U.S. patent application number 13/874654 was filed with the patent office on 2015-10-22 for in vivo delivery of nucleic acids to the liver or liver tissue.
The applicant listed for this patent is Veritas Bio, LLC. Invention is credited to Catherine PACHUK.
Application Number | 20150297625 13/874654 |
Document ID | / |
Family ID | 39789159 |
Filed Date | 2015-10-22 |
United States Patent
Application |
20150297625 |
Kind Code |
A9 |
PACHUK; Catherine |
October 22, 2015 |
In Vivo Delivery of Nucleic Acids to the Liver or Liver Tissue
Abstract
The invention encompasses methods of delivering nucleic acids,
including dsRNA, to mammalian target cells in vivo via
intercellular transfer, wherein the dsRNA is delivered to or
expressed in a first cell different from the target cell, wherein
the first cell facilitates delivery of the dsRNA to the target
cell.
Inventors: |
PACHUK; Catherine;
(Northborough, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Veritas Bio, LLC |
Plymouth Meeting |
PA |
US |
|
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20130344133 A1 |
December 26, 2013 |
|
|
Family ID: |
39789159 |
Appl. No.: |
13/874654 |
Filed: |
May 1, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12514237 |
Sep 2, 2010 |
8524679 |
|
|
PCT/US2007/083805 |
Nov 6, 2007 |
|
|
|
13874654 |
|
|
|
|
60857501 |
Nov 8, 2006 |
|
|
|
60907014 |
Mar 16, 2007 |
|
|
|
60956610 |
Aug 17, 2007 |
|
|
|
60974695 |
Sep 24, 2007 |
|
|
|
60978950 |
Oct 10, 2007 |
|
|
|
Current U.S.
Class: |
424/450 ;
514/44A; 514/44R |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2320/32 20130101; A61P 1/16 20180101; C12N 15/85 20130101;
A61K 35/34 20130101; C12N 2730/10122 20130101; Y02A 50/30 20180101;
A61K 31/713 20130101; A61K 35/36 20130101; C12N 15/111 20130101;
C12N 15/1131 20130101; C12N 2310/14 20130101; C12N 2310/53
20130101; Y02A 50/463 20180101; C12N 2310/111 20130101; A61P 31/12
20180101 |
International
Class: |
A61K 31/713 20060101
A61K031/713 |
Claims
1. A method of delivering at least one initial nucleic acid to
liver or liver tissue in an animal comprising: transfecting at
least one muscle or skin cell of said animal with a nucleic acid
wherein said transfection results in said nucleic acid being
delivered to at least one cell in the liver or liver tissue.
2. The method of claim 1 wherein the muscle or skin cell is
selected from the group consisting of fibroblast cells, cells in a
dermal layer in the skin, cells in a subcutaneous layer of the
skin, myocytes and myoblasts.
3. The method of claim 1 wherein the transfecting of the muscle
cell is comprised of administering intramuscularly the nucleic
acid.
4. The method of claim 1 wherein the transfecting of the skin cell
is comprised of administering subcutaneously or intradermally the
nucleic acid.
5. The method of claim 1 wherein the nucleic acid is a ribonucleic
acid (RNA).
6. The method of claim 5 wherein the RNA is a double-stranded RNA
(dsRNA) or a nucleic acid encoding said dsRNA.
7. The method claim 6 wherein one strand of said dsRNA is
substantially complementary to a region of a messenger RNA
transcribed by anendogenous target gene in the liver or liver
tissue.
8. The method of claim 7 wherein the endogenous target gene in the
liver or liver tissue regulates the production of cholesterol.
9. The method of claim 8 wherein the endogenous target gene is
selected from the group consisting of APOB, pcsk9, and A1AT.
10. The method of claim 1 wherein said transfection is facilitated
by one or more agents selected from the group consisting of polymer
or peptide complexes, cationic amphiphiles, cationic lipids,
cationic liposome formulations, a local anaesthetic, bupivacaine,
particulates, gold particles, gene gun delivery, polycationic
agents, cationic agents, spermine, spermine derivatives,
spermidine, spermidine derivatives, cholesteryl spermine compounds,
cholesteryl spermine carbamates, an electroporation-facilitating
agent, poly-L-glutamate, electroporation, needle injection,
needleless injection, and transdermal patch.
11. The method of claim 1 wherein said transfected cells further
express a transmembrane or surface ligand specific for a receptor
on the liver or liver tissue.
12. The method of claim 11 wherein a second nucleic acid expressing
said transmembrane or surface ligand is co-transfected with said
initial nucleic acid
13. The method of claim 12 wherein said nucleic acid expressing
said transmembrane or surface ligand and said initial nucleic acid
are encoded on a single vector or plasmid.
14. The method of claim 1 wherein said nucleic acid is a dsRNA
having between 15 to about 50 base pairs.
15. The method of claim 14 wherein the dsRNA an shRNA or an
siRNA
16. The method of claim 1 wherein said transfection of said nucleic
acid to said muscle or skin cell does not trigger a detectable PKR
response.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of and claims benefit of
priority to non-provisional application Ser. No. 12/514,237 filed
Sep. 2, 2010, and further claims priority benefit of PCT
international application PCT/US2007/083805 filed Nov. 6, 2007,
provisional application Ser. No. 60/857,501 filed Nov. 8, 2006,
provisional application Ser. No. 60/907,014 filed Mar. 16, 2007,
provisional application Ser. No. 60/956,610 filed Aug. 17, 2007,
and provisional application Ser. No. 60/974,695 filed Sep. 24,
2007, and provisional application Ser. No. 60/978,950 filed Oct.
10, 2007, all which are incorporated herein by reference in their
entireties.
FIELD OF INVENTION
[0002] The invention relates to methods of RNA-mediated inhibition
of target polynucleotides in mammalian cells. This includes
endogenously expressed siRNA, shRNA, miRNA, antisense nucleic
acids, and ribozymes as well as exogenously delivered synthetic
siRNA, shRNA, miRNA, antisense nucleic acids and ribozyme
molecules. The methods also apply to providing functional RNA
including mRNA for gene therapy indications. More particularly, it
relates to methods of inhibiting the function of a target
polynucleotide in a target mammalian cell in vivo comprising
introducing into a first cell such as a skin cell, muscle tissue
cell, including skeletal or striated muscle cells (myocyte or
myoblast), or any other competent cell of the mammal double
stranded RNA (dsRNA) or polynucleotide expression construct
encoding one or more dsRNA or RNAi agent(s) including siRNA, shRNA,
miRNA or other dsRNA, such that the RNAi agent is delivered
distally to the target cell.
BACKGROUND OF THE INVENTION
[0003] The ability of double stranded RNA to effectively silence
gene expression, a phenomenon now commonly known as RNA
interference (RNAi), has been one of the biggest scientific
findings of the past decade. Recently, scientists Andrew Fire and
Craig Mello were awarded the 2006 Nobel Prize for Medicine for
their pioneering work in the RNAi field. However, many challenges
still remain to move RNAi from the laboratory to the clinic. The
biggest challenge to RNAi-mediated inhibition of target gene
expression in animals and particularly humans is the efficient
delivery of the RNAi agent to a sufficient number of target cells.
A variety of delivery mechanisms are currently being explored in
the RNAi field.
[0004] For instance, a number of groups have demonstrated
successful and efficient delivery of double stranded (ds) RNA to
mouse liver by tail vein injection. McCaffrey et al. (Nature
Biotechnol. (2003) 21(6): 639-44) report inhibiting production of
hepatitis B virus replicative intermediates in mice following tail
vein injection of plasmids expressing HBV specific short hairpin
RNAs (shRNAs). Giladi et al. (Mol. Therapy (2003) 8(5): 769-76)
also report inhibition of HBV replication in mice following tail
vein injection of HBV specific short interfering RNA (siRNA), and
Song et al. (Nature Med. (2003) 9(3): 347-51) report RNA
interference of fulminant hepatitis in mice following tail vein
injection of siRNA specific for the fas gene.
[0005] While tail vein injection is suitable for inhibiting gene
expression in mice, it is not a clinically relevant technique that
may be used for humans. However, several groups have also shown
successful delivery of dsRNA therapeutics without tail vein
injection by systemic delivery using synthetic dsRNAs with improved
stability. See Soutschek et al. Nature (2004) 432(7014): 173-8; see
also Morrissey et al. Hepatol. (2005) 41(6): 1349-56. Local
administration to the liver has also been demonstrated by injecting
double stranded RNA directly into the circulatory system
surrounding the liver using renal vein catheterization. See Hamar
et al. PNAS (2004) 101(41): 14883-8. Still others have reported
successful delivery of dsRNA and particularly siRNA using cationic
complexes or liposomal formulations. See, e.g., Landen et al.
Cancer Biol. Ther. (2006) 5(12); see also Khoury et al. Arthritis
Rheumatol. (2006) 54(6): 1867-77.
[0006] In addition to injection into the circulatory system and
lipid-based means of delivering dsRNA, several groups have reported
the use of retroviral and adenoviral vectors for introducing dsRNA
into mammals. For instance, Van den Haute et al. (Human Gene
Therapy (2003) 14: 1799-1807) report lentiviral vector delivery of
short hairpin (shRNAs) against the reporter enhanced GFP (EGFP)
that were shown to knock down gene expression of EGFP in mouse
brain up to six months after transduction. McCaffrey et al.
(Abstract No. 039, Keystone Symposia on siRNAs and miRNAs, Apr.
14-19, 2004) report intravenous infusion of recombinant
adenoviruses expressing HBV-specific shRNAs in HBV infected mice as
a possible treatment approach against hepatitis virus infection in
animals.
[0007] Thus, although some success has been shown using localized
delivery, or by using systemic delivery of stabilized or complexed
dsRNA, there is still a great need for in vivo RNAi delivery
mechanisms that do not require specialized formulations or invasive
delivery procedures. Furthermore, the present inventors have shown
that DNA-based endogenous delivery of dsRNA is especially
advantageous in allowing one to avoid the interferon/PKR response
while providing a prolonged supply of expressed dsRNA. See US
2004/0152117, which is herein incorporated by reference in its
entirety. Accordingly, there is a particular need for targeted
delivery mechanisms for DNA-based RNAi expression vectors that do
not require the use of viruses.
[0008] RNA interference was first discovered in the nematode C.
elegans by Nobel prize laureates Andrew Fire and Craig Mello and
their colleagues. See U.S. Pat. No. 6,506,559, which is herein
incorporated by reference. In U.S. '559, Fire and Mello et al.
report that dsRNA-mediated inhibition showed a surprising ability
to cross cellular boundaries. This observation has since been
described as a phenomenon that is particular to nematodes or
invertebrates, and corresponding modes of such RNAi trafficking in
vertebrate organisms have been generally dismissed.
[0009] The present inventors have surprisingly discovered, however,
that intramuscular, intradermal and subcutaneous delivery of
expression constructs encoding dsRNA results in targeted inhibition
of gene expression in vivo in the liver and potentially other
organs and tissues of mammalian organisms. Without wishing to be
bound by any theory, the inventors hypothesize that delivery of
dsRNA to the liver from the muscle or skin, for example, may be
mediated by extracellular vesicles (exovesicles) containing
expressed RNA molecules such as dsRNA, antisense, miRNA, or mRNA or
injected/introduced RNA molecules such siRNA, shRNA, etc. that bud
from the surface of transfected muscle cells. The extrusion of such
exovesicles has been demonstrated for several cell types including
muscle.
[0010] There is evidence in the art that certain lectins are
exported from muscle cells and myoblasts through evaginations of
the cell membrane which pinch off to form extracellular vesicles
called exovesicles. Such lectins including beta galectins are known
to be on the surface of the extruded exovesicles. See Cooper and
Barondes, Evidence of export of a muscle lectin from cytosol to
extracellular matrix and for a novel secretory mechanism. J. Cell
Sci. (1990) 110: 1681-91; see also Harrison and Wilson, The 14 kDa
beta-galactoside binding lectin in myoblast and myotube cultures:
localization by confocal microscopy, J. Cell Sci. (1992) 101(Pt.
3): 635-46. Extracellular vesicles have also been observed at the
periphery of fibroblasts, which are present in high quantity in the
dermal layer of the skin. See Mehul and Hughes, 1997, Plasma
membrane targeting, vesicular budding, and release of galectin 3
from the cytoplasm of mammalian cells during secretion, J. Cell
Sci. 110: 1169-78. There is also evidence that lectins and certain
glycoproteins may be cleared from the circulation by specific
receptors on the surface of liver cells. See, e.g., Park et al.,
The asialoglycoprotein receptor clears glycoconjugates terminating
with sialic acid alpha 2,6GalNAc. PNAS (2005) 102(47): 17125-9; see
also Nagaoka et al., Galectin receptors are known to be expressed
on the surface of hepatocytes. Furthermore, betagalectin receptors
have been shown to be expressed in a polarized manner on the
sinusoidal side of the hepatocytes, "A quantitative analysis of
lectin binding to adult rat hepatocytes cell surfaces", In Vitro
Cellular and Developmental Biology (1988) 24: 401-412;
"Participation of a galectin-dependent mechanism in the hepatic
clearance of tissue-type plasminogen activator and plasma
kallikrein." Thromb Res (2003) 108: 257-262.
[0011] Thus, the present inventors propose that cytosolic content
including RNAs, e.g., mRNA, expressed siRNA/shRNA/miRNA, as well as
injected/introduced siRNA/shRNA/miRNA, or possibly even transfected
DNA present in the cytosol can be packaged within these exovesicles
and be transported to distal sites such as the liver. Other
mechanisms of transfer have not been ruled out. Whatever the
mechanism, to the present inventors' knowledge, no one has
recognized or proposed that intramuscular, intradermal or
subcutaneous administration of dsRNA and particularly expressed
dsRNA may be used in vivo in mammalian organisms as a therapeutic
nucleic acid delivery mechanism for liver diseases as well as
diseases affecting other distal organs and tissues.
SUMMARY OF INVENTION
[0012] The present invention encompasses methods of delivering
nucleic acids, including double stranded RNA molecules and/or
polynucleotide expression constructs encoding RNA molecules, e.g.,
mRNAs, antisense, ribozyme or dsRNA including RNAi agents such as
siRNA, shRNA, or miRNA, to a target cell in vitro or ex vivo by
delivering a nucleic acid to or expressing a nucleic acid in a cell
that is competent for distal cell targeting. The cell may then be
utilized for production in cell culture of RNA-containing
exovesicles, or for autologous or heterologous transplant into a
recipient mammalian organism. The cell may be a stem cell.
[0013] In one embodiment, among others, the invention includes
methods of delivering at least one double stranded RNA (dsRNA) to a
target cell in an animal comprising transfecting a first cell in
the animal other than said target cell with a nucleic acid encoding
said dsRNA, wherein said transfection results in the dsRNA being
delivered to the target cell. The nucleic acid encoding the dsRNA
may be cotransfected with a nucleic acid expressing a transmembrane
or surface ligand specific for said target cell, either on a single
vector or via separate nucleic acid constructs.
[0014] The methods of the present invention may be used to deliver
any nucleic acid that is capable of being delivered from the
transfected cell to a distal target cell. In some embodiments, the
nucleic acid is a polynucleotide expression construct, e.g., a DNA
plasmid or viral vector, which encodes an RNA effector molecule,
e.g., an RNAi molecule comprising a dsRNA region homologous and
complementary to a target gene in said distal organ or tissue (for
instance, for mediating RNA interference or RNAi), or another
biologically active RNA. Suitable expressed dsRNA or RNAi molecules
include shRNA, siRNA and miRNA and are typically between about 34
to about 500 bases in length and include double stranded or
partially double stranded regions of at least about 15 basepairs,
typically 19 to 29 basepairs; mRNAs sizes typically range from
about 700 nts to about 15,000 nts in length.
[0015] In one embodiment, among others, the present invention
encompasses methods of delivering nucleic acids to distal organs
and tissues via intramuscular administration and transfection of
muscle cells with at least one type of nucleic acid in vivo. For
instance, the invention includes a method of delivering at least
one double stranded RNA (dsRNA) to a target organ or tissue in an
animal comprising transfecting skeletal muscle cells in said animal
with a nucleic acid encoding said dsRNA, wherein said transfection
results in said dsRNA being delivered to said target tissue or
organ. When skeletal muscle cells are transfected, the target organ
or tissue is an organ or tissue or cell other than skeletal muscle.
In some embodiments, a skeletal muscle cell is transfected with an
expression construct encoding a dsRNA molecule, the dsRNA molecule
is expressed in the skeletal muscle cell, and the dsRNA molecule is
delivered to a target cell that is not a skeletal muscle cell.
[0016] In another embodiment, among others, the present invention
encompasses methods of delivering nucleic acids to distal organs
and tissues via intradermal or subcutaneous administration and
transfection of skin cells including fibroblasts with at least one
type of nucleic acid in vivo. For instance, the invention includes
a method of delivering at least one double stranded RNA (dsRNA) to
a target organ or tissue in an animal comprising transfecting skin
cells in said animal with a nucleic acid encoding said dsRNA,
wherein said transfection results in said dsRNA being delivered to
said target tissue or organ. When skin cells are transfected, the
target organ or tissue is an organ or tissue or cell other than the
skin. In some embodiments, a skin cell is transfected with an
expression construct encoding a dsRNA molecule, the dsRNA molecule
is expressed in the skin cell, and the dsRNA molecule is delivered
to a target cell that is not a skin cell.
[0017] While some embodiments encompass transfecting skeletal
muscle cells, skin cells or other competent cells in an animal with
a nucleic acid encoding a dsRNA, methods wherein dsRNA is directly
transfected into muscle cells, skin cells or other competent cells
are also encompassed. These dsRNA molecules include exogenously
prepared transcribed and synthetic siRNA, shRNA and or miRNA
molecules, including chemically modified RNAs. For instance, the
invention includes a method of delivering at least one dsRNA to a
target organ or tissue in an animal comprising transfecting
skeletal muscle cells, skin cells or other competent targeting
cells in said animal with said dsRNA, wherein said transfection
results in said dsRNA being delivered to said other target organ or
tissue. Suitable dsRNA molecules include shRNAs, siRNAs, and miRNAs
and are typically between about 34 to about 500 nucleotides,
preferably comprising at least 15 to 29 basepairs in
double-stranded conformation, including in some applications as
miRNAs certain mismatches. The methods of the invention may be
performed so as not to trigger an interferon/PKR response, for
instance by using shorter dsRNA molecules between 19 to 29 base
pairs, or by using other methods known in the art. See US
Publication 2004/0152117, which is herein incorporated by
reference. The RNAs may be chemically modified as known in the art
to increase stability and decrease non-specific effects and
toxicity.
[0018] Applicants have also demonstrated that dsRNA molecules,
including long dsRNA molecules (e.g., at least about 60, about 75,
about 100, about 150, about 200, about 300, about 400, about 500,
about 600 bp and greater), may be expressed intracellularly in
stress-response competent mammalian cells (e.g., non-embryonic,
differentiated or adult cells) without any evidence of their
inducing an interferon, stress, or "panic" response, see US
2004/0152117A1, which is herein incorporated by reference in its
entirety. In addition, the methods of the invention may themselves
serve to minimize or avoid triggering a stress response in the
target cell to which the dsRNA is delivered irrespective of the
length or nature of the dsRNA; e.g, dsRNAs delivered into distal
cells within "blebs" may avoid triggering a stress response, in
contrast to the same dsRNAs entering through the cell membrane
without the cover of the surrounding "bleb". Any molecule that may
be conjugated to dsRNA, co-transfected or co-expressed therewith,
and delivered therewith to the target cell may be included.
[0019] The present invention also encompasses methods of treating
or preventing diseases in distal organs or tissues in an animal via
intramuscular, intradermal or subcutaneous administration or
transfection of other competent targeting cells, with at least one
nucleic acid in vivo. For instance, the invention includes a method
of treating or preventing disease in a target organ or tissue in an
animal, comprising transfecting skeletal muscle cells, skin cells
or other competent non-target cells in said animal with a nucleic
acid encoding a dsRNA corresponding to a target gene in a cell of
said target organ or tissue, wherein said transfection results in
said dsRNA being delivered to said target tissue or organ, and
wherein delivery of said dsRNA to said target organ or tissue
inhibits or reduces expression of said target gene in said target
organ or tissue thereby treating or ameliorating said disease.
"Intramuscular", "intradermal", or "subcutaneous" delivery as
defined herein includes any method which achieves transfection of
cells within the identified tissue, including without limitation
needle injection into the tissue itself or delivery into a blood
vessel which supplies the tissue, intravascular delivery into a
vessel having enhanced permeability, needleless injection,
biolistic or gene gun projection into a cell or tissue, any of the
various known injection/electroporation technologies, transdermal
patch, etc.
[0020] Administration may be via any method or device which can
achieve the desired introduction of polynucleotide, e.g., needle,
syringe, catheter or cannula injection or needleless injection,
e.g., a Bioject needleless injection device, which can be adjusted
to deliver a liquid medication to various depths including
intradermal, subcutaneous, and/or intramuscular. A transdermal
patch might also be employed, as well as a biolistic injector or
"gene gun" device capable of shooting a plasmid expression vector
into cells. Any of the various injection/electroporation devices
and technologies (Inovio/Genetronics, Ichor, VGX etc.) may also be
used, as may hydrodynamic intravascular methods which utilize
various means, e.g., increased permeability/increased pressure, to
promote delivery to cells including muscle, e.g., the Mirus Pathway
IV.TM. Gene Delivery methods (Mirus, Madison, Wis.) which utilize a
cuff or tourniquet to restrict blood flow and increase pressure
within the vessel in order to facilitate intravascular delivery of
nucleic acids such as plasmid expression vectors to tissues
perfused by the vessel, e.g., limb muscle. A syringe, pump or other
suitable device may be used to effect rapid intravascular delivery
while blood flow is transiently occluded, thereby promoting
transfection of the adjoining muscle cells.
[0021] The methods of the present invention are particularly
suitable for treating or preventing diseases or conditions of or
involving the liver including viral diseases of the liver, liver
cancer and genetic diseases of the liver, or conditions which may
be modulated by targeting an RNA or gene in the liver via e.g.
antisense or RNA interference, or gene therapy where a functional
mRNA is replaced. Expressed therapeutic mRNAs and proteins may also
be delivered to target cells via the methods of the present
invention. The methods are also appropriate for targeting genes in
the liver responsible for certain metabolic diseases or disorders
such as high cholesterol levels for example, including but not
limited to apolipoprotein B and pcsk9. The methods may also be used
to deliver nucleic acid-based therapeutics to other cells and
organs or tissues, including cancer cells or HIV-infected cells,
for instance by expressing suitable receptors or other ligands on
the surface of target cells, and/or by co-expressing cell surface
or exovesicular-targeted ligands in transfected competent targeting
cells. The methods may also be used prophylactically, for instance
to deliver dsRNAs or other nucleic acid-based therapeutics to
target cells to protect against future infection or disease.
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1. Graph demonstrating the percent decrease in HBsAg
expression mediated by the NUC050 vector, which expresses four
HBV-targeted short hairpin dsRNAs, (experiment 183-9) compared to
control vector (183-10) in NOD.sup.scid mice. Mice were
administered either NUC050 plasmid (183-9) or negative control
plasmid NUC049 (183-10), formulated with bupivacaine and injected
intramuscularly (IM) at day 0. Both groups of mice received a
hydrodynamic injection (HDI) of HBsAg expression plasmid NUC054 at
day -5. Serum sAg levels were measured at various days after
dosing. Values represent mean s Ag as a percent of the pre-bleed
sAg value for each group of animals.
[0023] FIG. 2. Graph showing the ratio of Renilla:firefly
luciferase (RLU) in response to muscle electroporation of NUC050
versus NUC049 in C57B1/6 mice. Mice were administered either NUC050
plasmid or negative control plasmid NUC049 via intramuscular (IM)
injection concomitantly with electroporation (EP) at day 0. On day
6, both groups of mice received a hydrodynamic injection (HDI) of
the dual-luciferase reporter plasmid NUC060. Values represent the
mean Renilla RLU/Firefly RLU ratio for each group of animals. The
34.9% difference is statistically significant by nonparametric
Wilcoxon two-sample test (p<0.05).
[0024] FIG. 3. Box-and-whisker plot of individual mouse ND-300
ratios for NUC050 versus NUC049. The distribution of
Renilla:Firefly ratio values among individual animals in each
respective group can be visualized by the box-and whisker plot. The
`box` portion represents the interquartile range (Q1-Q3). The
vertical line within the box represents the median average.
[0025] FIG. 4. Schematic description of TaqMan RNA assays,
TaqMan-based real-time quantification of siRNAs includes two steps,
stem-loop RT and real-time PCR. Stem-loop RT primers bind to the 3'
portion of miRNA molecules and are reverse transcribed with reverse
transcriptase. Then, the RT product is quantified using
conventional TaqMan PCR that includes miRNA-specific forward
primer, reverse primer and dye-labeled TaqMan probes. The purpose
of tailed forward primer at 5' is to increase its melting
temperature (Tm) depending on the sequence composition of miRNA
molecules.
[0026] FIG. 5. Photos of published muscle blebs stained
immunologically for .beta.-galectin (FIG. 5, panels B, C and D)
compared with a time lapsed photo by the present inventors of a
myoblast secreting blebs (panel A).
[0027] FIG. 6. Box-and-whisker plot showing the distribution of
Renilla:Firefly ratio values among individual animals in each
respective group can be visualized by the box-and whisker plot. The
`box` portion represents the interquartile range (Q1-Q3). The
vertical line within the box represents the median average.
[0028] FIG. 7. Graph showing HBsAg Mean Values following
intramuscular electroporation of NUC050 plasmid. The mean sAg
levels of the three dose groups (10 ug, 5 ug, and Zug) are
represented in graph (A) day +2, (B) day+7, and (C) day+16. The
reduction in sAg in the NUC050 group is significant (p<0.05) in
the day+2 IOug group, the day+7 IOug group, and the day+7 5 ug
group.
[0029] FIG. 8. Graph showing the ND-360 ratio of Renilla:Firefly
luciferase (RLU) in response to subcutaneous
delivery/administration of NUC050 versus NUC049 in C57B1/6 mice.
Mice were administered either NUC050 plasmid or negative control
plasmid NUC049 via subcutaneous (SC) injection at day 0. Both
groups of mice received a hydrodynamic injection (HDI) of the
dual-luciferase reporter plasmid NUC060 at day 6. Values represent
the mean Renilla RLU/Firefly RLU ratio in the liver for each group
of animals on day 11. The 16.7% difference is statistically
significant by nonparametric Wilcoxon two-sample test
(p<0.05).
[0030] FIG. 9. Distribution of the individual mouse ND-360 ratios
of Renilla/Firefly Luciferase activity for NUC050 versus NUC049.
The distribution of Renilla:Firefly activity ratios among
individual animals in the experimental (NUC050) and control
(NUC049) groups of ND-360 is shown by the box-and whisker plot. The
`box` portion represents the interquartile range (Q1-Q3). The
vertical line within the box represents the median and the
horizontal lines extend to the lower and upper extremes of the
distribution.
[0031] FIG. 10. Distribution of individual mouse normalized HBsAg
levels for NUC 049 versus NUC050 at day 6 (13 days after vector
injection) and day 11 (18 days after vector injection).
DETAILED DESCRIPTION OF INVENTION
[0032] The present invention encompasses methods of delivering RNA
including double stranded RNA (dsRNA) to a distal target cell or
organ or tissue by expressing the RNA (e.g., a dsRNA) in, or
introducing the RNA into, a first cell that is competent for
inter-organ or inter-tissue or intercellular delivery. By "distal"
is meant that the RNA, e.g., a dsRNA is transported to a different
organ, tissue or cell than the cell into which it is originally
introduced or expressed. "Competent for inter-organ or inter-tissue
or intercellular delivery" or "competent for targeting a distal
cell or organ or tissue" means that the cell into which the dsRNA
is expressed or introduced is able to facilitate delivery of the
dsRNA to a distal organ, tissue or cell, e.g., through vesicle
extrusion. Such cells include muscle cells and skin cells, and any
other cell that is competent for RNA delivery to distal
tissues.
[0033] The present invention is based on the surprising discovery
that intramuscular, intradermal or subcutaneous injection of a
nucleic acid encoding a dsRNA corresponding to a target gene
results in inhibition of target gene expression in the liver.
Accordingly, in one embodiment, the invention encompasses methods
of delivering nucleic acids to distal organs or tissues in vivo and
methods of treating or preventing diseases and disorders in distal
organs or tissues via intramuscular, intradermal or subcutaneous
administration and transfection of muscle or skin cells with at
least one dsRNA, or at least one nucleic acid expressing a dsRNA
corresponding to a target gene in a cell of said distal organ or
tissue.
[0034] As reported herein, the present inventors have demonstrated
that intramuscular, intradermal or subcutaneous delivery of a
vector or DNA construct expressing target-specific dsRNA molecules,
e.g., shRNA (RNAi) molecules, is surprisingly able to reduce the
expression of Hepatitis B surface antigen (sAg), as well as other
target genes, in the liver. While not wishing to be bound by any
mechanism, it is hypothesized that the encoded double-stranded RNA
molecules (e.g., shRNAs or duplex dsRNAs) are transcribed from
expression constructs transfected into muscle or skin cells and the
RNAi molecules are then delivered to the liver. While no evidence
has been found that any significant quantity of intact dsRNA
expression plasmid DNA itself gets into liver hepatocytes, it
cannot yet be ruled out that DNA encoding the double-stranded
molecules of the invention is transferred to the liver, either
alone or in combination with the expressed dsRNA.
[0035] Muscle cells are one type of cell known to extrude plasma
membrane vesicles, or exovesicles, also known as membrane
"blebbing". For example, galectin is one protein expressed at high
levels in skeletal and smooth muscle cells, which lacks a signal
sequence and has been shown to be secreted by a mechanism distinct
from classical exocytosis. Prior to secretion, galectin has been
observed to become specifically concentrated under the myoblast
plasma membrane and in plasma membrane evaginations which appear to
pinch off to form galectin rich extracellular vesicles. Cooper and
Barondes, 1990; Cooper, 1997, Galectin-1: Secretion and Modulation
of Cell Interactions with Laminin, Trends in Glycoscience and
Glycotechnol. 9(45): 57-67; Harrison and Wilson, 1992, The 14 kDa
.beta.-galactosidase binding lectin in myoblast and myotube
cultures: localization by confocal microscopy, J. Cell Sci. 101:
635-46.
[0036] Although the process of membrane blebbing and the extent to
which membrane blebbing contributes to protein export in other cell
types are still unclear, membrane blebbing has also been observed
in cells other than muscle cells. Indeed, a variety of different
galectin genes have been detected in different cell types, each
lacking a signal sequence and containing a highly conserved core
sequence of about 130 amino acids. See Cooper and Barondes, 1999.
Galectin-1, the best-characterized of the galectin family, is
expressed in many tissues besides skeletal and smooth muscle,
including liver, lung, heart, spleen, intestine, brain,
lymphocytes, thymocytes and other vascular cells, the olfactory
system, and the central and peripheral nervous systems. Inagaki et
al. 2000, Oxidized galectin-1 promotes axonal regeneration in
peripheral nerves but does not possess lectin properties, European
J. Biochem. 267(10): 2955-64. Galectin-1 is also expressed and
secreted by CHO cells by a non-classical mechanism. See Seelenmeyer
et al., 2005, Cell surface counter receptors are essential
components of the unconventional export machinery of galectin-1, J.
Cell Biol. 171: 373-81. Galectin-3, which has also been shown to be
secreted in exovesicles that pinch off the plasma membrane, has
been detected in activated macrophages, eosinophils, neutrophils,
mast cells, the epithelium of the gastrointestinal and respiratory
tracts, the kidneys and some sensory neurons as well as many
tumors. Krzeslak and Lipinska, 2004, Galectin-3 as a
multifunctional protein, Cell. MoI. Biol. Letts. 9: 305-28.
[0037] Membrane blebbing, sometimes referred to as ectocytosis, has
been observed at the periphery of many cell types, including
fibroblasts, neutrophils and chondrocytes. See Mehul and Hughes,
1997, Plasma membrane targeting, vesicular budding, and release of
galectin 3 from the cytoplasm of mammalian cells during secretion,
J. Cell Sci. 110: 1169-78. Further, it has been hypothesized that
shedding of membrane exovesicles may also be a mechanism for FGF-2
secretion from a variety of other cell types. See Walter Nickel
2005 Unconventional Secretory Routes: Direct Protein Export Across
the Plasma Membrane of Mammalian Cells, Traffic 6: 607-14. Also,
membrane blebbing has also been proposed as a potential secretory
mechanism for certain apocrine-synthesized proteins, including
secretory transglutaminase. See Aumuller et al. 1999 Apocrine
secretion-Fact or artifact? Ann. Anat. 181(5): 437-46. Assuming
membrane blebbing is involved in the effects reported in the
present invention, the methods of the present invention may be
performed using any exovesicle-producing cell that is currently
known or that will be identified in the future. Since extruded
exovesicles are on average about 80 nm in diameter and coated with
surface galectins, they have the potential to interact with cell
types that contain galectin receptors. Such cells include
hepatocytes, whose galectin receptors are positioned to face the
sinusoids and thus be exposed to molecules and particles in the
blood.
[0038] Exovesicles, which generate as a process of membrane
blebbing or shedding, should be distinguished from exosomes or
multivesicular bodies. See Walter Nickel 2005; see also Cooper,
1997. Exosomes are produced from the endoplasmic reticulum and have
very little if any cytosolic content, although they do have some
MHC molecules on their surface and can be used as antigen
presenting vehicles. In contrast, exovesicles bud from the surface
of muscle cells and include cytosolic content as has been
demonstrated by the inventors. Indeed, in the process of expressed
interfering RNA (eiRNA), transcription occurs in the nucleus but
the RNA is then transported to the cytoplasmic compartment, where
the inventors hypothesize it is then incorporated into exovesicles
blebbing off the membrane surface.
[0039] Notwithstanding the actual mechanism, the present invention
encompasses methods of delivering at least one nucleic acid to a
target cell in an animal comprising transfecting a first cell in
the animal other than said target cell that is competent for distal
cell targeting with a nucleic acid encoding an RNA of interest,
e.g., an "RNA effector molecule" having a desired biological
activity, e.g., an antisense RNA, triplex-forming RNA, ribozyme, an
artificially selected high affinity RNA ligand (aptamer), a
double-stranded RNA (e.g., siRNA, shRNA, miRNA) or other regulatory
RNA or an mRNA, wherein said transfection results in either the DNA
or the encoded RNA being delivered to the target cell. The RNA may
or may not be polyadenylated. The RNA may or may not be capable of
being translated. The first competent cell may also be transfected
in vitro or ex vivo, and the competent cell thereafter introduced
into the animal. The methods of the present invention may be used
to deliver any nucleic acid that is present in the cytoplasm of the
transfected cell and is capable of being delivered to the distal
target cell. In addition to transfected and expressed dsRNAs, the
present invention also includes methods of delivering expressed
mRNA from therapeutic genes. RNAs that may be delivered to the
distal target cell include, but are not limited to, antisense RNA,
ribozyme RNA, dsRNAs including hairpin dsRNA, microRNA and duplex
dsRNA molecules, as well as mRNAs.
[0040] Suitable "competent" cells for use in the methods of the
invention include muscle cells, skin cells and any other competent
cell capable of delivering nucleic acids to a distal target cell.
Other competent cells may be identified using one of the RNA
transfer assays disclosed in WO 00/63364, which is herein
incorporated by reference in its entirety. For instance, Example 2
of WO 00/63364 describes two different in vitro assays that may be
used to detect the transfer of RNA molecules between co-cultured
donor and target cells.
[0041] By "double stranded RNA" or "dsRNA" is meant a ribonucleic
acid containing at least a region of nucleotides that are in a
double stranded conformation. The dsRNA may be a conventional
siRNA, shRNA or miRNA (including primary transcript or pri-miRNA,
pre-miRNA, or functional miRNA) or an RNA that contains more than
one hairpin structure. The double stranded RNA may be a single
molecule with one or more region(s) of self-complementarity such
that nucleotides in one segment of the molecule base pair with
nucleotides in another segment of the molecule. In various
embodiments, a double stranded RNA that consists of a single
molecule consists entirely of ribonucleotides, a combination of
ribonucleotides and modified bases, or includes a region of
ribonucleotides that is complementary to a region of
deoxyribonucleotides. Alternatively, the double stranded RNA may
include two different strands that have one or more region(s) of
complementarity to each other. Desirably, the region of the double
stranded RNA that is present in a double stranded conformation
includes at least about 15 to 20, 20 to 25, 25 to 30, 50, 75, 100,
200, 500, 1000, 2000 or 5000 nucleotides participating in one
strand of the double stranded structure, or includes all of the
nucleotides being represented in the double stranded RNA. In some
embodiments, the double stranded RNA is fully complementary, and
does not contain any single stranded regions, such as single
stranded ends. In other embodiments, as e.g., miRNA-type dsRNA
molecules, the double-stranded regions may be interspersed with one
or more single-stranded nucleotides or areas. In some embodiments
the dsRNA is an shRNA. All such synthetically prepared and
exogenously delivered RNAs, including shRNAs and duplex or siRNAs,
may be chemically stabilized and chemically modified, using one or
more of the methods and chemical modifications known to those of
skill in the art. Such modifications which may be used in
combination include sulfur chemistry modification such as
phosphorothioate linkages that make the drug more resistant to
degradation, T-.beta.-methoxyethyl modifications, etc. See e.g.
Chiu and Rana, siRNA function in RNAi: A chemical modification
analysis, RNA (2003), 9:1034-1048. Cold Spring Harbor Laboratory
Press, the teaching of which is incorporated by reference.
[0042] In some embodiments, the dsRNA region of the RNA molecule
corresponds to a target gene in said target organ or tissue (for
instance, for mediating RNA interference or RNAi). In such
instances, the dsRNA region is preferably not translated, and is
substantially homologous and complementary to a region of the
target gene. Where the dsRNA is used for RNA interference, one
strand of the dsRNA structure or region, i.e., the antisense
strand, will have at least about 70, 80, 90, 95, 98, or 100%
complementarity to a target nucleic acid, and the other strand or
region, i.e., the sense strand or region will have at least about
70, 80, 90, 95, 98, or 100% identity to a target nucleic acid. In
such embodiments, the dsRNA is considered to be both substantially
homologous and complementary to the target gene, meaning that the
dsRNA need not be entirely identical and complementary to the
target gene so long as it is still effective to mediate sequence
specific RNA interference. Such dsRNAs will usually have a sequence
of at least 19 contiguous nucleotides 100% complementary and
homologous to a target nucleic acid. Preferred for RNAi
applications are short hairpin dsRNA (shRNA) molecules and microRNA
(miRNA) molecules. By shRNA (short-hairpin RNA) is meant an RNA
molecule of less than approximately 400 to 500 nucleotides (nt),
preferably less than 100 to 200 nt, in which at least one stretch
of at least 15 to 100 nucleotides (preferably 17 to 50 nt, more
preferably 19 to 29 nt) is base paired with a complementary
sequence located on the same RNA molecule, and where said sequence
and complementary sequence are separated by an unpaired region of
at least about 4 to 7 nucleotides (preferably about 9 to about 15
nucleotides) which forms a single-stranded loop above the stem
structure created by the two regions of base complementarity. The
shRNA molecules comprise at least one stem-loop structure
comprising a double-stranded stem region of about 17 to about 100
bp; about 17 to about 50 bp; about 40 to about 100 bp; about 18 to
about 40 bp; or from about 19 to about 29 bp; homologous and
complementary to a target sequence to be inhibited; and an unpaired
loop region of at least about 4 to 7 nucleotides, preferably about
9 to about 15 nucleotides, which forms a single-stranded loop above
the stem structure created by the two regions of base
complementarity. In addition to single shRNAs, included shRNAs can
be dual or bi-finger and multi-finger hairpin dsRNAs, in which the
RNA molecule comprises two or more of such stem-loop structures
separated by a single-stranded spacer region. A recombinant vector
may be engineered to encode multiple, e.g., three, four, five or
more short hairpin dsRNAs and/or other RNAs such as mRNAs. The
hairpin dsRNA may be a single hairpin dsRNA or a bi-fingered, or
multi-fingered dsRNA hairpin as described in PCT/US03/033466 or WO
04/035766 or a partial or forced hairpin structure as described in
WO 2004/011624, or the dsRNA may be a polynucleotide comprising one
or more dsRNA effector molecules encoded in a miRNA context as
described in PCT/US2007/81103 filed 1 Oct. 2007. The teachings of
each of these documents are incorporated herein by reference in
their entireties.
[0043] An siRNA can be expressed or synthetic and is comprised of
two RNA strands that basepair with each other to form a dsRNA,
i.e., duplex RNA. The basepairing does not need to be 100% and thus
the complementarity of one strand with the second does not need to
be 100%. Complementarity should be sufficient to maintain the
stands in double-stranded confirmation. The amount of
complementarity needed is sequence and length dependent and can be
easily calculated by one skilled in the art. siRNA length is most
optimally 19-29 bp, next preferred is 30-40 bp. A limited number of
mismatches within the double-stranded region, especially in the
sense strand, is compatible with RNAi activity. siRNAs may be
chemically stabilized and chemically modified, using one or more of
the methods and chemical modifications known to those of skill in
the art.
[0044] By "target nucleic acid" is meant the nucleic acid sequence
in the distal target organ, tissue or cell whose expression is
modulated as a result of sequence-specific nucleic acid based
inhibition, e.g., post-transcriptional or transcriptional gene
silencing, antisense inhibition, ribozymal cleavage, etc. The
target nucleic acid sequence can be any nucleic acid in the target
cell, DNA, RNA or DNA/RNA hybrid, whose expression is desired to be
modulated, including without limitation gene sequences or
chromosomal sequences endogenous to the cell as well as introduced
sequences, genomic sequences, cDNA, mRNA sequences, sequences of
intracellular pathogens such as viral nucleic acids present in the
cell, transcribed and non-transcribed sequences, coding and
non-coding sequences, translated and non-translated sequences
including 3' and/or 5' UTRs, and regulatory sequences such as
transcription factor binding site, promoter, enhancer, and
repressor sequences. Suitable target nucleic acid sequences are
associated with cancer or abnormal cell growth, such as oncogenes,
and nucleic acid sequences associated with an autosomal dominant or
recessive disorders, as well as nucleic acid sequences associated
with pathogens including viruses. To "modulate" means to decrease
the expression of a target nucleic acid in a cell, or the
biological activity of the encoded target polypeptide in a cell, by
at least about 20%, more desirably by at least about 30%, 40%, 50%,
60%, 75%, 80%, 85%, 90%, 95% or even 100%. In some instances,
expression of genes in the target cell may also be increased, for
instance where the gene targeted by the dsRNA is a transcriptional
repressor or other negative regulatory gene. In some instances the
target nucleic acid will not be present in the first transfected
cell. In some instances the target nucleic acid will be present in
the first transfected cell as well as in the distal target
cell.
[0045] Typically with expressed interfering RNA (eiRNA), the dsRNA
is expressed in the first transfected cell from an expression
vector. In such a vector, the sense strand and the antisense strand
of the dsRNA may be transcribed from the same nucleic acid sequence
using e.g., two convergent promoters at either end of the nucleic
acid sequence or separate promoters transcribing either a sense or
antisense sequence. Alternatively, two plasmids can be
cotransfected, with one of the plasmids designed to transcribe one
strand of the dsRNA while the other is designed to transcribe the
other strand. Alternatively, the nucleic acid sequence encoding the
dsRNA comprises an inverted repeat, such that upon transcription
from a single promoter, the expressed RNA forms a double stranded
RNA, i.e. that has a hairpin or "stem-loop" structure, e.g., an
shRNA. The loop between the inverted repeat regions, or sense and
antisense regions, is typically at least four base pairs, but can
be at least about 10, at least about 15, at least about 20, at
least about 25, at least about 30, at least about 50, or at least
about 75, or more, or any size that permits formation of the double
stranded structure. Multiple stem-loop structures may be formed
from a single RNA transcript to generate a multi-target dsRNA. See
WO 00/63364, and WO2004/035765, which are herein incorporated by
reference in their entireties. Hairpin structures may be partial or
forced hairpin structures as described in WO2004/011624,
incorporated herein by reference.
[0046] By "expression vector" is meant a recombinant vector
including a DNA or RNA construct or viral vector that contains at
least one promoter operably linked to a sequence encoding a
regulatory RNA such as a siRNA, shRNA, miRNA, antisense, or a
downstream gene or coding region or other nucleic acid sequence to
be transcribed {e.g., a cDNA or genomic DNA fragment that encodes a
protein, optionally, operably linked to sequence lying outside a
coding region, or a sense and/or an antisense RNA coding region,
and/or RNA sequences lying outside a coding region). The
sequence(s) to be transcribed may include any target nucleic acid
sequence whose expression is desired to be modulated. Transfection
or transformation of the expression vector into a recipient cell
allows the cell to express RNA encoded by the expression vector. An
expression vector may be a genetically engineered plasmid, viral
vector including but not limited to AAV, adenovirus, poxvirus,
herpesvirus, retrovirus, lentevirus, and alphavirus, or artificial
chromosome derived from, for example, a bacteriophage, adenovirus,
adeno-associated virus, retrovirus, poxvirus, or herpesvirus.
Preferred for expression of dsRNA effector molecules in the methods
of the invention are RNA polymerase III Type 3 or "U6-type" RNA
polymerase III promoters and multiple RNA polymerase III promoter
expression constructs as taught in WO 06/033756. RNA polymerase II
promoters including mammalian viral promoters, and mammalian
including human cellular promoters may be utilized for expression
of longer RNAs including mRNAs. An expression construct can be
replicated in a living cell such as a bacterium or eukaryotic cell
or it can be made synthetically. For purposes of this application,
the terms "expression vector", "expression construct", "vector",
and "plasmid" are used interchangeably in the general illustrative
sense and are not intended to limit the invention to a particular
type of expression construct.
[0047] By "operably linked" is meant that a gene and one or more
transcriptional regulatory sequences, e.g., a promoter or enhancer,
are connected in such a way as to permit gene expression when the
appropriate molecules (e.g., transcriptional activator proteins)
are bound to the regulatory sequences.
[0048] By "promoter" is meant a minimal sequence sufficient to
direct transcription of a gene. Also included in this definition
are those transcription control elements (e.g., enhancers) that are
sufficient to render promoter-dependent gene expression
controllable in a cell type-specific, tissue-specific, or
temporal-specific manner, or that are inducible by external signals
or agents; such elements, which are well-known to skilled artisans,
may be found in a 5' or 3' region of a gene or within an intron.
Included are RNA pol I, RNA pol II and RNA pol III promoters,
including RNA polymerase III Type 3 promoters such as HI, 7SK, and
U6. Polymerase III Type 3 promoters may advantageously be used to
express short oligonucleotides such as the shRNAs, siRNAs, and
other oligonucleotide RNA effector molecules of no more than 300 to
400 nucleotides in length (see U.S. Pat. No. 5,624,802, Noonberg et
al.). A preferred RNA pol III 7SK promoter (7SK 4A) and expression
constructs comprising multiple polymerase III promoters are taught
in WO 06/033756. Also included are promoters that permit
overexpression of mRNAs in the cytoplasm of the transfected cell,
for instance to optimize incorporation of expressed mRNA molecules
into membrane exovesicles.
[0049] Expression plasmids that transcribe RNA effector molecules
including dsRNAs in either the cytoplasm or the nucleus may be
utilized. Expression vectors may be designed to integrate into the
chromosome of transfected cells, for instance by homologous
recombination. Alternatively, expression vectors may replicate in
transfected cells extrachromosomally. Nuclear transcription vectors
for protein expression are preferably designed to express
polyadenylated 5' capped RNA (for example, a vector containing an
RNA polymerase II promoter and a poly A site) to facilitate export
from the nucleus. Intracellular transcription may also utilize
bacteriophage T7 and SP6 promoters, i.e., by transfecting a vector
that coexpresses the appropriate RNA polymerase gene, which may be
designed to transcribe in the cytoplasm or in the nucleus.
Promoters for viral RNA polymerases, either DNA and RNA dependent,
may also be used. Alternatively, dsRNA replicating polymerases can
be used. Promoters for cellular polymerases such as RNA Polymerase
I, II, or III or mitochondrial RNA polymerase may also be utilized.
Tissue- or cell-specific promoters may be used to limit expression
of the dsRNA to the first transfected cell. Polymerase III
promoters are especially desirable for expression of small
engineered RNAs. See WO 06/033756, Multiple Polymerase III Promoter
Expression Constructs, incorporated herein by reference. Preferred
are polymerase III type 3 promoters, including various mammalian
U6, HI, and 7SK promoters, including the modified 7SK 4A promoter
sequence taught therein. See also, e.g., US 2005/0130184 Al, Xu et
al., directed to modified polymerase III promoters which utilize
polymerase II enhancer elements, as well as US 2005/0130919 Al, Xu
et al., directed to regulatable polymerase III and polymerase II
promoters, the teaching of which is hereby incorporated by
reference. In some embodiments it may be desirable to include one
or more polymerase I, and/or one or more polymerase II, and/or one
or more polymerase III promoters in a single expression construct,
as e.g., where it is desirable to utilize pol III promoters to
express one or more RNA effector molecules such as dsRNAs and one
or more pol II promoters to express one or more targeting
ligands.
[0050] A desirable approach for cytoplasmic expression is to use
endogenous polymerases such as the mitochondrial RNA polymerase to
make dsRNA in the cytoplasm. These vectors are formed by designing
DNA expression constructs that contain mitochondrial promoters
upstream of the sequence encoding the dsRNA. As described above for
nuclear transcription vectors, dsRNA can be generated using two
such promoters placed on either side of the target sequence, such
that the direction of transcription from each promoter is opposing
each other. Alternatively, two plasmids can be cotransfected. One
of the plasmids is designed to transcribe one strand of the target
sequence while the other is designed to transcribe the other
strand. Single promoter constructs may be developed such that two
units of the target sequence are transcribed in tandem, such that
the second unit is in the reverse orientation with respect to the
other. Alternate strategies include the use of filler sequences
between the tandem target sequences.
[0051] Cytoplasmic expression of dsRNA may also be achieved by
transcription of a single stranded RNA template in the nucleus of
the transfected cell, which is then transported into the cytoplasm
where it serves as a template for the transcription of dsRNA
molecules, utilizing a single subgenomic promoter opposite in
orientation with respect to the nuclear promoter. The nuclear
promoter generates one RNA strand that is transported into the
cytoplasm, and the singular subgenomic promoter at the 3' end of
the transcript is sufficient to generate its antisense copy by an
RNA dependent RNA polymerase to result in a cytoplasmic dsRNA
species. Both cytoplasmic and nuclear transcription vectors may
contain a reporter gene to enable monitoring of cells that have
taken up the plasmid. Any type of vector may be used, including
plasmids, viral vectors, retroviral vectors, adenoviral vectors,
AAV vectors, etc. The use of expression vectors to express double
stranded RNA is also discussed in detail in US 20040152117, which
is herein incorporated by reference in its entirety.
[0052] If desired, inducible and repressible transcription systems
can be used to control the timing of the synthesis of RNA effector
molecules including mRNAs. Inducible and repressible regulatory
systems involve the use of promoter elements that contain sequences
that bind prokaryotic or eukaryotic transcription factors upstream
of the sequence encoding dsRNA. In addition, these factors also
carry protein domains that transactivate or transrepress the RNA
polymerase II. The regulatory system also has the ability to bind a
small molecule (e.g., a coinducer or a corepressor). The binding of
the small molecule to the regulatory protein molecule (e.g., a
transcription factor) results in either increased or decreased
affinity for the sequence element. Both inducible and repressible
systems can be developed using any of the inducer/transcription
factor combinations by positioning the binding site appropriately
with respect to the promoter sequence. Examples of previously
described inducible/repressible systems include lac, ara,
Steroid-RU486, and ecdysone--Rheogene, Lac (Cronin et al. Genes
& Development 15: 1506-1517, 2001), ara (Khlebnikov et al., J.
Bacterid. 2000 December; 182(24):7029-34), ecdysone (Rheogene,
www.rheogene.com), RU48 (steroid, Wang X J, Liefer K M, Tsai S,
O'Malley B W, Roop D R., Proc Natl Acad Sci USA. 1999 JuI. 20;
96(15):8483-8), tet promoter (Rendal et al., Hum Gene Ther. 2002
January; 13(2):335-42. and Lamartina et al., Hum Gene Ther. 2002
January;13(2):199-210), or a promoter disclosed in WO 00/63364,
filed Apr. 19, 2000.
[0053] In one embodiment, among others, the present invention
encompasses methods of delivering nucleic acids to distal organs or
tissues via intramuscular, intradermal or subcutaneous
administration and transfection of muscle or skin cells with at
least one nucleic acid in vivo. When transfecting muscle cells, the
expression construct comprises polynucleotide sequences encoding
the double stranded RNA that are operably linked to regulatory
elements operable in the muscle cell. When transfecting skin cells,
the expression construct comprises polynucleotide sequences
encoding the double stranded RNA that are operably linked to
regulatory elements operable in the skin cell. Promoters and other
regulatory elements operable in muscle and/or skin cells are known
in the art, and for instance include, but are not limited to
polymerase I, polymerase II, and polymerase III promoters (e.g.,
preferably pol III type 3 promoters including human and other
mammalian U6, 7SK, and HI promoters) as well as mitochondrial
promoters, e.g., human and other mammalian mitochondrial heavy and
light chain promoters. Short RNAs (fewer than 300-400 nt engineered
RNAs such as shRNAs) are best expressed by pol I and/or pol III
promoters. Longer RNAs, including mRNAs, are best expressed by pol
II promoters, including viral promoters such as CMV IEP, RSV LTR,
SV40, etc. Bacteriophage promoters such as T7, T3, SP6, etc. may
also be utilized if the cell is also provided with the cognate T7,
T3, SP6 polymerase(s). For expression in muscle and/or skin cells,
such polymerase III promoters can be used to express small dsRNAs
and polymerase II promoters such as CMV (cytomegalovirus immediate
early promoter) including HCMV (human), MCMV (murine), SCMV
(simian), SV40, RSV, vaccinia, and other viral promoters;
eukaryotic including mammalian polymerase II promoters such as the
B-actin promoter, can be used to express a translatable mRNA
encoding a cell-surface protein, receptor, or targeting ligand or
other desired protein. The mRNA may be translated in the first cell
and/or a distal cell to which it is delivered.
[0054] Muscle cells include mammalian striated or skeletal
myocytes, including differentiated myocytes as well as
undifferentiated myoblasts. Cardiac muscle is also striated muscle.
A myoblast is a type of stem cell that exists in muscles. Skeletal
muscle cells are called muscle fibers or myocytes and are produced
when myoblasts fuse together. Therefore, muscle fibers may have
multiple nuclei. Myoblasts that do not form muscle fibers
differentiate into satellite cells. These satellite cells remain
adjacent to a muscle fiber, separated only by its cell membrane and
by the endomycium (the connective tissue of collagen surrounding
the muscle fiber).
[0055] "Intramuscular" administration means that the nucleic acid
is administered to muscle tissue and any muscle cell in the animal,
including but not limited to skeletal muscle such as the deltoid,
vastus lateralis, ventrogluteal, tibialis and dorsogluteal muscles.
The means by which intramuscular administration may be achieved
includes needle injection, needleless injection, electroporation,
biolistic approaches, and any other method that can accomplish
delivery into a muscle cell or a cell in muscle tissue. Such
delivery may be directly into the muscle tissue or via
intravascular delivery into muscle cells or into cells in muscle
tissue supplied by such blood vessel(s). In the methods of the
invention comprising intramuscular administration, the RNAi agent
or expressed dsRNA or other nucleic acid-based therapeutic is
designed to inhibit the function of a target polynucleotide in a
cell of the mammal which is not a muscle cell.
[0056] In one aspect of the invention, such an expression construct
encoding sequences homologous and complementary to one or more
target polynucleotide sequences present in a liver cell is
introduced into a skeletal or other muscle cell and the function of
one or more target polynucleotides in a liver hepatocyte is
inhibited, e.g., polynucleotides of a liver pathogen such as a
hepatitis virus, including HBV and/or HCV and HDV and HAV. In
another aspect, the invention involves introducing into an
appropriate cell such as a muscle cell an expression construct
encoding sequences targeting genes in the liver responsible for
metabolic diseases or disorders such as high cholesterol levels for
example, including but not limited to apolipoprotein B and pcsk9.
Another such potential liver target is the genetic disorder alpha
1-antitrypsin deficiency (.alpha.I-antitryspin deficiency, AlAD or
Alpha-1), caused by a mutation which results in defective
production of alpha 1-antitrypsin (AlAT), leading to decreased AlAT
activity in the blood and lungs, and deposition of excessive
abnormal AlAT protein in liver cells. Treatment utilizing the
methods of the invention would include providing an inhibitory
dsRNA which targets the mutated AlAT sequence, while co-expressing
an mRNA encoding the functional AlAT. This could be accomplished by
providing to muscle cells an expression vector(s) co-expressing the
inhibitory dsRNA and an mRNA encoding the functional protein, both
of which are delivered to liver cells.
[0057] "Intradermal" administration means in or into the skin, and
can include administration to any layer of the dermis or epidermis,
and delivery into any cell thereof. "Subcutaneous" administration
means just under the skin, or to the subcutaneous layer of the
skin, and delivery into any cell thereof. Also encompassed are
epicutaneous forms of administration, i.e., with "epicutaneous"
meaning on the surface of the skin (for instance using a
transdermal patch, ointment, lotion or any other suitable means).
Skin cells include cells of the epidermis, including for example
basal cells, melanocytes, Langerhans' cells, Merkel cells, sensory
nerves, keratinocytes, and any other cell found in the various
layers of the epidermis including the basal layer, the squamous
cell layer, the stratum granulosum, the stratum lucidum and the
stratum corneum. Skin cells also include cells of the dermis,
including vascular cells, lymph cells, cells of sweat and sebaceous
glands, nerve cells, fibroblasts, and any other cell found in the
various layers of the dermis including the papillary layer and the
reticular layer. Skin cells also include those of the subcutis,
i.e., the innermost layer of the skin, which includes fat and
collagen cells.
[0058] The present invention encompasses delivery regimens where
dsRNAs or nucleic acid vectors expressing the same are delivered to
both skin cells and muscle cells simultaneously or sequentially.
The means by which intradermal, subcutaneous, and/or intramuscular
administration may be achieved includes needle injection,
needleless injection, electroporation, biolistic approaches, and
any other method that can accomplish delivery into a muscle or skin
cell or a cell in muscle or skin tissue.
[0059] In one embodiment, the present invention encompasses methods
of delivering nucleic acids, including double stranded RNA
molecules and/or polynucleotide expression constructs encoding RNA
molecules, e.g., mRNAs, antisense, ribozyme or dsRNA including RNAi
agents such as siRNA, shRNA, or miRNA, to a target cell in vitro or
ex vivo by delivering a nucleic acid to or expressing a nucleic
acid in a cell that is competent for distal cell targeting.
Competent donor cells may also be utilized for production in cell
culture of RNA-containing exovesicles, or for autologous or
heterologous transplant into a recipient mammalian organism. The
cell may be a muscle cell, skin cell, stem cell, or any suitable
competent cell. A cell which is competent for distal cell targeting
may be obtained e.g., from a potential mammalian recipient, e.g., a
human recipient, or from another donor, transfected in vitro or ex
vivo with a selected polynucleotide expression construct or with
selected RNA molecules, and implanted, e.g., subcutaneously or
intramuscularly, into a recipient mammalian organism. The
transplanted cell(s) may be autologous or heterologous with respect
to the recipient. The recipient mammal may be an immunocompromised
mammal or a mammal administered immunosuppressants. The implanted
cells may then serve as a "factory" for in vivo production of RNA
effector molecules, e.g., RNAi and/or mRNA molecules, for transport
to a distal cell. Such cells may also express targeting ligands or
other proteins enhancing exovesicle production, transport,
targeting, and/or uptake, such as the receptor for HIV. The distal
cell may be a liver cell such as a hepatocyte or another cell. The
RNA effector molecule may repress a target gene in the liver, e.g.,
a gene of a pathogen such as a hepatitis virus or an endogenous
disease-related gene found in the liver. The distal target cell may
also be a non-liver cell, including any of the target cells
described herein.
[0060] In one aspect, the invention relates to a method of dsRNA
mediated gene inhibition or RNAi comprising delivering to muscle or
skin cells of a mammal in vivo a nucleic acid expression vector
encoding an RNAi or dsRNA agent. As described above, the RNAi
agent(s) may be one or more hairpin or duplex dsRNA molecules,
including one or more short hairpin dsRNA agents. The dsRNA
expression vector may be DNA or RNA, including plasmid DNA. The
expression vector may be a viral vector such as AAV for example.
The polynucleotide expression vector may be supplied to the muscle
as "naked" DNA or RNA (free from association with a transfection
facilitating agent) or in association with an agent which
facilitates transfection or transfer into mammalian skin cells or
muscle cells or myocytes, including differentiated myocytes as well
as undifferentiated myoblasts. In another aspect, the invention
relates to such an RNAi method involving delivery by intramuscular
electroporation-mediated transfection of skeletal muscle or
myocytes, or skin cells of a mammal in vivo with a vector or
construct expressing dsRNA molecules.
[0061] Numerous agents may be used to facilitate transfection of
mammalian muscle cells in vivo including but not limited to polymer
or peptide complexes, cationic amphiphiles, cationic lipids,
cationic liposomic formulations, including the amino amide local
anesthetic bupivacaine, particulates including gold particles
utilized for biolistic or "gene gun" delivery, polycationic or
cationic amphiphile agents including spermine and/or spermidine
derivatives including various cholesteryl spermine compounds. The
polynucleotide expression vector is frequently delivered to the
mammalian muscle or skin tissue formulated in association with or
as a complex with one or more of such transfection-facilitating
agents.
[0062] Bupivacaine is one of the amphiphilic amino amide local
anesthetic agents known to act as a transfection-facilitating agent
for delivery into tissues including skeletal muscle of
polynucleotide, including plasmid DNA, encoding immunogenic
proteins, e.g., antigens of pathogens, for use in the field of DNA
vaccines. The proteins are expressed in the muscle cells,
triggering both humoral and cellular immune responses. See e.g.,
U.S. Pat. Nos. 6,217,900 and 6,383,512, "Vesicular Complexes and
Methods of Making and Using the Same." Methods of injecting "naked"
DNA encoding immunogenic and other biologically active polypeptides
into muscle or skin are also known, see e.g., U.S. Pat. Nos.
5,580,859; 5,589,466. U.S. Pat. No. 6,413,942 describes delivering
into muscle cells "naked" DNA encoding a secretable therapeutic
polypeptide, e.g., growth hormone, which is released into the
circulation to achieve a therapeutic effect. Among the numerous
polycationic or cationic amphiphile compounds useful for
facilitating transfection of polynucleotides in vivo in mammalian
cells are various cholesteryl spermine or cholesteryl spermidine
compounds including cholesteryl spermine carbamates and
combinations thereof used as taught e.g. in U.S. Pat. Nos.
5,837,533; 6,127,170; 6,379,965; 5,650,096; and 5,783,565; and US
2006/0084617, published 20 Apr. 2006. These are just illustrative
of the many chemically diverse agents known to those of skill in
the art which may be employed to facilitate transfection of nucleic
acids including dsRNA expression constructs into mammalian muscle
or skin cells in accordance with the teaching of the invention.
[0063] Such naked and complexed nucleic acids may be used in
delivery methods including needle and/or needleless injection
directly into skin and/or muscle tissue, e.g., DNA expression
vector complexed with 0.25% bupivacaine in a suitable vehicle for
injection as taught above, as well as delivery to muscle or skin
cells by the vascular route, such as the hydrodynamic method
whereby increased intravascular pressure produces increased
vascular permeability to the passage of molecules including nucleic
acids into the interstitial space of muscle and skin tissue and
increased uptake of such molecules by cells of the skin and muscle.
Such increased intravascular pressure may be achieved through a
combination of externally applied pressure e.g. tourniquet or cuff;
and/or increased volume of drug administration; and/or increased
speed of administration. Volumes administered to the limb of a
mammal can be 250 ml, 500 ml, up to a liter or more. In one aspect,
the nucleic acid is a DNA plasmid expression vector which can be
administered in relatively large doses without toxicity, e.g. 100
mg, 200 mg, 350 mg, 500 mg to 1, 2, or 5 grams or more. Thus e.g. a
delivery vehicle may be formulated comprising 350-500 mg naked or
complexed DNA expression vector in 100 to 500 ml (e.g. 2 mg/ml) of
citrate buffered 5% dextrose in water for injection (D5W). When
administered rapidly into the afferent or efferent vascular system
supplying a mammalian limb subjected to externally applied
pressure, such a formulation provides a large amount of agent in
the interstitial space of muscle cells, thereby facilitating
transfection of cells by mass action. The formulation may be
hypotonic, isotonic, or hypertonic. Administration of a hypertonic
delivery vehicle may increase the transport of molecules such as
DNA or other nucleic acids into adjacent muscle cells. See
additional discussion below. Other delivery vehicles, excipients,
and methods suitable for use in the methods of the invention may be
formulated by those of skill in the art of pharmaceutical sciences,
see e.g., the teaching of Remington's Pharmaceutical Sciences
18.sup.th Ed. (1990); Remington: The Science and Practice of
Pharmacy, 20.sup.th Ed. (2000), 21.sup.st Ed. (2005). The teaching
of all these cited references is incorporated herein by
reference.
[0064] In another aspect, nucleic acids including dsRNA expression
constructs are delivered into mammalian skin cells or striated or
skeletal myocytes and/or myoblasts in vivo through electroporation.
See, e.g., the formulations and methodology of electroporation of
nucleic acid constructs into mammalian muscle cells as taught in US
2004/0014645 Al "Increased delivery of a nucleic acid construct in
vivo by the poly-L-glutamate (`PLG`) system" and the methods and
devices for electroporation taught in e.g., US 2005/0052630A1
"Constant current electroporation device and methods of use." See
also US 2005/0070841 Al and US 2004/0059285 Al "Electroporation
device and injection apparatus" and US 2004/0092907 Al "Method for
muscle delivery of drugs, nucleic acids and other compounds." The
various parameters including electric field strength required for
electroporation of any known cell type including muscle and skin
are generally known in the relevant research literature as well as
numerous patents and applications in the field. See e.g., U.S. Pat.
No. 6,678,556 "Electrical field therapy with reduced
histopathological change in muscle"; U.S. Pat. No. 7,171,264
"Intradermal delivery of active agents by needle-free injection and
electroporation"; and U.S. Pat. No. 7,173,116, which teaches
formulations for gene delivery via electroporation, including
formulations of various anionic polymers including
poly-L-glutamate. Apparatus for therapeutic application of
electroporation are available commercially, e.g., the
MedPulser.RTM. DNA Electroporation Therapy System
(Inovio/Genetronics, San Diego, Calif.), and are described in
patents such as U.S. Pat. No. 6,567,694; U.S. Pat. No. 6,516,223,
U.S. Pat. No. 5,993,434, U.S. Pat. No. 6,181,964, U.S. Pat. No.
6,241,701, and U.S. Pat. No. 6,233,482; electroporation may also be
used for transfection of cells in vitro as described e.g. in
US20070128708A1 Electroporation in vivo into mammalian muscle cells
presents an attractive alternative for experimental applications as
well as a promising delivery method for therapeutic applications in
mammals including humans, with clinical trials underway in the DNA
vaccines field. Electroporation may also be utilized to deliver
nucleic acids into cells in vitro. Accordingly,
electroporation-mediated administration into muscle and skin cells
of nucleic acids including expression constructs utilizing any of
the many available devices and electroporation systems known to
those of skill in the art presents an exciting new means for
delivering an RNA of interest to a distal target cell, tissue, or
organ such as a hepatocyte or other liver cell.
[0065] In another embodiment, administration may be via needle
injection, needleless injection, e.g., the Biojector.RTM. 2000
needleless injection device (Bioject Needle-free Injection Systems,
Tualatin, Oreg.), which can be adjusted to deliver a liquid
medication to various depths including intradermal, subcutaneous,
and/or intramuscular. Other commercially available needleless
injection systems include Dermo-jet (Robbins Instruments, Chatham,
N.J.). Needleless injection relies on a high-pressure stream of the
medication itself to penetrate the skin. As the fluid stream forces
its way through the tissue, it follows the path of least
resistance, resulting in a widely dispersed, spiderweb-like
distribution of the medication. A transdermal patch might also be
employed, as well as a biolistic injector or "gene gun" device
capable of shooting a plasmid expression vector into cells,
including cells in skin, the subcutaneous region, and/or muscle
tissue. Biolistic or gene gun devices for in vivo delivery to
mammals are commercially available, as e.g., the Helios Gene Gun
(Bio-Rad, Hercules, Calif.) See, e.g., U.S. Pat. Nos. 5,830,877 and
6,723,077, which are herein incorporated by reference in their
entireties.
[0066] In another aspect, intramuscular administration may be
achieved through hydrodynamic intravascular methods which utilize
various means, e.g., increased pressure, to promote delivery to
cells including muscle, e.g., the Mirus Pathway IV.TM. Gene
Delivery methods (Mirus, Madison, Wis.) which utilize a cuff or
tourniquet to restrict blood flow and increase pressure within the
vessel in order to facilitate intravascular delivery of nucleic
acids such as plasmid expression vectors to limb muscle. Any of a
variety of methods known in the art may be used to increase the
passage of a nucleic acid from afferent or efferent blood vessels
into cells, including parenchymal cells of adjacent tissues. For
example, increased vessel permeability to nucleic acids and other
molecules may be achieved by the external application of pressure
by a cuff such as a blood pressure cuff or tourniquet at a location
distal to the site of nucleic acid administration and/or through
increased intravascular pressure achieved by administering a
selected pharmaceutical formulation in a relatively large injection
volume and/or through rapid delivery and/or administration of
biologically active agents such as papaverine, hyaluronidase, etc.
The specific parameters for achieving optimal increases in vascular
permeability in test subjects such as laboratory animals as well as
human subjects are well within the level of skill in the arts of
animal science, anatomy, physiology, pharmacology and clinical
medicine. For example, optimal injection volume is related to the
size of the animal to be injected as well as target tissue volume,
e.g., volumes of 0.03 ml/g to 0.1 ml/g of body weight or greater
may be required, with injection volumes of 70 to 200 ml reported
for primates. Delivery to skeletal muscle tissue of a limb may be
achieved by rapid intravascular injection or delivery through
needle, catheter etc. of a relatively large volume (e.g., >5 ml
per rat limb or >70 ml for a primate) with concomitant external
application of pressure e.g. with a cuff or tourniquet, such that
pressure within the vessel is increased and permeability to outward
movement of oligonucleotide, polynucleotide, etc. is enhanced. See
e.g., US 2004/0259828, U.S. Pat. No. 6,379,966; US 2007/0244067;
Hagstrom et al., Molecular Therapy (2004) Vol. 10 (No. 2), 386-398,
Herweijer and Wolff, Gene Therapy (2007) 14, 99-107; Lewis and
Wolff, Advanced Drug Delivery Reviews 59 (2007) 115-123; the
teaching of each of which is incorporated herein by reference. Such
methods may be employed to deliver nucleic acids, including RNAs,
DNAs, and mixtures thereof, to various parenchymal cells of tissues
in a mammal, including cells of striated muscle as e.g., myoblasts,
satellite cells, myotubules and myofibers, by delivery into an
afferent or efferent blood vessel supplying the tissue, preferably
a vessel of the arterial system such as an artery, arteriole,
sinusoids, and/or capillary, but in some embodiments a vessel of
the venous system, including a vein, venule and capillary.
Increased transfection of such cells, including muscle cells, may
be achieved e.g. by increasing the permeability of an afferent
vessel proximal to the target tissue into which a selected nucleic
acid is administered as taught e.g. in U.S. Pat. No. 7,148,205,
"Intravascular delivery of non-viral nucleic acid". The nucleic
acid, e.g., an RNA or a DNA expression vector, may be "naked"
(i.e., free from agents which associate or complex with the nucleic
acid and promote transfection) or associated or complexed with any
one or more agents including amphipathic or amphiphilic compounds
such as cationic amphiphiles, cholesterol and/or spermine
containing complexes as described elsewhere herein. Various means
may be used in order to increase vessel permeability, e.g., the
naked or complexed nucleic acid may be supplied in a relatively
large solution volume, and/or with physical measures to increase
the pressure within the vessel by applying distal pressure and/or
decreasing the vessel lumen, as e.g., with a tourniquet or
cuff.
[0067] While some embodiments encompass transfecting skin cells or
skeletal muscle cells or other competent cells in an animal with a
nucleic acid encoding a dsRNA, methods wherein dsRNA is directly
transfected into skin or muscle cells or other competent targeting
cells are also encompassed. For instance, the invention includes a
method of delivering at least one dsRNA to a target organ or tissue
in an animal comprising transfecting skeletal skin or muscle cells
or other competent targeting cells in said animal with said dsRNA,
wherein said transfection results in said dsRNA being delivered to
said other target organ or tissue.
[0068] Suitable dsRNA molecules for delivery to skin and muscle
cells and other competent targeting cells include shRNAs and siRNAs
for RNAi embodiments and are typically between about 15 to about 50
base pairs, and more particularly between about 19 and about 29
base pairs. The dsRNA and complexes or other formulations
containing the same may be delivered to skin or muscle cells or
other cells using any method known in the art, including those
discussed above with regard to expression vectors.
[0069] Some dsRNA sequences, possibly in certain cell types and
through certain delivery methods, may result in an interferon
response. The methods of the invention may be performed so as not
to trigger an interferon/PKR response, for instance by using
shorter dsRNA molecules between 20 to 25 base pairs, by expressing
dsRNA molecules intracellularly, or by using other methods known in
the art. See US Application 200401521 17, which is herein
incorporated by reference. For instance, one of the components of
an interferon response is the induction of the interferon-induced
protein kinase PKR. To prevent an interferon response, interferon
and PKR responses may be silenced in the transfected and target
cells using a dsRNA species directed against the mRNAs that encode
proteins involved in the response. Alternatively, interferon
response promoters are silenced using dsRNA, or the expression of
proteins or transcription factors that bind interferon response
element (IRE) sequences is abolished using dsRNA or other known
techniques.
[0070] By "under conditions that inhibit or prevent an interferon
response or a dsRNA stress response" is meant conditions that
prevent or inhibit one or more interferon responses or cellular RNA
stress responses involving cell toxicity, cell death, an
anti-proliferative response, or a decreased ability of a dsRNA to
carry out a PTGS event. These responses include, but are not
limited to, interferon induction (both Type 1 and Type II),
induction of one or more interferon stimulated genes, PKR
activation, 2'5'-OAS activation, and any downstream cellular and/or
organismal sequelae that result from the activation/induction of
one or more of these responses. By "organismal sequelae" is meant
any effect(s) in a whole animal, organ, or more locally (e.g., at a
site of injection) caused by the stress response. Exemplary
manifestations include elevated cytokine production, local
inflammation, and necrosis. Desirably the conditions that inhibit
these responses are such that not more than about 95%, 90%, 80%,
75%, 60%, 40%, or 25%, and most desirably not more than about 10%
of the cells undergo cell toxicity, cell death, or a decreased
ability to carry out a PTGS event, compared to a cell not exposed
to such interferon response inhibiting conditions, all other
conditions being equal (e.g., same cell type, same transformation
with the same dsRNA).
[0071] Apoptosis, interferon induction, 2'5' OAS
activation/induction, PKR induction/activation, anti-proliferative
responses, and cytopathic effects are all indicators for the RNA
stress response pathway. Exemplary assays that can be used to
measure the induction of an RNA stress response as described herein
include a TUNEL assay to detect apoptotic cells, ELISA assays to
detect the induction of alpha, beta and gamma interferon, ribosomal
RNA fragmentation analysis to detect activation of 2'5' OAS,
measurement of phosphorylated eIF2a as an indicator of PKR (protein
kinase RNA inducible) activation, proliferation assays to detect
changes in cellular proliferation, and microscopic analysis of
cells to identify cellular cytopathic effects. See, e.g., US
Application 20040152117, which is herein incorporated by
reference.
[0072] As noted above, while not wishing to be bound by any
particular mechanism, the present inventors have hypothesized that
double-stranded RNA molecules transcribed from expression
constructs in muscle and skin cells are delivered to the liver,
possibly inside exovesicles formed from membrane blebbing or
shedding at the surface of the transfected cell. In line with this
hypothesis, the present invention also includes co-transfecting or
co-expressing, along with an RNA of interest including dsRNA or
therapeutic mRNA in muscle cells or other competent cells, genes
encoding surface or transmembrane ligands specific for the target
cell, organ or tissue of interest. Genes encoding targeting ligands
may be expressed on the same vector as the dsRNA, for instance from
a separate promoter, or may be expressed from a separate vector. In
some embodiments, among others, the dsRNA is expressed from a
polIII promoter and the targeting ligand is expressed from a polll
promoter. Incorporation of such surface ligands into exovesicles
could further enhance delivery to the liver, or facilitate delivery
to other targets such as cancer cells or immune cells.
[0073] For instance, the present invention encompasses methods
whereby skin or muscle cells or other competent targeting cells are
transfected with (1) eiRNA or dsRNA or dsRNA complexes and (2) an
expression vector encoding a cell-surface ligand that specifically
binds to a receptor on the target cell. The eiRNA expression vector
and the ligand-encoding expression vector may be a single
expression vector or two different expression vectors. As an
example, expressing a viral glycoprotein (such as the HIV envelope
glycoprotein gpl20) in muscle or skin cells in addition to
HIV-targeting dsRNAs should lead to the formation of anti-HIV
dsRNA-containing muscle exovesicles comprising HIV glycoprotein on
the surface. These exovesicles now have the potential to be taken
up by the T cells and other CD4+ immunocytes that HIV infects.
Other suitable cell surface ligands and target cells include the
influenza A hemaglutinin (HA) receptor binding domain which
recognizes and interacts with an oligosaccharide on the surface of
respiratory epithelial cells. Since avian influenza A viruses and
human influenza A viruses preferentially target different
epithelial cell-surface oligosaccharide receptors (e.g., epithelial
cell receptors identified as glycans terminated by an
<<2,3-linked sialic acid (SA) that preferentially bind avian
strains and glycans terminated by an ft2,6-linked SA that bind
human strains. J. Virol., August 2006, p. 7469-7480, Vol. 80, No.
15), expression constructs can be designed to express dsRNAs active
against human and/or avian influenza A viruses as well as influenza
A receptor binding domains that preferentially target the human
receptor and/or the avian receptor. Still other examples of cell
surface ligands and target cells will be readily apparent to those
of skill in the art of virology. For example, HBsAg can be encoded
to further facilitate delivery to hepatocytes. Any viral receptor
binding protein encoded by a virus can be expressed to target the
blebs or exovesicles to cells infected by or capable of being
infected by the respective viruses. Cells can be targeted
prophylactically or therapeutically.
[0074] Any suitable cell surface ligand having specificity for a
target cell surface receptor may be expressed in transfected cells,
by cloning the gene for the cell surface ligand behind a promoter
operable in the transfected cell such that the cell surface ligand
is expressed and displayed on the surface of the transfected cell.
In order to preferentially localize expressed cell surface ligands
into exovesicles, the gene for the cell surface ligand may be fused
to or be engineered to incorporate suitable targeting signals from
proteins known to be incorporated into exovesicles at the surface
of the transfected cell.
[0075] For example, as discussed above, galectin is one protein
expressed at high levels in skeletal and smooth muscle cells, which
has been observed to become specifically concentrated in plasma
membrane evaginations and extruded in extracellular vesicles.
Cooper and Barondes, 1990; Cooper, 1997; Harrison and Wilson, 1992.
A variety of other galectin genes have been detected in different
cell types, each lacking a signal sequence and containing a highly
conserved core sequence of about 130 to 135 amino acids containing
a carbohydrate recognition domain (CRD) between about residues 30
and 90. See Cooper and Barondes, 1999. Walter Nickel and colleagues
have found that the CRD domain in galectin is necessary for export,
suggesting that the galectin export machinery makes use of
.beta.-galactosidase-containing surface molecules as export
receptors for intracellular galectin-1. Seelenmeyer et al., 2005.
Accordingly, it may be possible to target other cell surface
ligands to exovesicle evaginations in the cell membrane by fusing
the coding regions for such cell surface ligands in frame to all or
part of the galectin CRD domain coding region. The complete amino
acid sequence of galectin-1 has been determined from human, as well
as several other species including cow, rat, mouse, chicken and
electric eel. Inagaki et al., 2000; Hirabayashi et al., 1988,
Complete amino acid sequence of a .beta.-galactosidase-binding
lectin from human placenta, J. Biochem. (Tokyo) 104:1-4; Abbott and
Feizi, 1989, Evidence that the 14 kDa soluble
beta-galactosidase-binding lectin in man is encoded by a single
gene, Biochem. J. 259: 291-94; Couraud et al., 1989, Molecular
cloning, characterization, and expression of a human 14 kDa lectin,
J. Biol. Chem. 264: 1310-16.
[0076] Galectin-3 is another member of the galectin family shown to
be secreted by the pinching off of evaginating membrane domains and
the release of extracellular vesicles where it is protected from
proteolysis. Krzeslak and Lipinska, 2004. Electron microscopy has
demonstrated that the vesicles are morphologically heterogenous and
have a small size (up to about 0.5 microns). Galectin-3 is unique
in the galectin family in possessing an extra N-terminal domain
consisting of 100-150 amino acids depending on the species of
origin, which has been proposed to contain targeting information
for non-classical secretion. Further, at least one group has shown
that the addition of this N-terminal segment to a normally
cytosolic protein such as chloramphenicol acetyltransferase (CAT)
resulted in efficient export of the fusion protein from transfected
Cos cells. See Mehul and Hughes, 1997. Accordingly, it should be
possible to target other cell surface ligands to exovesicle
evaginations in the cell membrane by fusing the coding regions for
such cell surface ligands in frame to all or part of the coding
region for this galectin-3 N-terminal domain. Other classical
methods of expressing targeting ligands on the cell surface may
also be used.
[0077] The invention also encompasses methods wherein genes for
cell surface receptors having binding specificity for cell surface
ligands expressed in the competent cell are cloned, transfected
into and expressed in target cells in vivo. Alternatively,
recombinant genes may be introduced into target cells that
upregulate expression of targeted cell surface receptors.
Administering certain drugs to the patient may also result in the
upregulation of target cell surface receptors depending on the
target cell surface receptor of interest.
[0078] In some embodiments, the methods of the present invention
may further comprise isolating at least one exovesicle from a
transfected cell, wherein the isolated exovesicle contains the
nucleic acid, for instance a dsRNA, and contacting said target cell
with the isolated exovesicle. Exovesicle-producing cells may be
transfected in vitro or in vivo, and dsRNA-containing exovesicles
thereafter isolated and used to contact target cells. Methods for
transfecting exovesicle-producing cells and cell lines in vitro
with expression vectors and dsRNA compositions are known in the
art, as are methods of isolating exovesicles. For example, Mehul
and Hughes have disclosed a method of isolating a
galectin-3-enriched vesicular fraction from murine macrophages and
Cos-7 cells transfected with galectin-3 expressing plasmid. Mehul
and Hughes, 1997, Plasma membrane targeting, vesicular budding, and
release of galectin 3 from the cytoplasm of mammalian cells during
secretion, J. Cell Sci. 110: 1169-78.
[0079] The methods of the present invention may be used in methods
of treating and preventing diseases in mammals, particularly
humans. Any mammal may be treated by the methods of the present
invention, including but not limited to humans, primates,
laboratory animals such as mice, rats, rabbits, guinea pigs, etc,
farm animals such as cows, sheep, pigs, horses, goats, etc., as
well as domestic animals including cats, dogs, etc. The experiments
described herein show that diseases may be treated therapeutically
or prophylactically. In particular, the present invention
demonstrates that dsRNA expressed in or just below the skin, or in
skeletal muscle may be delivered to other organs or tissues.
Accordingly, the present invention may be used to treat or prevent
any disease of an organ or tissue in which a reduction in gene
expression is effective. For example, the invention includes a
method of treating a patient suffering from an infection of an
organ or tissue, for instance a viral infection, by delivering
viral specific dsRNAs and dsRNA-containing viral drugs to the
infected target cell.
[0080] In the case of hepatitis B and/or C viral infection, for
example, HBV- and/or HCV-specific dsRNAs or other dsRNA-containing
HBV- or HCV-specific drugs are delivered to the liver by
intramuscular, intradermal or subcutaneous administration or by
administration to any other competent targeting cell. Any HBV
and/or HCV gene sequence may be targeted. Other liver viral
diseases treatable by the methods of the present invention include
CMV-induced hepatitis and HAV, HBV and/or HDV, and HEV and HAV.
[0081] In the case of HIV infection, for example, HIV-specific
dsRNAs or other dsRNA-containing HIV specific drugs are delivered
to T cells, T cell progenitors or other cells susceptible to HIV
infection by intramuscular, intradermal or subcutaneous
administration or by administration to any other competent
targeting cell. Any suitable HIV gene sequence may be targeted,
including but not limited to env (gp12), gag, and pol. As with any
highly mutable virus, it is desirable to deliver a plurality of
dsRNA molecules targeting two, three, four, five or more different
HIV viral gene sequences and/or different HIV viral genes, e.g.,
one or more sequences from HIV env (gp120 and gp 41), HIV gag (p24,
pi 7, etc.), and/or HIV pol (including protease, p31 integrase, pi
5 RNase, and p51 reverse transcriptase) which code for structural
proteins, and/or one or more sequences from the HIV regulatory
genes tat, rev, nef, vif, vpr and vpu, which code for proteins that
control the ability of HIV to infect a cell, produce new copies of
virus, or cause disease. In the case of HIV, as discussed above,
expressing HIV gpl20 glycoprotein in muscle cells or other
competent cells in addition to HIV-targeted dsRNA should lead to
the formation of dsRNA-containing exovesicles comprising HIV
glycoprotein on the surface. These exovesicles now have the
potential to be taken up by the T cells and other CD4+ immunocytes
that HIV infects. Any other ligand that binds to a receptor on the
surface of T cells could also be used to target dsRNA or
therapeutic mRNAs to T cells.
[0082] Other viruses that may be targeted by the present invention
include, but are not limited to, influenza, RSV, rabies,
picornarirus, polio, coxsacchie, herpes simplex virus Type I and 2,
St. Louis encephalitis, Epstein-Barr, myxoviruses, JC,
coxsakieviruses B, togaviruses, measles, paramyxoviruses,
echoviruses, bunyaviruses, cytomegaloviruses, varicella-zoster,
mumps, equine encephalitis, lymphocytic choriomeningitis,
rhabodoviruses including rabies, simian virus 40, human polyoma
virus, parvoviruses, papilloma viruses, primate adenoviruses,
coronavirases, retroviruses, Dengue, yellow fever, Japanese
encephalitis virus, and/or BK, or any viruses of the species/family
Astoviridae, Togaviridae, Flaviviridae, paramyxoviridae,
arteriviruses, Rhabdoviridae, Filoviridae, orthomyxoviridae,
bunyaviridae, arenaviridae, reoviridae, Birnaviridae, circoviridae,
adenoviridae, Iridoviridae, Retrovirus, Herpesvirus, Hepadenovirus,
Poxvirus, Parvovirus, Papillomavirus, and Papovavirus.
[0083] Prion RNA, e.g., mRNA, can also be targeted for
repression.
[0084] Infections by other pathogens may also be treated or
prevented using the methods of the present invention, including
protozoa, bacteria, yeast, and fungal infections. For example, for
intracellular parasites such as Plasmodia, pathogen-specific dsRNAs
or other dsRNA-containing drugs effective against the pathogen may
be delivered to cells susceptible to infection by intramuscular,
intradermal or subcutaneous administration or by administration to
any other competent targeting cell. The methods of the present
invention are especially useful for treating hepatocyte infection
by Plasmodia species by intramuscular, intradermal or subcutaneous
administration and/or expression and delivery of
Plasmodium-specific dsRNA to the liver.
[0085] As discussed above, the present inventors hypothesize that
expressed dsRNAs in muscle and skin cells are delivered to distal
organs or tissues after being incorporated into exovesicles at the
transfected cell surface. This incorporation could be a passive
mechanism based on the sheer numbers of expressed dsRNA molecules
in the cell cytoplasm, where dsRNAs are captured as a result of a
natural process and carried along in the vesicle. In this regard,
as described above, the invention would encompass methods of
delivering any nucleic acid or other cellular component expressed
at sufficient levels so as to be incorporated into membrane
exovesicles as they bleb from the cell surface, including mRNAs
expressed from therapeutic genes, i.e., gene therapy.
[0086] The following examples are provided to describe and
illustrate the present invention. As such, they should not be
construed to limit the scope of the invention. Those in the art
will well appreciate that many other embodiments also fall within
the scope of the invention, as it is described hereinabove and in
the claims.
EXAMPLES
[0087] As reported herein the present inventors have found that
intramuscular delivery of DNA/Bupivacaine complexes, or
intramuscular electroporation-mediated transfection of muscle cells
with a vector or construct expressing dsRNA molecules, e.g, shRNA
(RNAi) molecules, is surprisingly able to reduce the expression of
target genes expressed in the liver. Several sets of experiments
are described which have demonstrated gene silencing in mouse
liver, mediated by an expressed interfering RNA (eiRNA) expression
vector injected into the muscle. Experimental designs differ most
significantly in the sequence of administration of the test
material (therapeutic vs. prophylactic), and the end product that
is being assayed to ascertain the level of gene silencing taking
place. In the therapeutic model, the target molecule (plasmid
expressing an RNA to be silenced) is administered before the drug
molecule (plasmid expressing the shRNA silencing molecule) is
administered. The reverse is true for the prophylactic model. In
all experiments, the target RNA to be silenced is measured
indirectly by quantitating the level of protein or enzymatic
activity which is translated from the target RNA. In some
experiments, the HBV surface antigen (sAg) is the measured end
product. In others, luciferase activity is the measured end
product.
[0088] In all the experiments described here, the hydrodynamic
protocol used for injection of the target plasmid directs the
plasmid to the liver, and is assayed at time points when the
plasmid is expressed exclusively in the liver. In certain sets of
experiments, expression of the target RNA is further restricted to
the liver because a liver-specific promoter is used, which does not
permit significant levels of transcription in other tissues. Since
the liver secretes protein products into the circulatory system of
the animal it is possible and convenient to sample the blood serum
of the animal to measure the liver-based expression of the target
plasmid in some of these experiments. Since obtaining a serum
sample from the animal does not involve sacrificing the animal or
otherwise disturbing liver function, this allows the investigator
to repeatedly sample the target RNA levels in liver at multiple
time points, indirectly by measuring the protein product or
enzymatic activity of the indicator protein in the blood.
[0089] In all experiments "NUC050" refers to the eiRNA plasmid that
is HBV-specific and which mediates sAg gene silencing. NUC049 is a
negative control eiRNA plasmid (containing a mutated version of an
shRNA derived from NUC050).
Example 1
Therapeutic Inhibition of HBV sAg Gene Expression In Vivo by
Intramuscular Injection
[0090] In the therapeutic model, animals receive exogenous RNA
target in the form of a plasmid expressing the surface antigen
coding sequence of HBV via hydrodynamic tail vein injection.
Hydrodynamic injection is a method using a large volume with rapid
injection time, to preferentially direct the DNA plasmid to the
liver where it is expressed.
[0091] To obtain mice expressing a target gene in liver, HBsAg
(surface antigen) cDNA was placed under the control of a
liver-specific promoter in a commercially available plasmid vector
(pLIVE). On Day -10, this vector was injected hydrodynamically into
an immunodeficient strain of mice (NOD.CB17-Pkrdc.sup.scid/J). In
this way, DNA is largely localized to liver hepatocytes and the
tissue-specific promoter further restricts expression of the sAg
mRNA to these cells. Since the mice are immunodeficient, they are
able to express the target gene for long periods of time (greater
than a month) because immune response to the foreign protein
encoded by the target gene will not be made.
[0092] Five days following target plasmid administration (Day -5),
the mice were bled to determine levels of circulating HBsAg in
serum.
[0093] On Day 0, mice were intramuscularly injected with the NUC050
vector at 1.0 mg/ml in a 0.25% bupivacaine solution in a total
volume of 50 ul. The NUC050 vector encodes four different shRNA
molecules which target various portions of the hepatitis B genome
for degradation via the cellular RNAi mechanism. Three of these
target the HBsAg regions contained in the target vector
preadministered to the mice. A control group of mice was treated
with the negative control NUC049 plasmid. (In some experiments,
mice received another negative control plasmid, pGL2, which
expresses luciferase mRNA but no shRNA molecules.)
[0094] Animals were subsequently bled again on Days 4, 11, 19, and
26 days post eiRNA vector administration, respectively, and levels
of serum HBsAg were determined using an HBsAg ELISA commercially
available (Bio-Rad, Hercules, Calif. HBsAg 3.0 EIA cat#. 32591).
From 5 to 8 mice were used for each treatment group and the results
are presented as HBsAg percent of initial HBsAg values
(pre-treatment). The ability of the NUC050 vector treatment to
decrease HBsAg expression was estimated by calculating, for each
bleed day, a normalized difference value of average HBsAg levels
for control minus experimental groups. Normalization was done by
calculating the percent of HBsAg for each subsequent bleed day,
relative to the HBsAg values on pretreatment. Wilcoxon statistical
tests were used to assess the significance of the results.
Experimental vs. control differences were taken to be significant
at p-values less than 0.05.
[0095] Day 11 and Day 19 show statistically significant difference
averages of -36% and -28% respectively, between NUC050 and NUC049
(p=0.0088, p=0.0339). (These values reflect underlying normalized
average values of 56% and 93% prebleed (pretreatment) values for
NUC050 and NUC049 respectively. For Day 11 the normalized average
values compared to Prebleed values were 54% (NUC050) vs. 82%
(NUC049) for Day 19.). Average values for all bleed days for NUC050
were substantially lower than all corresponding NUC049 values, but
reached statistical significance on Days 11 and 19. See FIG. 1.
Example 2
Therapeutic Inhibition of HBV sAg Gene Expression In Vivo by
Intramuscular Injection
[0096] Mice (immunodeficient strain NOD.CB17-Pkrdc.sup.scid/J) were
given target HBV sAg (surface antigen) expression plasmid (directed
to liver by hydrodynamic injection as described in Example 1)
several days before being injected IM (intramuscularly) with 1)
eiRNA vector expressing anti HBV shRNA, 2) negative control vector,
or 3) left untreated after the initial injection of target plasmid.
The eiRNA vectors for IM injection were formulated with 0.25%
bupivacaine. Expression levels of the sAg, produced in the liver,
were monitored by sAg ELISA of serum samples over the course of
about 4 weeks.
[0097] In this model, sAg expression is expressed at a given level
following injection, and then declines gradually over several
weeks, if left simply to its own course, as seen in the mice left
untreated after the initial target plasmid injection. By
administering the eiRNA anti-sAg shRNA plasmid, the rate of decline
of sAg increases over time relative to mice not treated after the
injection of target HBsAg expression plasmid, or relative to mice
given a negative control plasmid instead of the anti HBV eiRNA. An
overall lower level of expression of sAg can also be observed in
experimental vs. control groups of mice. Success rate and
efficiency of muscle transfection by injection may be demonstrated
by cotransfecting a reporter gene (e.g., by encoding a reporter
gene such as EGFP on the eiRNA plasmids) and monitoring its
expression either in whole muscle or tissue sections after
injection.
Example 3
Prophylactic Inhibition of HBV sAg Gene Expression In Vivo by
Intramuscular Injection
[0098] Mice (immunocompetent strain C57B1/6) were given a single
intramuscular dose of the anti HBV shRNA effector plasmid, NUC050,
or a negative control plasmid, which was followed three days later
by hydrodynamic injection (via tail vein) of the target HBsAg
plasmid (same target plasmid as in Exp 1 above). The control
plasmid used in this experiment was the commercial vector pGL2,
which encodes no protein and is used as an irrelevant plasmid
control with respect to eiRNA activity. The IM injections were
formulated with bupivacaine (0.25% w/v) with a DNA concentration of
1.0 mg/ml. 100 ul of the bupivacaine formulation was administered
IM to each mouse (100 ug DNA).
[0099] Mice were bled for HBsAg ELISA assay at 3, 6, 9, and 13 days
after the hydrodynamic administration of target plasmid.
[0100] Since the target plasmid encoding HBsAg mRNA and protein is
given subsequent to the effector plasmid in the prophylactic model
it is not possible to obtain a "baseline" sAg value for these mice
prior to drug administration. Hydrodynamic injection is known to
produce generally robust but highly variable levels of sAg in this
type of animal model. Therefore, the sAg level determined at any
time point reflects an unknown variation in the potentially maximal
level of sAg expression from the target plasmid as well as the
experimental variable of interest, which is the gene silencing
effect of the eiRNA plasmid. For this reason, a comparison of the
overall levels of sAg in the control and experimental groups is not
conclusive, and a rate analysis (also called "slope" analysis") is
performed.
[0101] The rate of decline of sAg levels between days 3 and 13 is
approximated first by fitting a line to the data curve, and then
comparing the slopes of this best fit line between control and
experimental groups. The results revealed an increase in the decay
rate of sAg mediated by the NUC050 eiRNA plasmid, relative to
negative control plasmid or mice given only the target plasmid. The
rates of decrease range from 1.4 to 1.7 times greater for eiRNA
treatment compared to control mice.
Example 4
Prophylactic Model Using Immunodeficient Strain NOD. CBl
7-Pkrdc.sup.scid/J, Multiple Dosing and Luciferase Readout
[0102] In this experiment, using bupivacaine formulations only, of
the NUC050 (eiRNA against HBV sAg) and the NUC049 (negative
control) vectors, a dual reporter system was used to normalize for
the liver-directed expression of target plasmid.
[0103] The target plasmid contains two separate genes encoding
luciferases from two different organisms, firefly (FF) and
jellyfish (Renilla or "JF"). See WO 04076629A3: Methods and
constructs for evaluation of rnai targets and effector molecules.
Because each produces a different wavelength of luminescence upon
hydrolysis of luciferin substrate, the two signals can be measured
in the same sample. The renilla luciferase mRNA is engineered as a
fusion mRNA with sequence elements present in the HBV genome, such
that the fusion mRNA becomes a target for the NUC050 eiRNA plasmid,
and the signal from renilla is a measure of the gene silencing
effect of NUC050. Activity of NUC050 will therefore result in a
reduction of the renilla luciferase signal even though it targets
HBV sequences because the HBV sequences are present at the end of
the renilla mRNA. The FF luciferase signal serves as a
normalization standard to correct for overall variability in target
plasmid delivery/transfection, because it is not subject to down
modulation by the eiRNA effector, but is dependent on the same
plasmid for expression. Thus, taking the ratio, JF:FF luciferase
normalizes for the liver-directed expression of plasmid. In cases
where an insufficient FF luciferase is observed, it can be
concluded that the plasmid was not delivered, and therefore the
sample is not valid for analysis.
[0104] In this experiment, 25 animals were used for each treatment
group. Levels of FF luciferase were acceptable for 19/25 animals in
the eiRNA (NUC050) group and for 17/25 animals in the control
(NUC049) group. A box-and-whisker plot diagram of all ratio values
indicates a clear shift to lower renilla:FF ratios in the treatment
vs. the control group as expected from the silencing effect of the
NUC050 plasmid.
[0105] Because the average FF luciferase signals were higher in the
NUC050 vs. the NUC049 group, data were also analyzed by comparing
the renilla:FF ratios in subgroups of animals with similar levels
of FF luciferase expression in both treatment groups. In the top or
highest subgroup (most firefly luciferase) the ratio shift went
from 33.5 for the control NUC049 mice to 24.8 for the NUC050 mice
(26%). Thus, there was a 26% reduction in the renilla:FF ratio in
the subgroup of animals expressing the highest amount of firefly
luciferase. There were a total of 10 mice in this group. The next
highest subgroup showed an 8% difference and went from a ratio of
30.8 to 28.4. There were only 5 mice in this group or bucket. The
remainder of the mice were in lower expressing groups with lesser
differences between the groups as expected but still some
differences existed. The overall difference between the 2 groups
comparing all animals was 10%.
[0106] To assess the significance in the 10-26% reduction in
renilla:FF ratio seen across groups and subgroups, we compared the
reduction in ratio to that in animals receiving both the target and
effector plasmids together by direct hydrodynamic delivery. Direct
hydrodynamic delivery of both target and effector plasmids
typically resulted in a maximal 30% silencing effect in this
system. Therefore, as compared to a 30% maximal effect, the 10-26%
seen with this novel delivery mechanism appears quite significant
and suggests that these experiments can serve as a basis for novel
methods and compositions for eiRNA and siRNA/shRNA mediated gene
silencing via muscle delivery.
Example 5
In Vivo Electroporation Delivery of eiRNA: Dual Luciferase
Model
[0107] To test whether in vivo electroporation would be an
efficient way to deliver eiRNA into skeletal muscle cells, the mice
were first anesthetized, the IM injection given and the electrodes
placed into the muscle and the pulses are delivered. More
specifically, C57B1/6 female were given an intramuscular (IM)
injection in the tibialis muscle of one leg of either NUC 050 (drug
substance) or NUC 049 (negative control) formulation at a volume of
25 uL, concentration of 2.0 mg/ml. We used a 3-pronged probe from
Advisys, The Woodlands, Tex., and placed it on the tibialis muscle
of the mouse leg. Two pulses of electricity were administered (see
details in table below).
TABLE-US-00001 TABLE 1 Electroporator settings Pulse In Sequence: 1
2 Prewait (s): 4 1 Pulse Width (ms): 52 52 Pulse Current (A): 0.1
0.1
[0108] Six days after dosing, all mice were given a hydrodynamic
injection, or "challenge," of 1 ug of the expression plasmid (NUC
060, dual-luciferase HBV-fusion plasmid).
[0109] Five days after the hydrodynamic injection, all mice were
sacrificed and their livers were dissected, frozen, and stored at
-70 C. Livers were homogenized with a mechanical homogenizer in a
cell lysis buffer, centrifuged, and the supernatant was removed for
analysis. Supernatant samples from all livers were assayed for the
presence of both Renilla and firefly luciferase proteins. The ratio
of Renilla: firefly luciferase (RLU) represents a normalized
expression profile and serves as the output measure of the assay.
The mean Renilla:firefly luciferase ratio of the NUC 050 group is
compared to the mean ratio of the NUC 049 group. This difference is
represented as a net ratio value and a percent difference:
% Difference = Mean NUC 050 - Mean NUC 049 Mean NUC 049 .times. 100
% ##EQU00001##
[0110] The difference of the two means is tested for statistical
significance using a nonparametric 2-sample Wilcoxon test for a
p-value less than 0.05.
[0111] The results indicate a 35% reduction in the fusion Renilla
mRNA with respect to the Firefly mRNA in the NUC050 group (See
FIGS. 2 and 3 and Tables 2 and 3). With respect to the results
obtained with IM injection (non-electroporation) of NUC050, these
results are consistent with the better muscle transfection when
electroporation is used as the means for transfecting muscle with
the eiRNA vectors. This is also consistent with a liver delivery
rate of siRNAs or shRNAs to hepatocytes approximating and perhaps
exceeding what is typically achieved by hydrodynamic injection when
the eiRNA is hydrodynamically injected first and then the dual
luciferase vector challenge is given by hydrodynamic injection
(HDI) later. We estimate based on this data that about 40%-60% of
hepatocytes have likely picked up one or more shRNAs encoded by
NUC050. This is because each hydro injection typically transfects
about 40-60% of hepatocytes. Transfection of hepatocytes following
HDI is random and the second HDI would hit about 40-60% of the
cells that were transfected by the first HDI.
TABLE-US-00002 TABLE 2 Individual Mouse Values (ratios) 300-1 300-2
# Nuc050 NucO49 1 16.8 19.3 2 17.7 22.4 3 18.6 25.4 4 18.7 26.0 5
20.0 26.1 6 20.6 30.8 7 21.4 32.9 8 21.8 34.9 9 23.2 36.6 10 23.3
39.7 11 23.5 42.1 12 23.7 44.0 13 27.4 44.9 Mean 21.3 32.7 Sd 2.97
8.49
TABLE-US-00003 TABLE 3 Additional Analysis Nuc050 Nuc049 Mean 21.28
32.69 Standard Error 0.82 2.35 Median 21.43 32.90 Mode #N/A #N/A
Standard Deviation 2.97 8.49 Sample Variance 8.84 72.01 Kurtosis
-0.09 -1.30 Skewness 0.34 0.00 Range 10.62 25.60 Minimum 16.78
19.30 Maximum 27.40 44.90 Sum 276.70 425.01 Count 13 13
Example 6
In Vivo Electroporation Delivery of eiRNA Against HBV Surface
Antigen
[0112] In this experiment, immunocompetent C57B16 mice were
electroporated intramuscularly with the anti-HBV eiRNA (NUC050) or
with an irrelevant eiRNA (NUC049). Following electroporation,
shRNAs encoded by the eiRNA vectors are transcribed to high copy
levels in the electroporated muscle (2,000,000,000 copies of
individual shRNA detected by QRT-PCR in piece of electroporated
muscle). Seven days post intramuscular electroporation (IM-EP),
groups of mice were challenged by hydrodynamic injection with three
different doses of NUC054, an HBV expression vector encoding HBsAg.
The doses were 10 ug, 5.0 ug and 2.0 ug NUC054. The hydrodynamic
injections also all contained identical amounts of a hAAT
expression vector as a marker for successful HDI, i.e., serum hAAT
values are a surrogate marker of the amount of NUC054 transfection
since both plasmids were co-administered. The total amount of DNA
was kept constant in each injection through the inclusion of an
inert filler plasmid, pGL2-basic.
[0113] Two days, seven days and 16 days following challenge with
NUC054, blood was collected from mice for measurement of HBsAg. If
IM-EP of NUC050 is specifically able to downregulate serum HBsAg
(as compared to the control NUC049), then transfected muscle must
be able to relay plasmid specified molecules such as shRNA/siRNA
produced in the muscle to hepatocytes where RNAi of the HBV target
mRNA occurs. This is because NUC054 which encodes the HBV mRNA is
expressed in hepatocytes specifically following HDI of NUC054 and
if downregulation occurs, it must occur in hepatocytes. HBsAg is
made in hepatocytes and is secreted into serum where it can be
measured. As discussed further below, the results indicate that
NUC050 specifically and with statistical significance downregulates
the expression of HBsAg in mice that were given NUC050 via
intramuscular electroporation.
Statistical Analysis
[0114] The serum surface antigen (sAg) concentrations 2 days post
challenge from mice that received NUC050 plasmid treatment and 2, 5
or 10 ug of hydrodynamically injected sAg plasmid (NUC054) were
compared to the group comprised of serum sAg concentrations on the
same day from mice that received the control treatment NUC049
plasmid and either 2, 5, or 10 ug of hydrodynamically injected
NUC054 using a Wilcoxon two-sample one-sided test application
provided by Dr. Sam Litwin. The NUC050 treatment resulted in
statistically significantly lower serum sAg values compared to
those from the control group (p=0.005).
[0115] The analysis above was performed for data obtained 7 days
post challenge and the NUC050 treatment resulted in statistically
significantly lower serum sAg values when compared to the control
group (p=0.002).
[0116] The serum hAAT values from mice that received NUC050
treatment and 2, 5 or 10 ug of hydrodynamically injected sAg
plasmid were matched with hAAT values from mice that received the
control NUC049 treatment and 2, 5 or 10 ug of hydrodynamically
injected NUC054 plasmid. Serum hAAT values are a surrogate marker
of the amount of NUC054 transfection since both plasmids were
co-administered. Data from unmatched animal pairs was not used. The
day 2 sAg concentrations from mice that received NUC050 plasmid
treatment were compared to the matched group comprised of sAg
concentrations on the same day from mice that received the control
treatment NUC049 plasmid using a Wilcoxon paired-sample one-sided
test application provided by Dr. Sam Litwin. The results of the
test showed that the NUC050 treatment resulted in statistically
significantly lower sAg concentrations compared to the control
group (p=0.011).
[0117] The serum hAAT values from mice that received NUC050
treatment and 10 ug of hydrodynamically injected sAg plasmid were
matched with hAAT values from mice that received the control NUC049
treatment and 10 ug of hydrodynamically injected NUC054 plasmid.
Serum hAAT values are a surrogate marker of the amount of sAg
transfection since both plasmids were co-administered. Data from
unmatched animal pairs was not used. The sAg concentrations on day
2 from mice that received NUC050 plasmid treatment were compared to
the matched group comprised of sAg concentrations on the same day
from mice that received the control treatment NUC049 plasmid using
a Wilcoxon paired-sample one-sided test application provided by Dr.
Sam Litwin. The results of the test showed that the NUC050
treatment resulted in sAg concentrations that were statistically
significantly (p=0.009) less than those from the control NUC049
plasmid group. See Table 4.
TABLE-US-00004 TABLE 4 Sample Test p-value Combined day 2 data
Wilcoxon 2 sample 0.005 Combined day 7 data Wilcoxon 2 sample 0.002
Combined day 2 data matched Wilcoxon paired 0.011 10-ug day 2 data
matched Wilcoxon paired 0.009
Example 7
Quantitation of siRNA Expressed in Muscle
[0118] The purpose of this experiment was to measure the amount of
siRNA expressed in muscle from an eiRNA plasmid following
intramuscular electroporation. For our hypothesis of transfected
muscle cell to act as a depot to deliver siRNA/shRNA or DNA to
distal sites, the muscle must first be transfected. If muscle is
secreting or exporting vesicles containing siRNA/shRNA, then the
more of these molecules that are expressed, the more siRNA/shRNA
will be shipped out of the cell, and a higher delivery to distal
sites is expected.
[0119] In this experiment, mice were electroporated intramuscularly
with NUC050. NUC050 expresses four HBV-specific shRNAs that are
processed into siRNAs. For this experiment, only one of the siRNAs
encoded was measured. Following electroporation, the area of muscle
electroporated was harvested and snap frozen. RNA was subsequently
extracted and one of the siRNAs expressed from NUC050, si1737, was
measured by QRT-PCR.
[0120] QRT-PCR for detection of expressed siRNA's targeting HBV
including si1737, si1907 and si2791 was performed utilizing the
protocol described by Caifu Chen, et al. in (Chen Caifu/ABI Method:
Nucleic Acid Research, 2005, 33(20):el 79). Si1737 served as an
example of the protocol. The procedure involves a
reverse-transcription reaction to generate cDNA from the siRNA.
This is done primarily by the use of a loop primer, which matches 8
nucleotides of the siRNA sequence of 1737. (FIG. 4) This protocol
utilizes a stem-loop primer for generating the cDNA for PCR from
expressed siRNA. This method was shown to provide better RT
specificity and efficiency than linear primers due to the base
stacking of the stem of the primer, which enhances the thermal
stability of the resulting RNA-DNA heteroduplex. The spatial
constraint of the loop primer also improves assay specificity
compared to linear primers as shown by Chen.
[0121] RNA for reactions was collected by the Invitrogen Trizol
protocol (cat #15596-026). RNA from muscle tissue was extracted in
Trizol using homogenization. The RT reaction was done in a 15 ul
reaction volume with final concentrations of 10 mM MgCl.sub.2, Ix
GeneAmp PCR buffer (Applied Biosystems cat. #N808-0010), 50 nM loop
primer, 0.26 mM dNTP, 3.33 U/.mu.l MultiScribe Reverse
Transcriptase (Applied Biosystems cat #4319983), 0.26 U/.mu.l
GeneAmp RNase Inhibitor (Applied Biosystems cat. #N808-0119).
Reactions were incubated in an MJ Research PTC-200 Peltier Thermal
Cycler for 30 min at 16.degree. C., 30 min at 42.degree. C. and 5
min at 85.degree. C. The cDNA was then added to the Q-PCR reaction
with a higher concentration of the forward primer. The excess
forward primer preferentially binds and generates more antisense
cDNA. The FAM probe for Q-PCR then binds the antisense cDNA along
with the reverse primer, thus starting the Q-PCR detection. The
Q-PCR reaction was done in 20 .mu.l reaction volume with 2 .mu.l of
RT product input, and final concentrations of Ix Taqman Universal
Master Mix No Amperase UNG (Applied Biosystems cat #4324018), 1500
nM forward primer, 750 nM reverse primer, 200 nM FAM probe.
Reactions were run in an Applied Biosystems Real-Time PCR System
7300 for 40 cycles of 95.degree. C. for 15 sec and 60.degree. C.
for 1 min using a FAM detector. Primer and probe sequences were as
follows:
[0122] The sequences of si 1737 (underlined strands) and its loop
primer are listed below:
TABLE-US-00005 (SEQ ID NO: 1) 5' -GGAUUCAGCGCCGACGGGACG-3' (SEQ ID
NO: 2) 3' -TGCCCTGCGAGTTG-ACTTAACGGCTGAGGTGCTGTGGTCAACTC- 5'
[0123] After RT reaction, a cDNA as following will be
synthesized:
TABLE-US-00006 (SEQ ID NO: 3) 3'-
CCTAAGTCGCGGCTGCCCTGCGAGTTG-ACTTAACGGCTGAGGTGCTGTG GTCAACTC-S'
[0124] In Q-PCR reaction, higher concentration of forward primer
(pink strand) preferentially makes more antisense cDNA (the blue
strand):
##STR00001##
[0125] Si 1737 chemically synthesized by IDT, Ames Iowa was used to
generate a standard curve and for use in spike recovery.
[0126] All four electroporated muscles from study ND311 that were
injected with NUC050 and APL050 showed expression levels of si1737
between 8.0 e+006 to 22 e+009 siRNAs. Electroporated muscles
injected with the sAg expression vector alone, APL050, did not
yield any detection of siRNA as we predicted. Naive muscle was also
negative for siRNA expression as predicted. For results, see Table
5 below.
TABLE-US-00007 TABLE 5 sample name Detector Task Ct quantity
6.00E+08 1737 Standard 12.93 6.00E+08 6.00E+07 1737 Standard 15.55
6.00E+07 6.00E+06 1737 Standard 19.52 6.00E+06 6.00E+05 1737
Standard 22.51 6.00E+05 6.00E+04 1737 Standard 26.05 6.00E+04 ND311
APL050 1A muscle 1737 Unknown undet. ND311 APL050 1B muscle 1737
Unknown undet. ND311 APL050 1C muscle 1737 Unknown undet. ND311
APL050 1D muscle 1737 Unknown undet. ND311 ALPO5O + 1737 Unknown
19.04 7.24E+06 NucO5O 2A muscle ND311 ALP050 + Nuc050 1737 Unknown
19.88 4.04E+06 2B muscle ND311 ALPO5O + 1737 Unknown 14.95 1.24E+08
NucO5O 2C muscle ND311 ALP050 + Nuc050 1737 Unknown 15.97 6.10E+07
2D muscle Naive muscle 1737 Unknown undet. Negative control H20
1737 Unknown undet. Negative control H20 1737 Unknown undet. Note
1. RNA extracted from muscle was resuspended in a total volume of
12 ul. 5 ul of this extract was added to the initial RT reaction of
which the total volume was 15 ul. 2 u/l/15 ul of the RT-reaction
was used for a PCR reaction. This means the PCR values for siRNA
copy number were multipled by 18 to get the copy number of si 1737
in the muscle extracts. For example, the results obtained and
displayed as data in the above table were multiplied by 18 to get
the total copy number of siI737 in the extracted muscle sample.
Example 8
Electron Micrographs of Muscle Blebs
[0127] Photos of published muscle blebs stained immunologically for
B-galectin (FIG. 5, panels B, C and D) were compared with a time
lapsed photo by the present inventors of a myoblast secreting blebs
(panel A). Prior to taking the picture, L6 cells (which contain
myoblasts in culture that differentiate into myotubes) were
transfected with an EGFP expression plasmid to see if we could see
blebs and if so, whether they contain EGFP. If so, this indicates
that blebs pack up cytosolic content into their interior. The
picture in FIG. 5, panel A shows transfected myoblasts with bleb
like structures that are fluorescent.
Example 9
Prophylactic Inhibition of HBV sAg Gene Expression In Vivo by
Intramuscular Injection
[0128] This example shows that subcutaneous injection of an eiRNA
plasmid expressing siRNAs specific for Hepatitis B causing the
distal downregulation of mRNAs containing Hepatitis B target
sequences in liver hepatocytes. The results of the data would
indicate that subcutaneous injection of eiRNA molecules/siRNA
molecules and likely intradermal injection as well can mediate the
downregulation of gene(s) in hepatocytes, not limited to the HBV
sAg gene exemplified here. The molecules transferred to distal
sites could be siRNA/shRNA, the eiRNA plasmid DNA or the RNA
charged RNA Induced Silencing Complex. Any siRNA/shRNA and/or DNA
would therefore be predicted to transfer. Although this model is
prophylactic, since these results show that the active agent is
transferring to hepatocytes, a therapeutic subcutaneous injection
is also predicted to work.
EXPERIMENT BACKGROUND
[0129] In the prophylactic model, the drug molecule (plasmid
expressing the shRNA silencing molecule) is administered before the
target molecule (plasmid expressing an RNA to be silenced) is
administered.
[0130] In all experiments "NUC050" refers to an eiRNA plasmid
expression vector that expresses four different short hairpin
dsRNAs (shRNAs) specific to HBV (see e.g., WO 2006/033756, plasmid
pHB4, FIG. 9), which mediates silencing of an HBV-Luciferase fusion
vector, "NUC060", e.g., as described in WO 04076629/US
2006/0263764. "NUC049" is a negative control eiRNA plasmid (which
expresses a mutated version of a single shRNA derived from
NUC050).
[0131] The target plasmid contains two separate genes encoding
luciferases from two different organisms, Firefly (FF) and
jellyfish (Renilla or "JF"). See WO 04076629: Methods and
constructs for evaluation of RNAi targets and effector molecules.
Because each produces a different wavelength of luminescence upon
hydrolysis of luciferin substrate, the two signals can be measured
in the same sample. The Renilla luciferase mRNA is engineered as a
fusion mRNA with sequence elements present in the HBV genome, such
that the fusion mRNA becomes a target for the NUC050 eiRNA plasmid,
and the signal from Renilla is a measure of the gene silencing
effect of NUC050. Activity of NUC050 will therefore result in a
reduction of the Renilla luciferase signal even though it targets
HBV sequences because the HBV sequences are present at the end of
the Renilla mRNA. The FF luciferase signal serves as a
normalization standard to correct for overall variability in target
plasmid delivery/transfection, because it is not subject to down
modulation by the eiRNA effector, but is dependent on the same
plasmid for expression. Thus, taking the ratio, JF:FF luciferase
normalizes for the liver-directed expression of plasmid. In cases
where an insufficient FF luciferase is observed, it can be
concluded that the plasmid was not delivered, and therefore the
sample is not valid for analysis.
[0132] In Vivo Subcutaneous Delivery of eiRNA: Dual Luciferase
Model
[0133] C57B1/6 female mice were given a subcutaneous (SC) injection
of either NUC 050 (drug eiRNA substance) or NUC 049 (negative
control eiRNA substance) formulation at a volume of 200 .mu.l,
concentration of 1.5 mg/ml. The formulations consisted of DNA in an
isotonic saline solution. Six days after dosing, all mice were
given a hydrodynamic injection (HDI), or "challenge," of 1 ug of
the expression plasmid (NUC 060, dual-luciferase HBV-fusion
plasmid). HDI is a mechanism that allows selective transfection of
liver hepatocytes.
[0134] Five days after the hydrodynamic injection (day 11), all
mice were sacrificed and their livers were dissected, frozen, and
stored at -70 C. Livers were homogenized with a mechanical
homogenizer in a cell lysis buffer, centrifuged, and the
supernatant was removed for analysis. Supernatant samples from all
livers were assayed for the presence of both Renilla and Firefly
luciferase proteins. The ratio of Renilla:Firefly luciferase (RLU)
represents a normalized expression profile and serves as the output
measure of the assay. The mean Renilla:Firefly luciferase ratio of
the NUC 050 group is compared to the mean ratio of the NUC 049
group. This difference is represented as a net ratio value and a
percent
% Difference = Mean NUC 050 - Mean NUC 049 Mean NUC 049 .times. 100
% ##EQU00002##
difference:
[0135] The difference of the two means is tested for statistical
significance using a nonparametric 2-sample Wilcoxon test for a
p-value less than 0.05.
[0136] In this experiment, 15 animals were used for each treatment
group. Levels of FF luciferase were acceptable for 8/15 animals in
both the eiRNA (NUC050) group and the control (NUC049) group. A
box-and-whisker plot of Renilla:FF activity ratios in liver cells
shows a clear and statistically significant decrease of the Renilla
Luciferase-HBV mRNA fusion target in the treatment vs. the control
group. Mean levels of the target mRNA are reduced by 16.7% in the
treatment group (see FIGS. 8 and 9, Tables 6 & 7).
[0137] The observed silencing of the target mRNA indicates that
either the plasmid DNA, the expressed eiRNA and/or its processed
product (ie. the ds siRNA or RNA charged RNA Induced Silencing
Complex) have been transported from the subcutaneous injection site
to hepatocytes in the liver. This transport may be mediated by
cells at the injection site. Regardless of the mechanism involved
however, these results show that subcutaneous injection of an eiRNA
expressing plasmid can reduce the levels of target mRNA at a distal
site, in this case liver hepatocytes.
TABLE-US-00008 TABLE 6 Individual Mouse Values (ratios) 360-1 360-2
(Nuc050) (Nuc049) 1 12.0 12.3 2 12.2 14.4 3 12.3 17.6 4 13.3 17.7 5
16.1 18.2 6 16.69 18.3 7 17.2 21.8 8 18.5 22.1 Mean 14.8 17.8 Sd
2.6 3.3
TABLE-US-00009 TABLE 7 Additional Analysis 360-1 (Nuc050) 360-2
(Nuc049) Mean 14.8 17.79 Standard Error 0.93 1.17 Median 14.68
17.94 Mode #N/A #N/A Standard 2.62 3.30 Deviation Sample Variance
6.88 10.88 Kurtosis -2.10 -0.18 Skewness 0.17 -0.34 Range 6.47 9.78
Minimum 12.03 12.28 Maximum 18.50 22.06 Sum 118.47 142.30 Count 8
8
Example 10
Therapeutic Inhibition c Subcutaneous Adoptive Transfer of
NUC050-Transfected Cells
[0138] The NUC050 vector encodes four different shRNA molecules
which target various portions of the hepatitis B genome for
degradation via the cellular RNAi mechanism. Three of these target
the HBsAg regions contained in the target vector preadministered to
the mice.
[0139] In the therapeutic model, animals receive exogenous RNA
target in the form of a plasmid expressing the surface antigen
coding sequence of HBV via hydrodynamic tail vein injection.
Hydrodynamic injection is a method using a large volume with rapid
injection time, to preferentially direct the DNA plasmid to the
liver where it is expressed.
[0140] To obtain mice expressing a target gene in liver, HBsAg
(surface antigen) cDNA was placed under the control of a
liver-specific promoter in a commercially available plasmid vector
(pLIVE). On Day -7, this vector was injected hydrodynamically into
an immunodeficient strain of mice {NOD. CBI 7-Pkrdc.sup.scid/J). In
this way, DNA is largely localized to liver hepatocytes and the
tissue-specific promoter further restricts expression of the sAg
mRNA to these cells. Since the mice are immunodeficient, they are
able to express the target gene for long periods of time (greater
than a month) because immune response to the foreign protein
encoded by the target gene will not be made.
[0141] Four days following target plasmid administration (Day -3),
the mice were bled to determine levels of circulating HBsAg in
serum. On Day 0, mice were subcutaneously injected with a
suspension of RD (rhabdomyosarcoma) cells (RD; ATCC CCL-135) which
had been transfected with NUC050 within a total volume of 0.2-0.4
ml. A control group of mice was treated similarly with a suspension
of RD cells which had been transfected with the negative control
NUC049 plasmid.
[0142] The NUC050 and NUC049 cell suspensions were prepared
identically as follows:
[0143] Briefly, RD cells were plated in TI 50 flasks (150 cm.sup.2)
at a density of 5.times.10.sup.6 cells per flask and incubated @
37.degree. C., 5% CO.sub.2. One day later they were transfected
with either NUC050 vector or NUC049 negative control vector (28
ug/flask, respectively) mixed with the Roche Fugene.TM. 6
transfection reagent (cat. #11814443001). Cells were roughly 65%
confluent at the time of transfection. After transfection mix was
added, the RD cells were incubated overnight @ 37.degree. C., 5%
CO.sub.2. The next day the cells were rinsed in Ix Dulbecco's
Phosphate Buffered Saline (DPBS) and the medium was changed to
fresh Dulbecco's Modified Eagle's Medium (DMEM) with 10% FBS. Three
days post transfection, RD cells were rinsed in sterile DPBS and
trypsinized to liberate them from the flask surface. Cells were
counted and multiple aliquots of 1.times.10 cells were rinsed twice
in sterile DPBS and pelleted by centrifugation. The RD cells were
then resuspended in 4.5 ml sterile DPBS. A 0.2-0.4 ml cell
suspension containing approximately 8.times.10.sup.6 cells was then
injected subcutaneously into each NOD.CB17-ZWc*.sup.nd/J (NOD/SCID)
mouse in the right flank, using a 23 gauge needle.
[0144] Animals were subsequently bled again on Days 6 and 11 post
eiRNA vector administration, respectively and levels of serum HBsAg
were determined using a commercially available HBsAg ELISA
(Bio-Rad, Hercules, Calif. HBsAg 3.0 EIA cat#. 32591). Animals are
scheduled to be bled again on Days 18 and 25 days post eiRNA vector
administration as well with subsequent HBsAg level measurement.
From 9 to 11 mice were used for each treatment group and the
results are presented as HBsAg percent of initial HBsAg values
(pre-treatment). The ability of the adoptively transferred NUC050
vector treated cells to decrease HBsAg expression was estimated by
calculating, for each bleed day, a normalized difference value of
average HBsAg levels for control minus experimental groups.
Normalization was done by calculating the percent of HBsAg for each
subsequent bleed day, relative to the HBsAg values on
pretreatment.
[0145] Day 6 and Day 11 show difference averages of -8% and -18%
respectively, between NUC050 and NUC049 (FIG. 10 and Table 8).
(These values reflect underlying normalized average values of 124%
and 132% prebleed (pretreatment) values for NUC050 and NUC049
respectively for Day 6. The normalized average values compared to
Prebleed values were 105% (NUC050) vs. 123% (NUC049) for Day 11).
Based on this trend and historical data trends within this animal
model, we anticipate increasing differences between treatment and
control groups in the subsequent time points (Day 18 and Day
25).
[0146] Exogenously transfected cells e.g. muscle cells as described
herein could also be cultured and their culture medium used as a
source of RNA-containing "blebs" or exovesicles for use as
described elsewhere herein. One of skill in the art will also
recognize that the methods described can be utilized for
heterologous or autologous transplant into a recipient mammal of
exogenously transfected cells such as muscle cells for use as a
source of biologically active RNA effector molecules delivered to
distal cells including liver cells such as hepatocytes.
TABLE-US-00010 TABLE 8 Normalized HBsAg Levels (% prebleed) time pt
Nuc049 Nuc050 Difference Day 6 132.2 123.8 -8.4 Day 11 123.0 105.4
-17.6
Example 11
In Vivo Electroporation Delivery of eiRNA Against Endogenous
Interleukin-12 (IL-12)
[0147] In this experiment, immunocompetent BALB/c) mice are
administered an anti-IL-12 eiRNA vector or an irrelevant, negative
control eiRNA vector via intramuscular (IM) injection concomitantly
with electroporation (EP), (IM-EP). The anti-IL-12 eiRNA plasmid
vector encodes a shRNA molecule driven by a 7SK promoter, which
targets the p40 subunit of the mouse IL-12 mRNA sequence for
degradation via the sequence specific cellular RNAi mechanism.
Following IM-EP administration, shRNA molecules encoded by the
eiRNA vectors are transcribed to high copy levels in the
electroporated muscle (2,000,000,000 copies of individual shRNA
detectable by QRT-PCR in piece of electroporated muscle).
[0148] One day, four days, seven days, and 11 days following dosing
with the anti-IL-12 and control eiRNA vectors, blood is collected
from mice for measurement of IL-12 using a commercially-available
ELISA (R&D Systems). If IM-EP delivery of the anti-IL-12 eiRNA
vector is specifically able to downregulate endogenous serum IL-12
(as compared to the control vector), then transfected muscle must
be able to relay plasmid expressed molecules such as shRNA/siRNA
produced in the muscle to at least some of the various distal
immune cells (macrophages, monocytes, dendritic cells, and B cells)
which express IL-12 and where RNAi of the IL-12 target mRNA occurs.
Because IL-12 is expressed by multiple cell types throughout the
body, significant downregulation would be likely to signal
substantial delivery to multiple sites where such cells reside. In
our described study, we expect intramuscular injection of the
anti-IL-12 eiRNA vector with electroporation (IM-EP) in mice to
result in sustained downregulation of endogenous serum IL-12 over
all time points. We expect that alternative methods of delivery to
muscle cells {e.g., vascular delivery with increased pressure to
mammalian limb muscle as described elsewhere herein) would also
achieve downregulation of a target nucleic acid such as IL-12 in
distal non-muscle cells including immune cells.
[0149] All publications, patents and patent applications discussed
herein are incorporated herein by reference. While in the foregoing
specification this invention has been described in relation to
certain preferred embodiments thereof, and many details have been
set forth for purposes of illustration, it will be apparent to
those skilled in the art that the invention is susceptible to
additional embodiments and that certain of the details described
herein may be varied considerably without departing from the basic
principles of the invention.
Sequence CWU 1
1
10121RNAHepatitis B virus 1ggauucagcg ccgacgggac g
21244DNAHepatitis B virus 2ctcaactggt gtcgtggagt cggcaattca
gttgagcgtc ccgt 44357DNAHepatitis B virus 3ctcaactggt gtcgtggagt
cggcaattca gttgagcgtc ccgtcggcgc tgaatcc 57424DNAHepatitis B virus
4cagctgggag gattcagcgc cgac 24557DNAHepatitis B virus 5ctcaactggt
gtcgtggagt cggcaattca gttgagcgtc ccgtcggcgc tgaatcc
57666DNAHepatitis B virus 6cagctgggag gattcagcgc cgacgggacg
ctcaactgaa ttgccgactc cacgacacca 60gttgag 66724DNAHepatitis B virus
7cagctgggag gattcagcgc cgac 24866DNAHepatitis B virus 8cagctgggag
gattcagcgc cgacgggacg ctcaactgaa ttgccgactc cacgacacca 60gttgag
66918DNAHepatitis B virus 9tgccctgcga gttgactt 181020DNAHepatitis B
virus 10tcaactggtg tcgtggagtc 20
* * * * *
References