U.S. patent application number 14/680787 was filed with the patent office on 2015-10-01 for adam-15 antibodies and immunogenic peptides.
This patent application is currently assigned to Vasgen Limited. The applicant listed for this patent is Vasgen Limited. Invention is credited to Yatin Patel, Salman Rahman.
Application Number | 20150274842 14/680787 |
Document ID | / |
Family ID | 41114389 |
Filed Date | 2015-10-01 |
United States Patent
Application |
20150274842 |
Kind Code |
A1 |
Rahman; Salman ; et
al. |
October 1, 2015 |
ADAM-15 ANTIBODIES AND IMMUNOGENIC PEPTIDES
Abstract
The present invention relates to antibodies and antigen-binding
fragments thereof, immunogenic peptide(s), and siRNA molecules
which are capable of inhibiting neovascularization and/or
angiogenesis and endothelial cell proliferation. The invention
relates to antibodies and antigen-binding fragments thereof with
specificity towards the metalloprotease domain of ADAM 15 and to
immunogenic peptide(s) that elicits such antibodies. The invention
also relates to compositions and kits comprising the antibodies and
immunogenic peptide(s) of the invention, as well as methods and
uses of the antibodies and antigen-binding fragments thereof and
immunogenic peptide(s), as well as siRNA molecules.
Inventors: |
Rahman; Salman; (London,
GB) ; Patel; Yatin; (London, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Vasgen Limited |
London |
|
GB |
|
|
Assignee: |
Vasgen Limited
London
GB
|
Family ID: |
41114389 |
Appl. No.: |
14/680787 |
Filed: |
April 7, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12934541 |
Dec 6, 2010 |
9040049 |
|
|
PCT/IB09/05613 |
Mar 24, 2009 |
|
|
|
14680787 |
|
|
|
|
61038837 |
Mar 24, 2008 |
|
|
|
Current U.S.
Class: |
530/387.3 ;
435/254.11; 435/254.2; 435/320.1; 435/331; 435/348; 435/352;
435/354; 435/366; 530/387.9 |
Current CPC
Class: |
C07K 2299/00 20130101;
C12N 15/1137 20130101; C07K 2317/73 20130101; A61P 35/00 20180101;
C07K 16/40 20130101; C07K 2317/75 20130101; C12N 2310/14 20130101;
C12N 2310/141 20130101; C07K 2317/14 20130101; C07K 2317/33
20130101; C07K 2317/76 20130101; A61K 2039/505 20130101; C07K
2317/34 20130101; A61P 35/02 20180101 |
International
Class: |
C07K 16/40 20060101
C07K016/40; C12N 15/113 20060101 C12N015/113 |
Claims
1. An expression vector comprising a nucleic acid encoding an
ribonucleic acid (RNA) interference molecule that specifically
targets a human ADAM 15 nucleic acid and specifically inhibits
expression of the human ADAM 15 nucleic acid, wherein the human
ADAM 15 nucleic acid comprises sequence 5' CTCCATCTGTTCTCCTGACTT 3'
(nucleotides 3-23 of SEQ ID NO: 4) and/or complementary sequence 5'
AAGTCAGGAGAACAGATGGAG 3' (nucleotides 3-23 of SEQ ID NO: 5).
2. The expression vector of claim 1, wherein the RNA molecule is
selected from the group consisting of: microRNAs (miRNAs), short
interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs) and short
hairpin RNAs (shRNAs).
3. The expression vector of claim 1, wherein the RNA interference
molecule specifically targets sequence 5' CTCCATCTGTTCTCCTGACTT 3'
(nucleotides 3-23 of SEQ ID NO: 4) and/or complementary sequence 5'
AAGTCAGGAGAACAGATGGAG 3' (nucleotides 3-23 of SEQ ID NO: 5) of the
human ADAM 15 nucleic acid.
4. A cell comprising the expression vector of claim 1.
5. An isolated monoclonal antibody, or antigen-binding fragment
thereof, that specifically binds to the catalytic cleft of the
ADAM15 metalloprotease domain.
6. The isolated monoclonal antibody, or antigen-binding fragment
thereof, of claim 5, wherein the monoclonal antibody, or
antigen-binding fragment thereof, specifically inhibits ADAM15
metalloprotease activity.
7. The isolated monoclonal antibody, or antigen-binding fragment
thereof, of claim 5, wherein the antibody, or antigen-binding
fragment thereof, is a mouse, humanized, recombinant, chimeric, or
synthetic antibody or antigen-binding fragment thereof.
8. The isolated monoclonal antibody, or antigen-binding fragment
thereof, of claim 5, wherein the antibody, or antigen-binding
fragment thereof, comprises Fab, Fab1, F(ab')2, scFv, Fv, dsFv,
ds-scFv, Fd, dAbs, TandAbs dimers, minibodies, diabodies, multimers
thereof, or a bispecific antibody fragment.
9. An expression vector comprising a nucleic acid encoding the
isolated monoclonal antibody, or antigen binding fragment thereof,
of claim 5.
10. A host cell comprising the expression vector of claim 9.
11. The isolated monoclonal antibody, or antigen-binding fragment
thereof, of claim 6, wherein the antibody or antigen-binding
fragment thereof is a mouse, humanized, recombinant, chimeric, or
synthetic antibody or antigen-binding fragment thereof.
12. The isolated monoclonal antibody, or antigen-binding fragment
thereof, of claim 6, wherein the antibody, or antigen-binding
fragment thereof, comprises Fab, Fab1, F(ab')2, scFv, Fv, dsFv,
ds-scFv, Fd, dAbs, TandAbs dimers, minibodies, diabodies, multimers
thereof, or a bispecific antibody fragment.
13. An expression vector comprising a nucleic acid encoding the
isolated monoclonal antibody, or antigen binding fragment thereof,
of claim 6.
14. A host cell comprising the expression vector of claim 13.
Description
RELATED APPLICATIONS
[0001] This application claims is a continuation of U.S.
application Ser. No. 12/934,541, filed Dec. 6, 2010, which is a
national stage filing under 35 U.S.C. .sctn.371 of international
application number PCT/IB2009/005613, filed Mar. 24, 2009, which
claims the benefit under 35 U.S.C. .sctn.119(e) from U.S.
provisional application No. 61/038,837, filed Mar. 24, 2008, each
of which is incorporated herein by reference.
FIELD OF THE INVENTION
[0002] Aspects of the present invention relate to antibodies and
antigen-binding fragments thereof, and immunogenic peptides,
methods and uses thereof, and kits comprising said antibodies,
fragments and peptides.
BACKGROUND OF THE INVENTION
[0003] Cancer is one of the world's biggest killers, with estimates
that 7.6 million people died of cancer in 2005--representing 13% of
deaths worldwide. Between 2005 and 2015, 84 million more people
will die if urgent action is not taken (WHO forecast). Such
statistics have prompted a large-scale investment in cancer
research in both the public health and private sectors. Therefore,
there is an urgent need to translate medical research towards the
development of novel cancer treatments and drugs.
[0004] It was Folkman's group in the early 70's that performed
definitive experiments demonstrating the release by implanted
tumours of soluble factors that promote the induction of
angiogenesis within the host leading to the recruitment of a blood
supply supporting tumour growth and metastasis. These pioneering
experiments suggested that abrogation of tumour angiogenesis would
be a viable anti-cancer therapeutic strategy and this has been
supported by pre-clinical studies. The development of
anti-angiogenic drugs including monoclonal antibodies (Avastin) to
the important angiogenic factor VEGF has led to the successful
application of this strategy in the clinic. Anti-angiogenic drugs
in combination with standard chemotherapy have generated impressive
results in clinical trials. However, drugs such as Avastin have
shown signs of promoting severe side effects and this has prompted
the search for more selective and milder alternatives.
[0005] Angiogenesis is the process of neocapillary sprouting from
pre-existing vessels in response to signals induced by hypoxia.
Physiological angiogenesis is a finely regulated process involving
the interplay between distinct vascular cell types incorporating a
host of humoural regulatory molecules controlling and coordinating
primarily endothelial and smooth muscle cell responses. Newly
developing vessels are organised into a patterned vascular network
that is directed by the hypoxic requirements of a particular organ
but, nonetheless, undergo common cell-coordinated responses such as
migration, proliferation, tubulogenesis, and remodelling.
[0006] The most important physiological humoural mediator of
angiogenesis is VEGF-A which controls vessel permeability,
endothelial cell (EC) proliferation and survival, migration and
morphogenetic processes associated with vascular patterning (1).
The challenge to understanding the biology of angiogenesis is the
elucidation of the spatiotemporal regulation of VEGF A signalling
that controls the sequential processes during capillary sprouting,
growth and maturation.
[0007] Recent work has highlighted the important role of the
specialisation of the endothelial compartment of sprouting vessels.
Gerhardt et al showed in the retina that specialized tip cells
characterised by extensive filopodia present at the migrating front
of the developing vascular plexus guide vascular patterning in
response to matrix associated gradients of VEGF A. In contrast,
cells comprising the vessel stalk proliferate in response to
soluble VEGF A concentration (2, 3). At the molecular level, we and
others have shown that the extracellular matrix (ECM) component
fibronectin (Fn) augments EC responses induced by VEGF A through
collaborative signalling between the receptor tyrosine kinase
VEGFR2 and the integrin .alpha..sub.5.beta..sub.1 (4-6). We
identified and mapped a VEGF binding domain within domains
III.sub.12-14 of the Hep II region of Fn that augments VEGF
A/VEGFR2 mediated EC responses (7). The combined activity of the
Hep II VEGF binding domain and the cell-binding domain encompassing
modules III.sub.9-III.sub.10 present within a single Fn fragment
was indispensable for signal amplification.
[0008] While the discovery of binding domains in Fn and further
VEGF A sequestration by additional ECM components such as heparan
sulphate proteoglycans (2) provide molecular insights into how
matrix-associated VEGF A gradients are established to drive tip
cell migration, the VEGF A-dependent mechanisms that regulate
capillary stalk morphogenesis and integrity are not well
understood. Evidence highlighting the necessity of controlling VEGF
concentration during vasculogenesis have come from studies
employing VEGFR1 null mice which showed that embryonic lethality is
caused by abnormal vessel development in utero characterised by
vascular overgrowth, a consequence of dysregulated endothelial cell
proliferation (8). Furthermore, during development, the
extracellular domain of VEGFR1 was sufficient to support
vasculogenesis in VEGFR1 kinase null mice supporting the notion
that controlling VEGF A concentration is an important physiological
parameter in regulating angiogenesis through controlling the
proliferative capacity of endothelial cells (9).
[0009] These studies illustrate that during
angiogenesis/vasculogenesis signalling through the VEGF A-VEGFR2
axis is regulated through multiple pathways utilising several
distinct families of receptors, specially adapted endothelial
subpopulations and the spatial regulation of VEGF concentration and
gradients established in association with components of the ECM.
This raises the possibility that additional molecules may also be
involved in regulating VEGFR2 dependent processes including those
regulating stalk cell behaviour. A potential candidate gene family
for the regulation of VEGF signalling and angiogenesis are the
ADAMs family of disintegrin-metalloproteases that have been
implicated in modulating many cellular processes including
adhesion, fusion, differentiation and surface protein shedding
(10). ADAM's proteins were initially identified as important
regulators of gamete fusion but have since been implicated in
several other physiological processes including neurogenesis,
myogenesis and the regulation of the inflammatory response (11,
12). The presence of a disintegrin domain has been shown to mediate
integrin binding, although the physiological consequence of this
activity in many ADAMs family members remains controversial.
However, the biological function of their metalloprotease activity
shows increasing prominence in the process of protein ectodomain
shedding. For example, ADAM 17 or TACE has been shown to
proteolytically process the precursor form of the pro-inflammatory
cytokine TNF.alpha., thereby promoting the release of the active
cytokine from the cell surface (13). In addition, mammalian ADAM 10
(MADM) was also shown to possess TNF.alpha.-converting activity
whereas the Drosophila ortholog KUZ is known to regulate notch
signalling through cleavage of its extracellular domain promoting
lateral inhibition during neurogenesis (14, 15) Furthermore, ADAM
13 which is expressed in Xenopus neural crest cells, is necessary
for their migratory activity required for later stages of
neurogenesis and this is thought to be due to the re-modelling
(cleavage) of Fn by the metalloprotease domain (16, 17). Lastly,
ADAM 17 has been reported to be responsible for the ectodomain
shedding of GP1b.alpha. and GP V, components of the receptor
complex for vWF, from platelets after treatment with aspirin (18).
Therefore, it is conceivable that members of the ADAMs family could
regulate VEGF A mediated responses through mechanisms involving
these established biological activities or via hitherto
unappreciated modes of action.
[0010] Previous studies have shown that ADAM 15 is expressed in
cultured EC and smooth muscle cells (SMC) and its expression is
elevated in diseased vascular tissue (19) suggesting a role in
pathological vascular remodelling. ADAM 15 is a family member with
a predicted active metalloprotease which is expressed in cells of
haematopoeitic and neural origin. The human orthologue of ADAM 15,
metargidin, is the only ADAM family member with an active canonical
RGD sequence within its disintegrin domain (20). ADAM 15 has also
been co-localised to the adherens junctions of endothelium with
VE-cadherin suggesting that ADAM 15 may be involved in processes
involving these cell junctions (21).
[0011] In 2003, it was shown that ADAM 15.sup.-/- null mice develop
normally but exhibit impaired pathological angiogenesis. This lead
to speculation about a potential role for ADAM 15 in pathological
neovascularization in mice (22).
[0012] In 2004, Blobel et al. (51) suggested that therapeutic
agents which inhibit ADAM 9 and/or ADAM 15 might be used for the
treatment of vascularization-related disease or wound healing.
Antibodies, small molecule therapeutics, antisense RNAs and an
agent for introducing targeted mutations in the genetic sequence of
ADAM 9 or ADAM 15 were suggested in this regard although not
exemplified. Suitable targets for the development of antibody
therapies were said to include intact ADAM9, intact ADAM15,
portions of ADAM9 or ADAM15 derived from the extracellular portions
of the protein; the protease and disintegrin domains of the
extracellular portions were also postulated as potential targets.
However, no data in support of the action of such therapeutic
agents was presented and no antibodies were exemplified.
[0013] In 2005, Rahman et al. (52) disclosed two polyclonal rabbit
sera (Ab 576 and Ab 577) against a peptide corresponding to amino
acid residues 346-359 of the human ADAM 15 polypeptide. (Amino acid
residues 346-359 fall within the metalloprotease domain of ADAM 15
within the predicted catalytic cleft). Affinity-purified antibodies
derived from these sera were used to investigate the effect that
ADAM 15 has on endothelial cell migration in a Boyden chamber
assay. In direct contrast to the suggestions put forward in Blobel
(51), these anti-metalloprotease domain directed antibodies were
found to promote a 2-3 fold elevation in endothelial cell migration
(FIG. 5) of Rahman et al. This effect was confirmed by gene
silencing (siRNA to ADAM 15) experiments. These experiments
appeared to show that antibodies against the metalloprotease domain
of ADAM 15 could therefore potentially promote vascularization and
hence such antibodies would not be suitable as agents for the
prevention of neovascularization or angiogenesis.
SUMMARY OF THE INVENTION
[0014] Aspects of the present invention relate to antibodies and
antigen-binding fragments thereof, which, in certain embodiments
are capable of inhibiting neovascularization and/or angiogenesis.
Aspects of the present invention also relate to peptide(s) that, in
certain embodiments, comprise the principal/active component of a
vaccine preventing neovascularisation and/or angiogenesis. In
certain embodiments, the invention relates to antibodies and
antigen-binding fragments thereof with neutralizing specificity
towards the metalloprotease domain of ADAM 15. In certain
embodiments, the invention relates to an immunogenic peptide
region(s) of the metalloprotease domain of ADAM 15 that elicits
antibodies targeting ADAM 15 function. In certain embodiments, the
invention relates to compositions and kits comprising the
antibodies and peptides of described herein, as well as methods and
uses of the antibodies and antigen-binding fragments thereof, and
immunogenic peptides.
[0015] The inventors have now found that, whilst anti-ADAM 15
antibodies are capable of promoting endothelial cell migration in
vitro, ADAM 15, itself, promotes endothelial cell proliferation.
Aspects of the invention are based at least in part on the
unexpected finding that antibodies against ADAM 15 are capable of
impairing angiogenesis in vivo by blocking endothelial cell
proliferation and survival (FIGS. 2 and 3). A similar result has
been obtained using siRNA specific for ADAM 15 in vitro.
[0016] Without wanting to be bound by any particular theory, the
inhibitory effect of anti-ADAM-15 antibodies and/or siRNA upon cell
proliferation appears to be associated with the activation state of
the Akt kinase (Protein Kinase B), a downstream effector of the
enzyme PI3 kinase (FIG. 4). The PI3 kinase-Akt pathway is thought
to be particularly important in the pathogenesis of several cancers
as somatic mutations in the genes of the enzymes of this pathway
that lead to enhanced activity have been reported in tumour
isolates of several cancers (53-60). In certain embodiments,
anti-ADAM 15 antibodies are able to inhibit activation of the Akt
kinase.
[0017] The finding that, in certain embodiments, anti-ADAM 15
antibodies have an inhibitory effect on angiogenesis is
particularly surprising given the previous teachings in the art
towards the promotion of endothelial cell migration by anti-ADAM 15
antibodies (52). Aspects of the invention also relate to the
finding that ADAM 15, in certain embodiments, targets the urokinase
receptor uPAR for proteolysis in endothelial cells and in the
mononuclear cell line U937 (FIG. 6), indicating that ADAM 15 may
serve as a physiological negative regulator of plasminogen
activation, the end point of an important proteolytic system
regulating several physiological and pathophysiological processes
including those associated with inflammation (61). Plasmin is a
serine protease responsible for the degradation of fibrin and other
extracellular matrix components that assemble as a consequence of
damaged or leaky blood vessels (61). Plasmin also activates matrix
metalloproteases that degrade the extracellular matrix leading to
the disruption of immobilized growth factor/cytokine gradients
important for directed cell movement and tissue patterning
(2,3,62). Without wanting to be bound by a particular theory, the
reported elevation of ADAM 15 in both inflammatory cells in
conditions such as rheumatoid arthritis or inflammatory bowel
disease (63) and in metastasizing cancers (64) may also reflect a
role in regulating extracellular plasmin formation through the
controlled degradation of uPAR, in a manner that supports immune
cell infiltration or tumour cell invasion/metastasis. In certain
embodiments, anti-ADAM 15 antibodies may inhibit uPAR degradation
and may increase pericellular plasmin generation and may disrupt
immune cell infiltration and cancer cell metastasis through a
dysregulation of pericellular proteolytic environment.
[0018] Certain aspects of the invention, provide antibodies which
can be used to prevent neovascularization and which can be used to
prevent angiogenesis, particularly in tumours, and to treat
non-tumour pathologies including proliferative retinopathies and
inflammatory/proliferative vascular disorders such atherosclerosis
and restenosis, respectively. The invention, in certain aspects,
also provides an immunogenic peptide region derived from the
metalloprotease (MP) domain of ADAM 15 that may elicit, in certain
embodiments, the production of function-blocking antibodies against
ADAM 15, despite cross-species conservation of this sequence.
[0019] One advantage of some aspects of the present invention is
that, in some embodiments, the antibodies described herein target a
polypeptide (ADAM 15), which may not be required for normal
development or for adult homeostasis.
[0020] In a first aspect, the invention provides an isolated
antibody or antigen-binding fragment thereof which specifically
recognizes human ADAM 15 polypeptide, wherein the antibody is a non
rabbit-polyclonal antibody, and wherein the antibody or
antigen-binding fragment is capable of inhibiting proliferation of
endothelial cells.
[0021] In some embodiments of the invention, the antibody or
antigen-binding fragment is capable of inhibiting proliferation of
a population of endothelial cells when the antibody or
antigen-binding fragment is applied to said population.
[0022] In certain embodiments, the endothelial cells may be human
dermal microvessel endothelial cells (HMVECs) which have been
maintained, for example, in EBM-2 growth medium. Proliferation may
be tested using a standard cell division assay, for example as
described in Example 1.
[0023] In a further aspect, the invention provides an isolated
antibody or antigen-binding fragment thereof which specifically
recognizes human ADAM 15 polypeptide, wherein the antibody is a non
rabbit-polyclonal antibody, and wherein the antibody or
antigen-binding fragment is capable of inhibiting angiogenesis.
[0024] In some embodiments, the invention also provides an isolated
antibody or antigen-binding fragment thereof which specifically
recognizes human ADAM 15 polypeptide, wherein the antibody is a non
rabbit-polyclonal antibody, and wherein the antibody is capable of
preventing proteolytic cleavage of the urokinase receptor uPAR by
ADAM 15.
[0025] In a further aspect, the invention provides an isolated
antibody or antigen-binding fragment thereof which specifically
recognizes the metalloprotease domain of the human ADAM 15
polypeptide, wherein the antibody is a non rabbit-polyclonal
antibody.
[0026] In some embodiments, the antibody is a non-rabbit antibody.
In other embodiments, the antibody is a non-polyclonal
antibody.
[0027] In some aspects, the antibody or antigen binding fragment
specifically recognizes the proteolytic cleft of the
metalloprotease domain.
[0028] In some aspects, the human ADAM 15 polypeptide is a
polypeptide of SEQ ID NO: 1. It will be appreciated by the person
skilled in the art, however, that natural variations of this
sequence exist in the human population and that SEQ ID NO: 1 is
given merely as an example of one such sequence. It should be
appreciated that the invention is not limited to a human ADAM 15
polypeptide sequence of SEQ ID NO: 1.
BRIEF DESCRIPTION OF THE FIGURES
[0029] FIGS. 1A-1F illustrate non-limiting embodiments of the
development and characterisation of ADAM 15 MP domain site-specific
antibodies.
[0030] FIGS. 2A-2I illustrate non-limiting embodiments of ADAM 15
MP directed antibodies that dysregulate angiogenesis.
[0031] FIGS. 3A-3B illustrate non-limiting embodiments of the
importance of ADAM 15 for VEGF-induced endothelial cell
proliferation and cell survival.
[0032] FIGS. 4A-4B illustrate non-limiting embodiments of the
importance of ADAM 15 for VEGF signalling to Akt.
[0033] FIGS. 5A-5B illustrate non-limiting embodiments of ADAM 15
antagonism that enhances endothelial cell migration in vitro.
[0034] FIGS. 6A-6D illustrate non-limiting embodiments of targeted
proteolysis of uPAR in endothelial cells by ADAM 15.
[0035] FIGS. 7A-7D illustrate non-limiting embodiments of loss of
uPAR and urokinase activity in ADAM 15 transfected U937 cells.
[0036] FIG. 8. shows the human ADAM 15 amino acid precursor
sequence (AAC50404).
BRIEF DESCRIPTION OF THE SEQUENCES
[0037] SEQ ID NO: 1 shows the amino acid sequence of the human form
of ADAM 15.
[0038] SEQ ID NO: 2 shows the metzincin catalytic zinc-binding
amino acid consensus sequence of the ADAM 15 metalloprotease
domain.
[0039] SEQ ID NO: 3 shows the amino acid sequence of amino acids
346-359 of the human form of ADAM 15.
[0040] SEQ ID NOs: 4-7 are primers for the generation of ADAM
15-specific short interfering ribonucleic acids (SEQ ID NOS: 4 and
5) and control short interfering nucleic acids (SEQ ID NOS: 6 and
7).
[0041] SEQ ID NO: 8 corresponds to SEQ ID NO: 3 with additional N-
and/or C-terminal protecting groups.
DETAILED DESCRIPTION
[0042] Aspects of the invention relate to inhibitors of ADAM 15 and
their use for therapeutic applications. Aspects of the invention
are based, at least in part, on the involvement of ADAM 15 in
neovascularization and/or angiogenesis. In some embodiments,
inhibition of the protease activity of ADAM 15 can be useful to
reduce or prevent neovascularization and/or angiogenesis in
subjects having a disease or disorder associated with
neovascularization and/or angiogenesis. In some embodiments,
inhibition of the protease activity of ADAM 15 can be useful to
treat a condition or disorder associated with inflammation. In some
embodiments, inhibition of the protease activity of ADAM 15 can be
useful to treat a condition or disorder such as acute macular
degeneration or retinopathy.
[0043] The term "antibody" as used herein refers to immunoglobulin
molecules or other molecules which comprise at least one
antigen-binding domain.
[0044] The term "antibody" as used herein is intended to include
whole antibodies (e.g. IgG, IgA, IgE, IgM, or IgD), monoclonal
antibodies, polyclonal antibodies, humanized, chimeric antibodies,
human antibodies and totally synthetic and recombinant
antibodies.
[0045] Polyclonal antibodies can be produced in vivo in response to
immunization with different epitopes on an immunogen. Anti-serum
may be raised in a wide range of animals with one or more
injections of an antigen optionally along with a non-specific
enhancer of the immune response, such as an adjuvant. For many
small molecules or haptens, a carrier protein, which may provide
determinants recognized by helper T-cells, may be required for
conjugation via various bi-functional coupling reagents. Upon one
or more immunizations, the antibodies produced may be predominantly
IgG with some affinity to the epitope. Polyclonal antibodies
provide multiple specificity. The specificity of polyclonal
antibodies may be improved by affinity chromatography using
purified antigen.
[0046] Monoclonal antibodies may be produced in animals such as
mice and rats by immunization. B cells can be isolated from the
immunized animal, for example from the spleen. The isolated B cells
can be fused, for example with a myeloma cell line, to produce
hybridomas, that can be maintained indefinitely in in vitro
cultures. These hybridomas can be isolated by dilution (single cell
cloning) and grown into colonies. Individual colonies can be
screened for the production of antibodies of uniform affinity and
specificity. Hybridoma cells may be grown in tissue culture and
antibodies may be isolated from the culture medium. Hybridoma cells
may also be injected into an animal, such as a mouse, to form
tumors in vivo (such as peritoneal tumors) that produce antibodies
that can be harvested as intraperitoneal fluid (ascites). The lytic
complement activity of serum may be optionally inactivated, for
example by heating.
[0047] Proteins, peptides, haptens, chemical compounds, may be used
to generate antibodies. Peptides, haptens, and small compounds may,
in some embodiments, be conjugated to a carrier protein to elicit
an immune response. Antibody titers can be monitored by
antigen-specific ELISA. One or more animals are commonly used for
antibody production, such as rabbits, sheep, goats, chicken, mice,
rats, hamsters, and guinea pigs.
[0048] After one or more injections of the antigen, approximately
7-10 days after each boost, serum may be taken to determine the
production of specific antibodies (titer). The test bleeds may be
assayed against the immunogen itself, for example in an ELISA
assay.
[0049] Antibodies may be stored in several different buffers, for
example at neutral pH, such as 0.01M phosphate-buffered saline
(PBS) at pH 7.4, optionally containing, for example 0.1% sodium
azide to inhibit microbial growth. For long-term storage,
antibodies may be kept at a low temperature, such as 4.degree. C.,
-20.degree. C. or -70.degree. C. Antibodies may be stored at
>0.5 mg/mL and/or in the presence of a carrier protein (e.g., 1%
bovine serum albumin (BSA)), or if frozen, for example in 50%
glycerol.
[0050] Protocols for generating antibodies, including preparing
immunogens, immunization of animals, and collection of antiserum
may be found in Antibodies: A Laboratory Manual, E. Harlow and D.
Lane, ed., Cold Spring Harbor Laboratory (Cold Spring Harbor, N.Y.,
1988) pp. 55-120.
[0051] The term "antibody fragment" as used herein is intended to
include any appropriate antibody fragment which comprises an
antigen-binding domain that displays antigen binding function.
Examples of antibody fragments include Fab, Fab', F(ab').sub.2,
scFv, Fv, dsFv, ds-scFv, Fd, dAbs, TandAbs dimers, minibodies,
diabodies, and multimers thereof and bispecific antibody
fragments.
[0052] As used herein, the term "non rabbit-polyclonal antibody"
means that the antibody is not a rabbit polyclonal antibody.
[0053] Antibodies can be fragmented using conventional techniques.
For example, F(ab').sub.2 fragments can be generated by treating
the antibody with pepsin. The resulting F(ab').sub.2 fragment can
be treated to reduce disulfide bridges to produce Fab' fragments.
Papain digestion can lead to the formation of Fab fragments. Fab,
Fab' and F(ab').sub.2, scFv, Fv, dsFv, Fd, dAbs, TandAbs, ds-scFv,
dimers, minibodies, diabodies, bispecific antibody fragments and
other fragments can also be synthesized by recombinant techniques
or can be chemically synthesized. Techniques for producing antibody
fragments are well known and described in the art.
[0054] In some aspects, the antibody or antibody fragment comprises
an antibody light chain variable region (VL) and an antibody heavy
chain variable region (VH) which generally comprise the antigen
binding site. In certain embodiments, the antibody or antibody
fragment comprises all or a portion of a heavy chain constant
region, such as an IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgE, IgM or
IgD constant region. In some aspects, the heavy chain constant
region is an IgG1 heavy chain constant region, or a portion
thereof. Furthermore, the antibody or antibody fragment may
comprise all or a portion of a kappa light chain constant region or
a lambda light chain constant region, or a portion thereof. In some
aspects, the light chain constant region is a lambda light chain
constant region, or a portion thereof. All or part of such constant
regions may be produced naturally or may be wholly or partially
synthetic. Appropriate sequences for such constant regions are well
known and documented in the art.
[0055] In some embodiments of the invention, the antibodies or
antigen-binding fragments thereof are mammalian antibodies or
antigen-binding fragments, such as mouse, rat, rabbit, or human
antibodies or antigen-binding fragments.
[0056] In a certain embodiments, antibodies of the invention are
human antibodies. The term "human" as used herein in connection
with antibody molecules and fragments thereof refers to antibodies
having variable (e.g. VH, VL, CDR or FR regions) and/or constant
antibody regions derived from or corresponding to sequences found
in humans, e.g. in the human germline or somatic cells.
[0057] In some embodiments, human antibodies may be used in human
therapy. In such antibodies, the effector portion is human and
hence it may interact better with the other parts of the human
immune system. They are not recognized by the body as foreign; and
they will have half-lives similar to naturally-occurring human
antibodies.
[0058] In certain embodiments, human antibodies of the invention
may also comprise one or more amino acid residues which are not
naturally encoded by wild-type human nucleic acid sequences, but
which have been artificially changed/introduced in order to modify
the sequence of the antibody. For example, 1-5 amino acids might be
changed in the antigen binding domain in order to modify (e.g.
enhance) the affinity of the original antibody for the ADAM 15
polypeptide.
[0059] The ADAM family of disintegrin/metalloproteases are well
known in the art (10, 11). As used herein, the term "human ADAM 15"
refers to the ADAM 15 polypeptide as isolatable from human tissues.
Human ADAM 15 is also known as metargidin. One exemplary sequence
of the human ADAM 15 polypeptide is given herein as SEQ ID NO: 1
(FIG. 8); natural human variants of this sequence will be known.
The skilled person will appreciate that this sequence is included
merely for reference and that the scope of the invention is not to
be deemed as being limited to antibodies against polypeptides
having this sequence alone.
[0060] Other isoforms of ADAM 15 have been deposited. See for
example:
gi|46909600|refINP.sub.--997080.1|[46909600],
gi|46909598|refINP.sub.--997079.1|[46909598],
gi|46909596|refINP.sub.--997078.1|[46909596],
gi|46909594|refINP.sub.--997077.1|[46909594],
gi|46909592|refINP.sub.--997074.1|[46909592],
gi|46909590|refINP.sub.--003806.3|[46909590] and
gi|1235674|gbIAAC50404.1|[1235674]
[0061] At least 13 human isoforms of ADAM 15 have been reported and
different isoforms may be expressed in different cancers. The known
human isoforms differ in sequence only within the intracellular
portion of the molecule and are differentially spliced. No human
isoforms of ADAM 15 have been reported that differ in the
extracellular portion of the molecule or that differ within the
metalloprotease domain. However, it should be appreciated that
aspects of the invention are not limited to characterized isoforms
of ADAM 15. Any ADAM 15 isoform or variant may be i) used to
generate antibodies (for example based on the metalloprotease
domain), and/or ii) targeted therapeutically as described
herein.
[0062] As used herein, the term "metalloprotease domain" is the
region of the ADAM 15 polypeptide which is responsible for the
metalloprotease activity of the polypeptide. The metalloprotease
domain of ADAM 15 is predicted to conform to the general structure
of the metzincin superfamily of metalloendopeptidases. The ADAM 15
metalloprotease domain is thus characterized by the presence of a
C-terminally elongated zinc-binding motif, HEXXHXXGXXH/D (SEQ ID
NO: 2) with a strictly conserved glycine and a third zinc-binding
histidine or aspartate. This includes a substrate-binding crevice,
which subdivides the enzyme moiety into an upper and a lower
subdomain. A common five-stranded .beta.-sheet and two
.alpha.-helices are always found in the upper subdomain. The second
of these helices encompasses the first half of the elongated
consensus sequence and is therefore termed the active-site helix.
Other shared characteristics are an invariant methionine-containing
Met-turn beneath the catalytic metal and a further C-terminal helix
in the lower subdomain. In some embodiments, the metalloprotease
domain is a domain comprising or consisting of the peptide sequence
IAHELGHSLGLDHD (SEQ ID NO: 3), or a peptide sequence which has at
least 70%, 80%, 90% or 95% sequence identify with SEQ ID NO: 3.
[0063] In other embodiments, the antibodies of the invention or as
defined herein bind to the proteolytic cleft of the metalloprotease
domain.
[0064] In the human ADAM 15 amino acid sequence as given herein
(SEQ ID NO: 1), the metalloprotease domain comprises amino acids
346-359.
[0065] In a further embodiment, the invention provides an isolated
antibody or antigen-binding fragment thereof which specifically
binds to a peptide comprising or consisting of the amino acid
sequence IAHELGHSLGLDHD (SEQ ID NO: 3) or a peptide with at least
70%, at least 80% or at least 90%, sequence identity to SEQ ID NO:
3, wherein the antibody is a non rabbit-polyclonal antibody.
[0066] In some embodiments, the antibody is a non-rabbit antibody.
In other embodiments, the antibody is a non-polyclonal antibody. In
certain embodiments, the antibody is a mouse, humanised, human,
recombinant or synthetic antibody.
[0067] In a yet further embodiment, the invention provides an
isolated antibody or antigen-binding fragment thereof which
specifically binds to an epitope on human ADAM 15 polypeptide
defined by amino acids 346-359 of SEQ ID NO: 1, wherein the
antibody is a non rabbit-polyclonal antibody.
[0068] In some embodiments, the antibody is a non-rabbit antibody.
In other embodiments, the antibody is a non-polyclonal antibody. In
certain embodiments, the antibody is a mouse, humanised, human,
recombinant or synthetic antibody.
[0069] In certain embodiments, the invention also provides an
isolated antibody or antigen-binding fragment thereof which
specifically binds to human ADAM 15 polypeptide, wherein the
antibody is a non rabbit-polyclonal antibody, and wherein the
antibody or antigen-binding fragment thereof binds to the ADAM 15
epitope defined by amino acids 346-359 of SEQ ID NO: 1 such that
the antibody prevents proteolytic cleavage of the urokinase
receptor uPAR by ADAM 15.
[0070] The proteolysis of uPAR by ADAM 15 may be tested in an assay
wherein ADAM 15 and uPAR are co-expressed in a suitable cell line,
e.g. U937 cells as in Example 7.
[0071] In a yet further embodiment, the invention provides an
isolated antibody or antigen-binding fragment thereof which
specifically binds to an epitope on human ADAM 15 polypeptide
defined by the topographic region His.sup.352, Ser.sup.353,
Leu.sup.354, Gly.sup.355, Leu.sup.356, Asp.sup.357 and Asp.sup.359,
wherein the antibody is non rabbit-polyclonal antibody.
[0072] In one embodiment, the invention provides isolated antibody
or antigen-binding fragment thereof which specifically binds to an
epitope on human ADAM 15 polypeptide defined by the topographic
region Leu.sup.354, Gly.sup.355, Leu.sup.356, Asp.sup.357,
His.sup.358 and Asp.sup.359, wherein the antibody is a non
rabbit-polyclonal antibody.
[0073] The amino acid numbering referred to above is derived from
the human ADAM 15 amino acid sequence as given in SEQ ID NO: 1. The
skilled person will appreciate, however, that this numbering is not
limiting on this aspect of the invention.
[0074] In some embodiments, the antibodies and antigen binding
fragments of the invention have one or more of the following
properties:
(i) they specifically recognize the metalloprotease domain of the
human ADAM 15 polypeptide; and/or optionally the antibody or
antigen binding fragment specifically recognizes the proteolytic
cleft of the metalloprotease domain; (ii) they reduce or block, in
some embodiments, to a significant level, angiogenesis in vivo;
(iii) they stimulate, in some embodiments, to a significant level,
endothelial cell migration in vitro; (iv) they reduce or inhibit,
in some embodiments, to a significant level, endothelial cell
proliferation, (v) they reduce or inhibit, in some embodiments,
VEGF-induced endothelial cell proliferation; (vi) they do not
inhibit VEGF-induced Erk1/2 phosphorylation in endothelial cells;
(vii) they reduce or inhibit, in some embodiments, VEGF-induced Akt
activation in endothelial cells; (viii) they reduce or inhibit, in
some embodiments, phosphorylation of GSK 3.beta. in endothelial
cells; (ix) they are capable of enhancing, in some embodiments,
plasminogen activation.
[0075] In some embodiments, "block," "stimulate," "reduce or
inhibit" and "do not inhibit" may be to a level or extent that is
significant. In the present context, the term "significant" means
that it is statistically significant when compared to a parallel
cell population treated with a non-immune IgG control reagent, for
example, p<0.05, standard t-test.
[0076] In some embodiments, "block," "stimulate," "reduce or
inhibit" and "do not inhibit" may be a reduction or increase of 0%,
10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%,
99%, or 100% when compared to a parallel cell population treated
with a non-immune IgG control reagent.
[0077] As used herein, the term "specifically recognizes" refers to
the fact that the antibody and/or antigen-binding fragment thereof
is specific or substantially specific for the human ADAM 15
metalloprotease domain. In other words, the antibodies and
antigen-binding fragments thereof do not significantly bind to
other polypeptides, and/or they do not bind other polypeptides to
an extent which affects the use of the antibodies/fragments in
therapeutic or diagnostic applications. In some embodiments, the
term "specifically recognizes" means that the antibody binds to the
human ADAM 15 metalloprotease domain but not to the ADAM 15
prodomain or disintegrin domain. In some other embodiments, the
term "specifically recognizes" means that the antibody binds to the
human ADAM 15 metalloprotease domain but does not significantly
bind to the metalloprotease domains of one or more of ADAM 12, ADAM
17, ADAM 10, ADAM 7, MMP 2, MMP 3 or MMP 9.
[0078] In particular, the term "specifically recognizes" also means
that the antibody binds to an epitope which comprises 1, 2, 3, 4,
5, 6, 7, 8, 9, 10 or more of the amino acids which comprise the
metalloprotease domain.
[0079] Methods of determining the binding specificity of antibodies
and fragments thereof are well known in the art and include
functional, competition assays, ELISA, co-precipitation and
cross-reactivity assays including dot blotting, western blotting
and radioimmunoassays.
[0080] In certain embodiments, the antibodies described herein have
a binding affinity for ADAM 15 which corresponds to a K.sub.d of
less than 1 .mu.M, of less than 500, 400 or 300 nM, of less than
200, 190, 180, 170, 160, 150, 140, 130, 120, 110, or 100 nM, or of
less than 90, 80, 70, 60, 50, 40, 30, 20, 10, 5 or 1 nM. For
example, the binding affinity may be 1.times.10.sup.-7 M or less,
or 1.times.10.sup.-8 M or less. Any appropriate method of
determining K.sub.d may be used. The K.sub.d may, for example, be
determined by testing various concentrations of the antibody
against a fixed number of target cells in vitro to establish a
saturation curve, for example using the method of Scatchard.
[0081] In certain embodiments, the antibodies described herein have
a binding affinity for ADAM 15 which corresponds to a K.sub.m of
less than 1 .mu.M, of less than 500, 400 or 300 nM, of less than
200, 190, 180, 170, 160, 150, 140, 130, 120, 110, or 100 nM, or of
less than 90, 80, 70, 60, 50, 40, 30, 20, 10, 5 or 1 nM. For
example, the binding affinity may be 1.times.10.sup.-7 M or less,
or 1.times.10.sup.-8 M or less. Any appropriate method of
determining K.sub.m may be used. The K.sub.m may, for example, be
determined by testing various concentrations of the antibody
against a fixed number of target cells in vitro to establish a
saturation curve, for example using the Lineweaver-Burk method.
[0082] Aspects of the invention also relate to peptides and
polypeptides which are substantially homologous to the antibodies
and antigen-binding fragments thereof described herein.
[0083] In certain aspects, substantially homologous sequences of
antibodies of the invention include, without limitation, those
having conservative amino acid substitutions, or for example
alterations which do not affect the VH, VL or CDR domains of the
antibodies, e.g. include scFv antibodies where a different linker
sequence is used or antibodies where tag sequences or other
components are added which do not contribute to the binding of
antigen, or alterations to convert one type or format of antibody
molecule or fragment to another type or format of antibody molecule
or fragment (e.g. conversion from Fab to scFv or vice versa), or
the conversion of an antibody molecule to a particular class or
subclass of antibody molecule (e.g. the conversion of an antibody
molecule to IgG or a subclass thereof, e.g. IgG1 or IgG3).
[0084] A "conservative amino acid substitution", as used herein, is
one in which the amino acid residue is replaced with another amino
acid residue having a similar side chain. Families of amino acid
residues having similar side chains have been defined in the art,
including basic side chains (e.g., lysine, arginine, histidine),
acidic side chains (e.g. aspartic acid, glutamic acid), uncharged
polar side chains (e.g. glycine, asparagine, glutamine, serine,
threonine, tyrosine, cysteine), nonpolar side chains (e.g.,
alanine, valine, leucine, isoleucine, proline, phenylalanine,
methionine, tryptophan), beta-branched side chains (e.g.,
threonine, valine, isoleucine) and aromatic side chains (e.g.,
tyrosine, phenylalanine, tryptophan, histidine).
[0085] In certain embodiments, the antibodies and antigen-binding
fragments of the invention may also be used to produce further
antibodies/fragments which are specific for ADAM 15. Such uses
involve for example the addition, deletion, substitution or
insertion of one or more amino acids in the amino acid sequence of
a parent antibody/fragment to form a new antibody/fragment, wherein
said parent antibody is one of the antibodies/fragments of the
invention as defined elsewhere herein, and testing the resulting
new antibody/fragment to identify antibodies/fragments specific for
ADAM 15. Such methods can be used to form multiple new
antibodies/fragments which can all be tested for their ability to
bind ADAM 15. In certain embodiments, said addition, deletion,
substitution or insertion of one or more amino acids takes place in
one or more of the CDR domains.
[0086] A further aspect of the invention relates to a nucleic acid
molecule which encodes an antibody of the invention or an
antigen-binding fragment thereof.
[0087] In certain embodiments, the invention also provides a
nucleic acid molecule which encodes a polypeptide which is
substantially homologous to the amino acid sequence of an antibody
of the invention or an antigen-binding fragment thereof.
[0088] The nucleic acid molecules may be double stranded or single
stranded. The nucleic acid molecules may be wholly or partially
synthetic or recombinant.
[0089] In this context, the term "substantially homologous" means
that the polypeptide or peptide has, in certain embodiments, at
least 70%, 80%, 90%, 95% or 99% sequence identity to the antibody
of the invention or an antigen-binding fragment thereof. Sequence
comparisons may be performed either by manual evaluation of the
sequence by one skilled in the art, or by computer-automated
sequence comparison and identification using algorithms such as
BLAST (Basic Local Alignment Search Tool; Altschul, S. F., et al.,
(1993) J. Mol. Biol. 215:403-410; see also
www.ncbi.nlm.nih.gov/BLAST/), the Megalign program of the LASERGENE
bioinformatics computing suite (DNASTAR Inc., Madison, Wis.) or
using the Clustal method of alignment (Higgins and Sharp (1989)
CABIOS. 5: 151-153). If using the Clustal method, default
parameters for pairwise alignments may be KTUPLE 1, GAP PENALTY=3,
WINDOW=5 and DIAGONALS SAVED=5.
[0090] In certain embodiments, the antibodies, antigen-binding
fragments and nucleic acid molecules of the invention are isolated
molecules insofar as they are not present in situ within a human or
animal body or a tissue sample derived from a human or animal body.
Their sequences may, however, correspond to or be substantially
homologous to sequences as found in a human or animal body. Thus,
the term "isolated" as used herein in reference to nucleic acid
molecules or proteins or polypeptides, refers to such molecules
when isolated from or substantially free of their natural
environment, e.g. isolated from the human or animal body (if indeed
they occur naturally), or refers to such molecules when produced by
a technical process, for example includes recombinant and
synthetically produced molecules. An isolated nucleic acid molecule
may also be substantially free of sequences which naturally flank
the nucleic acid molecule (e.g. sequences located at the 5' and 3'
ends of the nucleic acid) from which the nucleic acid molecule is
derived or sequences which have been made to flank the nucleic acid
(e.g. tag sequences or other sequence which have no therapeutic
value) by for example genetic engineering.
[0091] The antibodies or antibody fragments can be produced
naturally or can be wholly or partially produced synthetically.
Thus the antibody may be from any appropriate source, for example
recombinant sources and/or produced in transgenic micro-organisms,
animals or plants. Thus, the antibody molecules may be produced in
vitro or in vivo.
[0092] In some embodiments, the nucleic acid molecules of the
present invention may be cloned or synthesised by any appropriate
method and may be incorporated in a known manner into an
appropriate expression vector which ensures good expression of the
antibodies and fragments of the invention. Possible expression
vectors include but are not limited to cosmids, plasmids, or
modified viruses (e.g. replication defective retroviruses,
adenoviruses and adeno-associated viruses), so long as the vector
is compatible with the host cell used. The expression vectors are
"suitable for transformation of a host cell", which means that the
expression vectors may contain a nucleic acid molecule of the
invention and regulatory sequences selected on the basis of the
host cells to be used for expression, which are operatively linked
to the nucleic acid molecule. Operatively-linked is intended to
mean that the nucleic acid is linked to regulatory sequences in a
manner which allows expression of the nucleic acid.
[0093] In certain embodiments, the invention provides an expression
vector comprising a nucleic acid molecule of the invention, or a
fragment thereof, operatively linked to regulatory sequences for
the transcription and translation of the polypeptide sequence
encoded by the nucleic acid molecule of the invention.
[0094] Suitable regulatory sequences may be derived from a variety
of sources, including bacterial, fungal, viral, mammalian, or
insect genes. Selection of appropriate regulatory sequences is
dependent on the host cell chosen as discussed below, and may be
readily accomplished by one of ordinary skill in the art. Examples
of such regulatory sequences include: a transcriptional promoter
and enhancer or RNA polymerase binding sequence, a ribosomal
binding sequence, including a translation initiation signal.
Additionally, depending on the host cell chosen and the vector
employed, other sequences, such as an origin of replication,
additional DNA restriction sites, enhancers, and sequences
conferring inducibility of transcription may be incorporated into
the expression vector.
[0095] In certain embodiments, the expression vectors of the
invention may also contain a selectable marker gene which
facilitates the selection of host cells transformed or transfected
with a molecule of the invention. Examples of selectable marker
genes are genes encoding a protein such as neomycin and hygromycin
which confer resistance to certain drugs, .beta.-galactosidase,
chloramphenicol acetyltransferase, firefly luciferase, or an
immunoglobulin or portion thereof such as the Fc portion of an
immunoglobulin, for example IgG. Transcription of the selectable
marker gene is monitored by changes in the concentration of the
selectable marker protein such as .beta.-galactosidase,
chloramphenicol acetyltransferase, or firefly luciferase. If the
selectable marker gene encodes a protein conferring antibiotic
resistance such as neomycin resistance transformant cells can be
selected with G418. Cells that have incorporated the selectable
marker gene will survive, while the other cells die. This makes it
possible to visualize and assay for expression of recombinant
expression vectors described herein and in particular to determine
the effect of a mutation on expression and phenotype. It will be
appreciated that selectable markers can be introduced on a separate
vector from the nucleic acid of interest.
[0096] The expression vectors may also contain genes which encode a
fusion moiety which provides increased expression of the antibody
protein; increased solubility of the protein; and/or aid in the
purification of the target protein by acting as a ligand in
affinity purification (for example appropriate "tags" to enable
purification and/or identification may be present, e.g. His tags or
myc tags). For example, a proteolytic cleavage site may be added to
the target recombinant protein to allow separation of the
recombinant protein from the fusion moiety subsequent to
purification of the fusion protein. Typical fusion expression
vectors include pGEX (Amrad Corp., Melbourne, Australia), pMal (New
England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway,
N.J.) which fuse glutathione S-transferase (GST), maltose E binding
protein, or protein A, respectively, to the recombinant antibody
protein.
[0097] Expression vectors can be introduced into host cells to
produce a transformed host cell. The terms "transformed with",
"transfected with", "transformation" and "transfection" are
intended to encompass introduction of nucleic acid (e.g. a vector)
into a cell by one of many possible techniques known in the
art.
[0098] The term "transformed host cell" as used herein is intended
to also include cells capable of glycosylation that have been
transformed with a recombinant expression vector described herein.
Prokaryotic cells can be transformed with nucleic acid by, for
example, electroporation or calcium-chloride mediated
transformation. For example, nucleic acid can be introduced into
mammalian cells via conventional techniques such as calcium
phosphate or calcium chloride co-precipitation, DEAE-dextran
mediated transfection, lipofectin, electroporation or
microinjection. Suitable methods for transforming and transfecting
host cells can be found in Sambrook et al. (Molecular Cloning: A
Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press
(1989), and other laboratory textbooks.
[0099] Furthermore, in certain embodiments, the invention provides
a host cell comprising one or more of the expression vectors or one
or more of the nucleic acid molecules of the invention, or a host
cell expressing one or more of the antibodies or fragments of the
invention.
[0100] In some embodiments, the host cell is an isolated host
cell.
[0101] Suitable host cells include a wide variety of eukaryotic
host cells and prokaryotic cells. For example, in certain
embodiments, the antibodies and fragments of the invention may be
expressed in yeast cells, fungal cells, insect cells or mammalian
cells (e.g. mouse, hamster or human cells).
[0102] In certain embodiments, N-terminal or C-terminal fusion
proteins comprising the antibodies and fragments of the invention
conjugated with other molecules, such as proteins, may be prepared
by fusing, through recombinant techniques. In certain embodiments,
the resultant fusion proteins contain an antibody of the invention
fused to the selected protein or marker protein, or tag protein as
described herein. The proteins of the invention may also be
conjugated to other proteins by known techniques. For example, the
proteins may be coupled using heterobifunctional thiol-containing
linkers as described in WO 90/10457,
N-succinimidyl-3-(2-pyridyldithio-proprionate) or N-succinimidyl-5
thioacetate. Examples of proteins which may be used to prepare
fusion proteins or conjugates include cell binding proteins such as
immunoglobulins, hormones, growth factors, lectins, insulin, low
density lipoprotein, glucagon, endorphins, transferrin, bombesin,
asialoglycoprotein glutathione-S-transferase (GST), hemagglutinin
(HA), and truncated myc.
[0103] A yet further aspect of the invention provides a method of
producing an antibody or antigen-binding fragment of the invention
comprising a step of culturing a host cell of the invention.
[0104] In certain embodiments, methods comprise the steps of (i)
culturing a host cell comprising one or more of the expression
vectors or one or more of the nucleic acid molecules of the
invention under conditions suitable for the expression of the
antibody or fragment; and optionally
(ii) isolating the antibody or fragment from the host cell or from
the growth medium/supernatant. In certain embodiments, such methods
of production may also comprise a step of (iii) purifying the
antibody or fragment, and/or (iv) formulating the antibody or
fragment into a composition, optionally including at least one
additional component, such as a pharmaceutically acceptable carrier
or excipient.
[0105] Monoclonal antibodies may be prepared using techniques which
are well known in the art.
[0106] In certain embodiments, the invention also provides a method
of obtaining a monoclonal antibody, the method comprising: [0107]
(i) immunizing an animal with a peptide whose amino acid sequence
comprises amino acids 346-359 of SEQ ID NO: 1 or a peptide
substantially homologous thereto, [0108] wherein the peptide is
optionally attached to a carrier, [0109] (ii) obtaining an
antibody-producing cell from the animal, wherein the
antibody-producing cell produces an antibody which binds to a
peptide whose amino acid sequence comprises amino acids 346-359 of
SEQ ID NO: 1, and [0110] (iii) fusing the antibody producing cell
with an immortal cell to produce a hybridoma that produces a
monoclonal antibody.
[0111] In certain embodiments, the animal is a mammal, for example
a mouse, rat, rabbit, goat, donkey or sheep. In certain
embodiments, the animal is a mouse, e.g. a BALB/c mouse.
[0112] In certain embodiments, antibodies of the invention may also
be produced by screening a recombinant library, e.g. a phagemid
library.
[0113] In some aspects, the invention relates to the use of small
nucleic acid molecules, including antisense nucleic acids and short
interfering nucleic acid (siNA), the latter include, for example:
microRNA (miRNA), short interfering RNA (siRNA), double-stranded
RNA (dsRNA), and short hairpin RNA (shRNA) molecules to knockdown
expression of target genes. As described herein, RNA interference
(RNAi) is a phenomenon describing double-stranded (ds)RNA-dependent
gene specific posttranscriptional silencing. Synthetic duplexes of
21 nucleotide RNAs can mediate gene specific RNAi in mammalian
cells, without invoking generic antiviral defense mechanisms
(Elbashir et al. Nature 2001, 411:494-498; Caplen et al. Proc Natl
Acad Sci 2001, 98:9742-9747). In certain embodiment, each strand of
the siNA molecule comprises about 19 to about 23 nucleotides, and
each strand comprises at least about 19 nucleotides that are
complementary to the nucleotides of the other strand. In certain
embodiments, the subject RNAi constructs are "siRNAs." These
nucleic acids are between about 19-35 nucleotides in length, or
21-23 nucleotides in length, e.g., corresponding in length to the
fragments generated by nuclease "dicing" of longer double-stranded
RNAs.
[0114] The siNA can be unmodified or chemically-modified. The siNA
can be chemically synthesized (for example as a short
oligonucleotide), expressed from an expression vector (for example
linked to a promoter element) or enzymatically synthesized. Short
oligonucleotides may, for example, be chemically-modified synthetic
short interfering nucleic acid (siNA) molecules capable of
modulating gene expression or activity in cells by RNA interference
(RNAi). The use of chemically-modified siNA improves various
properties of native siNA molecules through, for example, increased
resistance to nuclease degradation in vivo and/or through improved
cellular uptake. Furthermore, siNA having multiple chemical
modifications may retain its RNAi activity. There are several
examples in the art describing sugar, base and phosphate
modifications that can be introduced into nucleic acid molecules
with significant enhancement in their nuclease stability and
efficacy. For example, oligonucleotides are modified to enhance
stability and/or enhance biological activity by modification with
nuclease resistant groups, for example, 2'amino, 2'-C-allyl,
2'-flouro, 2'-O-methyl, 2'-H, nucleotide base modifications. Sugar
modification of nucleic acid molecules have been extensively
described in the art.
[0115] Production of polynucleotides comprising RNAi sequences is
well known in the art. For example, polynucleotides comprising RNAi
sequences can be produced by chemical synthetic methods or by
recombinant nucleic acid techniques. The siRNA molecules can be
purified using a number of techniques known to those of skill in
the art. For example, gel electrophoresis can be used to purify
such molecules. Alternatively, non-denaturing methods, such as
non-denaturing column chromatography, can be used to purify the
siRNA molecules. In addition, chromatography (e.g., size exclusion
chromatography), glycerol gradient centrifugation, affinity
purification with antibody can be used to purify siRNAs.
[0116] In some embodiments, one of the strands of the
double-stranded siNA molecule comprises a nucleotide sequence that
is complementary to a nucleotide sequence of a target RNA or a
portion thereof, and the second strand of the double-stranded siNA
molecule comprises a nucleotide sequence identical to the
nucleotide sequence or a portion thereof of the targeted RNA. In
another embodiment, one of the strands of the double-stranded siNA
molecule comprises a nucleotide sequence that is substantially
complementary to a nucleotide sequence of a target RNA or a portion
thereof, and the second strand of the double-stranded siNA molecule
comprises a nucleotide sequence substantially similar to the
nucleotide sequence or a portion thereof of the target RNA. In
certain embodiments, the number of tolerated nucleotide mismatches
between the target sequence and the RNAi construct sequence is no
more than 1 in 5 basepairs, or 1 in 10 basepairs, or 1 in 20
basepairs, or 1 in 50 basepairs. Mismatches in the center of the
siRNA duplex are important and may abolish cleavage of the target
RNA. In contrast, nucleotides at the 3' end of the siRNA strand
that is complementary to the target RNA do not significantly
contribute to specificity of the target recognition. An RNAi
construct contains a nucleotide sequence that hybridizes under
physiologic conditions of the cell to the nucleotide sequence of at
least a portion of the mRNA transcript of a gene of interest. In
certain embodiments, the double-stranded RNA need only be
sufficiently similar to natural RNA that it has the ability to
mediate RNAi. In certain embodiments, sequence identity may be
optimized by sequence comparison and alignment algorithms known in
the art (see Gribskov and Devereux, Sequence Analysis Primer,
Stockton Press, 1991) and calculating the percent difference
between the nucleotide sequences by, for example, the
Smith-Waterman algorithm as implemented in the BESTFIT software
program using default parameters (e.g., University of Wisconsin
Genetic Computing Group). In certain embodiments, the sequence
identity between the inhibitory RNA and the portion of the target
gene is greater than 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99%, or is 100%.
Tools for design and quality of siRNAs, shRNAs and/or miRNAs are
known in the art. Web-based online software system for designing
siRNA sequences and scrambled siRNA sequences are for example
siDirect, siSearch, SEQ2SVM, Deqor, siRNA Wizard (InvivoGen). The
specificity can be predicted using for example SpecificityServer,
miRacle. Target sequences can be researched for example at HuSiDa
(Human siRNA Database), and siRNAdb (a database of siRNA
sequences).
[0117] In certain embodiments, siNA molecules, as described herein,
are provided that specifically target ADAM-15 protein expression by
inducing RNA interference (RNAi).
[0118] It should be appreciated that ADAM-15 specific siNA
molecules (such as siRNA molecules) may be used for any method of
treatment provided herein alone or in combination with the
antibodies or fragments thereof or with the immunogenic peptides,
described herein.
[0119] In certain embodiments, the invention provides a composition
comprising an antibody or antigen-binding fragment thereof of the
invention, together with one or more pharmaceutically acceptable
excipients, carriers, diluents, buffers or stabilizers.
[0120] In certain embodiments, compositions are provided comprising
an antibody or antigen-binding fragment thereof, as described
herein, and further comprising a nucleic acid molecule capable of
inducing RNA interference (RNAi), such as short interfering nucleic
acid (siNA) molecules, further optionally comprising one or more
pharmaceutically acceptable excipients, carriers, diluents, buffers
or stabilizers.
[0121] In certain embodiments, the compositions of the present
invention can be formulated according to any of the conventional
methods known in the art and widely described in the literature.
Thus, the active ingredient (e.g. the antibody or antigen-binding
fragment thereof, siNA molecules and/or immunogenic peptides) may
be incorporated, optionally together with other active substances
(examples of which are as described below), with one or more
conventional pharmaceutically acceptable carriers, diluents and/or
excipients, etc., appropriate for the particular use for a
composition, to produce conventional preparations which are
suitable or can be made suitable for administration. They may be
formulated as liquids, as semi-solids or as solids, e.g. liquid
solutions, dispersions, suspensions, tablets, pills, powders,
sachets, cachets, elixirs, emulsions, syrups, ointments, liposomes,
suppositories, and the like, depending on the intended mode of
administration and therapeutic application. In some embodiments,
the composition comprising, for example an antibody or
antigen-binding fragment thereof, or an immunogenic peptide or an
siRNA or any combination thereof, described herein, is prepared in
a form of an injectable or infusible solution.
[0122] In some embodiments, the mode of administration is
parenteral, e.g. intraperitoneal, intravenous, subcutaneous,
intramuscular, intracavity or transdermal, although any other
appropriate mode may be used, for example oral administration. In
certain embodiments, intravenous injection or infusion may be used.
Any appropriate site of administration may be used. For example
they may be administered locally and directly at the site where
action is required or may be attached or otherwise associated, e.g.
conjugated, with entities which will facilitate the targeting to an
appropriate location in the body.
[0123] In certain embodiments, any physiologically compatible
carrier, excipient, diluent, buffer or stabilizer can be used in
the compositions of the invention. Examples of suitable carriers,
excipients, diluents, buffers and stabilizers include one or more
of water, saline, phosphate buffered saline, dextrose, glycerol,
ethanol and the like, as well as combinations thereof. In some
cases isotonic agents, e.g. sugars, polyalcohols (e.g. mannitol,
sorbitol), or sodium chloride may be included. The compositions may
additionally include lubricating agents, wetting agents,
emulsifying agents, suspending agents, preserving agents,
sweetening agents, flavouring agents, and the like. In certain
embodiments, the compositions of the invention may be formulated so
as to provide quick, sustained or delayed release of the active
ingredient after administration to the subject by employing
procedures well known in the art. As described above, in certain
embodiments, the composition is in a form suitable for injection
and suitable carriers may be present at any appropriate
concentration, but exemplary concentrations are from 1% to 20% or
from 5% to 10%.
[0124] Therapeutic compositions typically must be sterile and
stable under conditions of manufacture and storage. Appropriate
ways of achieving such sterility and stability are well known and
described in the art.
[0125] In certain embodiments, in addition to an antibody or
antigen-binding fragment thereof described herein, the composition
may further comprise one or more other active ingredients such as
other agents which are useful for treating cancers, in particular
breast cancer. Suitable additional active agents for inclusion in a
composition that is to be used in the treatment of mammals will be
known to a person skilled in the art and can be selected depending
on the nature of the disease which is to be treated by the
composition. Suitable additional agents include antibodies which
bind to other targets, cytokines, and chemical agents, e.g.
standard chemotherapeutics (small molecule drugs) or drugs
controlling side effects. For breast cancer treatment suitable
additional agents might include Herceptin, Doxil (Doxorubicin),
Avastin or Taxotere. In some embodiments, combined anti-anigiogenic
formulations are provided, e.g. combining an antibody or
antigen-binding fragment of the invention with an
anti-antiangiogenic agent, e.g. a angiopoietin, angiostatin and/or
endostatin.
[0126] Suitable doses of the antibody or antigen-binding fragment
thereof of the invention and the other active ingredients (if
included) will vary from patient to patient and will also depend on
the nature of the particular disease. In some embodiments, said
dosages constitute a therapeutically effective amount or a
prophylactically effective amount, depending on the nature of the
treatment involved. Suitable doses can be determined by the person
skilled in the art or the physician in accordance with the weight,
age and sex of the patient and the severity of the disease. The
ability of the binding protein to elicit a desired response in the
individual will also be a factor. Exemplary daily doses are: 0.1 to
250 mg/kg, or 0.1 to 200 or 100 mg/kg, or 1 to 50 or 1 to 10 mg/kg,
of the active ingredient. This can be administered as a single unit
dose or as multiple unit doses administered more than once a day.
It is to be noted however that appropriate dosages may vary
depending on the patient and that for any particular subject,
specific dosage regimes should be adjusted over time according to
the individual needs of the patient. Thus, the dosage ranges set
forth herein are to be regarded as exemplary and are not intended
to limit the scope or practice of the claimed composition.
[0127] In certain embodiments, the invention further provides kits
comprising one or more of the antibodies or antigen-binding
fragments or compositions of the invention or one or more of the
nucleic acid molecules encoding the antibodies or antigen-binding
fragment of the invention, or one or more expression vectors
comprising the nucleic acid molecules of the invention, or one or
more host cells comprising the expression vectors or nucleic acid
molecules of the invention. In some embodiments, said kits are for
use in the methods and uses as described herein, e.g. the
therapeutic, diagnostic or imaging methods as described herein, or
are for use in the in vitro assays or methods as described herein.
The antibodies/fragments in such kits may, in some embodiments, be
an antibody conjugate as described herein, e.g. may be conjugated
to a detectable moiety. In some embodiments, said kits comprise
instructions for use of the kit components, for example in
diagnosis.
[0128] In some embodiments, said kits are for diagnosing cancer and
optionally comprise instructions for use of the kit components to
diagnose cancer.
[0129] In certain embodiments, the invention further provides a kit
for diagnosing cancer comprising one or more of the antibodies or
antigen-binding fragments thereof of the invention and optionally
instructions for the use thereof to diagnose the cancer. In certain
embodiments, the invention also provides a kit for diagnosing
cancer comprising an antibody or antibody fragment as described
herein, and optionally instructions for the use thereof to diagnose
cancer.
[0130] In certain embodiments, the invention also provides methods
involving the antibodies of the invention. It will be noted,
however, that the methods described herein are not limited to the
antibodies described above. In certain embodiments, the methods of
the invention do not exclude the use of rabbit polyclonal
antibodies.
[0131] In certain embodiments, the invention also provides a method
of inhibiting or preventing angiogenesis comprising administering
to a patient a therapeutically effective amount of an antibody or
antigen-binding fragment which specifically recognises the
metalloprotease domain of the human ADAM 15 polypeptide.
[0132] In certain embodiments, the antibody or antigen-binding
fragment is an isolated antibody or antigen-binding fragment
thereof which specifically binds to a peptide comprising or
consisting of the amino acid sequence:
TABLE-US-00001 (SEQ ID NO: 3) IAHELGHSLGLDHD
or a peptide with at least 70%, or at least 80% or 90%, sequence
identity to SEQ ID NO: 3.
[0133] In other embodiments, the antibody or antigen-binding
fragment is an isolated antibody or antigen-binding fragment
thereof which specifically binds to an epitope on human ADAM 15
polypeptide defined by amino acids 346-359 of SEQ ID NO: 1.
[0134] In other embodiments, the antibody or antigen-binding
fragment is an isolated antibody or antigen-binding fragment
thereof which specifically binds to human ADAM 15 polypeptide, and
wherein the antibody or antigen-binding fragment thereof binds to
the ADAM 15 epitope defined by amino acids 346-359 of SEQ ID NO: 1
such that the antibody prevents proteolytic cleavage of the
urokinase receptor uPAR by ADAM 15.
[0135] In yet other embodiments, the antibody or antigen-binding
fragment is an isolated antibody or antigen-binding fragment
thereof which specifically binds to an epitope on human ADAM 15
polypeptide defined by the topographic region His.sup.352,
Ser.sup.353, Leu.sup.354, Gly.sup.355, Leu.sup.356, Asp.sup.357 and
Asp.sup.359, or an isolated antibody or antigen-binding fragment
thereof which specifically binds to an epitope on human ADAM 15
polypeptide defined by the topographic region Leu.sup.354,
Gly.sup.355, Leu.sup.356, Asp.sup.357, His.sup.358 and
Asp.sup.359.
[0136] In other aspects, the invention provides a method of
inhibiting or preventing endothelial cell proliferation in a
patient comprising administering to said patient a therapeutically
effective amount of an antibody or antigen-binding fragment thereof
as defined herein.
[0137] In certain embodiments, the invention also provides a method
of inhibiting or preventing neovascularization comprising
administering to a patient a therapeutically effective amount of an
antibody or antigen-binding fragment thereof as defined herein.
[0138] In certain embodiments, the invention further provides a
method of inhibiting or preventing neovascularization and/or
angiogenesis in a tumour comprising administering to a patient or
to the tumour a therapeutically effective amount of an antibody or
antigen-binding fragment thereof as defined herein.
[0139] In certain embodiments, the invention further provides a
method of inhibiting the spread of a tumour in a patient comprising
administering to a patient or to the tumour a therapeutically
effective amount of an antibody or antigen-binding fragment thereof
as defined herein.
[0140] In certain embodiments, the invention further provides a
method of treating cancer in a patient comprising administering to
said patient a therapeutically effective amount of an antibody or
antigen-binding fragment thereof as defined herein.
[0141] In certain embodiments, the invention further provides a
method of treating acute macular degeneration in a patient
comprising administering to said patient a therapeutically
effective amount of an antibody or antigen-binding fragment thereof
as defined herein.
[0142] In certain embodiments, the invention further provides a
method of treating diabetic retinopathy and/or proliferative
retinopathy in a patient comprising administering to said patient a
therapeutically effective amount of an antibody or antigen-binding
fragment thereof as defined herein.
[0143] Associated systemic and ocular diseases include sickling
hemoglobinopathies, branch retinal vein obstruction, diabetes
mellitus, sarcoidosis, intravenous drug abuse, the ocular ischemic
syndrome, pars planitis, Coats' disease and retinitis
pigmentosa/retinal detachment. In certain embodiments, the
invention relates to the treatment of such disease also.
[0144] In certain embodiments, the invention further provides a
method of treating inflammatory bowel disease (IBD) in a patient
comprising administering to said patient a therapeutically
effective amount of an antibody or antigen-binding fragment thereof
as defined herein.
[0145] In certain embodiments, the invention further provides a
method of treating Crohn's Disease in a patient comprising
administering to said patient a therapeutically effective amount of
an antibody or antigen-binding fragment thereof as defined
herein.
[0146] In certain embodiments, the invention further provides a
method of treating arthritis, for example rheumatoid arthritis or
osteoarthritis, in a patient comprising administering to said
patient a therapeutically effective amount of an antibody or
antigen-binding fragment thereof as defined herein.
[0147] In certain embodiments, the invention further provides a
method of treating an inflammatory vascular disorder, for example
restenosis and/or atherosclerosis, in a patient comprising
administering to said patient a therapeutically effective amount of
an antibody or antigen-binding fragment thereof as defined
herein.
[0148] In certain embodiments, the invention provides a methods of
treating a subject comprising administering an effective amount of
an antibody or antigen-binding fragment thereof as defined herein
to a biological sample (e.g. a blood sample) removed from the
subject, wherein the sample is subsequently returned to the
subject.
[0149] In certain embodiments, the invention also relates to a
method of producing anti-ADAM15 antibodies in human patient, the
method comprising administering to said patient a peptide
comprising or consisting of the amino acid sequence:
TABLE-US-00002 (SEQ ID NO: 8) X1-IAHELGHSLGLDHD-X2
wherein [0150] X1 is an N-terminal protecting group, optionally
absent, [0151] X2 is a C-terminal protecting group, optionally
absent, [0152] or a peptide with at least 70%, or at least 80% or
90%, sequence identity to SEQ ID NO: 8, wherein the peptide is
optionally bound to a carrier, optionally in admixture with one or
more adjuvants, diluents and/or excipients.
[0153] Examples of the N-terminal protecting group, X1, include Ac
and 1-5 amino acids. Examples of the C-terminal protecting group,
X2, include NH.sub.2 and 1-5 amino acids.
[0154] In certain embodiments, the invention also relates to a
method of treating a disorder as defined herein, comprising the
steps of the method of producing anti-ADAM15 antibodies as defined
above.
[0155] In certain embodiments, the present invention may be used to
treat animals and patients with aberrant angiogenesis, such as that
contributing to a variety of diseases and disorders. The most
prevalent and/or clinically important of these, outside the field
of cancer treatment, include arthritis, rheumatoid arthritis,
psoriasis, atherosclerosis, diabetic retinopathy, age-related
macular degeneration, Grave's disease, vascular restenosis,
including restenosis following angioplasty, arteriovenous
malformations (AVM), meningioma, hemangioma and neovascular
glaucoma. Other potential targets for intervention include
angiofibroma, atherosclerotic plaques, corneal graft
neovascularization, hemophilic joints, hypertrophic scars,
osler-weber syndrome, pyogenic granuloma retrolental fibroplasia,
scleroderma, trachoma, vascular adhesions, synovitis, dermatitis,
various other inflammatory diseases and disorders, and
endometriosis. In certain embodiments, the invention provides
antibodies and antigen-binding fragments thereof of the invention
or as disclosed herein for the treatment of such diseases.
[0156] In other embodiments, the invention therefore provides
antibodies and antigen-binding fragments thereof of the invention
or as disclosed herein for the treatment of inflammatory conditions
including Inflammatory Bowel Disease, Crohn's Disease, rheumatoid
or osteoarthritis.
[0157] Methods as described herein (for example, treatment, in vivo
methods, and the like) are generally carried out in a mammal. Any
mammal may be treated, for example humans and any livestock,
domestic or laboratory animal. Specific examples include mice,
rats, pigs, cats, dogs, sheep, rabbits, cows and monkeys. In some
embodiments, the mammal is a human.
[0158] The terms "therapy" or "treatment" as used herein include
prophylactic therapy, which may result in the prevention of
disease. The terms "therapy", "treatment" and "treating" include
combating or cure of disease but also include the controlling,
reduction or alleviation of disease or one or more of the symptoms
associated therewith.
[0159] An "effective amount" as used herein can refer to a
therapeutically effective amount or a prophylactically effective
amount depending on the nature of the treatment. A therapeutically
effective amount can be considered to be an amount necessary (at
appropriate dosages and administration regimes) to achieve the
desired therapeutic result. A prophylactically effective amount can
be considered to be an amount necessary (at appropriate dosages and
administration regimes) to achieve the desired prophylactic result.
The amounts of the antibody or antigen-binding fragment of the
invention are likely to vary depending on the weight, age and sex
of the patient, the severity of the disease and the ability of the
binding protein to elicit a desired response in the individual.
[0160] In one embodiment of the invention, cancer includes, without
limitation, cervical cancer, uterine cancer, ovarian cancer,
pancreatic cancer, kidney cancer, gallbladder cancer, liver cancer,
head and neck cancer, squamous cell carcinoma, gastrointestinal
cancer, breast cancer (such as carcinoma, ductal, lobular, and
nipple), prostate cancer, testicular cancer, lung cancer, non-small
cell lung cancer, non-Hodgkin's lymphoma, multiple myeloma,
leukemia (such as acute lymphocytic leukemia, chronic lymphocytic
leukemia, acute myelogenous leukemia, and chronic myelogenous
leukemia), brain cancer (e.g. astrocytoma, glioblastoma,
medulloblastoma), neuroblastoma, sarcomas, colon cancer, rectum
cancer, stomach cancer, anal cancer, bladder cancer, pancreatic
cancer, endometrial cancer, plasmacytoma, lymphomas,
retinoblastoma, Wilm's tumour, Ewing sarcoma, melanoma and other
skin cancers. In certain embodiments, the cancers are breast
cancer, prostate cancer, lung cancer, ovarian cancer, colon cancer,
kidney cancer and brain cancer (in particular glioblastoma).
[0161] In certain embodiments, the invention provides a method of
treating metastatic carcinoma of the colon or rectum in a patient
comprising administering to said patient a therapeutically
effective amount of an antibody or antigen-binding fragment thereof
of the invention or as defined herein. In certain embodiments, the
antibody or antigen-binding fragment thereof is administered
simultaneously, separately or sequentially with 5-fluorouracil
and/or AVASTIN.RTM. (Bevacizumab).
[0162] In certain embodiments, the invention provides a method of
treating recurrent or metastatic non-squamous, non-small cell lung
cancer in a patient comprising administering to said patient a
therapeutically effective amount of an antibody or antigen-binding
fragment thereof of the invention or as defined herein. In certain
embodiments, the antibody or antigen-binding fragment thereof is
administered simultaneously, separately or sequentially with
carboplatin and/or paclitaxel and/or AVASTIN.RTM.
(Bevacizumab).
[0163] Any reference herein to "cancer" or "tumour" should be
understood to include a reference to any of the cancer types listed
above.
[0164] In certain embodiments, cancer cells may be evaluated to
determine their susceptibility to the treatment methods of the
invention by, for example, obtaining a sample of the cancer cells
from a subject and determining the ability of the cancer cells in
the sample to bind to the antibodies or antibody fragments of the
invention or as described herein.
[0165] In certain embodiments, the present invention provides
diagnostic methods, agents, and kits that can be used by
themselves, or prior to, during or subsequent to the therapeutic
method of the invention in order to determine whether or not cancer
cells are present that express the antigen and can bind to the
antibodies and antibody fragments of the invention.
[0166] Widely accepted functional assays of angiogenesis and,
hence, anti-angiogenic agents are the corneal micropocket assay of
neovascularization and the chick chorio-allantoic membrane assay
(CAM) assay. Retinopathy of prematurity (ROP) U.S. Pat. No.
5,712,291 is specifically incorporated herein by reference to show
that the corneal micropocket and CAM assays are sufficiently
predictive to identify agents for use in the treatment of an
extremely wide range of angiogenic diseases.
[0167] Yet further aspects are methods of diagnosis or imaging of a
subject comprising administering an appropriate amount of an
antibody or antigen-binding fragment of the invention or as defined
herein to the subject and detecting the presence and/or amount
and/or the location of the said antibody or antigen-binding
fragment in the subject.
[0168] In certain embodiments, appropriate diseases to be treated,
imaged or diagnosed in accordance with the above described uses and
methods include any disease associated with molecules recognised by
the antibody or antigen-binding fragment of the invention, for
example cancer and the other diseases mentioned herein.
[0169] In certain embodiments, the invention provides a method of
diagnosing a disease, for example cancer, in a mammal comprising
the step of:
[0170] (1) contacting a test sample taken from said mammal with any
one or more of the antibodies or antigen-binding fragments thereof
of the invention or as disclosed herein.
[0171] In a further embodiment, the invention provides a method of
diagnosing disease, for example cancer, in a mammal comprising the
steps of:
[0172] (1) contacting a test sample taken from said mammal with one
or more of the antibody or antigen-binding fragment of the
invention or as disclosed herein;
[0173] (2) measuring the presence and/or amount and/or location of
binding protein-antigen complex in the test sample; and,
optionally
[0174] (3) comparing the presence and/or amount of binding
protein-antigen complex in the test sample to a control.
[0175] In the above methods, said contacting step is carried out
under conditions that permit the formation of a binding
protein-antigen complex. Appropriate conditions can readily be
determined by a person skilled in the art.
[0176] In the above methods any appropriate test sample may be
used, for example biopsy cells, tissues or organs suspected of
being affected by cancer, histological sections or blood.
[0177] In the above methods the presence of an amount of binding
protein-antigen complex in the test sample would be indicative of
the presence of cancer cells. For a positive diagnosis to be made,
generally the amount of binding protein-antigen complex in the test
sample is greater than, or significantly greater than, the amount
found in an appropriate control sample.
[0178] In certain embodiments, the significantly greater levels are
statistically significant, for example with a probability value of
<0.05. Appropriate methods of determining statistical
significance are well known and documented in the art and any of
these may be used.
[0179] Appropriate control samples could be readily chosen by a
person skilled in the art, for example, in the case of diagnosis of
a particular disease, an appropriate control would be a sample from
a subject that did not have that disease.
[0180] In certain embodiments, the amount of antibodies or antibody
fragments of the invention is measured by measuring the amount of
antibodies/fragments of the invention in the test sample, for
example by ELISA. In another embodiment, the amount of antibodies
of the invention is measured by measuring the expression levels of
nucleic acids encoding the antibodies of the invention in the test
sample, for example by RT-PCR.
[0181] In certain embodiments, the invention also provides
diagnostic or imaging agents comprising the antibodies or antibody
fragments of the invention or as disclosed herein attached to a
label that produces a detectable signal, directly or
indirectly.
[0182] The antibodies and antigen-binding fragments may be labelled
with a detectable marker such as a radio-opaque or radioisotope,
such as .sup.3H .sup.14C, .sup.32P, .sup.35S, .sup.123I, .sup.125I,
.sup.131I; a radioactive emitter (e.g. .alpha., .beta. or .gamma.
emitters); a fluorescent (fluorophore) or chemiluminescent
(chromophore) compound, such as fluorescein isothiocyanate,
rhodamine or luciferin; an enzyme, such as alkaline phosphatase,
beta-galactosidase or horseradish peroxidase; an imaging agent; or
a metal ion; or a chemical moiety such as biotin which may be
detected by binding to a specific cognate detectable moiety, e.g.
labelled avidin/streptavidin. Methods of attaching a label to an
antibody or antibody fragment, are well known in the art. Such
detectable markers allow the presence, amount or location of
antibody/fragment-antigen complexes in the test sample to be
examined.
[0183] In certain embodiments, the invention also provides a method
for screening for antibodies which are capable of inhibiting
endothelial cell proliferation, the method comprising the
steps:
[0184] (i) determining the binding affinity or avidity of a test
antibody for the metalloprotease domain of ADAM 15,
[0185] (ii) comparing the affinity or avidity of the test antibody
with that of an antibody of the invention or as disclosed
herein,
wherein a test antibody which has an affinity or avidity which is
about the same or higher than that of an antibody of the invention
or as disclosed herein is capable of inhibiting endothelial cell
proliferation.
EXAMPLES
Example 1
Materials and Methods
Reagents
[0186] A human ADAM 15 cDNA clone was kindly provided by Dr Carl
Blobel (Cornell University, NY). A canine ADAM 12 cDNA was isolated
from a canine smooth muscle cell library by standard
oligonucleotide hybridization followed by subcloning into
expression vectors (see below). uPAR polyclonal and monoclonal
antibodies were obtained from R&D systems, siRNA were produced
using the Silencer.TM. construction kit (Ambion) according to the
manufacturer's instructions. ADAM 15 specific primers sets were 5'
AACTCCATCTGTTCTCCTGACTTCCTGTCTC 3' (SEQ ID NO: 4) for the sense
template and 5' AAAAGTCAGGAGAACAGATGGAGCCTGTTCTC 3' (SEQ ID NO: 5)
for the antisense template. Control siRNAs were generated using the
primer sets 5'AAGCCCTTCCTTCCAGTTACCTTTCCTGTCTC 3' (SEQ ID NO: 6)
for the sense template and 5' AAAAAGGTAACTGGAAGGAAGGCCCTGTCTC 3'
(SEQ ID NO: 7) for the antisense template. Anti-uPAR antibodies
used were from R&D Systems, Oxon UK, a monoclonal (no MAB807)
and a polyclonal (no AF807).
Generation of Anti-Peptide Antibodies
[0187] A peptide immunogen aimed to target antibody binding to the
substrate binding cleft of the ADAM 15 MP domain was identified
through the construction of a molecular model of the MP domain
using ProMod II software (SWISS PRO) and the crystal structure of
Adamalysin II as a template (26). The peptide designated P15
corresponding to amino acids 346-359 of human ADAM 15 was
conjugated to a carrier immunogen (KLH) and injected into rabbits
as adjuvants (Sigma-Genosys). Antisera were characterised for
reactivity towards both peptide and parent antigen (ADAM 15) and
specific antibodies were purified by affinity chromatography using
P15-Sepharose columns.
In Vivo Angiogenesis Studies
[0188] Intraocular injections were performed on 3 days (P3) old
C57/B16 mouse pups as described previously (3). Eyes were injected
with 5 ng of affinity purified Abs 576 (n=8) or 577 (n=12) or
control non-immune rabbit IgG. (n=6). Eyes were enucleated after 48
h, fixed in 4% paraformaldehyde over night. Retinas were dissected
out and incubated with biotinylated isolectin B4 (1:10 dilution,
lectin from Griffonia simplicifolia, Sigma, Calif., USA) followed
by Alexa 488 streptavidin (Molecular Probes no. S11223) to
visualize blood vessels. Proliferating endothelial cells were
detected by double labelling by isolectin and polyclonal rabbit
anti-phospho-Histone H3 antibodies (1:200; Upstate, Lake Placid,
N.Y., no. 06-570) visualized by Alexa 568 conjugated
goat-anti-rabbit antibody (Molecular Probes no. A11034). Filopodia
number was measured (n=4/treatment), branch points counted
(n=4/treatment) and the number of proliferating endothelial cells
(n=3/treatment) in 2-6 fields/retina using the image-analysis
software ImageJ on images taken with a ZEISS confocal microscope
(Axiovert 200) using a 40.times. objective. Whole mount
immunohistochemistry of untreated normal P5 mouse retinas was
performed as described previously (3). Endothelial cells were
detected with isolectin as described above and uPAR by polyclonal
goat-anti uPAR (2 .mu.g/ml; R&D systems no. AF807) followed by
Alexa 568 conjugated rabbit anti-goat antibody (Molecular Probes
no. A11079)
In Vitro Endothelial Cell Assays
[0189] In vitro cell proliferation and migration assays were
performed as described previously (23). Briefly, human dermal
microvessel endothelial cells (HMVEC) were maintained in EBM-2
growth medium (Clonetics Corp). Migration studies were carried out
essentially as described previously (24) using serum starved
Calcein AM-loaded HMVEC in a modified Boyden chamber assay using
Fluoroblok transwell chambers (BD Bioscience) as described by the
manufacturer. Cell migration was detected by fluorescence
measurement (within the lower chamber compartment). Membranes of
transwell chambers were coated with Fn (10 .mu.g/ml) overnight at
4.degree. C. For antibody studies, HMVECs were pre-treated with Abs
576 or 577 affinity purified antibodies for 30 min at room
temperature prior to application to the upper transwell chamber.
For RNA interference studies, HMVECs were transfected with ADAM 15
and control siRNA using Lipofectamine (Invitrogen, Paisely, UK) 72
hours prior to the experiment (this period was determined as the
optimal period for knockdown ADAM 15 mRNA see FIG. 1 supp.). For
proliferation experiments, cell division was measured by either
fluorescence labelling of DNA (CyQuant, Molecular Probes) or by
counting cells directly using a microscope fitted with a grid
embossed eyepiece. HMVECs were plated on 24-well plates and
cultured overnight in EBM-2 medium containing 5% FBS. After washing
plates with PBS, HMVECs were then serum starved and then treated
with and without VEGF A (50 ng/ml) in the presence of Ab 576 or 577
or control IgG for antibody inhibition studies for 48 hours. Cell
numbers were then determined. For RNA interference studies, HMVECs
were transfected with ADAM 15 and control siRNA's 72 hours prior to
serum starvation and VEGF stimulation.
Immunoprecipitation Studies Western Blotting and Zymography
[0190] Immunoprecipitation studies were performed as described
previously (23). Briefly, human microvessel endothelial cells
(HMVEC) in serum-free MCDB-131 medium (BioWhittaker) supplemented
with 0.1% BSA were plated on uncoated petri dishes in the absence
or presence of VEGF A (50 ng/ml) for 15 to 120 minutes at room
temperature. Cells were then harvested in a Triton X-100 based
lysis buffer and immunoprecipitation was performed with a rabbit
monoclonal antibody (Cell Signalling Laboratories) to VEGFR2 or a
monoclonal uPAR (R&D Systems no MAB807). After analysis by
SDS-PAGE and protein transfer, the blot was then probed with anti
ADAM 15 MP domain antibodies Ab 576 or Ab 577 or a mixture of both
reagents and developed by chemiluminescence. For native Western
blotting, samples were electrophoretically transferred in
Tris-glycine buffers without SDS. Denaturation of proteins on PVDF
membranes was achieved by incubation in 0.2M NaOH for 15 min at
room temperature prior to the blocking step. Casein zymography was
performed as follows. Tris-glycine SDS-PAGE gels were made
containing casein (3 mg/ml) and Lys-plasminogen (10 .mu.g/ml)
(Enzyme research Laboratories, Swansea, UK no LPG2002). After
electrophoresis under non-reducing conditions, the gels were washed
in 2.5% Triton X-100 and incubated in 0.1 M glycine (pH 8.3) for 15
hours at 37.degree. C. Gels were then stained with Coommassie blue
and zones of lysis were assessed for relative activity using NIH
Image software. For semi-quantitative analysis of blots,
autoradiograhs were scanned and relative band intensities were
quantified by NIH Image software.
Measurement of Urokinase Activity
[0191] A whole cell urokinase activity assay was performed
essentially as described previously (25). U937 cells were selected
for stable transfection with ADAM 15 cDNA after a screen of cell
lines by Western blotting showed no expression of the antigen (see
FIG. 1F). Cells were transfected with pcDNA3 containing ADAM 15
cDNA insert using lipofection. Stable transfectants were isolated
by repetitive dilution and selection with antibiotic selection
using G418 at 400 ug/ml and western blotting for ADAM 15 antigen to
monitor expression. U937 cells stably transfected with pcDNA3-ADAM
15 or control cells were grown in RPMI complete medium supplemented
with 10% (v/v) foetal bovine serum to a density of approx.
1.times.10.sup.6/ml. Cells were harvested and washed in PBS, pH
7.4. Cells were then given a brief acidic wash in 0.1M glycine pH
3.0 for 1-2 min to remove endogenous cell associated urokinase,
followed by a further wash and final resuspension in Tris-saline pH
7.4 at 1.times.10.sup.6/ml. Cells were then incubated on ice with 2
nM Pro-uPA (Calbiochem UK no 672112) for 30 min in the presence or
absence of 10 nM PAI-1 (Calbiochem no 528205). The assay was
initiated by addition of 200 ul of the cell suspension to
microtiter wells preloaded with the urokinase specific fluorogenic
substrate Z-Gly-Gly-Arg-AMC HCl (Calbiochem, UK no 672159), at a
final concentration of 200 .mu.M. The reaction was followed for 30
min with readings taken every 2 min at 355/460 nm
excitation/emission. Background levels of substrate hydrolysis were
measured by inclusion of 200 ul of Tris-saline pH 7.4 into wells
pre-loaded with the fluorogenic peptide substrate.
In Vitro Protease Reaction
[0192] Recombinant ADAM 15 and canine ADAM 12 MP domains were
generated as GST-fusion proteins using an insect cell expression
system. ADAM 15 and 12 MP domain constructs were generated by PCR
from their respective cDNA clones and subcloned into a modified pMT
vector (Invitrogen, Paisely UK) containing a GST tag positioned
N-terminal to the MP domain inserts. Sf2 cells (Invitrogen,
Paisley, UK), stably transfected with ADAM 15 and 12 MP constructs,
were cultured in Schneider's medium (Invitrogen) supplemented with
10% (v/v) FBS plus 100 .mu.g/ml blasticidin (Invitrogen, Paisely,
UK). Gene expression was induced by addition of 500 .mu.M
Cu.sub.2SO.sub.4 for a period of 24 hours after which the cellular
fraction was processed for recombinant GST-ADAM 15 and 12 MP domain
purification by affinity chromatograghy using
glutathione-Sepharose. For the in vitro protease reaction, 100 ng
of purified recombinant soluble uPAR (R&D systems, UK, no
807-UK/CF) was incubated with 1.0 ng of recombinant GST-ADAM 15 MP
domain or GST-ADAM 12 MP domain for varying lengths of time in the
buffer 25 mM HEPES pH 7.4, 150 mM NaCl, 0.005% Brj 35, 1 mM
CaCl.sub.2, 50 .mu.M ZnCl.sub.2. The reaction was stopped by the
addition of Laemmli buffer and the samples evaluated by Western
blotting probing with a uPAR monoclonal (R&D systems no
MAB807).
Example 2
Development of Function Blocking Site-Directed Antibodies to ADAM
15
[0193] To facilitate a rational design of a peptide immunogen for
the development of a function-blocking site-directed anti-peptide
antibody towards the ADAM 15 MP domain, a molecular model of the
ADAM 15 MP domain was constructed using the crystal structure of
the snake venom disintegrin-metalloprotease Adamalysin II (26).
[0194] FIG. 1. shows the development and characterisation of ADAM
15 MP domain site-specific antibodies. Panel A--A molecular model
of the ADAM 15 metalloprotease domain was constructed using
ProModII (Swiss-Model). Ribbon diagram of a 2 .ANG. structure of
adamalysin II complexed with a peptide phosphonate inhibitor.
Histidine side chains in the catalytic cleft are marked (1 & 6
in panel B) coordinating a Zinc atom (2). The phosphonate peptide
is marked (3 & 5 in panel C) in the space filling model.
Opposite to this active-site cleft is an integrated calcium ion (4)
coordinated by carbonyl and strongly conserved
carboxylate/carboxamide residues.
[0195] Panel B--molecular model of ADAM 15 metalloprotease domain
showing a highly conserved structure with histidine side chains in
the catalytic cleft shown as red ball and stick structure. The
region of the catalytic cleft encompassing to the epitopes of Abs
576/577 within peptide P-15 is marked as (5) (Ab 577 specific
residues), (6) (Ab 576 specific), and (7) (overlapping
residues).
[0196] Panel C Models from panels A and B are superimposed.
[0197] Panel D--Abs 576 and 577 have Distinct Epitopes. Synthetic
peptides corresponding to the amino acid sequence 346-359 within
the ADAM 15 MP domain were synthesized with consecutive alanine
substitutions and (1.0 .mu.g) spotted onto nitrocellulose and
processed for blotting with affinity purified Abs 576 and 577. Dot
blots were developed by chemiluminescence. Essential amino acid
side chains comprising the epitopes for Abs 576 and 577 are shown
as bold. Synthetic peptides were synthesized corresponding to the
equivalent peptide region of other ADAMs proteins and MMPs and
analysed as above for cross-reactivity with Abs 576 and 577. No
cross reactivity was observed.
[0198] Panel E Abs 576 and 577 cross react with the MP domain of
human ADAM 15 (hMP 15) but not the MP domain of canine ADAM 12 (cMP
12). ADAM 15/12 MP domains were generated as GST-fusion proteins in
a modified insect cell vector (pSecTag, Invitrogen) and analysed by
SDS-PAGE and Western blotting. The blots were probed with the
antibodies shown. V5 antibodies (Invitrogen) cross react with both
recombinant MP domains.
[0199] Panel F U937 cells were transfected with full length ADAM 15
cDNA or control non-transfected cells were obtained by repetitive
dilution and antibiotic selection. Cell lysates were analysed by
SDS-PAGE and western blotting probing with Ab 576 and 577. Top
panel shows samples analysed without SDS in the blotting stage and
bottom panel shows the same blots re-probed after alkaline
denaturation.
[0200] A peptide (p15) corresponding to the sequence Ile346-Asp359
within a .beta.-loop structure located at the mouth of the active
site cleft was selected as an appropriate immunogen. Two antisera
were generated designated Ab 576 and Ab 577. An alanine scan of p15
showed that Abs 576 and 577 had distinct epitopes located towards
the C-terminal region of the peptide. The epitope for Ab 577 was
discontinuous and larger than Ab 576 comprising 7 indispensable
amino acid side chains (residues His352, Ser353, Leu354, Gly355,
Leu356, Asp357 and Asp359) as compared to 6 consecutive amino acids
(Leu354-Asp359, FIG. 1D top panel). These antisera were shown to be
selective for the ADAM 15 and displayed no detectable cross
reactivity to the corresponding regions of several other ADAMs
family members or MMPs (FIG. 1D bottom panel). In addition, both
Abs 576 and 577 specifically recognized a recombinant ADAM 15 MP
domain-GST fusion protein as opposed to an ADAM 12 counterpart and
native ADAM 15 antigen expressed in human cell lines and rat tissue
homogenates (FIG. 1E). Interestingly, under native blotting
conditions, Ab 576 preferentially recognized the inactive precursor
zymogen of ADAM 15 corresponding to an antigen of Mr 120 kDa in
stably transfected U937 cells expressing full length ADAM 15 (FIG.
1F top panel). In contrast, Ab 577 predominantly recognized the
activated metalloprotease corresponding to the 70 kDa antigen in
these cell lysates. The differential recognition of the ADAM 15
molecular species by the antibodies suggests that the region
Ile346-Asp359 adopts distinct conformations in the precursor and
active polypeptides. This was supported by the observation that
denaturation of the antigens immobilized on the blots engendered
the recognition of both precursor and active molecular species by
both antibodies (FIG. 1F bottom panel).
Example 3
ADAM 15 MP Domain Antibodies Dysregulate Angiogenesis
[0201] To investigate the role of ADAM 15 in angiogenesis in vivo,
we studied the effects of Abs 576 and 577 compared to control IgG
on the developing vascular plexus in post-natal mouse retina.
Intraocular microinjection of either Abs 576 or 577 into normal
mice promoted a dysregulated angiogenic response (FIG. 2 a-f).
[0202] FIG. 2 shows ADAM 15 MP directed antibodies dysregulate
angiogenesis.
(Panels a-f) Whole-mounts of retinas 48 h after intraocular
injections with control rabbit-IgG (a-c) and ADAM 15 antibody Ab
576 or Ab 577 (d-f), vessels are detected by isolectin staining
(depicted in panels a and d of FIG. 2; stained green in the
original experiments) and perfusion with mouse IgG (depicted in
panels b and e of FIG. 2; stained red in the original experiments).
Merged images with inverted colour to highlight the perfusion of
vessels (c, f). Panels (a-c) Normal vascular patterning is seen in
control-injected retinas. Panels (d-f) ADAM 15 antibody injection
leads to morphological changes including increased infiltration of
microglia/macrophage cells in the growing front (arrows in a, d)
and in the capillary plexus (arrow heads in d), and poor perfusion
(arrows in f pointing at non-perfused vessels). (Panels g-i)
Quantification of number of branch points (g), proliferating
endothelial cells (h), and filopodia (i) showed significantly
decreased numbers of branch points and proliferating endothelial
cells in ADAM 15 injected retinas but no change in filopodia number
compared to control injected retinas.
[0203] The vessels that developed during the 48 h exposure period
were characterized by reduced branching density, reduced patency
and poor perfusion (b c e). ADAM 15 antibody-treated retinas also
showed greater numbers of microglial/macrophage cells in the
growing front as well as behind in the capillary plexus (arrow
heads a, d); a phenotype commonly caused by either excessive
vascular leakage or retinal hypoxia (27). Quantification of
branchpoints revealed a slight but significant reduction in ADAM 15
antibody-treated specimens (FIG. 2g). However, EC proliferation,
assessed by anti-phosphohistone H3 immunofluorescence labelling,
was severely impaired in these retinas compared to eyes injected
with control IgG (FIG. 2h). Additionally, the vessels appeared very
thin and lacked perfusion (absence of luminal serum IgG
immunofluorescence, compare FIGS. 2c and f). As branching frequency
correlates with the relative number of tip cells, we quantified the
density of tip cell filopodia along the leading endothelial
membrane. Interestingly, the number of filopodia was not
significantly altered, indicating that ADAM 15 MP directed
antibodies do not affect VEGF mediated tip cell induction (FIG.
2i). Together, these in vivo observations suggest that ADAM 15 may
be primarily involved in cellular functions and signalling pathways
required for stalk patency and stalk cell proliferation during
angiogenic branching morphogenesis.
Example 4
ADAM 15 Promotes VEGF-Induced Endothelial Cell Proliferation and
Survival
[0204] To directly investigate the function of ADAM 15 in
endothelial cells, we examined the effect of blocking ADAM 15
function in VEGF A stimulated EC (human dermal microvessel
endothelial cells, HMVEC) in vitro.
[0205] FIG. 3 shows ADAM 15 is important for VEGF-induced
endothelial cell proliferation and cell survival.
Panel A--HMVECs monolayers were treated with anti-ADAM 15
antibodies Ab 576 or Ab 577 (top) or ADAM 15 siRNA (bottom) prior
analysis for cell proliferation. Proliferation was measured 48
hours post-VEGF stimulation. The data is an average of three
separate experiments performed with triplicate wells. Panel B Cell
survival measured by assessing DNA fragmentation at 6 hours post
serum depletion in the presence or absence of VEGF-A as shown.
Studies were performed in triplicate wells (n=3).
[0206] Cell division in samples treated with Ab 576 (or Ab 577 not
shown) was significantly reduced (approx. 73%) in response to
stimulation with VEGF after 48 hours compared to cell monolayers
treated with non-immune IgG (FIG. 3A top panel). Similarly,
endothelial monolayers treated with siRNA specific for ADAM 15 also
showed a dramatic reduction (>90%) in proliferation in response
to VEGF A stimulation compared to cells treated with control siRNA
(FIG. 3A bottom panel). To check whether loss of ADAM 15 function
was inducing apoptosis, DNA fragmentation in these samples was
measured. Treatment of endothelial cells with ADAM 15 siRNA's in
full serum condition did not induce apoptosis even after 72 hours
of treatment (FIG. 3B, time=0). However, serum depletion rapidly
induced DNA fragmentation (after 6 hours) in both control and siRNA
ADAM 15 treated cells. Adding VEGF A into the medium significantly
protected control siRNA treated cells, but not ADAM 15 siRNA
treated cells from apoptosis induced by serum deprivation (FIG.
3B). Thus, reducing ADAM 15 levels or blocking ADAM 15 MP function
in vitro abrogates VEGF A-induced endothelial cell proliferation
and survival under serum deprivation. This data is consistent with
the observed reduction in endothelial cell proliferation in vessel
stalks of retinas treated with antibodies to the ADAM 15 MP
domain.
Example 5
ADAM 15 is Necessary for VEGF Signalling to Akt
[0207] To gain insight into the mechanism of ADAM 15 dependent
regulation of EC proliferation and survival, we decided to analyse
possible direct interactions with VEGFR2 and effects on VEGF A
signalling. We previously showed that VEGFR2 signalling to the MAP
kinase pathway was enhanced by its association with the integrin
.alpha..sub.5.beta..sub.1.
[0208] FIG. 4 shows ADAM 15 is important for VEGF signalling to
Akt. Panel A VEGF increased ADAM 15 association with VEGFR2 by
co-immunoprecipitation. HMVECs were stimulated with VEGF for
various time points and lysed. Lysates were then immunoprecipitated
with anti-VEGFR2 antibodies. Panel B HMVEC monolayers were treated
with Ab 576 or control IgG (left panel) or ADAM 15 siRNA or control
siRNA (right panel) and stimulated with VEGF for various periods
(0-120 min). Cells were lysed and analysed by SDS-PAGE and Western
blotting using the phospho-specific antibodies shown. Blots were
then stripped and probed with antigen specific antibodies to assess
loading. The results are representative blots from three
experiments giving similar results.
[0209] Co-immunopreciptation analysis now showed that also ADAM 15
physically associates with VEGFR2, and that this interactions is
transiently increased following VEGF stimulation (FIG. 4A).
Immunoprecipitation of VEGR2 from non-stimulated EC lysates
co-precipitated a 120 kDa antigen reactive to ADAM 15 antibodies,
which corresponds to the inactive precursor. Following VEGF
stimulation, an increase in VEGFR2 associated ADAM 15 precursor
occurred peaking at 30 min and diminishing by 120 min.
Concomitantly, the appearance of a 75 kDa antigen corresponding to
the active form of ADAM 15 was observed to associate with VEGFR2
and this species remained associated with VEGFR2 even at 120 min
post stimulation. These results indicate that upon VEGF
stimulation, ADAM 15 association with VEGFR2 increases and this
process is accompanied by an activation of the MP domain by
proteolytic removal of the prodomain.
[0210] To investigate whether and how this association with ADAM 15
modulates VEGFR2 downstream signalling, we studied the activation
of two major effectors of VEGFR-2 namely MAP kinases Erk 1/2 and
the serine/threonine kinase Akt (FIG. 4 B). Stimulation of cells
treated with ADAM 15 MP domain antibodies (left panel) or ADAM 15
siRNA (right panel) both showed similar patterns of Erk1/2
phosphorylation over a 2 hour time course with a biphasic response
peaking at approx. 5 min and again at 60 min. Significantly, there
was no discernible difference in the magnitude of Erk 1/2
phosphorylation between control and ADAM 15 impaired samples
indicating that VEGF signalling to effectors of the MAP kinase
pathway was not significantly affected by loss of ADAM 15 function.
In contrast, stimulation of cells treated with ADAM 15 MP domain
antibodies or ADAM 15 siRNA both promoted a severe impairment of
Akt phosphorylation on Ser.sup.473. Impairment of Akt activation
was confirmed by assessing the phosphorylation of the down stream
substrate GSK 3.beta.. Phosphorylation of GSK 3.beta. on Ser.sup.9
was also significantly reduced (approx. 50%) in ADAM 15 impaired
cells compared with control cells after stimulation with VEGF.
Unlike Akt phosphorylation, GSK 3.beta. phosphosphorylation was not
fully inhibited as GSK 3.beta. is also regulated by other upstream
effectors such as PKC. Therefore, loss of ADAM 15 function appears
to significantly impair VEGF signalling to effectors of the PI3
kinase pathway without altering the efficacy of signal transduction
to effectors of the MAP kinase pathway. These studies are
consistent with the functional data obtained from both in vivo and
in vitro assays establishing that VEGF A induced proliferation is
inhibited in cells where ADAM 15 function is impaired since
previous work has established this pathway as essential for EC
proliferation (Qi et al., 1999). The loss of VEGF signalling to Akt
in cells treated with siRNA for ADAM 15 is also consistent with the
inability of VEGF A to rescue these cells from apoptosis induced by
serum deprivation.
Example 6
ADAM 15 Antagonises Endothelial Cell Migration In Vitro
[0211] In the retina, endothelial tip cells migrate along a network
of astrocytes which produce a Fn matrix (29,30) and lay down VEGF
gradients through heparin-binding VEGF isoforms (3). Blocking ADAM
15 MP function in vivo did not reveal significant defects in the
advancement of the sprouting front over the astrocytic network,
suggesting that ADAM 15 may not be required for tip cell migration
stimulated by VEGF on Fn. However, we previously showed in vitro
that VEGF A, in the presence of a Fn matrix, promoted an enhanced
migration response which was coupled predominantly to the MAP
kinase pathway (24). To directly assess whether ADAM 15 affects EC
migration in this context, we used a modified Boyden chamber
chemotaxis assay supplemented with a Fn matrix.
[0212] FIG. 5 shows antagonism of ADAM 15 enhances endothelial cell
migration in vitro.
Panel A--Calcein AM loaded HMVECs were pre-incubated with and
without Ab's 576 and 577 for 60 min at room temperature prior to
stimulation with VEGF-FN complexes in a modified Boyden chamber
assay. The results shown is a representative experiment of four
similar assays giving similar results. Panel B--RNA interference of
ADAM 15. HMVECs were transiently transfected with ADAM 15 specific
si RNA and a scrambled siRNA control. ADAM 15 expression was
maximally suppressed at 36 hours post-transfection at which point
the migration assay was performed (n=2). The data are expressed as
specific migration after subtraction of background migration.
[0213] Unexpectedly, cell migration towards VEGF A was elevated
(approx. 2-fold) following treatment of cells with Ab 576 (or Ab
577 not shown) (FIG. 5A). Migration was unchanged by treatment with
control IgG, but was strongly inhibited by co-administration of the
VEGF A inhibitor sflt-1 (soluble VEGFR1). Down regulation of ADAM
15 using ADAM 15 siRNA (FIG. 5B) also enhanced cell migration to a
similar extent as the MP domain antibodies whereas control siRNA
showed no significant effect. Baseline unstimulated (haptotactic)
migration of ADAM 15 siRNA and control siRNA treated ECs were of
similar magnitude (data not shown). Therefore, in contrast to EC
proliferation and survival, impairing ADAM 15 function or
expression did not diminish EC migration in response to VEGF A but
rather promoted an enhanced response in vitro.
Example 7
ADAM 15 Negatively Regulates the Plasminogen Activation System by
Processing uPAR
[0214] The observation that VEGF A-induced EC proliferation,
survival and migration are differentially affected by blocking ADAM
15 function in vitro suggested that ADAM 15 may modulate the
different VEGF responses via distinct mechanisms. Furthermore, the
absence of any significant effect upon Erk 1/2 phosporylation in
response to VEGF A in ADAM 15 impaired cells suggested that a
non-signal transduction mechanism may underlie the increased EC
migration observed in vitro. Prager et al recently showed that
VEGFR2 at the leading edge of migrating cells associates with uPAR
and that VEGF stimulation induced pro-urokinase activation in ECs
(31,32). We, therefore, decided to examine the effect of ADAM 15
impairment on urokinase activity in ECs.
[0215] FIG. 6 shows targeted proteolysis of uPAR in endothelial
cells by ADAM 15. Panel A Casein zymograhic analysis of HMVEC
lysates treated with control and ADAM 15 siRNAs. Bottom-analysis of
uPAR antigen levels in these lysates by Western blotting. Panel
B--VEGF A induces ADAM 15 association with uPAR. HMVECs were
stimulated with VEGF A for 30 min and then lysed. Lysates were
immunoprecipitated with anti-uPAR antibodies. Immunoprecipitates
were analysed by Western blotting probing with Abs 576 and/or 577.
Panel C-Degradation of soluble uPAR in a cell free system by
recombinant ADAM 15 MP domain. Soluble recombinant uPAR (10 ug) was
incubated with recombinant ADAM 15 MP domain (10-50 ng) or
recombinant ADAM 12 MP domain (10-50 ng) for various time points
and then analysed by Western blotting using an anti-uPAR monoclonal
antibody. Panel D Confocal images of whole-mounts of normal P5
retinas double labelled for isolectin (black in left panel) and
uPAR (red in left and right panels). Some uPAR is present in
tip-cells (top row, arrow), however uPAR is predominantly found in
endothelial stalk cells (middle row, arrows) and further back in
the capillary plexus (bottom row, arrows).
[0216] Plasminogen/casein zymography showed approx. 5-fold
increased urokinase activity in lysates of ADAM 15 siRNA compared
to control siRNA transfected EC (FIG. 6A top panel). Western blot
analysis also showed a corresponding approx. 5-fold increase in
uPAR protein levels (FIG. 6A bottom panel). These results suggested
that uPAR could be a physiological target for the ADAM 15
metalloprotease activity. Since previous work has shown that uPAR
associates with VEGFR2 following VEGF stimulation (32), we examined
if ADAM 15, likewise, associated with uPAR. Indeed, we detected
co-immunoprecipitation of uPAR and ADAM 15 in lysates of
unstimulated cells and this association was increased approx.
3-fold following VEGF A stimulation (FIG. 6B). Stimulation of cells
with HGF also promoted uPAR-ADAM 15 association but not to the same
extent as VEGF A. To confirm that ADAM 15 MP domain has intrinsic
uPAR processing activity, we performed an in vitro
substrate-protease reaction. We incubated either recombinant ADAM
15 or ADAM 12 MP domains with recombinant uPAR in vitro at similar
enzyme-substrate ratios and assessed the presence of the integrity
of an epitope for a uPAR specific monoclonal antibody over a period
of 48 hours as a measure of uPAR proteolytic processing (FIG. 6C).
The MP domain of ADAM 15 was significantly more reactive towards
the cleavage of the uPAR epitope compared to the MP domain of ADAM
12 suggesting that uPAR may indeed be a physiological substrate for
ADAM 15 MP activity. Normal vessels of the retina stained with a
polyclonal anti-uPAR antibody showed a distinct punctuate labelling
located to the EC bodies in the developing vascular plexus. The
staining pattern also showed that uPAR expression was predominantly
localised to vessel stalk cells and capillaries compared with tip
cells (FIG. 6D), consistent with the observation that treatment of
retinas with ADAM 15 MP domain antibodies altered capillary
morphology predominantly (FIG. 2).
[0217] To further test the hypothesis that ADAM 15 targets uPAR for
proteolysis, we over-expressed ADAM 15 in a high uPAR expressing
cell line and assayed the effects on uPAR surface expression and
urokinase activity. A screen of high uPAR expressing cell lines
with Ab 576 showed that U937 cells did not express detectable
levels of ADAM 15 antigen (FIG. 1E middle panel); these were
therefore selected for the analysis. Stable ADAM 15 transfectants
were generated that expressed ADAM 15 at levels comparable to
microvessel ECs (FIG. 1F and data not shown). uPAR surface
expression and antigen levels were measured in these cells in
comparison to control cells (FIG. 7).
[0218] FIG. 7 shows loss of uPAR and urokinase activity in ADAM 15
transfected U937 cells. Panel A--Stable ADAM 15 transfected U937
cells were established as described in the materials and methods.
Both control, non-transfected and ADAM 15 transfected cells were
stained with a uPAR primary monoclonal antibody followed by
staining with FITC anti-mouse conjugate. Samples were analysed by
FACs. Data is presented as histograms of number of events against
with background labelling (no primary antibody) shaded and ADAM 15
labelled samples.
Panel B Cell lysates (40 .mu.g per lane) as shown were analysed by
SDS-PAGE and Western blotting probing with a polyclonal anti-uPAR
antibody. Blots were developed by Chemiluminescence. Panel C Total
RNA was extracted from control transfected and ADAM 15 transfected
U937 cells and semi-quantitative PCR was performed with uPAR and
GAPDH specific primer sets. Total RNA template used were 10 ng
(lanes 1, 3, 6 and 7) and 50 ng (lanes 2, 4, 5, and 8). Panel D
Caesin/Lys-plasminogen zymograhic analysis of cell lysates from
ADAM 15 and control transfected U937 cells. Arrow marks zone of
lysis for uPA activity. Whole cell uPA activity assay. ADAM 15
(/.box-solid.) and control (.DELTA./.tangle-solidup.)
non-transfected U937 cells were incubated with a uPA-specific
fluorescent substrate in the presence (filled symbols) or absence
(open symbols) of PAI-1. Peptide hydrolysis was measured by an
increase in fluorescence over a 30 min duration. Each point was
performed in quadruplicate with SE less than 10%. The experiment is
a representative experiment performed three times with highly
similar results.
[0219] While control cells showed high uPAR surface expression
(FIG. 7A) and uPAR antigen (FIG. 7B), ADAM 15 transfected cells
showed severely (approx. 90%) diminished uPAR surface expression
and antigen levels. uPAR mRNA levels were not affected by ADAM 15
expression (FIG. 7C). Furthermore, urokinase activity assessed by
casein zymography (FIG. 7D top panel) and specific peptide
substrate hydrolysis (FIG. 7D bottom panel), was decreased approx.
3-5 fold in ADAM 15 transfected U937 compared to control U937
cells. Taken together, these studies illustrate that ADAM 15 MP
activity is involved in the down regulation of the plasminogen
activation pathway in ECs through the proteolytic processing of
surface uPAR. Consequently, the impairment of ADAM 15 function in
ECs leads to enhanced plasminogen activation consistent with the
enhanced migratory responses induced by VEGF A in vitro.
[0220] FIG. 8. shows the human ADAM 15 amino acid precursor
sequence (AAC50404).
REFERENCES
[0221] 1. Gerhardt, H., and Betsholtz, C. 2005. How do endothelial
cells orientate? Exs:3-15. [0222] 2. Ruhrberg, C., Gerhardt, H.,
Golding, M., Watson, R., Ioannidou, S., Fujisawa, H., Betsholtz,
C., and Shima, D. T. 2002. Spatially restricted patterning cues
provided by heparin-binding VEGF-A control blood vessel branching
morphogenesis. Genes Dev 16:2684-2698. [0223] 3. Gerhardt, H.,
Golding, M., Fruttiger, M., Ruhrberg, C., Lundkvist, A., Abramsson,
A., Jeltsch, M., Mitchell, C., Alitalo, K., Shima, D., et al. 2003.
VEGF guides angiogenic sprouting utilizing endothelial tip cell
filopodia. J Cell Biol 161:1163-1177. [0224] 4. Miralem, T.,
Steinberg, R., Price, D., and Avraham, H. 2001. VEGF(165) requires
extracellular matrix components to induce mitogenic effects and
migratory response in breast cancer cells. Oncogene 20:5511-5524.
[0225] 5. Wijelath, E. S., Rahman, S., Murray, J., Patel, Y.,
Savidge, G., and Sobel, M. 2004. Fibronectin promotes VEGF-induced
CD34 cell differentiation into endothelial cells. J Vasc Surg
39:655-660. [0226] 6. Zhang, X., Groopman, J. E., and Wang, J. F.
2005. Extracellular matrix regulates endothelial functions through
interaction of VEGFR-3 and integrin alpha5beta1. J Cell Physiol
202:205-214. [0227] 7. Wijelath, E. S., Rahman, S., Namekata, M.,
Murray, J., Nishimura, T., Mostafavi-Pour, Z., Patel, Y., Suda, Y.,
Humphries, M. J., and Sobel, M. 2006. Heparin-II Domain of
Fibronectin Is a Vascular Endothelial Growth Factor-Binding Domain.
Enhancement of VEGF Biological Activity by a Singular Growth
Factor/Matrix Protein Synergism. Circ Res. [0228] 8. Fong, G. H.,
Rossant, J., Gertsenstein, M., and Breitman, M. L. 1995. Role of
the Flt-1 receptor tyrosine kinase in regulating the assembly of
vascular endothelium. Nature 376:66-70. [0229] 9. Hiratsuka, S.,
Minowa, O., Kuno, J., Noda, T., and Shibuya, M. 1998. Flt-1 lacking
the tyrosine kinase domain is sufficient for normal development and
angiogenesis in mice. Proc Natl Acad Sci USA 95:9349-9354. [0230]
10. Blobel, C. P. 2005. ADAMs: key components in EGFR signalling
and development. Nat Rev Mol Cell Biol 6:32-43. [0231] 11. White,
J. M. 2003. ADAMs: modulators of cell-cell and cell-matrix
interactions. Curr Opin Cell Biol 15:598-606. [0232] 12. Yang, P.,
Baker, K. A., and Hagg, T. 2006. The ADAMs family: coordinators of
nervous system development, plasticity and repair. Prog Neurobiol
79:73-94. [0233] 13. Blobel, C. P. 1997.
Metalloprotease-disintegrins: links to cell adhesion and cleavage
of TNF alpha and Notch. Cell 90:589-592. [0234] 14. Lunn, C. A.,
Fan, X., Dalie, B., Miller, K., Zavodny, P. J., Narula, S. K., and
Lundell, D. 1997. Purification of ADAM 10 from bovine spleen as a
TNFalpha convertase. FEBS Lett 400:333-335. [0235] 15. Pan, D., and
Rubin, G. M. 1997. Kuzbanian controls proteolytic processing of
Notch and mediates lateral inhibition during Drosophila and
vertebrate neurogenesis. Cell 90:271-280. [0236] 16. Alfandari, D.,
Wolfsberg, T. G., White, J. M., and DeSimone, D. W. 1997. ADAM 13:
a novel ADAM expressed in somitic mesoderm and neural crest cells
during Xenopus laevis development. Dev Biol 182:314-330. [0237] 17.
Alfandari, D., Cousin, H., Gaultier, A., Smith, K., White, J. M.,
Darribere, T., and DeSimone, D. W. 2001. Xenopus ADAM 13 is a
metalloprotease required for cranial neural crest-cell migration.
Curr Biol 11:918-930. [0238] 18. Aktas, B., Pozgajova, M.,
Bergmeier, W., Sunnarborg, S., Offermanns, S., Lee, D., Wagner, D.
D., and Nieswandt, B. 2005. Aspirin induces platelet receptor
shedding via ADAM17 (TACE). J Biol Chem 280:39716-39722. [0239] 19.
Herren, B., Raines, E. W., and Ross, R. 1997. Expression of a
disintegrin-like protein in cultured human vascular cells and in
vivo. Faseb J 11:173-180. [0240] 20. Kratzschmar, J., Lum, L., and
Blobel, C. P. 1996. Metargidin, a membrane-anchored
metalloprotease-disintegrin protein with an RGD integrin binding
sequence. J Biol Chem 271:4593-4596. [0241] 21. Ham, C., Levkau,
B., Raines, E. W., and Herren, B. 2002. ADAM15 is an adherens
junction molecule whose surface expression can be driven by
VE-cadherin. Exp Cell Res 279:239-247. [0242] 22. Horiuchi, K.,
Weskamp, G., Lum, L., Hammes, H. P., Cai, H., Brodie, T. A.,
Ludwig, T., Chiusaroli, R., Baron, R., Preissner, K. T., et al.
2003. Potential role for ADAM15 in pathological neovascularization
in mice. Mol Cell Biol 23:5614-5624. [0243] 23. Rahman, S., Patel,
Y., Murray, J., Patel, K. V., Sumathipala, R., Sobel, M., and
Wijelath, E. S. 2005. Novel hepatocyte growth factor (HGF) binding
domains on fibronectin and vitronectin coordinate a distinct and
amplified Met-integrin induced signalling pathway in endothelial
cells. BMC Cell Biol 6:8. [0244] 24. Wijelath, E. S., Murray, J.,
Rahman, S., Patel, Y., Ishida, A., Strand, K., Aziz, S., Cardona,
C., Hammond, W. P., Savidge, G. F., et al. 2002. Novel vascular
endothelial growth factor binding domains of fibronectin enhance
vascular endothelial growth factor biological activity. Circ Res
91:25-31. [0245] 25. Bass, R., Werner, F., Odintsova, E., Sugiura,
T., Berditchevski, F., and Ellis, V. 2005. Regulation of urokinase
receptor proteolytic function by the tetraspanin CD82. J Biol Chem
280:14811-14818. [0246] 26. Cirilli, M., Gallina, C., Gavuzzo, E.,
Giordano, C., Gomis-Ruth, F. X., Gorini, B., Kress, L. F., Mazza,
F., Paradisi, M. P., Pochetti, G., et al. 1997. 2 angstrom X-ray
structure of adamalysin II complexed with a peptide phosphonate
inhibitor adopting a retro-binding mode. FEBS Lett 418:319-322.
[0247] 27. Davies, M. H., Eubanks, J. P., and Powers, M. R. 2006.
Microglia and macrophages are increased in response to
ischemia-induced retinopathy in the mouse retina. Mol Vis
12:467-477. [0248] 28. Qi, J. H., Matsumoto, T., Huang, K.,
Olausson, K., Christofferson, R., and Claesson-Welsh, L. 1999.
Phosphoinositide 3 kinase is critical for survival, mitogenesis and
migration but not for differentiation of endothelial cells.
Angiogenesis 3:371-380. [0249] 29. Uemura, A., Kusuhara, S.,
Wiegand, S. J., Yu, R. T., and Nishikawa, S. 2006. Tlx acts as a
proangiogenic switch by regulating extracellular assembly of
fibronectin matrices in retinal astrocytes. J Clin Invest
116:369-377. [0250] 30. Jiang, B., Liou, G. I., Behzadian, M. A.,
and Caldwell, R. B. 1994. Astrocytes modulate retinal
vasculogenesis: effects on fibronectin expression. J Cell Sci 107
(Pt 9):2499-2508. [0251] 31. Prager, G. W., Breuss, J. M., Steurer,
S., Olcaydu, D., Mihaly, J., Brunner, P. M., Stockinger, H., and
Binder, B. R. 2004. Vascular endothelial growth factor
receptor-2-induced initial endothelial cell migration depends on
the presence of the urokinase receptor. Circ Res 94:1562-1570.
[0252] 32. Prager, G. W., Breuss, J. M., Steurer, S., Mihaly, J.,
and Binder, B. R. 2004. Vascular endothelial growth factor (VEGF)
induces rapid prourokinase (pro-uPA) activation on the surface of
endothelial cells. Blood 103:955-962. [0253] 33. Stalmans, I., Ng,
Y. S., Rohan, R., Fruttiger, M., Bouche, A., Yuce, A., Fujisawa,
H., Hermans, B., Shani, M., Jansen, S., et al. 2002. Arteriolar and
venular patterning in retinas of mice selectively expressing VEGF
isoforms. J Clin Invest 109:327-336. [0254] 34. Takahashi, T., and
Shibuya, M. 1997. The 230 kDa mature form of KDR/Flk-1 (VEGF
receptor-2) activates the PLC-gamma pathway and partially induces
mitotic signals in NIH3T3 fibroblasts. Oncogene 14:2079-2089.
[0255] 35. Gerber, H. P., McMurtrey, A., Kowalski, J., Yan, M.,
Keyt, B. A., Dixit, V., and Ferrara, N. 1998. Vascular endothelial
growth factor regulates endothelial cell survival through the
phosphatidylinositol 3'-kinase/Akt signal transduction pathway.
Requirement for Flk-1/KDR activation. J Biol Chem 273:30336-30343.
[0256] 36. Primo, L., di Blasio, L., Roca, C., Droetto, S., Piva,
R., Schaffhausen, B., and Bussolino, F. 2007. Essential role of
PDK1 in regulating endothelial cell migration. J Cell Biol
176:1035-1047. [0257] 37. Matsumoto, T., Bohman, S., Dixelius, J.,
Berge, T., Dimberg, A., Magnusson, P., Wang, L., Wikner, C., Qi, J.
H., Wernstedt, C., et al. 2005. VEGF receptor-2 Y951 signaling and
a role for the adapter molecule TSAd in tumor angiogenesis. Embo J
24:2342-2353. [0258] 38. Yamaoka-Tojo, M., Tojo, T., Kim, H. W.,
Hilenski, L., Patrushev, N. A., Zhang, L., Fukai, T., and
Ushio-Fukai, M. 2006. IQGAP1 mediates VE-cadherin-based cell-cell
contacts and VEGF signaling at adherence junctions linked to
angiogenesis. Arterioscler Thromb Vasc Biol 26:1991-1997. [0259]
39. Laramee, M., Chabot, C., Cloutier, M., Stenne, R.,
Holgado-Madruga, M., Wong, A. J., and Royal, I. 2007. The
scaffolding adapter Gab1 mediates vascular endothelial growth
factor signaling and is required for endothelial cell migration and
capillary formation. J Biol Chem 282:7758-7769. [0260] 40. Dance,
M., Montagner, A., Yart, A., Masri, B., Audigier, Y., Perret, B.,
Salles, J. P., and Raynal, P. 2006. The adaptor protein Gab1
couples the stimulation of vascular endothelial growth factor
receptor-2 to the activation of phosphoinositide 3-kinase. J Biol
Chem 281:23285-23295. [0261] 41. Mahabeleshwar, G. H., Feng, W.,
Phillips, D. R., and Byzova, T. V. 2006. Integrin signaling is
critical for pathological angiogenesis. J Exp Med 203:2495-2507.
[0262] 42. Poghosyan, Z., Robbins, S. M., Houslay, M. D., Webster,
A., Murphy, G., and Edwards, D. R. 2002. Phosphorylation-dependent
interactions between ADAM15 cytoplasmic domain and Src family
protein-tyrosine kinases. J Biol Chem 277:4999-5007. [0263] 43.
Nath, D., Slocombe, P. M., Stephens, P. E., Warn, A., Hutchinson,
G. R., Yamada, K. M., Docherty, A. J., and Murphy, G. 1999.
Interaction of metargidin (ADAM-15) with alphavbeta3 and
alpha5beta1 integrins on different haemopoietic cells. J Cell Sci
112 (Pt 4):579-587. [0264] 44. Zhang, X. P., Kamata, T., Yokoyama,
K., Puzon-McLaughlin, W., and Takada, Y. 1998. Specific interaction
of the recombinant disintegrin-like domain of MDC-15 (metargidin,
ADAM-15) with integrin alphavbeta3. J Biol Chem 273:7345-7350.
[0265] 45. Eto, K., Puzon-McLaughlin, W., Sheppard, D.,
Sehara-Fujisawa, A., Zhang, X. P., and Takada, Y. 2000.
RGD-independent binding of integrin alpha9beta1 to the ADAM-12 and
-15 disintegrin domains mediates cell-cell interaction. J Biol Chem
275:34922-34930. [0266] 46. Carmeliet, P., Lampugnani, M. G.,
Moons, L., Breviario, F., Compernolle, V., Bono, F., Balconi, G.,
Spagnuolo, R., Oostuyse, B., Dewerchin, M., et al. 1999. Targeted
deficiency or cytosolic truncation of the VE-cadherin gene in mice
impairs VEGF-mediated endothelial survival and angiogenesis. Cell
98:147-157. [0267] 47. Chen, J., Somanath, P. R., Razorenova, 0.,
Chen, W. S., Hay, N., Bornstein, P., and Byzova, T. V. 2005. Akt1
regulates pathological angiogenesis, vascular maturation and
permeability in vivo. Nat Med 11:1188-1196. [0268] 48. Saunders, W.
B., Bohnsack, B. L., Faske, J. B., Anthis, N. J., Bayless, K. J.,
Hirschi, K. K., and Davis, G. E. 2006. Coregulation of vascular
tube stabilization by endothelial cell TIMP-2 and pericyte TIMP-3.
J Cell Biol 175:179-191. [0269] 49. Saunders, W. B., Bayless, K.
J., and Davis, G. E. 2005. MMP-1 activation by serine proteases and
MMP-10 induces human capillary tubular network collapse and
regression in 3D collagen matrices. J Cell Sci 118:2325-2340.
[0270] 50. Bajou, K., Masson, V., Gerard, R. D., Schmitt, P. M.,
Albert, V., Praus, M., Lund, L. R., Frandsen, T. L., Brunner, N.,
Dano, K., et al. 2001. The plasminogen activator inhibitor PAI-1
controls in vivo tumor vascularization by interaction with
proteases, not vitronectin. Implications for antiangiogenic
strategies. J Cell Biol 152:777-784. [0271] 51. Blobel et al.
International patent application publication WO2004/024089 [0272]
52. Rahman et al. Poster entitled "ADAM 15 is a negative regulator
of endothelial cell migration induced by VEGF-fibronectin"
presented at "Fibronectin, Integrins and Related Molecules" Gordon
Research Conference, Jan. 30-Feb. 4, 2005, Ventura Beach Marriott,
Ventura, Calif. [0273] 53 Bellacosa A, Kumar C C, Di Cristofano A
and Testa J R: Activation of AKT kinases in cancer: implications
for therapeutic targeting. Adv Cancer Res 94: 29-86, 2005. [0274]
54. Ikenoue T, Kanai F, HikibaY, et al: Functional analysis of
PIK3CA gene mutations in human colorectal cancer. Cancer Res 65:
4562-4567, 2005. [0275] 55. Samuels Y, Diaz L A Jr, Schmidt-Kittler
0, et al: Mutant PIK3CA promotes cell growth and invasion of human
cancer cells. Cancer Cell 7: 561-573, 2005. [0276] 56. Samuels Y,
Wang Z, Bardelli A, et al: High frequency of mutations of the
PIK3CA gene in human cancers. Science 304:554, 2004. [0277] 57.
Saal L H, Holm K, Maurer M, et al: PIK3CA Mutations correlate with
hormone receptors, node metastasis, and ERBB2, and are mutually
exclusive with PTEN loss in human breast carcinoma. Cancer Res 65:
2554-2559, 2005. [0278] 58. Levine D A, Bogomolniy F, Yee C J, Lash
A, Barakat R R, Borgen P I and Boyd J: Frequent mutation of the
PIK3CA gene in ovarian and breast cancers. Clin Cancer Res 11:
2875-2878, 2005. [0279] 59. Lee J W, Soung Y H, Kim S Y, et al:
PIK3CA gene is frequency mutated in breast carcinomas and
hepatocellular carcinomas. Oncogene 24: 1477-1480, 2005. [0280] 60.
Qiu W, Schonleben F, Li X, et al: PIK3CA mutations in head and neck
squamous cell carcinoma. Clin Cancer Res 12: 1441-1446, 2006.
[0281] 61. Busso, N and Hamilton, JA Extracellular coagulation and
the plasminogen activator/plasmin system in rheumatoid arthritis.
Arthritis Rheum. 46, 2046-2054, 2002. [0282] 62. Macri L,
Silverstein D, Clark R A. Growth factor binding to the pericellular
matrix and its importance in tissue engineering. Adv Drug Deliv
Rev. November 10; 59(13):1366-81. (2007). [0283] 63.
Charrier-Hisamuddin, L., Laboisse, C L, and Merlin, D. ADAM-15: a
metalloprotease that mediates inflammation. FASEB J 22, 1-14, 2007.
[0284] 64. Murphy, G. The ADAMs: signalling scissors in the tumour
microenvironment. Nat. Rev. Cancer, 8, 929-941, 2008.
[0285] Each of the foregoing patents, patent applications and
references that are recited in this application are herein
incorporated in their entirety by reference. Having thus described
several aspects of embodiments of this invention, it is to be
appreciated various alterations, modifications, and improvements
will readily occur to those skilled in the art in view of the
teachings set forth herein. Such alterations, modifications, and
improvements are intended to be part of this disclosure, and are
intended to be within the spirit and scope of the invention.
Accordingly, the description and drawings are by way of example
only.
Sequence CWU 1
1
81814PRThomo sapiens 1Met Arg Leu Ala Leu Leu Trp Ala Leu Gly Leu
Leu Gly Ala Gly Ser 1 5 10 15 Pro Leu Pro Ser Trp Pro Leu Pro Asn
Ile Gly Gly Thr Glu Glu Gln 20 25 30 Gln Ala Glu Ser Glu Lys Ala
Pro Arg Glu Pro Leu Glu Pro Gln Val 35 40 45 Leu Gln Asp Asp Leu
Pro Ile Ser Leu Lys Lys Val Leu Gln Thr Ser 50 55 60 Leu Pro Glu
Pro Leu Arg Ile Lys Leu Glu Leu Asp Gly Asp Ser His 65 70 75 80 Ile
Leu Glu Leu Leu Gln Asn Arg Glu Leu Val Pro Gly Arg Pro Thr 85 90
95 Leu Val Trp Tyr Gln Pro Asp Gly Thr Arg Val Val Ser Glu Gly His
100 105 110 Thr Leu Glu Asn Cys Cys Tyr Gln Gly Arg Val Arg Gly Tyr
Ala Gly 115 120 125 Ser Trp Val Ser Ile Cys Thr Cys Ser Gly Leu Arg
Gly Leu Val Val 130 135 140 Leu Thr Pro Glu Arg Ser Tyr Thr Leu Glu
Gln Gly Pro Gly Asp Leu 145 150 155 160 Gln Gly Pro Pro Ile Ile Ser
Arg Ile Gln Asp Leu His Leu Pro Gly 165 170 175 His Thr Cys Ala Leu
Ser Trp Arg Glu Ser Val His Thr Gln Thr Pro 180 185 190 Pro Glu His
Pro Leu Gly Gln Arg His Ile Arg Arg Arg Arg Asp Val 195 200 205 Val
Thr Glu Thr Lys Thr Val Glu Leu Val Ile Val Ala Asp His Ser 210 215
220 Glu Ala Gln Lys Tyr Arg Asp Phe Gln His Leu Leu Asn Arg Thr Leu
225 230 235 240 Glu Val Ala Leu Leu Leu Asp Thr Phe Phe Arg Pro Leu
Asn Val Arg 245 250 255 Val Ala Leu Val Gly Leu Glu Ala Trp Thr Gln
Arg Asp Leu Val Glu 260 265 270 Ile Ser Pro Asn Pro Ala Val Thr Leu
Glu Asn Phe Leu His Trp Arg 275 280 285 Arg Ala His Leu Leu Pro Arg
Leu Pro His Asp Ser Ala Gln Leu Val 290 295 300 Thr Gly Thr Ser Phe
Ser Gly Pro Thr Val Gly Met Ala Ile Gln Asn 305 310 315 320 Ser Ile
Cys Ser Pro Asp Phe Ser Gly Gly Val Asn Met Asp His Ser 325 330 335
Thr Ser Ile Leu Gly Val Ala Ser Ser Ile Ala His Glu Leu Gly His 340
345 350 Ser Leu Gly Leu Asp His Asp Leu Pro Gly Asn Ser Cys Pro Cys
Pro 355 360 365 Gly Pro Ala Pro Ala Lys Thr Cys Ile Met Glu Ala Ser
Thr Asp Phe 370 375 380 Leu Pro Gly Leu Asn Phe Ser Asn Cys Ser Arg
Arg Ala Leu Glu Lys 385 390 395 400 Ala Leu Leu Asp Gly Met Gly Ser
Cys Leu Phe Glu Arg Leu Pro Ser 405 410 415 Leu Pro Pro Met Ala Ala
Phe Cys Gly Asn Met Phe Val Glu Pro Gly 420 425 430 Glu Gln Cys Asp
Cys Gly Phe Leu Asp Asp Cys Val Asp Pro Cys Cys 435 440 445 Asp Ser
Leu Thr Cys Gln Leu Arg Pro Gly Ala Gln Cys Ala Ser Asp 450 455 460
Gly Pro Cys Cys Gln Asn Cys Gln Leu Arg Pro Ser Gly Trp Gln Cys 465
470 475 480 Arg Pro Thr Arg Gly Asp Cys Asp Leu Pro Glu Phe Cys Pro
Gly Asp 485 490 495 Ser Ser Gln Cys Pro Pro Asp Val Ser Leu Gly Asp
Gly Glu Pro Cys 500 505 510 Ala Gly Gly Gln Ala Val Cys Met His Gly
Arg Cys Ala Ser Tyr Ala 515 520 525 Gln Gln Cys Gln Ser Leu Trp Gly
Pro Gly Ala Gln Pro Ala Ala Pro 530 535 540 Leu Cys Leu Gln Thr Ala
Asn Thr Arg Gly Asn Ala Phe Gly Ser Cys 545 550 555 560 Gly Arg Asn
Pro Ser Gly Ser Tyr Val Ser Cys Thr Pro Arg Asp Ala 565 570 575 Ile
Cys Gly Gln Leu Gln Cys Gln Thr Gly Arg Thr Gln Pro Leu Leu 580 585
590 Gly Ser Ile Arg Asp Leu Leu Trp Glu Thr Ile Asp Val Asn Gly Thr
595 600 605 Glu Leu Asn Cys Ser Trp Val His Leu Asp Leu Gly Ser Asp
Val Ala 610 615 620 Gln Pro Leu Leu Thr Leu Pro Gly Thr Ala Cys Gly
Pro Gly Leu Val 625 630 635 640 Cys Ile Asp His Arg Cys Gln Arg Val
Asp Leu Leu Gly Ala Gln Glu 645 650 655 Cys Arg Ser Lys Cys His Gly
His Gly Val Cys Asp Ser Asn Arg His 660 665 670 Cys Tyr Cys Glu Glu
Gly Trp Ala Pro Pro Asp Cys Thr Thr Gln Leu 675 680 685 Lys Ala Thr
Ser Ser Leu Thr Thr Gly Leu Leu Leu Ser Leu Leu Val 690 695 700 Leu
Leu Val Leu Val Met Leu Gly Ala Gly Tyr Trp Tyr Arg Ala Arg 705 710
715 720 Leu His Gln Arg Leu Cys Gln Leu Lys Gly Pro Thr Cys Gln Tyr
Arg 725 730 735 Ala Ala Gln Ser Gly Pro Ser Glu Arg Pro Gly Pro Pro
Gln Arg Ala 740 745 750 Leu Leu Ala Arg Gly Thr Lys Ser Gln Gly Pro
Ala Lys Pro Pro Pro 755 760 765 Pro Arg Lys Pro Leu Pro Ala Asp Pro
Gln Gly Arg Cys Pro Ser Gly 770 775 780 Asp Leu Pro Gly Pro Gly Ala
Gly Ile Pro Pro Leu Val Val Pro Ser 785 790 795 800 Arg Pro Ala Pro
Pro Pro Pro Thr Val Ser Ser Leu Tyr Leu 805 810 211PRTartificial
sequencesynthetic polypeptide 2His Glu Xaa Xaa His Xaa Xaa Gly Xaa
Xaa Xaa 1 5 10 314PRTartificial sequencesynthetic polypeptide 3Ile
Ala His Glu Leu Gly His Ser Leu Gly Leu Asp His Asp 1 5 10
431DNAartificial sequencesynthetic oligonucleotide 4aactccatct
gttctcctga cttcctgtct c 31532DNAartificial sequencesynthetic
oligonucleotide 5aaaagtcagg agaacagatg gagcctgttc tc
32632DNAartificial sequencesynthetic oligonucleotide 6aagcccttcc
ttccagttac ctttcctgtc tc 32731DNAartificial sequencesynthetic
oligonucleotide 7aaaaaggtaa ctggaaggaa ggccctgtct c
31824PRTArtificial SequenceSynthetic Polypeptide 8Xaa Xaa Xaa Xaa
Xaa Ile Ala His Glu Leu Gly His Ser Leu Gly Leu 1 5 10 15 Asp His
Asp Xaa Xaa Xaa Xaa Xaa 20
* * * * *
References