A-B, where an exemplary signal activated
molecular construct ABCDE of FIGS. 3A and 3B is reported in FIG.
10A side by side with the structure of construct G3A8B12 of related
application No. 61/613,617 illustrated in FIG. 10B. Notable
differences between the construct of FIG. 10A and the construct of
FIG. 10B comprise the fact that in the construct of FIG. 10B the
targeting domain (A:B1/B2) has in the inactive state a distance
between the 5-3' base pair at opposite ends of the targeting domain
approximately of 3 nm while in the construct of FIG. 10A the
targeting domain a distance between the 5-3' base pair at opposite
ends of the targeting domain approximately 5.75 nm in both an
active and inactive state.
[0140] Additionally, in the construct of FIG. 10A, protection
segments C and D are complementary to a third molecule E in the new
construct, while in the construct of FIG. 10B segments C and B are
complementary to each other. Furthermore in the construct of FIG.
10B, the toehold is covalently attached to the segment C or D which
are covalently attached to the targeting domain, while in the
construct of FIG. 10A the toehold is attached to sensory strand E
which is detached from the targeting domain. In the construct of
FIG. 10B, one of the overhangs (C or D) of the targeting domain
binds the activating RNA while in the construct of FIG. 10A, strand
E binds the activating RNA or other activating signal molecule. In
the construct of FIG. 10B, the overhangs (C or D) of the targeting
domain binding the activating RNA has typically extensive chemical
modifications, in the construct of FIG. 10A, sensory strand E has
typically one or more modifications of the strand.
[0141] A further difference between constructs of FIG. 10B and the
activatable construct of the present disclosure such as the one of
FIG. 10A is that in the tile structure of the construct of this
disclosure is that the sensor strand is not covalently linked to
the rest of the complex. Such configuration allows a sensor strand
to completely dissociate from the targeting domain when the sensor
is bound to an activating transcript. The dissociation of the
targeting domain from the sensor-signal duplex leads to a
substantial increase in RNAi activity.
[0142] Another difference is that the in the structure of
activatable constructs of the disclosure such as the one of FIG.
10A the sensor and targeting domains are maintained adjacent to
each other so that the overall length of the complex is not longer
in any dimension than the sensor or targeting domain independently.
In the construct of FIG. 10B, the sensor domain can stack linearly
with a portion of the targeting domain, leading to a longer complex
which is expected to possibly be more immunogenic.
[0143] Variations in the targeting domain, the sensor domain, and
related molecular complexes shown in the illustration of FIGS. 3A-B
are identifiable by a skilled person in view of the present
disclosure. For example, the targeting domain RNA duplex can vary
in length from 19 to 30 base pairs; the sensor duplex can vary from
12 to 30 bp possibly 14 to 30 or 16 to 30 base pairs in length, and
can form an RNA:RNA, DNA:DNA, or DNA:RNA duplex; the toehold
segment can vary in length.
[0144] In particular, the exemplary targeting domain illustrated in
FIGS. 3A-3B is an RNA duplex that is 23 base pairs in length; the
guide strand of the duplex comprises a 3' overhang of two base
pairs. In some embodiments, the 3' end of the guide strand can be
blunt, comprising no overhangs. In some embodiments, mismatches and
bulges in the RNA duplex are permitted as long as the melting
temperature Tm of the duplex is predicted to be greater than the
operating temperature (e.g., 37.degree. C. in embodiments in which
detection of formation of RNA duplex is desired through methods
known to one skilled in the art such as Native PAGE followed by
visualization or UV-vis spectroscopy). In embodiments herein
described, duplex formation can be verified by Native PAGE or UV
vis spectroscopy or additional techniques identifiable by a skilled
person.
[0145] In some embodiments, the targeting domain duplex RNA can
have a length from 26 to 27 bp or from 28 to 30 bp. In those
embodiments, the assemblies are preferably purified to minimize
interference of mis-assemblied complexes. For example, the
assemblies can be run on an 8% Native PAGE gel, the band
corresponding to the correct assembly can be cut from the gel. The
extracted bands can be ground and the assemblies extracted using a
DNA gel extraction kit (such as: qiaquick-gel-extraction-kit
Qiagen) or an electrodialysis extraction system identifiable by a
skilled person.
[0146] In some embodiments, the targeting domain duplex RNA can
have a length from 28 to 30 bp. In those embodiments, the
assemblies are also preferably purified to minimize interference of
mis-assemblied complexes. Complexes herein described with a 28 to
30 bp targeting domain are also preferably tested for nonspecific
toxicity and the concentrations are preferably optimized to
minimize RNAi activity in the OFF inactive conformation and to
minimize toxicity while maximizing the ON state RNAi. In some of
those embodiments, the targeting domain is attached to a matching
length sensor domain and the matching length sensor domain can
include fewer modifications with respect to other constructs herein
described to obtain thermodynamic stability as will be understood
by a skilled person.
[0147] In preferred embodiments of the activatable constructs
herein described, the targeting domain duplex RNA is from 23 to 25
bp. In those embodiments, the bases of the targeting domain are
preferably RNA nucleotides with no modification and in particular
the region between the 19.sup.th and 21.sup.st base pair of the
targeting domain preferably includes no modification of the
ribonucleotides. In those embodiments, the sensor domain can be a
RNA:DNA, DNA:DNA or RNA:RNA duplex modified or unmodified in
various positions as will be understood by a skilled person upon
reading of the disclosure. In some of those embodiments the sensor
domain and the targeting domain are preferably of a same length
which can be predicted with molecular modeling which can also be
used to select the length of appropriate linkers.
[0148] In embodiments with a targeting domain duplex RNA from 19-
to 21 bp the 5' terminus of the guide strand and passenger strand
are protected by base modifications described in the present
disclosure to minimize occurrence of processing of the construct in
an inactive conformation.
[0149] In embodiments where the targeting domain duplex RNA is 22
bp higher concentrations of construct are preferably used with
respect to constructs having a 23 to 25 base pairing to maximize
the ON state RNAi activity of the targeting domain, Even higher
concentrations of construct with respect to constructs having 23 to
25 bp are also preferred for embodiments where the targeting domain
duplex RNA is 19 to 22 bp.
[0150] In embodiments where the targeting domain duplex RNA is 19
to 22 bp the 19.sup.th and 20.sup.th base paired base on the guide
strand and the 21.sup.st and 22.sup.nd bp on the passenger side and
those two bases are preferably not be modified are in particular
are not modified to include a phosphorothioate linkage. In those
embodiments the 2n base-pair is preferably unmodified and in
particular the 2.sup.nd does not include a 2'-O-methyl or other
nuclease resistant base. In those embodiments the 5' terminus is
modified to minimize loading by non-Dicer processing in an inactive
conformation.
[0151] In some embodiments, the guide strand, passenger strand,
first and second protection segments, at least one displacement
segment, toehold segment, and any other portion of the sensor
strand of the signal activatable complexes are mainly or entirely
composed of RNA and/or RNA derivatives.
[0152] The term "derivative" as used herein with reference to a
first compound (e.g., RNA or ribonucleotide) indicates a second
compound that is structurally related to the first compound and is
derivable from the first compound by a modification that introduces
a feature that is not present in the first compound while retaining
functional properties of the first compound. Accordingly, a
derivative of a molecule of RNA, usually differs from the original
molecule by modification of the chemical formula that might or
might not be associated with an additional function not present in
the original molecule. A derivative molecule of RNA retains however
one or more functional activities that are herein described in
connection with complementary base paring with other nucleotides.
Typically, ribonucleotides and deoxyribonucleotides can be modified
at the 2', 5', or 3' positions or the phosphate backbone chemistry
is replaced. Exemplary chemical modifications of a ribonucleotide
according to the current disclosure include 2'-o-methyl RNA,
2'-Fluoro RNA, locked nucleic acid (LNA), peptide nucleic acid
(PNA), morpholino, phosphorothioate oligonucleotides, and the like
that are identifiable by a skilled person (see e.g. "Modified
Nucleosides: in Biochemistry, Biotechnology and Medicine. Piet
herdewijn (Editor), Wiley-VCH, 2008, herein incorporated by
reference in its entirety). Also applicable are nucleosides which
are not normally comprised in DNA and RNA polynucleotides, such as
inosine. In some embodiments, a single oligonucleotide can be
composed of more than one type of the above derivatives.
[0153] In several embodiments herein described, modified bases can
be used throughout the complexes herein described to increase
thermodynamic stability, and nuclease resistance, decrease
toxicity, and/or increase specificity. FIGS. 11A-B show the line
drawing illustrations of structures of exemplary chemical groups
comprised in the exemplary signal activated molecular constructs of
the present disclosure. FIG. 11A illustrates the chemical structure
of the C6 amino chemical group modification from GE Dharmacon. FIG.
11B illustrates the chemical structure of the 3AmMO 3' amino
chemical group modification from IDT and Exiqon Inc.
[0154] Additional suitable modifications comprise, for example,
2'-O-methyls, introduction of a non-nucleic acid linker and/or an
unstructured RNA segment, and terminal modifications. In
particular, 2'-O-methyls can be used in particular in displacement
segment (ED) and toehold segment (ET) to increase thermodynamic
stability and prevent unwinding by RNA binding proteins. In
addition, non-nucleic acid linkers can be used confer desirable
properties to the construct and/or portions thereof. Exemplary non
nucleic acid linkers suitable to be used herein comprise C3 linkers
and tri and hexa-ethylene glycol linkers as well as any
biocompatible polymeric linker group with no-nonspecific
association with DNA. In particular, molecular constructs herein
described can comprise a non-nucleic acid polymer linker group with
a lower persistence length than nucleic acids (e.g.: C3,
polyethylene glycol (PEG)) to increase flexibility at the
attachment point. Such a linker group can reduce interference of
long overhangs against Dicer binding. Molecular constructs herein
described can also comprise a non-nucleic acid linker group to
interfere with degradation by exonucleases and endonucleases,
including RNAi pathway enzymes. Molecular constructs herein
described can further comprise an unstructured RNA segment to have
non-canonical interactions with other RNA segments, leading to
unpredictable tertiary conformations. Molecular constructs herein
described can further comprise a terminal modification can prevent
binding of the PAZ domain of Dicer, as well as other terminal
modifications useful for preventing Dicer binding, such as Inverted
dT Fluorescein and other groups incompatible with the PAZ domain
such as cytidine biphosphate, propanediol, puromycin, and
additional groups identifiable by a skilled person.
[0155] In some embodiments herein described, exemplary targeting
domains herein described can comprise exonuclease resistant
polynucleotides. The term "exonuclease" as used herein, indicates a
type of enzyme that works by cleaving nucleotides one at a time
from the end (exo) of a polynucleotide chain. A hydrolyzing
reaction that breaks phosphodiester bonds at either the 3' or the
5' end occurs. A 3' and 5' exonuclease can degrade RNA and DNA in
cells, and can degrade RNA and DNA in the interstitial space
between cells and in plasma, with a high efficiency and a fast
kinetic rate. A close relative is the endonuclease, which cleaves
phosphodiester bonds in the middle (endo) of a polynucleotide
chain. 3' and 5' exonuclease and exonucleolytic complexes can
degrade RNA and DNA in cells, and can degrade RNA and DNA in the
interstitial space between cells and in plasma. The term
"exoribonuclease" as used herein, refers to exonuclease
ribonucleases, which are enzymes that degrade RNA by removing
terminal nucleotides from either the 5' end or the 3' end of the
RNA molecule. Enzymes that remove nucleotides from the 5' end are
called 5'-3' exoribonucleases, and enzymes that remove nucleotides
from the 3' end are called 3'-5' exoribonucleases.
[0156] The term "exonuclease resistant" as used herein with
reference to a molecule and in particular a polynucleotide,
indicates resistance to exonucleolytic degradation. Exonucleolytic
degradation is the processive degradation of an oligonucleotide
from the 5' or 3' end by enzymes called exonucleases. Exonucleases
are enzymes that work by cleaving nucleotides one at a time from
the end (exo) of a polynucleotide chain. A hydrolyzing reaction
that breaks phosphodiester bonds occurs. Its close relative is the
endonuclease, which cleaves phosphodiester bonds in the middle
(endo) of a polynucleotide chain.
[0157] In some embodiments herein described, the passenger strand
of the targeting domain is an exonuclease resistant polynucleotide
comprising a blocker domain providing the polynucleotide with
exonuclease resistance.
[0158] A "blocker domain" in the sense of the present disclosure
indicates a part of the polynucleotide having the function of
reducing polynucleotide degradation by exonuclease activity.
[0159] In the passenger strand exonuclease resistant polynucleotide
herein described, the blocker domain is formed by a non-nucleic
acid polymer segment and a phosphorothioate segment.
[0160] The term "non-nucleic acid polymer" as used herein refers to
molecule composed of repeated subunits, known as monomers which do
not comprise nucleotides or modified nucleotides linked by a
phosphodiester or phosphorothioate linkages. The physical
properties of a polymer, such as flexibility, chain mobility
strength and toughness are dependent on the size or length of the
polymer chain. A common means of expressing the length of a chain
is the degree of polymerization, which quantifies the number of
monomers incorporated into the chain. As with other molecules, a
polymer's size can also be expressed in terms of molecular weight.
The weight of a polymer is often expressed statistically to
describe the distribution of chain lengths present in the same.
Common examples are the number average molecular weight and weight
average molecular weight. The ratio of these two values is the
polydispersity index, commonly used to express the "width" of the
molecular weight distribution. An additional measurement is contour
length, which can be understood as the length of the chain backbone
in its fully extended state. Exemplary non-nucleic acid polymers
comprise alkanes, polyamides, polyethers, polyesters,
polycarbonates, polysaccharides, polypeptides, polypropylenes,
aliphatic chains, polymers with heterogeneous residues and residue
to residue linkage chemistry and additional polymers identifiable
by a skilled person.
[0161] The term "linear polymer" as used herein indicates a polymer
wherein the residues are connected in a single linear and
non-circular chain without branches. The flexibility of an
unbranched chain polymer is characterized by its persistence
length. The term "persistence length" as used herein refers to the
length over which correlation in the direction of the ends of the
polymer are lost. The persistence length is a basic mechanical
property quantifying the stiffness of a polymer and is measurable
with methods identifiable.
[0162] In particular, in blocker domain herein described the
non-nucleic acid polymer segment comprises a linear polymer having
two to six monomer residues linked by residue to residue bonds. The
term "residue to residue bond" refers to a covalent bond connecting
consecutive residues of the polymer.
[0163] In particular, in embodiments herein described, the end to
end distance for the non-nucleic acid linear polymer in fully
extended conformation can be up to about 1.00 nm, and in particular
can be about 0.2 nm, about 0.4 nm, about 0.5 nm, about 0.65, about
0.8 nm, about 0.9 nm and about 1 nm. The end to end distance for
the fully extended polymer can be determined by drawing the polymer
in a maximally extended configuration with optimal bond length and
bond angles expected for the monomer residues and measuring the
distance between the first atom and the last atom in the polymer
chain.
[0164] In embodiments herein described, the non-nucleic acid linear
polymer has a persistence length of the polymer up to about 0.5 nm.
In particular in embodiments herein described the persistence
length can be about 0.38 nm.
[0165] In embodiments herein described the non-nucleic acid linear
polymer has a stability such that polymer degradation is not faster
than an unmodified RNA with the same number of monomers measured by
gel shift assay or mass spectroscopy. Polymer degradation is not
faster than an unmodified RNA when under comparable degradation
conditions the average length of the polymer is equal to or longer
than the length of the unmodified RNA. For example, a polymer of N
residues can be incubated in cell lysate at 37.degree. C. and
compared with a control oligonucleotide with an equal number of
nucleotides and the average length of the polymer over time can be
measured by mass spectroscopy and compared to the control
oligonucleotide. Under these conditions, the half-life of the full
length polymer is longer than the half-life of the full length
control oligonucleotide when the polymer degradation is not faster
than an unmodified RNA.
[0166] In embodiments herein described the non-nucleic acid linear
polymer has no covalent cross reactivity with the PAZ domain of
Dicer which can be determined by radiolabeling experiments
comprising providing a PAZ domain in a cell lysate buffer,
contacting a candidate polymer labeled with a terminal P.sub.32 at
25 C. temperature for a time and under condition to allow
interaction of the PAZ domain and the labeled non-nucleic acid
linear polymer. Following the contacting the method comprises
further extracting the protein under denaturing conditions and
detecting the radioactivity using suitable techniques such as
Western Blot or other techniques identifiable by a skilled person.
Additional methodology to measure covalent cross reactivity between
the non-nucleic acid linear polymer and PAZ domain are identifiable
by a skilled person.
[0167] In embodiments herein described, the degradation can occur
as fast, or faster than the unmodified RNA as long as the
degradation occurs such that a terminal phosphate is exposed or a
terminal --OH group that can be phosphorylated by a kinase is
exposed. A method to test the kination is to incubate the --OH
terminated polymer with the target kinase in the appropriate buffer
with P32 labeled Adenosine triphosphate as a source of the
phosphate and detect labeling of the polymer with radioactive
P32.
[0168] In some embodiments, polymers suitable to be comprised in
the non-nucleic acid polymer segment as non-nucleic acid linear
polymer herein described comprise a substituted or unsubstituted
alkyl chain, a polyether, a polypeptide (alkanes, polyamides,
polyethers, polyesters, polycarbonates, polysaccharides,
polypeptides, polypropylenes, aliphatic chains, polymers with
heterogeneous residues and residue to residue linkage chemistry) as
well as additional polymers that show the required number of
residues, end-to-end distance, persistence length, stability and
cross reactivity as will be understood by a skilled person. In
particular in some embodiments, non-nucleic acid linear polymers
comprising different but chemically compatible monomer units (e.g.
an amino acid flanked by an alkyl monomer) can be comprised in the
non-nucleic acid polymer segment as long as such the required
number of residues, end-to-end distance, persistence length,
stability and cross reactivity as will be understood by a skilled
person.
[0169] In the passenger strand comprising the exonuclease resistant
polynucleotide herein described, the phosphorothioate segment of
the blocker domain comprises at least one to five nucleotides
linked by phosphorothioate linkages to form a phosphorothioate
sequence having a 5' and a 3' end, and attaching at the 5' end the
first end of the non-nucleic acid polymer segment through a
phosphodiester linkage.
[0170] The term "phosphorothioate linkage" as used herein,
indicates a bond between nucleotides in which one of the
nonbridging oxygens is replaced by a sulfur. The term
"phosphodiester linkage" as described herein indicates the normal
sugar phosphate backbone linkage in DNA and RNA wherein a phosphate
bridges the two sugars.
[0171] In particular, in a blocker domain herein described the
phosphorothioate sequence comprises at least two bases wherein the
at least two bases are connected by a phosphorothioate linkage. The
bases can be modified or unmodified nucleotides, nucleosides, and
related analog forming RNA, DNA, or alternative nucleic acids as
would be understood by a person skilled in the art.
[0172] The term "modified nucleotides" refers to a nucleic acid
monomer that is not the standard DNA or RNA nucleotide or
nucleoside. In particular, modified nucleotides comprise nucleotide
analogs presenting one or more individual atoms which have been
replaced with a different atom or with a different functional
group. Exemplary functional groups that can be comprised in an
analog include methyl groups and hydroxyl groups and additional
groups identifiable by a skilled person.
[0173] The term "present" as used herein with reference to a
compound or functional group indicates attachment performed to
maintain the chemical reactivity of the compound or functional
group as attached. Accordingly, a functional group presented on
residue, a segment, or a molecule is able to perform under the
appropriate conditions the one or more chemical reactions that
chemically characterize the functional group.
[0174] In particular, a modified nucleotide in the sense of the
disclosure can be any nucleotides or nucleosides modified in the 2'
position with a group that interferes with hydrogen bonding. In
particular, modified nucleotide such has 2' O-methyl, 2'F
2'NH.sub.4 and additional groups identifiable by a skilled person
can be used in polynucleotides herein described. Exemplary modified
nucleotide can also include locked nucleic acids alone or in
combination with be 2' O-methyl, and/or 2' Fluoro modified
residues.
[0175] In some embodiments, the phosphorothioate segment can have
two to three residues modified to present a 2' O-methyl. In an
exemplary modification schematically illustrated in FIGS. 3A-B, a
first phosphorothioate links the first nucleotide, a mG, to a
second nucleotide mG, and a second phosphorothioate links the
second nucleotide mG to the third nucleotide mU.
[0176] In embodiments of the passenger strand comprising the
exonuclease resistant polynucleotide herein described, inclusion of
a phosphodiester linkage between the phosphorothioate sequence and
the linear polymer of the non-nucleic acid polymer segment allows
the resulting polynucleotide, when comprised at the 5' end of
either strands of a duplex polynucleotide configured to allow
processing by Dicer and/or Argonaute to maintain the duplex'
processability by Dicer and/or Argonaute.
[0177] In some other embodiments herein described, the passenger
strand does not comprise an exonuclease resistant polynucleotide as
described herein, but can comprise one or more exemplary chemical
modifications such as modified polynucleotides and/or
phosphorothioate linkages, as well as exemplary non-nucleic acid
polymer segments on the passenger strand 5' and 3' ends.
[0178] In some embodiments herein described, the guide strand,
first and second protection segments, displacement segment, and
toehold segment can comprise chemical modifications, modified
polynucleotides, non-nucleic acid polymer segments, and/or
phosphorothioate linkages.
[0179] Exemplary chemical modifications comprise replacement of
nucleotides that are needed to be base-paired to form a desired
secondary structure with modified nucleotides that are known to
increase thermodynamic stability (e.g., 2'-O-methyl modified
nucleotides, LNA, PNA and Morpholino). Additional exemplary
modifications comprise replacement of nucleotides that are not
desired according to a certain thermodynamic stability with
modified nucleotides to ensure that the resulting modified
structures are likely to retain the desired secondary structure
conformations and thermodynamic stability (e.g., replace a
ribonucleotide base with a deoxyribonucleic base). A person skilled
in the art will be able to identify other suitable modifications
upon reading of the current disclosure.
[0180] In particular, in some embodiments, the guide strand can
comprise one or more exemplary chemical modifications such as
modified polynucleotides and/or phosphorothioate linkages, as well
as exemplary non-nucleic acid polymer linkers on the guide strand
5' end. For example, in embodiments wherein the targeting duplex
length is greater than 19 base pairs, the 5' end of the guide
strand can have a terminal phosphorothioate and/or
non-oligonucleotide terminal groups (e.g., C3 or PEG linkers) to
prevent spurious PAZ domain association. In an exemplary guide
strand modification schematically illustrated in FIGS. 3A-B, for
example, a first phosphorothioate links the first nucleotide, a
2'-O-methyl modified C (mC), to a PEG linker, and a second
phosphorothioate links the first nucleotide mC to the second
nucleotide mG. The guide strand can comprise any other
modifications known to the art to be compatible with Dicer
processing and RNAi functioning, as described, for example, in
Collingwood et al. (Oligonucleotides. 2008 June; 18(2):187-200),
herein incorporated by reference in its entirety.
[0181] In some embodiments of signal activated molecular complexes
herein described, each of the first 5' terminal protection segment
and second 3' terminal protection segments can comprise
phosphorothioate linkages. For example, the 5' terminus of the
second 3' terminal protection segment and the 3' terminus of the
first 5' terminal protection segment can comprise phosphorothioate
bases or nuclease resistant bases to decrease spurious activation
of the constructs in the OFF inactive state, as long as the
modifications to the first and second protection segments allow
strand displacement reactions following binding to a signal
molecule to proceed. For example, as shown in FIGS. 3A and 1C, the
first 5' terminal protection segment can comprise phosphorothioate
linkages between the three nucleotides on the 3' most end (FIG.
3A), or between the six nucleotides on the 3' most end (FIG. 12A).
The second 3' terminal protection segment can comprise
phosphorothioate linkages between the three nucleotides on the 5'
most end (FIG. 3A), or between the six nucleotides on the 5' most
end (FIG. 12A). Additional positioning of phosphorothioate
modifications is possible, and will be recognizable to one skilled
in the art.
[0182] In embodiments of exemplary molecular complexes herein
described, the first and second protection segments are covalently
linked to the passenger strand of the targeting duplex. In
particular, in the molecular complex, the sensor domain is bound to
the targeting domain through covalent attachment of the 5' end of
first 5' terminal protection segment to the 3' end of passenger
strand, and through covalent attachment of the 3' end of the second
3' terminal protection segment to the 5' end of passenger strand.
In some embodiments, the linkage occurs with unmodified RNA or DNA
polynucleotides. Advantageously, the linkage occurs with an
exemplary non-nucleic acid polymer linker, such as a C3, C6,
tri-ethylene glycol, or hex-ethylene glycol linkers, or with
phosphorothioate and 2'-O-methyl modified RNA. In these
advantageous embodiments, spurious activation of the molecular
complex is reduced.
[0183] In particular, in embodiments wherein non-nucleic acid
polymer linkers are used to link the first and second protection
segments to the passenger strand, the dimensions of the linkers can
be determined using techniques identifiable by one skilled in the
art. For example, in an exemplary approach the dimensions of the
linkers can be determined by constructing two three-dimensional
models of the targeting and sensor domains. In constructing such a
model, the targeting domain model can be an RNA:RNA duplex with the
correct number of base-pairs. The sensor domain model can be a
RNA:RNA, RNA:DNA, or DNA:DNA duplex with the correct number of
base-pairs. If in the resulting construct there is a gap between
the duplex comprising a first 5' terminal protection segment and a
first displacement segment and the duplex comprising a second 3'
terminal protection segment and a second displacement segment, and
the corresponding gap is bridged by RNA bases on the sensor strand,
the RNA bases are added to fill in a gap in an A form alpha helical
configuration, thus bridging the gap. If the corresponding gap is
bridged by an unstructured linker, the fully stretched linker is
positioned between the duplex comprising the first 5' terminal
protection segment and a displacement segment and the duplex
comprising the second 3' terminal protection segment and a
displacement segment without rotating the sensor strand. The two
resulting duplexes are then positioned next to each other as close
as possible without touching (at least 0.1 nm distance between all
atoms) and oriented them to minimize the distance between the 3'
terminus of the passenger strand and the 5' terminus of the first
5' terminal protection segment and between the 5' terminus of the
passenger strand and the 3' terminus of the second 3' terminal
protection segment. The distance between each pair of termini can
then be measured and .about.0.3 nm can be added to provide the
minimum length of the linkers. In preferred embodiments, the
linkers allow no less than 0.3 nm and no more than 2 nm separation
between the sensor and targeting duplexes. The maximum distance
between the duplexes can be 5 nm. For a polymeric linker, to
determine the minimum linker length, the fully stretched length of
the polymer is utilized. For a polymeric linker, to determine
linker length (in polymer units) allowed for the maximum
separation, the estimated end-to-end distance of the polymer is
calculated according to polymer physics methods known to the art.
For example, for a well solvated polymer such as PEG, the distance
is .about.n (3/5)*d where n=(the fully outstretched length of the
polymer)/(2*persistence length of the polymer) and d
=(2*persistence length of the polymer). The persistence length of
many polymers such as DNA, and PEG are well known and documented in
the literature. Using the above model, the gap in the sensor duplex
is positioned on the side facing towards the targeting duplex by
changing the length of the duplex comprising the first 5' terminal
protection segment and a displacement segment and the duplex
comprising the second 3' terminal protection segment and a
displacement segment until the gap is approximately in the
middle.
[0184] In some embodiments of signal activated molecular complexes
herein described, the sensor strand can comprise one or more
exemplary chemical modifications such as modified polynucleotides
and/or phosphorothioate linkages, as well as exemplary non-nucleic
acid polymer linkers on the sensor strand 5' and 3' ends. In
particular, the sensor strand can comprise chemical modifications
that increase nuclease resistance, prevent protein binding, and
increase thermodynamic stability. Modification of the sensor strand
for nuclease resistance and thermodynamic stability greatly reduces
spurious RNAi processing of the inactivated state of exemplary
molecular constructs.
[0185] In some embodiments, the sensor strand can comprise one or
more phosphorothioate linkages between adjacent nucleotides;
advantageously, the sensor strand can comprise only
phosphorothioate linkages to increase nuclease resistance and
decrease protein binding. In some embodiments, the sensor strand
can comprise LNA modifications and/or 2'-O-methyl bases. In some
embodiments, inclusion of LNA modifications in the sensor strand
positioned across from the gap between the first and second
protection segments can increase the conformational stability of
the sensor duplex. In some embodiments, the sensor strand is
completely modified with phosphorothioate backbone connections and
nuclease resistant bases. If complete modification of the sensor
strand causes toxicity, the number of phosphorothioates and
nuclease resistant bases can be reduced to optimize the balance
between toxicity, leakage, and cost. When reducing
phosphorothioates and modified bases, the bases in the toeholds and
bases flanking the toeholds are preferably modified to be more
protected. Accordingly in embodiments where the number of
phosphorothioates and modified bases are reduced in the sensor
strand, the bases in the toeholds and bases flanking the toeholds
preferably comprise more phosphorothioates and modified bases, than
the bases in the interior of the base-paired regions of the sensor
strand.
[0186] Advantageously, and as illustrated on FIG. 3A, the sensor
strand can comprise LNA modifications every four bases, and
2'-O-methyl bases for all non-LNA bases. In some embodiments, the
sensor strand can comprise non-nucleic acid polymer linkers such as
PEG or C3 or other chemical groups that block protein binding,
exonuclease loading, or Dicer binding at the 3' and 5' end sensor
strand ends. In some embodiments, the sensor strand can comprise
non-nucleic acid polymer linkers positioned across from the gap
between the first and second protection segments, and between at
least one displacement segment and the toehold. In particular, in
some embodiments, the 5' and 3' termini of the sensor strand can
have non-nucleic acid polymer groups to prevent binding of Dicer,
exonucleases, and other helicases. These groups can be C3, PEG,
fluorophore, terminal amine, inverted dT or other groups that do
not present a terminal phosphate at the 5' end and a terminal
nucleotide at the 3'.
[0187] In several embodiments, the toehold segment can comprise a
polynucleotide sequence (herein also toehold sequence) that is at
least 2 nucleotides in length and is complementary to at least a
portion of the signal polynucleotide. This configuration of the
toehold segment is expected to allow binding of a signal
polynucleotide to bind to the signal activatable construct and
initiate the branch migration process. A smaller toehold sequence
is expected to result in better sequence specificity for signal
discrimination, while a longer toehold sequence is expected to
result in an increased ability to bind to the signal
polynucleotides to form a desired secondary structure with respect
to the ability of a shorter toehold segment. In some embodiments,
the toehold segment can be arranged in single-stranded form and
free of secondary structure. In particular, in some of those
embodiments, the toehold sequence can be 4 to 12 nucleotides in
length. In some embodiments, the toehold segment is composed of
unmodified ribonucleotide. In particular, in other embodiments, the
toehold segment comprises modified nucleotide configured for
improved nuclease resistance. Exemplary modifications include but
are not limited to 2'-O-methyl modification, 2'-Fluoro
modifications, inclusions of LNA and PNA, and the like that are
identifiable by a skilled person. In some embodiments, the
connection point between the toehold and the rest of sensor strand
preferably comprise nuclease resistant and thermodynamically
stabilizing chemical modifications to avoid spurious exonuclease
induced activation of the molecular construct.
[0188] The exemplary construct G6L1M1 illustrated in FIGS. 12A and
12B. The guide strand G6 and the passenger strand LIPS are
complementary to each other and bind to each other to form a
targeting domain duplex. In the exemplary construct of FIGS. 1C-1D,
the passenger strand L1Ps of the targeting domain RNA duplex is
covalently attached to a first and second RNA protection segments
L1P5' and L1P3', each having a 5' end and a 3' end. In particular,
the 5' end of the passenger strand L1Ps is covalently linked to the
3' end of the second protection segment L1P5', and the 3' end of
the passenger strand L1Ps is covalently linked to the 5' end of the
first 5' terminal protection segment L1P5', with a gap between the
3' end of first the 5' terminal protection segment L1P5' and the 5'
end of the second 3' terminal protection segment L1P3'. In the
inactive conformation of FIG. 12A, the 5' protection segment L1P5'
and the 3' protection segment L1P3' of the passenger strand are
complementary to different portions of the displacement segment E1D
of the sensor strand and bind to the displacement segment E1D to
form a sensor domain duplex. In the inactive conformation of FIG.
12A the targeting domain and the sensor domains form a tile small
activating RNA (saRNA). In the illustration of FIGS. 12A-12B, the
switching from the inactive conformation of FIG. 12A to the active
conformation of FIG. 12B is performed through displacement of the
sensor strand E1 from the L1P5' and L1P3' protection segments of
the passenger strand following binding of a signal strand S0
labeled RNA signal in FIGS. 12A-12B.
[0189] In particular the exemplary illustrations of FIGS. 12A-B,
the guide strand (G6) is the guide strand of an RNAi trigger, which
in the illustration of FIGS. 3A-B is a siRNA, but can be other
RNAai triggers such as a Dicer substrate siRNA, a miRNA, or another
Dicer substrates.
[0190] In some embodiments, the signal can be a single signal
polynucleotide of a length shorter than 30 nucleotides, and the
toehold segment and the displacement segment are fully
complementary to the signal polynucleotide. In other embodiments,
the signal can be formed by multiple homologous signal
polynucleotides. In these embodiments, the signal polynucleotides
can be tested with a sensor design. Mismatches and wobble pairings
or permissive bases such as inosine can be placed at positions in
the 3:5 duplex corresponding to the variable sequences. In
particular, in several embodiments, the Tm for the duplex formed by
the signal polynucleotides with the toehold segment and the
displacement segment is typically at least 25.degree. C. and is
typically at least equal to the operating temperature under which
the construct will be used.
[0191] In some embodiments the signal polynucleotide used in the
experiment can be selected to approximate the expected state of the
signal in the cell. In particular, in embodiments wherein the
signal polynucleotide is expected to be a short oligonucleotide or
RNA segment, such as a miRNA, a short oligonucleotide of the same
sequence as the signal polynucleotide can be used in experiments to
simulate the topological constraints imposed by having the toehold
segment in a hairpin loop. In embodiments wherein the signal is an
mRNA sequence, a polynucleotide having the same sequence as the
mRNA signal nucleotide can be used to simulate the topological
constraints imposed by having the toehold segment in a hairpin
loop. In embodiments wherein the region known to bind to the
toehold segment is in a hairpin loop, the signal nucleotide used in
the displacement experiment can have the toehold sequence in a
hairpin loop to simulate the topological constraints imposed by
having the toehold segment in a hairpin loop.
[0192] In some embodiments, the toehold segment can be connected to
the displacement segment through covalent linkage. In particular,
in some embodiments, the toehold segment can be arranged to the 5'
terminus of the displacement segment (see exemplary embodiments in
FIGS. 3A-B, 12A-27B). In some embodiments, the toehold segment can
be arranged as a single strand terminal sequence of the
displacement strand; in other embodiments, the toehold segment can
be provided as a single strand middle sequence of the displacement
strand, which can be arranged within a loop structure of the
displacement strand. In particular, in some embodiments, where the
toehold domain can be arranged within a loop structure of the
displacement strand, the loop can comprise at least 20 nucleotide
unmodified nucleotides, which in some cases can be ribonucleotides.
In some embodiments, the toehold segment can be at least 3
nucleotides in length. In particular, in some embodiments, the
toehold segment can be at least 4 nucleotides in length.
[0193] In some embodiments, the signal-activatable constructs
herein described can comprise one or more toehold segments. For
example, an exemplary sensor strand herein described can comprise a
first toehold segment as single strand terminal sequence of one end
of the displacement segment, and a second toehold segment as a
single terminal sequence of the opposite end of the displacement
segment. In some embodiments, an exemplary sensor strand herein
described can comprise a first toehold segment as single strand
terminal sequence of one end of the displacement segment, and a
second toehold segment arranged within a loop structure of the
displacement strand as described herein. In other embodiments, an
exemplary sensor strand herein described can comprise a first
toehold segment as single strand terminal sequence of one end of
the displacement segment, a second toehold segment as a single
terminal sequence of the opposite end of the displacement segment,
and a third toehold segment arranged within a loop structure of the
displacement strand as described herein. In some embodiments, the
one or more exemplary toehold segments herein described are
configured to bind the same signal molecule. In alternate
embodiments, the one or more exemplary toehold segments herein
described are configured to bind different signal molecules.
[0194] According to embodiments herein described, a signal molecule
can comprise a signal polynucleotide. A signal molecule can also
comprise a protein, peptide fragment, a biological metabolite, or
other natural biological product, or a metal ion or other molecules
known to bind aptamers.
[0195] The term "aptamers" as used here indicates oligonucleic acid
or peptide molecules that bind a specific target. In particular,
nucleic acid aptamers can comprise, for example, nucleic acid
species that have been engineered through repeated rounds of in
vitro selection or equivalently, SELEX (systematic evolution of
ligands by exponential enrichment) to bind to various molecular
targets such as small molecules, proteins, nucleic acids, and even
cells, tissues and organisms. Aptamers are useful in
biotechnological and therapeutic applications as they offer
molecular recognition properties that rival that of the antibodies.
Peptide aptamers are peptides that are designed to specifically
bind to and interfere with protein-protein interactions inside
cells. In particular, peptide aptamers can be derived, for example,
according to a selection strategy that is derived from the yeast
two-hybrid (Y2H) system. In particular, according to this strategy,
a variable peptide aptamer loop attached to a transcription factor
binding domain is screened against the target protein attached to a
transcription factor activating domain. In vivo binding of the
peptide aptamer to its target via this selection strategy is
detected as expression of a downstream yeast marker gene.
[0196] The term "small molecule" as used herein indicates an
organic compound that is of synthetic or biological origin and
that, although might include monomers and/or primary metabolites,
is not a polymer. In particular, small molecules can comprise
molecules that are not protein or nucleic acids, which play a
biological role that is endogenous (e.g. inhibition or activation
of a target) or exogenous (e.g. cell signaling), which are used as
a tool in molecular biology, or which are suitable as drugs in
medicine. Small molecules can also have no relationship to natural
biological molecules. Typically, small molecules have a molar mass
lower than 1 kgmol-l. Exemplary small molecules include secondary
metabolites (such as actinomicyn-D), certain antiviral drugs (such
as amantadine and rimantadine), teratogens and carcinogens (such as
phorbol 12-myristate 13-acetate), natural products (such as
penicillin, morphine and paclitaxel) and additional molecules
identifiable by a skilled person upon reading of the present
disclosure.
[0197] The terms "peptide" and "oligopeptide" usually indicate a
polypeptide with less than 50 amino acid monomers, wherein the term
"polypeptide" as used herein indicates an organic linear, circular,
or branched polymer composed of two or more amino acid monomers
and/or analogs thereof. The term "polypeptide" includes amino acid
polymers of any length including full length proteins and peptides,
as well as analogs and fragments thereof. As used herein the term
"amino acid", "amino acidic monomer", or "amino acid residue"
refers to any of the twenty naturally occurring amino acids,
non-natural amino acids, and artificial amino acids and includes
both D an L optical isomers. In particular, non-natural amino acids
include D-stereoisomers of naturally occurring amino acids (these
including useful ligand building blocks because they are not
susceptible to enzymatic degradation). The term "artificial amino
acids" indicate molecules that can be readily coupled together
using standard amino acid coupling chemistry, but with molecular
structures that do not resemble the naturally occurring amino
acids. The term "amino acid analog" refers to an amino acid in
which one or more individual atoms have been replaced, either with
a different atom, isotope, or with a different functional group but
is otherwise identical to original amino acid from which the analog
is derived.
[0198] Exemplary embodiments of possible variations of activatable
construct herein described with reference to the exemplary
construct of FIGS. 3A-3B and FIGS. 12A-12B are provided in the
illustration of FIGS. 13A-17B, and 19-27B, showing exemplary
molecular complexes of the disclosure configured in an inactive
conformation (FIGS. 13A, 14A, 15A, 16A 17A, 19, 20, 21A, 21B, 22A,
23A, 24 25, 26 and 27A-B) or presented in an active conformation
(FIGS. 13B, 14B, 15B, 16B, 17B, and 22B, 23B and 28).
[0199] FIGS. 13A-B show a schematic illustration of an exemplary
signal-activated molecular construct G6L1X1 according to
embodiments herein described in the OFF inactive conformation (FIG.
13A) and in the ON active conformation (FIG. 13B). In the
illustration of FIGS. 13A-B show the OFF state of the construct and
the ON state when the sensor strand of the construct is fully
base-paired with the activating RNA transcript and decoupled from
the activated RNAi targeting domain. G6 is the guide strand for the
targeting domain. L1Ps is the passenger strand attaching a 5'
terminal L1P5' overhang and a 3' terminal L1P3' overhang through C3
linkers. The 5' and 3' overhang of L1Ps form a sensor duplex with
sensor strand X1. X1 is a 2'-O-methyl modified RNA strand with
phosphorothioate backbone modifications. The 5' of X1 has a toehold
for binding of the signal RNA transcript. In the illustration of
FIGS. 13A-B, the signal molecule is an activating RNA signal S1 and
binds to the sequence mUmCmUmGmA in the toehold. The binding of the
signal to the sensor strand leaves an unpaired base, mU, between
the toehold and the rest of the base-pairs.
[0200] FIGS. 14A-B show a schematic illustration of an exemplary
signal-activated molecular complex, G6L2X2, in which the guide
strand G6 and the passenger strand L2Ps form the targeting duplex.
The overhangs of L2 (L2p5' and L2P3') and the displacement segment
E2D of the sensor strand X2 form the sensor duplex. In the
illustration of FIGS. 14A-B, the L2 strand differs from the L1
strand of the construct of FIGS. 13A-B in the pattern of chemical
modifications at the connection point to the L1P3' over hang. L2
segment has the sequence " . . . C*mG--overhang" instead of " . . .
*mC*mG--overhang". The change from the *mC of the L1Ps strand to
the C residues in the corresponding position of the L2Ps resulted
in improved RNAi activity in the ON state (see Examples
section).
[0201] FIGS. 15A-B show a schematic illustration of an exemplary
signal-activated molecular complex, G6L2X3, in which the guide
strand G6 and the passenger strand L2Ps form the targeting duplex
and the overhangs of L2P5' and L2P3' form the sensor duplex by
complementarily binding displacement segment X3D of sensor strand
X3. In the construct of FIGS. 15A-B, the X3 strand differs from X2
strand in construct of FIGS. 14A-B in that X3 contains LNA
modifications that increase the thermodynamic stability of the
construct. This results in significantly lower OFF state RNAi
activity compared with the construct of FIGS. 14A-B (see Examples
section).
[0202] FIGS. 16A-B show a schematic illustration of an exemplary
signal-activated molecular complex, G6L2X5, in which, the guide
strand G6 and the passenger strand L2Ps form the targeting duplex
and the overhangs of L2P5' and L2P3' form the sensor duplex by
complementarily binding the displacement segment X5D of the sensor
strand X5 form the sensor duplex. In the construct of FIGS. 16A-B,
the X5 strand differs from the X3 strand of the construct of FIGS.
15A-B, in that X5 has a longer toehold sequence that increase the
rate of isothermal strand displacement reactions allowing the
activation of the construct by the RNA activation sequence. (see
Examples section).
[0203] FIGS. 17A-B show a schematic illustration of an exemplary
signal-activated molecular complex, G6L2X6, in which the guide
strand G6 and the passenger strand L2Ps form the targeting duplex
and the overhangs of L2P5' and L2P3' form the sensor duplex by
complementarily binding the displacement segment X6D of the sensor
strand X6 form the sensor duplex. In the construct of FIGS. 17A-B,
the X6 strand differs from X5 strand in the construct of FIGS.
16A-B in that X6 has an LNA modified base in its toehold to
increase the toehold stability and thereby the rate of isothermal
strand displacement reactions allowing the activation of the
construct by the RNA activation sequence (see Examples
section).
[0204] FIGS. 18A-C illustrate exemplary toeholds according to some
embodiments of the present disclosure. In particular, FIG. 18A
illustrates the 5' toehold of construct G6L2X3 (FIGS. 15A-B), which
comprises six base pairs complementary to a signal strand and a
mismatch to said strand at position 7 of the toehold. FIG. 18B
illustrates the 5' toehold of construct G6L2X5 (FIGS. 16A-B), which
comprises eight base pairs complementary to a signal strand and has
no mismatches. FIG. 18C illustrates the 5' toehold of construct
G6L2X6 (FIGS. 17A-B), which comprises eight base pairs
complementary to a signal strand, has no mismatches, and further
comprises an LNA modified base. Different configuration of the
toehold affect the activation rate of the construct and the related
performance (see e.g. Example 3).
[0205] FIGS. 19 to 21B illustrate exemplary embodiments including
more than one toehold (FIGS. 19, 21A and 21B) and/or toehold in
positions alternative or additional to the 5' terminus of the
sensor strand (FIGS. 19 to 21B). In particular FIG. 19: Part A
illustrates a tile saRNA construct with both a 5' toehold Et1 and a
3' toehold ET2segments. In the illustration of FIG. 19, both
toeholds base-pair to different portions of HIV tat/rev mRNA,
thereby increasing the likelihood of activation by the matching
tat/rev RNA transcripts present in the host cell. In a possible
variation a 5' toehold ET1 and a 3' toehold ET2 can specifically
bind different signal molecule thus allowing a controlled
activation in different environments. FIG. 16B illustrates a tile
saRNA construct with an internal toehold E2T. The toehold allows
base-pairing to the HIV tat/rev mRNA. Compared with the construct
of FIG. 19, the passenger strand overhang are modified and the
pattern of LNA modifications on the sensor strand is changed to
accommodate the new secondary structure. In particular in the
illustration of FIG. 20, the sensor strand E2 comprises two
displacement segments E2D1 and ED2 complementary to C2 and D2
overhang protection segments attached to the targeting domain
through C3 linkers. In the illustration of FIG. 16B the
displacement segments E2D1 and ED2 flan the internal toehold E2T
which is directly attached with its 5' terminus to the 3' terminus
of E2D1 and with its 3' terminus with the 5' terminus of E2D2
[0206] In the exemplary constructs of FIGS. 21A and 21B the tile
saRNA has two toeholds and is designed to be activated by two
separate transcripts. In the illustration of FIG. 21A the binding
position of the first transcript to the toehold E2T1 is
highlighted. In the illustration of FIG. 21B, the binding position
of the second transcript to the toehold E2T2 is highlighted. The
two transcripts can be, for example, miRNAs expressed in the cell.
In some embodiments, in constructs such as the one of FIGS. 21A and
21B, the sequences can be configured so that both transcripts
and/or other signal molecule need to be present to fully displace
the sensor strand E2 and activate the tile saRNA.
[0207] In the exemplary construct of FIGS. 22A and 22B, the gap
between the protection 5' terminal protection segment D4 and 3'
terminal protection segment C4 has been filled by unmodified RNA
nucleotides and the passenger strand B4 has consequently been
circularized (for example, by enzymatic ligation) so that there is
no gap between overhang segments C4 and D4. In constructs of FIGS.
22A and 22B the bases positioned in positions where in
corresponding constructs the gap is present are preferably
unmodified in view of the covalent linkages interfering and
protecting from exonuclease degradation. In embodiments where
constructs have a configuration such as the one exemplified in
FIGS. 22A and 22B, use of a higher concentration of the construct
is preferred.
[0208] In the exemplary construct of FIGS. 23A and 23B, the gap
between protection segments C and D is moved segment B forming the
passenger strand. In those embodiments the targeting domain is
maintained in a straight conformation by the rigid and gapless
sensor domain, in absence of circularization of the passenger
strand of the targeting domain which is nicked.
[0209] The term "nicked" as used herein with reference to a
polynucleotide strand of a double stranded polynucleotides,
indicates a gap in the direct covalent linkage between two
nucleotides of the polynucleotide chain forming the strand that are
engaged in complementary binding within double stranded
polynucleotide. Accordingly, an RNA duplex comprising a nicked
passenger strand can be obtained by cleaving the covalent linkage
between suitable nucleotides e.g. by using suitable
endoribonucleases (such as an RNAase III enzyme) or by synthesis of
the a double stranded polynucleotide with selected
dideoxyribonucleotides used to introduce the nick as will be
understood by a skilled person. Additional approaches will also be
identifiable by the skilled person directed to obtain a passenger
strand in which two of the nucleotides forming the polynucleotide
chain engaged in the complementary binding with the guide strand
are not directly covalently linked to each other.
[0210] FIGS. 24 and 25 illustrate an exemplary constructs including
additional chemical modifications capable of influencing the
cellular distribution and localization of tile saRNA complexes to
increase or decrease the tile saRNA's sensitivity to the presence
of activating RNA transcripts. FIG. 24 shows the exemplary
molecular construct G6-L2-X3-Inosine in which the 5' toehold of the
sensor strand X3 is modified with a tract of 5 deoxyinosines. These
universal bases (see webpages
idtdna.com/site/Catalog/Modifications/Product/1061 at the date of
filing of the present disclosure) form weak base pairings with
single stranded DNA and RNA bases, thereby allowing for example the
construct to more efficiently sample cellular RNA transcripts. FIG.
25 shows the exemplary molecular construct G6-L2-X3-Inosine-HMW-PEG
where construct is modified with an additional high molecular
weight (10000 to 100000 Daltons) PEG to decrease spurious
association with cellular proteins and modify the cellular
distribution.
[0211] FIG. 26 shows the exemplary molecular construct AB6-C6D6E6
configured so that the RNA sensor is replaced by a DNA aptamer
based sensor for platelet derived growth factor B. In the
constructs of FIG. 26, PDGF-B binds to the aptamer toehold and
displaces the sensor strand E (the aptamer) from base-pairing to C
and D (Douglas, S. M., Bachelet, I. & Church, G. M. A
Logic-Gated Nanorobot for Targeted Transport of Molecular Payloads.
Science 335, 831-834).
[0212] In some variation of the construct of FIG. 26 since the
aptamer is unlikely to tolerate extensive chemical modifications
that differ from the original SELEX generated sequence (Green, L.
S., Jellinek, D., Jenison, R., Ostman, A., Heldin, C.-H. &
Janjic, N. Inhibitory DNA Ligands to Platelet-Derived Growth Factor
B-Chain. Biochemistry 35, 14413-14424, doi:10.1021/bi961544+ (1996)
thermodynamically stabilizing LNA modifications can be placed on
the passenger strand overhangs, although this might compromise
activation kinetics. In some variations chemical blocking groups
can also be added to the 3' (C3+3' amino) and 5' (PEG) termini of
the DNA aptamer to help reduce exonuclease degradation.
[0213] In some variations of the construct of FIG. 26, the two
helices with 1.5 nm long PEG linkers to lower the geometric strain
consequent to the inclusion in the duplex of DNA:DNA and RNA:RNA
bases, wherein DNA:DNA duplexes are longer than RNA:RNA duplexes of
equal base-pair number as will be understood by a skilled
person.
[0214] FIG. 27A and FIG. 27B show the exemplary molecular construct
G6 L2 X5-Loop which provides a variation of the G6 L2 X5 construct
to have a 5' toeholdX5T redesigned as a terminal loop X5T-loop. In
the construct of FIGS. 27A and 27B activating RNA transcripts use
the *mG* mU* mU *mC* sequence in the loop as the initial toehold.
The *mA*mA tract is used to increase the size of the loop to lower
steric hindrance for activation. Additional nucleotides or linkers
can be used to further open up the loop. The terminal loop is held
in place by four base-pair, including an LNA modification. To
minimize toxicity, the size of the terminal loop's base-pairs plus
the length of the sensor duplex is preferably below 28 total base
pairs.
[0215] Signal activatable constructs and related components herein
described can be designed and manufactured based on techniques
described herein and/or identifiable by the skilled person upon
reading of the present disclosure. In particular the configuration
of the segments of the constructs can be identified and designed
based on calculation of the thermodynamic stability of the various
conformation of the segments and constructs as a whole. For
example, thermodynamic stability of polynucleotide conformation
dependents on several factors identifiable by a skilled person,
including its i) chemical composition (for example, DNA:RNA duplex
is less than RNA: RNA duplex); ii) base composition (for example,
G/C base paring is more stable than A/T base paring, which is
approximately as stable as G/T, G/U wobble base pairing, and the
formation of a stable RNA hairpin requires at least 3 G/C base
pairs or at least 5 A/U, G/U base pairs); iii) nearest neighbors
such as presence of mismatches, open ends, and junctions near a
base-pair can substantially influence its energy contribution
according to the second-nearest neighbor model (for example, the
stacking of successive base-pairs is primarily responsible for the
stability of DNA helices); iv) non-canonical base pairing (for
example, RNA and DNA can form triple helix and quadraplex
structures via Hoogsteen base-pairing, which is less stable base
pairings than canonical base pairing); v) Geometry (e.g.
polynucleotide sequences can only adopt secondary structures that
are geometrically consistent or similar with the known tertiary
structural characteristics of RNA and DNA helices); vi)
Environmental factors, such as pH value, counter-ion concentration
and temperature and additional factors identifiable by a skilled
person.
[0216] Accordingly, designing the polynucleotide sequences
comprised in the signal activatable complexes can be performed
identifying the combination of length, sequence, complementarity
and substitutions that is associated with a desired relative
thermodynamic stability resulting in the configuration herein
described and the environment wherein the enzyme assisted molecular
delivery is desired. Specific sequences of desired signal
polynucleotides can be identified by a skilled person based on
environment (and in particular, specific cells and tissues) where
delivery is desired. For applications where molecular delivery in
cells is desired, polynucleotide sequences can be designed
according to the corresponding physiological conditions, such as
approximately, pH 7.3-7.4, about150 millimolar potassium or sodium
chloride or equivalent salt, and about 37.degree. C.
[0217] For base pairing between unmodified DNA segments or between
unmodified RNA segments, the base-pairing energies and the most
stable secondary structure conformations can be estimated by
computational methods known to and well established in the art.
Several packages are available and published in documents also
discussing in detail factors affecting the energy and stability of
nucleic acid secondary structures. Exemplary publications
describing the packages and factors comprise for i) NUPACK web
server: J. N. Zadeh, et al., J Comput Chem, 32, 170-173, (2011);
ii) NUPACK analysis algorithms: R. M. Dirks et al., SIAM Rev, 49,
65-88 (2007); R. M. Dirks et al., J Comput Chem, 24, 1664-1677
(2003); R. M. Dirks et al., J Comput Chem, 25, 1295-1304 (2004);
iii) NUPACK design algorithms: J. N. Zadeh et al., J Comput Chem,
32, 439-452, (2011); iv) mfold web server: M. Zuker, Nucleic Acids
Res. 31 (13), 3406-3415, (2003); A. Waugh et al., RNA 8 (6),
707-717, (2002); M. Zuker et al., RNA 4, 669-679, (1998); v)
UNAFold & mfold: N. R. Markham et al., Bioinformatics: Volume
2, Chapter 1, pp 3-31, Humana Press Inc., (2008); M. Zuker, et al.,
11-43, J. Barciszewski and B. F. C. Clark, eds., NATO ASI Series,
Kluwer Academic Publishers, Dordrecht, NL, (1999); M. Zuker, A. M.
Griffin and H. G. Griffin eds. Methods in Molecular Biology, Humana
Press Inc., 267-294, (1994); J. A. Jaeger et al., Methods in
Enzymology 183, 281-306 (1990); M. Zuker, Science 244, 48-52,
(1989); vi) Free energies for RNA: D. H. Mathews et al., J. Mol.
Biol. 288, 911-940, (1999); A. E. Walter et al., Proc. Natl. Acad.
Sci. USA 91, 9218-9222, (1994); vii) Methods and theory of RNA
secondary structure prediction: D. H. Mathews et al., Secondary
Structure Prediction. In Current Protocols in Nucleic Acid
Chemistry S. Beaucage, D. E. Bergstrom, G. D. Glick, and R. A.
Jones eds., John Wiley & Sons, New York, 11.2.1-11.2.10,
(2007); D. H. Mathews et al., Predicting RNA Secondary Structure.
In The RNA World, R. F. Gesteland, T. R. Cech and J. F. Atkins
eds., 3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., Chapter 22, (2006); D. H. Mathews et al. 3rd edition,
John Wiley & Sons, New York, Chapter 7, (2005); D. H. Mathews
et al., (2004); M. Zuker, Bull. Mathematical Biology 46, 591-621,
(1984); M. Zuker et al., Nucleic Acids Res. 9, 133-148, (1981) D.H
Mathews et al Folding and Finding RNA Secondary Structure in Cold
Spring Harb Perspect Biol. (2010); viii) Exemplary mfold &
UNAFold applications: J.-M. Rouillard et al., Nucleic Acids Res. 31
(12), 3057-3062 (2003); J.-M. Rouillard, et al., Bioinformatics 18
(3), 486-487, (2002). In addition, since some polynucleotide
structures typically fluctuate between an ensemble of secondary
structure conformations, the composition of the relevant ensemble
can be determined using computational methods known in the art (see
for example, see Sfold web server for statistical folding and
rational design of nucleic acids. Nucleic Acids Res. 32 Web Server
issue, W135-W141, (2004), and Ye Ding et al., RNA 11, 1157-1166.
2005, herein incorporated by reference in its entirety).
[0218] Accordingly, in several embodiments, design of a
polynucleotide sequence of the targeting and sensor domains of the
signal activatable construct herein described, can be performed for
sequences or portions of sequences consisting of unmodified DNA
and/or RNA base pairs, by computational methods and/or software
packages to calculate the free energy of the sequence and the
secondary structure conformation. In embodiments, wherein
polynucleotide sequences comprise derivatives of nucleotides, such
as chemically modified bases and analogues, and/or chimeric
polynucleotide sequences composed of a mixture of
deoxyribonucleotides and ribonucleotides, design can be performed
by computationally designing unmodified RNA structures with the
desired secondary structure conformations and thermodynamic
stability, and then introducing one or more chemical modifications
to achieve the desired thermodynamic stability.
[0219] In some embodiments addition of chemical moieties can be
performed to direct or control location and/or activation in
selected environment as will be understood by a skilled person. For
example the addition of an inosine tract (2 to 20 inosines) to the
end of the toehold domain could help the construct sample RNA
transcript inside cells by providing transient base-pairing to
arbitrary single stranded RNA domains. Also aptamers or chemical
moieties may be added to the 5' terminus of the guide strand or the
3' or 5' termini of the sensor strand to attach to cellular
structures or chemical moieties that could direct localization, RNA
sampling, or aid delivery Attachment of the saRNA to cellular
proteins, RNA structures, or chemical moieties known to localize in
certain cellular compartments (nucleus, mitochondria, membranes),
in some embodiments can help the saRNA preferentially sample RNA
transcripts in those compartments. Attachment of the construct to
other RNA binding domains such as polypeptides (see e.g. Tan, R.
& Frankel, A. D. in Proceedings of the National Academy of
Sciences 92, 5282-5286 (1995) proteins (see e.g. Castello, A., in.
Cell 149, 1393-1406, (2012) and Dreyfuss, G., et al in Nat Rev Mol
Cell Biol 3, 195-205 (2002)), cationic polymers, or RNA structures
such as ribosome (e.g. Yusupov, M. M., et al in. Science 292,
883-896, (2001) and Kahan, M., et al in Physica D: Nonlinear
Phenomena 237, 1165-1172 (2008))., and tRNA (Scherer, L. J., in
Nucleic Acids Research 35, 2620-2628, (2007)) can also increase
targeting of saRNA sample RNA transcripts in the cell.
[0220] The signal activatable construct designed according the
present disclosure can be synthesized using standard methods for
oligonucleotide synthesis well establish in the art, for example,
see Piet Herdewijn (2005), herein incorporated by reference in its
entirety.
[0221] The synthesized oligonucleotide can be allowed to form its
secondary structure under a desirable physiological condition,
(e.g. 1.times. phosphate buffered saline at pH 7.5 with 1 mmolar
concentration MgCl2 at 37.degree. C.). The formed secondary
structure can be tested using standard methods known in the art
such as chemical mapping or NMR (see e.g. Kertesz, M., et al in.
Nature 467, 103-107, (2010), Mathews, D. H., et al in. Cold Spring
Harbor Perspectives in Biology 2, (2010), and Watts, J. M., et al
in. Nature 460, 711-716, (2009)). For example, see Stephen Neidle,
Neidle, S. Principles of nucleic acid structure. (Academic Press,
2010) herein incorporated by reference in its entirety. The
designed construct can be further modified, according to the test
result, by introducing or removing chemical modifications,
mismatches, wobble pairings, as necessary, until the desired
structure is obtained. Reference is made in this connection to the
exemplary procedure provided in the Examples section.
[0222] In some embodiments, the construct is configured to minimize
immune responses. In these embodiments, each consecutive 30 base
pairs duplex can have at least 5% 2'-O-methyl modifications
(Molecular Therapy (2006) 13, 494-505, herein incorporated by
reference in its entirety) or one or two mismatches. In other
embodiments, the construct is configured to stimulate immune
responses. In these embodiments, the construct can comprises at
least one consecutive 30 base-pair duplex with no 2'-O-methyl
modifications when the construct is in the activated conformation.
For example, the total length of the toehold segment and the sensor
segment can be at least 30 nucleotides without 2'-O-methyl
modifications, and will be perfectly base paired with the signal
polynucleotide sequence.
[0223] In some embodiments, the guide strand is configured to
interfere with a target intracellular process of the cells through
RNAi in presence of the signal polynucleotide. Accordingly suitable
targeting domain include siRNA, microRNA and additional duplex
structure suitable to be used in connection with RNA
interfering.
[0224] The term "RNA interfering" or "RNAi" as used herein refers
to a mechanism or pathway of living cells that controls level of
gene expression that has been found in many eukaryotes, including
animals. The RNAi pathway has many important roles, including but
not limited to defending cells against parasitic genes such as
viral and transposon genes, directing development and regulating
gene expression in general. The enzyme Dicer, which is an
endoribonuclease in the RNAse III family, initiates the RNAi
pathway by cleaving double-stranded RNA (dsRNA) molecules into
short fragments of dsRNAs about 20-25 nucleotides in length. Dicer
contains two RNase III domains and one PAZ domain; the distance
between these two regions of the molecule is determined by the
length and angle of the connector helix and determines the length
of the siRNAs it produces. Dicer cleaves with the highest
efficiency dsRNA substrates 21 bp and longer with a two-base
overhang at the 3' end.
[0225] The small fragments of dsRNAs produced by Dicer are known as
small interfering RNA (siRNA). The term "small interfering RNA" or
"siRNA", sometimes also known as short interfering RNA or silencing
RNA, refers to a class of dsRNA molecules which is typically 20-25
nucleotides in length and plays a variety of roles in biology. The
most notable role of siRNA is its involvement in the RNAi pathway.
In addition to its role in the RNAi pathway, siRNA also acts in
RNAi-related pathways, including but not limited to several
antiviral pathways and shaping chromatin structure of a genome.
[0226] Each siRNA is unwound into two single-stranded (ss) ssRNAs,
namely the passenger strand and the guide strand. The passenger
strand is degraded, while the guide strand is incorporated into a
multiprotein complex, known as the RNA-induced silencing complex
(RICS). RICS uses the incorporated ssRNA as a template for
recognizing a target messenger RNA (mRNA) molecule that has
complementary sequence to the ssRNA. Upon binding to the target
mRNA, the catalytic component of RICS, Argonaute, is activated,
which is an endonuclease that degrades the bound mRNA molecule.
[0227] Similar to siRNAs, microRNAs (miRNAs) also mediate the RNAi
pathway. The term "microRNA" or "miRNA" as used herein indicates a
class of short RNA molecules of about 22 nucleotides in length,
which are found in most eukaryotic cells. miRNAs are generally
known as post-transcriptional regulators that bind to complementary
sequences on target mRNA transcripts, usually resulting in
translational repression and gene silencing.
[0228] miRNAs are encoded by miRNA genes and are initially
transcribed into primary miRNAs (pri-miRNA), which can be hundreds
or thousands of nucleotides in length and contain from one to six
miRNA precursors in hairpin loop structures. These hairpin loop
structures are composed of about 70 nucleotides each, and can be
further processed to become precursor-miRNAs (pre-miRNA) having a
hairpin-loop structure and a two-base overhang at its 3' end.
[0229] In the cytoplasm, the pre-miRNA hairpin is cleaved by the
RNase III enzyme Dicer. Dicer interacts with the 3' end of the
hairpin and cuts away the loop joining the 3' and 5' arms, yielding
an imperfect miRNA:miRNA duplex about 22 nucleotides in length.
Overall hairpin length and loop size influence the efficiency of
Dicer processing, and the imperfect nature of the miRNA:miRNA base
pairing also affects cleavage. Although either strand of the duplex
can potentially act as a functional miRNA, only one strand is
usually incorporated into RICS where the miRNA and its mRNA target
interact.
[0230] In those embodiments, wherein the guide strand is configured
for interfering a target intracellular process through RNAi, the
double-stranded duplex typically formed by the guide strand and
passenger strands can have a melting temperature (Tm) of at least
about 25.degree. C. In particular, the 5' terminal nucleotide of
the guide strand can be base paired to one of the passenger
strands. In some embodiments, nicked double-stranded duplex formed
by the guide strand and passenger strands are stable under
conditions of the environment where delivery will be performed. In
embodiments where RNAi is performed in mammals the nicked
double-stranded duplex typically formed by the guide strand and
passenger strand can have a melting temperature (Tm) of at least
about 37.degree. C.
[0231] In some embodiments, a double-stranded polynucleotide duplex
with a 3' overhang of 2 nucleotides in length is most efficiently
bound by the PAZ domain of the endonucleases enzyme Dicer (Jin-Biao
Ma, et al, 2004). In human cells, RNAse H commonly cleaves the RNA
sequence of a DNA:RNA duplex at a position that is 5 nucleotides
from the 5' end of the RNA sequence forming the duplex. If the
duplex is longer than 7 base pairs, RNAse H can cleave at
additional positions to the 3' of the first cleavage site.
Accordingly, in embodiments using an RNAse H substrate, the DNA:RNA
duplex formed in the activated conformation according to the
current disclosure is at least 5 nucleotides, and in particular 7-8
nucleotides.
[0232] In those embodiments where the targeting domain is
configured to interfere with a target intracellular process of the
cells through RNAi, the passenger strand and the guide strand are
at least 16 nucleotides in length. In particular, in some
embodiments, they are no shorter than 22 nucleotides. In
particular, in some embodiments, the guide strand is at least 2
nucleotides longer than the passenger strand. Accordingly, in some
embodiment, the double-stranded duplex formed by the guide strand
and passenger strand has a 2-base single strand overhang at the 3'
terminus of the guide strand.
[0233] In particular, in some embodiments, the double-stranded
duplex formed by the passenger strand and the guide strand is no
longer than 30 consecutive base pairs, if the duplex comprises only
unmodified ribonucleotides. In other embodiments, the
double-stranded duplex formed by the passenger strand and the guide
strand can be longer than 30 base pairs, if the duplex comprises
mismatches and/or modified ribonucleotides. The mismatches and/or
modifications are likely to prevent activation of innate immune
system responses. Exemplary modifications to the passenger strand
and the guide strand include but are not limited to
2'-O-methylation, 2'-Fluoro modifications, 2'-amino modifications,
and inclusion of LNA or PNA nucleotides. In particular,
2'-O-methyl, 2' Fluoro, 2' amino, LNA and PNA are expected to
improve stability of the structure.
[0234] Further, in these embodiments, at least one at least one
strand of the duplex is configured for interfering with a target
intracellular process through RNAi. In some embodiments, the at
least one strand is at least partially complementary to a target
gene sequence for silencing that gene through RNAi. In other
embodiments, the at least one strand is at least partially
complementary to a common sequence shared by multiple genes or
members of a gene family. In other embodiments, the at least one
strand is configured to be incorporated into a protein complex to
activate the complex and/or the substrate of the complex or to
initiate a cascade of activation of downstream effectors of the
complex. In some embodiments, from 2 to 8 bases of the at least one
strand incorporated into RISC is complementary with a target gene
forming a "seed region" usually considered particularly important
for RNAi activity as will be understood by a skilled person.
[0235] According to several embodiments, the duplex formed by the
guide strand and the passenger strand has a blunt end at the 3' end
of the guide strand. The duplex formed by the passenger strand and
the guide strand is at least 21 bp long. In particular, the first
21 nucleotide from the 3' terminus of the guide strand are
configured for interfering with a target intracellular process
through RNAi, and the 21.sup.st and 22.sup.nd 5' terminus of the
passenger strand and from the 3' terminus of the passenger strand
and the guide strand are unmodified RNA nucleotides so as to allow
efficient Dicer processing after signal activation of the signal
activatable construct.
[0236] In particular, in some embodiments, at least one of the
passenger strand and the guide strand comprises a sequence
homologous to an endogenous microRNA sequence. More particularly,
in some embodiments, the passenger strand and the guide strand have
the exact same sequence and structure as a known or predicted
pre-miRNA. In some embodiments, at least one of the passenger
strands and the guide strands has the same sequence as a known or
predicted mammalian miRNA. In some embodiments, the double-stranded
duplex formed by the passenger and guide strands comprises
mismatches and/or bulges configured to mimic a known or predicted
mammalian miRNA. In some embodiments at least one of the passenger
strands or guide strands is homologous to the sequence of a known
or predicted mammalian miRNA. The term "homologous" or "homology"
used herein with respect to biomolecule sequences as indicates
sequence similarity between at least two sequences. In particular,
according to the current disclosure, a homologous sequence of a
mammalian miRNA can have the same sequence located at base position
2-7 from the 5' terminus of the guide strand of the miRNA.
[0237] In some embodiments, a system for intracellular information
processing and controlling of cells is described. The system
comprising two or more signal activatable constructs as described
for simultaneous combined or sequential use in the cells, in which
the targeting domain of at least one construct of the two or more
constructs is configured to release a second signal in the presence
of the signal polynucleotide, and the second signal is configured
to activate one or more construct of the two or more
constructs.
[0238] In one embodiment, a sensor gated siRNA can be provided with
selectively activated RNAi activity in cells expressing a specific
RNA sequence. The activating sequence switches ON the siRNA by
binding to its sensor domain and triggering internal conformational
changes that induce processing by endogenous XRN1 or other enzymes.
The result is an active Dicer substrate that can direct targeted
RNAi.
[0239] As disclosed herein, the signal activated constructs and
related components herein described can be provided as a part of
systems for molecule delivery, including any of the deliveries
described herein. The systems can be provided in the form of kits
of parts. In a kit of parts, the signal activated constructs and
related components and other reagents to perform delivery can be
comprised in the kit independently. The signal activated constructs
and related components can be included in one or more compositions,
and each construct or component can be in a composition together
with a suitable vehicle.
[0240] Additional components can include labeled molecules and in
particular, labeled polynucleotides, labeled antibodies, labels,
microfluidic chip, reference standards, and additional components
identifiable by a skilled person upon reading of the present
disclosure. The terms "label" and "labeled molecule" as used herein
as a component of a complex or molecule referring to a molecule
capable of detection, including but not limited to radioactive
isotopes, fluorophores, chemiluminescent dyes, chromophores,
enzymes, enzymes substrates, enzyme cofactors, enzyme inhibitors,
dyes, metal ions, nanoparticles, metal sols, ligands (such as
biotin, avidin, streptavidin or haptens) and the like. The term
"fluorophore" refers to a substance or a portion thereof which is
capable of exhibiting fluorescence in a detectable image. As a
consequence, the wording "labeling signal" as used herein indicates
the signal emitted from the label that allows detection of the
label, including but not limited to radioactivity, fluorescence,
chemiluminescence, production of a compound in outcome of an
enzymatic reaction and the like.
[0241] In some embodiments, detection of molecule delivery can be
carried either via fluorescent based readouts, in which the labeled
antibody is labeled with fluorophore, which includes, but not
exhaustively, small molecular dyes, protein chromophores, quantum
dots, and gold nanoparticles. Additional techniques are
identifiable by a skilled person upon reading of the present
disclosure and will not be further discussed in detail.
[0242] In particular, the components of the kit can be provided,
with suitable instructions and other necessary reagents, in order
to perform the methods here described. The kit will normally
contain the compositions in separate containers. Instructions, for
example written or audio instructions, on paper or electronic
support such as tapes or CD-ROMs, for carrying out the assay, will
usually be included in the kit. The kit can also contain, depending
on the particular method used, other packaged reagents and
materials (i.e. wash buffers and the like).
[0243] In some embodiments, one or more signal activated constructs
and/or related components, (e.g., sensor domain) herein described
are comprised in a composition together with a suitable vehicle.
The term "vehicle" as used herein indicates any of various media
acting usually as solvents, carriers, binders or diluents for
signal activated constructs and related components that are
comprised in the composition as an active ingredient. In
particular, the composition including the signal activated
constructs and related components can be used in one of the methods
or systems herein described.
[0244] In some embodiments, a composition for signal activated
molecular delivery can comprise one or more of the signal
activatable construct as described together with a suitable
vehicle. In some embodiments, the vehicle is suitable for
delivering the signal activatable construct to cells. Exemplary
suitable vehicles according to the current disclosure include but
are not limited to nanoparticle, such as cyclodextrin, gold
nanoparticle and dendrimer; liposome and liposome analogues;
conjugated aptamer; conjugated antibody; conjugated cell
penetrating peptide or peptide analogue; carbon nanotubes;
conjugated fatty acids and quantum dots.
[0245] In some embodiments the signal activated constructs herein
described can be used in method for controlled release of a
targeting domain from an activated complex. The methods comprise
contacting the activated molecular complex with a signal molecule
capable of binding to the toehold segment for a time and under
condition to allow release of the targeting domain from the
activated molecular complex. In some embodiments the contacting can
be performed with methods identifiable by a skilled person that
will depend on specific target taking into account the selective
activation allows a contacting in environment other than the one
where the target is located (e.g. different cells and tissues). For
example in embodiments where a selective contacting in one or more
specific cell types is desired one or more constructs of this
disclosure can be used comprising moieties allowing a targeted
delivery of the construct to one or more specific cells types (e.g.
by including RNA aptamers to cell surface proteins that will bind
one or more target cell types). In embodiments where a more general
contacting is desired (e.g. in vivo) the administration can be
performed with or without moiety that maximize delivery in various
cell types (e.g. pegylation).
[0246] In embodiments herein described, the concentrations of
constructs to be provided in the contacting depend on the structure
of the construct and the related efficiency and on the
concentration of the target and can be determined based on the
desired effect as will be understood by a skilled person. For
example in an exemplary embodiments where knock out of a target in
a blood cell is desired, an initial verification of the
concentration of the specific construct to be used can be performed
by providing the specific RNA, designing a construct based on the
specific RNA and the specific signal and verifying the
concentration of the related ON and OFF conformation for the
construct and testing it on the target with a series of dilutions
(e.g. 10 fold dilutions series of each of ON and OFF construct) and
detecting the knock down of the target gene and/or target protein
with methods identifiable by a skilled person, such as real time
quantitative PCR (qRT PCR) for the target mRNA and/or Western
Blotting for the protein with a preferable use of methods allowing
quantitative detection. On this basis it is possible to select the
concentration range of the specific constructs that provides the
desired effect. In some embodiments this method can be performed in
vitro. For example the contacting can be performed in immortalized
cell lines, and/or primary cells depending on the experimental
settings. In other embodiments, contacting can be performed in vivo
for example in animals e.g. by using one or more set of
concentrations tracking the construct (e.g. with a fluorophore) to
be able to verify the delivery in the cells comprising the target.
In some embodiments following identification of effective
concentrations of the constructs to be used in vivo performed in
animal models, the concentration can be used to target a gene or a
protein in individuals according to approached identifiable by a
skilled person.
[0247] In some embodiments, the signal activated constructs and
related components herein described are comprised in pharmaceutical
compositions together with an excipient or diluent.
[0248] The term "excipient" as used herein indicates an inactive
substance used as a carrier for the active ingredients of a
medication. Suitable excipients for the pharmaceutical compositions
herein described include any substance that enhances the ability of
the body of an individual to absorb the signal activated constructs
and related components herein described or combinations thereof.
Suitable excipients also include any substance that can be used to
bulk up formulations with the peptides or combinations thereof, to
allow for convenient and accurate dosage. In addition to their use
in the single-dosage quantity, excipients can be used in the
manufacturing process to aid in the handling of the peptides or
combinations thereof concerned. Depending on the route of
administration, and form of medication, different excipients can be
used. Exemplary excipients include, but are not limited to,
antiadherents, binders, coatings, disintegrants, fillers, flavors
(such as sweeteners) and colors, glidants, lubricants,
preservatives, sorbents.
[0249] The term "diluent" as used herein indicates a diluting agent
which is issued to dilute or carry an active ingredient of a
composition. Suitable diluents include any substance that can
decrease the viscosity of a medicinal preparation.
[0250] In particular, in some embodiments, disclosed are
pharmaceutical compositions which contain at least one signal
activated constructs and related components as herein described, in
combination with one or more compatible and pharmaceutically
acceptable vehicles, and in particular with pharmaceutically
acceptable diluents or excipients. In those pharmaceutical
compositions the signal activated constructs and related components
can be administered as an active ingredient for treatment or
prevention of a condition in an individual.
[0251] The term "treatment" as used herein indicates any activity
that is part of a medical care for, or deals with, a condition,
medically or surgically.
[0252] The term "prevention" as used herein indicates any activity
which reduces the burden of mortality or morbidity from a condition
in an individual. This takes place at primary, secondary and
tertiary prevention levels, wherein: a) primary prevention avoids
the development of a disease; b) secondary prevention activities
are aimed at early disease treatment, thereby increasing
opportunities for interventions to prevent progression of the
disease and emergence of symptoms; and c) tertiary prevention
reduces the negative impact of an already established disease by
restoring function and reducing disease-related complications.
[0253] The term "condition" as used herein indicates a physical
status of the body of an individual (as a whole or as one or more
of its parts), that does not conform to a standard physical status
associated with a state of complete physical, mental and social
well-being for the individual. Conditions herein described include
but are not limited disorders and diseases wherein the term
"disorder" indicates a condition of the living individual that is
associated to a functional abnormality of the body or of any of its
parts, and the term "disease" indicates a condition of the living
individual that impairs normal functioning of the body or of any of
its parts and is typically manifested by distinguishing signs and
symptoms.
[0254] The wording "associated to" as used herein with reference to
two items indicates a relation between the two items such that the
occurrence of a first item is accompanied by the occurrence of the
second item, which includes but is not limited to a cause-effect
relation and sign/symptoms-disease relation.
[0255] The term "individual" as used herein in the context of
treatment includes a single biological organism, including but not
limited to, animals and in particular higher animals and in
particular vertebrates such as mammals and in particular human
beings.
[0256] In some embodiments, a method for treating a disease in an
individual through signal activated molecular delivery in cells,
comprises administering to the individual an effective amount of
one or more of the signal activatable constructs herein described
and in particular one or more of the molecular complexes,
activatable molecular complex, activated complexes and/or
exonuclease resistant complexes herein described, in effective
concentration which can be identified according to approaches
identifiable by a skilled person upon reading of the present
disclosure (e.g. by determining effective concentrations in
immortalized cell lines, primary cell lines and the in animal
models followed by clinical trials in individuals). In some
embodiments, a multi-stage therapeutic nanoparticles can be
provided that utilize enzyme activated release of a cargo in a cell
to achieve controlled step-wise disassembly and cargo release in
target environment such as solid tumor microenvironments.
[0257] A skilled person will be able to identify further
application and in particular therapeutic applications as well as
cargo molecules to be used as active agents in the treatment and
design a corresponding signal activatable construct to be
administered according to the features of the construct and the
desired effect. In particular, in applications wherein signal
activatable construct is desired system administration of the agent
can be performed. In embodiments, where an activated construct is
instead used, topical administration to the specific target cell
and tissue can be performed.
[0258] Further advantages and characteristics of the present
disclosure will become more apparent hereinafter from the following
detailed disclosure by way or illustration only with reference to
an experimental section.
EXAMPLES
[0259] The signal activatable constructs herein disclosed are
further illustrated in the following examples, which are provided
by way of illustration and are not intended to be limiting.
[0260] The following material and methods were used in the
experiments illustrated in the following examples.
[0261] Transfections for Luciferase analyses: Briefly, HCT116 cells
were transfected with the indicated exemplary constructs, duplexes,
or controls at the indicated final concentrations (ranging from
0.04 to 5 nMolar) with pBluescript (pBS) as carrier, using
Lipofectamine2000 according to the manufacturer's (Invitrogen)
protocol. The cell medium was replaced at 18 hours
post-transfection and lysates collected at 24 hours
post-transfection for analysis. Specifically, one day before
transfection, cells were seeded in growth medium in 48-well cluster
plates without antibiotics so that cells would reach 90-95%
confluency at the time of transfection (as recommended by
Invitrogen protocols). Each well was transfected with a final DNA
mix consisting of: 40 nanograms (ng) psiCHECK (Promega) plasmid
bearing a Firefly luciferase (Fluc) control reporter and a Renilla
luciferase (Fluc) reporter with the target in the 3' UTR
(untranslated region); 120 ng pBluescript carrier DNA; and the
experimental constructs or duplex diluted in 10 mM Tris/1 mM EDTA
pH 6.7 (TE). The final DNA mix therefore consisted of 16 ul of
target mix in OptiMEM and 4 ul of experimental DNA at 50.times. the
final desired concentration in TE. To reduce sample to sample
variability, the psiCHECK target mix was made in batch in OptiMEM
and aliquoted to allow 3 technical replicates (wells) for each
condition prior to addition of the experimental DNA. An equal
volume of a 1/50 dilution of Lipofectamine2000 in OptiMEM was added
(bringing the volume to 1/5th the final) and incubated according to
the manufacturer's instructions. The liposome/DNA constructs or
duplexes were added, along with fresh complete medium to the cells
to give a final volume of 200 ul. Medium was replaced at 18 hours
post-transfection. At 24 hours, samples were collected for
luciferase analysis using the Promega Dual-Luciferase Reporter
Assay System kit according to the manufacturer's protocol. For each
replicate, the Renilla luciferase (target) value was normalized to
the Firefly luciferase (internal control) value. Triplicates were
averaged, and the experimental values as a fraction of carrier
alone (no experimental construct), whose value is set at 1.
Therefore, the greater the RNAi activity, the lower the relative
luciferase units.
[0262] Theoretical and experimental prediction tools: the following
theoretical and experimental prediction tools can also be used in
procedures to make and use activatable construct of the present
disclosure: Thermodynamic prediction tools for RNA and DNA (e.g.
see webpages nupack.org, mfold.rna.albany.edu/?q=mfold and
sfold.wadsworth.org/cgi-bin/index.p1 at the date of filing of the
present disclosure); Thermodynamic prediction tools and structure
design tools for LNA modified oligos (e.g. web page
exiqon.com/oligo-tools at the date of filing of the present
disclosure); Experiments for determining melting temperature (e.g.
Temperature regulated UV-Vis and High precision calorimetry
techniques identifiable by a skilled person); Experimental and
theoretical measurements for determining end to end distance (e.g.
by molecular simulation, FRET measurements techniques, TEM or AFM
measurements if nanoparticles or carbon nanotubes are tethered at
either end, according to approaches identifiable by a skilled
person); Experimental measurements of general structure and
base-paired ness (e.g. by Gel migration assay on native structures
and nuclease protection mapping to understand secondary structure
techniques identifiable by a skilled person) and Experimental
measurements of strand displacement (e.g. by incubation of 1 nM
pre-annealed OFF state construct with 1 nM activating transcript at
37 C for 1 hour in PBS buffer, followed by running of native PAGE
assay and select constructs where at least 10 percent of constructs
switch to activated form); and Experimental measurements of
activation specificity (e.g. by performing the same procedure
indicated in this paragraph to verify strand displacement with
strands that are configured not to activate the construct and
select the constructs where no activation be detected within a set
time limit e.g. an 1 hour).
Example 1
Exemplary Activatable Constructs
[0263] Exemplary molecular constructs were provided having the
features summarized in Table 1 below. All sequences are listed in
the 5' to 3' direction.
TABLE-US-00001 TABLE 1 RNA Complexes and Component Strands
Complexes Abbreviation Sequences SEQ ID NOs FIG. FIGS. 3A, 3B, 9
(panels A-D) AB-CDE and 10A A PEG*mC*mG UCU GAG GGA UCU CUA SEQ ID
NO.: 1 GUU ACC UU D/B/C G*A*C*GAA GAG CUC C3 mG*mG*mU SEQ ID NO. 2;
AAC UAG AGA UCC CUC AGA*mC*mG SEQ ID NO. 3; C3 GCG GAG AC*A*G*C SEQ
ID NO. 4 E PEG*mG*mU*mU* C+ SEQ ID NO. 5 mU*mG*mA*mU*mG*mA*mG* mC*
T+ *mC* mU*T+*mC* mG*mU*C+ *mG*mC*T+* mG*mU*mC* mU*mC*mC* G+*mC* C3
*NH.sub.2 ET PEG*mG*mU*mU* +C*mU*mG*mA*mU* SEQ ID NO: 6 ED
mG*mA*mG* mC* +T *mC* mU*+T*mC* SEQ ID NO; 7 mG*mU*+C *mG*mC*+T*
mG*mU*mC* mU*mC*mC* +G*mC* C3 *NH.sub.2 G6 L1 FIGS. 12A and M1/G6
L1 12B/FIGS. X1/ 13A and 13B G6 9s*mC*mG UCU GAG GGA UCU CUA SEQ ID
NO. 8 GUU ACC UU L1P3'/L1Ps/ G*A*C*G*A*A GAG CUC C3 SEQ ID NO. 9;
L1P5' mG*mG*mU AAC UAG AGA UCC CUC SEQ ID NO. 10; AGA*mC*mG C3 GCG
GAG*A*C*A*G*C SEQ ID NO. 11 M1 PEG*mG*mU*mU* +C SEQ ID NO. 12
mU*mG*mA*mU*mG*mA*mG* mC* +T *mC* mU*+T*mC* mG*mU*+C *mG*mC*+T*
mG*mU*mC* mU*mC*mC* +G*mC* C3 *NH.sub.2 X1 9s*mU*mC*mU*mG*mA*mU*mU*
SEQ ID NO. 13 *mG*mA*mG* mC*mU*mC* mU*mU*mC* mG*mU*mC *mG*mC*mU*
mG*mU*mC* mU*mC*mC* mG*mC* C3 *idT X1 T 9s*mU*mC*mU*mG*mA*mU*mU*
SEQ ID NO. 14 X1D *mG*mA*mG* mC*mU*mC* SEQ ID NO. 15 mU*mU*mC*
mG*mU*mC *mG*mC*mU* mG*mU*mC* mU*mC*mC* mG*mC* C3 *idT FIGS. 14A G6
L2 X2 and 14B G6 9s*mC*mG UCU GAG GGA UCU CUA SEQ ID NO. 8 GUU ACC
UU L2P3'/L2PS/ G*A*C*G AAG AGC UC C3 mG*mG*mU SEQ ID NO. 16 L2P5'
AAC UAG AGA UCC CUC AGA C*mG C3 SEQ ID NO. 17; GCG GAG AC*A*G*C SEQ
ID NO. 18 X2 9s*mU*mC*mU*mG*mA*mU*mU*mG*m SEQ ID NO. 19
A*mG*mC*mU*mC*mU*mU*mC*mG*mU *mC *mG*mC*mU* mG*mU*mC* mU*mC*mC*
mG*mC*c3*(3'C6 Amino) X2T 9s*mU*mC*mU*mG*mA*mU*mU SEQ ID NO. 20 X2D
*mG*mA*mG*mC*mU*mC*mU*mU*mC* SEQ ID NO. 21 mG*mU*mC *mG*mC*mU*
mG*mU*mC* mU*mC*mC* mG*mC*c3*(3'C6 Amino) FIGS. 15A G6 L2 X3 and
15B, G6 9s*mC*mG UCU GAG GGA UCU CUA SEQ ID NO. 8 GUU ACC UU
L2P3'/L2Ps/ G*A*C*G AAG AGC UC C3 mG*mG*mU SEQ ID NO. 16; L2P5' AAC
UAG AGA UCC CUC AGA mC*mG SEQ ID NO. 17; C3 GCG GAG AC*A*G*C SEQ ID
NO. 18 X3 /5Sp9/mU*mC*mU*mG*mA*mU*mU*mG* SEQ ID NO. 22
mA*mG*mC*+T*mC*mU*+T*mC*mG*m U*+C*mG*mC*+T*mG*mU*mC*mU*mC*
mC*+G*mC*/3AmMO/ X3T /5Sp9/mU*mC*mU*mG*mA*mU*mU* SEQ ID NO: 23 See
also FIGS. 18A X3D mG*mA*mG*mC*+T*mC*mU*+T*mC*m SEQ ID NO: 24
G*mU*+C*mG*mC*+T*mG*mU*mC*mU* mC*mC*+G*mC*/3AmMO/ FIGS. 16A G6 L2
X5 and 16B G6 9s*mC*mG UCU GAG GGA UCU CUA SEQ ID NO. 8 GUU ACC UU
L2P3'/L2PS/ G*A*C*G AAG AGC UC C3 mG*mG*mU SEQ ID NO. 16; L2P5' AAC
UAG AGA UCC CUC AGA mC*mG SEQ ID NO. 17; C3 GCG GAG AC*A*G*C SEQ ID
NO. 18 X5 //5Sp9/ SEQ ID NO. 25 mG*mU*mU*mC*mU*mG*mA*mU*mG*
mA*mG*mC*+T*mC*mU*+T*mC*mG*m U*+C*mG*mC*+T*mG*mU*mC*mU*mC*
mC*+G*mC*/3AmMO/ X5T //5Sp9/ SEQ ID NO: 26 See also FIG.
mG*mU*mU*mC*mU*mG*mA*mU* 18B X5D mG*mA*mG*mC*+T*mC*mU*+T*mC*m SEQ
ID NO 27 G*mU*+C*mG*mC*+T*mG*mU*mC*mU* mC*mC*+G*mC*/3AmMO/ FIGS.
17A G6 L2 X6 and 17B G6 9s*mC*mG UCU GAG GGA UCU CUA SEQ ID NO. 8
GUU ACC UU L2P3'/L2Ps/ G*A*C*G AAG AGC UC C3 mG*mG*mU SEQ ID NO.
16; L2P5' AAC UAG AGA UCC CUC AGA C*mG C3 SEQ ID NO. 17; GCG GAG
AC*A*G*C SEQ ID NO. 18 X6 /5Sp9/mG*mU*mU*+C*mU*mG*mA*mU* SEQ ID NO.
28 mG*mA*mG*mC*+T*mC*mU*+T*mC*m G*mU*+C*mG*mC*+T*mG*mU*mC*mU*
mC*mC*+G*mC*/3AmMO/ X6T /5Sp9/mG*mU*mU*+C*mU*mG*mA*mU* SEQ ID NO:
29 See also FIG. 18C X6D mG*mA*mG*mC*+T*mC*mU*+T*mC*m SEQ ID NO; 30
G*mU*+C*mG*mC*+T*mG*mU*mC*mU* mC*mC*+G*mC*/3AmMO/ G6 L3 X7 G6
9s*mC*mG UCU GAG GGA UCU CUA SEQ ID NO. 8 GUU ACC UU L3P3'/LP/
G*C*G*GAGACAGCG C3 mG*mG*mU SEQ ID NO. LP5 AACUAGAGAUCCCUCAGA C*mG
C3 31; SEQ ID GGCAGGAA*G*A*A NO. 32; SEQ ID NO. 33 X7
/5Sp9/mC*mU*mC*mU*mU*mC*mG*mU* SEQ ID NO.
mC*mG*mC*+T*mG*mU*mC*+T*mC*mC 34 *mG*+C*mU*+T*mC*mU*mU*+C*mC*m
U*mG*+C*mC* /3AmMO/ X7T /5Sp9/mC*mU*mC*mU*mU*mC*mG*mU* SEQ ID NO.
35 X7D mC*mG*mC*+T*mG*mU*mC*+T*mC*mC SEQ ID NO.
*mG*+C*mU*+T*mC*mU*mU*+C*mC*m 36 U*mG*+C*mC* /3AmMO/ G6 L3 X8 G6
9s*mC*mG UCU GAG GGA UCU CUA SEQ ID NO. 8 GUU ACC UU L3P5'/LP/
G*C*G*GAGACAGCG C3 mG*mG*mU SEQ ID NO. LP3 AACUAGAGAUCCCUCAGA C*mG
C3 31; SEQ ID GGCAGGAA*G*A*A NO. 32; SEQ ID NO. 33 X8
/5Sp9/mC*mU*+C*mU*mU*mC*mG*mU* SEQ ID NO.
mC*mG*mC*+T*mG*mU*mC*+T*mC*mC 37 *mG*+C*mU*+T*mC*mU*mU*+C*mC*m
U*mG*+C*mC* /3AmMO/ X8T /5Sp9/mC*mU*+C*mU*mU*mC*mG*mU* SEQ ID NO.
38 X8D mC*mG*mC*+T*mG*mU*mC*+T*mC*mC SEQ ID NO.
*mG*+C*mU*+T*mC*mU*mU*+C*mC*m 39 U*mG*+C*mC* /3AmMO/ tat activator
strand unmodified S0 S0 G C G G A G A C A G C G A C G A A G SEQ ID
NO. A G C U C A U C A G 40 tat activator strand S1 28 bp S1 mA mA
mA mA mA G C G G A G A C A SEQ ID NO. G C G A C G A A G A G C U C A
U C A G 41 mA mA mA mA mA idT tat activator strand S2 31 bp S2 mA
mA mA mA mA G C G G A G A C A SEQ ID NO. G C G A C G A A G A G C U
C A U C A G 42 A A C mA mA mA mA mA idT tat activator strand S4 S4
mA mA mA mA mA GGC AGG AAG AAG SEQ ID NO. CGG AGA CAG CGA CGA AGA
GCU 43 CAU CAG AAC A mA mA mA mA mA idT
[0264] In Table 1, PEG refers to a polyethylene glycol (PEG)
linker; NH.sub.2 refers to a primary amine group; * asterisk refers
to phosphothiester linkages; mN refers to 2'-O-methyl bases, with N
representing any of the four bases; C3 refers to a three carbon
spacer; 9s refers to a tri-ethyleneglycol spacer; +N refers to an
LNA base; (3'C6 Amino) refers to a C6 Amino modification; idT
refers to an inverted dT exonuclease blocker; /5Sp9/ refers to a 5'
triethyleneglycol spacer; and /3AmMO/ refers to a 3' amino
modifier.
[0265] Additional exemplary constructs are summarized in Table 2
below
TABLE-US-00002 TABLE 2 Additional RNA constructs and related
strands Complexes SEQ ID Abbreviation Sequences NOs FIG. AB1-
C1D1E1 FIG. 19 A PEG*mC*mG UCU GAG GGA UCU CUA SEQ ID GUU ACC UU
NO. 1 D1/B1//C1 G*A*C*G AAG AGC UC C3 mG*mG*mU SEQ ID AAC UAG AGA
UCC CUC AGA mC*mG C3 NO. 44; GCG GAG AC*A*G*C C SEQ ID NO. 45; SEQ
ID NO. 46 E1 (/5Sp9/mG*mU*mU*+C*mU*mG*mA*mU*m SEQ ID
U*mG*mA*mG*mC*+T*mC*mU*+T*mC*m NO. 47
G*mU*+C*mG*mC*+T*mG*mU*mC*mU*m C*mC*+G*mC*mU*mU*mC*mU*mU*mC*m
G*/3AmMO/) E1T1 /5Sp9/mG*mU*mU*+C*mU*mG*mA*mU*mU* SEQ ID NO. 48 E1D
mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* SEQ ID
mU*+C*mG*mC*+T*mG*mU*mC*mU*mC* NO. 49 mC*+G*Mc E1T2
mU*mU*mC*mU*mU*mC*mC*/3AmMO/ SEQ ID NO. 50 Activation
GGAGAAGCGGAGACAGCGACGAAGAGC SEQ ID N/A sequence UCAAUCAGA NO. 51
for AB1-C1D1E1 AB2- C2D2E2 FIG. 20 A PEG*mC*mG UCU GAG GGA UCU CUA
SEQ ID GUU ACC UU NO. 1 D2/B2/C2 G*A*A*GAGCUCAUC C3 mG*mG*mU SEQ ID
AACUAGAGAUCCCUCAGA mC*mG C3 NO. 52 AGAGCGGA*G*A*C SEQ ID NO. 53 SEQ
ID NO. 54 E2 (/5Sp9/*mG*mA*+T*mG*mA*mG*mC*+T* SEQ ID
mC*mU*+T*mC*mG*mU*mC*mG*mC*mU* NO. 55
mG*mU*mC*+T*mC*mC*+G*mC*mU*+C*mU *C3*/3AmMO/) E2T
mC*mG*mU*mC*mG*mC*mU*mG SEQ ID NO. 56 E2D1
/5Sp9/*mG*mA*+T*mG*mA*mG*mC*_T*mC SEQ ID *mU*+T* NO. 57 E2D2
mU*mC*+T*mC*mC*+G*mC*mU*+C*mU* SEQ ID C3*/3AmMO/ NO. 58 Activation
AGAGCGGAGACAGCGACGAAGAGCUCA SEQ ID N/A sequence UC NO. 59 for
AB2-C2D2E2 FIGS. AB3- 21A and C3D3E3 21B A PEG*mC*mG UCU GAG GGA
UCU CUA SEQ ID GUU ACC UU NO. 1 D3/B3/C3 (G*A*A*GAGCUCAUC C3
mG*mG*mU SEQ ID AACUAGAGAUCCCUCAGAmC*mG C3 NO. 60 AGAGCGGA*G*A*C)
SEQ ID NO. 61; SEQ ID NO. 62 E3 (/5Sp9/*mG*mA*+T*mG*mA*mG*mC* SEQ
ID +T*mC*mU*+T*mC*mG*mU*mC*mG*mC* NO. 63
mU*mG*mU*mC*+T*mC*mC*+G*mC*mU*+C
*mU*mG*mU*mU*+C*mU*mG*mA*C3*/3AmMO//) E3T1
mG*mU*mU*+C*mU*mG*mA*C3*/3AmMO//) SEQ ID NO. 64 E3D1
mG*mU*mC*+T*mC*mC*+G*mC*mU*+C*mU* SEQ ID NO. 65 E3D2
(/5Sp9/*mG*mA*+T*mG*mA*mG*mC* SEQ ID +T*mC*mU*+T*mC NO. 66 E3T2
mG*mU*mC*mG*mC*mU* SEQ ID NO. 67 1.sup.st UCAGAACAGAGCGGAGAC SEQ ID
N/A Activation NO. 68 sequence for AB3-C3D3E3 2nd
AGCGACGAAGAGCUCAUC SEQ ID N/A Activation NO. 69 sequence for
AB3-C3D3E3 FIGS. A- 22A and B4C4D4-E4 22B A PEG*mC*mG UCU GAG GGA
UCU CUA SEQ ID GUU ACC UU NO. 1 D4/B4/C4 GACGAAGAGCUC C3 mG*mG*mU
SEQ ID AACUAGAGAUCCCUCAGA C*mG C3 NO. 70; GCGGAGACAGC
(Circularized) SEQ ID NO. 71; SEQ ID NO. 72 E4
(:/5Sp9/mG*mU*mU*+C*mU*mG*mA*mU SEQ ID
*mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* NO. 73
mU*+C*mG*mC*+T*mG*mU*mC*mU*mC* mC*+G*mC*/3AmMO/) E4T
/5Sp9/mG*mU*mU*+C*mU*mG*mA*mU SEQ ID NO. 74 E4D
mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* SEQ ID
mU*+C*mG*mC*+T*mG*mU*mC*mU*mC* NO. 75 mC*+G*mC*/3AmMO/) Activation
G C G G A G A C A G C G A C G A A G A G SEQ ID FIG. sequence C U C
A U C A G A A C NO. 76 22B for A-BCD-E4 FIGS. A-B5.sub.1CD5 23A and
B5.sub.2-E5 23B A PEG*mC*mG UCU GAG GGA UCU CUA SEQ ID GUU ACC UU
NO. 1 B5.sub.1C5D5 UCCCUCAGA C*mG C3 GCGGAGACAGC SEQ ID B5.sub.2
GACGAAGAGCUC C3 mG*mG*mU NO. 77; AACUAGAGA SEQ ID NO. 78; SEQ ID
NO. 79 E5 (:/5Sp9/mG*mU*mU*+C*mU*mG*mA*mU SEQ ID
*mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* NO. 80
mU*+C*mG*mC*+T*mG*mU*mC*mU*mC* mC*+G*mC*/3AmMO/) E5T
/5Sp9/mG*mU*mU*+C*mU*mG*mA*mU SEQ ID NO 81 E5D
mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* SEQ ID
mU*+C*mG*mC*+T*mG*mU*mC*mU*mC* NO. 82 mC*+G*mC*/3AmMO/) Activation
G C G G A G A C A G C G A C G A A G A G SEQ ID FIG. sequence for C
U C A U C A G A A C NO.83 23B A-B5.sub.1CD5 B5.sub.2-E5 G6 L2 X3-
Inosine FIG. 24 G6 9s*mC*mG UCU GAG GGA UCU CUA GUU SEQ ID ACC UU
NO. 8 L2P3'/L2Ps/ G*A*C*G AAG AGC UC C3 mG*mG*mU SEQ ID L2P5' AAC
UAG AGA UCC CUC AGA C*mG C3 NO. 16; GCG GAG AC*A*G*C SEQ ID NO. 17;
SEQ ID NO. 18 X3-Inosine (/5Sp9//ideoxyI/*/ideoxyI/*/ideoxyI/*/ SEQ
ID ideoxyI/*/ideoxyI/*mG*mU*mU*+C*mU*mG*mA*mU* NO. 84
mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* mU*+C*mG*mC*+T*mG*mU*mC*mU*mC*
mC*+G*mC*/3AmMO/) X3T- /5Sp9//ideoxyI/*/ideoxyI/*/ideoxyI/* SEQ ID
Inosine /ideoxyI/*/ideoxyI/*mG*mU*mU*+C*mU*mG*mA*mU* NO. 85 X3D
mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* SEQ ID
mU*+30C*mG*mC*+T*mG*mU*mC*mU*mC* NO. 86 mC*+G*mC* G6 L2 X3-
Inosine- HMW-PEG FIG. 25 G6 9s*mC*mG UCU GAG GGA UCU CUA GUU SEQ ID
ACC UU NO. 8 L2P3'/L2Ps/ G*A*C*G AAG AGC UC C3 mG*mG*mU SEQ ID
L2P5' AAC UAG AGA UCC CUC AGA C*mG C3 NO. 16; GCG GAG AC*A*G*C SEQ
ID NO. 17; SEQ ID NO. 18 X3- (/5Sp9//ideoxyI/*/ideoxyI/*/ideoxyI/*
SEQ ID Inosine- /ideoxyI/*/ideoxyI/*mG*mU*mU*+C*mU*mG*mA*mU* NO. 87
HMWp-PEG mG*mA*mG*mC*+T*mC*mU*+T*mC*mG*
mU*+C*mG*mC*+T*mG*mU*mC*mU*mC* mC*+G*mC*HMW-PEG X3T-
/5Sp9//ideoxyI/*/ideoxyI/*/ideoxyI/* SEQ ID Inosine-
/ideoxyI/*/ideoxyI/*mG*mU*mU*+C*mU*mG*mA*mU* NO. 88 HMW-PEG X3D
mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* SEQ ID
mU*+C*mG*mC*+T*mG*mU*mC*mU*mC* NO. 89 mC*+G*mC*-HMW-PEG AB6- C6D6E6
FIG. 26 A PEG*mC*mG UCU GAG GGA UCU CUA SEQ ID GUU ACC UU NO. 1
D6/B6/C6 +T*dT*dG*dG dG dA +C dC dA dC PEG mG* SEQ ID mG* mU
AACUAGAGAUCCCUCAGA NO. 90; mC*mG PEG dT dA +C dT +C dA dG dC * dC
SEQ ID *dC* dA NO. 91; SEQ ID NO. 92 E6 dC dA dC dT dC dA dG dG dG
dC dA dC dT SEQ ID dG dC dA dA dG dC dA dA dT dT dG dT dG NO. 93 dG
dT dC dC dC dA dA dT dG dG dG dC dT dG dA dG dT dA .sup.2 E6T dC dA
dC dT dC dA dG dG dG dC dA dC dT SEQ ID
dG dC dA dA dG dC dA dA dT dT NO. 94 E6D dG dT dG dG dT dC dC dC dA
dA dT dG dG SEQ ID dG dC dT dG dA dG dT dA .sup.2 NO. 95 FIG. G6 L2
X5- 27A and Loop 27B G6 9s*mC*mG UCU GAG GGA UCU CUA SEQ ID GUU ACC
UU NO. 8 L2P3'/L2PS/ G*A*C*G AAG AGC UC C3 mG*mG*mU SEQ ID L2P5'
AAC UAG AGA UCC CUC AGA C*mG C3 NO. 16; GCG GAG AC*A*G*C SEQ ID NO.
17; SEQ ID NO. 18 X5-Loop /5Sp9/mA*mU*+C*mA*mA*mA*mG*mU*m SEQ ID
U*mC*mU*mG*mA*mU*mG*mA*mG*mC* NO. 96
+T*mC*mU*+T*mC*mG*mU*+C*mG*mC*+T *mG*mU*mC*mU*mC*mC*+G*mC*/3AmMO/
X5T-Loop mG*mU*mU*mC*mU*mG*mA*mU* SEQ ID NO. 97 X5D
mG*mA*mG*mC*+T*mC*mU*+T*mC*mG* SEQ ID
mU*+C*mG*mC*+T*mG*mU*mC*mU*mC* NO. 98 mC*+G*mC*/3AmMO/ Activation G
C G G A G A C A G C G A C G A A G A G SEQ ID FIG. sequence C U C A
U C A G A A C NO. 99 27B for G6 L2 X5- Loop
[0266] In particular, Table 1 and Table 2 indicate for each
exemplary molecular construct the specific sequences of the strands
that are complementarily bound to provide the molecular constructs
herein described, as well as the specific sequences of the signal
strands utilized to convert the exemplary molecular constructs from
the OFF state to the ON state by isothermal strand displacement.
The corresponding configurations are illustrated in FIGS. 3A to
27B, wherein each construct is identified by the corresponding
abbreviation.
Example 2A
Process of Designing a Signal Activated Construct
[0267] Exemplary processes are described below for the designing,
synthesis, and testing the activity of a signal activated
construct, which comprise a targeting domain configured for
interfering a target intracellular process through RNAi.
[0268] To determine linker dimensions construct a possible approach
a process comprise building two three dimensional models of
targeting domain and the sensor domain.
[0269] In such an approach the targeting domain model is just an
RNA:RNA duplex with the correct number of base-pairs. The sensor
domain model is a RNA:RNA, RNA:DNA, or DNA:DNA duplex with the
correct number of base-pairs.
[0270] If in the final construct there is a gap between the
protection segments bound to one or more of the displacement
segments in the sensor strand with the gap is bridged by RNA bases
in the sensor strand, RNA bases can be added to create an RNA:RNA
duplex model with the duplex formed by the protection segments with
the corresponding displacement segments bridged by the correct
number of base-pairs and then remove the bases opposing the
displacement segment at the gap.
[0271] If in the final construct the gap is bridged by an
unstructured linker, position the fully stretched linker between
duplex formed by the protection segments with the corresponding
displacement segments without rotating the sensor strand.
[0272] Position the two duplexes next to each other as close as
possible without touching (at least 0.1 nm distance between all
atoms) and orient them to minimize the distance between the 3'
terminus of B and the 5' terminus of C and between the 5' terminus
of B and the 3' terminus of D
[0273] Measure the distance between each pair of termini and add
.about.0.3 nm. This is the minimum length of the linkers.
[0274] Preferably, the linkers allow no less than 0.3 nm and no
more than 2 nm separation between the duplexes with a maximum
distance between the duplexes of approximately 5 nm.
[0275] For a polymeric linker, to determine the minimum linker
length, use the fully stretched length of the polymer.
[0276] For a polymeric linker, to determine linker length (in
polymer units) allowed for the maximum separation, calculate the
estimated end-to-end distance of the polymer according to polymer
physics methods known to the art
[0277] Using the above model, one can position the nick on the
sensor duplex on the side facing towards the targeting duplex. This
can be performed by changing the length of the duplexes formed by
protection segments and displacement segments in the sensor until
the gap is in the middle, preferably with duplexes formed by
protection segments and displacement segments independently of a
length of 8 base pairs or more. Verification is preferably made
that each segment has a Tm>37 C or in any case a Tm associated
with thermodynamic stability in the environment where the construct
is to be used.
Example 2B
Design of the Constructs Used in the Experiments a Signal Activated
Construct
[0278] To design a construct, Applicants started with the analysis
of a RNA sequence that was to be targeted (interference) by RNAi,
such as a target mRNA or a set of target mRNAs. According to the
RNA sequence to be targeted, applicants selected the sequences for
the targeting domain of the construct that were known in the
art.
[0279] For example, in the G6L1X1 construct shown in FIGS. 13A-B,
Applicants started with the Dicer substrate siRNA with the guide
strand sequence 5' UGAGGGAUCUCUAGUUACC 3' (SEQ ID NO. 100), which
targets the sequence 5'-GGUAACUAGAGAUCCCUC-3' (SEQ ID NO. 101), for
knockdown. The guide strand G6: L1 was configured as a 23 bp Dicer
substrate siRNA. Applicants then selected an HIV viral RNA related
sequence: 5'-GCGGAGACAGCGAAGAGCUCAUCAGA-3' (SEQ ID NO. 102), as the
activation signal molecule. Applicants split this sequence into
three parts: 5' GCGGAGACAGC (SEQ ID NO. 103), became the 3'
extension of the passenger strand L1; 5' GACGAAGAGCUC (SEQ ID NO.
104), became the 5' extension of the passenger strand L1; finally,
the remaining sequence, UCAGA (SEQ ID NO:. 105), became the binding
partner for the toehold. The sequence of the sensor strand, X1,
could immediately be written as the complement of the activation
sequence: UCUGA-U-UGAGCUCUUGUC-GCUGUCUCCGC (SEQ ID NO:. 106-SEQ ID
NO:. 107-SEQ ID NO:. 108) (SEQ ID NO:. 109)). An extra base, "U",
was optionally added between the toehold and the rest of the sensor
strand to reduce the toxicity of the sensor-signal duplex.
[0280] To determine the linker to be used in connecting the
passenger strand L1 to its overhangs, a 3D model of the sensor and
targeting domain duplexes were positioned parallel to one another
using molecular modeling software to minimize the distance that the
linkers need to bridge. From this measurement, Applicants
determined that a C3 linker was sufficiently long to connect the
two duplexes without unacceptable strain.
[0281] The split between the two non-toehold domains was determined
to give approximately equal thermodynamic stability to each
separate duplex section, and to position the gap between the 3' and
5' extension of L1 approximately between the two parallel RNA
helices.
[0282] The Applicants added tri-ethylene glycol linker/spacers to
the 5' of G6 and X1 to decrease spurious binding by Dicer and other
RNA binding proteins. The 3' of X1 was modified with a C3 linker
connected to an inverted dT base for the same purpose.
[0283] Applicants then modified the entire X1 strand with
phosphorothioate and 2'-O-methyl modifications to increase
thermodynamic stability and to minimize spurious exonuclease
degradation and helicase unwinding of the L1:X1 duplex.
[0284] To increase the stability of L1's overhangs from potential
spurious exonuclease degradation, the 5' and 3' bases of L1 were
modified with phosphorothioates. However, 2'-O-methyl modifications
were not used because they might impede strand displacement
switching.
[0285] The segments connecting L1 to the C3 linker connecting its
5' overhang was modified with a special pattern of 2'-O-methyl
bases and phosphorothioates to ensure that, in the activated state,
XRN1 can degrade the 5'-overhang while leaving a terminal phosphate
for binding to Dicer's PAZ domain. Although not strictly necessary,
the same pattern was used to connect the 3' overhang.
[0286] Finally, Applicants added 5' terminal phosphorothioates and
2'-O-methyl bases to G6 to improve the thermodynamic stability and
nuclease resistance of the targeting domain while taking care to
avoid chemical modification patterns that could compromise its RNAi
efficiency. The applicants also took care to keep the targeting
domain less stable to nuclease degradation than the sensor domain.
This helps avoid spurious activation of the complex via premature
degradation of the sensor domain.
[0287] Several optimizations of the base construct were performed
to enhance desired activity. A first optimization of the construct
G6 L1 X1 concerned the chemical modification pattern near the C3
linker connecting the L1 strand to its 3' overhang. In G6 L1 X1 the
chemical modification interfered to some extent with Dicer
processing of the activated targeting domain by placing a
phosphorothioate backbone modification and a 2'-O-methyl base near
the Dicer cleavage site. Thus, in an evolution of the design, the
L2 strand eliminated these modifications and achieved a higher RNAi
efficiency as shown in FIG. 29.
[0288] An additional optimization of the X1 strand concerned the
related thermodynamic stability in connection with the ability to
turn OFF RNAi activity to a sufficient extent. In particular
Applicants added LNA modifications to strands X3, X5 and X6,
thereby achieving lower OFF state RNAi activity as desired.
[0289] Additionally, a further optimization of the X1 strand was
performed on the length of the toehold and number of mismatch that
did not allow a desired isothermal switching of the construct by
the signal strand. Thus, X5 and X6 adopted longer toeholds, thereby
achieving efficient isothermal switching, as shown in FIG. 28.
Example 3
Design of the Sensor Strand Toehold
[0290] Several variations of the 5' sensor strand toehold were
designed to increase the kinetic rate of strand migration following
signal strand binding to the sensor strand. In particular,
according to Srinivas, N., et al. Nucleic Acids Research 41,
10641-10658, (2013) (herein incorporated by reference), there is an
extra barrier to the initiation of branch migration in DNA, and
increasing the number of base pairs in a toehold can lead to an
improvement in strand displacement kinetics of six orders of
magnitude.
[0291] In addition, elimination of mismatches between the toehold
and the signal strand and the addition of LNA modification in the
toehold can allow the signal strand to overcome any extra kinetic
barrier present due to the inclusion of LNA modifications in the
sensor strand.
[0292] Thus, several variations of the toehold were designed, and
are illustrated in FIGS. 18A-C. As illustrated in FIG. 18A, the
toehold of the G6L2X3 construct contains the sequence, 5' to 3',
mU*mC*mU*mG*mA* mU*mU* (SEQ ID NO:. 110) with a mismatch at
position 7 (with mN representing 2'-O-methyl bases, and asterisks *
representing phosphothiester linkages). FIG. 18B shows the toehold
of construct G6L2X5, which contains the sequence
mG*mU*mU*mC*mU*mG*mA*mU (SEQ ID NO:. 111) and no mismatches to the
signal strand. FIG. 18C shows the toehold of construct G6L2X6,
which contains the sequence mG*mU*mU*C+mU*mG*mA*mU, (SEQ ID NO:.
111) no mismatches to the signal strand, and an LNA base
(represented by +N).
Example 4
Assembly and Activation of Exemplary Activatable Constructs.
[0293] The exemplary activatable constructs listed in Table 1 were
assembled by combining all three component strands and annealing by
incubation at 100 nM concentrations in 1.times. PBS buffer with 1
mM EDTA. The individual strands composing G6, L, and X were ordered
from one of three commercial companies--IDT, GE Dharmacon, or
Exiqon, Inc. A. Assembly took place by thermal annealing of the
three strands from 85.degree. C. to 25.degree. C. at 1 degree
Celsius per minute cooling rate. The component strands were
combined in concentrations of 100 nM G strand, 100 nM L strand, 120
nM X strand.
[0294] The quality of assembly is affected by the concentration and
stoichiometric ratio of the strands used in the assembly, the
duration of the annealing step, the temperature profile, the salt
concentration, the pH, and other constituents of the assembly
buffer.
[0295] When deviating from the described assembly procedure, the
quality of assembly can preferably be checked e.g. via native PAGE.
The assembled complex is typically presented as a single band with
minimal detectable higher molecular weight aggregates or lower
molecular weight fragments.
[0296] Preferably, a purification process can be used to extract
the proper molecular weight band. If a purification process is not
possible, it is desirable to use a slight (e.g. approximately 10%)
excess of the sensor strand in relation to the guide strand and the
passenger strand to ensure that all assembled targeting domains are
switched OFF.
[0297] Furthermore, it is preferable to have the structures
optimally assembled immediately before use. If the structures need
to be stored, they are best stored at -80 C. The quality of frozen
assemblies is preferably checked periodically to ensure that the
structures are not degraded.
[0298] Constituent strands and assembled structures are preferably
protected from RNA and DNA nucleases, which may degrade the
structures, resulting in increased leakage or lower RNAi activity
when switched ON.
[0299] The assembly buffer can be for example PBS near pH7.0, use
of a different buffer may lead to lower assembly efficiency
depending on the experimental conditions as will be understood by a
skilled person. The ionic strength of the assembly buffer is
preferably similar than PBS. A lower ionic strength buffer is
expected to possibly increase the leakage rate due to misassembly
depending on the reaction conditions.
[0300] To test the assembly and activation of exemplary constructs,
the three component strands of each of constructs G6L2X3, G6L2X5,
and G6L2X6 were combined with 100 mM of activation strand S1 and
assembled by thermal annealing by heating the mixture to 85.degree.
C. and then cooling to room temperature. This directly formed the
ON state of the constructs. Additionally, component strands of
constructs G6L2X3, G6L2X5, and G6L2X6 were assembled as above to
form the OFF constructs, and 200 nM S1 activation strand was added
to each construct (at 100 mM concentration) and incubated in
1.times. PBS buffer with 1 mM EDTA for one hour at 37.degree. C. to
form the "Test" group of constructs to verify conversion of the OFF
state to the ON state by isothermal strand displacement (a
schematic of which is illustrated in FIG. 9, panels A to D).
Samples were then run on 8% TBE polyacrylamide gel electrophoresis
(PAGE) gels in 1.times. TBE for one hour at 150V according to
methods known in the art. Samples were post-stained with Sybr Gold
to visualize the various bands.
[0301] FIG. 28 illustrates the visualization on the TBE PAGE gels
from the above experiment. In particular, for each of the three
constructs tested, the "Off" lanes illustrate a single band
representing the assembled construct, indicating that the strands
assemble into the desired complexes with minimal formation of
higher order spurious assemblies. The "On" lanes represent two
bands--the signal strand-sensor strand duplex and the processed
target duplex Dicer substrate--as well as a small amount of
remaining unactivated OFF state constructs. The "Test" lanes show a
single band representing the assembled OFF construct and the two
bands representing the ON state, indicating successful conversion
of the OFF state product into the ON state product by isothermal
strand displacement. As expected, G6L2X5 and G6L2X6 had more
efficient conversion into the ON state due to improved
thermodynamic stability of their toeholds.
Example 5
Confirmation of RNAi Processing of the Guide Strand in Exemplary
Complexes by Luciferase Analysis
[0302] To test successful release and processing of the guide
strand from a targeting domain in an activated conformation of the
exemplary molecular complexes of Example 1, Applicant transformed
some of the constructs of Example 1 into cells, and performed dual
Luciferase assays, the results of which are illustrated in FIGS.
29-33.
[0303] In particular, pre-annealed ON and OFF state constructs
assembled as described in Example 4 above were transfected into HCT
116 cells and incubated for 24 hours, after which time readout was
performed. The Renilla Luciferase utilized in the assay comprised
an HIV sequence targeted by the guide strand of the targeting
duplex. In these dual Luciferase assays, the ratio of Renilla
Luciferase to Firefly Luciferase luminosity is compared to a
negative control. A value of 1.0 signifies undetectable RNAi
activity. A value of 0.0 constitutes perfect RNAi activity, meaning
there is zero activity from the Renilla luciferase target of RNAi
knockdown. As a positive control, assembled targeting domains,
which are configured to provide have RNAi activity without any
signal activation, are used.
[0304] FIG. 29 illustrates a diagram showing the result of the dual
luciferase assay carried out with targeting domains G6L1 and G6L2,
as well as assembled constructs G6L2X1, G6L2X2, and G6L2X3 in the
OFF state. The y-axis represents relative luciferase unit ratio and
the x-axis represents the exemplary complexes used; the rows below
the x-axis indicate the normalized luciferase readout ratio for
each concentration of each construct. Constructs and targeting
domains were co-transfected with the dual luciferase construct at
concentrations of 0.25, 0.5, 1.0, and 2.0 nM. As illustrated in
FIG. 29, targeting domain G6L2 has improved RNAi efficiency
compared to G6L1 due to the adjustment to the chemical modification
pattern. In particular, the L2 passenger strand (shown in FIGS.
14A-B) differs from the L1 strand (shown in FIGS. 13A-B) in the
pattern of chemical modifications at the connection point to the 3'
over hang. L2 has the sequence C*mG immediately 5' of the C3
linker, while L1 instead has the sequence *mC*mG. The *mC portion
of the L1 strand interferes with RNAi processing of the targeting
domain because the modifications are too close to the passenger
strand cleavage site for Dicer. The change from *mC to C in the
G6L2 targeting duplex improves RNAi activity in the ON state.
[0305] Additionally, as also illustrated in FIG. 29, construct
G6L2X3 has clearly lower OFF state RNAi activity than constructs
G6L2X1 and G6L2X3 due to the incorporation of LNA modifications in
the X3 sensor strand.
[0306] FIG. 30 illustrates a diagram showing the comparison the
RNAi activity of the OFF state G6L2X3 construct versus the
targeting domain G6L2 alone observed from the experiment above. The
y-axis represents the level of the target protein remaining, and
the x-axis represents the final nanomolar concentrations of each of
the two exemplary complexes used. There is a high ON/OFF ratio of
RNAi activity between the OFF state of the G6L2X3 construct and the
constitutively active G6L2 domain at all transfection
concentrations. The ON/OFF ratio is highest at 2.0 nM
concentration, with a ratio of .about.30, and lowest at the 0.25 nM
concentration, with a ratio of .about.4.
[0307] FIG. 31 illustrates a diagram showing the activity of the
G6L2X3 construct, shown in FIGS. 15A-B, in the ON and OFF state.
The y-axis represents relative luciferase unit ratio and the x-axis
represents the exemplary complexes used; the rows below the x-axis
indicate the normalized luciferase readout ratio for each
concentration of each construct. The construct was co-transfected
with the dual luciferase construct at concentrations of 0.25, 0.5,
1.0, and 2.0 nM. In addition, components and subassemblies of
G6L2X3, including the G2L6 targeting domain, the G6, L2, X3, and S1
strands alone, and assemblies consisting of G6 and X3, L2 and X3,
and X3 and S1 were transfected at the same concentrations as the
assembled construct. As illustrated in FIG. 31, individual
component strands of the G6L2X3 construct did not have any
detectable RNAi activity, while the targeting domain G2L6 alone and
the activated ON construct G6L2X3S1 had significant RNAi activity.
Additionally, there was a high ON/OFF ratio of RNAi activity when
comparing G6L2X3S1 (ON) with G6L2X3 (OFF).
[0308] FIG. 32 illustrates a diagram showing the comparison in the
RNAi activity of the OFF state G6L2X3 construct versus the ON state
G6L2X3S1 construct from the experiment above. The y-axis represents
the normalized dual luciferase value, and the x-axis represents the
final nanomolar concentrations of each of the two exemplary
complexes used. There is a high ON/OFF ratio of RNAi activity
between the OFF state of the G6L2X3 construct and the ON state
G6L2X3S1 construct at all transfection concentrations. The ON/OFF
ratio is highest at 2.0 nM concentration, with a ratio of .about.6,
and lowest at the 0.25 nM concentration, with a ratio of
.about.2.
[0309] FIG. 33 illustrates a diagram showing the results of the
dual luciferase assay carried out with constructs G6L2X3, G6L2X5,
and G6L2X6 in the OFF state and the same constructs in the ON state
(G6L2X3S1, G6L2X5S1, and G6L2X6S1). The y-axis represents relative
luciferase unit ratio and the x-axis represents the exemplary
complexes used; the rows below the x-axis indicate the normalized
luciferase readout ratio for each concentration of each construct.
The constructs were co-transfected with the dual luciferase
construct at concentrations of 0.016, 0.08, 0.4, and 2.0 nM. As
illustrated in FIG. 33, all three constructs have similar OFF state
RNAi activity and ON/OFF ratios, and all three constructs shown
significant RNAi activity in the ON state. Additionally, all three
constructs achieved low OFF state RNAi activity and large ON/OFF
RNAi activity ratios. The maximum ON/OFF activity ratio observed
was .about.10.times. at 2.0 nM concentration, and the minimum
ration was observed at 0.016 nM and was .about.1.4. At the highest
concentration, there was some spurious RNAi activity observed in
the OFF state.
[0310] FIG. 29 in particular demonstrates that the energetic
stability of the sensor domain is a key feature to prevent OFF
state leakage. G6L2X3 is significantly more stable
thermodynamically than G6 L2 X1 and G6 L2 X2 due to extensive
incorporation of LNA modifications. Non-LNA modifications that are
observed to significantly increase the duplex stability of the
sensor domain (tested via, for example, melting curves obtained by
monitoring the UV absorbance as temperature is increased), are
expected to have the same effect. The adjustment of a
phosphorothioate near the 21.sup.st base pair in L2 vs L1 lead to
significant increase in RNAi activity. Thus, the ability of Dicer
to efficiently process the RNAi targeting domain at the cleavage
positions next to the 19.sup.th and 21.sup.st base pairs is
important to the ON state activity. Thus, a 23 bp to 27 bp
targeting domains is expected to have significantly better ON state
RNAi activity compared to targeting domain outside the range.
[0311] The examples set forth above are provided to give those of
ordinary skill in the art a complete disclosure and description of
how to make and use the embodiments of the materials, compositions,
systems and methods of the disclosure, and are not intended to
limit the scope of what the inventors regard as their
disclosure.
[0312] All patents and publications mentioned in the specification
are indicative of the levels of skill of those skilled in the art
to which the disclosure pertains.
[0313] The entire disclosure of each document cited (including
patents, patent applications, journal articles, abstracts,
laboratory manuals, books, or other disclosures) in the Background,
Summary, Detailed Description, and Examples is hereby incorporated
herein by reference. All references cited in this disclosure are
incorporated by reference to the same extent as if each reference
had been incorporated by reference in its entirety individually.
However, if any inconsistency arises between a cited reference and
the present disclosure, the present disclosure takes precedence.
Further, the computer readable form of the sequence listing,
submitted on May 20, 2015 as an ASCII text file named
P1632-US_ST25, is incorporated herein by reference in its
entirety.
[0314] The terms and expressions which have been employed herein
are used as terms of description and not of limitation, and there
is no intention in the use of such terms and expressions of
excluding any equivalents of the features shown and described or
portions thereof, but it is recognized that various modifications
are possible within the scope of the disclosure claimed. Thus, it
should be understood that although the disclosure has been
specifically disclosed by embodiments, exemplary embodiments and
optional features, modification and variation of the concepts
herein disclosed can be resorted to by those skilled in the art,
and that such modifications and variations are considered to be
within the scope of this disclosure as defined by the appended
claims.
[0315] It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting. As used in this specification and
the appended claims, the singular forms "a," "an," and "the"
include plural referents unless the content clearly dictates
otherwise. The term "plurality" includes two or more referents
unless the content clearly dictates otherwise. Unless defined
otherwise, all technical and scientific terms used herein have the
same meaning as commonly understood by one of ordinary skill in the
art to which the disclosure pertains.
[0316] When a Markush group or other grouping is used herein, all
individual members of the group and all combinations and possible
subcombinations of the group are intended to be individually
included in the disclosure. Every combination of components or
materials described or exemplified herein can be used to practice
the disclosure, unless otherwise stated. One of ordinary skill in
the art will appreciate that methods, device elements, and
materials other than those specifically exemplified may be employed
in the practice of the disclosure without resort to undue
experimentation. All art-known functional equivalents, of any such
methods, device elements, and materials are intended to be included
in this disclosure. Whenever a range is given in the specification,
for example, a temperature range, a frequency range, a time range,
or a composition range, all intermediate ranges and all subranges,
as well as, all individual values included in the ranges given are
intended to be included in the disclosure. Any one or more
individual members of a range or group disclosed herein may be
excluded from a claim of this disclosure. The disclosure
illustratively described herein suitably may be practiced in the
absence of any element or elements, limitation or limitations which
is not specifically disclosed herein.
[0317] A number of embodiments of the disclosure have been
described. The specific embodiments provided herein are examples of
useful embodiments of the invention and it will be apparent to one
skilled in the art that the disclosure can be carried out using a
large number of variations of the devices, device components,
methods steps set forth in the present description. As will be
obvious to one of skill in the art, methods and devices useful for
the present methods may include a large number of optional
composition and processing elements and steps.
[0318] In particular, it will be understood that various
modifications may be made without departing from the spirit and
scope of the present disclosure. Accordingly, other embodiments are
within the scope of the following claims.
Sequence CWU 1
1
118125RNAArtificial SequenceSynthetic Polynucleotide 1cgucugaggg
aucucuaguu accuu 25212RNAArtificial SequenceSynthetic
Polynucleotide 2gacgaagagc uc 12323RNAArtificial SequenceSynthetic
Polynucleotide 3gguaacuaga gaucccucag acg 23411DNAArtificial
SequenceSynthetic Polynucleotide 4gcggagacag c 11531DNAArtificial
SequenceSynthetic Polynucleotide 5guucugauga gctcutcguc gctgucuccg
c 3168RNAArtificial SequenceSynthetic Polynucleotide 6guucugau 8
723DNAArtificial SequenceSynthetic Polynucleotide 7gagctcutcg
ucgctgucuc cgc 23825RNAArtificial SequenceSynthetic Polynucleotide
8cgucugaggg aucucuaguu accuu 25912RNAArtificial SequenceSynthetic
Polynucleotide 9gacgaagagc uc 121023RNAArtificial SequenceSynthetic
Polynucleotide 10gguaacuaga gaucccucag acg 231111DNAArtificial
SequenceSynthetic Polynucleotide 11gcggagacag c 111231DNAArtificial
SequenceSynthetic Polynucleotide 12guucugauga gctcutcguc gctgucuccg
c 311330RNAArtificial SequenceSynthetic Polynucleotide 13ucugauugag
cucuucgucg cugucuccgc 30147RNAArtificial SequenceSynthetic
Polynucleotide 14ucugauu 7 1523RNAArtificial SequenceSynthetic
Polynucleotide 15gagcucuucg ucgcugucuc cgc 231612RNAArtificial
SequenceSynthetic Polynucleotide 16gacgaagagc uc
121723RNAArtificial SequenceSynthetic Polynucleotide 17gguaacuaga
gaucccucag acg 231811DNAArtificial SequenceSynthetic Polynucleotide
18gcggagacag c 111930RNAArtificial SequenceSynthetic Polynucleotide
19ucugauugag cucuucgucg cugucuccgc 30207RNAArtificial
SequenceSynthetic Polynucleotide 20ucugauu 7 2123RNAArtificial
SequenceSynthetic Polynucleotide 21gagcucuucg ucgcugucuc cgc
232230DNAArtificial SequenceSynthetic Polynucleotide 22ucugauugag
ctcutcgucg ctgucuccgc 30237RNAArtificial SequenceSynthetic
Polynucleotide 23ucugauu 7 2423DNAArtificial SequenceSynthetic
Polynucleotide 24gagctcutcg ucgctgucuc cgc 232531DNAArtificial
SequenceSynthetic Polynucleotide 25guucugauga gctcutcguc gctgucuccg
c 31268RNAArtificial SequenceSynthetic Polynucleotide 26guucugau 8
2723DNAArtificial SequenceSynthetic Polynucleotide 27gagctcutcg
ucgctgucuc cgc 232831DNAArtificial SequenceSynthetic Polynucleotide
28guucugauga gctcutcguc gctgucuccg c 31298RNAArtificial
SequenceSynthetic Polynucleotide 29guucugau 8 3023DNAArtificial
SequenceSynthetic Polynucleotide 30gagctcutcg ucgctgucuc cgc
233112DNAArtificial SequenceSynthetic Polynucleotide 31gcggagacag
cg 123223RNAArtificial SequenceSynthetic Polynucleotide
32gguaacuaga gaucccucag acg 233311DNAArtificial SequenceSynthetic
Polynucleotide 33ggcaggaaga a 113431DNAArtificial SequenceSynthetic
Polynucleotide 34cucuucgucg ctguctccgc utcuuccugc c
31358RNAArtificial SequenceSynthetic Polynucleotide 35cucuucgu 8
3623DNAArtificial SequenceSynthetic Polynucleotide 36cgctguctcc
gcutcuuccu gcc 233731DNAArtificial SequenceSynthetic Polynucleotide
37cucuucgucg ctguctccgc utcuuccugc c 31388RNAArtificial
SequenceSynthetic Polynucleotide 38cucuucgu 83923DNAArtificial
SequenceSynthetic Polynucleotide 39cgctguctcc gcutcuuccu gcc
234028RNAArtificial SequenceSynthetic Polynucleotide 40gcggagacag
cgacgaagag cucaucag 284138RNAArtificial SequenceSynthetic
Polynucleotide 41aaaaagcgga gacagcgacg aagagcucau cagaaaaa
384241RNAArtificial SequenceSynthetic Polynucleotide 42aaaaagcgga
gacagcgacg aagagcucau cagaacaaaa a 414353RNAArtificial
SequenceSynthetic Polynucleotide 43aaaaaggcag gaagaagcgg agacagcgac
gaagagcuca ucagaacaaa aaa 534412RNAArtificial SequenceSynthetic
Polynucleotide 44gacgaagagc uc 124523RNAArtificial
SequenceSynthetic Polynucleotide 45gguaacuaga gaucccucag acg
234612DNAArtificial SequenceSynthetic Polynucleotide 46gcggagacag
cc 124739DNAArtificial SequenceSynthetic Polynucleotide
47guucugauug agctcutcgu cgctgucucc gcuucuucg 39489RNAArtificial
SequenceSynthetic Polynucleotide 48guucugauu 9 4923DNAArtificial
SequenceSynthetic Polynucleotide 49gagctcutcg ucgctgucuc cgc
23507RNAArtificial SequenceSynthetic Polynucleotide 50uucuucc
75136RNAArtificial SequenceSynthetic Polynucleotide 51ggagaagcgg
agacagcgac gaagagcuca aucaga 365212RNAArtificial SequenceSynthetic
Polynucleotide 52gaagagcuca uc 125323RNAArtificial
SequenceSynthetic Polynucleotide 53gguaacuaga gaucccucag acg
235411DNAArtificial SequenceSynthetic Polynucleotide 54agagcggaga c
115529DNAArtificial SequenceSynthetic Polynucleotide 55gatgagctcu
tcgucgcugu ctccgcucu 29568RNAArtificial SequenceSynthetic
Polynucleotide 56cgucgcug 85711DNAArtificial SequenceSynthetic
Polynucleotide 57gatgagctcu t 115810DNAArtificial SequenceSynthetic
Polynucleotide 58uctccgcucu 105929RNAArtificial SequenceSynthetic
Polynucleotide 59agagcggaga cagcgacgaa gagcucauc
296012RNAArtificial SequenceSynthetic Polynucleotide 60gaagagcuca
uc 126123RNAArtificial SequenceSynthetic Polynucleotide
61gguaacuaga gaucccucag acg 236211DNAArtificial SequenceSynthetic
Polynucleotide 62agagcggaga c 116336DNAArtificial SequenceSynthetic
Polynucleotide 63gatgagctcu tcgucgcugu ctccgcucug uucuga
36647RNAArtificial SequenceSynthetic Polynucleotide 64guucuga
76511DNAArtificial SequenceSynthetic Polynucleotide 65guctccgcuc u
116612DNAArtificial SequenceSynthetic Polynucleotide 66gatgagctcu
tc 12676RNAArtificial SequenceSynthetic Polynucleotide 67gucgcu 6
6818RNAArtificial SequenceSynthetic Polynucleotide 68ucagaacaga
gcggagac 186918RNAArtificial SequenceSynthetic Polynucleotide
69agcgacgaag agcucauc 187012RNAArtificial SequenceSynthetic
Polynucleotide 70gacgaagagc uc 127123RNAArtificial
SequenceSynthetic Polynucleotide 71gguaacuaga gaucccucag acg
237211DNAArtificial SequenceSynthetic Polynucleotide 72gcggagacag c
117331DNAArtificial SequenceSynthetic Polynucleotide 73guucugauga
gctcutcguc gctgucuccg c 31748RNAArtificial SequenceSynthetic
Polynucleotide 74guucugau 8 7523DNAArtificial SequenceSynthetic
Polynucleotide 75gagctcutcg ucgctgucuc cgc 237631RNAArtificial
SequenceSynthetic Polynucleotide 76gcggagacag cgacgaagag cucaucagaa
c 317711RNAArtificial SequenceSynthetic Polynucleotide 77ucccucagac
g 117823RNAArtificial SequenceSynthetic Polynucleotide 78gcggagacag
cgacgaagag cuc 237912RNAArtificial SequenceSynthetic Polynucleotide
79gguaacuaga ga 128031DNAArtificial SequenceSynthetic
Polynucleotide 80guucugauga gctcutcguc gctgucuccg c
31818RNAArtificial SequenceSynthetic Polynucleotide 81guucugau
88223DNAArtificial SequenceSynthetic Polynucleotide 82gagctcutcg
ucgctgucuc cgc 238331RNAArtificial SequenceSynthetic Polynucleotide
83gcggagacag cgacgaagag cucaucagaa c 318431DNAArtificial
SequenceSynthetic Polynucleotide 84guucugauga gctcutcguc gctgucuccg
c 31858RNAArtificial SequenceSynthetic Polynucleotide 85guucugau
88623DNAArtificial SequenceSynthetic Polynucleotide 86gagctcutcg
ucgctgucuc cgc 238731DNAArtificial SequenceSynthetic Polynucleotide
87guucugauga gctcutcguc gctgucuccg c 31888RNAArtificial
SequenceSynthetic Polynucleotide 88guucugau 8 8923DNAArtificial
SequenceSynthetic Polynucleotide 89gagctcutcg ucgctgucuc cgc
239010DNAArtificial SequenceSynthetic Polynucleotide 90ttgggaccac
109123RNAArtificial SequenceSynthetic Polynucleotide 91gguaacuaga
gaucccucag acg 239211DNAArtificial SequenceSynthetic Polynucleotide
92tactcagccc a 119344DNAArtificial SequenceSynthetic Polynucleotide
93cactcagggc actgcaagca attgtggtcc caatgggctg agta
449423DNAArtificial SequenceSynthetic Polynucleotide 94cactcagggc
actgcaagca att 239521DNAArtificial SequenceSynthetic Polynucleotide
95gtggtcccaa tgggctgagt a 219637DNAArtificial SequenceSynthetic
Polynucleotide 96aucaaaguuc ugaugagctc utcgucgctg ucuccgc
37978RNAArtificial SequenceSynthetic Polynucleotide 97guucugau 8
9823DNAArtificial SequenceSynthetic Polynucleotide 98gagctcutcg
ucgctgucuc cgc 239931RNAArtificial SequenceSynthetic Polynucleotide
99gcggagacag cgacgaagag cucaucagaa c 3110019RNAArtificial
SequenceSynthetic Polynucleotide 100ugagggaucu cuaguuacc
1910118RNAArtificial SequenceSynthetic Polynucleotide 101gguaacuaga
gaucccuc 1810226RNAArtificial SequenceSynthetic Polynucleotide
102gcggagacag cgaagagcuc aucaga 2610311DNAArtificial
SequenceSynthetic Polynucleotide 103gcggagacag c
1110412RNAArtificial SequenceSynthetic Polynucleotide 104gacgaagagc
uc 121055RNAArtificial SequenceSynthetic Polynucleotide 105ucaga 5
1066RNAArtificial SequenceSynthetic Polynucleotide 106ucugau 6
10712RNAArtificial SequenceSynthetic Polynucleotide 107ugagcucuug
uc 1210811RNAArtificial SequenceSynthetic Polynucleotide
108gcugucuccg c 1110929RNAArtificial SequenceSynthetic
Polynucleotide 109ucugauugag cucuugucgc ugucuccgc
291107RNAArtificial SequenceSynthetic Polynucleotide 110ucugauu 7
1118RNAArtificial SequenceSynthetic Polynucleotide 111guucugau 8
1128RNAArtificial SequenceSynthetic Polynucleotide 112guucugau 8
11326RNAArtificial SequenceSynthetic Polynucleotide 113cgcgucugag
ggaucucuag uaccuu 2611412RNAArtificial SequenceSynthetic
Polynucleotide 114cccucagacg cc 1211514RNAArtificial
SequenceSynthetic Polynucleotide 115gaugagcuuc gucg
141168RNAArtificial SequenceSynthetic Polynucleotide 116gucuccgc
811714RNAArtificial SequenceSynthetic Polynucleotide 117cgacgaagcu
cauc 1411813RNAArtificial SequenceSynthetic Polynucleotide
118gguaacuaga gau 13
* * * * *