U.S. patent application number 14/801366 was filed with the patent office on 2015-11-05 for sirna against cbl-b and optionally il-2 and il-12 for use in the treatment of cancer.
This patent application is currently assigned to APEIRON BIOLOGICS AG. The applicant listed for this patent is APEIRON BIOLOGICS AG. Invention is credited to Isabella Haslinger, Gunther Lametschwandtner, Hans Loibner, Manfred Schuster, Sandra Seidl.
Application Number | 20150313931 14/801366 |
Document ID | / |
Family ID | 43902675 |
Filed Date | 2015-11-05 |
United States Patent
Application |
20150313931 |
Kind Code |
A1 |
Lametschwandtner; Gunther ;
et al. |
November 5, 2015 |
SIRNA AGAINST CBL-B AND OPTIONALLY IL-2 AND IL-12 FOR USE IN THE
TREATMENT OF CANCER
Abstract
The invention relates to a method for the immune activation of
NK cells by the reduction or inhibition of the Cbl-b function in
said cells. This stimulates the congenital immune system and thus
permits the therapy of appropriate diseases.
Inventors: |
Lametschwandtner; Gunther;
(Vienna, AT) ; Loibner; Hans; (Vienna, AT)
; Schuster; Manfred; (Schrick, AT) ; Haslinger;
Isabella; (Vienna, AT) ; Seidl; Sandra;
(Vienna, AT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
APEIRON BIOLOGICS AG |
Vienna |
|
AT |
|
|
Assignee: |
APEIRON BIOLOGICS AG
Vienna
AT
|
Family ID: |
43902675 |
Appl. No.: |
14/801366 |
Filed: |
July 16, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13977453 |
Aug 1, 2013 |
|
|
|
PCT/EP11/74099 |
Dec 27, 2011 |
|
|
|
14801366 |
|
|
|
|
Current U.S.
Class: |
424/85.2 ;
424/85.6; 424/85.7 |
Current CPC
Class: |
A61K 9/127 20130101;
A61K 38/2013 20130101; A61P 35/00 20180101; A61K 38/208 20130101;
A61K 38/215 20130101; C12N 15/1137 20130101; A61K 38/20 20130101;
A61K 38/212 20130101; A61K 38/2013 20130101; A61K 2300/00 20130101;
A61K 2300/00 20130101; A61K 38/208 20130101; A61K 31/713 20130101;
C12Y 603/02 20130101; C12N 2310/14 20130101 |
International
Class: |
A61K 31/713 20060101
A61K031/713; A61K 38/21 20060101 A61K038/21; A61K 9/127 20060101
A61K009/127; A61K 38/20 20060101 A61K038/20 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 28, 2010 |
EP |
10197146.3 |
Claims
1. A method of treating cancer in a patient comprising
administering at least one Cbl-b inhibitory nucleic acid further
defined as an antisense oligonucleotide, siRNA, or shRNA, in
combination with at least one NK cell-stimulatory substance further
defined as IL-2, IFN-alpha, IL-12 and IL-7, or IL-12 and IL-15 to
at least one NK cell of the patient in vivo and/or ex vivo, thereby
immune activating the at least one NK cell.
2. The method of claim 1, wherein when the Cbl-b inhibitor is
administered in combination with IL-2, one or more of IL-12, IL-23,
IFN-alpha, or IFN-beta, or any combination thereof is also
administered.
3. The method of claim 1, wherein when the Cbl-b inhibitor is
administered in combination with IFN-alpha, one or both of IL-15 or
IL-21 is also administered.
4. The method of claim 1, wherein when the Cbl-b inhibitor is
administered in combination with IL-12, one or both of IL-15 or
IL-7 is also administered.
5. The method of claim 1, wherein the Cbl-b inhibitor and at least
one further NK cell-stimulatory substance is administered in
combination with at least one of an immune cell-stimulatory
cytokine, an interferon or interferon stimulator, an antibody
having an Fc domain, or a TLR or PAMP receptor ligand.
6. The method of claim 1, wherein the Cbl-b inhibitor and at least
one further NK cell-stimulatory substance is administered in
combination with at least one of a cytokine of the common
gamma-chain cytokine, a cytokine of both the adaptive and the
innate immune system, an effector cell cytokine, a TLR receptor
agonist, or a PAMP receptor agonist.
7. The method of claim 1, wherein the at least one Cbl-b inhibitor
and the at least one further NK cell-stimulatory substance are
comprised in one or more pharmaceutically acceptable carrier.
8. The method of claim 7, wherein the pharmaceutically acceptable
carrier is suitable for intracellular administration in a
patient.
9. The method of claim 8, wherein the pharmaceutically acceptable
carrier is a liposomal or microsomal formulation.
10. The method of claim 1, wherein the patient is a mammal.
11. The method of claim 10, wherein the patient is a human.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Application Ser.
No. 13/977,453, which is a national phase application under 35
U.S.C. .sctn.371 of International Application No. PCT/EP2011/074099
filed 27 Dec. 2011, which claims priority to European Application
No. 10197146.3 filed 28 Dec. 2010. The entire contents of each of
the above-referenced disclosures is specifically incorporated
herein by reference without disclaimer.
BACKGROUND OF THE INVENTION
[0002] 1. Technical Field
[0003] The present invention relates to therapeutic methods for
activating the innate immune system, in particular NK cells.
[0004] 2. Description of Related Art
[0005] NK cells (natural killer cells) pertain to the group of
lymphocytes (a subtype of white blood cells or leukocytes). They
are capable of recognizing and killing abnormal cells, such as
tumor cells and virus-infected cells. NK cells do not have
antigen-specific receptors and are a part of the innate immune
system. NK cells recognize, i. a., the MHC I complex, which is
found on virtually all healthy cells of the body. If a cell is
infected by viruses or transforms into a tumor cell, the MHC I
complex located on the cell surface may be lost. Like other
lymphocytes, NK cells develop from lymphoid progenitor cells in the
bone marrow and at a later stage circulate in the bloodstream.
[0006] Loeser et al. (JEM (2007) doi:10.1084/iem.20061699) have
shown that Cbl-b is a negative regulator that is largely
responsible for the so-called immunoreactivity of T cells. Cbl-b
suppresses the activation of T cells and is capable of preventing
autoimmune reactions. In the absence of Cbl-b, substances that are
administered, but are hardly immunogenic, may lead to the induction
of a strong immune response. Furthermore, Cbl-b-deficient mice
(homozygous gene knockout) are viable and their immune system is
capable of efficiently recognizing autologously induced tumors and
establishing a lytic immune response thereto which is mainly based
on CD8.sup.+T cells. However, the complete deactivation of the
enzyme, as described in this document, also leads to an increase in
autoimmunity after the immunization with superantigens.
[0007] Chiang et al. (Journal of Clinical Investigation 117 (4)
(2007): 1033-1034) state that Cbl-b.sup.-/.sup.-CD8.sup.+T cells
can be used to enhance the anti-tumor reactivity in E.G7 mice.
[0008] Kojo et al. (PNAS 2009, 106 (42): 17847-17851) describe a
mechanism that is influenced by Cbl-b in an artificially induced
anergy of NKT cells.
[0009] WO 2008/033403 A describes the increase in reactivity of
CD8.sup.+T cells by reducing the activity of Cbl-b. Inhibitory RNA
sequences, in particular those from siRNA, directed against Cbl-b
are disclosed.
[0010] WO 2009/073905 A2 describes an ex vivo treatment of cells of
the immune system by means of Cbl-b inhibitors.
[0011] WO 2010/119061 A1 relates to methods for the intracellular
determination of the expression of Cbl-b.
[0012] Lametschwandtner et al. (Journal of Immunotherapy 31 (9)
(2008): 943) describe immunotherapies which are based on the
suppression of Cbl-b in T cells.
[0013] Wigginton et al. (Expert Opinion on Biological Therapy 2002,
2 (5): 513-524) describe the infiltration of tumor tissue by
CD8.sup.+T cells upon the administration of IL-12 and IL-2.
[0014] Weiss et al. (Expert Opinion on Biological Therapy, 2007, 7
(11): 1705-1721) describe various combinations of IL-12 and other
cytokines as anticancer agents.
[0015] Lametschwandtner et al. (J. of Immunotherapy 2010, 33 (8):
899) describe immune-enhancing effects of IL-7.
[0016] Stromnes et al. (J. of Clinical Investigation 2010, 120
(10): 3722-3734) show that the administration of ex vivo expanded
Cbl-b.sup.-/.sup.-CD8.sup.+T cells in an adoptive immunotherapy in
mice induces an anti-tumor response in vivo.
[0017] Thus it was already known that T-cells, i. e. cells of the
adaptive immune system, may be activated by means of Cbl-b
inhibition in order to promote an immune response. Such a promotion
of the immune response is of therapeutic interest, in particular
with respect to severe chronic diseases in which the insufficient
activity of the immune system is causal for the progression of the
disease. Such disorders are, for example, chronic infections or
tumor diseases. However, in particular effective immune responses
in these diseases require an efficient interaction of the adaptive
and the innate immune system. However, no sufficient treatment
approaches are clinically available yet, in particular with respect
to the activation of NK cells.
SUMMARY OF THE INVENTION
[0018] It is therefore a primary object of the present invention to
find new methods which are capable of providing a significantly
improved efficiency of the immune response by activating the innate
immune system, with particular reference to NK cells.
[0019] According to the present invention, this object has been
achieved by the inhibition of Cbl-b in NK cells.
[0020] In a first aspect, the present invention relates a method
for the immune activation of NK cells, comprising the step of
reducing or inhibiting the function of Cbl-b in NK cells. This
inhibition may be achieved by the administration of a Cbl-b
inhibitor. Such an inhibitor may be directly administered to a
patient in vivo.
[0021] In an equivalent related aspect, the present invention
relates to a Cbl-b inhibitor for use in a method for the
therapeutic treatment of a patient, comprising the introduction of
the Cbl-b inhibitor into NK cells in the patient. By this
treatment, the NK cells can be activated.
[0022] The terms "administration of a Cbl-b inhibitor" or "Cbl-b
inhibition" are used interchangeably herein, in particular with
respect to the description of specific embodiments.
[0023] The inhibition of Cbl-b according to the present invention
can be used for immunotherapies in a patient, in particular for the
activation of the immune system or the innate immune system,
specifically mediated by NK cells. In particular, the method
according to the present invention may be employed in the patient
for the treatment of cancer, a viral infection, a bacterial
infection, in particular a chronic infection, in particular a
chronic infection with persistent intracellular bacteria, or a
parasitic infection, in particular a mycosis. The therapy may be an
immunotherapy of a chronic disease, including chronic infections.
The infection may involve one or more organs, such as the liver.
Preferably, the infection is a viral infection. One example is
chronic hepatitis, e. g. triggered by a viral infection. The
treatment of hepatitis B or hepatitis C is particularly preferred.
The NK cell activation by the inhibition of Cbl-b according to the
present invention is in particular effective in such diseases. The
patient preferably is a mammal, in particular a human.
[0024] In particular in the case of cancer, the activation of NK
cells according to the present invention may be combined with
conventional therapies. Many tumor therapies, such as radiation
therapy, chemotherapy or the surgical removal of tumors have been
established for years and are constantly being refined and
improved. New therapies comprise immunotherapies and therapies that
are directed against specific markers of tumor cells, in particular
with the use of monoclonal antibodies. Particularly the effect of
the latter is largely dependent on the activity of NK cells that
recognize the tumor cell-bound antibodies via general antibody
determinants and consequently kill the tumor cell. The activation
of the innate immune system via the effect of NK cells thus
provides a further strategy that is able to complement and complete
the already existing approaches in order to promote immune
reactions on a broad scale, in particular for combating cancer
cells. In particular, therapies that have a direct cytotoxic effect
on tumor cells, such as chemotherapy or radiation therapy, are able
to induce the expression of molecules of the MHC class and other
immune-activating receptors, for example those of NKG2D ligands.
These cellular changes are recognized by the cells of the innate
immune system, in particular by NK cells, and lead to the
activation thereof, by means of which it is possible to achieve a
much stronger therapeutic effect owing to the synergy with the NK
cell activation according to the present invention.
[0025] Accordingly, the cancer disease to be treated according to
the present invention is preferably selected from cancer diseases
of the reproductive organs, in particular ovarian cancer,
testicular cancer, prostate cancer or breast cancer; cancer
diseases of the digestive tract, in particular stomach cancer,
colon cancer, rectal cancer, pancreatic cancer, esophageal cancer
and liver cancer; kidney cancer, skin cancer, in particular
melanoma, basal cell carcinoma and squamous cell carcinoma;
neuroblastoma and glioblastoma, lung cancer, thyroid cancer,
sarcoma, head and neck cancer, squamous cell carcinoma, lymphoma
and leukemia (wherein the terms "cancer", "tumor", "carcinoma" etc.
are always used interchangeably herein and refer to malignant
diseases).
[0026] The Cbl-b gene and its gene products have been extensively
described in the art (UniGene Id. Hs. 3144 and Hs. 381921). Cbl-b
sequences are, e.g., publicly available in the GenBank database
under the Acc. Nos. NM.sub.--008279 and NP.sub.--009112. Anti-Cbl-b
antibodies, siRNAs and antisense inhibitors are commercially
available. Specific siRNAs that are suitable for reducing or
inhibiting the expression and thus the function of Cbl-b have been
disclosed, for example, in document US 2007/0054355 in the form of
mixed RNA/DNA nucleotides and having a length of about 20
bases.
[0027] Cbl-b inhibitors are well known in the prior art. According
to the present invention, any Cbl-b inhibitor may be used.
Preferably, the Cbl-b inhibitor is selected from inhibitory nucleic
acids, in particular antisense oligonucleotides, in particular
antisense RNA, siRNA (small interfering RNA) or shRNA (short
hairpin RNA). Nucleic acid inhibitors can either be used as such or
in the form of vectors which encode and express the inhibition.
Suitable Cbl-b inhibitors are, for example, antagonists, aptamers
or intramers, wherein the use of Cbl-b siRNA is preferred. siRNA
technology for the attenuation of the specific gene expression has
already been described for Cbl-b. Cbl-b inhibitors in accordance
with the present invention are substances that reduce or inhibit
the expression and/or function of Cbl-b and may either be
identified as is known in the prior art (Loeser et al. (JEM (2007)
doi:10.1084/iem.20061699; Chiang et al. (Journal of Clinical
Investigation 117 (4) (2007): 1033-1034); Lametschwandtner et al.
(Journal of Immunotherapy 31 (9) (2008): 943); Paolini et al. (J.
Immunol. 2011 Feb. 15; 186 (4): 2138-47) or as described in the
Examples of the present application.
[0028] US 2007/0087988 relates to a method for regulating HPK1,
whose expression may be enhanced by increasing the expression of
Cbl-b, and vice versa (e.g. by Cbl-b siRNA inhibition).
[0029] Preferably, the function of Cbl-b is reduced or inhibited by
reducing or inhibiting the expression of Cbl-b. The terms
"reduce/reduction" or "inhibit/inhibition" relate to a reduction or
inhibition of the function (or expression) of Cbl-b as compared to
the unmodified natural function, optionally including the complete
inhibition of said function. Preferably, the function (or
expression) is reduced by at least 30%, 40%, 50%, 60%, 70%, 80%,
90% or 95%.
[0030] In preferred embodiments of the present invention, the
reduction or inhibition of the function of Cbl-b is transient, i.e.
the function is only temporarily reduced as described in the above
and can therefore recover again, e. g. by consumption or
degradation of inhibitors, such as Cbl-b siRNA, or by restructuring
or non-Cbl-b-impaired cells in vivo. The transient reduction of
Cbl-b in immune cells can also be performed in a repetitive manner,
e.g. until a therapeutic success has been achieved.
[0031] Preferably, the expression of Cbl-b is reduced or inhibited
by the use of Cbl-b antisense RNA or siRNA. For this purpose, short
DNA and/or RNA sequences that are complementary to one of the
regions of the target (Cbl-b) mRNA sequence are employed, so that
hybridization and inactivation of the corresponding sequences will
occur. These sequences preferably have a length of at least 15, 18,
20, 22, 25, 28, 30, 35, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160,
180 or up to 200 bases until the length of the complete target
sequence is reached, preferably up to 2500, 2000, 1500, 1000, 500
or 300 bases. Preferably, the sequences of SEQ ID Nos. 1, 2, 3, 4,
5, 6, 7 and/or 8 are used.
[0032] The function of Cbl-b can also be reduced or inhibited by a
plurality of other known components, e.g. by the use of Cbl-b
antagonists, inhibitors, in particular aptamers or intramers.
According to the present invention, any antagonists or inhibitors
that are capable of suppressing the effect or function of Cbl-b can
be used to enhance the immunoreactivity of NK cells. For the
inhibition of Cbl-b, substances may be used that either
specifically inhibit the enzymatic E3 ligase activity or inhibit
the intracellular association of Cbl-b with its interaction
partners or inhibit the expression of Cbl-b. Preferably,
antagonists or inhibitors can be used for the preparation of a
pharmaceutical agent for increasing the immunoreactivity of the NK
cells according to the present invention. Treatments of diseases
with a suppressed or inefficient immune system, in particular
cancer or chronic infections, are facilitated.
[0033] According to the present invention it was found that the
inhibition of Cbl-b together with further NK cell-stimulatory
substances (NK cell activators) induces a synergistic effect that
exceeds the effect that is to be expected based on the additive
effects of the inhibition of Cbl-b and the activation of NK cells.
Therefore, the administration of the Cbl-b inhibitor or the
inhibition of Cbl-b is preferably carried out together with a
further NK cell-stimulatory substance (NK cell activator). In the
following, the terms "NK cell-stimulatory substance", "NK
cell-activating substance" and "NK cell activator" are used
interchangeably. Such an NK cell-stimulatory substance is a
substance that differs from the Cbl-b inhibitor according to the
present invention. An NK cell-stimulatory substance according to
the present invention is a substance which induces the activation
or stimulation of NK cells in one or more suitable in vitro assays.
Preferably, the NK cell-stimulatory substance induces the
production of IFN-gamma and/or TNF-alpha and/or the surface
expression of CD107a by the NK cells in a manner independent of the
inhibition of Cbl-b. Such production of IFN-gamma and/or TNF-alpha
and/or surface expression of CD107a can be measured using methods
known in the art (Fauriat Blood. 2010 Mar. 18; 115 (11): 2167-76;
Dons'koi et al., J. Immunol. Methods 2011 Sep. 30; 372 (1-2):
187-95) or as is described in the Examples of the present
application. Likewise, the effect of the NK cell-stimulatory agents
may be tested by directly determining the cytotoxicity or "killing
activity" of the NK cells (as described in Example 4; other
suitable methods are well known in the art (Beano et al., J.
Transl. Med. 2008 May 16; 6: 25; Claus et al., J. Immunol. Methods
2009 February 28, 341 (1-2): 154-64; Fujisaki et al., Cancer Res.
2009 May 1, 69 (9): 4010-7; Cho et al., Clin. Cancer Res. 2010 Aug.
1, 16 (15): 3901-9), i.e. the cytotoxicity of NK cells and PBMCs,
respectively, against specific target cells (SKBR3 tumor cells in
Example 4) is determined, e.g. by measuring the release of the
enzyme LDH from the tumor cell cytosol as a measure for the degree
of cell lysis. In a corresponding in vitro measurement, the NK
cells are preferably activated or stimulated in order to be able to
measure the effect of the inhibition of Cbl-b, e.g. by contacting
with tumor cells (e. g. K562) and/or by using a NK cell-stimulatory
substance (e.g. one or more cytokines, such as IL-2 and/or IL-12)
and/or an antibody (e.g. trastuzumab (Herceptin.RTM.)).
[0034] In a specific embodiment, the present invention relates to
the co-administration of the Cbl-b inhibitor and an NK cell
activator, in particular selected from an immune cell-stimulatory
cytokine, e. g. a cytokine selected from the common gamma-chain
cytokines, in particular IL-2, IL-15 and IL-21; cytokines that
stimulate both the cells of the adaptive and of the innate immune
system, in particular IL-12, IL-23 and IL-27; effector cell
cytokines, such as IL-1, IL-17 and IL-18; an interferon, in
particular interferon-alpha; or an interferon stimulator; an
antibody, in particular an antibody which recognizes tumor cell
surface molecules and/or an antibody whose constant region is
capable of binding to the corresponding Fc receptor on NK cells; or
a TLR or PAMP receptor ligand, in particular agonists, preferably
of TLR-1, TLR-2, TLR-3, TLR-7, TLR-8 and TLR-9, as well as
combinations of the above-mentioned NK cell activators. The terms
"simultaneous" or "together with" or "in combination with" or
"combined with" as used in the context of the administration of the
substances according to the present invention refer to the
administration of at least one Cbl-b inhibitor and at least one NK
cell activator in a patient, which may be conducted in the form of
one (containing at least one Cbl-b inhibitor and at least one NK
cell activator) or more different pharmaceutical compositions (one
of which contains at least one Cbl-b inhibitor and the other at
least one NK cell activator and optionally other pharmaceutical
compositions). If the administration is carried out using a
plurality of different pharmaceutical compositions, the
co-administration may be conducted simultaneously or sequentially.
Particularly preferably, the administration of the Cbl-b inhibitor
is carried out in combination with at least one NK cell activator,
in particular IL-2, IL-15, IL-12, IL-23, interferon, an interferon
stimulator, imiquimod and other TLR7/8 agonists, e. g. resiquimod,
ssPolyU nucleotides, loxoribine, gardiquimod, CL075, CL097, CL264,
3M002, poly (I:C) oligonucleotides, CpG oligonucleotides, CD205
ligands or CD206 ligands, as well as combinations thereof.
Preferred combinations of NK cell activators that may be combined
with the administration of the Cbl-b inhibitor comprise, e.g., a
cytokine of the common gamma-chain cytokines in combination with
another of the above-mentioned NK cell activators; or a cytokine of
the both the adaptive and the innate immune system in combination
with another of the above-mentioned NK cell activators.
Particularly preferred combinations are those involving a cytokine
of the common gamma-chain cytokines and a cytokine of both the
adaptive and the innate immune system, in particular IL-2 and
IL-12.
[0035] According to the present invention, a cytokine of the common
gamma-chain cytokines is selected from the family of cytokines that
share the so-called common cytokine receptor gamma-chain
(.gamma..sub.c or CD132) in their receptor complexes and consists
of different members having a similar structure with four
alpha-helical bundles. This family includes, e. g., interleukin
(IL)-2, IL-4, IL-7, IL-9, IL-15, IL-21 and thymic stromal
lymphopoietin (TSLP). An immune cell-stimulatory cytokine, a
cytokine of both the adaptive and the innate immune system, an
effector cell cytokine or an interferon stimulator according to the
present invention are preferably selected from the group comprising
IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12,
IL-13, IL-14, IL-15, IL-16, IL- 17a, IL-17f, IL-18, IL-19, IL-20,
IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29,
IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, IFN-alpha, IFN-beta,
IFN-gamma, IFN-lambda, TNF-alpha and TNF-beta.
[0036] In a particularly preferred embodiment, the present
invention relates to the administration of a Cbl-b inhibitor in
combination with IL-2, optionally with one or more further NK cell
activators, in particular IL-12, IL-23, IFN-alpha and/or IFN-beta.
In a further particularly preferred embodiment, the present
invention relates to the administration of a Cbl-b inhibitor in
combination with IFN-alpha, optionally with one or more further NK
cell activators, in particular IL-15 and/or IL-21. In a further
particularly preferred embodiment, the present invention relates to
the administration of a Cbl-b inhibitor in combination with IL-12,
optionally with one or more further NK cell activators, in
particular IL-15 and/or IL-7.
[0037] Preferably, the NK cell-stimulatory substances used induce
in NK cells the production of IFN-gamma and/or TNF-alpha and/or an
increased surface expression of CD107a and/or an increased
cytotoxicity against the target cells. IFN-alpha, IL-12 or IL-23,
for instance, induce particularly strong IFN-gamma responses in NK
cells. Surprisingly, it was now found that the activation of NK
cells by the inhibition of Cbl-b with NK cell-stimulatory
substances that induce the production of IFN-gamma evoke
particularly strong synergistic effects that go far beyond the
expected effect of the individual substances.
[0038] Likewise, the Cbl-b inhibitor may be administered in
combination with an antibody, for example an antibody against tumor
cell determinants, optionally combined with one or more of the
above-mentioned immune activators or one or more of the
above-mentioned NK cell-stimulatory substances. The inhibition of
Cbl-b in NK cells as well as the administration of the additional
NK cell activator or the antibody directed against tumor cells may
be conducted in vivo, for example by direct administration to the
patient.
[0039] Preferably, the Cbl-b inhibitor is coupled to a ligand of an
NK cell recognition molecule, e.g. an NK cell surface molecule.
Such a ligand can, for example, be a naturally occurring protein, a
further biomolecule or a functional derivative thereof which is
capable of binding to NK cells. In particular, such a ligand may be
an antibody directed against an NK cell recognition molecule.
According to the present invention, the NK cells are preferably
specifically activated by the inhibition of Cbl-b in vivo, e. g. by
coupling to a ligand of such an NK cell recognition molecule. The
"specific" NK cell activation is to be understood as an effect on
NK cells that is enhanced as compared to the non-specific, e. g.
non-controlled or non-coupled, administration of a Cbl-b inhibitor,
which may also have an effect in other cells. In particular, the
"specific" NK cell activation is defined as an effect that is
particularly directed to NK cells, as compared to the
administration of a Cbl-b inhibitor alone (without the
co-administration of an NK cell activator) or as compared to the
administration of a Cbl-b inhibitor which is not coupled to a
ligand of an NK cell recognition molecule. A nonspecific
administration is carried out, e.g., by simple administration of
the inhibitor without an additional administration of NK cell
stimulators or NK cell-specific modifications of the inhibitor
achieved by coupling to an NK cell recognition molecule. By means
of the specific NK cell activation it is possible to control the NK
cell-mediated immune response according to the present invention
(innate immune system) with less undesired side effects which may,
e. g., be caused by the adaptive immune system.
[0040] The term "antibody" relates to all naturally occurring
antibodies, such as IgG, IgD, IgA, IgE and IgM antibodies as well
as functional derivatives thereof which comprise, e.g., Fab, Fab',
F(ab).sub.2, F(ab').sub.2 fragments, single-chain antibodies (scAb
or scFv) or a fragment of an antibody variable domain, and which
specifically bind to or are directed against an antigen, herein in
particular an NK cell recognition molecule, or the corresponding Fc
receptor on NK cells. Antibodies according to the present invention
preferably have a constant region, in particular an Fc domain,
which is capable of binding to the corresponding Fc receptor on NK
cells. The antibody can be monoclonal or polyclonal. Antibodies
which are to be administered within a therapy in combination with
the Cbl-b inhibitor of the present invention, as described in the
above, are directed against an epitope of a pathogen or a tumor and
preferably have an Fc domain.
[0041] Among the preferred NK cell recognition molecules are, in
particular, those which either specifically occur only on NK cells
or which are particularly frequently expressed on NK cells and
optionally on further additional immune cells whose activity can be
enhanced as desired by Cbl-b inhibition, for example, CD2, CD8a,
CD16, CD25, CD27, CD56, CD71, CD158, CD159, CD160, CD161, CD205,
CD206, CD205, CD314, CD335, CD336 and CD337. Thus, the Cbl-b
inhibitor can be contacted specifically with NK cells or with NK
cells and further relevant subtypes of immune cells in a patient
and can be taken up by the cells. Consequently, the Cbl-b inhibitor
will exert its therapeutic effect only in the desired target cells
in a specific manner.
[0042] In a further aspect, the present invention relates to a
pharmaceutical composition comprising a Cbl-b inhibitor and an
additional NK cell activator, as described above, in particular an
immune cell-stimulatory cytokine, an interferon or an interferon
stimulator, an antibody or a TLR or PAMP receptor ligand. Such a
composition can be used for the above-mentioned purpose of
inhibiting Cbl-b, either alone or in combination with further NK
cell activators.
[0043] Preferably, the composition comprises a pharmaceutically
acceptable carrier that is preferably suitable for the
intracellular administration in a patient. In particular, the
composition comprises vehicles such as liposomal or microsomal
formulations which are particularly preferred for the
administration of nucleic acids. Pharmaceutical compositions may
comprise pharmaceutically suitable salts as well as additional
buffers, tonicity components or pharmaceutically acceptable
carriers. In particular, inhibitory nucleic acids, such as
antisense nucleic acids, siRNA and shRNA, may be provided in
suitable therapeutic vector systems. Pharmaceutical carrier
substances are provided to improve the tolerability of the
composition and to improve the solubility and bioavailability of
the active ingredients. Examples include emulsifying agents,
thickening agents, redox components, starch, alcohol solutions,
polyethylene glycol or lipids. The selection of a suitable
pharmaceutical carrier strongly depends on the mode of
administration. For oral administration, liquid or solid carriers
can be used, whereas final compositions in liquid form are
advantageous for injections.
[0044] Preferably, the pharmaceutical composition to be used
according to the present invention comprises buffer substances or
tonic substances. By using a buffer, it is possible to adjust the
pH value of the pharmaceutical composition to physiological
conditions and to attenuate or buffer pH variations. An example for
such a substance is a phosphate buffer. Tonicity agents are used to
adjust the osmolarity and may comprise ionic substances, such as
inorganic salts, e. g. NaCl, or non-ionic substances, e. g.
glycerol, or carbohydrates.
[0045] Preferably, the composition to be used according to the
present invention is provided to be suitable for a systemic,
topical, oral or intranasal administration. These routes of
administration of the pharmaceutical composition according to the
present invention allow for a quick and easy intake. In case of an
oral administration, it is, e. g., possible to ingest solid or
liquid pharmaceutical compositions, either directly or in a diluted
form.
[0046] The pharmaceutical composition to be used according to the
present invention is preferably provided to be suitable for
intravenous, intraarterial, intramuscular, intravascular,
intraperitoneal or subcutaneous administration. For instance,
injection or transfusions are suitable for this purpose.
Administering the pharmaceutical composition directly into the
bloodstream will have the advantage that the active ingredients of
the pharmaceutical composition are distributed throughout the body
and are thus capable of reaching their target tissues quickly. In
addition, topical applications are provided. The administration
either directly to or in the vicinity of a site at which an immune
response is to be induced or enhanced, e. g. the site of an
infection or a tumor, has the particular advantage that the NK cell
activation will mainly occur at the target site.
[0047] In addition to the in vivo administration, an ex vivo
treatment of NK cells is also possible. To this end, NK cells are
isolated from a patient, treated ex vivo according to the present
invention, subsequently activated and then returned to the patient.
Such an ex vivo method for the treatment of cells of the immune
system is, for example, described in WO 2009/073905 (incorporated
herein by reference) and can be adapted to NK cells and used
according to the present invention. Preferably, the ex vivo
embodiment of the method according to the present invention is
carried out in combination with the above-mentioned additional NK
cell activators, such as immune cell-stimulatory cytokines, in
particular IL-2 and/or IL-12, an interferon or interferon
stimulator, an antibody or a TLR or PAMP receptor ligand,
preferably of TLR-2, TLR-7 and TLR-8, as well as combinations
thereof. It is possible that either the Cbl-b inhibitors or the
additional NK cell activators are administered ex vivo to the NK
cells and the further activation is carried out in vivo, e.g. ex
vivo inhibition of Cbl-b and in vivo administration of the
additional NK cell activator, or vice versa. Preferably, both
steps, i.e. the inhibition of Cbl-b and the additional activation
of NK cells, can be performed ex vivo. Isolated and activated NK
cells can be administered to the target site in a directed manner.
The NK cells can be isolated ex vivo. For a specific activation of
NK cells, the NK cells may be enriched in a cell isolate, e.g.
PBMCs, or be isolated therefrom ex vivo.
[0048] The ex vivo treatment of the NK cells may also include an
expanding step, preferably as described in documents U.S. Pat. No.
7,435,596 B2 or WO 2006/52534 A2 (both incorporated herein by
reference). In this context, for instance, NK cells can be
contacted with NK cell-activating cells which express the MHC I
complex only in a reduced manner and express membrane-bound IL-15.
Alternatively or additionally, the NK cells can be contacted with
IL-15 or an IL-15 receptor antibody and a CD137 ligand or a CD137
antibody. This expansion is optionally carried out in combination
with said additional NK cell activators, such as immune
cell-stimulatory cytokines
BRIEF DESCRIPTION OF THE DRAWINGS
[0049] The present invention is further illustrated by the
following Figures and Examples, without being limited thereto.
[0050] FIG. 1: PBMCs or cell fractions isolated therefrom were
inhibited by Cbl-b siRNA and subsequently stimulated with IL-2 and
IL-12, and the production of IFN-gamma was measured after 24
hours.
[0051] FIG. 2: PBMCs or cell fractions isolated therefrom were
inhibited by Cbl-b siRNA, stimulated by co-incubation with the
tumor cell line K562, and the production of IFN-gamma was measured
after 24 hours.
[0052] FIG. 3: Isolated NK cells were inhibited by Cbl-b siRNA,
stimulated by K562 or IL-2 and IL-12, and the production of
TNF-alpha was measured after 24 hours.
[0053] FIG. 4: PBMCs were inhibited with Cbl-b siRNA and incubated
for 4 hours with the tumor cell line SKBR3, as indicated, with the
addition of Herceptin or cytokine The cytotoxicity was then
determined based on the release of the cellular enzyme LDH which
was measured in an enzymatic assay.
[0054] FIG. 5: Cbl-b silencing in NK cells increases the reactivity
as compared to IFN-alpha stimulation: NK cells were inhibited by
Cbl-b siRNA and stimulated with IFN-alpha and the production of
IFN-gamma was measured after 24 h.
[0055] FIG. 6: Cbl-b silencing in NK cells increases the reactivity
as compared to combinations of interleukins and IFN-alpha: NK cells
were inhibited by Cbl-b siRNA and stimulated with IL-2, IL-7, IL-15
and IL-21, either alone or in combination with IL-12, IL-23 or
IFN-alpha, and the production of TNF-alpha was measured after 24
h.
[0056] FIG. 7: Cbl-b silencing in NK cells increases the reactivity
as compared to combinations of IL-12 with various cytokines of the
common cytokine receptor gamma-chain cytokines: NK cells were
inhibited by Cbl-b siRNA and stimulated with IL- 2, IL-7 and IL-15,
either alone or in combination with IL-12, and the production of
IFN-gamma was measured after 24 h.
[0057] FIG. 8: Cbl-b silencing in NK cells increases the reactivity
not only as compared to combinations of IL-2 with IL-12, IL-23 and
IFN-alpha or IFN-beta: NK cells were inhibited by Cbl-b siRNA and
stimulated with IL-23, IFN-alpha or IFN-beta, either alone or in
the presence of IL-2, and the production of IFN-gamma was measured
after 24 hours.
[0058] FIG. 9: The increased reactivity of NK cells subsequently to
Cbl-b silencing as compared to cytokine stimulation leads to an
increase of the activation marker CD69 on the cell surface: NK
cells were inhibited by Cbl-b siRNA and stimulated with IL-2 and
either IFN-alpha or IL-12, and the expression of CD69 was
determined after 48 h.
EXAMPLE 1
Sequences
[0059] The following siRNA sequences were used for the inhibition
of Cbl-b:
TABLE-US-00001 A. Sense sequence: GUACUGGUCCGUUAGCAAAUU (SEQ ID NO:
1) Antisense sequence: 5'PUUUGCUAACGGACCAGUACUU (SEQ ID NO: 2) B.
Sense sequence: GGUCGAAUUUUGGGUAUUAUU (SEQ ID NO: 3) Antisense
sequence: 5'PUAAUACCCAAAAUUCGACCUU (SEQ ID NO: 4)
EXAMPLE 2
CBL-B Inhibition in Nk Cells
[0060] Using CPT reaction tubes (Vacutainer) whole blood was
obtained from a donor and the PBMCs were separated therefrom by
centrifugation. NK cells were isolated from PBMCs (including the
CD8.sup.+CD3.sup.- fraction) and subsequently CD8 and CD4 T cells
were isolated by means of magnetic selection. FACS was used to
verify that the purity of the corresponding cell populations was at
least 90%. Both the PBMCs and the resulting isolated cell fractions
were transfected with siRNA Cbl-b using an Amaxa transfection
device and stimulated overnight with recombinant human IL-2 (50
ng/ml) and IL-12 (10 ng/ml) in Xvivol5 medium (FIG. 1). The
IFN-gamma secretion in the cells treated in this manner was then
measured in an ELISA. The result clearly indicates that the greatly
enhanced IFN-gamma production of Cbl-b-inhibited PBMCs after the
stimulation with IL-2 and IL-12 can be unambiguously assigned to
the reaction of the NK cells.
EXAMPLE 3
CBL-B Inhibition in Nk Cells and Co-Stimulation
[0061] One possibility of co-stimulating NK cells is via tumor cell
lines whose aberrant surface marker expression is no longer able to
maintain the appropriate balance of inhibiting and activating NK
receptors, thus leading to the activation of NK cells, for example
the tumor cell line K562. PBMCs as well as CD8 and NK cells were
isolated as described above and transfected with Cbl-b siRNA.
1.times.10 5 of these transfected cells were then incubated in
Xvivo medium overnight, either alone (unstim) or with 6.times.10 4
of K562 tumor cells, and the secretion of IFN-gamma was determined
as described above. The incubation of Cbl-b-inhibited PBMCs with
this tumor cell line again resulted in a strong IFN-gamma
production, which in turn could clearly be attributed to the
contribution of the NK cells (FIG. 2). Furthermore, both
stimulation methods resulted in an increase in the TNF-alpha
production in NK cells upon inhibition by Cbl-b (FIG. 3).
EXAMPLE 4
Tumor Cytotoxicity by Cbl-B Inhibition in Nk Cells
[0062] One of the main functions of NK cells in the context of
tumor development is the direct destruction of tumor cells. It was
therefore tested whether Cbl-b-inhibited PBMCs are better suitable
for the destruction of tumor cells. The Her2-positive breast
carcinoma line SKBR3 was used as a target cell line since in this
context it is also possible to test the antibody directed against
Her2 (trastuzumab or Herceptin) which is employed in tumor therapy.
PBMCs were again isolated as described above, transfected with
Cbl-b siRNA and incubated for 4 hours either alone or with 4 x 10 4
SKBR3 cells in Xvivo medium. In addition, 10 .mu.g/ml of Herceptin
antibody were added under the conditions indicated as Herceptin and
in the conditions indicated as IL-2 IL-12 the stimulation was
carried out as described above. The cytotoxicity of the PBMCs
against the SKBR3 tumor cells was then determined by colorimetric
measurement of the release of the enzyme LDH from the tumor cell
cytosol. In accordance with the instructions given by the
manufacturer of the colorimetric measurement kit (Biovision), the
spontaneous release of this enzyme from the PBMCs or tumor cells
was determined from the corresponding individual control conditions
and was subtracted. It was found that the cell lysis induced by
Cbl-b-inhibited immune cells was basically stronger than that
obtained with the cells that had been treated with control siRNA,
wherein, in particular, the simultaneous stimulation with IL-2 and
IL-12 resulted in a significant increase in tumor cell lysis (FIG.
4).
[0063] These in vitro results therefore show that the simultaneous
inhibition of Cbl-b in cells of the adaptive and the innate immune
system ex vivo in unseparated human PBMCs is possible and further
lead to the conclusion that the Cbl-b inhibition in NK cells forms
a rational basis for combining Cbl-b inhibition with tumor
therapies, such as the administration of recombinant IL-2 or
therapeutic antibodies directed against tumor antigens.
EXAMPLE 5
CBL-B Silencing in Nk Cells Increases the Reactivity as Compared to
Ifn-Alpha Stimulation
[0064] NK cells contained in PBMC were isolated as described in
Example 2 and were silenced using siRNA. The following siRNA
sequences directed against Cbl-b were used:
TABLE-US-00002 Cbl-b siRNA 1: 5'-CUCUAUUUGCGGAAUUA-3' (SEQ ID NO:
5) 3'-AAUUCCGCAAAAUAGAGC-5' (SEQ ID NO. 6) Cbl-b siRNA 2:
5'-GUGAGAAUGAGUACUUUAAA-3' (SEQ ID NO: 7)
3'-ACACUCUUACUCAUAAGAUU-5' (SEQ ID NO: 8)
[0065] The cells were then stimulated overnight either without
cytokine or with IFN-alpha (5 or 50 ng/ml, as indicated in FIG. 5)
and the IFN-gamma secretion of the cells thus treated was then
measured in an ELISA. The result clearly shows that the inhibition
of Cbl-b in NK cells results in a strong increase in IFN-gamma
production (FIG. 5). The IFN-gamma production of T and NK cells in
the liver has been defined as one of the causal factors of the
effectiveness of IFN-alpha therapy in the treatment of chronic
hepatitis infections. This represents a basis for a rationale for a
combination therapy with Cbl-b silencing and systemic IFN-alpha
therapy, in particular in cases where the standard therapy with
IFN-alpha alone is not sufficient to provide complete healing.
[0066] In principle, the liver is an ideal target organ for siRNA
therapies as the gene expression in the liver can easily be
modified by a systemic administration of siRNA. In the present
case, both the Cbl-b inhibition in NK cells by direct systemic
administration of Cbl-b siRNA and a cell therapy by transfer of NK
cells that have been silenced ex vivo are thus possible since it is
to be assumed that those cells migrate to the region of the
affected liver in a sufficient amount after intravenous
refunding.
EXAMPLE 6
CBL-B Silencing in Nk Cells Increases the Reactivity as Compared to
Combinations of Il-2 and Ifn-Alpha or IL-1211L-23.
[0067] As it could be shown in Examples 2 and 5 that the inhibition
of Cbl-b resulted in an increased stimulatability of NK cells by
IFN-alpha and IL-2 and IL-12, respectively, a more systematic
analysis of the stimulatability of Cbl-b-silenced NK cells was
carried out. IL-2 is a member of the so-called common cytokine
receptor gamma-chain family. Other members of this family include,
i. a., IL-7, IL-15 and IL-21. IL-23 in turn is similar to IL-12 in
various structural and functional aspects, just as IFN-alpha and
IL-12, and is produced by activated dendritic cells, which thus
also play an essential role in the activation of NK cells.
Therefore, the NK cells in this experiment were stimulated with the
common cytokine receptor gamma-chain cytokines IL-2, IL-7, IL-15
and IL-21, either alone or in combination with IL-12, IL-23 or
IFN-alpha. For comparison, the DC cytokines IL--12, IL-23 and
IFN-alpha were also added without common cytokine receptor
gamma-chain cytokines In this procedure, the NK cells contained in
PBMCs were isolated as described in Example 5 and were silenced
using siRNA (Cbl-b siRNA 2) and the control-treated and
Cbl-b-silenced NK cells were directly compared. As indicated, the
NK cells were stimulated with the cytokines overnight (all common
cytokine receptor gamma-chain cytokines 50 ng/ml; DC cytokines
IL-12, IL-23 and IFN-alpha 10 ng/ml). TNF-alpha was selected as a
readout (determined by ELISA) as TNF-alpha is a key cytokine in
immune reactions and its production is not as dependent on IL-12 as
that of IFN-gamma. The results in FIG. 6 show that the Cbl-b
inhibition of NK cells leads to a significantly stronger activation
and thus an increased production of TNF-alpha. The TNF-alpha
production was particularly strong when the Cbl-b-silenced NK cells
were costimulated with combinations of IL-2 and a DC cytokine, such
as IL-12, IL-23 and IFN-alpha. However, it was shown that other
common cytokine receptor gamma-chain cytokines, in particular IL-15
in the presence of IFN-alpha, resulted in a much stronger reaction
of Cbl-b-silenced NK cells. Since the production of DC cytokines,
such as IL-12, IL-23 and IFN-alpha, in vivo is mainly stimulated by
components of pathogens acting as TLR ligands, a therapeutic
rationale is therefore given to use the Cbl-b inhibition of NK
cells either in case of chronic infections or in the therapy of
tumor diseases with artificial TLR ligands (e. g. TLR7/8 ligands
such as imiquimod or TLR9 ligands such as CpG). The additional
stimulus provided by the common cytokine receptor gamma-chain
cytokines IL-2 and IL-15 in vivo may be mediated, for example, by
immunization with anti-tumor vaccines which lead to a production of
IL-2 and IL-15 by activated antigen-specific T cells or by a direct
therapeutic administration to the patient.
EXAMPLE 7
CBL-B Silencing in Nk Cells Increases the Reactivity as Compared to
Combinations of Il-12 with Various Common Cytokine Receptor
Gamma-Chain Cytokines.
[0068] As it could be shown in Example 6 that the inhibition of
Cbl-b may result in an increased stimulatability of NK cells by
various common cytokine receptor gamma-chain cytokines, in
particular when used in combination with cytokines that are usually
produced by DCs, it was tested whether, besides IL-2, IL-7 or IL-15
together with IL-12, the key factor for the induction of IFN-gamma,
can also lead to an increased production of this cytokine To this
end, the NK cells contained in PBMCs were isolated as described in
Example 5 and 6, silenced and stimulated overnight with the
cytokines IL-2 (50 ng/ml), IL-7 and IL-15 (20 ng/ml each), either
alone or in the presence of IL-12 (10 ng/ml), as indicated. The
IFN-gamma production was measured in an ELISA. The results in FIG.
7 show that the Cbl-b-silenced NK cells are capable of a much
stronger reaction in the form of IFN-gamma production in response
to all three tested common cytokine receptor gamma-chain cytokines
in the presence of IL-12. Likewise, it was found that only the
Cbl-b-silenced NK cells were capable of a measurable production of
IFN-gamma, solely based on the stimulation with IL-2. IL-2 has been
approved for the treatment of certain malignant tumor diseases, but
exerts a sufficient effect only a small subset of patients. The
inhibition of Cbl-b in NK cells is thus in a potential strategy for
improving the efficacy of IL-2 in tumor therapy. Furthermore,
Cbl-b-silenced NK cells are capable of a substantially stronger
response to the simultaneous presence of IL-12 and IL-7 or
IL-15.
EXAMPLE 8
CBL-B Silencing in Nk Cells Increases the Reactivity not Only as
Compared to Combinations of IL-2 with IL-12, IL-23 and Ifn-Alpha,
but Also to Ifn-Beta.
[0069] As it was shown in Example 6 that the inhibition of Cbl-b in
NK cells results in an increased stimulatability by IL-2 and
IFN-alpha, it was also tested whether IFN-beta was capable of
inducing an equivalent effect. To this end, the NK cells contained
in PBMCs were isolated as described in Example 6, silenced and
stimulated overnight with the cytokines IL-23, IFN-alpha or
IFN-beta, either alone or in the presence of IL-2 (50 ng/ml) as
indicated. The IFN-gamma production was measured in an ELISA. The
results in FIG. 8 show that the Cbl-b-silenced NK cells are capable
of a much stronger response in the form of IFN-gamma production to
all three cytokines tested in the presence of IL-2.
EXAMPLE 9
The Increased Reactivity of Nk Cells Upon Cbl-B Silencing as
Compared to Cytokine Stimulation Leads to an Increase of the
Activation Marker Cd69 on the Cell Surface.
[0070] As it was shown in the previous examples that Cbl-b-silenced
NK cells respond by increased cytokine production, the expression
of the activation marker CD69 on the cell surface was examined as a
further parameter using FACS. To this end, the NK cells contained
in PBMCs were isolated as described in Example 6, silenced and
stimulated with the cytokines IL-2 and IFN-alpha or IL-12. After 2
days, the cells were harvested and assayed for surface expression
of CD69 by a FACS analysis conducted on an FC500 cytometer. For
establishing the specificity of the staining, the cells were
counter-stained using CD56-PE-Cy5 and CD3-FITC and stained with
CD69-PE or a corresponding isotype control (the antibodies were
routinely employed according to the recommended procedure given by
the manufacturer Beckman-Coulter). As an example, FIG. 9A shows the
increased expression of CD69 in Cbl-b-silenced NK cells as compared
to control-treated NK cells, both of which were treated with
IFN-alpha and IL-2, in the overlay-histogram. FIG. 9B summarizes
the quantitative analysis of the CD69 expression for the
stimulation with IL-2 and either IFN-alpha or IL-12. In accordance
with the data obtained in the previous examples, it is shown that
Cbl-b-silenced NK cells are hyper-reactive to a stimulation with
these cytokines and that this increased reactivity directly
manifests itself in the increased up-regulation of the activation
marker CD69 on the cellular level.
Sequence CWU 1
1
8121RNAArtificial SequenceSynthetic siRNA 1guacuggucc guuagcaaau u
21221RNAArtificial SequenceSynthetic siRNA 2uuugcuaacg gaccaguacu u
21321RNAArtificial SequenceSynthetic siRNA 3ggucgaauuu uggguauuau u
21421RNAArtificial SequenceSynthetic siRNA 4uaauacccaa aauucgaccu u
21517RNAArtificial SequenceSynthetic siRNA 5cucuauuugc ggaauua
17618RNAArtificial SequenceSynthetic siRNA 6cgagauaaaa cgccuuaa
18720RNAArtificial SequenceSynthetic siRNA 7gugagaauga guacuuuaaa
20820RNAArtificial SequenceSynthetic siRNA 8uuagaauacu cauucucaca
20
* * * * *