U.S. patent application number 14/441713 was filed with the patent office on 2015-10-29 for non-viral vector.
The applicant listed for this patent is UNIVERSITY COLLEGE CORK. Invention is credited to Patrick Forde, Gerald O'Sullivan, Declan Soden.
Application Number | 20150307897 14/441713 |
Document ID | / |
Family ID | 47470283 |
Filed Date | 2015-10-29 |
United States Patent
Application |
20150307897 |
Kind Code |
A1 |
Soden; Declan ; et
al. |
October 29, 2015 |
NON-VIRAL VECTOR
Abstract
The present invention provides a non-viral vector which
comprises a sequence encoding an RNA replicase and a nuclear
localisation sequence. The vector may also comprise a nucleotide
sequence of interest (NOI). The vector may be used to deliver an
NOI to a target cell.
Inventors: |
Soden; Declan; (Cork,
IE) ; O'Sullivan; Gerald; (Cork, IE) ; Forde;
Patrick; (Cork, IE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
UNIVERSITY COLLEGE CORK |
Cork |
|
IE |
|
|
Family ID: |
47470283 |
Appl. No.: |
14/441713 |
Filed: |
November 7, 2013 |
PCT Filed: |
November 7, 2013 |
PCT NO: |
PCT/IB2013/059968 |
371 Date: |
May 8, 2015 |
Current U.S.
Class: |
514/44R ;
435/320.1; 435/375 |
Current CPC
Class: |
C07K 14/521 20130101;
C12N 2800/70 20130101; C07K 14/535 20130101; C12N 15/85 20130101;
C12N 2830/008 20130101; A01K 2217/072 20130101; C07K 14/52
20130101; A01K 67/0278 20130101 |
International
Class: |
C12N 15/85 20060101
C12N015/85; C07K 14/535 20060101 C07K014/535; C07K 14/52 20060101
C07K014/52 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 8, 2012 |
GB |
1220119.0 |
Claims
1. A non-viral vector which comprises a sequence encoding an RNA
replicase and a nuclear localisation sequence (NLS).
2. A vector according to claim 1, wherein the RNA replicase
comprises a viral RNA replicase.
3. A vector according to claim 2, wherein the RNA replicase is
derivable from Semliki Forest virus.
4. A vector according to claim 3, wherein the sequence encoding the
RNA replicase comprises non-structural proteins 1-4 of Semliki
Forest virus.
5. A vector according to claim 1, wherein the NLS comprises
sequence according to SEQ ID NO: 1 or a variant thereof having at
least 70% identity.
6. A vector according to claim 1 which also comprises a nucleotide
sequence of interest (NOI).
7. A vector according to claim 6, wherein the NOI comprises a
therapeutic gene.
8. A vector according to claim 6, wherein the NOI encodes a
cytokine.
9. A vector according to claim 8, wherein the NOI encodes
GM-CSF.
10. A vector according to claim 6, which encodes a chemokine.
11. A vector according to claim 6, wherein the NOI comprises an
miRNA or shRNA.
12. A vector according to claim 6, wherein the NOI encodes all or
part of an antigen.
13. A vector according to claim 1 which also comprises a cell- or
tissue-specific promoter.
14. A method for expressing a NOI in a target cell, which comprises
the step of delivering the NOI to the target cell using a vector
according to claim 6.
15. A method according to claim 14, wherein the RNA replicase
causes replication of nucleotide of interest in the cytoplasm of
the target cell.
16. A method for treating or preventing a disease which comprises
the step of administering a vector according to claim 1 to a
subject.
17. A method according to claim 16, wherein the vector causes
expression of the RNA replicase in a target cell in the subject
which leads to cytolysis of the target cell because the RNA
replicase over-rides the endogenous cellular machinery for
replication.
18. A method according to claim 16, wherein the vector also
comprises a nucleotide sequence of interest (NOI), and wherein
expression of the NOI down-regulates the production and/or activity
of T regulatory cells.
19. A method according to claim 16, wherein the disease is a
cancer.
20.-21. (canceled)
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a non-viral vector which
may be used for delivery of a nucleic acid sequence.
BACKGROUND TO THE INVENTION
[0002] A vector is a tool that allows or facilitates the transfer
of a nucleic acid sequence into a target cell. For a cell to
express an exogenous DNA sequence, it must be delivered to the
nucleus, whereupon it is transcribed by the host transcriptional
machinery. The ability to induce a target cell to express exogenous
sequence is an essential tool of biomedical research and offers
potential as a therapeutic strategy through gene therapy.
[0003] Vectors for genetic delivery may be non-viral or based on a
viral system.
[0004] Non-viral gene delivery includes plasmids that are
introduced into target cells through a variety of transfection
methods including electroporation, lipofection, ultrasound and
nanoparticle delivery. Each of these transfection strategies aims
to facilitate the transportation of the plasmid across the plasma
membrane, for example electroporation causes transient disruptions
in the integrity of the membrane allowing the plasmid to enter into
the cell whilst lipofection packages the plasmid into small lipid
particles which are internalised into the cell. In order for the
plasmid to be transcribed each must successfully enter the nucleus
of a target cell. In practice, however, plasmids enter the nucleus
at a very low efficiency, often leading to lower levels of
exogenous gene expression than are desired.
[0005] Viral-based gene delivery via transduction allows both
efficient delivery and expression of exogenous genetic material.
The virus life cycle, consisting of gaining entry to a target cell,
delivering viral genetic material and hijacking the host
biochemical processes to facilitate the expression of viral
proteins, is well-suited for manipulation to enable the expression
of exogenous genetic material via the insertion of selected nucleic
acid sequences into the viral genome. A variety of virus classes
have been utilised as genetic vectors, including retroviruses and
lentiviruses.
[0006] Both retroviruses and lentiviruses contain an RNA-based
genome that is converted to DNA by a viral-encoded reverse
transcriptase before being integrated into the host genome by an
integrase enzyme. Once integrated into the host genome the viral
genetic sequence, now termed a pro-virus, is transcribed by the
host transcriptional machinery. In addition, because the pro-virus
is integrated into the host genome, it is replicated as host
genomic sequence and retained in the progeny following cell
division. This feature makes the use of retroviruses and
lentiviruses favoured in basic research as the prolonged
manipulation of gene expression can be achieved. Integration into
the host genome can, however, have adverse consequences including
integration into genomic sites which may not be permissive of
transcription, sites which may disrupt the sequence of essential
host genes or sites which lead to transformation of the target
cell. This unpredictability of pro-virus integration into the host
genome is a particular concern for the use of these viral vectors
in gene therapy approaches.
[0007] All viral vectors, including retroviruses, lentiviruses and
other classes such as adenoviruses, are associated with immunogenic
effects when utilised in gene therapy due to their inherent
interaction with the host immune system. In addition the use of
viral vectors is accompanied by general safety concerns, for
example although all viruses must be inactivated before use there
is the possibility that the viral vectors may regain replicative
capacity, and as such they are general considered more hazardous in
comparison to non-viral based vectors.
[0008] There is thus a need for alternative vectors for gene
delivery which is not associated with the shortcoming of either
conventional plasmid vectors or viral vectors.
DESCRIPTION OF THE FIGURES
[0009] FIG. 1 is a schematic diagram comparing the process of mRNA
production from the pEEV to a conventional DNA plasmid.
[0010] FIG. 2 is a graph showing the relative luciferase levels
assayed following expression of a luciferase gene encoded in the
pEEV plasmid or a conventional DNA plasmid in a cell-free
cytoplasmic extract.
[0011] FIG. 3A is a graph demonstrating the relative levels of mRNA
derived from a pEEV-encoded lacZ transgene in a variety of murine
tissues compared to a conventional pCMV plasmid.
[0012] FIG. 3B demonstrates in situ hybridization staining to
assess .beta.-Galactosidase protein expression as an assay of pEEV
or pCMV-encoded lacZ transgene expression in a variety of porcine
tissues.
[0013] FIG. 4 is a graph showing the effects of expression of a
non-therapeutic lacZ transgene from pEEV on (A) tumour volume and
(B) survival in a CT26 tumour model.
[0014] FIG. 5 demonstrates TUNEL staining to assess the effect of
expression of a non-therapeutic lacZ transgene from pEEV in CT26
tumours.
[0015] FIG. 6 is a graph showing the effect of pEEV-GM-CSF/b71
transfection on (A) tumour growth and (B) survival rate in a B16F10
mouse melanoma model.
[0016] FIG. 7 is a panel of graphs indicating the effect of
pEEV-GM-CSF/b71 transfection in inflammatory cell abundance in both
the localised tumour environment and the spleen of a B16F10 mouse
melanoma model.
[0017] FIG. 8 is a graph showing the effects of pEEV-GM-CSF/b71
transfection on immune memory.
[0018] FIG. 9--Therapeutic effect on established solid tumours.
Representative CT26 tumour growth curve. Each Balb/C mouse was
subcutaneously injected with 1.times.10.sup.6 CT26 cells in the
flank. When tumours reached an approximate size of 100 mm.sup.3
they were treated with pMG (.box-solid.), pGT141GmCSF-b7.1
(.tangle-solidup.), pEEV () and pEEVGmCSF-b7.1 (.diamond-solid.) or
untreated ( ). 6 mice/groups were used and the experiment was
performed twice. Tumour volume was calculated using the formula
V=ab.sup.2/6. Data is presented as the means.+-.standard error of
the mean. It was observed the pEEVGmCSF-b7.1 therapy delayed the
growth of the tumours most effectively in comparison to the other
groups. 17 days post treatment pEEVGmCSF-b7.1 significantly delayed
tumour growth compared to untreated tumour (***P<0.0004)
standard therapy vector pGT141GmCSF-b7.1**P<0.002. (B)
Representative Kaplan-Meier survival curve of CT26 treated tumours
was measured. Only mice treated with pEEVGmCSF-b7.1 survived. 66%
of mice survived up to 150 days. All other groups were sacrificed
by day 36 (C) Representative growth curve of B16F10 tumour. Each
C57BL/6J was subcutaneously injected with 2.times.10.sup.5 B16F10
cells in the flank of the mice. When the tumours grew to an
approximate size of 100 mm.sup.3 they were treated with pMG
(.box-solid.), pGT141GmCSF-b7.1 (.tangle-solidup.), pEEV () and
pEEVGmCSF-b7.1 (.diamond-solid.) or untreated ( ). 6 mice/groups
were used and the experiment was performed twice. 12 days post
treatment pEEVGmCSF-b7.1 significantly delayed tumour growth
compared to untreated tumour (**P<0.0001) standard therapy
vector pGT141 GmCSF-b7.1 (*P<0.0001). (D) Representative
Kaplan-Meier survival curve of B16F10 showing pEEVGmCSF-b7.1 had
100% survival up to 150 days post treatment with all other groups
sacrificed by day 28. Similar results were obtained in two
independent experiments.
[0019] FIG. 10--Percentage of immune cells in tumour and spleen 72
hours post treatment. FIG. 10a Cells were isolated from CT26
tumours and spleens from treated, untreated or healthy control
Balb/C mice. They were analysed by flow cytometry in which 20,000
events were recorded. Data represents the mean percentage of
CD19.sup.+ (B cells), DX5.sup.+/CD3.sup.+ (NKT cells),
DX5.sup.+/CD3.sup.- (NK cells), CD11c.sup.+ (DC cells), F4/80.sup.+
(Macrophage cells), CD4.sup.+ and CD8.sup.+ (T cells) positive
cells at the time of analysis (48 hours) post treatment. Error bars
show SD from between 4 mice. The asterisks (*) indicate significant
values of *P<0.05, **P<0.01, ***P<0.001 as determined by
one-way ANOVA following Bonferroni's multiple comparison
pEEVGmCSF-b7.1 compared to untreated tumour. The asterisks ( )
indicate significance values of *P<0.05, **P<0.01,
***P<0.001 as determined by one-way ANOVA following Bonferroni's
multiple comparison of pEEVGmCSF-b7.1 compared to the standard
vector pGT141GmCSF-b7.1. Similar results were obtained in two
independent experiments.
[0020] FIG. 11--Percentage of the respective T cells found locally
at the site of the B16F10 tumours treated with pMG, pEEV,
pGT141GmCSF-b7.1, and pEEVGmCSF-b7.1 or untreated (a) Represents
data obtained for the CD4.sup.+CD25.sup.+FoxP3.sup.+ cells (b)
CD4.sup.+CD25.sup.-FoxP3.sup.+ cells (c) CD8.sup.+FoxP3.sup.+. Data
represents the mean of the respective cells. Error bars show SD
from 4 animals. The asterisks (*) indicate significant values of
*P<0.05 as determined by one-way ANOVA following Bonferroni's
multiple comparison pEEVGmCSF-b7.1 compared to untreated tumour.
The asterisks ( ) indicate significance values of *P<0.05 as
determined by one-way ANOVA following Bonferroni's multiple
comparison of pEEVGmCSF-b7.1 compared to the standard vector
pGT141GmCSF-b7.1. Similar results were obtained in two independent
experiments.
[0021] FIG. 12--Cytokine levels (IFN-.gamma., IL-10, IL-12 and
TNF-.alpha.) as measured from tumour and spleens isolated from
B16F10 tumour challenged treated, untreated and healthy mice. The
error bars represent the mean of 4 individual mice.+-.the SEM. The
significance of differences was determined by one-way ANOVA
following Bonferroni's multiple comparison (*P<0.05,
**P<0.01, ***P<0.001 untreated versus pEEVGmCSF-b7.1 and
*P<0.05, **P<0.01, ***P<0.001 pGT141GmCSF-b7.1 versus
pEEVGmCSF-b7.1. Similar results were obtained in two independent
experiments.
[0022] FIG. 13--Cytotoxicity of NK and B cells in tumour and
spleens of treated mice. Data represents the mean of the respective
cells. Error bars show SD from 4 animals. The asterisks (*)
indicate significant values of *P<0.05, **P<0.01,
***P<0.001 as determined by one-way ANOVA following Bonferroni's
multiple comparison pEEVGmCSF-b7.1 compared to untreated tumour.
The asterisks ( ) indicate significance values of **P<0.01 and
***P<0.001 as determined by one-way ANOVA following Bonferroni's
multiple comparison of pEEVGmCSF-b7.1 compared to the untreated
groups. Similar results were obtained in two independent
experiments.
[0023] FIG. 14--Tumour protection, cytotoxicity and immune memory.
a. Tumour protection was observed in the pEEVGmCSF-b7.1 treated
CT26 mice when challenged (s.c.) with 1.times.10.sup.6 tumour cells
(n=6/group) in the left flanks. `Cured` and naive mice were
challenged with CT26 and 4T1 tumour cells. T-hese mice were
observed for tumour development. 100% survival was observed in the
CT26 cured mice challenged with CT26. All other groups were
sacrificed due to tumour burden by day 25. Similar results were
obtained in two independent experiments. b. Augmentation of the in
vitro cytolytic activities of the spleen after pEEVGmCSF-b7.1
treatment of CT26 tumours, the specific cytotoxicity was greatest
at an effector target ratio of 50:1 after 48 hours incubation.
Groups included CT26, 4T1 cells, and Naive and `CT26 cured`
splenocytes incubated with CT26 and 4T1 cells respectively. The
highest cytotoxicity was observed in the CT26 cells incubated with
splenocytes obtained from `CT26 cure` mice treated with
pEEVGmCSF-b7.1. The data shown represents one of two separate
experiments with similar results (n=6/group). c. Adoptive transfer
of lymphocytes of CT26 study. Mice (n=6) received s.c., injections
of a mixture of mice receiving CT26 cells and splenocytes either
from cured or naive mice, a mixture of 4T1 cells and splenocytes
either from cured or naive mice, CT26 cells only or 4T1 cells only.
All mice receiving mixtures of CT26 cells and splenocytes either
from cured from pEEVGmCSF-b7.1 treatment survived up to 150 days
whereas tumours developed in all animals within the other groups.
d. Interferon gamma production measured from supernatents obtained
from stimulated splenocytes collected from adoptive transfer
survivors and naive animals and IFN-.gamma. was measured. High
levels of IFN-.gamma. were produced by pEEVGmCSF-b7.1 treated mice.
The y-axis represents the concentration of IFN-.gamma. in pg/ml of
the supernatant from the stimulated splenocytes. Error bars show SD
from 6 animals. e. Tumour protection was observed in the
pEEVGmCSF-b7.1 treated B16F10 mice when challenged (s.c.) with
2.times.10.sup.5 tumour cells (n=6/group) in the left flanks.
`Cured` and naive mice were challenged with B16F10 and Lewis lung
tumour cells. These mice were observed for tumour development. 100%
survival was observed in the B16F10 cured mice challenged with
B16F10. All other groups were sacrificed due to tumour burden by
day 28. Similar results were obtained in two independent
experiments. f. Augmentation of the in vitro cytolytic activities
of the spleen after pEEVGmCSF-b7.1 treatment of B16F10 tumours, the
specific cytotoxicity was greatest at an effector target ratio of
50:1 after 48 hours incubation. Groups included B16F10, Lewis lung
cells, and Naive and `B16F10 cured` splenocytes incubated with
B16F10 and Lewis lung cells respectively. The highest cytotoxicity
was observed in the B16F10 cells incubated with splenocytes
obtained from `B16F10 cure` mice treated with pEEVGmCSF-b7.1. The
data shown represents one of two separate experiments with similar
results (n=6/group). g. Adoptive transfer of lymphocytes of B16F10
study. Mice (n=6) received s.c., injections of a mixture of mice
receiving B16F10 cells and splenocytes either from cured or naive
mice, a mixture of Lewis lung cells and splenocytes either from
cured or naive mice, B16F10 cells only or Lewis lung cells only.
All mice receiving mixtures of B16F10 cells and splenocytes either
from cured from pEEVGmCSF-b7.1 treatment survived up to 150 days
whereas tumours developed in all animals within the other groups.
h. Interferon gamma production measured from supernatents obtained
from stimulated splenocytes collected from adoptive transfer
survivors and naive animals and IFN-.gamma. was measured. High
levels of IFN-.gamma. were produced by pEEVGmCSF-b7.1 treated mice.
The y-axis represents the concentration of IFN-.gamma. in pg/ml of
the supernatant from the stimulated splenocytes. Error bars show SD
from 6 animals.
SUMMARY OF ASPECTS OF THE INVENTION
[0024] The present inventors have developed an enhanced expression
vector (EEV) which is a non-viral vector, such as a plasmid, which
comprises a sequence encoding an RNA replicase. The RNA replicase
is capable of replicating the transcribed plasmid in the cytoplasm
of a transfected cell, resulting in considerably higher levels of
expression that a conventional plasmid vector.
[0025] The present inventors have found that the level of
expression can be further increased through the inclusion of a
nuclear targeting sequence in the vector.
[0026] Thus, in a first aspect, the present invention provides a
non-viral vector which comprises a sequence encoding an RNA
replicase and a nuclear localisation sequence (NLS).
[0027] The RNA replicase may be a viral RNA replicase, such as one
derivable from Semliki Forest virus. The RNA replicase may comprise
non-structural proteins 1-4 of Semliki Forest virus.
[0028] The NLS may comprise a sequence according to SEQ ID No. 1 or
a variant thereof having at least 70% identity.
[0029] The vector may also comprise a nucleotide sequence of
interest (NOI) which may, for example be a therapeutic gene.
[0030] The NOI may encode a protein of interest such as a cytokine,
chemokine or antigen.
[0031] The NOI may encode GM-CSF and/or b71.
[0032] The NOI may be or comprise an miRNA or shRNA.
[0033] The vector may also comprise a cell-, site- or
tissue-specific promoter.
[0034] In a second aspect, the present invention provides method
for expressing a NOI in a target cell, which comprises the step of
delivering the NOI to the target cell using a vector according to
the first aspect of the invention.
[0035] Once expressed within the cell the RNA replicase may cause
replication of the vector and/or the nucleotide of interest in the
cytoplasm of the target cell.
[0036] In a third aspect, the present invention provides a method
for treating or preventing a disease which comprises the step of
administering a vector according to the first aspect of the
invention to a subject.
[0037] The vector may cause exhaustion, cytolysis or apoptosis of
the target cell. This may be due to the RNA replicase over-riding
the endogenous cellular machinery for replication causing continued
RNA production.
[0038] Expression of the NOI in target cells of a subject may
down-regulate the production and/or activity of T regulatory cells
in the subject.
[0039] The disease may be a cancer.
[0040] In a fourth aspect, the present invention provides a vector
according to the first aspect of the invention for use in treating
cancer.
[0041] In a fifth aspect, the present invention provides the use of
a vector according to the first aspect of the invention in the
manufacture of a medicament for use in treating cancer.
[0042] The enhanced efficiency vector described herein thus
facilitates high levels of expression from a safe, non-viral
vector. The inclusion of an RNA replicase facilitates replicative
amplification of vector derived mRNA, meaning that only one copy of
the vector must reach the nucleus of the target cell in order to
give rise to high levels of transgene expression from the vector
(FIG. 1). The presence of a nuclear localisation sequence further
enhances expression levels.
DETAILED DESCRIPTION
[0043] Vector
[0044] In the first aspect, the present invention provides a
vector.
[0045] A vector is an agent capable of delivering or maintaining
nucleic acid in a host cell. The term includes plasmids, naked
nucleic acids, nucleic acids complexed with polypeptide or other
molecules and nucleic acids immobilised onto solid phase particles.
The vector of the present invention may be a plasmid, in particular
a DNA plasmid.
[0046] The vector is a non-viral vector, in that it is not based on
a virus. It does not include any viral components in order for the
vector to gain entry into the cell.
[0047] The non-viral vector may comprise a sequence encoding a
viral RNA replicase. The viral replicase sequence may be the only
viral-derived sequence in the vector.
[0048] RNA Replicase
[0049] An RNA replicase is an entity, such an enzyme, capable of
replicating RNA. An RNA replicase may catalyse the replication of
RNA from a single-stranded RNA template. An RNA replicase can also
be referred to as an RNA-dependent RNA polymerase.
[0050] The replicase may be wholly or partly derivable from a viral
RNA replicase.
[0051] Viruses with an RNA genome contain or encode an RNA
replicase to facilitate genomic replication and are classified
based upon the precise nature of the RNA that constitutes their
genome. RNA can either be positive-strand RNA (RNA(+)) or
negative-strand RNA (RNA(-)). RNA(+) (5' to 3') signifies that a
particular RNA sequence may be directly translated into protein.
Therefore, in RNA(+) viruses, the viral genome can be considered
viral mRNA and can be immediately translated by the host cell.
RNA(-) (3' to 5') is complementary to the required mRNA and thus
must be converted to positive-sense RNA by an RNA-dependent RNA
polymerase prior to translation. Therefore, like DNA, this RNA
cannot be translated into protein directly.
[0052] The RNA replicase sequence of the present invention may be
derived from non-structural protein (nsp)-1, nsp-2, nsp-3 and nsp-4
of the Semliki Forest Virus (SFV). SFV is an RNA(+) alphavirus with
an icosahedral capsid, enveloped by a lipid bilayer derived from
the host cell. The RNA(+) genome of SFV contains a 5' terminal cap,
a 3' terminal poly(A) tail and nine functional proteins which are
derived from two open-reading frames. The 5' two-thirds of the
genome are encode polypeptide P1234, from which the nsp-1, nsp-2,
nsp-3 and nsp-4 proteins are cleaved, whilst the remaining genome
contains structural polypeptides. SFV infects a host cell via
receptor-mediated endocytosis followed by membrane fusion
stimulated by low-pH, which allows the release of the capsid into
the cytoplasm. The liberated capsid is disassembled by ribosomes,
resulting in the release of the RNA genome, which is used directly
as mRNA to facilitate the synthesis of the non-structural
polyprotein (P1234). The polyprotein is autocatalytically processed
by the protease activity of nsp-2 to generate the individual
components of the SFV RNA replicase, nsp-1, nsp-2, nsp-3 and
nsp-4.
[0053] The replicative mechanism of the SFV RNA(+) genome consists
of a two-step process and occurs in association with specific
cytopathic vacuoles. Initially, the RNA(+) template is converted to
an RNA(-) intermediary via the action of partly uncleaved
polyprotein P123 and free nsp-4. The RNA(-) intermediary acts as a
template for the synthesis of multiple copies of the RNA(+) genome,
a process that is performed by completely cleaved nsp-1, nsp-2,
nsp-3 and nsp-4.
[0054] Nuclear Localisation Sequence (NLS)
[0055] The vector of the first aspect of the present invention
comprises a nuclear localisation sequence (NLS).
[0056] An NLS is a nucleic acid sequence that facilitates the
transport of a nucleic acid sequence into the nucleus of a target
cell.
[0057] DNA plasmids utilised in molecular biology and gene therapy
are often too large to enter into the nucleus via passive diffusion
and therefore require active uptake via proteins such as
importin-.alpha., importin-.beta. or transportin. Sequences
facilitating the active uptake of DNA into the nucleus are known
within the art, an example of which in an enhancer region within
the Simian Virus 40 (SV40) viral DNA.
[0058] The NLS increases the efficiency with which the vector
enters into the nucleus of a target cell.
[0059] The inclusion of a nuclear localisation sequence (NLS)
enables the vector to gain entry into the nucleus at an efficiency
that is far superior to that of a conventional plasmid. This speeds
up the process of entry and removes any blockades from the packed
cytoplasm that the plasmid must go through in order to gain entry
into the nucleus.
[0060] The NLS may comprise the sequence shown as SEQ ID 1 or a
variant thereof.
TABLE-US-00001 SEQ ID No. 1
CACATAACGGGAGGGCCGGCGGTTACCAGGTCGACGGATATGACGGCAGG
[0061] Here, the term "variant" means an nucleic acid sequence
having a certain identity with the sequence shown as SEQ ID No.
1.
[0062] In the present context, a variant sequence is taken to
include an NLS which is at least 70, 75, 85 or 90% identical, maybe
at least 95 or 98% identical to the sequence shown as SEQ ID No. 1.
The variant sequence act as an NLS, i.e. retains the capacity of
SEQ ID No. 1 to direct a nucleic acid to the nucleus.
[0063] Identity comparisons can be conducted by eye, or more
usually, with the aid of readily available sequence comparison
programs. These commercially available computer programs can
calculate % identity between two or more sequences. A suitable
computer program for carrying out such an alignment is the GCG
Wisconsin Bestfit package (University of Wisconsin, U.S.A.;
Devereux et al., 1984, Nucleic Acids Research 12:387). Examples of
other software than can perform sequence comparisons include, but
are not limited to, the BLAST package (see Ausubel et al., 1999
ibid--Chapter 18), FASTA (Atschul et al., 1990, J. Mol. Biol.,
403-410) and the GENEWORKS suite of comparison tools. Both BLAST
and FASTA are available for offline and online searching.
[0064] Once the software has produced an optimal alignment, it is
possible to calculate % identity. The software typically does this
as part of the sequence comparison and generates a numerical
result.
[0065] Nucleotide Sequence Of Interest (NOI)
[0066] The vector of the invention may comprise a nucleotide of
interest (NOI).
[0067] The NOI may encode a protein of interest (POI).
[0068] The NOI may be a DNA or RNA sequence. The NOI may be a whole
gene or part of a gene.
[0069] The NOI may be a therapeutic or prophylactic gene. The NOI
may encode a therapeutic or propylactic protein.
[0070] The NOI may be an anti-cancer gene or encode an anti-cancer
protein.
[0071] A therapeutic gene or protein is expressed within a subject
having an existing disease or condition in order to lessen, reduce
or improve at least one symptom associated with the disease and/or
to slow down, reduce or block the progression of the disease.
[0072] A prophylactic gene or protein is expressed within a subject
who has not yet contracted the disease and/or who is not showing
any symptoms of the disease to prevent or impair the cause of the
disease or to reduce or prevent development of at least one symptom
associated with the disease.
[0073] The NOI may encode a cytokine, chemokine or antigen.
[0074] Cytokine
[0075] A cytokine is a cell-signalling molecule involved in the
generation or maintenance of an immune response.
[0076] Examples of cytokines include, but are not limited to,
interleukin (IL)-2, IL-4, IL-5, IL-10, IL-12, IL-13, IL-17, IL-25,
TNF.alpha., GM-CSF, IFN.alpha., IFN.beta. and IFN.lamda..
[0077] Granulocyte-macrophage colony stimulating factor (GM-CSF) is
a cytokine that known to be secreted by macrophages, T cells, mast
cells, NK cells, endothelial cells and fibroblasts. It functions as
growth factor stimulating the differentiation of pluripotent
hematopoietic stem cells to myeloid stem cells and is required for
the development and function of cells throughout the myeloid
lineage, including eosinophils, basophils and monocytes.
[0078] The vector of the present invention may comprise a nucleic
acid sequence encoding for all, or part of, GM-CSF.
[0079] Chemokine
[0080] A chemokine is a protein associated with the immune system,
which is secreted by a cell and is capable of inducing the
chemotaxis of cells expressing a receptor recognising the given
chemokine.
[0081] Example of chemokines include, but are not limited to, CCL1,
CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CXCL1,
CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10.
[0082] b71
[0083] b71 is also referred to as CD80. It is a protein found on
activated B cells and monocytes that provides a co-stimulatory
signal necessary for T cell activation and survival. It is the
ligand for two different proteins on the T cell surface: CD28 (for
autoregulation and intercellular association) and CTLA-4 (for
attenuation of regulation and cellular disassociation).
[0084] The vector of the present invention may therefore contain a
nucleic acid sequence encoding for all, or part of, the b71
protein.
[0085] The vector may comprise a nucleic acid sequence that encodes
for GM-CSF and b71.
[0086] miRNA/shRNA
[0087] The NOI may affect the expression or activity of another
molecule, such as a nucleic acid molecule or protein within the
target cell. The NOI may, for example be or comprise anti-sense
RNA, miRNA or shRNA.
[0088] microRNAs (miRNAs) are short non-protein coding RNA
molecules (commonly 21-25 nucleotides in length) which are capable
of mediating the post-transcriptional regulation of target mRNAs
through RNA interference (RNAi) via a mechanism of partially
complementary base-pairing. They are generally defined through a
natural occurrence in the genome of an organism and generation
through a biogenesis pathway involving the actions of the Drosha
and Dicer enzyme complexes.
[0089] miRNA-mediated RNAi may involve decreasing the level of
protein derived from a target mRNA via mechanisms involving either
inhibiting or decreasing the efficiency of translation or through
direct mRNA degradation. miRNAs may also act to increase the
expression of certain proteins.
[0090] Short hairpin RNAs (shRNAs) are nucleic acid sequences that
generate an RNA molecule containing a hairpin turn and can be used
to silence target gene expression via RNAi.
[0091] shRNAs are generally distinguished from miRNAs by the use of
nucleic acid sequences that differ from those identified within the
genome of organisms.
[0092] Antigen
[0093] The term "antigen" means an entity that is recognised by
(i.e. binds specifically) a T-cell receptor and/or antibody.
[0094] An antigen may be a complete molecule, or a fragment
thereof. The antigen may be, or be derivable from, a naturally
occurring molecule.
[0095] The vector may act as a vaccine, causing expression of the
antigen in vivo which leads to an anti-antigen immune respone.
[0096] Where the vector is for use in the treatment of cancer, the
nucleic acid sequence may encode all or part of a tumour associated
antigen (TAA).
[0097] Where the vector is used to treat or prevent an autoimmune
disease, the antigen may be an autoantigen. Where the vector is
used to treat or prevent an allergic condition, the antigen may be
an allergen.
[0098] Promoter
[0099] A promoter element refers to a sequence of nucleic acids
that acts to recruit specific combinations of RNA polymerase,
transcription factors and co-factors in order that the
transcription of a downstream entity, such as a gene, be
co-ordinated and facilitated.
[0100] The vector of the invention may comprise a mammalian
promoter, so that it is transcribed in a mammalian target cell.
[0101] The promoter may be site, tissue or cell-specific. The
promoter may be specific for a cancer cell.
[0102] Strong promoters include those derived from the genomes of
viruses--such as polyoma virus, adenovirus, fowlpox virus, bovine
papilloma virus, avian sarcoma virus, cytomegalovirus (CMV),
retrovirus and SV40--or from heterologous mammalian promoters--such
as the actin promoter or ribosomal protein promoter. Transcription
of a gene may be further increased by inserting an enhancer
sequence in to the vector. Enhancers are relatively position and
orientation independent and be included in the vector at a position
5' or 3' to the promoter.
[0103] The promoter can additionally include features to ensure or
to increase expression in a suitable host. For example, the
features can be conserved regions e.g. a TATA box. The promoter may
even contain other sequences to affect (such as to maintain,
enhance, decrease) the levels of expression of a nucleotide
sequence. Suitable other sequences include the Sh1-intron or an ADH
intron. Other sequences include inducible elements--such as
temperature, chemical, light or stress inducible elements. Also,
suitable elements to enhance transcription or translation may be
present.
[0104] The promoter may, for example, be constitutive or tissue
specific.
[0105] Examples of constitutive promoters include CMV promoter, RSV
promoter, phosphoglycerate kinase (PGK) and thymidine kinase (TK)
promoter.
[0106] Examples of tissue specific promoters include Synapsin 1,
Enolase, .alpha.-calcium/calmodulin-dependent protein kinase II and
GFAP.
[0107] Method of Delivery
[0108] In a second aspect, the present invention provides a method
for expressing a NOI in a target cell, which comprises the step of
delivering the NOI to the target cell using a vector according to
the first aspect of the invention.
[0109] Once the vector has been transcribed in the target cell the
RNA replicase causes replication of the vector in the cytoplasm of
the target cell. The RNA replicase causes replication of the NOI in
the cytoplasm of the target cell, leading to much greater levels of
expression than a conventional plasmid.
[0110] The vector may be introduced into target cells using a
variety of techniques known in the art, such as electroporation,
lipofection or nanoparticle delivery.
[0111] Cells may be transfected with the vector in vitro, ex vivo
or in vivo.
[0112] The RNA replicase and any other NOI are "expressed" in the
host cell by being produced as a result of translation, and
optionally transcription, of the nucleic acid. Thus the desired
expressed products are produced in situ in the cell.
[0113] Method of Treatment
[0114] In a third aspect, the present invention provides a method
for treating or preventing a disease which comprises the step of
administering a vector of the present invention to a subject.
[0115] The vector may causes expression of the RNA replicase in a
target cell in the subject which leads to cytolysis of the target
cell because the RNA replicase over-rides the endogenous cellular
machinery for replication. Cellular exhaustion may occur from
continued RNA production.
[0116] The NOI may also comprise a therapeutic or prophylactic
gene.
[0117] The NOI may down-regulate the production and/or activity of
T regulatory cells in the subject.
[0118] The disease may be any disease amenable to treatment by
selective downregulation or apoptosis of a population of cells, or
amenable to treatment by in vivo expression of an NOI or POI. The
disease may be an autoimmune disease, allergy or infection. The
disease may be a cancer.
[0119] The invention will now be further described by way of
Examples, which are meant to serve to assist one of ordinary skill
in the art in carrying out the invention and are not intended in
any way to limit the scope of the invention.
EXAMPLES
Example 1
An Enhanced Expression Vector (EEV) is Capable of Self-Replication
Within the Cytoplasm
[0120] An EEV plasmid containing a luciferase transgene was
incubated in a standard rabbit reticulocyte lysate cell-free system
(Promega), consisting of cytoplasmic extract free of nuclear
material, along with mRNA encoding for T7 RNA polymerase. As
standard pCMV plasmid was used as a control and luciferase
expression from each plasmid was compared. Only pEEV-luciferase
expressed functional protein, as determined by the detection of
luminescence, indicating the ability of pEEV but not pCMV to
self-express in the presence of a cytoplasmic extract. The present
inventors thus demonstrate that a pEEV vector containing an RNA
replicase is able to self-replicate and express functional
luciferase protein in a cytoplasmic extract free of nuclear
material, whilst a conventional plasmid lacks this capacity (FIG.
2).
Example 2
EEV Causes Higher Levels of Transgene Expression than a
Conventional DNA Plasmids
[0121] A range of murine tissues, including a subcutaneous tumour
(Oe19) and healthy tissue (muscle, liver and spleen), were subject
to electroporation-mediated transfection with either 20 ug pEEV or
20 ug conventional pCMV vector, both encoding a lacZ transgene.
Tissues were surgically removed after 2 days and qPCR analysis
determined that, on average, a four-fold higher level of lacZ
transgene expression was derived from the pEEV vector in comparison
to the pCMV vector (p<0.0001) across the tissues analysed (FIG.
3A).
[0122] The level of pEEV-facilitated transgene expression in a
large animal was determined by transfecting a porcine model with
either pEEV-lacZ or pCMV-lacZ via electroporation. Transgene
expression was determined via examination of .beta.-Galactosidase
expression, resulting from the expression of the LacZ transgene.
Positive .beta.-Galactosidase staining indicated that the plasmid
DNA was successfully delivered and expressed in all tissues
analysed. The expression profile of pEEV-lacZ was more abundant in
comparison to the standard pCMV plasmid in all tissues analysed,
including liver, spleen, rectum and oesophagus. No
.beta.-Galactosidase expression was detected in the negative
controls (FIG. 3B).
Example 3
pEEV-Mediated Expression of a Non-Therapeutic Sequence Results in
Cytolytic Activity.
[0123] The potential in vivo anti-tumour activity of pEEV was
determined in an established tumour model. pEEV-lacZ,
pEEV-backbone, pCMV-lacZ and pMG-backbone were transfected into
Balb/C mice bearing CT26 tumours via subcutaneous injection with 20
.mu.g of plasmid DNA followed by electroporation. Growth and
survival rates were examined and compared to untreated CT26
tumours. The pEEV plasmid bearing a non-therapeutic lacZ transgene
significantly reduced tumour volume when compared to the untreated
tumour (p<0.05) (FIG. 4A). In addition, improved survival of
mice transfected with pEEV was demonstrated (FIG. 4B).
[0124] To assess whether the pEEV vector induces apoptotic death in
vivo, Balb/C mice bearing CT26 tumours were treated with 20 .mu.g
of pEEV, pEEV-lacZ or pCMV-lacZ via subcutaneous injection followed
by electroporation. Mice were culled at 24, 48 and 72 hours post
treatment and tumours were removed for detecting in situ apoptosis
by terminal deoxynucleotidyl transferase-mediated deoxyuridine
triphosphate nick-end labelling (TUNEL) staining, which marks
apoptotic cells. TUNEL staining demonstrates that the tumours
transfected with pEEV-lacZ were abundant in apoptotic nuclei with
double-strand DNA breaks which are a hallmark of apoptosis, while
apoptosis was not evident in the pCMV treated tumours (FIG. 5).
This collective data indicates that improved survival from the
non-therapeutic pEEV is due to the oncolytic effect of pEEV.
Example 4
pEEV-Mediated Expression of GM-CSF/b71 Confers Enhanced Anti-Tumour
Activity
[0125] pEEV-GM-CSF/b71 was delivered via electroporation to a
B16F10 mouse melanoma model whereupon tumour growth and the
survival of the mice post treatment was compared to groups treated
with pMG-backbone, pEEV-backbone or pGT141-GM-CSF-b71. Only the
mice treated with the pEEV-GM-CSF/b71 were able to eradicate the
tumours, as demonstrated by the survival of 100% of mice in this
group at 150 days post-treatment (FIG. 6A). All other groups,
including those treated with the conventional vectors, were not
able to eradicate the tumours (FIG. 6B) and died from tumour
burden.
[0126] Analysis at seven days post-treatment revealed that
pEEV-GM-CSF/b71 had increased production/recruitment of
pro-inflammatory cell populations but diminished abundance of T
regulatory cells compared to the conventional vector (FIG. 7).
Under normal circumstances, T regulatory cell proportions increase
as the tumour increases in size and hamper the ability of the
host's immune system to eradicate the tumour cells. The
pEEV-GM-CSF/b71 therapy resulted in diminution of T regulatory cell
populations, both in the local tumour environment and in the
spleen, reducing the percentage of T regulatory cells in the tumour
from .about.10% in the untreated group to <5% in the
pEEV-GM-CSF/b71 group and from 4.5% to <1% in the spleen (FIG.
7). This decrease in the level of T regulatory cells was
accompanied by an increase in the recruitment of a number of
pro-inflammatory cell types, including innate NK cells and adaptive
B cells (FIG. 7).
Example 5
Successful Treatment with pEEV-GM-CSF/b71 Leads to Immunological
Memory
[0127] An established B16F10 mouse melanoma model was successfully
treated with pEEV-GM-CSF/b71 as described previously (FIG. 8).
Following the successful clearance of tumour burden, mice were
re-challenged with either the same tumour, B16F10, or a different
tumour, in the form of lewis lung cells. 100% of `B16 cured`
animals receiving B16F10 survived to Day 100, whilst 0% of lewis
lung cells inoculated `B16 cured` mice and 0% of naive mice
inoculated with B16 or lewis lung cells survived. This demonstrates
an antigen specific immune response to the B16F10 tumour (FIG.
8A).
[0128] In a subsequent experiment mice received subcutaneous
injections of either B16F10 or lewis lung cells and splenocytes
either from `B16 cured` or naive mice. All mice that were
challenged with B16F10 and received splenocytes from `B16 cured`
mice failed to grow tumours, resulting in survival past the 100
days of the experiment. In contrast, tumours developed in all other
groups (FIG. 8B).
Example 6
Investigating the Therapeutic Efficacy of pEEVGmCSF-b7.1
[0129] The purpose of this study was to investigate the therapeutic
efficacy of pEEVGmCSF-b7.1 and its comparison to a standard vector
also expressing GmCSF-b7.1. To test the therapeutic efficacy two
tumour types were treated once by electroporating the tumours with
the respective plasmids. A CT26 murine colorectal tumour and B16F10
a metastatic melanoma tumour were treated (FIG. 9) with pMG
(standard plasmid backbone), pGT141GmCSF-b7.1 (standard plasmid
therapy), pEEV (backbone) and pEEVGmCSF-b7.1. The CT26 tumour
volumes of all non-electroporated (Untreated) tumours increased
exponentially (FIG. 9a). Tumours treated with the empty plasmids,
pMG and pEEV also increased in size. The pEEV empty plasmid did
however retard the growth of the CT26 tumour during days 8-12 but
then rapidly grew exponentially. Both therapeutic plasmids delayed
the growth rate of the CT26 tumour. The pEEVGmCSF-b7.1 treated
tumours significantly inhibited growth compared to pGT141GmCSF-b7.1
treated tumours (P<0.002) and from the control untreated tumours
(P<0.0004). By day 26 post treatment the untreated, pMG and pEEV
treated groups were sacrificed due to tumour size (FIG. 9b). While
the standard therapy pGT141GmCSF-b7.1 did inhibit tumour growth all
from this group were culled by day 36. One mouse was removed on
days 36 and 45 from the pEEVGmCSF-b7.1 treated group due to ethical
size and the remaining 66% survived. The surviving mice remained
tumour free until they were sacrificed on day 150 post treatment
for subsequent immune analysis. The B16F10 melanoma cell line was
chosen for its aggressive nature to further test the efficacy of
pEEVGmCSF-b7.1 therapy. Again the experiment was set up with groups
treated with pMG, pGT141GmCSF-b7.1, pEEV and pEEVGmCSF-b7.1 (FIG.
9c). The tumour growth was similar to the CT26 growth profile with
untreated tumours growth exponentially with the first untreated
tumour sacrifice due to tumour size 12 days post treatment. The
pEEVGmCSF-b7.1 delayed the growth compared to the untreated group
(P<0.0001) and pGT141GmCSF-b7.1 (P<0.0001). The pMG, pEEV,
untreated and pGT141GmCSF-b7.1 treated groups were sacrificed by
day 28 (FIG. 9d). Interestingly the standard pGT141GmCSF-b7.1
therapy had no real effect on survival with all mice removed by day
26. The pEEVGmCSF-b7.1 therapy showing a very striking response
with 100% survival and all animals remained tumour free for 150
days post treatment until they were removed for subsequent immune
analysis.
[0130] To determine what immune cells were recruited post treatment
spleens and tumours were removed and analysed by flow cytometry. A
snap shot at 72 hour post treatment was chosen as an analysis time
point. Overall there was a global immune response observed with
both an innate and adaptive immunity involvement. As shown in FIG.
10a, the CT26 tumour challenged mice showed that CD19.sup.+,
DX5.sup.+/CD3.sup.+, DX5.sup.+/CD3.sup.- and CD8.sup.+ cells were
all significantly unregulated in the spleens of pEEVGmCSF-b7.1
treated mice. All cells examined with the exception of CD4.sup.+
cells were unregulated in the tumours of the pEEVGmCSF-b7.1 treated
mice compared to the untreated tumours. It was also observed that
pEEVGmCSF-b7.1 treated mice had significantly more splenic
CD19.sup.+ cells (P<0.05) than the standard pGT141GmCSF-b7.1
treated mice. Locally at the tumour, pEEVGmCSF-b7.1 treated mice
had significantly more CD19.sup.+ (P<0.01) DX5.sup.+/CD3.sup.-
(P<0.001) F4/80 (P<0.001) and CD8.sup.+ (P<0.001) cells
compared to the pGT141GmCSF-b7.1 treated tumours. There was no real
trend for the spleen and tumour CD4.sup.+ cells with all groups
having similar numbers of cells. Spleens from healthy mice were
also used as a comparison with CD19.sup.+, DX5.sup.+/CD3.sup.-,
CD11c, and F4/80 cells expressed higher in the treated mice than in
the healthy mice indicating an involvement of both innate and
adaptive immunity. FIG. 10b presents the B16F10 treated tumour
immune data and follows a similar trend as observed for the CT26
immune data. CD19.sup.+ (P<0.001), DX5.sup.+/CD3.sup.+
(P<0.01), DX5.sup.+/CD3.sup.- (P<0.01), CD11c.sup.+
(P<0.001), F4/80 (P<0.001) and CD8.sup.+ (P<0.001) cells
were all significantly higher for the pEEVGmCSF-b7.1 treated mice
than the untreated B16F10 tumour. In the spleens of the same
animals CD19.sup.+ (P<0.001), DX5.sup.+/CD3.sup.- (P<0.001),
DX5.sup.+/CD3.sup.- (P<0.01), CD11c.sup.+ (P<0.001), F4/80
(P<0.001) and CD8.sup.+ (P<0.001) cells again were all
significantly present in the pEEVGmCSF-b7.1 treated mice than the
untreated mice. When the standard therapy pGT141GmCSF-b7.1 was
compared to the pEEVGmCSF-b7.1 CD19.sup.+ (P<0.001),
DX5.sup.+/CD3.sup.+ (P<0.01), CD11c.sup.+ (P<0.001) and
CD8.sup.+ (P<0.001) cells were all significantly recruited
indicating pEEVGmCSF-b7.1 recruits a more superior immune
recruitment locally at the tumour site. The spleen data had a
similar trend as the tumour data with CD19.sup.+ (P<0.01),
DX5.sup.+/CD3.sup.+ (P<0.001), CD11c.sup.+ (P<0.001), F4/80
(P<0.001) and CD8.sup.+ (P<0.001) cells all up regulated in
the pEEVGmCSF-b7.1 treated mice when compared to the standard
therapy. CD19.sup.+, DX5.sup.+/CD3.sup.+, CD11c.sup.+, F4/80.sup.+
and CD8.sup.+ cells were all higher in the pEEVGmCSF-b7.1 treated
mice than the health mice spleens again indicating the involvement
of an innate and adaptive immune response to the treatment.
[0131] Suppressor T cells are well recognised as a blockade for any
cancer therapy and for this reason their presence locally was
analysed in the B16F10 tumours of the treated animals (FIG. 11).
The pEEVGmCSF-b7.1 treatment group CD4.sup.+CD25.sup.+FoxP3.sup.+
cell population was reduced significantly (P<0.01) compared to
the untreated group (FIG. 11a). The CD4.sup.+CD25FoxP3.sup.+ tumour
cells were also reduced in the pEEVGmCSF-b7.1 treated animals
compared to the untreated tumours (P<0.01) whereas there was no
change in the standard treatment. CD8.sup.+CD25.sup.+ T effector
cell population was significantly increased in the pEEVGmCSF-b7.1
treated tumours in comparison to the untreated tumour and the
standard pGT141 GmCSF-b7.1 treatment (P<0.01). The
pGT141GmCSF-b7.1 treated tumour T effector cell levels were similar
to the untreated and backbone.
[0132] The concentrations of tumour and spleen cytokines in
treated; untreated and healthy animals 72 hours post treatment were
then examined. Results are presented in FIG. 12. Tumour
concentrations of IFN-.gamma., IL-12 and IL-10 were all elevated
for the pEEVGmCSF-b7.1 treatments compared to untreated
(P<0.001), pGT141GmCSF-b7.1 (P<0.001) and all the other
groups analysed. TNF-.alpha. was also elevated for the
pEEVGmCSF-b7.1 treatments compared to untreated (P<0.01),
pGT141GmCSF-b7.1 (P<0.05) and all the other groups analysed. In
contrast the IL-10 levels were lower in the pEEVGmCSF-b7.1 when
compared to the untreated group (P<0.05) and all other groups
analysed. The spleen data had similar results with elevated levels
of IFN-.gamma., IL-12, IL-10 and decreased levels for IL-10.
[0133] Expression of NK and B cells were significantly elevated in
both tumour types of the pEEVGmCSF-b7.1 mice. The
cytoxicity/activation capability of NK and B cells in the B16F10
challenged mice was then analysed (FIG. 13). NK cells positive for
IFN-.gamma. and CD107a (degranulation marker) were significantly
higher in the pEEVGmCSF-b7.1 treated groups compared to the
untreated (P<0.001) and the pEEV control (P<0.001) tumours.
The splenic data had similar results with elevated levels of
IFN-.gamma. positive NK cells compared to the untreated and healthy
mice. B cells positive for IL-12 were also significantly higher in
the pEEVGmCSF-b7.1 treated groups.
[0134] After successful treatment with pEEVGmCSF-b7.1, both CT26
and B16F10 cured mice and naive mice were challenged to determine
tumour protection. To compare tumour growth of `cured mice`, naive
mice of same age were inoculated with the same dose of viable
tumour cells (FIGS. 14a and e). To determine tumour specific
protection a different tumour (4T1 or Lewis lung) was selected and
cured and naive mice were challenged with. Long term
tumour-specific protection was seen in the pEEVGmCSF-b7.1 treated
`cured` mice group both for the CT26 and B16F10 models, surviving
100 days post challenge. All naive mice succumbed to disease
demonstrating that there were protective immune responses in the
pEEVGmCSF-b7.1 group where zero mice developed tumours. The immune
response was antigen specific, as tumour protection was limited to
the CT26 or B16F10 and not to the previously unexposed tumours such
as 4T1 and Lewis lung cancer in the respective models. This data
suggests that the pEEVGmCSF-b7.1 treatment results in a durable
response.
[0135] The in vitro cytotoxicity of splenic T lymphocytes against
CT26 and B16F10 cells was then determined. (FIGS. 14b and f). The
splenic T lymphocytes against CT26 and B16F10 cells were
significantly greater in the pEEVGmCSF-b7.1 treated `cured` mice
than in the naive mice. To determine the specificity of the
cytotoxicity the unexposed tumours 4T1 and Lewis lung were included
for the respective model. The splenic T lymphocytes against the 4T1
and B16F10 demonstrated low % cytotoxicity. These results
correspond with the observed immunity in vivo (FIGS. 14a and
e).
[0136] The possible development of an immune mediated anti-tumour
activity following pEEVGmCSF-b7.1 was further tested by a modified
Winn assay (adoptive transfer), where groups received subcutaneous
inoculation of a mixture of CT26 or B16F10 cells and splenocytes
from pEEVGmCSF-b7.1 treated `cured` mice or naive mice, a mixture
of 4T1 or Lewis lung cells and splenocytes from pEEVGmCSF-b7.1
treated `cured` mice or naive mice, 4T1 or Lewis lung and CT26 or
B16F10 in their respective model (FIGS. 14c and g). All mice
inoculated with splenocytes from naive mice developed tumours. Mice
inoculated with mixtures of splenocytes and 4T1 or Lewis lung
developed tumours, whereas no tumour growth was observed in mice
inoculated with splenocytes from pEEVGmCSF-b7.1 treated `cured`
mice in both the CT26 and B16F10 models indicating the protective
effect was antigen specific as observed in the in vitro analysis.
Control groups which were inoculated with CT26, B16F10, 4T1 or
Lewis lung cells all developed tumours and indicated that the
tumours were growing in the correct manner. The tumour protective
effect in the mice inoculated with splenocytes from pEEVGmCSF-b7.1
treated `cured` mice in both the CT26 and B16F10 models resulted in
prolonged survival (150 days). This suggests adoptive transfer to
naive mice of specific antitumour immune response provided
protection to tumour challenge.
[0137] High levels of IFN-.gamma. were observed from the animals
who received the adoptively transferred mixtures of both the CT26
and B16F10 and splenocytes from the pEEVGmCSF-b7.1 treated `cured`
mice of the respective model and naive mice of the same age (FIGS.
14 and h). Significantly higher levels of IFN-.gamma. were observed
in the adoptively transferred mice in comparison to the naive mice.
This observation indicated a high level of Th-1 T cell stimulation
in the treatment group and supports the cellular nature of the
immune resposes observed in the cytotoxic T lymphocyte assays.
[0138] All publications mentioned in the above specification are
herein incorporated by reference. Various modifications and
variations of the described methods and system of the invention
will be apparent to those skilled in the art without departing from
the scope and spirit of the invention. Although the invention has
been described in connection with specific preferred embodiments,
it should be understood that the invention as claimed should not be
unduly limited to such specific embodiments. Indeed, various
modifications of the described modes for carrying out the invention
which are obvious to those skilled in molecular biology or related
fields are intended to be within the scope of the following claims.
Sequence CWU 1
1
1150DNAArtificial SequenceNuclear localisation sequence (NLS)
1cacataacgg gagggccggc ggttaccagg tcgacggata tgacggcagg 50
* * * * *