U.S. patent application number 14/697470 was filed with the patent office on 2015-10-15 for rna with a combination of unmodified and modified nucleotides for protein expression.
This patent application is currently assigned to ETHRIS GMBH. The applicant listed for this patent is ETHRIS GMBH. Invention is credited to Michael Kormann, Carsten RUDOLPH.
Application Number | 20150291678 14/697470 |
Document ID | / |
Family ID | 43529748 |
Filed Date | 2015-10-15 |
United States Patent
Application |
20150291678 |
Kind Code |
A1 |
RUDOLPH; Carsten ; et
al. |
October 15, 2015 |
RNA WITH A COMBINATION OF UNMODIFIED AND MODIFIED NUCLEOTIDES FOR
PROTEIN EXPRESSION
Abstract
The invention relates to a polyribonucleotide with a sequence
that codes a protein or protein fragment, wherein the
polyribonucleotide comprises a combination of unmodified and
modified nucleotides, wherein 5 to 50% of the uridine nucleotides
and 5 to 50% of the cytidine nucleotides are modified uridine
nucleotides or modified cytidine nucleotides.
Inventors: |
RUDOLPH; Carsten; (Munchen,
DE) ; Kormann; Michael; (Erding, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ETHRIS GMBH |
Martinsried |
|
DE |
|
|
Assignee: |
ETHRIS GMBH
Martinsried
DE
|
Family ID: |
43529748 |
Appl. No.: |
14/697470 |
Filed: |
April 27, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13388140 |
Apr 13, 2012 |
|
|
|
PCT/EP2010/004681 |
Jul 30, 2010 |
|
|
|
14697470 |
|
|
|
|
Current U.S.
Class: |
514/44R ;
435/69.4; 536/23.5 |
Current CPC
Class: |
A61K 38/1816 20130101;
A61P 11/00 20180101; C12N 2320/50 20130101; A61P 37/04 20180101;
A61P 7/00 20180101; C12N 2320/30 20130101; A61K 48/0066 20130101;
C07K 14/785 20130101; A61L 27/227 20130101; C07K 14/505 20130101;
C12N 15/11 20130101; C12N 2310/335 20130101; A61K 48/00 20130101;
C12N 2310/334 20130101; C12N 15/67 20130101 |
International
Class: |
C07K 14/505 20060101
C07K014/505; A61K 38/18 20060101 A61K038/18 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 31, 2009 |
DE |
10 2009 035 507.3 |
Oct 22, 2009 |
DE |
10 2009 050 308.0 |
Claims
1-40. (canceled)
41. A therapeutic agent comprising a modified polyribonucleotide
having a sequence which encodes a protein or functional fragment
thereof, wherein said modified polyribonucleotide comprises a
combination of unmodified and modified nucleotides, which modified
nucleotides comprise analogs of uridine or analogs of cytidine,
wherein: (a) said modified polyribonucleotide induces less than a
5-fold change in a level of at least one inflammatory marker
selected from TNF-.alpha., IL-6, IL-8, IL-12, IFN-.alpha., IFN-3
and IFN-.gamma. expressed by peripheral blood mononuclear cells
exposed to said modified polyribonucleotide as compared to a level
of said at least one inflammatory marker in peripheral blood
mononuclear cells in a control that has been exposed to an
unmodified polyribonucleotide encoding said protein or functional
fragment thereof; and (b) said modified polyribonucleotide provides
an amount of said protein or functional fragment thereof over a
time period in cells having said modified polyribonucleotide,
wherein said time period is up to 4 weeks, and wherein said amount
is increased as compared to an amount in control cells having said
unmodified polyribonucleotide, as determined by a percentage
content of red fluorescent protein in said cells when said protein
or functional fragment thereof is red fluorescent protein.
42. The therapeutic agent of claim 41, wherein said modified
polyribonucleotide is formulated in a nanoparticle or
nanocapsule.
43. The therapeutic agent of claim 41, wherein said modified
polyribonucleotide is formulated in a cationic lipid, cationic
polymer, or nanoemulsion.
44. The therapeutic agent of claim 41, wherein said modified
polyribonucleotide comprises (i) uridine and cytidine; and (ii)
analogs of said uridine and cytidine.
45. The therapeutic agent of claim 44, wherein said modified
polyribonucleotide comprises uridines and cytidines, and 5% to 50%
of the uridines are analogs of uridine and 5% to 50% of the
cytidines are analogs of cytidine.
46. The therapeutic agent of claim 45, wherein said modified
polyribonucleotide comprises uridines and cytidines, and 15% to 30%
of the uridines are analogs of uridine and 15% to 30% of the
cytidines are analogs of cytidine.
47. The therapeutic agent of claim 44, wherein said analogs of
uridine are selected from the group consisting of 2-thiouridine,
5-iodouridine, and 5-methyluridine.
48. The therapeutic agent of claim 44, wherein the modified
polyribonucleotide does not comprise pseudouridine.
49. The therapeutic agent of claim 44, wherein said analogs of
cytidine are selected from the group consisting of
5-methylcytidine, 2'-amino-2'-deoxycytidine,
2'-fluoro-2'-deoxycytidine, and 5-iodocytidine.
50. The therapeutic agent of claim 44, wherein said modified
polyribonucleotide comprises 5-methylcytidine.
51. The therapeutic agent of claim 41, wherein said modified
polyribonucleotide comprises (i) adenosine or guanosine; and (ii)
analogs of said adenosine or guanosine.
52. The therapeutic agent of claim 41, wherein said modified
polyribonucleotide comprises less than 20% analogs of adenosine or
guanosine.
53. The therapeutic agent of claim 52, wherein said modified
polyribonucleotide does not comprise analogs of adenosine or
analogs of guanosine.
54. The therapeutic agent of claim 41, wherein said modified
polyribonucleotide has a transfection efficiency greater than 80%
among cells exposed to said modified polyribonucleotide.
55. The therapeutic agent of claim 41, wherein said at least one
inflammatory marker comprises at least two of TNF-.alpha., IL-6,
IL-8, IL-12, IFN-.alpha., IFN-.beta. and IFN-.gamma..
56. The therapeutic agent of claim 41, wherein said modified
polyribonucleotide comprises a 3' or 5' noncoding region flanking
said sequence which encodes said protein or functional fragment
thereof, wherein said noncoding region aids in said amount of said
protein or functional fragment thereof in said cells for said time
period.
57. The therapeutic agent of claim 41, wherein said modified
polyribonucleotide induces substantially no change in said level of
said at least one inflammatory marker expressed by peripheral blood
mononuclear cells exposed to said modified polyribonucleotide.
58. The therapeutic agent of claim 41, wherein (i) said sequence is
a gene or fragment whose defect or deficiency is associated with a
presence of a disease, or (ii) a lack or deficiency of said protein
or functional fragment is associated with the presence of said
disease.
59. The therapeutic agent of claim 41, wherein said time period is
up to 5 days.
60. A therapeutic agent comprising a modified polyribonucleotide
having a sequence which encodes a protein or functional fragment
thereof, wherein said modified polyribonucleotide comprises a
combination of unmodified and modified nucleotides, which modified
nucleotides comprise analogs of uridine or analogs of cytidine,
wherein: (a) said modified polyribonucleotide lowers an immune
response of a subject by at least 30% as compared to an unmodified
polyribonucleotide encoding said protein or functional fragment
thereof, which immune response is as determined by a level of at
least one inflammatory marker selected from TNF-.alpha., IL-6,
IL-8, IL-12, IFN-.alpha., IFN-.beta. and IFN-.gamma. expressed by
peripheral blood mononuclear cells exposed to said modified
polyribonucleotide as compared to a level of said at least one
inflammatory marker in peripheral blood mononuclear cells in a
control that has been exposed to an unmodified polyribonucleotide
encoding said protein or functional fragment thereof; and (b) said
modified polyribonucleotide provides an amount of said protein or
functional fragment thereof over a time period in cells of said
subject having said modified polyribonucleotide, wherein said time
period is up to 4 weeks, and wherein said amount is increased as
compared to an amount in control cells having said unmodified
polyribonucleotide, as determined by a percentage content of red
fluorescent protein in said cells when said protein or functional
fragment thereof is red fluorescent protein.
61. The therapeutic agent of claim 60, wherein said modified
polyribonucleotide comprises (i) uridine and cytidine; and (ii)
analogs of said uridine and cytidine.
62. The therapeutic agent of claim 61, wherein said modified
polyribonucleotide comprises uridines and cytidines, wherein 5% to
50% of the uridines are analogs of uridine and 5% to 50% of the
cytidines are analogs of cytidine.
63. The therapeutic agent of claim 62, wherein said modified
polyribonucleotide comprises uridines and cytidines, wherein 15% to
30% of the uridines are analogs of uridine and 15% to 30% of the
cytidines are analogs of cytidine.
64. The therapeutic agent of claim 61, wherein said modified
polyribonucleotide comprises 5-methylcytidine.
65. The therapeutic agent of claim 60, wherein said modified
polyribonucleotide comprises less than 20% analogs of adenosine or
guanosine.
66. The therapeutic agent of claim 60, wherein said modified
polyribonucleotide lowers an immune response of said subject by at
least 50% as compared to said unmodified polyribonucleotide.
67. The therapeutic agent of claim 60, wherein said modified
polyribonucleotide comprises a 3' or 5' noncoding region flanking
said sequence which encodes said protein or functional fragment
thereof, wherein said noncoding region aids in said amount of said
protein or functional fragment thereof in said cells for said time
period.
68. The therapeutic agent of claim 60, wherein (i) said sequence is
a gene or fragment whose defect or deficiency is associated with a
presence of a disease, or (ii) a lack or deficiency of said protein
or functional fragment is associated with the presence of said
disease.
69. The therapeutic agent of claim 60, wherein said time period is
up to 5 days.
Description
[0001] The invention relates to a polyribonucleotide, in particular
messenger RNA, which contains a combination of unmodified and
modified nucleotides, for protein expression and the use of such
RNAs for the therapy of diseases and for diagnostic procedures.
[0002] Messenger RNAs (mRNA) are polymers which are built up of
nucleoside phosphate building blocks mainly with adenosine,
cytidine, uridine and guanosine as nucleosides, which as
intermediate carriers bring the genetic information from the DNA in
the cell nucleus into the cytoplasm, where it is translated into
proteins. They are thus suitable as alternatives for gene
expression.
[0003] The elucidation of the biochemical processes in the cell and
the elucidation of the human genome have revealed connections
between deficient genes and diseases. Hence there has long been the
desire to heal diseases due to deficient genes by gene therapy. The
expectations were high, but attempts at this as a rule failed. A
first approach to gene therapy consisted in bringing the intact DNA
of a deficient or defective gene into the cell nucleus in a vector
in order to achieve the expression of the intact gene and thus the
provision of the missing or defective protein. These attempts were
as a rule not successful and the less successful attempts were
burdened with substantial side effects, in particular elevated
tumorigenesis.
[0004] Furthermore, there are diseases which are due to a lack of
proteins or a protein defect, without this being attributable to a
genetic defect. In such a case also, consideration is being given
to producing the relevant proteins in vivo by administration of
DNA. The provision of factors which play a part in the metabolism
and are destroyed or inhibited for pathological or non-pathological
reasons could also be effected by a zero or low side effect nucleic
acid therapy.
[0005] The use has also already been proposed of mRNAs for the
therapy of hereditary diseases in order to treat gene defects which
lead to diseases. The advantage in this is that the mRNA only has
to be introduced into the cytoplasm of a cell, but does not have to
be inserted into the nucleus. Insertion into the nucleus is
difficult and inefficient; moreover there is a considerable risk of
the chromosomal DNA being altered if the vector or parts thereof
become incorporated into the genome.
[0006] Admittedly it could be shown that in vitro transcribed
messenger RNA can in fact be expressed in mammalian tissue, however
further hurdles arose in the attempt to use mRNA for the therapy of
diseases. The lack of stability of the mRNA had the effect that the
desired protein could not be made available in sufficient quantity
in the mammalian tissue. A further substantial disadvantage
resulted from the fact that mRNA triggers considerable
immunological reactions. It is presumed that these strong immune
reactions arise through binding to Toll-like receptors such as
TLR3, TLR7, TLR8 and helicase RIG-1.
[0007] In order to prevent an immunological reaction, it was
proposed in WO 2007/024708 to use RNA wherein one of the four
ribonucleotides is replaced by a modified nucleotide. In
particular, it was investigated how mRNA behaves when the uridine
is totally replaced by pseudouridine. It was found that such an RNA
molecule is significantly less immunogenic. However, the biological
activity of these products was not yet sufficient for successful
therapy. Moreover, it was found that RNA sequences wherein two or
more types of nucleotides are fully replaced by modifications can
only be made with difficulty or not at all.
[0008] In order to be able to provide the body with necessary or
beneficial proteins and/or to treat a disease due to missing or
deficient proteins with nucleic acids, it is desirable to have a
nucleic acid available which can transfect cells, which remains
stable in the cell for long enough and provides a sufficient
quantity of protein, so that excessively frequent administration is
avoided. At the same time, however, this nucleic acid must not
cause immunological reactions to a significant extent.
[0009] Hence a purpose of the present invention was to provide an
agent which is suitable for the therapy of diseases caused by
deficient or defective genes or diseases caused by missing or
defective proteins, or which can in vivo produce necessary or
beneficial proteins, which triggers a markedly diminished or no
immune response, is stable in a physiological environment, i.e. is
not degraded immediately after administration and overall is
suitable as an agent for therapy. Further, it was a purpose of the
invention to provide an agent for the therapy of diseases which can
be positively influenced by in vivo production of proteins.
[0010] This problem is solved with a polyribonucleotide as defined
in claim 1. Particularly suitable is mRNA which encodes a protein
or protein fragment, a defect or lack whereof is disadvantageous to
the body, or expression whereof is of advantage to the body. When
the term "polyribonucleotide" or "mRNA" is used below, unless the
context states otherwise, it should always be assumed that this is
a polyribonucleotide or an mRNA which encodes a protein or protein
fragment which is connected with an illness or lack, as described
above, or encodes a protein or protein fragment which is beneficial
or supportive to the body.
[0011] It has surprisingly been found that the aforesaid problems
can be solved with ribonucleic acid or polyribonucleotides (also
generally referred to below as RNA), in particular with messenger
RNA (mRNA), if an RNA is used which contains both unmodified and
also modified nucleotides, it being essential that a predetermined
content of the uridine and the cytidine nucleotides respectively is
present in modified form.
[0012] Further, it has surprisingly been observed that RNA wherein
two types of nucleotides are each partially replaced with modified
nucleotides shows high translation and transfection efficiency,
i.e. the RNA transfects more cells and produces more of the encoded
protein per cell than was possible with known RNA. In addition, the
RNA modified according to the invention is active for longer than
the RNA or unmodified RNA known from the state of the art.
[0013] The advantages achieved with the RNA according to the
invention are obtained neither with unmodified nor with fully
modified RNA. It has been found that both diminished immunogenicity
and also increased stability can be achieved if the content of
modified uridine and cytidine nucleotides in the mRNA is
specifically set and is at least 5% and not more than 50% for each.
If an mRNA with no modifications is used, this is extremely
immunogenic, while when all uridine and cytidine nucleotides are
present in modified form the biological activity is too low for use
for therapeutic purposes to be possible. RNA in which the content
of modified nucleotides is very high can be produced under very
difficult conditions or not at all. Thus it has been established
that a nucleotide mixture which contains only pseudouridine instead
of uridine and only modified cytosine and/or modified adenosine
cannot yield any RNA sequence. Surprisingly, however, RNA sequences
which are modified in the manner according to the invention can be
produced easily with reasonable efficiency.
[0014] In addition, it has been found that the nature of the
modification is critical. The mRNAs modified according to the
invention show low immunogenicity and have a long lifetime.
[0015] It has been found that the stability of the RNA according to
the invention is markedly increased compared to previously used
nucleic acids. Thus it has been established that the mRNA according
to the invention is detectable 10 days after the transfection in a
quantity 10 times higher than unmodified RNA. As well as high
transfection rates, the increased lifetime above all enables the
use of the mRNA according to the invention for therapeutic
purposes, since the high stability and hence long lifetime makes it
possible to effect administration at longer time intervals which
are thus also acceptable to the patients.
[0016] Thus according to the invention a particularly advantageous
agent for therapeutic purposes is provided. The RNA according to
the invention fulfills the requirements that are placed on a
product to be used in therapy: as RNA it needs only to be
introduced into the cytoplasm and not into the cell nucleus to
develop its activity, the danger of integration into the genome
does not exist, the type of modification according to the invention
largely prevents an immune reaction and in addition the
modification protects the RNA from rapid degradation. Hence with
the RNA according to the invention it is possible to generate or to
regenerate physiological functions in tissues, e.g. to restore in
vivo functions which had failed owing to a deficient or defective
gene, and hence to treat diseases caused by deficient or defective
genes. Further, it has surprisingly been found that
polyribonucleotides according to the invention can favorably
influence diseases in that proteins are produced in vivo which can
directly or indirectly have an influence on the course of the
disease. Hence according to the invention polyribonucleotides can
also be provided which encode factors which are beneficial and
supportive to the body in general or in a specific situation, e.g.
growth factors, angiogenesis factors, stimulators, inducers,
enzymes or other biologically active molecules.
[0017] The invention is explained in more detail in the following
description and the attached diagrams.
[0018] FIGS. 1A-1C show the effect of different nucleotide
modifications on the immunogenicity and stability of various mRNAs.
FIG. 1A is a diagram on which the TNF-.alpha. level after
administration of various RNAs with differently modified
nucleotides is plotted. Unmodified and up to 25% singly modified
RNA leads to a high level of inflammatory markers and shows the
high immunogenicity of this RNA, while for RNA doubly modified
according to the invention the inflammatory markers are present in
tolerable amount. FIGS. 1B and 1C show the biological activity
(transfection efficiency and expression) of mRNA modified in
various ways in human cells and mouse cells as the percentage of
the cells positive for red fluorescing protein (RFP) and the
quantity of RFP per cell. The diagrams show that the proteins
encoded by unmodified, singly modified and completely modified RNA
can only be detected at a lower percentage content, while the RNA
partly doubly modified according to the invention yields
significantly higher quantities of protein owing to its greater
stability.
[0019] FIGS. 2A-2D show the higher stability and longer duration of
expression for multiply modified mRNA. FIGS. 2A and 2B each show
diagrams on which the duration of expression of various modified
and unmodified mRNAs is plotted. FIG. 2C shows data for RNA
immunoprecipitation for unmodified RNA, singly modified RNA and
multiply modified RNA. FIG. 2D shows diagrams in which the
immunogenicity of various mRNAs after in vivo intravenous
administration is plotted. The data show that an RNA doubly
modified according to the invention displays a combination of high
stability and low immunogenicity.
[0020] FIGS. 3A-3I show various test results which were obtained
after intratracheal aerosol application of modified SP-B mRNA in
SP-B conditionally deficient mice. FIG. 3A shows biolumin-escence
images of the lung of mice treated with unmodified RNA and multiply
modified RNA. It can clearly be seen that a sufficient quantity of
protein is still also expressed after 5 days only by RNA modified
according to the invention, while with unmodified RNA the
expression is already low after 3 hours. FIG. 3B shows a diagram in
which the flux is plotted against the time after transfection. It
can clearly be discerned that the modification according to the
invention prolongs the duration of expression. FIG. 3C shows the
dosing scheme for SP-B mRNA. FIG. 3D shows a diagram which presents
the survival rate for mice which were treated with modified mRNA
compared to mice which were treated with control mRNA, the survival
rate in mice treated with RNA according to the invention being
markedly longer. FIG. 3E shows an immunostaining in which it can be
seen that with RNA according to the invention which encodes SP-B
the SP-B in SP-B deficient mice could be reconstituted. FIG. 3F
shows as the result of a semi-quantitative Western blot analysis
the distribution of proteins in cell-free BALF supernatant. FIGS.
3G and H show images of lung histology preparations and
bronchoalveolar lavage preparations from mice treated according to
3C. While lung and lavage preparations from mice which had received
control RNA showed the lung damage usual for SP-B deficiency, the
preparations from mice treated with RNA according to the invention
were non-pathological. FIG. 3I shows a diagram concerning the lung
tolerance over time. The lung function was retained over a longer
period on treatment with RNA according to the invention, while lung
damage was found in animals treated with control RNA.
[0021] FIG. 4 shows a diagram in which the fluorescence intensity
of the RFP produced was plotted against time for unmodified and
differently modified mRNAs. The modified mRNA is translated later
and less strongly compared to the unmodified mRNA.
[0022] FIG. 5 shows three diagrams in which inflammatory markers
for mice treated with different mRNAs are plotted. It can clearly
be discerned that RNA modified according to the invention causes no
inflammatory reactions, while unmodified RNA leads to a strong
immune reaction.
[0023] FIG. 6 shows diagrams in which different typical lung
parameters are plotted for mice treated with different mRNAs
according to the invention. The parameters are tissue elasticity
(HL), tissue damping (GL), tissue inertia, airway resistance (Rn)
and lung tissue composition Eta (GL/HL). For the RNAs according to
the invention, none of the parameters was worsened compared to the
positive control group.
[0024] FIG. 7 shows the expression capacity of differently modified
mRNA in a diagram in which the percentage content of RFP positive
cells is plotted for mRNA with a different content of modified
nucleotides. The comparison shows that only mRNA modified according
to the invention leads to long-lasting expression, while mRNA
modified not according to the invention expresses to a lesser
extent both in human cells and also in mouse cells.
[0025] FIG. 8 shows the expression capacity of differently modified
mRNA in a diagram in which the percentage content of RFP positive
cells is plotted for mRNA with differently modified nucleotides.
The comparison shows that only mRNA modified according to the
invention leads to long-lasting expression, while mRNA modified not
according to the invention expresses to a lesser extent both in
human cells and also in mouse cells.
[0026] FIG. 9 shows the stability of freeze-dried RNA according to
the invention.
[0027] FIG. 10A shows a diagram in which the transfection
efficiency is plotted for various modified nucleotides. It can
clearly be discerned that the highest transfection efficiency is
attained with RNA wherein 10% of the uridine nucleotides and 10% of
the cytidine nucleotides and optionally also 5% of further
nucleotides are modified. FIG. 10B shows a diagram in which the
TNF-.alpha. production as a marker for the immunological reaction
is plotted for RNA with differently modified nucleotides. These are
the results of an ELISA of human PBMCs which were each transfected
with 5 .mu.g of mRNA. Unless otherwise stated, the modification
rate was 10% in each.
[0028] It is clearly discernible that RNA wherein between 5 and 50%
of the uridine nucleotides and cytidine nucleotides are modified
has a markedly reduced immunogenicity compared to unmodified
RNA.
[0029] FIGS. 11A-11D show the results of various tests with which
the stability and immunogenicity of mRNA modified according to the
invention, which encodes EPO, was measured. FIG. 11A shows the
content of erythropoietin which is detectable 14 days after
administration of mRNA encoding EPO which is modified in different
ways. It is clearly discernible that after 14 days the content of
EPO in mice into which mRNA modified according to the invention was
injected is 4.8 times higher than in untreated mice, but also 4.8
times higher than in mice treated with unmodified RNA and is still
2.5 times higher than in mice treated with singly modified RNA.
[0030] FIG. 11B shows hematocrit values 14 days and 28 days after
administration of EPO-encoding mRNA with different modifications.
The diagram clearly shows that mice treated with mRNA modified
according to the invention have a considerably higher hematocrit
value.
[0031] In the diagrams of FIG. 11C the production of the factors
typical for an immunological reaction is plotted. It is found that
all four inflammatory markers are elevated with the administration
of unmodified mRNA, while with RNA modified according to the
invention an immunological reaction is hardly detectable.
[0032] The diagrams of FIG. 11D show the corresponding values for
IFN-.alpha. and IL-12, which are also inflammatory markers. Here
also it is found that mRNA modified according to the invention
causes practically no immunological reaction, in contrast to
unmodified mRNA.
[0033] FIG. 12 shows a diagram in which the survival rate of three
groups of mice which were given SP-B mRNA modified according to the
invention twice in one week (B) or twice a week for 28 days (C), or
in the comparison group modified EGFPLuc mRNA (A) is plotted. It is
found that the mice only survive as long as they are given SP-B
mRNA (B, C). Without provision of SP-B mRNA, the mice die (A).
[0034] FIG. 13 shows cytokine levels in the bronchoalveolar lavage
of mice 8 hours after administration of unmodified SP-B mRNA, SP-B
mRNA modified according to the invention or SP-B plasmid DNA. The
results show that in contrast to the intratracheal administration
of unmodified mRNA or plasmid DNA, which each lead to a marked rise
in the inflammatory markers IFN.gamma. and IL-12, on administration
of SP-B mRNA modified according to the invention the inflammatory
markers are practically not elevated compared to the untreated
group or to the group treated with perfluorocarbon.
[0035] FIG. 14 shows hematocrit values as obtained after repeated
administration of mEPO mRNA modified according to the invention.
The results show that the repeated administration of mEPO mRNA
modified according to the invention is well tolerated and results
in long-persisting elevation of the hematocrit.
[0036] FIG. 15 shows the luciferase expression of cells which were
incubated with titanium implants which were provided with coatings
containing different forms of RNA modified according to the
invention. It was found that RNA modified according to the
invention which was contained in a coating of delayed release
polymer which had been applied onto titanium plates and which was
gradually released therefrom did not lose its activity.
[0037] FIG. 16 shows the luciferase expression for coatings applied
onto titanium implants which contained modified mRNA. It was found
that the protein expression for mRNA modified according to the
invention was far higher than for untreated RNA, but was also
higher than for plasmid DNA.
[0038] FIGS. 17A and 17B respectively show the relative content of
RFP-positive cells and the relative RFP expression of mRNA which
has micro-RNA binding sites for micro-RNA 142-3p. It was found that
the content of RFP-positive cells for RNA having micro-RNA binding
sites was lower and the expression of the encoded protein was
considerably lower in the cells which contained the corresponding
micro-RNA 142-3p.
[0039] FIG. 18 shows the sequence of an RNA modified by
incorporation of micro-RNA binding sites, which encodes RFP. The
RFP sequence is shown with a gray background. The fourfold tandem
repetition of the micro-RNA binding site for the micro-RNA 142-3p
(with light gray background) with the spacing sequences (no
background) is underlined.
[0040] According to the invention, a polyribonucleotide molecule
with partially multiply modified nucleotides, a partially multiply
modified mRNA, an IVT mRNA, and the use of the RNA molecules for
the production of a drug for the treatment of diseases due to
deficient or defective genes or for the treatment of diseases which
can be moderated or cured by the provision of proteins in vivo,
such as factors, stimulators, inducers or enzymes, are provided. In
a further embodiment, the mRNA according to the invention is
combined with target binding sites, targeting sequences and/or with
micro-RNA binding sites, in order to allow activity of the desired
mRNA only in the relevant cells. In a further embodiment, the RNA
according to the invention is combined with micro-RNAs or shRNAs
downstream of the 3' polyA tail. In a further embodiment, RNA whose
duration of action has been adjusted or extended by further
specific modifications is provided.
[0041] Thus a subject of the invention is an RNA with increased
stability and decreased immunogenicity. The RNA according to the
invention can be made in a manner known per se. As a rule it is
made by transcription of a DNA which encodes the intact or desired
protein which can influence an illness or the lack or deficient
form whereof causes a disease.
[0042] In the context of the present invention, RNA should be
understood to mean any polyribonucleotide molecule which, if it
comes into the cell, is suitable for the expression of a protein or
fragment thereof or is translatable to a protein or fragment
thereof. The term "protein" here encompasses any kind of amino acid
sequence, i.e. chains of two or more amino acids which are each
linked via peptide bonds and also includes peptides and fusion
proteins.
[0043] The RNA according to the invention contains a ribonucleotide
sequence which encodes a protein or fragment thereof whose function
in the cell or in the vicinity of the cell is needed or beneficial,
e.g. a protein the lack or defective form whereof is a trigger for
a disease or an illness, provision whereof can moderate or prevent
a disease or an illness, or a protein which can promote a process
which is beneficial for the body, in a cell or its vicinity. As a
rule, the RNA according to the invention contains the sequence for
the complete protein or a functional variant thereof. Further, the
ribonucleotide sequence can encode a protein which acts as a
factor, inducer, regulator, stimulator or enzyme, or a functional
fragment thereof, where this protein is one whose function is
necessary in order to remedy a disorder, in particular a metabolic
disorder or in order to initiate processes in vivo such as the
formation of new blood vessels, tissues, etc. Here, functional
variant is understood to mean a fragment which in the cell can
undertake the function of the protein whose function in the cell is
needed or the lack or defective form whereof is pathogenic. In
addition, the RNA according to the invention can also have further
functional regions and/or 3' or 5' noncoding regions. The 3' and/or
5' noncoding regions can be the regions naturally flanking the
encoded protein or else artificial sequences which contribute to
the stabilization of the RNA. Those skilled in the art can discover
the sequences suitable for this in each case by routine
experiments.
[0044] In a preferred embodiment, the RNA contains an m7GpppG cap,
an internal ribosome entry site (IRES) and/or a polyA tail at the
3' end in particular in order to improve translation. The RNA can
have further regions promoting translation. Critical for the RNA
according to the invention is its content of modified
nucleotides.
[0045] An RNA according to the invention with increased stability
and diminished immunogenicity is obtained by using for the
production thereof a nucleotide mixture wherein the content of the
modified cytidine nucleotides and the modified uridine nucleotides
is set. The RNA according to the invention is preferably produced
with a nucleotide mixture which contains both unmodified and also
modified nucleotides, where 5 to 50% of the cytidine nucleotides
and 5 to 50% of the uridine nucleotides are modified. The
adenosine- and guanosine-containing nucleotides can be unmodified.
A nucleotide mixture can also be used wherein some of the ATPs
and/or GTPs are also modified, where their content should not
exceed 20% and where their content, if present, should preferably
lie in a range from 0.5 to 10%.
[0046] Hence in a preferred embodiment an mRNA is provided which
has 5 to 50% of modified cytidine nucleotides and 5 to 50% of
uridine nucleotides and 50 to 95 of unmodified cytidine nucleotides
and 50 to 95% of unmodified uridine nucleotides, and the adenosine
and guanosine nucleotides can be unmodified or partially modified,
and they are preferably present in unmodified form.
[0047] Preferably 10 to 35% of the cytidine and uridine nucleotides
are modified and particularly preferably the content of the
modified cytidine nucleotides lies in a range from 7.5 to 25% and
the content of the modified uridine nucleotides in a range from 7.5
to 25%. It has been found that in fact a relatively low content,
e.g. only 10% each, of modified cytidine and uridine nucleotides
can achieve the desired properties, under the precondition that
these are the modifications according to the invention.
[0048] The nature of the modification of the nucleosides has an
effect on the stability and hence the lifetime and biological
activity of the mRNA. Suitable modifications are set out in the
following table:
TABLE-US-00001 Base Sugar modifi- modifi- cation cation Naturally
(5- (2'- in Name position) position) mRNA Uridine 5-methyluridine
CH.sub.3 -- no 5'-triphosphate (m5U) 5-idouridine I -- no
5'-triphosphate (I5U) 5-bromouridine Br -- no 5'-triphosphate
(Br5U) 2-thiouridine S -- no 5'-triphosphate (S4U) (in 2 position)
4-thiouridine S -- no 5'-triphosphate (S2U) (in 4 position)
2'-methyl-2'-deoxyuridine -- CH.sub.3 yes 5'-triphosphate (U2'm)
2'-amino-2'-deoxyuridine -- NH.sub.2 no 5'-triphosphate (U2'NH2)
2'-azido-2'-deoxyuridine -- N.sub.3 no 5'-triphosphate (U2'N3)
2'-fluoro-2'-deoxyuridine -- F no 5'-triphosphate (U2'F) Cytidine
5-methylcytidine CH.sub.3 -- yes 5'-triphosphate (m5C)
5-idocytidine I -- no 5'-triphosphate (I5U) 5-bromocytidine Br --
no 5'-triphosphate (Br5U) 2-thiocytidine S -- no 5'-triphosphate
(S2C) (in 2 position) 2'-methyl-2'-deoxycytidine -- CH.sub.3 yes
5'-triphosphate (C2'm) 2'-amino-2'-deoxycytidine -- NH.sub.2 no
5'-triphosphate (C2'NH2) 2'-azido-2'-deoxycytidine -- N.sub.3 no
5'-triphosphate (C2'N3) 2'-fluoro-2'-deoxycytidine -- F no
5'-triphosphate (C2'F) Adenosine N6-methyladenosine CH.sub.3 -- yes
5'-triphosphate (m6A) (in 6 position) N1-methyladenosine CH.sub.3
-- no 5'-triphosphate (m1A) (in 1 position) 2'-O-methyladenosine --
CH.sub.3 yes 5'-triphosphate (A2'm) 2'-amino-2'-deoxyadenosine --
NH.sub.2 no 5'-triphosphate (A2'NH2) 2'-azido-2'-deoxyadenosine --
N.sub.3 no 5'-triphosphate (A2'N3) 2'-fluoro-2'-deoxyadenosine -- F
no 5'-triphosphate (A2'F) Guanosine N1-methylguanosine CH.sub.3 --
no 5'-triphosphate (m1G) (in 1 position) 2'-O-methylguanosine --
CH.sub.3 yes 5'-triphosphate (G2'm) 2'-amino-2'-deoxyguanosine --
NH.sub.2 no 5'-triphosphate (G2'NH2) 2'-azido-2'-deoxyguanosine --
N.sub.3 no 5'-triphosphate (G2'N3) 2'-fluoro-2'-deoxyguanosine -- F
no 5'-triphosphate (G2'F)
[0049] For the RNA according to the invention, either all uridine
nucleotides and cytidine nucleotides can each be modified in the
same form or else a mixture of modified nucleotides can be used for
each. The modified nucleotides can have naturally or not naturally
occurring modifications. A mixture of various modified nucleotides
can be used. Thus for example one part of the modified nucleotides
can have natural modifications, while another part has
modifications not occurring naturally or a mixture of naturally
occurring modified and/or not naturally occurring modified
nucleotides can be used. Also, a part of the modified nucleotides
can have a base modification and another part a sugar modification.
In the same way, it is possible that all modifications are base
modifications or all modifications are sugar modifications or any
suitable mixture thereof. By variation of the modifications, the
stability and/or duration of action of the RNA according to the
invention can be selectively adjusted.
[0050] In one embodiment of the invention, at least two different
modifications are used for one type of nucleotide, where one type
of the modified nucleotides has a functional group via which
further groups can be attached. Nucleotides with different
functional groups can also be used, in order to provide binding
sites for the attachment of different groups. Thus for example a
part of the modified nucleotides can bear an azido group, an amino
group, a hydroxy group, a thiol group or some other reactive group
which is suitable for reaction under predefined conditions. The
functional group can also be such that it can under certain
conditions activate a naturally present group capable of binding,
so that molecules with functions can be coupled. Nucleotides which
are modified so that they provide binding sites can also be
introduced as adenosine or guanosine modifications. The selection
of the particular suitable modifications and the selection of the
binding sites to be made available depends on what groups are to be
introduced and with what frequency these are to be present. Thus
the content of the nucleotides provided with functional and/or
activating groups depends on how high the content of groups to be
coupled is to be and can easily be determined by those skilled in
the art. As a rule, the content of nucleotides modified with
functional and/or activating groups, if present, is 1 to 25% of the
modified nucleotides. Those skilled in the art can if necessary
determine the most suitable groups in each case and the optimal
content thereof by routine experiments.
[0051] It has been found that particularly good results can be
achieved when the RNA according to the invention 2'-thiouridine as
a modified uridine-containing nucleotide. Furthermore, it is
preferred that the RNA according to the invention contains
5'-methylcytidine as a modified cytidine nucleotide. These two
nucleotides are therefore preferred. Also preferred is a
combination of these two modifications. In an especially preferred
embodiment, these two nucleotides are each present at a content of
10 to 30%. Nucleotides modified in another way can optionally also
be present, as long as the total content of modified nucleotides
does not exceed 50% of the particular nucleotide type.
[0052] Preferred is a polyribonucleotide wherein 5 to 50%,
particularly preferably 5 to 30% and in particular 7.5 to 25% of
the uridine nucleotides are 2'-thiouridine nucleotides, and 5 to
50%, particularly preferably 5 to 30% and in particular 7.5 to 25%
of the cytidine nucleotides are 5'-methylcytidine nucleotides,
where the adenosine and guanosine nucleotides can be unmodified or
partially modified nucleotides. In a preferred embodiment, this
mRNA according to the invention additionally has a
7'-methylguanosine cap and/or a poly(A) end. Thus in a preferred
embodiment the mRNA is produced in its mature form, i.e. with a
GppG cap, an IRES and/or a polyA tail.
[0053] The optimal types and contents of modified uridine
nucleotides and cytidine nucleotides for a specific RNA can be
determined with routine experiments. In this context an mRNA whose
immunogenicity is so low that the treated organism is not stressed
and which has a predetermined stability and hence predetermined
duration of expression is described as optimal. Methods for the
testing and determination of these properties are known to those
skilled in the art and are described below and in the examples.
[0054] The RNA according to the invention can be produced in a
manner known per se. A method wherein the mRNA according to the
invention is produced by in vitro transcription from a mixture of
ATP, CTP, GTP and UTP, wherein 5 to 50%, preferably 5 to 30% and in
particular 7.5 to 25% of the cytidine nucleotides and 5 to 50%,
preferably 5 to 30% and in particular 7.5 to 25% of the uridine
nucleotides are modified and the rest is unmodified is for example
suitable. Guanosine and adenosine nucleosides, in particular
adenosine, can optionally also be modified. However, the
modification of UTP and CTP in the stated range is essential for
the invention. If the content of modified UTP and/or modified CTP
is lower or higher, the advantageous properties are no longer
achieved. Thus it has been found that outside the claimed ranges
the mRNA is no longer so stable. Moreover, with a lower content of
modification immunological reactions are to be expected. In order
to set the suitable ratio of unmodified and modified nucleotides,
the RNA is appropriately made using a nucleotide mixture, the
nucleoside contents whereof are partly modified and partly
unmodified in accordance with the desired ratio, where according to
the invention at least 5% of the uridine nucleosides and at least
54 of the cytidine nucleosides are modified, but in total not more
than 50% of uridine nucleosides and cytidine nucleosides
respectively are modified. Further nucleosides, i.e. adenosine and
guanosine, can be modified, however an upper limit of 50%
modification, preferably 20%, should also not be exceeded for these
nucleosides. Preferably only the appropriate contents of the
uridine nucleosides and cytidine nucleosides are modified.
[0055] The nucleosides to be modified can have modifications such
as are also to be found in naturally occurring nucleosides, e.g.
methylations or binding variations, but also "synthetic", i.e. not
occurring in nature, modifications or a mixture of nucleosides with
natural and/or synthetic modifications can be used. Thus naturally
modified nucleosides of at least one type can be combined with
synthetically modified nucleosides of the same type or another type
or else naturally and synthetically modified nucleosides of one
type with only naturally, only synthetically or mixed
naturally/synthetically modified nucleosides of another type, where
"type" here refers to the type of the nucleosides, i.e. ATP, GTP,
CTP or UTP. In many cases, as stated above, for the improvement of
immunogenicity and stability or for adjustment of properties it can
be beneficial to combine modified nucleosides with functional
groups, which provide binding sites, with non-functionally modified
nucleosides. The most suitable type or combination can easily be
found by those skilled in the art by routine experiments such as
are for example also stated below. Particularly preferably,
2-thiouridine and 5-methylcytidine are used as modified
nucleosides. If functionally modified nucleosides are desired,
2'-azido and 2'-amino nucleosides are preferably considered.
[0056] The length of the mRNA used according to the invention
depends on the gene product or protein or protein fragment which is
to be provided or supplemented. Hence the mRNA can be very short,
e.g. have only 20 or 30 nucleotides, or else corresponding to the
length of the gene have several thousand nucleotides. Those skilled
in the art can select the suitable sequence each time in the usual
way.
[0057] What is essential is that the function of the protein
causing a disease, of the protein moderating or preventing a
disease or of the protein controlling a beneficial property, for
which the mRNA is to be used, can be provided.
[0058] 2'-Thiouridine is preferably used as the modified
uridine-containing nucleotide for the production of the RNA
according to the invention. Furthermore, it is preferable to use
5'-methylcytidine as the modified cytidine nucleotide. Hence for
the production of the RNA according to the invention a nucleotide
mixture which as well as ATP and GTP respectively contains 95 to
50% of unmodified CTP and 95 to 50% of unmodified UTP and 5 to 50%
of 2'-thiouridine nucleotides and 5 to 50% of methylcytidine
nucleotides is preferably used. Hence a polyribonucleotide wherein
5 to 50%, preferably 5 to 30% and in particular 7.5 to 25% of the
uridine nucleotides are 2'-thiouridine nucleotides and 5 to 50%,
preferably 5 to 30% and in particular 7.5 to 25% of the cytidine
nucleotides are 5'-methylcytidine nucleotides and the adenosine and
guanosine nucleotides are unmodified nucleotides is particularly
preferred. Such a combination leads to the production of a
partially modified RNA which is characterized by particularly high
stability. It could be shown that RNA which was produced with a
nucleotide mixture which as CTP and UTP contained 5 to 50% of
2-thiouridine and 5-methylcytidine nucleotides respectively is
especially stable, i.e. had a lifetime increased up to 10-fold
compared to unmodified RNA or RNA modified in known manner.
[0059] In a further preferred embodiment, 1 to 50%, preferably 2 to
25%, of the 5 to 50% modified uridine or cytidine nucleotides are
nucleotides which have binding site-creating or activating groups
as a modification, i.e. 0.5 to 20%, preferably 1 to 10%; of the
cytidine nucleotides and/or uridine nucleotides can have a
modification which creates a binding site, such as for example
azido, NH, SH or OH groups. Through this combination, an RNA which
is both particularly stable and also versatile is provided.
[0060] Further, it is preferred that the polyribonucleotide
molecule built up of unmodified and modified nucleotides has a
7'-methylguanosine cap and/or a poly(A) end. In addition, the RNA
can also have additional sequences, e.g. non-translated regions and
functional nucleic acids, such as are well known to those skilled
in the art.
[0061] The RNA according to the invention is preferably provided as
in vitro transcribed RNA (IVT RNA). The materials necessary for
performing the in vitro transcription are known to those skilled in
the art and available commercially, in particular buffers, enzymes
and nucleotide mixtures. The nature of the DNA used for the
production of the RNA according to the invention is also not
critical; as a rule it is cloned DNA.
[0062] As stated above, an RNA, in particular mRNA, which has a
predetermined content of modified uridine nucleosides and modified
cytidine nucleosides is provided. The optimal content of modified
uridine nucleosides and cytidine nucleosides for a specific mRNA
can be determined by routine experiments which are well known to
those skilled in the art.
[0063] The RNA according to the invention is preferably used for
the therapy of diseases or for the provision of proteins beneficial
to the body. When the RNA according to the invention is used for
the therapy of diseases, it preferably has the in vitro transcript
for a protein or protein fragment, a defect or lack whereof leads
to a disease condition or the provision whereof leads to the
moderation of an illness. For the production of the RNA according
to the invention, a DNA is preferably used which encodes a protein
or protein fragment, a defect or lack whereof leads to a disease or
is connected with an illness. In one embodiment, the DNA of a gene,
a defect or lack whereof leads to a disease or illness, is used for
the production of the RNA according to the invention. In another
embodiment, a DNA which encodes a protein the presence, perhaps
temporary, whereof is beneficial or curative for an organism is
used for the production of the RNA according to the invention. Here
any state wherein physical and/or mental/psychological disorders or
changes are subjectively and/or objectively present, or where the
abnormal course of physical, mental or psychological processes
makes medical care necessary and may lead to inability to work is
regarded as a disease or illness.
[0064] Here a protein or protein fragment the presence whereof can
moderate an illness or be beneficial or supportive to the body are
understood to mean proteins or protein fragments which, without a
genetic defect being present, are to be made fully or temporarily
available to the body since they are missing either because of
disorders of some kind or because of natural circumstances or
because they can benefit the body under certain conditions, e.g. in
the treatment of defects or in the context of implantation. These
also include altered forms of proteins or protein fragments, i.e.
forms of proteins which alter in the course of the metabolism, e.g.
matured forms of a protein, etc. Proteins which play a part in
growth processes and angiogenesis, which are for example necessary
in controlled regeneration and can then be formed specifically by
introduction of the mRNA according to the invention, can also be
provided. This can for example be useful in growth processes or for
the treatment of bone defects, tissue defects and in the context of
implantation and transplantation.
[0065] It has been found that the mRNA modified according to the
invention can advantageously be used in order to promote the
ingrowth of implanted prostheses. If it is available on the surface
of prostheses to be inserted such as tooth implants, hip
endoprostheses, knee endoprostheses or vertebral fusion bodies, the
mRNA according to the invention can release factors which can
promote the ingrowth, new formation of blood vessels and other
functions which are necessary for the newly inserted prostheses.
Thus for example the administration of biologically active
substances such as growth factors such as BMP-2 or angiogenesis
factors in the context of implantation of prostheses or thereafter
is known. Since biological substances very often have extremely
short half-lives, it was previously necessary to use very high
dosages, which burdens the patient with severe side effects.
According to the invention, this disadvantage is avoided since
using the RNA according to the invention the desired and/or needed
proteins can be used selectively and suitably dosed. This decreases
or even completely spares the patient the side effects. In this
embodiment, the RNA according to the invention which encodes
desired and/or needed substances such as growth factors,
angiogenesis factors etc. can be applied onto the implant in a
coating releasing the RNA in a measured manner and then released
gradually therefrom in a measured manner, so that the cells in the
vicinity of the implant can continuously or intermittently produce
and if necessary release the desired factors. Carriers, as a rule
biocompatible, synthetic, natural or mixed natural-synthetic
polymers, the release properties whereof can be specifically
adjusted, are well known and thus need no more detailed explanation
here. Polylactide or polylactide/glycolide polymers are for example
used. In this way it is possible selectively to release the desired
factors continuously, intermittently, over a longer or shorter time
and at the desired site.
[0066] In the context of the present invention, a deficient or
defective gene or deficiency or lack are understood to mean genes
which are not expressed, incorrectly expressed or not expressed in
adequate quantity and as a result cause diseases or illnesses, e.g.
by causing metabolic disorders.
[0067] The RNA according to the invention can appropriately be used
in any case where a protein, which would naturally be present in
the body but is not present or is present in deficient form or in
too small a quantity because of gene defects or diseases, is to be
provided to the body. Proteins and the genes encoding them, the
deficiency or defect whereof are linked with a disease, are known.
Various proteins and genes in case of a lack whereof the RNA
according to the invention can be used are listed below.
TABLE-US-00002 TABLE 2 Diseases for which the administration of
mRNA according to the invention can be indicated: Organ Defect Lung
surfactant protein B deficiency Lung ABCA3 deficiency Lung cystic
fibrosis Lung alpha-1 antitrypsin deficiency Plasma proteins
clotting defects such as hemophilia A and B Plasma proteins
complement defects such as protein C deficiency Plasma proteins
thrombotic thrombocytopenic purpura (TPP, ADAMTS 13 deficiency)
Plasma proteins congenital hemochromatoses (e.g. hepcidin
deficiency) Severe combined immunodeficiencies (SCID) (T, B and NK
cells) X-chromosomally inherited combined immunodificiencies
(X-SCID) ADA-SCID (SCID due to lack of adenosine deaminase) SCID
with RAG1 mutation SCID with RAG2 mutation SCID with JAK3 mutation
SCID with IL7R mutation SCID with CD45 mutation SCID with
CD3.delta. mutation SCID with CD3.epsilon. mutation SCID with
purine nucleoside phosphorylase deficiency (PNP deficiency) Septic
granulomatoses (granulocytes) Disease Defect or mutation
X-chromosomal recessive CGD mutation of the gp91-phox gene CGD
cytochrome b positive tvpe 1 mutation of the p47-phox gene CGD
cytochrome b positive type 2 mutation of the p67-phox gene CGD
cytochrome b negative mutation of the p22-phox gene Other storage
diseases mutation in the Gaucher's disease glucocerebrosidase gene
mutation in the GALC gene Krabbe's disease lysosomal storage
diseases mucopolysaccharidoses Glycogen storage diseases Type
Defect Specific name I (a-d) Ia: glucose-6-phosphatase Von Gierke's
Ib, Ic, Id: glucose-6-phosphate disease translocase II lysosomal
.alpha.-glucosidase Pompe's disease III glycogen debranching enzyme
Cori's disease IV 1,4-.alpha.-glucan branching enzyme Andersen's
disease V muscle glycogen phosphorylase McArdle's disease VI
glycogen phosphorylase/ Hers disease phosphorylase kinase system
(liver and muscle) VII phosphofructokinase (muscle) Tarui's disease
VIII liver phosphorylase IX (a-c) liver phosphoryiase X cAMP-act.
phosphotylase XI GLUT-2 defect Fanconi-Bickel syndrome 0 UDP
glycogen synthase Other storage diseases mutation in the Gaucher's
disease glucocerebrosidase gene Krabbe's disease mutation in the
GALC gene mucopolysaccharidoses lysosomal storage diseases
Other diseases based on defective genes are stated below:
TABLE-US-00003 Type Variant Clinical features Defective enzyme I-H
Hurler- dysmorphia (gargoylism), .alpha.-L-iduronidase Pfaundler
syndrome cognitive retardation, skeletal malformation (dysostosis),
corneal clouding, decreased growth, hernias, hepatomegaly I-S
Scheie's disease not mentally retarded, .alpha.-L-iduronidase
skeletal malformation (dysostosis), corneal clouding, heart valve
faults I-H/S Hurler/Scheie variants mentally between I-H and I-S
.alpha.-L-iduronidase II Hunter's syndrome moderate cognitive
retardation, iduronate sulfate skeletal malformation (dysostosis),
silfatase considerable somatic changes, premature deafness III
Sanfilippo type A cognitive retardation, dysmorphia, heparan
sulfate syndrome corneal clouding can be lacking, sulfamidase type
B frequently hearing impairment, .alpha.-N-acetylglucose rapid
progression amidase type C acetyl-CoA; .alpha.- glucosaminid-N-
acetyl transferase type D N-acetylglucosamine- 6-sulfate sulfatase
IV Morquio type A normal cognitive development,
N-acetylglucosamine- syndrome skeletal malformation (dysostosis)
6-sulfate sulfatase very marked, no corneal clouding type B mild
form of type A .beta.- galactosidase V now; type I-S, see above VI
Maroteaux- normal cognitive development, N-acetylgalactos- Lasny
syndrome severe skeletal malformation amine-4-sulfate (dysostosis),
corneal clouding, sulfatase decreased growth VII Sly syndrome
moderate dysmorphia and skeletal .beta.-glucuronidase
malformations, corneal clouding, normal to limited intelligence
[0068] Thus the above table shows examples of genes in which a
defect leads to a disease which can be treated by transcript
replacement therapy with the RNA according to the invention. In
particular here, hereditary diseases can be mentioned which for
example affect the lungs, such as SPB deficiency, ABCA3 deficiency,
cystic fibrosis and al-antitrypsin deficiency, which affect plasma
proteins and cause clotting defects and complement defects, immune
defects such as for example SCID, septic granulomatosis and storage
diseases. In all these diseases, a protein, e.g. an enzyme, is
defective, which can be treated by treatment with the RNA according
to the invention, which makes the protein encoded by the defective
gene or a functional fragment thereof available.
[0069] Thus, examples of proteins which can be encoded by the RNA
according to the invention are erythropoietin (EPO), growth hormone
(somatotropin, hGH), cystic fibrosis transmembrane conductance
regulator (CFTR), growth factors such as GM-SCF, G-CSF, MPS,
protein C, hepcidin, ABCA3 and surfactant protein B. Further
examples of diseases which can be treated with the RNA according to
the invention are hemophilia A/B, Fabry's disease, CGD, ADAMTS13,
Hurler's disease, X chromosome-mediated A-.gamma.-globulinemia,
adenosine deaminase-related immunodeficiency and respiratory
distress syndrome in the newborn, which is linked with SP-B.
Particularly preferably, the mRNA according to the invention
contains the sequence for surfactant protein B (SP-B) or for
erythropoietin. Further examples of proteins which can be encoded
by RNA modified according to the invention are growth factors such
as BMP-2 or angiogenesis factors.
[0070] A further use field for the RNA according to the invention
arises for diseases or illnesses wherein proteins are no longer or
not formed in the body, e.g. because of organ failure. At present,
a recombinant protein is administered for replacement in such
diseases. According to the invention, RNA is now provided for this
so that the replacement of the missing protein can take place at
the level of the transcript. This has several advantages. If the
protein has glycosylations, then the replacement at the transcript
level has the effect that the glycosylation typical in humans takes
place in the body. With proteins that are recombinant, i.e.
normally produced in microorganisms, the glycosylation is as a rule
different from that in the body where replacement is to be
effected. This can lead to side effects. Generally it can be
assumed that the protein expressed from the RNA according to the
invention is identical with the endogenous protein as regards
structure and glycosylation, which is as a rule not the case with
recombinant proteins.
[0071] Examples of proteins replacement or introduction whereof can
be desirable are functional proteins such as erythropoietin and
growth factors such as somatotropin (hGH), G-CSF, GM-CSF and
thrombopoietin.
[0072] A further field in which the RNA according to the invention
can be used is the field of regenerative medicine. Through disease
processes or through aging, degenerative diseases arise which can
be treated and moderated or even cured by introduction of proteins
produced too little or not at all owing to the disease or aging
processes. By introduction of the relevant RNA encoding these
proteins, the degenerative process can be halted or regeneration
can even be initiated. Examples of this are growth factors for
tissue regeneration which can be used e.g. in growth disorders, in
degenerative diseases such as osteoporosis, arthrosis or impaired
wound healing. Here the RNA according to the invention offers not
only the advantage that the missing protein can be provided
selectively and in the correct dosage but in addition it is
possible to provide the protein in a time window. Thus for example
with impaired wound healing, the relevant healing factor or growth
factor can be provided for a limited time by dosed administration
of the RNA. In addition, via mechanisms to be explained later, it
can be arranged that the RNA is selectively brought to the site of
its desired action.
[0073] Examples of factors which can be expressed with the RNA
according to the invention so as to have a regenerative action are
fibroblast growth factor (FGF), e.g. FGF-1-23, transforming growth
factor (TGF), e.g. TGF-.alpha. and TGF-.beta., BMPs (bone
morphogenetic protein), e.g. BMP1 to 7, 8a & b, 10 & 15,
platelet-derived growth factor (PDGF), e.g. PDGF-A, PDGF-B, PDGF-C
and PDGF-D, epidermal growth factor (EGF), granulocyte-macrophage
colony stimulating factor (GM-CSF), vascular endothelial growth
factor (VEGF-A to F and PIGF), insulin-like growth factors, e.g.
IgF1 and IgF2, hepatocyte growth factor (HGF), interleukins, e.g.
interleukin-1B, IL-8 and IL-1 to 31, nerve growth factor (NGF) and
other factors which stimulate the formation of erythrocytes,
neutrophils, blood vessels, etc.
[0074] The RNA according to the invention can also be selectively
used in the field of cancer diseases. Through the expression of
tailor-made T cell receptors in T lymphocytes which recognize
specific tumor-associated antigens, these can become still more
effective. It has already been shown that in principle mRNA can be
successfully used in this field. However until now its use was
prevented by the immunogenic effects already described above. With
the less immunogenic and highly stable RNA provided according to
the invention, it is now possible to express T cell receptors
appropriately.
[0075] RNA according to the invention can also be used to express
transcription factors which ensure that somatic cells are
reprogrammed into embryonic stem cells. Examples of this are
O-cp3/4, Sox2, KLF4 and c-MYC. Stable RNA, especially mRNA,
according to the invention which encodes these transcription
factors can thus lead to the production of stem cells without
creating the side effects which can occur with the previously
considered gene transfer via viral or non-viral vectors.
[0076] An advantage of using the RNA according to the invention is
that, in contrast to the use of DNA vectors, the duration of the
treatment is adjustable. In the case of the induction of stem
cells, it is as a rule desirable that the transcription factors are
only transiently active, in order to reprogram somatic cells into
stem cells. Through dosed administration of the relevant RNA
encoding the transcription factors the activity is controllable
over time. In contrast to this, with the previously known methods
there is the danger of integration of the genes administered, which
leads to complications, e.g. tumorigenesis, and moreover renders it
impossible to control the duration.
[0077] In the vaccines field, the RNA according to the invention
also offers new possibilities. The standard development of vaccines
depends on killed or weakened pathogens. More recently, DNA which
encodes a protein of the pathogen has also come under
consideration. The production of these vaccines is laborious and
very time-consuming. Often side effects arise and lead to
vaccinations being refused. With the mRNA according to the
invention, it is possible to provide a vaccine which does not have
the problems associated with pathogens or DNA. In addition, such a
vaccine can be produced very quickly as soon as the antigen
sequences of a pathogen are known. This is particularly
advantageous under the threat of pandemics. Thus in one embodiment
of the present invention, an RNA is provided which encodes an
antigenic part of a disease pathogen, e.g. a surface antigen. It is
also possible to provide an mRNA which encodes an amino acid
sequence which has a combination of several epitopes, optionally
linked by spacer sections. A combination with immunomodulating
substances is also possible, either through the RNA encoding a
fusion protein or as a combination of nucleic acids.
[0078] Furthermore, the RNA according to the invention can also
encode proteins which as factors, stimulators, inducers, etc. have
an influence on the course of disease. Examples are diseases which
are not directly attributable to a gene defect but wherein the
disease process can be positively influenced by means of mRNA
expression. Examples are: erythropoietin for stimulation of the
formation of erythrocytes, G-CSF or GM-SCF for the formation of
neutrophils, growth factors for the formation of new blood vessels,
for bone and wound healing as factors for "tissue engineering",
treatment of tumors by induction of apoptosis or by formation of
proteinaceous cell poisons, e.g. diphtheria toxin A, by induction
of pluripotent stem cells (iPS) etc.
[0079] It has been found that only a polyribonucleotide according
to the invention, which has a predetermined content of modified and
unmodified nucleotides, has low immunogenicity with at the same
time high stability. In order to be able to determine the optimal
combination of modified and unmodified nucleotides for a certain
polyribonucleotide, immunogenicity and stability can be determined
in a manner known per se. For the determination of the
immunogenicity of an RNA, various methods well known to those
skilled in the art can be used. A very suitable method is the
determination of inflammatory markers in cells as a reaction to the
administration of RNA. Such a method is described in the examples.
Cytokines which are associated with inflammation, such as for
example TNF-.alpha., IFN-.alpha., IFN-.beta., IL-8, IL-6, IL-12 or
other cytokines known to those skilled in the art are normally
measured. The expression of DC activation markers can also be used
for the estimation of immunogenicity. A further indication of an
immunological reaction is the detection of binding to the Toll-like
receptors TLR-3, TLR-7 and TLR-8 and to helicase RIG-1.
[0080] The immunogenicity is as a rule determined in relation to a
control. In a common method, either the RNA according to the
invention or an RNA that is unmodified or modified in another way
is administered to cells and the secretion of inflammatory markers
in a defined time interval as a reaction to the administration of
the RNA is measured. As the standard used for comparison, either
unmodified RNA can be used, in which case the immune response
should be lower, or RNA which is known to cause little or no immune
response, in which case the immune response to the RNA according to
the invention should then lie in the same range and not be
elevated. With the RNA according to the invention it is possible to
lower the immune response compared to unmodified RNA by at least
30%, as a rule at least 50% or even 75% or even to prevent it
completely.
[0081] The immunogenicity can be determined by measurement of the
aforesaid factors, in particular by measurement of the TNF-.alpha.
and IL-8 levels and the binding capacity to TLR-3, TLR-7, TLR-8 and
helicase RIG-1. In order thereby to establish whether an mRNA has
the desired low immunogenicity, the quantity of one or more of the
aforesaid factors after administration of the polyribonucleotide
concerned can be measured. Thus for example a quantity of the mRNA
to be tested can be administered to mice via the caudal vein or
i.p. and then one or more of the aforesaid factors can be measured
in the blood after a predefined period, e.g. after 7 or 14 days.
The quantity of factor is then related to the quantity of factor
which is present in the blood of untreated animals. For the
determination of the immunogenicity it has been found very valuable
to determine the binding capacity to TLR-3, TLR-7, TLR-8 and/or
helicase RIG-1. The TNF-.alpha. levels and IL-8 levels also provide
very good indications. With the mRNA according to the invention, it
is possible to lower the binding capacity to TLR-3, TLR-7, TLR-8
and RIG-1 by at least 50% compared to unmodified RNA. As a rule it
is possible to lower the binding to said factors by at least 75% or
even by 80%. In preferred embodiments, the binding capacity to
TLR-3, TLR-7, TLR-8 and RIG-1 lies in the same range for the mRNA
according to the invention and for animals to which no mRNA was
administered. In other words, the mRNA according to the invention
causes practically no inflammatory or immunological reactions.
[0082] In every case, the RNA according to the invention has such
low immunogenicity that the general condition of the patient is not
affected. A slight increase in the aforesaid factors can thus be
tolerated as long as the general condition does not worsen as a
result. Further properties of the mRNA according to the invention
are its efficiency and stability. For this, transcription
efficiency, transfection efficiency, translation efficiency and
duration of protein expression are important and can be determined
by methods known per se.
[0083] The transcription efficiency indicates how efficiently RNA
can be produced from DNA. Here problems can arise with the use of a
high content of modified nucleotides. The RNA modified according to
the invention can be produced with high transcription
efficiency.
[0084] In order to obtain stable and adequate expression of the
proteins encoded by the RNA, it is important that sufficient RNA
reaches the desired cells. This can be determined in that after
administration of labeled RNA the content of RNA which has reached
the cells is determined by measurement of the labeling. Flow
cytometry can be used for the determination of the labeling. When
labeling is effected with a fluorescent molecule, the transfection
efficiency can be calculated, for example as the percentage of the
cell population wherein the fluorescence intensity is higher
compared to control cells which were only treated with PBS. It has
been found that the RNA modified according to the invention can be
produced effectively, in contrast to RNA wherein two or more
nucleotide types have been 100% replaced by modified nucleotides,
and that the transfection efficiency for RNA according to the
invention, wherein only a part of the nucleotides is modified, is
far higher than with RNA wherein any one type of nucleotides is
100% modified.
[0085] The translation efficiency designates the efficiency with
which the RNA is translated into the protein. The higher the
translation efficiency, the lower can be the dose of RNA that then
has to be used for the treatment. The translation efficiency can be
determined by comparing the proportion of translation for RNA
modified according to the invention with the translation ratio for
unmodified RNA. As a rule, the translation efficiency with the RNA
according to the invention is somewhat lower than with unmodified
RNA. This is however more than compensated by the far higher
stability which is manifested in the duration of the protein
expression.
[0086] The RNA according to the invention in particular provides
for high stability, which results in long-continuing protein
expression. Particularly when the RNA modified according to the
invention is intended for the treatment of diseases due to gene
defects, the longer it remains in the cell the more valuable it is.
The more rapidly the RNA is degraded, the more rapidly the protein
expression ends and the more often the RNA must be administered.
Conversely, with a stable RNA which remains in the cell for a long
time the frequency of dosing can be greatly reduced. It has been
found that RNA modified according to the invention is stably
expressed for up to 4 weeks.
[0087] For other embodiments, i.e. when RNA is only intended for
temporary expression, the duration of the protein expression can be
adjusted by influencing the stability.
[0088] A further valuable property of the RNA according to the
invention is thus that the duration of action can be adjusted
selectively via the stability so that the duration of the protein
expression can be tailored so that it takes place in a desired time
window. Secondly, a very long-acting RNA can be used where this is
necessary. The RNA modified according to the invention, expression
whereof can last up to 4 weeks, is thus ideally suited for the
treatment of chronic diseases since here it only has to be given
every 4 weeks. For embodiments wherein the RNA encodes factors
which are to be supplied to the body over a prolonged period in
order to moderate or prevent diseases, the high stability and
long-lasting protein expression is also advantageous, e.g. for the
use of RNA encoding erythropoietin. The RNA according to the
invention can also especially advantageously be used for the
treatment of hemophilia. Here it was previously necessary to
administer the missing factor weekly. With the provision of the RNA
according to the invention, the frequency of administration can be
reduced, so that RNA encoding the factor now only has to be given
every 2 or even every 4 weeks.
[0089] The stability of the mRNA according to the invention can be
determined by methods known per se. Particularly suitable are
methods for the determination of the viability of cells which
contain RNA modified according to the invention in comparison to
cells which contain unmodified or fully modified RNA, e.g. in
comparison to RNA that is unmodified or modified in known manner.
The production of the encoded protein over time can also be
monitored. Here stability of an RNA is understood to mean that when
it has been introduced into the cell, the RNA which can express the
desired protein or is translatable into the protein or a functional
fragment thereof, remains capable of expression over a prolonged
period, is not immediately degraded and is not inactivated.
[0090] A method for testing the stability and the survival time of
RNA in a cell thus consists in determining how long a protein
encoded by the RNA is detectable in the cell or performs its
function. Methods for this are described in the examples. Thus for
example an mRNA with a sequence encoding a reporter molecule can be
introduced into the cell, optionally together with an RNA encoding
a desired protein and after predefined time periods the presence of
reporter molecule and optionally protein are then determined.
Suitable reporter molecules are well known in the state of the art
and those commonly used can also be used here. In a preferred
embodiment, RFP, red fluorescing protein, is used as the reporter
molecule.
[0091] As stated above, the RNA according to the invention can be
used for therapy so that in the cell into which the RNA is
introduced a protein can be formed which is naturally not expressed
to the desired extent or at all. Here the RNA according to the
invention can be used both when the protein is not formed owing to
a deficiency of a gene and also in the cases when owing to a
disease a protein is not formed or in cases where the introduction
of the protein is advantageous for the body. The RNA can also be
used for supplementing a protein which is not expressed to an
adequate extent. The dose used in each case depends on the function
which the RNA is to fulfill. As stated above, the duration of
action of the RNA according to the invention can be deliberately
adjusted. The duration of the treatment depends on the particular
indication. If the RNA is used for the chronic therapy of a disease
due to a deficient gene, the duration of action will be as long as
possible, while with other indications it can be deliberately
adjusted to a time window.
[0092] According to a particularly preferred embodiment, an IVT
mRNA which encodes the surfactant protein B is used as the RNA.
When this protein is deficient in mammals, it results in the
development of the respiratory distress syndrome of the premature
and newborn. In the newborn, this syndrome often leads to death
owing to a lung disease. The use of a multiply modified in vitro
transcribed mRNA encoding SP-B wherein 5 to 50% of the uridine
nucleosides and 5 to 50% of the cytidine nucleosides are modified
results in the protein being formed and the disease being moderated
or cured.
[0093] According to a further preferred embodiment, an IVT mRNA
which encodes erythropoietin is used as the RNA. Erythropoietin is
a very important protein for the body which for example in kidney
diseases is no longer available in adequate quantity and therefore
must be supplied. Recombinant erythropoietin, which has been
produced in microorganisms or animal cells and hence has a
glycosylation not occurring naturally, is at present used for this.
With the use of the recombinant EPO there were in rare cases severe
side effects, for example erythrocyte aplasia.
[0094] The IVT mRNA provided according to the invention contains a
ribonucleic acid which encodes erythropoietin, wherein 5 to 50% of
the uridine nucleotides and 5 to 50% of the cytidine nucleotides
are modified. In a particularly preferred embodiment, an
EPO-encoding mRNA wherein 15 to 25% of the uridine nucleotides and
15 to 25% of the cytidine nucleotides are modified is provided. It
has been found that this mRNA has markedly reduced immunogenicity
compared to unmodified RNA. At the same time it displays a
transfection efficiency of over 90% and a stability such that the
hematocrit value is still elevated after 14 days. Since the EPO
produced by the RNA according to the invention in the body has the
correct glycosylation, side effects are not to be expected. Through
targeted intermittent administration of the EPO-encoding RNA
modified according to the invention, the hematocrit value could be
kept at the desired level for a prolonged period.
[0095] According to the invention, a non-immunogenic stable RNA is
provided which is usable in vivo in mammals and provides the
necessary protein in a form which is very similar if not identical
to the naturally present endogenous protein and in particular has
the endogenous glycosylation.
[0096] The mRNA according to the invention can be used directly as
such. However, there is also the possibility of further modifying
the mRNA in order to introduce further beneficial properties.
Firstly, the mRNA can be modified by attaching other coding or
non-coding sequences to the coding strand. Secondly, it can also be
modified by binding further molecules to functional groups provided
in the modified nucleotides.
[0097] In one embodiment, the mRNA according to the invention can
be combined with targeting ligands which bind to surface receptors
specific for the target cells, so that a receptor-mediated
transfection of the target cell is possible. For this firstly
vehicles which are suitable for the introduction of mRNA into
cells, or else the mRNA itself can be modified with a ligand.
Examples of suitable vehicles for the introduction of mRNA into
cells are cationic agents. These include cationic lipids, cationic
polymers or also nanoparticles, nanocapsules, magnetic
nanoparticles and nanoemulsions. Suitable vehicles are known to
those skilled in the art and described in the specialist
literature. Suitable ligands are also well known to those skilled
in the art and described in the literature and available. As
ligands for example transferrin, lactoferrin, clenbuterol, sugar,
uronic acids, antibodies, aptamers, etc. can be used.
[0098] However, the mRNA itself can also be modified with a ligand.
For this, mRNAs with modified nucleosides that bear a primary amino
group or an azido group in the 2' position of the ribose are
preferred. Examples can be found in the table above. Such
modifications are particularly preferred since they contribute to
the biological activity. Via these modifications, the ligand can
easily be incorporated by amide formation or "click" chemistry,
e.g. by bioconjugate techniques.
[0099] In a further embodiment, an RNA sequence which can bind to
proteins, e.g. receptors, (aptamer) is introduced at the 5' end of
the mRNA. This procedure has the advantage that the ligand can
already be introduced directly into the matrix at the DNA level and
cloned and introduced into the mRNA by the IVT. Hence subsequent
modification of the mRNA with the ligand is no longer
necessary.
[0100] In a further embodiment, the mRNA is modified by additional
modification with inert polymers, e.g. polyethylene glycol (PEG).
Methods for this are well known to those skilled in the art, and
processes such as are known for ligands can be used. Thus for
example a binding site for polyethylene glycol, to which the PEG is
bound after transcription, can be provided in a small part of the
modified nucleotides used for the mRNA according to the invention.
The polyethylene glycol serves for the extracellular stabilization
of the mRNA, i.e. it protects the polyribonucleotide molecule until
it has arrived in the cell. On entry into the cell, the PEG is
cleaved off. Hence the bond between PEG and RNA is preferably
designed such that the cleavage on entry into the cell is
facilitated. For this, for example a functional group can be
provided which is pH-dependently cleaved off. Other molecules
stabilizing the RNA can also be provided via appropriate active
sites on the modified nucleotides. In this way, the mRNA can be
protected by steric stabilization against enzymatic degradation and
an interaction with components of biofluids prevented. The mRNA
thus modified can be designated as "stealth" mRNA.
[0101] A preferred method for the protection and stabilization of
RNA is described in EP 11 98 489, to the content whereof reference
is expressly made here. RNA according to the invention is
preferably protected by the methods described in EP 11 98 489. It
has been found that firstly the RNA modified according to the
invention can also advantageously be stabilized and protected by
this method and secondly that the activity of RNA according to the
invention thus treated is not or not significantly restricted.
Hence in a preferred embodiment of the present invention, RNA
modified according to the invention is treated in accordance with
EP 11 98 489.
[0102] An example of cell-specific regulation is the incorporation
of micro-RNA binding sites for micro-RNA 142-3p, which is expressed
in hematopoietic cells, but not in cells of other origin. As a
result, the expression is controlled such that the mRNA translation
in hematopoietic cells is markedly diminished compared to other
cells. Similarly, the expression in other cell types can be
selectively controlled by incorporation of the relevant suitable
micro-RNA binding sites, which are known to those skilled in the
art.
[0103] In a further embodiment, the mRNA according to the invention
is combined with a target or a binding site for at least one
micro-RNA which is present only in healthy cells, but not the cells
affected by the disease. As a result, the protein encoded by the
mRNA is produced only in the cells which need the protein. The
selection of the suitable targets is made by routine methods which
are well known to those skilled in the art. A common method which
is performed at the DNA level is the cloning of a micro-RNA binding
site into 3'UTR (Gu et al, Nat Struct Mol Biol. 2009 February;
16(2): 144-50, Brown et al, Nat Biotechnol. 2007 December; 25(12):
1457-67, Brown et al, Nat Med. 2006 May; 12(5): 585-91, WO
2007000668). In a preferred embodiment, an RNA equipped with a
binding site for micro-RNA is used when the RNA encodes a
cytotoxin. In this case it is especially desirable to bring the
protein toxic to cells only where it is intended to deploy its
action. For this embodiment, it can also be advantageous to adjust
the duration of action of the RNA by specifically modifying the RNA
so that its stability lies in a predefined time window.
[0104] Further, the RNA according to the invention can be combined
with micro-RNAs or shRNAs downstream of the 3' polyA tail. This has
the advantage that the mRNA-micro-RNA/shRNA hybrid can be cleaved
intracellularly by Dicer and thereby two active molecules which
intervene in different pathogenic cascades can be released. Such a
hybrid can be provided for the treatment of diseases such as cancer
or asthma. Hence the RNA according to the invention is suitable for
simultaneously complementing a deficient mRNA and intervening in a
defective micro-RNA cascade.
[0105] Thus according to the invention, an RNA with advantageous
properties is provided which can be tested with a screening method
wherein a sequence coding for a reporter protein, e.g. red
fluorescing protein (RFP), is used. When the toxicity and stability
of sequences of a reporter gene with unmodified, singly or multiply
modified nucleotides with different modifications are tested for
their immunogenicity and transfection efficiency, it is found that
only the mRNA according to the invention, i.e. modified multiply,
wherein at least 5% respectively of the uridine nucleosides and
cytidine nucleosides are replaced by modified nucleosides leads to
a markedly reduced immunogenicity towards human primary monocytes
in the blood and at the same time can yield high transfection rates
of more than 80%. This can for example be tested in alveolar
epithelial cells type II in humans or in the mouse. Moreover, the
duration of the RNA expression for RNAs modified according to the
invention is significantly longer than with known RNA. It has been
found that mainly owing to the higher stability and lower
immunogenicity of the mRNA multiply modified according to the
invention the expression lasts longer than with known preparations.
In a quantitative assessment, a derivative modified according to
the invention showed a 10 times higher quantity of expression
product 10 days after the transfection than non- or only singly
modified RNA.
[0106] A further subject of the invention is a method for the
screening of nucleotide sequences in order to test the
immunogenicity and expression quality, wherein the mRNA sequence is
contacted with at least one receptor selected from TLR3, TLR3, TLR8
and helicase RIG-1 and the binding capacity measured in comparison
with a control sequence. As the control sequence, a sequence is
used the binding capacity whereof is known. The weaker the binding
to at least one of these receptors is, the more promising is the
sequence.
[0107] The properties of mRNA according to the invention, in
particular IVT mRNA, can be tested with a screening method on an
RNA expressing a reporter protein. The red fluorescing protein
(RFP) is preferred as the reporter protein. Sequences encoding this
protein which have nucleotides with different modifications can be
tested for their immunogenicity and transfection efficiency. Thus
various modifications of mRNA can be used for tests, e.g. uridine
nucleosides can be partially replaced by 2-thiouridine nucleosides
(also referred to below as s2U) and cytidine nucleosides can be
partially replaced by 5-methylcytidine nucleosides (also referred
to below as m5C).
[0108] FIGS. 1A, 1B, 1C, 2A and 2B show the results which are
obtained on performing such a screening method. More detailed
particulars are to be found in the examples. The results shown in
the figures are based on experiments which were performed for RFP
RNA and show that only multiply modified mRNA wherein at least 5%
of the uridine nucleosides and at least 5% of the cytidine
nucleosides respectively are modified lead to markedly reduced
immunogenicity towards human primary monocytes in the blood, both
ex vivo and in vivo, and at the same time can yield high
transfection rates of more than 80% both in alveolar epithelial
cells type II in humans and also in the mouse. Moreover, the
duration of the expression for mRNAs modified according to the
invention is significantly longer than for unmodified mRNA.
[0109] In a further embodiment, a method is provided for testing
whether an RNA under consideration is suitable for therapy, with
the use of an mRNA immunoprecipitation test (RIP). A suitable RIP
test is described in more detail in the examples. Studies have
shown that cells of the immune system are activated by unmodified
reporter mRNA via RNA binding to Toll-like receptor (TLR) 3, TLR7,
TLR8 and helicase RIG-1. When the results show that the binding of
a tested mRNA to TLR3, TLR7, TLR8 and/or RIG-1 is markedly
decreased compared to unmodified mRNA this is an indication of
decreased immunogenicity. It could be shown that in this respect
multiple modifications used according to the invention are
significantly more effective than single s2U modifications. In the
examples, the influence of RNA on the level of IFN-.gamma., IL-12
and IFN-.alpha. was studied, after the RNA had been injected
intravenously into mice. It was found that multiply modified
s2U.sub.(0.25)m5C.sub.(0.25) RFP mRNA prevented an immune response.
The results obtained in the examples together show that multiply
modified mRNA significantly decreases the TLR and RIG-1 binding and
hence lowers the immune response with at the same time elevated and
prolonged expression. Hence a multiply modified RNA, in particular
IVT mRNA, is a suitable candidate for the in vivo treatment of a
disease due to a deficient gene. A particularly promising candidate
is briefly explained below and described in more detail in the
examples.
[0110] In order to test whether it is possible to use RNA modified
according to the invention for treatment in the lung, multiply
modified mRNA which codes for a fusion protein of enhanced green
fluorescent protein and luciferase (EGFPLuc) was introduced
directly into the lung of a mouse and tested as to whether
luciferase was expressed in comparison with unmodified EGFPLuc RNA.
The luciferase expression reached a maximum after three hours in
the lung, although the total luminescent flux rapidly declined
after 24 hours to very low proportions 5 days after the treatment.
In contrast to this, high expression values were observed up to 5
days after the treatment in mice which had been treated with
multiply modified EGFPLuc mRNA.
[0111] In a particularly preferred embodiment, an RNA is provided
whose therapeutic potential allows treatment of the disease
attributable to SP-B deficiency, namely
s2U.sub.(0.25)m5C.sub.(0.25) SP-B mRNA. SP-B is a relatively small
amphipathic peptide which is encoded by a single gene and through
proteolytic processing creates a precursor with 381 amino acids in
type II alveolar epithelial cells which coat the alveoli. It
improves the distribution, adsorption and stability of the
surfactant lipids which are necessary for the reduction of the
surface tension in the alveoli. With a deficiency of SP-B, symptoms
such as thickened alveolar walls, cellular infiltration and
interstitial edema occur. This lung damage is accompanied by
congestion, i.e. an increased number of erythrocytes and an
increased number of macrophages, neutrophils and corresponding
proportions of inflammatory cytokines in the broncho-alveolar
fluid. The congenital deficiency in humans and studies on
transgenic mice have proved that SP-B plays an essential role in
survival after birth. Congenital SP-B deficiency, which arises
through mutations in the SP-B gene, is critical for the replacement
of the surfactant and leads to a fatal failure of the respiratory
tract in the newborn during the first months of life. Hence a lung
transplant is the only currently available therapeutic
intervention. Hence an mRNA therapy for SP-B deficiency, which is
rendered possible with the RNA according to the invention, is an
important alternative treatment.
[0112] The RNA according to the invention can be used for the
treatment of this disease, preferably with perfluorocarbon as
vehicle. Hence in a preferred embodiment a pharmaceutical
preparation comprising perfluorocarbon and
s2U.sub.(0.25)m5C.sub.(0.25) SP-B mRNA is provided. This
combination makes it possible to reconstitute SP-B in the lung of
patients with SP-B deficiency, so that the chances of survival are
increased. Because of the high stability of the RNA according to
the invention, administration at regular intervals, e.g. 1 to 3
times weekly is sufficient for this. Preferably the SP-B mRNA is
administered for this intratracheally as an aerosol by spraying at
high pressure. It has been found that the mRNA according to the
invention can ameliorate the symptoms described above and thus
improve the lung function, which can be demonstrated by testing of
the lung parameters, as described in detail in the examples.
[0113] The mRNA according to the invention can be effectively used
in therapeutic procedures and makes a treatment of diseases due to
missing or defective proteins possible. Systemic administration of
the multiply modified mRNA is possible. There can be cases wherein
the mRNA translation in cells which are not affected by the gene
defect is undesirable, e.g. because undesired side effects arise.
In order to have the mRNA translated selectively only in the cells
which need the encoded protein, e.g. in cells in which a gene
defect exists, the corresponding vector can either be supplemented
by sequences which enable addressing of the tissue affected, e.g.
via ligands. In a further embodiment, sequences to which endogenous
micro-RNAs bind, which are not expressed in the target cell, can be
added to the vector which contains the mRNA, so that the mRNA are
degraded in all cells which contain the relevant endogenous
micro-RNAs, while they are retained in the target cells. Thus side
effects can be minimized.
[0114] The RNA according to the invention can be administered in a
manner known per se to patients who need the protein or protein
fragment encoded by RNA, e.g. because they have a disease due to a
deficient gene. For this, the RNA is formulated as a pharmaceutical
preparation with normal pharmaceutically acceptable additives. The
form of the preparation depends on the location and the nature of
administration. Since the RNA according to the invention is
characterized by particularly high stability, it can be formulated
in many ways, depending on where and in what form it is to be used.
It has been found that the RNA according to the invention is so
stable that it can be freeze-dried, processed in this form, e.g.
crushed or milled, and stored, and can then be reconstituted when
required and retains its biological activity.
[0115] When the RNA is administered systemically, it is usually
formulated as an injectable liquid with normal additives such as
agents adjusting the tonicity and stabilizers, preferably as a unit
dosage form. As stabilizers, those normally known, such as for
example lipids, polymers and nanosystems or liposomes, are used. In
a preferred embodiment, a composition suitable for parenteral
administration is provided which contains RNA modified according to
the invention which encodes EPO.
[0116] In a preferred embodiment, particularly when the RNA encodes
SP-B protein, the RNA according to the invention is provided in a
form suitable for uptake via the lung, e.g. by inhalation. Suitable
formulae for this are known to those skilled in the art. In this
case the preparation is in a form which can be introduced into the
respiratory tract via normal nebulizers or inhalers, e.g. as a
liquid for nebulizing or as a powder. Devices for administration as
liquid are known, and ultrasound nebulizers or nebulizers with a
perforated oscillating membrane which operate with low shear forces
compared to nozzle jet nebulizers are suitable. Also suitable are
powder aerosols. Both mRNA complexed with cationic lipids and also
bare mRNA is available after the freeze-drying with the sugar
sucrose as powder that can then be crushed to a respirable size and
moreover shows biological activity.
[0117] In a preferred embodiment, a pharmaceutical composition
intended for pulmonary administration is combined with
perfluorocarbon, which is administered previously or simultaneously
with the pharmaceutical composition in order to increase the
transfection efficiency.
[0118] In a further preferred embodiment, RNA modified according to
the invention is provided in a delayed release polymer as a carrier
for the coating of implants. For this the RNA modified according to
the invention can be used as such or else an RNA protected with a
coating polymer and/or polymer complex.
[0119] A further subject of the invention are implants on the
surface whereof there is a coating of a delayed release polymer
which contains RNA which encodes beneficial factors for the
ingrowth of the implant. According to the invention both coatings
which contain mRNA which encodes only one factor and also coatings
which contain mRNAs which encode several factors, e.g. various
growth factors or growth factors and angiogenesis factors or
further factors promoting ingrowth, are possible here. The various
factors can also be provided in a form such that they are released
at staggered intervals.
[0120] Furthermore, the expression "RNA which encodes one or more
growth factors and one or more angiogenesis factors" should be
understood to mean both an RNA sequence which encodes more than one
protein, singly or as a fusion protein, and also a mixture of
different RNA sequences which encode different proteins, where each
RNA sequence encodes one protein.
[0121] The invention is further explained by the following
examples.
EXAMPLE 1
[0122] In order to be able to assess the therapeutic utility of an
IVT mRNA, it was assessed whether non-immunogenic IVT mRNA could be
obtained for in vivo use. Hence in a first step, in vitro
transcribed mRNA for red fluorescing protein (RFP) with modified
nucleosides was investigated with regard to immunogenicity and
transfection efficiency. The results show that multiply modified
mRNA wherein 25% of the uridine is replaced by 2-thiouridine (s2U)
and 25% of the cytidine by 5-methylcytidine (m5C) yields
s2U.sub.(0.25)m5C.sub.(0.25) IVT mRNA which has markedly reduced
immunogenicity towards human primary mononuclear blood cells, as
shown in FIG. 1A, and a high transfection rate of more than 80% in
epithelial cells of the alveolar type II both in humans (FIG. 1B)
and also in the mouse (FIG. 1C). Moreover, the duration of the mRNA
expression was significantly prolonged (FIG. 2A). The results show
that this prolonged expression is mainly due to the higher
stability of the mRNA multiply modified according to the invention.
An absolute quantitative assessment showed an approximately 10
times greater quantity of s2U.sub.(0.25)m5C.sub.(0.25) RFP mRNA 7
days after the transfection (FIG. 2B). The translation efficiency
was somewhat diminished for the modified RFP mRNA and hence could
not contribute to higher and longer activity (FIG. 4).
[0123] In the next step, the mechanism on which the reduced immune
response is based was investigated using a modified RNA
immunoprecipitation test (RIP assay). Studies have shown that cells
of the immune system are activated by unmodified reporter mRNA (1)
by RNA binding to Toll-like receptor (TLR) 3 (2), TLR7 (3), TLR8
(4) and helicase RIG-1 (5). The results show that the binding of
the multiply modified RFP mRNA according to the invention to TLR3,
TLR7, TLR8 and RIG-1 was markedly reduced compared to unmodified
RFP mRNA. In this respect, the multiple modifications were
considerably more effective than a single s2U modification (FIG.
2C). As was to be expected from the binding studies, unmodified RFP
mRNA increased IFN-.gamma., IL-12 and IFN-.alpha. to a considerable
extent when it was injected intravenously into mice, while multiply
modified s2U.sub.(0.25)m5C.sub.(0.25) RFP mRNA prevented an immune
response (FIG. 2D). Overall, these results show that the mRNA
multiply modified according to the invention markedly decreased the
TLR and RIG-1 binding and thereby the immune response, and at the
same time increased and prolonged expression, which makes such mRNA
a very promising candidate for in vivo tests.
[0124] It was therefore tested whether an
s2U.sub.(0.25)m5C.sub.(0.25) mRNA which encoded a fusion protein of
enhanced green fluorescent protein and luciferase (EGFPLuc) which
was introduced directly into the lungs of the mouse could intensify
and prolong the luciferase expression in vivo in comparison to
unmodified EGFPLuc mRNA. For this purpose, a high pressure spray
device for intratracheal administration known per se as described
for example in (6) was used, perfluorocarbon (fluorinated FC-77)
being administered beforehand in order to increase the transfection
efficiency (7). After 3 hours the luciferase expression reached a
maximum in the lungs in vivo, although the total luminescence
rapidly decreased after 24 hours to a low level 5 days after the
treatment (FIGS. 3A and B). In contrast to this, high expression
values were observed up to the 5.sup.th day after the treatment in
mice which were treated with s2U.sub.(0.25)m5C.sub.(0.25) EGFPLuc
mRNA (FIGS. 3A and B).
[0125] This shows that the therapeutic potential of the multiply
modified mRNA according to the invention for therapy is very
promising. Hence an s2U.sub.(0.25)m5C.sub.(0.25) SP-B mRNA multiply
modified according to the invention was tested for the treatment of
SP-B deficient mice. SP-B is a relatively small amphipathic peptide
which is encoded by a single gene and in epithelial cells of the
alveolar type II is converted by proteolytic processing into a
precursor with 381 amino acids which coats the alveoli (8, 9). It
improves the distribution, adsorption and stability of the
surface-active lipids which are necessary for the reduction of the
surface tension in the alveolus. If the gene for this protein is
deficient, disorders in the respiratory tract occur after birth
which can rapidly lead to death. It has been observed that a
hereditary defect in humans and in transgenic mice plays an
important part in postmortal survival (10). A hereditary SP-B
deficiency which arises through mutations in the SP-B gene prevents
the formation of the surface-active lipids, which leads to
respiratory failure during the first months after birth (11). A
lung transplant is the only therapeutic intervention that is
currently possible (12). Hence an mRNA therapy for SP-B deficiency
would be an alternative treatment to ensure viability with this
deficiency.
[0126] Hence a knockout mouse model for SP-B deficiency was
selected in order to test a gene therapy with multiply modified
mRNA of SP-B according to the invention. For this a mouse model was
chosen wherein the mouse SP-B cDNA was expressed under the control
of exogenous doxycycline in SP-B.sup.-/- knockout mice. Withdrawal
of doxycycline in adult SP-B.sup.-/- mice resulted in a decreased
content of SP-B in the lung, which resulted in respiratory failure
when the SP-B concentration fell below 25% of the normal level.
Conditioned transgenic mice which received doxycycline survived
normally (13, 14). The therapeutic strategy used comprised the
following: (i) pre-treatment of the mice with perfluorocarbon
before the introduction of SP-B mRNA, in order to increase
expression and (ii) repeated use of SP-B mRNA twice weekly every
third or fourth day for four weeks (FIG. 3C). In order to perform
an experiment to demonstrate this principle,
s2U.sub.(0.25)m5C.sub.(0.25) SP-B mRNA was administered
intratracheally as an aerosol into conditional SP-B.sup.-/- mice
using a high pressure nebulizer. This treatment saved the mice from
respiratory failure and extended their average lifespan to
28.8.+-.1.1 days (FIG. 3D), up to the defined endpoint of the
study. In contrast to this, after withdrawal of the doxycycline,
untreated SP-B.sup.-/- mice displayed symptoms of an acute
respiratory problem within 3 to 4 days. This was also observed
after administration of perfluorocarbon alone or perfluorocarbon
with s2U.sub.(0.25)m5C.sub.(0.25) EGFPLuc mRNA as a control, the
mice then dying within 3.8.+-.0.4 days (FIG. 3D, and data not
shown). Moreover, successful reconstitution of SP-B in the lungs of
the mice treated with s2U.sub.(0.25)m5C.sub.(0.25) SP-B mRNA was
confirmed by immunostaining (FIG. 3E) and semiquantitative Western
blot analysis (FIG. 3F) for SP-B. The pulmonary histology was
normal in mice which had been treated for 4 weeks with
s2U.sub.(0.25)m5C.sub.(0.25) SP-B mRNA, while the lungs of the mice
which had received s2U.sub.(0.25)m5C.sub.(0.25) EGFPLuc control
mRNA displayed thickened alveolar walls, cellular infiltration and
interstitial edema after 4 days (FIG. 3G). This lung damage was
accompanied by congestion (elevated number of erythrocytes) and an
elevated number of macrophages and neutrophils and an elevated
level of inflammatory cytokines (FIG. 3H) in the broncho-alveolar
lavage fluid (BALF), while this was largely prevented in the mice
treated with SP-B mRNA. It has been shown that the withdrawal of
doxycycline worsened pulmonary function without treatment (14, 15).
It has been observed that prolonged treatment of SP-B.sup.-/- mice
with s2U.sub.(0.25)m5C.sub.(0.25) SP-B mRNA maintained the normal
pulmonary function, as in the SP-B.sup.-/- mice which received
doxycycline (FIG. 3I).
[0127] To summarize, these results show that all functional and
pathological parameters of the SP-B deficiency in the lung improved
substantially and were comparable with conditional SP-B.sup.-/-
mice which received doxycycline.
[0128] The results show the therapeutic efficacy of the multiply
modified mRNA in a mouse model for a lethal lung disease. However,
the further application of the mRNA therapy can still be improved
as follows: (i) undesired mRNA translation in cells of unaffected
tissue could lead to undesired effects outside the target region,
(ii) if the multiply modified mRNA also reaches unaffected tissue,
an adequate quantity of mRNA must be provided and (iii) repeated
dosing is necessary for short-duration mRNA activity. In order to
improve this, micro-RNA biology can be enlisted in order to prevent
undesired mRNA translation in cells not affected by the disease. By
incorporating target sequences of endogenous micro-RNAs, which are
not expressed in the target cell, mRNA degradation can be
selectively caused in cells not affected by the disease, during
which however the mRNA is retained in the target cells, as a result
of which side effects are minimized (16, 17).
[0129] In a further approach, release systems, the targeting
ligands, which bind specific receptors to cell surfaces, can be
combined, so that receptor-mediated transfection of the target cell
is enabled. Since mRNA can be produced in large quantities nowadays
(18) and efficient production processes for the production even of
multiply modified mRNA on a large scale are possible, the clinical
use of the mRNA according to the invention is possible and this
makes it possible to develop mRNA systems specifically tailor-made
for each disease (19, 20), whereby the dosing frequency and the
short-duration activity can be kept to a minimum, which is not
possible with the currently known therapies. In this way, according
to the invention an effective molecular therapy for the treatment
of disease due to a gene deficiency is provided.
EXAMPLE 2
[0130] In order to show that in SP-B deficient mice an improvement
in condition or an increase in life expectancy is achieved merely
by the use of the mRNA modified according to the invention which
encodes SP-B, a further experiment was performed. The mouse model
and conditions as described in example 1 were used.
[0131] Three groups of mice were set up. One group of SP-B
deficient mice received mRNA modified according to the invention
twice in one week (B), a second group received mRNA modified
according to the invention twice a week for 28 days (C), and for
comparison a third group of mice received modified EGFP-Luc mRNA
(A).
[0132] It was found that the mice which received no SPB mRNA
modified according to the invention died after a short time. The
mice which received the RNA according to the invention survived
only as long as they were given the SP-B RNA according to the
invention. This proves that the RNA according to the invention is
biologically active and can replace necessary protein.
[0133] In detail, the experiment was performed as follows. SP-B KO
mice, as described in example 1, received either modified EGFP-Luc
mRNA (A) (n=10) or modified SP-B mRNA twice in one week (B) (n=4)
or modified SP-B mRNA twice a week for 28 days (C) (n=4).
Kaplan-Meier survival curves were plotted and a Wilcoxon-Gehan test
performed. It was found that the intratracheal administration of
the doubly modified SP-B mRNA twice within one week into the lungs
of transgenic SP-B mice (B) in which the SP-B gene is controlled by
the addition of doxycycline in the drinking water prolongs the
average survival time of the mice after withdrawal of the
doxycycline from the drinking water before the start of the
treatment to 10.2.+-.0.5 days (B) in comparison to 3.4.+-.0.2 days
after administration of an EGFP-Luc control mRNA.
[0134] The results are presented in the diagram of FIG. 12. It is
found that the intratracheal administration of the doubly modified
SP-B mRNA according to the invention is in fact life-saving.
Without addition of the mRNA according to the invention, the mice
die after a short time. This experiment also shows firstly that
SP-B mRNA produces the SP-B necessary to life in vivo and secondly
that the SP-B mRNA must be administered continuously to protect the
experimental animals from death.
EXAMPLE 3
[0135] In a further experiment in which the mice described in
example 1, which all received doxycycline, were used, it was
investigated whether the RNA according to the invention causes
inflammatory reactions in an early phase after administration. For
this, 5 groups were set up and cytokine levels, IFN.gamma. and
IL-12 were measured in the bronchoalveolar lavage of mice 8 hours
after administration of different preparations. The six groups
received the following preparations: a) control, untreated, i.e.
neither perfluorocarbon nor RNA, b) control, perfluorocarbon, c)
control, perfluorocarbon and unmodified SP-B mRNA, d) invention,
perfluorocarbon and modified s2U.sub.(0.25)m5C.sub.(0.25) SP-B mRNA
and e) control, perfluorocarbon and SP-B plasmid DNA, (n=4). In
each case 20 .mu.g (50 .mu.l) of a preparation were administered.
The results are shown in FIG. 13. In FIG. 13, the mean
value.+-.standard error is shown. The following abbreviations were
used in FIG. 13: Doxy--doxycycline, Pfc--perfluorocarbon,
pDNA--plasmid DNA (*P<0.05 compared with the untreated
group).
[0136] The results show that on intratracheal administration of
unmodified mRNA or plasmid DNA the inflammatory marker IL-12 is
markedly elevated in the bronchoalveolar lavage, while the
administration of doubly modified mRNA leads to no rise in IL-12 in
comparison to untreated mice. The administration of doubly modified
mRNA does slightly increase the level of the inflammatory marker
IFN.gamma., but only as far as is also observed after
administration of perfluorocarbon. In contrast to this, the
administration of unmodified mRNA or the administration of plasmid
DNA also leads to a marked rise in the IFN.gamma. level. Thus using
the mRNA modified according to the invention an inflammatory
reaction is not to be expected, while the administration of
unmodified mRNA or even plasmid DNA very rapidly causes
inflammatory reactions.
EXAMPLE 4
[0137] In order to demonstrate the possibilities for use of the
mRNA modified according to the invention, various types of
modifications and their effect on the transfection and translation
efficiency and on immunogenicity were studied. A459 cells were
transfected with 200 ng of mRNA in each case and how many of the
cells had been transfected and in how many cells the fluorescent
protein had been translated was then investigated. This evaluation
was made using the mean fluorescence intensity (MFI). The results
are shown in FIG. 10A. mRNA modified according to the invention was
tested and in comparison to this an mRNA modified not according to
the invention, in which two different modifications of uridine
nucleotides were used and non-modified mRNA. The mRNA molecules
modified according to the invention were:
[0138] s2U/m5C and s4U/m5C wherein the modified nucleotides each
had a content of 10% and RNA molecules which in addition to 10%/10%
s2U/m5C and s2U/5mC each contained a further 5% of modified
nucleotides, namely once C.sub.2'NH.sub.2 and once 5% G'N.sub.3.
The results show that the mRNA modified according to the invention
displays a very high transfection efficiency, while unmodified mRNA
and mRNA modified not according to the invention each show far
lower transfection and translation efficiency.
[0139] The immunogenicity was also tested for the modified mRNA
previously described, by investigating the TNF-.alpha. level on
human PBMCs after administration of 5 .mu.g of each mRNA. The
results are shown in FIG. 10B. As is clearly seen, the TNF-.alpha.
level is markedly elevated on administration of unmodified mRNA or
with mRNA wherein two types of modified uridine nucleotides were
used. The TNF-.alpha. level is lower by at least 50% with the RNAs
modified according to the invention than with unmodified RNA.
EXAMPLE 5
[0140] Method for the production of multiply modified mRNA
according to the invention.
[0141] a) Constructs for the In Vitro Transcription
[0142] For the in vitro transcription of RFP cDNA (678 bp), a
plasmid, pCS2+DsRedT4, containing an SP6 promoter was used. For the
in vitro transcription of SP-B cDNA (1146 bp), a pVAX1 plasmid
(Invitrogen) containing a T7 promoter was used. In order to create
the vector for the in vitro transcription of EGFPLuc (2.4 kb), a
pST1-2.beta.-globin-UTR-A-(120) construct containing a T7 promoter
which was obtained as described in (19) was used. The constructs
were cloned using standard techniques of molecular biology.
[0143] Production of Modified mRNA
[0144] In order to create templates for the in vitro transcription,
the pCS2+DsRed.T4, EGFPLuc and SP-B plasmids were linearized with
XbaI. The linearized vector DNAs were purified with the NucleoSpin
Extract II kit (Macherey-Nagel) and assessed by spectrophotometry.
The in vitro transcription was performed with the mMESSAGE-mMACHINE
SP6 or T7 Ultrakit (Ambion). The SP-6 kit capped the mRNA with
7-methylGpppG, while the T7 kit created the analogous antireverse
cap (ARCA; 7-methyl-(3'-O-methyl)GpppGm.sup.7G(5')ppp(5')G in a
transcription reaction with ultrahigh yield. In order to produce
RNA modifications, the following modified ribonucleic acid
triphosphates were added to the reaction system in the stated
ratios: 2'-thiouridine 5'-triphosphate, 5'-methylcytidine
5'-triphosphate, pseudouridine 5'-triphosphate and
N.sup.6-methyladenosine 5'-triphosphate (all from TriLink
BioTechnologies and checked for purity with HPLC and .sup.31P NMR).
After the in vitro transcription, the RNA from the pVAX1 SP-B
plasmid was enzymatically polyadenylated using the poly(A) tail kit
(Ambion). The poly(A) tails were approximately 200 nt long. All
capped mRNAs (RFP, EGFPLuc and SP-B) were purified using the
MEGAclear kit (Ambion) and analyzed for size and purity with the
Agilent RNA 6000 Nano Assay on a Bioanalysis Instrument 2100
(Agilent Technologies).
[0145] Cell Transfections
Lung Cell Transfection
[0146] Type II alveolar epithelial cell lines from humans and from
the mouse, A549 and MLE12 respectively, were grown in Minimal
Essential Medium (Invitrogen) which was supplemented with 10% fetal
calf serum (FCS), 1% penicillin-streptomycin and 0.5% gentamycin.
One day before the transfection, 80000 cells per well were plated
out in 24-well plates. The cells (more than 90% confluence) were
transfected with 200 ng of mRNA with the use of Lipofectamin 2000
(Invitrogen) according to the manufacturer's instructions. After 4
hours, the cells were washed with PBS and serum-containing medium
was added. For analyses of long-term expression, the cells were
regularly subdivided (when the confluence was >90%).
[0147] Human PBMC Transfection
[0148] Human PBMCs (CTL-Europe GmbH) cryoconserved in liquid
nitrogen were carefully thawed at 37.degree. C. using CTL
Anti-Aggregate Wash Supplement, during which sterile-filtered
RPMI-1640 (Invitrogen) was slowly added. For all experiments
described, a single characterized batch of PBMCs was used in order
to make the data reproducible.
[0149] Flow Cytometry
[0150] A flow cytometry analysis was performed on the A549 and
MLE12 cells which had been transfected with RFP mRNA, as described
above. The cells were removed from the plate surface with 0.25%
trypsin/EDTA, washed three times with PBS and again suspended in
PBS in order to measure the fluorescence using an FACSCalibur (BD
Biosciences). The transfection efficiency was calculated from the
percentage of the cell population which exceeded the fluorescence
intensity of the control cells, which had only been treated with
PBS. At least 2500 cells per tube were counted. The data were
analyzed with Cellquest Pro.
[0151] Cytokine Detection
[0152] Enzyme-linked immunosorbent assays (ELISA) were performed
using human IL-8 and TNF-.alpha. kits (RayBio), mouse IFN-.gamma.
and IL-12 (P40/P70) kits (RayBio) and mouse IFN-.alpha. kit (RnD
Systems).
[0153] Real Time In Vitro Translation
[0154] 500 ng of RFP mRNA was in vitro translated using Retic
Lysate IVT (Ambion). Methionine was added to a final concentration
of 50 .mu.M. The mixture was incubated at 30.degree. C. in a
water-bath, samples were withdrawn at various times and the
fluorescence intensity at 590 nm measured on a Wallac Victor.sup.2
1420 Multilabel Counter (Perkin Elmer).
[0155] Quantitative RT-PCR
[0156] The total RNA was extracted from A549 cells with RNeasy
Minikit (Qiagen) or from human PBMCs (see RIP protocol below) and
subjected to a reverse transcription (RT) in a batch of 20 .mu.l
using the iScript cDNA synthesis kit (Bio-Rad) in accordance with
the product manual. cDNA was amplified using the iQ SYBR Green
Supermix and iCycler (Bio-Rad) in double batches with the following
primers: RFP: 5'-GCACCCAGACCGCCAAGC (forwards) and RFP:
5'-ATCTCGCCCTTCAGCACGC (backwards). C.sub.t values were obtained
using the iCycler IQ software 3.1 (Bio-Rad) which automatically
calculated the baseline cycles and threshold values.
[0157] RNA Immunoprecipitation (RIP)
[0158] 1.times.10 human PBMCs (CTL-Europe GmbH) were transfected
with 5 .mu.g of mRNA using 12.8 .mu.l of Lipofectamin 2000 in 1 ml
of OptiMEM 1. After 4 hours, the media were supplemented with 10%
FCS. After 24 hours, the cell suspension was transferred into tubes
and the cells were pelletized by 10 minute centrifugation at 350
rpm. Next a modified version of the ChIP-IT Express protocol
(ActiveMotive) was used in order to perform the RIP. DEPC-treated
water (Serva Electrophoresis) was used for the preparation of all
necessary reagents. In accordance with the ChIP-IT manual, the
fixing solution and then the glycine stop-fix solution and ice-cold
1.times.PBS were added to the cells and the cells were pelletized
at 4.degree. C. Then the cells were again suspended in lysis buffer
to which the protease inhibitors PIC and PMSF had been added, and
incubated for 30 mins on ice. After 10 minute centrifugation at
2400 rpm at 4.degree. C., the supernatant was subjected to the
capture reaction. The TLR-mRNA/RIG-mRNA complexes were captured
overnight on magnetic beads in 8-well PCR strips, as described in
the ChIP-IT Express manual. In addition, SUPERase RNase inhibitor
(Applied Biosystems/Ambion) was added to a final concentration of 1
U/.mu.l. Anti-human TLR3 mouse IgG1, TLR7 rabbit IgG1, TLR8 mouse
IgG1 (all from Imgenex) and RIG-1 rabbit IgG1 (ProSci Incorporated)
were used as antibodies. After the washing of the magnetic beads,
the TLR-mRNA/RIG-mRNA antibody complexes were eluted, reverse
crosslinked and treated with proteinase K in accordance with the
ChIP-IT Express protocol. Finally, the eluted mRNA was subjected to
a reverse transcription and a quantitative RT-PCR, as described
above.
[0159] In Vivo Bioluminescence
[0160] D-luciferin substrate was dissolved in water, the pH
adjusted to 7 and the final volume adjusted such that a
concentration of 30 mg/ml was reached. 50 .mu.l of this solution
were applied onto the nostrils of the anesthetized mice and
absorbed by snuffling (1.5 mg luciferin/mouse). After 10 mins, the
bioluminescence was measured with an IVIS100 imaging system
(Xenogen) as described in (21) using the following camera settings:
visual field 10, f1 f-stop, high resolution and illumination times
from 1 to 10 mins. The signal in the pulmonary region was
quantitatively assessed and analyzed, the background being
subtracted using the Living Image Software Version 2.50
(Xenogen).
[0161] Animal Studies
[0162] 6 to 8 week old female BALB/C mice (Charles River
Laboratories) were kept under specific pathogen-free conditions and
kept in individually ventilated cages with a 12-hour light: 12-hour
dark cycle and supplied with food and water ad libitum. The animals
were acclimatized for at least 7 days before the start of the
experiments. All animal manipulations were approved and were
checked by the local ethical committee and performed according to
the guidelines of the German Animal Protection Law. For all
experiments except for the injection into the caudal vein, the
animals were anesthetized i.p. with a mixture of medetomidine (0.5
mg/kg), midazolam (5 mg/kg) and fentanyl (50 .mu.g/kg). After each
experiment, an antidote which consisted of atipamezol (50
.mu.g/kg), flumazenil (10 .mu.g/kg) and naloxone (24 .mu.g/kg) was
administered to the animals s.c. Blood for the ELISA tests was
obtained at various times by puncture of the retrobulbar vein using
heparinized 1.3 mm capillaries (Marienfeld).
[0163] Injection into the Caudal Vein
[0164] 25 .mu.g of RFP mRNA were mixed in vivo with Megafectin (MP
Biomedicals Europe) in a ratio of mRNA to lipid of 0.25 and
Enhancer-3 was added in accordance with the manufacturer's
recommendation. The integrity and particle size of the injected
complexes was determined with dynamic light scattering (DLS) using
a Zeta-PALS/zeta potential analyzer (Brookhaven Instruments Corp.).
The mice were laid in a restrainer and 100 .mu.l of the
mRNA/Megafectin solution (equivalent to 5 .mu.g of mRNA) were
injected into the caudal vein within 30 seconds using a 27 gauge
needle and a 1 ml syringe.
[0165] Intratracheal Administration by High Pressure
Nebulization
[0166] BALB/c and SP-B.sup.-/- mice were anesthetized as described
in (14) and immobilized on a plate system (Halowell EMC) such that
the upper teeth were at an angle of 45.degree.. A modified cold
light otoscope Beta 200 (Heine Optotechnik) was used in order to
optimally illuminate the pharynx. The lower jaw of the mouse was
opened with a small spatula and blunt forceps were used to push the
tongue aside and maximally expose the oropharynx. A model 1A-1C
microsprayer which was connected to a model FMJ-250 high pressure
syringe (both from PennCentury Inc.) was inserted endotracheally
and 25 .mu.l of Fluorinert FC-77 (Sigma) and 25 .mu.l of luciferase
mRNA solution (10 .mu.g) or 50 .mu.l of SP-B mRNA solution (20
.mu.g) were successively applied. After 5 secs the microsprayer
syringe was withdrawn and the mouse was taken from the support
after 5 mins.
[0167] Pulmonary Function Measurements
[0168] Homozygotic SP-B.sup.-/- mice.+-.doxycycline.+-.modified
mRNA were anesthetized as described above. To prevent spontaneous
breathing, vecuronium bromide (0.1 mg/kg) was injected
intraperitoneally. The pulmonary mechanical measurements were
performed as described in (22). In brief, a blunt steel cannula
(external diameter 1 mm) was inserted in the trachea with
tracheostomy. The piston pump respirator served both as respirator
and also as a measurement device (flexiVent, SAV). During the tidal
ventilation, the respirator was set to controlled volume- and
pressure-restricted ventilation (Vt=10 .mu.l/g, Pmax=30 cm
H.sub.2O, PEEP 2-3 cm H.sub.2O at 2.5 Hz and 100% oxygen). The Vt
used was 8.4.+-.1.4 .mu.l/g in animals which were receiving
doxycycline and 8.9.+-.0.4 .mu.l/g BW in animals which were
receiving doxycycline and mRNA (N.S.). The dynamic-mechanical
properties of the respiratory system and also the pulmonary entry
impedance were measured at 5 minute intervals in animals after
insufflation twice at 15 .mu.l/g for 1 sec in order to create a
standard volume history. For the oscillatory measurement, the
ventilation was stopped at the PEEP level. In order to determine
the impedance of the respiratory system (Z.sub.rs) by forced
oscillations (FOT), which consisted of a pseudorandom oscillatory
signal of 8 secs, an amplitude of 3 ml/g was used. The forced
signal had frequencies between 1.75 and 19.6 Hz (23, 24). The data
were collected at 256 Hz and analyzed with a window of 4 secs with
66% overlap. The pulmonary impedance data were represented as
resistance (real part) and reactivity (imaginary part) of the
respiratory system within the frequency domain. The pulmonary
impedance data (Zrs) were subdivided using the constant phase model
of the lung, as proposed by Hantos et al. (25). In this model, Zrs
consists of a respiratory resistance (Rn), a respiratory tract
inertia (inertia), a tissue elasticity (H.sub.L) and a tissue
damping (G.sub.L) according to the equation:
Zrs=Raw+j.omega.law+(G.sub.L-jH.sub.L)/.omega..sup..alpha.,
wherein .omega. is the angular frequency and .omega. the frequency
dependence of Zrs (.omega.=(2/.omega. tan.sup.-1(1/.omega.). The
pulmonary hysteresivity (eta=G.sub.L/H.sub.L) is a measure of the
lung tissue composition, wherein both the tissue damping and also
the tissue elasticity are included (26, 27). For each measurement
the constant phase model is automatically tested for fit. The fit
quality is represented as the coherence of the determination (COD),
and the data are rejected if the COD is below 0.85.
[0169] Analysis of the Surfactant Protein
[0170] The total protein content of the lavage supernatants was
determined with the Bio-Rad protein assay kit (Bio-Rad). 10 .mu.g
of total protein were separated under non-reducing conditions on
NuPage 10% bis-tris gels using a NOVEX Xcell II mini-cell system
(Novex). After the electrophoresis, the proteins were transferred
onto a PVDF membrane (ImmobilonP) with a NuPage blot module
(Novex). Surfactant protein B (SP-B) was detected with polyclonal
rabbit antiserum which was directed against SP-B (c329, gift from
Dr W. Steinhilber, Altana A G) and an improved chemiluminescence
test (Amersham Biosciences) was then performed with horseradish
peroxidase conjugated polyclonal goat anti-rabbit anti-IgG
(1:10000, Dianova). Under these conditions, the test could detect
about 2.5 ng of SP-B per track (28). As the chemiluminescence
detection system, DIANA III dev. 1.0.54 with the Aida image
analyzer (Ray test Isotopenmessgerate GmbH) was used and the data
were quantitatively assessed with Quantity One 4.6.7 (Bio-Rad).
[0171] Fluorescence Microscope Analysis
[0172] Sections fixed (3% paraformaldehyde) and embedded in
paraffin wax were subjected to immunohistochemistry as recommended
by the manufacturer (Abcam, www.abcam.com/technica). The slides
were incubated with anti-human anti-mouse SP-B antibody and with
Texas red-conjugated anti-rabbit IgG antibody (both from Abcam,
1:500) and counterstained with DAPI. Fluorescent images were
obtained by Zeiss Axiovert 135.
[0173] Statistics
[0174] Differences in mRNA expression between groups were analyzed
by pairwise fixed reallocation randomization tests with REST 2005
software (29). The half-lives for the decay of the bioluminescence
were calculated with Prism 5.0. All other analyses were performed
using the Wilcoxon-Mann-Whitney test with SPSS 15 (SPSS Inc.). The
data are stated as mean value.+-.SEM (standard error of the mean
value) or as median.+-.IQR (interquartile ranges) and P<0.05
(two-sided) was regarded as statistically significant.
EXAMPLE 6
[0175] mRNA multiply modified according to the invention which
encodes EPO
[0176] With a method essentially as described in example 3,
modified mRNA was produced which contained an EPO-encoding part.
The expression efficiency of this mRNA was tested. For this, 5
.mu.g of mRNA modified according to the invention or of
non-modified mRNA were injected i.m. into mice. Each group of mice
had four members. On day 14 and day 28 after administration of the
RNA, the content of EPO in the serum was assessed quantitatively
with an ELISA test. The hematocrit value was assessed in whole
blood from mice in the same experiment. The data shown in the
appended FIG. 11 each represent the mean value.+-.SEM. The scatter
blot shows the individual hematocrit values. Bars show median
values. *P<0.05 compared to the untreated group at each time
point; +P<0.05 compared to the unmodified mEPO group at each
time point.
[0177] (c) The data show the mean value.+-.SEM. Human PBMCs were
transfected with 5 .mu.g of unmodified or modified RFP mRNA and the
recovery rates were determined with RIP using antibodies specific
for TLR-3, TLR-7 and TLR-8. The boxes signify mean values.+-.IQR.
The lines show the minimum and maximum values. *P<0.5,
**P<0.01, ***P<0.001 compared to unmodified mEPO group.
[0178] (d) 5 .mu.g of unmodified and modified mEPO mRNA were
injected intravenously into mice (n=4 for each). After 24 hours,
the interferon-.gamma., IL-12 and interferon-.alpha. levels in the
serum were assessed quantitatively by ELISA.
[0179] As can be seen from the diagrams, for the RNA modified
according to the invention the inflammatory markers are in the
non-pathological range, while for unmodified RNA or modified RNA
only with modified uridine nucleotides the inflammatory markers are
markedly elevated.
[0180] Thus according to the invention an mRNA which encodes EPO is
provided which is very stable and at the same time causes few or no
immunological reactions. Such an mRNA can advantageously be used
for the treatment of erythropoietin deficiency. Because of the high
stability, administration is only necessary every 2 to 4 weeks.
EXAMPLE 7
[0181] It was investigated how the repeated administration of
EPO-encoding mRNA modified according to the invention affects the
hematocrit values. This was to show whether the mRNA modified
according to the invention also remains active over a longer period
when it is administered into the body. An immunological reaction to
the mRNA according to the invention would for example decrease the
activity.
[0182] Hence 10 .mu.g of modified mEPO mRNA (as described in
example 6) were administered to mice intramuscularly on days 0, 21
and 34 (n=10). The hematocrit value was then determined in the
whole blood from the mice on days 0, 21, 34, 42 and 51. The results
are shown in FIG. 14. The data in the diagram show the
mean.+-.standard error. *P<0.05 compared to the hematocrit value
on day 0.
[0183] The results confirm that repeated administration of the mRNA
modified according to the invention leads to a long-lasting
elevation of the hematocrit value. This shows that the mRNA remains
active, even when it is administered many times.
EXAMPLE 8
[0184] mRNA modified according to the invention is also suitable
for bringing proteins promoting healing or ingrowth into the
vicinity of implants in order thus to promote the healing process
or the ingrowth. In order to show that the mRNA modified according
to the invention is stably and lastingly expressed when it is
applied in the form of a coating on titanium surfaces, a coating
which contained mRNA which encoded luciferase was applied onto
titanium plates. It was then investigated whether and for how long
luciferase could be detected in the vicinity, free or in cells.
[0185] Two sequences encoding different proteins were used for the
experiment, namely an RNA for luciferase which is secreted from the
cell expressing it, as a model for proteins which are to be
released into the vicinity, such as for example growth factors or
angiogenesis factors. Further, RNA which encodes a luciferase which
is not secreted but remains in the cell was used as a model for
proteins which are to have some kind of effect in the cell. For the
secretion model, RNA which encoded Metridia luciferase was used,
wherein compared to the wild type 25% of the uridine units were
replaced by s2U and 25% of the cytidine units were replaced by m5C.
For the non-secretion protein model, a firefly luciferase-encoding
mRNA was used wherein likewise 25% of the uridine units were
replaced by s2U and 25% of the cytidine units were replaced by the
modified m5C.
[0186] It was found that the mRNA preparations according to the
invention, which were protected as a complex with polymer, after
release from the coating material remained active and were
expressed over a prolonged period. It was found that the respective
protein encoded by the mRNA modified according to the invention
could be detected over a prolonged period.
[0187] For the tests, the mRNA modified according to the invention,
protected by a polymer complex, was embedded in a carrier material
which was applied as a layer onto titanium plates. The carrier
material was polylactide (PDLLA), a well-known material for this
purpose, which can selectively release the contained mRNA
gradually. An advantage of such a coating is that the release can
be specifically adjusted. The results show that the polylactide
fragments released on degradation do not impair the activity of the
mRNA, so that this system is very suitable. The mRNA itself is
stabilized by a coating polymer.
[0188] For the experiments, Metridia luciferase-encoding plasmid
DNA (pDNA) or modified mRNA was used. 9 .mu.g respectively of
Metridia luciferase pDNA or doubly modified
s2U.sub.(0.25)m5C.sub.(0.25) mRNA in 200 .mu.l of H.sub.2O (+ if
necessary 500 .mu.g of lactose) were complexed with 9.4 .mu.g of
L-PEI (L-polyethyleneimine) in 200 .mu.l of H.sub.2O. After this,
the complexes were introduced into 100 .mu.l of a coating polymer
solution (2.4 .mu.l of 409.1 mM P6YE5C) and lyophilized overnight
(the coating polymer P6YE5C was prepared as described in EP 11 98
489). After this, the complexes were suspended in 72 .mu.l of a
PDLLA (poly-DL lactide)/EtOAc (50 mg/ml PDLLA) mixture on ice and
dispersed by means of a micropotter. Autoclaved titanium plates
(r=3 mm, 18 .mu.l each) in a 96-well plate were coated with this
dispersion. After a further lyophilization overnight, A549 cells in
200 .mu.l of RPMI-1640 medium were added (5000 cells/200 .mu.l).
From the second day, 50 .mu.l of the supernatant were taken in each
case, the medium changed and the Metridia luciferase expression
determined on the following days by means of 100 .mu.l of
coelenterazine solution (0.003 mM final concentration) for
each.
[0189] In a further experiment, the activity of the Metridia
luciferase-encoding mRNA modified according to the invention was
tested when this had been deposited onto calcium phosphate
particles and introduced into the coating in this form. For this, 4
.mu.g of Metridia luciferase s2U.sub.(0.25)m5C.sub.(0.25) mRNA in
600 .mu.l of 1.times.HBS were mixed each time with 33 .mu.l of 2.5M
CaCl.sub.2. After 30 mins, autoclaved titanium plates (r=3 mm, 18
.mu.l each) in a 96-well plate were coated with this. After
lyophilization overnight, A549 cells in 200 .mu.l of RPMI-1640
medium were added (5000 cells/200 .mu.l). From the second day, 50
.mu.l of each supernatant were taken, the medium changed and the
Metridia luciferase expression determined on the following days by
means of 100 .mu.l of coelenterazine solution (0.003 mM final
concentration) for each.
[0190] The results can be seen in the diagram in FIG. 15. The
results show clearly that mRNA modified according to the invention
stays active even when it is protected with a polymer coating,
introduced into a delayed release matrix and applied onto titanium
implants. Moreover the mRNA modified according to the invention
remains biologically active and is continuously translated into the
encoded protein. The secretion capacity is also retained, which is
seen from the fact that the Meridia luciferase can be detected in
the cell culture medium (as a model for secreted bone growth
factors such as for example BMP-2). In addition, the results
surprisingly show that the coating with modified mRNA yields higher
protein expression than the coating of titanium implants with the
analogous plasmid DNA. When the mRNA/PEI complexes are provided
with a coating polymer before the incorporation into the titanium
implant coating, still higher protein expression is obtained than
with the use of the same complexes, but without coating polymer (in
the figure mod. mRNA/IPEI-P6YE5C). Moreover it was found that the
addition of lactose as an additive is possible without the modified
mRNA losing its biological activity.
[0191] The results also show that modified mRNA precipitated onto
calcium phosphate particles retains its activity and can exercise
its advantageous properties in the titanium implant coating. The
biological activity is retained. This is of particular importance
since calcium phosphate can be directly incorporated into the
bone.
[0192] As indicated above, a further experiment was performed with
firefly luciferase-encoding DNA or RNA. For this, 9 g of firefly
luciferase pDNA or modified s2U.sub.(0.25)m5C.sub.(0.25) mRNA
respectively in 200 .mu.l of H.sub.2O were complexed with 9.4 .mu.g
of L-PEI in 200 .mu.l of H.sub.2O. After this, the complexes were
introduced into 100 .mu.l of a coating polymer solution (2.4 .mu.l
of 409.1 mM P6YE5C) and lyophilized overnight. Next, the complexes
were dissolved in 72 .mu.l of a poly-DL-lactic acid (PDLLA)/ethyl
acetate (EtOAc) (50 mg/ml PDLLA) mixture on ice and dispersed by
means of a micropotter. Autoclaved titanium plates (r=3 mm, 18
.mu.l each) in a 96-well plate were coated with this dispersion.
After a further lyophilization overnight, A549 cells in 200 .mu.l
of RPMI-1640 medium were added (5000 cells/200 .mu.l). On the
second day, 1 .mu.l of 350 .mu.M D-luciferin were added to each
well, incubated for 20 mins and the luciferase expression
determined by bio-imaging. The results are shown in FIG. 16. As can
be seen from the diagram on FIG. 16, titanium implants can be
coated with mRNA modified according to the invention during which
the mRNA also further remains biologically active and translates
the encoded protein. The protein formed remains in the cell and can
be detected intracellularly. In addition, the results show that the
coating with modified mRNA leads to higher protein expression than
the coating of titanium implants with the analogous plasmid
DNA.
EXAMPLE 9
[0193] In order to control the expression of the mRNA modified
according to the invention so that the encoded protein is only
expressed in cells in which it is wanted, but not in other cells, a
micro-RNA binding site was incorporated into the mRNA in order to
enable cell-specific regulation of the mRNA expression.
[0194] For this, HEK293 cells were cultured in MEM with 10% FCS and
1% penicillin-streptomycin. 24 hrs before the transfection, 100000
cells/well were sown into a 24-well plate. Directly before the
transfection, the medium was replaced by 400 .mu.l of Optimem
(Invitrogen). U937 cells were cultured in RPMI-1640 medium with 10%
FCS and 1% penicillin-streptomycin. Directly before the
transfection 800000 U937 cells in 400 .mu.l of Optimem medium
(Invitrogen) per well were sown into a 24-well plate. For each
well, 100 ng of EGFP mRNA and 250 ng of RFP miRNA-BS mRNA (see
below) were diluted to 50 .mu.l with Optimem. 2 .mu.l of
Lipofectamine 2000 were made up to 50 .mu.l with Optimem and
incubated for 5 mins at room temperature. Next the mRNA solution
was pipetted into the Lipofectamine 2000 solution and incubated for
a further 20 mins at room temperature. The resulting solution was
pipetted into the wells with the cells and after 4 hrs
penicillin-streptomycin (5 .mu.l) was added and the incubation
continued overnight in the incubator. After this, the HEK293 cells
were washed with PBS and detached from the floor of the wells by
addition of trypsin before being centrifuged for 5 mins at 300 G.
The U937 cells were also centrifuged for 5 mins at 300 G. The
supernatant was removed and the respective cells then washed twice
with PBS. Next the cells were resuspended in 500 .mu.l of PBS for
the FACS analysis. In the two diagrams of FIG. 17, the ratio of the
expression of EGFP to the expression of RFP is shown as the number
of positive cells (FIG. 17A) and as the mean RFP fluorescence
intensity (FIG. 17B).
[0195] The results show that by the incorporation of a micro-RNA
binding site into in vitro transcribed mRNA the expression can be
cell-specifically regulated. In the RFP miRNA-BS mRNA, the
untranslated sequence of a fourfold repetition of a micro-RNA
binding site, which are separated from one another by short spacing
sequences, is situated 3' from the RFP sequence and 5' from the
polyA tail (SEQ ID No.1). A micro-RNA binding site which binds to
the micro-RNA 142-3p was used. This micro-RNA is expressed in
hematopoietic cells such as U937 cells, but not in cells of other
origin, such as HEK-293 cells. When micro-RNA 142-3p binds to the
RFP miRNA-BS mRNA, e.g. in the U937 cells, the degradation of the
mRNA is initiated by RNA interference. As a result the formation of
RFP is decreased, i.e. fewer cells express RFP at lower intensity
than in cells in which micro-RNA 142-3p is not present. In order to
show that this principle also functions well with the mRNA modified
according to the invention, U937 and HEK-293 cells were each
co-transfected with EGFP mRNA (without micro-RNA binding site) and
RFP miRNA-BS mRNA (with fourfold tandem repetition of the micro-RNA
binding site for the micro-RNA 142-3p) and the expression of EGFP
and RFP then measured by FACS. Since the RFP miRNA-BS mRNA is
degraded because of RNA interference more rapidly in U937 cells
than in HEK-293 cells, while the EGFP mRNA is equally stable in
both cells, it is expected that the ratio of EGFP to RFP will be
higher in HEK-293 cells than in U937 cells. This could be confirmed
in the experiments performed. The diagram shows clearly that the
number of RFP-positive U937 cells after normalization to the number
of EGFP-positive cells is markedly lower than in HEK-293 cells. The
same applies for the quantity of RFP formed per cell. The results
thus also show clearly that the scale of the biological activity of
in vitro transcribed mRNA can be controlled after transfection in
cells by the incorporation of micro-RNA binding sites. The mRNA
translation can thus be suppressed in cells in which the mRNA
translation is undesired. Side effects can also be reduced
thereby.
[0196] The mRNA used for the experiments in this example has the
following sequence (SEQ ID No.1). The RFP sequence is shown with a
gray background. The underlined sequence shows the fourfold tandem
repetition of the micro-RNA binding site for the micro-RNA 142-3p
with spacing sequences. After synthesis, the sequence was cloned
into the vector pVAX1 using BamHI-EcoRv.
TABLE-US-00004 ##STR00001## ##STR00002## ##STR00003## ##STR00004##
##STR00005## ##STR00006## ##STR00007## ##STR00008## ##STR00009##
##STR00010## ##STR00011##
AAAGTAGGAAACACTACACGATTCCATAAAGTAGGAAACACTACAACCGG
TTCCATAAAGTAGGAAACACTACATCACTCCATAAAGTAGGAAACACTAC
ACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAGATATC
REFERENCES
[0197] 1. K. Kariko et al., Mol Ther (Sep. 16, 2008) [0198] 2. L.
Alexopoulou, A. C. Holt, R. Medzhitov, R. A. Flavell, Nature 413,
732 (Okt 18, 2001) [0199] 3. S. S. Diebold, T. Kaisho, H. Hemmi, S.
Akira, C. Reis e Sousa, Science 303, 1529 (Mar. 5, 2004) [0200] 4.
F. Heil et al., Science 303, 1526 (Mar. 5, 2004) [0201] 5. M.
Yoneyama et al., Nat Immunol 5, 730 (July, 2004) [0202] 6. M.
Bivas-Benita, R. Zwier, H. E. Junginger, G. Borchard, Eur J Pharm
Biopharm 61, 214 (Okt, 2005) [0203] 7. D. J. Weiss et al., Mol Ther
8, 927 (Dez, 2003) [0204] 8. T. E. Weaver, J. A. Whitsett, Am J
Physiol 257, L100 (Au, 1989) [0205] 9. S. W. Glasser et al., Proc
Natl Aced Sci USA 84, 4007 (June 1987) [0206] 10. J. A. Whitsett.
T. E. Weaver, N Engl J Med 347, 2141 (Dez 26, 2002) [0207] 11. L.
M. Nogee, D. E. de Mello, L. P. Dehner, H. R. Colten, N Engl J Med
328, 406 (Feb. 11, 1993) [0208] 12. A. Hamvas et al., J Pediatr
130, 231 (February, 1997) [0209] 13. J. C. Clark et al., Proc Natl
Aced Sci USA 92, 7794 (Aug. 15, 1995) [0210] 14. K. R. Melton et
al., Am J Physiol Lung Cell Mol Physiol 285, L543 (September 2003)
[0211] 15. M. Ikegami, J. A. Whitsett, P. C. Martis, T. E. Weaver,
Am J Physiol Lung Cell Mol Physiol 289, L962 (Dez, 2005) [0212] 16.
B. D. Brown, M. A. Venneri, A. Zingale, L. Sergi Sergi, L. Naldini,
Nat Med 12, 585 (Mai, 2006) [0213] 17. B. D. Brown et al, Nat
Biotechnol 25, 1457 (Dez, 2007) [0214] 18. S. A. McKenna et al.,
Nat Protoc 2, 3270 (2007) [0215] 19. S. Holtkamp et al., Blood 108,
4009 (Dez 15, 2006) [0216] 20. M. L. Read et al., Nucleic Acids Res
33, e86 (2005) [0217] 21. M. K. Aneja, R. Imker, C. Rudolph, J Gene
Med 9, 967 (November 2007) [0218] 22. P. Dames et al., Nat
Nenotechnol 2, 495 (August 2007) [0219] 23. J. J. Pillow, T. R.
Korfhagen, M. Ikegami, P. D. Sly, J Appl Physiol 91, 2730 (Dez
2001) [0220] 24. T. F. Schuessler, J. H. Bates, IEEE Trans Biomed
Eng 42, 860 (September 1995) [0221] 25. Z. Hantos, A. Adamicza, E.
Govaerts, B. Daroczy, J Appl Physiol 73, 427 (August 1992) [0222]
26. C. M. Alleyne, I. D. Frantz, 3rd, J. J. Fredberg, J Appl
Physiol 66, 542 (February 1989) [0223] 27. P. D. Sly, R. A.
Collins, C. Thamrin, D. J. Turner, Z. Hantos, J Appl Physiol 94,
1460 (April 2003) [0224] 28. M. Griese et al., Respir Res 6, 80
(2005) [0225] 29. M. W. Pfaffl, G. W. Horgan, L. Dempfle, Nucleic
Acids Res 30, e36 (Mai 1, 2002)
Sequence CWU 1
1
31868DNAArtificial SequenceDescription of artificial sequence note
= synthetic construct 1ggatccatgg cctcctccga ggacgtcatc aaggagttca
tgcgcttcaa ggtgcgcatg 60gagggctccg tgaacggcca cgagttcgag atcgagggcg
agggcgaggg ccgcccctac 120gagggcaccc agaccgccaa gctgaaggtg
accaagggcg gccccctgcc cttcgcctgg 180gacatcctgt ccccccagtt
ccagtacggc tccaaggtgt acgtgaagca ccccgccgac 240atccccgact
acaagaagct gtccttcccc gagggcttca agtgggagcg cgtgatgaac
300ttcgaggacg gcggcgtggt gaccgtgacc caggactcct ccctgcagga
cggctgcttc 360atctacaagg tgaagttcat cggcgtgaac ttcccctccg
acggccccgt aatgcagaag 420aagactatgg gctgggagcc ctccaccgag
cgcctgtacc cccgcgacgg cgtgctgaag 480ggcgagatcc acaaggccct
gaagctgaag gacggcggcc actacctggt ggagttcaag 540tccatctaca
tggccaagaa gcccgtgcag ctgcccggct actactacgt ggactccaag
600ctggacatca cctcccacaa cgaggactac accatcgtgg agcagtacga
gcgcgccgag 660ggccgccacc acctgttcct gtagctagag tcgactccat
aaagtaggaa acactacacg 720attccataaa gtaggaaaca ctacaaccgg
ttccataaag taggaaacac tacatcactc 780cataaagtag gaaacactac
acaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 840aaaaaaaaaa
aaaaaaaaaa aagatatc 868218DNAArtificial SequenceDescription of
artificial sequence note = synthetic construct 2gcacccagac cgccaagc
18319DNAArtificial SequenceDescription of artificial sequence note
= synthetic construct 3atctcgccct tcagcacgc 19
* * * * *
References