U.S. patent application number 14/733949 was filed with the patent office on 2015-11-05 for immunogenic fragments of t-cell receptor constant domains and peptides derived therefrom.
The applicant listed for this patent is Irun R. Cohen, Francisco Javier Quintana. Invention is credited to Irun R. Cohen, Francisco Javier Quintana.
Application Number | 20150313977 14/733949 |
Document ID | / |
Family ID | 37889254 |
Filed Date | 2015-11-05 |
United States Patent
Application |
20150313977 |
Kind Code |
A1 |
Cohen; Irun R. ; et
al. |
November 5, 2015 |
IMMUNOGENIC FRAGMENTS OF T-CELL RECEPTOR CONSTANT DOMAINS AND
PEPTIDES DERIVED THEREFROM
Abstract
The present invention is directed to an isolated T-Cell Receptor
constant domain and to peptides derived therefrom and recombinant
constructs encoding same, effective in therapy of T cell mediated
inflammatory disease, autoimmunity and graft rejection. Therapeutic
and prophylactic vaccine compositions and methods utilizing these
proteins and peptides, DNA vaccines encoding same and T cell
vaccines thereof are further provided.
Inventors: |
Cohen; Irun R.; (Rehovot,
IL) ; Quintana; Francisco Javier; (Buenos Aires,
AR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Cohen; Irun R.
Quintana; Francisco Javier |
Rehovot
Buenos Aires |
|
IL
AR |
|
|
Family ID: |
37889254 |
Appl. No.: |
14/733949 |
Filed: |
June 8, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12067652 |
Sep 9, 2008 |
9078843 |
|
|
PCT/IL06/01112 |
Sep 21, 2006 |
|
|
|
14733949 |
|
|
|
|
60719342 |
Sep 22, 2005 |
|
|
|
Current U.S.
Class: |
424/185.1 ;
435/7.92; 436/501; 506/9 |
Current CPC
Class: |
A61P 17/06 20180101;
A61P 1/04 20180101; A61P 3/10 20180101; A61P 37/04 20180101; G01N
2333/7051 20130101; A61K 2039/645 20130101; G01N 2800/102 20130101;
A61P 1/16 20180101; A61K 2039/53 20130101; A61P 37/06 20180101;
A61P 21/04 20180101; A61P 37/08 20180101; G01N 33/564 20130101;
A61P 25/28 20180101; A61P 29/00 20180101; G01N 33/6854 20130101;
A61K 39/0008 20130101 |
International
Class: |
A61K 39/00 20060101
A61K039/00; G01N 33/564 20060101 G01N033/564 |
Claims
1-71. (canceled)
72. A vaccine composition comprising: (a) at least one
pharmaceutically acceptable carrier, adjuvant, excipient or
diluent; and (b) at least one peptide immunogen comprising an
immunogenic fragment of the constant domain of a chain of a TCR,
wherein the immunogenic fragment of the constant domain of a chain
of a TCR is at least 12 amino acid residues in length and exhibits
at least one Major Histocompatibility Complex (MHC) Class II
binding motif, and wherein said peptide immunogen elicits an immune
response to the constant domain of the TCR chain as measured by an
increased anti-ergotypic T cell activity.
73. The composition of claim 72, wherein the chain of a TCR is
selected from the group consisting of TCR alpha chains and the
peptide immunogen comprises an amino acid sequence as set forth in
any one of SEQ ID NOS: 1-27, conservative variations, and salts
thereof.
74. The composition of claim 72, wherein the chain a TCR is
selected from the group consisting of TCR beta chains and the
peptide immunogen has an amino acid sequence as set forth in any
one of SEQ ID NOS: 28-64, conservative variations, and salts
thereof.
75. The composition of claim 74, wherein the peptide immunogen is a
peptide of up to about 50 amino acids in length comprising an amino
acid sequence as set forth in any one of SEQ ID NOs: 47-52, 55, 59,
64 and 152, conservative variations, and salts thereof.
76. The composition of claim 74, wherein the peptide comprises an
amino acid sequence as set forth in any one of SEQ ID NOs: 51, 59
and 152.
77. The composition of claim 72, wherein the chain of a TCR is
selected from the group consisting of TCR gamma chains and TCR
delta chains and the peptide immunogen comprises an amino acid
sequence as set forth in any one of SEQ ID NOs: 65-92, 93-146 and
157-167, conservative variations, and salts thereof.
78. The composition of claim 72, wherein said peptide immunogen is
a fusion peptide comprising a plurality of peptide sequences
derived from at least one TCR constant domain and a plurality of
MHC-II binding motifs, wherein at least one peptide sequence
derived from the at least one TCR constant domain comprises an
amino acid sequence as set forth in any one of SEQ ID
NOs:1-146.
79. The composition of claim 78, wherein at least one of the
plurality of peptide sequences derived from the at least one TCR
constant domain has an amino acid sequence as set forth in any one
of SEQ ID NOs: 47-52, 55, 64 and 152.
80. The composition of claim 72, wherein the adjuvant is a
metabolizable lipid emulsion.
81. A DNA vaccine composition comprising (a) at least one
pharmaceutically acceptable carrier; and (b) at least one
recombinant construct comprising an isolated nucleic acid sequence
encoding at least one immunogen selected from the group consisting
of: (i) the constant domain of a chain of a human T Cell Receptor
(TCR); and (ii) a peptide comprising an immunogenic fragment of the
constant domain of a chain of a TCR, wherein the immunogenic
fragment of the constant domain of a chain of a TCR is at least 12
amino acid residues in length, exhibits at least one Major
Histocompatibility Complex (MHC) Class II binding motif, and
elicits an immune response to the constant domain of a TCR chain as
measured by an increased anti-ergotypic T cell activity, said
peptide having an amino acid sequence as set forth in any one of
SEQ ID NOs: 1-146 and 157-167, wherein the nucleic acid sequence is
operatively linked to one or more transcription control
sequences.
82. A method of treating or preventing the development of a T-cell
mediated inflammatory autoimmune disease, the method comprising
administering to a subject in need thereof a therapeutically
effective amount of a vaccine composition according to claim
72.
83. The method of claim 82, wherein said T cell-mediated
inflammatory disease is selected from the group consisting of:
multiple sclerosis, rheumatoid arthritis, juvenile rheumatoid
arthritis, autoimmune neuritis, systemic lupus erythematosus,
psoriasis, Type I diabetes, Sjogren's disease, thyroid disease,
myasthenia gravis, sarcoidosis, autoimmune uveitis, inflammatory
bowel disease (Crohn's and ulcerative colitis), autoimmune
hepatitis, graft rejection, and allergies.
84. The method of claim 82, wherein said composition is
administered to said subject prior to the appearance of disease
symptoms.
85. A method of treating or preventing the development of a T-cell
mediated inflammatory disease, the method comprising administering
to a subject in need thereof a therapeutically effective amount of
at least one DNA vaccine composition according to claim 81.
86. A method of enhancing anti-ergotypic T cells activity in a
subject in need thereof, the method comprising administering to a
subject in need thereof a therapeutically effective amount of the
vaccine composition of claim 72.
87. A method of enhancing anti-ergotypic T cells activity in a
subject in need thereof, the method comprising administering to a
subject in need thereof a therapeutically effective amount of the
DNA vaccine composition of claim 81.
88. A method of diagnosing a condition associated with an immune
response in a subject in need thereof, the method comprising: (i)
obtaining an antibody-containing biological sample from a subject;
(iii) contacting the sample, under conditions such that an
antigen-antibody complex may be formed, with an antigen probe
comprising a peptide having an amino acid sequence as set forth in
any one of SEQ ID NOs: 1-146 and 157-167, conservative variations,
and salts thereof; and (iii) determining the capacity of the
antigen probe to specifically bind said antibody-containing
biological sample, wherein the capacity is indicative of the
condition.
Description
RELATED APPLICATION DATA
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/067,652, filed Mar. 21, 2008 (published as
US 20090035359), which is the U.S. National Stage of International
Application No. PCT/IL2006/001112, filed Sep. 21, 2006, which
claims the benefit of U.S. Provisional Patent Application No.
60/719,342, filed Sep. 22, 2005, the contents of each of which are
incorporated by reference in their entireties for all purposes.
INCORPORATION-BY-REFERENCE OF MATERIAL ELECTRONICALLY FILED
[0002] Incorporated by reference in its entirety herein is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: One 55,847
kilobyte ASCII (text) file named "Seq_List" created on Jun. 2,
2015.
FIELD OF THE INVENTION
[0003] The present invention is directed to immunomodulatory
fragments of the T-Cell Receptor constant domain and to peptides
derived therefrom and recombinant constructs encoding same,
effective in therapy of T cell mediated inflammatory disease,
autoimmunity and graft rejection. Therapeutic and prophylactic
vaccine compositions and methods comprising these proteins and
peptides, DNA vaccines encoding same and T cell vaccines thereof
are further provided.
BACKGROUND OF THE INVENTION
[0004] While the normal immune system is closely regulated,
aberrations in immune responses are not uncommon. In some
instances, the immune system functions inappropriately and reacts
to a component of the host as if it were, in fact, foreign. Such a
response results in an autoimmune disease, in which the host's
immune system attacks the host's own tissue. T cells, as the
primary regulators of the immune system, directly or indirectly
affect such autoimmune pathologies.
[0005] T cell-mediated inflammatory diseases refer to any condition
in which an inappropriate T cell response is a component of the
disease. This includes both diseases directly mediated by T cells,
and also diseases in which an inappropriate T cell response
contributes to the production of abnormal antibodies.
[0006] Numerous diseases are believed to result from autoimmune
mechanisms. Prominent among these are rheumatoid arthritis,
systemic lupus erythematosus, multiple sclerosis, Type I diabetes,
myasthenia gravis, pemphigus vulgaris. Autoimmune diseases affect
millions of individuals world-wide and the cost of these diseases,
in terms of actual treatment expenditures and lost productivity, is
measured in billions of dollars annually.
[0007] The existence of peripheral autoimmune T cells that
recognize dominant self-antigens is a property of all healthy
immune systems. The immunological dominance of self antigens such
as myelin basic protein (MBP), HSP60 and insulin is associated with
cellular networks consisting of the self-reacting T cells together
with a network of regulatory T cells that recognize and respond to
the autoimmune T cells. The two main regulatory T cells are
anti-idiotypic T cells and anti-ergotypic T cells (ergon in
Greek=work, action).
[0008] While anti-idiotypic T cells appear to recognize the
self-antigen receptors present on the pathogenic endogenous
autoimmune T cells, the anti-ergotypic T cells are defined as T
cells that respond to activated, syngeneic T cells independent of
their idiotypic specificities. Anti-ergotypic T cells recognize as
antigens the markers of the state of activation, ergotopes, of
activated T cells. An example of such ergotope is the .alpha. chain
of the IL-2 receptor (CD25), whose expression is up-regulated in
activated T cells during T cell activation (Minami et al 1993;
Taniguchi and Minami 1993). Anti-ergotypic T cells do not appear to
respond to their target T cells in the resting state.
[0009] A comparison between the anti-ergotypic regulatory T cells
and the anti-idiotypic regulatory T cells, although having some
features in common, also reveals a difference in cytokine profile.
While anti-idiotypic regulatory T cells secrete Th1 cytokines
(Cohen 2001; Kumar et al 2001), the anti-ergotypic regulatory T
cells secrete mainly IL-10, a Th2 cytokine.
[0010] Experimental autoimmune encephalomyelitis (EAE) is a T cell
mediated autoimmune disease of the central nervous system that
serves as an experimental model for multiple sclerosis. Autoimmune
diseases such as EAE could be prevented or treated by administering
attenuated, but potentially virulent autoimmune T cells specific
for the disease-related self-antigens, a procedure called T-cell
vaccination (TCV). It was discovered some years ago that T-cell
vaccination can be used to treat autoimmunity, graft rejection, or
allergies. The effect of TCV was hypothesized to be partially
mediated by the in vivo activation of anti-ergotypic T cells (Lohse
et al 1989).
[0011] Anti-ergotypic regulation is thought to be essential to
successful T-cell vaccination (Zhang et al 1993; Van der Aa et al
2003), an approach currently being used to treat a variety of
autoimmune diseases (Zhang et al 1993) and to prevent graft
rejection (Shapira et al 1993) and allergy (Zhang et al 1993).
Thus, agents that can activate anti-ergotypic regulation could have
a wide use for all conditions where it would be desirable to
modulate immune inflammation.
[0012] A preferable method for treating autoimmune diseases
includes modulating the immune system of a patient to assist the
patient's natural defense mechanisms. Traditional reagents and
methods used to attempt to regulate an immune response in a patient
also result in unwanted side effects and have limited
effectiveness. For example, immunosuppressive reagents (e.g.
cyclosporin A, azathioprine, and prednisone) used to treat patients
with autoimmune diseases also suppress the patient's entire immune
response, thereby increasing the risk of infection. In addition,
immunopharmacological reagents used to treat cancer (e.g.
interleukins) are short-lived in the circulation of a patient and
are ineffective except in large doses. Due to the medical
importance of immune regulation and the inadequacies of existing
immunopharmacological reagents, reagents and methods to regulate
specific parts of the immune system have been the subject of study
for many years.
[0013] Stimulation or suppression of the immune response in a
patient can be an effective treatment for a wide variety of medical
disorders. T lymphocytes (T cells) are one of a variety of distinct
cell types involved in an immune response. The activity of T cells
is regulated by an antigen, presented to a T cell in the context of
a major histocompatibility complex (MHC) molecule. The T cell
receptor (TCR) then binds to the MHC-antigen complex. Once antigen
is complexed to MHC, the MHC-antigen complex is bound by a specific
TCR on a T cell, thereby altering the activity of that T cell.
[0014] WO 01/57056 of Karin discloses a method of treating
rheumatoid arthritis of an individual. The method comprises the
step of expressing within the individual at least an
immunologically recognizable portion of a cytokine from an
exogenous polynucleotide encoding the at least a portion of the
cytokine, wherein a level of expression of the at least a portion
of the cytokine is sufficient to induce the formation of
anti-cytokine immunoglobulins which serve for neutralizing or
ameliorating the activity of a respective and/or cross reactive
endogenous cytokine, to thereby treat rheumatoid arthritis. U.S.
Pat. No. 6,316,420 to Karin and coworkers further discloses DNA
cytokine vaccines and use of same for protective immunity against
multiple sclerosis.
[0015] WO 00/27870 of Naparstek and colleagues discloses a series
of related peptides derived from heat shock proteins Hsp65 and
Hsp60, their sequences, antibodies, and use as vaccines for
conferring immunity against autoimmune and/or inflammatory
disorders such as arthritis. These peptides are intended by the
inventors to represent the shortest sequence or epitope that is
involved in protection of susceptible rat strains against adjuvant
induced arthritis. These sequences further disclose what the
inventors identify as the common "protective motif".
[0016] WO 03/096967 of the inventors and others discloses DNA
vaccines for treating a T cell mediated inflammatory autoimmune
where the DNA vaccine includes a recombinant construct comprising a
nucleic acid sequence encoding a mammalian heat shock protein.
[0017] There are a number of disclosures using peptides derived
from specific T Cell Receptors as therapeutics for immune-related
disease. For example, U.S. Pat. No. 5,614,192 discloses peptides
capable of reducing the severity of a T cell mediated disease
having an amino acid sequence comprising at least part of the
second complementarity determining region of a T cell receptor
characteristic of such T cell mediated disease.
[0018] WO 94/19470 discloses prophylactic and therapeutic
compositions for the treatment of autoimmune diseases which
comprises a prophylactically or therapeutically effective amount of
a soluble T-cell receptor .alpha.-chain produced by suppressor
T-cells. Specifically, the '470 application discloses a composition
comprising a soluble fragment of the variable region of a TCR
.alpha.-chain obtained from KLH-specific suppressor T cells. More
specifically, the use of a chimeric protein consisting of a
variable region fragment of a mouse TCR .alpha. chain, denoted
V.alpha.14J.alpha.281, fused to the constant region of mouse IgG,
is disclosed.
[0019] WO 97/43411 discloses polypeptides that contain
substantially part or the whole of the constant region of a T-cell
receptor .alpha.-chain, having immunosuppressive effects, but do
not substantially cause any production of antibodies against
themselves even when administered. This application discloses DNAs
coding for the polypeptides as well as pharmaceutical compositions
containing these polypeptides as the active ingredient.
[0020] JP11302299 discloses polypeptides having immunosuppressive
activity that substantially contain part or the whole of the
constant region of T-cell receptor .beta.-chain but do not
substantially contain the other regions of the above
.beta.-chain.
[0021] A nine amino acid peptide derived from the transmembrane
domain of the TCR.alpha. chain, denoted core peptide (CP), inhibits
T-cell antigen specific activation in vitro and in vivo (Manolios
et al., 1997) by co-localizing with the TCR molecules, thereby
inhibiting the proper assembly of the TCR-CD3 complex.
[0022] U.S. Patent Application Publication No. 2005/0260770 to some
of the inventors of the present invention discloses an antigen
array system and diagnostic uses thereof. The application provides
a method of diagnosing an immune disease or a predisposition
thereto in a subject, comprising determining a capacity of
immunoglobulins of the subject to specifically bind each antigen
probe of an antigen probe set. The antigen probe set comprises a
plurality of antigen probes selected from the group consisting of
at least a portion of a cell/tissue structure molecule, at least a
portion of a heat shock protein, at least a portion of an immune
system molecule, at least a portion of a homopolymeric polypeptide,
at least a portion of a hormone, at least a portion of a metabolic
enzyme, at least a portion of a microbial antigen, at least a
portion of a molluscan antigen, at least a portion of a nucleic
acid, at least a portion of a plant antigen, at least a portion of
a plasma molecule, and at least a portion of a tissue antigen,
wherein the binding capacity of the immunoglobulin of the subject
is indicative of the immune disease or the predisposition thereto.
Among the numerous antigen probes disclosed by the '770 publication
as potential diagnostic markers are peptides derived from a T cell
receptor, preferably from the constant domain of rat T cell
receptor beta chains.
[0023] Nowhere in the background art is it disclosed or suggested
that specific peptides having therapeutic properties suitable for
the treatment of autoimmune inflammatory disease may be derived
from the constant domain of a T Cell Receptor polypeptide.
[0024] Recently, the inventors and coworkers (Mimran et al 2004)
discovered that one of the target ergotopes on activated T cells is
the CD25 molecule. In that publication, it was demonstrated that
DNA vaccination with the ergotope CD25 protects rats from adjuvant
arthritis and increases the anti-ergotypic response in rats where
adjuvant arthritis was induced. This increased anti-ergotypic T
cell response was defined by the heightened proliferative response
to activated A6 T cell clones compared to the response observed in
rats not vaccinated with the CD25-DNA vaccine. The increased
anti-ergotopic T cell response was characterized by a reduction in
the secretion of IFN.gamma. and an increase in the secretion if
IL-10, or in other words, a cytokine shift from a Th1-like to a
Th2-like phenotype.
[0025] There exists a long-felt need for effective means of curing
or ameliorating T cell mediated inflammatory or autoimmune diseases
and ameliorating T cell mediated pathologies. Usually, only the
symptoms can be treated, while the disease continues to progress,
often resulting in severe debilitation or death. Such a treatment
should ideally control the inappropriate T cell response, rather
than merely reducing the symptoms.
SUMMARY OF THE INVENTION
[0026] The present invention provides vaccine compositions suitable
for preventing and treating T cell mediated pathologies, including
e.g. autoimmunity and graft rejection. Specifically, the present
invention provides immunogenic compositions comprising the T-Cell
Receptor constant domain and peptides derived therefrom, effective
in preventing or treating T cell mediated inflammatory disease. The
present invention also provides recombinant constructs encoding
these proteins and peptides and DNA vaccines and T cell vaccines
useful in therapy of inflammatory diseases. In certain embodiments,
novel peptide antigens useful in vaccination and diagnosis are
provided.
[0027] The present invention is based, in part, on the unexpected
discovery that immunization with the constant domain of the T-Cell
Receptor (TCR) provides protection against T cell mediated
inflammatory autoimmune diseases. Surprisingly, in accordance with
the present invention it has been discovered that both the C1 and
C2 variant molecules of the constant domain of the .beta. chain of
the T Cell Receptor as well as recombinant constructs encoding
these proteins elicit protective immunity against T cell mediated
inflammatory diseases. The principles of the invention are
exemplified for the animal disease model of adjuvant arthritis
(AA), a T cell mediated inflammatory autoimmune disease that serves
as an experimental model for rheumatoid arthritis. Moreover,
similar therapeutic and prophylactic properties have also been
observed using synthetic peptides derived from regions of the
constant domain of the T Cell Receptor that exhibit a Major
Histocompatibility Complex class II (MHC-II) binding motif.
[0028] According to a first aspect, the present invention is
directed to vaccine compositions comprising peptide antigens
derived from the constant domain of a chain of a TCR, useful for
treating and preventing the progression of T cell mediated
pathologies.
[0029] Specifically, there is provided a vaccine composition
comprising (a) at least one pharmaceutically acceptable carrier,
adjuvant, excipient or diluent; (b) at least one immunogen selected
from the group consisting of: [0030] (i) an isolated constant
domain of a chain of a human TCR; and [0031] (ii) a peptide
comprising an immunogenic fragment of the constant domain of a
chain of a TCR.
[0032] It should be understood that the terms "isolated TCR
constant domain" and "a peptide comprising an immunogenic fragment
of the constant domain" as used herein refer to fragments of a TCR
chain lacking the variable region of a TCR chain and fragments
thereof. Thus, the compositions of the invention do not
substantially include sequences encoded by TCR V D and J gene
segments or specific portions thereof. A "peptide comprising an
immunogenic fragment of the constant domain" refers to an amino
acid sequence corresponding to a portion of the constant domain,
but excluding the full-length constant domain.
[0033] Preferably, the immunogen is a peptide comprising an
immunogenic fragment of the constant domain of a human T cell
receptor.
[0034] According to certain embodiments, the peptide comprises at
least one MHC class II binding motif.
[0035] Advantageously, the polypeptides or peptides of the
invention comprises multiple MHC-II binding motifs, or overlapping
MHC-II binding motifs.
[0036] According to certain embodiments the polypeptides or
peptides of the invention comprise at least one peptide sequence
derived from at least one TCR constant domain. According to certain
preferred embodiments the polypeptides or peptides of the invention
comprise at least one peptide sequence derived from at least one
TCR constant domain, the polypeptide or peptide comprising a
plurality of MHC-II binding motifs. According to additional
preferred embodiments the polypeptides or peptides of the invention
comprise a plurality of peptide sequences derived from at least one
TCR constant domain, the polypeptide or peptide comprising a
plurality of MHC-II binding motifs. According to still additional
preferred embodiments the polypeptides or peptides of the invention
comprise a plurality of peptide sequences derived from a plurality
of TCR constant domains, the polypeptide or peptide comprising a
plurality of MHC-II binding motifs.
[0037] According to one embodiment, the peptides of the invention
may be derived from the constant domain of a chain of a T Cell
Receptor, wherein the chain is selected from the group consisting
of alpha chains, beta chains, gamma chains and delta chains.
[0038] According to preferred embodiments, the chain is selected
from the group consisting of T-cell receptor alpha chains, T-cell
receptor beta-1 chains, T-cell receptor beta-2 chains, T-cell
receptor gamma-1 chains, T-cell receptor gamma-2 chains, and T-cell
receptor delta chains.
[0039] In various embodiments, specific peptides derived from TCR
constant domain chains provided by the present invention, the
peptides comprising at least one MHC class II binding motif, are
presented in Tables 2-9 hereinbelow.
[0040] According to one embodiment, the chain is selected from the
group consisting of T-cell receptor alpha chains. According to
particular embodiments, the chain is the T-cell receptor alpha
chain and the peptide is selected from the group consisting of the
peptides having the sequence set forth in any one of SEQ ID NOS:
1-27 and analogs, derivatives and salts thereof. In certain other
particular embodiments, the peptide is selected from the group
consisting of the peptides having the sequence set forth in any one
of SEQ ID NOS: 1-12 and 15-27 and analogs, derivatives and salts
thereof.
[0041] According to another embodiment, the chain is selected from
the group consisting of T-cell receptor beta chains.
[0042] According to particular embodiments, the chain is the T-cell
receptor beta-1 chain and the peptide is selected from the group
consisting of the peptides having the sequence set forth in any one
of SEQ ID NOS: 28-60 and analogs, derivatives and salts
thereof.
[0043] According to particular embodiments, the chain is the T-cell
receptor beta-2 chain and the peptide is selected from the group
consisting of the peptides having the sequence set forth in any one
of SEQ ID NOS:31-49, SEQ ID NOS:51-59, and SEQ ID NOS:61-64 and
analogs, derivatives and salts thereof.
[0044] According to another embodiment, the chain is selected from
the group consisting of T-cell receptor delta chains.
[0045] According to particular embodiments, the chain is the T-cell
receptor delta chain and the peptide is selected from the group
consisting of the peptides having the sequence set forth in any one
of SEQ ID NOS:65-92 and analogs, derivatives and salts thereof.
[0046] According to another embodiment, the chain is selected from
the group consisting of T-cell receptor gamma chains.
[0047] According to particular embodiments, the chain is the T-cell
receptor gamma chain and the peptide has an amino acid sequence as
set forth in any one of SEQ ID NOS:93-130 and analogs, derivatives
and salts thereof.
[0048] According to other particular embodiments, the chain is the
T-cell receptor gamma chain and the peptide has an amino acid
sequence as set forth in any one of SEQ ID NOS:93-131 and analogs,
derivatives and salts thereof.
[0049] According to further particular embodiments, the chain is
the T-cell receptor gamma chain and the peptide has an amino acid
sequence as set forth in any one of SEQ ID NOS:93-100, SEQ ID NOS:
104-105, SEQ ID NOS:107-109, SEQ ID NOS:112-125, SEQ ID
NOS:127-129, SEQ ID NOS:131-140, and analogs, derivatives and salts
thereof.
[0050] According to other particular embodiments, the chain is the
T-cell receptor gamma chain and the peptide has an amino acid
sequence as set forth in any one of SEQ ID NOS:94-100, SEQ ID NOS:
104-105, SEQ ID NOS:107-109, SEQ ID NOS:112-130, SEQ ID NOS:133-146
and analogs, derivatives and salts thereof.
[0051] It is noted that the peptides identified as comprising the
required MHC class II binding motif are arbitrarily presented
herein as nine amino acids in length. It is explicitly to be
understood that the peptides used in accordance with the present
invention may include extensions on either or both termini, as well
as deletions or truncations, as long as they preserve the intended
function of suppressing autoimmune inflammatory disease.
[0052] In other particular embodiments, there are provided novel
immunogenic peptides derived from TCR gamma chain constant domain,
having an amino acid sequence as set forth in any one of SEQ ID
NOS:157-167 and analogs, derivatives and salts thereof.
[0053] In certain other particular embodiments, there are provided
novel fusion peptides derived from TCR constant region sequences.
The term "fusion peptide" as used herein denotes a polypeptide or
peptide in which two or more polypeptide or peptide sequences are
linked to one another directly or indirectly, preferably directly,
by chemical bonding, preferably peptide bonding, in a combination
which does not exist naturally.
[0054] In a preferable embodiment, there is provided a fusion
peptide comprising a plurality of immunogenic determinants derived
from at least one TCR constant domain. In various particular
embodiments, each immunogenic determinant comprises a peptide
fragment of the TCR constant domain, or an analog or derivative
thereof.
[0055] In other particular embodiments, the fusion peptide
comprises an amino acid sequence as set forth in any one of SEQ ID
NOS:157-167 and analogs, and derivatives thereof.
[0056] In another preferable embodiment, there is provided a fusion
peptide comprising a plurality of peptide sequences derived from at
least one T Cell Receptor constant domain, the fusion peptide
comprising a plurality of MHC-II binding motifs. In various
particular embodiments, each peptide sequence derived from the at
least one TCR constant domain comprises a peptide fragment of said
TCR constant domain, or an analog or derivative thereof. In certain
other particular embodiments, at least one peptide sequence derived
from the at least one TCR constant domain comprises an amino acid
sequence as set forth in any one of SEQ ID NOS:1-146.
[0057] According to preferred embodiments, the peptide is useful
for preventing or treating a T cell-mediated inflammatory disease.
According to specific embodiments, the peptide is an ergotope
capable of eliciting an anti-ergotypic T cell response and
inhibiting the development of a T cell mediated inflammatory
disease. In one embodiment, the anti-ergotypic T cell response is
defined by recognition of activated histocompatible T cells as
observed in proliferation response assays. In yet another
embodiment, the anti-ergotypic response may be defined by a shift
in the cytokine phenotype from IFN.gamma. and TNF.alpha. towards
IL-10, thereby driving the differentiation of activated T cells
from a Th1-like to a Th2-like phenotype.
[0058] In preferred embodiments, the composition is useful for
preventing or treating a T cell-mediated inflammatory disease.
According to particular embodiments, the composition inhibits or
treats the T cell-mediated inflammatory disease by eliciting an
anti-ergotypic T cell response.
[0059] The compositions and methods of the present invention are
effective in T-cell mediated inflammatory diseases including but
not limited to: multiple sclerosis, rheumatoid arthritis, juvenile
rheumatoid arthritis, autoimmune neuritis, systemic lupus
erythematosus, psoriasis, Type I diabetes, Sjogren's disease,
thyroid disease, myasthenia gravis, sarcoidosis, autoimmune
uveitis, inflammatory bowel disease (Crohn's and ulcerative
colitis) autoimmune hepatitis, allergies and graft rejection.
[0060] In various embodiments, the vaccine composition further
comprises at least one adjuvant capable of enhancing the
immunogenicity of the administered peptide. In a particular
embodiment, the adjuvant is a metabolizable lipid emulsion.
[0061] The present invention furthermore provides nucleic acids
encoding the above-mentioned peptides. In another aspect, there are
provided recombinant constructs comprising nucleic acid sequences
encoding these peptides, the nucleic acid sequences operatively
linked to one or more transcription control sequences.
[0062] In another aspect, the invention provides DNA vaccine
compositions encoding the TCR constant domain and peptides derived
therefrom, as detailed herein.
[0063] DNA vaccination represents a novel means of expressing
antigens in vivo for the generation of both humoral and cellular
immune responses. The present invention provides DNA vaccines
comprising a recombinant construct including an isolated nucleic
acid sequence encoding the constant domain of a chain of a T Cell
receptor or an active fragment thereof, the nucleic acid sequence
being operatively linked to one or more transcription control
sequences; and in a suitable expression system, enabling in vivo
expression of the encoded peptide or the active fragment thereof in
a human host.
[0064] More specifically, the present invention provides a DNA
vaccine composition comprising (a) at least one pharmaceutically
acceptable carrier (b) at least one recombinant construct
comprising an isolated nucleic acid sequence encoding at least one
immunogen selected from the group consisting of: [0065] (i) the
constant domain of a chain of a T Cell Receptor (TCR); and [0066]
(ii) a peptide comprising an immunogenic fragment of the constant
domain of a chain of a TCR, wherein the nucleic acid sequence is
operatively linked to one or more transcription control
sequences.
[0067] Not wishing to be bound by any theory or mechanism of
action, in certain embodiments the present invention uses a nucleic
acid molecule encoding the constant domain of a chain of the T Cell
Receptor or the active fragment in order to elicit an
anti-ergotypic T cell response with the encoded protein or peptide
as an ergotope.
[0068] In certain embodiments, said carrier comprises a delivery
vehicle that delivers the nucleic acid sequences to a subject. In
particular embodiments, said delivery vehicle is selected from the
group consisting of liposomes, micelles and cells.
[0069] In certain other particular embodiments, said recombinant
construct is a eukaryotic expression vector.
[0070] In another aspect, there is provided method of treating or
preventing the development of a T-cell mediated inflammatory
disease, the method comprising administering to a subject in need
thereof a therapeutically effective amount of a vaccine composition
of the invention, as detailed herein.
[0071] In one particular embodiment, said T cell-mediated
inflammatory disease is an autoimmune disease. In other particular
embodiments, said T cell-mediated inflammatory disease is selected
from the group consisting of: multiple sclerosis, rheumatoid
arthritis, juvenile rheumatoid arthritis, autoimmune neuritis,
systemic lupus erythematosus, psoriasis, Type I diabetes, Sjogren's
disease, thyroid disease, myasthenia gravis, sarcoidosis,
autoimmune uveitis, inflammatory bowel disease (Crohn's and
ulcerative colitis), autoimmune hepatitis, graft rejection and
allergies.
[0072] In various embodiments of the present invention, said
subject is selected from the group consisting of humans and
non-human mammals.
[0073] The compositions of the invention may be administered to
said subject after appearance of disease symptoms or, in alternate
embodiments, prior to appearance of disease symptoms.
[0074] In certain other particular embodiments, said composition is
administered by intravenous injection, intramuscular injection,
aerosol, oral, percutaneous or topical administration.
[0075] In another aspect, there is provided a method of enhancing
anti-ergotypic T cells activity in a subject in need thereof, the
method comprising administering to the subject in need thereof a
therapeutically effective amount of a vaccine composition of the
invention, as detailed herein. In one embodiment, the
anti-ergotypic T cell response is defined by recognition of
activated T cells as observed in proliferation response assays.
[0076] In another aspect, the invention provides a method of
treating or preventing the development of a T-cell mediated
inflammatory disease, the method comprising administering to a
subject in need thereof a therapeutically effective amount of at
least one recombinant construct, the recombinant construct
comprising an isolated nucleic acid sequence encoding at least one
immunogen of the invention as detailed herein, wherein the nucleic
acid sequence is operatively linked to one or more transcription
control sequences.
[0077] In certain embodiments, said construct is administering to
said subject in the form of a pharmaceutical composition further
comprising at least one pharmaceutically acceptable carrier,
excipient or diluent.
[0078] In one particular embodiment, said T cell-mediated
inflammatory disease is an autoimmune disease. In other particular
embodiments, said T cell-mediated inflammatory disease is selected
from the group consisting of: multiple sclerosis, rheumatoid
arthritis, juvenile rheumatoid arthritis, autoimmune neuritis,
systemic lupus erythematosus, psoriasis, Type I diabetes, Sjogren's
disease, thyroid disease, myasthenia gravis, sarcoidosis,
autoimmune uveitis, inflammatory bowel disease (Crohn's and
ulcerative colitis), autoimmune hepatitis, graft rejection and
allergies.
[0079] In various embodiments of the present invention, said
subject is selected from the group consisting of humans and
non-human mammals.
[0080] The compositions of the invention may be administered to
said subject after appearance of disease symptoms or, in alternate
embodiments, prior to appearance of disease symptoms.
[0081] In certain other particular embodiments, said composition is
administered by intravenous injection, intramuscular injection,
aerosol, oral, percutaneous or topical administration.
[0082] Not wishing to be bound by theory, in various embodiments
the administration of the composition increases the anti-ergotypic
T cell response in said individual and inhibits the development of
T cell mediated inflammatory disease in the individual. In one
embodiment, the anti-ergotypic T cell response is defined by
recognition of activated T cells as observed in proliferation
response assays.
[0083] Another aspect of the present invention is a method of
enhancing anti-ergotypic T cells activity in a subject in need
thereof, the method comprising administering to a subject in need
thereof a therapeutically effective amount of at least one
recombinant construct, the recombinant construct comprising an
isolated nucleic acid sequence encoding at least one immunogen of
the invention as detailed herein, wherein the nucleic acid sequence
is operatively linked to one or more transcription control
sequences. In one embodiment, the anti-ergotypic T cell response is
defined by recognition of activated T cells as observed in
proliferation response assays.
[0084] In yet another aspect, the invention provides a method for
treating or preventing the development of a T-cell mediated
inflammatory disease comprising the steps of [0085] (a) obtaining
cells from a subject or from a donor histocompatible with the
subject; [0086] (b) transfecting the cells in vitro with a
recombinant construct comprising an isolated nucleic acid sequence
encoding at least one immunogen of the invention as detailed
herein, the nucleic acid sequence being operatively linked to one
or more transcription control sequences; and [0087] (c) introducing
a therapeutically effective number of the transfected cells to said
subject.
[0088] In other aspects, the present invention is directed to cell
vaccines and methods of using same, utilizing T cells and/or other
antigen presenting cells exposed to an immunogen of the invention
as detailed herein.
[0089] In another aspect there is provided a pharmaceutical
composition comprising as an active ingredient attenuated activated
cells selected from the group consisting of antigen presenting
cells and T cells activated ex vivo to induce Major
Histocompatibility Complex II expression, wherein the cells have
been exposed ex vivo to an effective amount of at least one
immunogen selected from a group consisting of: [0090] (i) the
constant domain of a chain of a T Cell Receptor (TCR); and [0091]
(ii) a peptide comprising an immunogenic fragment of the constant
domain of a chain of a TCR.
[0092] In another aspect there is provided a pharmaceutical
composition comprising a population of T cells obtained by
culturing a first population of T cells ex vivo in the presence of
a second population of cells, the second population being
attenuated activated cells histocompatible with the cells of the
first population, wherein the cells of said second population are
selected from the group consisting of antigen presenting cells and
T cells activated ex vivo to induce Major Histocompatibility
Complex II expression, and wherein said cells of said second
population have been exposed ex vivo to at least one immunogen
selected from a group consisting of: [0093] (i) the constant domain
of a chain of a T Cell Receptor (TCR); and [0094] (ii) a peptide
comprising an immunogenic fragment of the constant domain of a
chain of a TCR.
[0095] These cell vaccine compositions may be administered to a in
a subject in need thereof for treating or preventing the
progression of a T cell mediated inflammatory disease, wherein the
administered cells are histocompatible with the subject.
[0096] In one embodiment, there is provided a method of treating or
preventing a T-cell mediated inflammatory disease comprising the
steps of: [0097] (a) isolating T cells from first subject or from a
donor histocompatible with said subject; [0098] (b) activating the
T cells ex vivo to induce Major Histocompatibility Complex (MHC) II
expression and exposing said activated cells to the immunogen; and
[0099] (c) attenuating said T cells and introducing a
therapeutically effective amount of said cells into said subject,
thereby treating or preventing the progression of said disease.
[0100] In another embodiment, the attenuation step is performed
after activating the cells and prior to exposing said cells to said
immunogen.
[0101] In another embodiment, the method comprises: [0102] (a)
isolating a first population of T cells from the subject or from a
donor histocompatible with said subject; [0103] (b) culturing the
first population of T cells in the presence of a second population
of histocompatible attenuated activated T cells or antigen
presenting cells and the immunogen; and [0104] (c) introducing a
therapeutically effective amount of said first population of T
cells into the subject thereby treating or preventing the
progression of said disease.
[0105] In another embodiment, step (b) comprises culturing the
first population of T cells in the presence of a second population
of histocompatible attenuated activated T cells or antigen
presenting cells that were previously exposed to said
immunogen.
[0106] In another aspect, the novel peptides of the invention may
be used for the diagnosis of conditions associated with an immune
response to these peptides in a subject, as detailed herein.
[0107] In one embodiment, there is provided a method of diagnosing
a condition associated with an immune response in a subject in need
thereof, the method comprising: [0108] a) obtaining an
antibody-containing biological sample from a subject; [0109] b)
contacting the sample, under conditions such that an
antigen-antibody complex may be formed, with an antigen probe
comprising a peptide having an amino acid sequence as set forth in
any one of SEQ ID NOS:1-146 and 157-167, and analogs, derivatives
and salts thereof; [0110] c) determining the capacity of the
antigen probe to specifically bind said antibody-containing
biological sample; [0111] wherein the capacity is indicative of the
condition.
[0112] In a preferable embodiment, step c) comprises determining
the capacity of at least one antibody of the IgG isotype in the
biological sample to specifically bind the antigen probe.
[0113] In certain embodiments, said condition is associated with an
increased T cell-mediated immune response. In another embodiment,
said condition is a T cell mediated inflammatory disease. In
another particular embodiment, said condition is associated with an
increased anti-ergotypic T cell activity.
[0114] In another aspect, the invention provides a diagnostic kit
comprising a peptide antigen having an amino acid sequence as set
forth in any one of SEQ ID NOS: 1-146 and 157-167, and analogs,
derivatives and salts thereof, and means for determining whether
the peptide antigen binds specifically to an antibody-containing
biological sample.
[0115] These and other embodiments of the present invention will
become apparent in conjunction with the figures, description and
claims that follow.
BRIEF DESCRIPTION OF THE FIGURES
[0116] FIGS. 1A and 1B illustrate the inhibition of AA (FIG. 1A)
and leg swelling (FIG. 1B) by vaccination with p.beta.C1 and
p.beta.C2. Note that in FIG. 1A pC1 denotes p.beta.C1 and pC2
denotes p.beta.C2.
[0117] FIGS. 2A-2C illustrate T cell response after DNA
vaccination. PPD, HSP65, and Mt176-190 are Mycobacterial antigens.
N12, MED12, and C2C are .beta.C1/2 peptides. Note that in FIGS.
2A-2C pC1 denotes p.beta.C1 and pC2 denotes p.beta.C2.
[0118] FIGS. 3A-3B illustrate anti-ergotypic responses after DNA
vaccination. FIG. 3A depicts activated and resting A2b T cell
clones. FIG. 3B depicts activated and resting p277b T cell clones.
Note that in FIGS. 3A-3B pC1 denotes p.beta.C1 and pC2 denotes
p.beta.C2.
[0119] FIGS. 4A-4B illustrate inhibition of AA by vaccination with
recombinant C1 or C2 (FIG. 4A) or C1/2 derived peptides (FIG. 4B).
Note that in FIG. 4A rC1 denotes r.beta.C1 and rC2 denotes
r.beta.C2.
[0120] FIGS. 5A-5B illustrate T cell responses to Mycobacterial
antigens (FIG. 5A) and C1/2 peptides (FIG. 5B) after vaccination
with r.beta.C1 or r.beta.C2. Note that in FIGS. 5A-5B rC1 denotes
r.beta.C1 and rC2 denotes r.beta.C2, and Mt180 denotes
Mt176-190.
[0121] FIGS. 6A-6B illustrate T cell responses to Mycobacterial
antigens (FIG. 6A) and C1/2 peptides (FIG. 6B) after vaccination
with r.beta.C1 or r.beta.C2. Note that in FIG. 6A Mt180 denotes
Mt176-190.
[0122] FIGS. 7A-7B illustrate inhibition of AA (FIG. 7A) and leg
swelling (Fig. B) by transfer of Con A-activated splenocytes from
pC1 or pC2 vaccinated rates. Note that in FIGS. 7A-7B pC1 denotes
p.beta.C1 and pC2 denotes p.beta.C2.
[0123] FIGS. 8A-8B illustrate inhibition of AA (FIG. 8A) and leg
swelling (FIG. 8B) by transfer of Con A-activated splenocytes from
rC1 or rC2 vaccinated rates. Note that in FIGS. 8A-8B rC1 denotes
r.beta.C1 and rC2 denotes r.beta.C2.
[0124] FIGS. 9A-9C illustrate proliferative response of T-cell
lines specific to C1/2 determinants N12 (FIG. 9A), MED12 (FIG. 9B)
and C2C (FIG. 9C). Note that in FIGS. 9A-9C rC1 denotes r.beta.C1
and rC2 denotes r.beta.C2.
[0125] FIGS. 10A-10B illustrate inhibition of AA (FIG. 10A) and leg
swelling (FIG. 10B) by transfer of T-cell lines to C1/2
determinants.
[0126] FIGS. 11A-11B illustrate anti-ergotypic responses of T-cell
lines to C1/2 determinants. FIG. 11A depicts activated and resting
A2b T cell clones. FIG. 11B depicts experiments with blocking
antibodies of OX6, OX17, CD80, CD86, and CD28 to determine the
mediators of the activation of these T cell lines to C1/2
determinants.
[0127] FIG. 12 illustrates proliferative responses of T cell lines
to C1/2 determinants.
DETAILED DESCRIPTION OF THE INVENTION
[0128] The present invention relates to novel compositions and
methods for controlling regulatory T cell activity. It is now shown
for the first time that vaccine compositions containing the
constant domain of a chain of a T Cell Receptor (TCR), active
peptides derived thereof, or nucleic acid molecules encoding these
proteins or peptides are effective therapeutic reagents for
treating T cell-mediated inflammatory disease. The efficacy of T
cell vaccines utilizing TCR-derived polypeptides or peptides is
also demonstrated for the first time.
[0129] The invention is based, in part, on the surprising discovery
that the constant domain of both beta-1 and beta-2 T cell receptor
variant chains (C1 and C2, respectively) may be used in therapy of
T cell mediated pathologies. Unexpectedly it was discovered that
vaccination with C1 and C2 domains, as well as specific peptides
derived therefrom, and recombinant constructs encoding same, is
capable of inhibiting T cell mediated inflammation in adjuvant
arthritis (AA), an animal model of an autoimmune disease. It was
further discovered unexpectedly, that T cell lines directed to
these epitopes ameliorate AA when adoptively transferred to
rats.
[0130] In accordance with the present invention, it has also been
discovered that peptides derived from the Major Histocompatibility
Complex (MHC) Class-II binding regions (Reizis et al 1996; Singh
and Raghava 2001) of the constant domain of the T cell receptor are
effective therapeutic agents for treating and preventing the
development of T cell-mediated disease.
Identification of TCR Constant Domain Peptides
[0131] In one aspect, the invention is directed to immunogenic
peptides derived from the constant domain of a TCR chain.
[0132] The term "immunogenic" or "immunogenicity" refers to the
ability of a peptide to induce an antigen-specific cell-mediated
and/or antibody immune response upon administration in an
appropriate form and by an appropriate route to a mammal. In other
words, administration of a peptide of the invention elicits
activation of T cells and/or antibodies directed against one or
more antigenic determinants (epitopes) included within said
peptide. It is to be understood, therefore, that the immunogenic
peptides of the invention are capable of eliciting an immune
response to one or more epitopes of a TCR chain constant domain.
This term further includes the term "antigenic" or "antigenicity"
which refers to the ability of the peptide to be recognized by,
which generally means bound by, an antibody.
[0133] In one particular embodiment, the TCR constant
domain-derived peptides of the invention are characterized in that
they elicit Abs against one or more antigenic determinants included
in said peptides when administered to a subject. In another
embodiment, said Abs specifically bind to at least one TCR constant
domain epitope. In a preferable embodiment, the Abs are of the IgG
isotype.
[0134] In another particular embodiment, the TCR constant
domain-derived peptides of the invention are characterized in that
they comprise one or more antigenic determinants which are
specifically bound by at least one Ab isolated from a subject. In a
preferable embodiment, the Ab is of the IgG isotype. In another
embodiment, said Ab is isolated from the subject prior to
administering a TCR constant domain-derived peptide to said
subject. In another particular embodiment, the subject is afflicted
with a condition associated with an increased T cell-mediated
immune response. In another particular embodiment, said condition
is a T cell-mediated inflammatory disease.
[0135] In another particular embodiment, the TCR constant
domain-derived peptides of the invention are characterized in that
they elicit an immune response to one or more epitopes of a TCR
chain constant domain as measured by increased peptide-specific T
cell activity. According to another particular embodiment, the
peptide-specific T cell activity is an anti-ergotypic T cell
activity.
[0136] The terms "anti-ergotypic T cell response" and
"anti-ergotypic T cell activity" refer to the activation of
regulatory anti-ergotypic T cells. In various embodiments, the
anti-ergotypic T cell response may be defined by a heightened
proliferative response to histocompatible (autologous or syngeneic)
activated T cells. For example, the proliferative response to
various activated T cell clones such as A2b which recognizes Mt
176-190, or p277 which recognizes residues 436-460 of HSP60 may be
determined when using animal models. Alternately, the
anti-ergotypic response may be defined by a shift in the cytokine
phenotype from IFN.gamma. and TNF.alpha. towards IL-10, thereby
driving the differentiation of the histocompatible activated T
cells from a Th1-like to a Th2-like phenotype.
[0137] Accordingly, in certain embodiments of the present
invention, identification of TCR constant domain-derived peptides
suitable for human vaccination may optionally be performed by at
least one of the following:
a) Determining the antigenicity of the peptides. By means of a
non-limitative example, this may optionally be performed by
screening candidate TCR constant domain-derived peptides for their
ability to bind e.g. IgG Abs of a subject afflicted with a T-cell
mediated inflammatory disease, using, for example, antigen-array
technology. A non-limitative example of peptide screening using
antigen-array-based methods is presented in Example 12 herein; b)
Determining the immunogenicity of the peptides. By means of a
non-limitative example, this may optionally be performed by
obtaining lymphocytes from a subject, raising a T cell line
directed to a candidate TCR constant domain-derived peptide, and
determining the ability of the resulting T cell line to proliferate
to histocompatible activated T cells. Non-limitative examples of
peptide screening using anti-ergotypic T cell lines are presented
in Examples 8-10 and 13 herein.
[0138] According to another aspect, the present invention provides
an isolated peptide derived from the constant domain of a chain of
a T Cell Receptor, wherein the peptide exhibits at least one MHC
class II (MHC-II) binding motif.
[0139] Thus, according to certain other embodiments, isolation of
TCR constant domain-derived peptides suitable for human vaccination
may be performed using an MHC-II prediction algorithm. A
non-limitative example of peptide screening using the ProPred
Algorithm for prediction of HLA-DR binding regions in the constant
domain of the T Cell Receptor is presented in Example 11
herein.
[0140] In various particular embodiments, the peptides of the
invention may be derived from various parts of the constant domain
of a TCR chain. In certain particular embodiments, the peptides are
derived from the cytoplasmic region of the constant domain of a TCR
chain. In other particular embodiments, the peptides of the
invention are derived the extracellular region of the constant
domain of a TCR chain. In further particular embodiments, the
peptides of the invention are derived the transmembrane region of
the constant domain of a TCR chain.
[0141] A nine amino acid peptide derived from the transmembrane
domain of the TCR.alpha. chain, denoted core peptide (CP) was
reported to inhibit T-cell antigen specific activation in vitro and
in vivo by co-localizing with the TCR molecules, thereby inhibiting
the proper assembly of the TCR-CD3 complex. It is to be understood
that the peptides of the present invention explicitly exclude the
peptide denoted CP, having an amino acid sequence GLRILLLKV (SEQ ID
NO:156). In certain embodiments, the peptides of the invention are
derived from a sequence other than the transmembrane region of the
constant domain of a TCR alpha chain.
[0142] In certain other particular embodiments, the invention
provides a fusion peptide derived from a TCR constant domain, said
fusion peptide comprising a plurality of immunogenic determinants
derived from at least one T Cell Receptor constant domain.
[0143] The term "fusion peptide" as used herein denotes a
polypeptide or peptide in which two or more polypeptide or peptide
sequences are linked to one another directly or indirectly,
preferably directly, by chemical bonding, preferably peptide
bonding, in a combination which does not exist naturally.
[0144] In certain specific embodiments, said fusion peptide has an
amino acid sequence as set forth in any one of SEQ ID NOS:157-167.
A non-limitative example of a fusion peptide according to the
invention is the peptide denoted by SEQ ID NO:165, which comprises
two immunogenic determinants derived from TCR gamma constant
domain, the immunogenic determinants denoted by SEQ ID NOS:160 and
162.
[0145] According to certain embodiments the present invention
provides recombinant or synthetic polypeptides or peptides
comprising at least one peptide sequence derived from at least one
T Cell Receptor constant domain. According to certain preferred
embodiments the present invention provides recombinant polypeptides
or peptides comprising at least one peptide sequence derived from
at least one T Cell Receptor constant domain, the recombinant
polypeptide or peptide comprising a plurality of MHC-II binding
motifs. According to additional preferred embodiments the present
invention provides recombinant polypeptides or peptides comprising
a plurality of peptide sequences derived from at least one T Cell
Receptor constant domain, the recombinant polypeptide or peptide
comprising a plurality of MHC-II binding motifs. According to still
additional preferred embodiments the present invention provides
recombinant polypeptides or peptides comprising a plurality of
peptide sequences derived from a plurality of T Cell Receptor
constant domains, the recombinant polypeptide or peptide comprising
a plurality of MHC-II binding motifs.
[0146] Most preferably, the peptides of the present invention are
derived from the constant domain of a human T cell receptor.
[0147] According to preferred embodiments, the chain is selected
from the group consisting of T-cell receptor alpha chains, T-cell
receptor beta-1 chains, T-cell receptor beta-2 chains, T-cell
receptor gamma-1 chains, T-cell receptor gamma-2 chains and T-cell
receptor delta chains. The amino acid sequences of the constant
domain of human TCR chains are presented in Table 10 below, and are
denoted by SEQ ID NOS:168-175. It should be understood that the
present invention further encompasses peptides derived from natural
allelic variants of these sequences.
[0148] According to one embodiment, the chain is selected from the
group consisting of T-cell receptor alpha chains. According to
particular embodiments, the chain is the T-cell receptor alpha
chain and the peptide is selected from the group consisting of the
peptides having the sequence set forth in any one of SEQ ID NOS:
1-27 and analogs, derivatives and salts thereof. in other
particular embodiments, the peptide is selected from the group
consisting of the peptides having the sequence set forth in any one
of SEQ ID NOS: 1-12 and 15-27 and analogs, derivatives and salts
thereof
[0149] According to one embodiment, the chain is selected from the
group consisting of T-cell receptor beta chains.
[0150] According to particular embodiments, the chain is the T-cell
receptor beta-1 chain and the peptide is selected from the group
consisting of the peptides having the sequence set forth in any one
of SEQ ID NOS: 28-60 and analogs, derivatives and salts
thereof.
[0151] According to particular embodiments, the chain is the T-cell
receptor beta-2 chain and the peptide is selected from the group
consisting of the peptides having the sequence set forth in any one
of SEQ ID NOS:31-49, SEQ ID NOS:51-59, and SEQ ID NOS:61-64 and
analogs, derivatives and salts thereof.
[0152] According to one embodiment, the chain is selected from the
group consisting of T-cell receptor gamma chains and T-cell
receptor delta chains.
[0153] According to particular embodiments, the chain is the T-cell
receptor delta chain and the peptide is selected from the group
consisting of the peptides having the sequence set forth in any one
of SEQ ID NOS:65-92 and analogs, derivatives and salts thereof.
[0154] According to particular embodiments, the chain is the T-cell
receptor gamma chain (accession no: A26659) and the peptide is
selected from the group consisting of the peptides denoted by SEQ
ID NOS:93-130 and analogs, derivatives and salts thereof.
[0155] According to particular embodiments, the chain is the T-cell
receptor gamma chain (accession no: AAB63314) and the peptide is
selected from the group consisting of the peptides denoted by SEQ
ID NOS:93-131 and analogs, derivatives and salts thereof.
[0156] According to particular embodiments, the chain is the T-cell
receptor gamma chain (accession no: AAB63312) and the peptide is
selected from the group consisting of the peptides denoted by
peptides denoted by SEQ ID NOS:93-100, SEQ ID NOS: 104-105, SEQ ID
NOS:107-109, SEQ ID NOS:112-125, SEQ ID NOS:127-129, SEQ ID
NOS:131-140, and analogs, derivatives and salts thereof.
[0157] According to particular embodiments, the chain is the T-cell
receptor gamma chain (accession no: AAB63313) and the peptide is
selected from the group consisting of the peptides having the
sequence set forth in any one of SEQ ID NOS:94-100, SEQ ID NOS:
104-105, SEQ ID NOS:107-109, SEQ ID NOS:112-130, SEQ ID NOS:133-146
and analogs, derivatives and salts thereof.
T Cell Mediated Pathologies
[0158] In one aspect, the present invention provides compositions
and methods for treating or preventing T cell-mediated inflammatory
diseases. "T cell-mediated inflammatory diseases" refer to any
condition in which an inappropriate or detrimental T cell response
is a component of the etiology or pathology of the disease or
disorder. This includes both diseases and conditions directly
mediated by T cells, and also diseases and conditions in which an
inappropriate T cell response contributes to the production of
abnormal antibodies (e.g. autoimmune or allergic diseases
associated with production of pathological IgG, IgA or IgE
antibodies), as well as graft rejection.
[0159] According to various embodiments, the T cell mediated
inflammatory disease includes, but is not limited to, autoimmune
diseases, allergic diseases, Th1 mediated diseases and other
inflammatory diseases. In one embodiment of the invention, the
compositions and methods of the invention are useful for treating a
T cell-mediated autoimmune disease, including but not limited to:
multiple sclerosis, rheumatoid arthritis, juvenile rheumatoid
arthritis, autoimmune neuritis, systemic lupus erythematosus,
psoriasis, Type I diabetes, Sjogren's disease, thyroid disease,
myasthenia gravis, sarcoidosis, autoimmune uveitis, inflammatory
bowel disease (Crohn's and ulcerative colitis) and autoimmune
hepatitis. In one particular embodiment, the autoimmune disease is
rheumatoid arthritis. In other particular embodiments the
compositions and methods of the invention are useful for treating a
Th1-associated inflammatory disease, e.g. Th1 mediated allergic
responses which result in skin sensitivity and inflammation, such
as contact dermatitis. In other particular embodiments the
compositions and methods of the invention are useful for treating a
Th2-associated inflammatory disease, lupus and allergies. In other
embodiments, the compositions and methods of the invention are
useful in treating a wide range of inflammatory diseases and
conditions including but not limited to inflammatory or allergic
diseases such as asthma (particularly allergic asthma),
hypersensitivity lung diseases, hypersensitivity pneumonitis,
delayed-type hypersensitivity, interstitial lung disease (ILD)
(e.g., idiopathic pulmonary fibrosis, or ILD associated with
rheumatoid arthritis or other inflammatory diseases). In other
embodiments, the T cell mediated pathology is graft rejection,
including allograft rejection and graft-versus-host disease (GVHD).
Allograft rejection, e.g. organ rejection, occurs by host immune
cell destruction of the transplanted tissue through an immune
response. Similarly, an immune response is also involved in GVHD,
but, in this case, the foreign transplanted immune cells destroy
the host tissues.
Protein and Peptide-Based Compositions and Methods
[0160] The polypeptides and peptides of the invention may be
isolated or synthesized using any recombinant or synthetic method
known in the art, including, but not limited to, solid phase (e.g.
Boc or f-Moc chemistry) and solution phase synthesis methods. For
example, the peptides can be synthesized by a solid phase peptide
synthesis method of Merrifield (1963). Alternatively, a peptide of
the present invention can be synthesized using standard solution
methods well known in the art (see, for example, Bodanszky, 1984)
or by any other method known in the art for peptide synthesis.
[0161] The peptides of the invention may be used having a terminal
carboxy acid, as a carboxy amide, as a reduced terminal alcohol or
as any pharmaceutically acceptable salt, e.g., as metal salt,
including sodium, potassium, lithium or calcium salt, or as a salt
with an organic base, or as a salt with a mineral acid, including
sulfuric acid, hydrochloric acid or phosphoric acid, or with an
organic acid e.g., acetic acid or maleic acid. Generally, any
pharmaceutically acceptable salt of the peptide of the invention
may be used, as long as the biological activity of the peptide with
respect to T cell-mediated disease are maintained.
[0162] Functional derivatives consist of chemical modifications to
amino acid side chains and/or the carboxyl and/or amino moieties of
said peptides. Such derivatized molecules include, for example,
those molecules in which free amino groups have been derivatized to
form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy
groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl
groups. Free carboxyl groups may be derivatized to form salts,
methyl and ethyl esters or other types of esters or hydrazides.
Free hydroxyl groups may be derivatized to form O-acyl or O-alkyl
derivatives. The imidazole nitrogen of histidine may be derivatized
to form N-im-benzylhistidine. Also included as chemical derivatives
are those peptides, which contain one or more naturally occurring
amino acid derivatives of the twenty standard amino acid residues.
For example: 4-hydroxyproline may be substituted for proline;
5-hydroxylysine may be substituted for lysine; 3-methylhistidine
may be substituted for histidine; homoserine may be substituted or
serine; and ornithine may be substituted for lysine.
[0163] The amino acid residues described herein are in the "L"
isomeric form, unless otherwise indicated. However, residues in the
"D" isomeric form can be substituted for any L-amino acid residue,
as long as the peptide substantially retains the desired functional
property.
[0164] It is to be understood by all of skill in the art that
suitable analogs of these new peptides may be readily synthesized
by now-standard peptide synthesis methods and apparatus. The
limitation on such analogs is that they have essentially the same
biological activity with respect to T-cell mediated disease. All
such analogs will essentially be based on the new peptides as
regards their amino acid sequence but will have one or more amino
acid residues deleted, substituted or added. When amino acid
residues are substituted, such conservative replacements which are
envisaged are those which do not significantly alter the structure
or biological activity of the peptide. For example basic amino
acids will be replaced with other basic amino acids, acidic ones
with acidic ones and neutral ones with neutral ones. In addition to
analogs comprising conservative substitutions as detailed above,
peptide analogs comprising non-conservative amino acid
substitutions. The peptide analogs of the invention are
characterized in that they retain the ability to bind MHC-II
molecules and/or retain the ability to elicit an immune response to
the constant domain of a TCR chain as measured by an increased
anti-ergotypic T cell activity.
[0165] The overall length of a peptide of the invention is
preferably between about 6 to 35 amino acids. It is
well-established in the art that class II MHC molecules bind to
peptides 12-15 amino acid residues in length, with a minimum length
perhaps as short as 7-9 amino acid residues. Thus, the TCR constant
domain fragments of the invention are preferably at least about 7-9
amino acids in length and comprise MHC-II binding motifs. In
certain embodiments, e.g. when the peptides comprise a plurality of
TCR constant domain-derived sequences, longer peptides, e.g. up to
50 amino acids in length, and isolated and recombinantly produced
polypeptides are within the scope of the present invention.
However, shorter peptides are preferable, in certain embodiments,
for being easier to manufacture.
[0166] In another aspect, the present invention provides
pharmaceutical compositions useful for vaccinating a subject in
need thereof against a T cell mediated pathology.
[0167] In one embodiment, there is provided a vaccine composition
comprising (a) at least one pharmaceutically acceptable carrier,
adjuvant, excipient or diluent; (b) at least one immunogen selected
from the group consisting of: [0168] (i) the constant domain of a
chain of a TCR, [0169] (ii) a peptide comprising an immunogenic
fragment of the constant domain of a chain of a TCR; and [0170]
(iii) analogs, derivatives and salts thereof
[0171] According to another embodiment, the composition is a
pharmaceutical composition comprising (a) a pharmaceutically
acceptable carrier, adjuvant, excipient or diluent; (b) the
constant domain of a chain of a T Cell Receptor, analogs,
derivatives, salts or a peptide derived thereof, wherein the
peptide exhibits the MHC Class II binding motif.
[0172] The term "vaccine" as used herein denotes a composition
useful for stimulating a specific immune response in a vertebrate.
This term explicitly includes both immunotherapeutic vaccines, i.e.
a vaccine administered to treat and/or prevent further progression
of the disease in a host already diagnosed with the disease, and
prophylactic vaccines.
[0173] The pharmaceutical composition of the invention is
administered to a subject in need of said treatment in a
therapeutically effective amount. According to the present
invention, a "therapeutically effective amount" is an amount that
when administered to a patient is sufficient to inhibit, preferably
to eradicate, or, in other embodiments, to prevent or delay the
progression of a T cell mediated pathology. A "therapeutically
effective amount" further refers to an amount which, when
administered to a subject, results in a substantial increase in the
immune response of the subject to the administered immunogen, as
described herein.
[0174] According certain embodiments, the subject is selected from
the group consisting of humans, dogs, cats, sheep, cattle, horses
and pigs. In a preferred embodiment, the subject is human.
[0175] Pharmaceutical compositions for use in accordance with these
embodiments may be formulated in conventional manner using one or
more physiologically acceptable carriers or excipients (vehicles).
The carriers) are "acceptable" in the sense of being compatible
with the other ingredients of the composition and not deleterious
to the recipient thereof. The vaccine composition can be optionally
administered in a pharmaceutically or physiologically acceptable
vehicle, such as physiological saline or ethanol polyols such as
glycerol or propylene glycol.
[0176] All variant molecules of the constant domain of any chain of
the T Cell Receptor are appropriate for the pharmaceutical
composition.
[0177] The pharmaceutical composition is provided in solid, liquid
or semi-solid form. A solid preparation may be prepared by blending
the above components to provide a powdery composition.
Alternatively, the pharmaceutical composition is provided as
lyophilized preparation. The liquid preparation is provided
preferably as aqueous solution, aqueous suspension, oil suspension
or microcapsule composition. A semi-solid composition is provided
preferably as hydrous or oily gel or ointment.
[0178] A solid composition may be prepared e.g. by mixing an
excipient with a solution of the protein or peptide of the
invention, gradually adding a small quantity of water, and kneading
the mixture. After drying, preferably in vacuum, the mixture is
pulverized. A liquid composition may be prepared e.g. by
dissolving, suspending or emulsifying the protein or peptide of the
invention in water, a buffer solution or the like. An oil
suspension may be prepared by e.g. suspending or emulsifying the
protein or peptide of the invention or protein in an oleaginous
base, such as sesame oil, olive oil, corn oil, soybean oil,
cottonseed oil, peanut oil, lanolin, petroleum jelly, paraffin,
Isopar, silicone oil, fatty acids of 6 to 30 carbon atoms or the
corresponding glycerol or alcohol esters. Buffers include e.g.
Sorensen buffer, Clark-Lubs buffer, Macllvaine buffer, Michaelis
buffer, and Kolthoff buffer.
[0179] A composition may be prepared as a hydrous gel, e.g. for
transnasal administration. A hydrous gel base is dissolved or
dispersed in aqueous solution containing a buffer, and the protein
or peptide of the invention, and the solution warmed or cooled to
give a stable gel.
[0180] Preferably, the protein or peptide of the invention is
administered through intravenous, intramuscular or subcutaneous
administration. Oral administration may not be as effective,
because the protein or peptide may be digested before being taken
up. Of course, this consideration may apply less to a protein or
peptide of the invention which is modified, e.g., by being cyclic
peptide, by containing non-naturally occurring amino acids, such as
D-amino acids, or other modification which enhance the resistance
of the protein or peptide to biodegradation. Decomposition in the
digestive tract may be lessened by use of certain compositions, for
instance, by confining the protein or peptide of the invention in
microcapsules such as liposomes. The pharmaceutical composition of
the invention may also be administered to other mucous membranes.
The pharmaceutical composition is then provided in the form of a
suppository, nasal spray or sublingual tablet.
[0181] The dosage of the proteins or peptides of the present
invention may depend upon the condition to be treated, the
patient's age, bodyweight, and the route of administration, and
will be determined by the attending physician.
[0182] In another embodiment, the proteins or peptides of the
invention may be provided in a pharmaceutical composition
comprising a biodegradable polymer including, but not limited to
frompoly-1,4-butylene succinate, poly-2,3-butylene succinate,
poly-1,4-butylene fumarate and poly-2,3-butylene succinate,
incorporating the protein or peptide of the invention as the
pamoate, tannate, stearate or palmitate thereof. Such compositions
are described e.g., in U.S. Pat. No. 5,439,688.
[0183] In another embodiment, a composition of the invention is a
fat emulsion.
[0184] The fat emulsion may be prepared e.g. by adding to a fat or
oil about 0.1-2. 4 w/w of emulsifier such as a phospholipid, an
emulsifying aid, a stabilizer, mixing mechanically, aided by
heating and/or removing solvents, adding water and isotonic agent,
and optionally, adjusting adding the pH agent, isotonic agent. The
mixture is then homogenized. Preferably, such fat emulsions contain
an electric charge adjusting agent, such as acidic phospholipids,
fatty acids, bile acids, and salts thereof. Acidic phospholipids
include phosphatidylserine, phosphatidylglycerol,
phosphatidylinositol, and phosphatidic acid. Bile acids include
deoxycholic acid, and taurocholic acid. The preparation of such
pharmaceutical compositions is described in U.S. Pat. No.
5,733,877.
[0185] Pharmaceutical compositions according to the invention may
optionally comprise additional adjuvants such as vegetable oils or
emulsions thereof, surface active substances, e.g., hexadecylamin,
octadecyl amino acid esters, octadecylamine, lysolecithin,
dimethyl-dioctadecylammonium bromide,
N,N-dicoctadecyl-N'-N'bis(2-hydroxyethyl-propane diamine),
methoxyhexadecylglycerol, and pluronic polyols; polyamines, e.g.,
pyran, dextransulfate, poly IC, carbopol; peptides, e.g., muramyl
dipeptide, dimethylglycine, tuftsin; immune stimulating complexes;
oil emulsions (including, but not limited to, oil-in-water
emulsions having oil droplets in the submicron range, such as those
disclosed by U.S. Pat. Nos. 5,961,970, 4,073,943 and 4,168,308);
liposaccharides such as MPL.RTM. and mineral gels. The antigens of
this invention can also be incorporated into liposomes, cochleates,
biodegradable polymers such as poly-lactide, poly-glycolide and
poly-lactide-co-glycolides, or ISCOMS (immunostimulating
complexes), and supplementary active ingredients may also be
employed. Metabolizable lipid emulsions, such as Intralipid or
Lipofundin, may also be used as vehicles for the vaccination in the
manner disclosed in WO 97/02016, the entire contents of which being
hereby incorporated herein by reference. As these materials are
known to cause a Th1 to Th2 cytokine shift, such lipid emulsions
are advantageous for the purpose of the present invention. These
lipid emulsions may be formulated as oil-in-water submicron
emulsion, as disclosed in U.S. Pat. No. 5,961,970.
[0186] The protein and peptide antigens of the present invention
can be coupled to albumin or to other carrier molecule in order to
modulate or enhance the immune response, all as are well known to
those of ordinary skill in the vaccine art.
[0187] In another aspect, the present invention provides a method
of treating a T-cell mediated inflammatory disease, wherein said
method comprises administering to an individual in need thereof a
therapeutic composition comprising an immunogen of the invention,
as detailed herein.
[0188] In another aspect, the present invention provides a method
of preventing the development of a T-cell mediated inflammatory
disease, wherein said method comprises administering to an
individual in need thereof a therapeutic composition comprising an
immunogen of the invention, as detailed herein.
[0189] In another aspect, the present invention provides a method
of preventing or treating the development of a T-cell mediated
inflammatory disease, wherein said method comprises administering
to an individual in need thereof a therapeutic composition
comprising the constant domain of a chain of a T Cell receptor or
an active fragment thereof, as detailed herein.
[0190] It is to be understood that a method of preventing or
treating the disease can also be described as a method of
vaccination for said disease.
[0191] In another aspect, there is provided method of enhancing
anti-ergotypic T cells activity in a subject in need thereof, the
method comprising administering to the subject in need thereof a
therapeutically effective amount of a vaccine composition of the
invention, as detailed herein.
[0192] In another aspect, the invention is directed to the use of
an immunogen selected from the group consisting of: [0193] (i) the
constant domain of a chain of a T Cell Receptor (TCR), [0194] (ii)
a peptide comprising an immunogenic fragment of the constant domain
of a chain of a TCR; and [0195] (iii) analogs, derivatives and
salts thereof; for the preparation of a vaccine. In various
embodiments, the vaccine is useful for treating a T cell mediated
inflammatory disease, for preventing the development of a T cell
mediated inflammatory disease, and/or for enhancing anti-ergotypic
T cells activity in a subject in need thereof.
[0196] In one embodiment, the peptide or protein should be
administered in a medically effective amount, at least once,
preferably soon after diagnosis. The protein or peptide may also be
administered another two times, preferably at one and six months
after the first administration, to provide a booster for the
patient.
[0197] In certain embodiments, said immunogen is administering to
the subject prior to appearance of disease symptoms. In other
embodiments, said immunogen is administering to the subject after
appearance of disease symptoms.
[0198] The vaccines can be administered to a human or animal by a
variety of routes, including but not limited to parenteral,
intradermal, transdermal (such as by the use of slow release
polymers), intramuscular, intraperitoneal, intravenous,
subcutaneous, oral and intranasal routes of administration,
according to protocols well known in the art. The vaccine
compositions of the invention are administered in a dose which is
suitable to elicit an immune response in said subject. The
particular dosage of the TCR constant domain antigen will depend
upon the age, weight and medical condition of the subject to be
treated, as well as on the identity of the antigen and the method
of administration. Suitable doses will be readily determined by the
skilled artisan. A preferred dose for human intramuscular,
subcutaneous and oral vaccination is between about 50 .mu.g to
about 100 mg, preferably between about 200 .mu.g to about 40 mg,
and more preferably between about 500 .mu.g to about 10 mg.
Adjustment and manipulation of established dosage ranges used with
traditional carrier antigens for adaptation to the present vaccine
is well within the ability of those skilled in the art.
DNA Vaccination and Related Methods
[0199] According to the present invention it is now disclosed that
it is possible to treat or prevent T cell-mediated inflammatory
diseases by using DNA vaccines encoding the constant domain of a
chain of a T Cell receptor, or an active fragment or homologue
thereof.
[0200] The invention discloses for the first time that vaccination
with a DNA vaccine comprising nucleotide encoding for the constant
domain of a chain of the T Cell Receptor inhibits T-cell mediated
inflammation and leads to an anti-ergotypic T cell response.
Without wishing to be bound by any theory or mechanism of action,
this suggests that the preventing or ameliorating of T
cell-mediated autoimmune diseases by nucleic acids encoding for the
constant domain of a chain of a T Cell Receptor might be related to
a shift in the cytokines secreted by the responding T cells, rather
than to suppression of the autoimmune T cell proliferation.
[0201] The use of DNA vaccination for the generation of cellular
immune responses is particularly advantageous. It provides an
effective therapeutic composition that enables the safe treatment
of an animal with a potentially toxic protein. Without wishing to
be bound by any theory or mechanism of action, expression of
nucleic acid molecules encoding the constant domain of a chain of a
T Cell Receptor or an active fragment thereof results in localized
production of the constant domain of the chain of the T Cell
Receptor or the active fragment thereby eliciting anti-ergotypic T
cell responses with the encoded protein or active fragment as an
ergotope. The therapeutic compositions of the present invention can
provide long-term expression of the constant domain of the chain of
the T Cell receptor or the active fragment thereof. Such long-term
expression allows for the maintenance of an effective, but
non-toxic, dose of the encoded protein or active fragment to treat
a disease and limits the frequency of administration of the
therapeutic composition needed to treat an animal. In addition,
because of the lack of toxicity, therapeutic compositions of the
present invention can be used in repeated treatments.
[0202] The present invention also relates to the use of a
recombinant construct, said recombinant construct comprises an
isolated nucleic acid sequence encoding the constant domain of a
chain of a T Cell Receptor, or an active fragment thereof, in order
to elicit anti-ergotypic T cells response. Such response is
required for example in T cell mediated autoimmune diseases in
which the balance between the anti-ergotypic T cells and the
autoimmune T cells is disturbed.
[0203] The isolated nucleic acid sequence encoding the constant
domain of various chains of T Cell Receptors and active fragments
thereof may include DNA, RNA, or derivatives of either DNA or RNA.
An isolated nucleic acid sequence encoding the constant domain of a
chain of a T Cell Receptor can be obtained from its natural source,
either as an entire (i.e., complete) gene or a portion thereof. A
nucleic acid molecule can also be produced using recombinant DNA
technology (e.g., polymerase chain reaction (PCR) amplification,
cloning) or chemical synthesis. Nucleic acid sequences include
natural nucleic acid sequences and homologues thereof, including,
but not limited to, natural allelic variants and modified nucleic
acid sequences in which nucleotides have been inserted, deleted,
substituted, and/or inverted in such a manner that such
modifications do not substantially interfere with the nucleic acid
molecule's ability to encode a functional constant domain of a T
Cell Receptor or active fragment thereof of the present
invention.
[0204] A nucleic acid sequence homologue can be produced using a
number of methods known to those skilled in the art (see, for
example, Sambrook et al., Molecular Cloning: A Laboratory Manual,
Cold Spring Harbor Labs Press, 1989). For example, nucleic acid
sequences can be modified using a variety of techniques including,
but not limited to, classic mutagenesis techniques and recombinant
DNA techniques, such as site-directed mutagenesis, chemical
treatment of a nucleic acid molecule to induce mutations,
restriction enzyme cleavage of a nucleic acid fragment, ligation of
nucleic acid fragments, polymerase chain reaction (PCR)
amplification and/or mutagenesis of selected regions of a nucleic
acid sequence, synthesis of oligonucleotide mixtures and ligation
of mixture groups to "build" a mixture of nucleic acid molecules
and combinations thereof. Nucleic acid molecule homologues can be
selected from a mixture of modified nucleic acids by screening for
the function of the protein encoded by the nucleic acid.
[0205] One embodiment of the present invention is an isolated
nucleic acid sequence that encodes at least a portion of the
constant domain of a chain of a T Cell Receptor, or a homologue of
the constant domain of a chain of a T Cell Receptor. As used
herein, "at least a portion of the constant domain of a chain of a
T Cell Receptor" refers to portions of the constant domain of a or
.beta. or .gamma. or .delta. chains of T Cell Receptors capable of
increasing the anti-ergotypic T cell response. In one preferred
embodiment, a nucleic acid sequence of the present invention
encodes an entire coding region of the constant domain of a chain
of a T Cell Receptor. Alternatively, the nucleic acid sequence
encodes a peptide derived from the constant domain of a chain of a
T Cell Receptor that exhibits the MHC-II binding motif. As used
herein, a homologue of the constant domain of a chain of the T Cell
Receptor is a protein or peptide having an amino acid sequence that
is sufficiently similar to a natural amino acid sequence that a
nucleic acid sequence encoding the homologue encodes a protein or
peptide capable of increasing the anti-ergotypic T cell
response.
[0206] In a particular embodiment, the invention provides isolated
and recombinant nucleic acid sequences encoding at lease one
peptide having an amino acid sequence as set forth in any one of
SEQ ID NOS:1-146 and 157-167, recombinant constructs comprising
them and DNA vaccines thereof.
[0207] In another embodiment, the invention provides a nucleic acid
sequence encoding a fusion peptide derived from the constant domain
of a chain of a T Cell Receptor (TCR), the fusion peptide
comprising a plurality of immunogenic determinants derived from at
least one TCR constant domain. In a particular embodiment, the
peptide comprises an amino acid sequence as set forth in any one of
SEQ ID NOS: 157-167.
[0208] In another embodiment, the invention provides a nucleic acid
sequence encoding a fusion peptide derived from the constant domain
of a chain of a TCR, the fusion peptide comprising a plurality of
peptide sequences derived from at least one TCR constant domain,
the peptide comprising a plurality of Major Histocompatibility
Complex (MHC)-II binding motifs. In particular embodiments, at
least one peptide sequence derived from the at least one TCR
constant domain comprises an amino acid sequence as set forth in
any one of SEQ ID NOS:1-146 and analogs and derivatives
thereof.
[0209] A polynucleotide or oligonucleotide sequence can be readily
deduced from the genetic code of a protein or peptide; however, the
degeneracy of the code must be taken into account. For example,
without limitation, oligonucleotide sequences denoted by SEQ ID
NOS:183-193 encode the immunogenic peptides of SEQ ID NOS:157-167
(see Table 14). However, nucleic acid sequences of the invention
also include sequences, which are degenerate as a result of the
genetic code, which sequences may be readily determined by those of
ordinary skill in the art. Nucleic acid sequences encoding the
constant domain of human TCR chains are presented in the Examples
below, and are denoted by SEQ ID NOS:176-182. It should be
understood that the present invention further encompasses nucleic
acid sequences derived from natural allelic variants of these
sequences.
[0210] The present invention includes a nucleic acid sequence of
the present invention operatively linked to one or more
transcription control sequences to form a recombinant molecule. The
phrase "operatively linked" refers to linking a nucleic acid
sequence to a transcription control sequence in a manner such that
the molecule is able to be expressed when transfected (i.e.,
transformed, transduced or transfected) into a host cell.
Transcription control sequences are sequences which control the
initiation, elongation, and termination of transcription.
Particularly important transcription control sequences are those
which control transcription initiation, such as promoter, enhancer,
operator and repressor sequences. Suitable transcription control
sequences include any transcription control sequence that can
function in at least one of the recombinant cells of the present
invention. A variety of such transcription control sequences are
known to those skilled in the art. Preferred transcription control
sequences include those which function in animal, bacteria,
helminth, insect cells, and preferably in animal cells. More
preferred transcription control sequences include, but are not
limited to RSV control sequences, CMV control sequences, retroviral
LTR sequences, SV-40 control sequences and .beta.-actin control
sequences as well as other sequences capable of controlling gene
expression in eukaryotic cells. Additional suitable transcription
control sequences include tissue-specific promoters and enhancers
(e.g., T cell-specific enhancers and promoters). Transcription
control sequences of the present invention can also include
naturally occurring transcription control sequences naturally
associated with a gene encoding a chain of the T Cell receptor or
an active peptide derived thereof of the present invention.
[0211] According to still further features in the described
preferred embodiments the recombinant construct is a eukaryotic
expression vector.
[0212] According to still further features in the described
particular embodiments the expression vector is selected from the
group consisting of pcDNA3, pcDNA3.1(+/-), pZeoSV2(+/-), pSecTag2,
pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pCI, pBK-RSV,
pBK-CMV, pTRES and their derivatives.
[0213] According to the present invention, a host cell can be
transfected in vivo (i.e., in an animal) or ex vivo (i.e., outside
of an animal). Transfection of a nucleic acid molecule into a host
cell can be accomplished by any method by which a nucleic acid
molecule can be inserted into the cell. Transfection techniques
include, but are not limited to, transfection, electroporation,
microinjection, lipofection, adsorption, and protoplast fusion.
Preferred methods to transfect host cells in vivo include
lipofection and adsorption.
[0214] It may be appreciated by one skilled in the art that use of
recombinant DNA technologies can improve expression of transfected
nucleic acid molecules by manipulating, for example, the number of
copies of the nucleic acid molecules within a host cell, the
efficiency with which those nucleic acid molecules are transcribed,
the efficiency with which the resultant transcripts are translated,
and the efficiency of post-translational modifications. Recombinant
techniques useful for increasing the expression of nucleic acid
molecules of the present invention include, but are not limited to,
operatively linking nucleic acid molecules to high-copy number
plasmids, integration of the nucleic acid molecules into one or
more host cell chromosomes, addition of vector stability sequences
to plasmids, substitutions or modifications of transcription
control signals (e.g., promoters, operators, enhancers),
substitutions or modifications of translational control signals
(e.g., ribosome binding sites, Shine-Dalgarno sequences),
modification of nucleic acid molecules of the present invention to
correspond to the codon usage of the host cell, and deletion of
sequences that destabilize transcripts. The activity of an
expressed recombinant protein of the present invention may be
improved by fragmenting, modifying, or derivatizing nucleic acid
molecules encoding such a protein.
[0215] According to yet another aspect of the present invention
there is provided a pharmaceutical composition suitable for
effecting the DNA vaccination methods of the present invention. The
composition includes a recombinant construct including an isolated
nucleic acid sequence encoding a chain of the T Cell receptor, an
active peptide derived thereof or an analog thereof, the nucleic
acid sequence being operatively linked to one or more transcription
control sequences, and a pharmaceutically acceptable carrier.
[0216] In one embodiment, there is provided a DNA vaccine
composition comprising (a) at least one pharmaceutically acceptable
carrier and (b) at least one recombinant construct comprising an
isolated nucleic acid sequence encoding at least one immunogen
selected from the group consisting of: [0217] (i) the constant
domain of a chain of a T Cell Receptor (TCR); and [0218] (ii) a
peptide comprising an immunogenic fragment of the constant domain
of a chain of a TCR, wherein the nucleic acid sequence is
operatively linked to one or more transcription control
sequences.
[0219] In another embodiment of the invention, the composition is
useful for treating a T cell-mediated inflammatory disease as
described hereinabove.
[0220] The DNA vaccine composition of the invention is administered
to an individual in need of said treatment. According to still
further features in the described preferred embodiments the
individual is selected from the group consisting of humans, dogs,
cats, sheep, cattle, horses and pigs.
[0221] In another embodiment of the present invention, a DNA
vaccine composition further comprises a pharmaceutically acceptable
carrier. With respect to DNA vaccines, a "carrier" refers to any
substance suitable as a vehicle for delivering a nucleic acid
sequence of the present invention to a suitable in vivo site. As
such, carriers can act as a pharmaceutically acceptable excipient
of a therapeutic composition containing a nucleic acid molecule of
the present invention. Preferred carriers are capable of
maintaining a nucleic acid molecule of the present invention in a
form that, upon arrival of the nucleic acid molecule to a cell, the
nucleic acid molecule is capable of entering the cell and being
expressed by the cell. Carriers for DNA vaccines of the present
invention include: (1) excipients or formularies that transport,
but do not specifically target a nucleic acid molecule to a cell
(referred to herein as non-targeting carriers); and (2) excipients
or formularies that deliver a nucleic acid molecule to a specific
site in an animal or a specific cell (i.e., targeting carriers).
Examples of non-targeting carriers include, but are not limited to
water, phosphate buffered saline, Ringer's solution, dextrose
solution, serum-containing solutions, Hank's solution, other
aqueous physiologically balanced solutions, oils, esters and
glycols. Aqueous carriers can contain suitable auxiliary substances
required to approximate the physiological conditions of the
recipient, for example, by enhancing chemical stability and
isotonicity.
[0222] Suitable auxiliary substances include, for example, sodium
acetate, sodium chloride, sodium lactate, potassium chloride,
calcium chloride, and other substances used to produce phosphate
buffer, Tris buffer, and bicarbonate buffer. Auxiliary substances
can also include preservatives, such as thimerosal, m- and
o-cresol, formalin and benzol alcohol. Preferred auxiliary
substances for aerosol delivery include surfactant substances
non-toxic to an animal, for example, esters or partial esters of
fatty acids containing from about six to about twenty-two carbon
atoms. Examples of esters include, caproic, octanoic, lauric,
palmitic, stearic, linoleic, linolenic, olesteric, and oleic acids.
Other carriers can include metal particles (e.g., gold particles)
for use with, for example, a biolistic gun through the skin.
Therapeutic compositions of the present invention can be sterilized
by conventional methods.
[0223] Targeting carriers are herein referred to as "delivery
vehicles". Delivery vehicles of the present invention are capable
of delivering a therapeutic composition of the present invention to
a target site in an animal. A "target site" refers to a site in an
animal to which one desires to deliver a therapeutic composition.
For example, a target site can be an inflamed region which is
targeted by direct injection or delivery using liposomes or other
delivery vehicles. Examples of delivery vehicles include, but are
not limited to, artificial and natural lipid-containing delivery
vehicles. Natural lipid-containing delivery vehicles include cells
and cellular membranes. Artificial lipid-containing delivery
vehicles include liposomes and micelles. A delivery vehicle of the
present invention can be modified to target to a particular site in
an animal, thereby targeting and making use of a nucleic acid
molecule of the present invention at that site. Suitable
modifications include manipulating the chemical formula of the
lipid portion of the delivery vehicle and/or introducing into the
vehicle a compound capable of specifically targeting a delivery
vehicle to a preferred site, for example, a preferred cell type.
Specifically targeting refers to causing a delivery vehicle to bind
to a particular cell by the interaction of the compound in the
vehicle to a molecule on the surface of the cell. Suitable
targeting compounds include ligands capable of selectively (i.e.,
specifically) binding another molecule at a particular site.
Examples of such ligands include antibodies, antigens, receptors
and receptor ligands. For example, an antibody specific for an
antigen found on the surface of a cancer cell can be introduced to
the outer surface of a liposome delivery vehicle so as to target
the delivery vehicle to the cancer cell. Manipulating the chemical
formula of the lipid portion of the delivery vehicle can modulate
the extracellular or intracellular targeting of the delivery
vehicle. For example, a chemical can be added to the lipid formula
of a liposome that alters the charge of the lipid bilayer of the
liposome so that the liposome fuses with particular cells having
particular charge characteristics.
[0224] A preferred delivery vehicle of the present invention is a
liposome. A liposome is capable of remaining stable in an animal
for a sufficient amount of time to deliver a nucleic acid sequence
of the present invention to a preferred site in the animal. A
liposome of the present invention is preferably stable in the
animal into which it has been administered for at least about 30
minutes, more preferably for at least about 1 hour and even more
preferably for at least about 24 hours.
[0225] A liposome of the present invention comprises a lipid
composition that is capable of targeting a nucleic acid molecule of
the present invention to a particular, or selected, site in an
animal Preferably, the lipid composition of the liposome is capable
of targeting to any organ of an animal, more preferably to the
lung, liver, spleen, heart brain, lymph nodes and skin of an
animal, and even more preferably to the lung of an animal.
[0226] A liposome of the present invention comprises a lipid
composition that is capable of fusing with the plasma membrane of
the targeted cell to deliver a nucleic acid molecule into a cell.
Preferably, the transfection efficiency of a liposome of the
present invention is about 0.5 microgram (.mu.g) of DNA per 16
nanomole (nmol) of liposome delivered to about 10.sup.6 cells, more
preferably about 1.0 .mu.g of DNA per 16 nmol of liposome delivered
to about 10.sup.6 cells, and even more preferably about 2.0 .mu.g
of DNA per 16 nmol of liposome delivered to about 10.sup.6
cells.
[0227] A preferred liposome of the present invention is between
about 100 and 500 nanometers (nm), more preferably between about
150 and 450 nm and even more preferably between about 200 and 400
nm in diameter.
[0228] Suitable liposomes for use with the present invention
include any liposome. Preferred liposomes of the present invention
include those liposomes routinely used in, for example, gene
delivery methods known to those of skill in the art. More preferred
liposomes comprise liposomes having a polycationic lipid
composition and/or liposomes having a cholesterol backbone
conjugated to polyethylene glycol.
[0229] Complexing a liposome with a nucleic acid sequence of the
present invention can be achieved using methods standard in the
art. A suitable concentration of a nucleic acid molecule of the
present invention to add to a liposome includes a concentration
effective for delivering a sufficient amount of nucleic acid
molecule to a cell such that the cell can produce sufficient
quantities of a constant domain of a chain of the T Cell receptor
or an active peptide derived thereof to regulate effector cell
immunity in a desired manner. Preferably, from about 0.1 .mu.g to
about 10 .mu.g of nucleic acid sequence of the present invention is
combined with about 8 nmol liposomes, more preferably from about
0.5 .mu.g to about 5 .mu.g of nucleic acid molecule is combined
with about 8 nmol liposomes, and even more preferably about 1.0
.mu.g of nucleic acid molecule is combined with about 8 nmol
liposomes.
[0230] Another preferred delivery vehicle comprises a recombinant
virus particle vaccine. A recombinant virus particle vaccine of the
present invention includes a therapeutic composition of the present
invention, in which the recombinant molecules contained in the
composition are packaged in a viral coat that allows entrance of
DNA into a cell so that the DNA is expressed in the cell. A number
of recombinant virus particles can be used, including, but not
limited to, those based on alphaviruses, poxviruses, adenoviruses,
herpesviruses, arena virus and retroviruses.
[0231] Another preferred delivery vehicle comprises a recombinant
cell vaccine. Preferred recombinant cell vaccines of the present
invention include cell vaccines, in which allogeneic (i.e., cells
derived from a source other than a patient, but that are histiotype
compatible with the patient) or autologous (i.e., cells isolated
from a patient) cells are transfected with recombinant molecules
contained in a therapeutic composition, irradiated and administered
to a patient by, for example, intradermal, intravenous or
subcutaneous injection. Therapeutic compositions to be administered
by cell vaccine, include recombinant molecules of the present
invention without carrier.
[0232] In order to treat an animal with disease, a DNA vaccine
composition of the present invention is administered to the animal
in an effective manner such that the composition is capable of
treating that animal from disease. For example, a recombinant
molecule, when administered to an animal in an effective manner, is
able to stimulate effector cell immunity in a manner that is
sufficient to alleviate the disease afflicting the animal According
to the present invention, treatment of a disease refers to
alleviating a disease and/or preventing the development of a
secondary disease resulting from the occurrence of a primary
disease. An effective administration protocol (i.e., administering
a DNA vaccine composition in an effective manner) comprises
suitable dose parameters and modes of administration that result in
treatment of a disease. Effective dose parameters and modes of
administration can be determined using methods standard in the art
for a particular disease. Such methods include, for example,
determination of survival rates, side effects (i.e., toxicity) and
progression or regression of disease. In particular, the
effectiveness of dose parameters and modes of administration of a
therapeutic composition of the present invention when treating
inflammatory diseases can be determined by assessing response
rates. Such response rates refer to the percentage of treated
patients in a population of patients that respond with either
partial or complete remission.
[0233] In accordance with the present invention, a suitable single
dose size is a dose that is capable of treating an animal with
disease when administered one or more times over a suitable time
period. Doses can vary depending upon the disease being treated.
Doses of a therapeutic composition of the present invention
suitable for use with direct injection techniques can be used by
one of skill in the art to determine appropriate single dose sizes
for systemic administration based on the size of an animal. A
suitable single dose of a therapeutic composition to treat an
inflammatory disease is a sufficient amount of sequence encoding an
immunogen of the invention to reduce, and preferably eliminate, the
T-cell mediated inflammatory disease following transfection of the
recombinant molecules into cells. A preferred single dose of a
recombinant molecule encoding an immunogen of the invention is an
amount that, when transfected into a target cell population leads
to the production of from about 250 femtograms (fg) to about 1
.mu.g, preferably from about 500 fg to about 500 picogram (pg), and
more preferably from about 1 .mu.g to about 100 .mu.g of "a
constant domain of a chain of the T Cell receptor or an active
peptide derived thereof" per transfected cell.
[0234] A preferred single dose of a recombinant molecule encoding
an immunogen of the invention complexed with liposomes, is from
about 100 .mu.g of total DNA per 800 nmol of liposome to about 2 mg
of total recombinant molecules per 16 micromole (.mu.mol) of
liposome, more preferably from about 150 .mu.g per 1.2 .mu.mol of
liposome to about 1 mg of total recombinant molecules per 8 .mu.mol
of liposome, and even more preferably from about 200 .mu.g per 2
.mu.mol of liposome to about 400 .mu.g of total recombinant
molecules per 3.2 .mu.mol of liposome.
[0235] A preferred single dose of a recombinant molecule encoding
an immunogen of the invention in a non-targeting carrier to
administer to an animal, is from about 12.5 .mu.g to about 20 mg of
total recombinant molecules per kg body weight, more preferably
from about 25 .mu.g to about 10 mg of total recombinant molecules
per kg body weight, and even more preferably from about 125 .mu.g
to about 2 mg of total recombinant molecules per kg body
weight.
[0236] It will be obvious to one of skill in the art that the
number of doses administered to an animal is dependent upon the
extent of the disease and the response of an individual patient to
the treatment. Thus, it is within the scope of the present
invention that a suitable number of doses includes any number
required to cause regression of a disease. A preferred protocol is
monthly administrations of single doses (as described above) for up
to about 1 year. A preferred number of doses of a therapeutic
composition comprising a recombinant molecule encoding an immunogen
of the invention in a non-targeting carrier or complexed with
liposomes is from about 1 to about 10 administrations per patient,
preferably from about 2 to about 8 administrations per patient, and
even more preferably from about 3 to about 5 administrations per
person. Preferably, such administrations are given once every 2
weeks until signs of remission appear, then once a month until the
disease is gone.
[0237] A DNA vaccine composition is administered to an animal in a
fashion to enable expression of the administered recombinant
molecule of the present invention into a curative protein in the
animal to be treated for disease. A DNA vaccine composition can be
administered to an animal in a variety of methods including, but
not limited to, local administration of the composition into a site
in an animal, and systemic administration.
[0238] DNA vaccine compositions to be delivered by local
administration include: (a) recombinant molecules of the present
invention in a non-targeting carrier (e.g., as "naked" DNA
molecules, such as is taught, for example in Wolff et al., 1990,
Science 247, 1465-1468); and (b) recombinant molecules of the
present invention complexed to a delivery vehicle of the present
invention. Suitable delivery vehicles for local administration
comprise liposomes. Delivery vehicles for local administration can
further comprise ligands for targeting the vehicle to a particular
site.
[0239] DNA vaccine compositions useful in systemic administration,
include recombinant molecules of the present invention complexed to
a targeted delivery vehicle of the present invention. Suitable
delivery vehicles for use with systemic administration comprise
liposomes comprising ligands for targeting the vehicle to a
particular site. Systemic administration is particularly
advantageous when organs, in particular difficult to reach organs
(e.g., heart, spleen, lung or liver) are the targeted sites of
treatment.
[0240] Preferred methods of systemic administration, include
intravenous injection, aerosol, oral and percutaneous (topical)
delivery. Intravenous injections can be performed using methods
standard in the art. Aerosol delivery can also be performed using
methods standard in the art (see, for example, Stribling et al.,
Proc. Natl. Acad. Sci. USA 189:11277-11281, 1992, which is
incorporated herein by reference in its entirety). Oral delivery
can be performed by complexing a DNA vaccine composition of the
present invention to a carrier capable of withstanding degradation
by digestive enzymes in the gut of an animal. Examples of such
carriers, include plastic capsules or tablets, such as those known
in the art. Topical delivery can be performed by mixing a
therapeutic composition of the present invention with a lipophilic
reagent (e.g., DMSO) that is capable of passing into the skin.
[0241] Yet another embodiment of the present invention is a method
to suppress T cell activity in an animal, the method comprising
administering to an animal an effective amount of a therapeutic
composition comprising: (a) a naked nucleic acid molecule encoding
a constant domain of a chain of the T Cell receptor or an active
peptide derived thereof or an analog thereof; and (b) a
pharmaceutically acceptable carrier, in which the nucleic acid
molecule is operatively linked to a transcription control sequence,
and in which the therapeutic composition is targeted to a site in
the animal that contains excessive T cell activity.
[0242] Suitable embodiments, single dose sizes, number of doses and
modes of administration of a therapeutic composition of the present
invention useful in a treatment method of the present invention are
disclosed in detail herein.
[0243] A DNA vaccine composition of the present invention is also
advantageous for the treatment of autoimmune diseases in that the
composition suppresses the harmful stimulation of T cells by
autoantigens (i.e., a "self", rather than a foreign antigen). A
recombinant molecule encoding an immunogen of the invention in a
DNA vaccine composition, upon transfection into a cell, produce a
constant domain of a chain of the T Cell receptor or an active
peptide derived thereof that reduces the harmful activity of T
cells involved in an autoimmune disease. A preferred therapeutic
composition for use in the treatment of autoimmune disease
comprises a recombinant molecule encoding an immunogen of the
invention. A more preferred therapeutic composition for use in the
treatment of autoimmune disease comprises a recombinant molecule
encoding an immunogen of the invention combined with a
non-targeting carrier of the present invention, preferably saline
or phosphate buffered saline.
[0244] Such a therapeutic composition of the present invention is
particularly useful for the treatment of autoimmune diseases,
including but not limited to, multiple sclerosis, systemic lupus
erythematosus, myasthenia gravis, rheumatoid arthritis, insulin
dependent diabetes mellitus, psoriasis, polyarthritis, immune
mediated vasculitides, immune mediated glomerulonephritis,
inflammatory neuropathies and sarcoidosis.
[0245] A single dose of a recombinant molecule encoding an
immunogen of the invention in a non-targeting carrier to administer
to an animal to treat an autoimmune disease is from about 12.5
.mu.g to about 20 mg of total recombinant molecules per kilogram
(kg) of body weight, more preferably from about 25 .mu.g to about
10 mg of total recombinant molecules per kg of body weight, and
even more preferably from about 125 .mu.g to about 2 mg of total
recombinant molecules per kg of body weight.
[0246] The number of doses of a recombinant molecule encoding an
immunogen of the invention in a non-targeting carrier to be
administered to an animal to treat an autoimmune disease is an
injection about once every 6 months, more preferably about once
every 3 months, and even more preferably about once a month.
[0247] A preferred method to administer a DNA vaccine composition
of the present invention to treat an autoimmune disease is by local
administration, preferably direct injection. Direct injection
techniques are particularly important in the treatment of an
autoimmune disease. Preferably, a DNA vaccine composition is
injected directly into muscle cells in a patient, which results in
prolonged expression (e.g., weeks to months) of a recombinant
molecule of the present invention. Preferably, a recombinant
molecule of the present invention in the form of "naked DNA" is
administered by direct injection into muscle cells in a
patient.
[0248] In another aspect, the invention is directed to the use of a
recombinant construct comprising an isolated nucleic acid sequence
encoding at least one immunogen selected from the group consisting
of: [0249] (i) the constant domain of a chain of a T Cell Receptor
(TCR), [0250] (ii) a peptide comprising an immunogenic fragment of
the constant domain of a chain of a TCR; and [0251] (iv) analogs,
derivatives and salts thereof; for the preparation of a DNA
vaccine. In various embodiments, the DNA vaccine is useful for
treating a T cell mediated inflammatory disease, for preventing the
development of a T cell mediated inflammatory disease, and/or for
enhancing anti-ergotypic T cells activity in a subject in need
thereof.
T Cell Vaccines and Related Methods
[0252] Alternatively, T-cell vaccination could be used in
accordance with the present invention. For that purpose, the
present invention provides a method for preventing or treating a
T-cell mediated inflammatory disease comprising the steps of (a)
obtaining cells from an individual; (b) exposing the cells in vitro
to the constant domain of a chain of a T Cell Receptor or an active
fragment thereof; and (c) reintroducing the exposed cells to the
individual. Not wishing to be bound by theory, in many embodiments
this increases the anti-ergotypic T cell response in said
individual, thereby treating or preventing the disease.
[0253] In another aspect, the invention provides a pharmaceutical
composition comprising attenuated activated T cells exposed ex vivo
to at least one immunogen selected from a group consisting of:
[0254] (i) the constant domain of a chain of a T Cell Receptor
(TCR), [0255] (ii) a peptide comprising an immunogenic fragment of
the constant domain of a chain of a TCR; and [0256] (iii) analogs,
derivatives and salts thereof.
[0257] According to this aspect, such T cell vaccines (TCV)
preferably include cell vaccines in which allogeneic (i.e., cells
derived from a source other than a patient, but that are
histocompatible with the patient) or autologous (i.e., cells
isolated from a patient) cells are activated in vitro to induce
MHC-II expression, exposed to a TCR constant domain or an immunogen
derived therefrom contained in a therapeutic composition,
attenuated and administered to a patient by, for example,
intradermal, intravenous or subcutaneous injection. In one
embodiment, the patient is human.
[0258] Suitable antigen-nonspecific agents capable of activating T
cells are known in the art and include, but are not limited to,
mitogens such as concanavalin A, phytohemagglutinin, and pokeweed
mitogen. Additional activating agents are antibodies to T
cell-surface structures, including but not limited to, antibodies
to the CD3 cell-surface molecule, antibodies to the CD2
cell-surface molecule, antibodies to the CD28 cell-surface
molecule, and the natural ligands of CD2 or CD28. Other activating
agents include phorbol esters, such as phorbol myristate acetate,
or a combination of a phorbol ester and a calcium ionophore, such
as ionomycin. Also intended as T cell activating agents are
antibodies to the T cell receptor chains. Upon activation by such
agents, T cells up regulate various surface markers, including, but
not limited to MHC-II, and may express TCR constant domain epitopes
in the context of MHC-II, as disclosed herein.
[0259] The T lymphocyte activation step of the present invention
may or may not include the addition of T cell growth factors or
stimulatory factors, such as, for example, IL-1, IL-2 or IL-4, to
the culture medium for part or all of the activation interval.
[0260] Treatment to attenuate the T lymphocytes, may include, but
is not limited to, gamma- or X-irradiation, or treatment with
mitomycin C, by methods well known in the art, may also be used
according to the invention (Ben-Nun, et al., 1987, Holoshitz et
al., 1983). In one particular embodiment, the cells are attenuated
by exposure to gamma irradiation (2000-10000 rads).
[0261] In another aspect, the invention provides methods of
treating or preventing a T cell mediated pathology in a subject in
need thereof, comprising: (a) isolating T cells from the subject or
from a donor histocompatible with said subject; (b) activating the
T cells ex vivo to induce Major Histocompatibility Complex (MHC) II
expression; (c) exposing said activated cells to an immunogen of
the invention; (d) attenuating said T cells; and (e) introducing
said cells into the subject in an amount sufficient to induce an
anti-ergotypic response in said subject.
[0262] Effective amounts of cells to be introduced into the subject
may be extrapolated from animal model test bioassays or systems.
Suitable amounts of attenuated TCR constant domain-derived
peptide-loaded T cells are preferably between 10.sup.6-10.sup.8
cells per administration.
[0263] In other embodiments, other suitable attenuated antigen
presenting cells (APC) may be exposed to a peptide of the invention
and administered to the subject. Such APC are capable of presenting
a peptide of the invention in the form of antigen-MHC class II
complex, in a manner recognizable by specific effector cells of the
immune system and thereby inducing an effective cellular immune
response against the antigen being presented. Suitable cell
populations may be e.g. peripheral blood mononuclear cells and APC
purified therefrom such as macrophages, B-cells and dendritic
cells
[0264] In other aspects, the invention provides T cell vaccine
compositions and methods thereof using adoptive transfer of
anti-ergotypic cells specific for a TCR constant domain-derived
peptide.
[0265] The generation of antigen-specific cell lines is within the
abilities of those of skill in the art, and is currently being
applied for the development of therapeutic TCV (see, for example,
Achiron et al., 2004). For the generation of anti-ergotypic cells
specific for an immunogen of the invention suitable for adoptive
transfer TCV, a first population of T cells is activated by
incubation in the presence of a second population of a TCR constant
domain-derived peptide-loaded attenuated activated T cells, or
other professional APC, as described above. Such attenuated T cells
or APC may be incubated with a TCR constant domain-derived peptide
prior to incubation with the first T cell population, or
alternatively be incubated with the first T cell population in the
presence of the TCR constant domain-derived peptide. Anti-ergotypic
T cells specific for the TCR constant domain-derived peptide
present in the first population recognize TCR constant domain
epitopes presented on MHC-II molecules of the second population. It
is to be understood, therefore, that both cell populations used are
histiotype compatible (histocompatible) with each other as well as
with the subject in need of said treatment. Advantageously, this
activation step is repeated at least once (and is typically
performed 2-3 times), in order to enrich the resulting T cell
population for the desired peptide-specific anti-ergotypic T cells.
The method may optionally further comprise one or more steps of
expanding the resulting peptide-specific anti-ergotypic-enriched T
cell population, e.g. by culturing in the presence of IL-2. The
resulting T cell population is then administered to said subject in
an amount sufficient to induce an anti-ergotypic response in said
subject. Suitable amounts of anti-ergotypic-enriched T cells
specific for the TCR constant domain-derived peptide are preferably
between 10.sup.7-3.times.10.sup.7 cells per administration.
Diagnostic Compositions and Methods
[0266] In other embodiments, the novel peptides of the invention
are useful for diagnosing conditions associated with an immune
response to these peptides. Thus, the invention provides diagnostic
methods effected by determining the capacity of immunoglobulins of
a subject to specifically bind an antigen probe comprising a
peptide of the invention, where such capacity is indicative of the
condition, and compositions and kits useful in these methods.
[0267] In one embodiment, there is provided a method of diagnosing
a condition associated with an immune response in a subject in need
thereof, the method comprising: [0268] d) obtaining an
antibody-containing biological sample from a subject; [0269] e)
contacting the sample, under conditions such that an
antigen-antibody complex may be formed, with an antigen probe
comprising a peptide having an amino acid sequence as set forth in
any one of SEQ ID NOS:1-146 and 157-167, and analogs, derivatives
and salts thereof; [0270] f) determining the capacity of at least
one antibody obtained from the subject to specifically bind the
antigen probe; [0271] wherein the capacity is indicative of the
condition.
[0272] In another embodiment, detection of the capacity of an
antibody to specifically bind an antigen probe may be performed by
quantifying specific antigen-antibody complex formation. The term
"specifically bind" as used herein means that the binding of an
antibody to an antigen probe is not competitively inhibited by the
presence of non-related molecules.
[0273] In certain embodiments, said condition is associated with an
increased T cell-mediated response. In certain particular
embodiments, said condition is associated with an increased T cell
activity. In various embodiments, the increased T cell-mediated
immune response may be a detrimental immune response, or, in
alternate embodiments, a protective immune response. In another
embodiment, said condition is a T cell mediated inflammatory
disease. In another particular embodiment, said condition is
associated with an increased anti-ergotypic T cell activity.
[0274] Preferably the method of the present invention is performed
by determining the capacity of a peptide of the invention to
specifically bind antibodies of the IgG isotype isolated from a
subject.
[0275] Methods for obtaining suitable antibody-containing
biological samples from a subject are well within the ability of
those of skill in the art. Typically, suitable samples comprise
whole blood and products derived therefrom, such as plasma and
serum. In other embodiments, other antibody-containing samples may
be used, e.g. urine and saliva samples. A non-limitative example
for obtaining human serum samples is presented in Example 12
below.
[0276] In certain embodiments, the peptides and peptide
compositions prepared in accordance with the present invention can
be used to diagnose a T cell mediated pathology by using them as
the test reagent in an enzyme-linked immunoadsorbent assay (ELISA),
an enzyme immunodot assay, a passive hemagglutination assay (e.g.,
PHA test), an antibody-peptide-antibody sandwich assay, a
peptide-antibody-peptide sandwich assay, or other well-known
immunoassays. In accordance with the present invention, any
suitable immunoassay can be used with the subject peptides. Such
techniques are well known to the ordinarily skilled artisan and
have been described in many standard immunology manuals and texts.
In one particular embodiment, the immunoassay is an ELISA using a
solid phase coated with the peptide compositions of the present
invention. For example, such a kit may contain a solid-phase
immobilized peptide of the invention and a tagged antibody capable
of recognizing the non-variable region of the antibody to be
detected, such as tagged anti-human Fab. The kit may also contain
directions for using the kit and containers to hold the materials
of the kit. Any conventional tag or label may be used, such as a
radioisotope, an enzyme, a chromophore or a fluorophore. A typical
radioisotope is iodine-125 or sulfur-35. Typical enzymes for this
purpose include horseradish peroxidase, horseradish galactosidase
and alkaline phosphatase.
[0277] In certain embodiments, the antigen probe comprises a
plurality of antigen probes comprising at least one peptide of the
invention.
[0278] In certain preferable embodiments, determining the capacity
of the antibodies to specifically bind the antigen probes is
performed using an antigen probe array-based method. Preferably,
the array is incubated with suitably diluted serum of the subject
so as to allow specific binding between antibodies contained in the
serum and the immobilized antigen probes, washing out unbound serum
from the array, incubating the washed array with a detectable
label-conjugated ligand of antibodies of the desired isotype,
washing out unbound label from the array, and measuring levels of
the label bound to each antigen probe. Ample guidance for
practicing array-based methods of determining the capacity of
antibodies of a subject to specifically bind to antigens such as
the antigen probes of the present invention is provided in the
Examples section which follows and in the literature of the art. A
non-limitative example of using an antigen array-based method in
the diagnosis of lung cancer is provided in Example 12
hereinbelow.
[0279] Various methods have been developed for preparing arrays
suitable for the methods of the present invention. State-of-the-art
methods involves using a robotic apparatus to apply or "spot"
distinct solutions containing antigen probes to closely spaced
specific addressable locations on the surface of a planar support,
typically a glass support, such as a microscope slide, which is
subsequently processed by suitable thermal and/or chemical
treatment to attach antigen probes to the surface of the support.
Suitable supports may also include silicon, nitrocellulose, paper,
cellulosic supports and the like.
[0280] Preferably, each antigen probe, or distinct subset of
antigen probes of the present invention, which is attached to a
specific addressable location of the array is attached
independently to at least two, more preferably to at least three
separate specific addressable locations of the array in order to
enable generation of statistically robust data.
[0281] In addition to antigen probes of the invention, the array
may advantageously include control antigen probes. Such control
antigen probes may include normalization control probes. The
signals obtained from the normalization control probes provide a
control for variations in binding conditions, label intensity,
"reading" efficiency and other factors that may cause the signal of
a given binding antibody-probe ligand interaction to vary. For
example, signals, such as fluorescence intensity, read from all
other antigen probes of the antigen probe array are divided by the
signal (e.g., fluorescence intensity) from the normalization
control probes thereby normalizing the measurements. Normalization
control probes can be bound to various addressable locations the
antigen probe array to control for spatial variation in
antibody-ligand probe efficiency. Preferably, normalization control
probes are located at the corners or edges of the array to control
for edge effects, as well as in the middle of the array.
[0282] The labeled antibody ligands may be of any of various
suitable types of antibody ligand. Preferably, the antibody ligand
is an antibody which is capable of specifically binding the Fc
portion of the antibodies of the subject used. For example, where
the antibodies of the subject are of the IgG isotype, the antibody
ligand is preferably an antibody capable of specifically binding to
the Fc region of IgG antibodies of the subject.
[0283] The ligand of the antibodies of the subject may be
conjugated to any of various types of detectable labels. Preferably
the label is a fluorophore, most preferably Cy3. Alternately, the
fluorophore may be any of various fluorophores, including Cy5,
fluorescein isothiocyanate (FITC), phycoerythrin (PE), rhodamine,
Texas red, and the like. Suitable fluorophore-conjugated antibodies
specific for antibodies of a specific isotype are widely available
from commercial suppliers and methods of their production are well
established.
[0284] Antibodies of the subject may be isolated for analysis of
their antigen probe binding capacity in any of various ways,
depending on the application and purpose. While the subject's
antibodies may be suitably and conveniently in the form of serum or
a dilution thereof, the antibodies may be subjected to any desired
degree of purification prior to being tested for their capacity to
specifically bind antigen probes. The method of the present
invention may be practiced using whole antibodies of the subject,
or antibody fragments of the subject which comprises an antibody
variable region.
[0285] Having now generally described the invention, the same will
be more readily understood through reference to the following
examples, which are provided by way of illustration and are not
intended to be limiting of the present invention.
EXAMPLES
[0286] As used herein, the terms "p.beta.C1" and "p.beta.C2" refer
to coding sequences of the C1 and the C2 variant molecules of the
.beta. chain of the constant domain of the T-cell receptor (TCR-C).
As used herein, the terms "recombinant .beta.C1" or "r.beta.C1" and
"recombinant .beta.C2" or "r.beta.C2" refer to recombinant C1 and
the C2 variant molecules of the 13 chain of the constant domain of
the T-cell receptor (TCR-C). .beta.C1/2 peptides are peptides
derived from the C1 or the C2 variant molecules of the .beta. chain
of the constant domain of the T-cell receptor (TCR).
[0287] Animals
[0288] Female Lewis rats were raised and maintained under
pathogen-free conditions in the Animal Breeding Center of The
Weizmann Institute of Science. One- to two-month old rats were used
for vaccination experiments. The experiments were performed under
the supervision and guidelines of the Animal Welfare Committee.
[0289] Antigens and Adjuvants
[0290] Peptides were synthesized as previously described (Quintana
et al 2002). The HSP65 Mt176-190 peptide used was EESNTFGLQLELTEG
(SEQ ID NO:155).
[0291] C1 and C2 peptides: see Table 1.
[0292] Purified recombinant HSP65 was generously provided by Prof.
Ruurd van der Zee (Institute of Infectious Diseases and Immunology,
Faculty of Veterinary Medicine, Utrecht, The Netherlands).
[0293] The .beta. chain of the C1 and C2 rat molecules were
sub-cloned from pcDNA3 into the BamHI/HindIII sites of the pQE-80L
plasmid (Qiagen) for bacterial expression using standard molecular
biology techniques. The C1 and C2 recombinant proteins (r.beta.C1
and r.beta.C2) were expressed and purified following the
manufacturer's instructions.
[0294] M. tuberculosis Strain H37Ra and incomplete Freund's
adjuvant (IFA) were purchased from Difco (Detroit, Mich., USA).
Tuberculin purified protein derivative (PPD) was provided by the
Statens Seruminstitut (Copenhagen, Denmark). Ovalbumin (OVA) and
Concanavalin A (Con A) were purchased from Sigma (Rehovot,
Israel).
[0295] DNA Plasmids and Vaccination
[0296] The p.beta.C1 and p.beta.C2 vectors were generated in the
following way. The C1 or C2 regions of the .beta. chain of the tcr
gene were amplified by PCR from cDNA prepared form lymph node cells
of Lewis rats using specific oligonucleotides containing
restriction sites for the enzymes BamHI (oligonucleotide 5') or
HindIII (oligonucleotide 3'). The amplicons were then cloned into
the pcDNA3 or pQE vectors (Invitrogen, NV, Leek, The Netherlands)
using standard molecular biology techniques. The plasmids were
sequenced to confirm correct insertion of the cDNA and transcribed
in vitro to check that they were functional.
[0297] Plasmid DNA was prepared in large scale and injected after
pretreatment with cardiotoxin (Sigma, Rehovot, Israel) as
previously described (Quintana et al., 2002). Briefly, rats were
vaccinated in the quadriceps three times (on days -40, -26 -12
relative to AA induction) with 150 .mu.g of pcDNA3, p.beta.C1 or
p.beta.C2. Endotoxin levels were checked by Limulus Amoebocyte
Lysate and found always to be under acceptable levels for in vivo
use (less than 0.02 EU/.mu.g DNA). AA was induced 12 days after the
last injection of DNA. The empty vector pcDNA3 was used as a DNA
vaccination control.
[0298] AA Induction and Assessment
[0299] AA was induced as described (Quintana et al 2002), using 1
mg per rat of heat-killed Mt strain H37Ra (Difco). Each
experimental and control group contained at least 8 rats. The day
of AA induction was designated as day 0, and disease severity was
assessed by direct observation of all 4 limbs in each animal. A
relative score between 0 and 4 was assigned to each limb, based on
the degree of joint inflammation, redness and deformity; thus the
maximum possible score for an individual animal was 16 (Quintana et
al 2002). The mean AA score (.+-.SEM) is shown for each
experimental group. Arthritis was also quantified by measuring hind
limb diameter with a caliper. Measurements were taken on the day of
the induction of AA and 26 days later (at the peak of AA); the
results are presented as the mean.+-.SEM of the difference between
the two values for all the animals in each group. The person who
scored the disease was blinded to the identity of the groups.
Experiments were repeated at least 3 times and produced similar
results.
[0300] T-Cell Proliferation
[0301] Unless otherwise stated, T-cell proliferation assays were
performed at day 26 after the induction of AA, when the disease is
at its peak, as previously described (Quintana et al 2002).
Briefly, popliteal and inguinal lymph node cells (LNC), were
cultured in quadruplicates in 200 .mu.l round bottom microtiter
wells (Costar Corp., Cambridge, USA) at 2.times.10.sup.5 cells per
well with or without antigen. The T-cell mitogen Concanavalin A
(Con A) was used as a positive control for T-cell proliferation.
Cultures were incubated for 96 hrs at 37.degree. C. in a humidified
atmosphere of 5% CO.sub.2. T-cell responses were detected by the
incorporation of [methyl-.sup.3H]-thymidine (Amersham,
Buckinghamshire, UK; 1 .mu.Ci/well), which was added to the wells
for the last 18 hours. The stimulation index (SI) was computed as
the ratio of the mean c.p.m. of antigen- or mitogen-containing
wells to control wells cultured with medium alone. The results of
T-cell proliferation experiments are shown as SI.+-.SEM, T-cell
responses with SI<2 were considered not significant.
[0302] For ergotypic stimulation, the Lewis rat 2 clones were
used--the Lewis rat A2 T cell clone, specific for the peptide
Mt176-190 and the p277 clone, specific for the peptide HSP60
residues 436-460.
[0303] Vaccination with Peptides or Recombinant Proteins
Female Lewis rats were immunized ip with a single dose of 100 .mu.g
of peptide or recombinant protein emulsified in IFA.
[0304] Adoptive Transfer of Cells
[0305] Spleen cells were prepared from peptide-vaccinated rats,
either 7 days after peptide vaccination, or 26 days after AA was
induced following peptide vaccination. The splenocytes (10.sup.7
cells per ml) were activated with 2.5 .mu.g/ml of Con A for 48 hr
at 37.degree. C. in a humidified atmosphere of 5% CO.sub.2. The
cells were washed with sterile PBS and injected iv into naive rats
(5.times.10.sup.7 cells per rat). Three days after the transfer of
the splenocytes, AA was induced.
Example 1
DNA Vaccination with C1 or C2 Protects from Adjuvant Arthritis
[0306] The inventors and coworkers previously demonstrated that DNA
vaccination with the .alpha. chain of the IL-2 receptor (CD25)
inhibited the development of AA (Mimran et al. 2004). We have now
cloned the C1 and the C2 variant molecules of the .beta. chain of
the constant domain of the rat T-cell receptor (TCR) in the pCDNA3
vector, suitable for DNA vaccination studies. In this way, we
generated p.beta.C1 and p.beta.C2 vaccination constructs. Lewis
rats were vaccinated with p.beta.C1, p.beta.C2 or with pcDNA3 as a
control, and AA was induced. FIG. 1A shows vaccination with
p.beta.C1 or p.beta.C2 significantly (p<0.001) inhibited
arthritis compared to the rats that had been vaccinated with the
pcDNA3 control. The protective effect of vaccination with p.beta.C1
or p.beta.C2 was also reflected in a significant reduction in ankle
swelling (FIG. 1B).
Example 2
Immune Responses of Rats Protected from AA by p.beta.C1 or
p.beta.C2 Vaccination
[0307] To study the immune responses associated with the inhibition
of AA by DNA vaccination with p.beta.C1 or p.beta.C2, we analyzed
the T-cell responses of immunized rats 26 days after the induction
of AA. We stimulated draining lymph node cells (LNC) in vitro with
a collective of Mycobacterial antigens known to be associated with
AA: HSP65, PPD and Mt176-190. The Mt176-190 peptide contains the
180-188 epitope of HSP65 described by van Eden et al which is
recognized by HSP65-specific T-cell clones that can transfer AA
(van Eden et al 1985). We also studied the immune response directed
to recombinant .beta.C1 and recombinant .beta.C2, or to .beta.C1/2
peptides predicted to bind the MHC class II molecule of the Lewis
rat (see Table 1). Glutathione-S-transferase (GST) was included as
a control antigen. None of the experimental groups showed
significant responses to GST, and they did not differ in their
responses to concanavalin A (Con A) (FIG. 2B). Nevertheless,
inhibition of AA by DNA vaccination with the p.beta.C1 or p.beta.C2
constructs was associated with the up-regulation of the T-cell
proliferative responses to the panel of Mycobacterial antigens
(PPD, HSP65 and Mt176-190; FIG. 2A-B). This enhancement of T-cell
proliferation was also found to accompany other immune treatments
that inhibited arthritis (Mimran et al 2004; Quintana et al 2002;
Quintana et al 2003 Hogervorst et al 1991) In addition, FIG. 2C
shows that p.beta.C1 vaccination induced significant responses
directed to the peptide of SEQ ID NO. 149 (MED12).
TABLE-US-00001 TABLE 1 rat Cl and C2 sequences A. Constant domains
of rat TCR beta chain variants C1 T-cell receptor beta chain (gi:
1332388; SEQ ID NO: 153) 1 ##STR00001## 61 ##STR00002## 121
##STR00003## C2 T-cell receptor beta chain (gi: 1332389; SEQ ID NO:
154) 1 dlktvtppkv slfepseaei tdkqkatlvc largffpdhv elswwvngke
irngvstdpq 61 aykesnnity clssrlrvsa pfwhnprnhf rcqvqfyglt
eednwsedsp kpvtqnisae 121 ##STR00004## B. N12, MED12 and C2C
peptides that were identified as MHC class II binders, based on the
binding motifs described by Reizis et al. N12 (Cl) 5
vtppkvslfepseaeia 21 C1 vtppkvslfepseaeia SEQ ID NO: 147 C2
vtppkvslfepseaeit SEQ ID NO: 148 MED12 (Cl) 108 dspkpvtqnisaeawgr
124 C1 dspkpvtqnisaeawgw SEQ ID NO: 149 C2 dspkpvtqnisaeawgr SEQ ID
NO: 150 C2C(C2) 157 vlvs alvlmamvkk kns 173 C1 vlvstlvvmtmvkrkss
SEQ ID NO: 151 C2 vlvsalvlmamvkkkns SEQ ID NO: 152
Example 3
DNA Vaccination with p.beta.C1 or p.beta.C2 Activates
Anti-Ergotypic Responses
[0308] To demonstrate that vaccination with p.beta.C1 or p.beta.C2
induced anti-ergotypic T cells, we studied the proliferative
response directed to resting or activated T cells following
vaccination. FIG. 3 shows that LNC isolated from p.beta.C1 or
p.beta.C2-vaccinated rats have strong anti-ergotypic responses. In
FIG. 3A, A-A2b denotes activated A2b T cell clones, while R-A2b
denotes resting A2b T cell clones. In FIG. 3B, A-p277 denotes
activated p277 T cell clones, while R-p277 denotes resting p277 T
cell clones. Thus, C1 or C2 ergotope determinants are generated by
the processing of endogenous TCR in activated T cells but not by
resting T cells.
Example 4
Vaccination with Recombinant C1, C2, or C1/2 Peptides Inhibits
AA
[0309] We studied the immune effects of vaccination with
recombinant C1 (r.beta.C1) or C2 (r.beta.C2), or with C1/2-derived
peptides (Table 1). Female Lewis rats were immunized with a single
ip dose of 100 .mu.g of protein or peptide in IFA, and seven days
later AA was induced. FIG. 4 shows that the severity of the disease
was significantly decreased in rats vaccinated with r.beta.C1,
r.beta.C2 (FIG. 4A) or with any of the .beta.C1/2 peptides N12 (SEQ
ID NO:147), MED12 (SEQ ID NO:149) or C2C (SEQ ID NO:152) (FIG. 4B).
Therefore, vaccination with r.beta.C1, r.beta.C2 or .beta.C1/2
peptides can specifically inhibit AA.
Example 5
Immune Responses in Vaccinated Rats
[0310] To study the effect of C1/2 vaccination on the immune
response to C1/2 peptides and to the target antigens of AA, we
vaccinated rats with r.beta.C1 or r.beta.C2, and then induced AA.
At day 26, we removed the draining lymph nodes and measured the
T-cell proliferative responses to peptides N12 (SEQ ID NO:147),
MED12 (SEQ ID NO:149) or C2C (SEQ ID NO:152), or to the
Mycobacterial antigens. FIG. 5A shows that vaccination with whole
r.beta.C1 or r.beta.C2 induced a proliferative response to the
TCR-C peptides; there was no response to the control peptide Mt3.
Thus the C1/2 peptides are immunologically dominant. Moreover,
vaccination using r.beta.C1 or r.beta.C2, like DNA vaccination with
p.beta.C1 or p.beta.C2 (see FIG. 2), also up-regulated the
proliferative responses to Mycobacterial antigens (FIG. 5B), which
is associated with inhibition of the arthritis (Mimran et al 2004;
Quintana et al 2002; Quintana et al 2003; Hogervorst et al
1991).
Example 6
C1/2 Peptides are Immunogenic
[0311] Study of the T-cell responses in rats that had been
vaccinated with the C1/2 peptides N12, MED12 or C2C revealed that
the three peptides were immunogenic; significant T-cell responses
could be detected in the immunized rats to each peptide (FIG. 6B).
In addition, LNC taken from peptide immunized rats showed increased
proliferative responses to PPD. LNC from C2C-vaccinated rats also
showed increased proliferative responses to mt180 and HSP65 (FIG.
6A). None of the experimental groups showed significant responses
to OVA, and they did not differ in their response to Con A.
Example 7
Adoptive Transfer of Vaccination-Induced Regulation
[0312] To learn whether the inhibition of AA triggered by
vaccination with C1 or C2, either as DNA vaccines or recombinant
proteins could be adoptively transferred by activated T-cells, we
vaccinated rats with p.beta.C1, p.beta.C2 (FIG. 7), r.beta.C1 or
r.beta.C2 (FIG. 8), induced AA, and obtained splenocytes for
adaptive transfer 26 days after the induction of AA. The
splenocytes were activated in vitro with Con A and transferred into
naive rats, and the rats were challenged three days later with Mt
and followed for the development of AA. Inhibition of AA by
vaccination with C1 or C2 could be adoptively transferred by
activated T-cells, as reflected in disease severity (FIGS. 7A and
8A) and ankle swelling (FIGS. 7B and 8B).
Example 8
T-Cell Lines to C1/2 Determinants
[0313] To further study the specificity of the C1/2 determinants
involved in the protection triggered by vaccination with C1 or C2,
we raised T cell lines against the N12, MED12 and C2C peptides that
were identified as MHC class II binders, based on the binding
motifs described by Reizis et al.
[0314] Female Lewis rats were immunized with a single ip dose of
100 .mu.g of peptide in IFA, and seven days later AA was induced.
At day 26, LNC were prepared and specific T cell lines were
generated by repeated stimulation with peptides N12, MED12 or C2C,
as described by Mor et al. FIG. 9 shows that, following 3 cycles of
stimulation, we obtained peptide-specific lines: N12-specific (FIG.
9A), MED12-specific (FIG. 9B) and C2C-specific (FIG. 9C). Each line
reacted with the peptide against which it was raised and showed no
cross-reactivity with the other C1/2-derived peptides. In addition,
only the line raised against MED12 could be activated by APC fed
with r.beta.C1 or r.beta.C2, suggesting that the epitope contained
in MED12 can be generated after processing of the full-length
molecule.
Example 9
T-Cell Lines to C1/2 Determinants Inhibit AA
[0315] To learn whether T-cell lines reactive with C1/2
determinants could transfer the inhibition of AA, we transferred ip
the activated cells (15 10.sup.5 cells/rat) at days -3, 4 and 11
relative to the induction of AA. As a control, we used a T-cell
line raised against guinea pig myelin basic protein (BP10). FIG. 10
shows that the recipients of the T-cell lines specific for C1/2
determinants (N12, MED12 or C2C) manifested a significantly milder
disease than recipients of the control line BP10, as reflected in
disease severity (FIG. 10A) and ankle swelling (FIG. 10B).
Example 10
T-Cell Lines to C1/2 Determinants Proliferate to Activated T
Cells
[0316] We studied the proliferative responses of the T-cell lines
to C1/2 determinants triggered by co-incubation with activated or
resting T cell lines. FIG. 11A shows that the N12, MED12 and C2C
lines proliferate upon incubation with activated A2b T cells.
Experiments done in the presence of blocking antibodies indicated
that the proliferative response to activated T cells was mediated
by MHC class II, CD28 and CD86 interactions (FIG. 11B). Thus,
T-cell lines to C1/2 determinants are anti-ergotypic.
[0317] In addition, we followed the proliferative response directed
to activated LNC isolated from arthritic or naive rats. The T-cell
lines to C1/2 determinants proliferated upon activation with LNC
that were previously activated with Con A (2.5 .mu.g/ml) (FIG. 12).
This proliferation could be inhibited with specific antibodies
directed against CD28 and OX6.
Example 11
Location of HLA-DR Binding Regions in the Constant Domain of the T
Cell Receptor Using ProPred Algorithm for Identifying HLA-DR
Binding Sites
[0318] A search was performed for HLA-DR binding regions in the
constant domain of the T Cell Receptor using the ProPred Algorithm
of Singh, H. and Raghava (2001). More specifically, the following
specific chains were searched: alpha (Accession No. gi:1335335),
beta-1 (Accession No. gi:338831), beta-2 (Accession No. gi:88760),
delta (Accession No. gi:107835), gamma (Accession Nos: A26659,
AAB63314, AAB63312, and AAB63313). The following MHC-II alleles
were considered in the analysis: DRB1.sub.--0101, DRB1.sub.--0102,
DRB1.sub.--0301, DRB1.sub.--0305, DRB1.sub.--0306, DRB1.sub.--0307,
DRB1.sub.--0308, DRB1.sub.--0309, DRB1.sub.--0311, DRB1.sub.--0401,
DRB1.sub.--0402, DRB1.sub.--0404, DRB1.sub.--0405, DRB1.sub.--0408,
DRB1.sub.--0410, DRB1.sub.--0421, DRB1.sub.--0423, DRB1.sub.--0426,
DRB1.sub.--0701, DRB1.sub.--0703, DRB1.sub.--0801, DRB1.sub.--0802,
DRB1.sub.--0804, DRB1.sub.--0806, DRB1.sub.--0813, DRB1.sub.--0817,
DRB1.sub.--1101, DRB1.sub.--1102, DRB1.sub.--1104, DRB1.sub.--1106,
DRB1.sub.--1107, DRB1.sub.--1114, DRB1.sub.--1120, DRB1.sub.--1121,
DRB1.sub.--1128, DRB1.sub.--1301, DRB1.sub.--1302, DRB1.sub.--1304,
DRB1.sub.--1305, DRB1.sub.--1307, DRB1.sub.--1311, DRB1.sub.--1321,
DRB1.sub.--1322, DRB1.sub.--1323, DRB1.sub.--1327, DRB1.sub.--1328,
DRB1.sub.--1501, DRB1.sub.--1502, DRB1.sub.--1506, DRB5.sub.--0101,
and DRB5.sub.--0105. The results are presented in Tables 2-9,
presenting predicted MHC-II binding peptides. It is noted that all
of the peptides presented in Tables 2-9 are arbitrarily exactly
nine amino acids long. It is explicitly to be understood that the
peptides used in accordance with the present invention may include
either extensions or truncations as long as they preserve the
intended function of suppressing autoimmune inflammatory
disease.
TABLE-US-00002 TABLE 2 MHC-II Binding Peptides for the Alpha Chain
SEQ ID NO: Amino Acid Sequence 1
Phe-Lys-Ser-Asn-Ser-Ala-Val-Ala-Trp 2
Val-Ala-Trp-Ser-Asn-Lys-Ser-Asp-Phe 3
Tyr-Ile-Thr-Asp-Lys-Thr-Val-Leu-Asp 4
Tyr-Gln-Leu-Arg-Asp-Ser-Lys-Ser-Ser 5
Phe-Asp-Ser-Gln-Thr-Asn-Val-Ser-Gln 6
Val-Tyr-Gln-Leu-Arg-Asp-Ser-Lys-Ser 7
Val-Leu-Asp-Met-Arg-Ser-Met-Asp-Phe 8
Val-Tyr-Ile-Thr-Asp-Lys-Thr-Val-Leu 9
Ile-Thr-Asp-Lys-Thr-Val-Leu-Asp-Met 10
Val-Cys-Leu-Phe-Thr-Asp-Phe-Asp-Ser 11
Met-Arg-Ser-Met-Asp-Phe-Lys-Ser-Asn 12
Phe-Gln-Asn-Leu-Ser-Val-Ile-Gly-Phe 13
Phe-Arg-Ile-Leu-Leu-Leu-Lys-Val-Ala 14
Ile-Leu-Leu-Leu-Lys-Val-Ala-Gly-Phe 15
Leu-Leu-Lys-Val-Ala-Gly-Phe-Asn-Leu 16
Phe-Asn-Leu-Leu-Met-Thr-Leu-Arg-Leu 17
Val-Lys-Leu-Val-Glu-Lys-Ser-Phe-Glu 18
Leu-Leu-Met-Thr-Leu-Arg-Leu-Trp-Ser 19
Phe-Asn-Asn-Ser-Ile-Ile-Pro-Glu-Asp 20
Phe-Glu-Thr-Asp-Thr-Asn-Leu-Asn-Phe 21
Ile-Ile-Pro-Glu-Asp-Thr-Phe-Phe-Pro 22
Ile-Gly-Phe-Arg-Ile-Leu-Leu-Leu-Lys 23
Val-Ile-Gly-Phe-Arg-Ile-Leu-Leu-Leu 24
Leu-Lys-Val-Ala-Gly-Phe-Asn-Leu-Leu 25
Leu-Leu-Leu-Lys-Val-Ala-Gly-Phe-Asn 26
Leu-Met-Thr-Leu-Arg-Leu-Trp-Ser-Ser 27
Val-Ala-Gly-Phe-Asn-Leu-Leu-Met-Thr
TABLE-US-00003 TABLE 3 MHC-II Binding Peptides for the Beta Chain
Variant Molecule 1 SEQ ID NO: Amino Acid Sequence 28
Leu-Asn-Lys-Val-Phe-Pro-Pro-Glu-Va 29
Leu-Val-Cys-Leu-Ala-Thr-Gly-Phe-Phe 30
Phe-Phe-Pro-Asp-His-Val-Glu-Leu-Ser 31
Trp-Trp-Val-Asn-Gly-Lys-Glu-Val-His 32
Trp-Val-Asn-Gly-Lys-Glu-Val-His-Ser 33
Phe-Glu-Pro-Ser-Glu-Ala-Glu-Ile-Ser 34
Val-Ala-Val-Phe-Glu-Pro-Ser-Glu-Ala 35
Val-Asn-Gly-Lys-Glu-Val-His-Ser-Gly 36
Val-Ser-Thr-Asp-Pro-Gln-Pro-Leu-Lys 37
Ile-Val-Ser-Ala-Glu-Ala-Trp-Gly-Arg 38
Leu-Arg-Val-Ser-Ala-Thr-Phe-Trp-Gln 39
Tyr-Cys-Leu-Ser-Ser-Arg-Leu-Arg-Val 40
Phe-Arg-Cys-Gln-Val-Gln-Phe-Tyr-Gly 41
Tyr-Gly-Leu-Ser-Glu-Asn-Asp-Glu-Trp 42
Val-Thr-Gln-Ile-Val-Ser-Ala-Glu-Ala 43
Val-Gln-Phe-Tyr-Gly-Leu-Ser-Glu-Asn 44
Leu-Ser-Ser-Arg-Leu-Arg-Val-Ser-Ala 45
Trp-Gln-Asn-Pro-Arg-Asn-His-Phe-Arg 46
Tyr-Glu-Ile-Leu-Leu-Gly-Lys-Ala-Thr 47
Tyr-Ala-Val-Leu-Val-Ser-Ala-Leu-Val 48
Leu-Val-Ser-Ala-Leu-Val-Leu-Met-Ala 49
Leu-Val-Leu-Met-Ala-Met-Val-Lys-Arg 50
Val-Ser-Tyr-Gln-Gln-Gly-Val-Leu-Ser 51
Val-Leu-Val-Ser-Ala-Leu-Val-Leu-Met 52
Val-Leu-Met-Ala-Met-Val-Lys-Arg-Lys 53
Ile-Leu-Tyr-Glu-Ile-Leu-Leu-Gly-Lys 54
Leu-Leu-Gly-Lys-Ala-Thr-Leu-Tyr-Ala 55
Leu-Tyr-Ala-Val-Leu-Val-Ser-Ala-Leu 56
Val-Leu-Ser-Ala-Thr-Ile-Leu-Tyr-Glu 57
Leu-Ser-Ala-Thr-Ile-Leu-Tyr-Glu-Ile 58
Leu-Met-Ala-Met-Val-Lys-Arg-Lys-Asp 59
Val-Ser-Ala-Leu-Val-Leu-Met-Ala-Met 60
Met-Ala-Met-Val-Lys-Arg-Lys-Asp-Phe
TABLE-US-00004 TABLE 4 MHC-II Binding Peptides for the Beta Chain
Variant Molecule 2 SEQ ID NO: Amino Acid Sequence 31
Trp-Trp-Val-Asn-Gly-Lys-Glu-Val-His 32
Trp-Val-Asn-Gly-Lys-Glu-Val-His-Ser 33
Phe-Glu-Pro-Ser-Glu-Ala-Glu-Ile-Ser 34
Val-Ala-Val-Phe-Glu-Pro-Ser-Glu-Ala 35
Val-Asn-Gly-Lys-Glu-Val-His-Ser-Gly 36
Val-Ser-Thr-Asp-Pro-Gln-Pro-Leu-Lys 37
Ile-Val-Ser-Ala-Glu-Ala-Trp-Gly-Arg 38
Leu-Arg-Val-Ser-Ala-Thr-Phe-Trp-Gln 39
Tyr-Cys-Leu-Ser-Ser-Arg-Leu-Arg-Val 40
Phe-Arg-Cys-Gln-Val-Gln-Phe-Tyr-Gly 41
Tyr-Gly-Leu-Ser-Glu-Asn-Asp-Glu-Trp 42
Val-Thr-Gln-Ile-Val-Ser-Ala-Glu-Ala 43
Val-Gln-Phe-Tyr-Gly-Leu-Ser-Glu-Asn 44
Leu-Ser-Ser-Arg-Leu-Arg-Val-Ser-Ala 45
Trp-Gln-Asn-Pro-Arg-Asn-His-Phe-Arg 46
Tyr-Glu-Ile-Leu-Leu-Gly-Lys-Ala-Thr 47
Tyr-Ala-Val-Leu-Val-Ser-Ala-Leu-Val 48
Leu-Val-Ser-Ala-Leu-Val-Leu-Met-Ala 49
Leu-Val-Leu-Met-Ala-Met-Val-Lys-Arg 51
Val-Leu-Val-Ser-Ala-Leu-Val-Leu-Met 52
Val-Leu-Met-Ala-Met-Val-Lys-Arg-Lys 53
Ile-Leu-Tyr-Glu-Ile-Leu-Leu-Gly-Lys 54
Leu-Leu-Gly-Lys-Ala-Thr-Leu-Tyr-Ala 55
Leu-Tyr-Ala-Val-Leu-Val-Ser-Ala-Leu 56
Val-Leu-Ser-Ala-Thr-Ile-Leu-Tyr-Glu 57
Leu-Ser-Ala-Thr-Ile-Leu-Tyr-Glu-Ile 58
Leu-Met-Ala-Met-Val-Lys-Arg-Lys-Asp 59
Val-Ser-Ala-Leu-Val-Leu-Met-Ala-Met 61
Leu-Lys-Asn-Val-Phe-Pro-Pro-Glu-Val 62
Leu-Val-Cys-Leu-Ala-Thr-Gly-Phe-Tyr 63
Phe-Tyr-Pro-Asp-His-Val-Glu-Leu-Ser 64
Met-Ala-Met-Val-Lys-Arg-Lys-Asp-Ser
TABLE-US-00005 TABLE 5 MHC-II Binding Peptides for the Delta Chain
SEQ ID NO: Amino Acid Sequence 65
Phe-Val-Met-Lys-Asn-Gly-Thr-Asn-Val 66
Ile-Asn-Leu-Val-Ser-Ser-Lys-Lys-Ile 67
Ile-Arg-Ile-Asn-Leu-Val-Ser-Ser-Lys 68
Leu-Val-Ser-Ser-Lys-Lys-Ile-Thr-Glu 69
Ile-Val-Ile-Ser-Pro-Ser-Gly-Lys-Tyr 70
Tyr-Pro-Lys-Asp-Ile-Arg-Ile-Asn-Leu 71
Val-Met-Lys-Asn-Gly-Thr-Asn-Val-Ala 72
Val-Lys-Leu-Gly-Lys-Tyr-Glu-Asp-Ser 73
Met-Lys-Asn-Gly-Thr-Asn-Val-Ala-Cys 74
Val-Phe-Val-Met-Lys-Asn-Gly-Thr-Asn 75
Phe-Tyr-Pro-Lys-Asp-Ile-Arg-Ile-Asn 76
Tyr-Asn-Ala-Val-Lys-Leu-Gly-Lys-Tyr 77
Val-Gln-His-Asp-Asn-Lys-Thr-Val-His 78
Val-Lys-Thr-Asp-Ser-Thr-Asp-His-Val 79
Val-Asn-Met-Met-Ser-Leu-Thr-Val-Leu 80
Met-Met-Ser-Leu-Thr-Val-Leu-Gly-Leu 81
Leu-Arg-Met-Leu-Phe-Ala-Lys-Thr-Val 82
Met-Leu-Phe-Ala-Lys-Thr-Val-Ala-Val 83
Val-Asn-Phe-Leu-Leu-Thr-Ala-Lys-Leu 84
Ile-Val-His-Thr-Glu-Lys-Val-Asn-Met 85
Phe-Leu-Leu-Thr-Ala-Lys-Leu-Phe-Phe 86
Val-His-Thr-Glu-Lys-Val-Asn-Met-Met 87
Phe-Ala-Lys-Thr-Val-Ala-Val-Asn-Phe 88
Leu-Leu-Thr-Ala-Lys-Leu-Phe-Phe-Leu 89
Leu-Phe-Ala-Lys-Thr-Val-Ala-Val-Asn 90
Leu-Gly-Leu-Arg-Met-Leu-Phe-Ala-Lys 91
Val-Leu-Gly-Leu-Arg-Met-Leu-Phe-Ala 92
Val-Ala-Val-Asn-Phe-Leu-Leu-Thr-Ala
TABLE-US-00006 TABLE 6 MHC-II Binding Peptides for the Gamma Chain
Variant Molecule SEQ ID NO: Amino Acid Sequence 93
Phe-Phe-Pro-Asp-Val-Ile-Lys-Ile-His 94
Ile-Lys-Ile-His-Trp-Gln-Glu-Lys-Lys 95
Phe-Leu-Pro-Ser-Ile-Ala-Glu-Thr-Lys 96
Leu-Gln-Lys-Ala-Gly-Thr-Tyr-Leu-Cys 97
Trp-Gln-Glu-Lys-Lys-Ser-Asn-Thr-Ile 98
Val-Ser-Pro-Lys-Pro-Thr-Ile-Phe-Leu 99
Leu-Cys-Leu-Leu-Glu-Lys-Phe-Phe-Pro 100
Ile-His-Trp-Gln-Glu-Lys-Lys-Ser-Asn 101
Val-Ile-Lys-Ile-His-Trp-Gln-Glu-Lys 102
Ile-Lys-Thr-Asp-Val-Ile-Thr-Met-Asp 103
Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn-Cys 104
Ile-Val-Arg-His-Glu-Asn-Asn-Lys-Asn 105
Val-Arg-His-Glu-Asn-Asn-Lys-Asn-Gly 106
Phe-Pro-Pro-Ile-Lys-Thr-Asp-Val-Ile 107
Met-Lys-Thr-Asn-Asp-Thr-Tyr-Met-Lys 108
Tyr-Met-Lys-Phe-Ser-Trp-Leu-Thr-Val 109
Val-Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn 110
Phe-Ser-Trp-Leu-Thr-Val-Pro-Glu-Lys 111
Trp-Leu-Thr-Val-Pro-Glu-Lys-Ser-Leu 112
Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser-Val 113
Leu-Leu-Leu-Leu-Lys-Ser-Val-Val-Tyr 114
Val-Val-Tyr-Phe-Ala-Ile-Ile-Thr-Cys 115
Tyr-Phe-Ala-Ile-Ile-Thr-Cys-Cys-Leu 116
Phe-Ala-Ile-Ile-Thr-Cys-Cys-Leu-Leu 117
Leu-Leu-Leu-Gln-Leu-Thr-Asn-Thr-Ser 118
Leu-Leu-Gln-Leu-Thr-Asn-Thr-Ser-Ala 119
Met-Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser 120
Leu-Leu-Leu-Leu-Leu-Lys-Ser-Val-Val 121
Leu-Leu-Leu-Lys-Ser-Val-Val-Tyr-Phe 122
Tyr-Met-Tyr-Leu-Leu-Leu-Leu-Leu-Lys 123
Leu-Leu-Lys-Ser-Val-Val-Tyr-Phe-Ala 124
Val-Tyr-Phe-Ala-Ile-Ile-Thr-Cys-Cys 125
Leu-Gln-Leu-Thr-Asn-Thr-Ser-Ala-Tyr 126
Leu-Leu-Arg-Arg-Thr-Ala-Phe-Cys-Cys 127
Leu-Thr-Asn-Thr-Ser-Ala-Tyr-Tyr-Met 128
Tyr-Tyr-Met-Tyr-Leu-Leu-Leu-Leu-Leu 129
Leu-Lys-Ser-Val-Val-Tyr-Phe-Ala-Ile 130
Ile-Ile-Thr-Cys-Cys-Leu-Leu-Arg-Arg
TABLE-US-00007 TABLE 7 MHC-II Binding Peptides for the Gamma Chain
Variant Molecule SEQ ID NO: Amino Acid Sequence 93
Phe-Phe-Pro-Asp-Val-Ile-Lys-Ile-His 94
Ile-Lys-Ile-His-Trp-Gln-Glu-Lys-Lys 95
Phe-Leu-Pro-Ser-Ile-Ala-Glu-Thr-Lys 96
Leu-Gln-Lys-Ala-Gly-Thr-Tyr-Leu-Cys 97
Trp-Gln-Glu-Lys-Lys-Ser-Asn-Thr-Ile 98
Val-Ser-Pro-Lys-Pro-Thr-Ile-Phe-Leu 99
Leu-Cys-Leu-Leu-Glu-Lys-Phe-Phe-Pro 100
Ile-His-Trp-Gln-Glu-Lys-Lys-Ser-Asn 101
Val-Ile-Lys-Ile-His-Trp-Gln-Glu-Lys 102
Ile-Lys-Thr-Asp-Val-Ile-Thr-Met-Asp 103
Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn-Cys 104
Ile-Val-Arg-His-Glu-Asn-Asn-Lys-Asn 105
Val-Arg-His-Glu-Asn-Asn-Lys-Asn-Gly 106
Phe-Pro-Pro-Ile-Lys-Thr-Asp-Val-Ile 107
Met-Lys-Thr-Asn-Asp-Thr-Tyr-Met-Lys 108
Tyr-Met-Lys-Phe-Ser-Trp-Leu-Thr-Val 109
Val-Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn 110
Phe-Ser-Trp-Leu-Thr-Val-Pro-Glu-Lys 111
Trp-Leu-Thr-Val-Pro-Glu-Lys-Ser-Leu 112
Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser-Val 113
Leu-Leu-Leu-Leu-Lys-Ser-Val-Val-Tyr 114
Val-Val-Tyr-Phe-Ala-Ile-Ile-Thr-Cys 115
Tyr-Phe-Ala-Ile-Ile-Thr-Cys-Cys-Leu 116
Phe-Ala-Ile-Ile-Thr-Cys-Cys-Leu-Leu 117
Leu-Leu-Leu-Gln-Leu-Thr-Asn-Thr-Ser 118
Leu-Leu-Gln-Leu-Thr-Asn-Thr-Ser-Ala 119
Met-Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser 120
Leu-Leu-Leu-Leu-Leu-Lys-Ser-Val-Val 121
Leu-Leu-Leu-Lys-Ser-Val-Val-Tyr-Phe 122
Tyr-Met-Tyr-Leu-Leu-Leu-Leu-Leu-Lys 123
Leu-Leu-Lys-Ser-Val-Val-Tyr-Phe-Ala 124
Val-Tyr-Phe-Ala-Ile-Ile-Thr-Cys-Cys 125
Leu-Gln-Leu-Thr-Asn-Thr-Ser-Ala-Tyr 126
Leu-Leu-Arg-Arg-Thr-Ala-Phe-Cys-Cys 127
Leu-Thr-Asn-Thr-Ser-Ala-Tyr-Tyr-Met 128
Tyr-Tyr-Met-Tyr-Leu-Leu-Leu-Leu-Leu 129
Leu-Lys-Ser-Val-Val-Tyr-Phe-Ala-Ile 130
Ile-Ile-Thr-Cys-Cys-Leu-Leu-Arg-Arg 131
Phe-Phe-Pro-Asp-Val-Ser-Pro-Lys-Pro
TABLE-US-00008 TABLE 8 MHC-II Binding Peptides for the Gamma Chain
Variant Molecule SEQ ID NO: Amino Acid Sequence 93
Phe-Phe-Pro-Asp-Val-Ile-Lys-Ile-His 94
Ile-Lys-Ile-His-Trp-Gln-Glu-Lys-Lys 95
Phe-Leu-Pro-Ser-Ile-Ala-Glu-Thr-Lys 96
Leu-Gln-Lys-Ala-Gly-Thr-Tyr-Leu-Cys 97
Trp-Gln-Glu-Lys-Lys-Ser-Asn-Thr-Ile 98
Val-Ser-Pro-Lys-Pro-Thr-Ile-Phe-Leu 99
Leu-Cys-Leu-Leu-Glu-Lys-Phe-Phe-Pro 100
Ile-His-Trp-Gln-Glu-Lys-Lys-Ser-Asn 104
Ile-Val-Arg-His-Glu-Asn-Asn-Lys-Asn 105
Val-Arg-His-Glu-Asn-Asn-Lys-Asn-Gly 106
Phe-Pro-Pro-Ile-Lys-Thr-Asp-Val-Ile 107
Met-Lys-Thr-Asn-Asp-Thr-Tyr-Met-Lys 108
Tyr-Met-Lys-Phe-Ser-Trp-Leu-Thr-Val 109
Val-Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn 109
Val-Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn 112
Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser-Val 113
Leu-Leu-Leu-Leu-Lys-Ser-Val-Val-Tyr 114
Val-Val-Tyr-Phe-Ala-Ile-Ile-Thr-Cys 115
Tyr-Phe-Ala-Ile-Ile-Thr-Cys-Cys-Leu 116
Phe-Ala-Ile-Ile-Thr-Cys-Cys-Leu-Leu 117
Leu-Leu-Leu-Gln-Leu-Thr-Asn-Thr-Ser 118
Leu-Leu-Gln-Leu-Thr-Asn-Thr-Ser-Ala 119
Met-Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser 120
Leu-Leu-Leu-Leu-Leu-Lys-Ser-Val-Val 121
Leu-Leu-Leu-Lys-Ser-Val-Val-Tyr-Phe 122
Tyr-Met-Tyr-Leu-Leu-Leu-Leu-Leu-Lys 123
Leu-Leu-Lys-Ser-Val-Val-Tyr-Phe-Ala 124
Val-Tyr-Phe-Ala-Ile-Ile-Thr-Cys-Cys 125
Leu-Gln-Leu-Thr-Asn-Thr-Ser-Ala-Tyr 127
Leu-Thr-Asn-Thr-Ser-Ala-Tyr-Tyr-Met 128
Tyr-Tyr-Met-Tyr-Leu-Leu-Leu-Leu-Leu 129
Leu-Lys-Ser-Val-Val-Tyr-Phe-Ala-Ile 131
Phe-Phe-Pro-Asp-Val-Ser-Pro-Lys-Pro 132
Ile-Lys-Ile-His-Trp-Gln-Lys-Gln-Leu 133
Phe-Phe-Pro-Asp-Ile-Ile-Lys-Ile-His 134
Ile-Ile-Lys-Ile-His-Trp-Gln-Glu-Lys 135
Ile-Lys-Thr-Asp-Val-Thr-Thr-Val-Asp 136
Phe-Ser-Trp-Leu-Thr-Val-Pro-Glu-Glu 137
Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn-Trp 138
Tyr-Ser-Lys-Asp-Ala-Asn-Asp-Val-Ile 139
Leu-Leu-Gly-Arg-Thr-Ala-Phe-Cys-Cys 140
Ile-Ile-Thr-Cys-Cys-Leu-Leu-Gly-Arg
TABLE-US-00009 TABLE 9 MHC-II Binding Peptides for the Gamma Chain
Variant Molecule SEQ ID NO: Amino Acid Sequence 94
Ile-Lys-Ile-His-Trp-Gln-Glu-Lys-Lys 95
Phe-Leu-Pro-Ser-Ile-Ala-Glu-Thr-Lys 96
Leu-Gln-Lys-Ala-Gly-Thr-Tyr-Leu-Cys 97
Trp-Gln-Glu-Lys-Lys-Ser-Asn-Thr-Ile 98
Val-Ser-Pro-Lys-Pro-Thr-Ile-Phe-Leu 99
Leu-Cys-Leu-Leu-Glu-Lys-Phe-Phe-Pro 100
Ile-His-Trp-Gln-Glu-Lys-Lys-Ser-Asn 104
Ile-Val-Arg-His-Glu-Asn-Asn-Lys-Asn 105
Val-Arg-His-Glu-Asn-Asn-Lys-Asn-Gly 107
Met-Lys-Thr-Asn-Asp-Thr-Tyr-Met-Lys 108
Tyr-Met-Lys-Phe-Ser-Trp-Leu-Thr-Val 109
Val-Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn 112
Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser-Val 113
Leu-Leu-Leu-Leu-Lys-Ser-Val-Val-Tyr 114
Val-Val-Tyr-Phe-Ala-Ile-Ile-Thr-Cys 115
Tyr-Phe-Ala-Ile-Ile-Thr-Cys-Cys-Leu 116
Phe-Ala-Ile-Ile-Thr-Cys-Cys-Leu-Leu 117
Leu-Leu-Leu-Gln-Leu-Thr-Asn-Thr-Ser 118
Leu-Leu-Gln-Leu-Thr-Asn-Thr-Ser-Ala 119
Met-Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser 120
Leu-Leu-Leu-Leu-Leu-Lys-Ser-Val-Val 121
Leu-Leu-Leu-Lys-Ser-Val-Val-Tyr-Phe 122
Tyr-Met-Tyr-Leu-Leu-Leu-Leu-Leu-Lys 123
Leu-Leu-Lys-Ser-Val-Val-Tyr-Phe-Ala 124
Val-Tyr-Phe-Ala-Ile-Ile-Thr-Cys-Cys 125
Leu-Gln-Leu-Thr-Asn-Thr-Ser-Ala-Tyr 126
Leu-Leu-Arg-Arg-Thr-Ala-Phe-Cys-Cys 127
Leu-Thr-Asn-Thr-Ser-Ala-Tyr-Tyr-Met 128
Tyr-Tyr-Met-Tyr-Leu-Leu-Leu-Leu-Leu 129
Leu-Lys-Ser-Val-Val-Tyr-Phe-Ala-Ile 130
Ile-Ile-Thr-Cys-Cys-Leu-Leu-Arg-Arg 133
Phe-Phe-Pro-Asp-Ile-Ile-Lys-Ile-His 134
Ile-Ile-Lys-Ile-His-Trp-Gln-Glu-Lys 135
Ile-Lys-Thr-Asp-Val-Thr-Thr-Val-Asp 136
Phe-Ser-Trp-Leu-Thr-Val-Pro-Glu-Glu 137
Ile-Thr-Met-Asp-Pro-Lys-Asp-Asn-Trp 138
Tyr-Ser-Lys-Asp-Ala-Asn-Asp-Val-Ile 139
Leu-Leu-Gly-Arg-Thr-Ala-Phe-Cys-Cys 140
Ile-Ile-Thr-Cys-Cys-Leu-Leu-Gly-Arg 141
Leu-Leu-Leu-Leu-Leu-Lys-Ser-Gly-Val 142
Leu-Leu-Lys-Ser-Gly-Val-Tyr-Phe-Ala 143
Leu-Leu-Leu-Leu-Lys-Ser-Gly-Val-Tyr 144
Tyr-Leu-Leu-Leu-Leu-Leu-Lys-Ser-Gly 145
Leu-Leu-Leu-Lys-Ser-Gly-Val-Tyr-Phe 146
Leu-Lys-Ser-Gly-Val-Tyr-Phe-Ala-Ile
TABLE-US-00010 TABLE 10 TCR constant domain chains A. TCR alpha
chain constant domain-gi: 1335335, SEQ ID NO: 168: diqnpdpavy
qlrdskssdk svclftdfds qtnvsqskds dvyitdktvl dmrsmdfksn savawsnksd
facanafnns iipedtffps pesscdvklv eksfetdtnl nfqnlsvigf rilllkvagf
nllmtlrlws s Coding sequence-gi: 36915, SEQ ID NO: 176. B. TCR
beta-1 chain constant domain-gi: 338831, SEQ ID NO: 169: dlnkvfppev
avfepseaei shtqkatlvc latgffpdhv elswwvngke vhsgvstdpq plkeqpalnd
sryclssrlr vsatfwqnpr nhfrcqvqfy glsendewtq drakpvtqiv saeawgradc
gftsysyqqg vlsatilyei llgkatlyav lvsalvlmam vkrkdf Coding
sequence-gi: 338830, SEQ ID NO: 177. C. TCR beta-2 chain constant
domain (gi: 88760, SEQ ID NO: 170): edlknvfppe vavfepseae
ishtqkatlv clatgfypdh velswwvngk evhsgvstdp qplkeqpaln dsryclssrl
rvsatfwqnp rnhfrcqvqf yglsendewt qdrakpvtqi vsaeawgrad cgftsesyqq
gvlsatilye illgkatlya vlvsalvlma mvkrkdsrg Coding sequence-gi:
338832, SEQ ID NO: 178. D. TCR delta chain constant domain-gi:
107835, SEQ ID NO: 171: sqphtkpsvf vmkngtnvac lvkefypkdi rinlvsskki
tefdpaivis psgkynavkl gkyedsnsvt csvqhdnktv hstdfevktd stdhvkpket
entkqpsksc hkpkaivhte kvnmmsltvl glrmlfaktv avnflltakl ffl Coding
sequence-gi: 339030, SEQ ID NO: 179. E. TCR gamma-1 chain constant
domain-A26659, SEQ ID NO: 172: dkqldadvsp kptiflpsia etklqkagty
lcllekffpd vikihwqekk sntilgsqeg ntmktndtym kfswltvpek sldkehrciv
rhennkngvd qeiifppikt dvitmdpkdn cskdandtll lqltntsayy mylllllksv
vyfaiitccl lrrtafccng eks F. TCR gamma chain constant
domain-AAB63314, SEQ ID NO: 173: vspkptiflp siaetklqka gtylcllekf
fpdvikihwq ekksntilgs qegntmktnd tymkfswltv peksldkehr civrhennkn
gvdqeiifpp iktdvitmdp kdncskdand tlllqltnts ayymylllll ksvvyfaiit
ccllrrtafc cngeks Coding sequence-gi: 2072752, SEQ ID NO: 180. G.
TCR gamma chain constant domain (AAB63312, SEQ ID NO: 174):
kqldadvspk ptiflpsiae tklqkagtyl cllekffpdi ikihwqekks ntilgsqegn
tmktndtymk fswltvpees ldkehrcivr hennkngidq eiifppiktd vttvdpkdsy
skdandyttv dpkynyskda ndvitmdpkd nwskdandtl llqltntsay ymylllllks
vvyfaiitcc llgrtafccn geks Coding sequence-gi: 2072750, SEQ ID NO:
181: H. TCR gamma chain constant domain-AAB63313, SEQ ID NO: 175:
kqldadvspk ptiflpsiae tklqkagtyl cllekffpdi ikihwqekks ntilgsqegn
tmktndtymk fswltvpees ldkehrcivr hennkngidq eiifppiktd vttvdpkyny
skdandvitm dpkdnwskda idtlllqltn tsayymylll llksgvyfai itccllrrta
fccngeks Coding sequence (gi: 2072751, SEQ ID NO: 182):
Example 12
Screening for Immunogenic TCR Constant Domain Peptides Using
Antigen Array Technology
[0319] The antigenicity of peptides derived from human T-cell
receptor gamma-chain constant region (accession no: AAB63314; SEQ
ID NO:173) was essayed using antigen array technology, as detailed
below.
[0320] Serum Samples:
[0321] Blood samples were obtained by random availability from 12
healthy adults and from 9 adults newly diagnosed with lung cancer,
before treatment. All samples were collected with informed consent
and approval of the Helsinki committee of the Sheba Medical Center,
Tel Hashomer, Israel. The blood samples were allowed to clot at
room temperature. After centrifugation, sera were collected and
stored at -20.degree. C.
[0322] Antigen Microarray:
[0323] Antigens diluted in PBS were placed in 384-well plates at a
concentration of 1 .mu.g/.mu.l. We used a robotic MicroGrid arrayer
with solid spotting pins of 0.2 mm in diameter (BioRobotics,
Cambridge, U.K.) to spot the antigens onto ArrayIt SuperEpoxi
microarray substrate slides (TeleChem, Sunnyvale, Calif.). the
antigens were spotted in replicates of 4, and the microarrays were
blocked for 1 h at 37.degree. C. with 1% bovine serum albumin, and
incubated under a cover-slip overnight at 4.degree. C. with a 1:5
dilution of the test serum in blocking buffer. The quantitative
range of signal intensity of binding to each antigen spot was
0.01-65,000, and this range of detection made it possible to record
reliable data with little dilution of test samples. The arrays were
then washed and incubated for 1 hour at 37.degree. C. with a 1:500
dilution of detection antibodies. Two detection antibodies were
used: a goat anti-human IgG Cy3-conjugated antibody and a goat
anti-human IgM Cy5-conjugated antibody, purchased from Jackson
ImmunoResearch, West Grove, Pa. The arrays were washed again,
spin-dried, and scanned with a ScanArray 4000X scanner (GSI
Luminomics, Billerica, Mass.). The results were recorded as TIFF
files. Image acquisition by laser and quantification were done as
described (Quintana et al., 2004).
[0324] Data Preprocessing and Background Filtering:
[0325] Antigen reactivity was defined by the mean intensity of the
4 replicates of binding to that antigen on the microarray. We
identified positive antibodies in the following way: To establish
the minimum level of significant antibody binding, we calculated
the mean reactivity level of 32 spots incubated with phosphate
buffered saline (PBS) in place of an antigen on each microarray
slide. A signal was scored as positive when it expressed intensity
greater than the upper limit of the PBS control, which was defined
as the mean intensity of the PBS spots plus 2-times the standard
deviation. Signal intensity above the PBS background was considered
positive antibody binding.
[0326] Peptide antigens having an amino acid sequence as set forth
in SEQ ID NOS:157-163, presented in Table 11, were identified,
using an algorithm for prediction of immunogenic sequences
(http://bio.dfci.harvard.edu/Tools/antigenic.html), from seven
different parts of the protein (see the starting and ending aa
positions). Peptides having an amino acid sequence as set forth in
SEQ ID NOS:158, 161 and 164-167, were synthesized and used for the
analysis. The tested peptides (Table 12) were as follows: [0327] a)
SEQ ID NO:164--a combination of SEQ ID NOS:157 and 159 in tandem;
[0328] b) SEQ ID NO:158; [0329] c) SEQ ID NO:165--a combination of
SEQ ID NOS:160 and 162 in tandem; [0330] d) SEQ ID NO:161; [0331]
e) SEQ ID NOS:166 and 167 are two partially overlapping 20mers of
SEQ ID NO:163.
TABLE-US-00011 [0331] TABLE 11 Predicted Immunogenic Sequences
(According To Algorithm) SEQ ID Start End Length NO: Position
SEQUENCE Position (aa) 157 4 KPTIFLPS 11 8 158 19
KAGTYLCLLEKFFPDVIKI 37 19 159 66 SWLTVPE 72 7 160 77 KEHRCIV 83 7
161 93 DQEIIFPPIKT 103 11 162 120 DTLLLQL 126 7 163 131
AYYMYLLLLLKSVVYFAIITC 162 32 CLLRRTAFCCN
TABLE-US-00012 TABLE 12 Peptides Synthesized Derived SEQ ID from
peptides Length NO: (SEQ ID NOS.): SEQUENCE (aa) 158 158
KAGTYLCLLEKFFPDVIKI 19 161 161 DQEIIFPPIKT 11 164 157 + 159
KPTIFLPSSWLTVPE 15 165 160 + 162 KEHRCIVDTLLLQL 14 166 163
AYYMYLLLLLKSVVYFAIIT 20 167 VVYFAIITCCLLRRTAFCCN 20
[0332] The presence of IgG and IgM in sera obtained from patients
with lung cancer and from healthy controls was determined using the
antigen microarray, as detailed above. The results, presented in
Table 13, represent the mean reactivity of 12 control subjects and
9 lung cancer subjects.
[0333] Results: immunoglobulins from lung cancer subjects reacted
with all but the peptide having an amino acid sequence as set forth
in SEQ ID NO:164. IgG antibodies reactive with all but the peptide
denoted by SEQ ID NO:164 were found in the sera of lung cancer
subjects, indicating the ability of these peptides to elicit IgG
antibodies in humans. Antibodies from control subjects responded
only to the peptide denoted by SEQ ID NO:158. Thus, according to
certain particular embodiments, immunogenic peptides and probes of
the invention include, without limitation, the peptides having an
amino acid sequence as set forth in any one of SEQ ID NOS:157-167,
preferably peptides having an amino acid sequence as set forth in
any one of SEQ ID NOS:161 and 165-167.
TABLE-US-00013 TABLE 13 Antigen Binding (Mean Intensity) Peptide
HEALTHY LUNG (SEQ ID CONTROLS CANCER NO:) IgM IgG IgM IgG 158 1753
2233 2381 2116 161 86 -147 160 846 164 -24 -240 86 -114 165 97 95
103 1095 166 87 199 140 996 167 548 376 512 1928
[0334] Table 14 indicates the nucleotide sequences of the
peptides:
TABLE-US-00014 TABLE 14 corresponding nucleotide sequences Peptide
Nucleotide SEQ SEQ ID ID NO: NO: Nucleotide sequence 157 183
aagcccactatttttcttccttca 158 184 aaggctggaacatacctttgtcttcttgaga
aatttttccctgatgttattaagata 159 185 agctggttaacggtgccagaa 160 186
aaagaacacagatgtatcgtc 161 187 gatcaagaaattatctttcctccaat aaagaca
162 188 gatacactactgctgcagctc 163 189
gcatattacatgtacctcctcctgctcctca agagtgtggtctattttgccatcatcacct
gctgtctgcttagaagaacggctttctgc tgcaat 164 190
aagcccactatttttcttccttca agctg gttaacggtgccagaa 165 191
aaagaacacagatgtatcgtc gatac actactgctgcagctc 166 192
gcatattacatgtacctcctcctgctcctc aagagtgtggtctattttgccatcatcacc 167
193 t gctgtctgcttagaagaacgg ctttctgc tgcaat
Example 13
Generation of Human T Cell Lines Directed to TCR Constant Domain
Peptides and Determination of an Anti-Ergotypic Response
[0335] Human T cell lines directed to TCR constant domain epitopes
are prepared as follows: peripheral blood mononuclear cells (PBMC)
are separated from 50 ml heparinized venous blood on ficoll
hypaque, plated in round bottom 96-well microplates,
2.times.10.sup.5 cells per well in the presence of 10-50 .mu.g/ml
of the TCR constant domain peptide. The cells are cultured in
medium RPMI-1640 (Gibco) supplemented with 10% human serum, 100
U/ml penicillin, 100 .mu.g/ml streptomycin, and 0.1% glutamine in
37.degree. C., 5% CO.sub.2 incubator. Following cultivation for
7-14 days, the cultures are split and subcultures are prepared on
10.sup.5 irradiated (400 Gy) autologous PBMC feeders and
restimulated with the peptide. The index of cell stimulation (SI)
in response to the peptide is examined after additional 72 h in
culture using .sup.3H-thymidine incorporation assays (Amersham,
Arlington Heights, Ill.). Wells exhibiting a minimal SI>3
(threefold increase in .sup.3H-thymidine incorporation relative to
the average incorporation in reference control wells not stimulated
with peptide) are selected for line propagation and expanded with
IL-2 (50 IU/ml, Roche).
[0336] To verify that the resulting T cell line is anti-ergotypic,
proliferation to autologous activated T cells is determined. To
this end, autologous T cells are isolated on a Ficoll gradient,
washed, and incubated (2 h, 37.degree. C., 7.5% CO.sub.2,
humidified atmosphere) on petri dishes. The nonadherent cells are
then collected and incubated (1 h, 37.degree. C., 7.5% CO.sub.2,
humidified atmosphere) on nylon wool columns (Novamed, Jerusalem,
Israel). Unbound cells are eluted from the columns by extensive
washings. The resulting T cells are activated on anti-CD3 mAb
pre-coated 24-well plates (0.5 .mu.g/ml; non tissue culture grade
plates) and irradiated (5000 rads). In other experiments,
autologous activated T cells are obtained by purification using
Macs columns (Miltenyi), activation with anti-CD3 and anti-CD28
Abs, and irradiation. Proliferation of the TCR constant domain
peptide-specific T cell line in the presence of the irradiated
activated autologous T cells is then determined as described
above.
REFERENCES
[0337] Cohen, I. R. 2001. Vaccine 20:706. [0338] Kumar et al.,
2001. Int Immunol 13:835. [0339] Hogervorst et al., 1991. Infect
Immun 59:2029. [0340] Lohse et al., 1989. Science 244:820. [0341]
Mimran et al., 2004. J Clin Invest 113:924. [0342] Minami et al.,
1993. Annu Rev Immunol 11:245. [0343] Mor et al., 1996. Jlmmunol
157:4855. [0344] Quintana et al., 2002. Jlmmunol 169:3422. [0345]
Quintana et al., 2003. Jlmmunol 171:3533 [0346] Reizis et al.,
1996. Int Immunol 8:1825. [0347] Shapira et al., 1993. J Clin
Invest 91:388. [0348] Singh, H. and Raghava, G. P. S. 2001.
Bioinformatics 17: 1236-7 [0349] Taniguchi, T., and Y. Minami.
1993. Cell 73:5. [0350] Van der Aa et al., 2003. Clin Exp Immunol
131:155 [0351] van Eden et al., 1985. Proc Natl Acad Sci USA
82:5117. [0352] Zhang et al., 1993. Science 261:1451. [0353]
Manolios et al., 1997. Nat Med 3: 84-88. [0354] Ben-Nun et al.,
1987. Nature 292:60. [0355] Holoshitz et. al., 1983. Science
219:56. [0356] Achiron et al., 2004. Clin. Immunol: 113 155-160.
[0357] Sambrook et al., 1989. Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Labs Press. [0358] Wolff et al., 1990.
Science 247, 1465-1468 [0359] Stribling et al., 1992. Proc. Natl.
Acad. Sci. USA 189:11277-11281. [0360] Quintana et al., 2004. Proc
Natl Acad Sci USA 101 Suppl 2:14615-14621.
[0361] The foregoing description of the specific embodiments will
so fully reveal the general nature of the invention that others
can, by applying current knowledge, readily modify and/or adapt for
various applications such specific embodiments without undue
experimentation and without departing from the generic concept,
and, therefore, such adaptations and modifications should and are
intended to be comprehended within the meaning and range of
equivalents of the disclosed embodiments. It is to be understood
that the phraseology or terminology employed herein is for the
purpose of description and not of limitation. The means, materials
and steps for carrying out various disclosed functions may take a
variety of alternative forms without departing from the
invention.
[0362] While the present invention has been particularly described,
persons skilled in the art will appreciate that many variations and
modifications can be made. Therefore, the invention is not to be
construed as restricted to the particularly described embodiments,
rather the scope, spirit and concept of the invention will be more
readily understood by reference to the claims which follow.
Sequence CWU 1
1
19319PRTArtificial SequenceSynthetic peptide 1Phe Lys Ser Asn Ser
Ala Val Ala Trp 1 5 29PRTArtificial SequenceSynthetic peptide 2Val
Ala Trp Ser Asn Lys Ser Asp Phe 1 5 39PRTArtificial
SequenceSynthetic peptide 3Tyr Ile Thr Asp Lys Thr Val Leu Asp 1 5
49PRTArtificial SequenceSynthetic peptide 4Tyr Gln Leu Arg Asp Ser
Lys Ser Ser 1 5 59PRTArtificial SequenceSynthetic peptide 5Phe Asp
Ser Gln Thr Asn Val Ser Gln 1 5 69PRTArtificial SequenceSynthetic
peptide 6Val Tyr Gln Leu Arg Asp Ser Lys Ser 1 5 79PRTArtificial
SequenceSynthetic peptide 7Val Leu Asp Met Arg Ser Met Asp Phe 1 5
89PRTArtificial SequenceSynthetic peptide 8Val Tyr Ile Thr Asp Lys
Thr Val Leu 1 5 99PRTArtificial SequenceSynthetic peptide 9Ile Thr
Asp Lys Thr Val Leu Asp Met 1 5 109PRTArtificial SequenceSynthetic
peptide 10Val Cys Leu Phe Thr Asp Phe Asp Ser 1 5 119PRTArtificial
SequenceSynthetic peptide 11Met Arg Ser Met Asp Phe Lys Ser Asn 1 5
129PRTArtificial SequenceSynthetic peptide 12Phe Gln Asn Leu Ser
Val Ile Gly Phe 1 5 139PRTArtificial SequenceSynthetic peptide
13Phe Arg Ile Leu Leu Leu Lys Val Ala 1 5 149PRTArtificial
SequenceSynthetic peptide 14Ile Leu Leu Leu Lys Val Ala Gly Phe 1 5
159PRTArtificial SequenceSynthetic peptide 15Leu Leu Lys Val Ala
Gly Phe Asn Leu 1 5 169PRTArtificial SequenceSynthetic peptide
16Phe Asn Leu Leu Met Thr Leu Arg Leu 1 5 179PRTArtificial
SequenceSynthetic peptide 17Val Lys Leu Val Glu Lys Ser Phe Glu 1 5
189PRTArtificial SequenceSynthetic peptide 18Leu Leu Met Thr Leu
Arg Leu Trp Ser 1 5 199PRTArtificial SequenceSynthetic peptide
19Phe Asn Asn Ser Ile Ile Pro Glu Asp 1 5 209PRTArtificial
SequenceSynthetic peptide 20Phe Glu Thr Asp Thr Asn Leu Asn Phe 1 5
219PRTArtificial SequenceSynthetic peptide 21Ile Ile Pro Glu Asp
Thr Phe Phe Pro 1 5 229PRTArtificial SequenceSynthetic peptide
22Ile Gly Phe Arg Ile Leu Leu Leu Lys 1 5 239PRTArtificial
SequenceSynthetic peptide 23Val Ile Gly Phe Arg Ile Leu Leu Leu 1 5
249PRTArtificial SequenceSynthetic peptide 24Leu Lys Val Ala Gly
Phe Asn Leu Leu 1 5 259PRTArtificial SequenceSynthetic peptide
25Leu Leu Leu Lys Val Ala Gly Phe Asn 1 5 269PRTArtificial
SequenceSynthetic peptide 26Leu Met Thr Leu Arg Leu Trp Ser Ser 1 5
279PRTArtificial SequenceSynthetic peptide 27Val Ala Gly Phe Asn
Leu Leu Met Thr 1 5 289PRTartificial SequenceSynthetic peptide
28Leu Asn Lys Val Phe Pro Pro Glu Val 1 5 299PRTArtificial
SequenceSynthetic peptide 29Leu Val Cys Leu Ala Thr Gly Phe Phe 1 5
309PRTArtificial SequenceSynthetic peptide 30Phe Phe Pro Asp His
Val Glu Leu Ser 1 5 319PRTArtificial SequenceSynthetic peptide
31Trp Trp Val Asn Gly Lys Glu Val His 1 5 329PRTArtificial
SequenceSynthetic peptide 32Trp Val Asn Gly Lys Glu Val His Ser 1 5
339PRTArtificial SequenceSynthetic peptide 33Phe Glu Pro Ser Glu
Ala Glu Ile Ser 1 5 349PRTArtificial SequenceSynthetic peptide
34Val Ala Val Phe Glu Pro Ser Glu Ala 1 5 359PRTArtificial
SequenceSynthetic peptide 35Val Asn Gly Lys Glu Val His Ser Gly 1 5
369PRTArtificial SequenceSynthetic peptide 36Val Ser Thr Asp Pro
Gln Pro Leu Lys 1 5 379PRTArtificial SequenceSynthetic peptide
37Ile Val Ser Ala Glu Ala Trp Gly Arg 1 5 389PRTArtificial
SequenceSynthetic peptide 38Leu Arg Val Ser Ala Thr Phe Trp Gln 1 5
399PRTArtificial SequenceSynthetic peptide 39Tyr Cys Leu Ser Ser
Arg Leu Arg Val 1 5 409PRTArtificial SequenceSynthetic peptide
40Phe Arg Cys Gln Val Gln Phe Tyr Gly 1 5 419PRTArtificial
SequenceSynthetic peptide 41Tyr Gly Leu Ser Glu Asn Asp Glu Trp 1 5
429PRTArtificial SequenceSynthetic peptide 42Val Thr Gln Ile Val
Ser Ala Glu Ala 1 5 439PRTArtificial SequenceSynthetic peptide
43Val Gln Phe Tyr Gly Leu Ser Glu Asn 1 5 449PRTArtificial
SequenceSynthetic peptide 44Leu Ser Ser Arg Leu Arg Val Ser Ala 1 5
459PRTArtificial SequenceSynthetic peptide 45Trp Gln Asn Pro Arg
Asn His Phe Arg 1 5 469PRTArtificial SequenceSynthetic peptide
46Tyr Glu Ile Leu Leu Gly Lys Ala Thr 1 5 479PRTArtificial
SequenceSynthetic peptide 47Tyr Ala Val Leu Val Ser Ala Leu Val 1 5
489PRTArtificial SequenceSynthetic peptide 48Leu Val Ser Ala Leu
Val Leu Met Ala 1 5 499PRTArtificial SequenceSynthetic peptide
49Leu Val Leu Met Ala Met Val Lys Arg 1 5 509PRTArtificial
SequenceSynthetic peptide 50Val Ser Tyr Gln Gln Gly Val Leu Ser 1 5
519PRTArtificial SequenceSynthetic peptide 51Val Leu Val Ser Ala
Leu Val Leu Met 1 5 529PRTArtificial SequenceSynthetic peptide
52Val Leu Met Ala Met Val Lys Arg Lys 1 5 539PRTArtificial
SequenceSynthetic peptide 53Ile Leu Tyr Glu Ile Leu Leu Gly Lys 1 5
549PRTArtificial SequenceSynthetic peptide 54Leu Leu Gly Lys Ala
Thr Leu Tyr Ala 1 5 559PRTArtificial SequenceSynthetic peptide
55Leu Tyr Ala Val Leu Val Ser Ala Leu 1 5 569PRTArtificial
SequenceSynthetic peptide 56Val Leu Ser Ala Thr Ile Leu Tyr Glu 1 5
579PRTArtificial SequenceSynthetic peptide 57Leu Ser Ala Thr Ile
Leu Tyr Glu Ile 1 5 589PRTArtificial SequenceSynthetic peptide
58Leu Met Ala Met Val Lys Arg Lys Asp 1 5 599PRTArtificial
SequenceSynthetic peptide 59Val Ser Ala Leu Val Leu Met Ala Met 1 5
609PRTArtificial SequenceSynthetic peptide 60Met Ala Met Val Lys
Arg Lys Asp Phe 1 5 619PRTArtificial SequenceSynthetic peptide
61Leu Lys Asn Val Phe Pro Pro Glu Val 1 5 629PRTArtificial
SequenceSynthetic peptide 62Leu Val Cys Leu Ala Thr Gly Phe Tyr 1 5
639PRTArtificial SequenceSynthetic peptide 63Phe Tyr Pro Asp His
Val Glu Leu Ser 1 5 649PRTArtificial SequenceSynthetic peptide
64Met Ala Met Val Lys Arg Lys Asp Ser 1 5 659PRTArtificial
SequenceSynthetic peptide 65Phe Val Met Lys Asn Gly Thr Asn Val 1 5
669PRTArtificial SequenceSynthetic peptide 66Ile Asn Leu Val Ser
Ser Lys Lys Ile 1 5 679PRTArtificial SequenceSynthetic peptide
67Ile Arg Ile Asn Leu Val Ser Ser Lys 1 5 689PRTArtificial
SequenceSynthetic peptide 68Leu Val Ser Ser Lys Lys Ile Thr Glu 1 5
699PRTArtificial SequenceSynthetic peptide 69Ile Val Ile Ser Pro
Ser Gly Lys Tyr 1 5 709PRTArtificial SequenceSynthetic peptide
70Tyr Pro Lys Asp Ile Arg Ile Asn Leu 1 5 719PRTArtificial
SequenceSynthetic peptide 71Val Met Lys Asn Gly Thr Asn Val Ala 1 5
729PRTArtificial SequenceSynthetic peptide 72Val Lys Leu Gly Lys
Tyr Glu Asp Ser 1 5 739PRTArtificial SequenceSynthetic peptide
73Met Lys Asn Gly Thr Asn Val Ala Cys 1 5 749PRTArtificial
SequenceSynthetic peptide 74Val Phe Val Met Lys Asn Gly Thr Asn 1 5
759PRTArtificial SequenceSynthetic peptide 75Phe Tyr Pro Lys Asp
Ile Arg Ile Asn 1 5 769PRTArtificial SequenceSynthetic peptide
76Tyr Asn Ala Val Lys Leu Gly Lys Tyr 1 5 779PRTArtificial
SequenceSynthetic peptide 77Val Gln His Asp Asn Lys Thr Val His 1 5
789PRTArtificial SequenceSynthetic peptide 78Val Lys Thr Asp Ser
Thr Asp His Val 1 5 799PRTArtificial SequenceSynthetic peptide
79Val Asn Met Met Ser Leu Thr Val Leu 1 5 809PRTArtificial
SequenceSynthetic peptide 80Met Met Ser Leu Thr Val Leu Gly Leu 1 5
819PRTArtificial SequenceSynthetic peptide 81Leu Arg Met Leu Phe
Ala Lys Thr Val 1 5 829PRTArtificial SequenceSynthetic peptide
82Met Leu Phe Ala Lys Thr Val Ala Val 1 5 839PRTArtificial
SequenceSynthetic peptide 83Val Asn Phe Leu Leu Thr Ala Lys Leu 1 5
849PRTArtificial SequenceSynthetic peptide 84Ile Val His Thr Glu
Lys Val Asn Met 1 5 859PRTArtificial SequenceSynthetic peptide
85Phe Leu Leu Thr Ala Lys Leu Phe Phe 1 5 869PRTArtificial
SequenceSynthetic peptide 86Val His Thr Glu Lys Val Asn Met Met 1 5
879PRTArtificial SequenceSynthetic peptide 87Phe Ala Lys Thr Val
Ala Val Asn Phe 1 5 889PRTArtificial SequenceSynthetic peptide
88Leu Leu Thr Ala Lys Leu Phe Phe Leu 1 5 899PRTArtificial
SequenceSynthetic peptide 89Leu Phe Ala Lys Thr Val Ala Val Asn 1 5
909PRTArtificial SequenceSynthetic peptide 90Leu Gly Leu Arg Met
Leu Phe Ala Lys 1 5 919PRTArtificial SequenceSynthetic peptide
91Val Leu Gly Leu Arg Met Leu Phe Ala 1 5 929PRTArtificial
SequenceSynthetic peptide 92Val Ala Val Asn Phe Leu Leu Thr Ala 1 5
939PRTArtificial SequenceSynthetic peptide 93Phe Phe Pro Asp Val
Ile Lys Ile His 1 5 949PRTArtificial SequenceSynthetic peptide
94Ile Lys Ile His Trp Gln Glu Lys Lys 1 5 959PRTArtificial
SequenceSynthetic peptide 95Phe Leu Pro Ser Ile Ala Glu Thr Lys 1 5
969PRTArtificial SequenceSynthetic peptide 96Leu Gln Lys Ala Gly
Thr Tyr Leu Cys 1 5 979PRTArtificial SequenceSynthetic peptide
97Trp Gln Glu Lys Lys Ser Asn Thr Ile 1 5 989PRTArtificial
SequenceSynthetic peptide 98Val Ser Pro Lys Pro Thr Ile Phe Leu 1 5
999PRTArtificial SequenceSynthetic peptide 99Leu Cys Leu Leu Glu
Lys Phe Phe Pro 1 5 1009PRTArtificial SequenceSynthetic peptide
100Ile His Trp Gln Glu Lys Lys Ser Asn 1 5 1019PRTArtificial
SequenceSynthetic peptide 101Val Ile Lys Ile His Trp Gln Glu Lys 1
5 1029PRTArtificial SequenceSynthetic peptide 102Ile Lys Thr Asp
Val Ile Thr Met Asp 1 5 1039PRTArtificial SequenceSynthetic peptide
103Ile Thr Met Asp Pro Lys Asp Asn Cys 1 5 1049PRTArtificial
SequenceSynthetic peptide 104Ile Val Arg His Glu Asn Asn Lys Asn 1
5 1059PRTArtificial SequenceSynthetic peptide 105Val Arg His Glu
Asn Asn Lys Asn Gly 1 5 1069PRTArtificial SequenceSynthetic peptide
106Phe Pro Pro Ile Lys Thr Asp Val Ile 1 5 1079PRTArtificial
SequenceSynthetic peptide 107Met Lys Thr Asn Asp Thr Tyr Met Lys 1
5 1089PRTArtificial SequenceSynthetic peptide 108Tyr Met Lys Phe
Ser Trp Leu Thr Val 1 5 1099PRTArtificial SequenceSynthetic peptide
109Val Ile Thr Met Asp Pro Lys Asp Asn 1 5 1109PRTArtificial
SequenceSynthetic peptide 110Phe Ser Trp Leu Thr Val Pro Glu Lys 1
5 1119PRTArtificial SequenceSynthetic peptide 111Trp Leu Thr Val
Pro Glu Lys Ser Leu 1 5 1129PRTArtificial SequenceSynthetic peptide
112Tyr Leu Leu Leu Leu Leu Lys Ser Val 1 5 1139PRTArtificial
SequenceSynthetic peptide 113Leu Leu Leu Leu Lys Ser Val Val Tyr 1
5 1149PRTArtificial SequenceSynthetic peptide 114Val Val Tyr Phe
Ala Ile Ile Thr Cys 1 5 1159PRTArtificial SequenceSynthetic peptide
115Tyr Phe Ala Ile Ile Thr Cys Cys Leu 1 5 1169PRTArtificial
SequenceSynthetic peptide 116Phe Ala Ile Ile Thr Cys Cys Leu Leu 1
5 1179PRTArtificial SequenceSynthetic peptide 117Leu Leu Leu Gln
Leu Thr Asn Thr Ser 1 5 1189PRTArtificial SequenceSynthetic peptide
118Leu Leu Gln Leu Thr Asn Thr Ser Ala 1 5 1199PRTArtificial
SequenceSynthetic peptide 119Met Tyr Leu Leu Leu Leu Leu Lys Ser 1
5 1209PRTArtificial SequenceSynthetic peptide 120Leu Leu Leu Leu
Leu Lys Ser Val Val 1 5 1219PRTArtificial SequenceSynthetic peptide
121Leu Leu Leu Lys Ser Val Val Tyr Phe 1 5 1229PRTArtificial
SequenceSynthetic peptide 122Tyr Met Tyr Leu Leu Leu Leu Leu Lys 1
5 1239PRTArtificial SequenceSynthetic peptide 123Leu Leu Lys Ser
Val Val Tyr Phe Ala 1 5 1249PRTArtificial SequenceSynthetic peptide
124Val Tyr Phe Ala Ile Ile Thr Cys Cys 1 5 1259PRTArtificial
SequenceSynthetic peptide 125Leu Gln Leu Thr Asn Thr Ser Ala Tyr 1
5 1269PRTArtificial SequenceSynthetic peptide 126Leu Leu Arg Arg
Thr Ala Phe Cys Cys 1 5 1279PRTArtificial SequenceSynthetic peptide
127Leu Thr Asn Thr Ser Ala Tyr Tyr Met 1 5 1289PRTArtificial
SequenceSynthetic peptide 128Tyr Tyr Met Tyr Leu Leu Leu Leu Leu 1
5 1299PRTArtificial SequenceSynthetic peptide 129Leu Lys Ser Val
Val Tyr Phe Ala Ile 1 5 1309PRTArtificial SequenceSynthetic peptide
130Ile Ile Thr Cys Cys Leu Leu Arg Arg 1 5 1319PRTArtificial
SequenceSynthetic peptide 131Phe Phe Pro Asp Val Ser Pro Lys Pro 1
5 1329PRTArtificial SequenceSynthetic peptide 132Ile Lys Ile His
Trp Gln Lys Gln Leu 1 5 1339PRTArtificial SequenceSynthetic peptide
133Phe Phe Pro Asp Ile Ile Lys Ile His 1 5 1349PRTArtificial
SequenceSynthetic peptide 134Ile Ile Lys Ile His Trp Gln Glu Lys 1
5 1359PRTArtificial SequenceSynthetic peptide 135Ile Lys Thr Asp
Val Thr Thr Val Asp 1 5 1369PRTArtificial SequenceSynthetic peptide
136Phe Ser Trp Leu Thr Val Pro Glu Glu 1 5 1379PRTArtificial
SequenceSynthetic peptide 137Ile Thr Met Asp Pro Lys Asp Asn Trp 1
5 1389PRTArtificial SequenceSynthetic peptide 138Tyr Ser Lys Asp
Ala Asn Asp Val Ile 1 5 1399PRTArtificial SequenceSynthetic peptide
139Leu Leu Gly Arg Thr Ala Phe Cys Cys 1 5 1409PRTArtificial
SequenceSynthetic peptide 140Ile Ile Thr Cys Cys Leu Leu Gly Arg 1
5 1419PRTArtificial SequenceSynthetic peptide 141Leu Leu Leu Leu
Leu Lys Ser Gly Val 1 5 1429PRTArtificial SequenceSynthetic peptide
142Leu Leu Lys Ser Gly Val Tyr Phe Ala 1 5 1439PRTArtificial
SequenceSynthetic peptide 143Leu Leu Leu Leu Lys Ser Gly Val Tyr 1
5 1449PRTArtificial SequenceSynthetic peptide 144Tyr Leu Leu Leu
Leu Leu Lys Ser Gly 1 5 1459PRTArtificial SequenceSynthetic peptide
145Leu Leu Leu Lys Ser Gly Val Tyr Phe 1 5 1469PRTArtificial
SequenceSynthetic peptide 146Leu Lys Ser Gly Val Tyr Phe Ala Ile 1
5 14717PRTRattus norvegicus 147Val Thr Pro Pro Lys Val Ser Leu Phe
Glu Pro Ser Glu Ala Glu Ile 1 5 10 15 Ala 14817PRTRattus norvegicus
148Val Thr Pro Pro Lys Val Ser Leu Phe Glu Pro Ser Glu Ala Glu Ile
1 5 10 15 Thr 14917PRTRattus norvegicus 149Asp Ser Pro Lys Pro Val
Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly 1 5 10 15 Arg
15017PRTRattus norvegicus 150Asp Ser Pro Lys Pro Val Thr
Gln Asn Ile Ser Ala Glu Ala Trp Gly 1 5 10 15 Arg 15117PRTRattus
norvegicus 151Val Leu Val Ser Thr Leu Val Val Met Thr Met Val Lys
Arg Lys Ser 1 5 10 15 Ser 15217PRTRattus norvegicus 152Val Leu Val
Ser Ala Leu Val Leu Met Ala Met Val Lys Lys Lys Asn 1 5 10 15 Ser
153171PRTRattus norvegicus 153Asp Leu Lys Thr Val Thr Pro Pro Lys
Val Ser Leu Phe Glu Pro Ser 1 5 10 15 Glu Ala Glu Ile Ala Asp Lys
Gln Lys Ala Thr Leu Val Cys Leu Ala 20 25 30 Arg Gly Phe Phe Pro
Asp His Val Glu Leu Ser Trp Trp Val Asn Gly 35 40 45 Lys Glu Ile
Arg Asn Gly Val Ser Thr Asp Pro Gln Ala Tyr Lys Glu 50 55 60 Ser
Asn Asn Ile Thr Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala 65 70
75 80 Pro Phe Trp His Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln
Phe 85 90 95 Tyr Gly Leu Thr Glu Glu Asp Asn Trp Ser Glu Asp Ser
Pro Lys Pro 100 105 110 Val Thr Gln Asn Ile Ser Ala Glu Ala Trp Gly
Arg Ala Asp Cys Arg 115 120 125 Ile Thr Ser Ala Ser Tyr Gln Gln Gly
Val Leu Ser Ala Thr Ile Leu 130 135 140 Tyr Glu Ile Leu Ile Gly Lys
Leu Tyr Ala Val Leu Val Ser Thr Leu 145 150 155 160 Val Val Met Thr
Met Val Lys Arg Lys Ser Ser 165 170 154173PRTRattus norvegicus
154Asp Leu Lys Thr Val Thr Pro Pro Lys Val Ser Leu Phe Glu Pro Ser
1 5 10 15 Glu Ala Glu Ile Thr Asp Lys Gln Lys Ala Thr Leu Val Cys
Leu Ala 20 25 30 Arg Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp
Trp Val Asn Gly 35 40 45 Lys Glu Ile Arg Asn Gly Val Ser Thr Asp
Pro Gln Ala Tyr Lys Glu 50 55 60 Ser Asn Asn Ile Thr Tyr Cys Leu
Ser Ser Arg Leu Arg Val Ser Ala 65 70 75 80 Pro Phe Trp His Asn Pro
Arg Asn His Phe Arg Cys Gln Val Gln Phe 85 90 95 Tyr Gly Leu Thr
Glu Glu Asp Asn Trp Ser Glu Asp Ser Pro Lys Pro 100 105 110 Val Thr
Gln Asn Ile Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly 115 120 125
Ile Thr Ser Ala Ser Tyr His Gln Gly Val Leu Ser Ala Thr Ile Leu 130
135 140 Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val
Ser 145 150 155 160 Ala Leu Val Leu Met Ala Met Val Lys Lys Lys Asn
Ser 165 170 15515PRTMycobacterium tuberculosis 155Glu Glu Ser Asn
Thr Phe Gly Leu Gln Leu Glu Leu Thr Glu Gly 1 5 10 15 1569PRTHomo
sapiens 156Gly Leu Arg Ile Leu Leu Leu Lys Val 1 5
1578PRTartificial sequenceSynthetic peptide 157Lys Pro Thr Ile Phe
Leu Pro Ser 1 5 15819PRTartificial sequenceSynthetic peptide 158Lys
Ala Gly Thr Tyr Leu Cys Leu Leu Glu Lys Phe Phe Pro Asp Val 1 5 10
15 Ile Lys Ile 1597PRTartificial sequenceSynthetic peptide 159Ser
Trp Leu Thr Val Pro Glu 1 5 1607PRTartificial sequenceSynthetic
peptide 160Lys Glu His Arg Cys Ile Val 1 5 16111PRTartificial
sequenceSynthetic peptide 161Asp Gln Glu Ile Ile Phe Pro Pro Ile
Lys Thr 1 5 10 1627PRTartificial sequenceSynthetic peptide 162Asp
Thr Leu Leu Leu Gln Leu 1 5 16332PRTartificial sequenceSynthetic
peptide 163Ala Tyr Tyr Met Tyr Leu Leu Leu Leu Leu Lys Ser Val Val
Tyr Phe 1 5 10 15 Ala Ile Ile Thr Cys Cys Leu Leu Arg Arg Thr Ala
Phe Cys Cys Asn 20 25 30 16415PRTartificial sequenceSynthetic
peptide 164Lys Pro Thr Ile Phe Leu Pro Ser Ser Trp Leu Thr Val Pro
Glu 1 5 10 15 16514PRTartificial sequenceSynthetic peptide 165Lys
Glu His Arg Cys Ile Val Asp Thr Leu Leu Leu Gln Leu 1 5 10
16620PRTartificial sequenceSynthetic peptide 166Ala Tyr Tyr Met Tyr
Leu Leu Leu Leu Leu Lys Ser Val Val Tyr Phe 1 5 10 15 Ala Ile Ile
Thr 20 16720PRTartificial sequenceSynthetic peptide 167Val Val Tyr
Phe Ala Ile Ile Thr Cys Cys Leu Leu Arg Arg Thr Ala 1 5 10 15 Phe
Cys Cys Asn 20 168141PRTHomo sapiens 168Asp Ile Gln Asn Pro Asp Pro
Ala Val Tyr Gln Leu Arg Asp Ser Lys 1 5 10 15 Ser Ser Asp Lys Ser
Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr 20 25 30 Asn Val Ser
Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr 35 40 45 Val
Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala 50 55
60 Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser
65 70 75 80 Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser
Cys Asp 85 90 95 Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr
Asn Leu Asn Phe 100 105 110 Gln Asn Leu Ser Val Ile Gly Phe Arg Ile
Leu Leu Leu Lys Val Ala 115 120 125 Gly Phe Asn Leu Leu Met Thr Leu
Arg Leu Trp Ser Ser 130 135 140 169176PRTHomo sapiens 169Asp Leu
Asn Lys Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro Ser 1 5 10 15
Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu Ala 20
25 30 Thr Gly Phe Phe Pro Asp His Val Glu Leu Ser Trp Trp Val Asn
Gly 35 40 45 Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro
Leu Lys Glu 50 55 60 Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu
Ser Ser Arg Leu Arg 65 70 75 80 Val Ser Ala Thr Phe Trp Gln Asn Pro
Arg Asn His Phe Arg Cys Gln 85 90 95 Val Gln Phe Tyr Gly Leu Ser
Glu Asn Asp Glu Trp Thr Gln Asp Arg 100 105 110 Ala Lys Pro Val Thr
Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala 115 120 125 Asp Cys Gly
Phe Thr Ser Val Ser Tyr Gln Gln Gly Val Leu Ser Ala 130 135 140 Thr
Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val 145 150
155 160 Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp
Phe 165 170 175 170179PRTHomo sapiens 170Glu Asp Leu Lys Asn Val
Phe Pro Pro Glu Val Ala Val Phe Glu Pro 1 5 10 15 Ser Glu Ala Glu
Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 20 25 30 Ala Thr
Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 35 40 45
Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 50
55 60 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg
Leu 65 70 75 80 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His
Phe Arg Cys 85 90 95 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp
Glu Trp Thr Gln Asp 100 105 110 Arg Ala Lys Pro Val Thr Gln Ile Val
Ser Ala Glu Ala Trp Gly Arg 115 120 125 Ala Asp Cys Gly Phe Thr Ser
Glu Ser Tyr Gln Gln Gly Val Leu Ser 130 135 140 Ala Thr Ile Leu Tyr
Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 145 150 155 160 Val Leu
Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 165 170 175
Ser Arg Gly 171153PRTHomo sapiens 171Ser Gln Pro His Thr Lys Pro
Ser Val Phe Val Met Lys Asn Gly Thr 1 5 10 15 Asn Val Ala Cys Leu
Val Lys Glu Phe Tyr Pro Lys Asp Ile Arg Ile 20 25 30 Asn Leu Val
Ser Ser Lys Lys Ile Thr Glu Phe Asp Pro Ala Ile Val 35 40 45 Ile
Ser Pro Ser Gly Lys Tyr Asn Ala Val Lys Leu Gly Lys Tyr Glu 50 55
60 Asp Ser Asn Ser Val Thr Cys Ser Val Gln His Asp Asn Lys Thr Val
65 70 75 80 His Ser Thr Asp Phe Glu Val Lys Thr Asp Ser Thr Asp His
Val Lys 85 90 95 Pro Lys Glu Thr Glu Asn Thr Lys Gln Pro Ser Lys
Ser Cys His Lys 100 105 110 Pro Lys Ala Ile Val His Thr Glu Lys Val
Asn Met Met Ser Leu Thr 115 120 125 Val Leu Gly Leu Arg Met Leu Phe
Ala Lys Thr Val Ala Val Asn Phe 130 135 140 Leu Leu Thr Ala Lys Leu
Phe Phe Leu 145 150 172173PRTHomo sapiens 172Asp Lys Gln Leu Asp
Ala Asp Val Ser Pro Lys Pro Thr Ile Phe Leu 1 5 10 15 Pro Ser Ile
Ala Glu Thr Lys Leu Gln Lys Ala Gly Thr Tyr Leu Cys 20 25 30 Leu
Leu Glu Lys Phe Phe Pro Asp Val Ile Lys Ile His Trp Gln Glu 35 40
45 Lys Lys Ser Asn Thr Ile Leu Gly Ser Gln Glu Gly Asn Thr Met Lys
50 55 60 Thr Asn Asp Thr Tyr Met Lys Phe Ser Trp Leu Thr Val Pro
Glu Lys 65 70 75 80 Ser Leu Asp Lys Glu His Arg Cys Ile Val Arg His
Glu Asn Asn Lys 85 90 95 Asn Gly Val Asp Gln Glu Ile Ile Phe Pro
Pro Ile Lys Thr Asp Val 100 105 110 Ile Thr Met Asp Pro Lys Asp Asn
Cys Ser Lys Asp Ala Asn Asp Thr 115 120 125 Leu Leu Leu Gln Leu Thr
Asn Thr Ser Ala Tyr Tyr Met Tyr Leu Leu 130 135 140 Leu Leu Leu Lys
Ser Val Val Tyr Phe Ala Ile Ile Thr Cys Cys Leu 145 150 155 160 Leu
Arg Arg Thr Ala Phe Cys Cys Asn Gly Glu Lys Ser 165 170
173166PRTHomo sapiens 173Val Ser Pro Lys Pro Thr Ile Phe Leu Pro
Ser Ile Ala Glu Thr Lys 1 5 10 15 Leu Gln Lys Ala Gly Thr Tyr Leu
Cys Leu Leu Glu Lys Phe Phe Pro 20 25 30 Asp Val Ile Lys Ile His
Trp Gln Glu Lys Lys Ser Asn Thr Ile Leu 35 40 45 Gly Ser Gln Glu
Gly Asn Thr Met Lys Thr Asn Asp Thr Tyr Met Lys 50 55 60 Phe Ser
Trp Leu Thr Val Pro Glu Lys Ser Leu Asp Lys Glu His Arg 65 70 75 80
Cys Ile Val Arg His Glu Asn Asn Lys Asn Gly Val Asp Gln Glu Ile 85
90 95 Ile Phe Pro Pro Ile Lys Thr Asp Val Ile Thr Met Asp Pro Lys
Asp 100 105 110 Asn Cys Ser Lys Asp Ala Asn Asp Thr Leu Leu Leu Gln
Leu Thr Asn 115 120 125 Thr Ser Ala Tyr Tyr Met Tyr Leu Leu Leu Leu
Leu Lys Ser Val Val 130 135 140 Tyr Phe Ala Ile Ile Thr Cys Cys Leu
Leu Arg Arg Thr Ala Phe Cys 145 150 155 160 Cys Asn Gly Glu Lys Ser
165 174204PRTHomo sapiens 174Lys Gln Leu Asp Ala Asp Val Ser Pro
Lys Pro Thr Ile Phe Leu Pro 1 5 10 15 Ser Ile Ala Glu Thr Lys Leu
Gln Lys Ala Gly Thr Tyr Leu Cys Leu 20 25 30 Leu Glu Lys Phe Phe
Pro Asp Ile Ile Lys Ile His Trp Gln Glu Lys 35 40 45 Lys Ser Asn
Thr Ile Leu Gly Ser Gln Glu Gly Asn Thr Met Lys Thr 50 55 60 Asn
Asp Thr Tyr Met Lys Phe Ser Trp Leu Thr Val Pro Glu Glu Ser 65 70
75 80 Leu Asp Lys Glu His Arg Cys Ile Val Arg His Glu Asn Asn Lys
Asn 85 90 95 Gly Ile Asp Gln Glu Ile Ile Phe Pro Pro Ile Lys Thr
Asp Val Thr 100 105 110 Thr Val Asp Pro Lys Asp Ser Tyr Ser Lys Asp
Ala Asn Asp Val Thr 115 120 125 Thr Val Asp Pro Lys Tyr Asn Tyr Ser
Lys Asp Ala Asn Asp Val Ile 130 135 140 Thr Met Asp Pro Lys Asp Asn
Trp Ser Lys Asp Ala Asn Asp Thr Leu 145 150 155 160 Leu Leu Gln Leu
Thr Asn Thr Ser Ala Tyr Tyr Met Tyr Leu Leu Leu 165 170 175 Leu Leu
Lys Ser Val Val Tyr Phe Ala Ile Ile Thr Cys Cys Leu Leu 180 185 190
Gly Arg Thr Ala Phe Cys Cys Asn Gly Glu Lys Ser 195 200
175188PRTHomo sapiens 175Lys Gln Leu Asp Ala Asp Val Ser Pro Lys
Pro Thr Ile Phe Leu Pro 1 5 10 15 Ser Ile Ala Glu Thr Lys Leu Gln
Lys Ala Gly Thr Tyr Leu Cys Leu 20 25 30 Leu Glu Lys Phe Phe Pro
Asp Ile Ile Lys Ile His Trp Gln Glu Lys 35 40 45 Lys Ser Asn Thr
Ile Leu Gly Ser Gln Glu Gly Asn Thr Met Lys Thr 50 55 60 Asn Asp
Thr Tyr Met Lys Phe Ser Trp Leu Thr Val Pro Glu Glu Ser 65 70 75 80
Leu Asp Lys Glu His Arg Cys Ile Val Arg His Glu Asn Asn Lys Asn 85
90 95 Gly Ile Asp Gln Glu Ile Ile Phe Pro Pro Ile Lys Thr Asp Val
Thr 100 105 110 Thr Val Asp Pro Lys Tyr Asn Tyr Ser Lys Asp Ala Asn
Asp Val Ile 115 120 125 Thr Met Asp Pro Lys Asp Asn Trp Ser Lys Asp
Ala Ile Asp Thr Leu 130 135 140 Leu Leu Gln Leu Thr Asn Thr Ser Ala
Tyr Tyr Met Tyr Leu Leu Leu 145 150 155 160 Leu Leu Lys Ser Gly Val
Tyr Phe Ala Ile Ile Thr Cys Cys Leu Leu 165 170 175 Arg Arg Thr Ala
Phe Cys Cys Asn Gly Glu Lys Ser 180 185 176426DNAHomo sapiens
176gatatccaga accctgaccc tgccgtgtac cagctgagag actctaaatc
cagtgacaag 60tctgtctgcc tattcaccga ttttgattct caaacaaatg tgtcacaaag
taaggattct 120gatgtgtata tcacagacaa aactgtgcta gacatgaggt
ctatggactt caagagcaac 180agtgctgtgg cctggagcaa caaatctgac
tttgcatgtg caaacgcctt caacaacagc 240attattccag aagacacctt
cttccccagc ccagaaagtt cctgtgatgt caagctggtc 300gagaaaagct
ttgaaacaga tacgaaccta aactttcaaa acctgtcagt gattgggttc
360cgaatcctcc tcctgaaagt ggccgggttt aatctgctca tgacgctgcg
gctgtggtcc 420agctga 426177533DNAHomo sapiens 177aggacctgaa
caaggtgttc ccacccgagg tcgctgtgtt tgagccatca gaagcagaga 60tctcccacac
ccaaaaggcc acactggtgt gcctggccac aggcttcttc cccgaccacg
120tggagctgag ctggtgggtg aatgggaagg aggtgcacag tggggtcagc
acggacccgc 180agcccctcaa ggagcagccc gccctcaatg actccagata
ctgcctgagc agccgcctga 240gggtctcggc caccttctgg cagaaccccc
gcaaccactt ccgctgtcaa gtccagttct 300acgggctctc ggagaatgac
gagtggaccc aggatagggc caaacccgtc acccagatcg 360tcagcgccga
ggcctggggt agagcagact gtggctttac ctcggtgtcc taccagcaag
420gggtcctgtc tgccaccatc ctctatgaga tcctgctagg gaaggccacc
ctgtatgctg 480tgctggtcag cgcccttgtg ttgatggcca tggtcaagag
aaaggatttc tga 533178539DNAHomo sapiens 178aggacctgaa aaacgtgttc
ccacccgagg tcgctgtgtt tgagccatca gaagcagaga 60tctcccacac ccaaaaggcc
acactggtgt gcctggccac aggcttctac cccgaccacg 120tggagctgag
ctggtgggtg aatgggaagg aggtgcacag tggggtcagc acagacccgc
180agcccctcaa ggagcagccc gccctcaatg actccagata ctgcctgagc
agccgcctga 240gggtctcggc caccttctgg cagaaccccc gcaaccactt
ccgctgtcaa gtccagttct 300acgggctctc ggagaatgac gagtggaccc
aggatagggc caaacctgtc acccagatcg 360tcagcgccga ggcctggggt
agagcagact gtggcttcac
ctccgagtct taccagcaag 420gggtcctgtc tgccaccatc ctctatgaga
tcttgctagg gaaggccacc ttgtatgccg 480tgctggtcag tgccctcgtg
ctgatggcca tggtcaagag aaaggattcc agaggctag 539179534DNAHomo sapiens
179ccttcctaca ctgggggata cgccgataaa ctcatctttg gaaaaggaac
ccgtgtgact 60gtggaaccaa gaagtcagcc tcataccaaa ccatccgttt ttgtcatgaa
aaatggaaca 120aatgtcgctt gtctggtgaa ggaattctac cccaaggata
taagaataaa tctcgtgtca 180tccaagaaga taacagagtt tgatcctgct
attgtcatct ctcccagtgg gaagtacaat 240gctgtcaagc ttggtaaata
tgaagattca aattcagtga catgttcagt tcaacacgac 300aataaaactg
tgcactccac tgactttgaa gtgaagacag attctacaga tcacgtaaaa
360ccaaaggaaa ctgaaaacac aaagcaacct tcaaagagct gccataaacc
caaagccata 420gttcataccg agaaggtgaa catgatgtcc ctcacagtgc
ttgggctacg aatgctgttt 480gcaaagactg ttgccgtcaa ttttctcttg
actgccaagt tatttttctt gtaa 534180501DNAHomo sapiens 180gtttccccca
agcccactat ttttcttcct tcaattgctg aaacaaagct ccagaaggct 60ggaacatacc
tttgtcttct tgagaaattt ttccctgatg ttattaagat acattggcaa
120gaaaagaaga gcaacacgat tctgggatcc caggagggga acaccatgaa
gactaacgac 180acatacatga aatttagctg gttaacggtg ccagaaaagt
cactggacaa agaacacaga 240tgtatcgtca gacatgagaa taataaaaac
ggagttgatc aagaaattat ctttcctcca 300ataaagacag atgtcatcac
aatggatccc aaagacaatt gttcaaaaga tgcaaatgat 360acactactgc
tgcagctcac aaacacctct gcatattaca tgtacctcct cctgctcctc
420aagagtgtgg tctattttgc catcatcacc tgctgtctgc ttagaagaac
ggctttctgc 480tgcaatggag agaaatcata a 501181617DNAHomo sapiens
181ataaacaact tgatgcagat gtttccccca agcccactat ttttcttcct
tcgattgctg 60aaacaaaact ccagaaggct ggaacatatc tttgtcttct tgagaaattt
ttcccagata 120ttattaagat acattggcaa gaaaagaaga gcaacacgat
tctgggatcc caggagggga 180acaccatgaa gactaacgac acatacatga
aatttagctg gttaacggtg ccagaagagt 240cactggacaa agaacacaga
tgtatcgtca gacatgagaa taataaaaac ggaattgatc 300aagaaattat
ctttcctcca ataaagacag atgtcaccac agtggatccc aaagacagtt
360attcaaaaga tgcaaatgat gtcaccacag tggatcccaa atacaattat
tcaaaggatg 420caaatgatgt catcacaatg gatcccaaag acaattggtc
aaaagatgca aatgatacac 480tactgctgca gctcacaaac acctctgcat
attacatgta cctcctcctg ctcctcaaga 540gtgtggtcta ttttgccatc
atcacctgct gtctgcttgg aagaacggct ttctgctgca 600atggagagaa atcataa
617182569DNAHomo sapiens 182ataaacaact tgatgcagat gtttccccca
agcccactat ttttcttcct tcgattgctg 60aaacaaaact ccagaaggct ggaacatacc
tttgtcttct tgagaaattt ttcccagata 120ttattaagat acattggcaa
gaaaagaaga gcaacacgat tctgggatcc caggagggga 180acaccatgaa
gactaacgac acatacatga aatttagctg gttaacggtg ccagaagagt
240cactggacaa agaacacaga tgtatcgtca gacatgagaa taataaaaac
ggaattgatc 300aagaaattat ctttcctcca ataaagacag atgtcaccac
agtggatccc aaatacaatt 360attcaaagga tgcaaatgat gtcatcacaa
tggatcccaa agacaattgg tcaaaagatg 420caattgatac actactgctg
cagctcacaa acacctctgc atattacatg tacctcctcc 480tgctcctcaa
gagtggtgtc tattttgcca tcatcacctg ctgtctgctt agaagaacgg
540ctttctgctg caatggagag aaatcataa 56918324DNAARTIFICIAL
SEQUENCESynthetic oligonucleotide 183aagcccacta tttttcttcc ttca
2418457DNAARTIFICIAL SEQUENCESynthetic oligonucleotide
184aaggctggaa catacctttg tcttcttgag aaatttttcc ctgatgttat taagata
5718521DNAARTIFICIAL SEQUENCESynthetic oligonucleotide
185agctggttaa cggtgccaga a 2118621DNAARTIFICIAL SEQUENCESynthetic
oligonucleotide 186aaagaacaca gatgtatcgt c 2118733DNAARTIFICIAL
SEQUENCESynthetic oligonucleotide 187gatcaagaaa ttatctttcc
tccaataaag aca 3318821DNAARTIFICIAL SEQUENCESynthetic
oligonucleotide 188gatacactac tgctgcagct c 2118996DNAARTIFICIAL
SEQUENCESynthetic oligonucleotide 189gcatattaca tgtacctcct
cctgctcctc aagagtgtgg tctattttgc catcatcacc 60tgctgtctgc ttagaagaac
ggctttctgc tgcaat 9619045DNAARTIFICIAL SEQUENCESynthetic
oligonucleotide 190aagcccacta tttttcttcc ttcaagctgg ttaacggtgc
cagaa 4519142DNAARTIFICIAL SEQUENCESynthetic oligonucleotide
191aaagaacaca gatgtatcgt cgatacacta ctgctgcagc tc
4219260DNAARTIFICIAL SEQUENCESynthetic oligonucleotide
192gcatattaca tgtacctcct cctgctcctc aagagtgtgg tctattttgc
catcatcacc 6019336DNAARTIFICIAL SEQUENCESynthetic oligonucleotide
193tgctgtctgc ttagaagaac ggctttctgc tgcaat 36
* * * * *
References