Adjuvant For Mucosal Vaccine

Abstract

An object of the present invention is to provide an adjuvant for a mucosal vaccine with high safety that induces a sufficient immune response on the mucosa. According to the present invention, an adjuvant for a mucosal vaccine comprising a protein complex composed of hemagglutinin (HA) subcomponents HA1, HA2, and HA3 of botulinum toxin is provided.

Description

TECHNICAL FIELD

[0001] The present invention relates to an effective and safe adjuvant for a mucosal vaccine and a mucosal vaccine preparation containing such adjuvant and vaccine antigens.

BACKGROUND ART

[0002] In recent years, the mechanisms of mucosal immunity on the respiratory apparatus, the digestive apparatus, the reproductive organs, and other organs have been gradually elucidated as the immune system to prevent infectious diseases such as influenza or acquired immunodeficiency syndrome (AIDS). For example, immune response to prevent influenza virus infection is associated with mucosal IgA antibody, serum IgG antibody to neutralize the viruses, and cytotoxic T cells that lyse infected cells to interrupt virus transmission. Such mucosal immune mechanisms are functional at the initial phase of infection, and play a key role in biophylaxis at the time of infection or during the initial phase of infection. Accordingly, mucosal vaccines inducing immune protection response against infection on the mucosa, which is the first barrier at portals of entry for pathogens, are considered as effective vaccine for various infectious diseases through mucosae.

[0003] While mucosal vaccines induce secretory IgA antibody in mucosal tissue upon mucosal administration (e.g., intranasal administration), and also induce IgG antibody in the serum. Thus, mucosal vaccines are capable of inducing immune responses in both the mucosal and systemic systems against pathogens. In addition, mucosal vaccines are superior to conventional vaccination with needles and syringe in terms of operability, safety, and economic efficiency. Accordingly, mucosal vaccines are expected as novel vaccines, and have been developed.

[0004] However, because mucosal vaccines with antigens alone are not capable of inducing sufficient immune responses, mucosal adjuvants for mucosal vaccines is necessary in order to induce effective immune responses on the mucosal surface. Up to the present, many mucosal adjuvants have been reported. For example, bacterial endotoxins such as cholera toxin (CT) and heat-labile enterotoxin (LT) of enterotoxigenic Escherichia coli, have been known as representative mucosal adjuvants (Non-Patent Documents 1 and 2). However, previous reports showed that clinical trials with LT intranasal administration caused facial nerve palsy (Bell's palsy). Accordingly, development of mucosal adjuvants with toxins such as CT or LT might be difficult in terms of safety. MPL resulting from attenuation of activity of endotoxin LPS, bacterial flagellin proteins (Patent Document 1), double-stranded RNA (poly(I:C)) (Patent Document 2), and other substances have been studied as mucosal adjuvants, which are not derived from toxins. However, since those candidates induce excessive inflammatory responses, they are not satisfactory for mucosal adjuvants in terms of safety. That is, no effective and safe adjuvants for mucosal vaccines are being put to practical use at present.

[0005] The hemagglutinin (HA) and the nontoxic-nonhemagglutinin (NTNH) component bind to the botulinum neurotoxin (NIX) produced by botulinum bacilli causing food poisoning, and those components form three types of neurotoxin complex (progenitor toxin (PTX)) whose molecular weight are 300,000, 500,000, or 900,000. Botulinum toxin blocks neuron transmission, and leads to death in human. Taking advantage of the activity thereof, botulinum toxin is used as an effective neurotransmission inhibitor for medical purposes. For example, a botulinum toxin type A (BOTOX) complex is known to be used for treatment of blepharospasm, hemifacial spasm, spasmodic torticollis, heterotropia, and the reduction of wrinkles. In the neurotoxin complex as described above, non-toxic HA is known to have functions of disrupting the epithelial barrier and transporting botulinum neurotoxins and macromolecules. When NTX and albumin antigens are subcutaneously administered to mice in combination with HA, production of serum antibody specific for antigens is enhanced through IL-6 production (Non-Patent Document 3). While Patent Documents 3 and 4 describe the adjuvant activity of an HA subcomponent (HA1 or HA3) and the use as a carrier of nucleic acids into cells, no protein complex composed of HA subcomponents (HA1, HA2, and HA3) has been discussed. The present inventors previously reported that HA acts on M cells in the epithelial cell layer of the Peyer's patch (i.e., M cells on the Peyer's patch), and that HA assists migration of neurotoxin complex from apical side of to basolateral side of M cells via transcytosis (Non-Patent Document 4). While the functions of the neurotoxin complex (HA to which the toxin component has been bound) to breach the intestinal epithelial barrier have been investigated in the study described above, interaction of toxin-free HA with M cells or adjuvant effects for delivering vaccine antigens for mucosal vaccines to infectious diseases have not yet been examined.

PRIOR ART DOCUMENTS

Patent Documents

[0006] Patent Document 1: WO 2005/070455 [0007] Patent Document 2: JP 2005-97267 A [0008] Patent Document 3: JP 2009-132686 A [0009] Patent Document 4: JP 2009-81997 A

Non-Patent Documents

[0009] [0010] Non-Patent Document 1: J. Xu-Amano et al., J. Exp. Med., 178, 1309, 1993 [0011] Non-Patent Document 2: I. Takahashi et al., J. Infect. Dis. 173, 627, 1996 [0012] Non-Patent Document 3: J. Lee et al., Microbiology, 151, 3739, 2005 [0013] Non-Patent Document 4: Takuhiro Matsumura et al., Japanese Journal of Bacteriology 64 (1) 79, 2009

SUMMARY OF THE INVENTION

[0014] Accordingly, an object of the present invention is to provide an adjuvant for mucosal vaccines with high both efficacy and safety.

[0015] The present inventors focused on hemagglutinin (HA), a non-toxic component of botulinum toxin, and the mice were intranasally immunized with a protein complex composed of HA subcomponents (HA1, HA2, and HA3) intranasal in combination with ovalbumin antigens or influenza HA antigens. As a result, they confirmed that production of serum IgG antibody and that of secretory IgA antibody on the mucosa would be accelerated by vaccine antigens with HA subcomponent, suggesting that HA augments systemic immunity and mucosal immunity to vaccine antigens. In addition, innate immunity (e.g., production of IL-6) caused by CpG or LPS would not be affected by additional HA. Thus, they discovered that the HA complex would be effective as an adjuvant for a mucosal vaccine without induction of inflammation.

[0016] The present invention includes the following.

(1) An adjuvant for a mucosal vaccine comprising a protein complex composed of hemagglutinin (HA) subcomponents HA1, HA2, and HA3 of botulinum toxin. (2) The adjuvant according to (1), wherein the protein complex is composed of the first component, the second component, and the third component described below: the first component:

[0017] (a) a protein consisting of the amino acid sequence as shown in SEQ ID NO: 1, or

[0018] (b) a protein consisting of an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 1 by deletion, substitution, or addition of one to several amino acids and having functions equivalent to those of the protein (a);

the second component:

[0019] (c) a protein consisting of the amino acid sequence as shown in SEQ ID NO: 2, or

[0020] (d) a protein consisting of an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 2 by deletion, substitution, or addition of one to several amino acids and having functions equivalent to those of the protein (c): and the third component:

[0021] (e) a protein consisting of the amino acid sequence as shown in SEQ ID NO: 3, or

[0022] (f) a protein consisting of an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 3 by deletion, substitution, or addition of one to several amino acids and having functions equivalent to those of the protein (e).

(3) The adjuvant according to (1) or (2), which is used simultaneously with vaccine antigens or before or after vaccine antigens are administered. (4) The adjuvant according to (3), wherein the vaccine antigens are subunit antigens or inactivated antigens. (5) The adjuvant according to (3) or (4), wherein the vaccine antigens are derived from pathogens causing mucosal infections. (6) The adjuvant according to (5), wherein the pathogens causing mucosal infections are viruses or bacteria. (7) The adjuvant according to (6), wherein the viruses are influenza viruses, human immunodeficiency viruses (HIV), chickenpox viruses, measles viruses, rubella viruses, mumps viruses, polioviruses, rotaviruses, adenoviruses, herpes viruses, RS viruses, dengue viruses, Japanese encephalitis viruses, severe acute respiratory syndrome (SARS) viruses, or hepatitis viruses (type A, type B, or type C). (8) The adjuvant according to (6), wherein the bacteria are Bordetella pertussis. Neisseria meningitidis, type B influenza, pneumococcus, tuberculosis bacteria, tetanus bacilli, or cholera bacilli. (9) The adjuvant according to any of (1) to (8), which is administered with any mucosal routes. (10) The adjuvant according to (9), wherein the administration with mucosal routes is intranasal administration. (11) A mucosal vaccine preparation comprising vaccine antigens and the adjuvant according to any of (1) to (10).

[0023] When the adjuvant of the present invention is administered to mucosa such as the intranasal mucosa in combination with vaccine antigens derived from pathogens causing mucosal infections, such as influenza viruses, production of serum IgG antibody and that of secretory IgA antibody on the mucosa are accelerated, and antigen-specific systemic and mucosal immune responses are enhanced. Accordingly, the adjuvant of the present invention is useful as an adjuvant for a mucosal vaccine against diseases of the respiratory apparatus or the digestive apparatus. In addition, the adjuvant of the present invention uses hemagglutinin (HA) subcomponent, which is a non-toxic botulinum toxin component, the adjuvant does not activate innate immunity, and the adjuvant is less likely to cause inflammations on mucosa after administration. Therefore, the adjuvant of the present invention is very safe for mucosal vaccines to use.

[0024] This patent application claims priority from Japanese Patent Application No. 2012-265532 filed on Dec. 4, 2012, and it includes part or all of the contents as disclosed in the description thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

[0025] FIG. 1 shows the amino acid sequence of recombinant botulinus HA1-3 used to prepare the botulinus HA (BHA) complex in Example 1. The underlined regions indicate vector-derived amino acid sequences (FLAG tag sequence: SEQ ID NO: 7; Strep tag sequence: SEQ ID NO: 8).

[0026] FIG. 2 shows purification of the BHA complex via gel filtration chromatography.

[0027] FIG. 3 shows interaction between M cells and each subcomponcnt HA1, HA2, or HA3 of botulinus (a microscope photograph showing localization of subcomponents on the follicle-associated epithelium (FAE)).

[0028] FIG. 4 shows interaction between M cell and the HA2+3 complex or the HA1+2+3 complex of botulinus (a microscope photograph showing localization of complexes on the follicle-associated epithelium (FAE)).

[0029] FIG. 5 shows the results of ELISA that measured the concentration of ovalbumin-specific IgG in sera and that of ovalbumin-specific IgA in the nasal cavity lavage or in the bronchoalveolar lavage (OVA: the group to which ovalbumin alone is administered; OVA+CTB: the group to which ovalbumin with the cholera toxin B subunit are administered; OVA+BHA: the group to which ovalbumin with the BHA complex are administered; Reciprocal log 2 titer: the antibody titer represented by the logarithm of the reciprocal of the maximal dilution factor exhibiting absorbance that is higher than the sample before immunization by 0.1).

[0030] FIG. 6 shows activation of innate immunity by the BHA complex (the amount of IL-6 produced).

[0031] FIG. 7 shows the results of ELISA that measured the concentration of influenza-antigen-specific IgG in the sera (SV: the group to which influenza split vaccine alone is administered; SV+BHA: the group to which influenza split vaccine with BHA complex are administered; SV+CTB: the group to which influenza split vaccine with cholera toxin B subunit are administered; NC: the group to which no antigens with adjuvants is administered (*** p<0.0001 ** p<0.001 * p<0.01)).

[0032] FIG. 8 shows the results of ELISA that measured the concentration of influenza-antigen-specific IgA in the nasal cavity lavage and in the bronchoalveolar lavage (SV: the group to which influenza split vaccine alone is administered; SV+BHA: the group to which influenza split vaccine with BHA complex are administered; SV+CTB: the group to which influenza split vaccine with cholera toxin B subunit are administered: NC: the group to which no antigens with adjuvants is administered (*** p<0.0001 ** p<0.001 * p<0.01)).

[0033] FIG. 9 shows the results of ELISA that measured the concentration of influenza-antigen-specific IgG in the sera (SV: the group to which influenza split vaccine alone is administered: SV+BHA: the group to which influenza split vaccine with BHA complex are administered: SV+BHA1-3: the group to which influenza split vaccine with BHA1, BHA2, or BHA3 are administered: SV+CTB: the group to which influenza split vaccine with cholera toxin B subunit are administered: NC: the group to which no antigens with adjuvants is administered (*** p<0.0001 ** p<0.001 * p<0.01)).

[0034] FIG. 10 shows the results of ELISA that measured the concentration of influenza-antigen-specific IgA in the nasal cavity lavage and in the bronchoalveolar lavage (SV: the group to which influenza split vaccine alone is administered: SV+BHA: the group to which influenza split vaccine with BHA complex are administered: SV+BHA1-3: the group to which influenza split vaccine with BHA1, BHA2, or BHA3 are administered; SV+CTB: the group to which influenza split vaccine with cholera toxin B subunit are administered: NC: the group to which no antigens with adjuvants is administered (*** p<0.0001 ** p<0.001 * p<0.01)).

EMBODIMENTS FOR CARRYING OUT THE INVENTION

[0035] The adjuvant for a mucosal vaccine of the present invention (hereafter it is merely referred to as an "adjuvant") is a protein complex composed of HA1, HA2, and HA3, which are hemagglutinin (HA) subcomponents of botulinum toxin. The term "adjuvant" used herein refers to a substance that is administered so as to enhance the immunogenicity of a vaccine antigen.

[0036] Botulinum toxins are classified as type A to type G in accordance with the different antigenicities of toxins produced by botulinum bacilli (Clostridium botulinum). The botulinum toxin complex for the adjuvant of the present invention is preferably of type A or type B.

[0037] The first component of the protein complex contained in the adjuvant of the present invention is the botulinum toxin complex HA1 the second component is the botulinum toxin complex HA2, and the third component is the botulinum toxin complex HA3. Specifically, HA1, HA2, and HA3 are a protein consisting of the amino acid sequence as shown in SEQ ID NO: 1, a protein consisting of the amino acid sequence as shown in SEQ ID NO: 2, and a protein consisting of the amino acid sequence as shown in SEQ ID NO: 3, respectively. The adjuvant of the present invention is preferably a protein complex composed of the first component, the second component, and the third component.

[0038] The three proteins composing the protein complex may be mutant proteins of the protein consisting of the amino acid sequence as shown in SEQ ID NO: 1, the protein consisting of the amino acid sequence as shown in SEQ ID NO: 2, and the protein consisting of the amino acid sequence as shown in SEQ ID NO: 3, respectively, provided that such mutant proteins have activities equivalent to those of the relevant original proteins. When mutant proteins "have activities equivalent to" those of the original proteins, the protein complex composed of such mutant proteins has mucosal adjuvant activity equivalent to that of the protein complex composed of the protein consisting of the amino acid sequence as shown in SEQ ID NO: 1, the protein consisting of the amino acid sequence as shown in SEQ ID NO: 2, and the protein consisting of the amino acid sequence as shown in SEQ ID NO: 3. The term "mucosal adjuvant activity" refers to activity that enhances production of antigen-specific antibody when the adjuvant is administered transmucosally in combination with vaccine antigens in both the mucosal and systemic immune response. Preferably, the influence of such activity on innate immunity is insignificant, and production of antigen-specific antibody is enhanced in both the mucosal and systemic immunity. More preferably, innate immunity is not influenced and production of antigen-specific antibody is enhanced in both the mucosal and systemic immunity. An example of such mutant protein is a protein consisting of an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 1, 2, or 3 by deletion, substitution, insertion, or addition of one to several amino acids. The term "one to several" used herein indicates the number of amino acids that can be deleted, substituted, or added by a known method for producing a mutant protein, such as site-directed mutagenesis. As long as the activity described above is retained, such number is not limited. For example, such number is 1 to 30, preferably 1 to 20, more preferably 1 to 10, and most preferably 1 to 5. A mutant protein may consist of an amino acid sequence having 90% or higher identity to the amino acid sequence as shown in SEQ ID NO: 1, 2, or 3. The term "90% or higher identity" used herein refers to sequence identity of preferably 95% or higher, more preferably 97% or higher, and most preferably 98% or higher. Amino acid sequence identity can be determined by FASTA or BLAST search. While the term "mutation" used herein primarily refers to a mutation that is artificially introduced in accordance with a known method of producing a mutant protein, an equivalent mutation existing in nature may be employed.

[0039] A method for producing the adjuvant of the present invention is not particularly limited. The protein complex may be derived from nature. Alternatively, proteins composing such protein complex may be produced via a genetic recombination technique, and the protein complex may be formulated using such proteins. The protein complex may be produced in accordance with a conventional genetic recombination technique using genes encoding the proteins of interest. Specifically, HA1, HA2, and HA3 can be produced by constructing expression vectors containing genes encoding the amino acid sequences as shown in SEQ ID NOs: 1, 2, and 3 (the nucleotide sequences are shown in SEQ ID NOs: 4, 5, and 6, respectively), introducing the expression vectors into adequate host cells, and culturing the host cells. Mutant proteins of HA1. HA2, and HA3 can be also produced by a well-known recombinant DNA technique by, for example, subjecting genes encoding the amino acid sequences as shown in SEQ ID NOs: 1, 2, and 3 to site-directed mutagenesis, obtaining genes encoding the mutant proteins, and using such genes. The protein productions can be easily carried out with reference to, for example. Molecular Cloning 2nd Ed., Cold Spring Harbor Laboratory Press, 1989. Alternatively, HA1, HA2, and HA3 can be chemically synthesized on the basis of the amino acid sequences thereof.

[0040] The resulting HA1. HA2, and HA3 proteins may be incubated in a solvent such as a phosphate buffer for 2 to 8 hours, preferably 3 to 5 hours, and more preferably 3 hours at 25.degree. C. to 40.degree. C. and preferably 37.degree. C. and the protein complex may be thus composed. Alternatively, a fusion protein may be prepared from the HA1, HA2, and HA3 proteins. When production of a fusion protein is intended, a known method in which DNA fragments encoding the HA1, HA2, and HA3 proteins are bound to be in-frame with each other, the resultant is introduced into an adequate expression vector, and the resultant is transcribed and translated with the aid of an adequate host so as to express the protein may be employed.

[0041] In general, the adjuvant of the present invention may be administered to organisms simultaneously with vaccine antigens. Alternatively, the adjuvant may be administered before the administration of vaccine antigens or after the administration of antigens. When the adjuvant is administered simultaneously with vaccine antigens, the adjuvant may be administered substantially simultaneously with the vaccines. For example, the adjuvant and vaccine antigens may be administered to the target at exactly the same time, or they may be continuously administered within a given period of time (preferably within several minutes).

[0042] The vaccine antigens are preferably inactivated antigens or subunit antigens. The term "inactivated antigens" refers to antigens of pathogens (e.g., viruses or bacteria) deprived of infectivity. Examples thereof include complete virus particles (virions), incomplete virus particles, virion-constituting particles, virus nonstructural proteins, the antigens to prevent infections, and neutralizing epitopes. Antigens may be inactivated by physical treatments (e.g., x-rays, heat, or ultrasound), chemical treatments (e.g., formalin, mercury, alcohol, or chlorine), or via other means. The term "subunit vaccines" refers to vaccines selectively containing particular antigens (i.e., the antigens to prevent infections) that are effective vaccine components among various types of antigens contained in inactivated vaccines. An example of a subunit vaccine against the influenza virus is a vaccine selectively containing hemagglutinin (HA) and neuraminidase (NA) that are surface antigens purified.

[0043] The vaccine antigens are not particularly limited, provided that the vaccine antigens are capable of inducing a mucosal immune response together with the adjuvant of the present invention. Typical antigens are derived from pathogens causing mucosal infections. Pathogens causing mucosal infections may be viruses or bacteria. Examples of viruses include, but are not limited to, influenza viruses, human immunodeficiency viruses (HIV), chickenpox viruses, measles viruses, rubella viruses, mumps viruses, polioviruses, rotaviruses, adenoviruses, herpes viruses, RS viruses, dengue viruses, Japanese encephalitis viruses, severe acute respiratory syndrome (SARS) viruses, and hepatitis viruses (type A, type B, and type C). Examples of bacteria include, but are not limited to, Bordetella pertussis, Neisseria meningitidis, type B influenza, pneumococcus, tuberculosis bacteria, tetanus bacilli, and cholera bacilli. Such antigens derived from pathogens may be derived from nature or artificially prepared via gene recombination or other techniques.

[0044] The vaccine antigens include allergens used for hyposensitization therapy. Accordingly, the adjuvant of the present invention can be used as an adjuvant for allergen vaccines. Allergen vaccines are used to block IgE causing allergies by producing IgG antibody against allergens or to increase allergen-specific type I helper T cells (Th1 cells) in vivo by administering allergens to organisms, thereby decreasing type II helper T cells (Th2 cells) associated with allergy symptoms. Allergen vaccines are capable of suppressing allergy symptoms via hyposensitization. Allergens are not particularly limited, and examples of allergens include food allergens (e.g., casein, lactalbumin, lactoglobulin, ovomucoid, ovalbumin, and conalbumin), house dust allergens (e.g., mite allergens), pollen allergens (e.g., cedar pollen allergens, ragweed allergens, and cocksfoot grass allergens), and allergens of animal body hair.

[0045] The adjuvant of the present invention is administered transmucosally in combination with the mucosal vaccine antigens. When an agent is "administered transmucosally," it is administered through the mucosa. Examples of mucosae include inner walls of hollow organs that lead to the exterior, such as the digestive apparatus, the respiratory apparatus, and the urogenital apparatus, and specific examples include the nasal cavity, oral cavity, pharynx, alveolus, air tube, intestinal tract, and vagina, with the nasal cavity being preferable. Accordingly, examples of forms of transmucosal administration include intranasal, intraoral, intra-alveolar, intratracheal, intravaginal, and intrarectal administration with the intranasal administration being preferable. Adjuvants and mucosal vaccines can be administered transmucosally in an adequate manner in accordance with the site of administration. In the case of nasal or oral administration, for example, the agents can be sprayed, added dropwise, or applied to the nasal cavity or oral cavity. Intra-alveolar administration can be carried out by a method involving the use of an inhaler or a sprayer or a method of administering a preparation comprising an aerosol preparation.

[0046] The amount of the adjuvant of the present invention to be administered varies in accordance with the age of the subject, body weight, disease type, route of administration, form of administration, and other conditions. In the case of oral administration, for example, 10 .mu.g to 100 mg, and preferably 1 .mu.g to 10 mg of the adjuvant of the present invention can be administered simultaneously with vaccine antigens per instance per adult human. In the case of nasal administration, 0.1 .mu.g to 100 mg, and preferably 1 .mu.g to 10 mg of the adjuvant can be administered, for example. Subjects of administration can be adequately determined in accordance with the types of vaccine antigens used in combination with the adjuvant. Examples thereof include, in addition to humans, non-human mammalians, birds, and crustaceans.

[0047] A person skilled in the art can easily determine the frequency of administration of the adjuvant of the present invention in combination with vaccine antigens to the subjects by taking, for example, age, body weight, medical history, clinical course of the subject, disease type, and other factors into consideration. As in the case of general vaccine preparations, administration may be carried out at an adequate time before the onset of the disease at the frequency of, in general, one to several instances per day for a day, or administration may be carried out several times at intervals of one to several weeks. Administration is preferably carried out while observing progress, and booster immunization is preferably carried out at intervals of at least a week. Intervals of booster immunization are preferably at least about two weeks. By providing booster immunization, more effective infection-protective effects can be expected.

[0048] In order to administer the adjuvant of the present invention simultaneously with vaccine antigens, the adjuvant may be mixed with vaccine antigens together with pharmaceutically acceptable carriers suitable for the dosage form, and vaccine preparations may be produced by various known techniques.

[0049] The amount of the adjuvant to be incorporated into vaccine preparations can be adequately determined in accordance with the types of vaccine antigens to be mixed. The content of the adjuvant in the preparations is not particularly limited, provided that sufficient antigen immune responses are induced via transmucosal administration. Such amount is generally 0.1% to 90% by weight, preferably 0.5% to 80% by weight, and more preferably 1% to 50% by weight relative to the entire preparation amount.

[0050] Dosage forms of the mucosal vaccine preparations of the present invention are not particularly limited, provided that the mucosal vaccine preparations can be administered transmucosally. Examples thereof include liquid preparations, suspensions, sprays, and powders. According to need, various additives that are generally used for vaccine preparations, such as solubilizers, anticoagulants, viscosity modifiers, pH adjusters, isotonizing agents, emulsifiers, antioxidants, fillers, surfactants, diluents, preservatives, stabilizers, desiccating agents, or moisturizing agents, can be added to the mucosal vaccine preparations of the present invention.

[0051] The vaccine preparations of the present invention can be in a liquid state or a dried state, and such vaccine preparations can be introduced into hermetically sealed vial bottles, syringes, atomizers, or scaled ampules.

[0052] Hereafter, the present invention is described in greater detail with reference to the examples, although the technical scope of the present invention is not limited thereto. The data obtained in the examples were statistically processed by the Student's t-test.

Example 1

Preparation of Botulinus HA (BHA) Complex

[0053] The botulinus HA (BHA) complex was prepared in the manner described below.

(1) Preparation of Plasmids

[0054] The genes encoding the proteins of the botulinus HA subcomponents (BHA1, BHA2, and BHA3) (BHA1: a protein consisting of amino acids 7 to 294 of the amino acid sequence as shown in SEQ ID NO: 1; BHA2: a protein consisting of amino acids 2 to 146 of the amino acid sequence as shown in SEQ ID NO: 2; and BHA3: a protein consisting of amino acids 19 to 626 of the amino acid sequence as shown in SEQ ID NO: 3) were amplified by PCR from genomic DNA of the Clostridium botulinum B-Okra strain as a template using the primers described below.

(Primers for BHA1 Amplification)

TABLE-US-00001 [0055] (SEQ ID NO: 9) BHA1 forward primer: cactataagcttatccaaaattcattaaatg (SEQ ID NO: 10) BHA1 reverse primer: gttgataggtaccttatgggttactcatag

(Primers for BHA2 Amplification)

TABLE-US-00002 [0056] BHA forward primer: (SEQ ID NO: 11) tgaataagctttcagctgaaagaacttttc BHA2 reverse primer: (SEQ ID NO: 12) cactttggtaccttatattttttcaagtttga

(Primers for BHA3 Amplification)

TABLE-US-00003 [0057] BHA3 forward primer: (SEQ ID NO: 13) gaaaaagggtaccaatatagtgatactattg BHA3 reverse primer: (SEQ ID NO: 14) cgtgtcgacttaattagtaatatctatatgc

[0058] The amplified DNA fragments of BHA1 and BHA2 were each inserted into the HindIII-SalI site of pT7-FLAG-1 (Sigma), and the amplified DNA fragment of BHA3 was inserted into the KpnI-SalI site of pET52b(+) (Novagen) (pET-BHA3).

(2) Protein Expression

[0059] The resulting plasmids were separately transformed into E. coli Rosetta2 (DE3) strains (Novagen). Protein expression was induced using the Overnight Express Autoinduction System 1 (Novagen). BHA1 and BHA3 were induced to express proteins at 30.degree. C. for 36 hours, and BHA2 was induced to express a protein at 18.degree. C. for 40 hours. E. coli strains were collected by centrifugation and stored at -80.degree. C.

(3) Protein Purification and Complex Preparation

[0060] BHA1 and BHA2 were purified using Anti-FLAG M2 agarose (Sigma). BHA3 was purified using StrepTrap HP (GE Healthcare). The amino acid sequences of the purified recombinant proteins. FLAG-BHA1, FLAG-BHA2, and Strep-BHA3, are shown in FIG. 1.

[0061] The purified recombinant proteins were mixed at a ratio of BHA1:BHA2:BHA3 of 4:4:1 by mole, and the resultant was incubated at 37.degree. C. for 3 hours, followed by purification with the use of StrepTrap HP. Thus, the BHA complex (BHA) was obtained.

(4) Gel Filtration Chromatography of Botulinus HA (BHA) Complex

[0062] The BHA complex (BHA) prepared in Example 1 was separated using Superdex 200 10/300 GL (GE Healthcare). In this test, C-terminal FLAG tag HA1, N-terminal His tag HA2, and N-terminal Strep tag HA3 were used for HA1, HA2, and HA3 composing the BHA complex (BHA). The results are shown in FIG. 2.

Example 2

Interaction Between M Cell and Botulinus HA Subcomponent Alone or Complex of Botulinus HA Subcomponents

[0063] HA1, HA2, and HA3 of botulinus type A (600 nM each) were labeled with Alexa 568 and injected into ligated intestinal loop of the mouse. Two hours later, HA subcomponent localization was observed under a confocal microscope. M cells were stained with FITC-labeled UEA-1. Neither M-cell binding nor transcytosis was substantially observed as a result when HA1, HA2, or HA3 alone was used (FIG. 3).

[0064] Separately, the HA213 complex and the HA1+2+3 complex of botulinus type A (600 nM each) were labeled with Alexa 568 and injected into ligated intestinal loop of the mouse. Two hours later, localization of complexes was observed under a confocal microscope. M cells were stained with FITC-labeled UEA-1. Neither M-cell binding nor transcytosis was substantially observed as a result when the HA2+3 complex was used. As with the case of native 16S toxin. M-cell binding and transcytosis were observed when the HA1+2+3 complex was used (FIG. 4). Thus, formation of a complex of HA1, HA2, and HA3 was found to be necessary for interaction between M cell and HA.

Example 3

Nasal Adjuvant Effects of BHA Complex Using Ovalbumin (OVA)

[0065] With the use of model antigens (ovalbumin, OVA), the efficacy of botulinus HA (BHA) as a mucosal vaccine adjuvant was inspected in the mouse with intranasal administration system. The BHA complex (BHA) prepared in Example 1 was used as BHA. OVA (5 .mu.g only), OVA (5 .mu.g)+BHA (15 .mu.g), and OVA (5 .mu.g)+cholera toxin B subunit (2 .mu.g) (as the positive control) were intranasally administered to BALB/c mice (6-week-old: a group of 3 individuals) at intervals of one week (at day 0, day 7, day 14, day 21, and day 28), and five times of administration was totally carried out. Production of OVA-specific IgG in the sera, that of OVA-specific IgA in the nasal cavity lavage, and that of OVA-specific IgA in bronchoalveolar lavage were assayed by ELISA on day 34.

[0066] The results are shown in FIG. 5. Production of IgA was not observed in any nasal cavity lavage or bronchoalveolar lavage in the group to which OVA alone had been administered, although a slight increase was observed in the sera IgG level on day 34. In the group to which OVA and BHA had been administered and the group to which OVA and the cholera toxin B subunit had been administered, the IgA levels in the nasal cavity lavage and the bronchoalveolar lavagc and the amount of IgG in the sera significantly increased.

Example 4

Evaluation of Ability of BHA Complex Adjuvant to Activate Innate Immunity (Activity to IL-6 Production)

[0067] The amount of IL-6 cytokine production resulting from treatment with the BHA complex adjuvant was measured using mouse splenocytes, and the ability of the BHA complex adjuvant to activate innate immunity was evaluated.

[0068] Splenocytes were sampled from native mice raised under SPF conditions (C57BL/6, 6-week-old, female, purchased from CLEA Japan. Inc.) and seeded onto a 96-well plate at a cell density of 1.times.10.sup.6 cells/well. Thereafter, the BHA complex (BHA) was serially diluted from 20 .mu.g/ml (20 .mu.g/ml, 2 .mu.g/ml. 0.2 .mu.g/ml), and the splenocytes were stimulated. The splenocytes were further stimulated with the BHA complex adjuvant in combination with a TLR ligand of CpG oligo DNA (K3 or D35, 20 .mu.g/ml) or LPS (1 .mu.g/ml). The culture supernatant was recovered 24 hours after the initiation of stimulation and the amount of cytokine (IL-6) in the culture supernatant was measured (R&D systems). The results are shown in FIG. 6. As shown in FIG. 6, the induction of IL-6 by the BHA complex adjuvant alone was below the detection limit. The amounts of TNF-.alpha., IL-1.beta., and IL-12 were also below the detection limit. Since the BHA complex adjuvant would not influence IL-6 production mediated by CpG or LPS stimulation, it was considered that the BHA complex adjuvant would not enhance or suppress signals to activate any other innate immunity. Thus, the BHA complex adjuvant was considered to be a non-inflammatory adjuvant that would not influence signals to activate innate immunity.

Example 5

Effects of Intranasal Adjuvant of BHA Complex Using Influenza HA Antigens

[0069] Influenza split vaccines were used as antigens to evaluate adjuvant effects of the BHA complex.

(1) Experimental Animals and Materials

[0070] BALB/c mice and C57BL/6 mice (6-week-old, female) were purchased from CLEA Japan, Inc. Mice were raised under SPF conditions.

[0071] The mouse-adapted A/Puerto Rico/8/34 (H1N1) split vaccines (hereafter referred to as "split vaccines") received from Kitasato Daiichi Sankyo Vaccine Co., Ltd. were used as vaccine antigens. During the experiment, antigens were refrigerated at 4.degree. C. in the dark.

[0072] The BHA complex (BHA) prepared in Example 1 was used as the adjuvant. Endotoxin content was determined by designating the standard for purification at 0.5 EU/ml or lower. The BHA adjuvant was cryopreserved at -80.degree. C. thawed immediately before use, and then used for immunization. The cholera toxin adjuvant (CTB) was prepared by mixing 1 .mu.g of cholera toxin B subunit (Catalog No. 033-20611, Wako Pure Chemical Industries. Ltd.) and 1 .mu.g of cholera toxin (Catalog No. 033-20621. Wako Pure Chemical Industries, Ltd.) for each mouse. The cholera toxin adjuvant was cryopreserved at -80.degree. C., thawed immediately before use, and then used for immunization.

(2) Test Method

[0073] PBS(-) was added to the mixture of 1 .mu.g of split vaccine antigens with 20 .mu.g of the BHA complex (BHA) adjuvant or with 2 .mu.g of the cholera toxin adjuvant to adjust the amount of each vaccine preparation to 12 .mu.l used for each mouse. The vaccine preparations were administered to 6-week-old mice through both nasal cavities in amounts of 6 .mu.l each. Administration was carried out four times in total at intervals of 2 weeks (day 0, day 14, day 28, and day 42). Immediately before booster immunizations were provided on day 14, day 28, and day 42, mice were anesthetized using Ketalar (Daiichi Sankyo Company, Limited)/Selactar (Bayer), and blood samples were obtained from the orbital venous plexus. The sampled blood was allowed to stand at 4.degree. C., overnight, and serum separation was carried out using a refrigerated benchtop centrifuge (9,100 g, 10 minutes, 4.degree. C.). The obtained serum specimens were cryopreserved at -20.degree. C. In order to evaluate adjuvant effects of the BHA complex, IgG levels (total IgG, IgG1, IG2a, and IG2c levels) in the serum specimens were measured.

[0074] Mice were anesthetized using Ketalar/Selactar 56 days after the initiation of immunization, exsanguinated via cardiopuncture, and euthanized. Immediately thereafter, nasal cavity lavages and bronchoalveolar lavages were sampled. Thereafter, the nasal cavity lavages and the bronchoalveolar lavages were stored on ice or refrigerated until ELISA assays were initiated.

[0075] ELISA assays were carried out in the manner described below. The split vaccine antigens were applied to a plate at a concentration of 1 .mu.g/ml (4.degree. C. overnight), and blocking was carried out with 1% BSA/PBST (Tween 20: 0.5%) by allowing the plate to stand at room temperature for 2 hours. The serum sample was serially diluted using 1% BSA/PBST (Tween 20: 0.5%). As secondary antibody, HRP-labeled antibody in accordance with subclasses was used. OD was measured using a plate reader after coloring, and the amounts of influenza-antigen-specific antibody were calculated. The nasal cavity lavages and the bronchoalveolar lavages were serially diluted using 1% BSA/PBST (Tween 20: 0.5%). In order to evaluate adjuvant effects of the BHA complex to potentiate the antigen-specific mucosal immunity, the amount of influenza-antigen-specific mucosal IgA produced was measured.

(3) Test Results

[0076] FIG. 7 shows the results of measurement of the level of influenza-antigen-specific IgG in the sera (56 days after the initiation of immunization).

[0077] As shown in FIG. 7, the level of the antigen-specific antibody reactions in the sera induced in the group subjected to immunization with the BHA complex (BHA) adjuvant in combination with the influenza antigens was significantly higher than that induced in the group subjected to immunization with influenza antigens alone. Such phenomenon was observed in all the evaluated IgG subclasses.

[0078] FIG. 8 shows the results of measurement of the amount of secretory IgA produced in the nasal cavity lavages and in the bronchoalveolar lavages. As shown in FIG. 8, the amount of antigen-specific IgA production was high in the group subjected to immunization with the BHA complex (BHA) adjuvant in combination with the influenza antigens. In contrast, secretory IgA production was not substantially observed in the group of mice subjected to immunization with influenza antigens alone.

Example 6

Comparison of Effects of Intranasal Adjuvants of BHA Complex with BHA1, BHA2, or BHA3 Respectively

[0079] With the use of the influenza split vaccines as antigens, adjuvant effects of the BHA complex were compared with adjuvant effects of BHA1, BHA2, and BHA3 that are composing elements of the BHA complex.

(1) Experimental Animals and Materials

[0080] BALB/c mice (6-week-old, female) were purchased from CLEA Japan. Inc. Mice were raised under SPF conditions.

[0081] The mouse-adapted A/Puerto Rico/8/34 (H1N1) split vaccines (hereafter referred to as "split vaccines") received from Kitasato Daiichi Sankyo Vaccine Co., Ltd. were used as immunogens. During the experiment, antigens were refrigerated at 4.degree. C. in the dark.

[0082] The BHA complex (BHA) prepared in Example 1 or BHA1, BHA2, and BHA3 that are composing elements of the BHA complex were used as the adjuvant. Endotoxin content was determined by designating the standard for purification at 0.5 EU/ml or lower. The BHA adjuvant was cryopreserved at -80.degree. C., thawed immediately before use, and then used for immunization. The cholera toxin adjuvant (CTB) was prepared by mixing 1 .mu.g of cholera toxin B subunit (Catalog No. 033-20611, Wako Pure Chemical Industries, Ltd.) and 1 .mu.g of cholera toxin (Catalog No. 033-20621, Wako Pure Chemical Industries, Ltd.) for each mouse. The cholera toxin adjuvant was cryopreserved at -80.degree. C., thawed immediately before use, and then used for immunization.

(2) Test Method

[0083] PBS(-) was added to the mixture of 1 .mu.g of split vaccine antigens and 20 .mu.g each of the BHA complex (BHA) adjuvant, the BHA1 adjuvant, the BHA2 adjuvant, or the BHA3 adjuvant or 2 .mu.g of the CTB adjuvant to adjust the amount of each vaccine preparation to 12 .mu.l used for each mouse. The vaccine preparations were administered to 6-week-old mice through both nasal cavities in amounts of 6 .mu.l each. Administration was carried out four times in total at intervals of 2 weeks (day 0, day 14, day 28, and day 42). Immediately before booster immunizations were provided on day 14, day 28, and day 42, mice were anesthetized using Ketalar (Daiichi Sankyo Company, Limited)/Selactar (Bayer), and blood samples were obtained from the orbital venous plexus. The sampled blood was allowed to stand at 4.degree. C. overnight, and serum separation was carried out using a refrigerated benchtop centrifuge (9.100 g, 10 minutes. 4.degree. C.). The obtained serum specimens were cryopreserved at -20.degree. C. In order to evaluate adjuvant effects of the BHA complex. IgG levels (total IgG, IgG1, and IG2a levels) in the serum specimens were measured.

[0084] Mice were anesthetized using Ketalar/Selactar 56 days after the initiation of immunization, exsanguinated via cardiopuncture, and euthanized. Immediately thereafter, nasal cavity lavages and bronchoalveolar lavages were sampled. Thereafter, the nasal cavity lavages and the bronchoalveolar lavages were stored on ice or refrigerated until ELISA assays were initiated.

[0085] ELISA assays were carried out in the manner described below. The split vaccine antigens were applied to a plate at concentration of 1 .mu.g/ml (4.degree. C., overnight), and blocking was carried out with 1% BSA/PBST (Tween 20: 0.5%) by allowing the plate to stand at room temperature for 2 hours. The serum sample was serially diluted using 1% BSA/PBST (Tween 20: 0.5%). As secondary antibody. HRP-labeled antibody in accordance with subclasses was used. After color had developed, OD was measured using a plate reader, and the amounts of influenza-antigen-specific antibody produced were measured. The nasal cavity lavages and the bronchoalveolar lavages were serially diluted using 1% BSA/PBST (Tween 20: 0.5%). In order to evaluate adjuvant effects of the BHA complex to potentiate the antigen-specific mucosal immunity, the amount of influenza-antigen-specific mucosal IgA produced was measured.

(3) Test Results

[0086] FIG. 9 shows the results of measurement of the level of influenza-antigen-specific IgG in the sera (56 days after the initiation of immunization).

[0087] As shown in FIG. 9, the level of the antigen-specific antibody reactions in the sera induced in the group subjected to immunization with the BHA complex (BHA) adjuvant in combination with the influenza antigens was significantly higher than that induced in the group subjected to immunization with influenza antigens alone. Such phenomenon was observed in all the evaluated IgG subclasses. In the group subjected to immunization with the BHA1, BHA2, or BHA3 adjuvants that are composing elements of the complex in combination with the influenza antigens, in contrast, antibody reactions in the sera were not significantly potentiated, compared with the group subjected to immunization with the influenza antigens alone. When intradermal administration via injection was employed instead of intranasal administration, antibody reactions in the sera were not significant in any of the groups subjected to immunization with the BHA complex (BHA) adjuvant, the BHA1 adjuvant, the BHA2 adjuvant, or the BHA3 adjuvant in combination with the influenza antigens.

[0088] FIG. 10 shows the results of measurement of the amount of secretory IgA in the nasal cavity lavages and in the bronchoalveolar lavages. As shown in FIG. 10, the amount of antigen-specific IgA was significantly higher in the group subjected to immunization with the BHA complex (BHA) adjuvant in combination with the influenza antigens than in the group subjected to immunization with the influenza antigens alone. In contrast, the amount of secretory IgA was not significantly increased in the group subjected to immunization with the BHA1, BHA2, or BHA3 adjuvants that are composing elements of the BHA complex in combination with the influenza antigens, compared with the group subjected to immunization with the influenza antigens alone. When intradermal administration via injection was employed instead of intranasal administration, the amount of secretory IgA production was below the detection limit in all the groups subjected to immunization with the BHA complex (BHA) adjuvant, the BHA1 adjuvant, the BHA2 adjuvant, or the BHA3 adjuvant in combination with the influenza antigens.

INDUSTRIAL APPLICABILITY

[0089] The present invention is applicable in the field of production of a mucosal adjuvant and a mucosal vaccine preparation comprising such adjuvant.

[0090] All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.

Sequence CWU 1

1

141294PRTClostridium botulinum 1Met Glu His Tyr Ser Thr Ile Gln Asn Ser Leu Asn Asp Lys Ile Val 1 5 10 15 Thr Ile Ser Cys Lys Ala Asn Thr Asp Leu Phe Phe Tyr Gln Val Pro 20 25 30 Gly Asn Gly Asn Val Ser Leu Phe Gln Gln Thr Arg Asn Tyr Leu Glu 35 40 45 Arg Trp Arg Ile Ile Tyr Asp Ser Asn Lys Ala Ala Tyr Lys Ile Lys 50 55 60 Ser Met Asn Ile Tyr Asn Thr Asn Leu Val Leu Thr Trp Asn Ala Pro 65 70 75 80 Thr His Asn Ile Ser Ala Gln Gln Asp Ser Asn Ala Asp Asn Gln Tyr 85 90 95 Trp Leu Leu Leu Lys Asp Ile Gly Asn Asn Ser Phe Ile Ile Ala Ser 100 105 110 Tyr Lys Asn Pro Asn Leu Val Leu Tyr Ala Asp Thr Val Ala Arg Asn 115 120 125 Leu Lys Leu Ser Thr Leu Asn Asn Ser Ser Tyr Ile Lys Phe Ile Ile 130 135 140 Glu Asp Tyr Val Ile Ser Asp Phe Lys Asn Phe Thr Cys Arg Ile Ser 145 150 155 160 Pro Ile Leu Ala Gly Gly Lys Val Val Gln Gln Val Ser Met Thr Asn 165 170 175 Leu Ala Val Asn Leu Tyr Ile Trp Asn Asn Asp Leu Asn Gln Lys Trp 180 185 190 Thr Ile Ile Tyr Asn Glu Glu Lys Ala Ala Tyr Gln Phe Phe Asn Lys 195 200 205 Ile Leu Ser Asn Gly Val Leu Thr Trp Ile Phe Ser Asp Gly Asn Thr 210 215 220 Val Arg Val Ser Ser Ser Ala Gln Asn Asn Asp Ala Gln Tyr Trp Leu 225 230 235 240 Ile Asn Pro Val Ser Asp Asn Tyr Asp Arg Tyr Thr Ile Thr Asn Leu 245 250 255 Arg Asp Lys Thr Lys Val Leu Asp Leu Tyr Gly Gly Gln Thr Ala Asp 260 265 270 Gly Thr Thr Ile Gln Val Phe Asn Ser Asn Gly Gly Asp Asn Gln Ile 275 280 285 Trp Thr Met Ser Asn Pro 290 2146PRTClostridium botulinum 2Met Ser Ala Glu Arg Thr Phe Leu Pro Asn Gly Asn Tyr Asn Ile Lys 1 5 10 15 Ser Ile Phe Ser Gly Ser Leu Tyr Leu Ser Pro Val Ser Gly Ser Leu 20 25 30 Thr Phe Ser Asn Glu Ser Ser Ala Asn Asn Gln Lys Trp Asn Val Glu 35 40 45 Tyr Met Ala Glu Asn Arg Cys Phe Lys Ile Ser Asn Val Ala Glu Pro 50 55 60 Asn Lys Tyr Leu Ser Tyr Asp Asn Phe Gly Phe Ile Ser Leu Asp Ser 65 70 75 80 Leu Ser Asn Arg Cys Tyr Trp Phe Pro Ile Lys Ile Ala Val Asn Thr 85 90 95 Tyr Ile Met Leu Ser Leu Asn Lys Val Asn Glu Leu Asp Tyr Ala Trp 100 105 110 Asp Ile Tyr Asp Thr Asn Glu Asn Ile Leu Ser Gln Pro Leu Leu Leu 115 120 125 Leu Pro Asn Phe Asp Ile Tyr Asn Ser Asn Gln Met Phe Lys Leu Glu 130 135 140 Lys Ile 145 3626PRTClostridium botulinum 3Met Asn Ser Ser Ile Lys Lys Ile Tyr Asn His Ile Gln Glu Lys Val 1 5 10 15 Ile Asn Tyr Ser Asp Thr Ile Asp Leu Ala Asp Gly Asn Tyr Val Val 20 25 30 Ser Arg Gly Asp Gly Trp Ile Leu Ser Arg Gln Asn Gln Ile Leu Gly 35 40 45 Gly Ser Val Ile Ser Asn Gly Ser Thr Gly Ile Val Gly Asp Leu Arg 50 55 60 Val Asn Asp Asn Ala Ile Pro Tyr Tyr Tyr Pro Thr Pro Ser Phe Asn 65 70 75 80 Glu Glu Tyr Ile Lys Asn Asn Ile Gln Thr Val Phe Ala Asn Phe Thr 85 90 95 Glu Ala Asn Gln Ile Pro Ile Gly Phe Glu Phe Ser Lys Thr Ala Pro 100 105 110 Ser Asn Lys Asn Leu Tyr Met Tyr Leu Gln Tyr Thr Tyr Ile Arg Tyr 115 120 125 Glu Ile Ile Lys Val Leu Gln His Glu Ile Ile Glu Arg Ala Val Leu 130 135 140 Tyr Val Pro Ser Leu Gly Tyr Val Lys Ser Ile Glu Phe Asn Pro Gly 145 150 155 160 Glu Lys Ile Asn Lys Asp Phe Tyr Phe Leu Thr Asn Asp Lys Cys Ile 165 170 175 Leu Asn Glu Gln Phe Leu Tyr Lys Lys Ile Leu Glu Thr Thr Lys Asn 180 185 190 Ile Pro Thr Asn Asn Ile Phe Asn Ser Lys Val Ser Ser Thr Gln Arg 195 200 205 Val Leu Pro Tyr Ser Asn Gly Leu Tyr Val Ile Asn Lys Gly Asp Gly 210 215 220 Tyr Ile Arg Thr Asn Asp Lys Asp Leu Ile Gly Thr Leu Leu Ile Glu 225 230 235 240 Ala Gly Ser Ser Gly Ser Ile Ile Gln Pro Arg Leu Arg Asn Thr Thr 245 250 255 Arg Pro Leu Phe Thr Thr Ser Asn Asp Ala Lys Phe Ser Gln Gln Tyr 260 265 270 Thr Glu Glu Arg Leu Lys Asp Ala Phe Asn Val Gln Leu Phe Asn Thr 275 280 285 Ser Thr Ser Leu Phe Lys Phe Val Glu Glu Ala Pro Ser Asn Lys Asn 290 295 300 Ile Cys Ile Lys Ala Tyr Asn Thr Tyr Glu Lys Tyr Glu Leu Ile Asp 305 310 315 320 Tyr Gln Asn Gly Ser Ile Val Asn Lys Ala Glu Tyr Tyr Leu Pro Ser 325 330 335 Leu Gly Tyr Cys Glu Val Thr Asn Ala Pro Ser Pro Glu Ser Glu Val 340 345 350 Val Lys Thr Gln Val Ala Glu Asp Gly Phe Ile Gln Asn Gly Pro Glu 355 360 365 Glu Glu Ile Val Val Gly Val Ile Asp Pro Ser Glu Asn Ile Gln Glu 370 375 380 Ile Asn Thr Ala Ile Ser Asp Asn Tyr Thr Tyr Asn Ile Pro Gly Ile 385 390 395 400 Val Asn Asn Asn Pro Phe Tyr Ile Leu Phe Thr Val Asn Thr Thr Gly 405 410 415 Ile Tyr Lys Ile Asn Ala Gln Asn Asn Leu Pro Ser Leu Lys Ile Tyr 420 425 430 Glu Ala Ile Gly Ser Gly Asn Arg Asn Phe Gln Ser Gly Asn Leu Cys 435 440 445 Asp Asp Asp Ile Lys Ala Ile Asn Tyr Ile Thr Gly Phe Asp Ser Pro 450 455 460 Asn Ala Lys Ser Tyr Leu Val Val Leu Leu Asn Lys Asp Lys Asn Tyr 465 470 475 480 Tyr Ile Arg Val Pro Gln Thr Ser Ser Asn Ile Glu Asn Gln Ile Lys 485 490 495 Phe Lys Arg Glu Glu Gly Asp Leu Arg Asn Leu Met Asn Ser Ser Val 500 505 510 Asn Ile Ile Asp Asn Leu Asn Ser Thr Gly Ala His Tyr Tyr Thr Arg 515 520 525 Gln Ser Pro Asp Val His Asp Tyr Ile Ser Tyr Glu Phe Thr Ile Pro 530 535 540 Gly Asn Phe Asn Asn Lys Asp Thr Ser Asn Ile Arg Leu Tyr Thr Ser 545 550 555 560 Tyr Asn Gln Gly Ile Gly Thr Leu Phe Arg Val Thr Glu Thr Ile Asp 565 570 575 Gly Tyr Asn Leu Ile Asn Ile Gln Gln Asn Leu Asn Leu Leu Asn Ser 580 585 590 Thr Lys Ser Ile Arg Leu Leu Asn Gly Ala Ile Tyr Ile Leu Lys Val 595 600 605 Glu Val Thr Glu Leu Asn Asn Tyr Asn Ile Lys Leu His Ile Asp Ile 610 615 620 Thr Asn 625 4885DNAClostridium botulinumCDS(1)..(885) 4atg gaa cac tat tca aca atc caa aat tca tta aat gac aaa atc gtt 48Met Glu His Tyr Ser Thr Ile Gln Asn Ser Leu Asn Asp Lys Ile Val 1 5 10 15 acc atc tcc tgt aag gct aat aca gat tta ttt ttt tat caa gtt ccc 96Thr Ile Ser Cys Lys Ala Asn Thr Asp Leu Phe Phe Tyr Gln Val Pro 20 25 30 ggt aac ggt aac gtt agc tta ttt caa caa act aga aat tac ctt gaa 144Gly Asn Gly Asn Val Ser Leu Phe Gln Gln Thr Arg Asn Tyr Leu Glu 35 40 45 aga tgg aga att ata tat gat tct aat aaa gct gct tat aaa ata aaa 192Arg Trp Arg Ile Ile Tyr Asp Ser Asn Lys Ala Ala Tyr Lys Ile Lys 50 55 60 agt atg aat atc tat aat act aat tta gtt tta aca tgg aat gca cca 240Ser Met Asn Ile Tyr Asn Thr Asn Leu Val Leu Thr Trp Asn Ala Pro 65 70 75 80 aca cat aat ata tca gcg caa caa gat tca aat gca gat aat caa tat 288Thr His Asn Ile Ser Ala Gln Gln Asp Ser Asn Ala Asp Asn Gln Tyr 85 90 95 tgg tta tta tta aaa gac att ggt aac aat tca ttt att att gca agt 336Trp Leu Leu Leu Lys Asp Ile Gly Asn Asn Ser Phe Ile Ile Ala Ser 100 105 110 tat aaa aac cct aac tta gta tta tat gct gat acc gta gct cgt aat 384Tyr Lys Asn Pro Asn Leu Val Leu Tyr Ala Asp Thr Val Ala Arg Asn 115 120 125 ttg aag ctt agc aca ctt aat aat tca agt tat ata aaa ttt atc ata 432Leu Lys Leu Ser Thr Leu Asn Asn Ser Ser Tyr Ile Lys Phe Ile Ile 130 135 140 gaa gat tat gta ata tca gat ttt aaa aat ttc aca tgt aga ata agt 480Glu Asp Tyr Val Ile Ser Asp Phe Lys Asn Phe Thr Cys Arg Ile Ser 145 150 155 160 cca ata tta gcc ggt ggt aaa gtt gta caa caa gtg tct atg aca aat 528Pro Ile Leu Ala Gly Gly Lys Val Val Gln Gln Val Ser Met Thr Asn 165 170 175 cta gct gtt aat tta tat att tgg aac aat gat ctc aat caa aaa tgg 576Leu Ala Val Asn Leu Tyr Ile Trp Asn Asn Asp Leu Asn Gln Lys Trp 180 185 190 aca att ata tat aat gaa gaa aaa gca gca tac cag ttt ttt aat aaa 624Thr Ile Ile Tyr Asn Glu Glu Lys Ala Ala Tyr Gln Phe Phe Asn Lys 195 200 205 ata ctt tca aac gga gtt cta aca tgg att ttt tca gat ggt aat act 672Ile Leu Ser Asn Gly Val Leu Thr Trp Ile Phe Ser Asp Gly Asn Thr 210 215 220 gta aga gtt tct tct agt gcg caa aac aat gat gcc caa tat tgg ctt 720Val Arg Val Ser Ser Ser Ala Gln Asn Asn Asp Ala Gln Tyr Trp Leu 225 230 235 240 ata aat cct gtt tca gat aat tat gac aga tat aca att act aat cta 768Ile Asn Pro Val Ser Asp Asn Tyr Asp Arg Tyr Thr Ile Thr Asn Leu 245 250 255 cgc gat aaa act aaa gtt cta gat tta tat ggc ggc caa aca gca gac 816Arg Asp Lys Thr Lys Val Leu Asp Leu Tyr Gly Gly Gln Thr Ala Asp 260 265 270 gga act act att caa gta ttt aat tct aat gga ggt gat aat cag ata 864Gly Thr Thr Ile Gln Val Phe Asn Ser Asn Gly Gly Asp Asn Gln Ile 275 280 285 tgg act atg agt aac cca taa 885Trp Thr Met Ser Asn Pro 290 5441DNAClostridium botulinumCDS(1)..(441) 5atg tca gct gaa aga act ttt cta cct aat ggt aat tac aat ata aaa 48Met Ser Ala Glu Arg Thr Phe Leu Pro Asn Gly Asn Tyr Asn Ile Lys 1 5 10 15 tct atc ttt tct ggt tct tta tat tta agt cct gta tca gga tca tta 96Ser Ile Phe Ser Gly Ser Leu Tyr Leu Ser Pro Val Ser Gly Ser Leu 20 25 30 aca ttt tca aat gaa tct tct gca aat aat caa aaa tgg aat gta gaa 144Thr Phe Ser Asn Glu Ser Ser Ala Asn Asn Gln Lys Trp Asn Val Glu 35 40 45 tat atg gct gaa aat aga tgc ttt aaa atc tct aat gta gca gaa cca 192Tyr Met Ala Glu Asn Arg Cys Phe Lys Ile Ser Asn Val Ala Glu Pro 50 55 60 aat aag tat tta agt tac gat aac ttt gga ttt att tct tta gat tca 240Asn Lys Tyr Leu Ser Tyr Asp Asn Phe Gly Phe Ile Ser Leu Asp Ser 65 70 75 80 tta tct aat aga tgc tac tgg ttt cct att aaa atc gct gta aat act 288Leu Ser Asn Arg Cys Tyr Trp Phe Pro Ile Lys Ile Ala Val Asn Thr 85 90 95 tat att atg tta agt tta aat aaa gtg aat gaa tta gat tat gcc tgg 336Tyr Ile Met Leu Ser Leu Asn Lys Val Asn Glu Leu Asp Tyr Ala Trp 100 105 110 gac att tat gat act aat gaa aat att tta agt cag cca cta ctc cta 384Asp Ile Tyr Asp Thr Asn Glu Asn Ile Leu Ser Gln Pro Leu Leu Leu 115 120 125 cta cct aat ttt gat ata tac aat tca aat caa atg ttc aaa ctt gaa 432Leu Pro Asn Phe Asp Ile Tyr Asn Ser Asn Gln Met Phe Lys Leu Glu 130 135 140 aaa ata taa 441Lys Ile 145 61881DNAClostridium botulinumCDS(1)..(1881) 6atg aat tca tct ata aaa aaa att tat aat cat ata caa gaa aaa gtt 48Met Asn Ser Ser Ile Lys Lys Ile Tyr Asn His Ile Gln Glu Lys Val 1 5 10 15 ata aac tat agt gat act att gat tta gct gat ggt aat tat gta gtt 96Ile Asn Tyr Ser Asp Thr Ile Asp Leu Ala Asp Gly Asn Tyr Val Val 20 25 30 agc aga ggg gat gga tgg ata tta tct aga caa aat caa ata cta ggt 144Ser Arg Gly Asp Gly Trp Ile Leu Ser Arg Gln Asn Gln Ile Leu Gly 35 40 45 gga agt gta att agt aat gga tca aca gga ata gtt ggg gac cta cgt 192Gly Ser Val Ile Ser Asn Gly Ser Thr Gly Ile Val Gly Asp Leu Arg 50 55 60 gta aat gat aat gcg ata cca tat tat tat cca aca cca tcc ttc aat 240Val Asn Asp Asn Ala Ile Pro Tyr Tyr Tyr Pro Thr Pro Ser Phe Asn 65 70 75 80 gaa gaa tat ata aaa aat aat ata caa act gta ttt gct aac ttt act 288Glu Glu Tyr Ile Lys Asn Asn Ile Gln Thr Val Phe Ala Asn Phe Thr 85 90 95 gaa gct aat caa att cca ata gga ttt gaa ttt agt aaa acc gct ccc 336Glu Ala Asn Gln Ile Pro Ile Gly Phe Glu Phe Ser Lys Thr Ala Pro 100 105 110 tca aat aaa aac tta tat atg tat tta caa tat acc tac att aga tat 384Ser Asn Lys Asn Leu Tyr Met Tyr Leu Gln Tyr Thr Tyr Ile Arg Tyr 115 120 125 gaa ata ata aaa gtc ttg caa cat gaa att ata gaa aga gca gtt tta 432Glu Ile Ile Lys Val Leu Gln His Glu Ile Ile Glu Arg Ala Val Leu 130 135 140 tat gtt cca tct ctt gga tat gtt aag tct ata gaa ttt aat cca ggg 480Tyr Val Pro Ser Leu Gly Tyr Val Lys Ser Ile Glu Phe Asn Pro Gly 145 150 155 160 gaa aaa ata aat aaa gat ttt tac ttt tta act aat gat aag tgc att 528Glu Lys Ile Asn Lys Asp Phe Tyr Phe Leu Thr Asn Asp Lys Cys Ile 165 170 175 tta aat gaa caa ttc cta tat aaa aaa att tta gaa act act aaa aat 576Leu Asn Glu Gln Phe Leu Tyr Lys Lys Ile Leu Glu Thr Thr Lys Asn 180 185 190 ata cca act aac aat att ttt aat tct aaa gtt agt agc aca caa cga 624Ile Pro Thr Asn Asn Ile Phe Asn Ser Lys Val Ser Ser Thr Gln Arg 195 200 205 gta ttg cct tat agt aat gga cta tat gtt att aat aag ggt gat gga 672Val Leu Pro Tyr Ser Asn Gly Leu Tyr Val Ile Asn Lys Gly Asp Gly 210 215 220 tat ata aga aca aat gat aaa gat ttg ata ggt aca tta tta atc gaa 720Tyr Ile Arg Thr Asn Asp Lys Asp Leu Ile Gly Thr Leu Leu Ile Glu 225 230 235 240 gca ggt tca tca gga agt att ata caa cct cga tta aga aat aca act 768Ala Gly Ser Ser Gly Ser Ile Ile Gln Pro Arg Leu Arg Asn Thr Thr 245 250 255 agg cca tta ttc acc aca agt aat gat gca aaa ttc tca caa caa tat 816Arg Pro Leu Phe Thr Thr Ser Asn Asp Ala Lys Phe Ser Gln Gln

Tyr 260 265 270 act gaa gaa aga ctt aaa gac gct ttc aat gta caa tta ttt aat aca 864Thr Glu Glu Arg Leu Lys Asp Ala Phe Asn Val Gln Leu Phe Asn Thr 275 280 285 tca aca tcg tta ttt aaa ttt gta gaa gaa gct cct tca aat aaa aat 912Ser Thr Ser Leu Phe Lys Phe Val Glu Glu Ala Pro Ser Asn Lys Asn 290 295 300 ata tgc ata aag gct tat aat acc tat gaa aag tat gaa tta ata gac 960Ile Cys Ile Lys Ala Tyr Asn Thr Tyr Glu Lys Tyr Glu Leu Ile Asp 305 310 315 320 tat caa aat gga agt att gtt aat aaa gct gag tat tac ctt cct tcc 1008Tyr Gln Asn Gly Ser Ile Val Asn Lys Ala Glu Tyr Tyr Leu Pro Ser 325 330 335 tta gga tat tgt gaa gta act aat gct cct tca cct gaa tct gaa gta 1056Leu Gly Tyr Cys Glu Val Thr Asn Ala Pro Ser Pro Glu Ser Glu Val 340 345 350 gtt aaa acg caa gtg gct gaa gat gga ttt ata cag aat ggc ccc gag 1104Val Lys Thr Gln Val Ala Glu Asp Gly Phe Ile Gln Asn Gly Pro Glu 355 360 365 gaa gaa atc gta gta ggt gtc ata gac cca tct gaa aat ata caa gaa 1152Glu Glu Ile Val Val Gly Val Ile Asp Pro Ser Glu Asn Ile Gln Glu 370 375 380 ata aat act gct att tca gat aat tac aca tat aac att ccg ggt att 1200Ile Asn Thr Ala Ile Ser Asp Asn Tyr Thr Tyr Asn Ile Pro Gly Ile 385 390 395 400 gta aat aat aat cca ttt tat ata tta ttt aca gta aat act aca gga 1248Val Asn Asn Asn Pro Phe Tyr Ile Leu Phe Thr Val Asn Thr Thr Gly 405 410 415 att tat aaa att aat gct caa aat aat cta cca tca tta aaa ata tat 1296Ile Tyr Lys Ile Asn Ala Gln Asn Asn Leu Pro Ser Leu Lys Ile Tyr 420 425 430 gaa gcg ata ggt tct ggt aat aga aat ttc caa tct ggg aat tta tgt 1344Glu Ala Ile Gly Ser Gly Asn Arg Asn Phe Gln Ser Gly Asn Leu Cys 435 440 445 gat gat gat att aaa gca ata aat tat att act ggg ttt gac agt cct 1392Asp Asp Asp Ile Lys Ala Ile Asn Tyr Ile Thr Gly Phe Asp Ser Pro 450 455 460 aat gct aaa agt tat tta gtt gtt ttg ctt aat aag gat aaa aat tac 1440Asn Ala Lys Ser Tyr Leu Val Val Leu Leu Asn Lys Asp Lys Asn Tyr 465 470 475 480 tac att aga gta cca caa act tct tct aat ata gaa aat caa ata aaa 1488Tyr Ile Arg Val Pro Gln Thr Ser Ser Asn Ile Glu Asn Gln Ile Lys 485 490 495 ttc aag aga gaa gaa ggg gat ctc cga aat tta atg aat tct tca gtt 1536Phe Lys Arg Glu Glu Gly Asp Leu Arg Asn Leu Met Asn Ser Ser Val 500 505 510 aat ata ata gat aat ctt aat tca aca ggt gca cat tac tat aca aga 1584Asn Ile Ile Asp Asn Leu Asn Ser Thr Gly Ala His Tyr Tyr Thr Arg 515 520 525 caa agc cct gat gtc cat gac tat att tca tat gaa ttt aca ata cct 1632Gln Ser Pro Asp Val His Asp Tyr Ile Ser Tyr Glu Phe Thr Ile Pro 530 535 540 ggt aac ttt aat aat aaa gat aca tct aac att agg ctt tat act agt 1680Gly Asn Phe Asn Asn Lys Asp Thr Ser Asn Ile Arg Leu Tyr Thr Ser 545 550 555 560 tat aac caa gga ata ggt act tta ttt aga gtc act gaa act att gac 1728Tyr Asn Gln Gly Ile Gly Thr Leu Phe Arg Val Thr Glu Thr Ile Asp 565 570 575 ggc tat aat tta att aat ata caa caa aat tta aat ctc tta aat agt 1776Gly Tyr Asn Leu Ile Asn Ile Gln Gln Asn Leu Asn Leu Leu Asn Ser 580 585 590 acc aag tca ata cgt tta tta aat ggt gca att tat ata tta aaa gta 1824Thr Lys Ser Ile Arg Leu Leu Asn Gly Ala Ile Tyr Ile Leu Lys Val 595 600 605 gaa gtt aca gaa tta aat aac tat aat ata aaa ttg cat ata gat att 1872Glu Val Thr Glu Leu Asn Asn Tyr Asn Ile Lys Leu His Ile Asp Ile 610 615 620 act aat taa 1881Thr Asn 625 710PRTArtificialsynthetic peptide 7Met Asp Tyr Lys Asp Asp Asp Asp Lys Leu 1 5 10 824PRTArtificialsynthetic peptide 8Met Ala Ser Trp Ser His Pro Gln Phe Glu Lys Gly Ala Leu Glu Val 1 5 10 15 Leu Phe Gln Gly Pro Gly Tyr Gln 20 931DNAArtificialprimer 9cactataagc ttatccaaaa ttcattaaat g 311030DNAArtificialprimer 10gttgataggt accttatggg ttactcatag 301130DNAArtificialprimer 11tgaataagct ttcagctgaa agaacttttc 301232DNAArtificialprimer 12cactttggta ccttatattt tttcaagttt ga 321331DNAArtificialprimer 13gaaaaagggt accaatatag tgatactatt g 311431DNAArtificialprimer 14cgtgtcgact taattagtaa tatctatatg c 31

Claims

1. An adjuvant for a mucosal vaccine comprising a protein complex composed of hemagglutinin (HA) subcomponents HA1, HA2, and HA3 of botulinum toxin.

2. The adjuvant according to claim 1, wherein the protein complex is composed of the first component, the second component, and the third component described below: the first component: (a) a protein consisting of the amino acid sequence as shown in SEQ ID NO: 1, or (b) a protein consisting of an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 1 by deletion, substitution, or addition of one to several amino acids and having functions equivalent to those of the protein (a); the second component: (c) a protein consisting of the amino acid sequence as shown in SEQ ID NO: 2, or (d) a protein consisting of an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 2 by deletion, substitution, or addition of one to several amino acids and having functions equivalent to those of the protein (c); and the third component: (e) a protein consisting of the amino acid sequence as shown in SEQ ID NO: 3, or (f) a protein consisting of an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 3 by deletion, substitution, or addition of one to several amino acids and having functions equivalent to those of the protein (e).

3. The adjuvant according to claim 1, which is used simultaneously with vaccine antigens or before or after vaccine antigens are administered.

4. The adjuvant according to claim 3, wherein the vaccine antigens are subunit antigens or inactivated antigens.

5. The adjuvant according to claim 3, wherein the vaccine antigens are derived from pathogens causing mucosal infections.

6. The adjuvant according to claim 5, wherein the pathogens causing mucosal infections are viruses or bacteria.

7. The adjuvant according to claim 6, wherein the viruses are influenza viruses, human immunodeficiency viruses (HIV), chickenpox viruses, measles viruses, rubella viruses, mumps viruses, polioviruses, rotaviruses, adenoviruses, herpes viruses, RS viruses, dengue viruses, Japanese encephalitis viruses, severe acute respiratory syndrome (SARS) viruses, or hepatitis viruses.

8. The adjuvant according to claim 6, wherein the bacteria are Bordetella pertussis, Neisseria meningitidis, type B influenza, pneumococcus, tuberculosis bacteria, tetanus bacilli, or cholera bacilli.

9. The adjuvant according to claim 1, which is administered with any mucosal routes.

10. The adjuvant according to claim 9, wherein the administration with mucosal routes is intranasal administration.

11. A mucosal vaccine preparation comprising vaccine antigens and the adjuvant according to claim 1.