U.S. patent application number 14/639495 was filed with the patent office on 2015-10-29 for podxl protein in colorectal cancer.
The applicant listed for this patent is Atlas Antibodies AB. Invention is credited to Karin Jirstrom, Fredrik Ponten, Mathias Uhlen.
Application Number | 20150309033 14/639495 |
Document ID | / |
Family ID | 41397610 |
Filed Date | 2015-10-29 |
United States Patent
Application |
20150309033 |
Kind Code |
A1 |
Jirstrom; Karin ; et
al. |
October 29, 2015 |
PODXL PROTEIN IN COLORECTAL CANCER
Abstract
The present disclosure provides a method for determining whether
a mammalian subject having a colorectal cancer belongs to a first
or a second group, wherein the prognosis of subjects of the first
group is better than the prognosis of subjects of the second group,
comprising the steps of: a) evaluating an amount of PODXL protein
in at least part of a sample earlier obtained from the subject, and
determining a sample value corresponding to the evaluated amount;
b) comparing said sample value from step a) with a predetermined
reference value; and if said sample value is higher than said
reference value, c1) concluding that the subject belongs to said
second group; and if said sample value is lower than or equal to
said reference value, c2) concluding that the subject belongs to
said first group. Related uses, means and a method of treatment are
also provided.
Inventors: |
Jirstrom; Karin; (Limhamn,
SE) ; Uhlen; Mathias; (Stocksund, SE) ;
Ponten; Fredrik; (Uppsala, SE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Atlas Antibodies AB |
Stockholm |
|
SE |
|
|
Family ID: |
41397610 |
Appl. No.: |
14/639495 |
Filed: |
March 5, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13456354 |
Apr 26, 2012 |
8999656 |
|
|
14639495 |
|
|
|
|
PCT/EP2010/066168 |
Oct 26, 2010 |
|
|
|
13456354 |
|
|
|
|
61254830 |
Oct 26, 2009 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
435/7.23; 436/547; 530/389.2 |
Current CPC
Class: |
G01N 2333/705 20130101;
C07K 16/3046 20130101; G01N 2800/52 20130101; C07K 2317/76
20130101; G01N 2333/90216 20130101; G01N 33/57419 20130101; C07K
16/22 20130101; G01N 2800/56 20130101; A61P 35/00 20180101 |
International
Class: |
G01N 33/574 20060101
G01N033/574; C07K 16/22 20060101 C07K016/22 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 26, 2010 |
EP |
09174045.6 |
Claims
1. Method of treatment of a subject having a colorectal cancer,
comprising: a) evaluating an amount of PODXL protein present in at
least part of a sample from the subject and determining a sample
value corresponding to the evaluated amount; b) comparing the
sample value obtained in step a) with a reference value; and, if
said sample value is higher than said reference value, c) treating
said subject with a colorectal cancer treatment regimen.
2. Method for determining whether a mammalian subject having a
colorectal cancer belongs to a first or a second group, wherein the
prognosis of subjects of the first group is better than the
prognosis of subjects of the second group, comprising the steps of:
a) evaluating an amount of PODXL protein in at least part of a
sample earlier obtained from the subject, and determining a sample
value corresponding to the evaluated amount; b) comparing said
sample value from step a) with a predetermined reference value; and
if said sample value is higher than said reference value, c1)
concluding that the subject belongs to said second group; and if
said sample value is lower than or equal to said reference value,
c2) concluding that the subject belongs to said first group.
3. Method according to claim 2, wherein each of the first and the
second group has two subgroups, .alpha. and .beta., and the
prognosis of subjects of the subgroup .alpha. is better than the
prognosis of subjects of the subgroup .beta. in each of the first
and the second group, the method further comprising the steps of:
d) evaluating an amount of COX-2 protein in at least part of a
sample earlier obtained from the subject, and determining a sample
value corresponding to the evaluated amount; e) comparing said
sample value from step d) with a predetermined reference value; and
if the sample value from step d) is higher than the reference value
of step e), f1) concluding that the subject belongs to subgroup
.beta.; and if the sample value from step d) is lower than or equal
to the reference value of step e), f2) concluding that the subject
belongs to subgroup .alpha..
4. Non-treatment strategy method for a subject having a colorectal
cancer, comprising: a) evaluating an amount of PODXL protein
present in at least part of a sample earlier obtained from the
subject, and determining a sample value corresponding to the
evaluated amount; b) comparing the sample value obtained in step a)
with a reference value; and, if said sample value is lower than or
equal to said reference value, c) refraining from treating said
subject with a colorectal cancer treatment regimen.
5. Method according to claim 1, wherein the colorectal cancer is in
Dukes' stage B or TNM stage II.
6. Method according to claim 5, wherein the colorectal cancer
treatment regimen is an adjuvant colorectal cancer
chemotherapy.
7. Method according to claim 6, further comprising: d) refraining
from treating the subject with the adjuvant colorectal treatment
regimen if said sample value is lower than or equal to said
reference value.
8. Method according to claim 1, wherein the colorectal cancer is in
Dukes' stage C or TNM stage III.
9. Method according to claim 8, wherein the colorectal cancer
treatment regimen comprises the administration of a combination of
two or more chemotherapeutic agents.
10. Method according to claim 9, further comprising: d) wherein the
colorectal cancer treatment regimen comprises the administration of
a single chemotherapeutic agent if said sample value is lower than
or equal to said reference value.
11. Method according to claim 1, wherein the evaluation of step a)
is limited to the membranes of tumor cells of said sample.
12. Method according to claim 1, wherein the evaluation of step a)
is limited to the membranes of tumor budding cells of said
sample.
13. Method according to claim 1, wherein step a) comprises: aI)
applying to said sample of step a) a quantifiable affinity ligand
capable of selective interaction with the PODXL protein to be
evaluated, said application being performed under conditions that
enable binding of the affinity ligand to PODXL protein present in
the sample; and aII) quantifying the affinity ligand bound to said
sample to evaluate said amount.
14. Kit for establishing a prognosis of colorectal cancer, which
comprises a) a quantifiable affinity ligand capable of selective
interaction with a PODXL protein; b) reagents necessary for
quantifying the amount of the quantifiable affinity ligand of a);
c) a quantifiable affinity ligand capable of selective interaction
with a COX-2 protein; and d) reagents necessary for quantifying the
amount of the quantifiable affinity ligand of c), wherein the
reagents of b) and d) are the same or different.
15. Method of establishing a prognosis for colorectal cancer,
comprising use of a PODXL protein as a prognostic marker.
16. Method of selection or purification of a prognostic agent for
establishing a prognosis for a mammalian subject having a
colorectal cancer, comprising use of an antigenically active
fragment of a PODXL protein, wherein the antigenically active
fragment consists of SEQ ID NO:14.
17. Method of production of a prognostic agent for establishing a
prognosis for a mammalian subject having a colorectal cancer,
comprising use of an antigenically active fragment of a PODXL
protein as an antigen in an immunization, wherein the antigenically
active fragment consists of SEQ ID NO:14.
18. Affinity ligand capable of selective interaction with a PODXL
protein fragment consisting of SEQ ID NO:14.
19. Method of establishing a prognosis for colorectal cancer,
comprising use of an affinity ligand capable of selective
interaction with a PODXL protein as a prognostic agent.
20. Method according to claim 19, wherein the affinity ligand is,
the affinity ligand according to claim 18.
Description
[0001] This application is a continuation of and claims priority to
U.S. patent application Ser. No. 13/456,354, filed Apr. 26, 2012,
now allowed, which is a Continuation-In-Part of International
Patent Application No. PCT/EP2010/066168, filed Oct. 26, 2010 which
claims priority to EP09174045.6, filed Oct. 26, 2009 and U.S.
Provisional Application No. 61/254,830, filed Oct. 26, 2009. The
entire content of each of these applications is incorporated herein
by reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Mar. 5, 2015 is named 9868-28TSIPCT_ST25.txt and is 25,387 bytes
in size.
FIELD OF THE INVENTION
[0003] The present invention relates to the field of colorectal
cancer prognostics and colorectal cancer treatment.
BACKGROUND OF THE INVENTION
Cancer
[0004] Cancer is one of the most common causes of disease and death
in the western world. In general, incidence rates increase with age
for most forms of cancer. As human populations continue to live
longer, due to an increase in the general health status, cancer may
affect an increasing number of individuals. The cause of most
common cancer types is still largely unknown, although there is an
increasing body of knowledge providing a link between environmental
factors (dietary, tobacco smoke, UV radiation etc) as well as
genetic factors (germ line mutations in "cancer genes" such as p53,
APC, BRCA1, XP etc) and the risk of developing cancer.
[0005] No definition of cancer is entirely satisfactory from a cell
biological point of view, despite the fact that cancer is
essentially a cellular disease, and defined as a transformed cell
population with net cell growth and anti-social behavior. Malignant
transformation represents the transition to a malignant phenotype
based on irreversible genetic alterations. Although this has not
been formally proven, malignant transformation is believed to take
place in one cell, from which a subsequently developed tumor
originates (the "clonality of cancer" dogma). Carcinogenesis is the
process by which cancer is generated and is generally accepted to
include multiple events that ultimately lead to growth of a
malignant tumor. This multi-step process includes several
rate-limiting steps, such as addition of mutations and possibly
also epigenetic events, leading to formation of cancer following
stages of precancerous proliferation. The stepwise changes involve
accumulation of errors (mutations) in vital regulatory pathways
that determine cell division, asocial behavior and cell death. Each
of these changes may provide a selective Darwinian growth advantage
compared to surrounding cells, resulting in a net growth of the
tumor cell population. A malignant tumor does not only necessarily
consist of the transformed tumor cells themselves but also
surrounding normal cells which act as a supportive stroma. This
recruited cancer stroma consists of connective tissue, blood
vessels and various other normal cells, e.g., inflammatory cells,
which act in concert to supply the transformed tumor cells with
signals necessary for continued tumor growth.
[0006] The most common forms of cancer arise in somatic cells and
are predominantly of epithelial origin, e.g., prostate, breast,
colon, urothelium and skin, followed by cancers originating from
the hematopoetic lineage, e.g., leukemia and lymphoma,
neuroectoderm, e.g., malignant gliomas, and soft tissue tumors,
e.g., sarcomas.
Cancer Diagnostics and Prognostics
[0007] Microscopic evaluation of a tissue section taken from a
tumor has for many years been the golden standard for determining a
diagnosis of cancer. For example, biopsy material from suspected
tumors is collected and examined under the microscope. To obtain a
firm diagnosis, the tumor tissue is fixated in formalin,
histo-processed and paraffin embedded. From the resulting paraffin
block, tissue sections can be produced and stained using both
histochemical, i.e., hematoxylin-eosin staining, and
immunohistochemical (IHC) methods. The surgical specimen is then
evaluated with pathology techniques, including gross and
microscopic analysis. This analysis often forms the basis for
assigning a specific diagnosis, i.e., classifying the tumor type
and grading the degree of malignancy, of a tumor.
[0008] Malignant tumors can be categorized into several stages
according to classification schemes specific for each cancer type.
The most common classification system for solid tumors is the
tumor-node-metastasis (TNM) staging system. The T stage describes
the local extent of the primary tumor, i.e., how far the tumor has
invaded and imposed growth into surrounding tissues, whereas the N
stage and M stage describe how the tumor has developed metastases,
with the N stage describing spread of tumor to lymph nodes and the
M stage describing growth of tumor in other distant organs. Early
stages include: T0-1, N0, M0, representing localized tumors with
negative lymph nodes. More advanced stages include: T2-4, N0, M0,
localized tumors with more widespread growth and T1-4, N1-3, M0,
tumors that have metastasized to lymph nodes and T1-4, N1-3, M1,
tumors with a metastasis detected in a distant organ. TNM stage I
refers to T1-2, N0, M0; TNM stage II refers to T3-4, N0, M0; TNM
stage III refers to T1-4, N1-2, M0; and TNM stage IV refers to any
T, any N, M1. Sometimes the respective stages are divided into
stage: IIA, IIB and IIC; IIIA, IIIB and IIIC; and IVA and IVB.
Staging of tumors is often based on several forms of examination,
including surgical, radiological and histopathological analyses. In
addition to staging, for most tumor types there is also a
classification system to grade the level of malignancy. The grading
systems rely on morphological assessment of a tumor tissue sample
and are based on the microscopic features found in a given tumor.
These grading systems may be based on the degree of
differentiation, proliferation and atypical appearance of the tumor
cells. Examples of generally employed grading systems include
Gleason grading for prostatic carcinomas and the Nottingham
Histological Grade (NHG) grading for breast carcinomas.
[0009] Accurate staging and grading is often crucial for a correct
diagnosis and may provide an instrument to predict a prognosis. The
diagnostic and prognostic information for a specific tumor may
subsequently determine an adequate therapeutic strategy for a given
cancer patient. A commonly used method, in addition to
histochemical staining of tissue sections, to obtain more
information regarding a tumor is immunohistochemical staining. IHC
allows for the detection of protein expression patterns in tissues
and cells using specific antibodies. The use of IHC in clinical
diagnostics allows for the detection of immunoreactivity in
different cell populations, in addition to the information
regarding tissue architecture and cellular morphology that is
assessed from the histochemically stained tumor tissue section. IHC
can be involved in supporting the accurate diagnosis, including
staging and grading, of a primary tumor as well as in the
diagnostics of metastases of unknown origin. The most commonly used
antibodies in clinical practice today include antibodies against
cell type "specific" proteins, e.g., PSA (prostate), MelanA
(melanocytes) and Thyroglobulin (thyroid gland), and antibodies
recognizing intermediate filaments (epithelial, mesenchymal,
glial), cluster of differentiation (CD) antigens (hematopoetic,
sub-classification of lympoid cells) and markers of malignant
potential, e.g., Ki67 (proliferation), p53 (commonly mutated tumor
suppressor gene) and HER-2 (growth factor receptor).
[0010] Aside from IHC, the use of in situ hybridization for
detecting gene amplification and gene sequencing for mutation
analysis are evolving technologies within cancer diagnostics. In
addition, global analysis of transcripts, proteins or metabolites
all add relevant information. However, most of these analyses still
represent basic research and have yet to be evaluated and
standardized for use in clinical medicine.
Adenocarcinomas from Colon and Rectum (Colorectal Cancer)
[0011] Colorectal cancer, a malignant epithelial tumor that
presents as an adenocarcinoma, is one of the most common forms of
human cancer worldwide. Data from the GLOBOCAN 2002 database
presented by Parkin et al show that around 1 million new cases of
colorectal cancer are identified yearly (Parkin D M et al (2005) CA
Cancer J Clin 55, 74-108). Further, the world incidence of
colorectal cancer is approximately 9.4% of all cancers, and
colorectal cancer constitutes the second most common cause of death
in the western world. The five-year survival rate of colorectal
cancer is approximately 60% in the western world, but as low as 30%
in Eastern Europe and India.
[0012] Early detection, and surgery with excision of the tumor, is
normally of critical importance for successful treatment. For
localized tumors, i.e. tumors that have not evolved into a
metastasizing disease, surgical intervention with radical resection
of the tumor and surrounding bowel and tissues is performed.
Colorectal tumors are categorized into several stages according to
Dukes' stages A-D, or more recently according to the TNM
classification. Early stage tumors (Dukes' stages A and B) are
generally associated with a relatively favorable outcome, while
later stage tumors, presenting with metastasis (Dukes' stage C and
D) have poor survival rates. Dukes' stage A, B, C and D corresponds
to TNM stage I, II, III and IV, respectively.
[0013] Unfortunately, colorectal tumors have often grown to a
considerable size before detection, and metastases are not
uncommon. The tumor typically metastasizes to regional lymph nodes,
but distant metastasis to the liver and lung are also common.
[0014] Symptoms depend on where in the distal gastrointestinal
tract the tumor is located, and include bowel distress, diarrhea,
constipation, pain and anemia (secondary to bleeding from the tumor
into the bowel). Current diagnostics are often based on patient
history, clinical and endoscopic examination (rectoscopy and
colonoscopy), optionally followed by radiological mapping to
determine extensiveness of tumor growth. In conjunction with
endoscopic examination, tissue biopsies are performed from dubious
lesions.
[0015] In differential diagnostics, cytokeratin 20 (CK20), an
intermediate filament marker abundant in the glandular cells of the
GI-tract, is commonly used to diagnose primary tumors in the
GI-tract including colorectal cancer. The CK20 marker is not ideal
as several other adenocarcinomas also can be positive for CK20
antibodies, whereas not all colorectal cancers are positive.
[0016] Today, prognostic information is mainly obtained from tumor
staging classification as there are no accepted grading systems or
biomarkers that provide additional prognostic data. For example,
there are no available biomarkers that can distinguish tumors of
low malignancy grade and low risk for developing into a
metastasizing disease from highly malignant tumors with a reduced
chance of survival. Thus, there is a great need for molecular
markers that can be used to predict patient outcome and to guide
patient management including therapeutic intervention.
Endpoint Analysis
[0017] Endpoint analysis for trials with adjuvant treatments for
cancer gives important information on how the patients respond to a
certain therapy. Overall survival (OS) has long been considered the
standard primary endpoint. OS takes in to account time to death,
irrespective of cause, e.g. if the death is due to cancer or not.
Loss to follow-up is censored and regional recurrence, distant
metastases, second primary colorectal cancers, and second other
primary cancers are ignored.
[0018] Today, an increasing number of effective treatments
available in many types of cancer have resulted in the need for
surrogate endpoints to allow for a better evaluation of the effect
of adjuvant treatments. Thus, the much longer follow-up required to
demonstrate that adjuvant treatments improve OS is often
complemented with other clinical endpoints that gives an earlier
indication on how successful the treatment is.
In the present disclosure, patient cohorts were evaluated by OS
analysis, however a surrogate endpoint was also considered, namely
disease-free survival (DFS). Analysis of DFS includes time to any
event related to the same cancer, i.e. all cancer recurrences and
deaths from the same cancer are events.
BRIEF DESCRIPTION
[0019] It is an object of some aspects of the present disclosure to
provide a method for establishing a colorectal cancer
prognosis.
[0020] Further, it is an object of some aspects of the present
disclosure to provide a method for obtaining colorectal cancer
treatment-related information and/or perform colorectal cancer
treatment.
[0021] Also, it is an object of some other aspects of the present
disclosure to provide means for performing one or both of the above
methods as well as other uses or means useful for obtaining
prognostic or treatment-related information.
[0022] The following is a non-limiting and itemized listing of
embodiments of the present disclosure, presented for the purpose of
providing various features and combinations provided by the
invention in certain of its aspects.
Items
[0023] 1. Method for determining whether a mammalian subject having
a colorectal cancer belongs to a first or a second group, wherein
the prognosis of subjects of the first group is better than the
prognosis of subjects of the second group, comprising the steps of:
[0024] a) evaluating an amount of PODXL protein in at least part of
a sample earlier obtained from the subject, and determining a
sample value corresponding to the evaluated amount; [0025] b)
comparing said sample value from step a) with a predetermined
reference value; and if said sample value is higher than said
reference value, [0026] c1) concluding that the subject belongs to
said second group; and if said sample value is lower than or equal
to said reference value, [0027] c2) concluding that the subject
belongs to said first group.
[0028] 2. Method according to item 1, wherein each of the first and
the second group has two subgroups, a and 13, and the prognosis of
subjects of the subgroup .alpha. is better than the prognosis of
subjects of the subgroup (3 in each of the first and the second
group, the method further comprising the steps of: [0029] d)
evaluating an amount of COX-2 protein in at least part of a sample
earlier obtained from the subject, and determining a sample value
corresponding to the evaluated amount; [0030] e) comparing said
sample value from step d) with a predetermined reference value; and
if the sample value from step d) is higher than the reference value
of step e), [0031] f1) concluding that the subject belongs to
subgroup 13; and if the sample value from step d) is lower than or
equal to the reference value of step e), [0032] f2) concluding that
the subject belongs to subgroup .alpha..
[0033] 3. Method according to item 2, wherein the sample of step a)
and the sample of step d) is the same type of sample selected from
the group consisting of tissue sample, body fluid sample, stool
sample and cytology sample.
[0034] 4. Method according to item 3, wherein the sample of step a)
and the sample of step d) is the same sample.
[0035] 5. Method for determining a prognosis for a mammalian
subject having a colorectal cancer, comprising the steps of: [0036]
a) evaluating an amount of PODXL protein present in at least part
of a sample earlier obtained from the subject, and determining a
sample value corresponding to the evaluated amount; [0037] b)
comparing the sample value obtained in step a) with a reference
value associated with a reference prognosis; and, if said sample
value is higher than said reference value, [0038] c1) concluding
that the prognosis for said subject is worse than said reference
prognosis; or if said sample value is lower than or equal to said
reference value, [0039] c2) concluding that the prognosis for said
subject is better than or equal to said reference prognosis.
[0040] 6. Method for determining whether a subject having a
colorectal cancer is not in need of a treatment with a colorectal
cancer treatment regimen, comprising the steps of: [0041] a)
evaluating an amount of PODXL protein present in at least part of a
sample earlier obtained from the subject, and determining a sample
value corresponding to the evaluated amount; [0042] b) comparing
the sample value obtained in step a) with a reference value; and,
if said sample value is lower than or equal to said reference
value, [0043] c) concluding that said subject is not in need of the
treatment with said colorectal cancer treatment regimen.
[0044] 7. Non-treatment strategy method for a subject having a
colorectal cancer, comprising: [0045] a) evaluating an amount of
PODXL protein present in at least part of a sample earlier obtained
from the subject, and determining a sample value corresponding to
the evaluated amount; [0046] b) comparing the sample value obtained
in step a) with a reference value; and, if said sample value is
lower than or equal to said reference value, [0047] c) refraining
from treating said subject with a colorectal cancer treatment
regimen.
[0048] 8. Method according to item 6 or 7, wherein the colorectal
cancer is COX-2 low.
[0049] 9. Method of treatment of a subject having a colorectal
cancer, comprising: [0050] a) evaluating an amount of PODXL protein
present in at least part of a sample from the subject and
determining a sample value corresponding to the evaluated amount;
[0051] b) comparing the sample value obtained in step a) with a
reference value; and, if said sample value is higher than said
reference value, [0052] c) treating said subject with a colorectal
cancer treatment regimen.
[0053] 10. Method according to item 9, wherein said colorectal
cancer is COX-2 high.
[0054] 11. Method according to any one of items 6-10, wherein said
colorectal cancer treatment regimen is neo-adjuvant therapy and/or
adjuvant therapy.
[0055] 12. Method according to item 11, wherein said neo-adjuvant
therapy is radiation therapy and said adjuvant therapy is selected
from colorectal cancer chemotherapies, colorectal cancer
immunotherapies, radiation therapies and combinations thereof.
[0056] 13. Method according to any one of the preceding items,
wherein said colorectal cancer is located in the colon.
[0057] 14. Method according to any one of the preceding items,
wherein said colorectal cancer is located in the sigmoideum.
[0058] 15. Method according to any one of the preceding items,
wherein said colorectal cancer is located in the rectum.
[0059] 16. Method according to any one of the preceding items,
wherein said colorectal cancer is colorectal carcinoma.
[0060] 17. Method according to any one of items 1-5, wherein said
prognosis is a probability of survival, such as overall survival or
disease free survival.
[0061] 18. Method according to item 17, wherein the probability of
survival is a probability of five-year, ten-year or 15-year
survival.
[0062] 19. Method according to any one of the preceding items,
wherein said sample is a body fluid sample, stool sample or
cytology sample.
[0063] 20. Method according to item 19, wherein said body fluid
sample is selected from the group consisting of blood, plasma,
serum, cerebral fluid, urine, semen and exudate.
[0064] 21. Method according to any one of the preceding items,
wherein said sample comprises cells, such as tumor cells, from said
subject.
[0065] 22. Method according to any one of items 1-8, wherein said
sample is a tissue sample.
[0066] 23. Method according to item 23, wherein said tissue sample
comprises tumor cells.
[0067] 24. Method according to item 24, wherein said tissue sample
is derived from colon or rectum.
[0068] 25. Method according to item 20, wherein said tissue sample
is derived from sigmoid colon.
[0069] 26. Method according to any one of items 21-25, wherein the
evaluation of step a) is limited to the membranes and/or cytoplasms
of cells of said sample.
[0070] 27. Method according to item 26, wherein the evaluation of
step a) is limited to the membranes and/or cytoplasms of tumor
cells of said sample.
[0071] 28. Method according to any one of the preceding items,
wherein said subject is a human.
[0072] 29. Method according to any one of the preceding items,
wherein said reference value is a value corresponding to a
predetermined amount of PODXL protein in a reference sample.
[0073] 30. Method according to any preceding item, wherein the
sample value of step a) is determined as being either 1,
corresponding to detectable PODXL protein in the sample, or 0,
corresponding to no detectable PODXL protein in the sample. 31.
Method according to any preceding item, wherein the reference value
of step b) corresponds to a reference sample having no detectable
PODXL protein.
[0074] 32. Method according to any preceding item, wherein the
reference value of step b) or e) is 0.
[0075] 33. Method according to any one of the preceding items,
wherein said reference value is a cytoplasmic fraction, a
cytoplasmic intensity, or a function of a cytoplasmic fraction and
a cytoplasmic intensity.
[0076] 34. Method according to item 33, wherein said reference
value of b) is a weak cytoplasmic intensity.
[0077] 35. Method according to item 33, wherein said reference
value of b) is an absent cytoplasmic intensity.
[0078] 36. Method according to item 33, wherein said reference
value of b) is a cytoplasmic fraction of 60% or lower.
[0079] 37. Method according to item 36, wherein said reference
value of b) is a cytoplasmic fraction of 5% or lower, such as 1% or
lower.
[0080] 38. Method according to any one of the preceding items,
wherein the amino acid sequence of the PODXL protein comprises a
sequence selected from:
[0081] i) SEQ ID NO:1; and
[0082] ii) a sequence which is at least 85% identical to SEQ ID
NO:1.
[0083] 39. Method according to any one of the preceding items,
wherein the amino acid sequence of the PODXL protein comprises or
consists of a sequence selected from:
[0084] i) SEQ ID NO:2 or 3; and
[0085] ii) a sequence which is at least 85% identical to SEQ ID
NO:2 or 3.
[0086] 40. Method according to any one of the preceding items,
wherein step a) comprises:
[0087] aI) applying to said sample of step a) a quantifiable
affinity ligand capable of selective interaction with the PODXL
protein to be evaluated, said application being performed under
conditions that enable binding of the affinity ligand to PODXL
protein present in the sample; and
[0088] aII) quantifying the affinity ligand bound to said sample to
evaluate said amount.
[0089] 41. Method according to any one of items 1-40, wherein step
a) comprises:
[0090] a1) applying to said sample or step a) a quantifiable
affinity ligand capable of selective interaction with the PODXL
protein to be quantified, said application being performed under
conditions that enable binding of the affinity ligand to PODXL
protein present in the sample;
[0091] a2) removing non-bound affinity ligand; and
[0092] a3) quantifying affinity ligand remaining in association
with the sample to evaluate said amount.
[0093] 42. Method according to item 40 or 41, wherein the
quantifiable affinity ligand is selected from the group consisting
of antibodies, fragments thereof and derivatives thereof.
[0094] 43. Method according to item 42, wherein said quantifiable
affinity ligand is obtainable by a process comprising a step of
immunizing an animal with a peptide whose amino acid sequence
consists of the sequence SEQ ID NO:1.
[0095] 44. Method according to item 40 or 41, wherein said
quantifiable affinity ligand is an oligonucleotide molecule.
[0096] 45. Method according to item 40 or 41, wherein the
quantifiable affinity ligand is a protein ligand derived from a
scaffold selected from the group consisting of staphylococcal
protein A and domains thereof, lipocalins, ankyrin repeat domains,
cellulose binding domains, .gamma. crystallines, green fluorescent
protein, human cytotoxic T lymphocyte-associated antigen 4,
protease inhibitors, PDZ domains, peptide aptamers, staphylococcal
nuclease, tendamistats, fibronectin type III domain and zinc
fingers.
[0097] 46. Method according to any one of items 40-45, wherein said
quantifiable affinity ligand is capable of selective interaction
with a peptide whose amino acid sequence consists of the sequence
SEQ ID NO:1.
[0098] 47. Method according to any one of items 40-46, wherein the
quantifiable affinity ligand comprises a label selected from the
group consisting of fluorescent dyes and metals, chromophoric dyes,
chemiluminescent compounds and bioluminescent proteins, enzymes,
radioisotopes, particles and quantum dots.
[0099] 48. Method according to any one of items 40-47, in which
said quantifiable affinity ligand is detected using a secondary
affinity ligand capable of recognizing the quantifiable affinity
ligand.
[0100] 49. Method according to item 48, in which said secondary
affinity ligand capable of recognizing the quantifiable affinity
ligand comprises a label selected from the group consisting of
fluorescent dyes and metals, chromophoric dyes, chemiluminescent
compounds and bioluminescent proteins, enzymes, radioisotopes,
particles and quantum dots.
[0101] 50. Kit for establishing a prognosis of colorectal cancer,
which comprises
[0102] a) a quantifiable affinity ligand capable of selective
interaction with a PODXL protein;
[0103] b) reagents necessary for quantifying the amount of the
quantifiable affinity ligand of a);
[0104] c) a quantifiable affinity ligand capable of selective
interaction with a COX-2 protein; and
[0105] d) reagents necessary for quantifying the amount of the
quantifiable affinity ligand of c), wherein the reagents of b) and
d) are the same or different.
[0106] 51. Kit according to item 50, in which the affinity ligand
of a) and/or c) is selected from the group consisting of
antibodies, fragments thereof and derivatives thereof.
[0107] 52. Kit according to item 51, in which the affinity ligand
of a) is obtainable by a process comprising a step of immunizing an
animal with a protein whose amino acid sequence consists of the
sequence SEQ ID NO:1.
[0108] 53. Kit according to item 50, in which the affinity ligand
of a) and/or c) is a protein ligand derived from a scaffold
selected from the group consisting of staphylococcal protein A and
domains thereof, lipocalins, ankyrin repeat domains, cellulose
binding domains, .gamma. crystallines, green fluorescent protein,
human cytotoxic T lymphocyte-associated antigen 4, protease
inhibitors, PDZ domains, peptide aptamers, staphylococcal nuclease,
tendamistats, fibronectin type III domain and zinc fingers.
[0109] 54. Kit according to item 50, in which the affinity ligand
of a) and/or c) is an oligonucleotide molecule.
[0110] 55. Kit according to any one of items 50-54, in which the
affinity ligand of a) is capable of selective interaction with a
PODXL protein comprising, or consisting of, a sequence selected
from:
[0111] i) SEQ ID NO:2 or 3; and
[0112] ii) a sequence which is at least 85% identical to SEQ ID
NO:2 or 3.
[0113] 56. Kit according to any one of items 50-55, in which the
affinity ligand of a) is capable of selective interaction with a
PODXL protein comprising, or consisting of, a sequence selected
from:
[0114] i) SEQ ID NO:1; and
[0115] ii) a sequence which is at least 85% identical to SEQ ID
NO:1.
[0116] 57. Kit according to any one of items 50-56, in which the
affinity ligand of a) and/or c) comprises a label selected from the
group consisting of fluorescent dyes and metals, chromophoric dyes,
chemiluminescent compounds and bioluminescent proteins, enzymes,
radioisotopes, particles and quantum dots.
[0117] 58. Kit according to any one of items 50-57, in which said
reagents of b) and/or d) comprise a secondary affinity ligand
capable of recognizing said quantifiable affinity ligand.
[0118] 59. Kit according to item 58, in which said secondary
affinity ligand comprises a label selected from the group
consisting of fluorescent dyes or metals, chromophoric dyes,
chemiluminescent compounds and bioluminescent proteins, enzymes,
radioisotopes, particles and quantum dots.
[0119] 60. Kit according to any one of items 50-59, further
comprising at least one reference sample for provision of a
reference value.
[0120] 61. Kit according to item 60, in which at least one
reference sample is a tissue sample comprising no detectable PODXL
protein.
[0121] 62. Kit according to item 60 or 61 in which at least one
reference sample comprises PODXL protein and/or at least one
reference sample comprises COX-2.
[0122] 63. Kit according to any one of items 60-62, in which at
least one reference sample comprises an amount of PODXL protein
corresponding to a weak cytoplasmic intensity.
[0123] 64. Kit according to any one of items 60-62, in which at
least one reference sample comprises an amount of PODXL protein
corresponding to an absent cytoplasmic intensity.
[0124] 65. Kit according to any one of items 60-62, in which at
least one reference sample comprises an amount of PODXL protein
corresponding to a cytoplasmic fraction of 60% or lower.
[0125] 66. Kit according to any one of items 65, in which at least
one reference sample comprises an amount of PODXL protein
corresponding to a cytoplasmic fraction of 5% or lower, such as 1%
or lower.
[0126] 67. Kit according to any one of items 60-66, in which at
least one reference sample comprises an amount of PODXL protein
corresponding to a value being higher than a PODXL protein
reference value.
[0127] 68. Kit according to item 67, in which at least one
reference sample comprises an amount of PODXL protein corresponding
to a strong cytoplasmic intensity.
[0128] 69. Kit according to item 67 or 68, in which at least one
reference sample comprises an amount of PODXL protein corresponding
to a cytoplasmic fraction of 75% or higher.
[0129] 70. Kit according to any one of items 60-69 comprising:
[0130] a first reference sample comprising an amount of PODXL
protein corresponding to a value (positive reference value) being
higher than a reference value; and
[0131] a second reference sample comprising an amount of PODXL
protein corresponding to a value (negative reference value) being
lower than or equal to said reference value.
[0132] 71. Kit according to any one of items 60-70, in which at
least one reference sample comprises an amount of COX-2
corresponding to a value being higher than a COX-2 reference
value.
[0133] 72. Kit according to item 71, in which at least one
reference sample comprises an amount of COX-2 corresponding to a
strong cytoplasmic intensity.
[0134] 73. Kit according to item 71 or 72, in which at least one
reference sample comprises an amount of COX-2 protein corresponding
to a cytoplasmic fraction of 75% or higher.
[0135] 74. Kit according to any one of items 60-73 comprising:
[0136] a first reference sample comprising an amount of COX-2
corresponding to a value (positive reference value) being higher
than a reference value; and
[0137] a second reference sample comprising an amount of COX-2
corresponding to a value (negative reference value) being lower
than or equal to said reference value.
[0138] 75. Kit according to any one of items 60-74, in which said
reference sample(s) comprise(s) cell lines.
[0139] 76. Use in vitro of a PODXL protein as a prognostic marker
for colorectal cancer.
[0140] 77. Use according to item 76, wherein said protein is
provided in a biological sample from a subject having a colorectal
cancer.
[0141] 78. Use according to item 77, wherein said protein is
provided in a colorectal tissue sample comprising tumor cells.
[0142] 79. Use according to item 78, wherein said colorectal tissue
sample is a colon sample.
[0143] 80. Use according to item 79, wherein said colorectal tissue
sample is a sigmoideum sample.
[0144] 81. Use in vitro of a PODXL protein, or an antigenically
active fragment thereof, for the selection or purification of a
prognostic agent for establishing a prognosis for a mammalian
subject having a colorectal cancer.
[0145] 82. Use of a PODXL protein, or an antigenically active
fragment thereof, as an antigen in an immunization for the
production of a prognostic agent for establishing a prognosis for a
mammalian subject having a colorectal cancer.
[0146] 83. Use according any one of items 76-82, wherein the amino
acid sequence of the PODXL protein comprises a sequence selected
from:
[0147] i) SEQ ID NO:1; and
[0148] ii) a sequence which is at least 85% identical to SEQ ID
NO:1.
[0149] 84. Use according any one of items 76-83, wherein the amino
acid sequence of the PODXL protein comprises or consists of a
sequence selected from:
[0150] i) SEQ ID NO:2 or 3; and
[0151] ii) a sequence which is at least 85% identical to SEQ ID
NO:2 or 3.
[0152] 85. Use in vitro of an affinity ligand capable of selective
interaction with a PODXL protein as a prognostic agent for
colorectal cancer.
[0153] 86. Use according to item 85, wherein said prognostic agent
is an affinity ligand capable of selective interaction with the
PODXL protein, or an antigenically active fragment thereof.
[0154] 87. Use of an affinity ligand capable of selective
interaction with a PODXL protein in the manufacture of a prognostic
agent for in vivo establishment of a prognosis for a mammalian
subject having a colorectal cancer.
[0155] 88. Use according to any one of items 85-87, wherein said
affinity ligand is obtainable by a process comprising a step of
immunizing an animal with a peptide whose amino acid sequence
consists of the sequence SEQ ID NO:1.
[0156] 89. Use according to any one of items 85-88, wherein said
affinity ligand is capable of selective interaction with a peptide
whose amino acid sequence consists of the sequence SEQ ID NO:1.
[0157] 90. Affinity ligand capable of selective interaction with a
PODXL protein fragment consisting of 20 amino acids or less, such
as 15 amino acids or less, and comprising an amino acid sequence
selected from SEQ ID NO:10-15.
[0158] 91. Affinity ligand capable of selective interaction with a
PODXL protein for use in treatment of a subject having colorectal
cancer.
[0159] 92. Affinity ligand according to item 91, capable of
selective interaction with the extracellular region SEQ ID NO:6 or
7 of the PODXL protein.
[0160] 93. Affinity ligand according to item 92, capable of
selective interaction with a peptide whose amino acid sequence
consists of the sequence SEQ ID NO:1.
[0161] 94. Affinity ligand according to any one of items 91-93,
which is a monoclonal or polyclonal antibody.
[0162] 95. Affinity ligand according to any one of items 91-94,
wherein said colorectal cancer is colon cancer, such as sigmoid
colon cancer.
[0163] 96. Method of treatment of a subject having a colorectal
cancer comprising the step of administrating an effective amount of
an affinity ligand capable of selective interaction with the PODXL
protein.
[0164] 97. Method according to item 96, wherein the affinity ligand
is capable of selective interaction with the extracellular region
SEQ ID NO:6 or 7 of the PODXL protein. 98. Method according to item
97, wherein the affinity ligand is capable of selective interaction
with a peptide whose amino acid sequence consists of the sequence
SEQ ID NO:1.
[0165] 99. Method according to any one of items 96-98, wherein the
affinity ligand is a monoclonal or polyclonal antibody, or a
fragment thereof.
[0166] 100. Use of a PODXL protein, or an antigenically active
fragment thereof, as an antigen in an immunization for the
production of a therapeutic affinity ligand according to any one of
items 90-94.
[0167] 101. Use according to item 100, wherein the PODXL protein
consists of the extracellular region SEQ ID NO:6 or 7 or a
subsequence thereof.
BRIEF DESCRIPTION OF THE FIGURES
[0168] FIGS. 1A and 1B show the results of survival analysis of 279
subjects diagnosed with sigmoid colon cancer. Briefly, the subjects
were split into four groups based on PODXL protein expression. "0"
represents an absent cytoplasmic intensity (CI) and a cytoplasmic
fraction (CF) of <1%. "1" represents a weak CI and a CF of
>1%. "2" represents a moderate or strong CI and a CF of 1-50%.
Finally, "3" represents moderate or strong CI and a CF of >50%.
FIG. 1A shows overall survival (OS) and FIG. 1B shows disease free
survival (DFS).
[0169] FIGS. 2A and 2B show the results of survival analysis of 279
subjects diagnosed with sigmoid colon cancer. Briefly, the subjects
were split into two groups based on PODXL protein expression,
wherein "low" represents "0" or "1" according to FIG. 1 and "high"
represents "2" or "3" according to FIG. 1. FIG. 2A shows OS and
FIG. 2B shows DFS.
[0170] FIGS. 3A and 3B show the results of survival analysis of 279
subjects diagnosed with sigmoid colon cancer. Briefly, the subjects
were split into two groups based on PODXL protein expression,
wherein "low" represents "0" according to FIG. 1 and "high"
represents "1", "2" or "3" according to FIG. 1. FIG. 3A shows OS
and FIG. 3B shows DFS.
[0171] FIGS. 4A and 4B show the results of survival analysis of 279
subjects diagnosed with sigmoid colon cancer. Briefly, the subjects
were split into four groups based on expression of PODXL protein
and COX-2.
"0" represents subjects that are PODXL protein low and COX-2 low.
"1" represents subjects that are PODXL protein low and COX-2 high.
"2" represents subjects that are PODXL protein high and COX-2 low.
Finally, "3" represents subjects that are PODXL protein high and
COX-2 high. "PODXL protein low" and "PODXL protein high" are as in
FIGS. 2A and 2B. "COX-2 low" is a CF of <10% and/or an absent,
weak or moderate CI. "COX-2 high" is a CF of .gtoreq.10% and a
strong CI. FIG. 4A shows OS and FIG. 4B shows DFS.
[0172] FIGS. 5A and 5B show the results of survival analysis of 279
subjects diagnosed with sigmoid colon cancer. Briefly, the subjects
were split into two groups based on expression of PODXL protein and
COX-2.
"0" represents subjects that are PODXL protein low and/or COX-2
low. "1"=represents subjects that are PODXL high and COX-2 high.
"PODXL protein low" and "PODXL protein high" are as in FIGS. 2A and
2B. "COX-2 low" is a CF of <10% and/or an absent, weak or
moderate CI. "COX-2 high" is a CF of .gtoreq.10% and a strong CI.
FIG. 5A shows OS and FIG. 5B shows DFS.
[0173] FIGS. 6A and 6B show the results of OS analysis of 112
subjects diagnosed with colorectal cancer. In FIG. 6A the subjects
were split into four groups in the same way as in FIGS. 1A and 1B.
In FIG. 6B the subjects were split into two groups in the same way
as in FIGS. 2A and 2B. FIG. 6A shows OS and FIG. 6B shows DFS.
[0174] FIG. 7 shows the results of OS analysis of 50 subjects
diagnosed with colon cancer. Briefly, the subjects were split into
two groups in the same way as in FIGS. 2A and 2B.
[0175] FIG. 8A shows the results of OS analysis of 112 subjects
diagnosed with colorectal cancer. Briefly, the subjects were split
into four groups based on expression of PODXL protein and
COX-2.
"0" represents subjects that are PODXL protein low and COX-2 low.
"1" represents subjects that are PODXL protein low and COX-2 high.
"2" represents subjects that are PODXL protein high and COX-2 low.
Finally, "3" represents subjects that are PODXL protein high and
COX-2 high. "PODXL protein low" and "PODXL protein high" are as in
FIG. 2. "COX-2 low" is a CF of <10% and/or an absent or weak CI.
"COX-2 high" is a CF of .gtoreq.10% and a moderate or strong
CI.
[0176] FIG. 8B shows the results of OS analysis of 112 subjects
diagnosed with colorectal cancer. Briefly, the subjects were split
into two groups based on expression of PODXL protein and COX-2. "0"
represents subjects that are PODXL protein low and/or COX-2 low.
"1"=represents subjects that are PODXL high and COX-2 high. "PODXL
protein low" is absent or weak CI. "PODXL protein high" is moderate
or strong CI. "COX-2 low" is a CF of <10% and/or an absent or
weak CI. "COX-2 high" is a CF of .gtoreq.10% and a moderate or
strong CI.
[0177] FIG. 9A shows overall survival for 270 colorectal cancer
patients (colorectal cancer cohort II) with absent, weak, moderate,
and strong PODXL expression (score 0 to 3) as determined by IHC
analysis. "0" represents an absent cytoplasmic intensity (CI) and a
cytoplasmic fraction (CF) of <1%. "1" represents a weak CI and a
CF of >1%. "2" represents a moderate or strong CI and a CF of
1-50%. Finally, "3" represents moderate or strong CI and a CF of
>50%.
[0178] FIG. 9B shows overall survival for the 270 colorectal cancer
patients (colorectal cancer cohort II) with absent or weak PODXL
expression (solid line) and moderate or high PODXL expression
(dotted line). "Absent or weak" represents "0" or "1" according to
FIG. 9A and "moderate or high" represents "2" or "3" according to
FIG. 9A.
[0179] FIG. 10A shows overall survival for 21 patients from
colorectal cancer cohort II with highly differentiated tumors.
Briefly, the subjects were split into two groups based on PODXL
protein expression. An absent PODXL expression (solid line)
represents "0" according to FIG. 9A, and tumors that stained
positive for PODXL (dotted line) represents "1", "2" or "3"
according to FIG. 9A.
[0180] FIG. 10B shows overall survival for 42 patients from
colorectal cancer cohort II with Dukes stage A tumors analyzed for
PODXL expression. Briefly, the subjects were split into two groups
based on PODXL protein expression. An absent or weak PODXL
expression (solid line) represents "0" or "1" according to FIG. 9A
and tumors that stained positive for PODXL (dotted line) represents
"2" or "3" according to FIG. 9A.
[0181] FIG. 11 shows the binding of the polyclonal anti-PODXL
antibody to the surface of living human colon cancer cells in
vitro. Increasing concentrations of anti-PODXL antibody was added
to CACO-2 cells, indicated by vertical lines in the figure. After
approximately 5 hours, also indicated by a vertical line in the
figure, the anti-PODXL antibody was removed, the cells were washed
and incubated with fresh complete medium only. Thus, from 5 hours
on, the retention phase can be seen.
[0182] FIG. 12 shows the epitope mapping of the anti-PODXL
polyclonal antibody. Antibody binding to 26 different peptides,
with a length of 15 amino acids (aa) and with a 10 aa overlap,
covering the entire PrEST region (SEQ ID NO:1) is shown. The y-axis
represents fluorescence intensity.
[0183] FIGS. 13A and 13B show colorectal cancer specific survival
(FIG. 13A) and overall survival (FIG. 13B) of 536 colorectal cancer
patients divided into 3 groups based on PODXL expression. Solid
line ("1") represents patients with no PODXL expression (n=268),
dotted line ("2") represents patients with weak or moderate PODXL
expression (n=196), and intermittent line ("3") represents patients
with high PODXL expression (n=72).
[0184] FIGS. 14A and 14 B show impact of PODXL expression and
adjuvant chemotherapy on colorectal cancer specific survival (FIG.
14A) and overall survival (FIG. 14B) of 122 colorectal cancer
patients with curatively resected stage III disease. The line "0"
represents patients with no PODXL expression that did not receive
adjuvant chemotherapy, "1" represents patients with no PODXL
expression that received adjuvant chemotherapy, "2" represents
patients with PODXL expression that did not receive adjuvant
chemotherapy, and "3" represents patients with no PODXL expression
that received adjuvant chemotherapy. P-values listed in FIG. 14B
represent 5-year overall survival.
DETAILED DESCRIPTION
[0185] As a first aspect of the present disclosure, there is thus
provided a method for determining whether a mammalian subject
having a colorectal cancer belongs to a first or a second group,
wherein the prognosis of subjects of the first group is better than
the prognosis of subjects of the second group, comprising the steps
of: [0186] a) evaluating an amount of PODXL protein in at least
part of a sample earlier obtained from the subject, and determining
a sample value corresponding to the evaluated amount; [0187] b)
comparing said sample value from step a) with a predetermined
reference value; and [0188] if said sample value is higher than
said reference value, [0189] c1) concluding that the subject
belongs to said second group; and [0190] if said sample value is
lower than or equal to said reference value, [0191] c2) concluding
that the subject belongs to said first group.
[0192] The present aspect based on the finding that levels of PODXL
protein may indicate the prognosis for a subject having colorectal
cancer has a number of benefits. In general, establishing a
prognosis may be of vital importance as it may help a physician
selecting an appropriate treatment strategy. For example, if a
cancer form of poor prognosis is identified, a painful or in any
other sense unpleasant treatment, which normally is avoided, may
anyway be considered. Further, if a cancer form of good prognosis
can be identified, over-treatment may be avoided. As a further
example, the PODXL protein, as a marker for which a certain level
of expression is correlated with a certain pattern of disease
progression, has a great potential, for example, in a panel for
making predictions or prognoses, or for the selection of a
treatment regimen.
[0193] In the method of the first aspect, it is determined whether
a colorectal cancer subject belongs to a first or a second group,
wherein subjects of the first group generally have a better
prognosis than subjects of the second group. The division of
colorectal cancer subjects into the two groups is determined by
comparing samples values from the subjects with a reference value.
In the present disclosure it is shown that various reference values
may be employed to discriminate between subjects that generally
survived for a comparatively long period, and subjects that
generally survived for a comparatively short period. The reference
value is thus the determinant for the size of the respective
groups; the lower the reference value, the fewer the subjects in
the first group and the lower the likelihood that a tested subject
belongs to the first group. As the time of survival generally
decreases as the PODXL expression level increases, a high reference
value may in some instances be selected to identify subjects with a
particularly poor prognosis. Guided by the present disclosure, the
person skilled in the art may select relevant reference values
without undue burden. This is further discussed below.
[0194] The first and the second group may consist exclusively of
subjects having colorectal cancers of the same or similar stage,
differentiation grade and/or location as the tested subject.
Further, the groups may consist only of subjects having the same or
similar age, race, sex, genetic (heretic) characteristics or
medical status or history.
[0195] Consequently, a physician may use the method according to
the first aspect to obtain additional information regarding the
prognosis of a colorectal cancer subject, which in turn may help
him to select the most appropriate treatment regimen. For example,
a subject shown to belong to the second group using the method of
the first aspect, may be given a more aggressive treatment than
what would otherwise have been considered, and vice versa.
[0196] Further, the inventors have realized that an even more
detailed prognosis may be obtained if the level of COX-2 protein is
also measured in a sample from the subject. This is illustrated in
FIGS. 4A, 4B, 5A, 5B and 8 and discussed further below.
[0197] Consequently, in an embodiment of the first aspect, each of
the first and the second group has two subgroups, .alpha. and
.beta., wherein the prognosis of subjects of the subgroup .alpha.
is better than the prognosis of subjects of the subgroup .beta. in
each of the first and the second group, the method further
comprising the steps of: [0198] d) evaluating an amount of COX-2
protein in at least part of a sample earlier obtained from the
subject, and determining a sample value corresponding to the
evaluated amount; [0199] e) comparing said sample value from step
d) with a predetermined reference value; and if the sample value
from step d) is higher than the reference value of step e), [0200]
f1) concluding that the subject belongs to subgroup .beta.; and if
the sample value from step d) is lower than or equal to the
reference value of step e), [0201] f2) concluding that the subject
belongs to subgroup .alpha..
[0202] As seen in FIGS. 4A, 4B and 8A, subjects expressing levels
of PODXL and COX-2 protein which both are higher than the reference
values have a particularly poor prognosis, while subjects
expressing levels of PODXL and COX-2 protein which both are lower
than or equal to the reference values have a particularly good
prognosis.
[0203] The prognostic information obtained by measuring the level
of PODXL protein may thus be resolved further by also measuring the
level of COX-2 protein.
[0204] In some embodiments, the sample of step a) and the sample of
step d) may be the same type of sample selected for the group
consisting of tissue sample, body fluid sample, stool sample and
cytology sample. Consequently, it may be enough to collect only one
type of samples from the subject, which may simplify the testing
procedure and minimize uncomfortable/painful interaction with the
subject's body. The sample of step a) and the sample of step d) may
also be the same sample, which further simplifies the procedure and
reduces discomfort/pain.
[0205] The embodiments relating to measurements of both PODXL
protein and COX-2 protein apply mutatis mutandis to the
configurations of the first aspect presented below as well as to
the second aspect.
[0206] The prognosis of the tested subject may also be determined
relative to a reference prognosis. Accordingly, as a first
configuration of the first aspect, there is provided a method for
determining a prognosis for a mammalian subject having a colorectal
cancer, comprising the steps of: [0207] a) evaluating an amount of
PODXL protein present in at least part of a sample earlier obtained
from the subject, and determining a sample value corresponding to
the evaluated amount; [0208] b) comparing the sample value obtained
in step a) with a reference value associated with a reference
prognosis; and, if said sample value is higher than said reference
value, [0209] c1) concluding that the prognosis for said subject is
worse than said reference prognosis; and/or if said sample value is
lower than or equal to said reference value, [0210] c2) concluding
that the prognosis for said subject is better than or equal to said
reference prognosis.
[0211] However closely related and covered by the same concept, c1)
and c2) provide two alternative conclusions.
[0212] In the present disclosure, different PODXL protein values
(sample values) corresponding to various prognoses are presented.
Typically, a low sample value is associated with a better prognosis
than a high sample value. In the method of the first configuration
of the first aspect, the sample value is compared to a reference
value, and if the sample value is equal to or lower than the
reference value, it is concluded that the prognosis for the subject
is equal to, or better than, a reference prognosis associated with
the reference value.
[0213] Consequently, the method may be adapted to a reference
value. In such case, starting from a sample value which under the
circumstances is considered to be relevant, a reference value which
is equal to the sample value may be selected. Subsequently, a
reference prognosis associated with that reference value may be
established. Guided by the present disclosure, the person skilled
in the art understands how to establish a reference prognosis which
corresponds to a given reference value. For example, the relation
between sample values and survival data in a relevant group of
cancer patients may be examined in line with what is described in
Examples, Section 3 or 4, below. The procedure described therein
may be adapted to a given reference value. Then, a prognosis
corresponding to the given reference value may be selected as the
reference prognosis.
[0214] Also, the above method may be adapted to a given reference
prognosis. In such case, starting from a reference prognosis which
under the circumstances is considered to be relevant, for example
for selecting an appropriate therapy, a corresponding reference
value may be established. Guided by the present disclosure, the
person skilled in the art understands how to establish a reference
value which corresponds to a given reference prognosis. For
example, the relation between sample values and survival data in a
group of cancer patients may be examined as in Examples, Section 3
or 4, below, but the procedure described therein may be adapted to
establish reference values corresponding to a given reference
prognosis. For example, different reference values may be tested
until one which correlates with the given reference prognosis is
found.
[0215] Accordingly, the reference prognosis may be based on a
previously established prognosis, e.g., obtained by an examination
of a relevant population of subjects. Such reference population may
be selected to match the tested subject's age, sex, race, Dukes'
stage and/or medical status and history. Further, a prognosis may
be adapted to a background risk in the general population, a
statistical prognosis/risk or an assumption based on an examination
of the subject. Such examination may also comprise the subject's
age, sex, race, Dukes' cancer stage, menopausal status and/or
medical status and history. Thus, a physician may for example adapt
the reference prognosis to the subject's colorectal cancer history,
the stage of the tumor, the morphology of the tumor, the location
of the tumor, the menopausal status, the presence and spread of
metastases and/or further cancer characteristics.
[0216] The inventive concept of the present disclosure may also
form the basis for a decision to refrain from a certain treatment
regimen.
[0217] For example, as shown in the attached figures, the prognoses
for subjects showing low PODXL protein levels are generally better
than those for subjects showing high PODXL protein levels. Provided
with the teachings of the present disclosure, a physician may
consider the prognosis of an PODXL protein low subject as being so
favorable that certain adjuvant treatment regimens are avoided and
a less aggressive adjuvant treatment regimen is selected instead.
For example, monotherapy may be selected instead of a combination
therapy or a therapeutic agent may be given in a lower dose. Also,
in some cases, the decision may be to refrain from all types of
adjuvant treatment. In conclusion, the present disclosure may
relieve subjects from over-treatment.
[0218] Thus, as a second configuration of the first aspect, there
is provided a method for determining whether a subject having a
colorectal cancer is not in need of a treatment with a colorectal
cancer treatment regimen, comprising the steps of: [0219] a)
evaluating an amount of PODXL protein present in at least part of a
sample earlier obtained from the subject, and determining a sample
value corresponding to the evaluated amount; [0220] b) comparing
the sample value obtained in step a) with a reference value; and,
if said sample value is lower than or equal to said reference
value, [0221] c) concluding that said subject is not in need of the
treatment with said colorectal cancer treatment regimen.
[0222] Further, as a third configuration of the first aspect, there
is provided a non-treatment strategy method for a subject having a
colorectal cancer, comprising: [0223] a) evaluating an amount of
PODXL protein present in at least part of a sample earlier obtained
from the subject, and determining a sample value corresponding to
the evaluated amount; [0224] b) comparing the sample value obtained
in step a) with a reference value; and, if said sample value is
lower than or equal to said reference value, [0225] c) refraining
from treating said subject with a colorectal cancer treatment
regimen.
[0226] For example, the refraining of step c) of the fifth
configuration may be a refraining from treatment during at least
one week from the completion of steps a)-b), such as at least one
month from the completion of steps a)-b), such as at least three
months from the completion of steps a)-b), such as at least six
months from the completion of steps a)-b), such as at least one
year from the completion of steps a)-b), such as at least two years
from the completion of steps a)-b).
[0227] Alternatively, the refraining of step c) may be a refraining
from treatment until the next time the method is performed or until
recurrence of an colorectal cancer tumor.
[0228] As discussed above and shown in FIGS. 4A and 4B, subjects
showing comparatively low levels of both PODXL protein and COX-2
have a particularly good prognosis and may therefore not be in need
of a certain treatment.
[0229] Embodiments of the methods of the second and third
configuration of the first aspect may therefore comprise COX-2
measurements (see above). Also, in embodiments of the second and
third configuration of the first aspect, the subject may be COX-2
low.
[0230] "COX-2 low" refers to that a measured COX-2 level from the
subject is lower than or equal to a reference level. Accordingly,
"COX-2 high" refers to that a measured COX-2 level from the subject
is higher than a reference level. Consequently, "COX-2 high" always
corresponds to, at the least, detectable COX-2 in a relevant part
of the subject's body or a relevant sample from the subject's body.
For example, "COX-2 high" may be that a COX-2 sample value is
higher than a reference value according to what is described in the
above embodiment of the first aspect involving COX-2 evaluation. In
the present disclosure, two different definitions of "COX-2 high"
are employed. One definition is that a sample from the subject
shows a CF of 10% and moderate or strong CI. An alternative
definition is that a sample from the subject shows a CF of 10% and
strong CI. If a subject is not "COX-2 high", it is "COX-2 low". In
general, the cut-off used for determining whether a subject is
"COX-2 high" or "COX-2 low" should be selected such that the
division becomes clinically relevant. A CF of 10% (without regard
to CI) may also be used as cut-off (see also Lambropoulou M et al
(2009) J Cancer Res Clin Oncol, September 16). Given the teachings
of the present disclosure, the skilled person understands how to
discriminate between "COX-2 high" and "COX-2 low" such that
relevant prognosis information is obtained.
[0231] As an alternative configuration of the first aspect, there
is provided a method for establishing a prognosis for a mammalian
subject having a colorectal cancer, comprising the steps of: [0232]
a) evaluating an amount of PODXL protein present in at least part
of a sample from the subject, and determining a sample value
corresponding to the evaluated amount; and [0233] b) correlating
the sample value of step a) to the prognosis for the subject.
[0234] In the context of the present disclosure, "establishing a
prognosis" refers to establishing a specific prognosis or a
prognosis interval.
[0235] In an embodiment of the alternative configuration, the
sample may be an earlier obtained sample.
[0236] The correlating of step b) refers to any way of associating
survival data to the obtained sample value so as to establish a
prognosis for the subject.
[0237] In general, when deciding on a suitable treatment strategy
for a patient having colorectal cancer, the physician responsible
for the treatment may take several parameters into account, such as
the result of an immunohistochemical evaluation, patient age, tumor
type, stage and grade, general condition and medical history, such
as colorectal cancer history. To be guided in the decision, the
physician may perform a PODXL protein test, or order a PODXL
protein test to be performed, according to the first aspect.
Further, the physician may assign to someone else, such as
laboratory staff, to perform step a), and optionally step b), while
performing step c), and optionally b), himself.
[0238] The inventive concept of the present disclosure may also
form the basis for applying various treatment regimes.
[0239] For example, as shown in the attached figures, the prognoses
for subjects showing high PODXL protein levels are generally worse
than those for subjects showing low PODXL protein levels. Provided
the teachings of the present disclosure, a physician may thus
consider the prognosis of a PODXL protein high subject as being so
poor that a certain adjuvant treatment regimen is appropriate. If
the subject is also COX2 high, the indications in favor of the
treatment may be even stronger. The present disclosure may thus
provide for accurate treatment of a previously undertreated
group.
[0240] As a second aspect of the present disclosure, there is thus
provided a method of treatment of a subject having a colorectal
cancer, comprising: [0241] a) evaluating an amount of PODXL protein
present in at least part of a sample from the subject and
determining a sample value corresponding to the evaluated amount;
[0242] b) comparing the sample value obtained in step a) with a
reference value; and, if said sample value is higher than said
reference value, [0243] c) treating said subject with a colorectal
cancer treatment regimen. According to one embodiment, the method
may comprise the additional step: [0244] d) and if said sample
value is lower than or equal to said reference value, refraining
from treating said subject with the colorectal cancer treatment
regimen.
[0245] In one embodiment of the second aspect, the reference value
of step b) may be associated with a reference prognosis and said
treatment regimen of step c) may be adapted to a prognosis which is
worse than the reference prognosis. In such an embodiment of the
second aspect, the method may comprise the additional step: d) and
if said sample value is lower than or equal to said reference
value, treating said subject with a treatment regimen adapted to a
prognosis which is better than or equal to the reference prognosis,
for which the appropriate treatment regimen may be no
treatment.
[0246] Embodiments of the second aspect may for example comprise
COX-2 measurements (see above). Also, in embodiments of the second
aspect, the subject may be COX-2 high.
[0247] The treatment of step c) may for example be a more
comprehensive treatment than what would have been standard under
the conditions if no PODXL protein or COX-2 information was
available.
[0248] A subject may have a colorectal cancer in such an advanced
stage that an adjuvant therapy would normally be considered
superfluous and unnecessary painful. However, in such case, a
physician may anyway decide to apply the adjuvant therapy if the
subject in question has an increased probability of prolonged
survival due to a low PODXL protein (and optionally COX-2)
value.
[0249] Thus, as a first configuration of the second aspect, there
is provided a method of treatment of a subject having a colorectal
cancer of an advanced stage, such as Dukes' stage C or D,
comprising: [0250] a) evaluating the amount of PODXL protein
present in at least part of a sample from the subject, and
determining a sample value corresponding to said evaluated amount;
[0251] b) comparing the sample value obtained in step b) with a
reference value; and, [0252] if said sample value is lower than or
equal to said reference value, [0253] c) treating said subject with
a colorectal cancer treatment regimen for prolonged survival.
[0254] Further, if said sample value is higher than reference
value, the subject may be treated with palliative treatment
only.
[0255] The physician responsible for the treatment according to the
second aspect may assign to someone else, such as a laboratory
staff, to perform step a), and optionally step b), while performing
step c), and optionally step b), himself.
[0256] The method of treatment may be limited to the
decision-making and treatment. Thus, as an alternative
configuration of the second aspect, there is provided a method of
treatment of a subject having a colorectal cancer, comprising:
[0257] .alpha.) comparing a sample value corresponding to a level
of PODXL protein in [0258] a sample from the subject with a
reference value; and, [0259] if said sample value is higher than
said reference value, [0260] .beta.) treating said subject with an
adjuvant colorectal cancer treatment regimen.
[0261] Numerous ways of obtaining a sample value corresponding to a
level of PODXL protein in a sample from a subject are described in
the present disclosure.
[0262] Regarding step a) of the methods of the present disclosure,
an increase in the amount of PODXL protein typically results in an
increase in the sample value, and not the other way around.
However, in some embodiments, the evaluated amount may correspond
to any of a predetermined number of discrete sample values. In such
embodiments, a first amount and a second, increased, amount may
correspond to the same sample value. In any case, an increase in
the amount of PODXL protein will not result in a decrease in the
sample value in the context of the present disclosure.
[0263] However inconvenient, but in an equivalent fashion, the
evaluated amounts may be inversely related to sample values if the
qualification between step b) and c) is inverted. For example, the
qualification between step b) and c) is inverted if the phrase "if
the sample value is higher than the reference value" is replaced
with "if the sample value is lower than the reference value".
[0264] In the context of the present disclosure, "prognosis" refers
to the prediction of the course or outcome of a disease and its
treatment. For example, prognosis may also refer to a determination
of chance of survival or recovery from a disease, as well as to a
prediction of the expected survival time of a subject. A prognosis
may specifically involve establishing the likelihood for survival
of a subject during a period of time into the future, such as three
years, five years, ten years or any other period of time. A
prognosis may further be represented by a single value or a range
of values.
[0265] Further, in the context of the methods of the present
disclosure, "earlier obtained" refers to obtained before the method
is performed. Consequently, if a sample earlier obtained from a
subject used in a method, the method does not involve obtaining the
sample from the subject, i.e., the sample was previously obtained
from the subject in a step separate from the method.
[0266] All the methods and uses of the present disclosure, except
the methods of treatment, may be carried out entirely in vitro
unless otherwise indicated.
[0267] Further, in the context of the present disclosure, "a
mammalian subject having a colorectal cancer" refers to a mammalian
subject having a primary or secondary colorectal tumor or a
mammalian subject which has had a tumor removed from the colon
and/or rectum, wherein the removal of the tumor refers to killing
or removing the tumor by any appropriate type of surgery or
therapy. In the method and use aspects of the present disclosure,
"a mammalian subject having a colorectal cancer" also includes the
cases wherein the mammalian subject is suspected of having a
colorectal at the time of the performance of the use or method and
the colorectal cancer diagnosis is established later.
[0268] Thus, a subject having a colorectal cancer located in the
colon, may refer to a subject who has had a tumor removed from the
colon.
[0269] Further, in the context of the present disclosure, the
"reference value" refers to a predetermined value found to be
relevant for making decisions or drawing conclusions regarding the
prognosis or a suitable treatment strategy for the subject.
[0270] Also, in the context of the present disclosure, a reference
value being "associated" with a reference prognosis refers to the
reference value being assigned a corresponding reference prognosis,
based on empirical data and/or clinically relevant assumptions. For
example, the reference value may be the average PODXL protein value
in a relevant group of subjects and the reference prognosis may be
an average survival in the same group. Further, the reference value
does not have to be assigned to a reference prognosis directly
derived from prognosis data of a group of subjects exhibiting the
reference value. The reference prognosis may for example correspond
to the prognosis for subjects exhibiting the reference value or
lower. That is, if the reference value is 1 on a scale from 0 to 2,
the reference prognosis may be the prognosis of the subjects
exhibiting the values 0 or 1. Consequently, the reference prognosis
may also be adapted to the nature of the available data. As further
discussed above, the reference prognosis may be further adapted to
other parameters as well.
[0271] Step a) of the methods of the above aspects involve
evaluating the amount of PODXL protein present in at least part of
the sample, and determining a sample value corresponding to the
amount. The "at least part of the sample" refers to a relevant part
or relevant parts of the sample for establishing the prognosis or
drawing conclusions regarding suitable treatments. The person
skilled in the art understands which part or parts that are
relevant under the circumstances present when performing the
method. For example, if evaluating a sample comprising cells, the
skilled person may only consider the tumor cells, or only the
membranes of tumor cells, of the sample.
[0272] Further, in step a) an amount is evaluated and a sample
value corresponding to the amount is determined. Consequently, an
exact measurement of the amount of PODXL protein is not required
for obtaining the sample value. For example, the amount of PODXL
protein may be evaluated by visual inspection of a stained tissue
sample and the sample value may then be categorized as e.g. high or
low based on the evaluated amount.
[0273] The evaluation and determination of step a) requires some
kind of processing or manipulation of the sample. It is not
possible to determine the sample value by mere inspection. Various
techniques, of which some are presented below, for such evaluation
and determination, are well known to the skilled person. The
methods of the present disclosure are therefore not limited to any
specific technique or techniques for the performance of step
a).
[0274] The treatment regimen of the first and second aspect may for
example be an adjuvant and/or a neo-adjuvant therapy. The
neo-adjuvant therapy may for example be radiation therapy,
especially in cases of rectal cancer. Appropriate adjuvant
therapies are primarily chemotherapies and immunotherapies.
Further, the adjuvant treatment may be chemotherapy and/or
immunotherapy in combination with radiation therapy.
[0275] The general strategy is that a more comprehensive treatment
is applied if a subject is found to be PODXL protein high than if
the subject is found to be PODXL protein low.
[0276] For example, if the subject has a Dukes' stage B colorectal
cancer, the adjuvant treatment regimen may be chemotherapy. That
means that according to some of the above methods, a
chemotherapeutic agent is administered to the subject if the
subject is PODXL protein high (and optionally COX-2 high). However,
if the subject is PODXL protein low (and optionally COX-2 low), the
treatment with the chemotherapeutic agent may be considered
unnecessary, and therefore, not administered to the subject.
[0277] As another example, if the subject has a Dukes' stage C
colorectal cancer, the treatment regimen may be a combination of
two or more chemotherapeutic agents. That means that according to
some of the above methods, the combination is administered to the
subject if the subject is PODXL protein high (and optionally COX-2
high). However, if the subject is PODXL protein low (and optionally
COX-2 low), the combination may be considered unnecessary, and
therefore, not applied to the subject. In the latter case,
treatment with one therapeutic agent may be considered
necessary.
[0278] Alternatively, the combination is applied in both cases,
however in a relatively high dose if the subject is PODXL protein
high and in a relatively low dose if the subject is PODXL protein
low. Here, the "relatively high dose" is high relative to the
"relatively low dose". For example, a dose considered to be normal
within the art may be decreased if a sample value from the subject
is lower than or equal to the reference value and increased if the
sample value from the subject is higher than the reference
value.
[0279] Non-limiting examples of chemotherapeutic agents are
5-fluorouracil (5-FU), capecitabine (Xeloda.RTM.) and oxaliplatin
(Eloxatin.RTM.). 5-fluorouracil, capecitabine and oxaliplatin are
today given as adjuvant after surgery, either alone, e.g.
5-fluorouracil, or in combinations e.g. as FOLFOX, including
5-fluorouracil, leucovorin and oxaliplatin. These drugs are also
used to treat metastatic disease, but then often in combination
and/or with other chemotherapeutic agents including tegafur-uracil
(UFT.RTM.), leucovorin (folonic acid) and/or irinotecan
(Camptosar.RTM.).
[0280] Non-limiting examples of immunotherapeutic agents are
bevacizumab (Avastin.RTM.) and cetuximab (Erbitux.RTM.).
[0281] Another example of an immunotherapy that may be applied is
discussed below in connection with the eighth and ninth aspect of
the present disclosure. The immunotherapy may thus be application
of an affinity ligand capable of selective interaction with the
PODXL protein. Various embodiments of such an affinity ligand is
discussed below in connection with the eighth aspect.
[0282] The treatment regimen of the first and second aspect may
also comprise or consist of COX-2 inhibition treatment. This
embodiment is particularly relevant when the subject is both PODXL
protein high and COX-2 high.
[0283] In embodiments of the first and second aspect, the prognosis
may be a probability of survival and the reference prognosis may be
a reference probability of survival, wherein both survivals are the
same type of survival. As explained in the background section,
there are several ways to measure "survival". The survivals of the
first and second aspects may for example be recurrence free
survivals, overall survivals or disease free survivals. Further,
the "survival" may be measured over different periods, such as
five, ten or 15 years. Accordingly, the survivals may be five-year,
ten-year or 15-year survivals.
[0284] In embodiments of the methods of the above aspects, the
subject may have colorectal cancer in different forms and/or
stages.
[0285] In some embodiments of these aspects, the colorectal cancer
in question may be a node-negative colorectal cancer, i.e.
colorectal cancer that has not progressed to the lymph node
metastazing stage. In other similar embodiments, the colorectal
cancer in question is in either Dukes' stage A or B. In yet other
embodiments, the colorectal cancer in question is colorectal
adenoma or colorectal carcinoma. In these embodiments, determining
that the subject exhibits high PODXL protein expression may be of
great value for the prognosis of future progression of the disease
and thus form the basis for an informed decision with regard to
future disease management. Within a group of subjects afflicted
with such a comparatively early stage of disease, subjects with
high PODXL protein expression probably are at a comparatively high
risk of developing a more aggressive disease. High PODXL protein
expression among subjects having node-negative colorectal cancer or
Dukes' stage A or B colorectal cancer may therefore indicate that
these subjects should be monitored more closely and/or treated
differently than subjects that do not exhibit high PODXL protein
expression. The methods according to the present disclosure
therefore offers the possibility of a greater chance for survival
over a certain period of time and/or longer survival time for such
subjects, owing to the additional prognostic information given by
the PODXL protein marker.
[0286] The inventors have found that the finding of the present
disclosure applies to colorectal cancers in all of the Dukes'
stages. In other words, the prognostic relevance appears to be
independent of the stage of the colorectal cancer in question.
[0287] Subjects having a Dukes' stage A colorectal cancer are
traditionally not treated with adjuvant chemotherapy. However,
guided by the teachings of the present disclosure, a physician may
decide to give such a subject exhibiting high PODXL protein
expression an adjuvant treatment anyway.
[0288] Consequently, in embodiments of the methods of the above
aspects, the colorectal cancer is in Dukes' stage A. In an
alternative or complementary embodiment, said colorectal cancer is
in T1-2, NO and M0 according to the TNM staging system described
above.
[0289] Regarding subjects having a Dukes' stage B cancer, it may be
particularly difficult to determine whether to apply an adjuvant
therapy or not. Dukes' stage B subjects, in particular may thus be
revealed from treatment after a favorable prognosis has been
determined by means of a PODXL protein measurement. Accordingly, in
some embodiments, the colorectal cancer of the methods of the above
aspects may be in Dukes' stage B.
[0290] Subjects having Dukes' stage C colorectal cancers are
normally treated with adjuvant treatment. If such a subject is
found to have a relatively poor prognosis, a combined adjuvant
treatment may be considered more appropriate than a single
treatment, even though the combined treatment causes more
side-effects and is more costly.
[0291] Accordingly, in some embodiments, the colorectal cancer of
the methods of the above aspects may be a metastazing colorectal
cancer. In similar embodiments, the colorectal cancer in question
may be in Dukes' stage C or D, preferably C.
[0292] A colorectal cancer invading the serosa layer (T4) is
normally considered to be particularly aggressive. Consequently, a
subject having such a colorectal cancer generally has a relatively
poor prognosis with risk for tumor spreading to the abdominal
cavity. The inventors have found that PODXL protein is
overexpressed in colorectal tumors invading the serosa.
Consequently, high levels of PODXL protein expression is an
indicator of a serosa-invading tumors (and thus of poor prognosis).
Further, the inventors see a connection between serosa invasion and
metastazing cancer. Consequently, high levels of PODXL protein
expression may also be an indicator of risk of metastasis.
Accordingly, colorectal cancer subjects having high levels of PODXL
may, according to one embodiment of the present disclosure, be
examined for metastases and/or monitored for the development of
metastases.
[0293] It follows that in embodiments of the first aspect, the
first and the second group may consist of subjects having cancers
of the same stage, grade and/or type as the subject of the
method.
[0294] In conclusion, the methods of the present disclosure may
yield information which forms the basis of a personalized treatment
regimen.
[0295] In embodiments of the methods of the above aspects, the
sample may be a body fluid sample. For example, the body fluid
sample may be selected from the group consisting of blood, plasma,
serum, cerebral fluid, urine, semen, lymph and exudate.
Alternatively, the sample may be a cytology sample or a stool
sample.
[0296] Here, blood (or blood-derived) samples are particularly
interesting. The inventors have noted that cells expressing PODXL
protein migrate towards blood vessels and are thus likely to leak
into the circulatory system. Further, anti-PODXL antibodies are
shown to bind living cells (see Examples, section 8) and the PODXL
protein has been detected in blood. Thus, step a) may involve
evaluating the amount of PODXL protein expressed in circulating
tumor cells.
[0297] The level of PODXL protein expression may preferably be
measured intracellularly. Thus, the body fluid, cytology or stool
sample may for example comprise cells, such as tumor cells.
[0298] In further embodiments of the methods of the above aspects,
the sample may be a tissue sample, such as a colorectal tissue
sample (a sample derived from the colon or rectum), such as a
colorectal tumor tissue sample. Tissue samples facilitate PODXL
protein expression analysis by means of immunohistochemistry.
[0299] The results of FIG. 7 are based on examination of tissue
samples from non-rectal colorectal tumors. Accordingly, in
embodiments of the methods of the above aspects the sample may be a
tissue sample derived from the colon.
[0300] The results of Examples, Section 3, are based on examination
on tissue samples from the sigmoid colon. Accordingly, in
embodiments of the methods of the above aspects the sample may be a
tissue sample derived from the sigmoid colon.
[0301] The inventors have noted that the PODXL expression in a
subset of tumor cells at the invasive tumor front may be
particularly relevant for the establishment of a prognosis or
selection of a treatment. Sometimes, such a subset of tumor cells
is referred to as "tumor budding cells", see e.g. Prall and Hase et
al. (Prall F: Tumour budding in colorectal carcinoma.
Histopathology 2007, 50(1):151-162 and Hase K et al: Prognostic
value of tumor "budding" in patients with colorectal cancer. Dis
Colon Rectum 1993, 36(7):627-635). The evaluation of step a) may
thus be limited to tumor budding cells of said sample.
[0302] Further, the inventors have noted that membranous or
cytoplasmic, in particular membranous, expression of PODXL protein
is relevant for determining prognoses or selecting treatments. The
evaluation of step a) may thus be limited to the membranes of
cells, such as tumor cells, of said sample.
[0303] Consequently, when a tissue sample is examined, only the
membranes of tumor cells, such as tumor budding cells, may be taken
into consideration. Such examination may for example be aided by
immunohistochemical staining.
[0304] The tissue samples in Examples, Sections 3 and 4, are from
male and female humans, and the inventors have found that the
prognostic relevance of PODXL protein is independent of the
subject's sex. Accordingly, the subject of the methods of the above
aspects may be a human, and further, the subject of the methods of
the above aspects may be male or female.
[0305] When performing the methods according to the above aspects,
it may be convenient to use zero as the reference value, because in
such case, it has only to be established in step a) whether PODXL
protein is present in the sample or not. FIG. 3 indicates that zero
(i.e. no detectable PODXL protein) is a working cut-off value for
establishing two subgroups of different prognosis.
[0306] Thus, in embodiments of the methods of the above aspects,
the sample value of step a) may be either 1, corresponding to
detectable PODXL protein in the sample, or 0, corresponding to no
detectable PODXL protein in the sample.
[0307] Consequently, in such embodiments, the evaluation of the
sample is digital: PODXL protein is considered to be either present
or not. In the context of the present disclosure, "no detectable
PODXL protein" refers to an amount of PODXL protein that is so
small that it is not, during normal operational circumstances,
detectable by a person or an apparatus performing the step a). The
"normal operational circumstances" refer to the laboratory methods
and techniques a person skilled in the art would find appropriate
for performing the methods of the present disclosure.
[0308] Likewise, in embodiments of the methods of the above
aspects, the sample value of step d) may be either 1, corresponding
to detectable COX-2 in the sample, or 0, corresponding to no
detectable COX-2 in the sample.
[0309] Accordingly, in embodiments of the methods of the present
disclosure, the reference value of step b) may be 0. And it follows
that, in further embodiments of the methods of the present
disclosure, the reference value of step b) may correspond to a
reference sample having no detectable PODXL protein (see
below).
[0310] Likewise, in embodiments of the methods of the present
disclosure, the reference value of step e) may be 0. And it follows
that, in further embodiments of the methods of the present
disclosure, the reference value of step e) may correspond to a
reference sample having no detectable COX-2 (see below).
[0311] A sample value of PODXL protein being higher than the
reference value, or a subject from which such sample value is
obtained, is sometimes referred to herein as being "PODXL protein
high". Further, a sample value of PODXL protein being lower than,
or equal to, the reference value, or a subject from which such
sample value is obtained, is sometimes referred to herein as being
"PODXL protein low".
[0312] Likewise, a sample value of COX-2 being higher than the
reference value, or a subject from which such sample value is
obtained, is sometimes referred to herein as being "COX-2 high".
Further, a sample value of COX-2 protein being lower than, or equal
to, the reference value, or a subject from which such sample value
is obtained, is sometimes referred to herein as being "COX-2
low".
[0313] In the context of the present disclosure, the terms "sample
value" and "reference value" are to be interpreted broadly. (The
discussion below applies mutatis mutandis to COX-2 and
quantification thereof.) The quantification of PODXL protein to
obtain these values may be done via automatic means, via a scoring
system based on visual or microscopic inspection of samples, or via
combinations thereof. However, it is also possible for a skilled
person, such as a person skilled in the art of histopathology, to
determine the sample and reference values by inspection of tissue
slides from said sample that have been stained for PODXL protein
expression. The determination of the sample value being higher than
the reference value may thus correspond to the determination, upon
visual or microscopic inspection, that a tissue slide from the
sample is more densely stained and/or exhibit a larger fraction of
stained cells than is the case for a reference tissue slide. The
sample value may also be compared to a reference value given by a
literal reference, such as a reference value described in wording
or by a reference picture. Consequently, the sample and/or
reference values may in some cases be mental values that the
skilled person determines upon inspection and comparison.
[0314] For example, the skilled person may categorize a sample as
being PODXL protein high or low, wherein the sample is categorized
as high if it contains more PODXL protein than a previously
inspected reference sample and low if it contains less or equally
much. Such evaluation may be assisted by staining the sample, and,
if necessary, a reference sample, with a staining solution
comprising e.g., antibodies selective for PODXL protein.
[0315] One or more of the steps of the methods of the present
disclosure may be implemented in an apparatus. For example, step a)
and optionally step b) may be performed in an automatic analysis
apparatus, and such apparatus may be based on a platform adapted
for immunohistochemical analysis. As an example, one or more tumor
tissue sample(s) from the subject in question may be prepared for
immunohistochemical analysis manually and then loaded into the
automatic analysis apparatus, which gives the sample value of step
a) and optionally also performs the comparison with the reference
value of step b). The operator performing the analysis, the
physician ordering the analysis or the apparatus itself may then
draw the conclusion of step c). Consequently, software adapted for
drawing the conclusion of step c) may be implemented on the
apparatus.
[0316] A reference value, found to be relevant for establishing a
prognosis or making treatment decisions regarding colorectal cancer
subjects, for use as comparison with the sample value from the
subject, may be provided in various ways. With the knowledge of the
teachings of the present disclosure, the skilled artisan can,
without undue burden, provide relevant reference values for
performing the methods of the present disclosure.
[0317] The person performing the methods of the above aspects may,
for example, adapt the reference value to desired information. For
example, the reference value may be adapted to yield the most
significant prognostic information, e.g., the largest separation
between the PODXL protein high survival curve and the PODXL protein
low survival curve (see the figures), which corresponds to the
largest difference in survival between the first and the second
group of the first aspect. Alternatively, the reference value may
be selected such that a group of subjects having particularly good
prognoses or particularly poor prognoses is singled out.
[0318] In embodiments of the methods of the above aspects, the
reference value may correspond to the amount of PODXL protein
expression in a healthy tissue, such as healthy colorectal tissue,
or stroma tissue of the subject of the method. As another example,
the reference value may be provided by the amount of PODXL protein
expression measured in a standard sample of normal tissue from
another, comparable subject. As another example, the reference
value may be provided by the amount of PODXL protein expression
measured in a reference sample comprising tumor cells, such as a
reference sample of tumor tissue, e.g., colorectal tumor tissue.
The amount of protein expression of the reference sample may
preferably be previously established.
[0319] Further, the reference value may for example be provided by
the amount of PODXL protein expression measured in a reference
sample comprising cell lines, such as cancer cell lines, expressing
a predetermined, or controlled, amount of PODXL protein. The person
skilled in the art understands how to provide such cell lines, for
example guided by the disclosure of Rhodes et al. (2006) The
biomedical scientist, p 515-520.
[0320] Consequently, the reference value may be provided by the
amount of PODXL protein measured in a reference sample comprising
cells expressing a predetermined amount of PODXL protein.
Accordingly, in embodiments of the methods of the present
disclosure, the reference value may be a predetermined value
corresponding to the amount of PODXL protein expression in a
reference sample.
[0321] However, the amount of PODXL protein in the reference sample
does not have to directly correspond to the reference value (this
is further discussed below). The reference sample may also provide
an amount of PODXL protein that helps a person performing the
method to assess various reference values. For example, the
reference sample(s) may help in creating a mental image of the
reference value by providing a "positive" reference value and/or a
"negative" reference value.
[0322] One alternative for the quantification of PODXL protein in a
sample, such as the sample earlier obtained from the subject or the
reference sample, is the determination of the fraction of cells in
the sample that exhibit PODXL protein expression over a certain
level. The fraction may for example be: a "cellular fraction",
wherein the PODXL protein expression of the whole cells is taken
into account; a "cytoplasmic fraction", wherein the PODXL protein
expression of only the membranes/cytoplasms of the cells is taken
into account; or a "nuclear fraction", wherein the PODXL protein
expression of only the nuclei of the cells is taken into account.
The nuclear or cytoplasmic fraction may for example be classified
as <1%, 1-50%, >50% immunoreactive cells of the relevant cell
population. The "cytoplasmic fraction" corresponds to the
percentage of relevant cells in a sample that exhibits a positive
staining in the membrane/cytoplasm, wherein a medium or distinct
and strong immunoreactivity in the membrane/cytoplasm is considered
positive and no or faint immunoreactivity in the membrane/cytoplasm
is considered negative. The person skilled in the art of pathology
understands which cells that are relevant under the conditions
present when performing the method and may determine a cytoplasmic
or nuclear fraction based on his general knowledge and the
teachings of the present disclosure. The relevant cells may for
example be tumor cells.
[0323] Another alternative for the quantification of PODXL protein
expression in a sample, such as the sample earlier obtained from
the subject or the reference sample, is the determination of the
overall staining intensity of the sample. The intensity may for
example be: a "cellular intensity", wherein the PODXL protein
expression of the whole cells is taken into account; a "cytoplasmic
intensity", wherein the PODXL protein expression of only the
membranes/cytoplasms of the cells is taken into account, or a
"nuclear intensity", wherein the PODXL protein expression of only
the nuclei of the cells is taken into account. Cytoplasmic and
nuclear intensity is subjectively evaluated in accordance with
standards used in clinical histopathological diagnostics. Outcome
of a cytoplasmic intensity determination may be classified as:
absent=no overall immunoreactivity in the membranes/cytoplasms of
relevant cells of the sample, weak=faint overall immunoreactivity
in the menbranes/cytoplasms of relevant cells of the sample,
moderate=medium overall immunoreactivity in the
membranes/cytoplasms of relevant cells of the sample, or
strong=distinct and strong overall immunoreactivity in the
membranes/cytoplasms of relevant cells of the sample. In some
embodiments, the absent and weak values may be combined into a
absent/weak value. The person skilled in the art understands which
cells that are relevant under the conditions present when
performing the method and may determine a nuclear or cytoplasmic
intensity based on his general knowledge and the teachings of the
present disclosure. The relevant cells may for example be tumor
cells.
[0324] The inventors have found that membranous/cytoplasmic
expression of PODXL protein is particularly relevant for
establishing prognoses.
[0325] Thus, in embodiments of the methods of the above aspects,
the reference value may be a cytoplasmic fraction, a cytoplasmic
intensity or a combination thereof. Accordingly, the sample value
may be a cytoplasmic fraction, a cytoplasmic intensity or a
combination thereof.
[0326] As seen in the figures, more than one reference value based
on cytoplasmic expression of PODXL protein may function as a
relevant reference value for determining whether the prognosis for
survival is relatively good or relatively poor.
[0327] Thus, in embodiments of the methods of the above aspects,
the reference value of step b) is a cytoplasmic fraction of 95% or
lower, such as 90% or lower, such as 85% or lower, such as 80% or
lower, such as 75% or lower, such as 70% or lower, such as 65% or
lower, such as 60% or lower, such as 55% or lower, such as 50% or
lower, such as 45% or lower, such as 40% or lower, such as 35% or
lower, such as 30% or lower, such as 25% or lower, such as 20% or
lower, such as 15% or lower, such as 10% or lower, such as 5% or
lower, such as 2% or lower, such as 1% or lower, such as 0%.
[0328] Further, in embodiments of the methods of the above aspects
the reference value of step b) may be a moderate cytoplasmic
intensity of PODXL protein expression or lower, such as a weak
cytoplasmic intensity of PODXL protein expression or lower, such as
an absent cytoplasmic of PODXL protein expression.
[0329] The results of the present disclosure are based on reference
values which are combinations or functions of cytoplasmic
intensities and cytoplasmic fractions.
[0330] For example, each sample may be assigned a value from 0-3,
wherein: "0" represents a negative cytoplasmic intensity and a
cytoplasmic fraction of <1%, "1" represents a weak cytoplasmic
intensity and a cytoplasmic fraction of 1-100%, "2" represents a
moderate or strong cytoplasmic intensity and a cytoplasmic fraction
of 1-50%, and "3" represents a moderate or strong cytoplasmic
intensity and a cytoplasmic fraction of >50%.
[0331] The cut-off line may for example be drawn between 1 and 2
(FIG. 2, 6B 7) or between 0 and 1 (FIG. 3).
[0332] Accordingly, an absent or moderate cytoplasmic intensity may
be a particularly relevant reference value. Further, a low
cytoplasmic fraction, such as 0-25% (or 0-10%) or an intermediate
cytoplasmic fraction, such as 25-75% (or 40-60%) may also be a
particularly relevant reference value.
[0333] Also, the criterion for the conclusion in step c) may for
example be that the sample value is higher than a cytoplasmic
fraction of 1% and higher than an absent cytoplasmic intensity.
Further, the criterion for the conclusion in step c) may for
example be that the sample value is higher than a cytoplasmic
fraction of 1% and higher than a weak cytoplasmic intensity.
[0334] The reference value of step e) (regarding COX-2) may for
example be a cytoplasmic fraction of 0-50%, such as 0-25%, such as
5-15%. Further, it may for example be an absent, weak or moderate
cytoplasmic intensity. Also, it may be combination or a function of
a cytoplasmic fraction and a cytoplasmic intensity.
[0335] The person skilled in the art realizes that another
reference value which is an intensity value or a fraction value
also fall within the scope of the present invention. Likewise, the
person skilled in the art realizes that other combinations or
functions of fractions and intensities also fall within the scope
of the present invention. Consequently, the reference value may
involve two, and possibly even more, criteria.
[0336] In general, the selection of an intensity value and/or a
fraction value as the reference value may depend on the staining
procedure, e.g., on the employed anti-PODXL antibody and on the
staining reagents.
[0337] Guided by the present disclosure, a person skilled in the
art, e.g. a pathologist, understands how to perform the evaluation
yielding a fraction, such as a cellular, cytoplasmic or nuclear
fraction, or an intensity, such as a cellular, cytoplasmic or
nuclear intensity. For example, the skilled artisan may use a
reference, sample comprising a predetermined amount of PODXL
protein for establishing the appearance of a certain fraction or
intensity.
[0338] However, a reference sample may not only be used for the
provision of the actual reference value, but also for the provision
of an example of a sample with an amount of PODXL protein that is
higher than the amount corresponding to the reference value. As an
example, in histochemical staining, such as in immunohistochemical
staining, the skilled artisan may use a reference sample for
establishing the appearance of a stained sample having a high
amount of PODXL protein, e.g., a positive reference. Subsequently,
the skilled artisan may assess the appearances of samples having
lower amounts of PODXL protein, such as the appearance of a sample
with an amount of PODXL protein corresponding to the reference
value. In other words, the skilled artisan may use a reference
sample to create a mental image of a reference value corresponding
to an amount of PODXL protein which is lower than that of the
reference sample. Alternatively, or as a complement, in such
assessments, the skilled artisan may use another reference sample
having a low amount of PODXL protein, or lacking detectable PODXL
protein, for establishing the appearance of such sample, e.g., as a
"negative reference".
[0339] For example, if a weak cytoplasmic intensity is used as the
reference value, two reference samples may be employed: a first
reference sample having no detectable PODXL protein, and thus
corresponding to a absent cytoplasmic intensity, which is lower
than the reference value; and a second reference sample having an
amount of PODXL protein corresponding to a strong cytoplasmic
intensity, which is higher than the reference value.
[0340] Consequently, in the evaluation, the skilled artisan may use
a reference sample for establishing the appearance of a sample with
a high amount of PODXL protein. Such reference sample may be a
sample comprising tissue expressing a high amount of PODXL protein,
such as a sample comprising colorectal tumor tissue having a
pre-established high expression of PODXL protein.
[0341] Accordingly, the reference sample may provide an example of
a strong cytoplasmic intensity (CI). With the knowledge of the
appearance of a sample with strong CI, the skilled artisan may then
divide samples into the CI categories absent, weak, moderate and
strong. This division may be further assisted by a reference sample
lacking detectable PODXL protein (negative reference), i.e., a
reference sample providing an absent cytoplasmic intensity. Also,
the reference sample may provide an example of a sample with a
cytoplasmic fraction (CF) higher than 75%. With the knowledge of
the appearance of a sample with more than 75% positive cells, the
skilled artisan may then evaluate the CF of other samples having
e.g., a lower percentage of positive cells. This division may be
further assisted by a reference sample essentially lacking PODXL
protein (negative reference), i.e., a reference sample providing a
low CF (such as <1% or 0).
[0342] As mentioned above, cell lines expressing a controlled
amount of PODXL protein may be used as the reference, in particular
as a positive reference.
[0343] One or more pictures may also be provided as the "reference
sample". For example, such a picture may show an example of a tumor
tissue slide stained with a certain antibody during certain
conditions exhibiting a certain cellular intensity and/or fraction.
The above discussion about the "reference sample" applies mutatis
mutandis to pictures.
[0344] The discussion above regarding reference samples applies
mutatis mutandis to the determination of the COX-2 status.
[0345] The cell lines or pictures may also form part of the kit
according to the present disclosure (see below).
[0346] Further, the skilled person should recognize that the
usefulness of the methods according to the above aspects is not
limited to the quantification of any particular variant of the
PODXL protein present in the subject in question, as long as the
protein is encoded by the relevant gene and presents the relevant
pattern of expression. As a non-limiting example, the PODXL protein
may comprise a sequence selected from:
[0347] i) SEQ ID NO:1; and
[0348] ii) a sequence which is at least 85% identical to SEQ ID
NO:1.
[0349] In some embodiments, sequence ii) above is at least 90%
identical, at least 91% identical, at least 92% identical, at least
93% identical, at least 94% identical, at least 95% identical, at
least 96% identical, at least 97% identical, at least 98% identical
or at least 99% identical to SEQ ID NO:1.
[0350] As another non-limiting example, the PODXL protein may
comprise, or consists of, a sequence selected from:
[0351] i) SEQ ID NO:2 or 3; and
[0352] ii) a sequence which is at least 85% identical to SEQ ID
NO:2.
[0353] SEQ ID NO:2 and 3 are two splice variants of the PODXL
protein. SEQ ID NO:1 is a subregion which is common to the
extracellular regions of the respective splice variants.
[0354] In some embodiments, sequence ii) above is at least 90%
identical, at least 91% identical, at least 92% identical, at least
93% identical, at least 94% identical, at least 95% identical, at
least 96% identical, at least 97% identical, at least 98% identical
or at least 99% identical to SEQ ID NO:2 or 3.
[0355] The term "% identical", as used in the context of the
present disclosure, is calculated as follows. The query sequence is
aligned to the target sequence using the CLUSTAL W algorithm
(Thompson, J. D., Higgins, D. G. and Gibson, T. J., Nucleic Acids
Research, 22: 4673-4680 (1994)). The amino acid residues at each
position are compared, and the percentage of positions in the query
sequence that have identical correspondences in the target sequence
is reported as % identical. Also, the target sequence determines
the number of positions that are compared. Consequently, in the
context of the present disclosure, a query sequence that is shorter
than the target sequence can never be 100% identical to the target
sequence. For example, a query sequence of 85 amino acids may at
the most be 85% identical to a target sequence of 100 amino
acids.
[0356] In some embodiments, step a) of the methods of the above
aspects may comprise:
[0357] obtaining biological material from the subject, excising or
selecting a relevant part of the biological material to obtain said
sample and optionally arranging the sample on a solid phase to
facilitate the evaluation of step a). Step a) may thus, as an
example, comprise obtaining tissue material from the colon or
rectum of said subject, optionally fixating the tissue material in
paraffin or formalin, histo-processing the tissue material to
obtain a section which constitute said sample and optionally
mounting said sample on a transparent slide, such as a glass slide,
for microscopy.
[0358] In embodiments of the methods of the aspects above, the
PODXL protein may be detected and/or quantified through the
application to the sample of a detectable and/or quantifiable
affinity ligand, which is capable of selective interaction with the
PODXL protein. The application of the affinity ligand is performed
under conditions that enable binding of the affinity ligand to any
PODXL protein in the sample.
[0359] To concretize, in embodiments of the methods of the aspects
above, step a) may comprise:
[0360] a1) applying to said sample a quantifiable affinity ligand
capable of selective interaction with the PODXL protein to be
evaluated, said application being performed under conditions that
enable binding of said affinity ligand to PODXL protein present in
said sample;
[0361] a2) removing non-bound affinity ligand; and
[0362] a3) quantifying the affinity ligand remaining in association
with said sample to evaluate said amount.
[0363] "Affinity ligand remaining in association with the sample"
refers to affinity ligand which was not removed in step a2), e.g.,
the affinity ligand bound to the sample. Here, the binding may for
example be the interaction between antibody and antigen.
[0364] However, the removal of non-bound affinity ligand according
to a2), e.g. the washing, is not always necessary. Thus, in some
embodiments of the methods of the aspects above, step a) may
comprise:
[0365] aI) applying to said sample a quantifiable affinity ligand
capable of selective interaction with the PODXL protein to be
evaluated, said application being performed under conditions that
enable binding of said affinity ligand to PODXL protein present in
said sample;
[0366] aII) quantifying the affinity bound to said sample to
evaluate said amount.
[0367] The two embodiments above apply mutatis mutandis to step d)
(COX-2 detection).
[0368] In the context of the present disclosure, "specific" or
"selective" interaction of e.g., an affinity ligand with its target
or antigen means that the interaction is such that a distinction
between specific and non-specific, or between selective and
non-selective, interaction becomes meaningful. The interaction
between two proteins is sometimes measured by the dissociation
constant. The dissociation constant describes the strength of
binding (or affinity) between two molecules. Typically the
dissociation constant between an antibody and its antigen is from
10.sup.-7 to 10.sup.-11 M. However, high specificity does not
necessarily require high affinity. Molecules with low affinity (in
the molar range) for its counterpart have been shown to be as
specific as molecules with much higher affinity. In the case of the
present disclosure, a specific or selective interaction refers to
the extent to which a particular method can be used to determine
the presence and/or amount of a specific protein, the target
protein, under given conditions in the presence of other proteins
in a tissue sample or fluid sample of a naturally occurring or
processed biological fluid. In other words, specificity or
selectivity is the capacity to distinguish between related
proteins. Specific and selective are sometimes used interchangeably
in the present description. For example, the specificity or
selectivity of an antibody may be determined as in Examples,
section 2, below, wherein analysis is performed using a protein
array set-up, a suspension bead array and a multiplexed competition
assay, respectively. Specificity and selectivity determinations are
also described in Nilsson P et al. (2005) Proteomics
5:4327-4337.
[0369] It is regarded as within the capabilities of those of
ordinary skill in the art to select or manufacture the proper
affinity ligand and to select the proper format and conditions for
detection and/or quantification. Nevertheless, examples of affinity
ligands that may prove useful, as well as examples of formats and
conditions for detection and/or quantification, are given below for
the sake of illustration.
[0370] Thus, in embodiments of the present disclosure, the affinity
ligand may be selected from the group consisting of antibodies,
fragments thereof and derivatives thereof, i.e., affinity ligands
based on an immunoglobulin scaffold. The antibodies and the
fragments or derivatives thereof may be isolated and/or
mono-specific. Antibodies comprise monoclonal and polyclonal
antibodies of any origin, including murine, rabbit, human and other
antibodies, as well as chimeric antibodies comprising sequences
from different species, such as partly humanized antibodies, e.g.,
partly humanized mouse antibodies. Polyclonal antibodies are
produced by immunization of animals with the antigen of choice.
Monoclonal antibodies of defined specificity can be produced using
the hybridoma technology developed by Kohler and Milstein (Kohler G
and Milstein C (1976) Eur. J. Immunol. 6:511-519). The antibody
fragments and derivatives of the present disclosure are capable of
selective interaction with the same antigen (e.g. PODXL protein) as
the antibody they are fragments or derivatives of. Antibody
fragments and derivatives comprise Fab fragments, consisting of the
first constant domain of the heavy chain (CH1), the constant domain
of the light chain (CL), the variable domain of the heavy chain
(VH) and the variable domain of the light chain (VL) of an intact
immunoglobulin protein; Fv fragments, consisting of the two
variable antibody domains VH and VL (Skerra A and Pluckthun A
(1988) Science 240:1038-1041); single chain Fv fragments (scFv),
consisting of the two VH and VL domains linked together by a
flexible peptide linker (Bird R E and Walker B W (1991) Trends
Biotechnol. 9:132-137); Bence Jones dimers (Stevens F J et al.
(1991) Biochemistry 30:6803-6805); camelid heavy-chain dimers
(Hamers-Casterman C et al. (1993) Nature 363:446-448) and single
variable domains (Cai X and Garen A (1996) Proc. Natl. Acad. Sci.
U.S.A. 93:6280-6285; Masat L et al. (1994) Proc. Natl. Acad. Sci.
U.S.A. 91:893-896), and single domain scaffolds like e.g., the New
Antigen Receptor (NAR) from the nurse shark (Dooley H et al. (2003)
Mol. Immunol. 40:25-33) and minibodies based on a variable heavy
domain (Skerra A and Pluckthun A (1988) Science 240:1038-1041).
[0371] SEQ ID NO:1 was designed for immunizations, e.g., designed
to lack transmembrane regions to ensure efficient expression in E.
coli, and to lack any signal peptide, since those are cleaved off
in the mature protein. Consequently, an antibody or fragment or
derivative thereof according to the present disclosure may for
example be one that is obtainable by a process comprising a step of
immunizing an animal, such as a rabbit, with a protein whose amino
acid sequence comprises, preferably consists of, the sequence SEQ
ID NO:1. For example, the immunization process may comprise primary
immunization with the protein in Freund's complete adjuvant. Also,
the immunization process may further comprise boosting at least two
times, in intervals of 2-6 weeks, with the protein in Freund's
incomplete adjuvant. Processes for the production of antibodies or
fragments or derivatives thereof against a given target are known
in the art.
[0372] In the context of the present disclosure, a "mono-specific
antibody" is one of a population of polyclonal antibodies which has
been affinity purified on its own antigen, thereby separating such
mono-specific antibodies from other antiserum proteins and
non-specific antibodies. This affinity purification results in
antibodies that bind selectively to its antigen. In the case of the
present disclosure, the polyclonal antisera are purified by a
two-step immunoaffinity based protocol to obtain mono-specific
antibodies selective for the target protein. Antibodies directed
against generic affinity tags of antigen fragments are removed in a
primary depletion step, using the immobilized tag protein as the
capturing agent. Following the first depletion step, the serum is
loaded on a second affinity column with the antigen as capturing
agent, in order to enrich for antibodies specific for the antigen
(see also Nilsson P et al. (2005) Proteomics 5:4327-4337).
[0373] Polyclonal and monoclonal antibodies, as well as their
fragments and derivatives, represent the traditional choice of
affinity ligands in applications requiring selective biomolecular
recognition, such as in the detection and/or quantification of
PODXL protein according to the method aspects above. However, those
of skill in the art know that, due to the increasing demand of high
throughput generation of selective binding ligands and low cost
production systems, new biomolecular diversity technologies have
been developed during the last decade. This has enabled a
generation of novel types of affinity ligands of both
immunoglobulin as well as non-immunoglobulin origin that have
proven equally useful as binding ligands in biomolecular
recognition applications and can be used instead of, or together
with, immunoglobulins.
[0374] The biomolecular diversity needed for selection of affinity
ligands may be generated by combinatorial engineering of one of a
plurality of possible scaffold molecules, and specific and/or
selective affinity ligands are then selected using a suitable
selection platform. The scaffold molecule may be of immunoglobulin
protein origin (Bradbury A R and Marks J D (2004) J. Immunol.
Meths. 290:29-49), of non-immunoglobulin protein origin (Nygren P A
and Skerra A (2004) J. Immunol. Meths. 290:3-28), or of an
oligonucleotide origin (Gold L et al. (1995) Annu. Rev. Biochem.
64:763-797).
[0375] A large number of non-immunoglobulin protein scaffolds have
been used as supporting structures in development of novel binding
proteins. Non-limiting examples of such structures, useful for
generating affinity ligands against PODXL protein for use according
to the present disclosure, are staphylococcal protein A and domains
thereof and derivatives of these domains, such as protein Z (Nord K
et al. (1997) Nat. Biotechnol. 15:772-777); lipocalins (Beste G et
al. (1999) Proc. Natl. Acad. Sci. U.S.A. 96:1898-1903); ankyrin
repeat domains (Binz H K et al. (2003) J. Mol. Biol. 332:489-503);
cellulose binding domains (CBD) (Smith G P et al. (1998) J. Mol.
Biol. 277:317-332; Lehtio J et al. (2000) Proteins 41:316-322);
.gamma. crystallines (Fiedler U and Rudolph R, WO01/04144); green
fluorescent protein (GFP) (Peelle B et al. (2001) Chem. Biol.
8:521-534); human cytotoxic T lymphocyte-associated antigen 4
(CTLA-4) (Hufton S E et al. (2000) FEBS Lett. 475:225-231; Irving R
A et al. (2001) J. Immunol. Meth. 248:31-45); protease inhibitors,
such as Knottin proteins (Wentzel A et al. (2001) J. Bacteriol.
183:7273-7284; Baggio R et al. (2002) J. Mol. Recognit. 15:126-134)
and Kunitz domains (Roberts B L et al. (1992) Gene 121:9-15; Dennis
M S and Lazarus R A (1994) J. Biol. Chem. 269:22137-22144); PDZ
domains (Schneider S et al. (1999) Nat. Biotechnol. 17:170-175);
peptide aptamers, such as thioredoxin (Lu Z et al. (1995)
Biotechnology 13:366-372; Klevenz B et al. (2002) Cell. Mol. Life
Sci. 59:1993-1998); staphylococcal nuclease (Norman T C et al.
(1999) Science 285:591-595); tendamistats (McConell S J and Hoess R
H (1995) J. Mol. Biol. 250:460-479; Li R et al. (2003) Protein Eng.
16:65-72); trinectins based on the fibronectin type III domain
(Koide A et al. (1998) J. Mol. Biol. 284:1141-1151; Xu L et al.
(2002) Chem. Biol. 9:933-942); and zinc fingers (Bianchi E et al.
(1995) J. Mol. Biol. 247:154-160; Klug A (1999) J. Mol. Biol.
293:215-218; Segal D J et al. (2003) Biochemistry
42:2137-2148).
[0376] The above-mentioned examples of non-immunoglobulin protein
scaffolds include scaffold proteins presenting a single randomized
loop used for the generation of novel binding specificities,
protein scaffolds with a rigid secondary structure where side
chains protruding from the protein surface are randomized for the
generation of novel binding specificities, and scaffolds exhibiting
a non-contiguous hyper-variable loop region used for the generation
of novel binding specificities.
[0377] In addition to non-immunoglobulin proteins, oligonucleotides
may also be used as affinity ligands. Single stranded nucleic
acids, called aptamers or decoys, fold into well-defined
three-dimensional structures and bind to their target with high
affinity and specificity. (Ellington A D and Szostak J W (1990)
Nature 346:818-822; Brody E N and Gold L (2000) J. Biotechnol.
74:5-13; Mayer G and Jenne A (2004) BioDrugs 18:351-359). The
oligonucleotide ligands can be either RNA or DNA and can bind to a
wide range of target molecule classes.
[0378] For selection of the desired affinity ligand from a pool of
variants of any of the scaffold structures mentioned above, a
number of selection platforms are available for the isolation of a
specific novel ligand against a target protein of choice. Selection
platforms include, but are not limited to, phage display (Smith G P
(1985) Science 228:1315-1317), ribosome display (Hanes J and
Pluckthun A (1997) Proc. Natl. Acad. Sci. U.S.A. 94:4937-4942),
yeast two-hybrid system (Fields S and Song 0 (1989) Nature
340:245-246), yeast display (Gai S A and Wittrup K D (2007) Curr
Opin Struct Biol 17:467-473), mRNA display (Roberts R W and Szostak
J W (1997) Proc. Natl. Acad. Sci. U.S.A. 94:12297-12302), bacterial
display (Daugherty P S (2007) Curr Opin Struct Biol 17:474-480,
Kronqvist N et al. (2008) Protein Eng Des Sel 1-9, Harvey B R et
al. (2004) PNAS 101(25):913-9198), microbead display (Nord 0 et al.
(2003) J Biotechnol 106:1-13, WO01/05808), SELEX (System Evolution
of Ligands by Exponential Enrichment) (Tuerk C and Gold L (1990)
Science 249:505-510) and protein fragment complementation assays
(PCA) (Remy I and Michnick S W (1999) Proc. Natl. Acad. Sci. U.S.A.
96:5394-5399).
[0379] Thus, in embodiments of the present disclosure, the affinity
ligand may be a non-immunoglobulin affinity ligand derived from any
of the protein scaffolds listed above, or an oligonucleotide
molecule.
[0380] The PODXL protein fragment SEQ ID NO:1 was designed to
consist of a unique sequence with low homology with other human
proteins and to minimize cross reactivity of generated affinity
reagents. Consequently, in embodiments of the present disclosure,
the affinity ligand may be capable of selective interaction with a
polypeptide consisting of the sequence SEQ ID NO:1.
[0381] "The affinity ligand capable of selective interaction with a
polypeptide consisting of the sequence SEQ ID NO:1" is capable of
distinguishing a SEQ ID NO:1 fragment from a fragment consisting of
another, non-overlapping, part of the PODXL protein.
[0382] As shown in Examples, sections 6 and 7, below, six epitope
regions have been identified within SEQ ID NO:1. Thus, in
embodiments of the present disclosure, the affinity ligand may be
capable of selective interaction with a polypeptide consisting of
20 amino acids or less, such as 15 amino acids or less and
comprising an amino acid sequence selected from SEQ ID
NO:10-15.
[0383] The detection and/or quantification of the affinity ligand
capable of selective interaction with the PODXL protein may be
accomplished in any way known to the skilled person for detection
and/or quantification of binding reagents in assays based on
biological interactions. Accordingly, any affinity ligand described
above may be used to quantitatively and/or qualitatively detect the
presence of the PODXL protein. These "primary" affinity ligands may
be labeled themselves with various markers or may in turn be
detected by secondary, labeled affinity ligands to allow detection,
visualization and/or quantification. This can be accomplished using
any one or more of a multitude of labels, which can be conjugated
to the affinity ligand capable of interaction with PODXL protein or
to any secondary affinity ligand, using any one or more of a
multitude of techniques known to the skilled person, and not as
such involving any undue experimentation.
[0384] Non-limiting examples of labels that can be conjugated to
primary and/or secondary affinity ligands include fluorescent dyes
or metals (e.g., fluorescein, rhodamine, phycoerythrin,
fluorescamine), chromophoric dyes (e.g., rhodopsin),
chemiluminescent compounds (e.g., luminal, imidazole),
bioluminescent proteins (e.g., luciferin, luciferase), and haptens
(e.g., biotin). A variety of other useful fluorescers and
chromophores are described in Stryer L (1968) Science 162:526-533
and Brand L and Gohlke J R (1972) Annu. Rev. Biochem. 41:843-868.
Affinity ligands can also be labeled with enzymes (e.g.,
horseradish peroxidase, alkaline phosphatase, beta-lactamase),
radioisotopes (e.g., .sup.3H, .sup.14C, .sup.32P, .sup.35S or
.sup.125I) and particles (e.g., gold). In the context of the
present disclosure, "particles" refer to particles, such as metal
particles, suitable for labeling of molecules. Further, the
affinity ligands may also be labeled with fluorescent semiconductor
nanocrystals (quantum dots). Quantum dots have superior quantum
yield and are more photostable compared to organic fluorophores and
are therefore more easily detected (Chan et al. (2002) Curr Opi
Biotech. 13: 40-46). The different types of labels can be
conjugated to an affinity ligand using various chemistries, e.g.,
the amine reaction or the thiol reaction. However, other reactive
groups than amines and thiols can be used, e.g., aldehydes,
carboxylic acids and glutamine.
[0385] The method aspects above may be put to use in any of several
known formats and set-ups, of which a non-limiting selection is
discussed below.
[0386] In a set-up based on histology, the detection, localization
and/or quantification of a labeled affinity ligand bound to its
PODXL protein target may involve visualizing techniques, such as
light microscopy or immunofluoresence microscopy. Other methods may
involve the detection via flow cytometry or luminometry.
[0387] A biological sample, such as a tumor tissue sample (biopsy),
which has been removed from the subject, may be used for detection
and/or quantification of PODXL protein. The biological sample, such
as the biopsy, may be an earlier obtained sample. If using an
earlier obtained sample in a method, no steps of the method are
practiced on the human or animal body. The affinity ligand may be
applied to the biological sample for detection and/or
quantification of the PODXL protein. This procedure enables not
only detection of PODXL protein, but may in addition show the
distribution and relative level of expression thereof.
[0388] The method of visualization of labels on the affinity ligand
may include, but is not restricted to, fluorometric, luminometric
and/or enzymatic techniques. Fluorescence is detected and/or
quantified by exposing fluorescent labels to light of a specific
wavelength and thereafter detecting and/or quantifying the emitted
light in a specific wavelength region. The presence of a
luminescently tagged affinity ligand may be detected and/or
quantified by luminescence developed during a chemical reaction.
Detection of an enzymatic reaction is due to a color shift in the
sample arising from a chemical reaction. Those of skill in the art
are aware that a variety of different protocols can be modified for
proper detection and/or quantification.
[0389] In embodiments of the methods of the above aspects, a
biological sample may be immobilized onto a solid phase support or
carrier, such as nitrocellulose or any other solid support matrix
capable of immobilizing PODXL protein present in the biological
sample applied to it. Some well-known solid state support materials
useful in the present invention include glass, carbohydrate (e.g.,
Sepharose), nylon, plastic, wool, polystyrene, polyethene,
polypropylene, dextran, amylase, films, resins, cellulose,
polyacrylamide, agarose, alumina, gabbros and magnetite. After
immobilization of the biological sample, primary affinity ligand
specific to PODXL protein may be applied, e.g., as described in
Examples, Section 3, of the present disclosure. If the primary
affinity ligand is not labeled in itself, the supporting matrix may
be washed with one or more appropriate buffers known in the art,
followed by exposure to a secondary labeled affinity ligand and
washed once again with buffers to remove unbound affinity ligands.
Thereafter, selective affinity ligands may be detected and/or
quantified with conventional methods. The binding properties for an
affinity ligand may vary from one solid state support to the other,
but those skilled in the art should be able to determine operative
and optimal assay conditions for each determination by routine
experimentation.
[0390] Consequently, in embodiments of the methods of the above
aspects, the quantifiable affinity ligand of a1) or a1) may be
detected using a secondary affinity ligand capable of recognizing
the quantifiable affinity ligand. The quantification of a3) or all)
may thus be carried out by means of a secondary affinity ligand
with affinity for the quantifiable affinity ligand. As an example,
the secondary affinity ligand may be an antibody or a fragment or a
derivative thereof.
[0391] As an example, one available method for detection and/or
quantification of the PODXL protein is by linking the affinity
ligand to an enzyme that can then later be detected and/or
quantified in an enzyme immunoassay (such as an EIA or ELISA). Such
techniques are well established, and their realization does not
present any undue difficulties to the skilled person. In such
methods, the biological sample is brought into contact with a solid
material or with a solid material conjugated to an affinity ligand
against the PODXL protein, which is then detected and/or quantified
with an enzymatically labeled secondary affinity ligand. Following
this, an appropriate substrate is brought to react in appropriate
buffers with the enzymatic label to produce a chemical moiety,
which for example is detected and/or quantified using a
spectrophotometer, fluorometer, luminometer or by visual means.
[0392] As stated above, primary and any secondary affinity ligands
can be labeled with radioisotopes to enable detection and/or
quantification. Non-limiting examples of appropriate radiolabels in
the present disclosure are .sup.3H, .sup.14C, .sup.32P, .sup.35S or
.sup.125I. The specific activity of the labeled affinity ligand is
dependent upon the half-life of the radiolabel, isotopic purity,
and how the label has been incorporated into the affinity ligand.
Affinity ligands are preferably labeled using well-known techniques
(Wensel T G and Meares C F (1983) in: Radioimmunoimaging and
Radioimmunotherapy (Burchiel S W and Rhodes B A eds.) Elsevier, New
York, pp 185-196). A thus radiolabeled affinity ligand can be used
to visualize PODXL protein by detection of radioactivity in vivo or
in vitro. Radionuclear scanning with e.g., gamma camera, magnetic
resonance spectroscopy or emission tomography function for
detection in vivo and in vitro, while gamma/beta counters,
scintillation counters and radiographies are also used in
vitro.
[0393] To perform the methods of the present disclosure, a kit may
be employed. As a third aspect of the present disclosure, there is
thus provided a kit for establishing a prognosis of colorectal
cancer, which comprises
[0394] a) a quantifiable affinity ligand capable of selective
interaction with a PODXL protein;
[0395] b) reagents necessary for quantifying the amount of the
quantifiable affinity ligand of a);
[0396] c) a quantifiable affinity ligand capable of selective
interaction with a COX-2 protein; and
[0397] d) reagents necessary for quantifying the amount of the
quantifiable affinity ligand of c),
[0398] wherein the reagents of b) and d) are the same or
different.
[0399] Accordingly, the same reagents, such as the same secondary
antibody, may be used for quantifying both the anti-PODXL protein
affinity ligand and the anti-COX-2 affinity ligand.
[0400] The present kit is thus particularly useful in the methods
wherein the level of COX-2 is evaluated.
[0401] Various components of the kit according to the third aspect
may be selected and specified as described above in connection with
the method aspects of the present disclosure.
[0402] Thus, the kit according to the present disclosure comprises
affinity ligands against PODXL protein and COX-2, as well as other
means that help to quantify the specific and/or selective affinity
ligands after thay have bound specifically and/or selectively to
the respective target proteins. For example, the kit may contain a
secondary affinity ligand for detecting and/or quantifying a
complex formed by the target proteins and the affinity ligands. The
kit may also contain various auxiliary substances other than
affinity ligands, to enable the kit to be used easily and
efficiently. Examples of auxiliary substances include solvents for
dissolving or reconstituting lyophilized protein components of the
kit, wash buffers, substrates for measuring enzyme activity in
cases where an enzyme is used as a label, target retrieval solution
to enhance the accessibility to antigens in cases where paraffin or
formalin-fixed tissue samples are used, and substances such as
reaction arresters, e.g., endogenous enzyme block solution to
decrease the background staining and/or counterstaining solution to
increase staining contrast, that are commonly used in immunoassay
reagent kits.
[0403] In embodiments of the kit aspect, the affinity ligand may be
selected as described above in connection with the method
aspects.
[0404] Consequently, the affinity ligand of a) and/or c) may be
selected from the group consisting of antibodies, fragments thereof
and derivatives thereof.
[0405] Further, in accordance with what is described above in
connection with the method aspects, the detectable affinity ligands
may in embodiments of the kit aspect comprise a label selected from
the group consisting of fluorescent dyes and metals, chromophoric
dyes, chemiluminescent compounds and bioluminescent proteins,
enzymes, radioisotopes, particles and quantum dots. Alternatively,
the reagents necessary for quantifying the amount of the affinity
ligands comprise one or more secondary affinity ligand(s) capable
of recognizing the quantifiable affinity ligands. As an example,
the secondary affinity ligand(s) capable of recognizing the
quantifiable affinity ligand(s) comprises a label selected from the
group consisting of fluorescent dyes or metals, chromophoric dyes,
chemiluminescent compounds and bioluminescent proteins, enzymes,
radioisotopes, particles and quantum dots.
[0406] The kit according to the kit aspect may also advantageously
comprise one or more reference sample(s) for provision of, or
yielding, one or more reference value(s) to be used for comparison
with PODXL protein and/or COX-2 sample values. For example, a
reference sample may comprise a predetermined amount of PODXL
protein or COX-2. Such a reference sample may for example be
constituted by a tissue or cell line sample containing the
predetermined amount of PODXL protein or COX-2. The tissue or cell
line reference sample may then be used by the person of skill in
the art in the determination of the protein expression status in
the sample being studied, by manual, such as ocular, or automated
comparison of expression levels in the reference tissue sample and
the subject sample.
[0407] The above-mentioned cell lines may for example be cancer
cell lines. Further, the cell lines may be expressing a
predetermined, or controlled, amount of PODXL protein. The person
skilled in the art understands how to provide such cell lines, for
example guided by the disclosure of Rhodes et al. (2006) The
biomedical scientist, p 515-520. As an example, the cell lines may
be formalin fixed. Also, such formalin fixed cell lines may be
paraffin embedded.
[0408] The above-mentioned tissue reference sample may be a tissue
sample adapted to ocular or microscopic evaluation. As an example,
the tissue reference sample may be fixated in paraffin or buffered
formalin and/or histo-processed to sections (e.g., .mu.m-thin
sections) that are mounted on microscopic glass-slides. The tissue
reference sample may be further adapted to staining with affinity
ligands, such as antibodies.
[0409] Consequently, in embodiments of the kit aspect, the
reference sample may be adapted to directly, or indirectly, provide
any relevant reference value, such as any one of the reference
values discussed above.
[0410] The wording "reference sample for provision of the reference
value" is to be interpreted broadly in the context of the present
disclosure. The reference sample may comprise an amount of PODXL
protein or COX-2 actually corresponding to the reference value, but
it may also comprise an amount of PODXL protein or COX-2
corresponding to a value being higher than the reference value. In
the latter case, the "high" value may be used by a person
performing the method as an upper reference (positive reference)
for assessing, e.g., the appearance of, a reference value which is
lower than the "high" value.
[0411] The person skilled in the art of immunohistochemistry
understands how to do such an assessment. Further, as an
alternative or a complementing example, the skilled person may use
another reference sample comprising a low amount of PODXL protein
or COX-2 for provision of a "low" value in such an assessment,
e.g., as a negative reference. This is further discussed above in
connection with the method aspects.
[0412] Consequently, in embodiments of the kit aspect, a reference
sample may comprise an amount of PODXL protein corresponding to a
reference value. Examples of such reference values are discussed
above in connection with the method aspects.
[0413] And further, in embodiments of the kit aspect, a reference
sample may comprise an amount of COX-2 corresponding to a reference
value. Examples of such reference values are also discussed above
in connection with the method aspects.
[0414] Further, in alternative or complementing embodiments of the
kit aspect, the kit may comprise a reference sample comprising an
amount of PODXL protein or COX-2 corresponding to a value being
higher than the reference value. Such reference sample may for
example comprise an amount of PODXL protein or COX-2 corresponding
to a cytoplasmic fraction of 75% or higher and/or a strong
cytoplasmic intensity.
[0415] Still further, in alternative or complementing embodiments
of the kit aspect, the kit may comprise a reference sample
comprising an amount of PODXL protein or COX-2 corresponding to a
value being lower than or equal to the reference value, e.g., an
absent cytoplasmic intensity and/or a cytoplasmic fraction of
<2%, such as 0%.
[0416] Consequently, in embodiments of the kit aspect, the
reference sample may be adapted to directly, or indirectly, provide
any relevant reference value, such as any one of the reference
values discussed above.
[0417] Following the findings presented above, the inventors have
realized several uses for the PODXL protein or a fragment
thereof.
[0418] Thus, as a fourth aspect of the present disclosure, there is
provided a use of a PODXL protein as a prognostic marker for
colorectal cancer. The use may be in vitro.
[0419] In a similar manner, there is provided a use of a PODXL
protein as a marker of a relatively poor prognosis for a mammalian
subject having a colorectal cancer.
[0420] As a configuration of the fourth aspect, there is provided a
use of the PODXL protein as a marker of serosa invasion or
metastazing cancer for a subject having colorectal cancer. This
configuration is further discussed above.
[0421] In the context of the present disclosure, "prognostic
marker" refers to something material which presence indicates a
prognosis. The marker may thus be a biomarker, such as a human
protein.
[0422] In embodiments of the fourth aspect, the PODXL protein may
be provided in a biological sample, such as a colorectal tumor
tissue sample, from a subject having a colorectal cancer. Further,
for reasons discussed above, the colorectal tumor tissue sample may
be a colon tumor tissue sample. The colon tumor tissue sample may
for example be derived from the sigmoideum.
[0423] As a fifth aspect of the present disclosure, there is
provided a use of a PODXL protein, or an antigenically active
fragment thereof, for the production, selection or purification of
a prognostic agent for establishing a prognosis for a mammalian
subject having a colorectal cancer. The use may be in vitro.
[0424] In the context of the present disclosure, "prognostic agent"
refers to an agent having at least one property being valuable in
an establishment of a prognosis, e.g., a prognosis for a mammalian
subject having a colorectal cancer.
[0425] For example, the prognostic agent may be capable of
selective interaction with the prognostic marker.
[0426] The prognostic agent may thus be an affinity ligand capable
of selective interaction with the PODXL protein or the
antigenically active fragment thereof. Examples of such affinity
ligands are discussed above in connection with the method
aspects.
[0427] Guided by the teachings of the present disclosure, the
person skilled in the art understands how to use the PODXL protein
or fragment in the production, selection or purification of the
prognostic agent. For example, the use may comprise affinity
purification on a solid support onto which the PODXL protein has
been immobilized. The solid support may for example be arranged in
a column. Further, the use may comprise selection of affinity
ligands having specificity for the PODXL protein using a solid
support onto which the polypeptide has been immobilized. Such solid
support may be well plates (such as 96 well plates), magnetic
beads, agarose beads or sepharose beads. Further, the use may
comprise analysis of affinity ligands on a soluble matrix, for
example using a dextran matrix, or use in a surface plasmon
resonance instrument, such as a Biacore.TM. instrument, wherein the
analysis may for example comprise monitoring the affinity for the
immobilized PODXL protein of a number of potential affinity
ligands.
[0428] Also, for the production of the prognostic agent, the PODXL
protein or an antigenically active fragment thereof may be used in
an immunization of an animal.
[0429] Such use may be involved in a method comprising the steps:
[0430] i) immunizing an animal using the PODXL protein or
antigenically an active fragment thereof as the antigen;
[0431] ii) obtaining serum comprising the prognostic agent from the
immunized animal; and, optionally, [0432] iii) isolating the
prognostic agent from the serum.
[0433] Alternatively the steps following the first step may be:
[0434] ii') obtaining cells from the immunized animal, which cells
comprise DNA encoding the prognostic agent, [0435] iii') fusing the
cells with myeloma cells to obtain at least one clone, and [0436]
iv') obtaining the prognostic agent expressed by the clone.
[0437] In embodiments of the fourth or fifth aspect, the amino acid
sequence of the PODXL protein (or fragment thereof) may comprise or
consist of a sequence selected from: [0438] i) SEQ ID NO:1; and
[0439] ii) a sequence which is at least 85% identical to SEQ ID
NO:1.
[0440] In some embodiments, sequence ii) is at least 90% identical,
at least 91% identical, at least 92% identical, at least 93%
identical, at least 94% identical, at least 95% identical, at least
96% identical, at least 97% identical, at least 98% identical or at
least 99% identical to SEQ ID NO:1.
[0441] Further, in embodiments of the fourth aspect the amino acid
sequence of the PODXL protein may comprise or consist of a sequence
selected from: [0442] i) SEQ ID NO:2 or 3; and [0443] ii) a
sequence which is at least 85% identical to SEQ ID NO:2 or 3.
[0444] In some embodiments, sequence ii) is at least 90% identical,
at least 91% identical, at least 92% identical, at least 93%
identical, at least 94% identical, at least 95% identical, at least
96% identical, at least 97% identical, at least 98% identical or at
least 99% identical to SEQ ID NO:2 or 3.
[0445] As demonstrated under Examples below, several antigenic
subregions of SEQ ID NO:1 have been identified. Thus, in
embodiments of the present disclosure, the "antigenically active
fragment" may consist of 25 amino acids or less and comprise an
amino acid sequence selected from SEQ ID NO:10-18. Here, SEQ ID
NO:10-15 may be considered to be preferred. In further embodiments,
the "antigenically active fragment" may consist of 20 amino acids
or less, such as 15 amino acids or less.
[0446] As a sixth aspect of the present disclosure, there is
provided an affinity ligand capable of selective interaction with a
PODXL protein.
[0447] Different embodiments of such an affinity ligand are
discussed above in connection with the method aspects.
[0448] As a seventh aspect of the present disclosure, there is
provided a use of an affinity ligand according to the sixth aspect
as prognostic agent for colorectal cancer. Consequently, the
affinity ligand may be used for establishing a prognosis for a
colorectal cancer subject. Such use may for example be performed in
vitro, e.g., involving the determination of the amount of PODXL in
at least part of a sample earlier obtained from the subject.
[0449] The PODXL protein is expressed on the surfaces of colorectal
tumor cells. Further, it is shown herein that the prognosis for
survival of a subject having a colorectal cancer decreases with
increased levels of PODXL protein expression in the tumor. The
inventors thus conclude that PODXL is a therapeutic target in
colorectal cancer and that an affinity ligand, such as an antibody,
capable of binding the PODXL protein may be employed as a
therapeutic agent.
[0450] The PODXL protein is reported to be involved in cell-cell
adhesion. Without being bound to any specific scientific theory,
targeting the PODXL protein of the colorectal tumor cells may
interfere with the cell-cell interactions and thereby affect tumor
growth and/or proliferation. Further, proteoglycans (PODXL is a
proteoglycan) have been suggested to be involved in response to
growth factors. Thus, targeting PODXL protein may also affect
growth factor signaling, which is important for tumor growth.
[0451] Thus, as an eighth aspect of the present disclosure, there
is provided an affinity ligand capable of selective interaction
with a PODXL protein for use as a medicament. In particular, the
affinity ligand may be for use in treatment of a subject having
colorectal cancer.
[0452] According to one embodiment, a part of a colorectal tumor of
the subject has been found to express PODXL protein, for example at
a level which is higher than the average PODXL protein expression
level of a relevant reference population of subjects having
colorectal cancer. Alternatively, the part of the colorectal tumor
may have been found to express PODXL protein at a level
corresponding to a sample value which is higher than anyone of the
reference values discussed above. Consequently, the affinity ligand
may according to one embodiment only be for use in treatment of
subjects having a tumor which has been found to express PODXL
protein. The tumor in question may for example have been surgically
removed before the PODXL expression status is established.
[0453] Also, according to one embodiment, the colorectal cancer of
the eighth aspect is COX-2 positive according to any one of the
above definitions.
[0454] Even though the therapeutic finding is not limited to any
particular type of colorectal cancer, the connection between poor
prognosis and PODXL expression has been shown specifically in colon
cancer subjects (FIG. 7) and sigmoid colon cancer subjects (FIG.
1-5). The colorectal cancer of the eighth aspect may thus be a
colon cancer. Further, the colon cancer may for example be sigmoid
colon cancer.
[0455] The affinity ligand of the eighth aspect may be any one of
the affinity ligands discussed in connection with the method
aspects above as long as it is still capable of selective
interaction with the PODXL protein.
[0456] According to an embodiment of the eighth aspect, the
affinity ligand may thus be capable of selective interaction with
the extracellular region of the PODXL protein (SEQ ID NO:6 or 7).
SEQ ID NO:1, which is discussed further above, is a subregion of
both splice variants the extracellular region of the PODXL protein
(SEQ ID NO:6 and 7). Thus, according to an embodiment of the eighth
aspect, the affinity ligand may be capable of selective interaction
with a peptide consisting of the amino acid sequence SEQ ID
NO:1.
[0457] A monoclonal antibody capable of selective interaction with
SEQ ID NO:1, such as a specific epitope within SEQ ID NO:1, may for
example be generated based on the hybridoma technology developed by
Kohler and Milstein (Kohler, G and Milstein, C, 1973, Nature 256,
495-497). SEQ ID NO: 1 may be used as the antigen and its
production is explained in Examples, section 1. An alternative
approach is to synthesize a peptide consisting of an amino acid
sequence within SEQ ID NO: 1, and use this peptide as the antigen.
Antigen is injected subcutaneously into BALB/c mice (4-6 weeks old,
female) at three-week intervals. Prior to immunization, the antigen
is mixed with complete Freund's adjuvant for the first injection
and incomplete Freund's adjuvant for the following injections.
Three days before fusion, the mouse is challenged with antigen
intravenously. Hybridomas are generated by fusion of splenocytes
from the immunized mice with a Sp2/0 myeloma cell line. Then,
several hybridoma cell lines are screened using ELISA, and cell
lines that secrete antibodies specific for one or more fragment(s)
consisting of an amino acid sequence within SEQ ID NO: 1 are
identified and selected for further characterization.
[0458] Further characterization may include epitope mapping, which
can be performed according to the following protocol based on
bacterial display: DNA corresponding to SEQ ID NO:1 is amplified by
PCR using vector pAff8c as template. The amplified DNA is
fragmentized to various lengths (approximately 50-150 bp) by
sonication, followed by ligation into the staphylococcal display
vector (pSCEM2) and transformed into S. carnosus. In-frame DNA
fragments are displayed as peptides on the staphylococcal surface.
After incubation with antibody (selective for SEQ ID NO:1, obtained
as described above) and fluorescently labeled secondary reagents,
positive and negative cells are separately sorted using flow
cytometry in order to isolate epitope and non-epitope presenting
cells (Rockberg J et al (2008) Nature Methods vol 5. no 12:
1039-45). Isolated cells are sequenced by pyrosequencing and
sequences finally aligned to the PODXL antigen for identification
of epitopes. A dual-labeling strategy with real-time monitoring of
the surface expression level may be used (Lofblom, J et al (2005)
FEMS Microbiol Lett 248: 189-198). It allows for normalization of
the binding signal with the expression level, provided low
cell-to-cell variations and make discrimination of different
epitope populations possible. Further, it also allows for a
parallel assay to determine non-binding peptides displayed on the
surface. An alternative approach to map the epitopes may be to
perform a peptide screen according to the following protocol: A
PEPscreen library (Sigma) consisting of biotinylated peptides
corresponding to SEQ ID NO:1) on PODXL will then be synthesized.
The peptides may be 15 amino acids long with a 10 amino acid
overlap, together covering the entire PrEST-sequence. Neutravidin
(Pierce, Rockford, Ill.) is then immobilized on carboxylated beads
(COOH Microspheres, Luminex-Corp., Austin, Tex.) in accordance to
the manufacturer's protocol. Coupling of beads is then performed
using a filter membrane bottomed microtiter plate (MultiScreen-HTS,
Millipore, Billerica, Mass.) as described by Larsson et al (Larsson
et al (2009) J Immunol Methods 15; 34(1-2):20-32, Schwenk et al
(2007) Mol Cell Proteomics 6(1) 125:32). Distinct groups of beads
with different color code IDs is activated using
1-Ethyl-3-(3-dimethylaminopropyl) carbodiirnide and
N-Hydroxysuccinimide. Neutravidin (100 .mu.g/ml in MES) is then
added to the beads and incubated for 120 min on a shaker. The beads
are then washed, re-suspended, and transferred to micro-centrifuge
tubes for storage at 4.degree. C. in a protein containing buffer
(BRE, Blocking Reagent for ELISA, Roche, Basel, Switzerland)
supplemented with NaN3. All coupled bead populations are treated
with sonication in an ultrasonic cleaner (Branson Ultrasonic
Corporation, Danbury, Conn.) for 5 min. The biotinylated peptides
are diluted in BRE to a concentration of 20 .mu.M, and 100 .mu.l of
each peptide is used in the coupling reaction, which is conducted
for 60 min with shaking at RT. Finally, the beads are washed with
3.times.100 .mu.l BRE buffer and stored at 4.degree. C. until
further use. The therapeutic properties of such monoclonal
antibodies or a polyclonal antibody capable of selective
interaction with (the extracellular region of) the PODXL protein
may be assessed using the following protocol: Cells expressing the
PODXL protein are seeded at 5.times.10.sup.4 cells/well in 24-well
dishes. After 24 h, cells are treated in triplicate with dilutions
of antibody (selective for SEQ ID NO:1, obtained as described
above) in concentrations ranging from 1 ng/ml to 1000 ng/ml. Cells
treated with PBS pH 7.2 are used as controls. After 5 days, cells
are trypsinized and counted three times each. Growth inhibition is
calculated as percentage of cells compared with untreated cultures.
The antibodies showing the highest growth inhibition may then be
selected as the therapeutic antibodies. The person skilled in the
art may thus, without undue burden, provide the affinity ligand of
the eighth aspect using his general knowledge and the teachings of
the present disclosure.
[0459] According to one embodiment, the affinity ligand is not part
of a targeting composition according to PCT publication WO
2009/108932. Thus, according to one embodiment, the affinity ligand
is not part of a composition further comprising a second antibody
to carcinoembryonic antigen (CEA) or CD44v. According to an
alternative or complementary embodiment, the affinity ligand is not
bound to a solid substrate. According to another alternative or
complementary embodiment, the affinity ligand is not part of a
composition further comprising a therapeutic or imaging agent bound
to the substrate or the affinity ligand. Here, the "therapeutic
agent" refers to an agent which is different from the therapeutic
affinity ligand of the present aspect. Examples of such a
therapeutic agent are the chemotherapeutic agents listed in Claim
28 of WO 2009/108932. The embodiments based on the disclosure of WO
2009/108932 described here in connection with the eighth aspect
apply mutatis mutandis to the sixth and seventh aspect. Further, it
is provided that the disclosure of WO 2009/108932 is based on a
concept that is different from the concept on which the present
disclosure is based. For example, the affinity ligands of the
present disclosure are not intended for in vivo imaging. Also, the
therapeutic effect of the present aspects does not rely on the
actions of another therapeutic agent (e.g. a known chemotherapeutic
agent which in itself is not capable of selective interaction with
PODXL protein).
[0460] As a ninth aspect of the present disclosure, there is
provided a method of treatment of a subject having a colorectal
cancer comprising the step of administrating an effective amount of
an affinity ligand capable of selective interaction with the PODXL
protein. The embodiments of the eighth aspect apply to the ninth
aspect mutatis mutandis.
[0461] It follows from the above that the level PODXL protein may
be detected to determine whether a colorectal cancer patient would
benefit from immunotherapy based on an anti-PODXL protein affinity
ligand. However, it should be noted that the eighth and ninth
aspects of the present disclosure are not limited to subjects
showing (high levels of) PODXL expression.
[0462] As a tenth aspect of the present disclosure, there is thus
provided a method of determining whether a mammalian subject having
a colorectal cancer is likely to benefit from a treatment with an
affinity ligand capable of selective interaction with a PODXL
protein, comprising the steps of: [0463] a) evaluating an amount of
PODXL protein in at least part of a sample earlier obtained from
the subject, and determining a sample value corresponding to the
evaluated amount; [0464] b) comparing said sample value from step
a) with a predetermined reference value; and if said sample value
is higher than said reference value, [0465] c) concluding that the
subject is likely to benefit from the treatment.
[0466] Being likely to benefit from the treatment refers to a
having a higher probability of survival or recovery if undergoing
the treatment than if not undergoing the treatment. In this
context, "recovery" refers to return from a colorectal cancer state
to a colorectal cancer free state. The "survival" may be an overall
survival or a disease free survival. Further, the "recovery" may be
a recurrence free recovery. Also, the "higher probability" may be a
probability benefit at five years, ten years or 15 years of at
least 5%, such as at least 10%.
[0467] The embodiments of the eighth aspect apply to the present
aspect mutatis mutandis. Further, the embodiments of the method
aspects above apply mutatis mutandis to the present aspect.
[0468] Also, as an eleventh aspect of the present disclosure, there
is provided a use of a PODXL protein, or an antigenically active
fragment thereof, as an antigen in an immunization for the
production of a therapeutic affinity ligand according to the eighth
aspect. The PODXL protein may for example consist of the
extracellular region (SEQ ID NO:6 or 7) or a subsequence thereof.
It is to be understood that such a subsequence is of sufficient
size to generate an affinity ligand capable of selective
interaction with the PODXL protein. An example of a PODXL protein
which is a subsequence of the extracellular region of PODXL is the
peptide consisting of the amino acid sequence SEQ ID NO:1, which is
generated in Examples, section 1 below and used as an antigen in
Examples, section 2 below.
Examples
Generation of Mono-Specific Antibodies Against PODXL Protein and
Use Thereof to Detect PODXL Protein in Colorectal Cancer
Samples
1. Generation of Antigen
a) Materials and Methods
[0469] A suitable fragment of the target protein encoded by the
EnsEMBL Gene ID ENSG00000128567 was selected using bioinformatic
tools with the human genome sequence as template (Lindskog M et al
(2005) Biotechniques 38:723-727, EnsEMBL, www.ensembl.org). The
fragment was used as template for the production of a 138 amino
acid long fragment (SEQ ID NO:1) corresponding to amino acids
278-417 of the PODXL protein ENSP00000319782 (SEQ ID NO:2) or
alternatively the amino acids 310-447 of the splice variant
ENSP00000367817 (SEQ ID NO:3).
[0470] A fragment of the PODXL gene transcript containing
nucleotides 832-1245 of EnsEMBL entry number ENST00000322985 (SEQ
ID NO:4), or alternatively nucleotides 928-1341 of the splice
variant ENST00000378555 (SEQ ID NO:5), was isolated by a
Superscript.TM. One-Step RT-PCR amplification kit with
Platinum.RTM. Taq (Invitrogen) and a human total RNA pool panel as
template (Human Total RNA, BD Biosciences Clontech). Flanking
restriction sites Notl and Ascl were introduced into the fragment
through the PCR amplification primers, to allow in-frame cloning
into the expression vector (forward primer: CTGCCAGAGACCATGAGC (SEQ
ID NO:8), reverse primer: GTCCCCTAGCTTCATGTCAC (SEQ ID NO:9)).
Then, the downstream primer was biotinylated to allow solid-phase
cloning as previously described, and the resulting biotinylated PCR
product was immobilized onto Dynabeads M280 Streptavidin (Dynal
Biotech) (Larsson M et al (2000) J. Biotechnol. 80:143-157). The
fragment was released from the solid support by Notl-Asci digestion
(New England Biolabs), ligated into the pAff8c vector (Larsson M et
al, supra) in frame with a dual affinity tag consisting of a
hexahistidyl tag for immobilized metal ion chromatography (IMAC)
purification and an immunopotentiating albumin binding protein
(ABP) from streptococcal protein G (Sjolander A et al (1997) J.
Immunol. Methods 201:115-123; Stahl S et al (1999) Encyclopedia of
Bioprocess Technology: Fermentation, Biocatalysis and Bioseparation
(Fleckinger M C and Drew S W, eds) John Wiley and Sons Inc., New
York, pp 49-63), and transformed into E. coli BL21(DE3) cells
(Novagen). The sequences of the clones were verified by
dye-terminator cycle sequencing of plasmid DNA amplified using
TempliPhi DNA sequencing amplification kit (GE Healthcare, Uppsala,
Sweden) according to the manufacturer's recommendations.
[0471] BL21(DE3) cells harboring the expression vector were
inoculated in 100 ml 30 g/I tryptic soy broth (Merck KGaA)
supplemented with 5 g/I yeast extract (Merck KGaA) and 50 mg/I
kanamycin (Sigma-Aldrich) by addition of 1 ml of an overnight
culture in the same culture medium. The cell culture was incubated
in a 1 liter shake flask at 37.degree. C. and 150 rpm until the
optical density at 600 nm reached 0.5-1.5. Protein expression was
then induced by addition of
isopropyl-.beta.-D-thiogalactopyranoside (Apollo Scientific) to a
final concentration of 1 mM, and the incubation was continued
overnight at 25.degree. C. and 150 rpm. The cells were harvested by
centrifugation at 2400 g, and the pellet was re-suspended in 5 ml
lysis buffer (7 M guanidine hydrochloride, 47 mM Na.sub.2HPO.sub.4,
2.65 mM NaH.sub.2PO.sub.4, 10 mM Tris-HCl, 100 mM NaCl, 20 mM
.beta.-mercaptoethanol; pH=8.0) and incubated for 2 hours at
37.degree. C. and 150 rpm. After centrifugation at 35300 g, the
supernatant containing the denatured and solubilized protein was
collected.
[0472] The His.sub.6-tagged fusion protein was purified by
immobilized metal ion affinity chromatography (IMAC) on columns
with 1 ml Talon.RTM. metal (Co.sup.2+) affinity resin (BD
Biosciences Clontech) using an automated protein purification
procedure (Steen J et al (2006) Protein Expr. Purif. 46:173-178) on
an ASPEC XL4.TM. (Gilson). The resin was equilibrated with 20 ml
denaturing washing buffer (6 M guanidine hydrochloride, 46.6 mM
Na.sub.2HPO.sub.4, 3.4 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH
8.0-8.2). Clarified cell lysates were then added to the column.
Thereafter, the resin was washed with a minimum of 31.5 ml washing
buffer prior to elution in 2.5 ml elution buffer (6 M urea, 50 mM
NaH.sub.2PO.sub.4, 100 mM NaCl, 30 mM acetic acid, 70 mM
Na-acetate, pH 5.0). The eluted material was fractioned in three
pools of 500, 700 and 1300 .mu.l. The 700 .mu.l fraction,
containing the antigen, and the pooled 500 and 1300 .mu.l fractions
were stored for further use.
[0473] The antigen fraction was diluted to a final concentration of
1 M urea with phosphate buffered saline (PBS; 1.9 mM
NaH.sub.2PO.sub.4, 8.1 mM Na.sub.2HPO.sub.4, 154 mM NaCl) followed
by a concentration step to increase the protein concentration using
Vivapore 10/20 ml concentrator with molecular weight cut off at
7500 Da (Vivascience AG). The protein concentration was determined
using a bicinchoninic acid (BCA) micro assay protocol (Pierce) with
a bovine serum albumin standard according to the manufacturer's
recommendations. The protein quality was analyzed on a Bioanalyzer
instrument using the Protein 50 or 200 assay (Agilent
Technologies).
b) Results
[0474] A gene fragment corresponding to nucleotides 832-1245 or
928-1341 of the full-lengths transcript of PODXL (SEQ ID NO:4 or 5)
was successfully isolated by RT-PCR from a human RNA pool using
specific primers. The fragment codes for amino acids 278-415 and
310-447 of the two splice variants of the target protein PODXL (SEQ
ID NO:2 and 3), respectively. The 138 amino acid fragment (SEQ ID
NO:1) of the target protein (SEQ ID NO:2 or 3) was designed to lack
transmembrane regions to ensure efficient expression in E. coli,
and to lack any signal peptide, since those are cleaved off in the
mature protein. In addition, the protein fragment was designed to
consist of a unique sequence with low homology with other human
proteins, to minimize cross reactivity of generated affinity
reagents, and to be of a suitable size to allow the formation of
conformational epitopes and still allow efficient cloning and
expression in bacterial systems.
[0475] A clone encoding the correct amino acid sequence was
identified, and, upon expression in E. coli, a single protein of
the correct size was produced, and subsequently purified using
immobilized metal ion chromatography. After dilution of the eluted
sample to a final concentration of 1 M urea, and concentration of
the sample to 1 ml, the concentration of the protein fragment was
determined to be 4.0 mg/ml and was 98.2% pure according to purity
analysis.
2. Generation of Antibodies
a) Materials and Methods
[0476] The purified PODXL fragment as obtained above was used as
antigen to immunize a rabbit in accordance with the national
guidelines (Swedish permit no. A 84-02). The rabbit was immunized
intramuscularly with 200 .mu.g of antigen in Freund's complete
adjuvant as the primary immunization, and boosted three times in
four week intervals with 100 .mu.g antigen in Freund's incomplete
adjuvant.
[0477] Antiserum from the immunized animal was purified by a
three-step immunoaffinity based protocol (Agaton C et al (2004) J.
Chromatogr. A 1043:33-40; Nilsson P et al (2005) Proteomics
5:4327-4337). In the first step, 7 ml of total antiserum was
buffered with 10.times.PBS to a final concentration of 1.times.PBS
(1.9 mM NaH.sub.2PO.sub.4, 8.1 mM Na.sub.2HPO.sub.4, 154 mM NaCl),
filtered using a 0.45 .mu.m pore-size filter (Acrodisc.RTM., Life
Science) and applied to an affinity column containing 5 ml
N-hydroxysuccinimide-activated Sepharose.TM. 4 Fast Flow (GE
Healthcare) coupled to the dual affinity tag protein His.sub.6-ABP
(a hexahistidyl tag and an albumin binding protein tag) expressed
from the pAff8c vector and purified in the same way as described
above for the antigen protein fragment. In the second step, the
flow-through, depleted of antibodies against the dual affinity tag
His.sub.6-ABP, was loaded at a flow rate of 0.5 ml/min on a 1 ml
Hi-Trap NHS-activated HP column (GE Healthcare) coupled with the
PODXL protein fragment used as antigen for immunization (SEQ ID
NO:1). The His.sub.6-ABP protein and the protein fragment antigen
were coupled to the NHS activated matrix as recommended by the
manufacturer. Unbound material was washed away with 1.times.PBST
(1.times.PBS, 0.1% Tween20, pH 7.25), and captured antibodies were
eluted using a low pH glycine buffer (0.2 M glycine, 1 mM EGTA, pH
2.5). The eluted antibody fraction was collected automatically, and
loaded onto two 5 ml HiTrap.TM. desalting columns (GE Healthcare)
connected in series for efficient buffer exchange in the third
step. The second and third purification steps were run on the
AKTAxpress.TM. platform (GE Healthcare). The antigen selective
(mono-specific) antibodies (msAbs) were eluted with PBS buffer,
supplemented with glycerol and NaN.sub.3 to final concentrations of
40% and 0.02%, respectively, for long term storage at -20.degree.
C. (Nilsson P et al (2005) Proteomics 5:4327-4337).
[0478] The specificity and selectivity of the affinity purified
antibody fraction were analyzed by binding analysis against the
antigen itself and against 94 other human protein fragments in a
protein array set-up (Nilsson P et al (2005) Proteomics
5:4327-4337). The protein fragments were diluted to 40 .mu.g/ml in
0.1 M urea and 1.times.PBS (pH 7.4) and 50 .mu.l of each were
transferred to the wells of a 96-well spotting plate. The protein
fragments were spotted in duplicate and immobilized onto epoxy
slides (SuperEpoxy, TeleChem) using a pin-and-ring arrayer
(Affymetrix 427). The slide was washed in 1.times.PBS (5 min) and
the surface was then blocked (SuperBlock.RTM., Pierce) for 30
minutes. An adhesive 16-well silicone mask (Schleicher &
Schuell) was applied to the glass before the mono-specific
antibodies were added (diluted 1:2000 in 1.times.PBST to appr. 50
ng/ml) and incubated on a shaker for 60 min. Affinity tag-specific
IgY antibodies were co-incubated with the mono-specific antibodies
in order to quantify the amount of protein in each spot. The slide
was washed with 1.times.PBST and 1.times.PBS twice for 10 min each.
Secondary antibodies (goat anti-rabbit antibody conjugated with
Alexa 647 and goat anti-chicken antibody conjugated with Alexa 555,
Molecular Probes) were diluted 1:60000 to 30 ng/ml in 1.times.PBST
and incubated for 60 min. After the same washing procedure as for
the first incubation, the slide was spun dry and scanned (G2565BA
array scanner, Agilent). Thereafter images were quantified using
image analysis software (GenePix 5.1, Axon Instruments).
b) Results
[0479] The quality of polyclonal antibody preparations has proven
to be dependent on the degree of stringency in the antibody
purifications, and it has previously been shown that depletion of
antibodies directed against epitopes not originated from the target
protein is necessary to avoid cross-reactivity to other proteins
and background binding (Agaton C et al (2004) J. Chromatogr. A
1043:33-40). Thus, a protein microarray analysis was performed to
ensure that mono-specific polyclonal antibodies of high specificity
had been generated by depletion of antibodies directed against the
His.sub.6-tag as well as of antibodies against the ABP-tag.
[0480] To quantify the amount of protein in each spot of the
protein array, a two-color dye labeling system was used, with a
combination of primary and secondary antibodies. Tag-specific IgY
antibodies generated in hen were detected with a secondary goat
anti-hen antibody labeled with Alexa 555 fluorescent dye. The
specific binding of the rabbit msAb to its antigen on the array was
detected with a fluorescently Alexa 647 labeled goat anti-rabbit
antibody. Each protein fragment was spotted in duplicates. The
protein array analysis shows that the affinity purified
mono-specific antibody against PODXL is highly selective to the
correct protein fragment and has a very low background to all other
protein fragments analyzed on the array.
3) Sigmoid Colon Cancer TMA
a) Material and Methods
[0481] Archival formalin-fixed paraffin-embedded tissue from a
patient cohort consisting of 305 retrospectively identified cases
from a prospective database with patients who underwent curative
resection for sigmoid colon cancer (148 women and 157 men) between
1993 and 2003 was collected from the Department of Pathology, Malmo
University Hospital, Sweden. The median age of patients was 74
(39-97) years. 47 tumors were Dukes' stage A, 129 Dukes' stage B,
84 Dukes' stage C and 45 with Dukes' stage D. Some of the patients
diagnosed with cancer with Duke's stage C or D tumor were offered
adjuvant treatment (5-FU) or in some cases palliative treatment.
Information regarding the date of death was obtained from the
regional cause-of-death registries for all patients. Ethical
permission was obtained from the Local Ethics Committee.
[0482] All 305 cases were histopathologically re-evaluated on
slides stained with hematoxylin and eosin. TMA:s were then
constructed by sampling 2.times.1.0 mm cores per case from areas
representative of sigmoid colon carcinoma. Automated
immunohistochemistry was performed as previously described (Kampf C
et al (2004) Clin. Proteomics 1:285-300). In brief, the glass
slides were incubated for 45 min in 60.degree. C., de-paraffinized
in xylene (2.times.15 min) and hydrated in graded alcohols. For
antigen retrieval, slides were immersed in TRS (Target Retrieval
Solution, pH 6.0, Dako, Copenhagen, Denmark) and boiled for 4 min
at 125.degree. C. in a Decloaking Chamber.RTM. (Biocare Medical).
Slides were placed in the Autostainer.RTM. (Dako) and endogenous
peroxidase was initially blocked with H.sub.2O.sub.2 (Dako). The
slides were incubated for 30 min at room temperature with the
primary PODXL antibody obtained as in Examples, section 2, or with
an anti-COX-2 antibody. For COX-2 IHC, a monoclonal antibody
(Zymed, clone 18-7379) diluted
1:200 was used. This was followed by incubation for 30 min at room
temperature with goat anti-rabbit peroxidase conjugated
Envision.RTM.. Between all steps, slides were rinsed in wash buffer
(Dako). Finally, diaminobenzidine (Dako) was used as chromogen and
Harris hematoxylin (Sigma-Aldrich) was used for counterstaining.
The slides were mounted with Pertex.RTM. (Histolab).
[0483] All samples of immunohistochemically stained tissue were
manually evaluated under the microscope and annotated by a
certified pathologist. Annotation of each sample was performed
using a simplified scheme for classification of IHC outcome. Each
tissue sample was examined for representativity and
immunoreactivity.
[0484] Basic annotation parameters included an evaluation of
subcellular localization (nuclear expression and/or
membranous/cytoplasmic expression), staining intensity and fraction
of stained cells. Staining intensity was subjectively evaluated in
accordance to standards used in clinical histopathological
diagnostics and outcome was classified as: absent=no
immunoreactivity, weak=faint immunoreactivity, moderate=medium
immunoreactivity, or strong=distinct and strong immunoreactivity.
Also fraction of stained cells was subjectively evaluated in
accordance to standards used in clinical histopathological
diagnostics and outcome was classified according to the percentage
immunoreactive cells of the relevant cell population. The skilled
artisan will recognize that this annotation procedure is similar to
a calculation of an Allred score, see e.g. Allred et al (1998) Mod
Pathol 11(2), 155.
[0485] For statistical analyses, levels of cytoplasmic intensity
(CI) and cytoplasmic fraction (CF) were evaluated in line with what
is described above. (As explained above, CI and CF are based on
membranous/cytoplasmic expression.) Briefly, the subjects were
split into four groups based on PODXL protein expression,
wherein:
[0486] "0" represents an absent cytoplasmic intensity (CI) and a
cytoplasmic fraction (CF) of <1%;
[0487] "1" represents a weak CI and a CF of >1%;
[0488] "2" represents a moderate or strong CI and a CF of 1-50%;
and
[0489] "3" represents moderate or strong CI and a CF of
>50%.
[0490] Based on the survival trends for individual strata,
dichotomized variables were constructed for further statistical
analyses. For analysis using the anti-PODXL protein antibody, two
definitions of PODXL protein "high" and "low" were employed. In the
first one, "PODXL protein high" represented "2" or "3" according to
the above, while "PODXL protein low" represented "0" or "1"
according to the above. In the second one, "PODXL protein high"
represented "1", "2" or "3" according to the above, while "PODXL
protein low" represented "0" according to the above. Consequently,
two different cut-off:s were employed and when using the latter,
substantially all subjects showing PODXL protein expression ended
up in the "high" category.
[0491] Further, the subjects were split into two groups (high and
low) based on COX-2 expression, wherein "high" represented a CF of
.gtoreq.10% and a strong CI and "low" represented a CF of <10%
and/or an absent, weak or moderate cytoplasmic intensity.
[0492] The above classification of samples was used to estimate
disease free survival (DFS) and overall survival (OS) according to
the Kaplan-Meier estimator, and the log-rank test was used to
compare survival in different strata. All statistical tests were
two-sided, and p-values of <0.05 were considered significant.
All calculations were made with the statistical package SPSS 17.0
(SPSS Inc. Illinois, USA).
b) Results
[0493] Immunohistochemical analysis of PODXL expression could be
performed on 279 tumor samples. The remaining cores either did not
contain tumor cells or had been lost during histoprocessing. PODXL
expression analysis resulted in a membranous/cytoplasmic staining
in 86 subjects. 193 (69%) lacked expression (CI<1%).
[0494] Survival analysis of the entire cohort revealed that
expression of PODXL in tumor tissues was significantly correlated
with overall and disease free survival (OS and DFS) (FIGS. 1A, 1B,
2A, 2B, 3A, 3B, 4A, 4B, 5A and 5B). FIGS. 1A and 1B shows OS and
DFS for all subjects when divided into four different categories
based on the CI. For patients with an absent or weak PODXL
expression both OS and DFS were higher than for patients with a
moderate or strong expression, with a five-year OS and DFS of
approximately 60% and 70% respectively. OS and DFS for patients
with moderate or strong expression of PODXL were approximately 40%
(FIGS. 1A and 1B). Thus, a lower CI indicates a relatively good
prognosis whereas a higher CI indicates a relatively poor
prognosis. Analysis of OS and DFS with dichotomized variables
further supports these findings (FIGS. 2A, 2B, 3A and 3B). Further,
these figures show that OS and DFS analyses at both a relatively
low (FIGS. 3A and 3B) and a relatively high (FIGS. 2A and 2B)
cut-off yield significant results.
[0495] Next, the impact on DFS and OS of different combinations of
PODXL protein expression and COX-2 expression was analyzed.
Briefly, all subjects were split into four groups based on PODXL
and COX-2 status, i.e. subjects that were PODXL low and COX-2 low,
subjects that were PODXL low and COX-2 high, subjects that were
PODXL high and COX-2 low and subjects that were PODXL high and
COX-2 high. The analysis revealed that these strata were associated
with differences in OS and DFS (FIGS. 4A and 4B). Surprisingly,
PODXL high and COX-2 high patients had a particularly poor outcome
whereas PODXL low and COX-2 low patients had a particularly good
outcome. Further, PODXL protein is a more important prognostic
marker than COX-2 according to FIGS. 4A and 4B. Analysis of OS and
DFS with dichotomized variables, where one group consists of
patients being PODXL low and/or COX-2 low and another group
consists of patients being PODXL high and COX-2 high, further
supports the differences in survival outcome (FIGS. 5A and 5B).
This group of PODXL high patients may also be particularly
interesting for COX-2 inhibition treatment.
[0496] In conclusion, for a patient diagnosed with sigmoid
carcinoma, the use of PODXL protein as a biomarker may be of
significant value for establishing a prognosis for a patient, e.g.
the probability of survival, such as five-year survival, as can be
seen in FIGS. 1A, 1B, 2A, 2B, 3A, 3B, 4A, 4B, 5A and 5B. Further,
the prognostic data may be refined by also considering the COX-2
status of the patient.
4) Colorectal Cancer TMA
a) Material and Methods
[0497] Archival formalin-fixed paraffin-embedded tissue from 118
patients (61 women and 57 men) diagnosed with colorectal carcinoma
between 1999 and 2002 was collected from the Department of
Pathology, Malmo University Hospital, Sweden. The median age of
patients was 73 (32-88) years. 51 of the samples were collected
from colon and 67 from rectum. 35 tumors were Dukes' stage A, 42
Dukes' stage B, 35 Dukes' stage C and 6 Dukes' stage D. Information
regarding the date of death was obtained from the regional
cause-of-death registries for all patients. Ethical permission was
obtained from the Local Ethics Committee.
[0498] All 118 cases of colorectal carcinoma were
histopathologically re-evaluated on slides stained with hematoxylin
and eosin. TMA:s were then constructed by sampling 2.times.1.0 mm
cores per case from areas representative of invasive cancer. The
TMA:s were prepared and automated immunohistochemistry was
performed as described in section 3 above, using the PODXL antibody
prepared as described in Examples, section 2 above and an
anti-COX-2-monoclonal antibody (Zymed, clone 18-7379) diluted
(1:200).
[0499] Annotation, classification, grouping and statistical
analyses were performed as described in section 3a above. However,
in the grouping based on COX-2 expression, "high" represented a CF
of 10% and a moderate or strong CI and "low" represented a CF of
<10% and/or an absent or weak (CI).
b) Results
[0500] Immunohistochemical analysis of PODXL expression could be
performed on 112 tumor samples. The remaining cores either did not
contain tumor cells or had been lost during histoprocessing. PODXL
expression analysis resulted in a membranous/cytoplasmic staining
in 67 subjects. 45 subjects (40%) lacked expression (CI<1%).
[0501] Survival analysis of the entire cohort revealed that
membranous/cytoplasmic expression of PODXL in tumor tissues was
significantly correlated with overall survival (OS) (FIGS. 6A, 6B
and 7). FIG. 6A shows OS for all subjects when divided into four
different categories based on the CI. Patients with an absent or
weak PODXL expression had a higher OS than patients with a moderate
or strong expression. Analysis of OS with dichotomized variables as
seen in FIG. 6B reveal that the five-year OS for patients with
absent or weak expression were above 60%, whereas the five-year OS
for patients with moderate or strong expression were below 40%.
Thus, a low CI indicates a relatively good prognosis whereas a high
CI indicates a relatively poor prognosis. If excluding rectal
samples from the OS analysis, the significant result remain, this
finding further supports PODXL as an important marker for colon
cancer aggressiveness (FIG. 7).
[0502] Next, the inventors investigated the association between the
expression of PODXL and COX-2, given the proposed role for COX-2 as
a predictor for poor prognosis in colon cancer. The impact on OS
for patients with different combinations of PODXL protein
expression and COX-2 expression were analyzed. Briefly, all
subjects were split into four groups based on PODXL and COX-2
status, i.e. subjects that were PODXL low and COX-2 low, subjects
that were PODXL low and COX-2 high, subjects that were PODXL high
and COX-2 low and subjects that were PODXL high and COX-2 high. The
analysis revealed that these defined strata were associated with
differences in OS (FIG. 8A). Surprisingly, PODXL high and COX-2
high patients had a particularly poor outcome whereas PODXL low and
COX-2 low patients had a particularly good outcome. Analysis of OS
with dichotomized variables, where one group contains PODXL and/or
COX-2 low patients and the second group consists of PODXL and COX-2
high patients, further supports the differences in survival outcome
(FIG. 8B). This group of PODXL high patients may also be
particularly interesting for COX-2 inhibition treatment.
[0503] Consequently, the results from the colorectal cancer cohort
(the present section) are very similar to those from the sigmoid
colon cancer cohort (section 3). The findings of the present
disclosure thus indicate that PODXL protein, optionally in
combination with COX-2, is a prognostically relevant biomarker in
the whole colorectal region as well as in colon and a subregion
thereof (i.e. the sigmoideum).
5) Colorectal Cancer TMA, Cohort II
a) Material and Methods
[0504] Archival formalin-fixed paraffin-embedded tissue from 270
patients (137 women and 133 men), surgically treated for colorectal
cancer between Jan. 1, 1990 and Dec. 31, 1991, was collected from
the Department of Pathology, Malmo University Hospital, Sweden. The
median age of patients was 73 (37-93) years. 217 of the samples
were collected from colon and 51 from rectum. 42 tumors were Dukes'
stage A, 118 Dukes' stage B, 70 Dukes' stage C and 40 Dukes' stage
D. Information regarding the date of death was obtained from the
regional cause-of-death registries for all patients. Ethical
permission was obtained from the Local Ethics Committee.
[0505] All 270 cases of colorectal carcinoma were
histopathologically re-evaluated on slides stained with hematoxylin
and eosin. TMA:s were then constructed by sampling 2.times.1.0 mm
cores per case from areas representative of invasive cancer. The
TMA:s were prepared and automated immunohistochemistry was
performed as described in section 3 above, using the PODXL antibody
prepared as described in Examples, section 2 above.
[0506] Annotation, classification, grouping and statistical
analyses were performed as described in section 3a above.
b) Results
[0507] Immunohistochemical analysis of PODXL expression could be
performed on all 270 tumor samples. PODXL expression analysis
resulted in a membranous/cytoplasmic staining in 121 subjects. 137
subjects (about 50%) lacked expression (CI<1%).
[0508] Survival analysis of the entire cohort revealed that
membranous/cytoplasmic expression of PODXL in tumor tissues was
significantly correlated with overall survival (OS) (FIGS. 9A and
9B). FIG. 9A shows OS for all subjects when divided into four
different categories based on the CI. Patients with an absent or
weak PODXL expression had a higher OS than patients with a moderate
or strong expression. Analysis of OS with dichotomized variables as
seen in FIG. 9B reveal that the five-year OS for patients with
absent or weak expression (solid line) were approximately 50%,
whereas the five-year OS for patients with moderate or strong
expression (dotted line) were below 30%. Thus, a low CI indicates a
relatively good prognosis whereas a high CI indicates a relatively
poor prognosis.
[0509] When analyzing patients with highly differentiated tumors
(FIG. 10A) there is a marked difference in OS between patients with
an absent PODXL expression (solid line), who fared considerably
better compared to those with tumors that stained positive for
PODXL (dotted line).
[0510] When analyzing patients with Dukes stage A tumors (FIG. 10B)
it can be seen that patients with absent or weak expression of
PODXL (solid line) had a higher OS than patients with a moderate or
strong expression (dotted line). The five-year survival for
patients with low PODXL expression was almost 80%, while the
five-year survival for patients expressing moderate to high PODXL
levels, was only 40%.
[0511] The results from this colorectal cancer cohort (the present
section) are thus similar to those from the other analyzed cohorts
(sections 3 and 4).
6) Colorectal Cancer TMA, Cohort III
a) Materials and Methods
[0512] Cohort III consists of colorectal cancer (CRC) samples from
the Malmo Diet and Cancer Study (MDCS), an ongoing population-based
prospective cohort study with the primary aim to examine whether a
Western diet rich in fat and low in fruit and vegetables increases
the risk of certain forms of cancer (Berglund et al, 1993). Between
1991 and 1996, a total number of 28 098 individuals, 11 063 (39.4%)
men and 17 035 (60.6%) women between 44 and 74 years where enrolled
(from a background population of 74 138). Follow-up is done
annually by record linkage to national registries for cancer and
cause of death. Approval for the MDCS was obtained from the Ethics
Committee at Lund University. Until the end of follow-up 31 Dec.
2008, 626 incident cases of CRC had been registered in the study
population. Cases were identified from the Swedish Cancer Registry
up until 31 Dec. 2007, and from The Southern Swedish Regional Tumor
Registry for the period of 1 January to 31 Dec. 2008. All tumors
with available slides and/or paraffin blocks were
histopathologically re-evaluated on haemotoxylin and eosin-stained
slides. Histopathological, clinical and treatment data were
obtained from clinical and/or pathology records. TNM staging was
performed according to the American Joint Committee on Cancer
(AJCC). Information on vital status and cause of death were
obtained from the Swedish Cause of Death Registry up until 31 Dec.
2009. Follow-up started at the date of diagnosis and ended at
death, emigration or 31 Dec. 2009, whichever came first.
[0513] Mean and median age of patients in the cohort was 71 years
(range 50-86), and approximately 52% of the patients were female.
Information on stage and grade was available for the majority of
patients, T-stage ranging from 1-4 (appr. 60% of patients belonging
to stage T3), N-stage ranging from 0-2 (appr. 60% to stage NO), and
M-stage ranging from 0-1 (appr. 80% to stage M0). About 6% of
patients had tumors with high differentiation grade, 70% with
intermediate differentiation grade, and 22% with low
differentiation grade. Information on adjuvant chemotherapy was
also available for the majority of patients.
[0514] For TMA construction, tumors with an insufficient amount of
material were excluded, and a total number of 557 (89%) tumors were
used in the TMA. Areas representative of cancer were then marked on
haematoxylin and eosin-stained slides and TMAs were constructed as
previously described (Kononen et al, 1998). In brief, two 1.0 mm
cores were taken from each tumor and mounted in a new recipient
block using a semi-automated arraying device (TMArrayer, Pathology
Devices, Westminster, Md., USA).
[0515] For immunohistochemical analysis, 4 mm TMA sections were
automatically pre-treated using the PT-link system (DAKO, Glostrup,
Denmark) and then stained in an Autostainer Plus (DAKO) with the
affinity-purified polyclonal anti-PODXL antibody, obtained as
described in Examples, Section 2 above, diluted 1:250. The Envision
Flex/HRP (K8010) kit (DAKO) was used for visualisation of the
staining. To control for heterogenous expression patterns, IHC was
also performed on full-face sections from 10 randomly selected
cases denoted as having negative PODXL expression and 10 cases with
high (score 3-4) PODXL expression.
[0516] The PODXL protein was expressed in the cytoplasm of the
tumor cells, with an accentuation towards the membrane in some
cases. No expression was seen in the nuclei. The expression was
recorded as negative (0), weakly positive in any proportion of
cells (1), moderately positive in any proportion (2), positive with
distinct membranous pattern in .ltoreq.50% of cells (3) and
positive with distinct membranous pattern in >50% of cells (4).
The staining was evaluated by two independent observers who were
blinded to clinical and outcome data. Scoring differences were
discussed in order to reach consensus.
[0517] For statistical purposes, categories of PODXL expression
were trichotomised into negative (0), weak-moderate (1-2) and
strong (3-4) PODXL staining, or dichotomised into low (0-2) and
high (3-4) PODXL staining. Spearman's Rho and Chi-square-tests were
used for comparison of PODXL expression and relevant
clinicopathological characteristics. Kaplan-Meier analysis and log
rank test were used to illustrate differences in colorectal cancer
specific survival (CRCSS) and overall survival (OS) according to
PODXL expression. Cox regression proportional hazards models were
used for estimation of hazard ratios (HRs) for death from CRC and
overall causes according to PODXL expression in both uni- and
multivariate analysis, adjusted for age, gender, TNM status,
differentiation grade and vascular invasion. A backward conditional
selection method was used for variable selection by the model. The
interaction between PODXL expression and adjuvant chemotherapy was
explored by a Cox model including a treatment variable and an
interaction variable. All tests were two-sided. A P-value of 0.05
was considered significant. All statistical analyses were performed
using SPSS version 18 (SPSSInc., Chicago, Ill., USA).
b) Results
[0518] Following antibody optimisation and staining, PODXL
expression could be evaluated in 536 of the 557 (96.2%) of the
tumors represented in the TMA. A total of 268 tumors (50.0%) were
negative for PODXL, 196 (36.6%) displayed weak-moderate staining
and 72 (13.4%) strong staining for PODXL. As endothelial cells
express PODXL, entrapped vessels served as internal positive
control. Notably, in the majority of cases denoted as positive,
PODXL was distinctly expressed in scattered invasive cells at the
tumor front, corresponding morphologically with tumor budding
(Prall, 2007). PODXL expression in full-face sections (n=20)
correlated with the TMA-based scoring in all cases. Analysis of the
relationship between PODXL expression and established
clinicopathological parameters revealed a strong correlation
between high PODXL expression and more advanced T-stage
(P<0.001), N-stage (P<0.001), M-stage (P=0.009), low
differentiation grade (P<0.001) and presence of vascular
invasion (P=0.008). There was no significant association between
PODXL expression and age at diagnosis, gender or tumor location.
Kaplan-Meier analysis revealed that PODXL expression correlated
with a significantly shorter CRCSS and OS (FIGS. 13A and 13B), with
the worst outcome for tumors with high PODXL expression (FIGS. 13A
and 13B, line 3). These findings were confirmed in univariate Cox
regression analysis using a dichotomised variable of low (0-2) and
high (3-4) PODXL expression (HR=1.98; 95% confidence interval (CI)
1.38-2.84, P<0.001 for CRCSS and HR=1.85; 95% CI 1.29-2.64,
P=0.001 for 5-year OS), and remained significant for 5-year OS in
multivariate analysis (HR=1.52; 95% CI 1.03-2.25, P=0.036) and
borderline significant for CRCSS (HR=1.57; 95% CI 0.99-2.18,
P=0.055), adjusted for age, gender, TNM status, differentiation
grade and vascular invasion. PODXL expression was also
significantly associated with long-term OS, both in univariate
analysis (HR=1.97; 95% CI 1.41-2.74, P<0.001) and multivariate
analysis (HR=1.57; 95% CI 1.10-2.25, P=0.014).
[0519] The impact of PODXL expression on survival in relation to
adjuvant treatment was analysed in 122 curatively resected stage
III (T1-4, N1-2, M0) patients, of whom 62 (50.8%) had received
adjuvant treatment and 60 (49.2%) had not. Kaplan-Meier analysis in
strata according to treatment and PODXL expression (FIG. 14)
demonstrated that patients having tumors with high PODXL expression
who were treated with adjuvant chemotherapy had a similar CRCSS
(FIG. 14A, line 3) and OS (FIG. 14B, line 3) as patients with low
PODXL-expressing tumors (FIGS. 14A and 14B, line 0 and 1).
Untreated patients with tumors with high PODXL expression, however,
had a significantly shorter CRCSS and OS (FIGS. 14A and 14B, line
2). Cox interaction analysis demonstrated that the P-value for the
unadjusted interaction variable between treatment and PODXL status
was 0.044 for 5-year OS, suggesting that patients having tumors
with high expression of PODXL had benefited from adjuvant
chemotherapy, whereas patients with low PODXL-expressing tumors did
not benefit from adjuvant treatment. In addition, when adjusted for
established prognostic factors, the term of interaction was
significant for both CRCSS (P=0.004) and 5-year OS (P=0.015). The
treatment benefit was similar for 5-fluorouracil alone or in
combination with oxaliplatin. In patients with stage II disease
(T3-4, N0, M0; n=205), high PODXL expression was associated with a
significantly shorter OS (HR=3.03; 95% CI 1.45-6.34, P=0.003) and
5-year OS (HR=2.83; 95% CI 1.14-7.16, P=0.025), whereas the
association with CRCSS did not reach significance (HR=2.19; 95% CI
0.84-5.75, P=0.11). Information on adjuvant chemotherapy was
available for 170 patients with stage II disease, of whom only 13
(6.2%) had received treatment, an insufficient number to allow for
analysis of a potential treatment benefit related to PODXL status
in this group.
7) Colorectal Cancer TMA, Cohort IV
a) Materials and Methods
[0520] The colorectal cancer cohort IV consisted of 337 patients
undergoing surgery for CRC at the Central District Hospital in
Vasteras, Sweden between
[0521] June 2000 and December 2003. Tumor tissue for tissue
microarray (TMA) construction was available from 320 (95%)
patients. Follow-up started at date of diagnosis and ended at death
or 15 Apr. 2010. Endpoints were defined according to Punt et al (J
Natl Cancer Inst 2007. 99(13):998-1103). All observations were
censored at loss to follow-up and at the end of the study period.
Information on vital status and cause of death was obtained from
the Regional Oncology Registry and hospital records.
Histopathological, clinical, and treatment data were obtained from
pathology and hospital records.
[0522] TMA construction and IHC staining was performed as described
in Section 6 above, using the anti-PODXL antibody obtained as
described in Section 2 above.
[0523] PODXL protein expression was recorded as negative (0),
weakly positive in any proportion of cells (1), moderately positive
in any proportion (2), positive with distinct membranous pattern in
.ltoreq.50% of cells (3) and positive with distinct membranous
pattern in >50% of cells (4). The staining was evaluated by two
independent observers who were blinded to clinical and outcome
data. Scoring differences were discussed in order to reach
consensus.
[0524] For statistical purposes, categories of PODXL protein
expression were dichotomized into low (0-2) and high (3-4) based on
PODXL staining as described in Examples, Section 6 above.
Spearman's Rho and Chi-square tests were used for comparison of
PODXL expression and relevant clinicopathological characteristics.
Kaplan-Meier analysis and log rank test were used to illustrate
differences in disease free survival (DFS) and 5-year overall
survival (OS) according to PODXL protein expression. Cox regression
proportional hazards models were used for estimation of hazard
ratios (HR) for DFS and TTR according to PODXL expression in both
uni- and multivariable analysis adjusted for age, gender,
TNM-status, differentiation grade, neural and vascular invasion. A
backward conditional selection method was used for variable
selection by the model. All tests were two sided. A p-value of 0.05
was considered significant. All statistical analyses were performed
using SPSS version 19 (SPSS Inc, Chicago, Ill.).
b) Results
[0525] Following antibody optimization and staining, PODXL
expression could be evaluated in 316/320 (98.8%) of tumors in the
cohort. There were 291 (92.1%) tumors denoted as having low PODXL
expression and 25 (7.9%) tumors with high expression.
[0526] High PODXL protein expression was associated with a more
advanced T-stage (p=0.017), N-stage (p<0.001), M-stage
(p<0.001), low differentiation grade (p=0.019) and presence of
vascular (p=0.016) and neural invasion (p=0.002). There was no
significant correlation between PODXL expression and age at
diagnosis, gender, or tumor location.
[0527] Kaplan Meier analysis demonstrated that high PODXL protein
expression was significantly associated with a shorter TTR and DFS
in curatively treated patients. Cox univariate analysis confirmed
this association with a shorter TTR (HR=2.93; 95% C11.26-6.82,
p=0.013) and DFS (HR=2.44; 95% CI 1.32-4.54, p=0.005), remaining
significant in multivariable analysis adjusted for age, gender, T-
and N-status, differentiation grade, vascular and neural invasion,
HR=2.50; 95% CI 1.05-5.96, p=0.038 for TTR and HR=2.11; 95% CI
1.13-3.94, p=0.019 for DFS.
8) Generation of Monoclonal Antibodies.
a) Materials and Methods
[0528] The purified fragment (SEQ ID NO:1) obtained in section 1
was used as antigen for production of monoclonal antibodies.
Antigen was sent to AbSea Biotechnology Ltd (Beijing, China) and
briefly, the antigen was injected subcutaneously into BALB/c mice
(4-6 weeks old, female) at three week intervals. The antigen was
mixed with complete Freund's adjuvant for the first injection and
incomplete Freund's adjuvant for the following injections. Three
days before fusion, the mouse was last challenged with antigen
intravenously. Hybridomas were generated by fusion of mouse
splenocytes with the Sp2/0 myeloma cell line. By screening several
cell lines using ELISA, cells that secreted antibodies specific for
the antigen (SEQ ID NO:1) were identified and delivered to Atlas
Antibodies AB for further characterization. Cell lines that showed
positive results in ELISA, Western blot (WB) and
immunohistochemistry (IHC) were selected for subcloning, performed
by AbSea Biotechnology Ltd.
[0529] In addition, the immunohistochemical staining patterns of
the monoclonal antibodies were compared to that of the polyclonal
anti-PODXL antibody generated in Section 2. This polyclonal
antibody is sometimes referred to herein as "anti-PODXL".
b) Results
[0530] Cell-lines were screened by ELISA (at AbSea) to identify
lines that produce monoclonal antibodies (mAbs) that recognize the
antigen (SEQ ID NO:1), but not the affinity tag His-ABP. 22
cell-lines showed specific binding to the antigen SEQ ID NO:1 in
ELISA and were selected for further testing. For each of the
selected eight clones 150-300 .mu.l supernatant was collected,
azide was added, and the supernatants were delivered to Atlas
Antibodies AB on wet ice. The supernatants were stored at
+4.degree. C. upon arrival according to the instructions from
AbSea. Further testing of the cell lines resulted in the
identification of three interesting cell lines, clones 8F6, 13C10
and 17C9, that gave positive results in both Western blot and IHC
analysis. These clones were selected for subcloning and expansion,
performed by AbSea Biotechnology Ltd.
9) Epitope Mapping Using Bioplex
a) Synthetic Peptide Preparation
[0531] A PEPscreen library consisting of 26 biotinylated peptides
corresponding to the protein fragment SEQ ID NO:1 of the PODXL
protein (SEQ ID NO:2 or SEQ ID NO:3) was synthesized by
Sigma-Genosys (Sigma-Aldrich). The peptides were 15 amino acids
long with a 10 amino acid overlap, together covering the entire
PrEST sequence (SEQ ID NO:1). The peptides were resolved in 80%
DMSO to a final concentration of 10 mg/ml.
b) Bead Coupling
[0532] Neutravidin (Pierce, Rockford, Ill.) was immobilized on
carboxylated beads (BioPlex COOH Beads, BioRad) in accordance to
the manufacturer's protocol. Coupling of 10.sup.6 beads was
performed using a filter membrane bottomed microtiter plate
(MultiScreen-HTS, Millipore, Billerica, Mass.) as previously
described (Larsson et al (2009) J Immunol Methods 15;
34(1-2):20-32, Schwenk et al (2007) Mol Cell Proteomics 6(1)
125:32). 26 distinct groups of beads with different color code IDs
were activated using 1-Ethyl-3-(3-dimethylamino-propyl)
carbodiimide and N-Hydroxysuccinimide. Neutravidin (250 .mu.g/ml in
50 mM Hepes pH 7,4) was added to the beads and incubated for 120
min on a shaker. The beads were finally washed, re-suspended, and
transferred to micro-centrifuge tubes for storage at 4.degree. C.
in PBS-BN (1.times.PBS, 1% BSA, 0,05% NaN3). The biotinylated
peptides were diluted in PBS-BN to a concentration of 0, 1 mg/ml,
and 50 .mu.l of each peptide was used in the coupling reaction,
which was conducted for 60 min with shaking at RT. Finally, the
beads were washed with 3.times.100 .mu.l PBS-BN buffer and stored
at 4.degree. C. until further use.
c) Determination of Binding Specificity
[0533] A bead mixture containing all 26 bead IDs was prepared and
10 .mu.l of rabbit anti-PODXL, obtained as described in section 2,
was mixed with 30 .mu.l of the bead mix and incubated for 60 min at
RT. A filter bottomed microtiter plate (Millipore) was utilized for
washing and following each incubation all wells were washed with
2.times.100 .mu.l PBS-BN. To the beads, 25 .mu.l of
R-Phycoerythrine labeled anti-rabbit IgG antibody (Jackson
ImmunoResearch) was added for a final incubation of 30 min at
RT.
[0534] Measurements were performed using the Bioplex 200 Suspension
Array instrumentation with Bio-Plex Manager 5.0 software. For each
experiment, 50 events per bead ID were counted and the median
fluorescence intensity (MFI) was used as a measurement of antibody
binding to individual bead populations.
d) Results
[0535] The specificities of the polyclonal anti-PODXL antibody and
the monoclonal anti-PODXL antibodies 8F6, 13C10 and 17C9 were
tested in an assay using beads coupled with synthetic biotinylated
peptides. The polyclonal anti-PODXL antibody showed binding to 11
of the peptides, namely 2, 3, 4, 5, 7, 8, 9, 18, 22, 24 and 25,
corresponding to what can be regarded as six regions on the PrEST
sequence (see FIG. 12). The first region (SEQ ID NO:10) corresponds
to the overlap of peptides 2 and 3, the second region (SEQ ID
NO:11) corresponds to the overlap of peptides 4 and 5, the third
region (SEQ ID NO:12) corresponds to the overlap of peptides 7, 8,
and 9, the fourth region (SEQ ID NO:13) corresponds to the peptide
18, the fifth region (SEQ ID NO:14) corresponds to the peptide 22
and the sixth region (SEQ ID NO:15) corresponds to the overlap of
peptides 24 and 25. corresponding to five regions on the PrEST
sequence.
[0536] The monoclonal antibodies 8F6, and 13C10 overlapped in
specificity and both reacted with the peptide 22, corresponding to
one distinct region on the PrEST sequence, sequence SEQ ID NO: 14
The monoclonal antibody 17C9 reacted with two peptides: 24 and 25,
corresponding to one distinct region on the PrEST sequence,
consensus sequence SEQ ID NO: 15.
10) Fractionation of the Polyclonal Anti-PODXL Antibody
a) Materials and Methods
[0537] Peptide specific antibodies were obtained by affinity
purification of the polyclonal antibody against peptides to which
the anti-PODXL antibody was shown to bind in Examples, section 9.
Peptides 3, 7, 18, 22 and 24, corresponding to SEQ ID NO: 16, 17,
13, 14, and 18, respectively, were chosen, and 600 nmol of each
biotinylated peptide were diluted with HiTrap.TM. Streptavidin
binding buffer to a final volume of 1100 .mu.l and applied to 1 ml
HiTrap.TM. Streptavidin HP columns (GE Healthcare Bio-Sciences AB,
Uppsala, Sweden) for binding. After coupling, columns were washed
with HiTrap.TM. Streptavidin binding buffer to remove unbound
peptides (and a blank run was performed on all columns prior to
sample loading.)
[0538] Serum obtained from a New Zeeland white rabbit immunized
with the recombinant PODXL fragment SEQ ID NO: 1 fused to a
His.sub.6-ABP tag, was purified on a AKTAxpress.TM. (GE Healthcare)
liquid chromatography system on eight columns in a serial mode as
follows: two 5 ml His.sub.6-ABP columns followed by 5 epitope
specific peptide columns and at the end a His.sub.6-ABP-PODXL
fusion protein column. After sample loading, the columns were
washed and eluted in parallel to obtain separate antibody
fractions. The eluted antibody fractions were epitope mapped using
Bioplex, as described above.
b) Results
[0539] When fractions were epitope mapped, all fractionated
antibodies bound their expected peptide. The fractions that bound
peptides 7, 18, 22 and 24 were confirmed to bind the PODXL protein
(SEQ ID NO:2 or SEQ ID NO:3) by IHC analysis. The fractions that
bound peptides 3, 7, 22, and 24 were confirmed to bind the PODXL
protein (SEQ ID NO:2 or SEQ ID NO:3) by Western Blot analysis.
12) Evaluation of Antibodies for IHC-Analysis of Colorectal Cancer
Samples
a) Material and Methods
[0540] Tissue sections from Dukes stage C colorectal cancer
samples, as well as samples from normal kidney (where PODXL is
known to be expressed in glomeruli) were chosen for evaluation of
six different primary antibodies. The antibodies evaluated were the
mouse monoclonal anti-PODXL antibodies 8F6 (SEQ ID NO:14) and 17C9
(SEQ ID NO:15), a rabbit polyclonal anti-PODXL antibody from
GeneTex, (catalogue no: GTX104764, obtained by using a peptide
sequence within SEQ ID NO:19 as immunogen), a goat polyclonal
anti-PODXL antibody from Abnova (catalogue no: PAB7292, obtained by
using the peptide sequence SEQ ID NO:20 as immunogen), the
polyclonal anti-PODXL antibody obtained as described in Section 2
above, and the fraction of the polyclonal anti-PODXL antibody
binding peptide 24 (SEQ ID NO:18, obtained as described in Section
10 above). Automated immunohistochemistry was performed as
previously described (Kampf C et al (2004) Clin. Proteomics
1:285-300). In brief, the glass slides were incubated for 45 min in
60.degree. C., de-paraffinized in xylene (2.times.5 min+1.times.1
min) and hydrated in graded alcohols. During hydration, endogenous
peroxidase was blocked with H.sub.2O.sub.2 (Merck). For antigen
retrieval, slides were immersed in Citrate buffer pH 6 (PT Module
Buffer 1, 100.times.-citrate buffer pH=6, Thermo Fisher Scientific)
and boiled for 4 min at 125.degree. C. in a Decloaking Chamber.RTM.
(Biocare Medical). Slides were placed in the Lab Vision Autostainer
480.RTM. (Thermo Fisher Scientific) and incubated for 30 min at
room temperature with the primary antibody. For goat and mouse
primaries, slides were then incubated for 20-30 min at room
temperature with either rabbit anti-goat secondary antibody
(Rockland) for goat primaries, or Primary Antibody Enhancer (Thermo
Fisher Scientific) for mouse primaries. All slides were then
incubated with HRP Polymer (UltraVision LP detection system, Thermo
Fisher Scientific).RTM. for 30 min at room temp for all antibodies.
Between all steps, slides were rinsed in wash buffer (ThermoFisher
Scientific). Finally, diaminobenzidine (Thermo Fisher Scientific)
was used as chromogen and Mayer's hematoxylin (Histolab) was used
for counterstaining. The slides were mounted with Pertex.RTM.
(Histolab).
All images of immunohistochemically stained tissue were manually
evaluated under the microscope.
b) Results
[0541] The staining patterns were ranked by two independent experts
in the field in a blind set-up for each of the tissue samples
stained. The antibodies/stainings were ranked based on how distinct
the staining was, and they were assigned a score from 1 to 6 with
the most distinct staining pattern corresponding to the highest
score. Thus, the least distinct staining pattern corresponded to a
score of 1. A total score was then obtained for each tissue type
(colorectal cancer and normal kidney) by adding the scores from the
two independent experts for each of the antibodies. An overall
score was then obtained for each of the antibodies by adding the
total scores from each tissue type (see the Table). The monoclonal
antibody 8F6 received the highest overall score, followed by the
polyclonal anti-PODXL antibody, demonstrating that antibodies
binding to SEQ ID NO:14 are superior for use in IHC compared to the
other antibodies in the experiment, among those, antibodies binding
to SEQ ID NO:15.
TABLE-US-00001 TABLE Score 1 Score 2 Antibody Kidney CRC Overall
score 8F6 12 10 22 17C9 6 5 11 GTX104764 2 2 4 PAB7292 4 7 11
anti-PODXL 9 11 20 Fraction binding 9 7 16 peptide 24
13) In Vitro Binding of Antibodies to the Surface of Living
Cells
a) Materials and Methods
[0542] The binding the polyclonal antibody, obtained as described
in section 2, to cultured colon cancer cells in vitro was
determined by LigandTracer Green
[0543] (Rigeview Instruments AB, Uppsala, Sweden) measurements. The
cell line used in the experiments was the colon cancer cell line
CACO-2. Cells were grown in complete media supplemented with 20%
fetal calf serum (Sigma, Germany), L-glutamine (2 mM) and PEST
(penicillin 100 IU/ml, and streptomycin 100 .mu.g/ml). The antibody
was labeled with an amine-reactive TexasRed dye, and circular cell
dishes with a large amount of CACO-2 cells were used in the assay.
The TexasRed labeling procedure was performed as follows: The
smallest amount of TexasRed that could be transferred from the
stock vial was dissolved in 100 .mu.l DMSO. A volume of 20 .mu.l
TexasRed solution was then mixed with 100 .mu.l borate buffer pH9,
approximately 20 .mu.g antibody, and incubated for 60 minutes in
room temperature. Free dye molecules were removed using a NAP-5
column.
[0544] The LigandTracer Green assay comprised one circular cell
dish with CACO-2 seeded in a local portion of the cell dish.
Labeled antibody was added, typically in the nM concentration range
in two or more steps. The resulting binding traces shows if binding
has taken place or not. TexasRed-labeled human serum albumin (HSA)
(labeled with a much higher number of dye molecules per HSA) was
used as negative control, and as positive control, the commersially
available anti-PODXL antibody 3D3 (Santa Cruz Biotechnology,
catalogue no: sc-23904) was used.
[0545] To confirm the results from the LigandTracer assay, manual
binding studies were conducted in multi-well cell-culture dishes.
Antibodies were radiolabeled with .sup.125I using the chloramine-T
method. Briefly, .sup.125I was added to 40 .mu.g of antibody in PBS
and 10 .mu.l chloramine-T (2 mg/ml in PBS, Sigma, USA) was added.
After 60 s incubation the reaction was stopped by adding 25 .mu.l
sodium metabisulphite (2 mg/ml in PBS, Sigma, USA). Labeled
antibody was separated from low molecular weight compunds using a
NAP-5 column (cut-off 5 kDa, Amersham Biosciences, Uppsala, Sweden)
equilibrated with PBS. Radiolabeled antibody was added to cells,
sometimes supplemented with a high concentration of unlabeled
antibody, and was then incubated for at least 4 hours. After
incubation, the cells were washed quickly 4 times, released by
trypsination, counted (# cells/ml) and quantified for radioactivity
(Bq/ml) in a Wallac 1480 Wizard gamma counter (Turku, Finland). As
positive control, the commersially available anti-PODXL antibody
3D3 (Santa Cruz Biotechnology, catalogue no: sc-23904) was used,
and as negative control, a monoclonal IgG2a antibody against
Troponin was used.
b) Results
[0546] The polyclonal anti-PODXL antibody was shown to bind to
living colon cancer cells in vitro (FIG. 11). A concentration
depentent binding of anti-PODXL to CACO-2 cells can be seen, with
an increased binding, reflected by a clear increase in signal
intensity, when exposing the cells to an increased concentration of
anti-PODXL antibody. The manual binding studies confirmed the
results from the LigandTracer assay using positive and negative
controls (results not shown).
[0547] Establishment of a Prognosis for a Colon Cancer Patient
14) A Non-Limiting Example
[0548] A cancer patient can present with symptoms or signs from
tumor growth, focal symptoms including pain and distress from the
region where the tumor grows or more general symptoms such as
weight loss and fatigue. Signs from growth of a colorectal tumor
can also become evident through blood in feces and/or dysfunction,
e.g. diarrhea/constipation.
[0549] The description below refers to the case where the
colorectal cancer is located in the sigmoid colon.
[0550] Following the establishment of a sigmoid colon cancer
diagnosis in a patient, a tumor tissue sample is obtained. The
tumor tissue sample may be obtained from a biopsy performed earlier
during the diagnosis of the cancer or from a specimen from an
earlier surgical removal of the tumor. Further, for the provision
of a "negative reference", a sample is taken from archival material
comprising tissue having low, or essentially lacking, PODXL protein
expression. Such archival tissue may for example be sigmoid colon
tumor tissue having a pre-established low PODXL protein expression
level. Further, for the provision of a "positive reference", a
sample is taken from archival material comprising tissue having
high PODXL protein expression, such as sigmoid colon tumor tissue
having a pre-established high PODXL protein expression level.
[0551] The sample material is fixated in buffered formalin and
histo-processed in order to obtain thin sections (4 .mu.m) of the
of the sample material.
[0552] Immunohistochemistry is performed as described in Examples,
Section 3. One or more sample sections from each sample is/are
mounted on glass slides that are incubated for 45 min in 60.degree.
C., de-paraffinized (if the sample in question was paraffinized) in
xylene (2.times.15 min) and hydrated in graded alcohols. For
antigen retrieval, slides are immersed in TRS (Target Retrieval
Solution, pH 6.0, DakoCytomation) and boiled for 4 min at
125.degree. C. in a Decloaking Chamber.RTM. (Biocare Medical).
Slides are placed in the Autostainer.RTM. (DakoCytomation) and
endogenous peroxidase is initially blocked with H.sub.2O.sub.2
(DakoCytomation). The reason for mounting multiple sample sections
is to increase the accuracy of the results.
[0553] A primary PODXL protein specific antibody is added to the
slides and incubated for 30 min in room temperature, followed by 30
min of incubation in room temperature with a labeled secondary
antibody; e.g. goat-anti-rabbit peroxidase conjugated
Envision.RTM.. The primary antibody may for example be produced as
described in Examples, section 2 above. To detect the secondary
antibody, diaminobenzidine (DakoCytomation) is used as chromogen,
contrasted with a Harris hematoxylin (Sigma-Aldrich)
counterstaining. Between all steps, slides are rinsed in wash
buffer (DakoCytomation). The slides are then mounted with
Pertex.RTM. (Histolab) mounting media.
[0554] As a tool to validate the staining procedure, two control
cell-lines may be used; e.g. one slide with cells expressing PODXL
protein (positive cell line) and one slide having cells with
indistinct weak or no PODXL protein expression (negative cell
line). The skilled artisan understands how to provide such cell
lines, for example guided by the disclosure of Rhodes et al. (2006)
The biomedical scientist, p 515-520. The control-line slides may be
simultaneously stained in the same procedure as the colorectal
cancer slides, i.e. incubated with the same primary and secondary
antibodies.
[0555] For example, the sigmoid colon tumor slides, the staining
reference slides, and optionally, the slides with control
cell-lines, may be scanned in a light microscope using a ScanScope
T2 automated slide scanning system (Aperio Technologies) at
.times.20 magnification. However, this scanning step is not
necessary, but may make the procedure easier if, for example, the
preparation and staining of the slides and the evaluation of the
stained slides (see below) are performed at different locations or
by different persons.
[0556] If control cell-lines are used, these are inspected to
validate the staining procedure. If the cell-lines display staining
results outside acceptable criteria, e.g. staining artifacts
recognized by the skilled artisan, the staining of the biopsy
samples is considered invalid and the whole staining procedure is
repeated with new slides. If the positive and negative cell-lines
display strong staining intensity and indistinct weak or no
staining intensity, respectively, the staining is considered as
valid.
[0557] The stained sample slide(s) from the tumor tissue is/are
evaluated manually by visual inspection in accordance to standards
used in clinical histopathological diagnostics, and the
immunoreactivity of the colorectal cancer slide(s) is/are graded as
described in Examples, Section 3.
[0558] That is, the cytoplasmic intensity (CI) and the cytoplasmic
fraction (CF) are examined.
[0559] In the determination of the CI and CF, the person performing
the evaluation and grading is aided by visual inspection of the
stained reference slides, i.e. the "positive reference" and the
"negative reference".
[0560] Each sample is then assigned a sample value on the scale
0-3, wherein:
[0561] "0" represents an absent CI and a CF of <1%;
[0562] "1" represents a weak CI and a CF of >1%;
[0563] "2" represents a moderate or strong CI and a CF of 1-50%;
and
[0564] "3" represents moderate or strong CI and a CF of
>50%.
[0565] The sample value(s) is/are then compared to a reference
value.
[0566] The reference value may be "0" or "1", preferably "1".
[0567] If the sample value(s) or a sample value average is/are
equal to or lower than the reference value "1", it is concluded
that the subject belongs to a group having a relatively good
prognosis. FIGS. 2A and 2B show that the relatively good prognosis
may be an overall five-year survival of about 60% (FIG. 2A, solid
line) or a disease free five-year survival of about 69% (FIG. 2B,
solid line).
[0568] If however the sample value(s) or a sample value average
is/are higher than the reference value "1", it is concluded that
the subject belongs to a group having a relatively poor prognosis.
FIGS. 2A and 2B show that the relatively poor prognosis may be an
overall five-year survival of about 34% (FIG. 2A, dashed line) or a
disease free five-year survival of about 38% (FIG. 2B, dashed
line).
[0569] Further, a primary COX-2 protein specific antibody (e.g.
Zymed, clone 18-7379) may be added to slides from the same samples
according to the staining and evaluation protocol outlined
above.
[0570] Each sample stained with the anti-COX-2 antibody is then
given a sample value selected from "high" and "low", wherein:
[0571] "high" represents a CF of 10% and a strong CI; and
[0572] "low" represents a CF of <10% and/or an absent, weak or
moderate cytoplasmic intensity.
[0573] Here, the implicit reference value is "low".
[0574] If the COX-2 sample value(s) or a COX-2 sample value average
is/are "low", it is concluded that the subject belongs to a
subgroup having a relatively good prognosis.
[0575] If however the COX-2 sample value(s) or a COX-2 sample value
average is/are "high", it is concluded that the subject belongs to
a subgroup having a relatively good prognosis.
[0576] The prognosis based on the PODXL status may thus be detailed
by also looking at the COX-2 status.
[0577] FIGS. 4A and 4B show that if the subject that has the lower
PODXL sample value(s) is COX-2 low, the probability of five-year
overall survival and disease free survival may be about 62% (FIG.
4A) and about 70% (FIG. 4B), respectively. However, if the subject
that has the lower PODXL sample value(s) is COX-2 high, the
probability of five-year overall survival and disease free survival
may be about 50% (FIG. 4A) and about 63% (FIG. 4B),
respectively.
[0578] Further, FIG. 4 shows that if the subject that has the
higher PODXL sample value(s) is COX-2 low, the probability of
five-year overall survival and disease free survival may be about
44% (FIG. 4A) and about 49% (FIG. 4B), respectively. However, if
the subject that has the higher PODXL sample value(s) is COX-2
high, the probability of five-year overall survival and disease
free survival may be about 21% (FIG. 4A) and about 28% (FIG. 4B),
respectively.
[0579] The prognosis may then form a basis for further decisions
relating to the treatment, or non-treatment, of the patient. For
example, if the patient is shown to belong to the group having
relatively high PODXL values and thus a relatively poor prognosis,
particulairy in combination with a high COX-2 expression level, the
decision may be to apply a "more aggressive chemotherapy tretment"
than what otherwise would have been considered.
[0580] Alternatively, the prognosis may form basis for further
decisions relating to the treatment, or non-treatment, of the
patient. For example, if the patient is shown to belong to the
group having relatively high PODXL values and thus a relatively
poor prognosis, the decision may be to apply immunotherapy using an
anti-PODXL antibody.
[0581] All cited material, including but not limited to
publications, DNA or protein data entries, and patents, referred to
in this application are herein incorporated by reference.
[0582] The invention being thus described, it will be obvious that
the same may be varied in many ways. Such variations are not to be
regarded as a departure from the spirit and scope of the present
invention, and all such modifications as would be obvious to one
skilled in the art are intended to be included within the scope of
the following claims.
Sequence CWU 1
1
201138PRTHomo sapiens 1Leu Pro Glu Thr Met Ser Ser Ser Pro Thr Ala
Ala Ser Thr Thr His 1 5 10 15 Arg Tyr Pro Lys Thr Pro Ser Pro Thr
Val Ala His Glu Ser Asn Trp 20 25 30 Ala Lys Cys Glu Asp Leu Glu
Thr Gln Thr Gln Ser Glu Lys Gln Leu 35 40 45 Val Leu Asn Leu Thr
Gly Asn Thr Leu Cys Ala Gly Gly Ala Ser Asp 50 55 60 Glu Lys Leu
Ile Ser Leu Ile Cys Arg Ala Val Lys Ala Thr Phe Asn 65 70 75 80 Pro
Ala Gln Asp Lys Cys Gly Ile Arg Leu Ala Ser Val Pro Gly Ser 85 90
95 Gln Thr Val Val Val Lys Glu Ile Thr Ile His Thr Lys Leu Pro Ala
100 105 110 Lys Asp Val Tyr Glu Arg Leu Lys Asp Lys Trp Asp Glu Leu
Lys Glu 115 120 125 Ala Gly Val Ser Asp Met Lys Leu Gly Asp 130 135
2526PRTHomo sapiens 2Met Arg Cys Ala Leu Ala Leu Ser Ala Leu Leu
Leu Leu Leu Ser Thr 1 5 10 15 Pro Pro Leu Leu Pro Ser Ser Pro Ser
Pro Ser Pro Ser Pro Ser Gln 20 25 30 Asn Ala Thr Gln Thr Thr Thr
Asp Ser Ser Asn Lys Thr Ala Pro Thr 35 40 45 Pro Ala Ser Ser Val
Thr Ile Met Ala Thr Asp Thr Ala Gln Gln Ser 50 55 60 Thr Val Pro
Thr Ser Lys Ala Asn Glu Ile Leu Ala Ser Val Lys Ala 65 70 75 80 Thr
Thr Leu Gly Val Ser Ser Asp Ser Pro Gly Thr Thr Thr Leu Ala 85 90
95 Gln Gln Val Ser Gly Pro Val Asn Thr Thr Val Ala Arg Gly Gly Gly
100 105 110 Ser Gly Asn Pro Thr Thr Thr Ile Glu Ser Pro Lys Ser Thr
Lys Ser 115 120 125 Ala Asp Thr Thr Thr Val Ala Thr Ser Thr Ala Thr
Ala Lys Pro Asn 130 135 140 Thr Thr Ser Ser Gln Asn Gly Ala Glu Asp
Thr Thr Asn Ser Gly Gly 145 150 155 160 Lys Ser Ser His Ser Val Thr
Thr Asp Leu Thr Ser Thr Lys Ala Glu 165 170 175 His Leu Thr Thr Pro
His Pro Thr Ser Pro Leu Ser Pro Arg Gln Pro 180 185 190 Thr Ser Thr
His Pro Val Ala Thr Pro Thr Ser Ser Gly His Asp His 195 200 205 Leu
Met Lys Ile Ser Ser Ser Ser Ser Thr Val Ala Ile Pro Gly Tyr 210 215
220 Thr Phe Thr Ser Pro Gly Met Thr Thr Thr Leu Pro Ser Ser Val Ile
225 230 235 240 Ser Gln Arg Thr Gln Gln Thr Ser Ser Gln Met Pro Ala
Ser Ser Thr 245 250 255 Ala Pro Ser Ser Gln Glu Thr Val Gln Pro Thr
Ser Pro Ala Thr Ala 260 265 270 Leu Arg Thr Pro Thr Leu Pro Glu Thr
Met Ser Ser Ser Pro Thr Ala 275 280 285 Ala Ser Thr Thr His Arg Tyr
Pro Lys Thr Pro Ser Pro Thr Val Ala 290 295 300 His Glu Ser Asn Trp
Ala Lys Cys Glu Asp Leu Glu Thr Gln Thr Gln 305 310 315 320 Ser Glu
Lys Gln Leu Val Leu Asn Leu Thr Gly Asn Thr Leu Cys Ala 325 330 335
Gly Gly Ala Ser Asp Glu Lys Leu Ile Ser Leu Ile Cys Arg Ala Val 340
345 350 Lys Ala Thr Phe Asn Pro Ala Gln Asp Lys Cys Gly Ile Arg Leu
Ala 355 360 365 Ser Val Pro Gly Ser Gln Thr Val Val Val Lys Glu Ile
Thr Ile His 370 375 380 Thr Lys Leu Pro Ala Lys Asp Val Tyr Glu Arg
Leu Lys Asp Lys Trp 385 390 395 400 Asp Glu Leu Lys Glu Ala Gly Val
Ser Asp Met Lys Leu Gly Asp Gln 405 410 415 Gly Pro Pro Glu Glu Ala
Glu Asp Arg Phe Ser Met Pro Leu Ile Ile 420 425 430 Thr Ile Val Cys
Met Ala Ser Phe Leu Leu Leu Val Ala Ala Leu Tyr 435 440 445 Gly Cys
Cys His Gln Arg Leu Ser Gln Arg Lys Asp Gln Gln Arg Leu 450 455 460
Thr Glu Glu Leu Gln Thr Val Glu Asn Gly Tyr His Asp Asn Pro Thr 465
470 475 480 Leu Glu Val Met Glu Thr Ser Ser Glu Met Gln Glu Lys Lys
Val Val 485 490 495 Ser Leu Asn Gly Glu Leu Gly Asp Ser Trp Ile Val
Pro Leu Asp Asn 500 505 510 Leu Thr Lys Asp Asp Leu Asp Glu Glu Glu
Asp Thr His Leu 515 520 525 3558PRTHomo sapiens 3Met Arg Cys Ala
Leu Ala Leu Ser Ala Leu Leu Leu Leu Leu Ser Thr 1 5 10 15 Pro Pro
Leu Leu Pro Ser Ser Pro Ser Pro Ser Pro Ser Pro Ser Gln 20 25 30
Asn Ala Thr Gln Thr Thr Thr Asp Ser Ser Asn Lys Thr Ala Pro Thr 35
40 45 Pro Ala Ser Ser Val Thr Ile Met Ala Thr Asp Thr Ala Gln Gln
Ser 50 55 60 Thr Val Pro Thr Ser Lys Ala Asn Glu Ile Leu Ala Ser
Val Lys Ala 65 70 75 80 Thr Thr Leu Gly Val Ser Ser Asp Ser Pro Gly
Thr Thr Thr Leu Ala 85 90 95 Gln Gln Val Ser Gly Pro Val Asn Thr
Thr Val Ala Arg Gly Gly Gly 100 105 110 Ser Gly Asn Pro Thr Thr Thr
Ile Glu Ser Pro Lys Ser Thr Lys Ser 115 120 125 Ala Asp Thr Thr Thr
Val Ala Thr Ser Thr Ala Thr Ala Lys Pro Asn 130 135 140 Thr Thr Ser
Ser Gln Asn Gly Ala Glu Asp Thr Thr Asn Ser Gly Gly 145 150 155 160
Lys Ser Ser His Ser Val Thr Thr Asp Leu Thr Ser Thr Lys Ala Glu 165
170 175 His Leu Thr Thr Pro His Pro Thr Ser Pro Leu Ser Pro Arg Gln
Pro 180 185 190 Thr Ser Thr His Pro Val Ala Thr Pro Thr Ser Ser Gly
His Asp His 195 200 205 Leu Met Lys Ile Ser Ser Ser Ser Ser Thr Val
Ala Ile Pro Gly Tyr 210 215 220 Thr Phe Thr Ser Pro Gly Met Thr Thr
Thr Leu Leu Glu Thr Val Phe 225 230 235 240 His His Val Ser Gln Ala
Gly Leu Glu Leu Leu Thr Ser Gly Asp Leu 245 250 255 Pro Thr Leu Ala
Ser Gln Ser Ala Gly Ile Thr Ala Ser Ser Val Ile 260 265 270 Ser Gln
Arg Thr Gln Gln Thr Ser Ser Gln Met Pro Ala Ser Ser Thr 275 280 285
Ala Pro Ser Ser Gln Glu Thr Val Gln Pro Thr Ser Pro Ala Thr Ala 290
295 300 Leu Arg Thr Pro Thr Leu Pro Glu Thr Met Ser Ser Ser Pro Thr
Ala 305 310 315 320 Ala Ser Thr Thr His Arg Tyr Pro Lys Thr Pro Ser
Pro Thr Val Ala 325 330 335 His Glu Ser Asn Trp Ala Lys Cys Glu Asp
Leu Glu Thr Gln Thr Gln 340 345 350 Ser Glu Lys Gln Leu Val Leu Asn
Leu Thr Gly Asn Thr Leu Cys Ala 355 360 365 Gly Gly Ala Ser Asp Glu
Lys Leu Ile Ser Leu Ile Cys Arg Ala Val 370 375 380 Lys Ala Thr Phe
Asn Pro Ala Gln Asp Lys Cys Gly Ile Arg Leu Ala 385 390 395 400 Ser
Val Pro Gly Ser Gln Thr Val Val Val Lys Glu Ile Thr Ile His 405 410
415 Thr Lys Leu Pro Ala Lys Asp Val Tyr Glu Arg Leu Lys Asp Lys Trp
420 425 430 Asp Glu Leu Lys Glu Ala Gly Val Ser Asp Met Lys Leu Gly
Asp Gln 435 440 445 Gly Pro Pro Glu Glu Ala Glu Asp Arg Phe Ser Met
Pro Leu Ile Ile 450 455 460 Thr Ile Val Cys Met Ala Ser Phe Leu Leu
Leu Val Ala Ala Leu Tyr 465 470 475 480 Gly Cys Cys His Gln Arg Leu
Ser Gln Arg Lys Asp Gln Gln Arg Leu 485 490 495 Thr Glu Glu Leu Gln
Thr Val Glu Asn Gly Tyr His Asp Asn Pro Thr 500 505 510 Leu Glu Val
Met Glu Thr Ser Ser Glu Met Gln Glu Lys Lys Val Val 515 520 525 Ser
Leu Asn Gly Glu Leu Gly Asp Ser Trp Ile Val Pro Leu Asp Asn 530 535
540 Leu Thr Lys Asp Asp Leu Asp Glu Glu Glu Asp Thr His Leu 545 550
555 41581DNAHomo sapiens 4atgcgctgcg cgctggcgct ctcggcgctg
ctgctactgt tgtcaacgcc gccgctgctg 60ccgtcgtcgc cgtcgccgtc gccgtcgccc
tcccagaatg caacccagac tactacggac 120tcatctaaca aaacagcacc
gactccagca tccagtgtca ccatcatggc tacagataca 180gcccagcaga
gcacagtccc cacttccaag gccaacgaaa tcttggcctc ggtcaaggcg
240accacccttg gtgtatccag tgactcaccg gggactacaa ccctggctca
gcaagtctca 300ggcccagtca acactaccgt ggctagagga ggcggctcag
gcaaccctac taccaccatc 360gagagcccca agagcacaaa aagtgcagac
accactacag ttgcaacctc cacagccaca 420gctaaaccta acaccacaag
cagccagaat ggagcagaag atacaacaaa ctctgggggg 480aaaagcagcc
acagtgtgac cacagacctc acatccacta aggcagaaca tctgacgacc
540cctcacccta caagtccact tagcccccga caacccactt cgacgcatcc
tgtggccacc 600ccaacaagct cgggacatga ccatcttatg aaaatttcaa
gcagttcaag cactgtggct 660atccctggct acaccttcac aagcccgggg
atgaccacca ccctaccgtc atcggttatc 720tcgcaaagaa ctcaacagac
ctccagtcag atgccagcca gctctacggc cccttcctcc 780caggagacag
tgcagcccac gagcccggca acggcattga gaacacctac cctgccagag
840accatgagct ccagccccac agcagcatca actacccacc gataccccaa
aacaccttct 900cccactgtgg ctcatgagag taactgggca aagtgtgagg
atcttgagac acagacacag 960agtgagaagc agctcgtcct gaacctcaca
ggaaacaccc tctgtgcagg gggcgcttcg 1020gatgagaaat tgatctcact
gatatgccga gcagtcaaag ccaccttcaa cccggcccaa 1080gataagtgcg
gcatacggct ggcatctgtt ccaggaagtc agaccgtggt cgtcaaagaa
1140atcactattc acactaagct ccctgccaag gatgtgtacg agcggctgaa
ggacaaatgg 1200gatgaactaa aggaggcagg ggtcagtgac atgaagctag
gggaccaggg gccaccggag 1260gaggccgagg accgcttcag catgcccctc
atcatcacca tcgtctgcat ggcatcattc 1320ctgctcctcg tggcggccct
ctatggctgc tgccaccagc gcctctccca gaggaaggac 1380cagcagcggc
taacagagga gctgcagaca gtggagaatg gttaccatga caacccaaca
1440ctggaagtga tggagacctc ttctgagatg caggagaaga aggtggtcag
cctcaacggg 1500gagctggggg acagctggat cgtccctctg gacaacctga
ccaaggacga cctggatgag 1560gaggaagaca cacacctcta g 158151677DNAHomo
sapiens 5atgcgctgcg cgctggcgct ctcggcgctg ctgctactgt tgtcaacgcc
gccgctgctg 60ccgtcgtcgc cgtcgccgtc gccgtcgccc tcccagaatg caacccagac
tactacggac 120tcatctaaca aaacagcacc gactccagca tccagtgtca
ccatcatggc tacagataca 180gcccagcaga gcacagtccc cacttccaag
gccaacgaaa tcttggcctc ggtcaaggcg 240accacccttg gtgtatccag
tgactcaccg gggactacaa ccctggctca gcaagtctca 300ggcccagtca
acactaccgt ggctagagga ggcggctcag gcaaccctac taccaccatc
360gagagcccca agagcacaaa aagtgcagac accactacag ttgcaacctc
cacagccaca 420gctaaaccta acaccacaag cagccagaat ggagcagaag
atacaacaaa ctctgggggg 480aaaagcagcc acagtgtgac cacagacctc
acatccacta aggcagaaca tctgacgacc 540cctcacccta caagtccact
tagcccccga caacccactt cgacgcatcc tgtggccacc 600ccaacaagct
cgggacatga ccatcttatg aaaatttcaa gcagttcaag cactgtggct
660atccctggct acaccttcac aagcccgggg atgaccacca ccctactaga
gacagtgttt 720caccatgtca gccaggctgg tcttgaactc ctgacctcgg
gtgatctgcc caccttggcc 780tcccaaagtg ctgggattac agcgtcatcg
gttatctcgc aaagaactca acagacctcc 840agtcagatgc cagccagctc
tacggcccct tcctcccagg agacagtgca gcccacgagc 900ccggcaacgg
cattgagaac acctaccctg ccagagacca tgagctccag ccccacagca
960gcatcaacta cccaccgata ccccaaaaca ccttctccca ctgtggctca
tgagagtaac 1020tgggcaaagt gtgaggatct tgagacacag acacagagtg
agaagcagct cgtcctgaac 1080ctcacaggaa acaccctctg tgcagggggc
gcttcggatg agaaattgat ctcactgata 1140tgccgagcag tcaaagccac
cttcaacccg gcccaagata agtgcggcat acggctggca 1200tctgttccag
gaagtcagac cgtggtcgtc aaagaaatca ctattcacac taagctccct
1260gccaaggatg tgtacgagcg gctgaaggac aaatgggatg aactaaagga
ggcaggggtc 1320agtgacatga agctagggga ccaggggcca ccggaggagg
ccgaggaccg cttcagcatg 1380cccctcatca tcaccatcgt ctgcatggca
tcattcctgc tcctcgtggc ggccctctat 1440ggctgctgcc accagcgcct
ctcccagagg aaggaccagc agcggctaac agaggagctg 1500cagacagtgg
agaatggtta ccatgacaac ccaacactgg aagtgatgga gacctcttct
1560gagatgcagg agaagaaggt ggtcagcctc aacggggagc tgggggacag
ctggatcgtc 1620cctctggaca acctgaccaa ggacgacctg gatgaggagg
aagacacaca cctctag 16776407PRTHomo sapiens 6Ser Pro Ser Pro Ser Pro
Ser Pro Ser Gln Asn Ala Thr Gln Thr Thr 1 5 10 15 Thr Asp Ser Ser
Asn Lys Thr Ala Pro Thr Pro Ala Ser Ser Val Thr 20 25 30 Ile Met
Ala Thr Asp Thr Ala Gln Gln Ser Thr Val Pro Thr Ser Lys 35 40 45
Ala Asn Glu Ile Leu Ala Ser Val Lys Ala Thr Thr Leu Gly Val Ser 50
55 60 Ser Asp Ser Pro Gly Thr Thr Thr Leu Ala Gln Gln Val Ser Gly
Pro 65 70 75 80 Val Asn Thr Thr Val Ala Arg Gly Gly Gly Ser Gly Asn
Pro Thr Thr 85 90 95 Thr Ile Glu Ser Pro Lys Ser Thr Lys Ser Ala
Asp Thr Thr Thr Val 100 105 110 Ala Thr Ser Thr Ala Thr Ala Lys Pro
Asn Thr Thr Ser Ser Gln Asn 115 120 125 Gly Ala Glu Asp Thr Thr Asn
Ser Gly Gly Lys Ser Ser His Ser Val 130 135 140 Thr Thr Asp Leu Thr
Ser Thr Lys Ala Glu His Leu Thr Thr Pro His 145 150 155 160 Pro Thr
Ser Pro Leu Ser Pro Arg Gln Pro Thr Ser Thr His Pro Val 165 170 175
Ala Thr Pro Thr Ser Ser Gly His Asp His Leu Met Lys Ile Ser Ser 180
185 190 Ser Ser Ser Thr Val Ala Ile Pro Gly Tyr Thr Phe Thr Ser Pro
Gly 195 200 205 Met Thr Thr Thr Leu Pro Ser Ser Val Ile Ser Gln Arg
Thr Gln Gln 210 215 220 Thr Ser Ser Gln Met Pro Ala Ser Ser Thr Ala
Pro Ser Ser Gln Glu 225 230 235 240 Thr Val Gln Pro Thr Ser Pro Ala
Thr Ala Leu Arg Thr Pro Thr Leu 245 250 255 Pro Glu Thr Met Ser Ser
Ser Pro Thr Ala Ala Ser Thr Thr His Arg 260 265 270 Tyr Pro Lys Thr
Pro Ser Pro Thr Val Ala His Glu Ser Asn Trp Ala 275 280 285 Lys Cys
Glu Asp Leu Glu Thr Gln Thr Gln Ser Glu Lys Gln Leu Val 290 295 300
Leu Asn Leu Thr Gly Asn Thr Leu Cys Ala Gly Gly Ala Ser Asp Glu 305
310 315 320 Lys Leu Ile Ser Leu Ile Cys Arg Ala Val Lys Ala Thr Phe
Asn Pro 325 330 335 Ala Gln Asp Lys Cys Gly Ile Arg Leu Ala Ser Val
Pro Gly Ser Gln 340 345 350 Thr Val Val Val Lys Glu Ile Thr Ile His
Thr Lys Leu Pro Ala Lys 355 360 365 Asp Val Tyr Glu Arg Leu Lys Asp
Lys Trp Asp Glu Leu Lys Glu Ala 370 375 380 Gly Val Ser Asp Met Lys
Leu Gly Asp Gln Gly Pro Pro Glu Glu Ala 385 390 395 400 Glu Asp Arg
Phe Ser Met Pro 405 7439PRTHomo sapiens 7Ser Pro Ser Pro Ser Pro
Ser Pro Ser Gln Asn Ala Thr Gln Thr Thr 1 5 10 15 Thr Asp Ser Ser
Asn Lys Thr Ala Pro Thr Pro Ala Ser Ser Val Thr 20 25 30 Ile Met
Ala Thr Asp Thr Ala Gln Gln Ser Thr Val Pro Thr Ser Lys 35 40 45
Ala Asn Glu Ile Leu Ala Ser Val Lys Ala Thr Thr Leu Gly Val Ser 50
55 60 Ser Asp Ser Pro Gly Thr Thr Thr Leu Ala Gln Gln Val Ser Gly
Pro 65 70 75 80 Val Asn Thr Thr Val Ala Arg Gly Gly Gly Ser Gly Asn
Pro Thr Thr 85 90 95 Thr Ile Glu Ser Pro Lys Ser Thr Lys Ser Ala
Asp Thr Thr Thr Val 100 105 110 Ala Thr Ser Thr Ala Thr Ala Lys Pro
Asn Thr Thr Ser Ser Gln Asn 115 120 125 Gly Ala Glu Asp Thr Thr Asn
Ser Gly Gly Lys Ser Ser His Ser Val 130 135 140 Thr Thr Asp Leu Thr
Ser Thr Lys Ala Glu His Leu Thr
Thr Pro His 145 150 155 160 Pro Thr Ser Pro Leu Ser Pro Arg Gln Pro
Thr Ser Thr His Pro Val 165 170 175 Ala Thr Pro Thr Ser Ser Gly His
Asp His Leu Met Lys Ile Ser Ser 180 185 190 Ser Ser Ser Thr Val Ala
Ile Pro Gly Tyr Thr Phe Thr Ser Pro Gly 195 200 205 Met Thr Thr Thr
Leu Leu Glu Thr Val Phe His His Val Ser Gln Ala 210 215 220 Gly Leu
Glu Leu Leu Thr Ser Gly Asp Leu Pro Thr Leu Ala Ser Gln 225 230 235
240 Ser Ala Gly Ile Thr Ala Ser Ser Val Ile Ser Gln Arg Thr Gln Gln
245 250 255 Thr Ser Ser Gln Met Pro Ala Ser Ser Thr Ala Pro Ser Ser
Gln Glu 260 265 270 Thr Val Gln Pro Thr Ser Pro Ala Thr Ala Leu Arg
Thr Pro Thr Leu 275 280 285 Pro Glu Thr Met Ser Ser Ser Pro Thr Ala
Ala Ser Thr Thr His Arg 290 295 300 Tyr Pro Lys Thr Pro Ser Pro Thr
Val Ala His Glu Ser Asn Trp Ala 305 310 315 320 Lys Cys Glu Asp Leu
Glu Thr Gln Thr Gln Ser Glu Lys Gln Leu Val 325 330 335 Leu Asn Leu
Thr Gly Asn Thr Leu Cys Ala Gly Gly Ala Ser Asp Glu 340 345 350 Lys
Leu Ile Ser Leu Ile Cys Arg Ala Val Lys Ala Thr Phe Asn Pro 355 360
365 Ala Gln Asp Lys Cys Gly Ile Arg Leu Ala Ser Val Pro Gly Ser Gln
370 375 380 Thr Val Val Val Lys Glu Ile Thr Ile His Thr Lys Leu Pro
Ala Lys 385 390 395 400 Asp Val Tyr Glu Arg Leu Lys Asp Lys Trp Asp
Glu Leu Lys Glu Ala 405 410 415 Gly Val Ser Asp Met Lys Leu Gly Asp
Gln Gly Pro Pro Glu Glu Ala 420 425 430 Glu Asp Arg Phe Ser Met Pro
435 818DNAHomo sapiens 8ctgccagaga ccatgagc 18920DNAHomo sapiens
9gtcccctagc ttcatgtcac 201010PRTHomo sapiens 10Ala Ala Ser Thr Thr
His Arg Tyr Pro Lys 1 5 10 1110PRTHomo sapiens 11Thr Pro Ser Pro
Thr Val Ala His Glu Ser 1 5 10 125PRTHomo sapiens 12Gln Thr Gln Ser
Glu 1 5 1315PRTHomo sapiens 13Cys Gly Ile Arg Leu Ala Ser Val Pro
Gly Ser Gln Thr Val Val 1 5 10 15 1415PRTHomo sapiens 14Ile His Thr
Lys Leu Pro Ala Lys Asp Val Tyr Glu Arg Leu Lys 1 5 10 15
1515PRTHomo sapiens 15Asp Lys Trp Asp Glu Leu Lys Glu Ala Gly Val
Ser Asp Met Lys 1 5 10 15 1615PRTHomo sapiens 16Ala Ala Ser Thr Thr
His Arg Tyr Pro Lys Thr Pro Ser Pro Thr 1 5 10 15 1715PRTHomo
sapiens 17Asn Trp Ala Lys Cys Glu Asp Leu Glu Thr Gln Thr Gln Ser
Glu 1 5 10 15 1815PRTHomo sapiens 18Tyr Glu Arg Leu Lys Asp Lys Trp
Asp Glu Leu Lys Glu Ala Gly 1 5 10 15 1955PRTHomo sapiens 19Lys Glu
Ala Gly Val Ser Asp Met Lys Leu Gly Asp Gln Gly Pro Pro 1 5 10 15
Glu Glu Ala Glu Asp Arg Phe Ser Met Pro Leu Ile Ile Thr Ile Val 20
25 30 Cys Met Ala Ser Phe Leu Leu Leu Val Ala Ala Leu Tyr Gly Cys
Cys 35 40 45 His Gln Arg Leu Ser Gln Arg 50 55 2015PRTHomo sapiens
20Asp Asn Leu Thr Lys Asp Asp Leu Asp Glu Glu Glu Asp Thr His 1 5
10 15
* * * * *
References