U.S. patent application number 14/550461 was filed with the patent office on 2015-10-29 for methods for the economical production of biofuel from biomass.
The applicant listed for this patent is GEVO, INC.. Invention is credited to Aristos A. Aristidou, Thomas Buelter, William A. Evanko, David A. Glassner, Patrick R. Gruber, Andrew C. Hawkins, Marco Landwehr, Peter Meinhold, Matthew W. Peters, James L. Wade.
Application Number | 20150307904 14/550461 |
Document ID | / |
Family ID | 40524580 |
Filed Date | 2015-10-29 |
United States Patent
Application |
20150307904 |
Kind Code |
A1 |
Hawkins; Andrew C. ; et
al. |
October 29, 2015 |
Methods for the Economical Production of Biofuel from Biomass
Abstract
Methods for producing a biofuel are provided. Also provided are
biocatalysts that convert a feedstock to a biofuel.
Inventors: |
Hawkins; Andrew C.; (Parker,
CO) ; Glassner; David A.; (Littleton, CO) ;
Buelter; Thomas; (Santa Monica, CA) ; Wade; James
L.; (San Diego, CA) ; Meinhold; Peter;
(Topanga, CA) ; Peters; Matthew W.; (Highlands
Ranch, CO) ; Gruber; Patrick R.; (Longmont, CO)
; Evanko; William A.; (Golden, CO) ; Aristidou;
Aristos A.; (Maple Grove, MN) ; Landwehr; Marco;
(Magdeburg, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GEVO, INC. |
ENGLEWOOD |
CO |
US |
|
|
Family ID: |
40524580 |
Appl. No.: |
14/550461 |
Filed: |
November 21, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13859903 |
Apr 10, 2013 |
8895272 |
|
|
14550461 |
|
|
|
|
12263436 |
Oct 31, 2008 |
8431374 |
|
|
13859903 |
|
|
|
|
60984235 |
Oct 31, 2007 |
|
|
|
60984521 |
Nov 1, 2007 |
|
|
|
60984793 |
Nov 2, 2007 |
|
|
|
60985155 |
Nov 2, 2007 |
|
|
|
60985209 |
Nov 3, 2007 |
|
|
|
60985460 |
Nov 5, 2007 |
|
|
|
60985607 |
Nov 5, 2007 |
|
|
|
60986151 |
Nov 7, 2007 |
|
|
|
60986235 |
Nov 7, 2007 |
|
|
|
60987984 |
Nov 14, 2007 |
|
|
|
60988588 |
Nov 16, 2007 |
|
|
|
60989032 |
Nov 19, 2007 |
|
|
|
60989785 |
Nov 21, 2007 |
|
|
|
61014297 |
Dec 17, 2007 |
|
|
|
61029222 |
Feb 15, 2008 |
|
|
|
Current U.S.
Class: |
435/160 ;
435/157 |
Current CPC
Class: |
C07K 14/245 20130101;
C10L 2200/0469 20130101; C12P 7/16 20130101; C12P 7/24 20130101;
C12N 9/2417 20130101; Y02P 30/20 20151101; C12Y 302/01001 20130101;
C12N 9/0006 20130101; C10G 2300/1014 20130101; C12N 9/2414
20130101; C10G 1/04 20130101; C10L 2290/26 20130101; C12Y 302/01003
20130101; C12N 9/2434 20130101; C12P 7/04 20130101; Y02E 50/16
20130101; C10G 2300/4025 20130101; C10L 1/02 20130101; C12Y
106/01002 20130101; C12N 9/2428 20130101; C12P 7/62 20130101; Y02E
50/10 20130101; C12N 9/0036 20130101 |
International
Class: |
C12P 7/16 20060101
C12P007/16; C12P 7/04 20060101 C12P007/04; C10L 1/02 20060101
C10L001/02 |
Claims
1. A method of making a biofuel, comprising: providing a
biocatalyst selected to convert a feedstock into the biofuel at a
yield of at least 80 percent of theoretical, a productivity of at
least 0.75 grams biofuel per liter per hour, and a titer equivalent
to a lower one of (i) a solubility limit of the biofuel in water
under the process conditions and (ii) 2% (w/w) of the biofuel in
water; providing the biocatalyst selected to have at least two
properties from a. to l. as follows: a. the biocatalyst selected to
convert at least two sugars, including each of (i) at least one of
a six-carbon sugar and a six-carbon sugar oligomer, and (ii) at
least one five-carbon sugar, derived from at least one of starch,
cellulose, hemicellulose, and pectin into the biofuel; b. the
biocatalyst exhibiting a level of endotoxin toxicity or exotoxin
toxicity, wherein the level of endotoxin or exotoxin toxicity in
the biocatalyst has a median lethal dose (LD50) of at least
1000-fold more than the amount present in 1 kilogram of at least
one of a DDG and a DDGS product; c. the biocatalyst containing no
DNA markers; d. the biocatalyst operable to produce the biofuel
free of byproducts that would require additional processing steps
for removal from the biofuel; e. the biocatalyst operable at a pH
value between about 2 to 10 to produce the biofuel; f. the
biocatalyst selected to have a recoverable productivity from a
sudden change of about 1 pH unit from the first pH; g. the
biocatalyst operable within a temperature range of about 20.degree.
C. to 60.degree. C. to produce the biofuel; h. the biocatalyst
selected to have a recoverable productivity from a sudden change of
about 5.degree. C. from the first temperature; i. the biocatalyst
operable in a medium comprising feedstock; j. the biocatalyst
selected to have a growth rate of at least 0.2 per hour; k.
providing a facultative anaerobic biocatalyst operable at dissolved
oxygen concentrations across a range of about 0% to about 0.01% air
saturation to produce the biofuel; and l. providing an anaerobic
biocatalyst selected to have a productivity that recovers from an
exposure to more than 1% air saturation that lasts for up to three
hours; and cultivating the biocatalyst in a culture medium until a
recoverable quantity of the biofuel is produced; and recovering the
biofuel.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Utility
application Ser. No. 13/859,903 filed Apr. 10, 2013, which is a
continuation of U.S. Utility application Ser. No. 12/263,436 filed
Oct. 31, 2008, now U.S. Pat. No. 8,431,374, which claims the
benefit of U.S. Provisional Application Ser. No. 60/984,235 filed
Oct. 31, 2007; U.S. Provisional Application Ser. No. 60/984,521
filed Nov. 1, 2007; U.S. Provisional Application Ser. No.
60/984,793 filed Nov. 2, 2007; U.S. Provisional Application Ser.
No. 60/985,155 filed Nov. 2, 2007; U.S. Provisional Application
Ser. No. 60/985,209 filed Nov. 3, 2007; U.S. Provisional
Application Ser. No. 60/985,460 filed Nov. 5, 2007; U.S.
Provisional Application Ser. No. 60/985,607 filed Nov. 5, 2007;
U.S. Provisional Application Ser. No. 60/986,151 filed Nov. 7,
2007; U.S. Provisional Application Ser. No. 60/986,235 filed Nov.
7, 2007; U.S. Provisional Application Ser. No. 60/987,984 filed
Nov. 14, 2007; U.S. Provisional Application Ser. No. 60/988,588
filed Nov. 16, 2007; U.S. Provisional Application Ser. No.
60/989,032 filed Nov. 19, 2007; U.S. Provisional Application Ser.
No. 60/989,785 filed Nov. 21, 2007; U.S. Provisional Application
Ser. No. 61/014,297 filed Dec. 17, 2007; and U.S. Provisional
Application Ser. No. 61/029,222 filed Feb. 15, 2008. This
application is also related to the U.S. patent application entitled
"Methods for the Economical Production of Biofuel Precursors that
is also a Biofuel from Biomass" with U.S. Utility application Ser.
No. 12/263,442 filed Oct. 31, 2008. Accordingly, this application
incorporates by reference in its entirety all subject matter of the
above-referenced applications to the extent such subject matter is
not inconsistent herewith.
TECHNICAL FIELD
[0002] The disclosure relates generally to methods and compositions
for producing biofuels.
DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY
[0003] The contents of the text file submitted electronically
herewith are incorporated herein by reference in their entirety: A
computer readable format copy of the Sequence Listing (filename:
GEVO.sub.--017.sub.--29US_SeqList.txt, date recorded: Nov. 20,
2014, file size 61 kilobytes).
BACKGROUND
[0004] Biofuels have a long history ranging back to the beginning
on the 20th century. As early as 1900, Rudolf Diesel demonstrated
at the World Exhibition in Paris, France, an engine running on
peanut oil. Soon thereafter, Henry Ford demonstrated his Model T
running on ethanol derived from corn. Petroleum-derived fuels
displaced biofuels in the 1930s and 1940s due to increased supply
and efficiency at a lower cost.
[0005] Market fluctuations in the 1970s, due the Arab oil embargo
and the Iranian revolution, coupled to the decrease in U.S. oil
production led to an increase in crude oil prices and a renewed
interest in biofuels. Today, many interest groups, including policy
makers, industry planners, aware citizens, and the financial
community, are interested in substituting petroleum-derived fuels
with biomass-derived biofuels. The leading motivation for
developing biofuels is of economical nature, namely, the threat of
`peak oil`, the point at which the consumption rate of crude oil
exceeds the supply rate, thus leading to significantly increased
fuel cost, and resulting in an increased demand for alternative
fuels.
[0006] Biofuels tend to be produced with local agricultural
resources in many, relatively small facilities, and are seen as a
stable and secure supply of fuels independent of geopolitical
problems associated with petroleum. At the same time, biofuels
enhance the agricultural sector of national economies. In addition,
environmental concerns relating to the possibility of carbon
dioxide related climate change is an important social and ethical
driving force which is starting to result in government regulations
and policies such as caps on carbon dioxide emissions from
automobiles, taxes on carbon dioxide emissions, and tax incentives
for the use of biofuels.
[0007] The acceptance of biofuels depends primarily on economical
competitiveness of biofuels when compared to petroleum-derived
fuels. As long as biofuels cannot compete in cost with
petroleum-derived fuels, use of biofuels will be limited to
specialty applications and niche markets. Today, the use of
biofuels is limited to ethanol and biodiesel. Currently, ethanol is
made by fermentation from corn in the US and from sugar cane in
Brazil and is competitive with petroleum-derived gasoline,
exclusive of subsidies or tax benefits, if crude oil costs above
$50 USD per barrel and $40 USD per barrel, respectively. Biodiesel
has a breakeven price of crude oil of over $60 USD/barrel to be
competitive with petroleum-based diesel (Nexant Chem Systems. 2006.
Final Report, Liquid Biofuels: Substituting for Petroleum, White
Plains, N.Y.).
SUMMARY
[0008] In an embodiment, there is provided a method of making a
biofuel, comprising providing a biocatalyst selected to convert a
feedstock into the biofuel at a yield of at least 80 percent
theoretical yield, a productivity of at least 0.75 grams biofuel
per liter per hour, and a titer equivalent to a lower one of (i) a
solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water, providing the
biocatalyst selected to have at least two properties from a. to l.
as follows: a. the biocatalyst selected to convert at least two
sugars, including each of (i) at least one of a six-carbon sugar
and a six-carbon sugar oligomer, and (ii) at least one five-carbon
sugar, derived from at least one of starch, cellulose,
hemicellulose, and pectin into the biofuel; b. the biocatalyst
exhibiting a level of endotoxin toxicity or exotoxin toxicity,
wherein the level of endotoxin or exotoxin toxicity in the
biocatalyst has a median lethal dose (LD50) of at least 1000-fold
more than the amount present in 1 kilogram of at least one of a DDG
and a DDGS product; c. the biocatalyst containing no DNA markers;
d. the biocatalyst operable to produce the biofuel free of
byproducts that would require additional processing steps for
removal from the biofuel; e. the biocatalyst operable at a pH value
between about 2 to about 7 to produce the biofuel; f. the
biocatalyst selected to have a recoverable productivity from a
sudden change of about 1 pH unit from the first pH, the
fermentation having a second pH that lasts for up to three hours
before returning to the first pH; g. the biocatalyst operable
within a temperature range of about 30.degree. C. to about
60.degree. C. to produce the biofuel; h. the biocatalyst selected
to have a recoverable productivity from a sudden change of about
10.degree. C. from the first temperature, the fermentation having a
second temperature that lasts for up to three hours before
returning to the first temperature; i. the biocatalyst operable in
a medium where mineral salts composed of major and minor
bioelements and vitamins are provided in addition to the feedstock;
j. the biocatalyst selected to have a growth rate of at least 0.2
per hour; k. one attribute chosen from (1) providing an anaerobic
biocatalyst operable at dissolved oxygen concentrations across a
range of about 0% to about 0.01% to produce the biofuel, and (2)
providing a facultative anaerobic biocatalyst modified to inhibit
aerobic respiration with dissolved oxygen present, the biocatalyst
operable with the dissolved oxygen present; and l. providing an
anaerobic biocatalyst selected to have a productivity that fully
recovers from an exposure to more than 1% air saturation that lasts
for up to three hours; and cultivating the biocatalyst in a culture
medium until a recoverable quantity of the biofuel is produced; and
recovering the biofuel.
[0009] In another embodiment, there is provided a method of making
a biofuel, comprising providing a biocatalyst selected to convert a
feedstock into the biofuel at a yield of at least 80 percent
theoretical yield, a productivity of at least 0.75 grams biofuel
per gram cell dry weight, and a titer equivalent to a lower one of
(i) a solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water; providing the
biocatalyst selected to convert at least two sugars, including each
of (i) at least one of a six-carbon sugar and a six-carbon sugar
oligomer, and (ii) at least one five-carbon sugar, derived from at
least one of starch, cellulose, hemicellulose, and pectin into the
biofuel; providing the biocatalyst exhibiting a level of endotoxin
toxicity or exotoxin toxicity, wherein the level of endotoxin or
exotoxin toxicity in the biocatalyst has a median lethal dose
(LD50) of at least 1000-fold more than the amount present in 1
kilogram of at least one of a DDG and a DDGS product; providing the
biocatalyst that contains no DNA markers; and providing the
biocatalyst operable to produce the biofuel free of byproducts that
would require additional processing steps for removal from the
biofuel; providing the biocatalyst operable at a pH value between
about 2 to about 7 to produce the biofuel; providing the
biocatalyst selected to have a recoverable productivity from a
sudden change of about 1 pH unit from the first pH, the
fermentation having a second pH that lasts for up to three hours
before returning to the first pH; providing the biocatalyst
operable within a temperature range of about 30.degree. C. to about
60.degree. C. to produce the biofuel; providing the biocatalyst
selected to have a recoverable productivity from a sudden change of
about 10.degree. C. from the first temperature, the fermentation
having a second temperature that lasts for up to three hours before
returning to the first temperature; providing the biocatalyst
operable in a medium where mineral salts composed of major and
minor bioelements and vitamins are provided in addition to the
feedstock; providing the biocatalyst selected to have a growth rate
of at least 0.2 per hour; providing the biocatalyst selected to
have one attribute chosen from: a. providing an anaerobic
biocatalyst operable at dissolved oxygen concentrations across a
range of about 0% to about 0.01% to produce the biofuel, and
wherein the anaerobic biocatalyst has a productivity that fully
recovers from an exposure to more than 1% air saturation that lasts
for up to three hours; and b. providing a facultative anaerobic
biocatalyst modified to inhibit aerobic respiration with dissolved
oxygen present, the biocatalyst operable with the dissolved oxygen
present; cultivating the biocatalyst in a culture medium until a
recoverable quantity of the biofuel is produced; and recovering the
biofuel.
[0010] In still another embodiment, there is provided a method of
making a biofuel, comprising providing a biocatalyst selected to
convert a feedstock into the biofuel at a yield of at least 80
percent theoretical yield, a productivity of at least 0.75 grams
biofuel per liter per hour, and a titer equivalent to a lower one
of (i) a solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water; providing the
biocatalyst operable to produce the biofuel free of byproducts that
would require additional processing steps for removal from the
biofuel; providing the biocatalyst operable at a pH value between
about 2 to about 7 to produce the biofuel; providing the
biocatalyst that has a growth rate of at least 0.2 per hour; and
providing the biocatalyst operable within a temperature range of
about 30.degree. C. to about 60.degree. C. to produce the biofuel;
providing the biocatalyst operable in a medium where mineral salts
composed of major and minor bioelements and vitamins are provided
in addition to the feedstock; cultivating the biocatalyst in a
culture medium until a recoverable quantity of the biofuel is
produced; and recovering the biofuel.
[0011] In yet another embodiment, there is provided a method of
making a biofuel, comprising providing a biocatalyst selected to
convert a feedstock into the biofuel at a yield of at least 80
percent theoretical yield, a productivity of at least 0.75 grams
biofuel per liter per hour, and a titer equivalent to a lower one
of (i) a solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water; and
cultivating the biocatalyst in a culture medium until a recoverable
quantity of the biofuel is produced; and recovering the
biofuel.
[0012] In another embodiment, methods of making a biofuel are
provided that include providing a biocatalyst selected to convert a
feedstock into the biofuel at a yield of at least 80 percent of
theoretical, a productivity of at least 0.75 grams biofuel per
liter per hour, and a titer equivalent to a lower one of (i) a
solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water. The methods
further include providing the biocatalyst selected to have at least
two properties from: a) the biocatalyst selected to convert at
least two sugars, including each of (i) at least one of a
six-carbon sugar and a six-carbon sugar oligomer, and (ii) at least
one five-carbon sugar, derived from at least one of starch,
cellulose, hemicellulose, and pectin into the biofuel; b) the
biocatalyst exhibiting a level of endotoxin toxicity or exotoxin
toxicity, wherein the level of endotoxin or exotoxin toxicity in
the biocatalyst has a median lethal dose (LD50) of at least
1000-fold more than the amount present in 1 kilogram of at least
one of a DDG and a DDGS product; c) the biocatalyst containing no
DNA markers; d) the biocatalyst operable to produce the biofuel
free of byproducts that would require additional processing steps
for removal from the biofuel; e) the biocatalyst operable at a pH
value between about 2 to about 7 to produce the biofuel; f) the
biocatalyst selected to have a recoverable productivity from a
sudden change of about 1 pH unit from the first pH; g) the
biocatalyst operable within a temperature range of about 30.degree.
C. to about 60.degree. C. to produce the biofuel; h) the
biocatalyst selected to have a recoverable productivity from a
sudden change of about 5=C from the first temperature; i) the
biocatalyst operable in a medium where mineral salts composed of
major and minor bioelements are provided in addition to the
feedstock; j) the biocatalyst selected to have a growth rate of at
least 0.2 per hour; k) one attribute chosen from (1) providing a
facultative anaerobic biocatalyst operable at dissolved oxygen
concentrations across a range of about 0% to about 0.01% to produce
the biofuel; and l) providing an anaerobic biocatalyst selected to
have a productivity that fully recovers from an exposure to more
than 1% air saturation that lasts for up to three hours. The
methods further include cultivating the biocatalyst in a culture
medium until a recoverable quantity of the biofuel is produced. The
methods optionally include recovering the biofuel.
[0013] In another embodiment, methods of making a biofuel are
provided that include providing a biocatalyst selected to convert a
feedstock into the biofuel at a yield of at least 80 percent
theoretical yield, a productivity of at least 0.75 grams biofuel
per gram cell dry weight, and a titer equivalent to a lower one of
(i) a solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water. The
biocatalyst is further selected to convert at least two sugars,
including each of (i) at least one of a six-carbon sugar and a
six-carbon sugar oligomer, and (ii) at least one five-carbon sugar,
derived from at least one of starch, cellulose, hemicellulose, and
pectin into the biofuel. The biocatalyst exhibits a level of
endotoxin toxicity or exotoxin toxicity having a median lethal dose
(LD50) of at least 1000-fold more than the amount present in 1
kilogram of at least one of a DDG and a DDGS product. The
biocatalyst contains no DNA markers and is operable to produce the
biofuel free of byproducts that require additional processing steps
for removal from the biofuel. The biocatalyst is operable at a pH
value between about 2 to about 7 and is selected to have a
recoverable productivity from a change of about 1 pH unit from the
first pH. The biocatalyst is operable within a temperature range of
about 30.degree. C. to about 60.degree. C. and is selected to have
a recoverable productivity from a change of about 5.degree. C. from
the first temperature. The biocatalyst is operable in a medium
where only mineral salts composed of major and minor bioelements
and are provided in addition to the feedstock and has a growth rate
of at least 0.2 per hour. The biocatalyst is further selected to
have one attribute chosen from: a) operable at dissolved oxygen
concentrations across a range of about 0% to about 0.01% to produce
the biofuel, or b) a productivity that fully recovers from an
exposure to more than 1% air saturation that lasts for up to three
hours. The methods further include cultivating the biocatalyst in a
culture medium until a recoverable quantity of the biofuel is
produced. The methods optionally include recovering the
biofuel.
[0014] In another embodiment, a method of making a biofuel is
provided. The method includes: providing a biocatalyst selected to
convert a feedstock into the biofuel at a yield of at least 80
percent of theoretical, a productivity of at least 0.75 grams
biofuel per liter per hour, and a titer equivalent to a lower one
of (i) a solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water; providing the
biocatalyst selected to have at least two properties from a. to l.
as follows: a. the biocatalyst selected to convert at least two
sugars, including each of (i) at least one of a six-carbon sugar
and a six-carbon sugar oligomer, and (ii) at least one five-carbon
sugar, derived from at least one of starch, cellulose,
hemicellulose, and pectin into the biofuel; b. the biocatalyst
exhibiting a level of endotoxin toxicity or exotoxin toxicity,
wherein the level of endotoxin or exotoxin toxicity in the
biocatalyst has a median lethal dose (LD50) of at least 1000-fold
more than the amount present in 1 kilogram of at least one of a DDG
and a DDGS product; c. the biocatalyst containing no DNA markers;
d. the biocatalyst operable to produce the biofuel free of
byproducts that would require additional processing steps for
removal from the biofuel; e. the biocatalyst operable at a pH value
between about 2 to 10 to produce the biofuel; f. the biocatalyst
selected to have a recoverable productivity from a sudden change of
about 1 pH unit from the first pH; g. the biocatalyst operable
within a temperature range of about 20.degree. C. to 60.degree. C.
to produce the biofuel; h. the biocatalyst selected to have a
recoverable productivity from a sudden change of about 5.degree. C.
from the first temperature; i. the biocatalyst operable in a medium
comprising feedstock; j. the biocatalyst selected to have a growth
rate of at least 0.2 per hour; k. providing a facultative anaerobic
biocatalyst operable at dissolved oxygen concentrations across a
range of about 0% to about 0.01% air saturation to produce the
biofuel; and l. providing an anaerobic biocatalyst selected to have
a productivity that recovers from an exposure to more than 1% air
saturation that lasts for up to three hours; and cultivating the
biocatalyst in a culture medium until a recoverable quantity of the
biofuel is produced; and optionally recovering the biofuel.
[0015] In another embodiment, a method of making a biofuel is
provided. The method includes: providing a biocatalyst selected to
convert a feedstock into the biofuel at a yield of at least 80
percent theoretical yield, a productivity of at least 0.75 grams
biofuel per liter per hour, and a titer equivalent to a lower one
of (i) a solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water; and
cultivating the biocatalyst in a culture medium until a recoverable
quantity of the biofuel is produced; and optionally recovering the
biofuel.
[0016] In another embodiment, a biofuel produced by any method set
forth in the present application is provided. In general, the
biofuel includes a 14C/12C ratio of 1:0 to about 0:11.
[0017] In another embodiment, a method of making a biofuel is
provided. The method includes: a) providing a feedstock comprising
a sugar selected from the group consisting of: i) a six-carbon
sugar; ii) a six-carbon sugar oligomer; iii) a five-carbon sugar;
and iv) any combination of i) through iii), wherein the sugar is
obtained from starch, cellulose, hemicellulose, or pectin: and b)
contacting the feedstock of a) with a biocatalyst that converts the
feedstock into a biofuel at: i) a yield of at least 68 percent
theoretical yield; ii) a productivity of at least 0.75 grams
biofuel per liter per hour change claims; and iii) a lower one of
(A) a solubility limit of the biofuel in water under the process
conditions and (B) 1.6% (w/v) of the biofuel in water; and c)
optionally recovering the biofuel.
[0018] In another embodiment, a method of making a biofuel is
provided. The method includes: a) providing a feedstock comprising
galactose obtained from starch, cellulose, hemicellulose, or
pectin; and b) contacting the feedstock of a) with a biocatalyst
that converts the feedstock into a biofuel at: i) a yield of at
least about 90 percent of the yield of the biocatalyst wherein the
feedstock comprises glucose: ii) a productivity of at least about
90 percent of the productivity of the biocatalyst wherein the
feedstock comprises glucose; and iii) a titer of at least about 90
percent of the titer of the biocatalyst wherein the feedstock
comprises glucose; and c) optionally recovering the biofuel.
[0019] In another embodiment, a method of making a biofuel is
provided, The method includes: a) providing a feedstock comprising
mannose obtained from starch, cellulose, hemicellulose, or pectin;
and b) contacting the feedstock of a) with a biocatalyst that
converts the feedstock into a biofuel at: i) a yield of at least
about 90 percent of the yield of the biocatalyst wherein the
feedstock comprises glucose; ii) a productivity of at least about
90 percent of the productivity of the biocatalyst wherein the
feedstock comprises glucose; and iii) a titer of at least about 90
percent of the titer of the biocatalyst wherein the feedstock
comprises glucose; and c) optionally recovering the biofuel.
[0020] In another embodiment, a method of making a biofuel is
provided. The method includes: a) providing a feedstock comprising
xylose obtained from starch, cellulose, hemicellulose, or pectin;
and b) contacting the feedstock of a) with a biocatalyst that
converts the feedstock into a biofuel at: i) a yield of at least
about 69 percent of the yield of the biocatalyst wherein the
feedstock comprises glucose: ii) a productivity of at least about
56 percent of the productivity of the biocatalyst wherein the
feedstock comprises glucose; and iii) a titer of at least about 59
percent of the titer of the biocatalyst wherein the feedstock
comprises glucose; and c) optionally recovering the biofuel.
[0021] In another embodiment, a method of making a biofuel is
provided. The method includes: a) providing a feedstock comprising
arabinose obtained from starch, cellulose, hemicellulose, or
pectin; and b) contacting the feedstock of a) with a biocatalyst
that converts the feedstock into a biofuel at: i) a yield of at
least about 56 percent of the yield of the biocatalyst wherein the
feedstock comprises glucose; ii) a productivity of at least about
70 percent of the productivity of the biocatalyst wherein the
feedstock comprises glucose; and iii) a titer of at least about 54
percent of the titer of the biocatalyst wherein the feedstock
comprises glucose; and c) optionally recovering the biofuel.
[0022] In another embodiment, a method of making a biofuel is
provided. The method includes: a) providing a feedstock comprising
lactose; and b) contacting the feedstock of a) with a biocatalyst
that converts the feedstock into a biofuel at: i) a productivity of
at least about 90 percent of the productivity of the biocatalyst
wherein the feedstock comprises glucose; and ii) a titer of at
least about 90 percent of the titer of the biocatalyst wherein the
feedstock comprises glucose; and c) optionally recovering the
biofuel.
[0023] In another embodiment, a method of making a biofuel is
provided. The method includes: a) providing a feedstock comprising
sucrose; and b) contacting the feedstock of a) with a biocatalyst
that converts the feedstock into a biofuel at: i) a productivity of
at least about 50 percent of the productivity of the biocatalyst
wherein the feedstock comprises glucose; and ii) a titer of at
least about 50 percent of the titer of the biocatalyst wherein the
feedstock comprises glucose; and c) optionally recovering the
biofuel.
[0024] In another embodiment, a method of making a biofuel
provided. The method includes: a) providing a feedstock comprising
a six carbon sugar obtained from starch, cellulose, hemicellulose,
or pectin; and b) contacting the feedstock of a) with a biocatalyst
that converts the feedstock into a biofuel at: i) a yield of at
least about 90 percent of the yield of the biocatalyst wherein the
feedstock comprises glucose; ii) a productivity of at least about
90 percent of the productivity of the biocatalyst wherein the
feedstock comprises glucose; and iii) a titer of at least about 90
percent of the titer of the biocatalyst wherein the feedstock
comprises glucose; and c) optionally recovering the biofuel.
[0025] In another embodiment, a method of making a biofuel is
provided. The method includes: a) providing a feedstock comprising
a five carbon sugar obtained from starch, cellulose, hemicellulose,
or pectin; and b) contacting the feedstock of a) with a biocatalyst
that converts the feedstock into a biofuel at: i) a yield of at
least about 55 percent of the yield of the biocatalyst wherein the
feedstock comprises glucose: ii) a productivity of at least about
55 percent of the productivity of the biocatalyst wherein the
feedstock comprises glucose; and iii) a titer of at least about 55
percent of the titer of the biocatalyst wherein the feedstock
comprises glucose; and c) optionally recovering the biofuel.
[0026] In another embodiment, a method of producing a biofuel is
provided. The method includes contacting a feedstock with a
biocatalyst, wherein the method produces a biofuel at a total titer
of greater than about 22 g/L.
[0027] In another embodiment, a method of producing a biofuel is
provided. The method includes contacting a feedstock with a
biocatalyst, wherein the method produces a biofuel at a yield of
greater than about 80 percent theoretical.
[0028] In another embodiment, a method of producing a biofuel is
provided. the method includes contacting a feedstock with a
biocatalyst, wherein the method produces a biofuel at a
productivity of greater than about 2 g biofuel per L per hour.
[0029] In another embodiment, an isolated or recombinant
biocatalyst is provided. The biocatalyst includes a recombinant
biochemical pathway to produce isobutanol from fermentation of a
suitable bio-mass, wherein the recombinant biochemical pathway
comprises elevated activity of: a) a KARI as compared to a parental
microorganism; and b) a ALS as compared to a parental
microorganism, wherein the biocatalyst produces recoverable amounts
of isobutanol.
[0030] In some implementations, the parental microorganism is
SA237.
[0031] In another embodiment, an isolated or recombinant
biocatalyst is provided. The biocatalyst includes a recombinant
biochemical pathway to produce isobutanol from fermentation of a
suitable bio-mass, wherein the recombinant biochemical pathway
comprises decreased activity of: a) a DHAD as compared to a
parental microorganism; and b) a kivd as compared to a parental
microorganism, wherein the biocatalyst produces recoverable amounts
of isobutanol.
[0032] In another embodiment, an isolated or recombinant
biocatalyst is provided. The biocatalyst includes a recombinant
biochemical pathway to produce isobutanol from fermentation of a
suitable bio-mass, wherein the recombinant biochemical pathway
comprises decreased activity of: a) DHAD as compared to a parental
microorganism; and increased activity of: b) ALS is broader as
compared to a parental microorganism; and c) KARI as compared to a
parental microorganism.
[0033] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of E. coli BW25113, and further
comprising a genotype of: .DELTA.ldhA-fnr::FRT, .DELTA.adhE::FRT,
.DELTA.frd::FRT, .DELTA.pta::FRT, pflB::FRT, .DELTA.mdh::FRT,
.DELTA.aceF::FRT F' (lacIq+), pSA55, pSA69, wherein the isolated or
recombinant biocatalyst produces isobutanol from a carbon source,
is provided. In some implementations the biocatalyst is GEVO1530,
pSA55, or pSA69.
[0034] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of E. coli B, and further
comprising a genotype of: .DELTA.adhE::FRT-kan-FRT,
attB::(Sp+lacIq+tetR+), pSA55, pGV1609), wherein the isolated or
recombinant biocatalyst produces a metabolite comprising isobutanol
from a carbon source, is provided. In some implementations the
biocatalyst is GEVO 1821.
[0035] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of (E. coli BW25113, and further
comprising a genotype of: .DELTA.ldhA-fnr::FRT, .DELTA.adhE::FRT,
.DELTA.frd::FRT, .DELTA.pta::FRT, pflB::FRT, F' (lacIq+), pGV1655,
pGV1698, wherein the isolated or recombinant biocatalyst produces
isobutanol from a carbon source, is provided. In some
implementations the biocatalyst is GEVO1780.
[0036] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of E. coli BW25113, and further
comprising a genotype of: .DELTA.ldhA-fnr::FRT, .DELTA.frd::FRT,
.DELTA.pta::FRT, F' (lacIq+),
.DELTA.adhE::[pLlacO1::kivd::ilvDco::FRT],
.DELTA.pflB::[pLlacO1::alsS::ilvCco::FRT].DELTA.sthA::[pLlacO1::pntA::pnt-
B::FRT]), wherein the isolated or recombinant biocatalyst produces
isobutanol from a carbon source, is provided. In some
implementations the biocatalyst is GEVO1886.
[0037] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of E. coli BW25113, and further
comprising a genotype of: .DELTA.ldhA-fnr::FRT, .DELTA.adhE::FRT,
.DELTA.frd::FRT, .DELTA.pta::FRT, pflB::FRT, F' (lacIq+),
.DELTA.ilvC::[PLlacO1::kivd::ilvDco::FRT], pGV1698, wherein the
isolated or recombinant biocatalyst produces isobutanol from a
carbon source, is provided. In some implementations the biocatalyst
is GEVO 1748, pGV1698.
[0038] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of E. coli BW25113, and further
comprising a genotype of: .DELTA.ldhA-fnr::FRT, .DELTA.frd::FRT,
.DELTA.pta::FRT, pflB::FRT, F' (lacIq+),
.DELTA.adhE::[PLlacO1::kivd::ilvDco::FRT], pGV1698, wherein the
isolated or recombinant biocatalyst produces isobutanol from a
carbon source, is provided. In some implementations the biocatalyst
is GEVO1749, pGV1698.
[0039] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of E. coli BW25113, and further
comprising a genotype of: .DELTA.ldhA-fnr::FRT, .DELTA.adhE::FRT,
.DELTA.frd::FRT, .DELTA.pflB::FRT, .DELTA.pta::FRT, F' (lacIq+),
.DELTA.ilvC::[PLlacO1::kivd::ilvDco::FRT], .DELTA.sthA::FRT,
pGV1698, wherein the isolated or recombinant biocatalyst produces
isobutanol from a carbon source, is provided. In some
implementations the biocatalyst is GEVO1844, pGV1698.
[0040] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of GEVO1748, and further
comprising a genotype of: pGV1745, pGV1698, wherein the isolated or
recombinant biocatalyst produces isobutanol from a carbon source,
is provided.
[0041] In some implementations, an isolated or recombinant
biocatalyst is GEVO1846.
[0042] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of E. coli BW25113, and further
comprising a genotype of: .DELTA.ldhA-fnr::FRT, .DELTA.frd::FRT,
.DELTA.pta::FRT, F (lacIq+),
.DELTA.adhE::[pLlacO1::kivd::ilvDco::FRT],
pflB::[pLlacO1::alsS::ilvCco::FRT], wherein the isolated or
recombinant biocatalyst produces isobutanol from a carbon source,
is provided. In some implementations the biocatalyst is
GEVO1859.
[0043] In another embodiment, an isolated or recombinant
biocatalyst including a genotype of E. coli BW25113, and further
comprising a genotype of: .DELTA.ldhA-fnr::FRT, .DELTA.frd::FRT,
.DELTA.pta::FRT, .DELTA.adhE::[pLlacO1::kivd::ilvDco::FRT],
.DELTA.pflB::[pLlacO1::alsS::ilvCco::FRT].DELTA.sthA::[pLlacO1::pntA::pnt-
B::FRT], wherein the isolated or recombinant biocatalyst produces
isobutanol from a carbon source, is provided. In some
implementations the biocatalyst is GEVO1948.
[0044] In various embodiments, a biofuel may be produced by any
biocatalyst provided herein. In general, the biocatalyst contacts a
feedstock under fermentation conditions suitable for producing a
biofuel. In some implementations, the biofuel is isobutanol.
[0045] In another embodiment, an isolated or recombinant nucleic
acid including pLlacO1::alsS::ilvC::ilvD, p15A, and Cm, is
provided. In some implementations, the nucleic acid is pGV1609.
[0046] In another embodiment, an isolated or recombinant nucleic
acid including pLlacO1:: kivd::ilvDco, pSC101, and Kan, is
provided. In some implementations the nucleic acid is pGV1655.
[0047] In another embodiment, an isolated or recombinant nucleic
acid including PLlacO1::alsS::ilvCco, ColE1, and Amp, is provided.
In some implementations the nucleic acid is pGV1698.
[0048] In another embodiment, an isolated or recombinant nucleic
acid including pLlacO1::pntAB, pSC101, and Kan, is provided. In
some implementations the nucleic acid is pGV1745.
[0049] In another embodiment, a biocatalyst selected to convert a
feedstock into the biofuel at a yield of at least 80 percent
theoretical yield, a productivity of at least 0.75 grams biofuel
per liter per hour, and a titer equivalent to a lower one of (i) a
solubility limit of the biofuel in water under the process
conditions and (ii) 2% (w/w) of the biofuel in water, is provided.
The biocatalyst selected to have the following properties: a. the
biocatalyst operable to produce the biofuel free of byproducts that
would require additional processing steps for removal from the
biofuel; and b. the biocatalyst selected to have a growth rate of
at least 0.2 per hour.
BRIEF DESCRIPTION OF THE DRAWINGS
[0050] The above and other features of the disclosure including
various details of construction and combinations of parts will now
be more particularly described with reference to the accompanying
drawings and pointed out in the claims. It will be understood that
the particular method and system embodying the disclosure is shown
by way of illustration only and not as a limitation of the
disclosure. The principles and features of this disclosure may be
employed in varied and numerous embodiments without departing from
the scope of the disclosure. Illustrative embodiments of the
invention are illustrated in the drawings, in which:
[0051] FIG. 1 illustrates a process of making a biofuel.
[0052] FIG. 2 illustrates an exemplary embodiment of making a
biofuel.
[0053] FIG. 3 illustrates an exemplary embodiment of making a
biofuel.
[0054] FIG. 4 illustrates an exemplary embodiment of making a
biofuel.
[0055] FIG. 5 illustrates an exemplary embodiment of making a
biofuel.
[0056] FIG. 6 illustrates the growth of an exemplary biocatalyst
under anaerobic shift conditions.
[0057] FIG. 7 illustrates biofuel production by an exemplary
biocatalyst under microaerobic conditions.
[0058] FIG. 8 illustrates the growth of exemplary biocatalysts
under anaerobic conditions.
[0059] FIG. 9 illustrates biofuel production by exemplary
biocatalysts under anaerobic conditions.
[0060] FIG. 10 illustrates the growth of an exemplary biocatalysts
under anaerobic conditions.
[0061] FIG. 11 illustrates biofuel production by exemplary
biocatalysts under microaerobic conditions.
[0062] FIG. 12 illustrates an exemplary pathway for producing a
biofuel.
[0063] FIG. 13 illustrates a map of an exemplary plasmid useful for
modifying a biocatalyst.
[0064] FIG. 14 illustrates a map of an exemplary plasmid useful for
modifying a biocatalyst.
[0065] FIG. 15 illustrates a map of an exemplary plasmid useful for
modifying a biocatalyst.
[0066] FIGS. 16A through 16C illustrate a nucleic acid sequence of
pGV1698 (SEQ ID NO: 28).
[0067] FIGS. 17A through 17B illustrate a nucleic acid sequence of
pGV1720 (SEQ ID NO: 29).
[0068] FIGS. 18A through 18D illustrate a nucleic acid sequence
pGV1745 (SEQ ID NO: 30).
[0069] FIG. 19 illustrates a map of an exemplary plasmid useful for
modifying a biocatalyst.
[0070] FIGS. 20A through 20B illustrate a nucleic acid sequence
pGV1655 (SEQ ID NO: 31).
[0071] FIG. 21 illustrates a map of an exemplary plasmid useful for
modifying a biocatalyst.
[0072] FIGS. 22A through 22B illustrate a nucleic acid sequence
pGV1609 (SEQ ID NO: 32).
[0073] FIG. 23 illustrates a map of an exemplary plasmid useful for
modifying a biocatalyst.
[0074] FIGS. 24A through 24B illustrate a nucleic acid sequence
pSA55 (SEQ ID NO: 33).
[0075] FIG. 25 illustrates a map of an exemplary plasmid useful for
modifying a biocatalyst.
[0076] FIGS. 26A through 26B illustrate a nucleic acid sequence
pSA69 (SEQ ID NO: 34).
DETAILED DESCRIPTION
[0077] As used herein and in the appended claims, the singular
forms "a," "and," and "the" include plural referents unless the
context dearly dictates otherwise. Thus, for example, reference to
"a polynucleotide" includes a plurality of such polynucleotides and
reference to "the microorganism" includes reference to one or more
microorganisms, and so forth.
[0078] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which this disclosure belongs.
Although methods and materials similar or equivalent to those
described herein can be used in the practice of the disclosed
methods and compositions, the exemplary methods, devices and
materials are described herein.
[0079] Any publications discussed above and throughout the text are
provided solely for their disclosure prior to the filing date of
the present application. Nothing herein is to be construed as an
admission that the inventors are not entitled to antedate such
disclosure by virtue of prior disclosure.
[0080] The term "biocatalyst" means a living system or cell of any
type that speeds up chemical reactions by lowering the activation
energy of the reaction and is neither consumed nor altered in the
process. Biocatalysts may include, but are not limited to,
microorganisms such as yeasts, fungi, bacteria, and archaea.
[0081] The biocatalyst herein disclosed can convert various carbon
sources into biofuels. The term "carbon source" generally refers to
a substance suitable to be used as a source of carbon for
prokaryotic or eukaryotic cell growth. Carbon sources include, but
are not limited to, biomass hydrolysates, starch, sucrose,
cellulose, hemicellulose, xylose, and lignin, as well as monomeric
components of these substrates. Carbon sources can comprise various
organic compounds in various forms, including, but not limited to
polymers, carbohydrates, acids, alcohols, aldehydes, ketones, amino
acids, peptides, etc. These include, for example, various
monosaccharides such as glucose, dextrose (D-glucose), maltose,
oligosaccharides, polysaccharides, saturated or unsaturated fatty
acids, succinate, lactate, acetate, ethanol, etc., or mixtures
thereof. Photosynthetic organisms can additionally produce a carbon
source as a product of photosynthesis. In some embodiments, carbon
sources may be selected from biomass hydrolysates and glucose.
[0082] The term "feedstock" is defined as a raw material or mixture
of raw materials supplied to a biocatalyst or fermentation process
from which other products can be made. For example, a carbon
source, such as biomass or the carbon compounds derived from
biomass, are a feedstock for a biocatalyst that produces a biofuel
in a fermentation process. However, a feedstock may contain
nutrients other than a carbon source.
[0083] The term "medium" refers to an aqueous solution that
minimally includes water and feedstock, but may include additional
components, such as mineral salts comprised of major and minor
bioelements, vitamins, and other components.
[0084] The term "fermentation" or "fermentation process" is defined
as a process in which a biocatalyst is cultivated in a culture
medium containing raw materials, such as feedstock and nutrients,
wherein the biocatalyst converts raw materials, such as a
feedstock, into products.
[0085] The term "major bioelements" refers to carbon, nitrogen,
phosphorus, sulfur, oxygen, hydrogen, sodium, potassium, magnesium,
calcium, iron, and chlorine.
[0086] The term "minor bioelements" refers to zinc, manganese,
selenium, cobalt, copper, nickel, vanadium, molybdenum, chromium,
and tungsten.
[0087] The term "traditional carbohydrates" refers to sugars and
starches generated from specialized plants, such as sugar cane,
corn, and wheat. Frequently, these specialized plants concentrate
sugars and starches in portions of the plant, such as grains, that
are harvested and processed to extract the sugars and starches.
Traditional carbohydrates may be used as food and also to a lesser
extent as renewable feedstocks for fermentation processes to
generate biofuels and chemicals.
[0088] The term "biomass" as used herein refers primarily to the
stems, leaves, and starch-containing portions of green plants, and
is mainly comprised of starch, lignin, cellulose, hemicellulose,
and/or pectin. Biomass can be decomposed by either chemical or
enzymatic treatment to the monomeric sugars and phenols of which it
is composed (Wyman, C. E. 2003 Biotechnological Progress
19:254-62). This resulting material, called biomass hydrolysate, is
neutralized and treated to remove trace amounts of organic material
that may adversely affect the biocatalyst, and is then used as a
feedstock for fermentations using a biocatalyst.
[0089] The term "starch" as used herein refers to a polymer of
glucose readily hydrolyzed by digestive enzymes. Starch is usually
concentrated in specialized portions of plants, such as potatoes,
corn kernels, rice grains, wheat grains, and sugar cane stems.
[0090] The term "lignin" as used herein refers to a polymer
material, mainly composed of linked phenolic monomeric compounds,
such as p-coumaryl alcohol, coniferyl alcohol, and sinapyl alcohol,
which forms the basis of structural rigidity in plants and is
frequently referred to as the woody portion of plants. Lignin is
also considered to be the non-carbohydrate portion of the cell wall
of plants.
[0091] The term "cellulose" as used herein refers is a long-chain
polymer polysaccharide carbohydrate of beta-glucose of formula
(C6H10O5)n, usually found in plant cell walls in combination with
lignin and any hemicellulose.
[0092] The term "hemicellulose" refers to a class of plant
cell-wall polysaccharides that can be any of several
heteropolymers. These include xylan, xyloglucan, arabinoxylan,
arabinogalactan, glucuronoxylan, glucomannan and galactomannan.
Monomeric components of hemicellulose include, but are not limited
to: D-galactose, L-galactose, D-mannose, L-rhamnose, L-fucose,
D-xylose, L-arabinose, and D-glucuronic acid. This class of
polysaccharides is found in almost all cell walls along with
cellulose. Hemicellulose is lower in weight than cellulose and
cannot be extracted by hot water or chelating agents, but can be
extracted by aqueous alkali. Polymeric chains of hemicellulose bind
pectin and cellulose in a network of cross-linked fibers forming
the cell walls of most plant cells.
[0093] The term "pectin" as used herein refers to a class of plant
cell-wall heterogeneous polysaccharides that can be extracted by
treatment with acids and chelating agents. Typically, 70-80% of
pectin is found as a linear chain of .alpha.-(1-4)-linked
D-galacturonic acid monomers. The smaller RG-I fraction of pectin
is comprised of alternating (1-4)-linked galacturonic acid and
(1-2)-linked L-rhamnose, with substantial arabinogalactan branching
emanating from the rhamnose residue. Other monosaccharides, such as
D-fucose, D-xylose, apiose, aceric acid, Kdo, Dha,
2-O-methyl-D-fucose, and 2-O-methyl-D-xylose, are found either in
the RG-II pectin fraction (<2%), or as minor constituents in the
RG-I fraction. Proportions of each of the monosaccharides in
relation to D-galacturonic acid vary depending on the individual
plant and its micro-environment, the species, and time during the
growth cycle. For the same reasons, the homogalacturonan and RG-I
fractions can differ widely in their content of methyl esters on
GalA residues, and the content of acetyl residue esters on the C-2
and C-3 positions of GalA and neutral sugars.
[0094] The term "cell dry weight" or "CDW" refers to the weight of
the biocatalyst after the water contained in the biocatalyst has
been removed using methods known to one skilled in the art. CDW is
reported in g/L. CDW may be calculated from optical density, when a
conversion factor is known. For example, a conversion factor of
0.25 g CDW/L per OD.sub.600 is used to calculate g CDW/L from
optical density for E. coli.
[0095] The term "biomass-derived inhibitor" refers to organic or
inorganic compounds derived from biomass during the pretreatment
process that impair a biocatalyst during a fermentation process.
Examples of biomass-derived inhibitors include, but are not limited
to: furfural, 5-hydroxymethylfurfural, 4-hydroxybenzaldehyde,
syringaldehyde, vanillin, catechol, coniferyl alcohol, furfuryl
alcohol, guaiacol, hydroquinone, methylcatechol, acetic acid, and
vanillyl alcohol.
[0096] The term "biofuel" refers to a fuel in which all carbon
contained within the fuel is derived from biomass and is
biochemically converted, at least in part, into a fuel by a
biocatalyst. A biofuel is further defined as a non-ethanol compound
which contains less than 0.5 oxygen atoms per carbon atom. A
biofuel is a fuel in its own right, but may be blended with
petroleum-derived fuels to generate a fuel. A biofuel may be used
as a replacement for petrochemically-derived gasoline, diesel fuel,
or jet fuel.
[0097] The term "biofuel precursor" refers to an organic molecule
in which all of the carbon contained within the molecule is derived
from biomass, and is biochemically converted from a feedstock into
the precursor. A biofuel precursor is not a biofuel in its own
right, e.g., it not configured for engine combustion, but may be
configured for conversion, either chemically or biochemically, into
a biofuel.
[0098] The term "log P" is defined as the logarithm of the
octanol:water partition coefficient, "P", of a compound.
[0099] The term "volumetric productivity" is defined as the amount
of product per volume of medium in a fermenter per unit of time. In
other words, the rate is the amount of product per unit of time,
e.g., g/hr, inasmuch as the volume of the fermenter may be fixed at
a chosen volume.
[0100] Units used can be reported as grams biofuel per liter per
hour.
[0101] The term "specific productivity" is defined as the rate of
formation of the product. To describe productivity as an inherent
parameter of the microorganism or biocatalyst and not of the
fermentation process, productivity is herein further defined as the
specific productivity in g product per g of cell dry weight (CDW)
per hour (g product g CDW.sup.-1 h.sup.-1).
[0102] The term "yield" is defined as the amount of product
obtained per unit weight of raw material and may be expressed as g
product/g substrate. Yield may be expressed as a percentage of the
theoretical yield. "Theoretical yield" is defined as the maximum
amount of product that can be generated per a given amount of
substrate as dictated by the stoichiometry of the metabolic pathway
used to make the product. For example, theoretical yield for one
typical conversion of glucose to butanol is 0.41 g/g. As such, a
yield of butanol from glucose of 0.39 g/g would be expressed as 95%
of theoretical or 95% theoretical yield.
[0103] The term "titer" is defined as the strength of a solution or
the concentration of a substance in solution. For example, the
titer of a biofuel in a fermentation broth is described as g of
biofuel in solution per liter of fermentation broth. The term
"titre" is used interchangeably throughout with the term
"titer".
[0104] The term "tolerance" is defined as the ability of the
biocatalyst to maintain its specific productivity at a given
concentration of an inhibitor. The term "tolerant" describes a
biocatalyst that maintains its specific productivity at a given
concentration of an inhibitor. For example, if in the presence of
2% of an inhibitor a biocatalyst maintains the specific
productivity that it had at 0 to 2%, the biocatalyst is tolerant to
2% of the inhibitor or has a tolerance to 2% of the inhibitor.
[0105] The term "rate of inhibition" is defined as the rate of
decrease of the specific productivity of a biocatalyst relative to
the increased concentration of an inhibitor, at inhibitor levels
above the inhibitory concentration.
[0106] The term "resistance" is defined as the property of a
biocatalyst to have a low rate of inhibition in the presence of
increasing concentrations of an inhibitor in the fermentation
broth. The term "more resistant" describes a biocatalyst that has a
lower rate of inhibition towards an inhibitor than another
biocatalyst with a higher rate of inhibition towards the same
inhibitor. For example, two biocatalysts A and B, both with a
tolerance of 2% to an inhibitor biofuel and a specific productivity
of 1 g product g CDW.sup.-1 h.sup.-1, exhibit at 3% biofuel a
specific productivity of 0.5 g product g CDW.sup.-1 h.sup.-1 and
0.75 g product g CDW.sup.-1 h.sup.-1 for A and B, respectively. The
biocatalyst B is more resistant than A.
[0107] A "facultative anaerobic organism" or a "facultative
anaerobic microorganism" or a "facultative anaerobic biocatalyst"
is defined as an organism that can grow in either the presence or
in the absence of oxygen.
[0108] A "strictly anaerobic organism" or a "strictly anaerobic
microorganism" or a "strictly anaerobic biocatalyst" is defined as
an organism that cannot grow in the presence of oxygen and which
does not survive exposure to any concentration of oxygen.
[0109] An "anaerobic organism" or an "anaerobic microorganism" or
an "anaerobic biocatalyst" is defined as an organism that cannot
grow in the presence of oxygen. "Aerobic conditions" are defined as
conditions under which the oxygen concentration in the fermentation
medium is sufficiently high for a aerobic or facultative anaerobic
microorganism to use as a terminal electron acceptor.
[0110] In contrast, "Anaerobic conditions" are defined as
conditions under which the oxygen concentration in the fermentation
medium is too low for the microorganism to use as a terminal
electron acceptor. Anaerobic conditions may be achieved by sparging
a fermentation medium with an inert gas such as nitrogen until
oxygen is no longer available to the microorganism as a terminal
electron acceptor. Alternatively, anaerobic conditions may be
achieved by the microorganism respiring the available oxygen of the
fermentation until oxygen is unavailable to the microorganism as a
terminal electron acceptor.
[0111] The term "byproduct" means an undesired product related to
the production of biofuel. Byproducts are generally disposed as
waste, adding cost to a process.
[0112] The term "co-product" means a secondary or incidental
product related to the production of biofuel. Co-products have
potential commercial value that increases the overall value of
biofuel production, and may be the deciding factor as to the
viability of a particular biofuel production process.
[0113] The term "distillers dried grains", abbreviated herein as
DDG, refers to the solids remaining after a fermentation, usually
consisting of unconsumed feedstock solids, remaining nutrients,
protein, fiber, and oil, as well as biocatalyst cell debris. The
term may also include soluble residual material from the
fermentation and is then referred to as "distillers dried grains
and solubles" (DDGS). DDG or DDGS are an example of a co-product
from a biofuel production process.
[0114] The term "nutrient" is defined as a chemical compound that
is used by a biocatalyst to grow and survive. Nutrients can be
organic compounds such as carbohydrates and amino acids or
inorganic compound such as metal salts.
[0115] The term "complex nutrient" is defined as a nutrient source
containing mostly monomeric organic compounds used by a biocatalyst
for the production of proteins, DNA, lipids, and carbohydrates. The
term "rich nutrient" is used interchangeably throughout with the
term complex nutrient. Typically, complex nutrients or rich
nutrients are derived from biological materials, such as
slaughterhouse waste, dairy wastes, or agricultural residues.
Complex nutrients or rich nutrients include, but are not limited
to: yeast extract, tryptone, peptone, soy extract, corn steep
liquor, soy protein, and casein.
[0116] The term "natural DNA" is defined as DNA (deoxyribonucleic
acid) that is greater than 99.9% derived from the organism in which
it is contained. For example, a biocatalyst that contains 4,635,035
native DNA base pairs out of 4,639,675 base pairs is said to
contain only natural DNA.
[0117] The term "native DNA" is defined as a DNA sequence that is
100% derived from the organism in which it is contained.
[0118] The term "foreign DNA" is defined as a DNA sequence that is
100% derived from an organism other than the organism in which it
is contained.
[0119] The term "genus" is defined as a taxonomic group of related
species according to the Taxonomic Outline of Bacteria and Archaea
(Garrity, G. M., Lilbum, T. G., Cole, J. R., Harrison, S. H.,
Euzeby, J., and Tindall, B. J. (2007) The Taxonomic Outline of
Bacteria and Archaea. TOBA Release 7.7, March 2007. Michigan State
University Board of Trustees.
[http://www.taxonomicoutline.org/]).
[0120] The term "species" is defined as a collection of closely
related organisms with greater than 97% 16S ribosomal RNA sequence
homology and greater than 70% genomic hybridization and
sufficiently different from all other organisms so as to be
recognized as a distinct unit.
[0121] The abbreviation "GMO" is used herein to refer to a
genetically modified organism.
[0122] The term "feed grade" as used herein, means material that
may be ingested by animals without harming the animal. Examples of
feed grade materials may be found in the annual publication of the
Association of American Feed Control Officials. Ingestible
materials may or may not be a nutrient source for the animal.
[0123] The term "endotoxin" as used herein refers to the
lipopolysaccharide (LPS) portion of the cell wall of certain gram
negative bacteria, which acts as a toxin when solubilized.
[0124] The term "exotoxin" as used herein refers to a protein
released extracellularly by a microorganism as it grows and
produces immediate damage to animals and animal cells. Most
exotoxins fall into one of three categories, which include, for
example, cytolytic toxins, A-B toxins, and superantigen toxins.
Cytolytic toxins enzymatically attack cell components and cause
lysis. The A-B toxins are two-component toxins that permit transfer
of one component into the target cell through the membrane and
cause damage to the target cell. Superantigen toxins stimulate
large numbers of immune response cells and cause damage to the
target organism.
[0125] The term "sudden change" is defined as an increase or
decreasethat occurs within three hours or less.
[0126] "Aerobic metabolism" refers to a biochemical process in
which oxygen is used to make energy, typically in the form of ATP,
from carbohydrates. Typical aerobic metabolism occurs via
glycolysis and the TCA cycle, wherein a single glucose molecule is
metabolized completely into carbon dioxide in the presence of
oxygen.
[0127] In contrast, "anaerobic metabolism" refers to a biochemical
process in which oxygen is not the final acceptor of electrons
contained in NADH. Anaerobic metabolism can be divided into
anaerobic respiration, in which compounds other than oxygen serve
as the terminal electron acceptor, and fermentation, in which the
electrons from NADH are utilized to generate a reduced product via
a "fermentative pathway."
[0128] In "fermentative pathways", NADH donates its electrons to a
molecule produced by the same metabolic pathway that produced the
electrons carried in NADH. For example, in one of the fermentative
pathways of certain yeast strains. NADH generated through
glycolysis transfers its electrons to pyruvate, yielding lactate.
Fermentative pathways are usually active under anaerobic conditions
but may also occur under aerobic conditions, under conditions where
NADH is not fully oxidized via the respiratory chain. For example,
above certain glucose concentrations, crabtree positive yeasts
produce large amounts of ethanol under aerobic conditions.
[0129] The term "homologue," "homolog," or "homologous" refers to
nucleic acid or protein sequences or protein structures that are
related to each other by descent from a common ancestral sequence
or structure. All members of a gene family are homologues or
homologous, by definition.
[0130] The term "analogue" or "analogous" refers to nucleic acid or
protein sequences or protein structures that are related to one
another in function only and are not from common descent or do not
share a common ancestral sequence. Analogues may differ in sequence
but may share a similar structure, due to convergent evolution. For
example, two enzymes are analogues or analogous if the enzymes
catalyze the same reaction of conversion of a substrate to a
product, are unrelated in sequence, and irrespective of whether the
two enzymes are related in structure.
[0131] The term "recombinant microorganism" and "recombinant host
cell" are used interchangeably herein and refer to microorganisms
that have been genetically modified to express or over-express
endogenous polynucleotides, or to express heterologous
polynucleotides, such as those included in a vector, or which have
a reduction in expression of an endogenous gene. The polynucleotide
generally encodes a target enzyme involved in a metabolic pathway
for producing a desired metabolite. It is understood that the terms
"recombinant microorganism" and "recombinant host cell" refer not
only to the particular recombinant microorganism but to the progeny
or potential progeny of such a microorganism. Because certain
modifications may occur in succeeding generations due to either
mutation or environmental influences, such progeny may not, in
fact, be identical to the parent cell, but are still included
within the scope of the term as used herein.
[0132] Accordingly, a "parental microorganism" or a "parental
strain" functions as a reference cell for successive genetic
modification events. Each modification event can be accomplished by
introducing a nucleic acid molecule in to the reference cell. The
introduction facilitates the expression or over-expression of a
target enzyme. It is understood that the term "facilitates"
encompasses the activation of endogenous polynucleotides encoding a
target enzyme through genetic modification of e.g., a promoter
sequence in a parental microorganism. It is further understood that
the term "facilitates" encompasses the introduction of heterologous
polynucleotides encoding a target enzyme in to a parental
microorganism.
[0133] As used herein, the term "metabolically engineered" or
"metabolic engineering" involves rational pathway design and
assembly of biosynthetic genes, genes associated with operons, and
control elements of such polynucleotides, for the production of a
desired metabolite. "Metabolically engineered" can further include
optimization of metabolic flux by regulation and optimization of
transcription, translation, protein stability and protein
functionality using genetic engineering and appropriate culture
condition including the reduction of, disruption, or knocking out
of, a competing metabolic pathway that competes with an
intermediate leading to a desired pathway.
[0134] The terms "metabolically engineered microorganism" and
"modified microorganism" are used interchangeably herein and refer
not only to the particular subject cell but to the progeny or
potential progeny of such a cell. Because certain modifications may
occur in succeeding generations due to either mutation or
environmental influences, such progeny may not, in fact, be
identical to the parent cell, but are still included within the
scope of the term as used herein.
[0135] Dissolved oxygen is expressed throughout as the percentage
of saturating concentration of oxygen in water.
[0136] The term "DNA marker" is used herein to refer to any DNA
sequence which encodes a protein that confers resistance to a
chemical or physical condition that is applied to the organism in
which the DNA marker sequence is contained. For example, a common
DNA marker is an antibiotic resistance DNA marker, such as the kan
gene APH(3')II. The kan gene encodes a protein that confers
resistance to the antibiotic kanamycin. Thus, the organism in which
the APH(3')II gene is present and expressed is resistant to
kanamycin.
[0137] The term "scar DNA" is used herein to describe short pieces
of foreign DNA of 100 nucleotide base pairs in length or less that
is contained within the chromosome of the biocatalyst. Scar DNA is
not translated into a protein. Scar DNA may not positively or
negatively affect the performance of a biocatalyst on its own, but
may be used as a replacement for a removed or deleted native gene
from the biocatalyst.
[0138] "Carbon of atmospheric origin" as used herein refers to
carbon atoms from carbon dioxide molecules that have recently, in
the last few decades, been free in the earth's atmosphere. Such
carbons in mass are identifiable by the ratio of particular
radioisotopes as described herein. "Green carbon". "atmospheric
carbon", "environmentally friendly carbon", "life-cycle carbon",
"non-fossil fuel based carbon", "non-petroleum based carbon",
"carbon of atmospheric origin", and "biobased carbon" are used
synonymously herein.
[0139] "Carbon of fossil origin" as used herein refers to carbon of
petrochemical origin. Carbon of fossil origin is identifiable by
means described herein. "Fossil fuel carbon", "fossil carbon",
"polluting carbon", "petrochemical carbon", "petrocarbon" and
"carbon of fossil origin" are used synonymously herein.
[0140] "Renewably-based" denotes that the carbon content of the
biomaterial and subsequent products made from the biomaterial is
from a "new carbon" source as measured by ASTM test method D
6866-05 Determining the Biobased Content of Natural Range Materials
Using Radiocarbon and Isotope Ratio Mass Spectrometry Analysis,
incorporated herein by reference. This test method measures the
14C/12C isotope ratio in a sample and compares it to the 14C/12C
isotope ratio in a standard 100% biobased material to give percent
biobased content of the sample. "Biobased materials" are further
defined as organic materials in which the carbon comes from
recently (on a human time scale) fixated CO.sub.2 present in the
atmosphere using sunlight energy (photosynthesis). On land, this
CO.sub.2 is captured or fixated by plant life (e.g., agricultural
crops or forestry materials). In the oceans, the CO.sub.2 is
captured or fixated by photosynthesizing bacteria or phytoplankton.
A biobased material has a 14C/12C isotope ratio in range of from
1:0 to greater than 0:1. Contrarily, a fossil-based material, has a
14C/12C isotope ratio of 0:1.
[0141] A small amount of the carbon dioxide in the atmosphere is
radioactive. This 14C carbon dioxide is created when nitrogen is
struck by a cosmic ray generated neutron, causing the nitrogen to
lose a proton and form carbon of atomic mass 14, which is
immediately oxidized to carbon dioxide. This radioactive isotope
represents a small, but measurable, fraction of atmospheric carbon.
Atmospheric carbon dioxide is processed by green plants to make
organic molecules during the process known as photosynthesis.
Virtually all forms of life on Earth depend on this green plant
production of organic molecule to produce the chemical energy that
facilitates growth and reproduction. Therefore, the 14C that exists
in the atmosphere becomes part of all life forms, and their
biological products. These renewably based organic molecules that
biodegrade to CO.sub.2 do not contribute to global warming as there
is no net increase of carbon emitted to the atmosphere. In
contrast, fossil fuel based carbon does not have the signature
14C:12C ratio of atmospheric carbon dioxide.
[0142] Methods and strategies for converting biomass derived
carbohydrates to commodity chemicals and biofuels are listed below.
FIG. 1 illustrates a process 100 of making a biofuel. Generally,
process 100 may include providing a feedstock 105 to a biocatalyst
including at least one selected biocatalyst 110. In turn, the
biocatalyst 110 may be selected to produce a biofuel 115. A
business strategy that employs the use of an economical method for
the production of biofuels is herein disclosed.
[0143] Specialized plants such as sugar cane, corn, and wheat
provide much of the traditional carbohydrates used today for food
and renewable fuels and chemicals production. The well established
processes for extraction of traditional carbohydrates from plants
include sucrose from sugar cane and dextrose syrup from corn grain.
Sucrose and dextrose are the most widely used fermentative sugars.
Sucrose and dextrose are also currently the lowest cost and the
most widely available traditional carbohydrates, having large uses
in the food industry and lower volume use as fermentation
feedstocks. To eliminate potential competition with food, processes
for the production of fuels and chemicals that avoid using
traditional carbohydrates like sucrose and dextrose syrup derived
from specialty plants are being developed.
[0144] Economical production of biofuels from biomass-derived
organic compounds via fermentation processes depends upon
biocatalysts that catalyze this conversion in very specific ways
described herein. A method of producing biofuels makes use of
biocatalysts that exhibit certain properties which decrease the
cost of the fermentation part of the biofuel production process. A
business strategy is disclosed that employs the use of an
economical method for the production of biofuels.
TABLE-US-00001 TABLE 1 The contents of cellulose, hemicellulose,
and lignin in common agricultural residues and wastes..sup.a
Cellulose Hemicellulose Lignocellulosic materials (%) (%) Lignin
(%) Hardwood stems 40-55 24-40 18-25 Softwood stems 45-50 25-35
25-35 Nut shells 25-30 25-30 30-40 Corn cobs 45 35 15 Grasses 25-40
35-50 10-30 Paper 85-99 0 0-15 Wheat straw 30 50 15 Sorted refuse
60 20 20 Leaves 15-20 80-85 0 Cotton seed hairs 80-95 5-20 0
Newspaper 40-55 25-40 18-30 Waste papers from chemical 60-70 10-20
5-10 pulps Primary wastewater solids 8-15 NA.sup.b 24-29 Swine
waste 6.0 28 NA.sup.b Solid cattle manure 1.6-4.7 1.4-3.3 2.7-5.7
Coastal Bermuda grass 25 35.7 6.4 Switch grass 45 31.4 12.0
.sup.aSources: Boopathy, R., 1998. Bioresour. Technol. 64, 1-6.;
Cheung, S. W., Anderson, B. C., 1997. Bioresour. Technol. 59,
81-96.; Dewes, T., Hueunsche, E., 1998. Biol. Agric. Hortic. 16,
251-268.; Reshamwala, S., Shawky, B. T., Dale, B. E., 1995. Appl.
Biochem. Biotechnol. 51/52, 43-55.; Sun, Y. and Cheng, J. 2002.
Bioresour. Technol. 83: 1-11. .sup.bNA--Not available.
[0145] Plant material or biomass of all types is typically composed
of about 70% carbohydrates, typically cellulose and hemicellulose
(Table 1). In addition, some waste materials also contain
carbohydrate materials in the form of processed biomass (Table 1).
Biomass is targeted as a low cost and renewable feedstock for
future liquid transportation fuels, organic chemicals, and
biomaterials. Biomass is renewable and captures carbon, in the form
of carbon dioxide, from the air. Biomass is an excellent source of
renewable feedstocks for the production of biofuels and chemicals
through processes like fermentation using a biocatalyst.
Additionally, technology for extracting carbon sources, including
carbohydrates, from recalcitrant biomass consisting of cellulose,
hemicellulose, and lignin, is in the final stages of development
for commercial use.
[0146] Biomass may be treated mechanically, chemically,
thermochemically, and/or enzymatically to generate soluble
carbohydrates from the pectin, cellulose, and hemicellulose
fractions of biomass (Wyman, C. E. et al. 2005 Bioresource
Technology 96:1959-1966). The soluble carbohydrates, which consist
mainly of six-carbon sugars (hexoses) such as glucose, and
five-carbon sugars (pentoses) such as xylose, are used as
substrates in fermentations with a biocatalyst to generate products
like ethanol. Generally, the lignin fraction of biomass is used as
fuel for combustion within the fermentation plant (Zaldivar, J. et
al. 2001 Applied Microbiology and Biotechnology 56:17-34).
[0147] Methods and strategies for the production of commodity
biofuels and chemicals from renewable feedstocks, like traditional
carbohydrates and biomass, are known in the art. The vast majority
of processes use only traditional carbohydrates and not
carbohydrates derived from other sources of biomass. For example,
in one strategy, the yeast Saccharomyces cerevisiae is used to
generate ethanol from starch or sugar derived from corn or sugar
cane. While this process is mature, it is not currently able to use
pentoses or other parts of biomass as a feedstock at the industrial
scale and is therefore not very efficient overall with respect to
use of other sources biomass as a feedstock (Zaldivar, J. et al.
2001 Applied Microbiology and Biotechnology 56:17-34). In another
example, the bacterium Clostridium acetobutylicum was used to
produce acetone, butanol, and ethanol (the so-called `ABE process`)
from a variety of substrates, most commonly molasses and corn
starch (Jones, D. T. 1986 Microbiological Reviews 50:484-524).
While the ABE process was a major industrial process for more than
60 years, this process suffered from low yields of desired
compounds (e.g. butanol) and low productivity. Low yield and low
productivity of the ABE process meant that this process could not
compete economically with petrochemically-derived butanol or
acetone and was generally abandoned by the end of the 20th century.
In the US, the ABE process was abandoned in the 1960s, in South
Africa ABE was abandoned in the 1980s, in England this happened in
the 1950s, in China ABE was abandoned around 2004. In Russia the
ABE process was abandoned in the late 1980s and in Egypt ABE
process was abandoned in the 1970s. Recently, renewed interest in
the ABE process has sparked a new era of research into the
improvement of the process (Duerre, P. 2007 Biotechnology Journal
2:1-10).
[0148] In another example, a commodity chemical produced from a
renewable feedstock is acetic acid. Acetic acid is produced
fermentatively from glucose by Acetobacter species of bacteria.
However, in the acetic acid process, the yields are only 75-80% of
the theoretical yield of 0.67 g/g glucose (Danner, H. 1999 Chemical
Society Reviews 28:395-405). Lactic acid is another commodity
chemical produced from fermentation of a renewable feedstock.
Lactic acid is produced from glucose or sucrose by bacterial
species, such as Lactobacillus or fungal species, such as Mucor,
fermentatively (John, R. et al. 2007 Applied Microbiology and
Biotechnology 74:524-534). Neither acetic acid nor lactic acid is
directly useful as a transportation fuel.
[0149] Ethanol may be produced from biomass or biomass derived
carbohydrates. Currently, two organisms, Escherichia coli and
Zymomonas mobilis, may be used to produce ethanol from biomass or
biomass derived carbohydrates. This process involves several unit
operations (e.g. biomass hydrolysis, separation of cellulose and
hemicellulose hydrolysate streams, separate hemicellulose and
cellulose hydrolysate fermentations) and pretreatment of the
biomass is required (e.g., fractionation of biomass into cellulose
and hemicellulose fractions, detoxification of some fractions
before fermentation, a solid/liquid separation step) (Zaldivar, J.
et al. 2001 Applied Microbiology and Biotechnology 56:17-34 and
Ingram, L. O. et al. 1999 Biotechnol Prog 15:855-866.) In another
example, Clostridium species was used in Russia to produce butanol
through an ABE fermentation of a feedstock that contained not more
than 5% biomass hydrolysate (mainly from hemicellulose), or
carbohydrates derived from treated biomass. While the solvent
yields for this ABE process were roughly equivalent to the process
using only starch or sucrose, the majority of the feedstock still
consisted of sucrose-containing molasses and thus competed with
food supplies (Zverlov, V. V. et al. 2006 Appl. Microbiol.
Biotechnol. 71: 587-597). Further, the Russian process would
currently suffer from poor economics, as the large portion of
traditional carbohydrate feedstock in that process would make it
more expensive than a process that could use greater fractions of
organic compounds derived from other sources of biomass.
[0150] Recently, an ABE fermentation using wheat straw hydrolysate
was demonstrated (Qureshi N. et al. 2007 Bioprocess Biosyst. Eng.
online DOI:10.1007/s00449-007-0137-9). Also, an ABE process that
produces butanol from corn fiber xylan was demonstrated (Qureshi N.
et al. 2006 Biotechnol. Prog. 22:673-680). Another example for ABE
with cellulosics is the use of corn cob hydrolysates as a feed
stock (Marchal, R. et al 1992 Bioresource Technology 42:205-217;
Nativel F. et al 1992 Int. J. Solar Energy 11:219-229). Also wood
hydrolysates were used in ABE (Maddox, I. S. and Murray, E.,
Production of n-butanol by fermentation of wood hydrolysate,
Biotechnol. Lett., 5, 175, 1983; Yu, E. K. C., L. Deschatelets, and
J. N. Saddler. 1984). The bioconversion of wood hydrolyzates to
butanol and butanediol. Biotechnol. Lett. 6:327-332). Aspen wood
xylan mixed with powdered cellulose was used in a two stage
fermentation set up using Clostridium thermocellum in a first stage
and then metabolizing with Clostridium acetobutylicum in a second
stage (Jones, D. T. and Woods, D. R. Acetone-Butanol Fermentation
revisited. Microbiological Reviews, 1986, 50:484-524; Yu, E. K. C.,
Chan, M. K. H., and Saddler, J. N., Butanol production from
cellulosic substrates by sequential co-culture of Clostridium
thermocellum and C. acetobutylicum, Biotechnol. Lett., 7, 509,
1985).
[0151] To produce commodity biofuels and chemicals from renewable
biomass substrates in an economically-viable process, improved
biocatalysts must be generated. For example, research to generate
biocatalysts that produce ethanol from biomass and use more of the
carbon compounds present, such as pentoses and hexoses, has
followed two strategies (1) improve the production of ethanol in
biocatalysts that can use both pentoses and hexoses, and (2)
engineer pentose utilization into ethanol producing biocatalysts
that use only hexoses. However, neither strategy has produced a
biocatalyst with industrially relevant properties yet (Gray, K. et
al. 2006 Current Opinion in Chemical Biology 10). There is a need
in the art to generate efficient and economical biocatalysts for
the production of other commodity biofuels and chemicals. There is
also a need to generate biocatalysts that not only use any
feedstock or source of carbohydrates available, but also possess
several other performance characteristics that favor an economical
industrial process for the production of biofuels and
chemicals.
[0152] Methods of converting biomass-derived organic compounds into
biofuels use biocatalysts that have certain performance
characteristics or combinations of performance characteristics to
enable a more economical process for the production of biofuels.
These performance characteristics include the following and are
described in detail below: uses any feedstock, biomass-derived
organic compound, or carbohydrate source as a substrate; resistant
and tolerant to high levels of biofuel and/or product, reaching a
high titer of biofuel or product; high productivity; low or no
toxin levels; high product yields; low production of undesired
metabolites or byproducts; uses natural DNA; no DNA markers;
acceptable temperature tolerance; acceptable pH tolerance; uses
simple nutrients; the ability of a biocatalyst to recover from
brief periods of varying oxygen availability; the ability of a
biocatalyst to recover from brief periods of the presence of
oxygen; the ability of a biocatalyst to tolerate the presence of
small amounts of oxygen throughout the fermentation process; the
ability of a biocatalyst to produce a biofuel under anaerobic
conditions; produces a biofuel. An ideal biocatalyst for the
production of a biofuel in an economical process has several or all
of the above performance characteristics and yields a process that
is economically favorable for the production of a biofuel.
[0153] Biomass processed via thermo-chemical and enzymatic
hydrolysis processes provide a variety of substrates for
fermentation. Since raw materials account for the majority of the
production cost for biologically produced commodity chemicals and
biofuels, it is important to utilize most, if not all
carbon-containing compounds from renewable substrates.
[0154] In some cases, especially for commodity chemicals, the
substrate cost can represent up to 70% of the value of the product
(Danner, H. 1999 Chemical Society Reviews 28:395-405). Corn for
example is typically processed into starch and further processed to
dextrose. However, when corn is processed to starch there are a
variety of impurities present. Some of the impurities are corn
gluten, gluten meal and germ. Others are a variety of starch,
dextrin and soluble dextrins or other and/or all oligomers and
dextrose. Here, dextrose (glucose) is currently the only feedstock
for further fermentation.
[0155] Inhibitors, such as furfurals, metals, and other inorganics
are sometimes generated during the biomass pre-treatment process.
Biofuel production from biomass requires pretreatment of biomass to
release carbohydrates from polymeric substances within the biomass
(such as cellulose, hemicellulose, and pectin). One common
pretreatment method is acid hydrolysis. During acid hydrolysis
pretreatment, a number of toxic compounds are generated from
biomass, such as soluble aromatic aldehydes from lignin, furfural
from pentoses and 5-hydroxymethylfurfural from hexoses. Examples of
aldehydes are: furfural, 5-hydroxymethylfurfural,
4-hydroxybenzaldehyde, syringaldehyde, and vanillin (du Preez, 1994
Enzyme Microb Technol 16; Hahn-Hagerdahl, 1996 Appl Biochem
Biotechnol 57/58; Hahn-Hagerdahl et al., 1991 Appl Biochem
Biotechnol 28/29). These toxins retard the fermentation of
hemicellulose containing syrups by conventional biocatalysts
(Zaldivar J Biotech Bioeng 1999, 65). The toxicity of these
compounds is related to their hydrophobicity. The toxin levels can
be reduced by ion-exchange resins (Frazer and McCaskey, 1989,
Biomass 18; Frazer and McCaskey 1991 Enzyme Microb Technol 13),
molecular exclusion chromatography (Buchert et al., 1990 Proc
Biotech Int 25), laccase (Jonsson et al., 1998 Appl Microbiol
Biotechnol 49), and treatment at high pH using lime (Perego et al.,
1990 J Indust Microbiol 6), but all have limitations. The removal
of these toxins from the feedstock is currently expensive and may
not suitable for an economic biofuel process.
[0156] During hydrolysis, a variety of growth inhibitory alcohols
are also produced which include aromatic alcohols from lignin and
furfuryl alcohol from pentose destruction. For example, some of the
inhibitory alcohols produced include catechol, coniferyl alcohol,
furfuryl alcohol, guaiacol, hydroquinone, methylcatechol, and
vanillyl alcohol. The toxicities of these compounds are directly
related to their hydrophobicity. In binary combination, the extent
of growth inhibition was roughly additive for most compounds
tested. However, combinations with furfuryl alcohol and furfural
appear synergistic in toxicity. When compared individually, alcohol
components which are formed during hemicellulose hydrolysis are
less toxic for growth than the aldehydes and organic acids either
on a weight basis or a molar basis (Zaldivar J et al. Biotechnol.
Bioeng. 1999 65:24-33 and 66:203-10).
[0157] Binary combinations of catechol with 4-hydroxybenzaldehyde,
and vanillin with catechol, furfural, or 4-hydroxybenzaldehyde
showed synergistic effect on toxicity on Kluyveromyces marxianus
and caused a 60-90% decrease in cell mass production. The presence
of aldehydes in the fermentation medium strongly inhibited cell
growth and ethanol production. Kluyveromyces marxianus reduces
aldehydes to their corresponding alcohols to mitigate the toxicity
of these compounds. The total reduction of aldehydes was needed to
start ethanol production. Vanillin, in binary combination, was
dramatically toxic and was the only compound for which inhibition
could not be overcome by yeast strain assimilation, causing a 90%
reduction in both cell growth and fermentation (Ballesteros 2004
Biotechnol Prog).
[0158] Furans and phenols generally inhibit growth and ethanol
production rate but not the ethanol yields in Saccharomyces
cerevisiae. Within the same phenol functional group (aldehyde,
ketone, and acid) the inhibition of volumetric ethanol productivity
was found to depend on the amount of methoxyl substituents and
hence hydrophobicity (log P) (Klinke H B 2004 Appl Microbiol
Biotechnol). Thermoanaerobacter mathranii A3M3 can grow on pentoses
and produce ethanol in hydrolysate without any need for
detoxification (Klinke 2001 Appl Microbiol Biotechnol).
[0159] Despite the generation of inhibitory substances from the
pretreatment of biomass, the most economical of all renewable
feedstocks is biomass and carbohydrates derived therefrom.
[0160] Process economics for products are enhanced by conversion of
all carbohydrates in a feedstock to targeted products.
Carbohydrates in plants are found in a variety of forms from
monomeric sugars to crystalline polymers such as cellulose and
hemicellulose. In fact, most carbohydrates in plants are found as
hemicellulose, cellulose, and pectins prior to physico-chemical,
thermal, and enzymatic conversions. The primary carbohydrates
derived from hemicellulose are D-galactose, L-galactose, D-mannose,
L-rhamnose, L-fucose, D-xylose, L-arabinose, and D-glucuronic acid.
The primary carbohydrates derived from cellulose are D-glucose,
cellobiose, cellotriose, and other dextrins. The primary
carbohydrates derived from pectins are D-galacturonic acid,
L-rhamnose, D-galactose, L-arabinose and D-xylose.
[0161] Acetate is present as a byproduct in biomass hydrolysates.
For example, in corn fiber hydrolysates the acetate carry over from
the biomass treatment amounted to 3 g/L in the ABE fermentation
(Ezeji et al. 2007 Biotechnology and Bioengineering, 97:1460-1469).
In other examples, biomass hydrolysate derived from corn stover may
contain 7-12 g/L acetate (National Renewable Energy Laboratory
publication NREL/TP-510-32438; McMillan. J. D., National Renewable
Energy Laboratory, presentation at DOE/NASULGC Biomass & Solar
Energy Workshops, Aug. 3-4, 2004).
[0162] The performance characteristics of the biocatalyst described
herein include a high productivity of the conversion of a feedstock
to a biofuel.
[0163] Productivity has an impact on capital costs for a biofuel
plant and depends on the amount of biocatalyst used during the
fermentation and the specific activity of the biocatalyst. High
volumetric productivity of the biocatalyst shortens the process
time and, therefore, for a given plant size, increases the output
of the plant over the plant lifetime. This increases the return on
the capital investment and decreases the cost of the biofuel. High
cell density fermentation increases the volumetric productivity and
reduces investment costs. However, it also increases the cost for
producing the cell mass, which is a function of the price for added
nutrients and decreases the product yield since substrate is
converted to biomass. Therefore, a high specific activity which
measures the efficiency of the biocatalyst, translates to a lower
amount of cell mass required in the fermentation step. For example,
ethanol production plants operate at volumetric productivities
ranging from 1-3 g ethanol L.sup.-1 h.sup.-1 with the specific
ethanol productivity, e.g., for Saccharomyces cerevisiae being
about 2 g ethanol g cell dry weight (CDW).sup.-1 h.sup.-1 (Appl.
Microbiol. Biotechnol. 2007 74:937-953), and about 2.1 g ethanol g
CDW.sup.-1 h.sup.-1 for an engineered Escherichia coli biocatalyst
(U.S. Pat. No. 5,424,202).
[0164] Specific productivity of the biocatalyst depends on the
capacity of the terminal pathway converting an intermediate of the
carbon metabolism of the host organism into a biofuel. Another
limiting factor for the specific productivity is the glycolytic
flux of the biocatalyst. For the biocatalyst production of certain
chemicals, typical glycolytic fluxes reported in the literature are
summarized in Table 2. The economic production of a biofuel by
fermentation requires cells that consume a carbohydrate feedstock
at similar or higher rates.
TABLE-US-00002 TABLE 2 Glycolytic flux achieved in biocatalytic
processes converting glucose into products. Strain or Glycolytic
flux Reference Biocatalyst Substrate Product [g g CDW.sup.-1
h.sup.-1] Elbing, K. et al. 2004. Appl. Saccharomyces glucose
ethanol 3.24 Environ. Micro. 70: cerevisiae 5323-5330 CEN.PK2-1C
Papagianni, M. et al. Lactococcus lactis spp. glucose lactate 4.59
Microbial Cell Factories. lactis LM0230 2007. 6: 16. Fong, S. et
al. 2005. E. coli MG1655 (pta, glucose lactate 4.14 Biotechnol.
Bioengineering. adhE), evolved 91: 643-648. Zhu, J. and Shimizu, K.
2004. E. coli BW25113 (pfl) glucose lactate 1.47 Appl. Microbiol.
Biotechnol. 64: 367-375 Van Hoek, P. et al. 2003. WO Kluyveromyces
glucose lactate 2.66 03/102200 A2. marxianus (PDC) Das Neves, M. A.
et al. 2007. Zymomonas mobilis glucose ethanol 10.9 J. Food Process
Engineering. NBRC 13758 30: 338-356 Das Neves, M. A. et al. 2007.
Saccharomyces glucose ethanol 1.02 J. Food Process Engineering.
cerevisiae 30: 338-356 Smits, H. P. et al. 2000. Yeast.
Saccharomyces glucose ethanol 4.4 16: 1325-1334. cerevisiae
CEN.PK.K45 Zhou, S. et al. 2006. E. coli (engineered) glucose
lactate 7.2 Biotechnol. Lett. 28: 671-676. Causey, T. B. et al.
2003. E. coli (engineered) glucose acetate 3.24 Proc. Nat. Acad.
Sci. USA. 100: 825-832. Roca, C. et al. 2003. Appl. Saccharomyces
glucose ethanol 4.5 Environ. Micro. cerevisiae TMB 3001 69:
4732-4736. Zhou, S. et al. 2006. E. coli B (engineered) glucose
lactate 1.3 Biotechnol. Lett. 28: 663-670.
[0165] Economical production of biofuels from biomass-derived
organic compounds via fermentation processes depends upon
biocatalysts that catalyze this conversion in very specific ways
described herein. A method of producing biofuels makes use of
biocatalysts that exhibit certain properties which decrease the
cost of the fermentation part of the biofuel production process. An
important characteristic of the biocatalyst is that the biocatalyst
contains DNA consisting of natural DNA. It is important that the
biocatalyst functions in a low cost and efficient manner within the
overall biofuels production process on the low cost nutrient. A
business strategy is disclosed that employs the use of an
economical method for the production of biofuels. Low cost biofuel
production requires the biocatalyst to provide optimal productivity
and yield on carbohydrate and biofuel concentration. Further,
biocatalysts that contain DNA consisting of natural DNA allow the
spent biocatalyst to be used as an animal feed supplement, as
fertilizer, or disposed of as waste with minimal treatment. An
ideal biocatalyst with these performance characteristics for the
production of a biofuel yields a process that is economically
favorable for the production of a commodity biofuel or
chemical.
[0166] Natural organisms may be used in the production of fuels or
chemicals by fermentation. Frequently, however, microorganisms must
be modified to be useful industrial biocatalysts. For example,
nucleic acids derived from a foreign organism may be inserted into
a biocatalyst to alter the properties of the biocatalyst. Nucleic
acids that encode pathways for the production of chemical
compounds, like amino acids or biofuels, may be inserted into a
biocatalyst. Sometimes, several genes must be transferred to a
biocatalyst to generate a useful product. Other times, only one or
two genes may be required. It is also possible to insert nucleic
acids that impart other properties on a biocatalyst that are not
directly involved with the conversion of a feedstock into a
product, but nevertheless enhance the ability of a biocatalyst to
convert feedstock into product at an industrial scale. For example,
nucleic acid sequences that enhance the tolerance of biocatalysts
to stressful conditions or compounds may be inserted into a
biocatalyst (Papoutsakis, E. T. et al. U.S. Pat. No. 6,960,465 B1,
2005).
[0167] During development of a biocatalyst, it may be necessary to
alter the natural state of the biocatalyst to remove unwanted
features or products, prior to the use of the biocatalyst in
industrial scale fermentation. Methods to impair or remove genes or
parts of genes from a biocatalyst can be random or targeted. In a
random approach, chemical or physical mutagens may be used to
accelerate the natural mutation frequencies of a biocatalyst and
paired with selection for improved performance or removal of
unwanted products or features. In a directed approach, specific
genes of known or unknown function may be removed or inhibited
through genetic modification. For example, in order to redirect the
carbon flow within a biocatalyst into an introduced metabolic
pathway for the production of a biofuel, it may be necessary to
remove or impair genes that encode native metabolic pathways in a
biocatalyst. European Union (EU) regulations define genetically
modified organisms (GMOs) which are modified using techniques that
require in vitro genetic modifications (European Commission
Regulation 1830/2003/EC, and Regulation1839/2003/EC). Organisms
that are only modified by non targeted mutagenesis, mutations and
alterations generated using viral infection, and introduction of
DNA by sexual transmission of DNA between organisms are not
considered GMOs by the EU, therefore their use in the EU is not
restricted.
[0168] Common targeted methods used to remove DNA from the genome
of biocatalysts may leave behind genetic markers, such as DNA
markers or genes that encode antibiotic resistance, or short
segments of DNA, such as scar DNA, used as enzyme recognition
sequences to remove said genetic markers. Similarly, common methods
are used to insert DNA into the genome of biocatalysts. Insertion
methods may also leave behind DNA markers or scar DNA in the genome
of a biocatalyst. Further, extra-chromosomal elements, such as
plasmids, cosmids, bacterial artificial chromosomes or yeast
artificial chromosomes, or phage, may be used to confer desirable
properties to a biocatalyst. These extra-chromosomal elements are
usually stabilized by the use of DNA markers contained within the
extra-chromosomal elements. Extra-chromosomal elements may contain
other foreign DNA as well, such as origins of replication, multiple
cloning sites, repressor genes, terminators, and promoters. Origins
of replication, multiple cloning sites, terminators, and promoters
do not encode for proteins in the biocatalyst. Further, segments of
enzyme recognition sequences, or scar DNA, used to remove genetic
markers from the chromosome of a biocatalyst, do not encode for
proteins within the biocatalyst. However, DNA markers and repressor
genes usually encode proteins that provide antibiotic resistance
and repress desired promoter regions, respectively.
[0169] The foreign DNA incorporated into the biocatalyst can
originate from within the same species, within the same genus, from
a different genus, or from a different taxa as the biocatalyst. The
evolutionary distance of the organisms might have an influence on
the limitations of use for the engineered organism. For example,
The United States Environmental Protection Agency regulates
organisms that contain DNA from organisms in different genera.
[0170] Biocatalysts that contain foreign DNA may pose several
environmental and food safety concerns, depending on how the spent
biocatalyst is used after industrial fermentation processes. One
concern is the release of live biocatalysts into the environment.
Biocatalysts that contain foreign DNA may be properly deactivated
or killed prior to release into the environment. Another concern is
the transfer of foreign DNA, such as DNA markers, from modified
biocatalysts into other organisms in the environment. For example,
transfer of a DNA marker that encodes a protein for antibiotic
resistance to a pathogenic or opportunistic pathogenic
microorganism in the environment may inhibit treatment of humans or
animals infected with said organism. In some cases, biocatalysts
that contain foreign genes may produce proteins that lead to
allergic or undesired reactions in humans or animals. In this case,
the spent biocatalyst must be not be used in applications that lead
to human or animal contact with proteins contained within the spent
biocatalyst. Here, spent biocatalysts may be incinerated for
disposal or for energy generation. Alternatively, the spent
biocatalyst may be used as a complex nutrient in another industrial
fermentation or degraded through an anaerobic sludge digestion
treatment process.
[0171] For an economic industrial fermentation process, the spent
biocatalyst has the highest possible value. In this case, it is
more economical to sell spent biocatalyst as a co-product, like
DDG, than to incinerate the spent biocatalyst for energy or
disposal. Spent biocatalyst that does not contain foreign DNA may
be used directly as a fertilizer or may be incinerated to generate
a potash-rich fertilizer. Depending on the treatment required to
generate fertilizer from spent biocatalyst, it may or may not have
economic value (Spivey, M. J. Process Biochemistry. November 1978.
pp 2-4, 25). Generally, the energy generated from the incineration
of spent biocatalyst is of less value than selling the spent
biocatalyst as part of DDG. Engineered organisms generally require
more elaborate equipment to ensure the containment of the
biocatalyst within the fermentation process. Accidental release of
an engineered biocatalyst through fermentation off-gas and spills
should be avoided. Additional capital equipment can be installed to
contain spills and prevent release of an engineered biocatalyst
through fermentation off-gas. The additional capital cost necessary
for the fermentation equipment adds to the overall process cost for
biocatalysts containing foreign DNA relative to organisms that
contains DNA consisting of natural DNA.
[0172] One paper describes the creation of an E. coli biocatalyst
for fuel ethanol production. The E. coli biocatalyst does not
contain any foreign genes (Kim, Y. 2007 Applied and Environmental
Microbiology 73(6)). Another paper describes generation of a yeast
strain with no foreign genes that can use a 5 carbon sugar as a
substrate and may be suitable for further development as industrial
biocatalysts (Attfield, P. V. 2006 FEMS Yeast Research 6).
Clostridia sp. fermentations for the production of acetone,
butanol, and ethanol used biocatalysts that were not genetically
modified to contain foreign DNA (Jones, D. T. and Woods, D. R.
Acetone-Butanol Fermentation revisited. Microbiological Reviews,
1986, 50:484-524; Spivey, M. J. Process Biochemistry. November
1978, 25:2-4). The ABE process was the only industrial scale
biofuel process that used a biocatalyst that contained DNA
consisting of natural DNA. The spent biocatalyst generated during
ABE fermentations was commonly sold as an animal feed supplement
(Jones, D. T. and Woods, D. R. Acetone-Butanol Fermentation
revisited. Microbiological Reviews, 1986, 50:484-524).
[0173] There is a need in the art to generate efficient and
economical biocatalysts for the production of biofuels and
chemicals. There is also a need to generate biocatalysts that not
only use any feedstock or source of carbohydrates available, but
also possess several other performance characteristics that favor
an economical industrial process for the production of biofuels and
chemicals.
[0174] The pH of a fermentation is regulated primarily by adding
acidic or basic solutions to the fermentation broth. Regulating the
pH of a fermentation adds operating cost to the process in many
ways. For example, the acid and base used to adjust the pH must be
purchased. Further, the addition of solutions of acid or base to
the fermentation dilutes the product, increasing the downstream
recovery costs of the desired product. Additionally, the acid and
base added to the fermentation generate salts that are of little or
no value and must be treated as waste. The adjustment of pH by the
addition of acid or base also generates heat that must be removed
from the fermentation with additional expensive cooling equipment.
For these reasons, it is desirable to use a biocatalyst that
functions at a wide range of pH values to decrease or eliminate the
need to control the pH of the fermentation.
[0175] Biocatalysts that function at low pH values, i.e. less than
pH 4, are especially valuable because most microorganisms that
commonly contaminate industrial fermentations do not grow at lower
pH values. Additionally, when biomass hydrolysate is used as a
fermentation substrate, the pH value of the hydrolysate is low and
is usually raised by the addition of base prior to use as a
fermentation feedstock. If a biocatalyst can function at the pH
level of biomass hydrolysate that does not require addition of base
prior to fermentation, it will greatly decrease the production cost
of the fermentation.
[0176] In addition to functioning at low pH values, a biocatalyst
that can withstand rapid pH changes in either direction is
particularly valuable. Further, a biocatalyst that can withstand
short durations of pH values one or more pH units above or below
the optimum pH for the fermentation is particularly valuable. For
example, costs associated with the dilution of the fermentation
broth during pH adjustments can be reduced if stronger acids or
bases are used for pH adjustment. If the biocatalyst can withstand
the quick pH change in the immediate vicinity of the addition,
which may include exposure to highly concentrated acids and bases,
then stronger acids and bases can be used.
[0177] The pH value of the fermentation impacts the number of
potential contaminants. In the pH range of 5.5 to 7.0, which is
typical for bacterial fermentations, many organisms are viable.
Therefore, this pH makes continuous operation unfeasible. For batch
fermentations in the pH range of 5.5 to 7.0, sanitary equipment and
careful aseptic procedures allow for largely contaminant-free
operation, but adds expense. At lower pH values of 4 to 5.5, many
bacteria do not grow or metabolize well. However, lactic acid
producing bacteria are prevalent at this pH range and many fungal
strains, including yeast, function very well in the pH range of 4
to 5.5. Continuous fermentation will likely be difficult, but batch
fermentation will require sanitary equipment and aseptic procedures
for contaminant-free operations. At pH values lower than 4, many
fungal strains can be competitive and thus may contaminate a
fermentation in this pH range. Bacterial strains that convert
carbohydrates to products are rare at pH values below 4 and with
any additional pressures, particularly from organic acids, the
bacteria cannot grow.
[0178] Simultaneous saccharification and fermentation, where
feedstock materials are treated to permit efficient fermentation
and a biocatalyst simultaneously converts the treated feedstock
material to desired products, is preferred over separate
saccharification and fermentation processes. Simultaneous
saccharification and fermentation is preferred over a separate
saccharification and fermentation process because sugars generated
in the separate process are vulnerable to non-productive
consumption by contaminating organisms prior to use in fermentation
(Lynd, Lee R et al., Consolidated bioprocessing of cellulosic
biomass: an update. Current Opinion in Biotechnology. 2005.
16:577-583). For simultaneous saccharification and fermentation,
the pH needs to permit optimal function of both the
saccharification enzymes and biocatalyst in the hydrolysate
solution or fermentation broth. For example, hydrolysis of
cellulose by cellulase enzymes can be started in an independent
saccharification process. However, since the concentration of
sugars is low enough to support microbial activity, processing
operations need to account for the microbial activity. Limited
duration batches, followed by cleaning-in-place (CIP) of the
vessels and associated piping, is required. Given the need to
minimize sugar loss and tank volume for saccharification and
fermentation, some portion of the saccharification must be done in
concert with the fermentation.
[0179] The whole process is more effective if the needs of the
saccharification enzymes, the biocatalyst, and the necessity to
keep out competitive microorganisms can be accomplished at high
rates, simultaneously with one another (Mojovic et al., Fuel 85
(2006) 1750-1755). This requires the pH of the simultaneous
saccharification and fermentation (SSF) to be optimal for the
enzyme, the biocatalyst, and the retardation of potential
contaminants. Enzymes that are added for the degradation of both
cellulose and starch have optimal activities in the pH 4-5 range.
Biomass hydrolysates and dry mill fermentation processes typically
suffer contaminations from bacteria, most often lactic acid
producing bacteria. Lactic acid and other bacteria can be stopped
by the presence of organic acids in the acid form. To accomplish
this, the pH must be low enough relative to the organic acid pKa to
provide organic acid in the acid form at concentrations above 5
g/L. Generally, this level of organic acid in the acid form retards
bacterial activity in a sugar solution.
[0180] Finally, biomass hydrolysates, in particular, contain acetic
acid derived from the hydrolysis of hemicellulose. The pKa of
acetic acid is about 4.8. Therefore, it has a significant
inhibitory impact on the biocatalyst if present in sufficient
concentration. Many biomass feedstocks provide acetic acid
concentrations of 5 to 15 g/l when pretreated at biomass solid
concentrations of 10 to 30%. At a pH of 4.8, 5 to 15 g/l of acetic
acid are present which retards bacterial contaminants and many
fungal contaminants. The economic benefits of a biocatalyst that
can operate at lower pH values include 1) improved yields by
reducing contaminant competition for feedstock, 2) ability to use
continuous fermentation, 3) enzymes used in saccharification are
kept in the optimal pH range thus reducing enzyme load and cost,
and 4) in a simultaneous saccharification and fermentation process,
the biocatalyst is able to convert sugars at a higher rate to
desired products.
[0181] Continuous fuel ethanol fermentations are run at pH values
less than 4.0. The ethanol fermentations are conducted with yeast
and the production of ethanol is anaerobic. Citric acid is produced
aerobically at pH values much less than 4.0, as the citric acid is
not neutralized. Air is required so the organism producing the
citric acid can respire on glucose providing the metabolic energy
to excrete the organic acids from the cell. This illustrates the
additional challenge that microorganisms or biocatalysts face in an
environment containing organic acids at pH values lower than the
pKa for the organic acid. For biomass feedstocks, once the
hemicellulose component is hydrolyzed, a significant quantity of
acetic acid, often in the range of 1%, is present. Even
Saccharomyces cerevisiae at pH values less than 5 is very
ineffective in growth or fermentation in the presence of acetic
acid (Verduyn, C 1991 Antonie van Leeuwenhoek 60: 325-353).
[0182] An ideal biocatalyst therefore will operate at low pH, pH
values in the range of 2 to 4, without organic acid challenge. In
the presence of organic acids, such as acetic, lactic, or other
organic acids, the biocatalyst will need to perform in the pH range
of 2 to 5, the higher pH reflecting the increased difficulty for
the biocatalyst in the presence of free organic acids (organic
acids below their pKa value). As an example, the ideal biocatalyst
will need to perform significantly better than Saccharomyces
cerevisiae typified as baker's yeast or used in fuel ethanol
production in order to provide the lowest manufacturing cost.
[0183] Fermentation temperature impacts the cost of biofuel
production in several ways. For example, in a case where cooling
water is not recirculated, the quantity of water required to cool
the fermentation increases when fermentation temperature increases
if the biocatalyst used does not tolerate higher temperatures. In
another example, where cooling water is recirculated and cooled by
an energy-consuming chiller, energy costs to cool the fermentation
increases when fermentation temperature increases if the
biocatalyst used does not tolerate higher temperatures. In the case
of simultaneous saccharification and fermentation, the fermentation
temperature affects the functionality of the enzymes used to
provide fermentable carbon sources to the biocatalysts. Generally,
the higher the temperature, the more active the enzymes.
Additionally, in normal industrial fermentation operating
environments, contaminant organisms are more likely than not
sensitive to high temperatures. Thus, fermentations using
biocatalysts that have a higher temperature tolerance are less
prone to contamination when the fermentation is operated at higher
temperature.
[0184] For corn dry milling and biomass based production processes,
the temperature of the fermentation affects the cost of using
simultaneous saccharification and fermentation processes. Typically
to reduce capital costs it is desired to do some or all of the
enzymatic saccharification of starch, cellulose or hemicellulose or
breakdown products of all three, in the fermentation vessel along
with fermentative conversion to the desired biofuels. Frequently,
raw materials for industrial fermentations require pretreatment,
such as saccharification of corn starch or release of monomeric
carbohydrates from biomass. These pretreatments are usually
performed at elevated temperatures, sometimes 50.degree. C. to
greater than 60.degree. C. In fermentations where the biocatalyst
is not tolerant to these temperatures, the pretreated substrates
must be cooled prior to subsequent fermentation. However, if a
biocatalyst is tolerant to higher temperatures, the process can be
either be simultaneous or will require less cooling of the
substrate prior to fermentation, increasing the total productivity
of the process and thus decreasing the overall cost. In addition to
having decreased operating costs, fermentations operating at
increased temperatures use less capital equipment for cooling the
pretreated carbon sources prior to fermentation, resulting in a
more economical process with respect to capital costs.
[0185] Without temperature control, the temperature of a
fermentation will generally increase over time due to heat
generated by biocatalyst metabolism and by mechanical agitation of
the fermentation broth (Weir. E. Dale et al. Plant/Operations
Progress. 1986. 5:142-7). The amount of heat produced by agitation
depends upon the size of the fermentation vessel and the nature of
the feedstock used. Specifically, the quantity of solids that the
feedstock adds to the fermenter will affect the amount of heat
generated due to friction. Raw cane sugar (unrefined sucrose
recovered from sugar cane plant), which mostly dissolves into the
fermentation broth, adds few solids into the fermentation. Dry
milled corn adds a substantial quantity of solids into the
fermentation that approaches 20-30% by weight in some of the high
concentration fermentations run today (Bothast et al. 2005 Applied
Microbiology and Biotechnology 67:19-25). Likewise the quantity of
solids in a biomass fermentation, at the start, will also approach
20% depending on the character of the biomass material (The Phyllis
Database for Biomass and Waste, http://www.ecn.nl/phyllis, Energy
Research Centre of the Netherlands). A higher fermentation
temperature for the production of biofuels would permit the use of
a lower quantity of cooling water, a smaller size of heat
exchangers, a smaller size of cooling towers, and potentially
eliminate any need for chilled water equipment and operation. As
these items all contribute to both capital and operating costs of
the fermentation, elimination of these items in higher temperature
fermentations yields a more economical fermentation process. If the
biocatalyst can operate at higher temperatures, e.g. 30-40.degree.
C. and higher, the need for chilled water is reduced or eliminated
and thus decreasing operating and capital costs for heat exchange
(Banat. I. M. et al. 1998. World Journal of Microbiology and
Biotechnology. 14:809-821)
[0186] In addition to functioning at higher temperature values, a
biocatalyst that can withstand rapid temperature changes in either
direction is particularly valuable. Further, a biocatalyst is
particularly valuable that can withstand short durations of
temperature of ten or more degrees Celsius above or below the
optimum temperature for the fermentation. For example, costs
associated with the control of temperature of a fermentation can be
reduced if the biocatalyst can withstand temperature fluctuations
caused by changes in ambient environmental temperature when no
temperature control is employed. If the biocatalyst can withstand
brief temperature changes, then temperature changes due to operator
error and equipment malfunction will not reduce the productivity of
the biocatalyst below an economic threshold.
[0187] The temperature of the fermentation impacts the number of
potential contaminants. In the temperature range of 25.degree. C.
to 40.degree. C., which is typical for bacterial fermentations,
many microorganisms are viable. Therefore, this temperature may
make continuous operation unfeasible. For batch fermentations in
the temperature range of 25.degree. C. to 40.degree. C., sanitary
equipment and careful aseptic procedures allow for largely
contaminant-free operation, but add expense. At higher temperature
values of 40.degree. C. to 60.degree. C., many bacteria do not grow
or metabolize well. Thus, in an industrial fermentation using a
biocatalyst that functions at higher temperatures, competition from
potential contaminating microorganisms is reduced. This results in
a more economic fermentation because high yield and high
productivity of the desired product is maintained.
[0188] There is a need in the art to generate efficient and
economical biocatalysts for the production of biofuels and
chemicals. There is also a need to generate biocatalysts that not
only use any feedstock or source of carbohydrates available, but
also possess several other performance characteristics that favor
an economical industrial process for the production of biofuels and
chemicals.
[0189] Given the fact that raw materials, primarily the carbon
source such as dextrose or sucrose, represent a large fraction
(30-60% in many cases) of the overall cost of producing biofuels
and chemicals using industrial biological processes, maximizing
conversion yields of sugars to product is of primary importance
(Hermann B G, Patel M. Today's and tomorrow's bio-based bulk
chemicals from white biotechnology: a techno-economic analysis.
Appl. Biochem. Biotechnol. 2007 March; 136(3):361-88; Fan Z, Lynd L
R. Conversion of paper sludge to ethanol, II: process design and
economic analysis. Bioprocess Biosyst Eng. 2007 January;
30(1):35-45). Hence, production organisms as well as associated
processes must be optimized such that conversion yields close to
maximum theoretical are achieved. For instance, early engineered
yeast strains for converting the biomass pentose sugar xylose to
ethanol were based on expressing the oxidoreductases xylose
reductase and xylitol dehydrogenase. As a result of the redox
imbalances and other metabolic constraints, such strains excreted a
large fraction of the utilized carbon source in the form of the
undesirable by-product xylitol instead of the target product
ethanol (Pitkanen et al. 2003. Metabolic Engineering 5:16-31;
Hahn-Hagerdal B, Karhumaa K, Fonseca C, Spencer-Martins I,
Gorwa-Grauslund M F. Appl Microbiol Biotechnol. 2007 April;
74:937-53). Pathway optimization that involved replacement of the
oxidoreductases with a xylose isomerase from anaerobic fungal
sources addressed this critical issue which in turn resulted in
high conversion yields, as well as conversion rates, while
minimizing or eliminating the accumulation or xylitol (Rajgarhia,
Vineet at al. US 20060234364 A1 (2006); Kuyper, M. et al. 2005.
FEMS Yeast Research 5:399-409). In other instances, byproducts may
inhibit the production organism, compromising conversion yields and
rates, as well as product titers. For example, the by-product
acetate significantly inhibits fermentation performance when
engineered E. coli strains are used for the production of ethanol
(Zaldivar J, Ingram L O. Biotechnol. Bioeng. 1999. 66:203-10) or
1,3-propanediol (Cameron, D. C., Altaras, N. E., Hoffman M L, Shaw,
A. J. Biotechnol. Prog. 1998. 14:116-25). In the case of the ABE
process, substantial quantities of carbon are typically diverted to
acetone instead of butanol thus limiting process yields and rates
(Qureshi. N., Blaschek, H. P. J. Ind. Microbiol. Biotechnol. 2001.
27:292-7). Byproducts also pose significant downstream and
separations issues, especially when additional unit operations to
reduce impurity levels below product specifications must be
installed to remove these byproducts. This results in a more
capital intensive process. Additionally, processes with byproducts
have higher operating costs and are potentially more difficult to
operate than processes with little or no byproducts. This is
especially true in cases where byproduct types and concentrations
vary with time or from batch-to-batch. For instance, fermentations
for the production of the biopolymer intermediates L-lactic acid or
1,3-propanediol must generate a product with very tight
specifications with regards to byproduct types and levels, as this
can impact the downstream polymerization process (Grabar T B, Zhou
S, Shanmugam K T, Yomano L P, Ingram L O. Biotechnol Lett. 2006.
28:1527-35; Avraham M. Baniel, Robert P. Jansen, Asher Vitner.
Anthony Baiada. 2006. U.S. Pat. No. 7,056,439).
[0190] For example, biocatalysts may economically convert biomass
into biofuel, to produce fuels that meet at least one of the fuel
specifications established by the American Society for Testing and
Materials (ASTM) after the biofuel is recovered from the
fermentation broth. Such production specification include, but are
not limited to, ASTM D4814 for gasoline, ASTM D910 for aviation
gasoline, ASTM D1655 for aviation turbine fuel, and ASTM D975 for
diesel fuel. Specifications ASTM D4814 for gasoline, ASTM D910 for
aviation gasoline, ASTM D1655 for aviation turbine fuel, and ASTM
D975 for diesel fuel and are hereby incorporated herein by
reference. In the case where an ASTM standard does not exist for a
particular biofuel, for example isobutanol, then a more stringent
standard for use of the compound as a solvent may be consulted, for
example ASTM D1719-05. For example, ASTM standard method D3242 is
referenced in the ASTM specifications to describe the maximum
amount of organic acids that are acceptable in fuels, i.e. less
than 0.10 mg potassium hydroxide/gram fuel is required to
neutralize any acidic material present in the fuel. Biocatalysts
that produce products that meet ASTM specifications without
extensive purification are economically advantageous because
additional processing is not required to remove organic acid
impurities from the product.
[0191] In another example, undesirable byproducts such as
aldehydes, ketones, and ethers, which give rise to oxidative
degradation of the fuel or participate in the formation of unstable
deposits in fuel systems, must be removed (Zrelov, V. N et al.
USSR. Korroziya i Zashchita v Neftegazovoi Promyshlennosti. 1972.
5:12-15; Zrelov, V. N. USSR. Itogi Nauki, Tekhnologiya
Organicheskikh Veshchestv. 1968. 1967:5-78). Undesirable byproducts
such as aldehydes, ketones, and ethers are incompatible with
aviation fuels, which must pass ASTM specifications for oxidative
stability (ASTM D3241) and gum content (ASTM D381). Thus,
biocatalysts used to produce biofuels that produce less aldehydes,
ketones, and ethers are more economical than biocatalysts that
produce higher quantities of these compounds. Similarly,
biocatalysts must not produce any byproducts or impurities which
may lead to metal corrosion. Biofuels produced by the biocatalysts
should be capable of passing a 2-hour copper corrosion test at
100.degree. C. (ASTM D130).
[0192] In an economical industrial fermentation process, a
biocatalyst produces a high level, or titer, of the desired
product. A high product titer reduces the cost of downstream
processing and product separation and can reduce the operating
costs associated with purification of the product. In a
fermentation process to produce a biofuel, the higher the biofuel
concentration, the less cost of recovering that biofuel from the
fermentation broth during product recovery. High product titers
also reduce the waste streams coming out of the fermentation and
out of the downstream processing, which reduces the overall process
cost. In order for a biocatalyst to produce high levels of biofuel
during fermentation, the biocatalyst must be tolerant and resistant
to high levels of the biofuel.
[0193] Biofuels, such as linear and branched alcohols, alkanes, and
aromatics have different levels of hydrophobicity. Table 3 lists
some properties of linear and branched chain alcohols, some of
which are biofuels. Hydrophobicity is commonly measured by the
octanol:water partition coefficient (P) or expressed as the
logarithm of this value (log P) (Laane, C. 1987. Biotechnology and
Bioengineering 30). The toxicity of a compound, like a biofuel,
correlates with the log P of the compound when log P is between 1
and 4. Within the range of 0 to 1, a compound with a higher log P
is generally more toxic to a cell than a compound with a lower log
P (Heipieper. H. et al. 2007. Applied Microbial. Biotechnology
74:961-973). Compounds with a log P value of greater than 1 are
generally less toxic to biocatalysts than compounds with a log P
value of 0 to 1.
[0194] Little prior art exists relating to the resistance of
biocatalysts to biofuels and related compounds during their
production. Most biofuel resistance prior art is related to the
resistance of cells to externally applied biofuels, solvents, or
similar compounds. It has been found that resistance of a biofuel
or related compound by cells that are producing the compound versus
cells that are simply exposed to the compound externally may not be
identical. Specifically, relevant resistance limits in the prior
art that are levels produced by the organism, and not added
externally, include ethanol at 97 g/L, produced in yeast (Lin, Y.
et al. 2006 Appl. Microbiol. Biotechnol. 69:627-642); butanol at 21
g/L (Chen, C. K. 1999 Applied Microbiology and Biotechnology 52;
Formanek, J 1998 WO 98/51813; Blascheck, H. 2002 U.S. Pat. No.
6,358,717 BI), and isopropanol at 5.5 g/L (Groot, W. 1986.
Biotechnology Letters 6(11)) produced in bacteria (Clostridium);
octanol at 20 g/L; but the solubility limit is <1.1 g/L so
remaining partitions out in two-phase system used (Chen, Q. 1995.
Journal of Bacteriology 177(23)); decanol at 750 mg/L, and
dodecanol at 310 mg/L, produced in bacteria (gram negative
bacteria) (Elgaali, H. 2002 Joumal of Basic Microbiology 42(6) and
Hamilton-Kemp, T. 2005. Current Microbiology 51); isobutanol
produced in yeasts at 1800 mg/L (Golubkov, I. WO 2005040392A1).
[0195] The biocatalyst of the invention produces high levels of
biofuel during a fermentation process and is resistant to high
levels of the biofuel product. The biocatalyst of this invention
functions normally or with minimal impairment in the presence of
high levels of biofuel product. Tert-butanol appears to be made
only synthetically from petrochemical routes and no prior art
describing the production of tert-buanol in a biocatalyst exists.
Hexanol is reportedly produced in yeast fermentations of grape
feedstocks during the production of wine in very small amounts.
Concentrations in the range of 1-5 mg/L have been documented as a
fermentation product during the production of wines (Garde-Cerdan,
T. 2006 Eur. Food Res. Technol. 222: 15-25 and Malacrino, P 2005
Letters in Applied Microbiology, 40: 466-472).
TABLE-US-00003 TABLE 3 Properties of some biofuel compounds.
Solubility in water Compound (20.degree. C., unless noted) log
P.sup.1 2-propanol miscible 0.14 1-propanol miscible 0.34
tert-butanol Very good (>100 g/L) 0.4 2-butanol 125 g/L 0.6
isobutanol 85 g/L @ 25.degree. C. 0.79 1-butanol 77 g/L 0.88
1-hexanol 5.9 g/L 2.03 1-octanol 0.30 mg/L 3 1-decanol insoluble
3.97 .sup.1Data from International Programme on Chemical Safety
INCHEM http://www.inchem.com; Kabelitz, N. 2003 FEMS Microbiology
Letters 220.
[0196] In an economic fermentation process, as many of the products
of the fermentation as possible, including the co-products that
contain biocatalyst cell material, should have value. Insoluble
material produced during fermentations using grain feedstocks, like
corn, is frequently sold as protein and vitamin rich animal feed
called distiller's dried grains (DDG). The term may also include
soluble residual material from the fermentation and is then
referred to as "distillers dried grains and solubles" (DDGS). To be
a valuable animal feed, the spent biocatalyst material that is part
of the insoluble fraction produced during the fermentation process
must not degrade the feed quality of the DDG or DDGS.
[0197] Corn dry milling can be used to provide a low cost substrate
for biofuel production. Corn dry milling and fermentation result in
a substantial volume of the co-product DDG or DDGS, which make up
about 35% of the initial corn dry mass. DDG or DDGS are typically
used as cattle feed.
[0198] One example of an element of toxicity in some biocatalysts
is endotoxin. Endotoxin commonly refers to the component of the
outer membrane of gram negative bacteria called lipopolysaccharide,
or LPS, or a portion of the LPS molecule. LPS is a structural
feature of gram negative bacteria and provides a barrier separating
the cell from the external milieu, with particular protection from
hydrophobic compounds. Endotoxin may be immunogenic and toxic to
animals and is therefore not desirable or desirable in very low
levels in biocatalysts that may be sold as a component of DDG or
DDGS.
[0199] Some genera of bacteria, like the enteric bacteria Shigella,
Escherichia, and Salmonella, contain endotoxin that can be
especially immunogenic and toxic. One example is the toxicity of
the LPS of a pathogenic E. coli 011:B4 that was measured to be
LD50=18 mg/kg in rat toxicity testing (Fletcher, M. A., et al.
Journal of Surgical Research 1993 55:147-154). There are reports on
the different levels of toxicity of endotoxin among different
strains of bacteria (Mayer, H. 1984. Reviews in Infectious Diseases
6(4); Barasoain, I. 1979. Revista Clinica Espanola 155(3)). For
example, LPS was extracted from microorganisms present in the rumen
of cattle and the toxicity of this LPS was compared to E. coli and
Salmonella LPS (Nagaraja, T. G. et al. 1978. Journal of Animal
Science 47:226-234). The toxicity of the E. coli and Salmonella LPS
was at least four to six times more toxic than that extracted from
rumen microorganisms, indicating variable toxicity of LPS among
different bacteria. Additionally, endotoxin toxicity can vary among
strains of the same species of gram negative bacteria and levels
can even be completely non-toxic in some strains (Mayer, H. et al.
1984. Rev. Infect. Dis. 6:542-545). Therefore, naturally occurring
gram negative strains can be identified that have low endotoxin
levels or low endotoxin toxicity. Selection of a biocatalyst for
the production of biofuels that has low endotoxin levels or low
endotoxin toxicity increases the value of the fermentation process
because the spent biocatalyst may be used in a DDG or DDGS
co-product. Further, modification of a biocatalyst to reduce
endotoxin levels or lower endotoxin toxicity increases the value of
the fermentation process because the spent biocatalyst may be used
in a DDG or DDGS co-product.
[0200] There are some reports regarding reducing the toxicity of
endotoxin while retaining immunogenicity for the application of
vaccine development (Steeghs L. et al. 2004. Joumal of Endotoxin
Research 10(2); Van der Ley, P. et al. 2001. Infection and Immunity
69(10); Van der Ley, P. et al. WO2000026384). Therefore, it is
possible to reduce the toxicity of endotoxin in strains of gram
negative bacteria. However, there are no reports of a biocatalyst
for the production of biofuels through fermentation being modified
to reduce the levels or toxicity of endotoxin.
[0201] Another type of toxin present in some microorganisms is an
exotoxin. An exotoxin is a protein released extracellularly by a
microorganism as it grows and produces immediate damage to animals
and animal cells. Most exotoxins fall into one of three categories,
which include cytolytic toxins, A-B toxins, and superantigen
toxins. Cytolytic toxins enzymatically attack cell components and
cause lysis. The A-B toxins are two-component toxins that permit
transfer of one component into the target cell through the membrane
and cause damage to the target cell. Superantigen toxins stimulate
large numbers of immune response cells and cause damage to the
target organism. Exotoxins can be produced by both gram positive
and gram negative bacteria and higher organisms, like fungi and
yeasts. The presence of exotoxins in DDG or DDGS renders the DDG or
DDGS inedible (not feed grade) and invaluable. Therefore, a
biocatalyst that produces biofuels by fermentation and becomes part
of the DDG or DDGS product must not produce any exotoxins.
Exclusion of exotoxins from a biocatalyst strain can be
accomplished by selecting exotoxin-free strains or modifying
exotoxin-producing strains such that they no longer produce
exotoxins. Exotoxins are proteins and thus can be inactivated by
being degraded. A common mechanism of protein inactivation or
degradation is digestion of the protein by specialized enzymes
called proteases. Another common mechanism of protein inactivation
or degradation is digestion of the protein by specialized enzymes
called peptidases. Another common mechanism of protein inactivation
or degradation is digestion of the protein by specialized enzymes
called amidases. Table 4 lists some common exotoxins.
TABLE-US-00004 TABLE 4 Common exotoxins produced by microorganisms.
Organism Disease Toxin or factor* Action Bacillus anthracis Anthrax
Lethal factor (LF) PA is the cell-binding B Edema factor (EF)
component, EF causes Protective antigen edema, LF causes cell (PA)
(AB) death Bacillus cereus Food poisoning Enterotoxin (?) Induces
fluid loss from intestinal cells Bordetella pertussis Whooping
cough Pertussis toxin (AB) Blocks G protein signal transduction,
kills cells Clostridium botulinum Botulism Neurotoxin (AB) Flaccid
paralysis Clostridium tetani Tetanus Neurotoxin (AB) Spastic
paralysis Clostridium Gas gangrene, .alpha.-Toxin (CT) Hemolysis
(lecithinase) perfringens food .beta.-Toxin (CT) Hemolysis
poisoning .gamma.-Toxin (CT) Hemolysis .delta.-Toxin (CT) Hemolysis
(cardiotoxin) .chi.-Toxin (E) Collagenase .lamda.-Toxin (E)
Protease Enterotoxin (CT) Alters permeability of intestinal
epithelium Corynebacterium Diphtheria Diphtheria toxin (AB)
Inhibits protein synthesis in diphtheriae eukaryotes Escherichia
coli Gastroenteritis Enterotoxin (AB) Induces fluid loss from
(enteropathogenic intestinal cells strains only) Pseudomonas P.
aeruginosa Exotoxin A (AB) Inhibits protein synthesis aeruginosa.
infections Salmonella spp Salmonellosis, Enterotoxin (AB) Inhibits
protein synthesis typhoid fever, and lyses host cells paratyphoid
Cytotoxin (CT) Induces fluid loss from fever intestinal cells
Shigella dysenteriae Bacterial Enterotoxin (AB) Inhibits protein
synthesis Staphylococcus dysentery .alpha.-Toxin (CT) Hemolysis
aureus Pyrogenic Toxic shock syndrome Systemic shock (pus-forming)
toxin (SA) infections Exfoliating toxin A Peeling of skin, shock
(boils, and so and B (SA) on), Leukocidin (CT) Destroys leukocytes
respiratory .beta.-Toxin (CT) Hemolysis infections, .gamma.-Toxin
(CT) Kills cells food .delta.-Toxin (CT) Hemolysis, leukolysis
poisoning, Enterotoxin A, B, C, D, Induce vomiting, diarrhea, toxic
shock and E (SA) shock syndrome, Coagulase (E) Induces fibrin
clotting scalded skin syndrome Streptococcus Pyrogenic Streptolysin
O (CT) Hemolysin pyogenes infections, Streptolysin S (CT) Hemolysin
tonsillitis, Erythrogenic toxin (SA) Causes scarlet fever rash
scarlet fever Streptokinase (E) Dissolves fibrin clots
Hyaluronidase (E) Dissolves hyaluronic acid in connective tissue
Vibrio cholerae Cholera Enterotoxin (AB) Induces fluid loss from
intestinal cells *AB, A-B toxin; CT, cytolytic toxin; E, enzymatic
virulence factor; SA, superantigen toxin; ?, not classified.
[0202] Economic studies indicate that the predominant factor
accounting for the production cost for commodity chemicals and
biofuels from fermentation processes is attributed to the feedstock
cost. An important measure of the process economics is therefore
the product yield. Complete substrate utilization is one of the
prerequisites to render biofuel processes economically competitive.
Therefore, not only must the biocatalyst convert all carbon sources
within a feedstock to the biofuel, it must also perform this
conversion to near completion. The ABE process reaches a 80%
theoretical yield of butanol, corresponding to 0.33 g butanol/g
glucose (Jones, D. T. and Woods, D. R. Acetone-Butanol Fermentation
revisited. Microbiological Review 1986, 50:484-524). As an example
for a commodity chemical produced by fermentation, the ethanol
fermentation process of sugar and starch generally reaches 90-95%
of the theoretical yield, equivalent to 0.45-0.48 g/g sugar in the
raw material. Typical yields for other processes are shown in Table
5, below.
TABLE-US-00005 TABLE 5 Typical yields of fermentation processes.
Yield Document % of Biomass Name Strain Substrate Product g
g.sup.-1 theoretical g g.sup.-1 Liu Journal of Torulopsis glucose
pyruvate 0.49 50 Applied glabrata Microbiology 100 (2006) p.
1043-1053 Liu Journal of Torulopsis glucose pyruvate 0.52 53
Applied glabrata Microbiology (engineered) 100 (2006) p. 1043-1053
Elbing Applied and Saccharo- glucose ethanol 0.33 63 Environmental
myces Microbiology 70 cerevisiae (2004) p. CEN. PK2-1C 5323-5330
Papagiann Lactococcus glucose lactate 96 Microbial Cell lactis spp.
lactis Factories 6 (2007) LM0230 Fong E. coli glucose lactate 0.7
Biotechnology and MG1655 Bioengineering (pta, adhE), 91 (2005) p.
evolved 643-648 Zhu Applied E. coli glucose lactate 0.73
Microbiology and BW25113 Biotechnology (pfl) 64 (2004) p. 367-375
PCT Patent Kluyveromyces glucose lactate 0.89 89 WO03102200A
marxianus 2 (PDC) Das Neves Journal Zyrpomonas glucose ethanol 0.48
94 0.03 of Food Process mobilis Engineering 30 NBRC 13758 (2007) p.
338-356 Das Neves Journal Saccharomyces glucose ethanol 0.43 84
0.08 of Food Process cerevisiae Engineering 30 (2007) p. 338-356
Smits Yeast 16 Saccharomyces glucose ethanol 0.35 0.08 (2000) p.
cerevisiae 1325-1334 CEN. PK. K45 Huang Applied Candida glucose
glycerol 0.51 Biochemistry and krusei Biotechnology 98-100 (2002)
p. 909-920 Qureshi Food E. coli xylose ethanol 0.47 and Bioproducts
(engineered) Processing 84 (2006) p. 114-122 Causey Proceedings E.
coli glucose acetate 86 of the National (engineered) Academy of
Sciences 100 (2003) p. 825-832 Grabar E. coli B glucose lactate
0.98 98 Biotechnology (engineered) Letters 28 (2006) p. 1527-1535
Causey Proceedings E. coli W3110 glucose pyruvate 0.75 77.9 of the
National (engineered) Academy of Sciences 101 (2004) p. 2235-2240
Danner Chemical Acetobacter acetate 0.55 80 Society Reviews 28
(1999) p. 395-405 Kwon Journal of Candida xylose xylitol 0.9
Bioscience and tropicalis Bioengineering KCTC 10457 101 (2006) p.
13-18 Roca Applied and Saccharomyces glucose ethanol 0.42 80
Environmental cerevisiae Microbiology 69 TMB 3001 (2003) p.
4732-4736 Zhou Biotechnology E. coli B glucose lactate 0.98 98 1.67
Letters 28 (2006) (engineered) p. 663-670 Geertman Metabolic
Saccharomyces glucose glycerol 0.46 0.073 Engineering 8 cerevisiae
(2006) p. 532-542 (engineered) U.S. Pat. No. Candida glucose
lactate 0.9 0.9 5.1 7,141,410 sonorensis (engineered)
[0203] For a biocatalyst to produce a bioue most economically, a
single product is desired. Extra products reduce primary product
yield increasing capital and operating costs, particularly if those
extra, undesired products have little or no value. Extra products
also require additional capital and operating costs to separate
these products from the product or biofuel of interest.
[0204] Low cost biofuels production technology for converting a
variety of plant based feedstocks to biofuels is required for an
economic business system. Low cost feedstock, low cost carbohydrate
hydrolysis technology, efficient biofuel recovery and purification
technology, and a low cost and efficient biocatalyst for conversion
of carbohydrates to the targeted biofuel or biofuel intermediate
are required. A critical characteristic of the low cost and
efficient biocatalyst is that maximum biocatalyst efficiency can be
obtained with a low cost nutrient source. Biocatalysts require a
nitrogen source, a carbon source, trace minerals, and, in some
cases, amino acids or vitamins. Often, complex nutrient sources,
such as yeast extract, tryptone and peptone, are utilized to
provide nitrogen, amino acids, trace minerals, and vitamins
required for biocatalyst growth and biofuels production. However,
these complex nutrient sources, while effective, are costly at
typical concentrations utilized. Lower cost complex nutrient
sources include corn steep liquor, soy bean meal, and other protein
containing streams, which, done inadvertently through typical
processing or done intentionally, are hydrolyzed to yield amino
acids, vitamins, as well as minerals. Nutrient sources of this type
are typically low cost, but can impact the recovery process
negatively. Many times, a significant quantity of nutrients needs
to be added (1 or more percent by weight of the fermentation broth)
which adds to the cost both of the nutrient and the recovery
process. Defined nutrient packages containing a nitrogen source,
vitamins, and amino acids, as well as trace minerals, can be used
for many biocatalysts. This type of media is a low cost nutrient
source for biofuels production, as well as for the recovery and
purification of biofuels. In one embodiment, a nutrient package
provides maximum efficiency function of the biocatalyst, e.g.,
volumetric productivity, yield and final biofuel concentration, and
has the lowest combined cost for the nutrient itself and the cost
impact on downstream biofuel processing. In an embodiment, a
biocatalyst utilizes a low cost nutrient package that provides
biocatalyst and process efficiency so as to yield the lowest cost
biofuel production.
[0205] Economical production of biofuels from biomass-derived
organic compounds via fermentation processes depends upon
biocatalysts that catalyze this conversion as described herein. A
method of producing biofuels makes use of biocatalysts that exhibit
certain properties which decrease the cost of the fermentation
component of the biofuel production process. An important
characteristic of the biocatalyst is the use of a low cost nutrient
package that provides efficient biocatalyst function and reduces
product recovery costs. The low cost nutrient package may include
one, or more of carbohydrates, organic compounds, minerals, amino
acids, oils, vitamins, salts, and spent biocatalyst from
fermentations. It is important that the biocatalyst functions in a
low cost and efficient manner within the overall biofuels
production process on the low cost nutrient package. A business
strategy is disclosed that employs the use of an economical method
for the production of biofuels. Low cost biofuel production
requires the biocatalyst to provide optimal productivity and yield
on carbohydrate and biofuel concentration. Low cost nutrients and
biocatalyst performance should support low cost recovery and
purification of the biofuel. A biocatalyst with these performance
characteristics for the production of a biofuel yields a process
that is economically favorable for the production of a commodity
biofuel or chemical.
[0206] Fermentation biocatalysts require nutrients to grow and
support cellular metabolism. However, nutrients have a cost and any
unconsumed nutrient added must ultimately be removed from the
product. Product recovery and purification typically accounts for
substantially more than 50% of the capital cost of a fermentation
process. For low cost products, such as biofuels, typically greater
than 80% of the capital cost results from product recovery and
purification. Product recovery costs, composed mainly of energy
costs, often approach 50% of the variable cash operating costs and
increase as the number and amount of byproducts or unconsumed
nutrients present increase. The cost of a fermentation process may
be decreased by minimizing the number and amount of nutrients added
and by using low cost nutrients.
[0207] Feedstocks vary in their nutrient content. Therefore, the
low cost nutrient package for a biocatalyst will vary depending on
the specific feedstock used. For example, high dextrose corn syrup
contains very little nutrients other than the dextrose, requiring
the addition of several nutrients before use in a fermentation. In
another example, a dry milled corn stream from a jet cooker
contains many nutrients and functions as a stand-alone nutrient
package and feedstock for biofuel fermentation. However, addition
of very specific nutrients, such as a nitrogen source, at low cost,
can improve the fermentation performance resulting in a lower
biofuel production cost.
[0208] Some industrially useful biocatalysts synthesize all of the
materials required to build and maintain a cell from very simple
sources of major and minor bioelements. Simple sources of major and
minor bioelements are monomeric sugars and salts containing cations
such as ammonia, calcium, sodium, potassium, and anions such as
sulfate, phosphate and nitrate (van Dijken J P, Weusthuis R A,
Pronk J T, Kinetics of growth and sugar consumption in yeasts,
Antonie Van Leeuwenhoek. 1993:63(3-4):343-52; and Chemical
Marketing Reporter). Generally. these simple sources of major and
minor bioelements are the least expensive. Other industrially
useful biocatalysts can grow using simple sources of major and
minor bioelements only if they are supplemented with a small amount
of one or two more expensive nutrients, such as vitamins or amino
acids. The use of more expensive nutrients is not necessarily
prohibitive, if used sparingly. For example, vitamins are costly on
a unit mass basis but typically single digit part per million
concentrations may be all that is required to supplement the
nutrients of a biocatalyst to allow growth of the biocatalyst or
increase performance of the biocatalyst in a biofuel production
process. In general, for an economic process, materials that are
relatively expensive per unit mass must be used sparingly, and
lower cost nutrients may be used in larger quantities.
[0209] The addition of a more expensive nutrient can be economical
if it results in an improved performance of the fermentation,
resulting in higher productivities and product concentrations
(Thomas K C, Ingledew W M, Fuel alcohol production: effects of free
amino nitrogen on fermentation of very-high-gravity wheat mashes,
Appl Environ Microbiol. 1990 July; 56(7):2046-50; Casey G P, Magnus
C A, Ingledew W M, High-Gravity Brewing: Effects of Nutrition on
Yeast Composition, Fermentative; Ability, and Alcohol Production,
Appl Environ Microbiol. 1984 September; 48(3):639-646; Wood B E,
Yomano L P, York S W, Ingram L O, Development of
industrial-medium-required elimination of the 2,3-butanediol
fermentation pathway to maintain ethanol yield in an ethanologenic
strain of Klebsiella oxytoca, Biotechnol Prog. 2005
September-October; 21(5):1366-72; and Wang F Q, Gao C J, Yang C Y,
Xu P, Optimization of an ethanol production medium in very high
gravity fermentation, Biotechnol Lett. 2007 February; 29(2):233-6.
Epub 2006 Nov. 8.) Higher productivities result in lower capital
costs and lower operating costs. Higher product concentrations
reduce the operating costs, particularly energy costs, and
typically provide a higher product to impurity ratio with respect
to the final product to the fermentation broth processed. However,
in an embodiment, the biocatalyst performs at its highest
productivity using only low cost major and minor bioelements as the
low cost nutrient package in addition to the feedstock.
[0210] Fermentation vessels and downstream processing equipment of
a biofuel manufacturing facility can be built from different
materials, depending on the composition of the fermentation broth.
Stainless steel is frequently used because it is more resistant to
corrosion caused by chloride ions in the aqueous solutions.
However, even stainless steel can be damaged by chloride ions that
get incorporated into the steel and lead to stress corrosion
cracking of the stainless steel. Carbon steel is a lower cost
alternative to stainless steel. It is less resistant to corrosion
caused by chloride ions and can therefore only be used as building
material if the chloride content of the fermentation broth is
minimized. Also, the lifetime of the equipment that is in contact
with the fermentation broth is shorter when high concentrations of
chloride ions are present. This is associated with higher operating
costs due to higher maintenance costs and faster capital
depreciation.
[0211] Chlorine is one of the major bioelements required for growth
of microorganisms. The amounts of chloride necessary to support
growth and metabolic activity of biocatalysts are strain specific.
A biocatalyst that functions at low concentrations of chloride ions
allows the use of lower cost material, such as carbon steel for the
fermentation equipment. Such a biocatalyst reduces capital and
operating costs of a biofuel production facility.
[0212] For an economical process, it is essential that the
biocatalyst used performs as well in a medium composed of only
inexpensive nutrients in addition to the feedstock as it does in
more expensive medium. For the production of biofuels, a
performance parameter is the yield of biofuels produced from
feedstock. Typically, a yield of greater than 0.35 g/g of biofuel
on six-carbon sugars is required for an economically viable
process.
[0213] Biocatalysts for the fermentative production of biofuels
require some nutrients in order to grow cells and produce the
biofuel(s) of interest. Biocatalysts uptake some of the
carbohydrate feedstock in order to grow and convert most of the
feedstock into a targeted biofuel. In addition to the carbohydrate
feedstock, microorganisms require mineral salts, amino acids,
lipids and vitamins to grow and produce biofuels. In many cases,
complex nutrient sources, such as yeast extract, peptone, corn
steep liquor, soy protein meal, and other sources that include some
or all of the microorganism requirements, are utilized to meet the
microorganism needs. Sometimes, the complex nutrients are
`processed` with enzymes, acids, etc., in order to hydrolyze
insoluble components into solution.
[0214] The objective of adding nutrients is to provide for
biocatalyst growth and conversion of carbohydrates to biofuels. The
cost of nutrients directly, and the cost of removing the unused
nutrients downstream, is balanced by the productivity and final
concentration that the biocatalyst can achieve with the nutrients
added. The source of carbohydrate feedstock also impacts the type
and quantity of fermentation nutrients required. A pure
carbohydrate source with no impurities will require addition of a
complete nutrient medium. For a low cost business system or method
to produce a biofuel, some impurities in the carbohydrate feed may
be acceptable. Carbohydrates produced by extraction of sugar from
sugar cane, hydrolysis of cellulosic biomass, dry milling of corn
and wet milling of corn all contain some impurities.
[0215] Microorganisms can be classified by their oxygen
requirements. Aerobic microorganisms, or aerobes, require oxygen
for metabolism and survival. The amount of oxygen required by
different aerobes may vary. Anaerobic microorganisms, or anaerobes,
do not require oxygen for metabolism or survival. Some anaerobes
tolerate the presence of oxygen, while others do not. Still other
microorganisms can grow and metabolize either with or without
oxygen present in their environment. These microorganisms are
referred to as facultative anaerobes (Gottschalk, G, "Bacterial
Metabolism" 2nd Ed. Springer-Verlag New York, 1986).
[0216] The presence of oxygen may lead to the generation of
highly-reactive oxygen species. For example, hydrogen peroxide,
superoxide anion, and hydroxyl radicals, may damage the cell in a
number of ways. The presence of reactive oxygen species can lead to
protein, DNA, and membrane damage. Most organisms contain genes
coding for defense mechanisms against toxic oxygen species like
superoxide dismutase, and catalase. These enzymes degrade the
reactive oxygen species (Storz, G, Hengge-Aronis, R, Bacterial
Stress Response, 2000, ASM Press Washington D.C.). Many anaerobic
microorganisms do not have these defense mechanisms and therefore
are vulnerable to the presence of even small amounts of oxygen in
their environment, which can lead to the generation of toxic oxygen
species. Some anaerobes contain superoxide dismutase and can
therefore tolerate exposure to oxygen for brief periods of time
(McCord, J M, et al., 1971 PNAS, 68:1024-1027). During exposure to
oxygen these strains survive in a state of suspended animation,
meaning that they stop growth and metabolism. After oxygen is
removed from the environment surrounding the microorganism, cells
start growing and metabolizing again.
[0217] In an anaerobic fermentation process under anaerobic
conditions, oxygen is excluded from the process. Usually, the
fermentation broth is stripped of oxygen through application of
heat or oxygen-free gasses, like nitrogen or carbon dioxide, at the
beginning of the fermentation. During the fermentation, oxygen is
prevented from entering the fermentation broth by a cushion of
oxygen-free gas above the surface of the broth and maintenance of
pressure inside the fermenter. If oxygen gets into a fermentation
that uses a strictly anaerobic biocatalyst, growth and metabolism
may cease and the cells may no longer function as a biocatalyst.
Even if oxygen is removed from the fermentation after some time,
the cells may be damaged and no longer function as a
biocatalyst.
[0218] If oxygen gets into a fermentation that uses an anaerobic
biocatalyst that can tolerate oxygen for brief periods of time,
growth and metabolism cease and productivity of the process is
reduced as long as oxygen is present. Once oxygen is then removed
from the fermentation after some time, the cells are viable and the
biocatalyst does regain its productivity.
[0219] If oxygen gets into a fermentation that uses a facultative
anaerobic biocatalyst that can grow and metabolize in the presence
as well as in the absence of oxygen, the biocatalyst metabolizes
oxygen. Because aerobic metabolism is more energy efficient than
anaerobic metabolism in these organisms, the organisms shift their
metabolism to aerobic metabolism as long as oxygen is present,
which may lead to undesired results in the fermentation. For
example, oxygen used for respiration leads to undesired loss of
carbon to carbon dioxide and reduced yield of the desired biofuel
product. If the influx of oxygen into the fermenter is stopped, the
oxygen present in the fermenter is consumed by the biocatalyst.
Once oxygen is removed from the fermentation after some time, the
cells are viable and the biocatalyst regains its productivity.
[0220] In some cases, it is economically advantageous to use a
biocatalyst that can tolerate small amounts of oxygen without
reducing process performance, such as productivity or yield,
throughout a fermentation process. A fermentation that does not
completely exclude oxygen is operated more economically. The
operating costs are reduced because less oxygen-free gas is
required for the fermentation and measures to remove oxygen from
the fermentation broth, such as application of heat or steam, are
reduced or not required. It is known in the art that the cryogenic
production of oxygen-free inert gasses, such as nitrogen, helium,
or carbon dioxide, is possible. However, at large scale, the use of
oxygen-free inert gasses to maintain oxygen-free conditions would
add cost to a fermentation process. An alternative strategy to
produce low oxygen inert gasses is also known in the art. Pressure
swing adsorption (PSA) is a method for the generation of inert
gasses that contain about 0.5% oxygen or less. The use of PSA
generates oxygen-limited inert gasses at about one-third the cost
of cryogenically-produced gasses. However, PSA generates gases that
would be unsuitable for a completely oxygen-free process because of
the trace amounts of oxygen present. A biocatalyst for the
production of biofuels that can tolerate 0.5% oxygen would be
unaffected and therefore quite valuable in the art. Further,
fermentations that are operated on large scales require large
fermentation vessels that may not be oxygen impermeable. This is
because building large fermentation vessels that completely exclude
oxygen require higher capital investment.
[0221] Productivity has an impact on capital costs for a biofuel
plant and depends on the amount of biocatalyst used during the
fermentation and the specific activity of the biocatalyst.
Volumetric productivity of the biocatalyst shortens the process
time and, therefore, for a given plant size, increases the output
of the plant over the plant lifetime. This increases the return on
the capital investment and decreases the cost of the biofuel.
[0222] Any one of the biocatalyst properties discussed herein may
have a positive effect on the process economics of a biofuel
production process. However, the biocatalyst should have a
combination of several or all of these properties to permit an
economic biofuel production process. For example a biocatalyst that
produces a biofuel from biomass derived carbon sources with the
addition of few or no nutrients in addition to the feedstock, at
high productivity, titer and yield may produce biofuel more
economically than a biocatalyst that only has one of these four
properties. The combination of the different process biocatalyst
properties discussed supra into one biocatalyst may result in a
biocatalyst that allows a biofuel production process to be more
economical than would be expected from the sum of the effects of
the individual properties. For example if the biocatalyst does not
contain DNA markers, nor produces toxins, then the economic effect
of these properties is larger than the economic effect of either of
these properties alone. The combination of these properties allows
the DDGS of the biofuel production process to be used as animal
feed, which is not possible if the biocatalyst has DNA markers or
if the biocatalyst produces toxins. Use of DDGS as animal feed is
the most economical use of spent biocatalyst available for a
biofuel production process.
[0223] The biocatalyst properties discussed herein may not provide
equal economic value to the biofuel production process. For example
yield, titer and productivity may have a larger impact on process
economics than oxygen tolerance or pH tolerance. The most preferred
biocatalyst properties are yield, titer and productivity followed
by operating temperature and pH ranges, lack of byproducts, high
growth rate, and operation with only feedstock and mineral salts
added. The other properties described herein also have economic
value for the biofuel production process.
[0224] Accordingly, the engineered isobutanol pathway to convert
pyruvate to isobutanol can be, but is not limited to, the following
reactions:
[0225] 1. 2 pyruvate.fwdarw.acetolactate+CO2
[0226] 2.
acetolactate+NADPH.fwdarw.2,3-dihydroxyisovalerate+NADP+
[0227] 3. 2,3-dihydroxyisovalerate.fwdarw.alpha-ketoisovalerate
[0228] 4. alpha-ketoisovalerate.fwdarw.isobutyraldehyde+CO2
[0229] 5. isobutyraldehyde+NADPH.fwdarw.isobutanol+NADP+
[0230] These reactions are carried out by the enzymes 1)
Acetolactate Synthase (ALS), 2) Ketol-acid Reducto-Isomerase
(KARI), 3) Dihydroxy-acid dehydratase (DHAD), 4) Keto-isovalerate
decarboxylase (KIVD), and 5) an Isobutyraldehyde Dehydrogenase
(IDH).
[0231] Plasmids disclosed herein were generally based upon parental
plasmids described previously (Lutz, R. & Bujard, H. (1997)
Nucleic Acids Research 25(6):1203-1210). pGV1698 and pGV1655
produce optimized levels of isobutanol pathway enzymes in a
production host when compared to other expression systems in the
art. Compared to the expression of the isobutanol pathway from
pSA55 and pSA69 as described in (WO 2008/098227) BIOFUEL PRODUCTION
BY RECOMBINANT MICROORGANISMS, pGV1698 and pGV1655 lead to higher
expression of ilvC and alsS and lower expression levels for kivd
and ilvD. These changes are the result of differences in plasmid
copy numbers. Also the genes coding for ilvD and ilvC were codon
optimized for E. coli. This leads to optimized expression of the
genes and it also avoids recombination of these genes with their
native copies on the E. coli chromosome, thus stabilizing the
production strain. The combination of two plasmids with the pSC101
and the ColE1 origin of replication in one cell as realized in a
production strain carrying pGV1698 and pGV1655 is known to be more
stable than the combination of two plasmids with p15A and ColE1
origins respectively as was used in the prior art ((WO 2008/098227)
BIOFUEL PRODUCTION BY RECOMBINANT MICROORGANISMS).
[0232] SA237 is a derivative of JCL260, both of which was described
in the art ((WO 2008/098227) BIOFUEL PRODUCTION BY RECOMBINANT
MICROORGANISMS). SA237 was shown to produce isobutanol.
[0233] It is understood that a range of microorganisms can be
modified to include a recombinant metabolic pathway suitable for
the production of isobutanol. It is also understood that various
microorganisms can act as "sources" for genetic material encoding
target enzymes suitable for use in a recombinant microorganism
provided herein.
[0234] The exogenous nucleic acid molecule contained within a host
cell of the disclosure can be maintained within that cell in any
form. For example, exogenous nucleic acid molecules can be
integrated into the genome of the cell or maintained in an episomal
state that can stably be passed on ("inherited") to daughter cells.
Such extra-chromosomal genetic elements (such as plasmids, etc.)
can additionally contain selection markers that ensure the presence
of such genetic elements in daughter cells. Moreover, the host
cells can be stably or transiently transformed. In addition, the
host cells described herein can contain a single copy, or multiple
copies of a particular exogenous nucleic acid molecule as described
above.
[0235] Host microorganisms within the scope of the invention may
have reduced enzymatic activity such as reduced alcohol
dehydrogenase activity. The term "reduced" as used herein with
respect to a particular enzymatic activity refers to a lower level
of enzymatic activity than that measured in a comparable host cell
of the same species. Thus, host cells lacking alcohol dehydrogenase
activity are considered to have reduced alcohol dehydrogenase
activity since most, if not all, comparable host cells of the same
species have at least some alcohol dehydrogenase activity. Such
reduced enzymatic activities can be the result of lower enzyme
expression level, lower specific activity of an enzyme, or a
combination thereof. Many different methods can be used to make
host cells having reduced enzymatic activity. For example, a host
cell can be engineered to have a disrupted enzyme-encoding locus
using common mutagenesis or knock-out technology.
[0236] Genes that are deleted or knocked-out to produce the
microorganisms herein disclosed are exemplified for E. coli. One
skilled in the art can easily identify corresponding, homologous
genes or genes encoding for enzymes which compete with the
isobutanol producing pathway for carbon and/or NAD(P)HNADH in other
microorganisms by conventional molecular biology techniques (such
as sequence homology search, cloning based on homologous sequences,
and other techniques, etc.). Once identified, the target gene(s)
can be deleted or knocked-out in these host organisms according to
well-established molecular biology methods.
[0237] In an embodiment, the deletion of a gene of interest occurs
according to the principle of homologous recombination. According
to this embodiment, an integration cassette containing a module
comprising at least one marker gene is flanked on either side by
DNA fragments homologous to those of the ends of the targeted
integration site. After transforming the host microorganism with
the cassette by appropriate methods, homologous recombination
between the flanking sequences may result in the marker replacing
the chromosomal region in between the two sites of the genome
corresponding to flanking sequences of the integration cassette.
The homologous recombination event may be facilitated by a
recombinase enzyme that may be native to the host microorganism or
may be heterologous and transiently overexpressed.
[0238] In addition, certain point-mutation(s) can be introduced
which results in an enzyme with reduced activity.
[0239] It is understood that integration of all the genes of a
metabolic pathway that lead to a product into the genome of the
production strain eliminates the need of a plasmid expression
system, as the enzymes are produced from the E. coli chromosome.
The integration of pathway genes avoids loss of productivity over
time due to plasmid loss. This is important for long fermentation
times and for fermentations in large scale where the seed train is
long and the production strain has to go through many doublings
from the first inoculation to the end of the large scale
fermentation. The present methods and biocatalysts encompass
integration of genetic elements into a host genome in order to
produce a biofuel.
[0240] Integrated genes are maintained in the strain without
selection. This allows the construction of production strains that
are free of marker genes which are commonly used for maintenance of
plasmids. Marker genes and especially antibiotic markers are
problematic for regulatory approval of a production organism. Also,
the use of the spent biocatalyst as DDGs may be more limited for
biocatalysts that contain markers. Production strains with
integrated pathway genes can contain minimal amounts of foreign DNA
since there are no origins of replication and other non coding DNA
necessary that have to be in plasmid based systems. The biocatalyst
with integrated pathway genes improves the yield of a production
process because it avoids energy and carbon requiring processes.
These processes are the replication of many copies of plasmids and
the production of non-pathway active proteins like marker proteins
in the production strain.
[0241] The expression of pathway genes on multi copy plasmids can
lead to over expression phenotypes for certain genes. These
phenotypes can be growth retardation, inclusion bodies, and cell
death. Therefore the expression levels of genes on multi copy
plasmids has to be controlled effectively by using inducible
expression systems, optimizing the time of induction of said
expression system, and optimizing the amount of inducer provided.
The use of an inducible promoter system leads to additional costs
for the inducer which can be prohibitive for large scale
production. The time of induction has to be correlated to the
growth phase of the biocatalyst, which can be followed by measuring
of optical density in the fermentation broth. Feedstocks that are
commonly used in fermentation like corn liquefact interfere with
the determination of cell density making the determination of the
right time of induction difficult. This leads to additional costs
on a more complex fermentation method and it causes inconsistencies
between fermentation runs.
[0242] A biocatalyst that has all pathway genes integrated on its
chromosome is far more likely to allow constitutive expression
since the lower number of gene copies avoids over expression
phenotypes. Thus integration of pathway genes makes the process
more economical.
[0243] Alternatively, antisense technology can be used to reduce
enzymatic activity. For example, host cells can be engineered to
contain a cDNA that encodes an antisense molecule that prevents an
enzyme from being made. The term "antisense molecule" as used
herein encompasses any nucleic acid molecule that contains
sequences that correspond to the coding strand of an endogenous
polypeptide. An antisense molecule also can have flanking sequences
(e.g., regulatory sequences). Thus antisense molecules can be
ribozymes or antisense oligonucleotides. A ribozyme can have any
general structure including, without limitation, hairpin,
hammerhead, or axhead structures, provided the molecule cleaves
RNA.
[0244] In certain embodiments, deletion of the genes encoding for
these enzymes improves the isobutanol yield because more carbon
and/or NADH is made available to one or more polypeptide(s) for
producing isobutanol.
[0245] In certain embodiments, the DNA sequences deleted from the
genome of the recombinant microorganism encode an enzyme selected
from the group consisting of: D-lactate dehydrogenase, pyruvate
formate lyase, acetaldehyde/alcohol dehydrogenase, phosphate acetyl
transferase, fumarate reductase, malate dehydrogenase,
transhydrogenase, and pyruvate dehydrogenase.
[0246] In particular when the microorganism is E. coli. the DNA
sequences deleted from the genome can be selected from the group
consisting of IdhA, pflB, pflDC, adhE, pta, ackA, frd, mdh, sthA,
aceE and aceF.
[0247] The enzymes D-lactate dehydrogenase, pyruvate formate lyase,
acetaldehyde/alcohol dehydrogenase, phosphate acetyl transferase,
acetate kinase A, fumarate reductase, malate dehydrogenase and
pyruvate dehydrogenase, may be required for certain competing
endogenous pathways that produce succinate, lactate, acetate,
ethanol, formate, carbon dioxide and/or hydrogen gas.
[0248] In particular, the enzyme D-lactate dehydrogenase (encoded
in E. coli by IdhA), couples the oxidation of NADH to the reduction
of pyruvate to D-lactate. Deletion of IdhA has previously been
shown to eliminate the formation of D-lactate in a fermentation
broth (Causey. T. B. et al, 2003, Proc. Natl. Acad. Sci., 100,
825-32).
[0249] The enzyme Pyruvate formate lyase (encoded in E. coli by
pflB), oxidizes pyruvate to acetyl-CoA and formate. Deletion of
pflB has proven important for the overproduction of acetate
(Causey, T. B. et al, 2003, Proc. Natl. Acad. Sci., 100, 825-32),
pyruvate (Causey, T. B. et al, 2004, Proc. Natl. Acad. Sci., 101,
2235-40) and lactate (Zhou, S., 2005, Biotechnol. Lett., 27,
1891-96). Formate can further be oxidized to CO.sub.2 and hydrogen
by a formate hydrogen lyase complex, but deletion of this complex
should not be necessary in the absence of pflB. pflDC is a homolog
of pflB and can be activated by mutation. As indicated above, the
pyruvate formate lyase may not need to be deleted for anaerobic
fermentation of isobutanol. A (heterologous) NADH-dependent formate
dehydrogenase may be provided, if not already available in the
host, to effect the conversion of pyruvate to acetyl-CoA coupled
with NADH production.
[0250] The enzyme acetaldehyde/alcohol dehydrogenase (encoded in E.
coli by adhE) is involved the conversion of acetyl-CoA to
acetaldehyde dehydrogenase and alcohol dehydrogenase. In
particular, under aerobic conditions, pyruvate is also converted to
acetyl-CoA, acetaldehyde dehydrogenase and alcohol dehydrogenase,
but this reaction is catalyzed by a multi-enzyme pyruvate
dehydrogenase complex, yielding CO.sub.2 and one equivalent of
NADH. Acetyl-CoA fuels the TCA cycle but can also be oxidized to
acetaldehyde and ethanol by acetaldehyde dehydrogenase and alcohol
dehydrogenase, both encoded by the gene adhE. These reactions are
each coupled to the reduction of one equivalents NADH.
[0251] The enzymes phosphate acetyl transferase (encoded in E. coli
by pta) and acetate kinase A (encoded in E. coli by ackA), are
involved in the pathway which converts acetyl-CoA to acetate via
acetyl phosphate. Deletion of ackA has previously been used to
direct the metabolic flux away from acetate production (Underwood,
S. A. et al, 2002, Appl. Environ. Microbiol., 68, 6263-72; Zhou, S.
D. et al, 2003, Appl. Environ. Mirobiol., 69, 399-407), but
deletion of pta should achieve the same result.
[0252] The enzyme fumarate reductase (encoded in E. coli by frd) is
involved in the pathway which converts pyruvate to succinate. In
particular, under anaerobic conditions, phosphoenolpyruvate can be
reduced to succinate via oxaloacetate, malate and fumarate,
resulting in the oxidation of two equivalents of NADH to NAD+. Each
of the enzymes involved in those conversions could be inactivated
to eliminate this pathway. For example, the final reaction
catalyzed by fumarate reductase converts fumarate to succinate. The
electron donor for this reaction is reduced menaquinone and each
electron transferred results in the translocation of two protons.
Deletion of frd has proven useful for the generation of reduced
pyruvate products.
[0253] The expression of gene fnr is associated with a series of
activities in E. coli. The pathways associated to the activity
expressed by fnr are usually related to oxygen utilization that is
down regulated as oxygen is depleted and in a reciprocal fashion,
alternative anaerobic pathways for fermentation are upregulated by
Fnr. An indication of those pathways can be found in Chrystala
Constantinidou et al., "A Reassessment of the FNR Regulon and
Transcriptomic Analysis of the Effects of Nitrate, Nitrite, NarXL,
and NarQP as Escherichia coli K12 Adapts from Aerobic to Anaerobic
Growth," J. Biol. Chem., 2006, 281:4802-4815 Kirsty Salmon et al.,
"Global Gene Expression Profiling in Escherichia coli K12--The
Effects Of Oxygen Availability And FNR" J. Biol. Chem. 2003,
278(32):29837-55" and Kirsty A. Salmon et al. "Global Gene
Expression Profiling in Escherichia coli K12--the Effects of Oxygen
Availability and ArcA" J. Biol. Chem., 2005, 280(15):15084-15096,
all incorporated by reference in their entirety in the present
application.
[0254] The deletion of the soluble transhydrogenase coded by sthA
from the E. coli genome avoids the conversion of NADPH to NADH
which is the natively catalyzed reaction of this enzyme. In strains
that are engineered to increase the supply of NADPH to the
isobutanol pathway the deletion of sthA can avoid the creation of a
futile cycle which would interconvert the redox cofactor while
consuming ATP.
[0255] aceF codes for a subunit of the pyruvate dehydrogenase
complex (pdh) which catalyzes the conversion of pyruvate to
acetyl-CoA. The deletion of aceF eliminates a pathway that competes
with the isobutanol pathway for the metabolite pyruvate. A
production strain lacking pdh activity should have a higher
isobutanol yield than the isogenic strain with active pdh.
[0256] mdh codes for the malate dehydrogenase (Mdh). This enzyme
catalyzes one step of the TCA cycle. The TCA cycle converts
acetyl-CoA to CO.sub.2 and a disruption of the TCA or a reduction
of the flux through the TCA will increase the yield of isobutanol
by avoiding CO.sub.2 production.
[0257] The F' episomal plasmid present in some biocatalyst strains,
such as GEVO1886, contains several genes, including a copy of the
lacI repressor as well as the Tn10 operon, which contains a DNA
marker for resistance to the antibiotic tetracycline and
simultaneously confers sensitivity to fusaric acid. Removal of the
F' plasmid from certain biocatalyst strains, especially those
strains that do not contain other DNA markers, leads to the
creation of a strain with no DNA markers. For example, GEVO1886
contains no other DNA markers, neither on the chromosome nor on a
plasmid and therefore, removal of the F' plasmid from this strain
creates a strain with no DNA markers. Removal of the F' plasmid
does not affect the production of isobutanol or other biofuels from
certain strains, especially those biocatalyst strains that contain
a metabolic pathway for the production of a biofuel, such as
isobutanol. The sensitivity to fusaric acid will be exploited as a
counter-selectable method to obtain a variant of GEVO1886 that is
fusaric acid-resistant (Fus.sup.R) and tetracycline-sensitive
(Tc.sup.S) and thus has lost the F' plasmid and has the
tetracycline DNA marker removed. Loss of the plasmid is confirmed
by PCR using F' plasmid-specific primer pairs.
[0258] Referring to FIG. 2, and in an exemplary embodiment, there
is shown a method 200 of method of making a biofuel. Method 200 may
include providing 205 a biocatalyst selected to convert a feedstock
into the biofuel at a yield of at least 80 percent theoretical
yield, a productivity of at least 0.75 grams biofuel per liter per
hour, and a titer equivalent to a lower one of (i) a solubility
limit of the biofuel in water under the process conditions and (ii)
2% (w/w) of the biofuel in water; providing the biocatalyst
selected to have at least two properties from a. to l. as follows:
a. the biocatalyst selected to convert at least two sugars,
including each of (i) at least one of a six-carbon sugar and a
six-carbon sugar oligomer, and (ii) at least one five-carbon sugar,
derived from at least one of starch, cellulose, hemicellulose, and
pectin into the biofuel; b. the biocatalyst exhibiting a level of
endotoxin toxicity or exotoxin toxicity, wherein the level of
endotoxin or exotoxin toxicity in the biocatalyst has a median
lethal dose (LD50) of at least 1000-fold more than the amount
present in 1 kilogram of at least one of a DDG and a DDGS product;
c. the biocatalyst containing no DNA markers; d. the biocatalyst
operable to produce the biofuel free of byproducts that would
require additional processing steps for removal from the biofuel;
e. the biocatalyst operable at a pH value between about 2 to about
7 to produce the biofuel; f. the biocatalyst selected to have a
recoverable productivity from a sudden change of about 1 pH unit
from the first pH, the fermentation having a second pH that lasts
for up to three hours before returning to the first pH; g. the
biocatalyst operable within a temperature range of about 30.degree.
C. to about 60.degree. C. to produce the biofuel; h. the
biocatalyst selected to have a recoverable productivity from a
sudden change of about 10.degree. C. from the first temperature,
the fermentation having a second temperature that lasts for up to
three hours before returning to the first temperature; i. the
biocatalyst operable in a medium where mineral salts composed of
major and minor bioelements and vitamins are provided in addition
to the feedstock; j. the biocatalyst selected to have a growth rate
of at least 0.2 per hour; k. one attribute chosen from (1)
providing an anaerobic biocatalyst operable at dissolved oxygen
concentrations across a range of about 0% to about 0.01% to produce
the biofuel, and (2) providing a facultative anaerobic biocatalyst
modified to inhibit aerobic respiration with dissolved oxygen
present, the biocatalyst operable with the dissolved oxygen
present; and l. providing an anaerobic biocatalyst selected to have
a productivity that fully recovers from an exposure to more than 1%
air saturation that lasts for up to three hours. Method 200 may
further include cultivating 210 the biocatalyst in a culture medium
until a recoverable quantity of the biofuel is produced. Method 200
may include recovering 215 the biofuel.
[0259] Referring to FIG. 3, and in an exemplary embodiment, there
is shown a method 300 of making a biofuel. Method 300 may include
providing 305 a biocatalyst selected to convert a feedstock into
the biofuel at a yield of at least 80 percent theoretical yield, a
productivity of at least 0.75 grams biofuel per gram cell dry
weight, and a titer equivalent to a lower one of (i) a solubility
limit of the biofuel in water under the process conditions and (ii)
2% (w/w) of the biofuel in water; providing the biocatalyst
selected to convert at least two sugars, including each of (i) at
least one of a six-carbon sugar and a six-carbon sugar oligomer,
and (ii) at least one five-carbon sugar, derived from at least one
of starch, cellulose, hemicellulose, and pectin into the biofuel;
providing the biocatalyst exhibiting a level of endotoxin toxicity
or exotoxin toxicity, wherein the level of endotoxin or exotoxin
toxicity in the biocatalyst has a median lethal dose (LD50) of at
least 1000-fold more than the amount present in 1 kilogram of at
least one of a DDG and a DDGS product; providing the biocatalyst
that contains no DNA markers; and providing the biocatalyst
operable to produce the biofuel free of byproducts that would
require additional processing steps for removal from the biofuel;
providing the biocatalyst operable at a pH value between about 2 to
about 7 to produce the biofuel; providing the biocatalyst selected
to have a recoverable productivity from a sudden change of about 1
pH unit from the first pH, the fermentation having a second pH that
lasts for up to three hours before returning to the first pH;
providing the biocatalyst operable within a temperature range of
about 30.degree. C. to about 60.degree. C. to produce the biofuel;
providing the biocatalyst selected to have a recoverable
productivity from a sudden change of about 10.degree. C. from the
first temperature, the fermentation having a second temperature
that lasts for up to three hours before returning to the first
temperature; providing the biocatalyst operable in a medium where
mineral salts composed of major and minor bioelements and vitamins
are provided in addition to the feedstock; providing the
biocatalyst selected to have a growth rate of at least 0.2 per
hour; providing the biocatalyst selected to have one attribute
chosen from: a. providing an anaerobic biocatalyst operable at
dissolved oxygen concentrations across a range of about 0% to about
0.01% to produce the biofuel, and wherein the anaerobic biocatalyst
has a productivity that fully recovers from an exposure to more
than 1% air saturation that lasts for up to three hours; and b.
providing a facultative anaerobic biocatalyst modified to inhibit
aerobic respiration with dissolved oxygen present, the biocatalyst
operable with the dissolved oxygen present. Method 300 may further
include cultivating 310 the biocatalyst in a culture medium until a
recoverable quantity of the biofuel is produced. Method 300 may
include recovering 315 the biofuel.
[0260] Referring to FIG. 4, and in an exemplary embodiment, there
is shown a method 400 of making a biofuel. Method 400 may include
providing 405 a biocatalyst selected to convert a feedstock into
the biofuel at a yield of at least 80 percent theoretical yield, a
productivity of at least 0.75 grams biofuel per liter per hour, and
a titer equivalent to a lower one of (i) a solubility limit of the
biofuel in water under the process conditions and (ii) 2% (w/w) of
the biofuel in water; providing the biocatalyst operable to produce
the biofuel free of byproducts that would require additional
processing steps for removal from the biofuel; providing the
biocatalyst operable at a pH value between about 2 to about 7 to
produce the biofuel; providing the biocatalyst that has a growth
rate of at least 0.2 per hour, and providing the biocatalyst
operable within a temperature range of about 30.degree. C. to about
60.degree. C. to produce the biofuel; providing the biocatalyst
operable in a medium where mineral salts composed of major and
minor bioelements and vitamins are provided in addition to the
feedstock. Method 400 may further include cultivating 410 the
biocatalyst in a culture medium until a recoverable quantity of the
biofuel is produced. Method 400 may include recovering 415 the
biofuel.
[0261] Referring to FIG. 5, and in an exemplary embodiment, there
is shown a method 500 of making a biofuel. Method 500 may include
providing 505 a biocatalyst selected to convert a feedstock into
the biofuel at a yield of at least 80 percent theoretical yield, a
productivity of at least 0.75 grams biofuel per liter per hour, and
a titer equivalent to a lower one of (i) a solubility limit of the
biofuel in water under the process conditions and (ii) 2% (w/w) of
the biofuel in water. Method 500 may further include cultivating
510 the biocatalyst in a culture medium until a recoverable
quantity of the biofuel is produced. Method 500 may include
recovering 515 the biofuel.
EXAMPLES
Example 1
[0262] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/L xylose, 2 g/L mannose, 2 g/L galactose,
1 g/L arabinose, 5 g/L acetic acid in solution. Three equal
portions of the pretreated cellulosic material are put into
agitated saccharification and fermentation vessels. All three are
charged with cellulase enzyme sufficient to hydrolyze 80% of the
cellulose in 72 hours. Three different biocatalysts are added to
the vessels. One biocatalyst, added to vessel number A1, converts
only glucose to butanol. A second biocatalyst, added to fermenter
number A2, converts glucose and xylose to butanol. A third
biocatalyst, added to fermenter number A3, converts glucose,
xylose, mannose, galactose and arabinose to butanol.
[0263] The vessels are agitated for 72 hours. At the end of 72
hours the fermentation broth is analyzed for butanol content.
Fermenter number A1 has 29.5 g/L butanol. Fermenter number A2
contains 44.3 g/L butanol. Fermenter number A3 contains 46.1 g/L
butanol.
[0264] Economic analysis of the three fermenters shows that revenue
from butanol recovered from fermenter A2 is 50.2% higher than the
revenue from butanol recovered from fermenter A1. The revenue from
butanol from fermenter A3 is 56.3% higher than the revenue from
butanol recovered from fermenter number A1. The revenue from
butanol from fermenter number A3 is 4.1% higher than the revenue
from butanol from fermenter number A2. The biocatalyst with the
broadest sugar consumption ability, biocatalyst A3, provides an
economic advantage because more product is produced from the same
quantity of feedstock and same feedstock processing capital.
Therefore, this example demonstrates that a biocatalyst that
consumes more than one sugar in the feedstock is preferred because
overall costs related to the feedstock are reduced.
Example 2
[0265] Dry corn is milled into a fine powder. The dry milled corn
is slurried and jet cooked at temperature of about 105' C and then
alpha-amylase enzyme is added to produce corn liquefact. The stream
is cooled and gluco-amylase is added. After a short
saccharification time of about 5-6 hours the slurry is cooled to
about 32' C. The slurry solids concentration at this point is 361
g/kg (insoluble & soluble solids). Two equal aliquots of the
corn slurry are placed in two identical batch fermenter tanks. Both
tanks are inoculated with biocatalysts that can convert dextrose to
isobutanol: Tank B1 is inoculated with biocatalyst B1 and Tank B2
is inoculated with biocatalyst B2. Both biocatalysts B1 & B2
are genetically engineered to convert dextrose to isobutanol: B1 is
engineered in a way such that it contains DNA consisting of natural
DNA, however, biocatalyst B2 does contains DNA comprised to 0.7% of
foreign DNA as a result of the specific approach taken to engineer
this organism for isobutanol production. The vessels are agitated
and sampled until isobutanol yield is 90%. Tank B1 is complete in
36 hours and B2 is complete in 29 hours. At the end of their
fermentations Tanks B1 and B2 fermentation broth is analyzed for
isobutanol content. Analysis of the fermentation samples reveals
the fermentation performance summarized in Table 6 for isobutanol
titers, production rates and production yields. Fermenter B2
produced isobutanol at a higher rate compared to fermenter B1.
Yield is defined as the actual amount of carbohydrate converted to
butanol divided by the theoretical amount of butanol based on a
0.41 g butanol per g glucose theoretical yield.
TABLE-US-00006 TABLE 6 Summary of fermentation performance for
fermentations B1 & B2 described above. Fermenter B1 Fermenter
B2 Production Organism B1 B2 (natural DNA) (foreign DNA) Isobutanol
Rate (g/l h) 1.3 1.6 Isobutanol Yield (% theoretical) 90 90
Isobutanol Titer (g/l) 47 47 Fermentation Time (hours) 36 29
[0266] The spent biocatalyst from fermentation B1 is dried and
added to DDGS sold for animal feed at current market rates. However
the spent biocatalyst from fermenter B2 are dried to produce DDGS,
which is burned for energy sold at current market rates. An
economic analysis of the value of the DDGS sold as a feed in
fermenter B1 compared to burning the DDGS from fermenter B2 was
completed. Results of the economic analysis indicate that the
co-product credit for selling the DDGS as animal feed results in a
cost reduction of $0.14/gallon of isobutanol compared to burning
the DDGS. The cost reduction as a result of the increased
productivity in fermenter B2 is $0.012/gallon isobutanol. An
economic analysis of the overall process costs for the two
biocatalysts reveals that the economic advantages from the higher
productivity in fermenter B2 is outweighed by the cost reduction
due to the sale of DDGS from fermenter B1 as animal feed. This
example illustrates the importance of producing a DDGS which can be
sold into the feed markets.
Example 3
[0267] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin. 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into an agitated saccharification and fermentation
vessel. All four experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose and are run in batch
mode for over 72 hours. A biocatalyst known to convert glucose,
xylose, mannose, galactose and arabinose to butanol is added to
each of the four fermentations. The fermentation vessel is
configured with an alkali and acid feed pH control system.
[0268] Fermentation C1 is controlled at pH 4.0. Fermentation C2 is
controlled at pH 4.5. Fermentation C3 is controlled at pH 5.0.
Fermentation C4 is controlled at pH 5.5. The vessels are agitated
for 72 hours. At the end of 72 hours the fermentation broth is
analyzed for butanol and organic acid content.
[0269] Fermentation C1 results in low butanol concentration of 30.5
g/L and low productivity of 0.42 g/L-hr. No organic acids are
observed. Fermentation C2 results in 46.3 g/l butanol and
productivity of 0.64 g/L-hr. No organic acids are observed in
Fermentation C2. Fermentation C3 contains 45.7 g/l butanol
resulting in a productivity of 0.63 g/L-hr and 1.2 g/l organic
acids. Fermentation C4 produced 36.5 g/L butanol, a productivity of
0.51 g/L-hour and 6.0 g/L organic acids. The pH controlled
fermentations at the higher pH range allowed for contaminant growth
that produced carboxylic acid metabolic byproducts, resulting in
butanol yield losses.
[0270] Economic analysis of the four batch fermentations indicates
butanol recovered from fermentation 2 has the highest carbohydrate
to butanol yield. Fermentation C1 has carbohydrate costs 51.8%
greater than fermentation C2. Fermentations C3 and C4 carbohydrate
costs are 1.3% and 26.9% higher compared to fermentation C2,
respectively. The fermentation C2 process at pH 4.5 minimized
carbohydrate costs relative to fermentations C1, C3 and C4. This
example shows that production costs are minimized for fermentation
C2 since substrate costs are the major raw material costs for such
processing plants. Small swings in carbohydrate conversion can
drastically impact economic viability and performance for high cash
flow business such as the biofuels market. The results of these
fermentations at various pH demonstrate the impact of utilization
of a pH tolerant organism capable of reducing contamination growth
of undesired byproducts.
Example 4
[0271] pH control impacts the ability of competing microorganisms
to produce other metabolites such as organic acids, i.e., lactic
acid. Dry corn is milled into a fine powder. The dry milled corn is
slurried and heated to 99.degree. C. and then alpha-amylase enzyme
is added. After a short saccharification time the slurry is cooled
to 30.degree. C. The slurry solids concentration at this point is
361 g/kg, including insoluble & soluble solids. Three equal
aliquots of the corn slurry are placed in three continuous
fermenter tanks. Gluco-amylase enzyme and biocatalyst 2 are added
to each of fermenter tanks D5, D6 & D7. Gluco-amylase and water
sufficient to complete the saccharification at the designed
dilution rate are added to each fermenter tank. The fermentation
carbohydrate concentration is fed to an equivalent feed of 60 g/l.
Calcium hydroxide and sulfuric acid are used as base and acid
solutions pH controlled fermentations.
[0272] Fermentation D5 is uncontrolled and maintains at about pH
3.5. Fermentation D6 is controlled at pH 4.0. Fermentation D7 is
controlled at pH 4.5. The fermentations are operated in a
continuous mode and are agitated throughout the experiment. Once
steady state, usually by 72 hours, the fermentation broth is
analyzed for butanol and organic acid content. Continuous
fermentation runs for fermenter D5. D6, & D7 are established at
a dilution rate of 0.014/hr. Fermentations are monitored until cell
density and residual glucose is stabilized.
[0273] The following steady state compositions are collected.
Fermentation D5 samples show butanol concentration at 22.8 g/l and
no lactic acid. Fermentation D6 results in 22.5 g/l butanol and 0.4
g/l lactic acid. Fermentation D7 results in 22.0 g/l butanol and
1.7 g/l lactic acid.
[0274] Economic analysis of the three continuous fermentations (D5,
D6, & D7) indicates butanol recovered from fermentation D5 has
the highest butanol yield and lowest carbohydrate costs.
Fermentation D6 has carbohydrate costs 1.3% greater than
Fermentation D5 performance. Fermentations D7 carbohydrate costs
are 3.6% higher compared to Fermentation D5. Fermentation D5
operating at pH 3.5 minimized carbohydrate costs relative to other
fermentations in the example and would minimize product costs as
carbohydrate substrate costs are the major raw material costs for
such processing plants. Small swings in carbohydrate conversion can
drastically impact economic viability and performance for high cash
flow business such as the biofuels market. The results of these
fermentations at various pH demonstrate the impact of utilization
of a pH tolerant organism capable of reducing contamination growth
of undesired byproducts.
[0275] Economic analysis of example 4 also demonstrates an impact
of pH on capital cost expenditures. Fermentation D5 produced the
highest yield and lowest operating costs based on cost of the
feedstock carbohydrates, but also did not require pH control. Lack
of pH control means that no capital expenditures for equipment nor
operating expenditures for acid and base are required to control pH
of fermentation D5 and this lowers the overall process costs
compared to fermentations D6 and D7. Product dilution and yield
impact equipment sizes and energy consumption in corn processing,
fermentation, and recovery equipment. Therefore, a biocatalyst that
can produce biofuels at a low pH with no requirement for pH control
yields a biofuel production process that is more economically
competitive.
Example 5
[0276] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into an agitated saccharification and fermentation
vessel. All four experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose and are run in batch
mode over 72 hours. A biocatalyst known to convert glucose, xylose,
mannose, galactose and arabinose to isobutanol is added to each of
the four fermentations. The fermentation vessel is configured with
an alkali and acid feed pH control system.
[0277] The fermentations are controlled at pH 6. The biocatalyst in
fermenters E1 and E2 is able to recover from sudden changes in pH.
The biocatalyst in fermenters E3 and E4 is not able to recover from
sudden changes in pH. At time 36 hours the pH control of fermenter
E1 and E3 malfunctions and the pH drops to pH 4 for 3 hours. At
time 39 hours, the pH of fermenters E1 and E3 is returned to pH 6
for the remainder of the experiment. Fermenters E2 and E4 are
controlled at pH 6 throughout the process. The vessels are agitated
for a total of 72 hours. At the end of 72 hours the fermentation
broth is analyzed for isobutanol.
[0278] Fermentations E2 and E4 result in an isobutanol
concentration of 36 g/L and productivity of 0.5 g/L-hr.
Fermentation E1 results in 34.5 g/L isobutanol and a productivity
of 0.48 g/L-hr. Fermentation E3 contains 18 g/L isobutanol
resulting in a productivity of 0.25 g/L-hour.
[0279] Economic analysis of the four batch fermentations indicates
isobutanol recovered from fermentations E2 and E4 have the highest
productivity and titer. Fermentation E1 produces isobutanol at a
cost 4% higher than fermentations E2 and E4. Fermentation E3
produces isobutanol at a cost 100% higher than fermentation E2 and
E4. The economic impact of the pH control malfunction has a far
reduced impact for the fermenter with biocatalyst which recovers
from sudden and sustained pH changes. Fluctuations in process
condition can drastically impact economic viability and performance
for high cash flow business such as the biofuels market. The
results of these fermentations under control malfunction conditions
demonstrate the positive impact of the use of a biocatlayst that
recovers from fluctuations in pH on the economics of a biofuel
production process.
Example 6
[0280] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. Three equal
portions of the pretreated cellulosic material are put into
agitated saccharification and fermentation vessels. All three are
charged with cellulase enzyme sufficient to hydrolyze 80% of the
cellulose in 72 hours. At the same time the Fermentation F1, F2,
& F3 are charged with biocatalyst with a temperature optimum at
50.degree. C. and is known to convert glucose, xylose, mannose,
galactose and arabinose to butanol is added to each of the three
fermentations. The fermentations are operated at different
temperatures. The fermentation vessel is configured with an alkali
and acid feed pH control system and are maintained at pH 4.0.
Titer, completion time and cell density are recorded at the
completion of each of the three fermentations.
[0281] Fermentation F1 is operated at 40.degree. C. Fermentation F2
is operated at 50.degree. C. Fermentation F3 is operated at
60.degree. C. The three fermentation experiments are monitored for
completion by monitoring carbohydrate concentration and considered
complete when less than 10% of the total fermentable sugar
remains.
[0282] The vessels are monitored for carbohydrate level, cell
density, and butanol titer over 72 hours. Fermentation F1 proceeds
to completion in 45.2 hours with a cell density of 3 g CDW (cell
dry weight)/kg and 44.5 g/L butanol. Fermentation F2 shows
completion in 34.6 hours with a cell density of 3 g CDW/kg and 45.1
g/L butanol. Fermentation F3 does not go to completion within 72
hours with a cell density of 1 g CDW/kg and 40.2 g/L butanol.
Fermentation F3 enzyme has essentially completed conversion of
cellulose but greater than 10% of the total fermentable sugars of
the original charge remained.
[0283] The three different operating temperatures of the enzyme and
organism combine to impact the availability of carbohydrate,
fermentation time and carbohydrate conversion. As the enzyme
treatment temperature is optimized, fermentation productivity and
economics are improved. Enzyme activity is optimized at 50.degree.
C. Fermentation F3 at 60.degree. C. is detrimental to the
biocatalyst metabolism and growth rate.
[0284] Economic analysis of the three fermentations shows that
fermenter capital expenditures from butanol produced in fermenter
F1 is 33% higher than the costs for butanol recovered from
fermenter F2. The fermenter capital costs for butanol from
fermentation F3 is 134% higher than the capital costs from butanol
produced in fermentation F2. The revenue from butanol from
fermentation F2 is 1.3% higher than fermentation F1. The revenue
from fermentation F2 is 12.1% higher than fermentation F3 (assuming
residual carbohydrate has no process value). Overall fermentation
F2 is the preferred economic minimum as it matches enzyme activity
and fermentation volumetric productivity relative to
temperature.
[0285] The example also demonstrates the economic impact of the
heat tolerant biocatalyst, which allows fermentation reactions at
elevated temperatures optimal for degradation of the feedstock by
digestive enzymes. These elevated temperatures allow better heat
transfer and smaller heat transfer capital equipment, slower
volumetric flows, and reduced capital and operating costs.
Example 7
[0286] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into four agitated saccharification and fermentation
vessels. G1, G2, G3, and G4. All four experiments are charged with
cellulase enzyme sufficient to hydrolyze 80% of the cellulose and
are run in batch mode over 72 hours. A biocatalyst known to convert
glucose, xylose, mannose, galactose and arabinose to isobutanol is
added to each of the four fermentations. The fermentation vessel is
configured with an alkali and acid feed pH control system and a
thermostat-regulated temperature control device to maintain
temperature at a preset value.
[0287] The temperature of the fermentations is controlled at
35.degree. C. The biocatalyst in fermenters G1 and G2 is able to
recover from sudden change in temperature. The biocatalyst in
fermenters G3 and G4 is not able to recover from sudden change in
temperature. At time 36 hours, the temperature control of fermenter
G1 and G3 malfunctions and the temperature rises to 65.degree. C.
and is sustained at 65.degree. C. for about 3 hours. At time 39
hours, the temperature of fermenters G1 and G3 is returned to
35.degree. C. for the remainder of the experiment. Fermenters G2
and G4 are controlled at 35.degree. C. throughout the process. The
vessels are agitated for a total of 72 hours. At the end of 72
hours the fermentation broth is analyzed for isobutanol.
[0288] Fermentations G2 and G4 result in an isobutanol
concentration of 36 g/L and productivity of 0.5 g/L-hour.
Fermentation G1 results in 34.5 g/L isobutanol and productivity of
0.48 g/L-hour. Fermentation G3 contains 18 g/L isobutanol resulting
in a productivity of 0.25 g/L-hour.
[0289] Economic analysis of the four batch fermentations indicates
isobutanol recovered from fermentations G2 and G4 have the highest
productivity and titer. Fermentation G1 produces isobutanol at a
cost 4% higher than fermentations G2 and G4. Fermentation G3
produces isobutanol at a cost 100% higher than fermentation G2 and
G4. The economic impact of the temperature control malfunction has
a far reduced impact for the fermenter, G1, with a biocatalyst that
recovers from sudden and sustained temperature changes.
Fluctuations in process condition can drastically impact economic
viability and performance for low profit margin business such as
the biofuels market. The results of these fermentations under
control malfunction conditions demonstrate the impact of the
utilization of a biocatalyst that recovers from fluctuation of
temperature on the economics of a biofuel production process.
Example 8
[0290] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/L xylose, 2 g/L mannose, 2 g/L galactose,
1 g/L arabinose, 5 g/L acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into four agitated saccharification and fermentation
vessels, H1, H2, H3, and H4. All four experiments are charged with
cellulase enzyme sufficient to hydrolyze 80% of the cellulose and
are run in batch mode for 72 hours. Four types of biocatalysts
known to convert glucose, xylose, mannose, galactose and arabinose
to butanol are individually added to each of the four
fermentations. The fermentation vessel is configured with an alkali
and acid feed pH control system and the pH is controlled at pH
values optimal for each of the four organisms (in the range of
4.5-7).
[0291] The vessels are agitated for 72 hours. At the end of 72
hours, the fermentation broth is analyzed for butanol and
byproducts content. Fermentation H1 results in low butanol
concentration of 27.8 g/L and low productivity of 0.39 g/L-hr and
low conversion yield of 0.25 g-butanol/g-total initial fermentable
sugars. This organism produces substantial amounts of byproducts as
detected in the broth (acetone, acetate, butyric acid and ethanol).
Fermentation H2 results in 32.4 g/L butanol and productivity of
0.45 g/L-hr and a conversion yield of 0.29 g/g. As in fermentation
H1, this organism also produces substantial amounts of byproducts
as detected in the broth (acetone, acetate, butyric acid and
ethanol), albeit at lower levels versus Fermenter H1. Fermentation
H3 results in 37.1 g/L butanol and productivity of 0.52 g/L-hr and
a conversion yield of 0.33 g/g. As in fermentation H1 and H2, this
organism also produces substantial amounts of byproducts as
detected in the broth (acetone, acetate, butyric acid and ethanol),
albeit at lower levels versus fermentations H1 and H2. Fermentation
H4 results in 41.7 g/L butanol and productivity of 0.58 g/L-hr and
a conversion yield of 0.37 g/g. Unlike the previous fermentations,
this fermentation produces no byproducts detectable in the
fermentation broth.
[0292] Economic analysis of the four batch fermentations indicates
butanol recovered from fermentation 4 has the highest carbohydrate
to butanol yield. Fermentation H1 has carbohydrate costs 50.0%
greater than Fermentation H4 performance. Fermentations H2 and H3
carbohydrate costs are 28.6% and 12.5% higher compared to
Fermentation H4, respectively. The fermentation results demonstrate
the significant impact of organism metabolite selectivity on
carbohydrate and feedstock economics. Additionally, the creation of
byproducts, such as acetate, increases capital costs and operating
costs required to separate the byproducts from the more complex
fermentation broth. This example demonstrates that a biocatalyst
for the production of biofuel that has a high theoretical yield and
also produces low or no levels of byproducts that require
downstream separation and have low value, is the most economical
for an economical biofuel production process.
Example 9
[0293] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield a slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/L xylose, 2 g/L mannose, 2 g/L galactose,
1 g/L arabinose, 5 g/L acetic acid in solution. For each experiment
equal portions of the pretreated cellulosic material are added into
two agitated saccharification and fermentation vessels, 11 and 12.
Both experiments are charged with cellulase enzyme sufficient to
hydrolyze 80% of the cellulose and are run in batch mode for 72
hours. Two types of biocatalysts known to convert glucose, xylose,
mannose, galactose and arabinose to isobutanol are used and
individually added to either one of the two fermentations.
[0294] The vessels are agitated for 72 hours. At the end of 72
hours the fermentation broth is analyzed for isobutanol and
byproducts content and the biofuel is recovered from the
fermentation broth. Both fermentations yield similar isobutanol
amounts. Fermentation 11 results in low (less than 0.01% (w/w))
amounts of byproducts such as butyrate, acetate, and
isobutyraldehyde in the biofuel product. The small amounts of these
byproducts cause the biofuel to not meet ASTM specifications (ASTM
D4814) for copper corrosion test (ASTM D130) and oxidation
stability (ASTM D525). Fermentation 12 results in no byproducts and
the biofuel meets the ASTM specifications. The biofuel produced in
fermentation 11 is treated with an additional purification step to
remove the impurities, adding an additional cost of 5% to the
overall process cost compared to the cost of fermentation 12.
Therefore, this example demonstrates that the biocatalyst that
produces less trace byproducts yields a biofuel that is more
economical.
Example 10
[0295] Corn grain is milled into a fine powder. The dry milled corn
is slurried and heated to 99'C and then alpha-amylase enzyme is
added. After a short saccharification time of about 5-6 hours, the
slurry is cooled to about 32.degree. C. The slurry solids
concentration at this point is about 361 g/kg, including insoluble
& soluble solids. Three equal aliquots of the corn slurry are
placed in three identical fermenter tanks, labeled fermenters J4,
J5 & J6. Gluco-amylase enzyme is added to all tanks, and
biocatalysts J4, J5 & J6 are added to tanks J4, J5, & J6,
respectively. Gluco-amylase sufficient to complete the
saccharification in 32 hours is also added to each tank.
[0296] Biocatalysts J4, J5, and J6 have a specific butanol
productivity of 0.5 g butanol per g cells per hr and reach a final
cell density of 3 g cells per liter. Biocatalysts J4, J5, and J6
show a linear reduction in their specific productivity above their
tolerance level for butanol. Beyond this level the specific
productivity is reduced by 10% for every increase in titer of 10
g/L. Biocatalyst J4 is tolerant to butanol up to a concentration of
20 g/L. Biocatalyst J5 is tolerant to butanol up to a final
concentration of 30 g/L. Biocatalyst J6 is tolerant to butanol up
to a final concentration of 40 g/L. This results in a fermentation
process time of about 112 hours for biocatalyst 4, 95 hours for
biocatalyst J5, and 83 hours for biocatalyst J6, respectively, to
permit consumption of greater than 98% of the total fermentable
sugars added in the original charge and liberated by the digestive
enzymes.
[0297] A commercial facility using biocatalyst J4, producing 100
million gallons of butanol per year using batch fermentations with
a turnaround time between subsequent fermentations of 10 hours, and
operating 350 days per year requires total fermentation volume of
10.3 million gallons total. Commercial processes for biocatalyst J5
and biocatalyst J6 require 8.9 and 7.8 million gallons of
fermentation capacity, respectively. The capital cost for the
fermentation portion using biocatalyst J6 compared to using
biocatalyst J4 is 17% less. The capital cost for the fermentation
portion of the butanol process using biocatalyst J5 is 10% less
when compared to utilizing biocatalyst J4. Finally, the capital
cost for the fermentation portion of the butanol process using
biocatalyst J6 is 8% less when compared to utilizing biocatalyst
J5. Using a depreciation and capital charge totaling 20% of the
invested capital per year, similar to a 10% Internal Rate of
Return, biocatalyst J6 is 1.3 cents per gallon lower in cost than
biocatalyst J4, and 0.5 cents per gallon lower in cost than
biocatalyst J5.
[0298] Overall, the high tolerance of biocatalyst J6 is favored
compared to biocatalyst J5 or biocatalyst J4. This example
demonstrates that the higher the tolerance of the biocatalyst for
the production of biofuel, the lower the cost of fermentation
capital. Higher tolerance and higher volumetric productivities are
economically favored.
Example 11
[0299] Corn grain is milled into a fine powder. The dry milled corn
is slurried and heated to 99'C and then alpha-amylase enzyme is
added. After a short saccharification time of about 5-6 hours the
slurry is cooled to about 32.degree. C. The slurry solids
concentration at this point is about 361 g/kg, including insoluble
& soluble solids. Three equal aliquots of the corn slurry are
placed into three identical fermenter tanks labeled fermenters K14,
K15 & K16. Gluco-amylase enzyme is added to all tanks, and
biocatalysts K14, K15 & K16 are added to fermentation tanks
K14, K15, & K16, respectively. Gluco-amylase sufficient to
complete the saccharification in 32 hours is also added to each
tank.
[0300] Biocatalysts K14, K15, and K16 have a specific butanol
productivity of 0.5 g butanol per g cells per hr and reach a final
cell density of 3 g cells per liter. Biocatalyst K14, K15 and K16
are tolerant to butanol up to a concentration of 50 g/L.
Biocatalysts K14, K15, and K16 show a linear reduction in their
specific productivity above the inhibitory concentration for
butanol. The rate of inhibition is different for the three
biocatalysts. Beyond the inhibitory concentration the specific
productivity is reduced by 20% for every increase in titer of 10
g/L for biocatalyst K14. Beyond the inhibitory concentration, the
specific productivity is reduced by 15% for every increase in titer
of 10 g/L for biocatalyst K15. Beyond the inhibitory concentration,
the specific productivity is reduced by 10% for every increase in
titer of 10 g/L for biocatalyst K16.
[0301] A commercial facility using biocatalyst K14, producing 100
million gallons of butanol per year using batch fermentations with
a turnaround time between subsequent fermentations of 10 hours, and
operating 350 days per year requires total fermentation volume of
12.0 million gallons total. Commercial processes for biocatalyst
K15 and biocatalyst K16 require 8.3 and 7.2 million gallons of
fermentation capacity, respectively. The capital cost for the
fermentation portion using biocatalyst K16 is 30% less when
compared to using biocatalyst K14. The capital cost for the
fermentation portion of the butanol process using biocatalyst K15
is 23% less when compared to utilizing biocatalyst K14. Finally,
the capital cost for the fermentation portion of the butanol
process using biocatalyst K16 is 9% less when compared to utilizing
biocatalyst K15. Using a depreciation and capital charge totaling
20% of the invested capital per year, similar to a 10% Internal
Rate of Return, biocatalyst K16 is 2.5 cents per gallon lower in
cost than biocatalyst K14, and 0.6 cents per gallon lower in cost
than biocatalyst K15.
[0302] Overall, the low rate of inhibition of biocatalyst K16 is
favored compared to biocatalyst K15 or biocatalyst K14. This
example demonstrates that the higher the specific productivity at
the same cell density and at higher titers of biofuel. the lower
the cost of fermentation capital. Lower rates of inhibition of the
biocatalyst by the biofuel and higher volumetric productivities are
economically favored and lead to a more economical biofuel
production process.
Example 12
[0303] Corn grain is milled into a fine powder. The dry milled corn
is slurried and heated to 99.degree. C. and then alpha-amylase
enzyme is added. After a short saccharification time of about 5-6
hours the slurry is cooled to about 32.degree. C. The slurry solids
concentration at this point is about 361 g/kg, including insoluble
& soluble solids. Three equal aliquots of the corn slurry are
placed in four identical fermenter tanks labeled fermenters L23,
L24, L25 & L26. Gluco-amylase enzyme is added to all tanks, and
biocatalysts L23, L24, L25 & L26 are added to tanks L23, L24,
L25, & L26, respectively. Gluco-amylase sufficient to complete
the saccharification in 32 hours is also added to each tank.
[0304] Biocatalysts L23, L24, L25, and L26 have a specific butanol
productivity of 0.5 g butanol per g cells per hr, and reach a final
cell density of 3 g cells per liter. Biocatalyst L23, L24, L25 and
L26 are not tolerant to butanol. Biocatalysts L23, L24, L25, and
L26 show a linear reduction in their specific productivity with
increasing concentration of butanol. The rate of inhibition is
different for the four biocatalysts and inhibition begins at 0 g/L
isobutanol for each of the biocatalysts. The specific productivity
is reduced by 5% for every increase in titer of 10 g/L for
biocatalyst L23. The specific productivity is reduced by 10% for
every increase in titer of 10 g/L for biocatalyst L24. The specific
productivity is reduced by 20% for every increase in titer of 10
g/L for biocatalyst L25. The specific productivity is reduced by
40% for every increase in titer of 10 g/L for biocatalyst L26.
[0305] A commercial facility using biocatalyst L23 reaches an
economically feasible titer of greater than 80 g/l after 68 hours.
Using biocatalyst L24, in the same process time, the titer would be
64 g/l. Biocatalyst L25 reaches a titer of 43 g/l, and biocatalyst
L26 has a titer of 25 g/l. This example shows that biocatalyst L23
has a 25% higher titer when compared to biocatalyst L24, leading to
smaller capital costs and smaller downstream processing costs. This
example demonstrates that biocatalysts that produce biofuel with
lower rates of inhibition due to the biofuel, resulting in higher
titers of biofuel due to increased resistance of biocatalysts, are
economically favored.
Example 13
[0306] Corn is fed into holding tanks and steeped in preparation
for processing into germ, fiber and starch. The corn is processed
and the starch is recovered and saccharified with alpha-amylase and
gluco-amylase enzymes with the resulting sugar solution being 97%
dextrose at a total solids concentration of about 30 weight %.
Three equal aliquots of this sugar are put into three separate
fermentation vessels. Biocatalysts M35, M36, & M37, which
convert dextrose to isobutanol, are inoculated into fermentation
vessels MA, MB, & MC, respectively. The fermentations utilizing
biocatalysts M35, M36 & M37 are finished converting sugar after
30 hours, 42 hours, and 56 hours, respectively. The final
isobutanol concentrations for fermentation M35, M36 & M37 are
80 g/l, 63 g/l, and 47 g/l, respectively.
[0307] Biocatalyst M35 clearly offers superior fermentation
performance because it is tolerant of higher isobutanol
concentrations resulting in higher final titers and higher
volumetric productivities. The results of biocatalyst M35 support a
business system with lower energy costs for recovery and spent
fermentation broth drying. Additionally, biocatalyst M35 has lower
fermentation capital cost because of the higher productivities. For
the purposes of the economic analysis, the excess sugar left after
the fermentation stops are not considered in results analysis. The
reason is that the initial sugar concentration will be diluted to
provide only the quantity of sugar that the biocatalyst can
consume. Economic analysis of the results shows that the cost per
gallon for biocatalyst M36 is increased by 5.7 cents per gallon of
isobutanol compared to biocatalyst M35. Economic analysis of the
results shows the cost per gallon of butanol is increased by 15.3
cents for biocatalyst M37 compared to biocatalyst M35. The cost
increases include the cost of natural gas to make steam and extra
depreciation for larger fermentation vessels to make the same
quantity of product. The depreciation charge was calculated on a
straight line, 10-year basis. This example demonstrates that the
business system and method of producing biofuel benefits from use
of biocatalysts with greater biofuel, and in this case isobutanol,
tolerance. Biocatalysts that have higher tolerance to the biofuel
lead to a biofuel production process that is more economical.
Example 14
[0308] Biocatalysts N7 & N8 both have high 2-propanol specific
and volumetric productivity, high yield, and high final
concentration when grown on dry milled corn feedstock. Biocatalyst
N7 produces an endotoxin, toxic to humans and cattle, while
biocatalyst N8 does not.
[0309] Dry milled corn is prepared and put into two fermenter
tanks, N7 and N8. Dry milled corn is prepared by first milling into
a fine powder. The dry milled corn is then slurried and heated to
99.degree. C. and then alpha-amylase enzyme is added. After a short
saccharification time the slurry is cooled to 30.degree. C. The
slurry solids concentration at this point is about 361 g/kg
(insoluble & soluble solids). Fermentation tank N7 is charged
with biocatalyst N7. Fermentation tank N8 is charged with
biocatalyst N8. The residue from fermentation tank N7, after
stripping off the 2-propanol, is dried and used to fire a boiler,
providing a value of about $40/ton. The residue from fermentation
tank N8 is dried and sold as animal feed for $90/ton because it
contains no endotoxin. Based on a $50/ton difference in value for
the residual solids from the spent fermentation stream, the
2-propanol produced by biocatalyst N8 costs 17 cents per gallon
less to produce than the 2-propanol produced using biocatalyst N7.
This example demonstrates that biocatalysts that do not produce
endotoxin or compounds harmful to cattle provide a lower cost
biofuel, and here specifically, 2-propanol, because co-product
value is enhanced.
Example 15
[0310] Biocatalysts 09 & 010 both have high isobutanol specific
and volumetric productivity, high yield, and high final
concentration when grown on dry milled corn feedstock. Biocatalyst
09 produces an exotoxin, toxic to humans and cattle, while
biocatalyst O10 does not. Dry milled corn is prepared as described
in example 14 and put into two fermenter tanks. Fermentation tank
O9 is charged with biocatalyst O9. Fermentation tank O10 is charged
with biocatalyst O10. The residue from fermentation tank O9, after
stripping off the isobutanol, can be dried and used to fire a
boiler, providing a value of about $40/ton. The residue from
fermentation tank O10 is dried and sold as animal feed for $90/ton
because it contains no exotoxin. Based on a $50/ton difference in
value for the residual solids from the spent fermentation stream,
the isobutanol utilizing biocatalyst O10 costs 17 cents per gallon
less to produce than the isobutanol produced using biocatalyst O9.
This example demonstrates that biocatalysts that do not produce
exotoxin or compounds harmful to cattle provide a lower cost
biofuel, and here specifically isobutanol, because co-product value
is enhanced.
Example 16
[0311] Corn grain is milled into a fine powder. The dry milled corn
is slurried and heated to about 105.degree. C. and then
alpha-amylase enzyme is added. After a short saccharification time
of about 5-6 hours the slurry is cooled to about 32.degree. C. The
slurry solids concentration at this point is about 361 g/kg
(insoluble & soluble solids). Five equal aliquots of the corn
slurry are placed in five identical fermenter tanks labeled
fermenters P10, P11, P12, P13 & P14. Gluco-amylase enzyme is
added to all tanks and biocatalysts P10, P11, P12, P13, & P14
are added to tanks P10, P11, P12, P13, & P14, respectively.
Gluco-amylase sufficient to complete the saccharification in 48
hours is also added to each tank.
[0312] Biocatalysts P10, P11, P12, P13 & P14 are all engineered
to produce butanol from glucose and in 48 hours time have converted
all sugar to produce 84.7 g/L, 90.0 g/L. 95.3 g/L, 97.4 g/L and
99.5 g butanol/L fermentation broth respectively. Biocatalysts P10,
P11, P12, P13, & P14 have theoretical weight yields of butanol
on sugar consumed of 80, 85, 90, 92 & 94% respectively.
[0313] The difference in yields shown by biocatalysts P10, P11,
P12, P13, and P14 impact the quantity of feedstock, the operating
cost, and the capital cost needed to make a gallon of butanol. This
example demonstrates that lower yield increases the cost of
feedstock and other operating costs and capital cost in a
fermentation for the production of biofuel. Therefore, this example
demonstrates that a biocatalyst that produces a biofuel at high
yields is more economical compared to a biocatalyst that produces a
biofuel at a lower yield.
Example 17
[0314] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. Three equal
portions of the pretreated cellulosic material are put into
agitated saccharification and fermentation vessels. All three are
charged with cellulase enzyme sufficient to hydrolyze 80% of the
cellulose in 72 hours. Three equal sized samples of the slurry are
put into identical saccharification and fermentation vessels
labeled Q7, Q8, and Q9.
[0315] Biocatalysts Q7, Q8 & Q9 were each used to inoculate one
of the saccharification and fermentation vessels with the
corresponding label Q7, Q8, and Q9, respectively.
[0316] Biocatalysts Q7, Q8, and Q9 are all engineered to produce
butanol from pretreated cellulosic material (hydrolysate) and in 48
hours time have converted all sugar to produce 10 g/L, 12.5 g/L,
and 15 g butanol/L fermentation broth respectively.
[0317] The difference in yields shown by biocatalysts Q7, Q8, and
Q9 impact the quantity of feedstock, the operating cost, and the
capital cost needed to make a gallon of butanol. This example
demonstrates that lower yield increases the cost of feedstock and
other operating costs and capital cost in a fermentation for the
production of biofuel. Therefore, this example demonstrates that a
biocatalyst that produces a biofuel at high yields is more
economical compared to a biocatalyst that produces a biofuel at a
lower yield.
Example 18
[0318] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into an agitated saccharification and fermentation
vessel. All four experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose and are run in batch
mode over 72 hours. A biocatalyst known to convert glucose, xylose,
mannose, galactose and arabinose to butanol is added to each of the
four fermentations. The fermentation vessels are configured with an
alkali and acid feed pH control system. Furthermore, each of the
four vessels is supplemented with additional nutrients, as shown in
Table 7.
TABLE-US-00007 TABLE 7 Media supplementations for fermenters R1-R4
listed in g/L. Fermenter Fermenter Fermenter Fermenter R1 R2 R3 R4
Yeast Extract 10 0 5 2.5 Peptone 20 0 10 5 Ammonium Sulfate 0 5 5 5
Potassium Phosphate 0 1 1 1 Monobasic Magnesium Sulfate 0 0.5 0.5
0.5 Sodium Chloride 0 0.1 0.1 0.1 Calcium Chloride 0 0.1 0.1 0.1
Biotin 0 0.000002 0 0 D-Pantothenic Acid.cndot.Ca 0 0.0004 0 0
Folic Acid 0 0.00002 0 0 Inositol 0 0.002 0 0 Niacin 0 0.0004 0 0
p-Aminobenzoic Acid 0 0.0002 0 0 Pyridoxine HCl 0 0.0004 0 0
Riboflavin 0 0.0002 0 0 Thiamine HCl 0 0.0004 0 0
[0319] The vessels are agitated for 72 hours. At the end of 72
hours, the fermentation broth is analyzed for butanol and carbon
sources. Analysis of the fermentation samples reveals the
fermentation performance summarized in Table 8 for butanol titers,
production rates and production yields.
TABLE-US-00008 TABLE 8 Summary of fermentation performance for
fermentations 1-4 described above. Fermenter Fermenter Fermenter
Fermenter R1 R2 R3 R4 Butanol Rate (g/L/h) 1 0.5 0.8 0.7 Butanol
Yield 90 72 81 72 (% theoretical) Butanol Titer (g/L) 45 22.5 36
31.5
[0320] Fermentation R2 on salts plus vitamins defined medium,
results in relatively low butanol rate, titer and yield, whereas
the fermentation of fermenter R1, on rich complex media, achieves
the highest performance (Table 8). The fermentations of fermenters
R3 and R4 achieve intermediate rates, titers and yields.
[0321] Economic analysis of the four batch fermentations indicates
butanol recovered from the fermentation of fermenter R1 has the
highest butanol to carbohydrate yield. The fermentation of
fermenter R2 has 60% greater carbohydrate costs than the
fermentation of fermenter R1, relative to the amount of butanol
produced. The fermentations of fermenters R3 and R4 carbohydrate
have 12.5% and 14.3% higher costs when compared to the fermentation
of fermenter R1, respectively, and relative to the amount of
butanol produced. The economic comparison of nutrient costs reveals
that the fermentation of fermenter R2 is the most economical
nutrient composition of all four examples. The fermentation of
fermenter R1 has nutrient costs of almost 600% more that of the
fermentation of fermenter R2. The fermentations of fermenters R3
and R4 have nutrient costs of 380% and 220% when compared to the
fermentation of fermenter R2. When economic costs for carbohydrate
and nutrients are combined, the experiments show the fermentation
of fermenter R2 to be the most cost effective. Carbohydrate and
nutrient costs for the fermentation of fermenter R1 is 312% greater
than that of the fermentation of fermenter R2. Carbohydrate and
nutrient costs for the fermentations of fermenters R3 and R4 are
199% and 141% greater than that of the fermentation of fermenter
R2, respectively.
[0322] This example demonstrates that economic production of
butanol must consider both the efficiency of carbohydrate
conversion by the biocatalysts, as well as nutrient cost and
biocatalyst performance as a system. Selection of a biocatalyst
that can convert carbohydrate on a defined medium with average
productivity and yield can lead to better economics than selection
of a biocatalyst that functions at higher productivity and yields
on complex media.
Example 19
[0323] Dry corn is milled into a fine powder. The dry milled corn
is slurried and jet cooked at temperature of about 105.degree. C.
and then alpha-amylase enzyme is added. The stream is cooled and
gluco-amylase is added. After a short saccharification time of
about 5-6 hours, the slurry is cooled to about 32.degree. C. The
slurry solids concentration at this point is about 361 g/kg,
insoluble and soluble solids. Three equal aliquots of the corn
slurry are placed in three identical batch fermenter tanks. A
biocatalyst that can convert dextrose to isobutanol is added to all
tanks. Furthermore, each of the three vessels is supplemented with
additional nutrients, as shown in Table 9.
TABLE-US-00009 TABLE 9 Media supplementations for fermenters S1-S3
listed in g/L. Fermenter S1 Fermenter S2 Fermenter S3 Yeast Extract
0 5 2.5 Peptone 0 10 5 Ammonium Sulfate 5 5 5 Potassium Phosphate 1
1 1 Monobasic Magnesium Sulfate 0.5 0.5 0.5 Sodium Chloride 0.1 0.1
0.1 Calcium Chloride 0.1 0.1 0.1 Biotin 0.000002 0 0 D-Pantothenic
0.0004 0 0 Acid.cndot.Ca Folic Acid 0.00002 0 0 Inositol 0.002 0 0
Niacin 0.0004 0 0 p-Aminobenzoic Acid 0.0002 0 0 Pyridoxine HCl
0.0004 0 0 Riboflavin 0.0002 0 0 Thiamine HCl 0.0004 0 0
[0324] The vessels are agitated for 52 hours. At the end of 52
hours, the fermentation broth is analyzed for isobutanol content
and carbon sources. Analysis of the fermentation samples reveals
the fermentation performance summarized in Table 10 for isobutanol
titers, production rates, and production yields.
TABLE-US-00010 TABLE 10 Summary of fermentation performance for
fermentations S1-S3 described above. Fermenter S1 Fermenter S2
Fermenter S3 Isobutanol Production 1.05 1.5 1.35 Rate (g/L/h)
Isobutanol Yield 81 90 90 (% theoretical) Isobutanol Titer (g/L)
66.5 95 85.5
[0325] The fermentation of fermenter S1 utilizes a defined media
consisting of salts plus vitamins results in relatively low
isobutanol rates, titers and yields, whereas fermentation S2 on
rich complex media achieves the highest performance. The
fermentation of fermenter S3 achieves results between the
fermentation of fermenter S1 and the fermentation of fermenter S2
in volumetric rate, titer and yield.
[0326] Economic analysis of the three batch fermentations indicates
isobutanol recovery from the fermentation of fermenter S2 has the
highest isobutanol yield on carbohydrate. The fermentation of
fermenter S1 has carbohydrate costs 29% greater than the
fermentation of fermenter S2 on a unit of biofuels production
basis. The fermentation of fermenter S3 shows carbohydrate cost 11%
higher than the fermentation of fermenter S2. The economic
comparison of nutrient costs reveals that the fermentation of
fermenter S1 is the most economical nutrient composition of all
three examples. The fermentation of fermenter S2 has nutrient costs
more than 40 times the cost of nutrients for the fermentation of
fermenter S1. The fermentation of fermenter S3 has nutrients
costing 24 times those of the fermentation of fermenter S1. In this
example, the fermentation of fermenter S1 has the lowest biofuel
cost even though the fermentations of fermenters S2 and S3 show
better fermentation performance. Carbohydrate and nutrient cost for
the fermentation of fermenter S2 is 52.5% greater than the
fermentation of fermenter S1. Carbohydrate and nutrient costs for
the fermentation of fermenter S3 are 27.8% more expensive than the
fermentation of fermenter S1.
[0327] This example demonstrates that economic production of a
biofuel, and here isobutanol, must consider the biocatalyst
efficiency at carbohydrate conversion, as well as the nutrient cost
and biocatalyst performance as a system. Selection of a biocatalyst
that can convert carbohydrate utilizing a low cost minimal medium
consisting of a low cost nutrient package with average productivity
and yield can provide a lower cost biofuel production compared to
complex media producing higher productivities or concentrations.
The low cost nutrient package needs to be chosen to provide the low
cost biofuel production and must take into account the feed stock,
fermentation performance and downstream recovery and
purification.
Example 20
[0328] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into four agitated saccharification and fermentation
vessels. All four experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose, and are run in batch
mode over 72 hours. Biocatalysts TA and TB are known to convert
glucose, xylose, mannose, galactose and arabinose to butanol.
Biocatalyst TA is added to the fermentations of fermenters T1 and
T2. Biocatalyst TB is added to the fermentations of fermenters T3
and T4. The fermentation vessels are configured with an alkali and
acid feed pH control system. Furthermore, each of the four vessels
is supplemented with additional nutrients, as shown in Table
11.
TABLE-US-00011 TABLE 11 Media supplementations for fermenters T1-T4
listed in g/L. Fermenter Fermenter T1 and T3 T2 and T4 Yeast
Extract 10 0 Peptone 20 0 Ammonium Sulfate 0 5 Potassium Phosphate
0 1 Monobasic Magnesium Sulfate 0 0.5 Sodium Chloride 0 0.1 Calcium
Chloride 0 0.1 Biotin 0 0.000002 D-Pantothenic 0 0.0004
Acid.cndot.Ca Folic Acid 0 0.00002 Inositol 0 0.002 Niacin 0 0.0004
p-Aminobenzoic Acid 0 0.0002 Pyridoxine HCl 0 0.0004 Riboflavin 0
0.0002 Thiamine HCl 0 0.0004
[0329] The vessels are agitated for 72 hours. At the end of 72
hours the fermentation broth is analyzed for butanol and carbon
sources. Analysis of the fermentation samples reveals the
fermentation performance summarized in Table 12 for butanol titers,
production rates and production yields.
TABLE-US-00012 TABLE 12 Summary of fermentation performance for
fermentations T1-T4 described above. Fermenter Fermenter Fermenter
Fermenter T1, T2, T3, T4, Biocatalyst Biocatalyst Biocatalyst
Biocatalyst TA TA TB TB Butanol Rate 1 0.5 1 0.25 (g/L/h) Butanol
Yield 90 72 90 36 (% theoretical) Butanol Titer 45 22.5 45 11
(g/L)
[0330] The fermentation of fermenter T1 and the fermentation of
fermenter T3 on rich, complex media achieved the highest
performance. The fermentation of fermenter T2 with Biocatalyst TA
on salts plus vitamins defined media results in intermediate
butanol rates, titers and yields, whereas the fermentation of
fermenter T4 with Biocatalyst TB achieved a low rate, titer and
yield.
[0331] Economic analysis of the four batch fermentations indicates
butanol recovered from the fermentation of fermenter T1 and T3 have
the highest butanol to carbohydrate yield. The fermentation of
fermenter T2 has 60% greater carbohydrate costs than the
fermentation of fermenter T1 and T3. The fermentation of fermenter
T4 carbohydrate costs are 120% higher compared to the fermentations
of fermenters T1 and T3. The economic comparison of nutrient costs
reveals that the fermentations of fermenters T2 and T4 are the most
economical nutrient compositions of all four experiments. The
fermentations of fermenters T1 and T3 have nutrient costs at almost
600% that of the fermentation of fermenter T2. The fermentation of
fermenter T4 has nutrient costs similar to that of the fermentation
of fermenter T2. When economic costs for carbohydrate and nutrients
are combined, the experiments show the fermentation of fermenter T2
to be the most cost effective. Carbohydrate and nutrient costs for
the fermentations of fermenters T1 and T3 are the same.
Carbohydrate and nutrient costs for the fermentations of fermenters
T1 and T3 are 312% that of the fermentations of fermenters T2.
Carbohydrate and nutrient costs for the fermentation of fermenter
T4 is about 200% greater than for the fermentation of fermenter
T2.
[0332] This example demonstrates that economic production of
biofuel, and here butanol, must consider both the efficiency of
carbohydrate conversion by the biocatalysts and nutrient cost and
performance as a biofuel fermentation system. As Biocatalyst TA
operates with better performance on a defined medium, relative to
the performance of Biocatalyst TB, whereas in complex medium,
Biocatalyst TA and Biocatalyst TB have the same performance.
Therefore, Biocatalyst TA is economically superior to Biocatalyst
TB. Selection of an organism that can convert carbohydrate into
biofuel on low-cost, defined medium with sufficient productivity
and yield can lead to better economics than selection of a
biocatalyst that leads to insufficient productivity and yield of
biofuel on low-cost, defined medium and, therefore, requires
complex medium for economical productivity and yield.
Example 21
[0333] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into an agitated saccharification and fermentation
vessel. All four experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose and are run in batch
mode over 72 hours. Biocatalysts UA and UB are known to convert
glucose, xylose, mannose, galactose and arabinose to butanol.
Biocatalyst UA is added to fermentations U1 and U2. Biocatalyst UB
is added to fermentations U3 and U4. The fermentation vessels are
configured with an alkali and acid feed pH control system.
Furthermore, each of the four vessels is supplemented with
additional nutrients, as shown in Table 13.
TABLE-US-00013 TABLE 13 Media supplementations for fermenters U1-U4
listed in g/L. Fermenter Fermenter U1 and U3 U2 and U4 Yeast
Extract 0 0 Peptone 0 0 Ammonium Sulfate 5 5 Potassium Phosphate 1
1 Monobasic Magnesium Sulfate 0.5 0.5 Sodium Chloride 0.1 0.1
Calcium Chloride 0.1 0.1 Iron Sulfate 0.1 0.1 Biotin 0.000002 0
D-Pantothenic 0.0004 0 Acid.cndot.Ca Folic Acid 0.00002 0 Inositol
0.002 0 Niacin 0.0004 0 p-Aminobenzoic Acid 0.0002 0 Pyridoxine HCl
0.0004 0 Riboflavin 0.0002 0 Thiamine HCl 0.0004 0
[0334] The vessels are agitated for 72 hours. At the end of 72
hours the fermentation broth is analyzed for butanol and carbon
sources. Analysis of the fermentation samples reveals the
fermentation performance summarized in Table 14 for butanol titers,
production rates and production yields.
TABLE-US-00014 TABLE 14 Summary of fermentation performance for
fermentations U1-U4 described above Fermenter Fermenter Fermenter
Fermenter U1, U2, U3, U4, Biocatalyst Biocatalyst Biocatalyst
Biocatalyst UA UA UB UB Butanol Rate 1 1 1 0.5 (g/L/h) Butanol
Yield 90 90 90 45 (% theoretical) Butanol Titer 45 45 45 22.5
(g/L)
[0335] The fermentation of fermenter U1 and the fermentation of
fermenter U3 on minimal medium plus vitamins result in equal
butanol rates, titers and yields. The fermentation of fermenter U2
with Biocatalyst UA on salts defined media results in equal butanol
rate, titer and yield when compared to Fermentations U1 and U3.
However, the fermentation of fermenter U4 with Biocatalyst UB
achieved a lower rate, titer and yield, relative to the
fermentations of fermenters U1, U2, and U3.
[0336] Economic analysis of the four batch fermentations indicates
butanol recovered from the fermentations of fermenters U1, U2, and
U3 have the highest butanol to carbohydrate yield. The fermentation
of fermenter U4 has 60% greater carbohydrate costs than the
fermentations of fermenters U1, U2, and U3. The fermentations of
fermenters U2 and U4 use the most economical nutrient composition
of all four fermentations. The fermentations of fermenters U1 and
U3 have nutrient costs at almost 150% that of the fermentation of
fermenter U2. The fermentation of fermenter U4 has nutrient costs
at almost 200% that of the fermentation of fermenter U2. When
economic costs for carbohydrate and nutrients are combined, the
experiments show the fermentation of fermenter U2 to be the most
cost effective. Carbohydrate and nutrient costs for the
fermentations of fermenters U1 and U3 are the same. Carbohydrate
and nutrient costs for the fermentations of fermenters U1 and U3
are 150% that of the fermentation of fermenter U2. Carbohydrate and
nutrient costs for the fermentation of fermenter U4 is about 200%
that of the fermentation of fermenter U2. The biocatalyst UA is
able to produce butanol with only mineral salts composed of major
and minor bioelements, whereas the biocatalyst UB requires addition
of vitamins and other nutrients. Therefore, since the fermentation
in fermenter U2 using biocatalyst UA is the most economical for
production of butanol, the biocatalyst UA is economically superior
to biocatalyst UB and is thus the preferred biocatalyst.
[0337] This example demonstrates that economic production of
biofuel must consider both the efficiency of carbohydrate
conversion by the biocatalysts, nutrient cost, and biocatalyst
performance as a biofuel fermentation system. Biocatalyst UA
operates with better performance on a minimal medium, relative to
the performance of Biocatalyst UB, whereas in minimal medium plus
vitamins, Biocatalyst UA and Biocatalyst UB have the same
performance. Therefore, Biocatalyst UA is economically superior to
Biocatalyst UB. Selection of an organism that can convert a
feedstock like carbohydrate into biofuel on low-cost, minimal
medium of mineral salts comprised of major and minor bioelements in
addition to the feedstock, and with sufficient productivity and
yield, can lead to better economics than selection of a biocatalyst
that leads to insufficient productivity and yield on low-cost,
minimal medium and, therefore, requires vitamins for
economically-viable productivity and yield.
Example 22
[0338] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into four agitated saccharification and fermentation
vessels. All four experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose and are run in batch
mode over 72 hours. Biocatalysts VA and VB are known to convert
glucose, xylose, mannose, galactose and arabinose to butanol.
Biocatalyst VA is added to the fermentations of fermenters V1 and
V2. Biocatalyst VB is added to the fermentations of fermenters V3
and V4. The fermentation vessels are configured with an alkali and
acid feed pH control system. Furthermore, each of the four vessels
is supplemented with additional nutrients, as shown in Table
15.
TABLE-US-00015 TABLE 15 Media supplementations for fermenters V1-V4
listed in g/L. Fermenter Fermenter V1 and V3 V2 and V4 Yeast
Extract 0 0 Peptone 0 0 Ammonium Sulfate 5 5 Potassium Phosphate 1
1 Monobasic Magnesium Sulfate 0.5 0.5 Sodium Chloride 0.1 0 Calcium
Chloride 0.1 0 Sodium Sulfate 0 0.1 Calcium Phosphate 0 0.1 Iron
Sulfate 0.1 0.1
[0339] The vessels are agitated for 72 hours. At the end of 72
hours, the fermentation broth is analyzed for butanol and carbon
sources. Analysis of the fermentation samples reveals the
fermentation performance summarized in Table 16 for butanol titers,
production rates and production yields.
TABLE-US-00016 TABLE 16 Summary of fermentation performance for
fermentations V1-V4 described above. Fermenter Fermenter Fermenter
Fermenter V1, V2, V3, V4, Biocatalyst Biocatalyst Biocatalyst
Biocatalyst VA VA VB VB Butanol Rate 1 1 1 0.5 (g/L/h) Butanol
Yield 90 90 90 45 (% theoretical) Butanol Titer 45 45 45 22.5
(g/L)
[0340] The fermentation of fermenter V1 and the fermentation of
fermenter V3 on minimal medium with chloride salts result in equal
butanol rates, titers and yields. The fermentation of fermenter V2
with Biocatalyst VA on minimal medium without chloride salts
results in equal butanol rate, titer and yield when compared to the
fermentations of fermenters V1 and V3. However, the fermentation of
fermenter V4 with Biocatalyst VB achieved a lower rate, titer and
yield, relative to Fermenters V1. V2, and V3.
[0341] Economic analysis of the four batch fermentations indicates
butanol recovered from the fermentations of fermenters V1, V2, and
V3 have the highest butanol to carbohydrate yield. The fermentation
of fermenter V4 has carbohydrate costs 200% that of the
fermentations of fermenters V1, V2, and V3. The fermentation of
fermenter V4 has nutrient costs almost 150% that of the
fermentations of fermenters V1, V2, and V3 relative to butanol
produced. When economic costs for carbohydrate and nutrients are
combined, the experiments show the fermentations of fermenters V1,
V2, and V3 to be the most cost effective. Carbohydrate and nutrient
costs for the fermentation of fermenter V4 are about 250% than the
costs of the fermentations of fermenters V1, V2, and V3. Capital
costs for the fermentations of fermenters V2 and V4 are less than
the capital costs for the fermentations of fermenters V1 and V3.
The presence of chloride salts in the fermentation of fermenter V1
and V3 make it necessary to use stainless steel to build the
fermentation vessels and the downstream equipment for these
fermentations. However, the lack of chloride salts in the added
nutrients in the fermentations of fermenters V2 and V4 permit the
use of carbon steel. Carbon steel is much less expensive than
stainless steel, and therefore the capital costs for the
fermentations of fermenters V2 and V4 are lower. However, for the
fermentations of fermenters V4, the lower performance of the
biocatalyst without chloride in the nutrients added leads to an
increase in capital costs relative to fermentation V2 because a
larger vessel size is needed to compensate for the lower
performance of Biocatalyst VB. In summary, Biocatalyst VA is
superior to Biocatalyst VB because capital and operating costs are
lower.
[0342] This example demonstrates that economic production of
biofuel must consider both the efficiency of carbohydrate
conversion by the biocatalysts, nutrient cost, biocatalyst
performance as a biofuel fermentation system and capital cost
requirements. Biocatalyst VA operates with better performance on a
minimal medium excluding chloride salts, relative to the
performance of Biocatalyst VB, whereas in minimal medium including
chloride salts, Biocatalyst VA and Biocatalyst VB have the same
performance. Therefore, Biocatalyst VA is economically superior to
Biocatalyst VB. Selection of an organism that can convert a
feedstock like carbohydrate into biofuel like butanol on minimal
medium excluding chloride salts with sufficient productivity and
yield can lead to better economics than selection of a biocatalyst
that leads to insufficient productivity and yield on minimal medium
without chloride salts and, therefore, requires chloride salts for
economical productivity and yield.
Example 23
[0343] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into an agitated saccharification and fermentation
vessel. All six experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose and are run in batch
mode over 72 hours. Biocatalysts WA, WB, and WC are anaerobes known
to convert glucose, xylose, mannose, galactose and arabinose to
butanol. Biocatalyst WA does not function in the presence of
oxygen, but recovers from oxygen exposure and regains its original
butanol specific productivity when oxygen is removed. When exposed
to oxygen for 3 hours, Biocatalyst WB is damaged such that it loses
50% of its butanol specific productivity. When exposed to oxygen
for 3 hours, Biocatalyst WC is damaged such that it loses all of
its butanol specific productivity. All three biocatalysts continue
to consume feedstock when exposed to oxygen. Biocatalyst WA is
added to Fermenter W1 and Fermenter W2. Biocatalyst WB is added to
Fermenter W3 and Fermenter W4. Biocatalyst WC is added to Fermenter
W5 and Fermenter W6. All six fermenters contain 3 g/cell dry weight
of throughout the experiment.
[0344] At the beginning of the fermentations, all fermenters are
controlled to exclude oxygen completely. Fermenters W1, W3 and W5
remain completely without oxygen throughout the fermentation.
Fermenters W2, W4, and W6 are exposed to oxygen at a dissolved
oxygen concentration of about 10% air saturation at 36 hours into
the fermentation. The oxygen exposure lasts for about 3 hours and
then oxygen is removed completely from Fermenters W2, W4, and W6
for the remainder of the fermentations. The vessels are operated
for 72 hours. At the end of 72 hours the fermentation broth is
analyzed for butanol.
[0345] Fermentations W1. W3, and W5 produce the same amount of
butanol after 72 hours. Fermentation W2 produces 4% less butanol
than Fermentations W1, W3, and W5. Fermentation W4 produces 16.5%
less butanol than Fermentations W1, W3, and W5. Fermentation W6
produces 50% less butanol than Fermentations W1, W3, and W5.
[0346] Economic analysis of the six batch fermentations indicates
butanol recovered from Fermentations W1, W3, and W5, which have the
highest volumetric productivity, can be produced at a lower cost.
The cost of butanol produced in Fermentation W2 is slightly more
expensive than butanol produced in Fermentations W1, W3, and W5.
The cost of butanol produced in Fermentation W4 is more expensive
than butanol produced in Fermentation W2. The cost of butanol
produced in Fermentation W6 is significantly more expensive than
butanol produced in Fermentation W2. The reduced butanol titer of
fermentations W2, W4, and W6 results in higher operating costs
since less butanol is produced from the same amount of feedstock
consumed and in the same amount of time. Furthermore, the lower
titer reached in these fermentations requires higher energy input
during downstream separation and processing, thus further
increasing the costs of fermentations W2, W4, and W6. However, the
additional operating costs incurred using biocatalyst WA are less
than the operating costs incurred through the use of biocatalysts
WB and WC. Therefore, biocatalyst WA is the most economical
biocatalyst when introduction of oxygen occurs during an anaerobic
fermentation because biocatalyst WA can tolerate brief exposure to
oxygen and regains 100% of the specific butanol productivity once
the oxygen is removed.
[0347] If consistent costs for butanol production are to be
achieved and to compensate for differences in performance of
biocatalysts WA, WB, and WC under the conditions of this example, a
manufacturing facility must build fermentation vessels of different
sizes to ensure equal overall productivity of the manufacturing
facility. The reduced productivity in fermenter W2 results in a
slight increase in capital costs, relative to Fermenters W1, W3,
and W5. The reduced productivity in fermenter W4 results in a
moderate increase in capital costs, relative to Fermenter W2. The
reduced productivity in fermenter W6 results in a significant
increase in capital costs, relative to Fermenter W2. In order to
reach the same overall productivity that is reached in fermentation
W2 and by biocatalyst WA, a biofuel manufacturing facility
operating fermenters W4 and W6 requires larger volume fermentation
vessels built at a higher capital expense. The results of these
fermentations at various levels of oxygen contamination demonstrate
the impact of utilization of an oxygen tolerant biocatalyst capable
of recovering from exposure to oxygen on the capital costs of the
biofuel production process.
Example 24
[0348] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into four agitated saccharification and fermentation
vessels. All four experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose and are run in batch
mode over 72 hours. Biocatalysts XA and XB are anaerobes known to
convert glucose, xylose, mannose, galactose and arabinose to
isobutanol. Biocatalyst XA functions in the presence of small
amounts of oxygen. When exposed to oxygen, Biocatalyst XB is
damaged such that it loses 50% of its specific productivity.
Biocatalyst XA is added to Fermenter X1 and Fermenter X2.
Biocatalyst XB is added to Fermenter X3 and Fermenter X4. All four
fermenters contain 3 g/cell dry weight of throughout the
experiment.
[0349] Fermenters X1 and X3 remain completely without oxygen
throughout the fermentation. Fermenters X2 and X4 are exposed to
oxygen at a dissolved oxygen concentration of 0.1% saturation
throughout the fermentation. The vessels are operated for 72 hours.
At the end of 72 hours the fermentation broth is analyzed for
isobutanol. Fermentations X1, X2 and X3 produce the same amount of
isobutanol after 72 hours. Fermentation X4 produces 50% less
isobutanol than Fermentations X1, X2, and X3.
[0350] Economic analysis of the four batch fermentations indicates
isobutanol recovered from Fermentations X1, X2, and X3, which have
the highest volumetric productivity, can be produced at a lower
cost. However, the overall cost of isobutanol produced in Fermenter
X2, using Biocatalyst XA, is less expensive than isobutanol
produced in Fermenters X1 and X3. The operating costs of Fermenter
X2 are lower, since less heat in the form of steam and oxygen-free
gas must be used to remove oxygen from the fermenter. The cost of
isobutanol produced in Fermentation X4 is significantly more
expensive than isobutanol produced in Fermentations X1, X2, and X3.
Therefore, a biofuel manufacturing facility operating a process
that uses Biocatalyst XA can operate a fermentation setup that
permits small amounts of oxygen to be present in the fermentation
broth without sacrificing the overall productivity of the process.
To compensate for differences in performance of biocatalysts XA and
XB under the conditions of this example, a biofuel manufacturing
facility must build fermentation vessels of increased size or of
material composition that exclude oxygen completely to ensure equal
overall productivity of the biofuel manufacturing facility. The
reduced productivity of Biocatalyst XB in fermenter X4 results in a
significant increase in capital costs, relative to Biocatalyst XA
in Fermenter X2. The results of these fermentations at various
levels of oxygen contamination demonstrate the impact of
utilization of an oxygen tolerant organism capable of recovering
from exposure to oxygen on the capital costs of the biofuel
production process.
Example 25
[0351] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into an agitated saccharification and fermentation
vessel. All four experiments are charged with cellulase enzyme
sufficient to hydrolyze 80% of the cellulose and are run in batch
mode over 72 hours. Biocatalysts YA and YB are facultative
anaerobes known to convert glucose, xylose, mannose, galactose and
arabinose to butanol. Biocatalyst YA is modified such that it does
not consume oxygen through respiration, but instead in the presence
of oxygen, the biocatalyst still produces butanol at undiminished
productivity. When exposed to oxygen, Biocatalyst YB activates
aerobic pathways that lead to byproducts that reduce the yield of
butanol. Biocatalyst YA is added to Fermenter Y1 and Fermenter Y2.
Biocatalyst YB is added to Fermenter Y3 and Fermenter Y4. All four
fermenters contain 3 g/cell dry weight of throughout the
experiment.
[0352] Fermenters Y1 and Y3 remain completely without oxygen
throughout the fermentation. Oxygen levels in Fermenters Y2 and Y4
are maintained at 0.1% air saturation dissolved oxygen
concentration. The vessels are operated for 72 hours. At the end of
72 hours the fermentation broth is analyzed for butanol.
Fermentations Y1, Y2 and Y3 produce the same amount of butanol
after 72 hours. Fermentation Y4 produces 50% less butanol than
Fermentations Y1, Y2, and Y3. All four fermenters consume the same
amount of feedstock. Economic analysis of the four batch
fermentations indicates butanol recovered from Fermentations Y1,
Y2, and Y3, which have the highest titers of butanol, can be
produced at a lower cost. However, the overall cost of butanol
produced in Fermenter Y2, using Biocatalyst YA, is less expensive
than butanol produced in Fermenters Y1 and Y3. The operating costs
of Fermenter Y2 are lower, since less heat in the form of steam and
oxygen-free gas must be used to remove oxygen from the fermenter.
The cost of butanol produced in Fermentation Y4 is significantly
more expensive than butanol produced in Fermentations Y1, Y2, and
Y3, due to the lower yield of butanol and the increased cost of
feedstock relative to the amount of butanol produced. Therefore, a
biofuel manufacturing facility operating a process that uses
Biocatalyst YA can operate a biofuel fermentation setup that
permits small amounts of oxygen to be present in the fermentation
broth without sacrificing the overall productivity of the process.
To compensate for differences in performance of biocatalysts YA and
YB under the conditions of this example, a biofuel manufacturing
facility must build fermentation vessels of increased size or of
material composition that exclude oxygen completely to ensure equal
overall productivity of the manufacturing facility. The reduced
productivity of Biocatalyst YB in fermenter Y4 results in a
significant increase in capital costs, relative to Biocatalyst YA
in Fermenter Y2. The results of these biofuel fermentations at
various levels of oxygen contamination demonstrate the impact of
utilization of an oxygen tolerant biocatalyst capable of recovering
from exposure to oxygen on the capital costs of the process.
Example 26
[0353] Dry corn is milled into a fine powder. The dry milled corn
is slurried and jet cooked at temperature of about 105.degree. C.
and then alpha-amylase enzyme is added. The stream is cooled and
gluco-amylase is added. After a short saccharification time of
about 5-6 hours the slurry is cooled to about 30.degree. C. The
slurry solids concentration at this point is about 361 g/kg
(insoluble & soluble solids). Two equal aliquots of the corn
slurry are placed in two identical batch fermenter tanks. No
additional nutrients are added to fermentation tank Z1, whereas
fermentation tank Z2 receives additional mineral salts and
vitamins, as required by the properties of the biocatalysts ZA and
ZB used in each tank (Table 17). Both tanks are inoculated with
biocatalysts that can convert dextrose to isobutanol: Tank Z1 is
inoculated with biocatalyst ZA and Tank Z2 is inoculated with
biocatalyst ZB. Fermenter tanks Z1 and Z2 are operated under
different conditions as required by the properties of the
biocatalysts ZA and ZB used in each tank (Table 17). Both
biocatalysts ZA and ZB are genetically engineered to convert
dextrose to isobutanol. Biocatalyst ZA is engineered in a way such
that it contains DNA consisting of natural DNA, however,
biocatalyst ZB contains DNA comprised to 2% of foreign DNA, in the
form of a DNA marker, as a result of the specific approach taken to
engineer this organism for isobutanol production. Both tank Z1 and
tank Z2 contain 1 g/L cell dry weight. Fermenter Z1 is temperature
controlled at 30.degree. C. and fermenter Z2 is controlled at
25.degree. C. Fermenter Z1 is controlled at a pH of 5 and fermenter
Z2 is controlled at a pH of 8. Both fermenter Z1 and fermenter Z2
experience equipment malfunctions that cause a 10.degree. C.
increase in temperature of the fermentation for a brief period of
time. After this time, the fermenters are restored to their
original temperature. Also, during the fermentation, both fermenter
Z1 and fermenter Z2 experience equipment malfunctions that cause a
one unit increase of pH in the fermentation for a brief period of
time. After this time, the fermenters are restored to their
original pH. The vessels are agitated until maximum titer is
reached. At the point of maximum titer, the fermentation broth of
each fermenter is analyzed for isobutanol content, byproducts, and
dextrose. DDG product comprising spent biocatalyst ZA and spent
biocatalyst ZB are analyzed for toxicity.
[0354] Analysis of the fermentation samples reveals the
fermentation performance parameters summarized in Table 17 for
isobutanol titers, production rates, production yields, toxicity of
DDG, and growth rates. Fermenter Z1 produces isobutanol at a higher
rate, titer, yield, compared to fermenter Z2 (Table 17).
Biocatalyst ZA has a higher growth rate and lower toxicity compared
to biocatalyst ZB (Table 17). The spent biocatalyst from
fermentation Z1 is dried and added to DDGS sold for animal feed at
current market rates. However the spent biocatalyst from fermenter
Z2 are dried and burned for energy sold at current market
rates.
TABLE-US-00017 TABLE 17 Summary of biocatalyst parameters and
fermentation results for fermentations Z1 & Z2. Fermenter Z1
Fermenter Z2 Production Biocatalyst ZA ZB Isobutanol titer 2% (w/w)
1% (w/w) Isobutanol Rate (g/l h) 0.5 0.4 DDG toxicity of 1 kg
1/1000 of LD.sub.50 1/250 of LD.sub.50 Isobutanol Yield (%
theoretical) 80 70 Byproduct concentration None 5% DNA content
Natural DNA 2% foreign DNA Operating pH 5 8 pH fluctuation .+-.1 pH
.+-.1 pH Operating temperature 30.degree. C. 25.degree. C.
Temperature fluctuation .+-.10.degree. C. .+-.10.degree. C.
Additional nutrients provided None Mineral salts and vitamins
Biocatalyst growth rate 0.3 per h 0.17 per h
[0355] An economic analysis of the value of the DDGS sold as a feed
in fermenter Z1 compared to burning the spent biocatalyst from
fermenter Z2 is performed. Additionally, an economic analysis of
the cost of the isobutanol produced from fermenter Z1 with
biocatalyst ZA and fermenter Z2 with biocatalyst ZB is performed.
Results of the economic analyses indicate that the co-product
credit for selling the DDGS as animal feed results in a cost
reduction of isobutanol compared to burning the spent biocatalyst.
There is also a cost reduction of isobutanol per gallon as a result
of the increased productivity, titer, yield, and biocatalyst ZA
growth rate in fermenter Z1. Additionally, fermenter Z1 and
biocatalyst ZA results in lower operating costs than fermenter Z2
and biocatalyst ZB, since no nutrients in addition to the feedstock
are added. Further still, fermenter Z1 does not require as much
energy for cooling as fermenter Z2 and thus energy costs for
fermenter Z1 are less than for fermenter Z2. An economic analysis
of the overall process costs for the two biocatalysts reveals that
fermenter Z1 costs are 10% less than fermenter Z2. Thus, fermenter
Z1 and biocatalyst ZA provide an economic advantage. This example
illustrates the importance of economically superior performance
parameters and properties of a biocatalyst in a biofuel production
process, as shown in Table 17.
Example 27
[0356] A cellulosic material consisting of 45% cellulose, 25%
hemicellulose, 22% lignin and 8% other materials is pretreated to
yield slurry of 8% insoluble cellulose with about 4% insoluble
lignin, 1% glucose, 40 g/l xylose, 2 g/l mannose, 2 g/l galactose,
1 g/l arabinose, 5 g/l acetic acid in solution. For each
experiment, equal portions of the pretreated cellulosic material
are added into an agitated saccharification and fermentation
vessel. All fermenters are charged with cellulase enzyme sufficient
to hydrolyze 80% of the cellulose. This results in about 119 g
fermentable carbon source per kg dry feed used. Biocatalysts known
to convert glucose, xylose, mannose, galactose and arabinose to
butanol are added to each of nine fermentation vessels, but all
nine biocatalysts exhibit different performance characteristics.
Each fermentation vessel is configured with an alkali and acid feed
pH control system. Biocatalyst AA1 shows a combination of optimal
performance characteristics. All eight other biocatalysts are
compared to AA1. Biocatalyst AA exhibits improved productivity,
compared to biocatalyst AA2. Biocatalyst AA1 exhibits a higher
titer due to lack of inhibition, compared to biocatalyst AA3.
Biocatalyst AA1 exhibits a higher yield, compared to biocatalyst
AA4. Biocatalyst AA1 exhibits a higher yield due to the lack of
production of byproducts, compared to biocatalyst AA5. Biocatalyst
AA1 exhibits a higher productivity due to lack of inhibition at
process pH, compared to biocatalyst AA6, which exhibits partial
inhibition at process pH. Biocatalyst AA1 exhibits a higher
productivity than biocatalyst AA7 because biocatalyst AA7 exhibits
partial inhibition at the process temperature. Biocatalyst AA8
shows the same performance as biocatalyst AA1, except only in the
presence of 10 g/L complex nutrients (5 g/L of yeast extract and 5
g/L of peptone). Thus, 10 g/L complex nutrients are also added
along with the feedstock to fermenter AA8. Biocatalyst AA9 combines
all reduced performance characteristics of biocatalyst AA2 through
biocatalyst AA8.
[0357] Fermentations are run and at the point of maximum titer, the
runs are ended. Samples are taken from each fermenter and analyzed
for butanol concentration. Analysis of the fermentation samples
reveals the fermentation performance summarized in Table 18 for
butanol titers, production rates and production yields. Resulting
costs are based on a feedstock cost of $0.22/kg butanol. The
butanol plant has a capacity of 100 million gallons per year. The
capital costs for this plant are $8 million per million gallon
fermenter capacity.
TABLE-US-00018 TABLE 18 Summary of performance for fermentations
using biocatalysts AA1-AA9 and resulting costs.
Biocatalyst/Fermenter AA1 AA2 AA3 AA4 AA5 AA6 AA7 AA8 AA9
Approximate medium 0.1 0.1 0.1 0.1 0.1 0.1 0.1 5.1 5.1 cost
(cents/L) Butanol Rate (g/L h) 1.0 0.8 1.0 1.0 1.0 0.6 0.4 1.0 0.2
Butanol Yield (% 90.0 90.0 90.0 72.0 54.0 90.0 90.0 90.0 43.2
theoretical) Butanol Titer (g/L) 45.0 45.0 22.5 45.0 45.0 45.0 45.0
45.0 22.5 Capital cost for 72.3 90.3 72.3 72.3 72.3 120.4 180.6
72.3 380.3 fermenter System (million $) Capital costs compared 100
125 100 100 100 167 250 100 526 to Biocatalyst AA1 (%) Total
Feedstock & 184.3 184.3 191.1 228.7 302.6 184.3 184.3 525.0
1064.7 Medium Costs Annually (million $) Sugar and nutrient costs
100 100 104 124 164 100 100 285 578 ratio compared to biocatalyst
AA1 (%)
[0358] Economic analysis of the batch fermentations indicates
butanol recovered from fermentation AA1 shows the best economics.
Compared to fermentation AA1, fermentations AA2, AA6 and AA7 show
higher capital costs of 125%, 167% and 250%, respectively. Compared
to fermentation AA1, fermentations AA3, AA4, AA5 and AA8 show
higher operating costs of 104%, 124%, 164% and 385%, respectively.
Fermentation AA9 has a higher capital cost of 526% and a higher
operating cost of 578% compared to fermentation AA1. In addition to
the cost considerations of this model, increased down-stream
recovery costs for processes based on less efficient biocatalysts
also affect the overall process economics. Biocatalyst AA1 has
favorable and economic down-stream recovery costs.
[0359] This example demonstrates that economic production of
biofuel must consider a broad range of biocatalyst performance
characteristics for the efficient conversion of a feedstock, such
as carbohydrate, into a biofuel. Further, this example demonstrates
that use of a biocatalyst with lower performance characteristics
negatively impacts capital and operating costs of a biofuel
production process. Selection and use of a biocatalyst that shows
the best performance of a combination of characteristics for
biofuel production is crucial for economic success.
Example 28
[0360] General methods used in this disclosure. Sample preparation:
All Samples (2 mL) from fermentation experiments performed in shake
flasks were stored at -20.degree. C. for later substrate and
product analysis. Prior to analysis, samples were thawed, mixed
well, and then centrifuged at 14,000.times.g for 10 min. The
supernatant was filtered through a 0.2 .mu.m filter. Analysis by
HPLC or GC of substrates and products was performed using authentic
standards (>99%, obtained from Sigma-Aldrich), and a five-point
calibration curve (with 1-pentanol as an internal standard for
analysis by gas chromatography).
[0361] Determination of Optical Density and Cell Dry Weight:
[0362] The optical density of cultures was determined at 600 nm
using a DU 800 spectrophotometer (Beckman-Coulter, Fullerton,
Calif., USA). Samples were diluted as necessary to yield an optical
density of between 0.1 and 0.8. The cell dry weight was determined
by centrifuging 50 mL of culture prior to decanting the
supernatant. The cell pellet was washed once with 50 mL of milliQ
H.sub.2O, centrifuged and the pellet was washed again with 25 mL of
milliQ H.sub.2O. The cell pellet was then dried at 80.degree. C.
for at least 72 hours. The cell dry weight was calculated by
subtracting the weight of the centrifuge tube from the weight of
the centrifuge tube containing the dried cell pellet. For E. coli
cultures, an OD600 to cell dry weight conversion factor of 0.25 was
used.
[0363] Gas Chromatography:
[0364] Analysis of volatile organic compounds, including ethanol
and isobutanol, was performed on a HP 5890 gas chromatograph fitted
with an HP 7673 Autosampler, a DB-FFAP column (J&W; 30 m
length, 0.32 mm ID, 0.25 .mu.M film thickness) or equivalent
connected to a flame ionization detector (FID). The temperature
program was as follows: 200.degree. C. for the injector,
300.degree. C. for the detector, 100.degree. C. oven for 1 minute,
70.degree. C./minute gradient to 235.degree. C., and then hold for
2.5 min. Analysis was performed using authentic standards (>99%,
obtained from Sigma-Aldrich), and a 5-point calibration curve with
1-pentanol as the internal standard.
[0365] High Performance Liquid Chromatography:
[0366] Analysis of glucose and organic acids was performed on a
HP-1100 High Performance Liquid Chromatography system equipped with
a Aminex HPX-87H Ion Exclusion column (Bio-Rad, 300.times.7.8 mm)
or equivalent and an H.sup.+ cation guard column (Bio-Rad) or
equivalent. Organic acids were detected using an HP-1100 UV
detector (210 nm, 8 nm 360 nm reference) while glucose was detected
using an HP-1100 refractive index detector. The column temperature
was 60.degree. C. This method was isocratic with 0.008N sulfuric
acid in water as mobile phase. Flow was set at 0.6 mL/min.
Injection size was 20 .mu.L and the run time was 30 minutes.
[0367] Molecular Biology and Bacterial Cell Culture:
[0368] Standard molecular biology methods for cloning and plasmid
construction were generally used, unless otherwise noted (Sambrook,
J., Russel, D. W. Molecular Cloning, A Laboratory Manual. 3 ed.
2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory
Press).
[0369] Standard recombinant DNA and molecular biology techniques
used in the Examples are well known in the art and are described by
Sambrook, J., Russel, D. W. Molecular Cloning, A Laboratory Manual.
3 ed. 2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory
Press; and by T. J. Silhavy, M. L. Bennan, and L. W. Enquist,
Experiments with Gene Fusions, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N. Y. (1984) and by Ausubel, F. M. et al.,
Current Protocols in Molecular Biology, pub. by Greene Publishing
Assoc. and Wiley-Interscience (1987).
[0370] General materials and methods suitable for the routine
maintenance and growth of bacterial cultures are well known in the
art. Techniques suitable for use in the following examples may be
found as set out in Manual of Methods for General Bacteriology
(Phillipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W.
Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips,
eds.), American Society for Microbiology, Washington, D.C. (1994))
or by Thomas D. Brock in Biotechnology: A Textbook of Industrial
Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland,
Mass. (1989).
[0371] Preparation of Electrocompetent Cells and
Transformation:
[0372] The acceptor strain culture was grown in SOB-medium
(Sambrook, J., Russel, D. W. Molecular Cloning, A Laboratory
Manual. 3 ed. 2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor
Laboratory Press) to an OD.sub.600 of about 0.6 to 0.8. The culture
was concentrated 100-fold, washed once with ice cold water and 3
times with ice cold 10% glycerol. The cells were then resuspended
in 150 .mu.L of ice-cold 10% glycerol and aliquoted into 50 .mu.L
portions. These aliquots were used immediately for standard
transformation or stored at -80.degree. C. These cells were
transformed with the desired plasmid(s) via electroporation. After
electroporation, SOC medium (Sambrook, J., Russel, D. W. Molecular
Cloning, A Laboratory Manual. 3 ed. 2001, Cold Spring Harbor, N.Y.:
Cold Spring Harbor Laboratory Press) was immediately added to the
cells. After incubation for an hour at 37.degree. C. the cells were
plated onto LB-plates containing the appropriate antibiotics and
incubated overnight at 37.degree. C.
Example 29
[0373] Construction of Strains and Plasmids:
[0374] GEVO1748 and GEVO1749 are derivatives of JCL260 ((WO
2008/098227) BIOFUEL PRODUCTION BY RECOMBINANT MICROORGANISMS). For
the construction of GEVO1748 PLlacO1::kivd::ilvDco was integrated
into the ilvC locus on the E. coli chromosome. In particular
primers 869 and 1030 were used to amplify the kanamycin resistance
cassette (Kan) from pKD13, and primers 1031 and 1032 were used to
amplify PLlacO1::kivd::ilvDco from pGV1655. For the construction of
GEVO1749 PLlacO1::kivd::ilvDco was integrated into the adhE locus
on the E. coli chromosome. In particular primers 50 and 1030 were
used to amplify the kanamycin resistance cassette from pKD13, and
primers 1031 and 1205 were used to amplify PLlacO1::kivd::ilvDco
from pGV1655. Afterwards, SOE (splicing by overlap extension)
(Horton, R M, Cai, Z L, Ho, S N, et al. Biotechniques Vol. 8 (1990)
pp 528) reactions were done to connect the gene expression
cassettes to the resistance cassette using primers 1032 and 869 for
the ilvC locus and primers 1205 and 50 for the adhE locus.
[0375] The linear PCR products were transformed into W3110 pKD46
electro competent cells and the knock ins of
PLlacO1::kivd::ilvDco::FRT::Kan::FRT were verified by PCR. The
knock ins were further verified by sequencing. Lysates of the new
strains E. coli W3110,
.DELTA.ilvC::PLlacO1::kivd::ilvDco::FRT::Kan::FRT) and E. coli
W3110, .DELTA.adhE::PLlacO1::kivd::ilvDco::FRT::Kan::FRT) were
prepared and the knock ins were transferred to JCL260 by P1
transduction. Removal of the Kan resistance cassette from this
strain using expression of FLP recombinase yielded GEVO1748 and
GEVO1749.
[0376] GEVO1844 is a derivative of GEVO1748 and was constructed by
P1 transduction of the sthA gene deletion from the Keio collection
strain CGSC11459 (E. coli BW25113, .DELTA.sthA::FRT-kan-FRT) into
GEVO1748. Removal of the Kan resistance cassette from this strain
using expression of FLP recombinase yielded GEVO1844.
[0377] GEVO1859 was constructed according to the standard protocol
for gene integration using the Wanner method (Datsenko, K and
Wanner, B. One-step Inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. PNAS 2000). Primers 1219
and 1485 were used to amplify PLlacO::alsS::ilvC co from pGV1698.
Primers 1218 and 1486 were used to amplify the kan resistance
cassette from pKD13. SOE (splicing by overlap extension) was used
to combine the two pieces to one integration cassette. The linear
PCR product was transformed into E. coli W3110 pKD46 electro
competent cells and the knock in of PLlacO1::alsS::ivC
co::FRT::Kan::FRT into the pflB locus was verified by PCR. The
knock in was further verified by sequencing. Lysate of the new
strain (E. coli W3110, .DELTA.pflB:: PLlacO1::alsS::ilvC
co::FRT::Kan::FRT) was prepared and the knock in was transferred
into GEVO1749 by P1 transduction. Removal of the Kan resistance
cassette from this strain using expression of FLP recombinase
yielded GEVO1859.
[0378] GEVO1886 (E. coli BW25113, .DELTA.ldhA-fnr::FRT,
.DELTA.frd::FRT, .DELTA.pta::FRT, F' (lacIq+),
.DELTA.adhE::[pLlacO1::kivd::ilvDco::FRT],
.DELTA.pflB::[pLlacO1::alsS::ilvCco::FRT].DELTA.sthA::[pLlacO1::pntA::pnt-
B::FRT]) was constructed according to the standard protocol for
gene integration using the Wanner method (Datsenko, K and Wanner,
B. One-step Inactivation of chromosomal genes in Escherichia coli
K-12 using PCR products. PNAS 2000). Primers 1562 and 1539 were
used to amplify PLlacO::pntAB from pGV1745. Primers 1479 and 1561
were used to amplify the kan resistance cassette from pKD13. SOE
was used to combine the two pieces to one integration cassette. The
linear PCR product was transformed into E. coli W3110 pKD46 electro
competent cells and the knock in of PLlacO1::pntAB::FRT::Kan::FRT
into the sthA locus was verified by PCR. The knock in was further
verified by sequencing. Lysate of the new strain (E. coli W3110,
.DELTA.sthA:: PLlacO1::pntAB::FRT::Kan::FRT) was prepared and the
knock in was transferred into GEVO1859 by P1 transduction. Removal
of the Kan resistance cassette from this strain using expression of
FLP recombinase yielded GEVO1886.
[0379] GEVO1530 is a derivative of JCL260 and was constructed by
deletion of aceF and mdh from the E. coli chromosome.
[0380] The gene aceF was deleted according to the standard protocol
for gene integration using the Wanner method (Datsenko, K and
Wanner, B. One-step Inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. PNAS 2000). Primers 1026
and 1027 were used to amplify the Kan resistance cassette from
pKD13. The linear PCR product was transformed into E. coli W3110
pKD46 electro competent cells and the knockout of aceF was verified
by PCR. Lysate of the new strain (E. coli W3110,
.DELTA.aceF::FRT::Kan::FRT) was prepared and the knock out was
transferred into JCL260 by P1 transduction. The Kan resistance
cassette was removed from this strain using expression of FLP
recombinase. The gene mdh was deleted according to the standard
protocol for gene integration using the Wanner method (Datsenko, K
and Wanner, B. One-step Inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. PNAS 2000). Primers 226
and 227 were used to amplify the Kan resistance cassette from
pKD13. The linear PCR product was transformed into E. coli W3110
pKD46 electro competent cells and the knockout of mdh was verified
by PCR. Lysate of the new strain (E. coli W3110,
.DELTA.mdh::FRT::Kan::FRT) was prepared and the knock out was
transferred into JCL260, aceF by P1 transduction. Removal of the
Kan resistance cassette from this strain using expression of FLP
recombinase yielded GEVO1530.
[0381] GEVO1627 is a derivative of E. coli B (USDA, NRRL B-14943).
To create an isobutanol production strain based on E. coli B the
main competing pathway to the isobutanol pathway was deleted by
deletion of the adhE gene coding for the alcohol dehydrogenase.
Also to render the expression of the isobutanol pathway genes from
plasmids inducible the Z1 module which contains the lacIq
expression cassette was integrated into this strain. E. coli B is
known to have less catabolite repression than E. coli K12 which
enables this strain to convert several carbon sources at the same
time. Also the B strain is known to maintain low acetate levels
during fermentation. Both characteristics are advantageous for an
isobutanol production strain. In particular the adhE gene was
deleted according to the standard protocol for gene integration
using the Wanner method (Datsenko, K and Wanner, B. One-step
Inactivation of chromosomal genes in Escherichia coli K-12 using
PCR products. PNAS 2000). Primers 49 and 50 were used to amplify
the Kan resistance cassette from pKD13. The linear PCR product was
transformed into E. coli WA837 pKD46 electro competent cells and
the knockout of adhE was verified by PCR. Lysate of the new strain
(E. coli WA837. .DELTA.adhE::FRT::Kan::FRT) was prepared and the
knock out was transferred into E. coli B by P1 transduction. The Z1
module was integrated into the chromosome of E. coli B
.DELTA.adhE::FRT::Kan::FRT by P1 transduction from the strain E.
coli W3110,Z1 (Lutz, R, Bujard, H Nucleic Acids Research (1997) 25,
1203-1210). The resulting strain was GEVO1627.
TABLE-US-00019 Strain Genotype GEVO1530 E. coli BW25113,
.DELTA.ldhA-fnr::FRT, .DELTA.adhE::FRT, .DELTA.frd::FRT,
.DELTA.pta::FRT, pflB::FRT, .DELTA.mdh::FRT, .DELTA.aceF::FRT
F{grave over ( )} (laclq+) GEVO1627 E. coli B,
.DELTA.adhE::FRT-kan-FRT, attB::(Sp+ laclq+ tetR+) GEVO1748 E. coli
BW25113, .DELTA.ldhA-fnr::FRT, .DELTA.adhE::FRT, .DELTA.frd::FRT,
.DELTA.pta::FRT, pflB::FRT, F{grave over ( )} (laclq+),
.DELTA.ilvC::[PLlacO1::kivd::ilvDco::FRT] GEVO1749 E. coli BW25113,
.DELTA.ldhA-fnr::FRT, .DELTA.frd::FRT, .DELTA.pta::FRT, pflB::FRT,
F{grave over ( )} (laclq+),
.DELTA.adhE::[PLlacO1::kivd::ilvDco::FRT] GEVO1780 E. coli BW25113,
.DELTA.ldhA-fnr::FRT, .DELTA.adhE::FRT, .DELTA.frd::FRT,
.DELTA.pta::FRT, pflB::FRT, F{grave over ( )} (laclq+), pGV1655,
pGV1698 GEVO1821 E. coli B, .DELTA.adhE::FRT-kan-FRT, attB::(Sp+
laclq+ tetR+), pSA55, pGV1609 GEVO1844 E. coli BW25113,
.DELTA.ldhA-fnr::FRT, .DELTA.adhE::FRT, .DELTA.frd::FRT,
.DELTA.pflB::FRT, .DELTA.pta::FRT, F{grave over ( )} (laclq+),
.DELTA.ilvC::[PLlacO1::kivd::ilvDco::FRT], .DELTA.sthA::FRT
GEVO1846 GEVO1748, pGV1745, pGV1698 GEVO1859 E. coli BW25113,
.DELTA.ldhA-fnr::FRT, .DELTA.frd::FRT, .DELTA.pta::FRT, F{grave
over ( )} (laclq+), .DELTA.adhE::[pLlacO1::kivd::ilvDco::FRT],
pflB::[pLlacO1::alsS::ilvCco::FRT] GEVO1886 E. coli BW25113,
.DELTA.ldhA-fnr::FRT, .DELTA.frd::FRT, .DELTA.pta::FRT, F{grave
over ( )} (laclq+), .DELTA.adhE::[pLlacO1::kivd::ilvDco::FRT],
.DELTA.pflB::[pLlacO1::alsS::ilvCco::FRT]
.DELTA.sthA::[pLlacO1::pntA::pntB::FRT] GEVO1948 E. coli BW25113,
.DELTA.ldhA-fnr::FRT, .DELTA.frd::FRT, .DELTA.pta::FRT,
.DELTA.adhE::[pLlacO1::kivd::ilvDco::FRT],
.DELTA.pflB::[pLlacO1::alsS::ilvCco::FRT]
.DELTA.sthA::[pLlacO1::pntA::pntB::FRT]
[0382] Table 20 provides a list of plasmids:
TABLE-US-00020 Plasmid Genotype pSA55* pLlacO1::kivd::adh2, ColE1,
Amp pSA69* pLlacO1::alsS::ilvC::ilvD, p15A, Kan pGV1609
pLlacO1::alsS::ilvC::ilvD, p15A, Cm pGV1655 pLlacO1::kivd::ilvDco,
pSC101, Kan pGV1698 PLlacO1::alsS::ilvCco, ColE1, Amp pGV1720
pLlacO1::empty, pSC101, Kan pGV1745 pLlacO1::pntAB, pSC101, Kan
*pSA55 and pSA69 plasmids are described in the prior art ((WO
2008/098227) BIOFUEL PRODUCTION BY RECOMBINANT MICROORGANISMS)
[0383] Table 21 provides a list of primer sequences:
TABLE-US-00021 Primer No. Sequence 49
GTTATCTAGTTGTGCAAAACATGCTAATGTAGCCACCAAA TCGTGTAGGCTGGAGCTGCTTC
(SEQ ID NO: 1) 50 GCAGTTTCACCTTCTACATAATCACGACCGTAGTAGGTAT
CATTCCGGGGATCCGTCGACC (SEQ ID NO: 2) 226
TTGGCTGAACGGTAGGGTATATTGTCACCACCTGTTGGAA TGTTGGTGTAGGCTGGAGCTGCTTC
(SEQ ID NO: 3) 227 GTATCCAGCATACCTTCCAGCGCGTTCTGTTCAAATGCGC
TCAGGATTCCGGGGATCCGTCGACC (SEQ ID NO: 4) 869
CTTAACCCGCAACAGCAATACGTTTCATATCTGTCATATA GCCGCATTCCGGGGATCCGTCGACC
(SEQ ID NO: 5) 1026 CACCGAGATCCTGGTCAAAGTGGGCGACAAAGTTGAAGCC
GTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 6) 1027
GCGGTGGTCGAAGGAGAGAGAAATCGGCAGCATCAGACGC ATTCCGGGGATCCGTCGACC (SEQ
ID NO: 7) 1030 GTCGGTGAACGCTCTCCTGAGTAGGGTGTAGGCTGGAGCT GCTTC (SEQ
ID NO: 8) 1031 GAAGCAGCTCCAGCGTACACCCTACTGAGGAGAGCGTTCA CCGAC (SEQ
ID NO: 35) 1032 CACAACATCACGAGGAATCACCATGGCTAACTACTTCAAT
ACACCACGAGGCCCTTTCGTCTTCACCTC (SEQ ID NO: 9) 1205
GTTATCTAGTTGTGCAAAACATGCTAATGTAGCCACGAAA
TGCACGAGGCCCTTTCGTGTTCAGCTG (SEQ ID NO: 10) 1214
TTAAGGTACCATGCGAATTGGCATACCAAG (SEQ ID NO: 11) 1215
TAATGTCGACGCAATCCTGAAAGCTCTGTAA (SEQ ID NO: 12) 1218
GCTCACTCAAAGGCGGTAATACGTGTAGGCTGGAGCTGCT TC (SEQ ID NO: 13) 1219
GAAGCAGCTCCAGGCTACACGTATTACCGCCTTTGAGTGA GC (SEQ ID NO: 14) 1478
CCATTCTGTTGCTTITATGTATAAGAACAGGTAAGGCCTA CCATGATTCCGGGGATCCGTCGACC
(SEQ ID NO: 15) 1479 CCGATAGGCTTCCGCCATCGTCGGGTAGTTAAAGGTGGTG
TTGAGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 16) 1485
GCCTTTATTGTACGCTTTTTACTGTAGGATTTCAGTCAAA
TCTAACACGAGGCCCTTTCGTCTTCACCTC (SEQ ID NO: 17) 1486
AAGTACGCAGTAAATAAAAAATCCACTTAAGAAGGTAGGT GTTACATTCCGGGGATCCGTCGACC
(SEQ ID NO: 18) 1539 CCATTCTGTTGCTTTTATGIATAAGAACAGGTAAGCCCTA
CCATGGAGAATTGTGAGCGGATAAC (SEQ ID NO: 19) 1561
GCAATCGTGAAAGCTCTGTAACATTCCGGGGATCCGTCGA CC (SEQ ID NO: 20) 1562
GGTCGACGGATCCCCGGAATGTTACAGAGCTTTCAGGATT GC (SEQ ID NO: 21)
Example 30
[0384] High Titer and High Volumetric Productivity Example: Two 400
mL DasGip fermenter vessels containing 200 mL each of EZ Rich
medium (Neidhardt, F. C., P. L. Bloch, and D. F. Smith. 1974.
Culture medium for enterobacteria. J Bacteriol. 119:736-47)
containing 72 g/L glucose and 10 g/L yeast extract were inoculated
with Gevo1530 containing the two plasmids pSA55 and pSA69 from
which the isobutanol pathway genes were expressed. Cells from a
fresh transformation plate were used. GEVO1530 is a modified
bacterial biocatalyst that contains genes on two plasmids which
encode a pathway of enzymes that convert pyruvate into isobutanol.
When the biocatalyst GEVO1530 was contacted with glucose in a
medium suitable for growth of the biocatalyst, at about 30.degree.
C., the biocatalyst produced isobutanol from the glucose. The
fermenter vessels were attached to a computer control system to
monitor and control pH at 6.5 through addition of base, temperature
at about 30.degree. C., dissolved oxygen, and agitation. The
vessels were agitated, with a minimum agitation of 300 rpm and
agitation was varied to maintain a dissolved oxygen content of
about 50% using a 12 sL/h air sparge until the OD.sub.600 was about
1.0. The vessels were then induced with 0.1 mM IPTG. The vessels
were operated under these conditions for about 12 hours. At about
12 hours, the contents of the fermenter vessels were then poured
into 500 ml sterile graduated plastic bottles and centrifuged for
20 minutes at 4500 rpm. The cells were resuspended in 50 ml total
volume of EZ Rich medium. A 400 ml DasGip vessel containing 150 ml
of EZ Rich medium containing 72 g/L glucose and 10 g/L yeast
extract was inoculated with 50 ml of the cell containing medium and
then induced with 0.1 mM IPTG. Constant dissolved oxygen content of
5% was maintained using a 2.5 sL/h air sparge with variable
agitation automatically controlled from 300 to 1200 rpm and a
variable oxygen concentration ranging from 21% to about 30%.
Measurement of the fermentor vessel off-gas by trapping in an
octanol bubble trap then analysis by GC was performed for
isobutanol and ethanol. Continuous measurement of off-gas
concentrations of carbon dioxide and oxygen were also measured by a
DasGip off-gas analyzer throughout the experiment. Samples were
aseptically removed from the fermenter vessel throughout the
experiment and used to measure OD.sub.600, glucose concentration
and isobutanol concentration in the broth. Isobutanol production
reached a maximum at around 42 hours with a titer of about 22.9 g/L
and with a yield of approximately 79% maximum theoretical.
Volumetric productivity of the fermentation, calculated when the
titer of isobutanol was between 1 g/L and 15 g/L, was about 2.8
g/L/h.
Example 31
[0385] High Titer Example 2: GEVO1780 is a modified bacterial
biocatalyst that contains genes on two plasmids which encode a
pathway of enzymes that convert pyruvate into isobutanol. When the
biocatalyst GEVO1780 was contacted with glucose in a medium
suitable for growth of the biocatalyst, at about 30.degree. C., the
biocatalyst produced isobutanol from the glucose. An overnight
starter culture was started in a 250 mL Erlenmeyer flask with
GEVO1780 cells from a freezer stock with a 40 mL volume of modified
M9 medium consisting of 85 g/L glucose, 20 g/L yeast extract, 20
.mu.M ferric citrate, 5.72 mg/L H.sub.3BO.sub.3, 3.62 mg/L
MnCl.sub.2.4H.sub.2O, 0.444 mg/L ZnSO.sub.4.7H.sub.2O, 0.78 mg/L
Na.sub.2MnO.sub.4.2H.sub.2O, 0.158 mg/L CuSO.sub.4.5H.sub.2O,
0.0988 mg/L CoCl.sub.2.6H.sub.2O, NaHPO.sub.4 6.0 g/L,
KH.sub.2PO.sub.4 3.0 g/L, NaCl 0.5 g/L, NH.sub.4Cl 2.0 g/L,
MgSO.sub.4 0.0444 g/L and CaCl.sub.20.00481 g/L and at a culture
OD600 of about 0.05. The starter culture was grown for
approximately 14 hrs in a 30.degree. C. shaker at 250 rpm. Some of
the starter culture was then transferred to a 2000 mL DasGip
fermenter vessel containing about 1500 mL of modified M9 medium to
achieve an initial culture OD.sub.600 of about 0.1. The fermenter
vessel was attached to a computer control system to monitor and
control pH at 6.5 through addition of base, temperature at about
30.degree. C., dissolved oxygen, and agitation. The vessel was
agitated, with a minimum agitation of 400 rpm and agitation was
varied to maintain a dissolved oxygen content of about 50% using a
25 sL/h air sparge until the OD.sub.600 was about 1.0. The vessel
was then induced with 0.1 mM IPTG. After continuing growth for
approximately 8-10 hrs, the dissolved oxygen content was decreased
to 5% with 400 rpm minimum agitation and 10 sl/h airflow.
Continuous measurement of the fermentor vessel off-gas by GC-MS
analysis was performed for oxygen, isobutanol, ethanol, and carbon
dioxide throughout the experiment. Samples were aseptically removed
from the fermenter vessel throughout the experiment and used to
measure OD.sub.600, glucose concentration and isobutanol
concentration in the broth. Throughout the experiment, supplements
of pre-grown and pre-induced biocatalyst cells were added as a
concentrate three times since the start of the experiment: at 21 h,
38 h, and 46.3 h. These cells were the same strain and plasmids
shown above and used in the fermenter. Supplemented cells were
grown as 1 L cultures in 2.8 L Fembach flasks and incubated at
30.degree. C., 250 RPM in Modified M9 Medium with 85 g/L of
glucose. Cultures were induced upon inoculation with 0.1 mM IPTG.
When the cells had reached an OD.sub.600 of about 4.0-5.0, the
culture was concentrated by centrifugation and then added to the
fermenter. A sterile glucose feed of 500 g/L glucose in DI water
was used intermittently during the production phase of the
experiment at time points great than 12 h to maintain glucose
concentration in the fermenter of about 30 g/L or above.
[0386] The fermenter vessel was attached by tubing to a smaller 400
mL fermenter vessel that served as a flash tank and operated in a
recirculation loop with the fermenter. The biocatalyst cells within
the fermenter vessel were isolated from the flash tank by means of
a cross-flow filter placed in-line with the fermenter/flash tank
recirculation loop. The filter only allowed cell-free fermentation
broth to flow from the fermenter vessel into the flash tank. The
volume in the flash tank was approximately 100 mL and the hydraulic
retention time was about 10 minutes. Heat and vacuum were applied
to the flash tank. The vacuum level applied to the flash tank was
initially set at 45 mBar and the flash tank was set at about
45.degree. C. These parameters were adjusted to maintain
approximately 6-10 g/L isobutanol in the fermenter throughout the
experiment. Generally, the vacuum ranged from 45-100 mBar and the
flash tank temperature ranged from 43.degree. C. to 45.degree. C.
throughout the experiment. Vapor from the heated flash tank was
condensed into a collection vessel as distillate. Cell-free
fermentation broth was continuously returned from the flash tank to
the fermentation vessel.
[0387] The distillate recovered in the experiment was strongly
enriched for isobutanol. Isobutanol formed an azeotrope with water
and usually lead to a two phase distillate: an isobutanol rich top
phase and an isobutanol lean bottom phase. Distillate samples were
analyzed by GC for isobutanol concentration. Isobutanol production
reached a maximum at around 95 hrs with a total titer of about 63
g/L. As used herein, the term "titer" is defined as the strength of
a solution or the concentration of a substance in solution plus the
substance in the gas phase. For example, the titer of a biofuel in
a fermentation is described as g of biofuel in solution plus the g
of biofuel in the gas phase per liter of fermentation broth. The
term "titre" is used interchangeably throughout with the term
"titer". The isobutanol production rate was about 0.64 g/L/h and
the percent theoretical yield was approximately 86%.
Example 32
[0388] High Yield Example: The modified biocatalyst GEVO1530 was
transformed with the two plasmids pSA69 and pSA55, which encode a
pathway of enzymes that convert pyruvate into isobutanol. When the
biocatalyst Gevo1530 (pSA69, pSA55) was contacted with glucose in a
medium suitable for growth of the biocatalyst, at about 30.degree.
C. the biocatalyst produced isobutanol from the glucose. An
overnight starter culture was started in a 250 mL Erlenmeyer flask
with GEVO1530 cells from a fresh transformation plate with a 40 mL
volume of EZ Rich medium (Neidhardt, F. C., P. L. Bloch, and D. F.
Smith. 1974. Culture medium for enterobacteria. J Bacteriol.
119:736-47) containing 72 g/L glucose and 10 g/L yeast extract and
at a culture OD.sub.600 of about 0.05. The starter culture was
grown for approximately 14 hrs in a 37.degree. C. shaker at 250
rpm. Some of the starter culture was then transferred to a 2 L
DasGip fermenter vessel containing about 1000 mL of EZ Rich medium
containing 72 g/L glucose and 10 g/L yeast extract to achieve a 1%
v/v inoculum. The fermenter vessel was attached to a computer
control system to monitor and control pH at 6.5 through addition of
base, temperature at 30.degree. C., dissolved oxygen, and
agitation. The vessel was agitated, with a minimum agitation of 300
rpm and agitation was varied to maintain a dissolved oxygen content
of about 50% using a 25 sL/h air sparge until the OD.sub.600 was
about 1.0. The vessel was then induced with 0.1 mM IPTG. After
continuing growth for approximately 8-10 hrs, the dissolved oxygen
content was decreased to 5% with 300 rpm minimum agitation and 5
sl/h airflow. Measurement of the fermentor vessel off-gas by
trapping in an octanol bubble trap and then measurement by GC was
performed for isobutanol and ethanol. Continuous measurement of off
gas concentrations of carbon dioxide and oxygen were also measured
by a DasGip off-gas analyzer throughout the experiment. Samples
were aseptically removed from the fermenter vessel throughout the
experiment and used to measure OD.sub.600, glucose concentration by
HPLC, and isobutanol concentration in the broth by GC. Isobutanol
production reached a maximum at around 48 hrs with a titer of about
18 g/L. Yield of the fermentation, calculated when the titer of
isobutanol was between 1 g/L and 15 g/L, was approximately 83%
maximum theoretical.
Example 33
[0389] High Volumetric Productivity Example: GEVO1780 is a modified
bacterial biocatalyst that contains genes on two plasmids which
encode a pathway of enzymes that convert pyruvate into isobutanol.
When the biocatalyst GEVO1780 was contacted with glucose in a
medium suitable for growth of the biocatalyst, at about 30.degree.
C., the biocatalyst produced isobutanol from the glucose. Two 400
mL DasGip fermenter vessels containing 200 mL each of modified M9
medium consisting of 85 g/L glucose, 20 g/L yeast extract, 20 .mu.M
ferric citrate, 5.72 mg/L H3BO3, 3.62 mg/L MnCl2.4H2O, 0.444 mg/L
ZnSO4.7H2O, 0.78 mg/L Na2MnO4.2H2O, 0.158 mg/L CuSO4.5H2O, 0.0988
mg/L CoCl2.6H2O. NaHPO4 6.0 g/L, KH2PO4 3.0 g/L, NaCl 0.5 g/L,
NH4Cl 2.0 g/L, MgSO4 0.0444 g/L and CaCl2 0.00481 g/L were
inoculated with GEVO1780 cells from frozen stocks. The fermenter
vessels were attached to a computer control system to monitor and
control pH at 6.5 through addition of base, temperature at
30.degree. C., dissolved oxygen, and agitation. The vessels were
agitated, with a minimum agitation of 300 rpm and agitation was
varied to maintain a dissolved oxygen content of about 50% using a
12 sL/h air sparge until the OD.sub.600 was about 1.0. The vessels
were then induced with 0.1 mM IPTG. The vessels were operated under
these conditions for about 12 hours. At about 12 hours, the
contents of the fermenter vessels were then poured into 500 ml
sterile graduated plastic bottles and centrifuged for 20 minutes at
4500 rpm. The cells were resuspended in 50 ml total volume of
modified M9 medium. A 400 ml DasGip vessel containing 150 ml of
modified M9 medium was inoculated with 50 ml of the cell containing
medium and then induced with 0.1 mM IPTG. Constant dissolved oxygen
content of 5% was maintained using a 2.5 sL/h air sparge with
variable agitation automatically controlled from 300 to 1200 rpm.
Continuous measurement of the fermentor vessel off gas by GC-MS
analysis was performed for oxygen, isobutanol, ethanol, carbon
dioxide, and nitrogen throughout the experiment. Samples were
aseptically removed from the fermenter vessel throughout the
experiment and used to measure OD.sub.600, glucose concentration by
HPLC, and isobutanol concentration in the broth by GC. Isobutanol
production reached a maximum at around 22 hours with a titer of
about 22 g/L and with a yield of approximately 80% maximum
theoretical. Volumetric productivity of the fermentation,
calculated when the titer of isobutanol was between 1 g/L and 15
g/L, was about 2.3 g/L/h.
Example 34
[0390] Inexpensive Nutrients and Biomass Example (Corn Liquefact):
GEVO1780 is a modified bacterial biocatalyst that contains genes on
two plasmids which encode a pathway of enzymes that convert
pyruvate into isobutanol. When the biocatalyst GEVO1780 was
contacted with glucose in a medium suitable for growth of the
biocatalyst, at about 30.degree. C., the biocatalyst produced
isobutanol from the glucose. An overnight starter culture was
started in a 250 mL Erlenmeyer flask with GEVO1780 cells from a
freezer stock with a 40 mL volume of modified M9 medium consisting
of 85 g/L glucose, 10 g/L yeast extract, 10 .mu.M ferric citrate,
2.86 mg/L H3B03, 1.81 mg/L MnCl2.4H2O, 0.222 mg/L ZnSO4.7H2O, 0.39
mg/L Na2MnO4.2H2O, 0.079 mg/L CuSO4.5H2O, 0.0494 mg/L CoCl2.6H2O,
NaHPO4 6.0 g/L, KH2PO4 3.0 g/L, NaCl 0.5 g/L, NH4Cl 2.0 g/L, MgSO4
0.0222 g/L and CaCl2 0.00241 g/L and at a culture OD.sub.600 of
0.02 to 0.05. The starter culture was grown for approximately 14
hrs in a 30.degree. C. shaker at 250 rpm. Some of the starter
culture was then transferred to two 400 mL DasGip fermenter vessels
to achieve an inoculum of about 0.1 OD600. One fermenter vessel, A,
contained about 200 mL of medium consisting of liquefact hydrolyzed
corn substrate, deionized water, and 2.5 g/L (NH4)2SO4. A second
fermenter vessel, B, contained about 200 mL of medium consisting of
liquefact hydrolyzed corn substrate and deionized water with no
additional supplements. The liquefact hydrolyzed corn substrate was
generated by traditional corn-ethanol dry mill processing methods
known to one skilled in the art. At inoculation, glucoamylase
sufficient to hydrolyze the starch present in the liquefact to
available glucose was added to each fermenter vessel. The vessels
were attached to a computer control system to monitor and control
pH at 6.5 through addition of base, temperature at about 30.degree.
C., dissolved oxygen, and agitation. The vessels were agitated,
with a minimum agitation of 200 rpm and agitation was varied to
maintain a dissolved oxygen content of about 50% using a 12 sL/h
air sparge for about 2 hours. The vessels were then induced with
0.1 mM IPTG. After continuing growth for approximately 7 hours, the
dissolved oxygen content was decreased to 5% with 200 rpm minimum
agitation and 2.5 sL/h airflow. Continuous measurement of fermentor
vessel off-gas by GC-MS analysis was performed for oxygen,
isobutanol, ethanol, carbon dioxide, and nitrogen throughout the
experiment for each vessel. Samples were aseptically removed from
each fermenter vessel throughout the experiment and used to measure
free glucose concentration by HPLC and isobutanol concentration in
the broth by GC. In fermenter vessel A, isobutanol production
reached a maximum at around 52 hrs with a titer of about 8 g/L and
a volumetric productivity of about 0.2 g/L/h. In fermenter vessel
B, isobutanol production reached a maximum at around 52 hrs with a
titer of about 4 g/L and a volumetric productivity of about 0.1
g/L/h. The complete fermentation results for each vessel are found
in Table 22, below. Yield was not determined.
[0391] Table 22 provides exemplary fermentation data:
TABLE-US-00022 Elapsed Isobutanol Vessel Fermentation Time (h)
Concentration (g/L) A 0.0 0.03 A 2.0 0.03 A 7.0 0.08 A 24.0 3.44 A
28.0 4.90 A 31.0 5.67 A 48.0 7.43 A 52.0 7.65 B 0.0 0.17 B 2.0 0.11
B 7.0 0.24 B 24.0 2.47 B 28.0 3.10 B 31.0 3.17 B 48.0 3.93 B 52.0
4.09
Example 35
[0392] Cheap Nutrients and Biomass Example--Acid Pretreated Corn
Stover Hydrolysate: Corn stover hydrolysate was conditioned with
ammonium hydroxide by adjusting the pH to 8.5, incubating for 30
minutes with stirring at room temperature (about 23.degree. C.),
then adjusting the pH to 6.5 with concentrated sulfuric acid. The
conditioned corn stover hydrolysate was then filtered through a 0.2
.mu.m filter and the permeate was used in the experiment.
[0393] GEVO1780 is a modified bacterial biocatalyst that contains
genes on two plasmids which encode a pathway of enzymes that
convert pyruvate into isobutanol. When the biocatalyst GEVO1780 was
contacted with glucose in a medium suitable for growth of the
biocatalyst, at about 30.degree. C., the biocatalyst produced
isobutanol from the glucose. An overnight starter culture was
started in a 250 mL Erlenmeyer flask with GEVO1780 cells from a
freezer stock with a 40 mL volume of LB medium (5 g/L yeast
extract, 10 g/L tryptone, 10 g/L NaCl in dionized water) and at a
culture OD600 of 0.02 to 0.05. The starter culture was grown for
approximately 14 hrs in a 37.degree. C. shaker at 250 rpm. Some of
the starter culture was then transferred to 20 mL volume of
modified M9 medium in a 250 mL Erlenmeyer flask consisting of 10%
v/v, 20% v/v, 30% v/v, 40% v/v, or 50% v/v conditioned corn stover
hydrolysate, 10 g/L yeast extract, 10 .mu.M ferric citrate, 2.86
mg/L H.sub.3BO.sub.3, 1.81 mg/L MnCl.sub.2.4H.sub.2O, 0.222 mg/L
ZnSO.sub.4.7H.sub.2O, 0.39 mg/L Na.sub.2MnO.sub.4.2H.sub.2O, 0.079
mg/L CuSO.sub.4.5H.sub.2O, 0.0494 mg/L CoCl.sub.2.6H.sub.2O,
NaHPO.sub.4 6.0 g/L, KH.sub.2PO.sub.4 3.0 g/L, NaCl 0.5 g/L,
NH.sub.4Cl 2.0 g/L, MgSO.sub.4 0.0222 g/L and CaCl.sub.2 0.00241
g/L and at a culture OD600 of about 0.1. The flasks were incubated
for about 4 hours in a 37.degree. C. shaker at 250 rpm. The flasks
were then induced with 0.1 mM IPTG and transferred to 30.degree. C.
shaker at 250 rpm. Incubation continued for about 50 hours with
periodic sampling to measure OD.sub.600, isobutanol concentration
by GC, and sugar concentrations by HPLC.
[0394] The biocatalyst GEVO1780 produced isobutanol from the
conditioned corn stover hydrolysate (20% by volume), with two
independent replicates producing about 5.2 g/L and 5.0 g/L
isobutanol, respectively, in 52 h. In an experiment that contained
10% by volume conditioned corn stover hydrolysate, the biocatalyst
GEVO1780 produced about 3.2 g/L and 3.2 g/L isobutanol,
respectively, in 52 h in two independent replicates. In an
experiment that contained 30% by volume conditioned corn stover
hydrolysate, the biocatalyst GEVO1780 produced about 3.4 g/L
isobutanol in 52 h. The complete fermentation results for each
experiment are found in Table 23, below.
[0395] Table 23 provides data for isobutanol produced from
hydrolyzed corn stover:
TABLE-US-00023 Isobutanol Concentration (g/L) Elasped 10% 10% 20%
20% 30% 30% Fermentation Hydrolysate Hydrolysate Hydrolysate
Hydrolysate Hydrolysate Hydrolysate Time (h) Replicate 1 Replicate
2 Replicate 1 Replicate 2 Replicate 1 Replicate 2 0.0 0.01 0.01
0.00 0.00 0.00 0.00 2.0 0.01 0.01 0.00 0.00 0.00 0.00 3.5 0.04 0.04
0.02 0.02 0.01 0.00 5.0 0.20 0.21 0.07 0.07 0.03 0.02 7.0 3.18 3.14
3.85 3.62 0.44 0.44 24.0 3.25 3.17 3.23 3.10 1.14 1.13 52.0 3.16
3.16 5.20 5.04 3.42 3.42
Example 36
[0396] Cheap Nutrients and Biomass Example: Isobutanol Production
from Cellulose: GEVO1780 is a modified bacterial biocatalyst that
contains genes on two plasmids which encode a pathway of enzymes
that convert pyruvate into isobutanol. When the biocatalyst
GEVO1780 was contacted with glucose in a medium suitable for growth
of the biocatalyst, at about 30.degree. C., the biocatalyst
produced isobutanol from the glucose. An overnight starter culture
was started in a 250 mL Erlenmeyer flask with GEVO1780 cells from a
freezer stock with a 40 mL volume of LB medium (5 g/L yeast
extract, 10 g/L tryptone, 10 g/L NaCl in dionized water) and at a
culture OD.sub.600 of about 0.05. The starter culture was grown for
approximately 14 hrs in a 37.degree. C. shaker at 250 rpm. Some of
the starter culture was then transferred to 20 mL volume of
modified M9 medium in a 250 mL Erlenmeyer flask consisting of 77
g/L purified cellulose (Sigmacell 50, Sigma Aldrich Chemical
Company), 10 g/L yeast extract, 10 .mu.M ferric citrate, 2.86 mg/L
H3BO3, 1.81 mg/L MnCl2.4H2O, 0.222 mg/L ZnSO4.7H2O, 0.39 mg/L
Na2MnO4.2H2O, 0.079 mg/L CuSO4.5H2O, 0.0494 mg/L CoCl2.6H2O, NaHPO4
6.0 g/L, KH2PO4 3.0 g/L, NaCl 0.5 g/L, NH4Cl 2.0 g/L, MgSO4 0.0222
g/L and CaCl2 0.00241 g/L and at a culture OD.sub.600 of about 0.1.
Cellulase enzyme (Genencor Accelerase) sufficient to hydrolyze the
purified cellulose into monomeric glucose was added to each flask
at the time of inoculation. The flasks were incubated for about 4
hours in a 37.degree. C. shaker at 250 rpm. The flasks were then
induced with 0.1 mM IPTG and transferred to 30.degree. C. shaker at
250 rpm. Incubation continued for about 50 hours with periodic
sampling to measure OD600, isobutanol concentration by GC, and
sugar concentration by HPLC.
[0397] The biocatalyst GEVO1780 produced isobutanol from 77 g/L
cellulose, with three independent replicates producing about 5.6
g/L, 5.4 g/L, and 4.7 g/L isobutanol, respectively, in 52 h. The
complete fermentation results for each experiment are found in
Table 24 below.
[0398] Table 24 provides data for isobutanol production from
cellulose:
TABLE-US-00024 Elapsed Fermentation Isobutanol Concentration (g/L)
Time (h) Replicate 1 Replicate 2 Replicate 3 0.0 0.04 0.03 0.03 2.0
0.02 0.01 0.01 3.5 0.03 0.03 0.03 5.0 0.29 0.28 0.19 7.0 4.17 4.04
3.58 24.0 3.53 3.35 3.10 52.0 5.57 5.38 4.68
Example 37
[0399] Growth of Biocatalyst on Biomass Sugars Example: To assess
growth on different carbon sources GEVO1627, a modified bacterial
biocatalyst, was streaked onto a LB (5 g/L yeast extract, 10 g/L
tryptone, 10 g/L NaCl in dionized water) plate from a frozen stock.
A colony from this plate was used to start two overnight starter
cultures from the same colony in 3 mL modified M9 medium consisting
of 40 g/L glucose, 10 g/L yeast extract, 10 .mu.M ferric citrate,
2.86 mg/L H3BO3, 1.81 mg/L MnCl2.4H2O, 0.222 mg/L ZnSO4.7H2O, 0.39
mg/L Na2MnO4.2H2O, 0.079 mg/L CuSO4.5H2O, 0.0494 mg/L CoCl2.6H2O,
NaHPO4 6.0 g/L, KH2PO4 3.0 g/L, NaCl 0.5 g/L, NH4Cl 2.0 g/L, MgSO4
0.0222 g/L and CaCl2 0.00241 g/L and the antibiotics
chloramphenicol and ampicillin in a snap cap tube. The cultures
were incubated for about 14 h at 37.degree. C. and 250 rpm.
Cultures were used to inoculate baffled 250 mL flasks containing 40
mL modified M9 medium containing 40 g/L of the desired sugar
(glucose, galactose, mannose, arabinose, xylose, lactose or
sucrose) and the antibiotics chloramphenicol and ampicillin and at
a culture OD600 of about 0.1. The cells were incubated at
37.degree. C. and 250 rpm and OD600 measurements were taken at 1.5,
3, 5, and 6.5 h after inoculation. GEVO1627 grew on all the tested
sugars (Table 25). All cultures grew to an OD600 of between 11.5
and 11.7 with the exception of the cultures supplemented with
arabinose, which reached an OD of 9.6, and the cultures
supplemented with sucrose, which reached an OD of 7.3. The initial
growth rate of GEVO1627 was the same independent of the carbon
source used.
[0400] Table 25 provides OD values for GEVO1627 grown in
fermentation medium supplemented with different sugars (40
g/L):
TABLE-US-00025 OD values time lac- su- man- xy- arabi- galac- glu-
[h] tose crose nose lose nose tose cose 1.5 0.39 0.40 0.35 0.38
0.37 0.38 0.40 3 4.3 4.4 4.0 4.2 4.1 4.2 4.2 5 10.2 7.0 10.6 11.1
9.1 11.0 10.2 6.5 11.1 7.3 11.7 11.2 9.6 10.4 11.5
Example 38
[0401] Conversion of Biomass Sugars to Isobutanol Example: The
plasmids pGV1609 (PLlacO1::alsS::ilvC::ilvD, p15A, Cm) and pSA55
(pLlacO1::kivd::ADH2, ColE1, Amp) were introduced into the strain
GEVO1627 yielding strain GEVO1821. In particular, a culture of
GEVO1627 was grown in SOB medium (Sambrook, J. and Russell, D.
2001. Molecular Cloning: A Laboratory Manual, Third Edition. ISBN
978-087969577-4) to an OD600 of about 0.6 to 0.8. The strain was
then made electro-competent by concentrating it 100-fold, washing
once with ice cold water and 3 times with ice cold 10% glycerol.
The cells were then resuspended in 150 .mu.L of ice-cold 10%
glycerol. The electro-competent cells were transformed with the
plasmids pGV1609 and pSA55 using an electroporator set to
25.degree. F., 2.5 kV and the pulse controller at 2000. After the
electroporation, SOC medium (Sambrook, J. and Russell, D. 2001.
Molecular Cloning: A Laboratory Manual, Third Edition. ISBN
978-087969577-4) was immediately added to the cells. After
incubation for an hour at 37.degree. C., the cells were plated onto
LB (5 g/L yeast extract, 10 g/L tryptone, 10 g/L NaCl in dionized
water) plates containing the antibiotics chloramphenicol and
ampicillin and incubated for about 18 h at 37.degree. C. Plates
were removed from the incubator and stored at room temperature
until further use.
[0402] GEVO1821 is a modified bacterial biocatalyst that contains
genes on two plasmids which encode a pathway of enzymes that
convert pyruvate into isobutanol. When the biocatalyst GEVO1821 was
contacted with glucose in a medium suitable for growth of the
biocatalyst, at about 30.degree. C., the biocatalyst produced
isobutanol from the glucose. Starter cultures of GEVO1821 were
inoculated in 3 mL LB medium and the antibiotics chloramphenicol
and ampicillin in snap cap tubes. The cultures were incubated for
about 14 h at 37.degree. C. and 250 rpm. Isobutanol fermentations
were carried out in modified M9 medium consisting of 40 g/L of the
desired sugar (glucose, galactose, mannose, arabinose, xylose,
lactose or sucrose), 10 g/L yeast extract, 10 .mu.M ferric citrate,
2.86 mg/L H3BO3, 1.81 mg/L MnCl2.4H2O, 0.222 mg/L ZnSO4.7H2O, 0.39
mg/L Na2MnO4.2H2O, 0.079 mg/L CuSO4.5H2O, 0.0494 mg/L CoCl2.6H2O,
NaHPO4 6.0 g/L, KH2PO4 3.0 g/L, NaCl 0.5 g/L, NH4Cl 2.0 g/L, MgSO4
0.0222 g/L and CaCl2 0.00241 g/L and the antibiotics
chloramphenicol and ampicillin in 250 mL screw cap flasks with 20
mL fermentation medium, inoculated with about 0.1 OD600 of the
grown starter cultures. The cells were incubated at 37.degree. C.
and 250 rpm until the strains reached an OD600 of between 0.6 and
0.8 and were then induced with IPTG at 1 mM final concentration.
Samples were taken from the cultures at 24 h and 48 h after
inoculation, centrifuged at 22000 g to separate the cell pellet
from the supernatant and the supernatant stored frozen at
-20.degree. C. until analysis. The samples were analyzed for sugar
concentration by HPLC and isobutanol concentration by GC.
[0403] GEVO1821 was tested in an isobutanol fermentation using
modified M9 medium with seven different sugars. All samples grew to
an OD600 of about 7 to 8 with the exception of the cultures with
sucrose. Sucrose cultures grew to an OD600 of about 3. Over the
course of the fermentation, some cultures produced acid, and were
neutralized at the 24 h time point, as they were at a pH of 5.0 or
below. The pH was adjusted to 7 using 2 M NaOH as needed. All
hexose sugars (galactose and mannose) and the disaccharide lactose
yielded isobutanol production similar to isobutanol production from
glucose (Table 26). The cultures grown on pentose sugars reached
isobutanol titers of about 5 g/L for xylose and about 4 g/L for
arabinose. The cultures grown on sucrose produced 0.41 g/L
isobutanol. Maximal titers were seen at the 48 h time point.
Volumetric productivity was calculated from zero to 24 h and is
indicated in Table 26 for each sugar. Yields were calculated at 48
h and are shown as a percentage of theoretical yield. No yield was
determined for lactose and sucrose fermentations.
[0404] Table 26 provides the results for volumetric productivity,
titer and yield for the tested sugar fermentations to isobutanol
using biocatalyst GEVO1821:
TABLE-US-00026 Volumetric Maximum Productivity (0-24 h) Titer (48
h) Yield samples [g/L/h] [g/L] [% theoretical] glucose 0.255 8.72
60.8 galactose 0.320 8.11 59.8 mannose 0.221 8.41 63 xylose 0.144
5.17 42.1 arabinose 0.178 4.67 34.1 lactose 0.337 8.90 Not
determined sucrose 0.019 0.43 Not determined
Example 39
[0405] No-byproducts Example: An isobutanol fermentation was
carried out using a biocatalyst that produces isobutanol from
glucose. During the course of the fermentation, isobutanol was
removed from the fermenter using vacuum distillation directly
applied to the fermenter. As a result, 20 liters of a two-phase
solution of isobutanol in water was recovered from the fermentation
broth. The solution contained approximately 8% v/v isobutanol. An
initial distillation was conducted at moderate vacuum (0.5 bar) and
40-50.degree. C. where a low boiling azeotrope of isobutanol/water
boiled and was condensed in the recovery vessel. The condensed
mixture phase separated into an isobutanol rich phase (of
approximate composition of 85% volume/volume isobutanol and 15%
water) and an aqueous phase (of approximate composition of 8%
volume/volume) isobutanol in water). Distillation continued until
the initial aqueous broth contained less than 2 g/L isobutanol
(<0.2% weight/volume). The recovered two-phase mixture was
transferred to a separation funnel where the two liquids were
separated. The aqueous phase was recycled into the next batch for
distillation and distillation continued until the initial aqueous
broth contained less than 2 g/L isobutanol (<0.2%
weight/volume). About 1.6 liters of the isobutanol-rich phase were
recovered.
[0406] The isobutanol-rich phase was then fed into a second stage
distillation apparatus. In the second distillation, the azeotrope
was boiled overhead, leaving a relatively dry isobutanol in the
flask. The solution was distilled at atmospheric pressure and
temperature from 85-100.degree. C. The boiled mixture was collected
in a recovery flask where it phase separated as described
previously in this example. The two-phase mixture was transferred
to separation funnel and decanted as previously described above.
The aqueous phase was recycled into the feed of the next batch for
initial distillation. The isobutanol-rich phase was recycled into
the subsequent batch of second-stage distillation. One liter of
isobutanol was recovered with approximately 0.13% weight/volume
water.
[0407] The isobutanol recovered from such a process was assigned a
lot identifier of 05E08C3N00P and was then subjected to several
tests for purity and compositional analysis. Tests are described
below and methods used were known to one skilled in the art and
from the ASTM International specifications ASTM D3120, ASTM D5453,
ASTM 4629, ASTM D5762, and ASTM E-1064. ASTM specifications were
met or exceeded by the purified isobutanol (Table 27). The ASTM
specification for isobutanol as a solvent, ASTM D1719-05 was met
with the purified isobutanol (Table 27). There is currently no
specification for isobutanol for use as a fuel or a fuel additive,
but the purified isobutanol also met portions of the specification
for ethanol as a fuel ASTM D4806-07, such as water content,
acidity, and nonvolatile matter (g/100 mL) (Table 27) and would
likely meet a newly-developed specification for isobutanol as a
fuel or fuel additive.
[0408] Exemplary specifications are provided in Table 27:
TABLE-US-00027 Test Method Specification Results for This Lot
Appearance Visual Clear and Bright Clear and Bright Color by Pt--Co
Scale ASTM D1209 10 max .sup.1 Colorless Water by Karl Fischer ASTM
E1064 0.2% .sup.1 or 0.13% (ppm/%) 1.0% .sup.2 max Isobutanol (%)
GC method 98% min 99.1% Apparent Specific Gravity ASTM D891 B 0.794
to 0.801 0.7997 25/25.degree. C. Acidity (weight %) ASTM D1613
0.003% .sup.1 or 0.002% 0.007% .sup.2 max Nonvolatile Matter (g/100
mL) ASTM D1353 0.005 .sup.1, 2 0.001 Organic Impurities by GC: GC
method -- -- Ethanol (ppm/%) GC method Report 606 ppm/0.06% Acetic
Acid (ppm/%) GC method Report <10 ppm Propanols (ppm/%) GC
method Report Each <10 ppm Propionic Acid GC method Report
<10 ppm (ppm/%) Acetone (ppm/%) GC method Report 15 ppm/0.0015%
1- and 2-Butanols GC method Report Each <10 ppm (ppm/%)
Butyraldehydes GC method Report Each <10 ppm (ppm/%) Butyric
Acids (ppm/%) GC method Report Each <10 ppm Pentanols (ppm/%) GC
method Report Each Isopentanol 3483 ppm/0.35% <10 ppm others
detected Pentaldehydes GC method Report Each <10 ppm (ppm/%)
Pentanoic Acids GC method Report Each <10 ppm (ppm/%) Sulfur
Content (ppm).sup.3 ASTM D3120 30 max .sup.1 <1 Nitrogen Content
(ppm).sup.3 ASTM D5762 Report <40 .sup.1 ASTM D1719-05
specification for solvent isobutanol. .sup.2 ASTM D4806-07
specification for fuel grade ethanol for blending with gasoline.
.sup.3Tests were performed by Core Lab, 8210 Mosley Rd., Houston,
TX 77075; Ph: 713-943-9776.
Example 40
[0409] Isotope Fractionation Example--Detection of isobutanol made
from renewable feedstock: Isobutanol obtained from a method
described herein was analyzed by mass spectrometry to compare its
carbon isotope distribution with the distribution of
petroleum-derived isobutanol. To determine the isotope ratio of
both materials, 0.5 .mu.L of neat isobutanol was injected into a
Varian CP-3800 Gas Chromatograph configured with a Varian 320-MS
single quadrupole Mass Spectrometer detector, a CTC Analytics
CombiPAL autosampler, a Varian 1079 split/splitless injector
configuration, and a Varian FactorFour VF-5 ms capillary column
(30M.times.0.25 mm internal diameter.times.0.25 .mu.M film
thickness) under the following conditions: 250.degree. C. injector
temperature, 100:1 split ratio, helium carrier gas at 1.0 mL/min
constant flow, 35.degree. C. isothermal oven temperature, and mass
spectrometer operated in Electron Ionization mode at 70 eV.
Isobutanol eluted at 2.7 minutes and a mass intensity table from
the apex of this peak was measured. Three samples of each type of
isobutanol were injected, and the isotope distribution ratios were
averaged.
[0410] The intensity of the following mass peaks were measured for
each sample: 74.1 (corresponding to C12-based isobutanol), 75.1
(corresponding to C12-isobutanol with one C13), and 76.1
(corresponding to one C14 or two C13 per renewable molecule or two
C13 per petroleum-based molecule). The ratios of the intensity of
the 75.1 and 76.1 peaks to the intensity of the 74.1 peak were
calculated for each sample and each ratio from the three replicates
was averaged for each type of sample. Based upon the natural
abundance of the carbon 13 isotope (carbon 14 decays rapidly on a
geological time scale and is generally not present in petroleum
products), the 75.1/74.1 ratio should be 0.046 and the 76.1/74.1
ratio should be 0.0027 for a petroleum based sample. Material that
is produced by a biological process will be different due to
cumulative kinetic isotope effects inside the organism that
produces the material. The petroleum based material exhibited an
average 75.1/74.1 ratio of 0.045 and an average 76.1/74.1 ratio of
0.0027. The renewable isobutanol obtained by a method provided
herein exhibited an average 75.1/74.1 ratio of 0.0060 and an
average 76.1/74.1 ratio of 0.0060, a 30% increase in C13 over the
petroleum based material and a measurable amount of C14 not present
in the non-renewable isobutanol.
Example 41
[0411] High Volumetric Productivity Example 2: The modified
biocatalyst Gevo1530 was transformed with the two plasmids pSA69
and pSA55, which encode a pathway of enzymes that convert pyruvate
into isobutanol. When the biocatalyst Gevo1530 (pSA69, pSA55) was
contacted with glucose in a medium suitable for growth of the
biocatalyst, at about 30.degree. C., the biocatalyst produced
isobutanol from the glucose. Two 400 mL DasGip fermenter vessels
containing 200 mL each of EZ Rich medium (Neidhardt, F. C., P. L.
Bloch, and D. F. Smith. 1974. Culture medium for enterobacteria. J
Bacteriol. 119:736-47) containing 72 g/L glucose and 10 g/L yeast
extract were inoculated with Gevo1530 (pSA69, pSA55) cells. The
vessels were attached to a computer control system to monitor and
control pH at 6.5 through addition of base, temperature at about
30.degree. C., dissolved oxygen, and agitation. The vessels were
agitated, with a minimum agitation of 300 rpm and agitation was
varied to maintain a dissolved oxygen content of about 50% using a
12 sL/h air sparge until the OD.sub.600 was about 1.0. The vessels
were then induced with 0.1 mM IPTG. The vessels were operated under
these conditions for about 11 hours. At about 11 hours, the
contents of the fermenter vessels were then poured into 500 ml
sterile graduated plastic bottles and centrifuged for 20 minutes at
4500 rpm. The cells were resuspended in 50 ml total volume of
modified M9 medium. A 400 ml DasGip vessel containing 150 ml of EZ
Rich medium containing 72 g/L glucose and 10 g/L yeast extract was
inoculated with 50 ml of the cell containing medium and then
induced with 0.1 mM IPTG. Cell concentration was approximately 6 g
CDW per L. Constant dissolved oxygen content of 5% was maintained
using a 2.5 sL/h air sparge with variable agitation automatically
controlled from 300 to 1200 rpm. Measurement of the fermentor
vessel off-gas by trapping in an octanol bubble trap and then
measurement by GC was performed for isobutanol and ethanol.
Continuous measurement of off-gas concentrations of carbon dioxide
and oxygen were also measured by a DasGip off-gas analyzer
throughout the experiment. Samples were aseptically removed from
the fermenter vessel throughout the experiment and used to measure
OD.sub.600, glucose concentration by HPLC, and isobutanol
concentration in the broth by GC. Isobutanol production reached a
maximum at around 4 hours with a titer of 15 g/L and with a yield
of approximately 86% maximum theoretical. Volumetric productivity
of the fermentation, calculated from the inception of the
fermentation at time 0 h to an elapsed fermentation time of about 4
h, was about 3.5 g/L/h.
Example 42
[0412] High Volumetric Productivity Example 3: The modified
biocatalyst Gevo1530 was transformed with the two plasmids pSA69
and pSA55, which encode a pathway of enzymes that convert pyruvate
into isobutanol. When the biocatalyst Gevo1530 (pSA69, pSA55) was
contacted with glucose in a medium suitable for growth of the
biocatalyst, at about 30.degree. C., the biocatalyst produced
isobutanol from the glucose. Two 400 mL DasGip fermenter vessels
containing 200 mL each of EZ Rich medium (Neidhardt, F. C., P. L.
Bloch, and D. F. Smith. 1974. Culture medium for enterobacteria. J
Bacteriol. 119:736-47) containing 72 g/L glucose and 10 g/L yeast
extract were inoculated with Gevo1530 (pSA69, pSA55) cells. The
vessels were attached to a computer control system to monitor and
control pH at 6.5 through addition of base, temperature at about
30.degree. C., dissolved oxygen, and agitation. The vessels were
agitated, with a minimum agitation of 300 rpm and agitation was
varied to maintain a dissolved oxygen content of about 50% using a
12 sL/h air sparge until the OD.sub.600 was about 1.0. The vessels
were then induced with 0.1 mM IPTG. The vessels were operated under
these conditions for about 11 hours. At about 11 hours, the
contents of the fermenter vessels were then poured into 500 ml
sterile graduated plastic bottles and centrifuged for 20 minutes at
4500 rpm. The cells were resuspended in 50 ml total volume of
modified M9 medium. A 400 ml DasGip vessel containing 150 ml of EZ
Rich medium containing 72 g/L glucose and 10 g/L yeast extract was
inoculated with 50 ml of the cell containing medium and then
induced with 0.1 mM IPTG. Cell concentration was approximately 6 g
CDW per L. Constant dissolved oxygen content of 5% was maintained
using a 1 sL/h air sparge with variable agitation automatically
controlled from 300 to 1200 rpm. Measurement of the fermentor
vessel off-gas by trapping in an octanol bubble trap and then
measurement by GC was performed for isobutanol and ethanol.
Continuous measurement of off-gas concentrations of carbon dioxide
and oxygen were also measured by a DasGip off-gas analyzer
throughout the experiment. Samples were aseptically removed from
the fermenter vessel throughout the experiment and used to measure
OD.sub.600 glucose concentration by HPLC, and isobutanol
concentration in the broth by GC. Isobutanol production reached a
maximum at around 4 hours with a titer of about 13.7 g/L and with a
yield of approximately 87% maximum theoretical. Volumetric
productivity of the fermentation, calculated from the inception of
the fermentation at time 0 h to an elapsed fermentation time of
about 4 h, was about 3.2 g/L/h.
Example 43
[0413] High Titer Example 4: GEVO1780 is a modified bacterial
biocatalyst that contains genes on two plasmids which encode a
pathway of enzymes that convert pyruvate into isobutanol. When the
biocatalyst GEVO1780 was contacted with glucose in a medium
suitable for growth of the biocatalyst, at about 30.degree. C., the
biocatalyst produced isobutanol from the glucose. An overnight
starter culture was started in a 250 mL Erlenmeyer flask with
GEVO1780 cells from a freezer stock with a 40 mL volume of modified
M9 medium consisting of 85 g/L glucose, 20 g/L yeast extract, 20
.mu.M ferric citrate, 5.72 mg/L H.sub.3BO.sub.3, 3.62 mg/L
MnCl.sub.2.4H.sub.2O, 0.444 mg/L ZnSO.sub.4.7H.sub.2O, 0.78 mg/L
Na.sub.2MnO.sub.4.2H.sub.2O, 0.158 mg/L CuSO.sub.4.5H.sub.2O,
0.0988 mg/L CoCl.sub.2.6H.sub.2O, NaHPO.sub.4 6.0 g/L,
KH.sub.2PO.sub.4 3.0 g/L, NaCl 0.5 g/L, NHaCl 2.0 g/L, MgSO.sub.4
0.0444 g/L and CaCl.sub.2 0.00481 g/L and at a culture OD600 of
0.02 to 0.05. The starter culture was grown for approximately 14
hrs in a 30.degree. C. shaker at 250 rpm. Some of the starter
culture was then transferred to a 2000 mL DasGip fermenter vessel
containing about 1500 mL of modified M9 medium to achieve an
initial culture OD600 of about 0.1. The vessel was attached to a
computer control system to monitor and control pH at 6.5 through
addition of base, temperature at about 30.degree. C., dissolved
oxygen, and agitation. The vessel was agitated, with a minimum
agitation of 400 rpm and agitation was varied to maintain a
dissolved oxygen content of about 50% using a 25 sL/h air sparge
until the OD600 was about 1.0. The vessel was then induced with 0.1
mM IPTG. After continuing growth for approximately 8-10 hrs, the
dissolved oxygen content was decreased to 5% with 400 rpm minimum
agitation and 10 sl/h airflow. Continuous measurement of the
fermentor vessel off-gas by GC-MS analysis was performed for
oxygen, isobutanol, ethanol, and carbon dioxide throughout the
experiment. Samples were aseptically removed from the fermenter
vessel throughout the experiment and used to measure OD600, glucose
concentration, and isobutanol concentration in the broth.
Throughout the experiment, supplements of pre-grown and pre-induced
biocatalyst cells were added as a concentrate two times after the
start of the experiment: at 40 h and 75 h. These cells were the
same strain and plasmids shown above and used in the fermenter.
Supplemented cells were grown as 1 L cultures in 2.8 L Fernbach
flasks and incubated at 30.degree. C., 250 RPM in Modified M9
Medium with 85 g/L glucose. Cultures were induced upon inoculation
with 0.1 mM IPTG. When the cells had reached an OD.sub.600 of about
4.0-5.0, the culture was concentrated by centrifugation and then
added to the fermenter. A glucose feed of about 500 g/L glucose in
DI water was used intermittently during the production phase of the
experiment at time points greater than 12 h to maintain glucose
concentration in the fermenter of about 30 g/L or above.
[0414] The fermenter vessel was attached by tubing to a smaller 400
mL fermenter vessel that served as a flash tank and operated in a
recirculation loop with the fermenter. The biocatalyst cells within
the fermenter vessel were isolated from the flash tank by means of
a cross-flow filter placed in-line with the fermenter/flash tank
recirculation loop. The filter only allowed cell-free fermentation
broth to flow from the fermenter vessel into the flash tank. The
volume in the flash tank was approximately 100 mL and the hydraulic
retention time was about 10 minutes. Heat and vacuum were applied
to the flash tank. The vacuum level applied to the flash tank was
initially set at about 50 mBar and the flash tank was set at about
45.degree. C. These parameters were adjusted to maintain
approximately 6-13 g/L isobutanol in the fermenter throughout the
experiment. Generally, the vacuum ranged from 45-100 mBar and the
flash tank temperature ranged from 43.degree. C. to 45.degree. C.
throughout the experiment. Vapor from the heated flash tank was
condensed into a collection vessel as distillate. Cell-free
fermentation broth was continuously returned from the flash tank to
the fermentation vessel.
[0415] The distillate recovered in the experiment was strongly
enriched for isobutanol. Isobutanol formed an azeotrope with water
and usually lead to a two phase distillate: an isobutanol rich top
phase and an isobutanol lean bottom phase. Distillate samples were
analyzed by GC for isobutanol concentration. Isobutanol production
reached a maximum at around 118 hrs with a total titer of about 87
g/L. The isobutanol production rate was about 0.74 g/L/h on average
over the course of the experiment. The percent theoretical yield of
isobutanol was approximately 90.4% at the end of the
experiment.
Example 44
[0416] High Titer Example 5: GEVO1780 is a modified bacterial
biocatalyst that contains genes on two plasmids which encode a
pathway of enzymes that convert pyruvate into isobutanol. When the
biocatalyst GEVO1780 was contacted with glucose in a medium
suitable for growth of the biocatalyst, at about 30.degree. C., the
biocatalyst produced isobutanol from the glucose. An overnight
starter culture was started in a 250 mL Erlenmeyer flask with
GEVO1780 cells from a freezer stock with a 40 mL volume of modified
M9 medium consisting of 85 g/L glucose, 20 g/L yeast extract, 20
.mu.M ferric citrate, 5.72 mg/L H.sub.3BO.sub.3, 3.62 mg/L
MnCl.sub.2.4H.sub.2O, 0.444 mg/L ZnSO.sub.4.7H.sub.2O, 0.78 mg/L
Na.sub.2MnO.sub.4.2H.sub.2O, 0.158 mg/L CuSO.sub.4.5H.sub.2O,
0.0988 mg/L CoCl.sub.2.6H.sub.2O, NaHPO.sub.4 6.0 g/L,
KH.sub.2PO.sub.4 3.0 g/L, NaCl 0.5 g/L, NH.sub.4Cl 2.0 g/L,
MgSO.sub.4 0.0444 g/L and CaCl.sub.2 0.00481 g/L and at a culture
OD.sub.600 of about 0.05. The starter culture was grown for
approximately 14 hrs in a 30.degree. C. shaker at 250 rpm. Some of
the starter culture was then transferred to a 2000 mL DasGip
fermenter vessel containing about 1500 mL of modified M9 medium to
achieve an initial culture OD.sub.600 of about 0.1. The vessel was
attached to a computer control system to monitor and control pH at
6.5 through addition of base, temperature at about 30.degree. C.,
dissolved oxygen, and agitation. The vessel was agitated, with a
minimum agitation of 400 rpm and agitation was varied to maintain a
dissolved oxygen content of about 50% using a 25 sL/h air sparge
until the OD.sub.600 was about 1.0. The vessel was then induced
with 0.1 mM IPTG. After continuing growth for approximately 8-10
hrs, the dissolved oxygen content was decreased to 5% with 400 rpm
minimum agitation and 10 sl/h airflow. Continuous measurement of
the fermentor vessel off-gas by GC-MS analysis was performed for
oxygen, isobutanol, ethanol, and carbon dioxide throughout the
experiment. Samples were aseptically removed from the fermenter
vessel throughout the experiment and used to measure OD.sub.600,
glucose concentration, and isobutanol concentration in the broth.
Throughout the experiment, supplements of pre-grown and pre-induced
biocatalyst cells were added as a concentrate after the start of
the experiment: at 62.5 h, 87 h, 113 h, and 142 h. These cells were
the same strain and plasmids shown above and used in the fermenter.
Supplemented cells were grown as 1 L cultures in 2.8 L Fernbach
flasks and incubated at 30.degree. C., 250 RPM in Modified M9
Medium. Cultures were induced upon inoculation with 0.1 mM IPTG.
When the cells had reached an OD.sub.600 of about 4.0-5.0, the
culture was concentrated by centrifugation and then added to the
fermenter. A glucose feed of about 500 g/L glucose in DI water was
used intermittently during the production phase of the experiment
at time points greater than 12 h to maintain glucose concentration
in the fermenter of about 30 g/L or above.
[0417] The fermenter vessel was attached by tubing to a smaller 400
mL fermenter vessel that served as a flash tank and operated in a
recirculation loop with the fermenter. The volume in the flash tank
was approximately 100 mL and the hydraulic retention time was about
5-10 minutes. Heat and vacuum were applied to the flash tank. The
vacuum level applied to the flash tank was initially set at about
40 mBar and the flash tank was set at about 36.degree. C. These
parameters were adjusted to maintain approximately 5-10 g/L
isobutanol in the fermenter throughout the experiment. Generally,
the vacuum ranged from about 20-50 mBar and the flash tank
temperature of about 36.degree. C. throughout the experiment. Vapor
from the heated flash tank was condensed into a collection vessel
as distillate. The fermentation broth was continuously returned
from the flash tank to the fermentation vessel.
[0418] The distillate recovered in the experiment was strongly
enriched for isobutanol. Isobutanol formed an azeotrope with water
and usually lead to a two phase distillate: an isobutanol rich top
phase and an isobutanol lean bottom phase. Distillate samples were
analyzed by GC for isobutanol concentration. Isobutanol production
reached a maximum at around 166 hrs with a total titer of about 106
g/L. The isobutanol production rate was about 0.64 g/L/h and the
percent theoretical yield was approximately 91% at the end of the
experiment.
Example 45
[0419] High Titer Example 6: GEVO1780 is a modified bacterial
biocatalyst that contains genes on two plasmids which encode a
pathway of enzymes that convert pyruvate into isobutanol. When the
biocatalyst GEVO1780 was contacted with glucose in a medium
suitable for growth of the biocatalyst, at about 30.degree. C., the
biocatalyst produced isobutanol from the glucose. Overnight starter
cultures were started in four 2.8 L Fembach flasks with GEVO1780
cells from freezer stocks with four 1000 mL volumes of modified M9
medium consisting of 85 g/L glucose, 20 g/L yeast extract, 20 .mu.M
ferric citrate, 5.72 mg/L H.sub.3BO.sub.3, 3.62 mg/L
MnCl.sub.2.4H.sub.2O, 0.444 mg/L ZnSO.sub.4.7H.sub.2O, 0.78 mg/L
Na.sub.2MnO.sub.4.2H.sub.2O, 0.158 mg/L CuSO.sub.4.5H.sub.2O,
0.0988 mg/L CoCl.sub.2.6H.sub.2O, NaHPO.sub.4 6.0 g/L,
KH.sub.2PO.sub.4 3.0 g/L, NaCl 0.5 g/L, NH.sub.4Cl 2.0 g/L,
MgSO.sub.4 0.0444 g/L and CaCl.sub.20.00481 g/L and at a culture
OD.sub.600 of about 0.05. The cultures were induced with 1 mM IPTG
at the point of inoculation and grown for approximately 14 hrs in a
30.degree. C. shaker at 250 rpm. At about 14 hours, the contents of
the flasks were then poured into 500 ml sterile graduated plastic
bottles and centrifuged for 20 minutes at 4500 rpm. The cells were
resuspended in about 100 ml total volume of modified M9 medium
without glucose, then transferred to a 2000 mL DasGip fermenter
vessel containing about 1500 mL of modified M9 medium, wherein the
glucose was replaced by clarified corn liquefact to give an
approximate glucose concentration of about 100 g/L and to achieve
an initial culture OD.sub.600 of about 10. Clarified corn liquefact
was prepared by incubating a slurry of ground corn at about
60.degree. C. for about 24 hrs to which alpha-amyalse and
gluco-amalyase enzymes had been added in sufficient amounts to
liberate free glucose from the corn starch. After about 24 hours of
treatment as described above, the corn liquefact was clarified by
centrifugation and filtration to remove most of the solids and
generate a clarified corn liquefact solution of about 250 g/L
glucose. The fermenter vessel was attached to a computer control
system to monitor and control pH at 6.5 through addition of base,
temperature at about 30.degree. C., dissolved oxygen, and
agitation. The vessel was agitated, with a minimum agitation of 400
rpm and agitation was varied to maintain a dissolved oxygen content
of about 5% using a 10 sL/h air sparge. Continuous measurement of
the fermentor vessel off-gas by GC-MS analysis was performed for
oxygen, isobutanol, ethanol, and carbon dioxide throughout the
experiment. Samples were aseptically removed from the fermenter
vessel throughout the experiment and used to measure OD.sub.600,
glucose concentration, and isobutanol concentration in the broth.
Supplements of pre-grown and pre-induced biocatalyst cells were
added as a concentrate throughout this experiment. These cells were
the same strain and plasmids shown above and used in the fermenter.
Supplemented cells were grown as 1 L cultures in 2.8 L Fernbach
flasks and incubated at 30.degree. C., 250 RPM in Modified M9
Medium using glucose as the main carbon source. Cultures were
induced upon inoculation with 1 mM IPTG. When the cells had reached
an OD.sub.600 of about 2.0-5.0, the culture was concentrated by
centrifugation and then added to the fermenter. A feed of clarified
corn liquefact containing about 250 g/L glucose was used
intermittently during the experiment to maintain glucose
concentration in the fermenter of about 30 g/L or above.
[0420] The fermenter vessel was attached by tubing to a smaller 400
mL fermenter vessel that served as a flash tank and operated in a
recirculation loop with the fermenter. The volume in the flash tank
was approximately 100 mL and the hydraulic retention time was about
5-10 minutes. Heat and vacuum were applied to the flash tank. The
vacuum level applied to the flash tank was initially set at about
40 mBar and the flash tank was set at about 36.degree. C. These
parameters were adjusted to maintain approximately 5-10 g/L
isobutanol in the fermenter throughout the experiment. Generally,
the vacuum ranged from about 20-50 mBar and the flash tank
temperature of about 36.degree. C. throughout the experiment. Vapor
from the heated flash tank was condensed into a collection vessel
as distillate. The fermentation broth was continuously returned
from the flash tank to the fermentation vessel.
[0421] The distillate recovered in the experiment was strongly
enriched for isobutanol. Isobutanol formed an azeotrope with water
and usually lead to a two phase distillate: an isobutanol rich top
phase and an isobutanol lean bottom phase. Distillate samples were
analyzed by GC for isobutanol concentration. Isobutanol production
reached a maximum at around 217 hrs with a total titer of about 124
g/L. The isobutanol production rate was about 0.57 g/L/h on average
over the course of the experiment, but a maximum isobutanol
production rate of about 1.3 g/L/h was achieved in the experiment.
The percent theoretical yield was approximately 74% at the end of
the experiment, but a maximum theoretical yield of about 88%
theoretical yield was achieved during the experiment.
Example 46
[0422] High Titer Example 7: GEVO1780 is a modified bacterial
biocatalyst that contains genes on two plasmids which encode a
pathway of enzymes that convert pyruvate into isobutanol. When the
biocatalyst GEVO1780 was contacted with glucose in a medium
suitable for growth of the biocatalyst, at about 30.degree. C., the
biocatalyst produced isobutanol from the glucose. An overnight
starter culture was started in a 2.8 L Fembach flask with GEVO1780
cells from a freezer stock with a 1000 mL volume of modified M9
medium consisting of 85 g/L glucose, 20 g/L yeast extract, 20 .mu.M
ferric citrate, 5.72 mg/L H.sub.3BO.sub.3, 3.62 mg/L
MnCl.sub.2.4H.sub.2O, 0.444 mg/L ZnSO.sub.4.7H.sub.2O, 0.78 mg/L
Na.sub.2MnO.sub.4.2H.sub.2O, 0.158 mg/L CuSO.sub.4.5H.sub.2O,
0.0988 mg/L CoCl.sub.2.6H.sub.2O, NaHPO.sub.4 6.0 g/L,
KH.sub.2PO.sub.4 3.0 g/L, NaCl 0.5 g/L, NH.sub.4Cl 2.0 g/L,
MgSO.sub.4 0.0444 g/L and CaCl.sub.2 0.00481 g/L and at a culture
OD.sub.600 of about 0.05. The culture was induced with 1 mM IPTG at
the point of inoculation and grown for approximately 14 hrs in a
30.degree. C. shaker at 250 rpm. At about 14 hours, the contents of
the flask was then poured into 500 ml sterile graduated plastic
bottles and centrifuged for 20 minutes at 4500 rpm. The cells were
resuspended in about 40 ml total volume of modified M9 medium, then
transferred to a 2000 mL DasGip fermenter vessel containing about
1500 mL of modified M9 medium, wherein the glucose was replaced by
corn liquefact with about 17% dry solids concentration and to
achieve an initial calculated culture OD.sub.600 of about 3. Corn
liquefact, which was treated with alpha-amyalse, was prepared by
diluting sterilized corn liquefact with a dry solids concentration
of about 35% with sterile dionized water to a final dry solids
concentration of about 17%. The diluted corn liquefact was then
added to the modified M9 medium components described above without
additional glucose and placed in the 2000 mL fermenter vessel. At
the point of inoculation, a dose of gluco-amylase was added to the
fermenter vessel in sufficient quantity to hydrolyse the corn
starch oligomers present in the corn liquefact to monomeric
glucose. The vessel was attached to a computer control system to
monitor and control pH at about 6.5 through addition of base,
temperature at about 30.degree. C., dissolved oxygen, and
agitation. The vessel was agitated, with a minimum agitation of 400
rpm and agitation was varied to maintain a dissolved oxygen content
of about 5% using a 10 sL/h air sparge. Continuous measurement of
the fermentor vessel off-gas by GC-MS analysis was performed for
oxygen, isobutanol, ethanol, and carbon dioxide throughout the
experiment. Samples were aseptically removed from the fermenter
vessel throughout the experiment and used to measure glucose
concentration and isobutanol concentration in the broth.
Supplements of pre-grown and pre-induced biocatalyst cells were
added as a concentrate throughout this experiment. These cells were
the same strain shown above and used in the fermenter. Supplemented
cells were grown as 1 L cultures in 2.8 L Fembach flasks and
incubated at 30.degree. C., 250 RPM in Modified M9 Medium using
glucose as the main carbon source. Cultures were induced upon
inoculation with 1 mM IPTG. When the cells had reached an
OD.sub.600 of about 2.0-5.0, the culture was concentrated by
centrifugation and then added to the fermenter. A feed of corn
liquefact was prepared by adding dose of gluco-amylase in
sufficient quantity to hydrolyse the corn starch oligomers present
in the corn liquefact to monomeric glucose and incubation at about
50.degree. C. for 24 hrs prior to use. The resulting solution
contained about 188 g/L glucose and was used intermittently during
the experiment to maintain glucose concentration in the fermenter
of about 40 g/L or above.
[0423] The fermenter vessel was attached by tubing to a smaller 400
mL fermenter vessel that served as a flash tank and operated in a
recirculation loop with the fermenter. The volume in the flash tank
was approximately 100 mL and the hydraulic retention time was about
5-10 minutes. Heat and vacuum were applied to the flash tank. The
vacuum level applied to the flash tank was initially set at about
40 mBar and the flash tank was set at about 36.degree. C. These
parameters were adjusted to maintain approximately 5-10 g/L
isobutanol in the fermenter throughout the experiment. Generally,
the vacuum ranged from about 20-50 mBar and the flash tank
temperature was about 36.degree. C. throughout the experiment.
Vapor from the heated flash tank was condensed into a collection
vessel as distillate. The fermentation broth was continuously
returned from the flash tank to the fermentation vessel.
[0424] The distillate recovered in the experiment was strongly
enriched for isobutanol. Isobutanol formed an azeotrope with water
and usually lead to a two phase distillate: an isobutanol rich top
phase and an isobutanol lean bottom phase. Distillate samples were
analyzed by GC for isobutanol concentration. Isobutanol production
reached a maximum at around 166 hrs with a total titer of about 30
g/L. The isobutanol production rate was about 0.31 g/L/h on average
over the course of the experiment. The percent theoretical yield
was not determined in this experiment.
Example 47
[0425] Low-Level Anaerobic Production of Isobutanol: This example
illustrates that a microorganism which is metabolically engineered
to overexpress an isobutanol producing pathway produces a low
amount of isobutanol under anaerobic conditions.
[0426] Overnight cultures of GEVO1859 were started from glycerol
stocks stored at -80.degree. C. of previously transformed strains.
These cultures were started in 3 mL M9 minimal medium (Sambrook,
J., Russel, D. W. Molecular Cloning, A Laboratory Manual. 3 ed.
2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory
Press), supplemented with 10 g/L yeast extract, 10 .mu.M ferric
citrate and trace metals, containing 8.5% glucose and the
appropriate antibiotics in snap cap tubes about 14 h prior to the
start of the fermentation. Isobutanol fermentations were then
carried out in screw cap flasks containing 20 mL of the same medium
that was inoculated with 0.2 mL of the overnight culture. The cells
were incubated at 37.degree. C./250 rpm until the strains had grown
to an OD600 of 0.6-0.8 and were then induced with Isopropyl
.beta.-D-1-thiogalactopyranoside at 1 mM final concentration.
[0427] Three hours after induction the cultures were either kept
under the current conditions (micro-aerobic conditions) or shifted
to anaerobic conditions by loosening the cap of the flasks and
placing the flasks into to a Coy Laboratory Products Type B Vinyl
anaerobic chamber (Coy Laboratory Products, Grass Lakes, Mich.)
through an airlock in which the flasks were cycled three times with
nitrogen and vacuum, and then filled with the a hydrogen gas mix
(95% Nitrogen, 5% Hydrogen).
[0428] Once the flasks were inside the anaerobic chamber, the
flasks were closed again and incubated without shaking at
30.degree. C. The flasks in the anaerobic chamber were swirled
twice a day. Samples (2 mL) were taken at the time of the shift and
at 24 h and 48 h after inoculation, spun down at 22000 g for 1 min
to separate the cell pellet from the supernatant and stored frozen
at -20.degree. C. until analysis. The samples were analyzed using
High performance liquid chromatography (HPLC) and gas
chromatography GC. All experiments were performed in duplicate.
[0429] GEVO1859 was run in triplicate. Stable OD values can be
observed for all strains under anaerobic shift conditions over the
course of the fermentation. FIG. 6 illustrates the growth of Gevo
1859 under anaerobic shift conditions over the course of the
fermentation.
[0430] A complete pathway integrant strain showed low-level
anaerobic isobutanol production over the course of the fermentation
(see FIG. 7 and Table 30 below). FIG. 7 illustrates isobutanol
production by Gevo 1859 under microaerobic conditions over the
course of the fermentation.
[0431] Table 30 provides results for volumetric productivity,
specific productivity titer and yield reached in an anaerobic
fermentation for the tested strains and plasmid systems:
TABLE-US-00028 Volumetric Specific Productivity Productivity Titer
Yield [g/ [g/L/ [g/ [g/ Samples L/h] .+-. h/OD] .+-. L] .+-. g]
.+-. GEVO1859 0.088 0.028 0.019 0.005 4.22 1.35 0.140 0.029
[0432] As shown in Table 31 below, in the period from 6 to 48, i.e.
under anaerobic conditions GEVO1859 demonstrated limited production
of isobutanol.
[0433] Table 31 provides results for volumetric productivity,
specific productivity titer and yield reached in the period from 6
to 48 h for the tested strains and plasmid systems:
TABLE-US-00029 Volumetric Specific Productivity Productivity Titer
Yield Samples Condition [g/L/h] .+-. [g/L/h/OD] .+-. [g/L] .+-.
[g/g] .+-. GEVO1859 Microaerobic 0.266 0.010 0.040 0.004 11.2 0.4
0.33 0.016 GEVO1859 Anaerobic 0.086 0.026 0.019 0.005 3.60 1.1 0.14
0.032
Example 48
[0434] Overexpression of pntAB improves isobutanol fermentation
performance: This example illustrates that overexpression of a
transhydrogenase, exemplified by the E. coli pntAB operon product,
on a low copy plasmid improves isobutanol production under
anaerobic conditions.
[0435] GEVO1748 was transformed with plasmids pGV1698 one of either
pGV1720 (control) or pGV1745 (pntAB).
[0436] The aforementioned strains were plated on LB-plates
containing the appropriate antibiotics and incubated overnight at
37.degree. C. Overnight cultures were started in 3 mL EZ-Rich
medium (Neidhardt, F. C., P. L. Bloch, and D. F. Smith. 1974.
Culture medium for enterobacteria. J Bacteriol. 119:736-47)
containing 5% glucose and the appropriate antibiotics in snap cap
tubes about 14 h prior to the start of the fermentation. Isobutanol
fermentations were then carried out in EZ-Rich Medium containing 5%
glucose and the appropriate antibiotics. Screw cap flasks with 20
mL EZ-Rich medium containing 5% glucose and the appropriate
antibiotics were inoculated with 1% of the grown overnight culture.
The cells were incubated at 37.degree. C./250 rpm until they
reached an OD600 of 0.6-0.8 followed by induction with Isopropyl
.beta.-D-1-thiogalactopyranoside (IPTG, 1 mM) and
anhydrotetracycline (aTc, 100 ng/mL). Samples (2 mL) were taken 24
h and 48 h post inoculation, centrifuged at 22,000.times.g for 1
min and stored frozen at -20.degree. C. until via Gas
Chromatography (GC) and High Performance Liquid Chromatography
(HPLC). Fermentations were run with two biological replicates.
[0437] All cultures grew to an OD of 5.5 to 6.5. Volumetric
productivity and titer were improved by 45%, specific productivity
improved by 51%. Yield was improved by 8% (Table 32).
[0438] Table 32 provides data indicating that overexpression of
pntAB improves isobutanol fermentation performance:
TABLE-US-00030 Volumetric Specific Productivity Productivity Titer
Yield [g/ [g/L/ [g/ [g/ Strain L/h] .+-. h/OD] .+-. L] .+-. g] .+-.
GEVO1748 + 0.205 0.001 0.035 0.001 9.86 0.04 0.311 0.001 pGV1698 +
pGV1720 control) GEVO1748 + 0.298 0.006 0.053 0.003 14.29 0.28
0.337 0.001 pGV1698 + pGV1745 (pntAB)
Example 49
[0439] Overexpression of pntAB enables anaerobic isobutanol
production: This example illustrates that overexpression of a
transhydrogenase, exemplified by the E. coli pntAB operon product,
improves anaerobic isobutanol.
[0440] GEVO1844 was transformed with plasmids pGV1698 and one of
either pGV1720 (control) or pGV1745 (pntAB). GEVO1748 was
transformed with plasmids pGV1698 and pGV1720 (control) or pGV1745
(pntAB).
[0441] Overnight cultures of the aforementioned strains were
started from glycerol stocks stored at -80.degree. C. of previously
transformed strains. These cultures were started in 3 mL M9 minimal
medium (Sambrook, J., Russel, D. W. Molecular Cloning, A Laboratory
Manual. 3 ed. 2001, Cold Spring Harbor, N.Y.: Cold Spring Harbor
Laboratory Press), supplemented with 10 g/L yeast extract, 10 .mu.M
ferric citrate and trace metals, containing 8.5% glucose and the
appropriate antibiotics in snap cap tubes about 14 h prior to the
start of the fermentation. Isobutanol fermentations were then
carried out in screw cap flasks containing 20 mL of the same medium
that was inoculated with 0.2 mL of the overnight culture. The cells
were incubated at 37.degree. C./250 rpm until the strains had grown
to an OD600 of 0.6-0.8 and were then induced with Isopropyl
.beta.-D-1-thiogalactopyranoside at 1 mM final concentration.
[0442] Three hours after induction the cultures were shifted to
anaerobic fermentation conditions by loosening the cap of the
flasks and placing the flasks into to a Coy Laboratory Products
Type B Vinyl anaerobic chamber (Coy Laboratory Products, Grass
Lakes, Mich.) through an airlock in which the flasks were cycled
three times with nitrogen and vacuum, and then filled with the a
hydrogen gas mix (95% Nitrogen, 5% Hydrogen). Once the flasks were
inside the anaerobic chamber, the flasks were closed again and
incubated without shaking at 30.degree. C. Inside the chamber, an
anaerobic atmosphere (less than 5 ppm oxygen) was maintained
through the hydrogen gas mix (95% Nitrogen, 5% Hydrogen) reacting
with a palladium catalyst to remove oxygen. The flasks in the
anaerobic chamber were swirled twice a day. Samples (2 mL) were
taken at the time of the shift and at 24 h and 48 h after
inoculation, spun down at 22000 g for 1 min to separate the cell
pellet from the supernatant and stored frozen at -20.degree. C.
until analysis. The samples were analyzed using High performance
liquid chromatography (HPLC) and gas chromatography GC. All
experiments were performed in duplicate.
[0443] At the time of shifting the cultures to anaerobic conditions
all samples had an OD600 ranging between 2.3 and 3.3. All samples
featuring an overexpressed pntAB operon (pGV1745) increased in
OD600 from 6 h to 24 h by 0.2-1.1, all samples lacking pntAB
(pGV1720) decreased in OD600 by 0.5-1.2 (FIG. 8), indicating that
overexpression of pntAB is beneficial under anaerobic conditions.
FIG. 8 provides data for the growth of the tested samples under
anaerobic condition over the course of the fermentation. The first
data point at 6 hours indicates the shift to anaerobic
conditions.
[0444] Furthermore, pntAB over-expression is beneficial for
anaerobic isobutanol production. All samples featuring pntAB
continued isobutanol production under anaerobic conditions until
the fermentation was stopped at 48 hours whereas the samples
lacking pntAB did not produce isobutanol between 24 and 48 hours
(FIG. 8). FIG. 9 provides additional data for isobutanol production
of the tested samples under anaerobic conditions over the course of
the fermentation.
[0445] In the strain overexpressing pntAB volumetric productivity
and titer are increased 2.4-fold, specific productivity by 85% and
yield by 9% (Table 33).
[0446] Table 33 summarizes the results for volumetric productivity,
specific productivity titer and yield reached in an anaerobic
fermentation for the tested strains and plasmid systems:
TABLE-US-00031 Volumetric Specific Productivity Productivity Titer
Yield [g/ [g/L/ [g/ [g/ samples L/h] .+-. h/OD] .+-. L] .+-. g]
.+-. GEVO1748 + 0.047 0.022 2.24 0.279 pGV1720 + pGV1698 (control)
GEVO1748 + 0.111 0.002 0.041 0.012 5.32 0.10 0.304 0.004 pGV1745 +
pGV1698 (pntAB)
[0447] In the period from 6 to 48, i.e. under anaerobic conditions
GEVO1748 transformed with plasmids pGV1698 and pGV1745 (carrying
pntAB) demonstrated significantly higher productivity, titer, and
yield of isobutanol compared to the control strain carrying pGV1720
(without pntAB) (Table 34).
[0448] Table 34 summarizes results for volumetric productivity,
specific productivity titer and yield reached in the period from 6
to 48 h for the tested strains and plasmid systems:
TABLE-US-00032 Volumetric Specific Productivity Productivity Titer
Yield [g/ [g/L/ [g/ [g/ samples L/h] .+-. h/OD] .+-. L] .+-. g]
.+-. GEVO1748 + 0.029 0.014 1.21 0.171 pGV1720 + pGV1698 (control)
GEVO1748 + 0.096 0.003 0.035 0.015 4.01 0.15 0.246 0002 pGV1745
pGV1698 (pntAB)
Example 50
[0449] Chromosomal Integration of pntAB improves anaerobic
isobutanol production: This example illustrates that overexpression
of a transhydrogenase, exemplified by the E. coli pntAB operon
product, from the chromosome improves isobutanol production under
anaerobic conditions compared to the case in which pntAB is
expressed from a low copy plasmid. Overnight cultures of GEVO1846,
GEVO1859. GEVO1886 were started from glycerol stocks stored at
-80.degree. C. of previously transformed strains. These cultures
were started in 3 mL M9 minimal medium (Sambrook, J., Russel, D. W.
Molecular Cloning, A Laboratory Manual. 3 ed. 2001, Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory Press), supplemented
with 10 g/L yeast extract, 10 .mu.M ferric citrate and trace
metals, containing 8.5% glucose and the appropriate antibiotics in
snap cap tubes about 14 h prior to the start of the fermentation.
Isobutanol fermentations were then carried out in screw cap flasks
containing 20 mL of the same medium that was inoculated with 0.2 mL
of the overnight culture. The cells were incubated at 37.degree.
C./250 rpm until the strains had grown to an OD600 of 0.6-0.8 and
were then induced with Isopropyl .beta.-D-1-thiogalactopyranoside
at 1 mM final concentration. Three hours after induction the
cultures were either kept under the current conditions
(micro-aerobic conditions) or shifted to anaerobic conditions by
loosening the cap of the flasks and placing the flasks into to a
Coy Laboratory Products Type B Vinyl anaerobic chamber (Coy
Laboratory Products, Grass Lakes, Mich.) through an airlock in
which the flasks were cycled three times with nitrogen and vacuum,
and then filled with the a hydrogen gas mix (95% Nitrogen, 5%
Hydrogen). Once the flasks were inside the anaerobic chamber, the
flasks were closed again and incubated without shaking at
30.degree. C. The flasks in the anaerobic chamber were swirled
twice a day. Samples (2 mL) were taken at the time of the shift and
at 24 h and 48 h after inoculation, spun down at 22000 g for 1 min
to separate the cell pellet from the supernatant and stored frozen
at -20.degree. C. until analysis. The samples were analyzed using
High performance liquid chromatography (HPLC) and gas
chromatography GC. All experiments were performed in duplicate.
GEVO1886, GEVO1859 and GEVO1846 were run in parallel. Each strain
was run in triplicate. Stable OD values can be observed for all
strains under anaerobic shift conditions over the course of the
fermentation (FIG. 10). The over-expression of pntAB in the
complete pathway integrant strain again showed improvement for
isobutanol production over the course of the fermentation (FIG.
10). FIG. 10 illustrates growth under anaerobic shift conditions
over the course of the fermentation. FIG. 11 illustrates isobutanol
production under microaerobic conditions over the course of the
fermentation.
[0450] Compared to the complete pathway integrant strain without
pntAB knock-in (GEVO1859), volumetric productivity and titer are
increased 3.8 fold, specific productivity is increased 2.8 fold and
yield is 2.2 fold higher in GEVO1886 (Table 35). In addition,
GEVO1886 shows superior performance compared to the plasmid system
strain (GEVO1846) under anaerobic conditions. Volumetric
productivity and titer are increased by 48%, specific productivity
is increased by 18% and yield is 12% higher (Table 35). Comparing
the performance of GEVO 1886 aerobically and anaerobically
volumetric.
[0451] Table 35 summarizes the results for volumetric productivity,
specific productivity titer and yield reached in an anaerobic
fermentation for the tested strains and plasmid systems:
TABLE-US-00033 Volumetric Specific Productivity Productivity Titer
Yield [g/ [g/L/ [g/ [g/ Samples L/h] .+-. h/OD] .+-. L] .+-. g]
.+-. GEVO1886 0.335 0.002 0.053 0.001 16.08 0.08 0.307 0.004
GEVO1859 0.088 0.028 0.019 0.005 4.22 1.35 0.140 0.029 GEVO1846
0.227 0.021 0.045 0.005 10.88 1.01 0.274 0.003
[0452] The performance numbers in the period from 6 to 48
demonstrate that most of isobutanol production occurred during
under anaerobic conditions. Highest values for yield and specific
productivity were reached by the strain featuring the complete
pathway integration and the pntAB knock-in (GEVO1886) under
anaerobic conditions. In addition this strain reached the highest
values for volumetric productivity and titer under both conditions
anaerobic and microaerobic (Table 36).
[0453] Table 36 summarizes results for volumetric productivity,
specific productivity titer and yield reached in the period from 6
to 48 h for the tested strains and plasmid systems:
TABLE-US-00034 Volumetric Specific Productivity Productivity Titer
Yield Samples Condition [g/L/h] .+-. [g/L/h/OD] .+-. [g/L] .+-.
[g/g] .+-. GEVO1886 Microaerobic 0.355 0.004 0.042 0.001 14.9 0.2
0.33 0.012 GEVO1859 Microaerobic 0.266 0.010 0.040 0.004 11.2 0.4
0.33 0.016 GEVO1846 Microaerobic 0.344 0.007 0.051 0.004 14.4 0.3
0.33 0.005 GEVO1886 Anaerobic 0.355 0.008 0.056 0.001 14.9 0.1 0.35
0.004 GEVO1859 Anaerobic 0.086 0.026 0.019 0.005 3.60 1.1 0.14
0.032 GEVO1846 Anaerobic 0.209 0.019 0.041 0.004 8.79 0.8 0.27
0.006
[0454] The performance numbers in the period from 6 to 48
demonstrate that most of isobutanol production occurred during
under anaerobic conditions. Highest values for yield and specific
productivity were reached by the strain featuring the complete
pathway integration and the pntAB knock-in (GEVO1886) under
anaerobic conditions.
Example 51
[0455] Anaerobic batch fermentation of GEVO1886. This example
illustrates that an engineered microorganism produces a biofuel in
a batch fermentation at a productivity of about 0.4 g/L/h, a titer
21 g/L/h, and a yield of about 88% of theoretical.
[0456] An overnight culture was started in a 250 mL Erlenmeyer
flask with GEVO1886 cells from a freshly streaked plate with a 40
mL volume of M9 medium (Miller, J. H. A Short Course in Bacterial
Genetics: A laboratory manual and handbook for Escherichia coli and
related bacteria. 1992. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.) containing 85 g/L glucose, 20 g/L yeast
extract, 20 .mu.M ferric citrate, trace metals, an additional 1 g/L
NH.sub.4Cl, an additional 1 mM MgSO.sub.4 and an additional 1 mM
CaCl.sub.2 and at a culture OD.sub.600 of about 0.05. The starter
culture was grown for approximately 14 hours at 30.degree. C. at
250 rpm.
[0457] Some of the starter culture was then transferred to a 400 mL
DasGip fermenter vessel containing about 200 mL of M9 medium
(Miller, J. H. A Short Course in Bacterial Genetics: A laboratory
manual and handbook for Escherichia coli and related bacteria.
1992. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.) containing 85 g/L glucose, 20 g/L yeast extract, 20 .mu.M
ferric citrate, trace metals, an additional 1 g/L NH.sub.4Cl, an
additional 1 mM MgSO.sub.4 and an additional 1 mM CaCl.sub.2 to
achieve a starting cell concentration by optical density at 600 nm
of 0.1. The vessel was attached to a computer control system to
monitor and control pH at 6.5 through addition of base, temperature
at 30.degree. C., dissolved oxygen, and agitation. The vessel was
agitated, with a minimum agitation of 200 rpm and agitation was
varied to maintain a dissolved oxygen content of about 50% using a
12 sL/h air sparge until the OD.sub.600 was about 1.0. The vessel
was then induced with 1 mM IPTG.
[0458] After continuing growth for 3 hours, the dissolved oxygen
content was decreased to 0% with 200 rpm agitation and 2.5 sL/h
sparge with nitrogen (N.sub.2) gas. Measurement of the fermenter
vessel off-gas for isobutanol and ethanol was performed throughout
the experiment by passage of the off-gas stream through a mass
spectrometer. Continuous measurement of off-gas concentrations of
carbon dioxide and oxygen were also measured by a DasGip off-gas
analyzer throughout the experiment. Samples were aseptically
removed from the fermenter vessel throughout the experiment and
used to measure OD.sub.600, glucose concentration by HPLC, and
isobutanol concentration in the broth by GC.
[0459] Isobutanol production reached a maximum titer of 21 g/L at a
productivity of 0.4 g/L/h. Yield of the fermentation, calculated
when the titer of isobutanol was between 1 g/L and 15 g/L, was
approximately 88% of theoretical.
Example 52
[0460] (prophetical): Anaerobic batch fermentation of GEVO1886 with
continuous product removal. This example illustrates that an
engineered microorganism produces a biofuel at a yield of at
greater than about 95% of theoretical.
[0461] An overnight culture is started in a 250 mL Erlenmeyer flask
with GEVO1886 cells from a freezer stock with a 40 mL volume of
modified M9 medium consisting of 85 g/L glucose, 20 g/L yeast
extract, 20 .mu.M ferric citrate, 5.72 mg/L H.sub.3BO.sub.3, 3.62
mg/L MnCl.sub.2.4H.sub.2O, 0.444 mg/L ZnSO.sub.4.7H.sub.2O, 0.78
mg/L Na.sub.2MnO.sub.4.2H.sub.2O, 0.158 mg/L CuSO.sub.4.5H.sub.2O,
0.0988 mg/L CoCl.sub.2.6H.sub.2O, NaHPO.sub.4 6.0 g/L,
KH.sub.2PO.sub.4 3.0 g/L, NaCl 0.5 g/L, NH.sub.4Cl 2.0 g/L,
MgSO.sub.4 0.0444 g/L and CaCl.sub.20.00481 g/L and at a culture
OD.sub.600 of about 0.05. The starter culture is grown for
approximately 14 hrs in a 30.degree. C. shaker at 250 rpm. Some of
the starter culture is then transferred to a 2000 mL DasGip
fermenter vessel containing about 1500 mL of modified M9 medium to
achieve an initial culture OD.sub.600 of about 0.1. The fermenter
vessel is attached to a computer control system to monitor and
control pH at 6.5 through addition of base, temperature at about
30.degree. C., dissolved oxygen, and agitation. The vessel is
agitated, with a minimum agitation of 400 rpm and agitation is
varied to maintain a dissolved oxygen content of about 50% using a
25 sL/h air sparge until the OD.sub.600 is about 1.0. The vessel is
then induced with 0.1 mM IPTG. After continuing growth for about 3
hours, the dissolved oxygen content is decreased to 0% with 200 rpm
agitation and 2.5 sL/h sparge with nitrogen (N.sub.2) gas.
Continuous measurement of the fermentor vessel off-gas by GC-MS
analysis is performed for, isobutanol, ethanol, and carbon dioxide
throughout the experiment. Samples are aseptically removed from the
fermenter vessel throughout the experiment and used to measure
OD.sub.600, glucose concentration and isobutanol concentration in
the broth. Throughout the experiment, supplements of pre-grown and
pre-induced biocatalyst cells are added as a concentrate several
times since the start of the experiment. These cells are the same
strain and plasmids shown above and used in the fermenter.
Supplemented cells are grown as 1 L cultures in 2.8 L Fembach
flasks and incubated at 30.degree. C., 250 RPM in Modified M9
Medium with 85 g/L of glucose. Cultures are induced upon
inoculation with 0.1 mM IPTG. When the cells reach an OD.sub.600 of
about 4.0-5.0, the culture is concentrated by centrifugation and
then added to the fermenter. A sterile glucose feed of 500 g/L
glucose in DI water is used intermittently during the production
phase of the experiment at time points greater than 12 h to
maintain glucose concentration in the fermenter of about 30 g/L or
above.
[0462] The fermenter vessel is attached by tubing to a smaller 400
mL fermenter vessel that serves as a flash tank and is operated in
a recirculation loop with the fermenter. The volume in the flash
tank is approximately 100 mL and the hydraulic retention time is
about 10 minutes. Heat and vacuum are applied to the flash tank.
The vacuum level applied to the flash tank is initially set at
about 45 mBar and the flash tank is set at about 36.degree. C.
These parameters are adjusted to maintain approximately 6-10 g/L
isobutanol in the fermenter throughout the experiment. Generally,
the vacuum ranges from about 30-100 mBar and the flash tank
temperature ranges from 34.degree. C. to 36.degree. C. throughout
the experiment. Vapor from the heated flash tank is condensed into
a collection vessel as distillate. The fermentation broth is
continuously returned from the flash tank to the fermentation
vessel.
[0463] The distillate recovered in the experiment is strongly
enriched for isobutanol. Isobutanol forms an azeotrope with water
and usually leads to a two phase distillate: an isobutanol rich top
phase and an isobutanol lean bottom phase. Distillate samples are
analyzed by GC for isobutanol concentration. Isobutanol production
reaches a maximum with a total titer of greater than 50 g/L. The
percent theoretical yield is approximately 95%.
Example 53
[0464] Removal of the F' episome from GEVO1886 to generate a DNA
marker-free isobutanol producing biocatalyst: The F' episomal
plasmid present in biocatalyst strain GEVO1886 contains several
genes, including a copy of the lacI repressor as well as the Tn10
operon, which contains a DNA marker for resistance to the
antibiotic tetracycline and simultaneously confers sensitivity to
fusaric acid. GEVO1886 contains no other DNA markers, neither on
the chromosome nor on a plasmid. The sensitivity to fusaric acid
will be exploited as a counter-selectable method to obtain a
variant of GEVO1886 that is fusaric acid-resistant (Fus.sup.R) and
tetracycline-sensitive (Tc.sup.S) and thus has lost the F' plasmid
and has the tetracycline DNA marker removed. Loss of the plasmid is
confirmed by PCR using F' plasmid-specific primer pairs.
[0465] Counter-selection against F' plasmid-containing cells on
fusaric acid plate. Fusaric acid-containing plates are prepared by
combining, in a first flask: 12 g Agar, 4 g Tryptone, 4 g Yeast
Extract, 40 mg Chlortetracycline, and 400 mL water. In a second
flask, 8 g of NaCl and 8 g of NaH.sub.2PO.sub.4 are dissolved in
400 mL water. The two flasks are autoclaved (20 minutes) and are
allowed to cool to approximately 45.degree. C. 9.6 mg of fusaric
acid are dissolved in 0.5 mL dimethylformamide and added to the
first flask. 4 mL of 20 mM ZnCl.sub.2 are added to the second
flask. The contents of the two flasks are mixed together well and
poured into sterile plates (approximately 30 mL/plate). The plates
are used within 36 hours of being poured.
[0466] GEVO1886 containing an F' plasmid carrying Tn10 [Tc.sup.R]
is grown overnight in LB liquid media containing tetracycline (at a
final concentration of 5 .mu.g/mL) or anhydrous tetracycline (aTc)
at a final concentration of 0.1 .mu.g/mL, to induce expression of
the tetracycline-resistance cassette. Following overnight growth,
0.1 mL each of a 10.sup.-6, 10.sup.-7, 10.sup.-8, and 10.sup.-9
dilutions of the dense overnight culture are plated onto the
fusaric acid plates and incubated at 42.degree. C. until colonies
appear, approximately 36 hours later. Colonies that arise are
patched onto LB plates and grown at 37.degree. C. until patches of
cells are visible on the plates. The patches are then replica
plated onto LB plates containing either tetracycline (15 .mu.g/mL
final concentration) or fusaric acid (as described, above) and
grown at 37.degree. C. until cells grow to confirm the, Fus.sup.R
and Tc.sup.S phenotypes. Cells that are Fus.sup.R, Tc.sup.S are
likely to be F' plasmid cured and are the desired phenotype.
Patches on tetracycline plates may not grow.
[0467] Fus.sup.R Tc.sup.S colonies, likely to be F' plasmid cured,
are then screened by PCR for the presence of three distinct regions
of the F plasmid. This technique will confirm the presence or loss
of the F plasmid in each colony. The PCR primers used are listed
below in Table 38.
[0468] Table 38 summarizes the sequences of PCR primers that may be
used to confirm presence or absence of the F' plasmid:
TABLE-US-00035 PRIMER # Primer Name Primer Sequence Notes 1278
[1278]F' plasmid Gtgaaaacgcaggttaagctggctta With 1279, OriV Ori2
CHECK FOR gc (SEQ ID NO: 22) (Rep ORI 2) of F' plasmid. 530 bp
product 1279 [1279]F' plasmid ATACTGTTATCTGGCTTTTAGTAAGC OrI2 CHECK
REV C (SEQ ID NO: 23) 1280 [1280]F' plasmid
Gacataacataagctggagcaggtag With 1281, Rep ORI1 CHECK FOR (SEQ ID
NO: 24) ORI 1 of F' plasmid. 1165 bp product 1281 [1281]F' plasmid
TACAACCTGTGGCGCTGATGCGTC ORI1 CHECK REV (SEQ ID NO: 25) 1282
[1282]F' plasmid Caggagcctgtgtagcgtttatagg With 1283, Rep ORI3
CHECK FOR (SEQ ID NO: 26) ORI 1 of F' plasmid. 790 bp product 1283
[1283]F' plasmid TCATGTTCCTGTAGGGTGCCATCAG ORI3 CHECK REV (SEQ ID
NO: 27)
[0469] For templates, a small amount of the cells from each colony
are used in several typical colony PCR reactions. Only those
colonies which fail to give any signal for all three primer sets in
a reaction, where the same cocktail mix gave (1) positive,
correct-sized product for the parental F' strain as template, and
(2) give no product for no-template-added control samples, are
deemed correct as F'-cured strains. An F' plasmid cured strain is
selected, which is also tetracycline marker or DNA marker free, and
named GEVO1948. GEVO1948 is contacted with an appropriate
fermentation medium containing glucose, under the appropriate
conditions, and isobutanol is produced.
Example 54
[0470] Comparison of Improved Biocatalysts Provided Herein to a
Parental Strain SA237 for productivity, titer and yield: GEVO1530
and GEVO1780 are modified bacterial biocatalysts that contain genes
on two plasmids which encode a pathway of enzymes that convert
pyruvate into isobutanol. When the biocatalysts GEVO1530 and
GEVO1780 were contacted with glucose in a medium suitable for
growth of the biocatalyst, at about 30.degree. C., the biocatalysts
produced isobutanol from the glucose. Parental strain SA237 is a
biocatalyst described previously (see e.g., WO 2008/098227,
entitled "BIOFUEL PRODUCTION BY RECOMBINANT MICROORGANISMS" and
incorporated herein by reference). Two 400 mL DasGip fermenter
vessels containing 200 mL each of modified M9 medium comprising of
85 g/L glucose, 20 g/L yeast extract, 20 .mu.M ferric citrate, 5.72
mg/L H.sub.3BO.sub.3, 3.62 mg/L MnCl.sub.2.4H.sub.2O, 0.444 mg/L
ZnSO.sub.4.7H.sub.2O, 0.78 mg/L Na.sub.2MnO.sub.4.2H.sub.2O, 0.158
mg/L CuSO.sub.4.5H.sub.2O, 0.0988 mg/L CoCl.sub.2.6H.sub.2O,
NaHPO.sub.4 6.0 g/L, KH.sub.2PO.sub.4 3.0 g/L, NaCl 0.5 g/L,
NH.sub.4Cl 2.0 g/L, MgSO.sub.4 0.0444 g/L and CaCl.sub.2 0.00481
g/L were inoculated with GEVO1780, GEVO1530, or SA237 cells from
frozen stocks. The vessels were attached to a computer control
system to monitor and control pH at 6.5 through addition of base,
temperature at about 30.degree. C., dissolved oxygen, and
agitation. The vessels were agitated, with a minimum agitation of
300 rpm and agitation was varied to maintain a dissolved oxygen
content of about 50% using a 12 sL/h air sparge until the
OD.sub.600 was about 1.0. The vessels were then induced with 0.1 mM
IPTG. The vessels were operated under these conditions for about 12
hours. At about 12 hours, the contents of the fermenter vessels
were then poured into 500 ml sterile graduated plastic bottles and
centrifuged for 20 minutes at 4500 rpm. The cells were resuspended
in 50 ml total volume of modified M9 medium to create concentrated
cells in medium. Duplicate 400 ml DasGip vessels containing 150 ml
each of modified M9 medium were inoculated with 50 ml of the
concentrated GEVO1530, GEVO1780, or SA237 cells in medium and then
induced with 0.1 mM IPTG. The vessels were attached to a computer
control system to monitor and control pH at 6.5 through addition of
base, temperature at about 30.degree. C., dissolved oxygen, and
agitation. Constant dissolved oxygen content of about 5% was
maintained using a 2.5 sL/h air sparge with variable agitation
automatically controlled from 300 to 1200 rpm. Continuous
measurement of each fermentor vessel off-gas by GC-MS analysis was
performed for oxygen, isobutanol, ethanol, carbon dioxide, and
nitrogen throughout the experiment. Samples were aseptically
removed from the fermenter vessel throughout the experiment and
used to measure OD600 and glucose concentration by HPLC, and
isobutanol concentration in the broth by GC. Results reported are
an average of duplicate fermentations. Volumetric productivity and
yield were calculated when the titer of isobutanol was between 1
g/L and 15 g/L. For SA237, isobutanol production reached a maximum
at around 21 hours with a titer of about 15.6 g/L and with a yield
of approximately 67% maximum theoretical. Volumetric productivity
of the SA237 fermentation, calculated when the titer of isobutanol
was between 1 g/L and 15 g/L, was about 1.45 g/L/h. For GEVO1530,
isobutanol production reached a maximum at around 24 hours with a
titer of about 19.5 g/L and with a yield of approximately 73%
maximum theoretical. Volumetric productivity of the GEVO1530
fermentation, calculated when the titer of isobutanol was between 1
g/L and 15 g/L, was about 1.51 g/L/h. For GEVO1780, isobutanol
production reached a maximum at around 21.5 hours with a titer of
about 21.3 g/L and with a yield of approximately 82% maximum
theoretical. Volumetric productivity of the GEVO1780 fermentation,
calculated when the titer of isobutanol was between 1 g/L and 15
g/L, was about 1.91 g/L/h.
Example 55
[0471] Comparison of Improved Biocatalysts Provided Herein to a
Parental Strain SA237--Improved biocatalysts produce less acetate
than SA237: GEVO1530 and GEVO1780 are modified bacterial
biocatalysts that contain genes on two plasmids which encode a
pathway of enzymes that convert pyruvate into isobutanol. When the
biocatalysts GEVO1530 and GEVO1780 were contacted with glucose in a
medium suitable for growth of the biocatalyst, at about 30.degree.
C., the biocatalysts produced isobutanol from the glucose. SA237 is
a biocatalyst described previously ((WO 2008/098227) BIOFUEL
PRODUCTION BY RECOMBINANT MICROORGANISMS). Overnight starter
cultures of GEVO1530, GEVO1780, or SA237 were started in 250 mL
Erlenmeyer flasks with cells from a fresh transformation plate or a
frozen glycerol stock with a 40 mL volume of EZ Rich medium
(Neidhardt, F. C., P. L. Bloch, and D. F. Smith. 1974. Culture
medium for enterobacteria. J Bacteriol. 119:736-47) containing 85
g/L glucose and 10 g/L yeast extract and at a culture OD600 of
about 0.05. The starter cultures were grown for approximately 14
hrs in a 37.degree. C. shaker at 250 rpm. Some of each starter
culture was then transferred to respective 400 mL DasGip fermenter
vessel containing about 200 mL of EZ Rich medium containing 85 g/L
glucose and 10 g/L yeast extract to achieve a 1% v/v inoculum. The
vessels were attached to a computer control system to monitor and
control pH at 6.5 through addition of base, temperature at about
30.degree. C., dissolved oxygen, and agitation. The vessels were
agitated, with a minimum agitation of 300 rpm and agitation was
varied to maintain a dissolved oxygen content of about 50% using a
12 sL/h air sparge until the OD600 was about 1.0. The vessels were
then induced with 0.1 mM IPTG. After continuing growth for
approximately 8-10 hrs, the dissolved oxygen content was decreased
to about 5% with 300 rpm minimum agitation and 2.5 sl/h airflow.
Measurement of each fermentor vessel off-gas by trapping in an
octanol bubble trap then measurement by GC was performed for
isobutanol and ethanol. Continuous measurement of off gas
concentrations of carbon dioxide and oxygen were also measured by a
DasGip off gas analyzer throughout the experiment. Samples were
aseptically removed from the fermenter vessel throughout the
experiment and used to measure OD600, glucose and acetate
concentration by HPLC, and isobutanol concentration in the broth by
GC. Table 39 summarizes the results for acetate and isobutanol
production in each strain. The strains GEVO1530 and GEVO1780
produce about 50% less of the undesired byproduct acetate than
SA237.
[0472] Table 39 summarizes the fermentation results of SA237
(parental), GEVO1530, and GEVO1780:
TABLE-US-00036 SA237 GEVO1530 GEVO1780 Replicate EFT Acetate iBuOH
Replicate EFT Acetate iBuOH Replicate EFT Acetate iBuOH # (h) (g/L)
(g/L) # (h) (g/L) (g/L) # (h) (g/L) (g/L) 1 0.0 0.12 0.01 1 0.0
0.15 0.00 1 0.0 0.21 0.10 1 3.0 0.18 0.01 1 3.0 0.21 0.01 1 4.0
0.14 0.22 1 5.0 0.32 0.05 1 5.0 0.34 0.04 1 5.0 ND 0.00 1 7.0 0.44
0.47 1 7.0 0.43 0.45 1 10.0 0.30 3.48 1 9.0 0.50 1.66 1 9.0 0.61
1.73 1 20.0 0.61 14.30 1 21.0 1.17 12.38 1 21.0 0.61 13.04 1 24.0
0.73 16.86 1 24.5 1.19 15.37 1 24.5 0.48 14.77 1 28.0 0.78 19.39 1
27.5 1.52 16.16 2 0.0 0.14 0.01 2 0.0 0.15 0.01 2 0.0 0.22 0.15 2
3.0 0.19 0.01 2 3.0 0.19 0.01 2 4.0 0.16 0.17 2 5.0 0.34 0.05 2 5.0
0.35 0.04 2 5.0 ND 0.00 2 7.0 0.46 0.47 2 7.0 0.47 0.43 2 10.0 0.30
3.53 2 9.0 0.63 1.84 2 9.0 0.49 1.71 2 20.0 0.60 14.83 2 21.0 1.28
14.13 2 21.0 0.47 11.94 2 24.0 0.74 17.57 2 24.5 1.15 16.25 2 24.5
0.60 13.29 2 28.0 0.80 14.25 2 27.5 1.37 17.47 2 27.5 0.70 14.18 2
30.0 0.69 19.34 2 31.0 1.67 18.50 2 31.0 0.65 15.27 2 48.0 0.92
20.78 2 47.0 1.40 18.64 2 47.0 0.66 16.73 Abbreviations used in
this table: ND, not determined; EFT, elapsed fermentation time in
hours; iBuOH, isobutanol
Example 56
[0473] Tolerance of GEVO Biocatalyst to pH change during
fermentation: Biocatalysts provided herein are operable under a
wide range of pH units: GEVO1821 is a modified bacterial
biocatalyst that contains genes on two plasmids which encode a
pathway of enzymes that convert pyruvate into isobutanol. When the
biocatalyst GEVO1821 was contacted with glucose in a medium
suitable for growth of the biocatalyst, at about 30.degree. C., the
biocatalysts produced isobutanol from the glucose. The strain
GEVO1821 was used in two different fermentations. Fermentation 1
was done in screw cap flasks without pH control. Fermentation 2 was
done in a fermenter with pH control. For Fermentation 1 an
overnight starter culture of GEVO1821 was inoculated from a fresh
transformation plate in 14 mL culture tubes with a 3 mL volume of
LB medium. The starter culture was grown for approximately 14 h at
37.degree. C. and 250 rpm. The starter culture was then used to
inoculate 250 mL screw cap flasks containing about 20 mL of M9
minimal medium according to Miller (Jeffrey H. Miller. A Short
Course in Bacterial Genetics: A Laboratory Manual and Handbook for
Escherichia coli and Related Bacteria. Published by CSHL Press,
1992, ISBN 0879693495), supplemented with 10 g/L yeast extract, 10
.mu.M ferric citrate and 1.times. trace metals, containing 40 g/L
of glucose and with a pH of 7. The flasks were inoculated to a
starting OD600 of about 0.1. The cultures were incubated at
37.degree. C. and 250 rpm until the OD.sub.600 of the cultures
reached between 0.6 and 0.8. At this time the cultures were induced
with the addition of IPTG to a final concentration of 1 mM. The
induced cultures were incubated at 30.degree. C. and 250 rpm until
24 h past inoculation. At the 24 h timepoint samples were taken
from the cultures and these samples were analyzed for OD.sub.600,
pH, glucose and metabolite concentrations by HPLC, and isobutanol
concentration by GC.
[0474] For Fermentation 2, a 500 mL Erlenmeyer flask containing 40
mL of modified M9 medium containing twice the standard
concentration of trace elements, MgSO.sub.4, CaCl.sub.2, ferric
citrate and 20 g/L yeast extract at pH 6.5 (2.times.M9) (see Table
40 below) was inoculated with GEVO 1821 from a frozen glycerol
stock to a culture OD.sub.600 of about 0.1. The starter culture was
grown for approximately 16 h in a 30.degree. C. shaker at 250 rpm.
Some of the starter culture was then transferred to two 400 mL
DasGip fermenter vessels containing about 200 mL each of 2.times.M9
medium to achieve an OD.sub.600 of about 0.1.
[0475] The vessels were attached to a computer control system to
monitor and control pH at 6.5 through addition of base, temperature
at about 30.degree. C., dissolved oxygen, and agitation. The
vessels were agitated, with a minimum agitation of 200 rpm and
agitation was varied to maintain a dissolved oxygen content of
about 50% using a 12 sL/h air sparge until the OD.sub.600 was about
0.8-1.0. The vessels were then induced with 0.1 mM IPTG. After
continuing growth for approximately 6-8 h, the dissolved oxygen
content was decreased to about 5% with 200 rpm minimum agitation
and 2.5 sl/h airflow. Isobutanol and ethanol in the off-gas of each
fermentor vessel were trapped in an octanol bubble trap and then
measured by GC. Samples were aseptically removed from the fermenter
vessel at 24 h after inoculation to measure OD.sub.600, and
isobutanol concentration in the broth by GC. Samples were also
taken from the octanol bubble traps and these samples were analyzed
for isobutanol by GC. The pH of the two cultures in Fermentation 1
dropped from pH 7 at the time of inoculation to pH 5.5 at 24 h
after inoculation. The pH in the two fermenter vessels of
Fermentation 2 was held constant at pH 6.5 throughout the
fermentation. The strain GEVO1821 reached the same specific
productivity in both Fermentation 1 and Fermentation 2. Specific
productivities in the flasks of Fermentation 1 were 0.033 g/L/h/OD
and 0.034 g/L/h/OD respectively. Specific productivities in the
fermenter vessels of Fermentation 2 were 0.033 g/L/h/OD and 0.034
g/L/h/OD respectively. Strain GEVO1821 retained 100% of its
productivity despite a drop in pH of 1.5 units. This shows that
this biocatalyst is operable under a wide range of pH and tolerates
changes in the pH during fermentation.
[0476] Table 40 summarizes the ingredients for modified M9 media
termed "2.times.M9" that contains twice the normal amount of
magnesium sulfate, calcium chloride, trace metals and ferric
citrate. In addition to this, the yeast extract content has been
doubled from the usual 10 g/L to 20 g/L.
[0477] Table 40 summarizes the ingredients for modified M9 media
termed "2.times.M9":
TABLE-US-00037 A. M9 salts (Miller) (g/L) NaHPO.sub.4 6.0
KH.sub.2PO.sub.4 3.0 NaCl 0.5 NH.sub.4Cl 2.0 MgSO.sub.4 0.0444
CaCl.sub.2 0.00481 B. Trace Metals1 (mg/L) H.sub.3B0.sub.3 5.72
MnCl.sub.2.cndot.4H.sub.20 3.62 ZnSO.sub.4.cndot.7H.sub.20 0.444
Na.sub.2MoO.sub.4.cndot.2H.sub.20 0.78 CuSO.sub.4.cndot.5H.sub.20
0.158 CoCl.sub.2.cndot.6H.sub.20 0.0988 C. Others Ferric Citrate 20
.mu.M Yeast Extract 20 g/L Glucose 85 g/L 1Handbook of Media for
Environmental Microbiology By Ronald M. Atlas. 1995. University of
Chicago Press. p. 68.
Example 57
[0478] Anaerobic batch fermentation of GEVO1948 (Prophetic). This
example illustrates that an engineered microorganism with no DNA
markers and with DNA consisting of natural DNA produces a biofuel
in a batch fermentation at a productivity of about 0.4 g/L/h, a
titer of about 21 g/L/h, and a yield of about 88% of
theoretical.
[0479] An overnight culture is started in a 250 mL Erlenmeyer flask
with GEVO1948 cells from a freshly streaked plate with a 40 mL
volume of M9 medium (Miller, J. H. A Short Course in Bacterial
Genetics: A laboratory manual and handbook for Escherichia coli and
related bacteria. 1992. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.) containing 85 g/L glucose, 20 g/L yeast
extract, 20 .mu.M ferric citrate, trace metals, an additional 1 g/L
NH.sub.4Cl, an additional 1 mM MgSO.sub.4 and an additional 1 mM
CaCl.sub.2 and at a culture OD.sub.600, of about 0.05. The starter
culture is grown for approximately 14 hours at 30.degree. C. at 250
rpm.
[0480] Some of the starter culture is then transferred to a 400 mL
DasGip fermenter vessel containing about 200 mL of M9 medium
(Miller, J. H. A Short Course in Bacterial Genetics: A laboratory
manual and handbook for Escherichia coli and related bacteria.
1992. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.
N.Y.) containing 85 g/L glucose, 20 g/L yeast extract, 20 M ferric
citrate, trace metals, an additional 1 g/L NH.sub.4Cl, an
additional 1 mM MgSO4 and an additional 1 mM CaCl.sub.2 to achieve
a starting cell concentration by optical density at 600 nm of about
0.1. The fermenter vessel is attached to a computer control system
to monitor and control pH at 6.5 through addition of base,
temperature at about 30'C, dissolved oxygen, and agitation. The
vessel is agitated, with a minimum agitation of 200 rpm and
agitation is varied to maintain a dissolved oxygen content of about
50% using a 12 sL/h air sparge until the OD.sub.600 is about
1.0.
[0481] After continuing growth for 3 hours, the dissolved oxygen
content is decreased to 0% with 200 rpm agitation and 2.5 sL/h
sparge with nitrogen (N.sub.2) gas. Measurement of the fermenter
vessel off-gas for isobutanol and ethanol is performed throughout
the experiment by passage of the off-gas stream through a mass
spectrometer. Continuous measurement of off-gas concentrations of
carbon dioxide and oxygen are also measured by a DasGip off-gas
analyzer throughout the experiment. Samples are aseptically removed
from the fermenter vessel throughout the experiment and used to
measure OD.sub.600, glucose concentration by HPLC, and isobutanol
concentration in the broth by GC.
[0482] Isobutanol production reaches a maximum titer of greater
than 10 g/L at a productivity of greater than 0.2 g/L/h. Yield of
the fermentation is greater than 85% of theoretical. This example
demonstrates that a biocatalyst that contains no DNA markers and a
biocatalyst that contains DNA consisting of natural DNA produces
isobutanol at titer, rate, and yield.
[0483] The entirety of each patent, patent application, publication
and document referenced herein hereby is incorporated by reference.
Citation of the above patents, patent applications, publications
and documents is not an admission that any of the foregoing is
pertinent prior art, nor does it constitute any admission as to the
contents or date of these publications or documents.
[0484] Singular forms "a", "an", and "the" include plural reference
unless the context clearly dictates otherwise. The term "or" is not
meant to be exclusive to one or the terms it designates. For
example, as it is used in a phrase of the structure "A or B" may
denote A alone, B alone, or both A and B.
[0485] Unless defined otherwise, all technical and scientific terms
used herein have the same meanings as commonly understood by one of
ordinary skill in the art to which this invention belongs.
Abbreviations used herein and their meanings include: "s" means
second(s), "min" means minute(s), "h" or "hr" or "hrs" means
hour(s), "psi" means pounds per square inch, "nm" means nanometers,
"d" means day(s), ".mu.L" means microliter(s), "mL" means
milliliter(s), "L" means liter(s), "sL/h" means standard liters per
hour, a standard liter is a volume equal to a liter at standard
temperature and pressure, "mm" millimeter(s), "nm" means
nanometer(s), "mM" means millimolar, ".mu.M" means micromolar, "g"
means gram(s), "sL/h" means standard Liters per hour, ".mu.g" means
microgram(s), "OD" means optical density, "OD600" means optical
density measured at a wavelength of 600 nm, "% w/v" means
weight/volume percent, "rpm" or "RPM" means revolutions per minute,
"% v/v" volume/volume percent, "IPTG" means
isopropyl-b-D-thiogalactopyranoside, "HPLC" means high performance
liquid chromatography and "GC" means gas chromatography.
[0486] Although any methods and systems similar or equivalent to
those described herein can be used in the practice or testing of
the present invention, the methods, systems, and materials are now
described. All publications mentioned herein are incorporated
herein by reference for the purpose of describing and disclosing
the processes, compositions, and methodologies that are reported in
the publications which might be used in connection with the
invention. Nothing herein is to be construed as an admission that
the invention is not entitled to antedate such disclosure by virtue
of prior invention.
[0487] The foregoing detailed description has set forth various
embodiments of the systems and/or methods via the use of block
diagrams, flowcharts, and/or examples. Insofar as such block
diagrams, flowcharts, and/or examples contain one or more functions
and/or operations, it will be understood by those within the art
that each function and/or operation within such block diagrams,
flowcharts, or examples can be implemented, individually and/or
collectively, by a wide range of hardware. It will further be
understand that method steps may be presented in a particular order
in flowcharts, and/or examples herein, but are not necessarily
limited to being performed in the presented order. For example,
steps may be performed simultaneously, or in a different order than
presented herein, and such variations will be apparent to one of
skill in the art in light of this disclosure.
[0488] In a general sense, those skilled in the art will recognize
that the various embodiments described herein can be implemented,
individually and/or collectively, by various types of systems
having a wide range of components.
[0489] One skilled in the art will recognize that the herein
described components (e.g., steps), devices, and objects and the
discussion accompanying them are used as examples for the sake of
conceptual clarity and that various configuration modifications are
within the skill of those in the art. Consequently, as used herein,
the specific exemplars set forth and the accompanying discussion
are intended to be representative of their more general classes. In
general, use of any specific exemplar herein is also intended to be
representative of its class, and the non-inclusion of such specific
components (e.g., steps), devices, and objects herein should not be
taken as indicating that limitation is desired.
[0490] With respect to the use of substantially any plural and/or
singular terms herein, those having skill in the art can translate
from the plural to the singular and/or from the singular to the
plural as is appropriate to the context and/or application. The
various singular/plural permutations are not expressly set forth
herein for sake of clarity.
[0491] While particular aspects of the present subject matter
described herein have been shown and described, it will be apparent
to those skilled in the art that, based upon the teachings herein,
changes and modifications may be made without departing from the
subject matter described herein and its broader aspects and,
therefore, the appended claims are to encompass within their scope
all such changes and modifications as are within the true spirit
and scope of the subject matter described herein. Furthermore, it
is to be understood that the invention is defined by the appended
claims. It will be understood by those within the art that, in
general, terms used herein, and especially in the appended claims
(e.g., bodies of the appended claims) are generally intended as
"open" terms (e.g., the term "including" should be interpreted as
"including but not limited to," the term "having" should be
interpreted as "having at least," the term "includes" should be
interpreted as "includes but is not limited to," etc.). It will be
further understood by those within the art that if a specific
number of an introduced claim recitation is intended, such an
intent will be explicitly recited in the claim, and in the absence
of such recitation no such intent is present. For example, as an
aid to understanding, the following appended claims may contain
usage of the introductory phrases "at least one" and "one or more"
to introduce claim recitations. However, the use of such phrases
should not be construed to imply that the introduction of a claim
recitation by the indefinite articles "a" or "an" limits any
particular claim containing such introduced claim recitation to
inventions containing only one such recitation, even when the same
claim includes the introductory phrases "one or more" or "at least
one" and indefinite articles such as "a" or "an" (e.g., "a" and/or
"an" should typically be interpreted to mean "at least one" or "one
or more"); the same holds true for the use of definite articles
used to introduce claim recitations. In addition, even if a
specific number of an introduced claim recitation is explicitly
recited, those skilled in the art will recognize that such
recitation should typically be interpreted to mean at least the
recited number (e.g., the bare recitation of "two recitations,"
without other modifiers, typically means at least two recitations,
or two or more recitations). Furthermore, in those instances where
a convention analogous to "at least one of A, B, and C, etc." is
used, in general such a construction is intended in the sense one
having skill in the art would understand the convention (e.g., "a
system having at least one of A, B, and C" would include but not be
limited to systems that have A alone, B alone, C alone, A and B
together, A and C together, B and C together, and/or A, B, and C
together, etc.). In those instances where a convention analogous to
"at least one of A, B, or C, etc." is used, in general such a
construction is intended in the sense one having skill in the art
would understand the convention (e.g., "a system having at least
one of A, B, or C" would include but not be limited to systems that
have A alone, B alone, C alone, A and B together, A and C together,
B and C together, and/or A, B, and C together, etc.). It will be
further understood by those within the art that virtually any
disjunctive word and/or phrase presenting two or more alternative
terms, whether in the description, claims, or drawings, should be
understood to contemplate the possibilities of including one of the
terms, either of the terms, or both terms. For example, the phrase
"A or B` will be understood to include the possibilities of "A" or
"B" or "A and B."
[0492] While various aspects and embodiments have been disclosed
herein, other aspects and embodiments will be apparent to those
skilled in the art. The various aspects and embodiments disclosed
herein are for purposes of illustration and are not intended to be
limiting, with the true scope and spirit being indicated by the
following claims.
Sequence CWU 1
1
35162DNAArtificial SequenceSynthetic primer 1gttatctagt tgtgcaaaac
atgctaatgt agccaccaaa tcgtgtaggc tggagctgct 60tc 62261DNAArtificial
SequenceSynthetic primer 2gcagtttcac cttctacata atcacgaccg
tagtaggtat cattccgggg atccgtcgac 60c 61365DNAArtificial
SequenceSynthetic primer 3ttggctgaac ggtagggtat attgtcacca
cctgttggaa tgttggtgta ggctggagct 60gcttc 65465DNAArtificial
SequenceSynthetic primer 4gtatccagca taccttccag cgcgttctgt
tcaaatgcgc tcaggattcc ggggatccgt 60cgacc 65565DNAArtificial
SequenceSynthetic primer 5cttaacccgc aacagcaata cgtttcatat
ctgtcatata gccgcattcc ggggatccgt 60cgacc 65660DNAArtificial
SequenceSynthetic primer 6caccgagatc ctggtcaaag tgggcgacaa
agttgaagcc gtgtaggctg gagctgcttc 60760DNAArtificial
SequenceSynthetic primer 7gcggtggtcg aaggagagag aaatcggcag
catcagacgc attccgggga tccgtcgacc 60845DNAArtificial
SequenceSynthetic primer 8gtcggtgaac gctctcctga gtagggtgta
ggctggagct gcttc 45969DNAArtificial SequenceSynthetic primer
9cacaacatca cgaggaatca ccatggctaa ctacttcaat acaccacgag gccctttcgt
60cttcacctc 691067DNAArtificial SequenceSynthetic primer
10gttatctagt tgtgcaaaac atgctaatgt agccaccaaa tccacgaggc cctttcgtct
60tcacctc 671130DNAArtificial SequenceSynthetic primer 11ttaaggtacc
atgcgaattg gcataccaag 301231DNAArtificial SequenceSynthetic primer
12taatgtcgac gcaatcctga aagctctgta a 311342DNAArtificial
SequenceSynthetic primer 13gctcactcaa aggcggtaat acgtgtaggc
tggagctgct tc 421442DNAArtificial SequenceSynthetic primer
14gaagcagctc cagcctacac gtattaccgc ctttgagtga gc
421565DNAArtificial SequenceSynthetic primer 15ccattctgtt
gcttttatgt ataagaacag gtaagcccta ccatgattcc ggggatccgt 60cgacc
651664DNAArtificial SequenceSynthetic primer 16ccgataggct
tccgccatcg tcgggtagtt aaaggtggtg ttgagtgtag gctggagctg 60cttc
641770DNAArtificial SequenceSynthetic primer 17gcctttattg
tacgcttttt actgtacgat ttcagtcaaa tctaacacga ggccctttcg 60tcttcacctc
701865DNAArtificial SequenceSynthetic primer 18aagtacgcag
taaataaaaa atccacttaa gaaggtaggt gttacattcc ggggatccgt 60cgacc
651965DNAArtificial SequenceSynthetic primer 19ccattctgtt
gcttttatgt ataagaacag gtaagcccta ccatggagaa ttgtgagcgg 60ataac
652042DNAArtificial SequenceSynthetic primer 20gcaatcctga
aagctctgta acattccggg gatccgtcga cc 422142DNAArtificial
SequenceSynthetic primer 21ggtcgacgga tccccggaat gttacagagc
tttcaggatt gc 422228DNAArtificial SequenceSynthetic primer
22gtgaaaacgc aggttaagct ggcttagc 282327DNAArtificial
SequenceSynthetic primer 23atactgttat ctggctttta gtaagcc
272426DNAArtificial SequenceSynthetic primer 24gacataacat
aagctggagc aggtag 262524DNAArtificial SequenceSynthetic primer
25tacaacctgt ggcgctgatg cgtc 242625DNAArtificial SequenceSynthetic
primer 26caggagcctg tgtagcgttt atagg 252725DNAArtificial
SequenceSynthetic primer 27tcatgttcct gtagggtgcc atcag
25285336DNAArtificial SequenceSynthetic polynucleotide 28taagaaacca
ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt 60cgtcttcacc
tcgagaattg tgagcggata acaattgaca ttgtgagcgg ataacaagat
120actgagcaca tcagcaggac gcactgaccg aattcattaa agaggagaaa
ggtacaatgt 180tgacaaaagc aacaaaagaa caaaaatccc ttgtgaaaaa
cagaggggcg gagcttgttg 240ttgattgctt agtggagcaa ggtgtcacac
atgtatttgg cattccaggt gcaaaaattg 300atgcggtatt tgacgcttta
caagataaag gacctgaaat tatcgttgcc cggcacgaac 360aaaacgcagc
attcatggcc caagcagtcg gccgtttaac tggaaaaccg ggagtcgtgt
420tagtcacatc aggaccgggt gcctctaact tggcaacagg cctgctgaca
gcgaacactg 480aaggagaccc tgtcgttgcg cttgctggaa acgtgatccg
tgcagatcgt ttaaaacgga 540cacatcaatc tttggataat gcggcgctat
tccagccgat tacaaaatac agtgtagaag 600ttcaagatgt aaaaaatata
ccggaagctg ttacaaatgc atttaggata gcgtcagcag 660ggcaggctgg
ggccgctttt gtgagctttc cgcaagatgt tgtgaatgaa gtcacaaata
720cgaaaaacgt gcgtgctgtt gcagcgccaa aactcggtcc tgcagcagat
gatgcaatca 780gtgcggccat agcaaaaatc caaacagcaa aacttcctgt
cgttttggtc ggcatgaaag 840gcggaagacc ggaagcaatt aaagcggttc
gcaagctttt gaaaaaggtt cagcttccat 900ttgttgaaac atatcaagct
gccggtaccc tttctagaga tttagaggat caatattttg 960gccgtatcgg
tttgttccgc aaccagcctg gcgatttact gctagagcag gcagatgttg
1020ttctgacgat cggctatgac ccgattgaat atgatccgaa attctggaat
atcaatggag 1080accggacaat tatccattta gacgagatta tcgctgacat
tgatcatgct taccagcctg 1140atcttgaatt gatcggtgac attccgtcca
cgatcaatca tatcgaacac gatgctgtga 1200aagtggaatt tgcagagcgt
gagcagaaaa tcctttctga tttaaaacaa tatatgcatg 1260aaggtgagca
ggtgcctgca gattggaaat cagacagagc gcaccctctt gaaatcgtta
1320aagagttgcg taatgcagtc gatgatcatg ttacagtaac ttgcgatatc
ggttcgcacg 1380ccatttggat gtcacgttat ttccgcagct acgagccgtt
aacattaatg atcagtaacg 1440gtatgcaaac actcggcgtt gcgcttcctt
gggcaatcgg cgcttcattg gtgaaaccgg 1500gagaaaaagt ggtttctgtc
tctggtgacg gcggtttctt attctcagca atggaattag 1560agacagcagt
tcgactaaaa gcaccaattg tacacattgt atggaacgac agcacatatg
1620acatggttgc attccagcaa ttgaaaaaat ataaccgtac atctgcggtc
gatttcggaa 1680atatcgatat cgtgaaatat gcggaaagct tcggagcaac
tggcttgcgc gtagaatcac 1740cagaccagct ggcagatgtt ctgcgtcaag
gcatgaacgc tgaaggtcct gtcatcatcg 1800atgtcccggt tgactacagt
gataacatta atttagcaag tgacaagctt ccgaaagaat 1860tcggggaact
catgaaaacg aaagctctct aggtcgacga ggagacaaca ttatggcgaa
1920ttatttcaac actctgaacc tgcgtcaaca actggcgcaa ctgggtaagt
gccgtttcat 1980gggtcgtgac gagtttgcgg acggtgcttc ttatctgcaa
ggcaagaagg ttgttattgt 2040tggttgcggt gcgcaaggcc tgaatcaagg
tctgaatatg cgcgacagcg gcctggacat 2100tagctatgcg ctgcgcaagg
aggctatcgc ggaaaaacgt gctagctggc gcaaggctac 2160tgagaacggc
ttcaaggttg gcacctatga ggagctgatt ccgcaagctg acctggttat
2220caatctgacc ccagataaac aacatagcga cgttgttcgt actgttcaac
cgctgatgaa 2280ggatggtgct gctctgggtt atagccacgg ctttaacatt
gttgaggtag gtgaacaaat 2340tcgcaaggac attactgttg ttatggtggc
tccaaagtgt ccgggtactg aggttcgcga 2400ggaatataag cgcggttttg
gtgttccaac cctgatcgcg gtgcatccag agaatgaccc 2460aaagggtgag
ggtatggcta tcgcgaaggc gtgggctgcg gcgactggcg gccatcgcgc
2520tggcgttctg gagagcagct ttgtggctga ggttaagagc gatctgatgg
gtgaacagac 2580tattctgtgt ggtatgctgc aagcgggtag cctgctgtgt
tttgataaac tggttgagga 2640gggcactgac ccggcgtatg cggagaagct
gatccaattt ggctgggaga ctattactga 2700ggcgctgaag caaggtggta
ttactctgat gatggatcgc ctgagcaatc cagctaagct 2760gcgcgcgtac
gctctgagcg agcaactgaa ggaaattatg gcaccgctgt ttcaaaagca
2820catggatgat atcattagcg gtgagtttag cagcggcatg atggctgatt
gggcgaatga 2880cgacaaaaag ctgctgactt ggcgcgagga aactggtaag
actgctttcg agactgctcc 2940acaatacgag ggtaagattg gtgaacaaga
atattttgac aagggtgttc tgatgatcgc 3000tatggttaag gctggtgtgg
agctggcttt tgagactatg gttgacagcg gtattatcga 3060ggaaagcgcg
tactacgaga gcctgcatga actgccactg atcgcgaata ctattgcgcg
3120caaacgcctg tatgagatga atgttgtgat tagcgacact gcggaatatg
gcaattacct 3180gtttagctat gcgtgcgttc cactgctgaa gccattcatg
gcggaactgc agccaggtga 3240tctgggcaag gcgatcccag agggtgctgt
tgacaatggt cagctgcgcg acgttaatga 3300ggctatccgt tctcacgcta
tcgaacaagt tggcaaaaag ctgcgtggtt acatgaccga 3360catgaagcgc
atcgcggtgg ctggctaacc tagggcgttc ggctgcggcg agcggtatca
3420gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc
aggaaagaac 3480atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa
aggccgcgtt gctggcgttt 3540ttccataggc tccgcccccc tgacgagcat
cacaaaaatc gacgctcaag tcagaggtgg 3600cgaaacccga caggactata
aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 3660tctcctgttc
cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc
3720gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt
cgttcgctcc 3780aagctgggct gtgtgcacga accccccgtt cagcccgacc
gctgcgcctt atccggtaac 3840tatcgtcttg agtccaaccc ggtaagacac
gacttatcgc cactggcagc agccactggt 3900aacaggatta gcagagcgag
gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 3960aactacggct
acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc
4020ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg
tagcggtggt 4080ttttttgttt gcaagcagca gattacgcgc agaaaaaaag
gatctcaaga agatcctttg 4140atcttttcta cggggtctga cgctcagtgg
aacgaaaact cacgttaagg gattttggtc 4200atgactagtg cttggattct
caccaataaa aaacgcccgg cggcaaccga gcgttctgaa 4260caaatccaga
tggagttctg aggtcattac tggatctatc aacaggagtc caagcgagct
4320cgtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc
tcagcgatct 4380gtctatttcg ttcatccata gttgcctgac tccccgtcgt
gtagataact acgatacggg 4440agggcttacc atctggcccc agtgctgcaa
tgataccgcg agacccacgc tcaccggctc 4500cagatttatc agcaataaac
cagccagccg gaagggccga gcgcagaagt ggtcctgcaa 4560ctttatccgc
ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc
4620cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg
tcacgctcgt 4680cgtttggtat ggcttcattc agctccggtt cccaacgatc
aaggcgagtt acatgatccc 4740ccatgttgtg caaaaaagcg gttagctcct
tcggtcctcc gatcgttgtc agaagtaagt 4800tggccgcagt gttatcactc
atggttatgg cagcactgca taattctctt actgtcatgc 4860catccgtaag
atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt
4920gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc
gcgccacata 4980gcagaacttt aaaagtgctc atcattggaa aacgttcttc
ggggcgaaaa ctctcaagga 5040tcttaccgct gttgagatcc agttcgatgt
aacccactcg tgcacccaac tgatcttcag 5100catcttttac tttcaccagc
gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa 5160aaaagggaat
aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt
5220attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa
tgtatttaga 5280aaaataaaca aataggggtt ccgcgcacat ttccccgaaa
agtgccacct gacgtc 5336293644DNAArtificial SequenceSynthetic
polynucleotide 29taagaaacca ttattatcat gacattaacc tataaaaata
ggcgtatcac gaggcccttt 60cgtcttcacc tcgagaattg tgagcggata acaattgaca
ttgtgagcgg ataacaagat 120actgagcaca tcagcaggac gcactgaccg
aattcattag tcgacattat gcggccgcgg 180atccataagg aggattaatt
aagacttccc gggtgatccc atggtacgcg tgctagaggc 240atcaaataaa
acgaaaggct cagtcgaaag actgggcctt tcgttttatc tgttgtttgt
300cggtgaacgc tctcctgagt aggacaaatc cgccgcccta gacctagcta
gggtacgggt 360tttgctgccc gcaaacgggc tgttctggtg ttgctagttt
gttatcagaa tcgcagatcc 420ggcttcagcc ggtttgccgg ctgaaagcgc
tatttcttcc agaattgcca tgattttttc 480cccacgggag gcgtcactgg
ctcccgtgtt gtcggcagct ttgattcgat aagcagcatc 540gcctgtttca
ggctgtctat gtgtgactgt tgagctgtaa caagttgtct caggtgttca
600atttcatgtt ctagttgctt tgttttactg gtttcacctg ttctattagg
tgttacatgc 660tgttcatctg ttacattgtc gatctgttca tggtgaacag
ctttaaatgc accaaaaact 720cgtaaaagct ctgatgtatc tatctttttt
acaccgtttt catctgtgca tatggacagt 780tttccctttg atatctaacg
gtgaacagtt gttctacttt tgtttgttag tcttgatgct 840tcactgatag
atacaagagc cataagaacc tcagatcctt ccgtatttag ccagtatgtt
900ctctagtgtg gttcgttgtt tttgcgtgag ccatgagaac gaaccattga
gatcatgctt 960actttgcatg tcactcaaaa attttgcctc aaaactggtg
agctgaattt ttgcagttaa 1020agcatcgtgt agtgtttttc ttagtccgtt
acgtaggtag gaatctgatg taatggttgt 1080tggtattttg tcaccattca
tttttatctg gttgttctca agttcggtta cgagatccat 1140ttgtctatct
agttcaactt ggaaaatcaa cgtatcagtc gggcggcctc gcttatcaac
1200caccaatttc atattgctgt aagtgtttaa atctttactt attggtttca
aaacccattg 1260gttaagcctt ttaaactcat ggtagttatt ttcaagcatt
aacatgaact taaattcatc 1320aaggctaatc tctatatttg ccttgtgagt
tttcttttgt gttagttctt ttaataacca 1380ctcataaatc ctcatagagt
atttgttttc aaaagactta acatgttcca gattatattt 1440tatgaatttt
tttaactgga aaagataagg caatatctct tcactaaaaa ctaattctaa
1500tttttcgctt gagaacttgg catagtttgt ccactggaaa atctcaaagc
ctttaaccaa 1560aggattcctg atttccacag ttctcgtcat cagctctctg
gttgctttag ctaatacacc 1620ataagcattt tccctactga tgttcatcat
ctgagcgtat tggttataag tgaacgatac 1680cgtccgttct ttccttgtag
ggttttcaat cgtggggttg agtagtgcca cacagcataa 1740aattagcttg
gtttcatgct ccgttaagtc atagcgacta atcgctagtt catttgcttt
1800gaaaacaact aattcagaca tacatctcaa ttggtctagg tgattttaat
cactatacca 1860attgagatgg gctagtcaat gataattact agtccttttc
ccgggagatc tgggtatctg 1920taaattctgc tagacctttg ctggaaaact
tgtaaattct gctagaccct ctgtaaattc 1980cgctagacct ttgtgtgttt
tttttgttta tattcaagtg gttataattt atagaataaa 2040gaaagaataa
aaaaagataa aaagaataga tcccagccct gtgtataact cactacttta
2100gtcagttccg cagtattaca aaaggatgtc gcaaacgctg tttgctcctc
tacaaaacag 2160accttaaaac cctaaaggct taagtagcac cctcgcaagc
tcgggcaaat cgctgaatat 2220tccttttgtc tccgaccatc aggcacctga
gtcgctgtct ttttcgtgac attcagttcg 2280ctgcgctcac ggctctggca
gtgaatgggg gtaaatggca ctacaggcgc cttttatgga 2340ttcatgcaag
gaaactaccc ataatacaag aaaagcccgt cacgggcttc tcagggcgtt
2400ttatggcggg tctgctatgt ggtgctatct gactttttgc tgttcagcag
ttcctgccct 2460ctgattttcc agtctgacca cttcggatta tcccgtgaca
ggtcattcag actggctaat 2520gcacccagta aggcagcggt atcatcaaca
ggcttacccg tcttactgtc cctagtgctt 2580ggattctcac caataaaaaa
cgcccggcgg caaccgagcg ttctgaacaa atccagatgg 2640agttctgagg
tcattactgg atctatcaac aggagtccaa gcgagctctc gaaccccaga
2700gtcccgctca gaagaactcg tcaagaaggc gatagaaggc gatgcgctgc
gaatcgggag 2760cggcgatacc gtaaagcacg aggaagcggt cagcccattc
gccgccaagc tcttcagcaa 2820tatcacgggt agccaacgct atgtcctgat
agcggtccgc cacacccagc cggccacagt 2880cgatgaatcc agaaaagcgg
ccattttcca ccatgatatt cggcaagcag gcatcgccat 2940gggtcacgac
gagatcctcg ccgtcgggca tgcgcgcctt gagcctggcg aacagttcgg
3000ctggcgcgag cccctgatgc tcttcgtcca gatcatcctg atcgacaaga
ccggcttcca 3060tccgagtacg tgctcgctcg atgcgatgtt tcgcttggtg
gtcgaatggg caggtagccg 3120gatcaagcgt atgcagccgc cgcattgcat
cagccatgat ggatactttc tcggcaggag 3180caaggtgaga tgacaggaga
tcctgccccg gcacttcgcc caatagcagc cagtcccttc 3240ccgcttcagt
gacaacgtcg agcacagctg cgcaaggaac gcccgtcgtg gccagccacg
3300atagccgcgc tgcctcgtcc tgcagttcat tcagggcacc ggacaggtcg
gtcttgacaa 3360aaagaaccgg gcgcccctgc gctgacagcc ggaacacggc
ggcatcagag cagccgattg 3420tctgttgtgc ccagtcatag ccgaatagcc
tctccaccca agcggccgga gaacctgcgt 3480gcaatccatc ttgttcaatc
atgcgaaacg atcctcatcc tgtctcttga tcagatcttg 3540atcccctgcg
ccatcagatc cttggcggca agaaagccat ccagtttact ttgcagggct
3600tcccaacctt accagagggc gccccagctg gcaattccga cgtc
3644306575DNAArtificial SequenceSynthetic polynucleotide
30taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt
60cgtcttcacc tcgagaattg tgagcggata acaattgaca ttgtgagcgg ataacaagat
120actgagcaca tcagcaggac gcactgaccg aattcattag tcgacaggag
aaaggtacta 180tgcgaattgg cataccaaga gaacggttaa ccaatgaaac
ccgtgttgca gcaacgccaa 240aaacagtgga acagctgctg aaactgggtt
ttaccgtcgc ggtagagagc ggcgcgggtc 300aactggcaag ttttgacgat
aaagcgtttg tgcaagcggg cgctgaaatt gtagaaggga 360atagcgtctg
gcagtcagag atcattctga aggtcaatgc gccgttagat gatgaaattg
420cgttactgaa tcctgggaca acgctggtga gttttatctg gcctgcgcag
aatccggaat 480taatgcaaaa acttgcggaa cgtaacgtga ccgtgatggc
gatggactct gtgccgcgta 540tctcacgcgc acaatcgctg gacgcactaa
gctcgatggc gaacatcgcc ggttatcgcg 600ccattgttga agcggcacat
gaatttgggc gcttctttac cgggcaaatt actgcggccg 660ggaaagtgcc
accggcaaaa gtgatggtga ttggtgcggg tgttgcaggt ctggccgcca
720ttggcgcagc aaacagtctc ggcgcgattg tgcgtgcatt cgacacccgc
ccggaagtga 780aagaacaagt tcaaagtatg ggcgcggaat tcctcgagct
ggattttaaa gaggaagctg 840gcagcggcga tggctatgcc aaagtgatgt
cggacgcgtt catcaaagcg gaaatggaac 900tctttgccgc ccaggcaaaa
gaggtcgata tcattgtcac caccgcgctt attccaggca 960aaccagcgcc
gaagctaatt acccgtgaaa tggttgactc catgaaggcg ggcagtgtga
1020ttgttgacct ggcagcccaa aacggcggca actgtgaata caccgtgccg
ggtgaaatct 1080tcactacgga aaatggtgtc aaagtgattg gttataccga
tcttccgggc cgtctgccga 1140cgcaatcctc acagctttac ggcacaaacc
tcgttaatct gctgaaactg ttgtgcaaag 1200agaaagacgg caatatcact
gttgattttg atgatgtggt gattcgcggc gtgaccgtga 1260tccgtgcggg
cgaaattacc tggccggcac cgccgattca ggtatcagct cagccgcagg
1320cggcacaaaa agcggcaccg gaagtgaaaa ctgaggaaaa atgtacctgc
tcaccgtggc 1380gtaaatacgc gttgatggcg ctggcaatca ttctttttgg
ctggatggca agcgttgcgc 1440cgaaagaatt ccttgggcac ttcaccgttt
tcgcgctggc ctgcgttgtc ggttattacg 1500tggtgtggaa tgtatcgcac
gcgctgcata caccgttgat gtcggtcacc aacgcgattt 1560cagggattat
tgttgtcgga gcactgttgc agattggcca gggcggctgg gttagcttcc
1620ttagttttat cgcggtgctt atagccagca ttaatatttt cggtggcttc
accgtgactc 1680agcgcatgct gaaaatgttc cgcaaaaatt aaggggtaac
atatgtctgg aggattagtt 1740acagctgcat acattgttgc cgcgatcctg
tttatcttca gtctggccgg tctttcgaaa 1800catgaaacgt ctcgccaggg
taacaacttc ggtatcgccg ggatggcgat tgcgttaatc 1860gcaaccattt
ttggaccgga tacgggtaat gttggctgga tcttgctggc gatggtcatt
1920ggtggggcaa ttggtatccg tctggcgaag aaagttgaaa tgaccgaaat
gccagaactg 1980gtggcgatcc tgcatagctt cgtgggtctg gcggcagtgc
tggttggctt taacagctat 2040ctgcatcatg acgcgggaat ggcaccgatt
ctggtcaata ttcacctgac ggaagtgttc 2100ctcggtatct tcatcggggc
ggtaacgttc acgggttcgg tggtggcgtt cggcaaactg 2160tgtggcaaga
tttcgtctaa accattgatg ctgccaaacc gtcacaaaat gaacctggcg
2220gctctggtcg tttccttcct gctgctgatt gtatttgttc gcacggacag
cgtcggcctg 2280caagtgctgg cattgctgat aatgaccgca attgcgctgg
tattcggctg gcatttagtc 2340gcctccatcg gtggtgcaga tatgccagtg
gtggtgtcga tgctgaactc gtactccggc 2400tgggcggctg cggctgcggg
ctttatgctc agcaacgacc tgctgattgt gaccggtgcg 2460ctggtcggtt
cttcgggggc tatcctttct tacattatgt gtaaggcgat gaaccgttcc
2520tttatcagcg ttattgcggg tggtttcggc accgacggct cttctactgg
cgatgatcag 2580gaagtgggtg agcaccgcga aatcaccgca gaagagacag
cggaactgct gaaaaactcc 2640cattcagtga tcattactcc ggggtacggc
atggcagtcg cgcaggcgca atatcctgtc 2700gctgaaatta ctgagaaatt
gcgcgctcgt ggtattaatg tgcgtttcgg tatccacccg 2760gtcgcggggc
gtttgcctgg acatatgaac gtattgctgg ctgaagcaaa agtaccgtat
2820gacatcgtgc tggaaatgga cgagatcaat gatgactttg ctgataccga
taccgtactg 2880gtgattggtg ctaacgatac ggttaacccg gcggcgcagg
atgatccgaa gagtccgatt 2940gctggtatgc ctgtgctgga agtgtggaaa
gcgcagaacg tgattgtctt taaacgttcg 3000atgaacactg gctatgctgg
tgtgcaaaac ccgctgttct tcaaggaaaa cacccacatg 3060ctgtttggtg
acgccaaagc cagcgtggat gcaatcctga aagctctgta acgtcgacat
3120tatgcggccg cggatccata aggaggatta attaagactt cccgggtgat
cccatggtac 3180gcgtgctaga ggcatcaaat aaaacgaaag gctcagtcga
aagactgggc ctttcgtttt 3240atctgttgtt tgtcggtgaa cgctctcctg
agtaggacaa atccgccgcc ctagacctag 3300ctagggtacg ggttttgctg
cccgcaaacg ggctgttctg gtgttgctag tttgttatca 3360gaatcgcaga
tccggcttca gccggtttgc cggctgaaag cgctatttct tccagaattg
3420ccatgatttt ttccccacgg gaggcgtcac tggctcccgt gttgtcggca
gctttgattc 3480gataagcagc atcgcctgtt tcaggctgtc tatgtgtgac
tgttgagctg taacaagttg 3540tctcaggtgt tcaatttcat gttctagttg
ctttgtttta ctggtttcac ctgttctatt 3600aggtgttaca tgctgttcat
ctgttacatt gtcgatctgt tcatggtgaa cagctttaaa 3660tgcaccaaaa
actcgtaaaa gctctgatgt atctatcttt tttacaccgt tttcatctgt
3720gcatatggac agttttccct ttgatatcta acggtgaaca gttgttctac
ttttgtttgt 3780tagtcttgat gcttcactga tagatacaag agccataaga
acctcagatc cttccgtatt 3840tagccagtat gttctctagt gtggttcgtt
gtttttgcgt gagccatgag aacgaaccat 3900tgagatcatg cttactttgc
atgtcactca aaaattttgc ctcaaaactg gtgagctgaa 3960tttttgcagt
taaagcatcg tgtagtgttt ttcttagtcc gttacgtagg taggaatctg
4020atgtaatggt tgttggtatt ttgtcaccat tcatttttat ctggttgttc
tcaagttcgg 4080ttacgagatc catttgtcta tctagttcaa cttggaaaat
caacgtatca gtcgggcggc 4140ctcgcttatc aaccaccaat ttcatattgc
tgtaagtgtt taaatcttta cttattggtt 4200tcaaaaccca ttggttaagc
cttttaaact catggtagtt attttcaagc attaacatga 4260acttaaattc
atcaaggcta atctctatat ttgccttgtg agttttcttt tgtgttagtt
4320cttttaataa ccactcataa atcctcatag agtatttgtt ttcaaaagac
ttaacatgtt 4380ccagattata ttttatgaat ttttttaact ggaaaagata
aggcaatatc tcttcactaa 4440aaactaattc taatttttcg cttgagaact
tggcatagtt tgtccactgg aaaatctcaa 4500agcctttaac caaaggattc
ctgatttcca cagttctcgt catcagctct ctggttgctt 4560tagctaatac
accataagca ttttccctac tgatgttcat catctgagcg tattggttat
4620aagtgaacga taccgtccgt tctttccttg tagggttttc aatcgtgggg
ttgagtagtg 4680ccacacagca taaaattagc ttggtttcat gctccgttaa
gtcatagcga ctaatcgcta 4740gttcatttgc tttgaaaaca actaattcag
acatacatct caattggtct aggtgatttt 4800aatcactata ccaattgaga
tgggctagtc aatgataatt actagtcctt ttcccgggag 4860atctgggtat
ctgtaaattc tgctagacct ttgctggaaa acttgtaaat tctgctagac
4920cctctgtaaa ttccgctaga cctttgtgtg ttttttttgt ttatattcaa
gtggttataa 4980tttatagaat aaagaaagaa taaaaaaaga taaaaagaat
agatcccagc cctgtgtata 5040actcactact ttagtcagtt ccgcagtatt
acaaaaggat gtcgcaaacg ctgtttgctc 5100ctctacaaaa cagaccttaa
aaccctaaag gcttaagtag caccctcgca agctcgggca 5160aatcgctgaa
tattcctttt gtctccgacc atcaggcacc tgagtcgctg tctttttcgt
5220gacattcagt tcgctgcgct cacggctctg gcagtgaatg ggggtaaatg
gcactacagg 5280cgccttttat ggattcatgc aaggaaacta cccataatac
aagaaaagcc cgtcacgggc 5340ttctcagggc gttttatggc gggtctgcta
tgtggtgcta tctgactttt tgctgttcag 5400cagttcctgc cctctgattt
tccagtctga ccacttcgga ttatcccgtg acaggtcatt 5460cagactggct
aatgcaccca gtaaggcagc ggtatcatca acaggcttac ccgtcttact
5520gtccctagtg cttggattct caccaataaa aaacgcccgg cggcaaccga
gcgttctgaa 5580caaatccaga tggagttctg aggtcattac tggatctatc
aacaggagtc caagcgagct 5640ctcgaacccc agagtcccgc tcagaagaac
tcgtcaagaa ggcgatagaa ggcgatgcgc 5700tgcgaatcgg gagcggcgat
accgtaaagc acgaggaagc ggtcagccca ttcgccgcca 5760agctcttcag
caatatcacg ggtagccaac gctatgtcct gatagcggtc cgccacaccc
5820agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat
attcggcaag 5880caggcatcgc catgggtcac gacgagatcc tcgccgtcgg
gcatgcgcgc cttgagcctg 5940gcgaacagtt cggctggcgc gagcccctga
tgctcttcgt ccagatcatc ctgatcgaca 6000agaccggctt ccatccgagt
acgtgctcgc tcgatgcgat gtttcgcttg gtggtcgaat 6060gggcaggtag
ccggatcaag cgtatgcagc cgccgcattg catcagccat gatggatact
6120ttctcggcag gagcaaggtg agatgacagg agatcctgcc ccggcacttc
gcccaatagc 6180agccagtccc ttcccgcttc agtgacaacg tcgagcacag
ctgcgcaagg aacgcccgtc 6240gtggccagcc acgatagccg cgctgcctcg
tcctgcagtt cattcagggc accggacagg 6300tcggtcttga caaaaagaac
cgggcgcccc tgcgctgaca gccggaacac ggcggcatca 6360gagcagccga
ttgtctgttg tgcccagtca tagccgaata gcctctccac ccaagcggcc
6420ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa acgatcctca
tcctgtctct 6480tgatcagatc ttgatcccct gcgccatcag atccttggcg
gcaagaaagc catccagttt 6540actttgcagg gcttcccaac cttaccagag ggcgc
6575317112DNAArtificial SequenceSynthetic polynucleotide
31taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt
60cgtcttcacc tcgagaattg tgagcggata acaattgaca ttgtgagcgg ataacaagat
120actgagcaca tcagcaggac gcactgaccg aattcattaa agaggagaaa
ggtaccatgt 180atacagtagg agattaccta ttagaccgat tacacgagtt
aggaattgaa gaaatttttg 240gagtccctgg agactataac ttacaatttt
tagatcaaat tatttcccgc aaggatatga 300aatgggtcgg aaatgctaat
gaattaaatg cttcatatat ggctgatggc tatgctcgta 360ctaaaaaagc
tgccgcattt cttacaacct ttggagtagg tgaattgagt gcagttaatg
420gattagcagg aagttacgcc gaaaatttac cagtagtaga aatagtggga
tcacctacat 480caaaagttca aaatgaagga aaatttgttc atcatacgct
ggctgacggt gattttaaac 540actttatgaa aatgcacgaa cctgttacag
cagctcgaac tttactgaca gcagaaaatg 600caaccgttga aattgaccga
gtactttctg cactattaaa agaaagaaaa cctgtctata 660tcaacttacc
agttgatgtt gctgctgcaa aagcagagaa accctcactc cctttgaaaa
720aagaaaactc aacttcaaat acaagtgacc aagagatctt gaacaaaatt
caagaaagct 780tgaaaaatgc caaaaaacca atcgtgatta caggacatga
aataattagt tttggcttag 840aaaaaacagt ctctcaattt atttcaaaga
caaaactacc tattacgaca ttaaactttg 900gaaaaagttc agttgatgaa
gctctccctt catttttagg aatctataat ggtaaactct 960cagagcctaa
tcttaaagaa ttcgtggaat cagccgactt catcctgatg cttggagtta
1020aactcacaga ctcttcaaca ggagccttca ctcatcattt aaatgaaaat
aaaatgattt 1080cactgaatat agatgaagga aaaatattta acgaaagcat
ccaaaatttt gattttgaat 1140ccctcatctc ctctctctta gacctaagcg
aaatagaata caaaggaaaa tatatcgata 1200aaaagcaaga agactttgtt
ccatcaaatg cgcttttatc acaagaccgc ctatggcaag 1260cagttgaaaa
cctaactcaa agcaatgaaa caatcgttgc tgaacaaggg acatcattct
1320ttggcgcttc atcaattttc ttaaaaccaa agagtcattt tattggtcaa
cccttatggg 1380gatcaattgg atatacattc ccagcagcat taggaagcca
aattgcagat aaagaaagca 1440gacacctttt atttattggt gatggttcac
ttcaacttac ggtgcaagaa ttaggattag 1500caatcagaga aaaaattaat
ccaatttgct ttattatcaa taatgatggt tatacagtcg 1560aaagagaaat
tcatggacca aatcaaagct acaatgatat tccaatgtgg aattactcaa
1620aattaccaga atcatttgga gcaacagaag aacgagtagt ctcgaaaatc
gttagaactg 1680aaaatgaatt tgtgtctgtc atgaaagaag ctcaagcaga
tccaaataga atgtactgga 1740ttgagttaat tttggcaaaa gaagatgcac
caaaagtact gaaaaaaatg ggcaaactat 1800ttgctgaaca aaataaatca
taaggtcgac aggagatata ctatgcctaa atatcgcagc 1860gcaactacta
cccacggccg caacatggca ggcgcgcgtg ctctgtggcg tgcgactggt
1920atgactgatg cggactttgg caaaccaatc attgctgtgg ttaatagctt
tactcagttc 1980gttccaggcc atgttcacct gcgtgacctg ggcaagctgg
ttgcggagca gatcgaggct 2040gcgggtggtg tggcgaagga atttaacacc
atcgctgttg acgacggtat cgcgatgggt 2100catggtggta tgctgtacag
cctgccgagc cgtgagctga ttgcggacag cgtggaatac 2160atggttaatg
cgcattgtgc ggatgcgatg gtttgtatta gcaactgtga taagattact
2220ccaggtatgc tgatggcgag cctgcgtctg aacatcccag ttattttcgt
gagcggtggt 2280ccaatggaag cgggtaagac taagctgagc gaccagatta
tcaaactgga cctggtggac 2340gctatgattc aaggtgctga tccaaaggtt
agcgatagcc aatctgacca agtggagcgc 2400agcgcttgcc caacttgtgg
cagctgtagc ggtatgttca ctgcgaatag catgaattgt 2460ctgactgagg
ctctgggtct gagccaacca ggtaatggta gcctgctggc gactcatgcg
2520gatcgcaaac aactgtttct gaacgcgggc aagcgtatcg tggagctgac
taagcgctac 2580tatgaacaga atgatgagtc cgcgctgcca cgcaacattg
cgtccaaagc tgctttcgag 2640aatgcgatga ccctggacat tgctatgggc
ggtagcacca atactgttct gcatctgctg 2700gctgctgctc aagaggctga
gattgatttt actatgtccg acattgacaa actgagccgt 2760aaagtgccgc
aactgtgcaa ggtggctcca tctactcaaa agtatcacat ggaggacgtg
2820catcgcgcgg gtggcgtgat tggcatcctg ggtgagctgg accgtgctgg
tctgctgaat 2880cgcgacgtta agaatgttct gggtctgacc ctgccacaga
ccctggagca gtatgatgtg 2940atgctgactc aagacgatgc tgttaagaac
atgtttcgtg ctggtccggc gggtatccgc 3000actacccaag cgtttagcca
ggactgtcgc tgggacaccc tggatgatga ccgtgcgaac 3060ggttgcattc
gtagcctgga acatgcgtat tctaaggatg gtggtctggc tgttctgtat
3120ggcaatttcg ctgagaatgg ttgtattgtt aagaccgcgg gtgttgacga
ttctattctg 3180aagtttactg gtccagctaa ggtttatgag tctcaagatg
acgctgttga ggctatcctg 3240ggtggcaagg tggttgcggg tgacgttgtt
gttatccgtt acgagggtcc aaagggtggc 3300ccaggtatgc aagagatgct
gtatccgact tcttttctga agagcatggg cctgggtaag 3360gcgtgcgctc
tgattactga tggccgcttt agcggcggta ctagcggcct gagcattggt
3420catgttagcc cagaggctgc gtctggtggt tctatcggtc tgatcgagga
cggcgatctg 3480attgcgattg atattccaaa tcgcggtatc caactgcaag
tttctgacgc ggagctggct 3540gctcgccgcg aggctcaaga tgcgcgtggc
gataaggcgt ggaccccaaa gaaccgcgag 3600cgccaagtta gcttcgcgct
gcgcgcgtac gcctctctgg cgacttctgc ggataagggt 3660gctgttcgtg
acaagagcaa gctgggtggc taaacgcgtg ctagaggcat caaataaaac
3720gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg
gtgaacgctc 3780tcctgagtag gacaaatccg ccgccctaga cctagctagg
gtacgggttt tgctgcccgc 3840aaacgggctg ttctggtgtt gctagtttgt
tatcagaatc gcagatccgg cttcagccgg 3900tttgccggct gaaagcgcta
tttcttccag aattgccatg attttttccc cacgggaggc 3960gtcactggct
cccgtgttgt cggcagcttt gattcgataa gcagcatcgc ctgtttcagg
4020ctgtctatgt gtgactgttg agctgtaaca agttgtctca ggtgttcaat
ttcatgttct 4080agttgctttg ttttactggt ttcacctgtt ctattaggtg
ttacatgctg ttcatctgtt 4140acattgtcga tctgttcatg gtgaacagct
ttaaatgcac caaaaactcg taaaagctct 4200gatgtatcta tcttttttac
accgttttca tctgtgcata tggacagttt tccctttgat 4260atctaacggt
gaacagttgt tctacttttg tttgttagtc ttgatgcttc actgatagat
4320acaagagcca taagaacctc agatccttcc gtatttagcc agtatgttct
ctagtgtggt 4380tcgttgtttt tgcgtgagcc atgagaacga accattgaga
tcatgcttac tttgcatgtc 4440actcaaaaat tttgcctcaa aactggtgag
ctgaattttt gcagttaaag catcgtgtag 4500tgtttttctt agtccgttac
gtaggtagga atctgatgta atggttgttg gtattttgtc 4560accattcatt
tttatctggt tgttctcaag ttcggttacg agatccattt gtctatctag
4620ttcaacttgg aaaatcaacg tatcagtcgg gcggcctcgc ttatcaacca
ccaatttcat 4680attgctgtaa gtgtttaaat ctttacttat tggtttcaaa
acccattggt taagcctttt 4740aaactcatgg tagttatttt caagcattaa
catgaactta aattcatcaa ggctaatctc 4800tatatttgcc ttgtgagttt
tcttttgtgt tagttctttt aataaccact cataaatcct 4860catagagtat
ttgttttcaa aagacttaac atgttccaga ttatatttta tgaatttttt
4920taactggaaa agataaggca atatctcttc actaaaaact aattctaatt
tttcgcttga 4980gaacttggca tagtttgtcc actggaaaat ctcaaagcct
ttaaccaaag gattcctgat 5040ttccacagtt ctcgtcatca gctctctggt
tgctttagct aatacaccat aagcattttc 5100cctactgatg ttcatcatct
gagcgtattg gttataagtg aacgataccg tccgttcttt 5160ccttgtaggg
ttttcaatcg tggggttgag tagtgccaca cagcataaaa ttagcttggt
5220ttcatgctcc gttaagtcat agcgactaat cgctagttca tttgctttga
aaacaactaa 5280ttcagacata catctcaatt ggtctaggtg attttaatca
ctataccaat tgagatgggc 5340tagtcaatga taattactag tccttttccc
gggagatctg ggtatctgta aattctgcta 5400gacctttgct ggaaaacttg
taaattctgc tagaccctct gtaaattccg ctagaccttt 5460gtgtgttttt
tttgtttata ttcaagtggt tataatttat agaataaaga aagaataaaa
5520aaagataaaa agaatagatc ccagccctgt gtataactca ctactttagt
cagttccgca 5580gtattacaaa aggatgtcgc aaacgctgtt tgctcctcta
caaaacagac cttaaaaccc 5640taaaggctta agtagcaccc tcgcaagctc
gggcaaatcg ctgaatattc cttttgtctc 5700cgaccatcag gcacctgagt
cgctgtcttt ttcgtgacat tcagttcgct gcgctcacgg 5760ctctggcagt
gaatgggggt aaatggcact acaggcgcct tttatggatt catgcaagga
5820aactacccat aatacaagaa aagcccgtca cgggcttctc agggcgtttt
atggcgggtc 5880tgctatgtgg tgctatctga ctttttgctg ttcagcagtt
cctgccctct gattttccag 5940tctgaccact tcggattatc ccgtgacagg
tcattcagac tggctaatgc acccagtaag 6000gcagcggtat catcaacagg
cttacccgtc ttactgtccc tagtgcttgg attctcacca 6060ataaaaaacg
cccggcggca accgagcgtt ctgaacaaat ccagatggag ttctgaggtc
6120attactggat ctatcaacag gagtccaagc gagctctcga accccagagt
cccgctcaga 6180agaactcgtc aagaaggcga tagaaggcga tgcgctgcga
atcgggagcg gcgataccgt 6240aaagcacgag gaagcggtca gcccattcgc
cgccaagctc ttcagcaata tcacgggtag 6300ccaacgctat gtcctgatag
cggtccgcca cacccagccg gccacagtcg atgaatccag 6360aaaagcggcc
attttccacc atgatattcg gcaagcaggc atcgccatgg gtcacgacga
6420gatcctcgcc gtcgggcatg cgcgccttga gcctggcgaa cagttcggct
ggcgcgagcc 6480cctgatgctc ttcgtccaga tcatcctgat cgacaagacc
ggcttccatc cgagtacgtg 6540ctcgctcgat gcgatgtttc gcttggtggt
cgaatgggca ggtagccgga tcaagcgtat 6600gcagccgccg cattgcatca
gccatgatgg atactttctc ggcaggagca aggtgagatg 6660acaggagatc
ctgccccggc acttcgccca atagcagcca gtcccttccc gcttcagtga
6720caacgtcgag cacagctgcg caaggaacgc ccgtcgtggc cagccacgat
agccgcgctg 6780cctcgtcctg cagttcattc agggcaccgg acaggtcggt
cttgacaaaa agaaccgggc 6840gcccctgcgc tgacagccgg aacacggcgg
catcagagca gccgattgtc tgttgtgccc 6900agtcatagcc gaatagcctc
tccacccaag cggccggaga acctgcgtgc aatccatctt 6960gttcaatcat
gcgaaacgat cctcatcctg tctcttgatc agatcttgat cccctgcgcc
7020atcagatcct tggcggcaag aaagccatcc agtttacttt gcagggcttc
ccaaccttac 7080cagagggcgc cccagctggc aattccgacg tc
7112327093DNAArtificial SequenceSynthetic polynucleotide
32cgatatcaaa ttacgccccg ccctgccact catcgcagta ctgttgtaat tcattaagca
60ttctgccgac atggaagcca tcacagacgg catgatgaac ctgaatcgcc agcggcatca
120gcaccttgtc gccttgcgta taatatttgc ccatggtgaa aacgggggcg
aagaagttgt 180ccatattggc cacgtttaaa tcaaaactgg tgaaactcac
ccagggattg gctgagacga 240aaaacatatt ctcaataaac cctttaggga
aataggccag gttttcaccg taacacgcca 300catcttgcga atatatgtgt
agaaactgcc ggaaatcgtc gtggtattca ctccagagcg 360atgaaaacgt
ttcagtttgc tcatggaaaa cggtgtaaca agggtgaaca ctatcccata
420tcaccagctc accgtctttc attgccatac gaaactccgg atgagcattc
atcaggcggg 480caagaatgtg aataaaggcc ggataaaact tgtgcttatt
tttctttacg gtctttaaaa 540aggccgtaat atccagctga acggtctggt
tataggtaca ttgagcaact gactgaaatg 600cctcaaaatg ttctttacga
tgccattggg atatatcaac ggtggtatat ccagtgattt 660ttttctccat
tttagcttcc ttagctcctg aaaatctcga taactcaaaa aatacgcccg
720gtagtgatct tatttcatta tggtgaaagt tggaacctct tacgtgccga
tcaacgtctc 780attttcgcca gatatcgacg tctaagaaac cattattatc
atgacattaa cctataaaaa 840taggcgtatc acgaggccct ttcgtcttca
cctcgagaat tgtgagcgga taacaattga 900cattgtgagc ggataacaag
atactgagca catcagcagg acgcactgac cgaattcatt 960aaagaggaga
aaggtacaat gttgacaaaa gcaacaaaag aacaaaaatc ccttgtgaaa
1020aacagagggg cggagcttgt tgttgattgc ttagtggagc aaggtgtcac
acatgtattt 1080ggcattccag gtgcaaaaat tgatgcggta tttgacgctt
tacaagataa aggacctgaa 1140attatcgttg cccggcacga acaaaacgca
gcattcatgg cccaagcagt cggccgttta 1200actggaaaac cgggagtcgt
gttagtcaca tcaggaccgg gtgcctctaa cttggcaaca 1260ggcctgctga
cagcgaacac tgaaggagac cctgtcgttg cgcttgctgg aaacgtgatc
1320cgtgcagatc gtttaaaacg gacacatcaa tctttggata atgcggcgct
attccagccg 1380attacaaaat acagtgtaga agttcaagat gtaaaaaata
taccggaagc tgttacaaat 1440gcatttagga tagcgtcagc agggcaggct
ggggccgctt ttgtgagctt tccgcaagat 1500gttgtgaatg aagtcacaaa
tacgaaaaac gtgcgtgctg ttgcagcgcc aaaactcggt 1560cctgcagcag
atgatgcaat cagtgcggcc atagcaaaaa tccaaacagc aaaacttcct
1620gtcgttttgg tcggcatgaa aggcggaaga ccggaagcaa ttaaagcggt
tcgcaagctt 1680ttgaaaaagg ttcagcttcc atttgttgaa acatatcaag
ctgccggtac cctttctaga 1740gatttagagg atcaatattt tggccgtatc
ggtttgttcc gcaaccagcc tggcgattta 1800ctgctagagc aggcagatgt
tgttctgacg atcggctatg acccgattga atatgatccg 1860aaattctgga
atatcaatgg agaccggaca attatccatt tagacgagat tatcgctgac
1920attgatcatg cttaccagcc tgatcttgaa ttgatcggtg acattccgtc
cacgatcaat 1980catatcgaac acgatgctgt gaaagtggaa tttgcagagc
gtgagcagaa aatcctttct 2040gatttaaaac aatatatgca tgaaggtgag
caggtgcctg cagattggaa atcagacaga 2100gcgcaccctc ttgaaatcgt
taaagagttg cgtaatgcag tcgatgatca tgttacagta 2160acttgcgata
tcggttcgca cgccatttgg atgtcacgtt atttccgcag ctacgagccg
2220ttaacattaa tgatcagtaa cggtatgcaa acactcggcg ttgcgcttcc
ttgggcaatc 2280ggcgcttcat tggtgaaacc gggagaaaaa gtggtttctg
tctctggtga cggcggtttc 2340ttattctcag caatggaatt agagacagca
gttcgactaa aagcaccaat tgtacacatt 2400gtatggaacg acagcacata
tgacatggtt gcattccagc aattgaaaaa atataaccgt 2460acatctgcgg
tcgatttcgg aaatatcgat atcgtgaaat atgcggaaag cttcggagca
2520actggcttgc gcgtagaatc accagaccag ctggcagatg ttctgcgtca
aggcatgaac 2580gctgaaggtc ctgtcatcat cgatgtcccg gttgactaca
gtgataacat taatttagca 2640agtgacaagc ttccgaaaga attcggggaa
ctcatgaaaa cgaaagctct ctaggtcgac 2700gaggaatcac catggctaac
tacttcaata cactgaatct gcgccagcag ctggcacagc 2760tgggcaaatg
tcgctttatg ggccgcgatg aattcgccga tggcgcgagc taccttcagg
2820gtaaaaaagt agtcatcgtc ggctgtggcg cacagggtct gaaccagggc
ctgaacatgc 2880gtgattctgg tctcgatatc tcctacgctc tgcgtaaaga
agcgattgcc gagaagcgcg 2940cgtcctggcg taaagcgacc gaaaatggtt
ttaaagtggg tacttacgaa gaactgatcc 3000cacaggcgga tctggtgatt
aacctgacgc cggacaagca gcactctgat gtagtgcgca 3060ccgtacagcc
actgatgaaa gacggcgcgg cgctgggcta ctcgcacggt ttcaacatcg
3120tcgaagtggg cgagcagatc cgtaaagata tcaccgtagt gatggttgcg
ccgaaatgcc 3180caggcaccga agtgcgtgaa gagtacaaac gtgggttcgg
cgtaccgacg ctgattgccg 3240ttcacccgga aaacgatccg aaaggcgaag
gcatggcgat tgccaaagcc tgggcggctg 3300caaccggtgg tcaccgtgcg
ggtgtgctgg aatcgtcctt cgttgcggaa gtgaaatctg 3360acctgatggg
cgagcaaacc atcctgtgcg gtatgttgca ggctggctct ctgctgtgct
3420tcgacaagct ggtggaagaa ggtaccgatc cagcatacgc agaaaaactg
attcagttcg 3480gttgggaaac catcaccgaa gcactgaaac agggcggcat
caccctgatg atggaccgtc 3540tctctaaccc ggcgaaactg cgtgcttatg
cgctttctga acagctgaaa gagatcatgg 3600cacccctgtt ccagaaacat
atggacgaca tcatctccgg cgaattctct tccggtatga 3660tggcggactg
ggccaacgat gataagaaac tgctgacctg gcgtgaagag accggcaaaa
3720ccgcgtttga aaccgcgccg cagtatgaag gcaaaatcgg cgagcaggag
tacttcgata 3780aaggcgtact gatgattgcg atggtgaaag cgggcgttga
actggcgttc gaaaccatgg 3840tcgattccgg catcattgaa gagtctgcat
attatgaatc actgcacgag ctgccgctga 3900ttgccaacac catcgcccgt
aagcgtctgt acgaaatgaa cgtggttatc tctgataccg 3960ctgagtacgg
taactatctg ttctcttacg cttgtgtgcc gttgctgaaa ccgtttatgg
4020cagagctgca accgggcgac ctgggtaaag ctattccgga aggcgcggta
gataacgggc 4080aactgcgtga tgtgaacgaa gcgattcgca gccatgcgat
tgagcaggta ggtaagaaac 4140tgcgcggcta tatgacagat atgaaacgta
ttgctgttgc gggttaaccc ggaaggagat 4200ataccatgcc taagtaccgt
tccgccacca ccactcatgg tcgtaatatg gcgggtgctc 4260gtgcgctgtg
gcgcgccacc ggaatgaccg acgccgattt cggtaagccg attatcgcgg
4320ttgtgaactc gttcacccaa tttgtaccgg gtcacgtcca tctgcgcgat
ctcggtaaac 4380tggtcgccga acaaattgaa gcggctggcg gcgttgccaa
agagttcaac accattgcgg 4440tggatgatgg gattgccatg ggccacgggg
ggatgcttta ttcactgcca tctcgcgaac 4500tgatcgctga ttccgttgag
tatatggtca acgcccactg cgccgacgcc atggtctgca 4560tctctaactg
cgacaaaatc accccgggga tgctgatggc ttccctgcgc ctgaatattc
4620cggtgatctt tgtttccggc ggcccgatgg aggccgggaa aaccaaactt
tccgatcaga 4680tcatcaagct cgatctggtt gatgcgatga tccagggcgc
agacccgaaa gtatctgact 4740cccagagcga tcaggttgaa cgttccgcgt
gtccgacctg cggttcctgc tccgggatgt 4800ttaccgctaa ctcaatgaac
tgcctgaccg aagcgctggg cctgtcgcag ccgggcaacg 4860gctcgctgct
ggcaacccac gccgaccgta agcagctgtt ccttaatgct ggtaaacgca
4920ttgttgaatt gaccaaacgt tattacgagc aaaacgacga aagtgcactg
ccgcgtaata 4980tcgccagtaa ggcggcgttt gaaaacgcca tgacgctgga
tatcgcgatg ggtggatcga 5040ctaacaccgt acttcacctg ctggcggcgg
cgcaggaagc ggaaatcgac ttcaccatga 5100gtgatatcga taagctttcc
cgcaaggttc cacagctgtg taaagttgcg ccgagcaccc 5160agaaatacca
tatggaagat gttcaccgtg ctggtggtgt tatcggtatt ctcggcgaac
5220tggatcgcgc ggggttactg aaccgtgatg tgaaaaacgt acttggcctg
acgttgccgc 5280aaacgctgga acaatacgac gttatgctga cccaggatga
cgcggtaaaa aatatgttcc 5340gcgcaggtcc tgcaggcatt cgtaccacac
aggcattctc gcaagattgc cgttgggata 5400cgctggacga cgatcgcgcc
aatggctgta tccgctcgct ggaacacgcc tacagcaaag 5460acggcggcct
ggcggtgctc tacggtaact ttgcggaaaa cggctgcatc gtgaaaacgg
5520caggcgtcga tgacagcatc ctcaaattca ccggcccggc gaaagtgtac
gaaagccagg 5580acgatgcggt agaagcgatt ctcggcggta aagttgtcgc
cggagatgtg gtagtaattc 5640gctatgaagg cccgaaaggc ggtccgggga
tgcaggaaat gctctaccca accagcttcc 5700tgaaatcaat gggtctcggc
aaagcctgtg cgctgatcac cgacggtcgt ttctctggtg 5760gcacctctgg
tctttccatc ggccacgtct caccggaagc ggcaagcggc ggcagcattg
5820gcctgattga agatggtgac ctgatcgcta tcgacatccc gaaccgtggc
attcagttac 5880aggtaagcga tgccgaactg gcggcgcgtc gtgaagcgca
ggacgctcga ggtgacaaag 5940cctggacgcc gaaaaatcgt gaacgtcagg
tctcctttgc cctgcgtgct tatgccagcc 6000tggcaaccag cgccgacaaa
ggcgcggtgc gcgataaatc gaaactgggg ggttaaacgc 6060gtgctagagg
catcaaataa aacgaaaggc tcagtcgaaa gactgggcct ttcgttttat
6120ctgttgtttg tcggtgaacg ctctcctgag taggacaaat ccgccgccct
agacctaggg 6180gatatattcc gcttcctcgc tcactgactc gctacgctcg
gtcgttcgac tgcggcgagc 6240ggaaatggct tacgaacggg gcggagattt
cctggaagat gccaggaaga tacttaacag 6300ggaagtgaga gggccgcggc
aaagccgttt ttccataggc tccgcccccc tgacaagcat 6360cacgaaatct
gacgctcaaa tcagtggtgg cgaaacccga caggactata aagataccag
6420gcgtttcccc ctggcggctc cctcgtgcgc tctcctgttc ctgcctttcg
gtttaccggt 6480gtcattccgc tgttatggcc gcgtttgtct cattccacgc
ctgacactca gttccgggta 6540ggcagttcgc tccaagctgg actgtatgca
cgaacccccc gttcagtccg accgctgcgc 6600cttatccggt aactatcgtc
ttgagtccaa cccggaaaga catgcaaaag caccactggc 6660agcagccact
ggtaattgat ttagaggagt tagtcttgaa gtcatgcgcc ggttaaggct
6720aaactgaaag gacaagtttt ggtgactgcg ctcctccaag ccagttacct
cggttcaaag 6780agttggtagc tcagagaacc ttcgaaaaac cgccctgcaa
ggcggttttt tcgttttcag 6840agcaagagat tacgcgcaga ccaaaacgat
ctcaagaaga tcatcttatt aatcagataa 6900aatatttcta gatttcagtg
caatttatct cttcaaatgt agcacctgaa gtcagcccca 6960tacgatataa
gttgttacta gtgcttggat tctcaccaat aaaaaacgcc cggcggcaac
7020cgagcgttct gaacaaatcc agatggagtt ctgaggtcat tactggatct
atcaacagga 7080gtccaagcga gct 7093334946DNAArtificial
SequenceSynthetic polynucleotide 33ctcgagaatt gtgagcggat aacaattgac
attgtgagcg gataacaaga tactgagcac 60atcagcagga cgcactgacc gaattcatta
aagaggagaa aggtaccatg tatacagtag 120gagattacct attagaccga
ttacacgagt taggaattga agaaattttt ggagtccctg 180gagactataa
cttacaattt ttagatcaaa ttatttccca caaggatatg aaatgggtcg
240gaaatgctaa tgaattaaat gcttcatata tggctgatgg ctatgctcgt
actaaaaaag 300ctgccgcatt tcttacaacc tttggagtag gtgaattgag
tgcagttaat ggattagcag 360gaagttacgc cgaaaattta ccagtagtag
aaatagtggg atcacctaca tcaaaagttc 420aaaatgaagg aaaatttgtt
catcatacgc tggctgacgg tgattttaaa cactttatga 480aaatgcacga
acctgttaca gcagctcgaa ctttactgac agcagaaaat gcaaccgttg
540aaattgaccg agtactttct gcactattaa aagaaagaaa acctgtctat
atcaacttac 600cagttgatgt tgctgctgca aaagcagaga aaccctcact
ccctttgaaa aaggaaaact 660caacttcaaa tacaagtgac caagaaattt
tgaacaaaat tcaagaaagc ttgaaaaatg 720ccaaaaaacc aatcgtgatt
acaggacatg aaataattag ttttggctta gaaaaaacag 780tcactcaatt
tatttcaaag acaaaactac ctattacgac attaaacttt ggtaaaagtt
840cagttgatga agccctccct tcatttttag gaatctataa tggtacactc
tcagagccta 900atcttaaaga attcgtggaa tcagccgact tcatcttgat
gcttggagtt aaactcacag 960actcttcaac aggagccttc actcatcatt
taaatgaaaa taaaatgatt tcactgaata 1020tagatgaagg aaaaatattt
aacgaaagaa tccaaaattt tgattttgaa tccctcatct 1080cctctctctt
agacctaagc gaaatagaat acaaaggaaa atatatcgat aaaaagcaag
1140aagactttgt tccatcaaat gcgcttttat cacaagaccg cctatggcaa
gcagttgaaa 1200acctaactca aagcaatgaa acaatcgttg ctgaacaagg
gacatcattc tttggcgctt 1260catcaatttt cttaaaatca aagagtcatt
ttattggtca acccttatgg ggatcaattg 1320gatatacatt cccagcagca
ttaggaagcc aaattgcaga taaagaaagc agacaccttt 1380tatttattgg
tgatggttca cttcaactta cagtgcaaga attaggatta gcaatcagag
1440aaaaaattaa tccaatttgc tttattatca ataatgatgg ttatacagtc
gaaagagaaa 1500ttcatggacc aaatcaaagc tacaatgata ttccaatgtg
gaattactca aaattaccag 1560aatcgtttgg agcaacagaa gatcgagtag
tctcaaaaat cgttagaact gaaaatgaat 1620ttgtgtctgt catgaaagaa
gctcaagcag atccaaatag aatgtactgg attgagttaa 1680ttttggcaaa
agaaggtgca ccaaaagtac tgaaaaaaat gggcaaacta tttgctgaac
1740aaaataaatc ataagcatgc aggagatata ccatgtctat tccagaaact
caaaaagcca 1800ttatcttcta cgaatccaac ggcaagttgg agcataagga
tatcccagtt ccaaagccaa 1860agcccaacga attgttaatc aacgtcaagt
actctggtgt ctgccacacc gatttgcacg 1920cttggcatgg tgactggcca
ttgccaacta agttaccatt agttggtggt cacgaaggtg 1980ccggtgtcgt
tgtcggcatg ggtgaaaacg ttaagggctg gaagatcggt gactacgccg
2040gtatcaaatg gttgaacggt tcttgtatgg cctgtgaata ctgtgaattg
ggtaacgaat 2100ccaactgtcc tcacgctgac ttgtctggtt acacccacga
cggttctttc caagaatacg 2160ctaccgctga cgctgttcaa gccgctcaca
ttcctcaagg tactgacttg gctgaagtcg 2220cgccaatctt gtgtgctggt
atcaccgtat acaaggcttt gaagtctgcc aacttgagag 2280caggccactg
ggcggccatt tctggtgctg ctggtggtct aggttctttg gctgttcaat
2340atgctaaggc gatgggttac agagtcttag gtattgatgg tggtccagga
aaggaagaat 2400tgtttacctc gctcggtggt gaagtattca tcgacttcac
caaagagaag gacattgtta 2460gcgcagtcgt taaggctacc aacggcggtg
cccacggtat catcaatgtt tccgtttccg 2520aagccgctat cgaagcttct
accagatact gtagggcgaa cggtactgtt gtcttggttg 2580gtttgccagc
cggtgcaaag tgctcctctg atgtcttcaa ccacgttgtc aagtctatct
2640ccattgtcgg ctcttacgtg gggaacagag ctgataccag agaagcctta
gatttctttg 2700ccagaggtct agtcaagtct ccaataaagg tagttggctt
atccagttta ccagaaattt 2760acgaaaagat ggagaagggc caaattgctg
gtagatacgt tgttgacact tctaaataat 2820ctagaggcat caaataaaac
gaaaggctca gtcgaaagac tgggcctttc gttttatctg 2880ttgtttgtcg
gtgaacgctc tcctgagtag gacaaatccg ccgccctaga cctaggcgtt
2940cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc
cacagaatca 3000ggggataacg caggaaagaa catgtgagca aaaggccagc
aaaaggccag gaaccgtaaa 3060aaggccgcgt tgctggcgtt tttccatagg
ctccgccccc ctgacgagca tcacaaaaat 3120cgacgctcaa gtcagaggtg
gcgaaacccg acaggactat aaagatacca ggcgtttccc 3180cctggaagct
ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc
3240gcctttctcc cttcgggaag cgtggcgctt tctcaatgct cacgctgtag
gtatctcagt 3300tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg
aaccccccgt tcagcccgac 3360cgctgcgcct tatccggtaa ctatcgtctt
gagtccaacc cggtaagaca cgacttatcg 3420ccactggcag cagccactgg
taacaggatt agcagagcga ggtatgtagg cggtgctaca 3480gagttcttga
agtggtggcc taactacggc tacactagaa ggacagtatt tggtatctgc
3540gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc
cggcaaacaa 3600accaccgctg gtagcggtgg tttttttgtt tgcaagcagc
agattacgcg cagaaaaaaa 3660ggatctcaag aagatccttt gatcttttct
acggggtctg acgctcagtg gaacgaaaac 3720tcacgttaag ggattttggt
catgactagt gcttggattc tcaccaataa aaaacgcccg 3780gcggcaaccg
agcgttctga acaaatccag atggagttct gaggtcatta ctggatctat
3840caacaggagt ccaagcgagc tcgtaaactt ggtctgacag ttaccaatgc
ttaatcagtg 3900aggcacctat ctcagcgatc tgtctatttc gttcatccat
agttgcctga ctccccgtcg 3960tgtagataac tacgatacgg gagggcttac
catctggccc cagtgctgca atgataccgc 4020gagacccacg ctcaccggct
ccagatttat cagcaataaa ccagccagcc ggaagggccg 4080agcgcagaag
tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg
4140aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc
attgctacag 4200gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt
cagctccggt tcccaacgat 4260caaggcgagt tacatgatcc cccatgttgt
gcaaaaaagc ggttagctcc ttcggtcctc 4320cgatcgttgt cagaagtaag
ttggccgcag tgttatcact catggttatg gcagcactgc 4380ataattctct
tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa
4440ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg
gcgtcaatac 4500gggataatac cgcgccacat agcagaactt taaaagtgct
catcattgga aaacgttctt 4560cggggcgaaa actctcaagg atcttaccgc
tgttgagatc cagttcgatg taacccactc 4620gtgcacccaa ctgatcttca
gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 4680caggaaggca
aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca
4740tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc
atgagcggat 4800acatatttga atgtatttag aaaaataaac aaataggggt
tccgcgcaca tttccccgaa 4860aagtgccacc tgacgtctaa gaaaccatta
ttatcatgac attaacctat aaaaataggc 4920gtatcacgag gccctttcgt cttcac
4946347248DNAArtificial SequenceSynthetic polynucleotide
34taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt
60cgtcttcacc tcgagaattg tgagcggata acaattgaca ttgtgagcgg ataacaagat
120actgagcaca tcagcaggac gcactgaccg aattcattaa agaggagaaa
ggtacaatgt 180tgacaaaagc aacaaaagaa caaaaatccc ttgtgaaaaa
cagaggggcg gagcttgttg 240ttgattgctt agtggagcaa ggtgtcacac
atgtatttgg cattccaggt gcaaaaattg 300atgcggtatt tgacgcttta
caagataaag gacctgaaat tatcgttgcc cggcacgaac 360aaaacgcagc
attcatggcc caagcagtcg gccgtttaac tggaaaaccg ggagtcgtgt
420tagtcacatc aggaccgggt gcctctaact tggcaacagg cctgctgaca
gcgaacactg 480aaggagaccc tgtcgttgcg cttgctggaa acgtgatccg
tgcagatcgt ttaaaacgga 540cacatcaatc tttggataat gcggcgctat
tccagccgat tacaaaatac agtgtagaag 600ttcaagatgt aaaaaatata
ccggaagctg ttacaaatgc atttaggata gcgtcagcag 660ggcaggctgg
ggccgctttt gtgagctttc cgcaagatgt tgtgaatgaa gtcacaaata
720cgaaaaacgt gcgtgctgtt gcagcgccaa aactcggtcc tgcagcagat
gatgcaatca 780gtgcggccat agcaaaaatc caaacagcaa aacttcctgt
cgttttggtc ggcatgaaag 840gcggaagacc ggaagcaatt aaagcggttc
gcaagctttt gaaaaaggtt cagcttccat 900ttgttgaaac atatcaagct
gccggtaccc tttctagaga tttagaggat caatattttg 960gccgtatcgg
tttgttccgc aaccagcctg gcgatttact gctagagcag gcagatgttg
1020ttctgacgat cggctatgac ccgattgaat atgatccgaa attctggaat
atcaatggag 1080accggacaat tatccattta gacgagatta tcgctgacat
tgatcatgct taccagcctg 1140atcttgaatt gatcggtgac attccgtcca
cgatcaatca tatcgaacac gatgctgtga 1200aagtggaatt tgcagagcgt
gagcagaaaa tcctttctga tttaaaacaa tatatgcatg 1260aaggtgagca
ggtgcctgca gattggaaat cagacagagc gcaccctctt gaaatcgtta
1320aagagttgcg taatgcagtc gatgatcatg ttacagtaac ttgcgatatc
ggttcgcacg 1380ccatttggat gtcacgttat ttccgcagct acgagccgtt
aacattaatg atcagtaacg 1440gtatgcaaac actcggcgtt gcgcttcctt
gggcaatcgg cgcttcattg gtgaaaccgg 1500gagaaaaagt ggtttctgtc
tctggtgacg gcggtttctt attctcagca atggaattag 1560agacagcagt
tcgactaaaa gcaccaattg tacacattgt atggaacgac agcacatatg
1620acatggttgc attccagcaa ttgaaaaaat ataaccgtac atctgcggtc
gatttcggaa 1680atatcgatat cgtgaaatat gcggaaagct tcggagcaac
tggcttgcgc gtagaatcac 1740cagaccagct ggcagatgtt ctgcgtcaag
gcatgaacgc tgaaggtcct gtcatcatcg 1800atgtcccggt tgactacagt
gataacatta atttagcaag tgacaagctt ccgaaagaat 1860tcggggaact
catgaaaacg aaagctctct aggtcgacga ggaatcacca tggctaacta
1920cttcaataca ctgaatctgc gccagcagct ggcacagctg ggcaaatgtc
gctttatggg 1980ccgcgatgaa ttcgccgatg gcgcgagcta ccttcagggt
aaaaaagtag tcatcgtcgg 2040ctgtggcgca cagggtctga accagggcct
gaacatgcgt gattctggtc tcgatatctc 2100ctacgctctg cgtaaagaag
cgattgccga gaagcgcgcg tcctggcgta aagcgaccga 2160aaatggtttt
aaagtgggta cttacgaaga actgatccca caggcggatc tggtgattaa
2220cctgacgccg gacaagcagc actctgatgt agtgcgcacc gtacagccac
tgatgaaaga 2280cggcgcggcg ctgggctact cgcacggttt caacatcgtc
gaagtgggcg agcagatccg 2340taaagatatc accgtagtga tggttgcgcc
gaaatgccca ggcaccgaag tgcgtgaaga 2400gtacaaacgt gggttcggcg
taccgacgct gattgccgtt cacccggaaa acgatccgaa 2460aggcgaaggc
atggcgattg ccaaagcctg ggcggctgca accggtggtc accgtgcggg
2520tgtgctggaa tcgtccttcg ttgcggaagt gaaatctgac ctgatgggcg
agcaaaccat 2580cctgtgcggt atgttgcagg ctggctctct gctgtgcttc
gacaagctgg tggaagaagg 2640taccgatcca gcatacgcag aaaaactgat
tcagttcggt tgggaaacca tcaccgaagc 2700actgaaacag ggcggcatca
ccctgatgat ggaccgtctc tctaacccgg cgaaactgcg 2760tgcttatgcg
ctttctgaac agctgaaaga gatcatggca cccctgttcc agaaacatat
2820ggacgacatc atctccggcg aattctcttc cggtatgatg gcggactggg
ccaacgatga 2880taagaaactg ctgacctggc gtgaagagac cggcaaaacc
gcgtttgaaa ccgcgccgca 2940gtatgaaggc aaaatcggcg agcaggagta
cttcgataaa ggcgtactga tgattgcgat 3000ggtgaaagcg ggcgttgaac
tggcgttcga aaccatggtc gattccggca tcattgaaga 3060gtctgcatat
tatgaatcac tgcacgagct gccgctgatt gccaacacca tcgcccgtaa
3120gcgtctgtac gaaatgaacg tggttatctc tgataccgct gagtacggta
actatctgtt 3180ctcttacgct tgtgtgccgt tgctgaaacc gtttatggca
gagctgcaac cgggcgacct 3240gggtaaagct attccggaag gcgcggtaga
taacgggcaa ctgcgtgatg tgaacgaagc 3300gattcgcagc catgcgattg
agcaggtagg taagaaactg cgcggctata tgacagatat 3360gaaacgtatt
gctgttgcgg gttaacccgg aaggagatat accatgccta agtaccgttc
3420cgccaccacc actcatggtc gtaatatggc gggtgctcgt gcgctgtggc
gcgccaccgg 3480aatgaccgac gccgatttcg gtaagccgat tatcgcggtt
gtgaactcgt tcacccaatt 3540tgtaccgggt cacgtccatc tgcgcgatct
cggtaaactg gtcgccgaac aaattgaagc 3600ggctggcggc gttgccaaag
agttcaacac cattgcggtg gatgatggga ttgccatggg 3660ccacgggggg
atgctttatt cactgccatc tcgcgaactg atcgctgatt ccgttgagta
3720tatggtcaac gcccactgcg ccgacgccat ggtctgcatc tctaactgcg
acaaaatcac 3780cccggggatg ctgatggctt ccctgcgcct gaatattccg
gtgatctttg tttccggcgg 3840cccgatggag gccgggaaaa ccaaactttc
cgatcagatc atcaagctcg atctggttga 3900tgcgatgatc cagggcgcag
acccgaaagt atctgactcc cagagcgatc aggttgaacg 3960ttccgcgtgt
ccgacctgcg gttcctgctc cgggatgttt accgctaact caatgaactg
4020cctgaccgaa gcgctgggcc tgtcgcagcc gggcaacggc tcgctgctgg
caacccacgc 4080cgaccgtaag cagctgttcc ttaatgctgg taaacgcatt
gttgaattga ccaaacgtta 4140ttacgagcaa aacgacgaaa gtgcactgcc
gcgtaatatc gccagtaagg cggcgtttga 4200aaacgccatg acgctggata
tcgcgatggg tggatcgact aacaccgtac ttcacctgct 4260ggcggcggcg
caggaagcgg aaatcgactt caccatgagt gatatcgata agctttcccg
4320caaggttcca cagctgtgta aagttgcgcc gagcacccag aaataccata
tggaagatgt 4380tcaccgtgct ggtggtgtta tcggtattct cggcgaactg
gatcgcgcgg ggttactgaa 4440ccgtgatgtg aaaaacgtac ttggcctgac
gttgccgcaa acgctggaac aatacgacgt 4500tatgctgacc caggatgacg
cggtaaaaaa tatgttccgc gcaggtcctg caggcattcg 4560taccacacag
gcattctcgc aagattgccg ttgggatacg ctggacgacg atcgcgccaa
4620tggctgtatc cgctcgctgg aacacgccta cagcaaagac ggcggcctgg
cggtgctcta 4680cggtaacttt gcggaaaacg gctgcatcgt gaaaacggca
ggcgtcgatg acagcatcct 4740caaattcacc ggcccggcga aagtgtacga
aagccaggac gatgcggtag aagcgattct 4800cggcggtaaa gttgtcgccg
gagatgtggt agtaattcgc tatgaaggcc cgaaaggcgg 4860tccggggatg
caggaaatgc tctacccaac cagcttcctg aaatcaatgg gtctcggcaa
4920agcctgtgcg ctgatcaccg acggtcgttt ctctggtggc acctctggtc
tttccatcgg 4980ccacgtctca ccggaagcgg caagcggcgg cagcattggc
ctgattgaag atggtgacct 5040gatcgctatc gacatcccga accgtggcat
tcagttacag gtaagcgatg ccgaactggc 5100ggcgcgtcgt gaagcgcagg
acgctcgagg tgacaaagcc tggacgccga aaaatcgtga 5160acgtcaggtc
tcctttgccc tgcgtgctta tgccagcctg gcaaccagcg ccgacaaagg
5220cgcggtgcgc gataaatcga aactgggggg ttaaacgcgt gctagaggca
tcaaataaaa 5280cgaaaggctc agtcgaaaga ctgggccttt cgttttatct
gttgtttgtc ggtgaacgct 5340ctcctgagta ggacaaatcc gccgccctag
acctagggga tatattccgc ttcctcgctc 5400actgactcgc tacgctcggt
cgttcgactg cggcgagcgg aaatggctta cgaacggggc 5460ggagatttcc
tggaagatgc caggaagata cttaacaggg aagtgagagg gccgcggcaa
5520agccgttttt ccataggctc cgcccccctg acaagcatca cgaaatctga
cgctcaaatc 5580agtggtggcg aaacccgaca ggactataaa gataccaggc
gtttccccct ggcggctccc 5640tcgtgcgctc tcctgttcct gcctttcggt
ttaccggtgt cattccgctg ttatggccgc 5700gtttgtctca ttccacgcct
gacactcagt tccgggtagg cagttcgctc caagctggac 5760tgtatgcacg
aaccccccgt tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt
5820gagtccaacc cggaaagaca tgcaaaagca ccactggcag cagccactgg
taattgattt 5880agaggagtta gtcttgaagt catgcgccgg ttaaggctaa
actgaaagga caagttttgg 5940tgactgcgct cctccaagcc agttacctcg
gttcaaagag ttggtagctc agagaacctt 6000cgaaaaaccg ccctgcaagg
cggttttttc gttttcagag caagagatta cgcgcagacc 6060aaaacgatct
caagaagatc atcttattaa tcagataaaa tatttctaga tttcagtgca
6120atttatctct tcaaatgtag cacctgaagt cagccccata cgatataagt
tgttactagt 6180gcttggattc tcaccaataa aaaacgcccg gcggcaaccg
agcgttctga acaaatccag 6240atggagttct gaggtcatta ctggatctat
caacaggagt ccaagcgagc tctcgaaccc 6300cagagtcccg ctcagaagaa
ctcgtcaaga aggcgataga aggcgatgcg ctgcgaatcg 6360ggagcggcga
taccgtaaag cacgaggaag cggtcagccc attcgccgcc aagctcttca
6420gcaatatcac gggtagccaa cgctatgtcc tgatagcggt ccgccacacc
cagccggcca 6480cagtcgatga
atccagaaaa gcggccattt tccaccatga tattcggcaa gcaggcatcg
6540ccatgggtca cgacgagatc ctcgccgtcg ggcatgcgcg ccttgagcct
ggcgaacagt 6600tcggctggcg cgagcccctg atgctcttcg tccagatcat
cctgatcgac aagaccggct 6660tccatccgag tacgtgctcg ctcgatgcga
tgtttcgctt ggtggtcgaa tgggcaggta 6720gccggatcaa gcgtatgcag
ccgccgcatt gcatcagcca tgatggatac tttctcggca 6780ggagcaaggt
gagatgacag gagatcctgc cccggcactt cgcccaatag cagccagtcc
6840cttcccgctt cagtgacaac gtcgagcaca gctgcgcaag gaacgcccgt
cgtggccagc 6900cacgatagcc gcgctgcctc gtcctgcagt tcattcaggg
caccggacag gtcggtcttg 6960acaaaaagaa ccgggcgccc ctgcgctgac
agccggaaca cggcggcatc agagcagccg 7020attgtctgtt gtgcccagtc
atagccgaat agcctctcca cccaagcggc cggagaacct 7080gcgtgcaatc
catcttgttc aatcatgcga aacgatcctc atcctgtctc ttgatcagat
7140cttgatcccc tgcgccatca gatccttggc ggcaagaaag ccatccagtt
tactttgcag 7200ggcttcccaa ccttaccaga gggcgcccca gctggcaatt ccgacgtc
72483545DNAArtificial SequenceSynthetic primer 35gaagcagctc
cagcctacac cctactcagg agagcgttca ccgac 45
* * * * *
References