U.S. patent application number 14/710661 was filed with the patent office on 2015-10-15 for materials and methods relating to modifying the binding of antibodies.
The applicant listed for this patent is Cancer Research Technology Limited. Invention is credited to Kerry Chester, Heide Kogelberg, John F. Marshall.
Application Number | 20150291695 14/710661 |
Document ID | / |
Family ID | 38701737 |
Filed Date | 2015-10-15 |
United States Patent
Application |
20150291695 |
Kind Code |
A1 |
Chester; Kerry ; et
al. |
October 15, 2015 |
MATERIALS AND METHODS RELATING TO MODIFYING THE BINDING OF
ANTIBODIES
Abstract
The invention relates to materials and methods for modifying the
binding of antibodies, and more particularly to antibodies that are
obtainable by inserting an amino acid sequence capable of binding
to a target into a complementarity determining region of a parent
antibody so that the antibody thus obtained is capable of binding
to the target. The invention further relates to the uses of the
antibodies for therapy, diagnosis or imaging, and to methods of
producing the antibodies.
Inventors: |
Chester; Kerry; (London
Greater London, GB) ; Kogelberg; Heide; (London
Greater London, GB) ; Marshall; John F.;
(Charterhouse Square, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Cancer Research Technology Limited |
London |
|
GB |
|
|
Family ID: |
38701737 |
Appl. No.: |
14/710661 |
Filed: |
May 13, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12680320 |
Aug 26, 2010 |
9050321 |
|
|
PCT/GB2008/003283 |
Sep 26, 2008 |
|
|
|
14710661 |
|
|
|
|
Current U.S.
Class: |
424/9.1 ;
424/133.1; 435/252.33; 435/254.2; 435/320.1; 435/69.6; 530/387.3;
530/391.3; 530/391.7; 536/23.53 |
Current CPC
Class: |
C07K 16/2839 20130101;
C07K 16/3007 20130101; C07K 2317/565 20130101; A61K 39/39541
20130101; A61K 39/39558 20130101; C07K 2318/10 20130101; C07K
2319/00 20130101; C07K 2317/77 20130101; C07K 2317/31 20130101;
C07K 2317/24 20130101; C07K 2317/622 20130101 |
International
Class: |
C07K 16/28 20060101
C07K016/28 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 26, 2007 |
GB |
0718843.6 |
Claims
1.-48. (canceled)
49. An anti-.alpha.v.beta.6 integrin antibody as obtainable by
inserting an amino acid sequence of between 12 and 20 amino acids
in length, which comprises RGDLX.sup.5X.sup.6X.sup.7, wherein
X.sup.5 and X.sup.6 represent any amino acid and X.sup.7 is Leu or
Ile between adjacent amino acid residues Thr98 an Gly99 (Kabat
numbering) of heavy chain complementary determining region (CDR) 3
of a parent antibody, wherein the parent antibody comprises heavy
chain CDRs 1 to 3 and light chain CDRs 1 to 3, and wherein the
parent heavy chain CDR 3 has the sequence (i) Gly Thr Pro Thr Gly
Pro Tyr Tyr Phe Asp Tyr (SEQ ID NO: 55) or (ii) Gly Thr Pro Thr Gly
Pro Tyr Pro Phe Asp Tyr (SEQ ID NO: 56).
50. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the parent antibody comprises the following CDR sequences: (a)
Heavy Chain CDR 1: Asp Ser Tyr Met His (SEQ ID NO: 53); and (b)
Heavy Chain CDR 2: Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala
Pro Lys Phe Gln Gly (SEQ ID NO: 54); and (c) Heavy Chain CDR 3: Gly
Thr Pro Thr Gly Pro Tyr Tyr Phe Asp Tyr (SEQ ID NO: 55), or (ii)
Gly Thr Pro Thr Gly Pro Tyr Pro Phe Asp Tyr (SEQ ID NO: 56); and
(d) Light Chain CDR 1: (i) Ser Ala Ser Ser Ser Val Pro Tyr Met His
(SEQ ID NO: 57), or (ii) Ser Ala Ser Ser Ser Val Ser Tyr Met His
(SEQ ID NO: 58); and (e) Light Chain CDR 2: (i) Ser Thr Ser Asn Leu
Ala Ser (SEQ ID NO: 59), or (ii) Leu Thr Ser Asn Leu Ala Ser (SEQ
ID NO: 60); and (f) Light Chain CDR 3: Gln Gln Arg Ser Ser Tyr Pro
Leu Thr (SEQ ID NO: 61).
51. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the antibody is humanised.
52. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
antibody is a scFv or a diabody.
53. The anti-.alpha.v.beta.6 integrin antibody of claim 52, wherein
the scFv or diabody comprises a linker having the sequence
(Gly.sub.4Ser).sub.n, wherein n is between 1 and 4 (SEQ ID NOs:
26-29), respectively.
54. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the antibody is a chimeric molecule comprising an immunoglobulin
binding domain comprising said CDRs, wherein the immunoglobulin
binding domain is fused to another polypeptide.
55. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the parent antibody comprises the mutation G44C in the heavy chain,
A100C in the light chain and/or Y100bP in the heavy chain (using
Kabat nomenclature).
56. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
X.sup.5 and X.sup.6 are independently selected from Glu, Ala, Leu,
Met, Gln, Lys, Arg, Val, Ile, Trp, Phe, Asp, His and Thr.
57. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the inserted amino acid sequence consists of the amino acid
sequence AVPNLRGDLQVLAQKVA (SEQ ID NO: 19).
58. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the antibody is conjugated to a detectable moiety.
59. The anti-.alpha.v.beta.6 integrin antibody of claim 58, wherein
the detectable moiety is detectable by Magnetic Resonance Imaging
(MRI), Magnetic Resonance Spectroscopy (MRS), Single Photon
Emission Computed Tomography (SPECT), Positron Emission Tomography
(PET) or optical imaging.
60. The anti-.alpha.v.beta.6 integrin antibody of claim 58, wherein
the detectable moiety is a radioactive moiety.
61. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the antibody is conjugated to a therapeutically active moiety.
62. The anti-.alpha.v.beta.6 integrin antibody of claim 61, wherein
the therapeutically active moiety is an anti-cancer agent.
63. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the antibody is conjugated to a tagging group for use in
purification or detection.
64. The anti-.alpha.v.beta.6 integrin antibody of claim 63, wherein
the tagging group is c-Myc or a poly-histidine group.
65. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the antibody is directly or indirectly conjugated or linked to one
or more of a cytotoxic moiety, an agent capable of converting a
prodrug to a cytotoxic moiety, a radiosensitiser and/or a
radioactive atom.
66. The anti-.alpha.v.beta.6 integrin antibody of claim 65, wherein
the cytotoxic moiety is a chemotherapeutic agent or a cytotoxic
polypeptide.
67. The anti-.alpha.v.beta.6 integrin antibody of claim 65, wherein
the agent capable of converting a prodrug to a cytotoxic moiety is
an enzyme for use in antibody directed enzyme prodrug therapy
(ADEPT).
68. The anti-.alpha.v.beta.6 integrin antibody of claim 49, wherein
the parent antibody comprises the amino acid sequence of residues 1
to 244 of SEQ ID NO: 2.
69. A nucleic acid molecule that encodes an anti-.alpha.v.beta.6
integrin antibody of claim 49.
70. An expression vector comprising a nucleic acid molecule of
claim 69, operably linked to control sequences to direct its
expression.
71. An isolated host cell transformed with the expression vector of
claim 70.
72. A method of producing the anti-.alpha.v.beta.6 integrin
antibody of claim 49, comprising culturing the host cell of claim
23 and isolating the antibody thus produced.
73. A method of modifying a parent antibody to an antibody capable
of binding .alpha.v.beta.6 integrin, wherein the parent antibody
comprises heavy chain CDRs 1 to 3 and light chain CDRs 1 to 3, and
wherein the parent heavy chain CDR 3 has the sequence (i) Gly Thr
Pro Thr Gly Pro Tyr Tyr Phe Asp Tyr (SEQ ID NO: 55) or (ii) Gly Thr
Pro Thr Gly Pro Tyr Pro Phe Asp Tyr (SEQ ID NO: 56), and wherein
the method comprises inserting an amino acid sequence of between 12
and 20 amino acids in length, which comprises
RGDLX.sup.5X.sup.6X.sup.7, wherein X.sup.5 and X.sup.6 represent
any amino acid and X.sup.7 is Leu or Ile, between adjacent amino
acid residues Thr98 and Gly99 (Kabat numbering) of heavy chain CDR
3 of the parent antibody.
74. The method of claim 73, wherein the parent antibody comprises
the following CDR sequences: (a) Heavy Chain CDR 1: Asp Ser Tyr Met
His (SEQ ID NO: 53); and (b) Heavy Chain CDR 2: Trp Ile Asp Pro Glu
Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe Gln Gly (SEQ ID NO: 54);
and (c) Heavy Chain CDR 3: Gly Thr Pro Thr Gly Pro Tyr Tyr Phe Asp
Tyr (SEQ ID NO: 55), or (ii) Gly Thr Pro Thr Gly Pro Tyr Pro Phe
Asp Tyr (SEQ ID NO: 56); and (d) Light Chain CDR 1: (i) Ser Ala Ser
Ser Ser Val Pro Tyr Met His (SEQ ID NO: 57), or (ii) Ser Ala Ser
Ser Ser Val Ser Tyr Met His (SEQ ID NO: 58); and (e) Light Chain
CDR 2: (i) Ser Thr Ser Asn Leu Ala Ser (SEQ ID NO: 59), or (ii) Leu
Thr Ser Asn Leu Ala Ser (SEQ ID NO: 60); and (f) Light Chain CDR 3:
Gln Gln Arg Ser Ser Tyr Pro Leu Thr (SEQ ID NO: 61).
75. The method of claim 73, wherein the method further comprises
humanizing the antibody capable of binding .alpha.v.beta.6 integrin
or the parent antibody by mutating one or more amino acid
residues.
76. A method for diagnosing or imaging a condition characterised by
diseased cells which express .alpha.v.beta.6 integrin and/or which
is a disease mediated by .alpha.v.beta.6 integrin, the method
comprising administering to a subject suspected of having the
condition the antibody conjugated to a detectable moiety according
to claim 58 and detecting the detectable moiety to diagnose or
image the condition.
77. The method of claim 76, wherein the imaging or diagnosis is for
a cancer.
78. A method of treating an .alpha.v.beta.6 integrin-mediated
disease or a disease in which cells overexpress .alpha.v.beta.6
integrin, said disease being selected from the group consisting of:
cancer, chronic fibrosis, chronic obstructive pulmonary disease
(COPD), lung emphysemia and epidermolysis bullosa, the method
comprising administering to a patient in need thereof a
therapeutically effective amount of an antibody according to claim
49.
79. The method of claim 78, wherein said disease is an epithelial
cancer.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to materials and methods for
modifying the binding of antibodies, and more particularly to
antibodies that are obtainable by inserting an amino acid sequence
capable of binding to a target into a complementarity determining
region of a parent antibody so that the antibody thus obtained is
capable of binding to the target. The present invention further
relates to the uses of the antibodies for therapy, diagnosis or
imaging and to methods of producing the antibodies.
BACKGROUND OF THE INVENTION
[0002] Integrins are a family of heterodimeric class I
transmembrane receptors. Individual integrins comprise an .alpha.
and .beta. subunit in non covalent association and there are known
to exist at least 18 .alpha. subunits and 8 .beta. subunits that
can form 24 different heterodimers. They are involved in numerous
cell-matrix and cell-cell interactions and facilitate cell
adhesion, proliferation, migration and invasion. These processes
occur in several normal and pathological processes, including wound
healing, inflammation and tumour growth and metastasis.
[0003] .alpha.v.beta.6 is an epithelial cell-restricted integrin
and has been shown to be expressed in malignant but not in normal
epithelium. De novo expression of this integrin has been reported
in oral squamous cell carcinomas (SCC) and ovarian cancer tissues
and cancer cell lines and over-expression in adenocarcinomas of the
breast, and ovarian cancer, colon carcinoma, oral squamous cell
carcinoma and in gastroenteropancreatic adenocarcinomas, in
particular in pancreatic ductal adenocarcinomas. It has also been
shown that expression of .beta.6 into a poorly invasive SCC cell
line increased migration on fibronectin and invasion through the
reconstituted basement membrane, suggesting a primary role for this
integrin in oral SCC invasion and metastasis. The transcriptional
activation of .beta.6 and subsequent, expression of .alpha.v.beta.6
has been observed during the epithelial-mesenchymal transition
(EMT), which allows colon carcinoma cells to acquire a more
aggressive phenotype. Moreover, analysis of colorectal carcinoma
samples revealed that the elevated expression is associated with a
significant reduced survival time of patients.
[0004] WO2007/039728 (Cancer Research Technology Limited) discloses
experiments in which .alpha.v.beta.6 peptide ligands comprising the
sequence motif RGDLXXL/I, wherein LXXL/I is contained within an
alpha helical structure are investigated. The use of this peptide
motif arose from studies in which .alpha.v.beta.6 expression was
involved in activation of autocrine TGF-.beta. in post-EMT cells.
The Latency Associated Protein (LAP) of the latent LAP-TGF.beta.1
complex is a known ligand for .alpha.v.beta.6 and binding has a
role in the activation of TGF-.beta.1. The LAP protein contains the
arginine-glycine-aspartic acid (RGD) sequence, a known binding
motif for most integrins. In addition, a further ligand for
.alpha.v.beta.6 is the viral protein 1 (VP1) of the foot-and-mouth
disease virus (FMDV), which also contains the RGD motif. FMDV uses
.alpha.v.beta.6 to attach to host cells and the integrin most
likely also plays a role in virus uptake into endosomes. The
binding of VP1 specifically to .alpha.v.beta.6 is mediated via
residues immediately following and including the aspartic acid of
the RGD motif; the DLXXL sequence has been identified as an
additional .alpha.v.beta.6 binding motif from its ability to
inhibit .alpha.v.beta.6-fibronectin interactions. Peptides in which
either of the two leucine residues were mutated were less good as
inhibitors of FMDV C-S8c1 to recognize and infect susceptible
cells. The highly related RGDLXXI motif is present in the LAP
protein and would be predicted to be also involved in binding with
high affinity to .alpha.v.beta.6.
[0005] A previous study engineered a RGD motif and three RGD
repeats into the CRD3 loop of an immunoglobulin human/mouse
chimeric heavy chain antibody and showed that the antibody
recognized specifically the integrin .alpha.v.beta.3 (20).
Similarly, a gp120 binding antibody was created by inserting a
peptide from the CD4 receptor into the CRD3 loop (21) and a
DNA-binding antibody by replacing the CDR3 loop with a sequence
from a class B basic helix-loop-helix protein (22). More recently
peptide sequences of the prion protein that are known epitopes for
monoclonal antibodies that inhibit prion disease formation were
grafted into the CD3 loop of the heavy chain of an IgG antibody
specific for the envelope glycoprotein of HIV-1 (23). The resulting
PrP-IgGs bound specifically to disease-associated conformations of
PrP but not to the HIV envelope.
SUMMARY OF THE INVENTION
[0006] Broadly, the present invention concerns antibodies that are
obtainable by inserting an amino acid sequence that is capable of
binding to a target into the complementarity determining region
(CDR) of a parent antibody so that the antibody thus obtained is
capable of binding to the target. Thus, this approach may be used
to introduce a new binding specificity to the antibody. As the
insertion is made in one of the CDRs of the parent antibody, and is
preferably made in CDR H3, the insertion often has the effect of
reducing or abolishing the binding of the parent antibody for the
antigen to which it initially bound. The antibodies of the present
invention are useful as they are able to bind to the target, such
as .alpha.v.beta.6 integrin, while retaining one or more of the
useful properties of the parent antibody, such as interacting with
the immune system (e.g. recruitment of complement), a
pharmacological property such as stability and/or half-life, e.g.
when the antibody is administered in vivo and especially when
compared to the corresponding peptide, and/or ease of production in
recombinant host cells. In the present invention, the parent
antibodies are based on MFE-23 antibodies and variants and
derivatives thereof as discussed in more detail below.
[0007] Accordingly, in a first aspect, the present invention
provides an antibody which is capable of binding to a target as
obtainable by inserting an amino acid sequence capable of binding
to the target into a complementarity determining region of a parent
antibody, wherein the parent antibody comprises the following
complementary determining regions (CDRs): [0008] (a) Heavy Chain
CDR 1: Gly Phe Asn Ile Lys Asp Ser; and/or [0009] (b) Heavy Chain
CDR 2: Asp Pro Glu Asn Gly Asp; and/or [0010] (c) Heavy Chain CDR
3: Thr Pro Thr Gly Pro Tyr Tyr Phe Asp; and/or [0011] (d) Light
Chain CDR 1: (i) Ser Ser Ser Val Pro, or (ii) Ser Ser Ser Val Ser;
and/or [0012] (e) Light Chain CDR 2: (i) Ser Thr Ser, or (ii) Leu
Thr Ser; and/or [0013] (f) Light Chain CDR 3: Arg Ser Ser Tyr Pro
Leu.
[0014] In some embodiments, the antibody may have an amino acid
sequence capable of binding to the target inserted into more than
one of the complementarity determining regions of the parent
antibody. Additionally or alternatively, the antibody may have an
amino acid sequence capable of binding to the target grafted onto a
complementarity determining region of the parent antibody.
[0015] As discussed further herein, the above CDRs are derived from
MFE-23 antibodies and amino acid sequence for binding to the target
is preferably inserted into the heavy chain CDR3 of the parent
antibody, and more preferably between amino acids Thr and Gly
residues of CDR H3 of the parent antibody, i.e. between residues 98
and 99 as shown in the sequence of MFE-23 provided herein.
[0016] In another preferred embodiment, the target is inserted into
the heavy chain CDR2 of the parent antibody, preferably between
amino acids Glu and Asn of CDR H2 of the parent antibody, i.e.
between residues 53 and 54 of the sequence of MFE-23.
[0017] In a further aspect, the present invention provides an
antibody as described herein for use in therapy, diagnosis or
imaging.
[0018] In a further aspect, the present invention provides the use
of an antibody as described herein for the preparation of a reagent
for imaging or diagnosis using a detectable group conjugated or
linked to the antibody.
[0019] In a further aspect, the present invention provides the use
of an antibody as described herein for the preparation of a
medicament for the treatment of a condition characterised by
diseased cells which express the target, for example a condition in
which the cells overexpress the target and/or display the target on
the cell surface and/or which is a disease mediated by the
target.
[0020] Examples of such conditions are provided below and include
cancer, for example by making use of the antigens expressed on the
surface of cancer cells. In some embodiments, the conditions
include .alpha.v.beta.6-mediated diseases or diseases in which
cells overexpress .alpha.v.beta.6, such as cancer, chronic
fibrosis, chronic obstructive pulmonary disease (COPD), lung
emphysemia or chronic wounding skin disease.
[0021] In a further aspect, the present invention provides a method
for diagnosing or imaging a condition characterised by diseased
cells which express the target and/or which is a disease mediated
by the target, the method comprising (a) administering to a patient
suspected of having the disease an antibody as described herein
which is linked to a detectable moiety and (b) detecting the
detectable moiety to diagnose or image the condition.
[0022] In a further aspect, the present invention provides a method
of treating a condition characterised by diseased cells which
express the target and/or which is a disease mediated by the
target, the method comprising administering to patient a
therapeutically effective amount of an antibody as described
herein.
[0023] In further aspect, the present invention provides nucleic
acid sequences, expression vectors and host cells for producing
antibodies according to the present invention.
[0024] Embodiments of the present invention will now be further
described by way of example and not limitation with reference to
the accompanying figures and tables.
BRIEF DESCRIPTION OF THE FIGURES
[0025] The application file contains at least one drawing executed
in color. Copies of this application with color drawings will be
provided upon request and payment of the necessary fee.
[0026] FIG. 1A-FIG. 1B. Schematic presentation of the construction
of MFEVP1 and NFEVP1. FIG. 1A) Insertion of the RGD containing
peptide sequences of VP1 (A.sub.140 to A.sub.156) into the CDR3
loop (between T98 and G99) of the VH chain of MFE-23 gives MFEVP1.
Y.sub.100b to P.sub.100b mutation of MFEVP1 gives NFEVP1. (FIG. 1B)
Ribbon diagram of the X-ray structure of MFE-23. CDR 3 loop
residues P.sub.97 to P.sub.100 of the VH chain of MFE are shown in
stick presentation and the site of peptide insertion in MFE-23 is
indicated by an arrow. Y.sub.100b that was mutated to P.sub.100b to
give NFEVP1 is shown in ball-and-stick presentation.
[0027] FIG. 2. E. coli expressed NFEVP1 separated into monomeric
and dimeric forms on size-exclusion chromatography (Superdex75).
The E. coli protein was applied after Ni2+- affinity and the P.
Pastoris after EMD-IMAC and Ni2+- affinity chromatographies. 12%
Tris-glycine reducing SDS-PAGE shows dimeric (D) and monomeric (M)
fraction of the E. coli expressed protein.
[0028] FIG. 3A-FIG. 3D. MFEVP1 showed concentration dependent
binding to immobilized .alpha..nu..beta.6 in ELISA and on cells and
inhibited cell migration of V.beta.6 cells through LAP coated
wells. (FIG. 3A) MFEVP1 (various concentrations) and MFE (10
.mu.g/ml) were applied to immobilized .alpha..nu..beta.6 and
control Tris-buffered wells. Binding was detected with rabbit
anti-MFE followed by goat horseradish peroxidase (HRP)-linked
secondary anti-rabbit IgG antibody. (FIG. 3B) MFE or MFEVP1 were
allowed to bind to A375P.beta.6 and A375Ppuro cells. Bound scFvs
were detected by Flow Cytometry with mouse anti-Tetra-His IgG
followed by Alexa Fluor.RTM.-conjugated anti-mouse Fc. Grey solids,
non-immune IgG; black lines, 10D5 (anti-.alpha..nu..beta.6). MFEVP1
is denoted by red lines (50 .mu.g/ml), orange lines (5 .mu.g/ml),
green lines (0.5 .mu.g/ml) and blue lines (0.05 .mu.g/ml).
Concentrations lower than 50 .mu.g/ml are omitted for MFE, and all
A375Ppuro experiments. 50 .mu.g/ml MFEVP1 binding to A375P.beta.6
overlapped with the histograms for 5 .mu.g/ml and 0.5 .mu.g/ml and
is not shown. Data is representative of three independent
experiments with similar results. (FIG. 3C and FIG. 3D) V.beta.6
cells were allowed to invade through LAP-coated polycarbonate
filters in the presence of proteins. Inhibition of cell migration
was observed for MFEVP1, NFEVP1 (both at 50 .mu.g/ml) and 10D5
(FIG. 3C) and in a concentration-dependent manner for MFEVP1 (FIG.
3D). W632, designated control, and 10D5 antibodies were used at
1:100 and 10 .mu.g/ml, respectively. The data represent the mean of
triplicate measurements and error bars represent the standard
deviation at each data point (FIG. 3A, FIG. 3C and FIG. 3D).
[0029] FIG. 4A-FIG. 4B. MFEVP1 and NFEVP1 bound to immobilized
.alpha..nu..beta.6 and not to .alpha..nu..beta.3 by ELISA.
A375Ppuro and A375P.beta.6 expressed .alpha..nu..beta.8,
.alpha..nu..beta.5, .alpha.v.beta.3 and .alpha.5.beta.1 at similar
levels. .alpha..nu..beta.6 expression is only detected by the
A375P.beta.6 cells. (FIG. 4A) Binding of MFEVP1, NFEVP1 and MFE
[all at 20 .mu.g/ml] was detected with rabbit anti-MFE followed by
goat horseradish peroxidase (HRP)-labelled anti-rabbit IgG
antibodies and, to detect integrin immobilization, wells were also
incubated with mouse anti-.alpha..nu. followed by sheep HR-labelled
anti-mouse IgG. The data represent the mean of triplicate
measurements and error bars represent the standard deviation at
each data point. (FIG. 4B) A375Ppuro and A375P.beta.6 cells were
incubated with antibodies. Negative controls (white histograms) had
secondary antibody only.
[0030] FIG. 5A-FIG. 5B. MFEVP1 showed residual binding to
immobilized CEA and bound to CEA-expressing LS-174T cells. CEA
binding was eliminated by the Y.sub.100b to P.sub.100b mutation.
(FIG. 5A) MFEVP1 and NFEVP1 (at three different concentrations)
were added to immobilized CEA and PBS wells. Binding was detected
with rabbit anti-MFE followed by goat horseradish peroxidase
(HRP)-labelled anti-rabbit IgG. The data represent the mean of
triplicate measurements and error bars represent the standard
deviation at each data point. (FIG. 5B) Cells were incubated with
MFEVP1, NFEVP1 and MFE (all at 50 .mu.g/ml). Binding was detected
by Flow Cytometry with rabbit anti-MFE IgG followed by
R-phycoerythrin (R-PE)-labelled goat anti-rabbit IgG. The Omission
Control is the MFE experiment without rabbit anti-MFE IgG. Results
are representative of three independent experiments. % Gates
Fluorescence Intensities (7.times.10.sup.1-10.sup.4, as indicated)
are mean values from three separate experiments of which the mean
control values have been subtracted.
[0031] FIG. 6A-FIG. 6C. NFEVP1 (P) is internalized by
.beta.6-transfected (FIG. 6A) A375P cells as revealed by indirect
fluorescence confocal microscopy. .beta.6-transfected and
non-transfected (puro) (FIG. 6B) A375P cells were incubated with
NFEVP1 for 1 hr at 4.degree. C., the scFv was removed and cells
were shifted to 37.degree. C. for the times indicated. Cell surface
bound and internalized NFEVP1 was detected with rabbit anti-mouse
IgG followed by Alexa Fluor.RTM.546 labelled goat anti-rabbit IgG
(red). In the control experiment (FIG. 6C) NFEVP1 was omitted. Blue
reveals nuclear staining with Hoechst.
[0032] FIG. 7A-FIG. 7B. NFEVP1 and MFE had very similar secondary
structure elements and denaturation curves as determined by FT-IR
spectroscopy. (FIG. 7A) Second derivative FT-IR spectra of NFEVP1
and MFE were obtained from the absorbance spectra recorded at
30.degree. C. after buffer control subtraction. (FIG. 7B) for the
denaturation curve both proteins were heated from 25.degree. C. to
85.degree. C. and the FT-IR spectra were measured. The midpoints of
denaturation were obtained from fitting of the peak intensity at
1635 cm.sup.-1 of the 2.sup.nd derivative spectra to a sigmoidal
curve as 47.degree. C. for MFE and 45.degree. C. for NFEVP1.
[0033] FIG. 8A-FIG. 8C. HFEVP1 eluted almost exclusively as dimer
on size-exclusion chromatography (Superdex 75), bound to
immobilized .alpha..nu..beta.6 in ELISA and inhibited the adhesion
of .alpha..nu..beta.6-expressing 3T3.beta.6.19 cells to LAP. (FIG.
8A) P. Pastoris expressed HFEVP1 was applied after EDB-IMAC and
Ni.sup.2+-affinity chromatographies. Twelve percent Tri-glycine
SDS-PAGE under reducing and non-reducing conditions is shown of the
dimeric fraction. (FIG. 8B) NFEVP1, HFEVP1 and MFE were applied at
20 .mu.g/ml to immobilized .alpha.v.beta.6 and control Tris
buffered wells. Binding was detected with mouse anti-Tetra-His IgG
followed by sheep anti-mouse horseradish peroxidase (HRP)-linked
secondary antibody. The data represent the mean of triplicate
measurements and error bars represent the standard deviation at
each data point. (FIG. 8C) Radiolabelled [.sup.51Cr]3T3.beta.6.19
cells in various concentrations of MFE, NFEVP1, HFEVP1 or 10D5 were
added to 96-well plates coated with 50 .mu.l (0.25 .mu.g/ml) LAP.
Data show the mean and standard deviations of quadruplet wells.
[0034] FIG. 9A-FIG. 9C. IMAC purification of hMFE, hMFE23-RGD and
hMFE23-RGE. Western blotting of hMFE (FIG. 9A), hMFE23-RGD (FIG.
9B) and hMFE23-RGE (FIG. 9C) using anti-His.sub.4. Samples were
applied as follows: supernatant (lane 1), PBS wash (lane 2), 40 mM
imidazole wash (lane 3), 200 mM imidazole wash (lane 4), 200 mM
imidazole wash after dialysis against PBS (lane 5) and EDTA wash
(lane 6).
[0035] FIG. 10. Binding of hMFE, hMFE23-RGD and hMFE23-RGE to CEA.
hMFE, hMFE23-RGD and hMFE23-RGE as neat supernatant, 1:10 dilution
and 1:100 dilution for hMFE and 2YT were added to immobilized CEA.
Binding was detected with mouse anti-His4 and HRP-conjugated sheep
anti-mouse IgG.
[0036] FIG. 11. Detection of His-tagged hMFE, hMFE-RGD and hMFE-RGE
proteins binding to immobilized CEA, rs.alpha..nu..beta.6 or PBS
control. 96-well plates were coated with 1 .mu.g/ml CEA/1.5
.mu.g/ml rs.alpha..nu..beta.6 or PBS, and residual non-specific
binding sites blocked with 1% Tween 20, 5% BSA. Purified proteins
were diluted 1/50 added to the wells and allowed to bind for one
hour before washing and detection with Qiagen TetraHis (mouse
anti-4.times.His) followed peroxidase-conjugated anti-mouse. Bound
peroxidase was visualized by the colour change reaction on addition
of the TMB+ reagent (DAKO), and quantitated by the absorbance at
450 nm after the reaction had been stopped with 1N H.sub.2SO.sub.4.
TetraHis and anti-mouse were omitted from some control wells, as
shown. Data shown are the results of duplicate wells.
DETAILED DESCRIPTION
Antibodies
[0037] In general, the present invention provides antibodies in
which a peptide sequence capable of binding to a target, such as
.alpha.v.beta.6 integrin, is inserted into at least one
complementarity determining region of a parent, antibody in order
to modify the parent antibody so that it is capable of binding to
the target, while retaining other useful properties of the parent
antibody, such as the antibody's properties in interacting with the
immune system (e.g. recruitment of complement), stability and
half-life when administered in vivo, especially when compared to
the corresponding peptide, and ease of production. Multiple
target-binding sequences may be inserted into different
complementarity determining regions of the parent antibody.
Additionally or alternatively, in addition to the inserted
sequence(s), a target-binding sequence may be grafted onto one or
more of the complementarity determining regions of the parent
antibody. The presence of multiple target binding sequences may
permit the formation of dimeric or multimeric forms of the
antibody. Examples of targets and the peptide sequences that are
capable of binding to them are discussed in more detail below.
[0038] In particular, the present invention employs MFE-23 antibody
scaffolds and variants thereof as the parent antibodies into which
the targeting peptides are inserted. As used herein, MFE-23
antibodies include the following examples from this family as
parent antibody scaffolds that may be used in the present
invention. MFE-23 was originally a scFv isolated from a murine
phage display library and selected for specific binding to
carcinoembryonic antigen (CEA) (Chester et al., Lancet 343:
455-456, 1994). MFE-23 has been humanised in order to reduce the
likelihood of immunogenicity (hMFE) and the humanised antibody has
been affinity matured to produce the mutant scFv sm3E. A stabilised
humanised form of MFE-23 is referred to as shMFE. MFE-23
antibodies, and derivatives thereof, are disclosed in WO95/15341 or
EP 0733072A and U.S. Pat. No. 7,232,888, which are expressly
referenced in this context for their disclosure of these
antibodies, including their complete sequences including CDRs and
properties. The antibodies have also undergone successful
pre-clinical, and in some cases clinical, studies support its
potential for use in targeted cancer therapies (e.g.,
radioimmunotherapy, cellular immunotherapy, gene therapy, targeted
cytokine therapy) and as an imaging agent. These include Phase I
studies of radiolabelled MFE-23 for use as an imaging agent, for
radioimmunoguided surgery and as the tumour-targeting moiety of an
antibody directed enzyme prodrug therapy.
[0039] MFE-23 antibodies comprise the following six CDRs, as shown
in SEQ ID NO: 6 of U.S. Pat. No. 7,232,888 (with the exception of
CDR (d) (ii) disclosed elsewhere in the patent [and CDR (e) (i)
disclosed elsewhere in the patent]):
TABLE-US-00001 (a) Heavy Chain CDR 1: Gly Phe Asn Ile Lys Asp Ser;
(b) Heavy Chain CDR 2: Asp Pro Glu Asn Gly Asp; (c) Heavy Chain CDR
3: Thr Pro Thr Gly Pro Tyr Tyr Phe Asp; (d) Light Chain CDR 1: (i)
Ser Ser Ser Val Pro, or (ii) Ser Ser Ser Val Ser; (e) Light Chain
CDR 2: (i) Ser Thr Ser, or (ii) Leu Thr Ser; (f) Light Chain CDR 3:
Arg Ser Ser Tyr Pro Leu.
[0040] In Light Chain CDR2, (i) is derived from the sequence of the
CDR of the murine MFE-23 antibodies and (ii) is derived from the
sequence of the CDR of humanised MFE-23.
[0041] Since CDR loops are the accessible regions for interaction
with the epitopes of the antigen to which the parent antibody was
specific, it is generally desirable in the present invention to
insert the targeting peptide sequences into these regions. While
any CDR of the parent MFE-23 antibodies may be suitable, it is
preferred that the peptide sequence capable of binding to the
target is inserted into the CDR H3 region of the parent antibody,
and preferably between residues Thr98 and Gly99. This is because
the present inventors realised that in the parent MFE-23
antibodies, CDR H3 is the longest and most variable CDR and is
essential for antigen binding. The site between Thr98 and Gly99 was
selected as the sequence is at the end of a protruding loop
structure and therefore means that the inserted targeting peptide
should be available for binding to the target.
[0042] In one embodiment, the antibody of the present invention is
a scFv or a diabody which comprises a linker having the sequence
(Gly.sub.4Ser).sub.n, wherein n is between 1 and 4. A preferred
example of a scFv or diabody having this general structure is
represented in FIG. 1.
[0043] The insertion may also be combined with mutation of one or
more amino acid residues of the CDRs or framework regions of the
parent antibody to modify or otherwise improve the properties of
parent antibody, for example to reduce or eliminate the binding of
the parent antibody to the antigen to which it was raised or was
initially capable of specifically binding or to humanise the
antibody or to increase affinity for the target. However, in other
embodiments, it may be useful to retain the specificity of the
parent antibody so that the antibody of the present invention is
bispecific. Examples of other changes made to the amino acid
sequence of the parent antibody include mutation of G44 to C44 of
the VH domain and A100 to C100 of the VL domain to introduce two
cysteine residues to form an inter-molecular stabilising disulphide
bridge in a diabody and Y.sub.100b to P.sub.100b of the VH domain
to help to reduce or eliminate any remaining residual binding to
CEA. Further examples of other changes to the amino acid sequence
of the parent antibody include mutations to improve affinity,
specificity or stability and methods for achieving this are well
known in the art. For example, if affinity maturation or increased
specificity is required, residues in the CDR H3 could be varied
using PCR mutagenesis or site directed mutagenesis. In addition,
the remaining CDRs could be varied using PCR mutagenesis, site
directed mutagenesis or rational addition/replacement of peptides
(Hoogenboom, (2005) and references therein). The resulting mutated
genes would be cloned and expressed as scFvs in filamentous
bacteriophage libraries. The libraries would be screened for phage
displaying scFvs with improved binding and biological efficacy. If
increased stability or yield is required the whole DNA could be
varied using PCR mutagenesis, site directed mutagenesis or growth
in mutator strains of bacteria (Hoogenboom, (2005) and references
therein). The resulting mutated genes would be cloned and expressed
as scFvs in filamentous bacteriophage libraries. The libraries
would be screened for phage displaying scFvs with high expression
levels and stability. In some embodiments it may also be useful to
reduce the immunogenicity. Potential immunogenicity of the scFv,
for example HFEVP1 or affinity matured variant, could be addressed
by identification and modification of T-cell epitopes and methods
for this are well known in the art. This is based on the rationale
that T cell help is required in order to mount a long-lived,
isotype switched and high affinity antibody response [Chester K A,
et al (2005)]. The approach requires the identification of short
peptides contained within the protein sequence that have a capacity
to bind to the MHC class II binding groove and stimulate a
subsequent T-cell response. Key residues in these peptides that
contribute to T-cell epitope formation can be identified by
determining whether the side chains interact with key binding
pockets in the MHC class II binding groove or with the T-cell
receptor (TCR). Subsequent amino acid substitutions at these key
residues can inhibit T-cell epitope formation by reducing the
peptide affinity for MHC class II or preventing TCR recognition of
the peptide MHC complex. An experimental approach using a T-cell
proliferation assays could be used as this takes into account
factors that contribute to epitope formation, such as antigen
processing and TCR binding. In vitro studies could be performed
with peptides spanning the whole of the scFv sequence, for example,
15mer peptides overlapping by 12 amino acids. The peptides could be
tested for ability to stimulate T-cells in T-cell proliferation
assays.
[0044] Typically, T-cells from healthy donors expressing a wide
range of HLA alleles would be used in addition to T-cells obtained
from any patients demonstrating an immune response to the scFv. The
precise location of key residues responsible for T-cell activation
could be determined by residue replacement (usually with alanine)
and testing the resultant peptides in T-cell proliferation assays.
In silico analysis could also be used to predict amino acid
substitutions that should disrupt peptides binding to MHC class II.
In the final stage, in silico modelling could be applied to predict
those amino acid substitutions likely to eliminate immune
reactivity to the scFv without disruption of scFv structure or loss
of scFv function. The gene for the preferred variant could be
manufactured by recombinant DNA technology.
[0045] In the present invention, "MFE-23 antibody" includes
antibodies which comprise the CDRs of the scFv MFE-23, fragments or
derivatives thereof. It also includes the CDRs when incorporated
into other antibody framework as described above, e.g. to produce a
complete antibody structure, a diabody or another antibody. These
include antibody fragments which comprise an antigen binding domain
are such as Fab, scFv, Fv, dAb, Fd and diabodies. It is possible to
take monoclonal and other antibodies and use techniques of
recombinant DNA technology to produce other antibodies or chimeric
molecules which retain the specificity of the original antibody.
Such techniques may involve introducing DNA encoding the
immunoglobulin variable region, or the complementarity determining
regions (CDRs), of an antibody to the constant regions, or constant
regions plus framework regions, of a different immunoglobulin. See,
for instance, EP 0 184 187 A, GB 2,188,638 A or EP 0 239 400 A.
[0046] Antibodies can be modified in a number of ways and the term
"antibody" should be construed as covering any specific binding
member or substance having an antibody antigen-binding domain with
the required specificity. Thus, this term covers antibody fragments
and derivatives, including any polypeptide comprising an
immunoglobulin binding domain, whether natural or wholly or
partially synthetic. Chimeric molecules comprising an
immunoglobulin binding domain, or equivalent, fused to another
polypeptide are therefore included. Cloning and expression of
chimeric antibodies are described in EP 0 120 694 A and EP 0 125
023 A.
[0047] It has been shown that fragments of a whole antibody can
perform the function of binding antigens. Examples of binding
fragments are (i) the Fab fragment consisting of VL, VH, CL and CH1
domains; (ii) the Fd fragment consisting of the VH and CH1 domains;
(iii) the Fv fragment consisting of the VL and VH domains of a
single antibody; (iv) the dAb fragment (Ward, E. S. et al., Nature
341, 544-546 (1989)) which consists of a VH domain; (v) isolated
CDR regions; (vi) F(ab')2 fragments, a bivalent fragment comprising
two linked Fab fragments (vii) single chain Fv molecules (scFv),
wherein a VH domain and a VL domain are linked by a peptide linker
which allows the two domains to associate to form an antigen
binding site (Bird et al, Science, 242; 423-426, 1988; Huston et
al, PNAS USA, 85: 5879-5883, 1988); (viii) bispecific single chain
Fv dimers (WO93/11161) and (ix) "diabodies", multivalent or
multispecific fragments constructed by gene fusion (WO 94/13804;
Holliger et al, P.N.A.S. USA, 90: 6444-6448, 1993). Fv, scFv or
diabody molecules may be stabilised by the incorporation of
disulphide bridges linking the VH and VL domains (Reiter et al,
Nature Biotech, 14: 1239-1245, 1996). Minibodies comprising a scFv
joined to a CH3 domain may also be made (Hu et al, Cancer Res., 56:
3055-3061, 1996).
[0048] In terms of utility of these antibodies, this is primarily
therapeutic with imaging/diagnosis being a secondary utility. In
terms of therapeutic use, antibodies have advantages over peptides
as it is generally appreciated in the art that peptides tend to
have short serum half-life in vivo. In contrast, antibody
therapeutics tend to possess greater stability and longer
half-life. Additional advantages of preferred antibodies of the
present invention include combining high affinity binding
properties of the .alpha.v.beta.6 binding peptides together with
advantages of the MFE antibody scaffold, namely stability, good
production yields, e.g. in Pichia pastoris, and for humanised
versions of the MFE antibody scaffold, low predicted immunogenic
potential.
Targeting Peptides
[0049] The present invention involves the insertion of amino acid
sequences generally referred to herein as "targeting peptides" that
are capable of binding to a target. Generally, the inserted amino
acid sequences capable of binding to the target are between 8, 10
or 12 amino acids and 24 or 30 amino acids in length, and more
preferably are between 12 and 20 amino acids in length. In one
embodiment, the target is an antigen present on diseased cells, to
which the antibodies of the present invention are capable of
binding using the targeting peptide. By way of illustration, the
diseased cells may be surface antigen on, for example, cancer
cells. In a preferred embodiment, the targeting peptide is capable
of binding to an integrin, such as .alpha.v.beta.6 integrin which
is known to be involved in normal and pathological processes such
as wound healing, inflammation and tumour growth and
metastasis.
[0050] More generally, the targets for the antibodies of the
present invention may be targets that (i) are overexpressed or de
novo expressed in diseased cells (and more specifically cancer
cells) and/or (ii) are expressed in diseased cells and mediate the
disease (and more specifically cancer). Thus, the present invention
includes antibodies which can be used as tumour targeting
antibodies, where target is overexpressed or de novo expressed in
diseased cell, and/or function-modulating antibodies, e.g. whereby
the target is expressed on the diseased cell and the antibody
modulates the activity of the target and/or the targets ability to
interact with its binding partners. In addition to .alpha.v.beta.6
integrin, some specific examples include tumour associated antigens
and/or antigens involved in mediated disease such as MUC1, 5T4,
VEGFR (Hofmeister V et al., 2007), Tie2, endoglin (CD105)
(Hofmeister V et al., 2007; Munoz R et al., 2007), uPA receptor
(uPAR) (Li Y et al., 2007), PSMA (Baccala A et al., 2007, Buhler P
et al., 2007) .sup.4,5, and members of the ErbB (Her) family
(Johnston J B et al., 2006).
[0051] Further targets may be identified using techniques well
known in the art. These might include the following approaches.
[0052] In one approach, preferred peptides would include epitopes
of the antigen-binding protein that are located on surface-exposed
loops, making use of the three-dimensional structure of the
antigen-binding protein. For example, in design of the
MFE/shMFE/VP1 constructs we used the knowledge that the inserted
17-mer VP1 peptide is part of a long highly mobile loop that forms
a self contained unit in the VP1 protein of FMDV (Logan, D.,
Abu-Ghazaleh, R., Blakemore, W., Curry, S., Jackson, T., King, A.,
Lea, S., Lewis, R., Newman, J., Parry, N., (1993) Structure of a
major immunogenic site on foot-and-mouse disease virus Nature
362:566-568). It is a general feature that residues of the ligand
that bind to .alpha.v.beta.6 are part of a surface exposed loop. In
fibronectin also, which is a further ligand for .alpha.v.beta.6,
the RGD binding motif is part of a highly mobile loop, which
protrudes from the rest of the tenth type III module (Main, A. L.,
Harvey, T. S., Baron, M., Boyd, J., and Campbell, I. D. (1992) The
three-dimensional structure of the tenth type III module of
fibronectin: An insight into RGD-mediated interactions Cell
71:671-678).
[0053] In a second approach, preferred peptides could be rationally
designed using three-dimensional structures of the ligand-antigen
complex if these are available. In this case the ligand residues
that are involved in binding to the cell surface antigen are known
from the detail of the ligand-antigen interaction.
[0054] In a third approach, preferred peptides could be those which
are potent in inhibiting antigen/antigen-binding protein
interactions as shown in vitro in ELISA or cell-based assays. For
example, a 17-mer peptide that contained the 17-mer VP1 peptide
sequence minus the N-terminal alanine and a 20-mer peptide that
contained the 17-mer peptide sequence used to create MFEVP1 were
potent inhibitors of FMDV binding to purified .alpha.v.beta.6 and
.alpha.v.beta.6-expressing cells (Burman, A., Clark, S., Abrescia,
N. G., Fry, E. E., Stuart, D. I., and Jackson, T. (2006)
Specificity of the VP1 GH Loop of Foot-and-Mouth Disease Virus for
.alpha.v Integrins J. Virol. 80:9798-9810) and of
.beta.6-transfected fibroblast cells to LAP (Dicara, D., Rapisarda,
C., Sutclifffe, J. L., Violette, S. M., Weinreb, P. H., Hart, I.
R., Howard, M. J., and Marshall, J. F. (2007) Structure-function
analysis of Arg-Gly-Asp helix motifs in alpha v beta 6 integrin
ligands J. Biol. Chem 282:9657-9665), respectively.
[0055] In a fourth approach, preferred peptides could be those that
are selected in vitro or in vivo from peptide libraries displayed
on filamentous bacteriophage. This method has been used to obtain
peptides with high affinity and specificity for tumour targets
(Landon, L. A., Deutscher, S. L. (2003) Combinatorial Discovery of
Tumor Targeting Peptides Using Phage Display. J Cell Biochem.
90:509-517). Peptide libraries consist of random cyclic and linear
peptide sequences. In vitro selection is performed using purified
recombinant proteins or cells that express the target protein.
[0056] For example, the 17-mer peptide VP1 peptide sequence
inserted into MFE-23 to create MFEVP1 contains the DLXXL sequence,
which has specificity for .alpha.v.beta.6, and has also been
identified from screening 12-mer peptide libraries displayed on
phage using recombinant transmembrane truncated soluble receptor.
(Kraft, S., Diefenbach, B., Mehta, R., Jonczyk, A., Luckenbach, G.
A., and Goodman, S. L. (1999) Definition of an Unexpected Ligand
Recognition Motif for .alpha.v.beta.6 Integrin J. Biol. Chem.
274:1979-1985).
[0057] In another example, a random phage library consisting of
linear 12 amino acid peptides identified peptides that bound
specifically to recombinant prostate-specific membrane antigen
(PMSA), an attractive candidate for targeted therapy for prostate
and other solid tumours (Aggarwal, S., Singh, P., Topaloglu, O.,
Isaacs, J. T., Denmeade, S. R. (2006) A Dimeric Peptide That Binds
Selectively to Prostate-Specific Membrane Antigen and Inhibits its
Enzymatic Activity Cancer Res. 66:9171-9177). A pIII-displayed
disulphide-constrained heptamer peptide library was screened on
purified extracellular PSMA to identify PSMA binding peptides.
[0058] In another example, the epidermal growth factor receptor,
type 2 (ErbB-2) tyrosine kinase receptor that shows increasing
promise as a target for cancer diagnosis and therapy has been used
as bait. In this case, a random 6 amino acid peptide bacteriophage
display library was selected against purified ErbB-2 extracellular
domain to identify peptide binding sequences (Karasseva, N. G.,
Glinsky, V. V., Chen, N. X., Komatireddy, R., Quinn, T. P. (2002)
Identification and Characterization of Peptides that Bind Human
ErbB-2 Selected from a Bacteriophage Display Library J. Protein
Chem. 21:287-296).
[0059] Peptide sequences can also be selected by display of peptide
libraries on phage that bind to carbohydrate antigens, which show
different composition in malignant transformations.
[0060] For example, an in vitro phage display was employed to find
peptides that bind to the Thomsen-Friedenreich (TF)
tumour-associated antigen (Peletskaya, E. N., Glinsky, V. V.,
Glinsky, G. V., et al. (1997) Characterisation of peptides that
bind the tumour-associated Thomson-Friendenreich antigen selected
from bacteriophage display libraries J. Mol. Biol.
270:374-384).
[0061] Peptide library selection on cells was used to identify a
further .alpha.v.beta.6 binding peptide sequence. A 20-mer peptide
library fused to bacteriophage coat protein pIII selected a peptide
that bound specifically to a lung adenocarcinoma cell line and was
shown subsequently to bind to .quadrature.v.quadrature.6 (Elayadi,
A. N., Samli, K. N., Prudkin, L., Liu, Y.-H., Bian, A., Xie, X.-J.,
Wistuba, I. I., Roth, J. A., McGuire, M. J., Brown, K. C. (2007) A
Peptide Selected by Biopanning Identifies the Integrin avb6 as a
Prognostic Biomarker for Nonsmall Cell Lung Cancer. Cancer Res.
67:5889-5895).
[0062] Peptides that bind to tumour and tumour-associated
vasculature have also been successfully selected from phage peptide
libraries in vivo (Landon, L. A., Deutscher, S. L. (2003)
Combinatorial Discovery of Tumor Targeting Peptides Using Phage
Display. J Cell Biochem. 90:509-517). This approach allows for
targeting of novel antigens in addition to known targets. Using as
a target the RIP1-Tag2 mouse model of multistage tumorigenesis
involving the pancreatic islets of Langerhans, allowed the
identification of several peptides that discriminate between the
vasculature of the premalignant angiogenic islets and the fully
developed tumours (Joyce, J. A., Laakkonen, P., Bernasconi, M.,
Bergers, G., Ruoslahti, E., Hanahan, D. (2003) Stage-specific
vascular markers revealed by phage display in a mouse model of
pancreatic islet tumorigenesis Cancer Cell 4:309-403). A similar
study isolated peptides selective for angiogenic progenitors and
solid tumours from the skin of a transgenic mouse model involving
the human papillomavirus type 16 oncogene (Hoffman, J. A., Giraudo,
E., Singh, M., Zhang, L., Inoue, M., Porkka, K., Hanahan, D.,
Ruoslahti, E. (2003) Progressive vascular changes in a transgenic
mouse model of squamous cell carcinoma Cancer Cell 4:383-391).
Peptides specific for human vasculature and human tissue have been
derived from peptide phage library selection on human tissue
transplanted into SCID mice (George, A. J. T., Lee, L., Pitzalis,
C. (2003) Isolating ligands specific for human vasculature using in
vivo phage selection Trends Biotech. 21:199-203).
[0063] By way of example, the targeting peptides that may be used
in accordance with the present invention include those disclosed in
our earlier application, WO2007/039728. These peptides include
peptides which comprise the amino acid sequence motif
RGDLX.sup.5X.sup.6X.sup.7, wherein X.sup.5, X.sup.6 and X.sup.7
independently represent any amino acid residue, and preferably
independently selected from Glu, Ala, Leu, Met, Gln, Lys, Arg, Val,
Ile, Trp, Phe, Asp, His and Thr. While the peptides disclosed in
WO2007/039728 generally comprise an alpha helical structure induced
by the amino acids following the RGD sequence, this is not a
requirement of the peptides of the present invention, in particular
as they are inserted into the CDR of a parent antibody and may not
therefore be able to adopt this secondary structural feature.
[0064] Preferred examples of peptides capable of binding to
.alpha.v.beta.6 integrin include peptides which comprise amino acid
sequences represented by the following general formulae, based on
the peptides disclosed in WO2007/039728:
. . . RGDLX.sup.5X.sup.6X.sup.7 . . .
[0065] wherein
[0066] X.sup.5 is selected from Glu, Ala or Gln;
[0067] X.sup.6 is selected from His, Val, Thr or Glu;
[0068] X.sup.7 is selected from Leu or Ile.
[0069] These peptide sequence above may be part of a longer
sequences, for example having one, two, three, four, five, ten or
more additional amino acids linked to the N- and/or C-terminus of
the peptide, while optionally conforming to the preferred ranges of
lengths of peptide sequence set out above. A particularly preferred
targeting peptide sequence has the amino acid sequence
AVPNLRGDLQVLAQKVA.
[0070] In some embodiments, the peptides may comprise an "alpha
helical structure" as disclosed in WO2007/039728, that is a
sequential group of amino acids in a peptide that interact with a
particular hydrogen bonding pattern and thus define a helical
structure. For example, the hydrogen bonding pattern in a standard
alpha helix is between the carbonyl oxygen of residue n and the
amide hydrogen of residue n+4. For the 3.sub.10-helix, this
hydrogen bonding pattern is between residues n and n+3 and for a
pi-helix it is between residues n and n+5. The number of residues
per turn in each alpha-helix is 3.6, 3.0 and 4.4 for the standard
alpha-helix, 3.sub.10-helix and pi-helix respectively, see for
example WO95/00534.
Variants and Uses of the Antibodies
[0071] In one aspect, the antibodies of the present invention may
be linked to a detectable moiety. The term "detectable moiety"
relates to a group that, when located at the target site following
administration of the antibodies of the present to a patient, may
be detected, typically non-invasively from outside the body and the
site of the target located. Thus, the antibodies of the present
invention are useful in imaging and diagnosis. Detectable moiety
are entities that are detectable by imaging techniques such as
Magnetic Resonance Imaging (MRI), Magnetic Resonance Spectroscopy
(MRS), Single Photon Emission Computed Tomography (SPECT) and
Positron Emission Tomography (PET) and optical imaging. Preferably,
imaging moieties are stable, non-toxic entities that retain their
properties under in vitro and in vivo conditions. Examples of such
moieties include but are not limited to radioactive moieties, for
example radioactive isotopes. Suitable radioactive atoms include
technetium-99m or iodine-123 for scintigraphic studies. Other
readily detectable moieties include, for example, spin labels for
MRI such as iodine-123 again, iodine-131, indium-111, fluorine-18,
carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron
and optical moieties which include Cy5.5 and quantum dots.
[0072] Alternatively or additionally, the antibodies of the present
invention may be conjugated or linked to a therapeutically active
moiety, for example a moiety that is cytotoxic.
[0073] A further class of groups that can be incorporated into the
antibodies of the present invention are affinity tags that can be
introduced into the antibodies to enable them to be manipulated or
detected in one or more subsequent steps. A wide range of affinity
tags are known in the art suitable affinity tags include members of
specific binding pairs, antibodies and antigens, biotin which binds
to streptavidin and avidin, polyhistidine (e.g. hexa-His or tri-His
tags) or amino di- or tri-carboxylates which bind to metal ions
such as Ni.sup.2+ or Co.sup.2+, Flag or Glu epitopes which bind to
anti-Flag antibodies, S-tags which bind to streptavidin, calmodulin
binding peptide which binds to calmodulin in the presence of
Ca.sup.2+; ribonuclease S which binds to aporibonuclease S; and
c-Myc which recognises anti-c-Myc antibody. Examples of other
affinity tags that can be used in accordance with the present
invention will be apparent to those skilled in the art. Antibodies
including these affinity tags can be easily purified and
manipulated.
[0074] The term "therapeutically active moiety" encompasses a
moiety having beneficial, prophylactic and/or therapeutic
properties.
[0075] In one embodiment the therapeutically active moiety is a
cytotoxic chemotherapeutic agent. Cytotoxic chemotherapeutic agents
are well known in the art and include anti-cancer agents such
as:
[0076] Alkylating agents including nitrogen mustards such as
mechlorethamine (HN2), cyclophosphamide, ifosfamide, melphalan
(L-sarcolysin) and chlorambucil; 10 ethylenimines and
methylmelamines such as hexamethylmelamine, thiotepa; alkyl
sulphonates such as busulfan; nitrosoureas such as carmustine
(BCNU), lomustine (CCNLJ), semustine (methyl-CCN-U) and
streptozoein (streptozotocin); and triazenes such as decarbazine
(DTIC; dimethyltriazenoimidazolecarboxamide); Antimetabolites
including folic acid analogues such as methotrexate (amethopterin);
pyrimidine analogues such as fluorouracil (5-fluorouracil; 5-FU),
floxuridine (fluorodeoxyuridine; FUdR) and cytarabine (cytosine
arabinoside); and purine analogues and related inhibitors such as
mercaptopurine (6-mercaptopurine; 6-MP), thioguanine
(6-thioguanine; TG) and pentostatin (2'-deoxycofonnycin). Natural
Products including vinca alkaloids such as vinblastine (VLB) and
vincristine; epipodophyllotoxins such as etoposide and teniposide;
antibiotics such as dactinomycin (actinomycin D), daunorabicin
(daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin
(mithramycin) and mitomycin (mitomycin Q; enzymes such as
L-asparaginase; and biological response modifiers such as
interferon alphenomes. Miscellaneous agents including platinum
coordination complexes such as cisplatin (cis-DDP) and carboplatin;
anthracenedione such as mitoxantrone and antbracycline; substituted
urea such as hydroxyurea; methyl hydrazine derivative such as
procarbazine (N-methylhydrazine, MIH); and adrenocortical
suppressant such as mitotane (o, p'-DDD) and aminoglutethimide;
taxol and analogues/derivatives; and hormone agonists/antagonists
such as flutamide and tamoxifen.
[0077] Methods of conjugating antibodies to therapeutic agents are
well known in the art.
[0078] In further embodiments, the antibodies of the present
invention may be formulated using particle based delivery systems
such as nanoparticles and lipid-based vesicles such as liposomes or
other similar structures composed of lipids. Liposomes are a
spherical vesicles comprising a phospholipid bilayer that may be
used as agents to deliver materials such as drugs or genetic
material. Liposomes can be composed of naturally-derived
phospholipids with mixed lipid chains (egg
phosphatidylethanolamine) or of pure components like DOPE
(dioleolyiphosphatidylethanolamine). The synthesis and use of
liposomes is now well established in the art. Liposomes are
generally created by sonication of phospholipids in a suitable
medium such as water. Low shear rates create multilamellar
liposomes having multi-layered structures. Continued high-shear
sonication tends to form smaller unilamellar liposomes. Research
has also been able to enable liposomes to avoid detection by the
immune system, for examples by coating the liposomes with
polyethylene glycol (PEG). It is also possible to incorporate
species in liposomes, such as the peptides of the invention to help
to target them to a delivery site, e.g. in cells or in vivo.
[0079] The use of nanoparticles as delivery agents for materials
associated with or bound to the nanoparticles is known in the art.
Some types of nanoparticle comprises a core, often of metal and/or
semiconductor atoms, to which ligands of one or more different
types may be linked, including, for example, one or more of the
peptides of the present invention, see for example WO02/32404,
WO2005/10816 and WO2005/116226. Other types of nanoparticle may be
formed from materials such as liposomes. In some instances, the
nanoparticles may be derivatised or conjugated to other ligands may
be present to provide the nanoparticles with different properties
or functions. In some embodiments, the nanoparticles may be quantum
dots, that is nanocrystals of semiconducting materials which have
the striking chemical and physical properties that differ markedly
from those of the bulk solid (see Gleiter, Adv. Mater. 1992, 4,
474-481). Now that their quantum size effects are understood,
fundamental and applied research on these systems has become
increasingly popular. An interesting application is the use of
nanocrystals as luminescent labels for biological systems, see for
example Brucher et al, Science. 1998, 281, 2013-2016, Chan &
Nie, Science, 1998, 281, 2016-2018, Mattousi et al, J. Am. Chem.
Soc., 2000, 122, 12142-12150, and Alivisatos, Pure Appl. Chem.
2000, 72, 3-9. The quantum dots have several advantages over
conventional fluorescent dyes: quantum dots emit light at a variety
of precise wavelengths depending on their size and have long
luminescent lifetimes.
[0080] In a further embodiment, the cytotoxic moiety is a cytotoxic
peptide or polypeptide moiety by which we include any moiety which
leads to cell death.
[0081] Cytotoxic peptide and polypeptide moieties are well known in
the art and include, for example, ricin, abrin, Pseudomonas
exotoxin, RNase, tissue factor and the like.
[0082] The use of ricin as a cytotoxic agent is described in
Burrows & Thorpe, P.N.A.S. USA 90: 8996-9000, 1993,
incorporated herein by reference, and the use of tissue factor,
which leads to localised blood clotting and infarction of a tumour,
has been described by Ran et al., Cancer Res. 58: 4646-4653, 1998
and Huang et al., Science 275: 25 547-550, 1997. Tsai et al., Dis.
Colon Rectum 38: 1067-1074, 1995 describes the abrin A chain
conjugated to a monoclonal antibody and is incorporated herein by
reference. Other ribosome inactivating proteins are described as
cytotoxic agents in WO 96/06641. Pseudomonas exotoxin may also be
used as the cytotoxic polypeptide moiety (see, for example, Aiello
et al, P.N.A.S. USA 92: 10457-10461, 1995.
[0083] Certain cytokines, such as TNF.alpha. and IL-2, may also be
useful as cytotoxic and/or therapeutic agents.
[0084] Certain radioactive atoms may also be cytotoxic if delivered
in sufficient doses. Thus, the cytotoxic moiety may comprise a
radioactive atom which, in use, delivers a sufficient quantity of
radioactivity to the target site so as to be cytotoxic. Suitable
radioactive atoms include phosphorus-32, iodine-125, iodine-131,
indium-111, rhenium-186, rhenium-188 or yttrium-90, or any other
isotope which emits enough energy to destroy neighbouring cells,
organelles or nucleic acid. Preferably, the isotopes and density of
radioactive atoms in the antibody of the invention are such that a
dose of more than 4000 cGy, and more preferably at least 6000, 8000
or 10000 cGy, is delivered to the target site and, preferably, to
the cells at the target site and their organelles, particularly the
nucleus.
[0085] The radioactive atom may be attached to the binding moiety
in known ways. For example, EDTA or another chelating agent may be
attached to the binding moiety and used to attach .sup.111In or
.sup.90Y. Tyrosine residues may be labelled with .sup.125I or
.sup.131I.
[0086] In a further embodiment, the present invention provides a
polypeptide is linked to viral coat protein other than FMDV to
change the trophism of the virus for delivery of DNA encoding
therapeutic genes.
[0087] Alternatively, any of these systems can be incorporated into
a prodrug system. Such prodrug systems are well known in the art
and include ADEPT systems in which an antibody according to the
present invention is conjugated or conjugatable or fused to an
agent capable of converting a prodrug to a cytotoxic moiety is an
enzyme for use in antibody directed enzyme prodrug therapy.
[0088] In a further aspect, the present invention provides a
pharmaceutical composition comprising peptide and/or nucleic acid
and/or expression vector as defined above and a pharmaceutical
acceptable carrier.
[0089] The term "pharmaceutically acceptable carrier" generally
includes components, that are compatible with the peptide, nucleic
acid or vector and are not deleterious to the recipients thereof.
Typically, the carriers will be water or saline which will be
sterile and pyrogen free. However, other acceptable carriers may be
used. Typically, the pharmaceutical compositions o'r formulations
of the invention are for parenteral administration, more
particularly for intravenous administration.
[0090] In a further aspect, the present invention provides the use
of an antibody as described herein, or nucleic acid encoding the
antibody or a vector comprising the nucleic acid, for the
preparation of a medicament for the treatment of a condition
characterised by diseased cells which express the target, for
example a condition in which the cells overexpress the target
and/or display the target on the cell surface and/or which is
disease that is mediated by the target.
[0091] Examples of such conditions are provided below and include
cancer, for example by making use of the antigens expressed on the
surface of cancer cells. In some embodiments, the conditions
include .alpha.v.beta.6-mediated diseases or diseases in which
cells overexpress .alpha.v.beta.6, such as cancer, chronic
fibrosis, chronic obstructive pulmonary disease (COPD), lung
emphysemia or chronic wounding skin disease, such as epidermolysis
bullosa. As mentioned herein, these conditions also include the
treatment of wound healing and inflammation.
[0092] The medicament or pharmaceutical composition of the present
invention as defined above may usefully be administered to a
patient who is also administered other medicaments, as it will be
known to those skilled in the art. For example, in the case of
cancer, the medicament or pharmaceutical composition of the present
invention may be administered to a patient before, after or during
administration of the other anti-tumour agent(s), for example
before, after or during chemotherapy. Treatment with the antibody
after chemotherapy may be particularly useful in reducing or
preventing recurrence of the tumour or metastasis. For example, the
anti-tumour agent can be covalently linked directly or indirectly
(via liposomes/nanoparticles) to an antibody of the present
invention.
[0093] In a further aspect, the present invention provides a method
of imaging epithelial cells overexpressing .alpha.v.beta.6 in the
body of an individual, the method comprising administering to the
individual an effective amount of an antibody as defined herein.
The method is particularly useful for the imaging of chronic
fibrosis, chronic obstructive pulmonary disease (COPD), lung
emphysema, chronic wounding skin disease (e.g. epidermolysis
bullosa) or epithelial tumour cells. For example, the method of
imaging may include linking the targeting antibody to a fluorescent
probe and incorporate into a mouth-wash, chewing gum, spray or
other emolument such that the antibody-probe conjugate may be
visualised by its fluorescent tag.
Examples
[0094] The experimental examples set out below demonstrate that the
specificity of a parent antibody can be modified by inserting a
.alpha.v.beta.6 binding peptide sequence into the CDR of the parent
antibody. In the examples, the parent antibody is a single-chain Fv
antibody fragment (scFv), which consists of the variable heavy and
variable light chain regions tethered by a flexible linker that
retains the complete antibody's binding properties. By way of
example, the scFv may be based on a MFE-23 scFv, a scFv developed
by phage technology that binds with high affinity to the
carcinoembryonic antigen, CEA (14). CEA is a tumour selective
marker that is highly expressed on most gastrointestinal carcinomas
and on a number of breast, lung and ovarian carcinomas. Iodinated
MFE has been used in patients for imaging (15) and
radioimmunoguided surgery in colorectal cancer (16). MFE has also
shown promise for cancer therapy when used as a fusion protein with
carboxypeptidase G2 in antibody-directed enzyme prodrug therapy
(ADEPT)(17); (18).
[0095] In this embodiment of the present invention, a scFv against
.alpha.v.beta.6 was produced rationally by antibody engineering by
inserting the peptide binding motifs of the known .alpha.v.beta.6
peptide ligands, such as VP1 proteins, into the loop region of MFE.
The third complementarity-determining region (CRD3) of the variable
heavy chain (VH) of MFE provides the major site of interaction with
CEA, as assessed by mutagenesis, and accordingly was chosen as a
preferred site for such an insertion.
[0096] In the experiments set out below, the insertion of an
.alpha.v.beta.6-binding peptide of VP1 from the FMDV strain O.sub.1
BFS into the CRD3 loop of the VH domain of MFE is described. A
17-mer peptide and a 20-mer peptide corresponding to this region of
VP1 have previously been shown to be potent inhibitors of FMDV
binding to purified .alpha.v.beta.6 and .alpha.v.beta.6-expressing
cells (24) and of .beta.6-transfected fibroblast cells to LAP (25),
respectively. The addition of a 17-mer peptide of VP1, equivalent
in sequence to the inhibitory peptides, to MFE changed binding
specificity of the scFv from CEA to .alpha.v.beta.6, as shown by
ELISA, cell-binding and inhibition in a migration assay. Additional
mutation of Y.sub.100b to P.sub.100b of the VH domain as in NFEVP1
eliminated all remaining residual binding to CEA.
Materials and Methods
3D Protein Visualisation
[0097] The X-ray structure of MFE (pdb code 1QOK) (26) was
visualised in Insight II (Accelrys) on a Silicon Graphics
workstation.
Antibodies
[0098] Murine monoclonal antibodies to .alpha.v.beta.3 (LM609),
.alpha.v.beta.6 (10D5) and .alpha.5.beta.1 (P1D6) were purchased
from Chemicon International, Harrow, UK whereas those to
.alpha.v.beta.5 (P1F6) and .alpha.v.beta.8 (14E5) were generous
gifts from Drs. Dean Sheppard and Steve Nishimura (UCSF),
respectively. The secondary antibody was Alexafluor-488 conjugated
rabbit anti-mouse antisera (Molecular Probes) unless otherwise
stated.
Construction of Plasmids for Expression in E. coli
Construction of MFE-RGD and MFE-RGE Plasmid, MFE-RGD/pUC119 and
MFE-RGE/pUC119
[0099] MFE-RGD and MFE23-RGE were constructed by site-directed
mutagenesis using the MFE-RGD forward
(5'_CTACTGCAACGAAGGGACAGCTAGAGGTGATTTGGCTACTTTGTTCGACTACTGGG
GACAAG.sub.--3') and MFE-RGD reverse
(5'_CTTGTCCCCAGTAGTCGAACAAAGTAGCCAAATCACCTCTAGCTGTCCCTTCGTTG
CAGTAG.sub.--3') primers or MFE-RGE forward
(5'_GAAGGGACAGCTAGAGGTGAATTGGCTACTTTGTTCGACTACTG.sub.--3') and
MFE-RGE reverse
(5'_CAGTAGTCGAACAAAGTAGCCAATTCACCTCTAGCTGTCCCTTC.sub.--3')
respectively. The PCR reactions used the phMFEhis.sub.--119 plasmid
as template, which incorporated the humanised form of MFE-23 (hMFE)
and a C-terminal 6.times.His tag enabling purification by
Immobilised Metal Ion Affinity Chromatography (LMAC).
Construction of MFE and HFE MFE VH CDR3 Loop Variant Plasmid,
MFEVP1/pUC119 and HFEVP1/pUC119
[0100] MFEVP1 and HFEVP1, which contain the MFE of HFE sequences
respectively, and a 17-mer .alpha.v.beta.6-binding peptide of VP1
in the CRD3 loop of the heavy chain (FIG. 1), were constructed from
three PCR reactions. First, the 5'end were constructed with the VH
MFEVP1 (5' CATGCCATGGCCCAGGTGAAACTG) or VH HFEVP1 (5'
CATGCCATGGCCCAAGTTAAACTGGAACAG TCC) sense primers and the MFEVP1
(5'GCGCCAGCACCTGCAGATCACCTCGCAGATTCGGAACTGCAGTCGGAGTCCCCTCAT TAC)
or HFEVP1
(5'GAGCCAGCACCTGCAGATCACCTCGCAGATTCGGAACTGCAGTTGGTGTCCCTTCGT TGC)
anti-sense primers, respectively, that contained parts of the
additional peptides of the .alpha.v.beta.6-binding motif of VP1
(shown underlined in the primes). Second, the 3'ends were
constructed with the VL MFEVP1 (5' ATAGTTTAGCGGCCGCCCGTTTCAGCTC) or
VL HFEVP1 (5' ATAGTTTAGCGGCCGCAGCCTTGATTTC) anti-sense primers and
the MFEVP1
(5'CTGCGAGGTGATCTGCAGGTGCTGGCGCAGAAAGTTGCAGGGCCGTACTACTTTGAC TACTG)
or HFEVP1
(5'CTGCGAGGTGATCTGCAGGTGCTGGCTCAGAAAGTTGCAGGTCCTTACCCTTTCGAC
TACTGGGGACAAGG) sense primers, respectively which contain part of
the additional .alpha.v.beta.6-binding motif and in the case of
HFEVP1 also introduced the Y100b to P100b mutation (shown bold and
underlined in the primer; amino acid numbering is given with the
Rabat nomenclature). The PCR reactions for MFEVP1 used the
MFE/puc119 as template and those for HFEVP1 the HFE/pCTCON plasmid
(27) as templates. Third, the PCR products from the first two
reactions, were used as templates and amplified with the VH MFEVP1
sense and VL MFEVP1 anti-sense or VH NFEVP1 sense and VL HFECP1
anti-sense primers to give the PCR product for MFEVP1 or HFEVP1
respectively. The VH sense and VL anti-sense primers introduced
NcoI and NotI sites (shown in bold and underlined in the primers)
into the PCR products, respectively. Thus, the third PCR products
and the puC119 plasmid were treated with these restriction enzymes
and ligated to yield either MFEVP1/pUC119 or HFEVP1 plasmids.
Correctness of the DNA sequences was verified by DNA
sequencing.
Introduction of the VH-Y.sub.100b to VH-P.sub.100b Mutation in
MFEVP1 Plasmid
[0101] The Y.sub.100b to P.sub.100b mutations of the VH domain of
the MFEVP1 was introduced by site-directed mutagenesis. The Pro
mutation was introduced in MFEVP1/pUC119 with
5'GTTGCAGGGCCGTACCCGTTTGACTACTGGGGC 3' as the sense and
5'GCCCCAGTAGTCAAACGGGTACGGCCCTGCAAC 3' as the anti-sense primers to
give NFEVP1/pUC119 (the Pro nucleotide sequence is shown in bold).
DNA sequencing verified these Pro mutations.
Construction of NFEVP1/pICZ.alpha.BHis and
HFEVP1/pCIZ.alpha.BCysHis Plasmid for Expression in Yeast
[0102] The NFEVP1/pUC119 and HFEVP1/pUC119 plasmid were digested
with SfiI and NotI and cloned into an equally digested
pICZ.alpha.BHis or pPICZ.alpha.BCysHis vectors respectively, for
expression in yeast. The modified pICZ.alpha.BHis and
pICZ.alpha.BCysHis vectors, when compared to the original
pPICZ.alpha.B vector (Invitrogen, Karlsruhe, Germany), do not
contain the myc-tag but the His tag is present. The
pPICZ.alpha.BCysHis vector in addition contains a Cys immediately
before the six His residues.
Expression and Purification of MFE-RGD and MFE-RGE in E. coli
[0103] The MFE-RGD/pUC119 and MFE-RGE/pUC119 plasmids were
electroporated into competent E. coli TG1 cells and grown on
2.times.YT, containing ampicillin (100 .mu.g/ml) and 1% glucose
plates at 37.degree. C. Single colonies were used to inoculate 10
ml of 2.times.YT, containing ampicillin (as above) and 1% glucose
media and after 1:500 dilution were grown in 50 ml of 2.times.YT,
ampicillin (as above) and 0.1% glucose at 37.degree. C. until the
OD.sub.600nm was 0.9. Protein expression and secretion into the
media was induced by addition of 1 mM
isopropyl-.beta.-D-thiogalactoside (IPTG, Sigma) and grown at
30.degree. C. O/N. The supernatant was separated from the cells by
centrifugation at 4,000 rpm for 20 min.
Purification by Qiagen Ni-NTA.
[0104] MFE-RGD and MFE-RGE proteins were purified under native
conditions from bacterial supernatant using the Qiagen Ni-NTA Spin
Column kit broadly according to the manufacturer's instructions.
Briefly, a spin column holding a nickel-containing resin was
equilibrated with "Lysis Buffer" (see below) before supernatant
containing the 6.times.His-tagged protein was spun through and the
column washed to remove non-specifically bound material. During
this procedure exposed his-tags bind to the nickel resin, and are
therefore retained specifically in the column. His-tagged proteins
were then eluted by two spins with an imidazole buffer. The
manufacturer's instructions were followed with amendments as
follows: bacterial supernatant was loaded directly onto the
equilibrated column (thereby avoiding the lysis steps) and this
step repeated until approximately 4.8 ml bacterial supernatant had
passed through each column. Buffer recipes were altered as follows:
"Lysis Buffer": PBS, 300 mM sodium chloride; "Wash Buffer": PBS,
300 mM sodium chloride, 20 mM imidazole; "Elution Buffer": PBS, 300
mM sodium chloride, 250 mM imidazole. Bound protein was eluted with
2.times.200 .mu.l Elution Buffer and the two fractions dialysed
separately against PBS using Slide-a-lyser dialysis cassettes
(Perbio Science UK Ltd, Cramlington, UK) according to the
manufacturer's instructions. Dialysed protein was removed from the
Slide-a-lyser and stored at -80.degree. C.
Purification by Streamline
[0105] Hundred fifty ml of clarified supernatant was dialysed
against three changes of PBS and NaCl was added to a final
concentration of 1M. The proteins were purified by Streamline.TM.
Chelating (Amersham Biosciences). The matrix was charged with 5
volumes Of 0.1M CuSO.sub.4 for 5 min, excess CuSO.sub.4 was washed
off with 5 volumes of dH.sub.2O and equilibrated with 10 volumes of
binding buffer (PBS/1M NaCl). The dialysed supernatant was mixed
with the 1.5 ml of charged matrix and poured into a small column.
Non-specific bound proteins were washed off the column with PBS/1M
NaCl followed by 40 mM Imidazole/PBS/1M NaCl. The proteins were
eluted with 200 mM Imidazole/PBS/1M NaCl. The matrix was then
washed with 5 volumes of 0.1M EDTA. Each washing and elution step
was done with 4.5 ml volumes. Fractions of interest were pooled and
dialyzed against PBS. Protein yields in the 200 mM imidazole
fraction measured after dialysis were as follows: hMFE, 0.181
mg/ml, hMFE23-RGD, 0.101 mg/ml and hMFE23-RGE, 0.108 mg/ml.
Washing, eluted and dialysed samples revealed by Western Blotting
are shown in FIG. 9 A-C.
Expression and Purification of MFEVP1 and NFEVP1 in E. coli
[0106] The MFEVP1/pUC119 and NFEVP1/pUC119 plasmids were
electroporated into competent E. coli TG1 cells and grown on
2.times.YT, containing ampicillin (50 .mu.g/ml) and 1% glucose
plates at 37.degree. C. Single colonies were used to inoculate 5 ml
of 2.times.YT, containing ampicillin (as above) and 1% glucose
media and after 1:500 dilution were grown in 2.times.500 ml of
2.times.YT, ampicillin (as above) and 0.05% glucose at 37.degree.
C. until the OD.sub.600nm was 0.9. Protein expression and secretion
into the media was induced by addition of 1 mM
isopropyl-.beta.-D-thiogalactoside (IPTG, Sigma) and grown at
30.degree. C. O/N. The supernatant was separated from the cells by
centrifugation at 16,000 g for 25 min and was further clarified by
filtration through 0.2 .mu.m membranes (Nalgene) and subsequently
dialysed three times against PBS.
[0107] Purification of MFEVP1 and NFEVP1 was by immobilized
metal-affinity chromatography (IMAC). Ten ml of Cu-charged
Streamline.TM. chelating resin (GE Healthcare) were incubated with
the supernatant, after addition of 1M NaCl, at RT for 1 h. The
resin was collected, washed with 1M NaCl/PBS, 40 mM imidazole and
bound proteins were eluted with 200 mM imidazole. The 200 mM
imidazole protein containing fractions were dialysed against TBS,
concentrated by an Amicon stirred cell with a YM3 membrane
(Millipore) and further purified by size-exclusion chromatography.
Size-exclusion chromatography was performed on Superdex75 column in
Tris buffered saline, pH 7.5 (TBS) at 1.5 ml/min. MFEVP1 and NFEVP1
eluted as two peaks, representing the monomeric (67 ml) and dimeric
(56 ml) forms. Their molecular weights were estimated from
molecular weight standards, Ovalbumin (44 kDa), Carbonic Anhydrase
(29 kDa), and Myoglobin (17 kDa) and the monomeric and dimeric
forms of MFE.
Expression and Purification of NFEVP1 and HFEVP1 in P. pastoris
[0108] For expression of NFEVP1 and HFEVP1 in P. pastoris the
NFEVP1/pPICZ.alpha.BHis and HFEVP1/pICZ.alpha.BCysHis plasmids,
respectively, were linearized with PmeI and transformed into
electrocompetent X33 cells (Invitrogen) by electroporation.
Transformants were grown on YPDS/100 .mu.g/ml Zeocin (Invitrogen,
Karlsruhe, Germany) plates. Single colonies were screened for
protein expression and for inserts by PCR with the 5'AOX and 3'AOX
primers. The colony with highest protein expression was stored in
20% glycerol at -80.degree. C. NFEVP1 and HFEVP1 were produced by
fermentation and initial purification involved expanded bed
adsorption immobilized metal affinity chromatography (EBA-IMAC),
which also concentrates the proteins, following previously
described procedures. (22;23) The 200 mM imidazole EBA-IMAC eluate
fraction, containing either NFEVP1 or HFEVP1, were dialysed into
PBS. To the concentrate 1M NaCl was added and this was applied to a
Ni2+ charged HiTrap Chelating HP 1 ml affinity column (GE
Healthcare) for further concentration. Elution in 1 ml fractions
was by 500 mM imidazole/1M NaCl/PBS. The diabody containing eluate
(2 ml) was further purified by size-exclusion chromatography on a
Superdex 75 column in PBS, with a flow rate of 1.5 ml/min.
SDS-Polyacrylamide Gel Electrophoresis (PAGE) and Western Blot
Analysis
[0109] Proteins were analysed by SDS/PAGE using Tris/Glycine Gels
(Invitrogen) and stained with Coomassie brilliant blue.
Western Blot Analysis
[0110] Proteins separated by SDS-PAGE were transferred to a PVDF
membrane (Bio-Rad) at 125 mA for 90 min. For detection with
specific antibodies, the membrane was blocked with 5% milk proteins
(Marvel)/PBS for 2-16 h at RT. Detection was performed by
incubation with mouse anti-His4 (1:1000 dilution) followed by
incubation with HRP-conjugated sheep anti-mouse IgG (1:1000
dilution, GEHealthcare). Both antibodies were diluted in 1% milk
proteins/PBS (w/v) and incubation was for 1 h at RT. Final staining
was achieved by incubation with 0.25 mg/ml 3,3'-diaminobenzidine
(DAB, Sigma) with H.sub.2O.sub.2 (1/2000). Washing steps consisted
of five washes with 0.1% Tween 20/PBS (v/v) followed by three PBS
washes.
Binding of MFE CDR3 VH Loop Variants and Anti-.alpha.v Antibody to
Immobilized .alpha.v.beta.6 and .alpha.v.beta.3 by ELISA
[0111] Ninety-six-well plates (Nunc-Immuno.TM. Plates, Maxi Sorp,
Nalge Nunc International) were coated with 100 .mu.l/well of 1
.mu.g/ml of .alpha.v.beta.6 or 3 .mu.g/ml of .alpha.v.beta.3
(Chemicon International, Harrow, UK) in Tris buffered saline (TBS),
pH 7.5 at RT for 1 h or TBS as a control. The plate was washed 2
times with 0.1% Tween 20 in TBS followed by 8 washes with TBS, and
150 .mu.l/well of 5% Marvel in TBS was added for 1 h at RT to block
non-specific binding. The plate was washed as above but the TBS
solutions contained 1 mM MgCl.sub.2, 1 mM MnCl.sub.2 and 1 mM
CaCl.sub.2 (TBSM), and dilutions of MFE, MFEVP1, NFEVP1 and HFEVP1
and mouse anti-.alpha.v (1:1000, Chemicon International, Harrow,
UK) in 1% Marvel in TBSM were added (100 .mu.l/well). The plate was
incubated for 1 h at RT, washed, and incubated for 1 h with 100
.mu.l/well of rabbit anti-MFE and with anti-.alpha.v for mouse
anti-.alpha.v wells (1:1000), washed and incubated for 1 h with 100
.mu.l/well of HRP-conjugated goat anti-rabbit IgG (Sigma, 1:1000
dilution) and with sheep HRP-labelled anti-mouse IgG (GE
Healthcare, 1:1000 dilution) for anti-.alpha.v wells. Bound samples
were detected by applying 100 .mu.l of the substrate
o-phenylenediamine dihydrochloride (OPD, Sigma) in citrate buffer
pH 5.0; the reaction was stopped with 100 .mu.l of 4M HCl and the
absorbance read at 490 nm on a Dynex Technologies Plate Reader. In
experiments testing the metal dependence of MFE CDR3 loop variants
binding, the diluent was TBS containing 10 mM EDTA (pH 7.5) and all
washing steps included 10 mM EDTA.
Binding of MFE CDR3 VH Loop Variants and hMFE23-RGD, hMFE23-RGE and
hMFE to Immobilized CEA by ELISA
[0112] Ninety-six-well plates (as under Binding of MFE CDR3 VH loop
variants to immobilized .alpha.v.beta.6, by ELISA) were coated with
100 .mu.l/well of CEA at 1 .mu.g/ml in PBS or PBS as a control,
washed with twice with PBS on an automatic plate washer (Thermo
Labsystems) and blocked with 5% Marvel in PBS. MFEVP1, NFEVP1, MFE,
hMFE23-RGD, hMFE23-RGE and hMFE were diluted in 1% Marvel in PBS
and 100 .mu.l added to the wells in triplicate, washed as above,
incubated with rabbit anti-MFE (1:1000 dilution) for MFEVP1,
NFEVP1, MFE and with mouse anti-His4 (1:1000 dilution, Qiagen Ltd.)
for hMFE23-RGD, hMFE23-RGE and hMFE washed once with 0.1% Tween
20/PBS and four times with H.sub.2O, and incubated with
HRP-conjugated goat anti-rabbit IgG (1:1000 dilution) for MFEVP1,
NFEVP1, MFE and with HRP-conjugated sheep anti-mouse IgG (1:1000
dilution, GE Healthcare) for hMFE23-RGD, hMFE23-RGE and hMFE. After
washing as above with 0.1% Tween-20/PBS and H.sub.2O binding was
detected with OPD and absorbance read at 490 nm (as under Binding
of MFE CDR3 VH loop variants to immobilized .alpha.v.beta.6 and
.alpha.v.beta.3 by ELISA).
Flow Cytometric Analysis of MFE and MFE Loop Variants' Binding to
LS-174T Cells
[0113] LS-174T cells were washed twice with PBS and detached with
trypsin/EDTA (Cambrex). On average 5.times.10.sup.5 cells were
incubated with 50 .mu.g/ml of MFEVP1, NFEVP1 and MFE and washed
with PBS. Detection of binding was first by incubation with rabbit
anti-MFE IgG (1:100 dilution), washing with PBS and second by
incubation with 1 .mu.g of R-Phycoerythrin (R-PE)-conjugated goat
anti-rabbit IgG (Invitrogen, Karlsruhe, Germany) followed by
washing with PBS. All incubation steps were carried out for 60 min
at 4.degree. C. in 100 .mu.l PBS containing 0.1% (w/v) Bovine Serum
Albumin (BSA) and 0.1% (w/v) sodium azide. In control experiments
the rabbit anti-MFE IgG was omitted. Cells were fixed (IntraStain
kit, DakoCytomation) and analysed by flow cytometry on a
FACSCalibur.TM. cytometer (Becton Dickinson, Oxford, UK).
Flow Cytometric Analysis of MFEVP1 and MFE Binding to the
.alpha.v.beta.6 Expressing Cell Line, A375P.beta.6 and the Parent
Cell Line, A375Ppuro
[0114] A375P.beta.6 and A375Ppuro cells (generated as described
previously(25)) were washed once in Dulbecco's modified Eagle's
medium (DMEM) supplemented with 0.1% (w/v) Bovine Serum Albumin
(BSA) and 0.10 (w/v) sodium azide (DMEM 0.1/0.1) and re-suspended
in an appropriate volume. 50 .mu.l of this suspension containing
approximately 2.times.10.sup.5 cells was transferred to individual
wells of V-bottomed 96-well plates and mixed with 50 .mu.l of
MFEVP1, MFE and 10D5 (Chemicon International, Harrow, UK) at
various concentrations. After incubation at 4.degree. C. for 60
minutes, cells were washed two times with 150 .mu.l DMEM 0.1/0.1.
Cells were re-suspended in 50 .mu.l mouse Tetra-His antibody
(Qiagen, Crawley, UK) diluted 1:100 in DMEM 0.1/0.1 and incubated
for a further 35 minutes at 4.degree. C. Cells were then washed
twice with 150 .mu.l DMEM 0.1/0.1 as above. Alexa-488-conjugated
goat anti-mouse (1:200 dilution in DMEM 0.1/0.1; Molecular Probes)
was then added and cells incubated for a further thirty minutes at
4.degree. C. Cells were washed three times as above and transferred
to 5 ml centrifuge tubes (BD Falcon 352054, supplied by VWR, UK).
Cells were analysed on an LSR-1 FACS flow cytometer (Becton
Dickinson, Oxford, UK) using CellQuest software.
Flow Cytometric Analysis of Anti-.alpha.v.beta.6,
Anti-.alpha.v.beta.8, Anti-.alpha.v.beta.5, Anti-.alpha.v.beta.3
and .alpha.v.beta.1 Binding to the .alpha.v.beta.6 Expressing Cell
Line, A375P.beta.6 and the Parent Cell Line, A375Ppuro.
[0115] Flow cytometric analysis of RGD-directed integrin
expression--A375Ppuro and A375P.beta.6puro cells were detached with
trypsin/EDTA, resuspended in DMEM 0.1/0.1 to 210.sup.5 cells/50
.mu.l and mixed with 50 .mu.l of anti-integrin antibodies (at 10
.mu.g/ml). After 45 minutes at 4.degree. C. the cells were washed
twice with DMEM 0.1/0.1 and bound antibodies detected with 50 .mu.l
of 1:200 dilutions of Alexafluor-488 conjugated anti-mouse
antibodies for 30 minutes at 4.degree. C. After two washed samples
were analysed by flow cytometry as above. Negative controls
received similar concentrations of mouse IgG (Dako).
Immunofluorescence Confocal Microscopy of Internalisation of
NFEVP1.
[0116] A375416 and A375Ppuro cells were trypsinized, re-suspended
in DMEM, containing L-glutamine, supplemented with 10%
heat-inactivated fetal bovine serum. Cells
(.about.2.times.10.sup.5) were seeded in 2 ml of the above media in
24=.sup.2 dishes containing glass coverslips and allowed to attach
for 48 hrs at 37.degree. C. The media was removed and exchanged
with DMEM containing 1% heat-inactivated fetal bovine serum and 50
.mu.g/mL of NFEVP1 and either directly incubated at 10 min, 30 min,
1 hr and 3 hr at 37.degree. C. or first pre-incubated at 4.degree.
C. for 1 hr, upon which the scFv was removed, and the cells were
shifted to 37.degree. C. After incubation cells on the coverslips
were washed with PBS, containing 2 mM Ca.sup.2+ and 1 mM Mg.sup.2+,
fixed in 4% paraformaldehyde/PBS for 20 min on ice, washed with PBS
and incubated with 10 mM ammonium chloride for 10 min at RT,
washed, permeabilized with 0.1% Triton X-100 for 5 min on ice,
washed and blocked with 3% (w/v) BSA/PBS for 20 min at RT. Cells
were washed, and stained with 10 .mu.g/mL Affini Pure Rabbit
anti-mouse IgG (H+L, Jackson Immune Research) in 1% (w/v) BSA/PBS,
washed and stained with 10 .mu.g/mL Alexa Fluor 546.RTM. labelled
Goat anti-rabbit IgG (H+L, Molecular Probes, Invitrogen),
containing Hoechst trihydrochloride (1:5000) in 1% (w/v) BSA/PBS,
washed three times with PBS and one time with H.sub.2O. All washes
were three times with PBS if not indicated otherwise. Coverslips
were mounted on slides using ProLong Gold antifade (Molecular
Probes, Invitrogen). Cells were visualized with a Olympus.RTM.
confocal scanning microscope (Olympus, London, UK).
Migration Assays
[0117] Haptotactic cell migration assays were performed using
matrix coated polycarbonate filters (8 .mu.m pore size,
Transwell.RTM., Becton Dickinson, Oxford, UK). The membrane
undersurface was coated with LAP (0.5 .mu.g/ml) in .alpha.-MEM for
1 hour at 37.degree. C. and blocked with migration buffer (0.1% BSA
in .alpha.-MEM) for 30 minutes at 37.degree. C. For blocking
experiments, cells were incubated with MFEVP1, NFEVP1 and 10D5
antibody (at 10 .mu.g/ml, Chemicon International, Harrow, UK) for
60 minutes at 4.degree. C. prior to seeding. The lower chamber was
filled with 500 .mu.l of migration buffer, following which cells
were plated in the upper chamber of quadruplicate wells, at a
density of 5.times.10.sup.4 in 50 .mu.l of migration buffer and
incubated at 37.degree. C. for 20 hours. Following incubation, the
cells in the lower chamber (including those attached to the
undersurface of the membrane) were trypsinised and counted on a
Casy 1 counter (Sharfe System GmbH, Germany).
Fourier-Transform Infrared (FT-IR) Spectroscopy of NFEVP1 and
MFE
[0118] FT-IR spectra were recorded using a Perkin-Elmer1750 FT-IR
spectrometer equipped with a fast recovery TGS type detector.
NFEVP1 at 0.47 mg/ml, MFE at 0.59 mg/ml and PBS control were
dialysed with three buffer changes at 4.degree. C. into 20 mM
Phosphate buffer, pH7.5 and subsequently lyophilized. NFEVP1 and
MFE were dissolved in .sup.2H.sub.2O to a final concentration of 10
mg/ml and control at an equivalent volume. Eight .mu.l of each
protein and control were placed into the 6 .mu.m recess on one of
the two specialists-made CaF.sub.2 windows (Feinoptische Werkstatt,
Berlin, Germany) that was mounted inside a Beckman FH-01 CFT
micro-cell. For denaturation experiments the cell was exposed to
temperatures from 25.degree. C. to 85.degree. C. in steps of
2-5.degree. C. using an attached waterbath. Before each spectrum
acquisition samples were maintained at the desired temperature in
order to stabilize the temperature inside the cell (10 min). A
total of 200 scans were acquired at each temperature for the
denaturation measurements, whereas for comparison of NFEVP1 and MFE
secondary structural elements 1000 scans were acquired at
30.degree. C. each. The absorbance spectra were first subtracted by
their respective buffer control followed by calculation of the
second derivative spectra using a 13 data point Savitsky-Golay
smoothing function.
Inhibition of Cell Adhesion
[0119] The ability of modified and unmodified scFv antibodies to
inhibit the .alpha.v.beta.6-specific adhesion of
[.sup.51Cr]-labelled 3T3.beta.6.19 fibroblast cells to LAP was
performed as described previously(31).
Results
[0120] Construction, expression in E. coli and purification of scFv
MFE VH loop variants, hMFE23-RGD (also known as hMFE-RGD) and
hMFE23-RGE (also known as hMFE-RGE) and binding of hMFE23-RGD and
hMFE23-RGE to CEA and .alpha.v.beta.6.
[0121] The MFE antibody has no .alpha.v.beta.6-binding capability.
Initial attempts to confer affinity for .alpha.v.beta.6 using
site-directed mutagenesis to delete the CDR 3 loop residues 123-128
of the VH chain of MFE, which are known to be critical for CEA
binding (Boehm et al., 2000b), and replace them with the peptide
sequence RGDLATL, an RXDLXXL motif based on the sequence of
TGF.beta.1 Latency Associated Peptide (LAP), failed. In addition,
it was decided to insert one alanine residue prior to the RGD, as
bioinformatic modeling suggested that this might improve the
presentation of the motif by increasing its solvent accessibility.
As the aspartate residue is critical to integrin binding
(Humphries, 1990), an ARGELATL recombinant was also constructed as
a control. The proteins were expressed in E. coli and secreted into
the supernatant. Proteins were purified from the bacterial
supernatants using Nickel spin columns and visualised by SDS-PAGE
followed by Western blotting and detection with an anti-4.times.His
monoclonal antibody (FIG. 9).
[0122] The parent scFv, MFE, binds to CEA so it was important to
establish whether hMFE23-RGD and hMFE23-RGE would remain some of
this binding activity. Results showed that hMFE23-RGD and
hMFE23-RGE showed some residual binding to immobilised CEA (FIG.
10). The ability of hMFE23-RGD and hMFE23-RGE to bind
.alpha.v.beta.6 was then investigated. Results showed that both
hMFE23-RGD or hMFE23-RGE failed to show any measurable binding to
immobilised .alpha.v.beta.6. Although there was a high level of
background, the hMFE23-RGD gave no signal over and above that of
the negative control hMFE23 (FIG. 11).
Construction, Expression in E. coli and the Yeast, P. Pastoris, and
Purification of scFv MFE VH Loop Variants, MFEVP1, NFEVP1 and
shMFE(P)CDR2VP1
[0123] For construction of a .alpha.v.beta.6-binding MFE the
peptide sequence from A.sub.140 to A.sub.156 of the viral coat
protein VP1 of the Foot-and-Mouth disease virus (FMDV) was inserted
at the tip of the CDR3 loop of the VH chain of MFE, between T98 and
G99 (using Kabat nomenclature as shown in FIG. 1). This VH loop
variant of MFE was named MFEVP1. The DNA sequence of MFEVP1 was
generated by overlapping PCR as described in Material and Methods.
The protein was expressed in E. coli and secreted into the
supernatant at comparable levels and similar size to the parent
molecule, MFE. Initial purification and concentration of the
protein was obtained by IMAC chromatography. The protein was
further purified by size-exclusion chromatography (FIG. 2a). MFEVP1
eluted as two distinct peaks, 56 ml and 67 ml, representing the
dimeric and monomeric forms, respectively. A further scFv MFE loop
variant, NFEVP1, containing the .alpha.v.beta.6-binding sequence of
VP1 and a Y.sub.100b to P.sub.100b mutation in the VH domain was
constructed (see FIG. 1a) from MFEVP1 by site-directed mutagenesis.
Expression and purification in E. coli of this protein was similar
to MFEVP1. The DNA sequence of NFEVP1 was also cloned into a yeast
vector for expression in P. pastoris. NFEVP1 was obtained at 56
mg/L after initial EDB-IMAC chromatography, using previously
described procedures. (22, 23). NFEVP1 was concentrated and final
purification was by size-exclusion chromatography (FIG. 2b). The
chromatographic profile of the yeast expressed protein was
virtually super imposable to that obtained from E. coli.
[0124] A further MFE VH loop variant, shMFE(P)CDR2VP1, was
constructed by inserting the A.sub.140-A.sub.156 VP1 peptide
between the DNA sequences of VH CDR2 residues E53 and N54 of the
shMFE.sup.2 sequence (which contains the Y.sub.100bP mutation).
This DNA sequence was cloned into a yeast vector and expressed in
P. pastoris. The expressed protein was analysed by SDS-PAGE and
Western blotting, which showed that the protein was stably
expressed in yeast.
Binding of MFEVP1 and NFEVP1 to .alpha.v.beta.6 and Inhibition of
Migration
[0125] The ability of pure monomeric forms of MFEVP1 and NFEVP1 to
bind to .alpha.v.beta.6 was investigated. MFEVP1 showed
concentration dependent binding to .alpha.v.beta.6 immobilized
plates in ELISA when probed with anti-MFE followed by anti-rabbit
labelled HRP IgG (FIG. 3a). In contrast, the absorbance reading for
parent MFE, tested under identical conditions, was similar to
background levels. In agreement with metal dependent
integrin-ligand binding MFEVP1 did not bind in the presence of EDTA
(data not shown).
[0126] MFEVP's ability to bind to .alpha.v.beta.6 when expressed on
cells was also investigated. MFEVP1 showed concentration dependent
binding to .beta.6-transfected A375P.beta.6 cells (a retrovirally
with .beta.6 cDNA transfected melanoma cell line(25)) by Flow
Cytometry when monitored with mouse anti-His followed by
Alexa488-conjugated anti-mouse Fc (FIG. 3b). Observed fluorescence
shifts were similar for the 5 .mu.g/ml and 0.5 .mu.l/ml
concentrations, indicating that MFEVP1 reached almost saturation
levels of binding at 0.5 .mu.g/ml. The .alpha.v.beta.6-specific
antibody, 10D5, was included as a positive control whereas MFE, the
negative control, was not shifted beyond background levels. Neither
10D5, MFEVP1 nor MFE showed binding to the non-transfected parent
cell, A375Ppuro (transfected with empty vector), confirming that
the observed binding of MFEVP1 to the .beta.6-transfected cell line
was specifically to .alpha.v.beta.6.
[0127] The VP1-inserted scFvs' ability to functionally inhibit
migration of .alpha.v.beta.6-expressing cells was investigated
next. VB6 cells, a well characterised retrovirally with .beta.6
cDNA transfected oral SCC cell line(27), were allowed to migrate
towards the .alpha.v.beta.6-specifically binding ligand, LAP, which
is coated underneath a Transwell filter. Addition of 50 .mu.g/ml of
MFEVP1 and the Y.sub.100b to P.sub.100b mutant, NFEVP1, to VB6
cells considerably inhibited their migration when compared to MFE
(FIG. 3c). The function blocking .alpha.v.beta.6-specific 10D5
antibody added at 10 .mu.g/ml showed similar levels of inhibition
of cell migration of VB6 cells as the scFvs. The inhibition of
migration was concentration dependent as shown for MFEVP1 (FIG.
3d).
Investigation of Binding of scFv MFE VH Loop Variants to Integrins
Other than .alpha.v.beta.6
[0128] Cross reactivity of MFEVP1 and NFEVP1 with integrins other
than .alpha.v.beta.6 was first investigated by ELISA, using
immobilized .alpha.v.beta.3 and .alpha.v.beta.6, and by cell
binding studies using cells expressing a variety of integrins.
Results showed that MFEVP1 and NFEVP1 did not bind to immobilized
.alpha.v.beta.3 in ELISA when probed with rabbit anti-MFE followed
by HRP-labelled anti-rabbit IgG (FIG. 4a) whereas binding to
.alpha.v.beta.6 was observed. Immobilization of both integrins to
the wells was confirmed with an anti-.alpha.v antibody. Selectivity
of MFEVP1 and NFEVP1 for .alpha.v.beta.6 was also in agreement with
the cell binding studies described under "Binding of scFv MFE VH
loop variants to .alpha.v.beta.6 and inhibition of migration"
(shown in FIG. 3b). Because both scFvs did not bind to the
non-transfected A375Ppuro cell line, which express .alpha.v.beta.3
at similar levels to the .beta.6-transfected A375P.beta.6 cell line
(FIG. 4b), this agrees with the ELISA results that MFEVP1 and
NFEVP1 did not bind at detectable levels to .alpha.v.beta.3. In
addition, the A375Ppuro cells also expressed .alpha.v.beta.8,
.alpha.v.beta.5 and .alpha.5.beta.1 at similar levels to those
found on A375P.beta.6 cells (FIG. 4b) which showed that MFEVP1 and
NFEVP1 did also not bind at detectable levels to these
integrins.
Binding of MFEVP1 and NFEVP1 to CEA
[0129] The parent scFv, MFE, binds to CEA so it was important to
establish whether MFEVP1 would remain some of this binding
activity. Results showed that MFEVP1 showed residual binding to
immobilized CEA in ELISA in a concentration-dependent manner,
although considerably below that seen for MFE (FIG. 5a) when
revealed with rabbit anti-MFE and HRP-labelled goat anti-rabbit
IgG. The Tyr.sub.100b to Pro.sub.100b mutant, NFEVP1, showed no
residual binding on ELISA to immobilized CEA. This same mutation
when introduced into MFE had been shown previously to completely
abolish binding to CEA(19). The ability of MFEVP1 to bind to CEA
when expressed on cells was also investigated. These experiments
showed that MFEVP1 bound to the human colon adenocarcinoma cell
line LS174T, which is known to express high levels of CEA, when
revealed by Flow Cytometry with rabbit anti-MFE followed by goat
phycoerythrin-labelled anti-rabbit IgG (FIG. 5b). The shift in
fluorescence intensity was only slightly below that of the parent
molecule, MFE, as measured by gated fluorescence intensity, 53.8%
for MFE and 42.5% for MFEVP1. Consistent with the ELISA results the
Tyr.sub.100b to Pro.sub.100b mutant, NFEVP1, showed no binding to
theses cells, the observed fluorescence intensity was equal to that
of the omission control. The Tyr.sub.100b to Pro.sub.100b mutation
was thus able to eliminate all residual binding of NFEVP1 to CEA as
has been seen previously for the parent molecule, MFE.
Internalization of NFEVP1 into .beta.6-Transfected A375P Cells
[0130] Having shown binding of NFEVP1 to .alpha.v.beta.6 on cells,
we then investigated whether binding of NFEVP1 to .alpha.v.beta.6
on the cell surface resulted in internalization of the scFv in
these cells. .beta.6-transfected A375P cells were therefore
incubated at 4.degree. C. with NFEVP1 for 1 hr, the scFv was
removed and cells were incubated at various temperatures (described
under Material and Methods and shown in FIG. 6) at 37.degree. C.
After 10 minutes incubation at 37.degree. C. the scFv was seen as a
well defined thin line surrounding, at a distance, the nucleus
(Hoechst staining and shown in blue) when revealed with rabbit
anti-mouse IgG followed by Alexa Fluor.RTM. 546 labeled goat
anti-rabbit IgG and shown in red; typifying its location in the
plasma membrane. After 3 hrs incubation the scFv was diffused and
speckled around the nucleus, identifying its location inside the
cells. The scFv was also found inside the cells 30 minutes and 1
hrs after incubation of the cells at 37.degree. C. (data not
shown). When compared with the equivalent 10 min and 3 hr
incubation experiments of NFEVP1 with the A375Ppuro cells and the
control experiment where the scFv was omitted it can be concluded
that the fluorescence levels were significantly above background
level; experiments were recorded and depicted under identical
conditions. It was assured that internalization is mediated
entirely by .alpha.v.beta.6 and not some other mechanism by
pre-incubating the scFv at 4.degree. C. and removing it before
incubation at 37.degree. C. as Flow Cytometry results (see above)
showed that NFEVP1 bound only to the .beta.6-transfected cells and
not the puro cells. However, similar results were obtained when
cells were incubated without prior incubation at 4.degree. C. and
removal of the scFv (data not shown).
Fourier-Transform Infrared (FT-IR) Spectroscopy of NFEVP1.
[0131] Having obtained pure, monomeric NFEVP1, identified
.alpha.v.beta.6 binding and inhibition of migration of
.alpha.v.beta.6 expressing cells, it was investigated whether
insertion of the 17-mer VP1 peptide had affected the structure and
stability of the protein when compared with the parent molecule,
MFE. The 2.sup.nd derivative FT-IR spectra of NFEVP1 and MFE were
virtually super imposable. NFEVP1 showed a strong band at 1635 cm-1
in agreement with a protein whose structure consists mainly of
.beta.-sheet and shown previously in the x-ray structure of MFE
(25). The secondary structural elements associated with the FT-IR
bands have been assigned previously for MFE. (26) The intensity of
the .beta.-sheet band at 1635 cm.sup.-1 was used to monitor
stability of the protein; with increasing temperature this band
will reduce in intensity while the protein denatures. Recording of
the denaturing curve and fitting to a sigmoidal curve gave a
midpoint of denaturation of 45.degree. C. for NFEVP1 (FIG. 7b). For
MFE this temperature was 47.degree. C., identical to the previously
reported value(28). Therefore, insertion of the VP1 peptide did not
affect the structure of the protein and NFEVP1 had very similar
stability when compared to MFE.
Expression, Purification, .alpha.v.beta.6-Binding and Inhibition of
Cell Binding of Stabilized Humanized NFEVP1 (HFEVP1)
[0132] Having established that the murine scFv, MFE, can be used as
a scaffold for introduction of the .alpha.v.beta.6-binding peptide,
VP1, the same strategy was applied but using the previously
described stabilized humanized MFE (HFE)(27) as a scaffold. The
protein expressing vector was obtained by overlapping PCR identical
to the murine analogue with the Y100b to P100b mutation in the
heavy chain that eliminated CEA binding. Stabilized humanized
NFEVP1 (HFEVP1) was expressed at 115 mg/L by P. Pastoris,
determined after initial EDB-IMAC chromatography. The protein
formed almost exclusively a dimer as revealed by size-exclusion
chromatography (FIG. 8(a)). Fractions, containing dimer were
separated and used for subsequent experiments. HFEVP1 bound to
immobilized .alpha.v.beta.6 in ELISA when probed with anti-His
followed by anti-mouse labelled HRP IgG (FIG. 8(b). HFEVP1 also
inhibited the adhesion of .alpha.v.beta.6-expressing 3T3.beta.6.19
cells towards LAP (FIG. 8(c)). HFEVP1 was the most potent inhibitor
tested in the assay. IC50 values determined from the assay were
21.97 .mu.g/ml (768 .mu.M) for NFEVP1, 8.42 .mu.g/ml (56.1 .mu.M
for 10D5 and 2.55 .mu.g/ml (45.14 .mu.M) for HFEVP1.
Discussion
[0133] Whole antibodies with specificity for their target have been
classically obtained by hybridoma screening technology after
immunization with the antigen(30). A further well established
approach that selects for scFvs is phage display technology where
repertoires of scFvs are displayed on the surface of filamentous
bacteriophage and screened for binding to antigen(31). In addition,
antibodies with binding specifities for their targets can be
generated by a rational structure based approach, grafting of a
target-binding sequence from a ligand into the CDR region of the
antibody.
[0134] Here we describe the generation of the scFv, MFEVP1, with
.alpha.v.beta.6 binding specificity by a rational structure based
approach by insertion of the binding region of the viral coat
protein, VP1, of Foot-and-mouth disease virus (FMDV), serotype O,
into the CDR3 loop region of the VH domain of MFE. Previous
structural data of VP1 have identified the integrin-binding RGD
motif on the tip of the GH loop(32;33). A further motif, DLXXL, was
identified by displaying peptide libraries on phage as crucial for
.alpha.v.beta.6 binding (12). In VP1 this motif includes the D
residue of the RGD sequence and the two L residues are arranged in
a DLXXL motif.
[0135] The resulting scFv loop variant, named MFEVP1, was expressed
in E. coli and secreted into the media at comparable levels to the
parent MFE. Purification was via the His-tag followed by
size-exclusion chromatography to obtain the monomeric form.
[0136] We showed by ELISA that the monomeric scFv bound to
immobilized .alpha.v.beta.6 and by Flow cytometry when expressed on
cells. In agreement with integrin-ligand interactions the binding
was metal dependent and was abolished in the presence of EDTA.
Furthermore, MFEVP1 inhibited the migration of
.alpha.v.beta.6-expressing cells towards its ligand, LAP-1.
[0137] MFEVP1 was specific for the integrin .alpha.v.beta.6 and did
not show binding at detectable levels to immobilized
.alpha.v.beta.3 in ELISA and to .alpha.v.beta.3, .alpha.v.beta.8,
.alpha.v.beta.5 and .alpha.5.beta.1 expressed on cells.
[0138] Insertion of the binding region of VP1 of FMDV of O type
strain into MFE was predicted to be a promising strategy in order
to develop a scFv with specificity for .alpha.v.beta.6 because
previous studies have shown that in .beta.6-transfected cells
.alpha.v.beta.6 functions as the major receptor for virus
attachment, whereas other epithelial expressed integrins, namely
.alpha.5.beta.1 or .alpha.v.beta.5, appear not to have a
role(34).
[0139] MFEVP1 had the desired specificity for .alpha.v.beta.6,
however, also residual binding to the parent target, CEA. This
binding could be eliminated when the VH residue Y.sub.100b was
mutated to P.sub.100b, thus generating NFEVP1. Previous work has
shown that binding of MFE to CEA was abolished when this mutation
was introduced in MFE(19). MFE-CEA interactions were predicted from
the way a MFE molecule interacts with another MFE molecule in the
X-ray structure and this highlighted the importance of Y.sub.100b
(26). This was further elaborated by a subsequent modelling study
of the interaction of MFE with CEA(35).
[0140] The .alpha.v.beta.6-binding peptide did not affect the
structure of the scFv and maintained a similar midpoint of
denaturation when compared to MFE, NFEVP1, 45.degree. C., MFE,
47.degree. C., as determined by FT-IR spectroscopy.
[0141] A link between .alpha.v.beta.6 expression and carcinoma
progression has been suggested due to its ability to modulate
invasion, inhibit apoptosis, regulate protease expression and
activate TGF-.beta.1 (36). .alpha.v.beta.6 has also been
highlighted as a promising cancer target due to its de novo
expression on various cancerous tissues(36). A 12-mer
.alpha.v.beta.6-binding peptide has shown promise in mediating T
cell killing of .alpha.v.beta.6 expressing ovarian tumour targets
when fused to human IgG4 hinge-Fc extracellular domain and to the
cytoplasmic tail of CD3-.xi. (37).
[0142] Although scFvs might not be in itself good targeting agents
due to their rapid blood clearance they will allow genetic fusion
to toxins, increasing the size and slower blood clearance, in
particular when the toxin forms dimeric or multimeric arrangements,
which will introduce avidity. Delivery of scFv-toxin fusion's would
benefit from their ability to internalize. NFEVP1 was able to
internalize in .alpha.v.beta.6-expressing A375P.beta.6 cells. scFvs
can also be multimerically attached to drug carrying vehicles, such
as liposomes and polymers. scFvs can be converted into whole
antibodies for dimeric presentation, exploiting the intrinsic toxic
functions, antibody-dependent cellular cytotoxicity (ADCC) and
complement-dependent cytotoxicity (CDC). A construct which provides
good tumour penetration, high target retention, due to its dimeric
binding, and rapid blood clearance is the diabody(38). The diabody
is double the size of the scFv and considerable smaller than a
whole antibody. It is generated by shortening the scFv
(Gly.sub.4Ser).sub.3 VH-VL linker to a Gly.sub.4Ser linker, which
forces the VH and VL domains from different chains to pair(39).
[0143] A major problem in cancer therapy is immunogenicity of the
antibody therapeutic in particular in repeated treatment. NFEVP1 is
of murine origin and is likely to result in immunogenetic reactions
in humans. Hence previous studies have addressed this problem by
converting MFE into a humanized version. (27) Comparison of the
x-ray structure of MFE with a human analogue allowed identification
of 28 surface residues for humanization of MFE. (25) These residues
when introduced into MFE combined with three additional mutations
for stabilization identified by yeast display expression maturation
produced stabilized humanized MFE(27). In this study the stabilized
humanized MFE was used as a scaffold to insert the VP1 peptide and
combined with the Y100b to P100b mutation gave HFEVP1. The protein
was expressed almost exclusively as a dimer in P. Pastoris as shown
by size-exclusion chromatography. HFEVP1 bound to .alpha.v.beta.6
in ELISA and inhibited the adhesion of .alpha.v.beta.6 expressing
cells to LAP thus mimicking the behaviour of the murine analogue.
HFEVP1 was a slightly better inhibitor than the commercially
available whole antibody, 10D5; IC50 value for HFEVP1 was 2.55
.mu.g/ml (45.14 .mu.M) and for 10D5 was 8.42 .mu.g/ml (56.1
.mu.M).
[0144] In conclusion, a .alpha.v.beta.6-binding scFv was generated
by insertion of the RQD-containing VP1 peptide of FMDV into MFE
that had no binding for MFE's target, CEA, when combined with the
VHY.sub.100b to VHP.sub.100b mutation. This study has shown that
MFE-23 (including the humanised variants) are good scaffolds for
peptide insertion to alter binding specificity of the scFv. The
MFE-23 antibody (including the humanised variants) could thus be
envisaged to be used to obtain binding to other tumour targeting
antigens using a similar approach.
REFERENCES
[0145] All publications, patent and patent applications cited
herein or filed with this application, including references filed
as part of an Information Disclosure Statement are incorporated by
reference in their entirety. [0146] 1. Hynes, R. O. (2002) Cell
110, 673-687 [0147] 2. Ruoslahti, E. (1991) J. Clin. Invest 87, 1-5
[0148] 3. Giancotti, F. G. and Mainiero, F. (1994) Biochim.
Biophys. Acta 1198, 47-64 [0149] 4. Breuss, J. M., Gallo, J.,
DeLisser, H. M., Klimanskaya, I. V., Folkesson, H. G., Pittet, J.
F., Nishimura, S. L., Aldape, K., Landers, D. V., Carpenter, W.,
and (1995) J. Cell Sci. 108 (Pt 6), 2241-2251 [0150] 5. Ahmed, N.,
Pansino, F., Clyde, R., Murthi, P., Quinn, M. A., Rice, G. E.,
Agrez, M. V., Mok, S., and Baker, M. S. (2002) Carcinogenesis 23,
237-244 [0151] 6. Arihiro, K., Kaneko, M., Fujii, S., Inai, K., and
Yokosaki, Y. (2000) Breast Cancer 7, 19-26 [0152] 7. Sipos, B.,
Hahn, D., Carceller, A., Piulats, J., Hedderich, J., Kalthoff, H.,
Goodman, S. L., Kosmahl, M., and Kloppel, G. (2004) Histopathology
45, 226-236 [0153] 8. Ramos, D. M., But, M., Regezi, J., Schmidt,
B. L., Atakilit, A., Dang, D., Ellis, D., Jordan, R., and Li, X.
(2002) Matrix Biology 21, 297-307 [0154] 9. Bates, R. C., Bellovin,
D. I., Brown, C., Maynard, E., Wu, B., Kawakatsu, H., Sheppard, D.,
Oettgen, P., and Mercurio, A. M. (2005) J. Clin. Invest 115,
339-347 [0155] 10. Munger, J. S., Huang, X., Kawakatsu, H.,
Griffiths, M. J., Dalton, S. L., Wu, J., Pittet, T. F., Kaminski,
N., Garat, C., Matthay, M. A., Rifkin, D. B., and Sheppard, D.
(1999) Cell 96, 319-328 [0156] 11. Jackson, T., King, A. M.,
Stuart, D. I., and Fry, E. (2003) Virus Res. 91, 33-46 [0157] 12.
Kraft, S., Diefenbach, B., Mehta, R., Jonczyk, A., Luckenbach, G.
A., and Goodman, S. L. (1999) J. Biol. Chem. 274, 1979-1985 [0158]
13. Mateu, M. G., Valero, M. L., Andreu, D., and Domingo, E. (1996)
J. Biol. Chem. 271, 12814-12819 [0159] 14. Chester, K. A., Begent,
R. H., Robson, L., Keep, P., Pedley, R. B., Boden, J. A., Boxer,
G., Green, A., Winter, G., Cochet, O., and (1994) Lancet 343,
455-456 [0160] 15. Begent, R. H., Verhaar, M. J., Chester, K. A.,
Casey, J. L., Green, A. J., Napier, M. P., Hope-Stone, L. D.,
Cushen, N., Keep, P. A., Johnson, C. J., Hawkins, R. E., Hilson, A.
J., and Robson, L. (1996) Nat. Med. 2, 979-984 [0161] 16. Mayer,
A., Tsiompanou, E., O'Malley, D., Boxer, G. M., Bhatia, J., Flynn,
A. A., Chester, K. A., Davidson, B. R., Lewis, A. A., Winslet, M.
C., Dhillon, A. P., Hilson, A. J., and Begent, R. H. (2000) Clin.
Cancer Res. 6, 1711-1719 [0162] 17. Chester, K. A., Bhatia, J.,
Boxer, G., Cooke, S. P., Flynn, A. A., Huhalov, A., Mayer, A.,
Pedley, R. B., Robson, L., Sharma, S. K., Spencer, D. I., and
Begent, R. H. (2000) Dis. Markers 16, 53-62 [0163] 18. Chester, K.
A., Mayer, A., Bhatia, J., Robson, L., Spencer, D. I., Cooke, S.
P., Flynn, A. A., Sharma, S. K., Boxer, G., Pedley, R. B., and
Begent, R. H. (2000) Cancer Chemother. Pharmacol. 46 Suppl, S8-12
[0164] 19. Read, D. A., Chester, K. A., Keep, P. A., Begent, R. H.
J., Pedersen, J. T., and Rees, A. R. (1995) Br. J. Cancer 71,
[0165] 20. Lanza, P., Felding-Habermann, B., Ruggeri, Z. M.,
Zanetti, M., and Billetta, R. (1997) Blood Cells Mol. Dis. 23,
230-241 [0166] 21. Lanza, P., Billetta, R., Antonenko, S., and
Zanetti, M. (1993) Proc. Natl. Acad. Sci. U.S.A 90, 11683-11687
[0167] 22. McLane, K. E., Burton, D. R., and Ghazal, P. (1995)
Proc. Natl. Acad. Sci. U.S.A 92, 5214-5218 [0168] 23. Moroncini,
G., Kanu, N., Solforosi, L., Abalos, G., Telling, G. C., Head, M.,
Ironside, J., Brockes, J. P., Burton, D. R., and Williamson, R. A.
(2004) Proc. Natl. Acad. Sci. U.S.A 101, 10404-10409 [0169] 24.
Burman, A., Clark, S., Abrescia, N. G., Fry, E. E., Stuart, D. I.,
and Jackson, T. (2006) J. Virol. 80, 9798-9810 [0170] 25. Dicara,
D., Rapisarda, C., Sutclifffe, J. L., Violette, S. M., Weinreb, P.
H., Hart, I. R., Howard, M. J., and Marshall, J. F. (2007) J. Biol.
Chem. [0171] 26. Boehm, M. K., Corper, A. L., Wan, T., Sohi, M. K.,
Sutton, B. J., Thornton, J. D., Keep, P. A., Chester, K. A.,
Begent, R. H., and Perkins, S. J. (2000) Biochem. J. 346 Pt 2,
519-528 [0172] 27. Thomas, G. J., Lewis, M. P., Whawell, S. A.,
Russell, A., Sheppard, D., Hart, I. R., Speight, P. M., and
Marshall, J. F. (2001) J. Invest Dermatol. 117, 67-73 [0173] 28.
Lee, Y. C., Boehm, M. K., Chester, K. A., Begent, R. H., and
Perkins, S. J. (2002) J. Mol. Biol. 320, 107-127 [0174] 29. Tolner,
B., Smith, L., Begent, R. H. J., and Chester, K. A. (2006) Nat.
Protocols in press, [0175] 30. Kohler, G. and Milstein, C. (1975)
Nature 256, 495-497 [0176] 31. Winter, G., Griffiths, A. D.,
Hawkins, R. E., and Hoogenboom, H. R. (1994) Annu. Rev. Immunol.
12, 433-455 [0177] 32. Acharya, R., Fry, E., Stuart, D., Fox, G.,
Rowlands, D., and Brown, F. (1989) Nature 337, 709-716 [0178] 33.
Logan, D., Abu-Ghazaleh, R., Blakemore, W., Curry, S., Jackson, T.,
King, A., Lea, S., Lewis, R., Newman, J., Parry, N., and (1993)
Nature 362, 566-568 [0179] 34. Jackson, T., Sheppard, D., Denyer,
M., Blakemore, W., and King, A. M. (2000) J Virol. 74, 4949-4956
[0180] 35. Boehm, M. K. and Perkins, S. J. (2000) FEBS Lett. 475,
11-16 [0181] 36. Thomas, G. J., Nystrom, M. L., and Marshall, J. F.
(2006) J. Oral Pathol. Med. 35, 1-10 [0182] 37. Pameijer, C. R.,
Navanjo, A., Meechoovet, B., Wagner, J. R., Aguilar, B., Wright, C.
L., Chang, W. C., Brown, C. E., and Jensen, M. C. (2007) Cancer
Gene Ther. 14, 91-97 [0183] 38. Holliger, P. and Hudson, P. J.
(2005) Nat. Biotechnol. 23, 1126-1136 [0184] 39. Holliger, P.,
Prospero, T., and Winter, G. (1993) Proc. Natl. Acad. Sci. U.S.A
90, 6444-6448 [0185] 40. FitzGerald, K., Holliger, P., and Winter,
G. (1997) Protein Eng 10, 1221-1225 [0186] 41. Graff, C. P.,
Chester, K. Begent, R., and Wittrup, K. D. (2004) Protein Eng Des
Sel 17, 293-304 [0187] Chester K A, Baker M and Mayer A (2005)
Overcoming the immunological response to foreign enzymes in cancer
therapy Expert Rev. Clin. Immunol. 1: 549-559 [0188] Hoogenboom,
(2005). Selecting and screening recombinant antibody libraries. Nat
Biotechnology, 23, 1105-1116 [0189] Hofmeister V, Schrama D, Becker
J C, Anti-cancer therapies targeting the tumor stroma, Cancer
Immunol Immunother. 2007 Jul. 27; in press [0190] Li Y, Cozzi P J,
Targeting uPA/uPAR in prostate cancer. Cancer Treat Rev. 2007,
33(6):521-7. [0191] Munoz R, Arias Y, Ferreras J M, Rojo M A,
Gayoso M J, Nocito M, Benitez J, Jimenez P, Bernabeu C, Girbes T.,
Targeting a marker of the tumour neovasculature using a novel
anti-human CD105-immunotoxin containing the non-toxic type 2
ribosome-inactivating protein nigrin b. Cancer Lett. 2007 Oct. 18;
256(1):73-80. [0192] Baccala A, Sercia L, Li J, Heston W, Zhou M.
Expression of prostate-specific membrane antigen in
tumor-associated neovasculature of renal neoplasms. Urology. 2007
August; 70(2):385-90. [0193] Buhler P, Wolf P, Gierschner D,
Schaber I, Katzenwadel A, Schultze-Seemann W, Wetterauer U, Tacke
M, Swamy M, Schamel W W, Elsasser-Beile U. A bispecific diabody
directed against prostate-specific membrane antigen and CD3 induces
T-cell mediated lysis of prostate cancer cells. Cancer Immunol
Immunother. 2007 Jun. 20; in press [0194] Johnston J B, Navaratnam
S, Pitz M W, Maniate J M, Wiechec E, Baust H, Gingerich J, Skliris
G P, Murphy L C, Los M. Targeting the EGFR Pathway for cancer
therapy. Curr Med Chem. 2006, 13:3483-3492.
Sequence CWU 1
1
611761DNAArtificial sequenceSynthetic sequence MFE-23 Cloned into
pUC119 and expressed in E. coli 1ccatggcc cag gtg aaa ctg cag cag
tct ggg gca gaa ctt gtg agg tca 50 Gln Val Lys Leu Gln Gln Ser Gly
Ala Glu Leu Val Arg Ser 1 5 10 ggg acc tca gtc aag ttg tcc tgc aca
gct tct ggc ttc aac att aaa 98Gly Thr Ser Val Lys Leu Ser Cys Thr
Ala Ser Gly Phe Asn Ile Lys 15 20 25 30 gac tcc tat atg cac tgg ttg
agg cag ggg cct gaa cag ggc ctg gag 146Asp Ser Tyr Met His Trp Leu
Arg Gln Gly Pro Glu Gln Gly Leu Glu 35 40 45 tgg att gga tgg att
gat cct gag aat ggt gat act gaa tat gcc ccg 194Trp Ile Gly Trp Ile
Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro 50 55 60 aag ttc cag
ggc aag gcc act ttt act aca gac aca tcc tcc aac aca 242Lys Phe Gln
Gly Lys Ala Thr Phe Thr Thr Asp Thr Ser Ser Asn Thr 65 70 75 gcc
tac ctg cag ctc agc agc ctg aca tct gag gac act gcc gtc tat 290Ala
Tyr Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr 80 85
90 tat tgt aat gag ggg act ccg act ggg ccg tac tac ttt gac tac tgg
338Tyr Cys Asn Glu Gly Thr Pro Thr Gly Pro Tyr Tyr Phe Asp Tyr Trp
95 100 105 110 ggc caa ggg acc acg gtc acc gtc tcc tca ggt gga ggc
ggt tca ggc 386Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly
Gly Ser Gly 115 120 125 gga ggt ggc tct ggc ggt ggc gga tca gaa aat
gtg ctc acc cag tct 434Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Asn
Val Leu Thr Gln Ser 130 135 140 cca gca atc atg tct gca tct cca ggg
gag aag gtc acc ata acc tgc 482Pro Ala Ile Met Ser Ala Ser Pro Gly
Glu Lys Val Thr Ile Thr Cys 145 150 155 agt gcc agc tca agt gta agt
tac atg cac tgg ttc cag cag aag cca 530Ser Ala Ser Ser Ser Val Ser
Tyr Met His Trp Phe Gln Gln Lys Pro 160 165 170 ggc act tct ccc aaa
ctc tgg att tat agc aca tcc aac ctg gct tct 578Gly Thr Ser Pro Lys
Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser 175 180 185 190 gga gtc
cct gct cgc ttc agt ggc agt gga tct ggg acc tct tac tct 626Gly Val
Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser 195 200 205
ctc aca atc agc cga atg gag gct gaa gat gct gcc act tat tac tgc
674Leu Thr Ile Ser Arg Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys
210 215 220 cag caa agg agt agt tac cca ctc acg ttc ggt gct ggc acc
aag ctg 722Gln Gln Arg Ser Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr
Lys Leu 225 230 235 gag ctg aaa cgg gcg gcc gca cat caccatcatc
accat 761Glu Leu Lys Arg Ala Ala Ala His 240 245 2246PRTArtificial
sequenceSynthetic Construct 2Gln Val Lys Leu Gln Gln Ser Gly Ala
Glu Leu Val Arg Ser Gly Thr 1 5 10 15 Ser Val Lys Leu Ser Cys Thr
Ala Ser Gly Phe Asn Ile Lys Asp Ser 20 25 30 Tyr Met His Trp Leu
Arg Gln Gly Pro Glu Gln Gly Leu Glu Trp Ile 35 40 45 Gly Trp Ile
Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe 50 55 60 Gln
Gly Lys Ala Thr Phe Thr Thr Asp Thr Ser Ser Asn Thr Ala Tyr 65 70
75 80 Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr
Cys 85 90 95 Asn Glu Gly Thr Pro Thr Gly Pro Tyr Tyr Phe Asp Tyr
Trp Gly Gln 100 105 110 Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly
Gly Ser Gly Gly Gly 115 120 125 Gly Ser Gly Gly Gly Gly Ser Glu Asn
Val Leu Thr Gln Ser Pro Ala 130 135 140 Ile Met Ser Ala Ser Pro Gly
Glu Lys Val Thr Ile Thr Cys Ser Ala 145 150 155 160 Ser Ser Ser Val
Ser Tyr Met His Trp Phe Gln Gln Lys Pro Gly Thr 165 170 175 Ser Pro
Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly Val 180 185 190
Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr 195
200 205 Ile Ser Arg Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln
Gln 210 215 220 Arg Ser Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys
Leu Glu Leu 225 230 235 240 Lys Arg Ala Ala Ala His 245
321DNAArtificial sequenceSynthetic sequence MFE-23 Cloned into
pUC119 and expressed in E. coli 3atggtgatga tggtgatgtg c
214812DNAArtificial sequenceSynthetic sequence MFEVP1 Cloned into
pUC119 Expressed in E. coli 4ccatggcc cag gtg aaa ctg cag cag tct
ggg gca gaa ctt gtg agg tca 50 Gln Val Lys Leu Gln Gln Ser Gly Ala
Glu Leu Val Arg Ser 1 5 10 ggg acc tca gtc aag ttg tcc tgc aca gct
tct ggc ttc aac att aaa 98Gly Thr Ser Val Lys Leu Ser Cys Thr Ala
Ser Gly Phe Asn Ile Lys 15 20 25 30 gac tcc tat atg cac tgg ttg agg
cag ggg cct gaa cag ggc ctg gag 146Asp Ser Tyr Met His Trp Leu Arg
Gln Gly Pro Glu Gln Gly Leu Glu 35 40 45 tgg att gga tgg att gat
cct gag aat ggt gat act gaa tat gcc ccg 194Trp Ile Gly Trp Ile Asp
Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro 50 55 60 aag ttc cag ggc
aag gcc act ttt act aca gac aca tcc tcc aac aca 242Lys Phe Gln Gly
Lys Ala Thr Phe Thr Thr Asp Thr Ser Ser Asn Thr 65 70 75 gcc tac
ctg cag ctc agc agc ctg aca tct gag gac act gcc gtc tat 290Ala Tyr
Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr 80 85 90
tat tgt aat gag ggg act ccg act gca gtt ccg aat ctg cga ggt gat
338Tyr Cys Asn Glu Gly Thr Pro Thr Ala Val Pro Asn Leu Arg Gly Asp
95 100 105 110 ctg cag gtg ctg gcg cag aaa gtt gca ggg ccg tac tac
ttt gac tac 386Leu Gln Val Leu Ala Gln Lys Val Ala Gly Pro Tyr Tyr
Phe Asp Tyr 115 120 125 tgg ggc caa ggg acc acg gtc acc gtc tcc tca
ggt gga ggc ggt tca 434Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser
Gly Gly Gly Gly Ser 130 135 140 ggc gga ggt ggc tct ggc ggt ggc gga
tca gaa aat gtg ctc acc cag 482Gly Gly Gly Gly Ser Gly Gly Gly Gly
Ser Glu Asn Val Leu Thr Gln 145 150 155 tct cca gca atc atg tct gca
tct cca ggg gag aag gtc acc ata acc 530Ser Pro Ala Ile Met Ser Ala
Ser Pro Gly Glu Lys Val Thr Ile Thr 160 165 170 tgc agt gcc agc tca
agt gta agt tac atg cac tgg ttc cag cag aag 578Cys Ser Ala Ser Ser
Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys 175 180 185 190 cca ggc
act tct ccc aaa ctc tgg att tat agc aca tcc aac ctg gct 626Pro Gly
Thr Ser Pro Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala 195 200 205
tct gga gtc cct gct cgc ttc agt ggc agt gga tct ggg acc tct tac
674Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr
210 215 220 tct ctc aca atc agc cga atg gag gct gaa gat gct gcc act
tat tac 722Ser Leu Thr Ile Ser Arg Met Glu Ala Glu Asp Ala Ala Thr
Tyr Tyr 225 230 235 tgc cag caa agg agt agt tac cca ctc acg ttc ggt
gct ggc acc aag 770Cys Gln Gln Arg Ser Ser Tyr Pro Leu Thr Phe Gly
Ala Gly Thr Lys 240 245 250 ctg gag ctg aaa cgg gcg gcc gca cat
caccatcatc accat 812Leu Glu Leu Lys Arg Ala Ala Ala His 255 260
5263PRTArtificial sequenceSynthetic Construct 5Gln Val Lys Leu Gln
Gln Ser Gly Ala Glu Leu Val Arg Ser Gly Thr 1 5 10 15 Ser Val Lys
Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile Lys Asp Ser 20 25 30 Tyr
Met His Trp Leu Arg Gln Gly Pro Glu Gln Gly Leu Glu Trp Ile 35 40
45 Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe
50 55 60 Gln Gly Lys Ala Thr Phe Thr Thr Asp Thr Ser Ser Asn Thr
Ala Tyr 65 70 75 80 Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala
Val Tyr Tyr Cys 85 90 95 Asn Glu Gly Thr Pro Thr Ala Val Pro Asn
Leu Arg Gly Asp Leu Gln 100 105 110 Val Leu Ala Gln Lys Val Ala Gly
Pro Tyr Tyr Phe Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Thr Val Thr
Val Ser Ser Gly Gly Gly Gly Ser Gly Gly 130 135 140 Gly Gly Ser Gly
Gly Gly Gly Ser Glu Asn Val Leu Thr Gln Ser Pro 145 150 155 160 Ala
Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Ile Thr Cys Ser 165 170
175 Ala Ser Ser Ser Val Ser Tyr Met His Trp Phe Gln Gln Lys Pro Gly
180 185 190 Thr Ser Pro Lys Leu Trp Ile Tyr Ser Thr Ser Asn Leu Ala
Ser Gly 195 200 205 Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr
Ser Tyr Ser Leu 210 215 220 Thr Ile Ser Arg Met Glu Ala Glu Asp Ala
Ala Thr Tyr Tyr Cys Gln 225 230 235 240 Gln Arg Ser Ser Tyr Pro Leu
Thr Phe Gly Ala Gly Thr Lys Leu Glu 245 250 255 Leu Lys Arg Ala Ala
Ala His 260 6144DNAArtificial sequenceSynthetic sequence MFEVP1
Cloned into pUC119 and expressed in E. coli 6tggagatgca gacatgattg
ctggagactg ggtgagcaca ttttctgatc cgccaccgcc 60agagccacct ccgcctgaac
cgcctccacc tgaggagacg gtgaccgtgg tcccttggcc 120ccagtagtca
aacgggtacg gccc 1447111DNAArtificial sequenceSynthetic sequence
MFEVP1 Cloned into pUC119 and expressed in E. coli 7atggtgatga
tggtgatgtg cggccgcccg tttcagctcc agcttggtgc cagcaccgaa 60cgtgagtggg
taactactcc tttgctggca gtaataagtg gcagcatctt c 1118812DNAArtificial
sequenceSynthetic sequence NFEVP1 Cloned in Puc119, expressed in E.
coli and clone in Modified pPICZalphaB expressed in P. pastoris
8ccatggcc cag gtg aaa ctg cag cag tct ggg gca gaa ctt gtg agg tca
50 Gln Val Lys Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Ser 1 5 10
ggg acc tca gtc aag ttg tcc tgc aca gct tct ggc ttc aac att aaa
98Gly Thr Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile Lys
15 20 25 30 gac tcc tat atg cac tgg ttg agg cag ggg cct gaa cag ggc
ctg gag 146Asp Ser Tyr Met His Trp Leu Arg Gln Gly Pro Glu Gln Gly
Leu Glu 35 40 45 tgg att gga tgg att gat cct gag aat ggt gat act
gaa tat gcc ccg 194Trp Ile Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr
Glu Tyr Ala Pro 50 55 60 aag ttc cag ggc aag gcc act ttt act aca
gac aca tcc tcc aac aca 242Lys Phe Gln Gly Lys Ala Thr Phe Thr Thr
Asp Thr Ser Ser Asn Thr 65 70 75 gcc tac ctg cag ctc agc agc ctg
aca tct gag gac act gcc gtc tat 290Ala Tyr Leu Gln Leu Ser Ser Leu
Thr Ser Glu Asp Thr Ala Val Tyr 80 85 90 tat tgt aat gag ggg act
ccg act gca gtt ccg aat ctg cga ggt gat 338Tyr Cys Asn Glu Gly Thr
Pro Thr Ala Val Pro Asn Leu Arg Gly Asp 95 100 105 110 ctg cag gtg
ctg gcg cag aaa gtt gca ggg ccg tac ccg ttt gac tac 386Leu Gln Val
Leu Ala Gln Lys Val Ala Gly Pro Tyr Pro Phe Asp Tyr 115 120 125 tgg
ggc caa ggg acc acg gtc acc gtc tcc tca ggt gga ggc ggt tca 434Trp
Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser 130 135
140 ggc gga ggt ggc tct ggc ggt ggc gga tca gaa aat gtg ctc acc cag
482Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Asn Val Leu Thr Gln
145 150 155 tct cca gca atc atg tct gca tct cca ggg gag aag gtc acc
ata acc 530Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr
Ile Thr 160 165 170 tgc agt gcc agc tca agt gta agt tac atg cac tgg
ttc cag cag aag 578Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His Trp
Phe Gln Gln Lys 175 180 185 190 cca ggc act tct ccc aaa ctc tgg att
tat agc aca tcc aac ctg gct 626Pro Gly Thr Ser Pro Lys Leu Trp Ile
Tyr Ser Thr Ser Asn Leu Ala 195 200 205 tct gga gtc cct gct cgc ttc
agt ggc agt gga tct ggg acc tct tac 674Ser Gly Val Pro Ala Arg Phe
Ser Gly Ser Gly Ser Gly Thr Ser Tyr 210 215 220 tct ctc aca atc agc
cga atg gag gct gaa gat gct gcc act tat tac 722Ser Leu Thr Ile Ser
Arg Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr 225 230 235 tgc cag caa
agg agt agt tac cca ctc acg ttc ggt gct ggc acc aag 770Cys Gln Gln
Arg Ser Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys 240 245 250 ctg
gag ctg aaa cgg gcg gcc gca cat caccatcatc accat 812Leu Glu Leu Lys
Arg Ala Ala Ala His 255 260 9263PRTArtificial sequenceSynthetic
Construct 9Gln Val Lys Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Ser
Gly Thr 1 5 10 15 Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn
Ile Lys Asp Ser 20 25 30 Tyr Met His Trp Leu Arg Gln Gly Pro Glu
Gln Gly Leu Glu Trp Ile 35 40 45 Gly Trp Ile Asp Pro Glu Asn Gly
Asp Thr Glu Tyr Ala Pro Lys Phe 50 55 60 Gln Gly Lys Ala Thr Phe
Thr Thr Asp Thr Ser Ser Asn Thr Ala Tyr 65 70 75 80 Leu Gln Leu Ser
Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Glu
Gly Thr Pro Thr Ala Val Pro Asn Leu Arg Gly Asp Leu Gln 100 105 110
Val Leu Ala Gln Lys Val Ala Gly Pro Tyr Pro Phe Asp Tyr Trp Gly 115
120 125 Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly
Gly 130 135 140 Gly Gly Ser Gly Gly Gly Gly Ser Glu Asn Val Leu Thr
Gln Ser Pro 145 150 155 160 Ala Ile Met Ser Ala Ser Pro Gly Glu Lys
Val Thr Ile Thr Cys Ser 165 170 175 Ala Ser Ser Ser Val Ser Tyr Met
His Trp Phe Gln Gln Lys Pro Gly 180 185 190 Thr Ser Pro Lys Leu Trp
Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly 195 200 205 Val Pro Ala Arg
Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu 210 215 220 Thr Ile
Ser Arg Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln 225 230 235
240 Gln Arg Ser Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu
245 250 255 Leu Lys Arg Ala Ala Ala His 260 10144DNAArtificial
sequenceSynthetic sequence NFEVP1
Cloned in Puc119, expressed in E. coli and clone in Modified
pPICZalphaB expressed in P. pastoris 10tggagatgca gacatgattg
ctggagactg ggtgagcaca ttttctgatc cgccaccgcc 60agagccacct ccgcctgaac
cgcctccacc tgaggagacg gtgaccgtgg tcccttggcc 120ccagtagtca
aacgggtacg gccc 14411111DNAArtificial sequenceSynthetic sequence
NFEVP1 Cloned in Puc119, expressed in E. coli and clone in Modified
pPICZalphaB expressed in P. pastoris 11atggtgatga tggtgatgtg
cggccgcccg tttcagctcc agcttggtgc cagcaccgaa 60cgtgagtggg taactactcc
tttgctggca gtaataagtg gcagcatctt c 11112764DNAArtificial
sequenceSynthetic sequence shMFE-23 Cys Cloned into modified
pPICZalphaB Expressed in P. pastoris 12ccatggcc caa gtt aaa ctg gaa
cag tcc ggt gct gaa gtt gtc aaa cca 50 Gln Val Lys Leu Glu Gln Ser
Gly Ala Glu Val Val Lys Pro 1 5 10 ggt gct tcc gtg aag ttg tcc tgt
aaa gcc tct ggt ttt aac atc aag 98Gly Ala Ser Val Lys Leu Ser Cys
Lys Ala Ser Gly Phe Asn Ile Lys 15 20 25 30 gat tcg tat atg cat tgg
ttg aga caa ggg cca gga caa aga ttg gaa 146Asp Ser Tyr Met His Trp
Leu Arg Gln Gly Pro Gly Gln Arg Leu Glu 35 40 45 tgg att ggc tgg
att gat cca gag aat ggt gat act gag tac gct cct 194Trp Ile Gly Trp
Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro 50 55 60 aaa ttt
cag gga aag gct act ttt act acc gac act tcc gct aat acc 242Lys Phe
Gln Gly Lys Ala Thr Phe Thr Thr Asp Thr Ser Ala Asn Thr 65 70 75
gca tac ttg ggc tta tct tcc ttg aga cca gag gac act gcc gta tac
290Ala Tyr Leu Gly Leu Ser Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr
80 85 90 tac tgc aac gaa ggg aca cca act ggt cct tac tat ttc gac
tac tgg 338Tyr Cys Asn Glu Gly Thr Pro Thr Gly Pro Tyr Tyr Phe Asp
Tyr Trp 95 100 105 110 gga caa ggt acc tta gtt act gtc tct agc ggt
ggc gga ggt tca ggc 386Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly
Gly Gly Gly Ser Gly 115 120 125 ggt gga ggg tct gga ggt ggc ggt agt
gaa aat gtg ctg acc caa tct 434Gly Gly Gly Ser Gly Gly Gly Gly Ser
Glu Asn Val Leu Thr Gln Ser 130 135 140 cca agc tcc atg tct gcc tct
gtt ggc gat aga gta acc atc gct tgt 482Pro Ser Ser Met Ser Ala Ser
Val Gly Asp Arg Val Thr Ile Ala Cys 145 150 155 agc gca tcc tct agt
gtc cca tat atg cac tgg ttt caa cag aag cca 530Ser Ala Ser Ser Ser
Val Pro Tyr Met His Trp Phe Gln Gln Lys Pro 160 165 170 ggt aaa agc
cca aag ttg ttg att tat tcg aca tcc aac ttg gct tct 578Gly Lys Ser
Pro Lys Leu Leu Ile Tyr Ser Thr Ser Asn Leu Ala Ser 175 180 185 190
gga gtg cct tca agg ttt tct ggt tcc ggc tca gga acc gat tat agt
626Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser
195 200 205 ttg act att agc tca gtg cag cca gag gat gct gca acc tac
tat tgc 674Leu Thr Ile Ser Ser Val Gln Pro Glu Asp Ala Ala Thr Tyr
Tyr Cys 210 215 220 cag caa agg tcc tca tat cca ctg act ttc ggg ggt
gga acg aag ttg 722Gln Gln Arg Ser Ser Tyr Pro Leu Thr Phe Gly Gly
Gly Thr Lys Leu 225 230 235 gaa atc aag gct gcg gcc gcc tgt cat cat
cat cat cat cat 764Glu Ile Lys Ala Ala Ala Ala Cys His His His His
His His 240 245 250 13252PRTArtificial sequenceSynthetic Construct
13Gln Val Lys Leu Glu Gln Ser Gly Ala Glu Val Val Lys Pro Gly Ala 1
5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Phe Asn Ile Lys Asp
Ser 20 25 30 Tyr Met His Trp Leu Arg Gln Gly Pro Gly Gln Arg Leu
Glu Trp Ile 35 40 45 Gly Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu
Tyr Ala Pro Lys Phe 50 55 60 Gln Gly Lys Ala Thr Phe Thr Thr Asp
Thr Ser Ala Asn Thr Ala Tyr 65 70 75 80 Leu Gly Leu Ser Ser Leu Arg
Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Glu Gly Thr Pro
Thr Gly Pro Tyr Tyr Phe Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Leu
Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125 Gly
Ser Gly Gly Gly Gly Ser Glu Asn Val Leu Thr Gln Ser Pro Ser 130 135
140 Ser Met Ser Ala Ser Val Gly Asp Arg Val Thr Ile Ala Cys Ser Ala
145 150 155 160 Ser Ser Ser Val Pro Tyr Met His Trp Phe Gln Gln Lys
Pro Gly Lys 165 170 175 Ser Pro Lys Leu Leu Ile Tyr Ser Thr Ser Asn
Leu Ala Ser Gly Val 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser
Gly Thr Asp Tyr Ser Leu Thr 195 200 205 Ile Ser Ser Val Gln Pro Glu
Asp Ala Ala Thr Tyr Tyr Cys Gln Gln 210 215 220 Arg Ser Ser Tyr Pro
Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile 225 230 235 240 Lys Ala
Ala Ala Ala Cys His His His His His His 245 250 14815DNAArtificial
sequenceSynthetic sequence HFEVP1 Cys Cloned into modified
pPICZalphaB Expressed in P. pastoris 14ccatggcc caa gtt aaa ctg gaa
cag tcc ggt gct gaa gtt gtc aaa cca 50 Gln Val Lys Leu Glu Gln Ser
Gly Ala Glu Val Val Lys Pro 1 5 10 ggt gct tcc gtg aag ttg tcc tgt
aaa gcc tct ggt ttt aac atc aag 98Gly Ala Ser Val Lys Leu Ser Cys
Lys Ala Ser Gly Phe Asn Ile Lys 15 20 25 30 gat tcg tat atg cat tgg
ttg aga caa ggg cca gga caa aga ttg gaa 146Asp Ser Tyr Met His Trp
Leu Arg Gln Gly Pro Gly Gln Arg Leu Glu 35 40 45 tgg att ggc tgg
att gat cca gag aat ggt gat acc gag tac gct cct 194Trp Ile Gly Trp
Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro 50 55 60 aaa ttt
cag gga aag gct act ttt act acc gac act tcc gct aat acc 242Lys Phe
Gln Gly Lys Ala Thr Phe Thr Thr Asp Thr Ser Ala Asn Thr 65 70 75
gca tac ttg ggc tta tct tcc ttg aga cca gag gac act gcc gta tac
290Ala Tyr Leu Gly Leu Ser Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr
80 85 90 tac tgc aac gaa ggg aca cca act gca gtt ccg aac ctg cga
ggt gat 338Tyr Cys Asn Glu Gly Thr Pro Thr Ala Val Pro Asn Leu Arg
Gly Asp 95 100 105 110 ctg cag gtg ctg gct cag aaa gtt gca ggt cct
tac cct ttc gac tac 386Leu Gln Val Leu Ala Gln Lys Val Ala Gly Pro
Tyr Pro Phe Asp Tyr 115 120 125 tgg gga caa ggt acc tta gtt act gtc
tct agc ggt ggc gga ggt tca 434Trp Gly Gln Gly Thr Leu Val Thr Val
Ser Ser Gly Gly Gly Gly Ser 130 135 140 ggc ggt gga ggg tct gga ggt
ggc ggt agt gaa aat gtg ctg acc caa 482Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Glu Asn Val Leu Thr Gln 145 150 155 tct cca agc tcc atg
tct gct tct gtt ggc gat aga gta acc atc gct 530Ser Pro Ser Ser Met
Ser Ala Ser Val Gly Asp Arg Val Thr Ile Ala 160 165 170 tgt agc gca
tcc tct agt gtc cca tat atg cac tgg ttt caa cag aag 578Cys Ser Ala
Ser Ser Ser Val Pro Tyr Met His Trp Phe Gln Gln Lys 175 180 185 190
cca ggt aaa agc cca aag ttg ttg att tat tcg aca tcc aac ttg gct
626Pro Gly Lys Ser Pro Lys Leu Leu Ile Tyr Ser Thr Ser Asn Leu Ala
195 200 205 tct gga gtg cct tca agg ttt tct ggt tcc ggc tca gga acc
gat tat 674Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr
Asp Tyr 210 215 220 agt ttg act att agc tca gtg cag cca gag gat gct
gca acc tac tat 722Ser Leu Thr Ile Ser Ser Val Gln Pro Glu Asp Ala
Ala Thr Tyr Tyr 225 230 235 tgc cag caa agg tcc tca tat cca ctg act
ttc ggg ggt gga acg aag 770Cys Gln Gln Arg Ser Ser Tyr Pro Leu Thr
Phe Gly Gly Gly Thr Lys 240 245 250 ttg gaa atc aag gct gcg gcc gcc
tgt cat cat cat cat cat cat 815Leu Glu Ile Lys Ala Ala Ala Ala Cys
His His His His His His 255 260 265 15269PRTArtificial
sequenceSynthetic Construct 15Gln Val Lys Leu Glu Gln Ser Gly Ala
Glu Val Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys
Ala Ser Gly Phe Asn Ile Lys Asp Ser 20 25 30 Tyr Met His Trp Leu
Arg Gln Gly Pro Gly Gln Arg Leu Glu Trp Ile 35 40 45 Gly Trp Ile
Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe 50 55 60 Gln
Gly Lys Ala Thr Phe Thr Thr Asp Thr Ser Ala Asn Thr Ala Tyr 65 70
75 80 Leu Gly Leu Ser Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr Tyr
Cys 85 90 95 Asn Glu Gly Thr Pro Thr Ala Val Pro Asn Leu Arg Gly
Asp Leu Gln 100 105 110 Val Leu Ala Gln Lys Val Ala Gly Pro Tyr Pro
Phe Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Leu Val Thr Val Ser Ser
Gly Gly Gly Gly Ser Gly Gly 130 135 140 Gly Gly Ser Gly Gly Gly Gly
Ser Glu Asn Val Leu Thr Gln Ser Pro 145 150 155 160 Ser Ser Met Ser
Ala Ser Val Gly Asp Arg Val Thr Ile Ala Cys Ser 165 170 175 Ala Ser
Ser Ser Val Pro Tyr Met His Trp Phe Gln Gln Lys Pro Gly 180 185 190
Lys Ser Pro Lys Leu Leu Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly 195
200 205 Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser
Leu 210 215 220 Thr Ile Ser Ser Val Gln Pro Glu Asp Ala Ala Thr Tyr
Tyr Cys Gln 225 230 235 240 Gln Arg Ser Ser Tyr Pro Leu Thr Phe Gly
Gly Gly Thr Lys Leu Glu 245 250 255 Ile Lys Ala Ala Ala Ala Cys His
His His His His His 260 265 1651DNAArtificial sequenceSynthetic
sequence HFEVP1 Cys Cloned into modified pPICZalphaB Expressed in
P. pastoris 16tgcaactttc tgagccagca cctgcagatc acctcgcaga
ttcggaactg c 51177PRTArtificial sequenceSynthetic sequence Sequence
motif 17Arg Gly Asp Leu Xaa Xaa Leu 1 5 187PRTArtificial
sequenceSynthetic sequence Sequence motif 18Arg Gly Asp Leu Xaa Xaa
Ile 1 5 1917PRTArtificial sequenceSynthetic sequence Targeting
peptide 19Ala Val Pro Asn Leu Arg Gly Asp Leu Gln Val Leu Ala Gln
Lys Val 1 5 10 15 Ala 207PRTArtificial sequenceSynthetic sequence
Heavy chain CDR1 20Gly Phe Asn Ile Lys Asp Ser 1 5 216PRTArtificial
sequenceSynthetic sequence Heavy chain CDR2 21Asp Pro Glu Asn Gly
Asp 1 5 229PRTArtificial sequenceSynthetic sequence Heavy chain
CDR3 22Thr Pro Thr Gly Pro Tyr Tyr Phe Asp 1 5 235PRTArtificial
sequenceSynthetic sequence Light chain CDR1 23Ser Ser Ser Val Pro 1
5 245PRTArtificial sequenceSynthetic sequence Light chain CDR1
24Ser Ser Ser Val Ser 1 5 256PRTArtificial sequenceSynthetic
sequence Light chain CDR3 25Arg Ser Ser Tyr Pro Leu 1 5
265PRTArtificial sequenceSynthetic sequence Linker 26Gly Gly Gly
Gly Ser 1 5 2710PRTArtificial sequenceSynthetic sequence Linker
27Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 2815PRTArtificial
sequenceSynthetic sequence Linker 28Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 2920PRTArtificial
sequenceSynthetic sequence Linker 29Gly Gly Gly Gly Ser Gly Gly Gly
Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Gly Ser 20
3062DNAArtificial sequenceSynthetic sequence Primer 30ctactgcaac
gaagggacag ctagaggtga tttggctact ttgttcgact actggggaca 60ag
623162DNAArtificial sequenceSynthetic sequence Primer 31cttgtcccca
gtagtcgaac aaagtagcca aatcacctct agctgtccct tcgttgcagt 60ag
623244DNAArtificial sequenceSynthetic sequence Primer 32gaagggacag
ctagaggtga attggctact ttgttcgact actg 443344DNAArtificial
sequenceSynthetic sequence Primer 33cagtagtcga acaaagtagc
caattcacct ctagctgtcc cttc 443424DNAArtificial sequenceSynthetic
sequence Primer 34catgccatgg cccaggtgaa actg 243533DNAArtificial
sequenceSynthetic sequence Primer 35catgccatgg cccaagttaa
actggaacag tcc 333660DNAArtificial sequenceSynthetic sequence
Primer 36gcgccagcac ctgcagatca cctcgcagat tcggaactgc agtcggagtc
ccctcattac 603760DNAArtificial sequenceSynthetic sequence Primer
37gagccagcac ctgcagatca cctcgcagat tcggaactgc agttggtgtc ccttcgttgc
603828DNAArtificial sequenceSynthetic sequence Primer 38atagtttagc
ggccgcccgt ttcagctc 283928DNAArtificial sequenceSynthetic sequence
Primer 39atagtttagc ggccgcagcc ttgatttc 284062DNAArtificial
sequenceSynthetic sequence Primer 40ctgcgaggtg atctgcaggt
gctggcgcag aaagttgcag ggccgtacta ctttgactac 60tg
624171DNAArtificial sequenceSynthetic sequence Primer 41ctgcgaggtg
atctgcaggt gctggctcag aaagttgcag gtccttaccc tttcgactac 60tggggacaag
g 714233DNAArtificial sequenceSynthetic sequence Primer
42gttgcagggc cgtacccgtt tgactactgg ggc 334333DNAArtificial
sequenceSynthetic sequence Primer 43gccccagtag tcaaacgggt
acggccctgc aac 33447PRTArtificial sequenceSynthetic sequence 44Arg
Gly Asp Leu Ala Thr Leu 1 5 457PRTArtificial sequenceSynthetic
sequence Motif 45Arg Xaa Asp Leu Xaa Xaa Leu 1 5 468PRTArtificial
sequenceSynthetic sequence 46Ala Arg Gly Glu Leu Ala Thr Leu 1 5
475PRTArtificial sequenceSynthetic sequence Sequence motif 47Asp
Leu Xaa Xaa Leu 1 5 484PRTArtificial sequenceSynthetic sequence
Sequence motif 48Leu Xaa Xaa Leu 1 494PRTArtificial
sequenceSynthetic sequence Sequence motif 49Leu Xaa Xaa Ile 1
507PRTArtificial sequenceSynthetic sequence Motif 50Arg Gly Asp Leu
Xaa Xaa Xaa 1 5 517PRTArtificial sequenceSynthetic sequence Motif
51Arg Gly Asp Leu Xaa Xaa Xaa 1 5 527PRTArtificial
sequenceSynthetic sequence Motif 52Arg Gly Asp Leu Xaa Xaa Xaa 1 5
535PRTArtificial SequenceHeavy Chain CDR1 sequence 53Asp Ser Tyr
Met His1 5 5417PRTArtificial SequenceHeavy Chain CDR2 sequence
54Trp Ile Asp Pro Glu Asn Gly Asp Thr Glu Tyr Ala Pro Lys Phe Gln1
5 10 15 Gly5511PRTArtificial SequenceHeavy Chain CDR3 sequence
55Gly Thr Pro Thr Gly Pro Tyr Tyr Phe Asp Tyr1 5 10
5611PRTArtificial SequenceHeavy Chain CDR3 sequence 56Gly Thr Pro
Thr Gly Pro Tyr Pro Phe Asp Tyr1 5 10 5710PRTArtificial
SequenceLight Chain CDR1 sequence 57Ser Ala Ser Ser Ser Val Pro Tyr
Met His1 5 10 5810PRTArtificial SequenceLight Chain CDR1 sequence
58Ser
Ala Ser Ser Ser Val Ser Tyr Met His1 5 10 597PRTArtificial
SequenceLight Chain CDR2 sequence 59Ser Thr Ser Asn Leu Ala Ser1 5
607PRTArtificial SequenceLight Chain CDR2 sequence 60Leu Thr Ser
Asn Leu Ala Ser1 5 619PRTArtificial SequenceLight Chain CDR3
sequence 61Gln Gln Arg Ser Ser Tyr Pro Leu Thr1 5
* * * * *