U.S. patent application number 14/626467 was filed with the patent office on 2015-10-01 for antagonist antibody for the treatment of cancer.
The applicant listed for this patent is SANOIFI. Invention is credited to Veronique BLANC, Claudia FROMAND, Jiawen HAN, Min LI, Fabienne PARKER, Michel STREULI, Daniel TAVARES, Chonghui ZHANG, Xiao-Mai ZHOU.
Application Number | 20150274824 14/626467 |
Document ID | / |
Family ID | 37635710 |
Filed Date | 2015-10-01 |
United States Patent
Application |
20150274824 |
Kind Code |
A1 |
BLANC; Veronique ; et
al. |
October 1, 2015 |
ANTAGONIST ANTIBODY FOR THE TREATMENT OF CANCER
Abstract
Antibodies, humanized antibodies, resurfaced antibodies,
antibody fragments, derivatized antibodies, and conjugates of same
with cytotoxic agents, which specifically bind to, and inhibit A
class of Eph receptors, antagonize the effects of growth factors on
the growth and survival of tumor cells, and which have minimal
agonistic activity or are preferrentially devoid of agonist
activity. Said antibodies and fragments thereof may be used in the
treatment of tumors that express elevated levels of A class of Eph
receptors, such as breast cancer, colon cancer, lung cancer,
ovarian carcinoma, synovial sarcoma and pancreatic cancer, and said
derivatized antibodies may be used in the diagnosis and imaging of
tumors that express elevated levels of A class of Eph receptors.
Also provided are cytotoxic conjugates comprising a cell binding
agent and a cytotoxic agent, therapeutic compositions comprising
the conjugate, methods for using the conjugates in the inhibition
of cell growth and the treatment of disease, and a kit comprising
the cytotoxic conjugate are disclosed are all embodiments of the
invention. In particular, the cell binding agent is a monoclonal
antibody, and epitope-binding fragments thereof, that recognizes
and binds the A class of Eph receptors.
Inventors: |
BLANC; Veronique; (Paris,
FR) ; FROMAND; Claudia; (Paris, FR) ; PARKER;
Fabienne; (Paris, FR) ; HAN; Jiawen; (Paris,
FR) ; TAVARES; Daniel; (Natick, MA) ; ZHANG;
Chonghui; (Brookline, MA) ; LI; Min; (Sudbury,
MA) ; ZHOU; Xiao-Mai; (Watertown, MA) ;
STREULI; Michel; (Brookline, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SANOIFI |
Paris |
|
FR |
|
|
Family ID: |
37635710 |
Appl. No.: |
14/626467 |
Filed: |
February 19, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13787293 |
Mar 6, 2013 |
8992912 |
|
|
14626467 |
|
|
|
|
12373574 |
Oct 2, 2009 |
8460667 |
|
|
PCT/IB2007/003074 |
Jul 13, 2007 |
|
|
|
13787293 |
|
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/143.1; 424/178.1; 435/320.1; 435/334; 435/7.23; 530/387.3;
530/388.22; 530/391.7; 536/23.53 |
Current CPC
Class: |
C07K 2317/24 20130101;
A61K 2039/505 20130101; C07K 16/40 20130101; A61P 35/04 20180101;
A61K 39/3955 20130101; C07K 16/28 20130101; C07K 16/30 20130101;
C07K 2317/73 20130101; C07K 2317/76 20130101; A61K 45/06 20130101;
C07K 16/2866 20130101; A61P 35/00 20180101; A61K 47/6849 20170801;
G01N 2333/705 20130101; A61P 43/00 20180101; C07K 2317/92 20130101;
G01N 33/57492 20130101; G01N 2333/91205 20130101 |
International
Class: |
C07K 16/28 20060101
C07K016/28; C07K 16/40 20060101 C07K016/40; A61K 45/06 20060101
A61K045/06; G01N 33/574 20060101 G01N033/574; A61K 47/48 20060101
A61K047/48; A61K 39/395 20060101 A61K039/395 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 18, 2006 |
EP |
06291160.7 |
Claims
1. An antibody or an epitope-binding fragment thereof that
specifically binds to an EphA2 receptor and is an antagonist of
said receptor.
2. The antibody or epitope-binding fragment thereof according to
claim 1, wherein one or more of the following conditions is met: a)
said antibody or epitope-binding fragment thereof is a monoclonal
antibody b) said antibody or epitope-binding fragment thereof is a
Fab, Fab', F(ab').sub.2 or F.sub.v fragment; c) said antibody or
epitope-binding fragment thereof is capable of inhibiting growth of
a cancer cell; d) said antibody or epitope-binding fragment thereof
is capable of inhibiting migration of a cancer cell; e) said
antibody or epitope-binding fragment thereof is capable of
inhibiting angiogenesis; f) said antibody or epitope-binding
fragment thereof is devoid of agonist activity; g) said antibody or
epitope-binding fragment thereof is capable of inhibiting the
binding of a ligand to said receptor; h) said antibody or
epitope-binding fragment thereof is capable of inhibiting EphA2
tyrosine phosphorylation; i) said antibody or epitope-binding
fragment thereof is capable of inhibiting EphA2-mediated signaling;
j) said antibody or epitope-binding fragment thereof binds EphA2
with a K.sub.D of 3.times.10.sup.-10 M or smaller; and k) said
EphA2 receptor is human.
3-5. (canceled)
6. The antibody or an epitope-binding fragment thereof according to
claim 2, wherein one or more of the following conditions are met:
a) said cancer cell is a cell of a cancer selected from the group
consisting of a breast cancer, colon cancer, endometrial cancer,
ovarian carcinoma, osteosarcoma, cervical cancer, prostate cancer,
lung cancer, synovial carcinoma pancreatic cancer, a sarcoma, a
glioma, head and neck cancer, gastric cancer, liver cancer, and
other carcinomas; b) said antibody or epitope-binding fragment
thereof does not stimulate EphA2 tyrosine phosphorylation; c) said
ligand is ephrinA1; d) said antibody or epitope-binding fragment
thereof is capable of inhibiting EphA2 tyrosine phosphorylation in
presence of ephrinA1; and e) wherein the inhibition of
EphA2-mediated signaling results in an increase in Akt
phosphorylation.
7-17. (canceled)
18. An antibody or epitope-binding fragment thereof according to
claim 1, wherein one or more of the following conditions are met:
a) said antibody or epitope-binding fragment thereof comprises one
or more complementarity-determining region having an amino acid
sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 61, 62, 63,
64, 65, 66, 67, 68, 69, 70, 71, and 72; b) said antibody or
epitope-binding fragment thereof comprises a light chain variable
region having an amino acid sequence selected from the group
consisting of SEQ ID NOs: 26, 28, 30, 78, and 80; c) said antibody
or epitope-binding fragment thereof comprises a heavy chain
variable region having an amino acid sequence selected from the
group consisting of SEQ ID NOs: 20, 22, 24, 74, and 76; d) said
antibody or epitope-binding fragment thereof comprises at least one
heavy chain and at least one light chain, wherein said heavy chain
comprises three sequential complementarity-determining regions
having amino acid sequences represented by SEQ ID NOs: 1, 2, and 3,
and wherein said light chain comprises three sequential
complementarity-determining regions having amino acid sequences
represented by SEQ ID NOs: 4, 5, and 6; e) said antibody or
epitope-binding fragment thereof comprises at least one heavy chain
and at least one light chain, wherein said heavy chain comprises
three sequential complementarity-determining regions having amino
acid sequences represented by SEQ ID NOs: 7, 8, and 9, and wherein
said light chain comprises three sequential
complementarity-determining regions having amino acid sequences
represented by SEQ ID NOs: 10, 11, and 12; f) said antibody or
epitope-binding fragment thereof comprises at least one heavy chain
and at least one light chain, wherein said heavy chain comprises
three sequential complementarity-determining regions having amino
acid sequences represented by SEQ ID NOs: 13, 14, and 15, and
wherein said light chain comprises three sequential
complementarity-determining regions having amino acid sequences
represented by SEQ ID NOs: 16, 17, and 18; g) said antibody or
epitope-binding fragment thereof comprises at least one heavy chain
and at least one light chain, wherein said heavy chain comprises
three sequential complementarity determining regions having amino
acid sequences represented by SEQ ID NOs: 61, 62, and 63, and
wherein said light chain comprises three sequential
complementarity-determining regions having amino acid sequences
represented by SEQ ID NOs: 64, 65, and 66; h) said antibody or
epitope-binding fragment thereof comprises at least one heavy chain
and at least one light chain, wherein said heavy chain comprises
three sequential complementarity determining regions having amino
acid sequences represented by SEQ ID NOs: 67, 68, and 69, and
wherein said light chain comprises three sequential
complementarity-determining regions having amino acid sequences
represented by SEQ ID NOs: 70, 71, and 72; and i) said antibody or
epitope-binding fragment thereof is a murine antibody or
epitope-binding fragment thereof and is produced by a hybridoma
designated 37.3D7, wherein said hybridoma is deposited at the
American Type Culture Collection under the accession number
PTA-7660; a hybridoma designated 37.1F5, wherein said hybridoma is
deposited at the American Type Culture Collection under the
accession number PTA-7661; a hybridoma designated 53.2H11, wherein
said hybridoma is deposited at the American Type Culture Collection
under the accession number PTA-7662; a hybridoma EphA2-N1, wherein
said hybridoma is deposited at the American Type Culture Collection
under the accession number PTM-8407; or a hybridoma designated
EphA2-N2, wherein said hybridoma is deposited at the American Type
Culture Collection under the accession number PTM-8408.
19-36. (canceled)
37. A humanized or resurfaced antibody or epitope-binding fragment
thereof that binds the same epitope as an antibody or
epitope-binding fragment thereof according to claim 18.
38. A humanized or resurfaced antibody or epitope-binding fragment
thereof according to claim 37 wherein one or more of the following
conditions are met: a) said humanized or resurfaced antibody or
epitope-binding fragment thereof comprises one or more
complementarity-determining region having an amino acid sequence
selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 61, 62, 63, 64, 65,
66, 67, 68, 69, 70, 71, and 72 b) said humanized or resurfaced
antibody or epitope-binding fragment thereof comprises a light
chain variable region having an amino acid sequence selected from
the group consisting of SEQ ID NOS: 47, 48, 49, 50, and 52; c) said
humanized or resurfaced antibody or epitope-binding fragment
thereof comprises a heavy chain variable region having an amino
acid sequence selected from the group consisting of SEQ ID NOS: 32,
34, 36, 37, 38, 40, 42, 43, and 45; d) said humanized or resurfaced
antibody or epitope-binding fragment thereof comprises at least one
heavy chain and at least one light chain, wherein said heavy chain
comprises three sequential complementarity-determining regions
having amino acid sequences represented by SEQ ID NOS: 1, 2, and 3,
and wherein said light chain comprises three sequential
complementarity-determining regions having amino acid sequences
represented by SEQ ID NOS: 4, 5, and 6; e) said humanized or
resurfaced antibody or epitope-binding fragment thereof comprises
at least one heavy chain and at least one light chain, wherein said
heavy chain comprises three sequential complementarity-determining
regions having amino acid sequences by SEQ ID NOS: 7, 8, and 9, and
wherein said light chain comprises three sequential
complementarity-determining regions having amino acid sequences
represented by SEQ ID NOS: 10, 11, and 12; f) said humanized or
resurfaced antibody or epitope-binding fragment thereof comprises
at least one heavy chain and at least one light chain, wherein said
heavy chain comprises three sequential complementarity-determining
regions having amino acid sequences represented by SEQ ID NOS: 13,
14, and 15, and wherein said light chain comprises three sequential
complementarity-determining regions having amino acid sequences
represented by SEQ ID NOS:16, 17, and 18; g) said humanized or
resurfaced antibody or epitope-binding fragment thereof comprises
at least one heavy chain and at least one light chain, and said
heavy chain comprises three sequential complementarity-determining
regions having amino acid sequences selected from the group
consisting of SEQ ID NOs: 61, 62, and 63, and said light chain
comprises three sequential complementarity-determining regions
having amino acid sequences selected from the group consisting of
SEQ ID NOs: 64, 65, and 66; h) said humanized or resurfaced
antibody or epitope-binding fragment thereof comprises at least one
heavy chain and at least one light chain, and said heavy chain
comprises three sequential complementarity-determining regions
having amino acid sequences selected from the group consisting of
SEQ ID NOs: 67, 68, and 69, and said light chain comprises three
sequential complementarity-determining regions having amino acid
sequences selected from the group consisting of SEQ ID NOs: 70, 71,
and 72; and i) said humanized or resurfaced antibody or
epitope-binding fragment thereof is selected from a group
consisting of hu37.3D7, hu37.1F5, hu53.2H11, huEphA2-N1, and
huEphA2-N2.
39-52. (canceled)
53. A conjugate comprising the antibody or epitope-binding fragment
thereof according to claim 1 linked to a cytotoxic agent.
54. The conjugate of claim 53, characterized in that said cytotoxic
agent is selected from the group consisting of a maytansinoid, a
small drug, a tomaymycin derivative, a leptomycin derivative, a
prodrug, a taxoid, CC-1065 and a CC-1065 analog.
55. The conjugate of claim 53, characterized in that said cytotoxic
agent is: a) the maytansine DM1 of formula: ##STR00019## b) the
maytansine DM4 of formula: ##STR00020## c) a tomaymycin derivative
selected group the mu consisting of:
8,8'-[1,3-benzenediylbis(methyleneoxy)]-bis[(S)-2-eth-(E)-ylidene-7-metho-
xy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[5-methoxy-1,3-benzenediylbis(methyleneoxy)]-bis[(S)-2-eth-(E)-ylide-
ne-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-
e]
8,8'-[1,5-pentanediylbis(oxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,-
3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[1,4-butanediylbis(oxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3,1-
1a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[3-methyl-1,5-pentanediylbis(oxy)]-bis[(S)-2-eth-(E)-ylidene-7-metho-
xy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[2,6-pyridinediylbis(oxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3-
,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[4-(3-tert-butoxycarbonylaminopropyloxy)-2,6-pyridinediylbis-(methyl-
eneoxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrro-
lo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[5-(3-aminopropyloxy)-1,3-benzenediylbis(methyleneoxy)]-bis[(S)-2-et-
h-(E)-ylidene-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodi-
azepin-5-one]
8,8'-[5-(N-methyl-3-tert-butoxycarbonylaminopropyl)-1,3-benzenediylbis-(m-
ethyleneoxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3,11a-tetrahydro-5H--
pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-{5-[3-(4-methyl-4-methyldisulfanyl-pentanoylamino)propyloxy]-1,3-ben-
zenediylbis(methleneoxy)}-bis[(S)-2-eth-ylidene-7-methoxy-1,2,3,11a-tetrah-
ydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[5-acetylthiomethyl-1,3-benzenediylbis(methyleneoxy)]-bis[(S)-2-meth-
ylene-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-
-one]
bis-{2-[(S)-2-methylene-7-methoxy-5-oxo-1,3,11a-tetrahydro-5H-pyrrol-
o[2,1-c][1,4]benzodiazepin-8-yloxy]-ethyl}-carbamic acid tert-butyl
ester
8,8'-[3-(2-acetylthioethyl)-1,5-pentanediylbis(oxy)]-bis[(S)-2-methylene--
7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[5-(N-4-mercapto-4,4-dimethylbutanoyl)amino-1,3-benzenediylbis(methy-
leneoxy)]-bis[7-methoxy-2-methylene-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c]-
[1,4]benzodiazepin-5-one]
8,8'-[5-(N-4-methyldithio-4,4-dimethylbutanoyl)-amino-1,3-benzenediylbis(-
methyleneoxy)]-bis[7-methoxy-2-methylene-1,2,3,11a-tetrahydro-5H-pyrrolo[2-
,1-c][1,4]benzodiazepin-5-one]
8,8'-[5-(N-methyl-N-(2-mercapto-2,2-dimethylethyl)amino-1,3-benzenediyl(m-
ethyleneoxy)]-bis[7-methoxy-2-methylene-1,2,3,11a-tetrahydro-5H-pyrrolo[2,-
1-c][1,4]benzodiazepin-5-one]
8,8'-[5-(N-methyl-N-(2-methyldithio-2,2-dimethylethyl)amino-1,3-benzenedi-
yl(methyleneoxy)]-bis[7-methoxy-2-methylene-1,2,3,11a-tetrahydro-5H-pyrrol-
o[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(4-(2-(4-mercapto-4-methyl)-pentanamido-ethoxy)-pyridin-2,6-dimethy-
l)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-pyrro-
lo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(1-(2-(4-methyl-4-methyldisulfanyl)-pentanamido-ethoxy)-benzene-3,5-
-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahyd-
ro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(4-(3-(4-methyl-4-methyldisulfanyl)-pentanamido-propoxy)-pyridin-2,-
6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahy-
dro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(4-(4-(4-methyl-4-methyldisulfanyl)-pentanamido-butoxy)-pyridin-2,6-
-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahyd-
ro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(4-(3-[4-(4-methyl-4-methyldisulfanyl-pentanoyl)-piperazin-1-yl]-pr-
opyl)-pyridin-2,6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1-
,2,3,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(1-(3-[4-(4-methyl-4-methyldisulfanyl-pentanoyl)-piperazin-1-yl]-pr-
opyl)-benzene-3,5-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1-
,2,3,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(4-(2-{2-[2-(4-methyl-4-methyldisulfanyl-pentanoylamino)-ethoxy]-et-
hoxy}-ethoxy)-pyridin-2,6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dim-
ethoxy-1,2,3,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(1-(2-{2-[2-(2-{2-[2-(4-methyl-4-methyldisulfanyl-pentanoylamino)-e-
thoxy]-ethoxy}-ethoxy)-ethoxy]-ethoxy}-ethoxy)-benzene-3,5-dimethyl)-dioxy-
]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-pyrrolo[2,1-c-
][1,4]benzodiazepin-5-one]
8,8'-[(1-(2-{2-[2-(4-methyl-4-methyldisulfanyl-pentanoylamino)-ethoxy]-et-
hoxy}-ethoxy)-benzene-3,5-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dim-
ethoxy-1,2,3,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(4-(2-{2-[2-(2-{2-[2-(4-methyl-4-methyldisulfanyl-pentanoylamino)-e-
thoxy]-ethoxy}-ethoxy)-ethoxy]-ethoxy}-ethoxy)-pyridin-2,6-dimethyl)-dioxy-
]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-pyrrolo[2,1-c-
][1,4]benzodiazepin-5-one]
8,8'-[(1-(2-[methyl-(2-methyl-2-methyldisulfanyl-propyl)-amino]-ethoxy)-b-
enzene-3,5-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11-
a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(4-(3-[methyl-(4-methyl-4-methyldisulfanyl-pentanoyl)-amino]-propyl-
)-pyridin-2,6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3-
,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
8,8'-[(4-(3-[methyl-(2-methyl-2-methyldisulfanyl-propyl)-amino]-propyl)-p-
yridin-2,6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11-
a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]; and
8,8'-[(1-(4-methyl-4-methyldisulfanyl)-pentanamido)-benzene-3,5-dimethyl)-
-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-pyrrolo-
[2,1-c][1,4]benzodiazepin-5-one]; or d) a leptomycin derivative
selected from the group consisting of:
(2-Methylsulfanyl-ethyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-Hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid (2-methylsulfanyl-ethyl)-amid
Bis-[(2-mercaptoethyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2-
S,3S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,-
18-pentaenoic acid] (2-Mercapto-ethyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid (2-Methyldisulfanyl-ethyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid (2-Methyl-2-methyldisulfanyl-propyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid; and (2-Mercapto-2-methyl-propyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid.
56-58. (canceled)
59. A pharmaceutical composition containing an antibody or
epitope-binding fragment thereof according to claim 1 and a
pharmaceutically acceptable carrier or excipients.
60. An antibody or epitope-binding fragment thereof according to
claim 1 for use as a medicament.
61. The use of an antibody or epitope-binding fragment thereof
according to claim 1 to make a medicament to treat cancer.
62. The use of claim 61, wherein one or more of the following
conditions are met: a) said cancer is a metastatic cancer; b) said
antibody or epitope-binding fragment thereof inhibits tumor
neovascularization; and c) said cancer is selected from the group
consisting of breast cancer, colon cancer, endometrial cancer,
ovarian carcinoma, osteosarcoma, cervical cancer, kidney cancer,
prostate cancer, lung cancer, synovial carcinoma pancreatic cancer,
a sarcoma, glioma, head and neck cancer, gastric cancer, liver
cancer, and other carcinomas.
63-64. (canceled)
65. The use according to claim 61, further comprising the use of a
further therapeutic agent in the manufacture of the same or
different composition.
66. The use according to claim 65 characterized in that the further
therapeutic agent is an antagonist of fibroblast-growth factor
(FGF), hepatocyte growth factor (HGF), tissue factor (TF), protein
C, protein S, platelet-derived growth factor (PDGF), or HER2
receptor.
67. A method of diagnosing a cancer in a subject known to or
suspected to have a cancer, said method comprising: a) Contacting
cells of said patient with an antibody or epitope-binding fragment
thereof, b) Measuring the binding of said antibody or
epitope-binding fragment thereof to said cells, and c) Comparing
the expression in part (b) with that of a normal reference subject
or standard.
68. The method of claim 67, wherein said cancer is a cell of a
cancer selected from the group consisting of a breast cancer, colon
cancer, endometrial cancer, ovarian carcinoma, osteosarcoma,
cervical cancer, kidney cancer, prostate cancer, lung cancer,
synovial carcinoma pancreatic cancer, a sarcoma, glioma, head and
neck cancer, gastric cancer, liver cancer, and other
carcinomas.
69. The method of claim 68, characterized in that the said cells
are in frozen or fixed tissue or cells from said patient.
70. A polynucleotide encoding a polypeptide selected from the group
consisting of SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 37, 38,
40, 42, 43, 45, 47, 48, 49, 50, 52, 61, 62, 63, 64, 65, 66, 67, 68,
69, 70, 71, 72, 74, 76, 78 and 80.
71. A polynucleotide according to claim 70 characterized in that
said polynucleotide has a sequence sharing at least 80% homology
with a polynucleotide selected from the group consisting of SEQ ID
NOs: 19, 21, 23, 25, 27, 29, 31, 33, 35, 39, 41, 44, 46, 51, 73,
75, 77, and 79.
72. A recombinant vector comprising the polynucleotide of claim
70.
73. A host cell comprising the vector of claim 72.
74. The host cell of claim 78, characterised in that it is selected
from the group consisting of the hybridoma cell line designated
37.3D7 wherein said hybridoma cell line is deposited at the
American Type Culture Collection under the accession number
PTA-7660; the hybridoma cell line designated 37.1F5, wherein said
hybridoma cell line is deposited at the American Type Culture
Collection under the accession number PTA-7661; the hybridoma cell
line designated 53.2H11, wherein said hybridoma cell line is
deposited at the American Type Culture Collection under the
accession number PTA-7662; the hybridoma cell line designated
EphA2-N1, wherein said hybridoma cell line is deposited at the
American Type Culture Collection under the accession number
PTM-8407; or the hybridoma cell line designated EphA2-N2, wherein
said hybridoma cell line is deposited at the American Type Culture
Collection under the accession number PTM-8408.
75. A pharmaceutical composition containing a conjugate according
to claim 53 and a pharmaceutically acceptable carrier or
excipients.
76. A conjugate according to claim 53 for use as a medicament.
77. The use of a conjugate according to claim 53 to make a
medicament to treat cancer.
78. A host cell expressing the antibody of claim 1.
Description
FIELD OF THE INVENTION
[0001] The present invention provides novel murine anti-Eph
monoclonal antibodies or fragments thereof, and humanized or
resurfaced versions thereof. More specifically, the invention
relates to novel monoclonal antibodies or fragments thereof, and
humanized or resurfaced versions thereof, which interact with the
EphA receptor family and act as antagonists. More particularly, the
invention relates to anti-EphA2 receptor antibodies that inhibit
the cellular functions of the EphA2 receptor. Still more
particularly, the invention relates to anti-EphA2 receptor
antibodies that antagonize growth and survival of tumor cells and
which are devoid of agonist activity.
[0002] The present invention is further directed to cytotoxic
conjugates comprising a cell binding agent and a cytotoxic agent,
therapeutic compositions comprising the conjugate, methods for
using the conjugates in the inhibition of cell growth and the
treatment of disease, and a kit comprising the cytotoxic conjugate.
In particular, the cell binding agent is a monoclonal antibody, or
epitope-binding fragment thereof, and a humanized or resurfaced
version thereof that recognizes and binds the EphA family of
receptors.
BACKGROUND OF THE INVENTION
[0003] Receptor tyrosine kinases play a diverse role in cell growth
and differentiation during normal physiologic responses and in
oncogenic transformation and tumor progression. Eph receptors are a
unique family of receptor tyrosine kinases (RTK), the largest in
the genome, consisting of at least 16 receptors that interact with
nine membrane-bound ephrin ligands (Pasquale, E. B. et al., 2005,
Nature Reviews Mol. Cell Biol., 6: 462-475). They can be further
divided into two groups, class A and B, based on the sequence
homology and binding affinity (Pasquale, E. B. et al., 2005, Nature
Reviews Mol. Cell Biol., 6: 462-475). Class A Eph receptors
interact with multiple ligands of the ephrin-A family, a group of
glycosyl-phosphatidylinositol (GPI)-linked membrane proteins, while
class B Eph receptors bind to ephrin-B ligands, a family of
transmembrane proteins. Binding of Eph receptors to their ligands
induces receptor clustering, activation of kinase activity, and
subsequent trans-phosphorylation of the cytoplasmic domains on
tyrosine residues, creating docking sites for a number of signaling
proteins (Kullander, K. and Klein, R., 2002, Nature Reviews Mol.
Cell Biol., 3: 475-486; Noren, N. K. and Pasquale, E. B., 2004,
Cell signal., 16: 655-666).
[0004] Cancer is a disease characterized by uncontrolled
proliferation, resulting from aberrant signal transduction. The
most dangerous forms of cancer are malignant cells which have the
ability of these to spread, either by direct growth into adjacent
tissue through invasion, or by implantation into distant sites by
metastasis. Metastatic cells have acquired the ability to break
away from the primary tumor, translocate to distant sites through
the bloodstream or lymphatic system, and colonize distant and
foreign microenvironments.
[0005] It is now clear that the Eph molecules also have a role in
disease states such as cancer. In particular, overexpression of the
EphA2 receptor has been reported in cancers of the ovary, breast,
prostate, lung, colon, oesophagus, renal cell, cervix, and
melanoma. EphA2 was suggested to be a positive regulator of cell
growth and survival in malignant cells (Landen, C. N. et al., 2005,
Expert. Opin. Ther. Targets, 9 (6): 1179-1187). A role for EphA2 in
metastasis has also been described, since EphA2 overexpression
alone is sufficient to transform mammary epithelial cells into a
malignant phenotype (Zelinski et al., 2001, Cancer Res., 61:
2301-2306), and increases spontaneous metastasis to distant sites
(Landen, C. N. et al., 2005, Expert. Opin. Ther. Targets, 9 (6):
1179-1187). Furthermore, increasing evidence suggests that EphA2 is
involved in tumor angiogenesis (Ogawa et al., 2000, Oncogene, 19:
6043-6052; Cheng et al. 2002, Mol. Cancer Res., 1: 2-11; Cheng et
al., 2003, Neoplasia, 5 (5): 445-456; Dobrzanski et al., 2004,
Cancer Res., 64: 910-919).
[0006] Phosphorylation of EphA2 has been shown to be linked to its
abundance. Tyrosine phosphorylated EphA2 is rapidly internalised
and fated for degradation, whereas unphosphorylated EphA2
demonstrates reduced turnover and therefore accumulates at the cell
surface. It is currently thought that this kind of model might
contribute to the high frequency of EphA2 overexpression in cancer
(Landen, C. N. et al., 2005, Expert. Opin. Ther. Targets, 9 (6):
1179-1187). However, reality may be more complex, since recent data
seem to indicate a role for EphA2 kinase-dependent and -independent
functions in tumor progression (Fang W. B., 2005, Oncogene, 24:
7859-7868).
[0007] Agonistic antibodies have been developped which promote
EphA2 tyrosine phosphorylation and internalisation, ultimately
resulting in inhibition of tumor cell growth (Dodge-Zantek et al.,
1999, Cell Growth & Differ., 10: 629-638; WO 01/12172, WO
03/094859, WO 2004/014292, WO 2004/101764, WO 2006/023403, WO
2006/047637, WO 2007/030642). These antibodies are directed against
the extracellular domain of EphA2. Since these agonist antibodies
do not inhibit but rather stimulate EphA2 receptor phosphorylation
and downstream signals, these antibodies might not be effective for
tumors which take advantage of the EphA2 kinase activity. On the
other hand, the use of antagonistic agents, including antibodies,
has been proposed (WO 2004/092343), but no actual antagonistic
antibody was disclosed therein. Moreover, such antibodies were
proposed to stimulate, rather than inhibit, cell proliferation.
Application WO 2006/084226 discloses antibodies which neither
increase nor decrease EphA2 kinase activity but are capable of
impeding tumor cell proliferation. However, there is no indication
therein that these antibodies prevent ephrinA1 binding to the
receptor and inhibit ephrinA1-induced EphA2 phosphorylation.
Rather, they may affect tumor cell proliferation through a totally
different mechanism, e.g. by preventing receptor clustering
following ephrinA1 binding. The skilled person would thus not have
concluded that these antibodies are antagonists, but, rather, that
their mechanism of action is unclear.
[0008] Therefore, there is a need for new, antagonistic anti-EphA2
antibodies, which bind to the extracellular domains of EphA2
receptor, inhibit its activation by the ligand ephrin A1 and
inhibit EphA2 kinase-dependend tumor cell growth. Such antagonistic
antibodies should be useful for the treatment of cancer.
SUMMARY OF THE INVENTION
[0009] Accordingly, it is an object of the invention to provide
agents that specifically bind to class A Eph receptor family
members, such as EphA2, and inhibit the cellular activity of the
receptor by antagonizing the receptor. Thus, the present invention
includes antibodies or fragments thereof that recognize the EphA2
receptor, preferably human, and function as antagonists of said
receptor.
[0010] The EphA2 receptor has a role in the development and the
growth of tumors, and has also been involved in metastasis. In some
embodiments, the antibodies of the invention are capable of
inhibiting the growth of a cancer cell. In some other embodiments,
the antibodies of the invention are capable of preventing the
migration of metastatic cancer cells. In preferred embodiments, the
cancer cell is a cell of a cancer selected from the group
consisting of a breast cancer, colon cancer, endometrial cancer,
ovarian carcinoma, osteosarcoma, cervical cancer, prostate cancer,
lung cancer, synovial carcinoma pancreatic cancer, a sarcoma, a
glioma, head and neck cancer, gastric cancer, liver cancer, and
other carcinomas. In another embodiment, the antibodies of the
invention are capable of inhibiting angiogenesis.
[0011] Whereas the anti-EphA2 antibodies disclosed in the prior art
were mostly agonists (e.g. WO 03/094859, WO 2004/014292, WO
2004/101764, WO 2006/023403, WO 2006/047637, WO 2007/030642), this
invention encompasses antibodies recognizing said receptor wich
have minimal agonistic activity, or, preferentially, which are
devoid of any agonist activity towards the receptor. In a preferred
embodiment, the antibodies of the invention do not stimulate EphA2
tyrosine phosphorylation.
[0012] The antibodies of the invention are capable of inhibiting
the binding of a ligand, preferably ephrin A1, to the EphA2
receptor. In some embodiments, they are capable of inhibiting EphA2
tyrosine phosphorylation. In another embodiment, EphA2 tyrosine
phosphorylation is inhibited by the antibodies of the invention
even in the presence of ephrinA1. In some embodiments, antibodies
of the invention can block EphA2-mediated signaling; in particular,
they are capable of inhibiting EphA2-dependent phosphorylation of
Akt.
[0013] This invention also provides antibodies which bind the EphA2
receptor with a K.sub.D of 0.3.times.10.sup.-9 M or smaller.
[0014] Antibodies of the invention can be polyclonal or monoclonal.
Epitope-binding fragments such as Fab, Fab', F(ab').sub.2, or Fv
fragments are included within the scope of this invention.
Preferred are monoclonal anti-EphA2 antibodies. In a more preferred
embodiment, there are provided murine antibodies selected from
37.3D7; 37.1F5; 53.2H11; EphA2-N1; and EphA2-N2, which are fully
characterized herein with respect to the amino acid sequences of
both their light and heavy chain variable regions, the cDNA
sequences of the genes for the light and heavy chain variable
regions, the identification of their CDRs
(complementarity-determining regions), the identification of their
surface amino acids, and means for their expression in recombinant
form. The hybridoma producing murine anti-EphA2 monoclonal
antibodies 37.3D7, 37.1F5, and 53.2H11, and EphA2-N1 and EphA2-N2
have been deposited under the Budapest Treaty on Jun. 16, 2006 and
on May 3, 2007, respectively, at the American Type Culture
Collection, 10801 University Boulevard, Manassas, Va. 20110-2209,
USA, under the accession numbers PTA-7660, PTA-7661, PTA-7662,
PTA-8407, and PTA-8408, respectively.
[0015] The present invention includes the murine anti-EphA2
monoclonal antibody selected from 37.3D7, 37.1F5, 53.2H11,
EphA2-N1, and EphA2-N2, and resurfaced or humanized versions of the
37.3D7, 37.1F5, 53.2H11, EphA2-N1, and EphA2-N2 antibodies wherein
surface-exposed residues of the variable region frameworks of the
antibodies, or their epitope-binding fragments, are replaced in
both light and heavy chains to more closely resemble known human
antibody surfaces. The humanized antibodies and epitope-binding
fragments thereof of the present invention have improved properties
in that they are less immunogenic (or completely non-immunogenic)
than murine versions in human subjects to which they are
administered. Thus, the different versions of humanized 37.3D7;
37.1F5; 53.2H11; EphA2-N1; and EphA2-N2 antibodies and
epitope-binding fragments thereof of the present invention
specifically recognize EphA2 receptor while not being immunogenic
to a human.
[0016] The humanized versions of the 37.3D7, 37.1F5, 53.2H11,
EphA2-N1, and EphA2-N2 antibodies of the present invention are
fully characterized herein with respect to their respective amino
acid sequences of both light and heavy chain variable regions, the
DNA sequences of the genes for the light and heavy chain variable
regions, the identification of the complementarity determining
regions (CDRs), the identification of their variable region
framework surface amino acid residues, and disclosure of a means
for their expression in recombinant form.
[0017] This invention also contemplates the use of conjugates
between cytotoxic conjugates comprising (1) a cell binding agent
that recognizes and binds the EphA receptor, such as, EphA2
receptor, and (2) a cytotoxic agent. In the cytotoxic conjugates,
the cell binding agent has a high affinity for the EphA receptor
(e.g., EphA2 receptor) and the cytotoxic agent has a high degree of
cytotoxicity for cells expressing the EphA receptor, such that the
cytotoxic conjugates of the present invention form effective
killing agents.
[0018] In a preferred embodiment, the cell binding agent is an
anti-EphA2 antibody (e.g., 37.3D7, 37.1F5, 53.2H11, EphA2-N1, or
EphA2-N2) or an epitope-binding fragment thereof, more preferably a
humanized anti-EphA2 antibody (e.g., 37.3D7, 37.1F5, 53.2H11,
EphA2-N1, or EphA2-N2) or an epitope-binding fragment thereof,
wherein a cytotoxic agent is covalently attached, directly or via a
cleavable or non-cleavable linker, to the antibody or
epitope-binding fragment thereof. In more preferred embodiments,
the cell binding agent is the humanized 37.3D7; 37.1F5; 53.2H11;
EphA2-N1; and EphA2-N2 antibodies or an epitope-binding fragment
thereof, and the cytotoxic agent is a taxol, a maytansinoid, a
tomaymycin derivative, a leptomycin derivative, CC-1065 or a
CC-1065 analog.
[0019] In preferred embodiments of the invention, the cell binding
agent is the humanized anti-EphA2 antibody 37.3D7, 37.1F5, 53.2H11,
EphA2-N1, or EphA2-N2 and the cytotoxic agent is a maytansine
compound, such as DM1 or DM4.
[0020] The present invention also encompasses the use of fragments
of anti-EphA2 antibodies which retain the ability to bind the EphA2
receptor. In another aspect of the invention, the use of functional
equivalents of anti-EphA2 antibodies is contemplated.
[0021] The present invention also includes a method for inhibiting
the growth of a cell expressing the EphA2 receptor. In preferred
embodiments, the method for inhibiting the growth of the cell
expressing the EphA2 receptor takes place in vivo and results in
the death of the cell, although in vitro and ex vivo applications
are also included.
[0022] The present invention also provides a therapeutic
composition comprising an anti-EphA2 antibody or an anti-EphA2
antibody-cytotoxic agent conjugate, and a pharmaceutically
acceptable carrier or excipients. In some embodiments, the
therapeutic composition comprises a second therapeutic agent. This
second therapeutic agent can be chosen from the group comprising
the antagonists of fibroblast-growth factor (FGF), hepatocyte
growth factor (HGF), tissue factor (TF), protein C, protein S,
platelet-derived growth factor (PDGF), or HER2 receptor.
[0023] The present invention further includes a method of treating
a subject having cancer using the therapeutic composition. In some
embodiments, the cancer is a metastatic cancer. In particular, the
cancer cell is a cell of a cancer selected from the group
consisting of breast cancer, colon cancer, endometrial cancer,
ovarian carcinoma, osteosarcoma, cervical cancer, prostate cancer,
lung cancer, synovial carcinoma pancreatic cancer, a sarcoma, a
glioma, head and neck cancer, gastric cancer, liver cancer, and
other carcinomas. In preferred embodiments, the cytotoxic conjugate
comprises an anti-EphA2 antibody and a cytotoxic agent. In more
preferred embodiments, the cytotoxic conjugate comprises a
humanized 37.3D7, 37.1F5, 53.2H11, EphA2-N1, and EphA2-N2
antibody-DM1 conjugate, humanized 37.3D7, 37.1F5, 53.2H11,
EphA2-N1, and EphA2-N2 antibody-DM4, a humanized 37.3D7, 37.1F5,
53.2H11, EphA2-N1, and EphA2-N2 antibody-taxane conjugate, or a
humanized 37.3D7, 37.1F5, 53.2H11, EphA2-N1, and EphA2-N2
antibody-tomaymycin derivative conjugate, and the conjugate is
administered along with a pharmaceutically acceptable carrier or
excipients.
[0024] In another aspect of the invention, anti-EphA2 antibodies
are used to detect the EphA2 protein in a biological sample. In a
preferred embodiment, said antibodies are used to determine EphA2
levels in a tumor tissue.
[0025] The present invention also includes a kit comprising an
anti-EphA2 antibody or an anti-EphA2 antibody-cytotoxic agent
conjugate and instructions for use. In preferred embodiments, the
anti-EphA2 antibodies are the humanized 37.3D7, 37.1F5, 53.2H11,
EphA2-N1, and EphA2-N2 antibodies, the cytotoxic agent is a
maytansine compound, such as DM1 or DM4, a taxane, a leptomycin
derivative, or a tomaymycin derivative, and the instructions are
for using the conjugates in the treatment of a subject having
cancer. The kit may also include components necessary for the
preparation of a pharmaceutically acceptable formulation, such as a
diluent if the conjugate is in a lyophilized state or concentrated
form, and for the administration of the formulation.
[0026] Unless otherwise stated, all references and patents cited
herein are incorporated by reference.
BRIEF DESCRIPTION OF THE FIGURES
[0027] FIGS. 1A-1C show the analysis of the specific binding of
anti-EphA2 antibodies to cells overexpressing human EphA2
(300-19/hu-EphA2 cells) by FACS analysis. FIG. 1A shows the data
for the 37.3D7 antibody, FIG. 1B for the 37.1F5 antibody, and FIG.
1C for the 53.2H11 antibody, respectively.
[0028] FIG. 2 shows the specific binding of purified 37.3D7
antibody to BxPC3 human pancreatic cancer cells, MDA-MB-231 human
breast cancer cells, and HT-29 human colon cancer cells. Histograms
of FACS analysis are shown.
[0029] FIGS. 3A-3C show binding curves for the antibodies 37.3D7
(FIG. 3A), 37.1F5 (FIG. 3B), and 53.2H11 (FIG. 3C) established with
human EphA2 overexpressing murine 300-19 cells
(300-19/hu-EphA2).
[0030] FIG. 4 shows the specific binding of purified 37.3D7 and
53.2H11 antibodies to cells overexpressing EphA2. Histograms of
FACS analysis are shown. FIG. 4A shows the data for cells
overexpressing murine EphA2 (300-19/mu-EphA2) and FIG. 4B shows the
data for cells overexpressing rat EphA2 (300-19/rat-EphA2).
[0031] FIG. 5A shows the specific binding of purified 37.3D7,
37.1F5, and 53.2H11 antibodies to VERO monkey kidney epithelial
cells. Histograms of FACS analysis are shown.
[0032] FIG. 5B shows the binding curves for the antibodies 37.3D7,
37.1F5, and 53.2H11 established with VERO monkey kidney epithelial
cells.
[0033] FIG. 6 shows the inhibition of the binding of biotinylated
ephrinA1 to mammary MDA-MB-231 human breast cancer cells by 37.3D7,
37.1F5, and 53.2H11 antibodies.
[0034] FIG. 7A shows the inhibition of ephrinA1-stimulated
EphA2-phosphorylation in mammary MDA-MB-231 cells by 37.3D7 and
37.1F5 antibodies.
[0035] FIG. 7B shows the inhibition of ephrinA1-stimulated
EphA2-phosphorylation in mammary MDA-MB-231 cells by 37.3D7 and
53.2H11 antibodies.
[0036] FIG. 7C shows the inhibition of ephrinA1-stimulated Akt
phosphorylation in pancreatic CFPAC-1 cells by 37.3D7 and 37.1F5
antibodies.
[0037] FIGS. 8A and B show the stimulation of EphA2-phosphorylation
by ephrinA1 and the absence of stimulation of EphA2-phosphorylation
by the antibodies 37.3D7, 37.1F5, and 53.2H11 in mammary MDA-MB-231
cells.
[0038] FIGS. 9A-9D show the inhibition of serum-stimulated growth
and survival of colon HT-29 cells (9A), colon LoVo cells (9B),
pancreatic CFPAC-1 cells (9C) and melanoma UACC-257 cells (9D) by
37.3D7 and 53.2H11 antibodies.
[0039] FIG. 10A shows the dose-dependent inhibition of
serum-stimulated growth of pancreatic BxPC3 cells by 37.3D7
antibody.
[0040] FIG. 10B shows the dose-dependent inhibition of
serum-stimulated growth of colon LoVo cells by the 53.2H11
antibody.
[0041] FIG. 10C shows the dose-dependent inhibition of
EGF-stimulated growth of colon LoVo cells by 53.2H11 antibody.
[0042] FIG. 11A shows the binding curve of 37.3D7 antibody to HUVEC
cells.
[0043] FIG. 11B shows the binding curve of 37.1F5 antibody to HUVEC
cells.
[0044] FIG. 12 shows the inhibition of VEGF-stimulated HUVEC cell
growth and survival by 37.3D7 antibody.
[0045] FIG. 13 shows the inhibition of VEGF-induced Akt
phosphorylation by 37.3D7 antibody in HUVEC cells.
[0046] FIG. 14 shows the effect of the treatment with 37.3D7
antibody on the growth of HT-29 colon cancer xenograft in mice. The
effect is compared with that of an anti-EGFR antibody and a
non-binding control IgG1 antibody.
[0047] FIG. 15A shows the inhibition of the growth of PC3 prostate
tumor cells by hu37.3D7-SPDB-DM4.
[0048] FIG. 15B shows the inhibition of the growth of PC3 prostate
tumor cells by hu53.2H11-SPDB-DM4.
[0049] FIG. 16A shows the effect of the treatment with
hu37.3D7-SPDB-DM4 on the growth of MDA-MB-231 breast tumor
xenograft in mice.
[0050] FIG. 16B shows the effect of the treatment with
hu53.2H11-SPDB-DM4 on the growth of MDA-MB-231 breast tumor
xenograft in mice.
DETAILED DESCRIPTION OF THE INVENTION
[0051] New agents capable to specifically bind EphA receptors and
antagonize said receptors are herein provided. In particular, the
present inventors have discovered novel antibodies that
specifically bind to EphA receptors on the cell surface. While
previously known antibodies which specifically bind the EphA
receptor also activate it even in the absence of its ligands, the
antibodies or fragments of the present invention are preferentially
devoid of any agonist activity. On the other hand, they have the
unique ability to inhibit the cellular functions of the receptor
even in the presence of its ligands, a characteristic which is
totally absent from the previously known EphA2-binding antibodies.
Furthermore, the antagonistic antibodies and antibody fragments of
the present invention inhibit the growth and/or the migration of
human tumor cells, and/or angiogenesis, three properties totally
unanticipated in view of the prior art (Landen, C. N. et al., 2005,
Expert. Opin. Ther. Targets, 9 (6): 1179-1187; WO 01/12172; WO
2004/014292; WO 2004/092343).
[0052] As used herein, the term "Eph receptor" refers to a tyrosine
kinase belonging to the Eph receptors family (reviewed in Pasquale,
E. B. et al., 2005, Nature Reviews Mol. Cell Biol., 6, 462-475).
"Class A Eph receptor family" or "EphA receptors" as used herein
preferentially interact with glycosylphosphatidylinositol
(GPI)-linked ligands (of the Ephrin-A subclass, which presently
comprises five ligands). Specific EphA receptors include: EphA1
(also called Eph and Esk); EphA2 (also called Eck, mEck, Myk2,
Sek2); EphA3 (also termed Hek, Mek4, Tyro4 and Cek4); EphA4 (also
known as Hek8, Sek1, Tyrol, and Cek8); EphA5 (also called Hek7,
Bsk, Ehk1, Rek7 and Cek7); EphA6 (also called mEhk2 and Ehk2);
EphA7 (otherwise named Hek11, Mdk1, Ebk, Ehk3); and EphA8 (also
termed Eek and mEek) and naturally occurring variants thereof. The
preferred Eph receptor herein is the "EphA2 receptor", comprising,
for example, an amino sequence as in Genbank accession Nos
NM.sub.--004431 (human EphA2), NM.sub.--010139 (murine EphA2), or
NXM.sub.--345596 (rat EphA2). The term "Eph ligand" as used herein
refers to a protein that binds to, and optionally activates (e.g.
stimulates the autophosphorylation of), an Eph receptor. A
preferred Eph ligand herein is "ephrinA1", which binds to the EphA2
receptor and comprises, for example, an amino sequence as in
Genbank accession NM.sub.--004428 (human ephrinA1).
[0053] The term "antagonist" as used herein refers to a molecule
which is capable of inhibiting one or more of the biological
activities of a target molecule, such as an EphA receptor.
Antagonists may act by interfering with the binding of a receptor
to a ligand and vice versa, by decreasing EphA2 phosphorylation,
and/or by incapacitating or killing cells which have been activated
by a ligand. The antagonist may completely block receptor-ligand
interactions or may substantially reduce such interactions. All
such points of intervention by an antagonist shall be considered
equivalent for purposes of this invention. Thus, included within
the scope of the invention are antagonists (e.g. neutralizing
antibodies) that bind to EphA receptor, Eph ligand or a complex of
an Eph receptor and Eph ligand; amino acid sequence variants or
derivatives of an EphA receptor or EphA ligand which antagonize the
interaction between an EphA receptor and EphA ligand; soluble EphA
receptor or soluble EphA ligand, optionally fused to a heterologous
molecule such as an immunoglobulin region (e.g. an immunoadhesin);
a complex comprising an EphA receptor in association with EphA
ligand; synthetic or native sequence peptides which bind to EphA
receptor or EphA ligand.
[0054] The term "agonist" as used herein refers to any compound,
including a protein, a polypeptide, a peptide, an antibody, an
antibody fragment, a conjugate, a large molecule, a small molecule,
capable of activating one or more of the biological activities of
the target molecule. EphA agonists act by stimulating
phosphorylation of the protein, thereby triggering degradation of
said protein.
[0055] Thus in a preferred embodiment the present invention
provides, among other features, anti-EphA monoclonal antibodies,
anti-EphA humanized antibodies, and fragments of the anti-EphA
antibodies. Each of the antibodies and antibody fragments of the
present invention is designed to specifically recognize and bind
the EphA2 receptor, and acts as an EphA2 receptor antagonist.
Moreover, the antagonistic antibodies and antibody fragments of the
invention have the unique properties of being able to inhibit the
growth of human tumor cells, and/or the migration of metastatic
cancer cells, and/or angiogenesis.
[0056] A preferred EphA receptor bound by the antagonistic
antibodies and antibody fragments of the invention is the EphA2
receptor. Human EphA2 is a preferred EphA2 receptor.
[0057] The EphA2 receptor belongs to a family of receptor whose
cytoplasmic tail phosphorylation is increased after ligand binding
to interact with a variety of adapter and signalling proteins,
leading to the activation of different downstream cellular
signalling pathways (Kullander, K. and Klein, R., 2002, Nature
Reviews Mol. Cell Biol., 3: 475-486; Noren, N. K. and Pasquale, E.
B., 2004, Cell signal., 16: 655-666). As used herein, the term
"EphA2-mediated signaling" refers to all the cellular events which
occur in response to ligand binding by EphA2. Whereas antibodies
disclosed in the prior art agonize the EphA2 receptor, and, in
particular, increase the tyrosine phosphorylation of the EphA2
protein, the antibodies and antibody fragments of the invention are
preferentially devoid of any such agonistic properties. In
particular, they are unable to stimulate EphA2 phoshorylation by
themselves.
[0058] On the other hand, this invention provides the first actual
antagonistic anti-EphA2 antibodies. In one embodiment, the
antibodies and antibody fragments of the invention can inhibit the
binding of a ligand to an EphA receptor. In a preferred embodiment,
the binding of ephrinA1 to EphA2 is prevented by the antibodies and
fragments thereof provided by this invention. Remarkably, in
another embodiment, the antibodies and antibody fragments of the
invention are capable of inhibiting tyrosine phosphorylation of the
EphA2 receptor, even in the presence of ephrinA1. Moreover, said
antibodies and fragments thereof are capable of inhibiting
EphA2-mediated signaling. In particular, Akt ephrinA1-dependent
phosphorylation can be prevented by the antibodies and antibody
fragments of the invention.
[0059] Antibodies
[0060] The term "antibody" is used herein in the broadest sense and
specifically covers monoclonal antibodies (including full length
monoclonal antibodies) of any isotype such as IgG, IgM, IgA, IgD,
and IgE, polyclonal antibodies, multispecific antibodies, chimeric
antibodies, and antibody fragments. An antibody reactive with a
specific antigen can be generated by recombinant methods such as
selection of libraries of recombinant antibodies in phage or
similar vectors, or by immunizing an animal with the antigen or an
antigen-encoding nucleic acid.
[0061] A typical antibody is comprised of two identical heavy
chains and two identical light chains that are joined by disulfide
bonds. Each heavy and light chain contains a constant region and a
variable region. Each variable region contains three segments
called "complementarity-determining regions" ("CDRs") or
"hypervariable regions", which are primarily responsible for
binding an epitope of an antigen. They are usually referred to as
CDR1, CDR2, and CDR3, numbered sequentially from the N-terminus.
The more highly conserved portions of the variable regions are
called the "framework regions".
[0062] As used herein, "V.sub.H" or "VH" refers to the variable
region of an immunoglobulin heavy chain of an antibody, including
the heavy chain of an Fv, scFv, dsFv, Fab, Fab', or F(ab')2
fragment. Reference to "V.sub.L" or "VL" refers to the variable
region of the immunoglobulin light chain of an antibody, including
the light chain of an Fv, scFv, dsFv, Fab, Fab', or F(ab')2
fragment.
[0063] A "polyclonal antibody" is an antibody which was produced
among or in the presence of one or more other, non-identical
antibodies. In general, polyclonal antibodies are produced from a
B-lymphocyte in the presence of several other B-lymphocytes
producing non-identical antibodies. Usually, polyclonal antibodies
are obtained directly from an immunized animal.
[0064] A "monoclonal antibody", as used herein, is an antibody
obtained from a population of substantially homogeneous antibodies,
i.e. the antibodies forming this population are essentially
identical except for possible naturally occurring mutations which
might be present in minor amounts. These antibodies are directed
against a single epitope and are therefore highly specific.
[0065] An "epitope" is the site on the antigen to which an antibody
binds. It can be formed by contiguous residues or by non-contiguous
residues brought into close proximity by the folding of an
antigenic protein. Epitopes formed by contiguous amino acids are
typically retained on exposure to denaturing solvents, whereas
epitopes formed by non-contiguous amino acids are typically lost
under said exposure.
[0066] As used herein, the term "K.sub.D" refers to the
dissociation constant of a particular antibody/antigen
interaction.
[0067] The present invention proceeds from murine anti-EphA2
antibodies, herein 37.3D7; 37.1F5; 53.2H11; EphA2-N1; and EphA2-N2
which are fully characterized with respect to the amino acid
sequences of both light and heavy chains, the identification of the
CDRs, the identification of surface amino acids, and means for
their expression in recombinant form. The primary amino acid and
DNA sequences of antibodies 37.3D7; 37.1F5; 53.2H11; EphA2-N1; and
EphA2-N2 light and heavy chains, and of humanized versions, are
disclosed herein.
[0068] Antibodies 37.3D7, 37.1F5, 53.2H11, EphA2-N1, and EphA2-N2
are produced by hybridomas respectively designated 37.3D7, 37.1F5,
53.2H11, EphA2-N1, and EphA2-N2, and deposited under the Budapest
Treaty on Jun. 16, 2006 and May 3, 2007, respectively, at the
American Type Culture Collection, 10801 University Boulevard,
Manassas, Va. 20110-2209, USA, under the accession numbers
PTA-7660, PTA-7661 PTA-7662, PTA-8407 and PTA-8408,
respectively.
[0069] The scope of the present invention is not limited to
antibodies and fragments comprising these sequences. Instead, all
antibodies and fragments that specifically bind to EphA2 receptor
and antagonize the biological activity of the receptor, but which
are devoid of agonist activity, fall within the scope of the
present invention. Thus, antibodies and antibody fragments may
differ from antibody 37.3D7; 37.1F5; 53.2H11; EphA2-N1; and
EphA2-N2 or the humanized derivatives in the amino acid sequences
of their scaffold, CDRs, light chain and heavy chain, and still
fall within the scope of the present invention.
[0070] In one embodiment, this invention provides antibodies or
epitope-binding fragment thereof comprising one or more CDRs having
an amino acid sequence selected from the group consisting of SEQ ID
NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, and 72.
[0071] In a preferred embodiment, the antibodies of the invention
comprise at least one heavy chain and at least one light chain, and
said heavy chain comprises three sequential CDRs having amino acid
sequences selected from the group consisting of SEQ ID NOS: 1, 2,
3, 7, 8, 9, 13, 14, 15, 61, 62, 63, 67, 68, and 69, and said light
chain comprises three sequential CDRs having amino acid sequences
selected from the group consisting of SEQ ID NOS: 4, 5, 6, 10, 11,
12, 16, 17, 18, 64, 65, 66, 70, 71, and 72.
[0072] In a more preferred embodiment, the antibodies of the
invention comprise three CDRS having amino acid sequences selected
from the group of SEQ ID NOS: 1, 2, 3, 4, 5, and 6. In a further
more preferred embodiment, there is provided a 37.3D7 antibody,
which comprises at least one heavy chain and at least one light
chain, and said heavy chain comprises three sequential CDRs having
amino acid sequences consisting of SEQ ID NOS: 1, 2, and 3, and
said light chain comprises three sequential CDRs having amino acid
sequences consisting of SEQ ID NOS: 4, 5, and 6.
[0073] In another more preferred embodiment, the antibodies of the
invention comprise three CDRS having amino acid sequences selected
from the group of SEQ ID NOS: 7, 8, 9, 10, 11, and 12. In further
more preferred embodiment, there is provided a 37.1F5 antibody,
which comprises at least one heavy chain and at least one light
chain, and said heavy chain comprises three sequential CDRs having
amino acid sequences consisting of SEQ ID NOS: 7, 8, and 9, and
said light chain comprises three sequential CDRs having amino acid
sequences consisting of SEQ ID NOS: 10, 11, and 12.
[0074] In another more preferred embodiment, the antibodies of the
invention comprise three CDRS having amino acid sequences selected
from the group of SEQ ID NOS: 13, 14, 15, 16, 17, and 18. In a
further more preferred embodiment, there is provided a 53.2H11,
which comprises at least one heavy chain and at least one light
chain, and said heavy chain comprises three sequential CDRs having
amino acid sequences consisting of SEQ ID NOS: 13, 14, and 15, and
said light chain comprises three sequential CDRs having amino acid
sequences consisting of SEQ ID NOS: 16, 17, and 18.
[0075] In another more preferred embodiment, the antibodies of the
invention comprise three CDRS having amino acid sequences selected
from the group of SEQ ID NOS: 61, 62, 63, 64, 65, and 66. In a
further more preferred embodiment, there is provided a EphA2-N1
antibody, which comprises at least one heavy chain and at least one
light chain, and said heavy chain comprises three sequential CDRs
having amino acid sequences consisting of SEQ ID NOS: 61, 62, and
63, and said light chain comprises three sequential CDRs having
amino acid sequences consisting of SEQ ID NOS: 64, 65, and 66.
[0076] In another more preferred embodiment, the antibodies of the
invention comprise three CDRS having amino acid sequences selected
from the group of SEQ ID NOS: 67, 68, 69, 70, 71, and 72. In a
further more preferred embodiment, there is provided a EphA2-N2
antibody, which comprises at least one heavy chain and at least one
light chain, and said heavy chain comprises three sequential CDRs
having amino acid sequences consisting of SEQ ID NOS: 67, 68, and
69, and said light chain comprises three sequential CDRs having
amino acid sequences consisting of SEQ ID NOS: 70, 71, and 72.
[0077] In another embodiment, the antibodies of the invention
comprises a V.sub.H having an amino acid sequence selected from the
group consisting of SEQ ID NOS: 20, 22, 24, 74 and 76. In a
preferred embodiment, there is provided a 37.3D7 antibody
comprising a V.sub.H having an amino acid sequence consisting of
SEQ ID NO 20. In another preferred embodiment, there is provided a
37.1F5 antibody comprising a V.sub.H having an amino acid sequence
consisting of SEQ ID NO 22. In another preferred embodiment, there
is provided a 53.2H11 antibody comprising a V.sub.H having an amino
acid sequence consisting of SEQ ID NO 24. In another preferred
embodiment, there is provided a EphA2-N1 antibody comprising a
V.sub.H having an amino acid sequence consisting of SEQ ID NO 74.
In another preferred embodiment, there is provided a EphA2-N2
antibody comprising a V.sub.H having an amino acid sequence
consisting of SEQ ID NO 76.
[0078] In another preferred embodiment, the antibodies of the
invention comprise a V.sub.L having an amino acid sequence selected
from the group consisting of SEQ ID NOS: 26, 28, 30, 78 and 80. In
a preferred embodiment, there is provided a 37.3D7 antibody
comprising a V.sub.L having an amino acid sequence consisting of
SEQ ID NO 26. In another preferred embodiment, there is provided a
37.1F5 antibody comprising a V.sub.L having an amino acid sequence
consisting of SEQ ID NO 28. In another preferred embodiment, there
is provided a 53.2H11 antibody comprising a V.sub.L having an amino
acid sequence consisting of SEQ ID NO 30. In another preferred
embodiment, there is provided a EphA2-N1 antibody comprising a
V.sub.L having an amino acid sequence consisting of SEQ ID NO 78.
In another preferred embodiment, there is provided a EphA2-N2
antibody comprising a V.sub.L having an amino acid sequence
consisting of SEQ ID NO 80.
[0079] Humanized or Resurfaced 37.3D7, 37.1F5; 53.2H11; EphA2-N1;
and EphA2-N2 Antibodies
[0080] As used herein, the term "humanized antibody" refers to a
chimeric antibody which contain minimal sequence derived from
non-human immunoglobulin. A "chimeric antibody", as used herein, is
an antibody in which the constant region, or a portion thereof, is
altered, replaced, or exchanged, so that the variable region is
linked to a constant region of a different species, or belonging to
another antibody class or subclass. "Chimeric antibody" also refers
to to an antibody in which the variable region, or a portion
thereof, is altered, replaced, or exchanged, so that the constant
region is linked to a variable region of a different species, or
belonging to another antibody class or subclass.
[0081] The goal of humanization is a reduction in the
immunogenicity of a xenogenic antibody, such as a murine antibody,
for introduction into a human, while maintaining the full antigen
binding affinity and specificity of the antibody. Humanized
antibodies, or antibodies adapted for non-rejection by other
mammals, may be produced using several technologies such as
resurfacing and CDR grafting. As used herein, the resurfacing
technology uses a combination of molecular modeling, statistical
analysis and mutagenesis to alter the non-CDR surfaces of antibody
variable regions to resemble the surfaces of known antibodies of
the target host.
[0082] Strategies and methods for the resurfacing of antibodies,
and other methods for reducing immunogenicity of antibodies within
a different host, are disclosed in U.S. Pat. No. 5,639,641, which
is hereby incorporated in its entirety by reference. Briefly, in a
preferred method, (1) position alignments of a pool of antibody
heavy and light chain variable regions is generated to give a set
of heavy and light chain variable region framework surface exposed
positions wherein the alignment positions for all variable regions
are at least about 98% identical; (2) a set of heavy and light
chain variable region framework surface exposed amino acid residues
is defined for a rodent antibody (or fragment thereof); (3) a set
of heavy and light chain variable region framework surface exposed
amino acid residues that is most closely identical to the set of
rodent surface exposed amino acid residues is identified; (4) the
set of heavy and light chain variable region framework surface
exposed amino acid residues defined in step (2) is substituted with
the set of heavy and light chain variable region framework surface
exposed amino acid residues identified in step (3), except for
those amino acid residues that are within 5 .ANG. of any atom of
any residue of the complementarity-determining regions of the
rodent antibody; and (5) the humanized rodent antibody having
binding specificity is produced.
[0083] Antibodies can be humanized using a variety of other
techniques including CDR-grafting (EP 0 239 400; WO 91/09967; U.S.
Pat. Nos. 5,530,101; and 5,585,089), veneering or resurfacing (EP 0
592 106; EP 0 519 596; Padlan E. A., 1991, Molecular Immunology
28(4/5): 489-498; Studnicka G. M. et al., 1994, Protein Engineering
7(6): 805-814; Roguska M. A. et al., 1994, Proc. Natl. Acad. Sci.
U.S.A., 91:969-973), and chain shuffling (U.S. Pat. No. 5,565,332).
Human antibodies can be made by a variety of methods known in the
art including phage display methods. See also U.S. Pat. Nos.
4,444,887, 4,716,111, 5,545,806, and 5,814,318; and international
patent application publication numbers WO 98/46645, WO 98/50433, WO
98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741
(said references incorporated by reference in their
entireties).
[0084] The present invention provides humanized antibodies or
fragments thereof, which recognizes EphA2 receptor and acts as
antagonists. In another embodiment, the humanized antibodies or
epitope-binding fragments thereof have the additional ability to
inhibit growth of a cancer cell expressing the EphA2 receptor. In a
further embodiment, the humanized antibody or epitope-binding
thereof have the additional ability to inhibit the migration of a
metastatic cancer cell expressing the EphA2 receptor.
[0085] A preferred embodiment of such a humanized antibody is a
humanized 37.3D7, 37.1F5; 53.2H11; EphA2-N1 or EphA2-N2 antibody,
or an epitope-binding fragment thereof.
[0086] In more preferred embodiments, there are provided resurfaced
or humanized versions of the 37.3D7, 37.1F5; 53.2H11; EphA2-N1 and
EphA2-N2 antibodies wherein surface-exposed residues of the
antibody or its fragments are replaced in both light and heavy
chains to more closely resemble known human antibody surfaces. The
humanized 37.3D7, 37.1F5; 53.2H11; EphA2-N1 and EphA2-N2 antibodies
or epitope-binding fragments thereof of the present invention have
improved properties. For example, humanized 37.3D7, 37.1F5; and
53.2H11 antibodies or epitope-binding fragments thereof
specifically recognize EphA2 receptor. More preferably, the
humanized 37.3D7, 37.1F5, 53.2H11, EphA2-N1, and EphA2-N2
antibodies or epitope-binding fragments thereof have the additional
ability to inhibit growth of a cell expressing the EphA2
receptor.
[0087] The humanized versions of the 37.3D7, 37.1F5, 53.2H11,
EphA2-N1, and EphA2-N2 antibodies are also fully characterized
herein with respect to their respective amino acid sequences of
both light and heavy chain variable regions, the DNA sequences of
the genes for the light and heavy chain variable regions, the
identification of the CDRs, the identification of their surface
amino acids, and disclosure of a means for their expression in
recombinant form. However, the scope of the present invention is
not limited to antibodies and fragments comprising these sequences.
Instead, all antibodies and fragments that specifically bind to
EphA2 receptor are included in the present invention. Preferably,
the antibodies and fragments that specifically bind to EphA2
receptor antagonize the biological activity of the receptor. More
preferably, such antibodies further are substantially devoid of
agonist activity. Thus, antibodies and epitope-binding antibody
fragments of the present invention may differ from the 37.3D7,
37.1F5, 53.2H11, EphA2-N1 or EphA2-N2 antibody or the humanized
derivatives thereof, in the amino acid sequences of their scaffold,
CDRs, and/or light chain and heavy chain, and still fall within the
scope of the present invention.
[0088] The CDRs of the 37.3D7, 37.1F5, 53.2H11, EphA2-N1 or
EphA2-N2 antibodies are identified by modeling and their molecular
structures have been predicted. Again, while the CDRs are important
for epitope recognition, they are not essential to the antibodies
and fragments of the invention. Accordingly, antibodies and
fragments are provided that have improved properties produced by,
for example, affinity maturation of an antibody of the present
invention.
[0089] The mouse light chain IgV.kappa. and J.kappa. germline genes
and heavy chain IgVh and Jh germline genes from which 37.3D7,
37.1F5, 53.2H11, EphA2-N1, and EphA2-N2 were likely derived have
been identified, as disclosed in the experimental Examples section.
Such germline gene sequences are useful to identify somatic
mutations in the antibodies, including in the CDRs.
[0090] The sequences of the heavy chain and light chain variable
regions of the 37.3D7, 37.1F5, 53.2H11, EphA2-N1, and EphA2-N2
antibodies, and the sequences of their CDRs were not previously
known and are set forth in this application. Such information can
be used to produce humanized versions of the 37.3D7, 37.1F5,
53.2H11, EphA2-N1, and EphA2-N2 antibodies. These humanized
anti-EphA antibodies or their derivatives may also be used as the
cell binding agent of the present invention.
[0091] Thus, in one embodiment, this invention provides humanized
antibodies or epitope-binding fragment thereof comprising one or
more CDRs having an amino acid sequence selected from the group
consisting of SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
and 72. In a preferred embodiment, the humanized antibodies of the
invention comprise at least one heavy chain and at least one light
chain, and said heavy chain comprises three sequential CDRs having
amino acid sequences selected from the group consisting of SEQ ID
NOS: 1, 2, 3, 7, 8, 9, 13, 14, 15, 61, 62, 63, 67, 68, and 69, and
said light chain comprises three sequential CDRs having amino acid
sequences selected from the group consisting of SEQ ID NOS: 4, 5,
6, 10, 11, 12, 16, 17, 18, 64, 65, 66, 70, 71, and 72. In a further
preferred embodiment, the humanized antibodies of the invention
comprise at least one heavy chain and at least one light chain,
wherein said heavy chain comprises three sequential CDRs having
amino acid sequences represented by SEQ ID NOS: 1, 2, and 3, and
wherein said light chain comprises three sequential CDRs having
amino acid sequences represented by SEQ ID NOS: 4, 5, and 6. In
another further preferred embodiment, the humanized antibodies of
the invention comprise at least one heavy chain and at least one
light chain, wherein said heavy chain comprises three sequential
CDRs having amino acid sequences represented by SEQ ID NOS: 7, 8,
and 9, and wherein said light chain comprises three sequential CDRs
having amino acid sequences represented by SEQ ID NOS: 10, 11, and
12. In another further preferred embodiment, the humanized
antibodies of the invention comprise at least one heavy chain and
at least one light chain, wherein said heavy chain comprises three
sequential CDRs having amino acid sequences represented by SEQ ID
NOS: 13, 14, and 15, and wherein said light chain comprises three
sequential CDRs having amino acid sequences represented by SEQ ID
NOS: 16, 17, and 18. In another more preferred embodiment, the
humanized antibodies of the invention comprise at least one heavy
chain and at least one light chain, wherein said heavy chain
comprises three sequential CDRs having amino acid sequences
consisting of SEQ ID NOS: 61, 62, and 63, and wherein said light
chain comprises three sequential CDRs having amino acid sequences
consisting of SEQ ID NOS: 64, 65, and 66. In another more preferred
embodiment, the humanized antibodies of the invention comprise at
least one heavy chain and at least one light chain, wherein said
heavy chain comprises three sequential CDRs having amino acid
sequences consisting of SEQ ID NOS: 67, 68, and 69, and wherein
said light chain comprises three sequential CDRs having amino acid
sequences consisting of SEQ ID NOS: 70, 71, and 72.
[0092] In one embodiment, this invention provides humanized
antibodies or fragments thereof which comprise a V.sub.H having an
amino acid sequence chosen from the group consisting of SEQ ID NOS:
32, 34, 36, 37, 38, 40, 42, 43, and 45. In a preferred embodiment,
a humanized 37.1 D7 antibody is provided which comprises a V.sub.H
having an amino acid sequence chosen from the group consisting of
SEQ ID NOS: 32, 34, and 36. In another preferred embodiment, a
humanized 37.1F5 antibody is provided which comprises a V.sub.H
having an amino acid sequence chosen from the group consisting of
SEQ ID NOS: 37 and 38. In another preferred embodiment, a humanized
53.2H11 antibody is provided which comprises a V.sub.H having an
amino acid sequence chosen from the group consisting of SEQ ID NOS:
40, 42, 43, and 45.
[0093] In another embodiment, this invention provides humanized
antibodies or fragments thereof which comprise a V.sub.L having an
amino acid sequence chosen from the group consisting of SEQ ID NOS:
47, 48, 49, 50, and 52. In a preferred embodiment, a humanized 37.1
D7 antibody is provided which comprises a V.sub.L having an amino
acid sequence consisting of SEQ ID NO 47. In another preferred
embodiment, a humanized 37.1F5 antibody is provided which comprises
a V.sub.L having an amino acid sequence chosen from the group
consisting of SEQ ID NOS: 48, 49, and 50. In another preferred
embodiment, a humanized 53.2H11 antibody is provided which
comprises a V.sub.L having an amino acid sequence consisting of SEQ
ID NO 52.
[0094] The humanized 37.3D7 antibodies and epitope-binding
fragments thereof of the present invention can also include
substitution in light and/or heavy chain amino acid residues at one
or more positions defined by the grey residues in Table 1A and 1B
which represent the murine surface framework residues that have
been changed from the original murine residue to the corresponding
framework surface residue in the human antibody, 28E4. The starred
(*) residues in Table 1B correspond to the murine back mutations in
the humanized 37.3D7 heavy chain variants (SEQ ID NO: 34 and SEQ ID
NO:36). The residues for back mutations are proximal to CDR's and
were chosen as described in U.S. Pat. No. 5,639,641 or in analogy
to the selection of residues that had in previous humanization
efforts resulted in a decrease in antigen binding affinity (Roguska
et al., 1996, Protein Eng.; 9(10): 895-904; U.S. patent application
publications 2003/0235582 and 2005/0118183).
[0095] Likewise, the humanized 37.1F5; 53.2H11; EphA2-N1; and
EphA2-N2 antibodies and epitope-binding fragments thereof of the
present invention can also include substitution in light and/or
heavy chain amino acid residues.
[0096] Polynucleotides, Vectors, and Host Cells
[0097] Nucleic acids encoding anti-EphA2 antibodies of the
invention are provided. In one embodiment, the nucleic acid
molecule encodes a heavy and/or a light chain of an anti-EphA2
immunoglobulin. In a preferred embodiment, a single nucleic acid
encodes a heavy chain of an anti-EphA2 immunoglobulin and another
nucleic acid molecule encodes the light chain of an anti-EphA2
immunoglobulin.
[0098] In another aspect of this invention, there are provided
polynucleotides encoding polypeptides having an amino acid sequence
selected from the group of SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 22, 24, 26, 28, 30, 32, 34,
36, 37, 38, 40, 42, 43, 45, 47, 48, 49, 50, 52, 61, 62, 63, 64, 65,
66, 67, 68, 69, 70, 71, 72, 74, 76, 78 and 80. In a preferred
embodiment, the polynucleotide of the invention is selected from
the group consisting of SEQ ID NOs: 19, 21, 23, 25, 27, 29, 31, 33,
35, 39, 41, 44, 46, 51, 73, 75, 77, and 79. The invention is not
limited to said polynucleotides per se but also includes all
polynucleotides displaying at least 80% identity with said
polynucleotides.
[0099] The invention provides vectors comprising the
polynucleotides of the invention. In one embodiment, the vector
contains a polynucleotide encoding a heavy chain of an anti-EphA2
immunoglobulin. In another embodiment, said polynucleotide encodes
the light chain of an anti-EphA2 immunoglobulin. The invention also
provides vectors comprising polynucleotide molecules encoding
fusion proteins, modified antibodies, antibody fragments, and
probes thereof.
[0100] In order to express the heavy and/or light chain of the
anti-EphA2 antibodies of the invention, the polynucleotides
encoding said heavy and/or light chains are inserted into
expression vectors such that the genes are operatively linked to
transcriptional and translational sequences. Expression vectors
include plasmids, YACs, cosmids, retrovirus, EBV-derived episomes,
and all the other vectors that the skilled man will know to be
convenient for ensuring the expression of said heavy and/or light
chains. The skilled man will realize that the polynucleotides
encoding the heavy and the light chains can be cloned into
different vectors or in the same vector. In a preferred embodiment,
said polynucleotides are cloned in the same vector.
[0101] Polynucleotides of the invention and vectors comprising
these molecules can be used for the transformation of a suitable
mammalian host cell, or any other type of host cell known to the
skilled person. Transformation can be by any known method for
introducing polynucleotides into a cell host. Such methods are well
known of the man skilled in the art and include dextran-mediated
transformation, calcium phosphate precipitation, polybrene-mediated
transfection, protoplast fusion, electroporation, encapsulation of
the polynucleotide into liposomes, biolistic injection and direct
microinjection of DNA into nuclei.
[0102] Antibody Fragments
[0103] The antibodies of the present invention include both the
full length antibodies discussed above, as well as epitope-binding
fragments. As used herein, "antibody fragments" include any portion
of an antibody that retains the ability to bind to the epitope
recognized by the full length antibody, generally termed
"epitope-binding fragments." Examples of antibody fragments
include, but are not limited to, Fab, Fab' and F(ab').sub.2, Fd,
single-chain Fvs (scFv), single-chain antibodies, disulfide-linked
Fvs (dsFv) and fragments comprising either a V.sub.L or V.sub.H
region. Epitope-binding fragments, including single-chain
antibodies, may comprise the variable region(s) alone or in
combination with the entirety or a portion of the following: hinge
region, C.sub.H1, C.sub.H2, and C.sub.H3 domains.
[0104] Such fragments may contain one or both Fab fragments or the
F(ab').sub.2 fragment. Preferably, the antibody fragments contain
all six CDRs of the whole antibody, although fragments containing
fewer than all of such regions, such as three, four or five CDRs,
are also functional. Further, the fragments may be or may combine
members of any one of the following immunoglobulin classes: IgG,
IgM, IgA, IgD, or IgE, and the subclasses thereof.
[0105] Fab and F(ab').sub.2 fragments may be produced by
proteolytic cleavage, using enzymes such as papain (Fab fragments)
or pepsin (F(ab').sub.2 fragments).
[0106] The "single-chain FVs" ("scFvs") fragments are
epitope-binding fragments that contain at least one fragment of an
antibody heavy chain variable region (V.sub.H) linked to at least
one fragment of an antibody light chain variable region (V.sub.L).
The linker may be a short, flexible peptide selected to ensure that
the proper three-dimensional folding of the (V.sub.L) and (V.sub.H)
regions occurs once they are linked so as to maintain the target
molecule binding-specificity of the whole antibody from which the
single-chain antibody fragment is derived. The carboxyl terminus of
the (V.sub.L) or (V.sub.H) sequence may be covalently linked by a
linker to the amino acid terminus of a complementary (V.sub.L) or
(V.sub.H) sequence.
[0107] Single-chain antibody fragments of the present invention
contain amino acid sequences having at least one of the variable or
complementarity determining regions (CDRs) of the whole antibodies
described in this specification, but are lacking some or all of the
constant domains of those antibodies. These constant domains are
not necessary for antigen binding, but constitute a major portion
of the structure of whole antibodies. Single-chain antibody
fragments may therefore overcome some of the problems associated
with the use of antibodies containing a part or all of a constant
domain. For example, single-chain antibody fragments tend to be
free of undesired interactions between biological molecules and the
heavy-chain constant region, or other unwanted biological activity.
Additionally, single-chain antibody fragments are considerably
smaller than whole antibodies and may therefore have greater
capillary permeability than whole antibodies, allowing single-chain
antibody fragments to localize and bind to target antigen-binding
sites more efficiently. Also, antibody fragments can be produced on
a relatively large scale in prokaryotic cells, thus facilitating
their production. Furthermore, the relatively small size of
single-chain antibody fragments makes them less likely to provoke
an immune response in a recipient than whole antibodies.
[0108] Single-chain antibody fragments may be generated by
molecular cloning, antibody phage display library or similar
techniques well known to the skilled artisan. These proteins may be
produced, for example, in eukaryotic cells or prokaryotic cells,
including bacteria. The epitope-binding fragments of the present
invention can also be generated using various phage display methods
known in the art. In phage display methods, functional antibody
domains are displayed on the surface of phage particles which carry
the polynucleotide sequences encoding them. In particular, such
phage can be utilized to display epitope-binding domains expressed
from a repertoire or combinatorial antibody library (e.g., human or
murine). Phage expressing an epitope-binding domain that binds the
antigen of interest can be selected or identified with antigen,
e.g., using labeled antigen bound or captured to a solid surface or
bead. Phage used in these methods are typically filamentous phage
including fd and M13 binding domains expressed from phage with Fab,
Fv or disulfide-stabilized Fv antibody domains recombinantly fused
to either the phage gene III or gene VIII protein.
[0109] Examples of phage display methods that can be used to make
the epitope-binding fragments of the present invention include
those disclosed in Brinkman et al., 1995, J. Immunol. Methods, 182:
41-50; Ames et al., 1995, J. Immunol. Methods, 184: 177-186;
Kettleborough et al., 1994, Eur. J. Immunol., 24:952-958; Persic et
al., 1997, Gene 187: 9-18; Burton et al., 1994, Advances in
Immunology, 57: 191-280; PCT application No. PCT/GB91/01134; PCT
publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO
93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426;
5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047;
5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743
and 5,969,108; each of which is incorporated herein by reference in
its entirety.
[0110] After phage selection, the regions of the phage encoding the
fragments can be isolated and used to generate the epitope-binding
fragments through expression in a chosen host, including mammalian
cells, insect cells, plant cells, yeast, and bacteria, using
recombinant DNA technology, e.g., as described in detail below. For
example, techniques to recombinantly produce Fab, Fab' and
F(ab').sub.2 fragments can also be employed using methods known in
the art such as those disclosed in PCT publication WO 92/22324;
Mullinax et al., 1992, BioTechniques, 12(6): 864-869; Sawai et al.,
1995, AJRI, 34: 26-34; and Better et al., 1988, Science, 240:
1041-1043; said references incorporated by reference in their
entireties. Examples of techniques which can be used to produce
single-chain Fvs and antibodies include those described in U.S.
Pat. Nos. 4,946,778 and 5,258,498; Huston et al., 1991, Methods in
Enzymology 203: 46-88; Shu et al., 1993, Proc. Natl. Acad. Sci.
U.S.A., 90: 7995-7999; Skerra et al., 1988, Science, 240:
1038-1040.
[0111] Functional Equivalents
[0112] Also included within the scope of the invention are
functional equivalents of the anti-EphA antibody and the humanized
anti-EphA2 receptor antibody. The term "functional equivalents"
includes antibodies with homologous sequences, chimeric antibodies,
artificial antibodies and modified antibodies, for example, wherein
each functional equivalent is defined by its ability to bind to
EphA2 receptor. The skilled artisan will understand that there is
an overlap in the group of molecules termed "antibody fragments"
and the group termed "functional equivalents." Methods of producing
functional equivalents are known to the person skilled in the art
and are disclosed, for example, in PCT Application WO 93/21319,
European Patent No. EP 0239400; PCT Application WO 89/09622;
European Patent No. EP 0338745; and European Patent Application EP
0332424, which are incorporated in their respective entireties by
reference.
[0113] Antibodies with homologous sequences are those antibodies
with amino acid sequences that have sequence homology with amino
acid sequence of an anti-EphA antibody and a humanized anti-EphA
antibody of the present invention. Preferably homology is with the
amino acid sequence of the variable regions of the anti-EphA
antibody and humanized anti-EphA antibody of the present invention.
"Sequence homology" as applied to an amino acid sequence herein is
defined as a sequence with at least about 90%, 91%, 92%, 93%, or
94% sequence homology, and more preferably at least about 95%, 96%,
97%, 98%, or 99% sequence homology to another amino acid sequence,
as determined, for example, by the FASTA search method in
accordance with Pearson and Lipman, 1988, Proc. Natl. Acad. Sci.
U.S.A., 85: 2444-2448.
[0114] A chimeric antibody is one in which different portions of an
antibody are derived from different animal species. For example, an
antibody having a variable region derived from a murine monoclonal
antibody paired with a human immunoglobulin constant region.
Methods for producing chimeric antibodies are known in the art.
See, e.g., Morrison, 1985, Science, 229: 1202; Oi et al., 1986, Bio
Techniques, 4: 214; Gillies et al., 1989, J. Immunol. Methods, 125:
191-202; U.S. Pat. Nos. 5,807,715; 4,816,567; and 4,816,397, which
are incorporated herein by reference in their entireties.
[0115] Humanized forms of chimeric antibodies are made by
substituting the complementarity determining regions of, for
example, a mouse antibody, into a human framework domain, e.g., see
PCT Pub. No. WO92/22653. Humanized chimeric antibodies preferably
have constant regions and variable regions other than the
complementarity determining regions (CDRs) derived substantially or
exclusively from the corresponding human antibody regions and CDRs
derived substantially or exclusively from a mammal other than a
human.
[0116] Artificial antibodies include scFv fragments, diabodies,
triabodies, tetrabodies and mru (see reviews by Winter, G. and
Milstein, C., 1991, Nature, 349: 293-299; Hudson, P. J., 1999,
Current Opinion in Immunology, 11: 548-557), each of which has
antigen-binding ability. In the single chain Fv fragment (scFv),
the V.sub.H and V.sub.L domains of an antibody are linked by a
flexible peptide. Typically, this linker peptide is about 15 amino
acid residues long. If the linker is much smaller, for example 5
amino acids, diabodies are formed, which are bivalent scFv dimers.
If the linker is reduced to less than three amino acid residues,
trimeric and tetrameric structures are formed that are called
triabodies and tetrabodies. The smallest binding unit of an
antibody is a CDR, typically the CDR2 of the heavy chain which has
sufficient specific recognition and binding that it can be used
separately. Such a fragment is called a molecular recognition unit
or mru. Several such mrus can be linked together with short linker
peptides, therefore forming an artificial binding protein with
higher avidity than a single mru.
[0117] The functional equivalents of the present application also
include modified antibodies, e.g., antibodies modified by the
covalent attachment of any type of molecule to the antibody. For
example, modified antibodies include antibodies that have been
modified, e.g., by glycosylation, acetylation, pegylation,
phosphorylation, amidation, derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to a
cellular ligand or other protein, etc. The covalent attachment does
not prevent the antibody from generating an anti-idiotypic
response. These modifications may be carried out by known
techniques, including, but not limited to, specific chemical
cleavage, acetylation, formylation, metabolic synthesis of
tunicamycin, etc. Additionally, the modified antibodies may contain
one or more non-classical amino acids.
[0118] Functional equivalents may be produced by interchanging
different CDRs on different chains within different frameworks.
Thus, for example, different classes of antibody are possible for a
given set of CDRs by substitution of different heavy chains,
whereby, for example, IgG1-4, IgM, IgA1-2, IgD, IgE antibody types
and isotypes may be produced. Similarly, artificial antibodies
within the scope of the invention may be produced by embedding a
given set of CDRs within an entirely synthetic framework.
[0119] Functional equivalents may be readily produced by mutation,
deletion and/or insertion within the variable and/or constant
region sequences that flank a particular set of CDRs, using a wide
variety of methods known in the art.
[0120] The antibody fragments and functional equivalents of the
present invention encompass those molecules with a detectable
degree of binding to EphA, when compared to the 37.3D7, 37.1F5,
53.2H11, EphA2-N1 or EphA2-N2 antibody. A detectable degree of
binding includes all values in the range of at least 10-100%,
preferably at least 50%, 60% or 70%, more preferably at least 75%,
80%, 85%, 90%, 95% or 99% the binding ability of the murine 37.3D7,
37.1F5, 53.2H11, EphA2-N1 or EphA2-N2 antibody to EphA.
[0121] Improved Antibodies
[0122] The CDRs are of primary importance for epitope recognition
and antibody binding. However, changes may be made to the residues
that comprise the CDRs without interfering with the ability of the
antibody to recognize and bind its cognate epitope. For example,
changes that do not affect epitope recognition, yet increase the
binding affinity of the antibody for the epitope may be made.
[0123] Thus, also included in the scope of the present invention
are improved versions of both the murine and humanized antibodies,
which also specifically recognize and bind EphA, preferably with
increased affinity.
[0124] Several studies have surveyed the effects of introducing one
or more amino acid changes at various positions in the sequence of
an antibody, based on the knowledge of the primary antibody
sequence, on its properties such as binding and level of expression
(Yang, W. P. et al., 1995, J. Mol. Biol., 254: 392-403; Rader, C.
et al., 1998, Proc. Natl. Acad. Sci. U.S.A., 95: 8910-8915;
Vaughan, T. J. et al., 1998, Nature Biotechnology, 16:
535-539).
[0125] In these studies, equivalents of the primary antibody have
been generated by changing the sequences of the heavy and light
chain genes in the CDR1, CDR2, CDR3, or framework regions, using
methods such as oligonucleotide-mediated site-directed mutagenesis,
cassette mutagenesis, error-prone PCR, DNA shuffling, or
mutator-strains of E. coli (Vaughan, T. J. et al., 1998, Nature
Biotechnology, 16: 535-539; Adey, N. B. et al., 1996, Chapter 16,
pp. 277-291, in "Phage Display of Peptides and Proteins", Eds. Kay,
B. K. et al., Academic Press). These methods of changing the
sequence of the primary antibody have resulted in improved
affinities of the secondary antibodies (Gram, H. et al., 1992,
Proc. Natl. Acad. Sci. U.S.A., 89: 3576-3580; Boder, E. T. et al.,
2000, Proc. Natl. Acad. Sci. U.S.A., 97: 10701-10705; Davies, J.
and Riechmann, L., 1996, Immunotechnolgy, 2: 169-179; Thompson, J.
et al., 1996, J. Mol. Biol., 256: 77-88; Short, M. K. et al., 2002,
J. Biol. Chem., 277: 16365-16370; Furukawa, K. et al., 2001, J.
Biol. Chem., 276: 27622-27628).
[0126] By a similar directed strategy of changing one or more amino
acid residues of the antibody, the antibody sequences described in
this invention can be used to develop anti-EphA antibodies with
improved functions, including improved affinity for EphA.
[0127] Preferred amino acid substitutions are those which: (1)
reduce susceptibility to proteolysis, (2) reduce susceptibility to
oxidation, (3) alter binding affinity for forming protein
complexes, and (4) confer or modify other physico-chemical or
functional properties of such analogs. Analogs can include various
muteins of a sequence other than the naturally-occurring peptide
sequence. For example, single or multiple amino acid substitutions
(preferably conservative amino acid substitutions) may be made in
the naturally-occurring sequence (preferably in the portion of the
polypeptide outside the domain (s) forming intermolecular contacts.
A conservative amino acid substitution should not substantially
change the structural characteristics of the parent sequence (e.
g., a replacement amino acid should not tend to break a helix that
occurs in the parent sequence, or disrupt other types of secondary
structure that characterizes the parent sequence). Examples of
art-recognized polypeptide secondary and tertiary structures are
described in Proteins, Structures and Molecular Principles
(Creighton, Ed., W. H. Freeman and Company, New York (1984));
Introduction to Protein Structure (C. Branden and J. Tooze, eds.,
Garland Publishing, New York, N. Y. (1991)); and Thornton et al.,
1991, Nature, 354: 105, which are each incorporated herein by
reference.
[0128] Improved antibodies also include those antibodies having
improved characteristics that are prepared by the standard
techniques of animal immunization, hybridoma formation and
selection for antibodies with specific characteristics.
[0129] The present invention also includes cytotoxic conjugates.
These cytotoxic conjugates comprise two primary components, a
cell-binding agent and a cytotoxic agent.
[0130] As used herein, the term "cell binding agent" refers to an
agent that specifically recognizes and binds the EphA receptors on
the cell surface. In one embodiment, the cell binding agent
specifically recognizes the EphA receptor such that it allows the
conjugates to act in a targeted fashion with little side-effects
resulting from non-specific binding.
[0131] In another embodiment, the cell binding agent of the present
invention also specifically recognizes the EphA receptor so that
the conjugates will be in contact with the target cell for a
sufficient period of time to allow the cytotoxic drug portion of
the conjugate to act on the cell, and/or to allow the conjugates
sufficient time in which to be internalized by the cell.
[0132] In a preferred embodiment, the cytotoxic conjugates comprise
an anti-EphA antibody as the cell binding agent, more preferably
the murine 37.3D7, 37.1F5, 53.2H11, EphA2-N1 or EphA2-N2 anti-EphA
monoclonal antibody. In a more preferred embodiment, the cytotoxic
conjugate comprises a humanized 37.3D7, 37.1F5, 53.2H11, EphA2-N1
or EphA2-N2 antibody or an epitope-binding fragment thereof. The
37.3D7, 37.1F5, 53.2H11, EphA2-N1 or EphA2-N2 antibody is able to
specifically recognize an EphA receptor, such as EphA2, and directs
the cytotoxic agent to an abnormal cell or a tissue, such as cancer
cells, in a targeted fashion.
[0133] The second component of the cytotoxic conjugates of the
present invention is a cytotoxic agent. The term "cytotoxic agent"
as used herein refers to a substance that reduces or blocks the
function, or growth, of cells and/or causes destruction of
cells.
[0134] In preferred embodiments, the cytotoxic agent is a taxoid, a
maytansinoid such as DM1 or DM4, a small drug, a tomaymycin
derivative, a leptomycin derivative, a prodrug, CC-1065 or a
CC-1065 analog. In preferred embodiments, the cell binding agents
of the present invention are covalently attached, directly or via a
cleavable or non-cleavable linker, to the cytotoxic agent.
[0135] The cell binding agents, cytotoxic agents, and linkers are
discussed in more detail below.
[0136] Cell Binding Agents
[0137] The effectiveness of the compounds of the present invention
as therapeutic agents depends on the careful selection of an
appropriate cell binding agent. Cell binding agents may be of any
kind presently known, or that become known, and includes peptides
and non-peptides. The cell binding agent may be any compound that
can bind a cell, either in a specific or non-specific manner.
Generally, these can be antibodies (especially monoclonal
antibodies), lymphokines, hormones, growth factors, vitamins,
nutrient-transport molecules (such as transferrin), or any other
cell binding molecule or substance.
[0138] More specific examples of cell binding agents that can be
used include: [0139] polyclonal antibodies; [0140] monoclonal
antibodies; [0141] fragments of antibodies such as Fab, Fab', and
F(ab').sub.2, Fv (Parham, 1983, J. Immunol., 131:2895-2902; Spring
et al., 1974, J. Immunol., 113: 470-478; Nisonoff et al., 1960,
Arch. Biochem. Biophys., 89: 230-244).
[0142] Preferably, a humanized anti-EphA antibody is used as the
cell binding agent of the present invention. More preferably the
humanized anti-EphA antibody is selected from humanized or
resurfaced 37.3D7, 37.1F5; 53.2H11; EphA2-N1 and EphA2-N2
antibodies.
[0143] Cytotoxic Agents
[0144] In another embodiment, the humanized antibody or an
epitope-binding fragment thereof can be conjugated to a drug, such
as a maytansinoid or a tomaymycin derivative, to form a prodrug
having specific cytotoxicity towards antigen-expressing cells by
targeting the drug to the EphA2 receptor. Cytotoxic conjugates
comprising such antibodies and a small, highly toxic drug (e.g.,
maytansinoids, taxanes, tomaymycin derivatives, a leptomycin
derivative, CC-1065, and CC-1065 analogs) can be used as a
therapeutic for treatment of tumors, such as breast and ovarian
tumors.
[0145] The cytotoxic agent used in the cytotoxic conjugate of the
present invention may be any compound that results in the death of
a cell, or induces cell death, or in some manner decreases cell
viability. Preferred cytotoxic agents include, for example,
maytansinoids and maytansinoid analogs, a prodrug, tomaymycin
derivatives, taxoids, a leptomycin derivative, CC-1065 and CC-1065
analogs, defined below. These cytotoxic agents are conjugated to
the antibodies, antibodies fragments, functional equivalents,
improved antibodies and their analogs as disclosed herein.
[0146] The cytotoxic conjugates may be prepared by in vitro
methods. In order to link a drug or prodrug to the antibody, a
linking group is used. Suitable linking groups are well known in
the art and include disulfide groups, thioether groups, acid labile
groups, photolabile groups, peptidase labile groups and esterase
labile groups. Preferred linking groups are disulfide groups and
thioether groups. For example, conjugates can be constructed using
a disulfide exchange reaction or by forming a thioether bond
between the antibody and the drug or prodrug.
[0147] Maytansinoids
[0148] Among the cytotoxic agents that may be used in the present
invention to form a cytotoxic conjugate, are maytansinoids and
maytansinoid analogs. Examples of suitable maytansinoids include
maytansinol and maytansinol analogs. Maytansinoids are drugs that
inhibit microtubule formation and that are highly toxic to
mammalian cells.
[0149] Examples of suitable maytansinol analogues include those
having a modified aromatic ring and those having modifications at
other positions. Such suitable maytansinoids are disclosed in U.S.
Pat. Nos. 4,424,219; 4,256,746; 4,294,757; 4,307,016; 4,313,946;
4,315,929; 4,331,598; 4,361,650; 4,362,663; 4,364,866; 4,450,254;
4,322,348; 4,371,533; 6,333,410; 5,475,092; 5,585,499; and
5,846,545.
[0150] Specific examples of suitable analogues of maytansinol
having a modified aromatic ring include:
[0151] (1) C-19-dechloro (U.S. Pat. No. 4,256,746) (prepared by LAH
reduction of ansamytocin P2);
[0152] (2) C-20-hydroxy (or C-20-demethyl)+/-C-19-dechloro (U.S.
Pat. Nos. 4,361,650 and 4,307,016) (prepared by demethylation using
Streptomyces or Actinomyces or dechlorination using LAH); and
[0153] (3) C-20-demethoxy, C-20-acyloxy (--OCOR), +/-dechloro (U.S.
Pat. No. 4,294,757) (prepared by acylation using acyl
chlorides).
[0154] Specific examples of suitable analogues of maytansinol
having modifications of other positions include:
[0155] (1) C-9-SH (U.S. Pat. No. 4,424,219) (prepared by the
reaction of maytansinol with H.sub.2S or P.sub.2S.sub.5),
[0156] (2) C-14-alkoxymethyl (demethoxy/CH.sub.2OR) (U.S. Pat. No.
4,331,598);
[0157] (3) C-14-hydroxymethyl or acyloxymethyl (CH.sub.2OH or
CH.sub.2OAc) (U.S. Pat. No. 4,450,254) (prepared from
Nocardia);
[0158] (4) C-15-hydroxy/acyloxy (U.S. Pat. No. 4,364,866) (prepared
by the conversion of maytansinol by Streptomyces);
[0159] (5) C-15-methoxy (U.S. Pat. Nos. 4,313,946 and 4,315,929)
(isolated from Trewia nudiflora);
[0160] (6) C-18-N-demethyl (U.S. Pat. Nos. 4,362,663 and 4,322,348)
(prepared by the demethylation of maytansinol by Streptomyces);
and
[0161] (7) 4,5-deoxy (U.S. Pat. No. 4,371,533) (prepared by the
titanium trichloride/LAH reduction of maytansinol).
[0162] In a preferred embodiment, the cytotoxic conjugates of the
present invention utilize the thiol-containing maytansinoid (DM1),
formally termed
N.sup.2'-deacetyl-N.sup.2'-(3-mercapto-1-oxopropyl)-maytansine, as
the cytotoxic agent. DM1 is represented by the following structural
formula (I):
##STR00001##
[0163] In another preferred embodiment, the cytotoxic conjugates of
the present invention utilize the thiol-containing maytansinoid
N.sup.2'-deacetyl-N-.sup.2'(4-methyl-4-mercapto-1-oxopentyl)-maytansine
as the cytotoxic agent. DM4 is represented by the following
structural formula (II):
##STR00002##
[0164] In further embodiments of the invention, other maytansines,
including thiol and disulfide-containing maytansinoids bearing a
mono or di-alkyl substitution on the carbon atom bearing the sulfur
atom, may be used. These include a maytansinoid having, at C-3,
C-14 hydroxymethyl, C-15 hydroxy, or C-20 desmethyl, an acylated
amino acid side chain with an acyl group bearing a hindered
sulfhydryl group, wherein the carbon atom of the acyl group bearing
the thiol functionality has one or two substituents, said
substituents being CH.sub.3, C.sub.2H.sub.5, linear or branched
alkyl or alkenyl having from 1 to 10 carbon atoms, cyclic alkyl or
alkenyl having from 3 to 10 carbon atoms, phenyl, substituted
phenyl, or heterocyclic aromatic or heterocycloalkyl radical, and
further wherein one of the substituents can be H, and wherein the
acyl group has a linear chain length of at least three carbon atoms
between the carbonyl functionality and the sulfur atom.
[0165] Such additional maytansines include compounds represented by
formula (III):
##STR00003##
[0166] wherein:
[0167] Y' represents
(CR.sub.7R.sub.8).sub.l(CR.sub.9.dbd.CR.sub.10).sub.p(C.ident.C).sub.qA.-
sub.r(CR.sub.5R.sub.6).sub.mD.sub.u(CR.sub.11.dbd.CR.sub.12).sub.r(C.ident-
.C).sub.sB.sub.t(CR.sub.3R.sub.4).sub.nCR.sub.1R.sub.2SZ,
[0168] wherein: [0169] R.sub.1 and R.sub.2 are each independently
CH.sub.3, C.sub.2H.sub.5, linear alkyl or alkenyl having from 1 to
10 carbon atoms, branched or cyclic alkyl or alkenyl having from 3
to 10 carbon atoms, phenyl, substituted phenyl or heterocyclic
aromatic or heterocycloalkyl radical, and in addition R.sub.2 can
be H; [0170] A, B, D are cycloalkyl or cycloalkenyl having 3-10
carbon atoms, simple or substituted aryl or heterocyclic aromatic
or heterocycloalkyl radical; [0171] R.sub.3, R.sub.4, R.sub.5,
R.sub.6, R.sub.7, R.sub.8, R.sub.9, R.sub.10, R.sub.11, and
R.sub.12 are each independently H, CH.sub.3, C.sub.2H.sub.5, linear
alkyl or alkenyl having from 1 to 10 carbon atoms, branched or
cyclic alkyl or alkenyl having from 3 to 10 carbon atoms, phenyl,
substituted phenyl or heterocyclic aromatic or heterocycloalkyl
radical; [0172] l, m, n, o, p, q, r, s, and t are each
independently 0 or an integer of from 1 to 5, provided that at
least two of l, m, n, o, p, q, r, s and t are not zero at any one
time; and [0173] Z is H, SR or --COR, wherein R is linear alkyl or
alkenyl having from 1 to 10 carbon atoms, branched or cyclic alkyl
or alkenyl having from 3 to 10 carbon atoms, or simple or
substituted aryl or heterocyclic aromatic or heterocycloalkyl
radical.
[0174] Preferred embodiments of formula (III) include compounds of
formula (III) wherein: [0175] R.sub.1 is methyl, R.sub.2 is H and Z
is H. [0176] R.sub.1 and R.sub.2 are methyl and Z is H. [0177]
R.sub.1 is methyl, R.sub.2 is H, and Z is --SCH.sub.3 [0178]
R.sub.1 and R.sub.2 are methyl, and Z is --SCH.sub.3
[0179] Such additional maytansines also include compounds
represented by formula (IV-L), (IV-D), or (IV-D,L):
##STR00004##
[0180] wherein: [0181] Y represents
(CR.sub.7R.sub.8).sub.l(CR.sub.5R.sub.6).sub.m(CR.sub.3R.sub.4).sub.nCR.s-
ub.1R.sub.2SZ,
[0182] wherein: [0183] R.sub.1 and R.sub.2 are each independently
CH.sub.3, C.sub.2H.sub.5, linear alkyl or alkenyl having from 1 to
10 carbon atoms, branched or cyclic alkyl or alkenyl having from 3
to 10 carbon atoms, phenyl, substituted phenyl, or heterocyclic
aromatic or heterocycloalkyl radical, and in addition R.sub.2 can
be H; [0184] R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7 and
R.sub.8 are each independently H, CH.sub.3, C.sub.2H.sub.5, linear
alkyl or alkenyl having from 1 to 10 carbon atoms, branched or
cyclic alkyl or alkenyl having from 3 to 10 carbon atoms, phenyl,
substituted phenyl, or heterocyclic aromatic or heterocycloalkyl
radical; [0185] l, m and n are each independently an integer of
from 1 to 5, and in addition n can be 0; [0186] Z is H, SR or --COR
wherein R is linear or branched alkyl or alkenyl having from 1 to
10 carbon atoms, cyclic alkyl or alkenyl having from 3 to 10 carbon
atoms, or simple or substituted aryl or heterocyclic aromatic or
heterocycloalkyl radical; and [0187] May represents a maytansinoid
which bears the side chain at C-3, C-14 hydroxymethyl, C-15 hydroxy
or C-20 desmethyl.
[0188] Preferred embodiments of formulas (IV-L), (IV-D) and
(IV-D,L) include compounds of formulas (IV-L), (IV-D) and (IV-D,L)
wherein: [0189] R.sub.1 is methyl, R.sub.2 is H, R.sub.3, R.sub.6,
R.sub.7, and R.sub.8 are each H, l and m are each 1, n is 0, and Z
is H. [0190] R.sub.1 and R.sub.2 are methyl, R.sub.5, R.sub.6,
R.sub.7, R.sub.8 are each H, l and m are 1, n is 0, and Z is H.
[0191] R.sub.1 is methyl, R.sub.2 is H, R.sub.5, R.sub.6, R.sub.7,
and R.sub.8 are each H, l and m are each 1, n is 0, and Z is
--SCH.sub.3. [0192] R.sub.1 and R.sub.2 are methyl, R.sub.5,
R.sub.6, R.sub.7, R.sub.8 are each H, l and m are 1, n is 0, and Z
is --SCH.sub.3.
[0193] Preferably the cytotoxic agent is represented by formula
(IV-L).
[0194] Such additional maytansines also include compounds
represented by formula (V):
##STR00005##
[0195] wherein:
[0196] Y represents
(CR.sub.7R.sub.8).sub.l(CR.sub.5R.sub.6).sub.m(CR.sub.3R.sub.4).sub.nCR.s-
ub.1R.sub.2SZ,
[0197] wherein: [0198] R.sub.1 and R.sub.2 are each independently
CH.sub.3, C.sub.2H.sub.5, linear alkyl or alkenyl having from 1 to
10 carbon atoms, branched or cyclic alkyl or alkenyl having from 3
to 10 carbon atoms, phenyl, substituted phenyl or heterocyclic
aromatic or heterocycloalkyl radical, and in addition R.sub.2 can
be H; [0199] R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7 and
R.sub.8 are each independently H, CH.sub.3, C.sub.2H.sub.5, linear
alkyl or alkenyl having from 1 to 10 carbon atoms, branched or
cyclic alkyl or alkenyl having from 3 to 10 carbon atoms, phenyl,
substituted phenyl, or heterocyclic aromatic or heterocycloalkyl
radical; [0200] l, m and n are each independently an integer of
from 1 to 5, and in addition n can be 0; and [0201] Z is H, SR or
--COR, wherein R is linear alkyl or alkenyl having from 1 to 10
carbon atoms, branched or cyclic alkyl or alkenyl having from 3 to
10 carbon atoms, or simple or substituted aryl or heterocyclic
aromatic or heterocycloalkyl radical.
[0202] Preferred embodiments of formula (V) include compounds of
formula (V) wherein: [0203] R.sub.1 is methyl, R.sub.2 is H, R5,
R6, R7, and R8 are each H; l and m are each 1; n is 0; and Z is H.
[0204] R.sub.1 and R.sub.2 are methyl; R.sub.5, R.sub.6, R.sub.7,
R.sub.8 are each H, l and m are 1; n is 0; and Z is H. [0205]
R.sub.1 is methyl, R.sub.2 is H, R.sub.5, R.sub.6, R.sub.7, and
R.sub.8 are each H, l and m are each 1, n is 0, and Z is
--SCH.sub.3. [0206] R.sub.1 and R.sub.2 are methyl, R.sub.5,
R.sub.6, R.sub.7, R.sub.8 are each H, l and m are 1, n is 0, and Z
is --SCH.sub.3.
[0207] Such additional maytansines further include compounds
represented by formula (VI-L), (VI-D), or (VI-D,L):
##STR00006##
[0208] wherein: [0209] Y.sub.2 represents
(CR.sub.7R.sub.8).sub.l(CR.sub.5R.sub.6).sub.m(CR.sub.3R.sub.4).sub.nCR.s-
ub.1R.sub.2SZ.sub.2,
[0210] wherein: [0211] R.sub.1 and R.sub.2 are each independently
CH.sub.3, C.sub.2H.sub.5, linear alkyl or alkenyl having from 1 to
10 carbon atoms, branched or cyclic alkyl or alkenyl having from 3
to 10 carbon atoms, phenyl, substituted phenyl or heterocyclic
aromatic or heterocycloalkyl radical, and in addition R.sub.2 can
be H; [0212] R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7 and
R.sub.8 are each independently H, CH.sub.3, C.sub.2H.sub.5, linear
cyclic alkyl or alkenyl having from 1 to 10 carbon atoms, branched
or cyclic alkyl or alkenyl having from 3 to 10 carbon atoms,
phenyl, substituted phenyl or heterocyclic aromatic or
heterocycloalkyl radical; [0213] l, m and n are each independently
an integer of from 1 to 5, and in addition n can be 0; [0214]
Z.sub.2 is SR or COR, wherein R is linear alkyl or alkenyl having
from 1 to 10 carbon atoms, branched or cyclic alkyl or alkenyl
having from 3 to 10 carbon atoms, or simple or substituted aryl or
heterocyclic aromatic or heterocycloalkyl radical; and [0215] May
is a maytansinoid.
[0216] Such additional maytansines also include compounds
represented by formula (VII):
##STR00007##
[0217] wherein:
[0218] Y.sub.2' represents
(CR.sub.7R.sub.8).sub.l(CR.sub.9.dbd.CR.sub.10).sub.p(C.ident.C).sub.qA.-
sub.r(CR.sub.5R.sub.6).sub.mD.sub.u(CR.sub.11.dbd.CR.sub.12).sub.r(C.ident-
.C).sub.sB.sub.t(CR.sub.3R.sub.4).sub.nCR.sub.1R.sub.2SZ.sub.2,
[0219] wherein: [0220] R.sub.1 and R.sub.2 are each independently
CH.sub.3, C.sub.2H.sub.5, linear branched or alkyl or alkenyl
having from 1 to 10 carbon atoms, cyclic alkyl or alkenyl having
from 3 to 10 carbon atoms, phenyl, substituted phenyl or
heterocyclic aromatic or heterocycloalkyl radical, and in addition
R.sub.2 can be H; [0221] A, B, and D each independently is
cycloalkyl or cycloalkenyl having 3 to 10 carbon atoms, simple or
substituted aryl, or heterocyclic aromatic or heterocycloalkyl
radical; [0222] R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
R.sub.8, R.sub.9, R.sub.10, R.sub.11, and R.sub.12 are each
independently H, CH.sub.3, C.sub.2H.sub.5, linear alkyl or alkenyl
having from 1 to 10 carbon atoms, branched or cyclic alkyl or
alkenyl having from 3 to 10 carbon atoms, phenyl, substituted
phenyl or heterocyclic aromatic or heterocycloalkyl radical; [0223]
l, m, n, o, p, q, r, s, and t are each independently 0 or an
integer of from 1 to 5, provided that at least two of l, m, n, o,
p, q, r, s and t are not zero at any one time; and [0224] Z.sub.2
is SR or --COR, wherein R is linear alkyl or alkenyl having from 1
to 10 carbon atoms, branched or cyclic alkyl or alkenyl having from
3-10 carbon atoms, or simple or substituted aryl or heterocyclic
aromatic or heterocycloalkyl radical.
[0225] Preferred embodiments of formula (VII) include compounds of
formula (VII) wherein: R, is methyl, R.sub.2 is H.
[0226] The above-mentioned maytansinoids can be conjugated to
anti-EphA antibody 37.3D7, 37.1F5, 53.2H11, EphA2-N1 or EphA2-N2 or
a homologue or fragment thereof, wherein the antibody is linked to
the maytansinoid using the thiol or disulfide functionality that is
present on the acyl group of an acylated amino acid side chain
found at C-3, C-14 hydroxymethyl, C-15 hydroxy or C-20 desmethyl of
the maytansinoid, and wherein the acyl group of the acylated amino
acid side chain has its thiol or disulfide functionality located at
a carbon atom that has one or two substituents, said substituents
being CH.sub.3, C.sub.2H.sub.5, linear alkyl or alkenyl having from
1 to 10 carbon atoms, branched or cyclic alkyl or alkenyl having
from 3 to 10 carbon atoms, phenyl, substituted phenyl or
heterocyclic aromatic or heterocycloalkyl radical, and in addition
one of the substituents can be H, and wherein the acyl group has a
linear chain length of at least three carbon atoms between the
carbonyl functionality and the sulfur atom.
[0227] A preferred conjugate of the present invention is the one
that comprises the anti-EphA antibody 37.3D7, 37.1F5, 53.2H11,
EphA2-N1 or EphA2-N2 or a homologue or fragment thereof, conjugated
to a maytansinoid of formula (VIII):
##STR00008##
[0228] wherein:
[0229] Y.sub.1' represents
(CR.sub.7R.sub.8).sub.l(CR.sub.9.dbd.CR.sub.10).sub.p(C.ident.C).sub.qA.-
sub.r(CR.sub.5R.sub.6).sub.mD.sub.u(CR.sub.11.dbd.CR.sub.12).sub.r(C.ident-
.C).sub.sB.sub.t(CR.sub.3R.sub.4).sub.nCR.sub.1R.sub.2S--,
[0230] wherein: [0231] A, B, and D, each independently is
cycloalkyl or cycloalkenyl having 3-10 carbon atoms, simple or
substituted aryl, or heterocyclic aromatic or heterocycloalkyl
radical; [0232] R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7,
R.sub.8, R.sub.9, R.sub.10, R.sub.11, and R.sub.12 are each
independently H, CH.sub.3, C.sub.2H.sub.5, linear alkyl or alkenyl
having from 1 to 10 carbon atoms, branched or cyclic alkyl or
alkenyl having from 3 to 10 carbon atoms, phenyl, substituted
phenyl or heterocyclic aromatic or heterocycloalkyl radical; and
[0233] l, m, n, o, p, q, r, s, and t are each independently 0 or an
integer of from 1 to 5, provided that at least two of l, m, n, o,
p, q, r, s and t are non-not zero at any one time.
[0234] Preferably, R.sub.1 is methyl, R.sub.2 is H, or R.sub.1 and
R.sub.2 are methyl.
[0235] An even more preferred conjugate of the present invention is
the one that comprises the anti-EphA antibody 37.3D7, 37.1F5,
53.2H11, EphA2-N1 or EphA2-N2 or a homologue or fragment thereof,
conjugated to a maytansinoid of formula (IX-L), (IX-D), or
(IX-D,L):
##STR00009##
[0236] wherein:
[0237] Y.sub.1 represents
(CR.sub.7R.sub.8).sub.l(CR.sub.5R.sub.6).sub.m(CR.sub.3R.sub.4).sub.nCR.s-
ub.1R.sub.2S--,
[0238] wherein: [0239] R.sub.1 and R.sub.2 are each independently
CH.sub.3, C.sub.2H.sub.5, linear alkyl or alkenyl having from 1 to
10 carbon atoms, branched or cyclic alkyl or alkenyl having from 3
to 10 carbon atoms, phenyl, substituted phenyl, heterocyclic
aromatic or heterocycloalkyl radical, and in addition R.sub.2 can
be H; [0240] R.sub.3, R.sub.4, R.sub.5, R.sub.6, R.sub.7 and
R.sub.8 are each independently H, CH.sub.3, C.sub.2H.sub.5, linear
alkyl or alkenyl having from 1 to 10 carbon atoms, branched or
cyclic alkyl or alkenyl having from 3 to 10 carbon atoms, phenyl,
substituted phenyl or heterocyclic aromatic or heterocycloalkyl
radical; [0241] l, m and n are each independently an integer of
from 1 to 5, and in addition n can be 0; and [0242] May represents
a maytansinol which bears the side chain at C-3, C-14
hydroxymethyl, C-15 hydroxy or C-20 desmethyl.
[0243] Preferred embodiments of formulas (IX-L), (IX-D) and
(IX-D,L) include compounds of formulas (IX-L), (IX-D) and (IX-D,L)
wherein: [0244] R.sub.1 is methyl, R.sub.2 is H, or R.sub.1 and
R.sub.2 are methyl, [0245] R.sub.1 is methyl, R.sub.2 is H,
R.sub.5, R.sub.6, R.sub.7 and R.sub.8 are each H; l and m are each
1; n is 0, [0246] R.sub.1 and R.sub.2 are methyl; R.sub.5, R.sub.6,
R.sub.7 and R.sub.8 are each H; l and m are 1; n is 0.
[0247] Preferably the cytotoxic agent is represented by formula
(IX-L).
[0248] A further preferred conjugate of the present invention is
the one that comprises the anti-EphA antibody 37.3D7, 37.1F5,
53.2H11, EphA2-N1 or EphA2-N2 or a homologue or fragment thereof,
conjugated to a maytansinoid of formula (X):
##STR00010##
[0249] wherein the substituents are as defined for formula (IX)
above.
[0250] Especially preferred are any of the above-described
compounds, wherein R.sub.1 is H, R.sub.2 is methyl, R.sub.5,
R.sub.6, R.sub.7 and R.sub.8 are each H, l and m are each 1, and n
is 0.
[0251] Further especially preferred are any of the above-described
compounds, wherein R.sub.1 and R.sub.2 are methyl, R.sub.5,
R.sub.6, R.sub.7, R.sub.8 are each H, l and m are 1, and n is 0
[0252] Further, the L-aminoacyl stereoisomer is preferred.
[0253] Each of the maytansinoids taught in pending U.S. patent
application Ser. No. 10/849,136, filed May 20, 2004, may also be
used in the cytotoxic conjugate of the present invention. The
entire disclosure of U.S. patent application Ser. No. 10/849,136 is
incorporated herein by reference.
[0254] Disulfide-Containing Linking Groups
[0255] In order to link the maytansinoid to a cell binding agent,
such as the 37.3D7, 37.1F5, 53.2H11, EphA2-N1 or EphA2-N2 antibody,
the maytansinoid comprises a linking moiety. The linking moiety
contains a chemical bond that allows for the release of fully
active maytansinoids at a particular site. Suitable chemical bonds
are well known in the art and include disulfide bonds, acid labile
bonds, photolabile bonds, peptidase labile bonds and esterase
labile bonds. Preferred are disulfide bonds.
[0256] The linking moiety also comprises a reactive chemical group.
In a preferred embodiment, the reactive chemical group can be
covalently bound to the maytansinoid via a disulfide bond linking
moiety.
[0257] Particularly preferred reactive chemical groups are
N-succinimidyl esters and N-sulfosuccinimidyl esters.
[0258] Particularly preferred maytansinoids comprising a linking
moiety that contains a reactive chemical group are C-3 esters of
maytansinol and its analogs where the linking moiety contains a
disulfide bond and the chemical reactive group comprises a
N-succinimidyl or N-sulfosuccinimidyl ester.
[0259] Many positions on maytansinoids can serve as the position to
chemically link the linking moiety. For example, the C-3 position
having a hydroxyl group, the C-14 position modified with
hydroxymethyl, the C-15 position modified with hydroxy and the C-20
position having a hydroxy group are all expected to be useful.
However the C-3 position is preferred and the C-3 position of
maytansinol is especially preferred.
[0260] While the synthesis of esters of maytansinol having a
linking moiety is described in terms of disulfide bond-containing
linking moieties, one of skill in the art will understand that
linking moieties with other chemical bonds (as described above) can
also be used with the present invention, as can other
maytansinoids. Specific examples of other chemical bonds include
acid labile bonds, photolabile bonds, peptidase labile bonds and
esterase labile bonds. The disclosure of U.S. Pat. No. 5,208,020,
incorporated herein, teaches the production of maytansinoids
bearing such bonds.
[0261] The synthesis of maytansinoids and maytansinoid derivatives
having a disulfide moiety that bears a reactive group is described
in U.S. Pat. Nos. 6,441,163 and 6,333,410, and U.S. application
Ser. No. 10/161,651, each of which is herein incorporated by
reference.
[0262] The reactive group-containing maytansinoids, such as DM1,
are reacted with an antibody, such as the 37.3D7, 37.1F5, 53.2H11,
EphA2-N1 or EphA2-N2 antibody, to produce cytotoxic conjugates.
These conjugates may be purified by HPLC or by gel-filtration.
[0263] Several excellent schemes for producing such
antibody-maytansinoid conjugates are provided in U.S. Pat. No.
6,333,410, and U.S. application Ser. Nos. 09/867,598, 10/161,651
and 10/024,290, each of which is incorporated herein in its
entirety.
[0264] In general, a solution of an antibody in aqueous buffer may
be incubated with a molar excess of maytansinoids having a
disulfide moiety that bears a reactive group. The reaction mixture
can be quenched by addition of excess amine (such as ethanolamine,
taurine, etc.). The maytansinoid-antibody conjugate may then be
purified by gel-filtration.
[0265] The number of maytansinoid molecules bound per antibody
molecule can be determined by measuring spectrophotometrically the
ratio of the absorbance at 252 nm and 280 nm. An average of 1-10
maytansinoid molecules/antibody molecule is preferred. [0266]
Conjugates of antibodies with maytansinoid drugs can be evaluated
for their ability to suppress proliferation of various unwanted
cell lines in vitro. For example, cell lines such as the human
epidermoid carcinoma line A-431, the human small cell lung cancer
cell line SW2, the human breast tumor line SKBR3 and the Burkitt's
lymphoma cell line Namalwa can easily be used for the assessment of
cytotoxicity of these compounds. Cells to be evaluated can be
exposed to the compounds for 24 hours and the surviving fractions
of cells measured in direct assays by known methods. IC.sub.50
values can then be calculated from the results of the assays.
[0267] PEG-Containing Linking Groups
[0268] Maytansinoids may also be linked to cell binding agents
using PEG linking groups, as set forth in U.S. application Ser. No.
10/024,290. These PEG linking groups are soluble both in water and
in non-aqueous solvents, and can be used to join one or more
cytotoxic agents to a cell binding agent. Exemplary PEG linking
groups include hetero-bifunctional PEG linkers that bind to
cytotoxic agents and cell binding agents at opposite ends of the
linkers through a functional sulfhydryl or disulfide group at one
end, and an active ester at the other end.
[0269] As a general example of the synthesis of a cytotoxic
conjugate using a PEG linking group, reference is again made to
U.S. application Ser. No. 10/024,290 for specific details.
Synthesis begins with the reaction of one or more cytotoxic agents
bearing a reactive PEG moiety with a cell-binding agent, resulting
in displacement of the terminal active ester of each reactive PEG
moiety by an amino acid residue of the cell binding agent, such as
the 37.3D7, 37.1F5, 53.2H11, EphA2-N1 or EphA2-N2 antibody, to
yield a cytotoxic conjugate comprising one or more cytotoxic agents
covalently bonded to a cell binding agent through a PEG linking
group.
[0270] Taxanes
[0271] The cytotoxic agent used in the cytotoxic conjugates
according to the present invention may also be a taxane or
derivative thereof.
[0272] Taxanes are a family of compounds that includes paclitaxel
(taxol), a cytotoxic natural product, and docetaxel (Taxotere), a
semi-synthetic derivative, two compounds that are widely used in
the treatment of cancer. Taxanes are mitotic-spindle poisons that
inhibit the depolymerization of tubulin, resulting in cell death.
While docetaxel and paclitaxel are useful agents in the treatment
of cancer, their antitumor activity is limited because of their
non-specific toxicity towards normal cells. Further, compounds like
paclitaxel and docetaxel themselves are not sufficiently potent to
be used in conjugates of cell binding agents.
[0273] A preferred taxane for use in the preparation of cytotoxic
conjugates is the taxane of formula (XI):
##STR00011##
[0274] Methods for synthesizing taxanes that may be used in the
cytotoxic conjugates of the present invention, along with methods
for conjugating the taxanes to a cell binding agent, such as the
37.3D7, 37.1F5, 53.2H11, EphA2-N1 or EphA2-N2 antibody, are
described in detail in U.S. Pat. Nos. 5,416,064, 5,475,092,
6,340,701, 6,372,738 and 6,436,931, and in U.S. application Ser.
Nos. 10/024,290, 10/144,042, 10/207,814, 10/210,112 and
10/369,563.
[0275] Tomaymycin Derivatives
[0276] The cytotoxic according to the present invention may also a
tomaymycin derivative. Tomaymycin derivatives are
pyrrolo[1,4]benzodiazepines (PBDs), a known class of compounds
exerting their biological properties by covalently binding to the
N2 of guanine in the minor groove of DNA. PBDs include a number of
minor groove binders such as anthramycin, neothramycin and
DC-81.
[0277] Novel tomaymycin derivatives that retain high cytotoxicity
and that can be effectively linked to cell binding agents are
described in the International Application No. PCT/IB2007/000142,
whose content is herein incorporated by reference. The cell binding
agent-tomaymycin derivative complexes permit the full measure of
the cytotoxic action of the tomaymycin derivatives to be applied in
a targeted fashion against unwanted cells only, therefore avoiding
side effects due to damage to non-targeted healthy cells.
[0278] The cytotoxic agent according to the present invention
comprises one or more tomaymycin derivatives, linked to a cell
binding agent, such as the 37.3D7, 37.1F5, 53.2H11, EphA2-N1 or
EphA2-N2 antibody, via a linking group. The linking group is part
of a chemical moiety that is covalently bound to a tomaymycin
derivative through conventional methods. In a preferred embodiment,
the chemical moiety can be covalently bound to the tomaymycin
derivative via a disulfide bond.
[0279] The tomaymycin derivatives useful in the present invention
have the formula (XII) shown below:
##STR00012##
[0280] wherein
[0281] ---- represents an optional single bond;
[0282] represents either a single bond or a double bond;
[0283] provided that when represents a single bond, U and U', the
same or different, independently represent H, and W and W', the
same or different, are independently selected from the group
consisting of OH, an ether such as --OR, an ester (e.g. an
acetate), such as --OCOR, a carbonate such as --OCOOR, a carbamate
such as --OCONRR', a cyclic carbamate, such that N10 and C11 are a
part of the cycle, a urea such as --NRCONRR', a thiocarbamate such
as --OCSNHR, a cyclic thiocarbamate such that N10 and C11 are a
part of the cycle, --SH, a sulfide such as --SR, a sulphoxide such
as --SOR, a sulfone such as --SOOR, a sulphonate such as --SO3-, a
sulfonamide such as --NRSOOR, an amine such as --NRR', optionally
cyclic amine such that N10 and C11 are a part of the cycle, a
hydroxylamine derivative such as --NROR', an amide such as --NRCOR,
an azido such as --N3, a cyano, a halo, a trialkyl or
triarylphosphonium, an aminoacid-derived group; Preferably W and W'
are the same or different and are OH, Ome, Oet, NHCONH.sub.2,
SMe;
[0284] and when represents a double bond, U and U' are absent and W
and W' represent H; [0285] R1, R2, R1', R2' are the same or
different and independently chosen from Halide or Alkyl optionally
substituted by one or more Hal, CN, NRR', CF.sub.3, OR, Aryl, Het,
S(O).sub.qR, or R1 and R2 and R1' and R2' form together a double
bond containing group .dbd.B and .dbd.B' respectively.
[0286] Preferably, R1 and R2 and R1' and R2' form together a double
bond containing group .dbd.B and .dbd.B' respectively. [0287] B and
B' are the same or different and independently chosen from Alkenyl
being optionally substituted by one or more Hal, CN, NRR',
CF.sub.3, OR, Aryl, Het, S(O).sub.qR or B and B' represent an
oxygen atom. [0288] Preferably, B.dbd.B'. [0289] More preferably,
B.dbd.B'.dbd..dbd.CH.sub.2 or .dbd.CH--CH.sub.3, [0290] X, X' are
the same or different and independently chosen from one or more
--O--, --NR--, --(C.dbd.O)--, --S(O).sub.q--. [0291] Preferably,
X.dbd.X'. [0292] More preferably, X.dbd.X'.dbd.O. [0293] A, A' are
the same or different and independently chosen from Alkyl or
Alkenyl optionally containing an oxygen, a nitrogen or a sulfur
atom, each being optionally substituted by one or more Hal, CN,
NRR', CF.sub.3, OR, S(O).sub.qR, Aryl, Het, Alkyl, Alkenyl. [0294]
Preferably, A=A'. [0295] More preferably, A=A'=linear unsubstituted
alkyl. [0296] Y, Y' are the same or different and independently
chosen from H, OR; [0297] Preferably, Y.dbd.Y'. [0298] More
preferably, Y.dbd.Y'=OAlkyl, more preferably OMethyl. [0299] T is
--NR--, --O--, --S(O).sub.q-, or a 4 to 10-membered aryl,
cycloalkyl, heterocyclic or heteroaryl, each being optionally
substituted by one or more Hal, CN, NRR', CF.sub.3, R, OR,
S(O).sub.qR, and/or linker(s), or a branched Alkyl, optionally
substituted by one or more Hal, CN, NRR', CF.sub.3, OR, S(O).sub.qR
and/or linker(s), or a linear Alkyl substituted by one or more Hal,
CN, NRR', CF.sub.3, OR, S(O).sub.qR and/or linker(s).
[0300] Preferably, T is a 4 to 10-membered aryl or heteroaryl, more
preferably phenyl or pyridyl, optionally substituted by one or more
linker(s).
[0301] Said linker comprises a linking group. Suitable linking
groups are well known in the art and include thiol, sulfide,
disulfide groups, thioether groups, acid labile groups, photolabile
groups, peptidase labile groups and esterase labile groups.
Preferred are disulfide groups and thioether groups.
[0302] When the linking group is a thiol-, sulfide (or so-called
thioether --S--) or disulfide (--S--S--)-- containing group, the
side chain carrying the thiol, the sulfide or disulfide group can
be linear or branched, aromatic or heterocyclic. One of ordinary
skill in the art can readily identify suitable side chains.
[0303] Preferably, said linker is of formula:
-G-D-(Z)p-S--Z'
[0304] where
[0305] G is a single or double bond, --O--, --S-- or --NR--;
[0306] D is a single bond or -E-, -E-NR--, -E-NR--F--, -E-O--,
-E-O--F--, -E-NR--CO--, -E-NR--CO--F--, -E-CO--, --CO-E-, -E-CO--F,
-E-S--, -E-S--F--, -E-NR--C--S--, -E-NR--CS--F--;
[0307] where E and F are the same or different and are
independently chosen from linear or branched
--(OCH2CH2)iAlkyl(OCH2CH2)j-, -Alkyl(OCH2CH2)i-Alkyl-,
--(OCH2CH2)i-, --(OCH2CH2)iCycloalkyl(OCH2CH2)j-,
--(OCH2CH2)iHeterocyclic(OCH2CH2)j-, --(OCH2CH2)iAryl(OCH2CH2)j-,
--(OCH2CH2)iHeteroaryl(OCH2CH2)j-,
-Alkyl-(OCH2CH2)iAlkyl(OCH2CH2)j-, -Alkyl-(OCH2CH2)i-,
-Alkyl-(OCH2CH2)iCycloalkyl(OCH2CH2)j-,
-Alkyl(OCH2CH2)iHeterocyclic(OCH2CH2)j-,
-Alkyl-(OCH2CH2)iAryl(OCH2CH2)j-,
-Alkyl(OCH2CH2)iHeteroaryl(OCH2CH2)j-, -Cycloalkyl-Alkyl-,
-Alkyl-Cycloalkyl-, -Heterocyclic-Alkyl-, -Alkyl-Heterocyclic-,
-Alkyl-Aryl-, -Aryl-Alkyl-, -Alkyl-Heteroaryl-,
-Heteroaryl-Alkyl-;
[0308] where i and j, identical or different are integers and
independently chosen from 0, 1 to 2000;
[0309] Z is linear or branched -Alkyl-;
[0310] p is 0 or 1;
[0311] Z' represents H, a thiol protecting group such as COR, R20
or SR20, wherein R20 represents H, methyl, Alkyl, optionally
substituted Cycloalkyl, aryl, heteroaryl or heterocyclic, provided
that when Z' is H, said compound is in equilibrium with the
corresponding compound formed by intramolecular cyclisation
resulting from addition of the thiol group --SH on the imine bond
--NH.dbd. of one of the PBD moieties. [0312] n, n', equal or
different are 0 or 1. [0313] q is 0, 1 or 2. [0314] R, R' are equal
or different and independently chosen from H, Alkyl, Aryl, each
being optionally substituted by Hal, CN, NRR', CF3, R, OR, S(O)qR,
Aryl, Het;
[0315] or their pharmaceutically acceptable salts, hydrates, or
hydrated salts, or the polymorphic crystalline structures of these
compounds or their optical isomers, racemates, diastereomers or
enantiomers.
[0316] The compounds of the general formula (XII) having
geometrical and stereoisomers are also a part of the invention.
[0317] The N-10, C-11 double bond of tomaymycin derivatives of
formula (XII) is known to be readily convertible in a reversible
manner to corresponding imine adducts in the presence of water, an
alcohol, a thiol, a primary or secondary amine, urea and other
nucleophiles. This process is reversible and can easily regenerate
the corresponding tomaymycin derivatives in the presence of a
dehydrating agent, in a non-protic organic solvant, in vacuum or at
high temperatures (Z. Tozuka, 1983, J. Antibiotics, 36: 276).
[0318] Thus, reversible derivatives of tomaymycin derivatives of
general formula (XIII) can also be used in the present
invention:
##STR00013##
[0319] where A, X, Y, n, T, A', X', Y', n', R1, R2, R1', R2' are
defined as in formula (XII) and W, W' are the same or different and
are selected from the group consisting of OH, an ether such as
--OR, an ester (e.g. an acetate), such as --OCOR, --COOR, a
carbonate such as --OCOOR, a carbamate such as --OCONRR', a cyclic
carbamate, such that N10 and C11 are a part of the cycle, a urea
such as --NRCONRR', a thiocarbamate such as --OCSNHR, a cyclic
thiocarbamate such that N10 and C11 are a part of the cycle, --SH,
a sulfide such as --SR, a sulphoxide such as --SOR, a sulfone such
as --SOOR, a sulphonate such as --SO3-, a sulfonamide such as
--NRSOOR, an amine such as --NRR', optionally cyclic amine such
that N10 and C11 are a part of the cycle, a hydroxylamine
derivative such as --NROR', an amide such as --NRCOR, --NRCONRR',
an azido such as --N3, a cyano, a halo, a trialkyl or
triarylphosphonium, an aminoacid-derived group. Preferably, W and
W' are the same or different and are OH, Ome, Oet, NHCONH2,
SMe.
[0320] Compounds of formula (XIII) may thus be considered as
solvates, including water when the solvent is water; these solvates
can be particularly useful.
[0321] In a preferred embodiment, the tomaymycin derivatives of the
invention are selected from the group consisting in: [0322]
8,8'-[1,3-benzenediylbis(methyleneoxy)]-bis[(S)-2-eth-(E)-ylidene-7-metho-
xy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
[0323]
8,8'-[5-methoxy-1,3-benzenediylbis(methyleneoxy)]-bis[(S)-2-eth-(E)-ylide-
ne-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-
e] [0324]
8,8'-[1,5-pentanediylbis(oxy)]-bis[(S)-2-eth-(E)-ylidene-7-metho-
xy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
[0325]
8,8'-[1,4-butanediylbis(oxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3,1-
1a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0326]
8,8'-[3-methyl-1,5-pentanediylbis(oxy)]-bis[(S)-2-eth-(E)-ylidene-7-metho-
xy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
[0327]
8,8'-[2,6-pyridinediylbis(oxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3-
,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0328]
8,8'-[4-(3-tert-butoxycarbonylaminopropyloxy)-2,6-pyridinediylbis-(methyl-
eneoxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrro-
lo[2,1-c][1,4]benzodiazepin-5-one] [0329]
8,8'-[5-(3-aminopropyloxy)-1,3-benzenediylbis(methyleneoxy)]-bis[(S)-2-et-
h-(E)-ylidene-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodi-
azepin-5-one] [0330]
8,8'-[5-(N-methyl-3-tert-butoxycarbonylaminopropyl)-1,3-benzenediylbis-(m-
ethyleneoxy)]-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3,11a-tetrahydro-5H--
pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0331]
8,8'-{5-[3-(4-methyl-4-methyldisulfanyl-pentanoylamino)propyloxy]-1,3-ben-
zenediylbis(methyleneoxy)}-bis[(S)-2-eth-(E)-ylidene-7-methoxy-1,2,3,11a-t-
etrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0332]
8,8'-[5-acetylthiomethyl-1,3-benzenediylbis(methyleneoxy)]-bis[(S)-2-meth-
ylene-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-
-one] [0333]
bis-{2-[(S)-2-methylene-7-methoxy-5-oxo-1,3,11a-tetrahydro-5H-pyrrolo[2,1-
-c][1,4]benzodiazepin-8-yloxy]-ethyl}-carbamic acid tert-butyl
ester [0334]
8,8'-[3-(2-acetylthioethyl)-1,5-pentanediylbis(oxy)]-bis[(S)-2-met-
hylene-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin--
5-one] [0335]
8,8'-[5-(N-4-mercapto-4,4-dimethylbutanoyl)amino-1,3-benzenediylbis(methy-
leneoxy)]-bis[7-methoxy-2-methylene-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c]-
[1,4]benzodiazepin-5-one] [0336]
8,8'-[5-(N-4-methyldithio-4,4-dimethylbutanoyl)-amino-1,3-benzenediylbis(-
methyleneoxy)]-bis[7-methoxy-2-methylene-1,2,3,11a-tetrahydro-5H-pyrrolo[2-
,1-c][1,4]benzodiazepin-5-one] [0337]
8,8'-[5-(N-methyl-N-(2-mercapto-2,2-dimethylethyl)amino-1,3-benzenediyl(m-
ethyleneoxy)]-bis[7-methoxy-2-methylene-1,2,3,11a-tetrahydro-5H-pyrrolo[2,-
1-c][1,4]benzodiazepin-5-one] [0338]
8,8'-[5-(N-methyl-N-(2-methyldithio-2,2-dimethylethyl)amino-1,3-benzenedi-
yl(methyleneoxy)]-bis[7-methoxy-2-methylene-1,2,3,11a-tetrahydro-5H-pyrrol-
o[2,1-c][1,4]benzodiazepin-5-one] [0339]
8,8'-[(4-(2-(4-mercapto-4-methyl)-pentanamido-ethoxy)-pyridin-2,6-dimethy-
l)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-pyrro-
lo[2,1-c][1,4]benzodiazepin-5-one] [0340]
8,8'-[(1-(2-(4-methyl-4-methyldisulfanyl)-pentanamido-ethoxy)-benzene-3,5-
-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahyd-
ro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0341]
8,8'-[(4-(3-(4-methyl-4-methyldisulfanyl)-pentanamido-propoxy)-pyridin-2,-
6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahy-
dro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0342]
8,8'-[(4-(4-(4-methyl-4-methyldisulfanyl)-pentanamido-butoxy)-pyridin-2,6-
-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahyd-
ro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0343]
8,8'-[(4-(3-[4-(4-methyl-4-methyldisulfanyl-pentanoyl)-piperazin-1-yl]-pr-
opyl)-pyridin-2,6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1-
,2,3,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0344]
8,8'-[(1-(3-[4-(4-methyl-4-methyldisulfanyl-pentanoyl)-piperazin-1-yl]-pr-
opyl)-benzene-3,5-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1-
,2,3,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0345]
8,8'-[(4-(2-{2-[2-(4-methyl-4-methyldisulfanyl-pentanoylamino)-ethoxy]-et-
hoxy}-ethoxy)-pyridin-2,6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dim-
ethoxy-1,2,3,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
[0346]
8,8'-[(1-(2-{2-[2-(2-{2-[2-(4-methyl-4-methyldisulfanyl-pentanoylamino)-e-
thoxy]-ethoxy}-ethoxy)-ethoxy]ethoxy}-ethoxy)-benzene-3,5-dimethyl)-dioxy]-
-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-pyrrolo[2,1-c]-
[1,4]benzodiazepin-5-one] [0347]
8,8'-[(1-(2-{2-[2-(4-methyl-4-methyldisulfanyl-pentanoylamino)-ethoxy]eth-
oxy}-ethoxy)-benzene-3,5-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dime-
thoxy-1,2,3,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one]
[0348]
8,8'-[(4-(2-{2-[2-(2-{2-[2-(4-methyl-4-methyldisulfanyl-pentanoylamino)-e-
thoxy]-ethoxy}-ethoxy)-ethoxy]ethoxy}-ethoxy)-pyridin-2,6-dimethyl)-dioxy]-
-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-pyrrolo[2,1-c]-
[1,4]benzodiazepin-5-one] [0349]
8,8'-[(1-(2-[methyl-(2-methyl-2-methyldisulfanyl-propyl)-amino]-ethoxy)-b-
enzene-3,5-di
methyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-
-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0350]
8,8'-[(4-(3-[methyl-(4-methyl-4-methyldisulfanyl-pentanoyl)-amino]-propyl-
)-pyridin-2,6-dimethyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3-
,11a-tetrahydro-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0351]
8,8'-[(4-(3-[methyl-(2-methyl-2-methyldisulfanyl-propyl)-amino]propyl)-py-
ridin-2,6-di
methyl)-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-
-pyrrolo[2,1-c][1,4]benzodiazepin-5-one] [0352]
8,8'-[(1-(4-methyl-4-methyldisulfanyl)-pentanamido)-benzene-3,5-dimethyl)-
-dioxy]-bis[(S)-2-eth-(E)-ylidene-7-dimethoxy-1,2,3,11a-tetrahydro-pyrrolo-
[2,1-c][1,4]benzodiazepin-5-one]
[0353] as well as the corresponding mercapto derivatives, or their
pharmaceutically acceptable salts, hydrates, or hydrated salts, or
the polymorphic crystalline structures of these compounds or their
optical isomers, racemates, diastereomers or enantiomers.
[0354] Preferred compounds are those of formula:
##STR00014##
[0355] where X, X', A, A', Y, Y', T, n, n' are defined as
above.
[0356] The compounds of formula (XII) may be prepared in a number
of ways well known to those skilled in the art. The compounds can
be synthesized, for example, by application or adaptation of the
methods described below, or variations thereon as appreciated by
the skilled artisan. The appropriate modifications and
substitutions will be readily apparent and well known or readily
obtainable from the scientific literature to those skilled in the
art. In particular, such methods can be found in R. C. Larock,
Comprehensive Organic Transformations, Wiley-VCH Publishers,
1999.
[0357] Methods for synthesizing the tomaymycin derivatives which
may be used in the invention are described in the International
Application No. PCT/IB2007/000142. Compounds of the present
invention may be prepared by a variety of synthetic routes. The
reagents and starting materials are commercially available, or
readily synthesized by well-known techniques by one of ordinary
skill in the arts (see, for example, WO 00/12508, WO 00/12507, WO
2005/040170, WO 2005/085260, FR1516743, M. Mori et al., 1986,
Tetrahedron, 42: 3793-3806).
[0358] The conjugate molecules of the invention may be formed using
any techniques. The tomaymycin derivatives of the invention may be
linked to an antibody or other cell binding agent via an acid
labile linker, or by a photolabile linker. The derivatives can be
condensed with a peptide having a suitable sequence and
subsequently linked to a cell binding agent to produce a peptidase
labile linker. The conjugates can be prepared to contain a primary
hydroxyl group, which can be succinylated and linked to a cell
binding agent to produce a conjugate that can be cleaved by
intracellular esterases to liberate free derivative. Preferably,
the derivatives are synthesized to contain a free or protected
thiol group, and then one or more disulfide or thiol-containing
derivatives are each covalently linked to the cell binding agent
via a disulfide bond or a thioether link.
[0359] Numerous methods of conjugation are taught in U.S. Pat. No.
5,416,064 and U.S. Pat. No. 5,475,092. The tomaymycin derivatives
can be modified to yield a free amino group and then linked to an
antibody or other cell binding agent via an acid labile linker or a
photolabile linker. The tomaymycin derivatives with a free amino or
carboxyl group can be condensed with a peptide and subsequently
linked to a cell binding agent to produce a peptidase labile
linker. The tomaymycin derivatives with a free hydroxyl group on
the linker can be succinylated and linked to a cell binding agent
to produce a conjugate that can be cleaved by intracellular
esterases to liberate free drug. Most preferably, the tomaymycin
derivatives are treated to create a free or protected thiol group,
and then the disulfide- or thiol containing tomaymycin dimers are
linked to the cell binding agent via disulfide bonds.
[0360] Preferably, monoclonal antibody- or cell binding
agent-tomaymycin derivative conjugates are those that are joined
via a disulfide bond, as discussed above, that are capable of
delivering tomaymycin derivatives. Such cell binding conjugates are
prepared by known methods such as by modifying monoclonal
antibodies with succinimidyl pyridyl-dithiopropionate (SPDP)
(Carlsson et al., 1978, Biochem. J., 173: 723-737). The resulting
thiopyridyl group is then displaced by treatment with
thiol-containing tomaymycin derivatives to produce disulfide linked
conjugates. Alternatively, in the case of the aryldithio-tomaymycin
derivatives, the formation of the cell binding conjugate is
effected by direct displacement of the aryl-thiol of the tomaymycin
derivative by sulfhydryl groups previously introduced into antibody
molecules. Conjugates containing 1 to 10 tomaymycin derivative
drugs linked via a disulfide bridge are readily prepared by either
method.
[0361] More specifically, a solution of the dithio-nitropyridyl
modified antibody at a concentration of 2.5 mg/ml in 0.05 M
potassium phosphate buffer, at pH 7.5 containing 2 mM EDTA is
treated with the thiol-containing tomaymycin derivative (1.3 molar
eq./dithiopyridyl group). The release of thio-nitropyridine from
the modified antibody is monitored spectrophotometrically at 325 nm
and is complete in about 16 hours. The antibody-tomaymycin
derivative conjugate is purified and freed of unreacted drug and
other low molecular weight material by gel filtration through a
column of Sephadex G-25 or Sephacryl S300. The number of tomaymycin
derivative moieties bound per antibody molecule can be determined
by measuring the ratio of the absorbance at 230 nm and 275 nm. An
average of 1-10 tomaymycin derivative molecules/antibody molecule
can be linked via disulfide bonds by this method.
[0362] The effect of conjugation on binding affinity towards the
antigen-expressing cells can be determined using the methods
previously described by Liu et al., 1996, Proc. Natl. Acad. Sci.
U.S.A., 93: 8618-8623. Cytotoxicity of the tomaymycin derivatives
and their antibody conjugates to cell lines can be measured by
back-extrapolation of cell proliferation curves as described in
Goldmacher et al., 1985, J. Immunol., 135: 3648-3651. Cytotoxicity
of these compounds to adherent cell lines can be determined by
clonogenic assays as described in Goldmacher et al., 1986, J. Cell
Biol., 102: 1312-1319.
[0363] Leptomycin Derivatives
[0364] The cytotoxic according to the present invention may also a
leptomycin derivative. According to the present invention,
"leptomycin derivatives" refer to members of the leptomycin family
as defined in Kalesse et al. (2002, Synthesis 8: 981-1003), and
includes: leptomycins, such as leptomycin A and leptomycin B,
callystatins, ratjadones such as ratjadone A and ratjadone B,
anguinomycins such as anguinomycin A, B, C, D, kasusamycins,
leptolstatin, leptofuranins, such as leptofuranin A, B, C, D.
Derivatives of leptomycin A and B are preferred.
[0365] More specifically, the derivatives of the invention are of
formula (I):
##STR00015##
[0366] wherein
[0367] Ra and Ra' are H or -Alk; preferably Ra is -Alk, preferably
methyl and Ra' is H;
[0368] R17 is alkyl optionally substituted by OR, CN, NRR',
perfluoroalkyl; preferably, R17 is alkyl, more preferably methyl or
ethyl;
[0369] R9 is alkyl optionally substituted by OR, CN, NRR',
perfluoroalkyl; preferably, R9 is alkyl, more preferably
methyl;
[0370] X is --O-- or --NR--; preferably, X is --NR--;
[0371] Y is --U--, --NR--U--, --O--U--, --NR--CO--U--,
--U--NR--CO--, --U--CO--, --CO--U--;
[0372] preferably, when X is --O--, Y is --U--, --NR--U--,
--U--NR--CO--;
[0373] where U is chosen from linear or branched -Alk-,
-Alk(OCH.sub.2CH.sub.2).sub.m--, --(OCH.sub.2CH.sub.2).sub.m-Alk-,
-Alk(OCH.sub.2CH.sub.2).sub.m-Alk-, --(OCH.sub.2CH.sub.2).sub.m--,
-Cycloalkyl-, -Heterocyclic-, -Cycloalkyl-Alk-, -Alk-Cycloalkyl-,
-Heterocyclic-Alk-, -Alk-Heterocyclic-;
[0374] where m is an integer chosen from 1 to 2000;
[0375] preferably, U is linear or branched -Alk-,
[0376] Z is -Alk-;
[0377] n is 0 or 1; preferably n is 0;
[0378] T represents H, a thiol protecting group such as Ac, R.sub.1
or SR.sub.1, wherein R.sub.1 represents H, methyl, Alk, Cycloalkyl,
optionally substituted aryl or heterocyclic, or T represents
##STR00016##
[0379] where:
[0380] Ra, Ra', R17, R9, X, Y, Z, n are defined as above;
[0381] preferably, T is H or SR.sub.1, wherein R.sub.1 represents
Alk, more preferably methyl;
[0382] R, R' identical or different are H or alkyl;
[0383] Alk represents a linear or branched alkyl; preferably Alk
represents (--(CH.sub.2-q(CH.sub.3).sub.q).sub.p-- where p
represents an integer from 1 to 10; and q represents an integer
from 0 to 2; preferably, Alk represents --(CH.sub.2)-- ou
--C(CH.sub.3).sub.2--.
[0384] or their pharmaceutically acceptable salts, hydrates, or
hydrated salts, or the polymorphic crystalline structures of these
compounds or their optical isomers, racemates, diastereomers or
enantiomers.
[0385] Preferred compounds may be chosen from: [0386]
(2-Methylsulfanyl-ethyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-Hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid [0387] Bis-[(2-mercaptoethyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid] [0388] (2-Mercapto-ethyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid [0389] (2-Methyldisulfanyl-ethyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid [0390] (2-Methyl-2-methyldisulfanyl-propyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid [0391] (2-Mercapto-2-methyl-propyl)-amid of
(2E,10E,12E,16Z,18E)-(R)-6-hydroxy-3,5,7,9,11,15,17-heptamethyl-19-((2S,3-
S)-3-methyl-6-oxo-3,6-dihydro-2H-pyran-2-yl)-8-oxo-nonadeca-2,10,12,16,18--
pentaenoic acid
[0392] or their pharmaceutically acceptable salts, hydrates, or
hydrated salts, or the polymorphic crystalline structures of these
compounds or their optical isomers, racemates, diastereomers or
enantiomers.
[0393] In order to link the derivative to a cell-binding agent, the
derivative must include a moiety (linking group) that allows the
derivatives to be linked to a cell binding agent via a linkage such
as a disulfide bond, a sulfide (or called herein thioether) bond,
an acid-labile group, a photo-labile group, a peptidase-labile
group, or an esterase-labile group. The derivatives are prepared so
that they contain a moiety necessary to link the leptomycin
derivative to a cell binding agent via, for example, a disulfide
bond, a thioether bond, an acid-labile group, a photo-labile group,
a peptidase-labile group, or an esterase-labile group. In order to
further enhance solubility in aqueous solutions, the linking group
can contain a polyethylene glycol spacer. Preferably, a sulfide or
disulfide linkage is used because the reducing environment of the
targeted cell results in cleavage of the sulfide or disulfide and
release of the derivatives with an associated increase in
cytotoxicity.
[0394] Compounds of the present invention may be prepared by a
variety of synthetic routes. The reagents and starting materials
are commercially available, or readily synthesized by well-known
techniques by one of ordinary skill in the art. Methods for
synthesizing leptomycin derivatives that may be used in the
cytotoxic conjugates of the present invention, along with methods
for conjugating said leptomycin derivatives to cell binding agents
such as antibodies, are described in detail in in European Patent
Application No. 06290948.6, whose content is incorporated herein by
reference.
[0395] CC-1065 Analogues
[0396] The cytotoxic agent used in the cytotoxic conjugates
according to the present invention may also be CC-1065 or a
derivative thereof.
[0397] CC-1065 is a potent anti-tumor antibiotic isolated from the
culture broth of Streptomyces zelensis. CC-1065 is about 1000-fold
more potent in vitro than are commonly used anti-cancer drugs, such
as doxorubicin, methotrexate and vincristine (B. K. Bhuyan et al.,
1982, Cancer Res., 42, 3532-3537). CC-1065 and its analogs are
disclosed in U.S. Pat. Nos. 6,372,738, 6,340,701, 5,846,545 and
5,585,499.
[0398] The cytotoxic potency of CC-1065 has been correlated with
its alkylating activity and its DNA-binding or DNA-intercalating
activity. These two activities reside in separate parts of the
molecule. Thus, the alkylating activity is contained in the
cyclopropapyrroloindole (CPI) subunit and the DNA-binding activity
resides in the two pyrroloindole subunits.
[0399] Although CC-1065 has certain attractive features as a
cytotoxic agent, it has limitations in therapeutic use.
Administration of CC-1065 to mice caused a delayed hepatotoxicity
leading to mortality on day 50 after a single intravenous dose of
12.5 .mu.g/kg (V. L. Reynolds et al., 1986, J. Antibiotics, XXIX:
319-334). This has spurred efforts to develop analogs that do not
cause delayed toxicity, and the synthesis of simpler analogs
modeled on CC-1065 has been described (M. A. Warpehoski et al.,
1988, J. Med. Chem., 31: 590-603).
[0400] In another series of analogs, the CPI moiety was replaced by
a cyclopropabenzindole (CBI) moiety (D. L. Boger et al., 1990, J.
Org. Chem., 55: 5823-5833; D. L. Boger et al., 1991, BioOrg. Med.
Chem. Lett., 1: 115-120). These compounds maintain the high in
vitro potency of the parental drug, without causing delayed
toxicity in mice. Like CC-1065, these compounds are alkylating
agents that bind to the minor groove of DNA in a covalent manner to
cause cell death. However, clinical evaluation of the most
promising analogs, Adozelesin and Carzelesin, has led to
disappointing results (B. F. Foster et al., 1996, Investigational
New Drugs, 13: 321-326; I. Wolff et al., 1996, Clin. Cancer Res.,
2: 1717-1723). These drugs display poor therapeutic effects because
of their high systemic toxicity.
[0401] The therapeutic efficacy of CC-1065 analogs can be greatly
improved by changing the in vivo distribution through targeted
delivery to the tumor site, resulting in lower toxicity to
non-targeted tissues, and thus, lower systemic toxicity. In order
to achieve this goal, conjugates of analogs and derivatives of
CC-1065 with cell-binding agents that specifically target tumor
cells have been described (U.S. Pat. Nos. 5,475,092; 5,585,499;
5,846,545). These conjugates typically display high target-specific
cytotoxicity in vitro, and exceptional anti-tumor activity in human
tumor xenograft models in mice (R. V. J. Chari et al., 1995, Cancer
Res., 55: 4079-4084).
[0402] Recently, prodrugs of CC-1065 analogs with enhanced
solubility in aqueous medium have been described (European Patent
Application No. 06290379.4). In these prodrugs, the phenolic group
of the alkylating portion of the molecule is protected with a
functionality that renders the drug stable upon storage in acidic
aqueous solution, and confers increased water solubility to the
drug compared to an unprotected analog. The protecting group is
readily cleaved in vivo at physiological pH to give the
corresponding active drug. In the prodrugs described in EP
06290379.4, the phenolic substituent is protected as a sulfonic
acid containing phenyl carbamate which possesses a charge at
physiological pH, and thus has enhanced water solubility. In order
to further enhance water solubility, an optional polyethylene
glycol spacer can be introduced into the linker between the indolyl
subunit and the cleavable linkage such as a disulfide group. The
introduction of this spacer does not alter the potency of the
drug.
[0403] Methods for synthesizing CC-1065 analogs that may be used in
the cytotoxic conjugates of the present invention, along with
methods for conjugating the analogs to cell binding agents such as
antibodies, are described in detail in EP 06290379.4 (whose content
is incorporated herein by reference) and U.S. Pat. Nos. 5,475,092,
5,846,545, 5,585,499, 6,534,660 and 6,586,618 and in U.S.
application Ser. Nos. 10/116,053 and 10/265,452.
[0404] Other Drugs
[0405] Drugs such as methotrexate, daunorubicin, doxorubicin,
vincristine, vinblastine, melphalan, mitomycin C, chlorambucil,
calicheamicin, tubulysin and tubulysin analogs, duocarmycin and
duocarmycin analogs, dolastatin and dolastatin analogs are also
suitable for the preparation of conjugates of the present
invention. The drug molecules can also be linked to the antibody
molecules through an intermediary carrier molecule such as serum
albumin. Doxarubicin and Danorubicin compounds, as described, for
example, in U.S. Pat. No. 6,630,579, may also be useful cytotoxic
agents.
[0406] Therapeutic Composition
[0407] The invention also relates to a therapeutic composition for
the treatment of a hyperproliferative disorder in a mammal which
comprises a therapeutically effective amount of a compound of the
invention and a pharmaceutically acceptable carrier. In one
embodiment said pharmaceutical composition is for the treatment of
cancer, including (but not limited to) the following: carcinoma,
including that of the bladder, breast, colon, kidney, liver, lung,
ovary, pancreas, stomach, cervix, thyroid and skin; including
squamous cell carcinoma; hematopoietic tumors of lymphoid lineage,
including leukemia, acute lymphocytic leukemia, acute lymphoblastic
leukemia, B-cell lymphoma, T-cell lymphoma, Burkitt's lymphoma;
hematopoietic tumors of myeloid lineage, including acute and
chronic myelogenous leukemias and promyelocytic leukemia; tumors of
mesenchymal origin, including fibrosarcoma and rhabdomyoscarcoma;
other tumors, including melanoma, seminoma, tetratocarcinoma,
neuroblastoma and glioma; tumors of the central and peripheral
nervous system, including astrocytoma, neuroblastoma, glioma, and
schwannomas; tumors of mesenchymal origin, including fibrosarcoma,
rhabdomyoscarama, and osteosarcoma; and other tumors, including
melanoma, xeroderma pigmentosum, keratoactanthoma, seminoma,
thyroid follicular cancer and teratocarcinoma, and other cancers
yet to be determined in which EphA is expressed predominantly. In a
preferred embodiment, the pharmaceutical compositions of the
invention are used for treatment of cancer of the lung, breast,
colon, prostate, kidney, pancreas, ovary, cervix and lymphatic
organs, osteosarcoma, synovial carcinoma, a sarcoma, head and neck,
a glioma, gastric, liver or other carcinomas in which EphA is
expressed. In particular, the cancer is a metastatic cancer. In
another embodiment, said pharmaceutical composition relates to
other disorders such as, for example, autoimmune diseases, such as
systemic lupus, rheumatoid arthritis, and multiple sclerosis; graft
rejections, such as renal transplant rejection, liver transplant
rejection, lung transplant rejection, cardiac transplant rejection,
and bone marrow transplant rejection; graft versus host disease;
viral infections, such as mV infection, HIV infection, AIDS, etc.;
and parasite infections, such as giardiasis, amoebiasis,
schistosomiasis, and others as determined by one of ordinary skill
in the art.
[0408] The instant invention provides pharmaceutical compositions
comprising: [0409] an effective amount of an antibody, antibody
fragment or antibody conjugate of the present invention, and [0410]
a pharmaceutically acceptable carrier, which may be inert or
physiologically active.
[0411] As used herein, "pharmaceutically-acceptable carriers"
includes any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, and the like that are
physiologically compatible. Examples of suitable carriers, diluents
and/or excipients include one or more of water, saline, phosphate
buffered saline, dextrose, glycerol, ethanol, and the like, as well
as combination thereof. In many cases, it will be preferable to
include isotonic agents, such as sugars, polyalcohols, or sodium
chloride in the composition. In particular, relevant examples of
suitable carrier include: (1) Dulbecco's phosphate buffered saline,
pH .about.7.4, containing or not containing about 1 mg/ml to 25
mg/ml human serum albumin, (2) 0.9% saline (0.9% w/v sodium
chloride (NaCl)), and (3) 5% (w/v) dextrose; and may also contain
an antioxidant such as tryptamine and a stabilizing agent such as
Tween 20.
[0412] The compositions herein may also contain a further
therapeutic agent, as necessary for the particular disorder being
treated. Preferably, the antibody, antibody fragment or antibody
conjugate of the present invention, and the supplementary active
compound will have complementary activities, that do not adversely
affect each other. In a preferred embodiment, the further
therapeutic agent is an antagonist of fibroblast-growth factor
(FGF), hepatocyte growth factor (HGF), tissue factor (TF), protein
C, protein S, platrelet-derived growth factor (PDGF), or HER2
receptor.
[0413] The compositions of the invention may be in a variety of
forms. These include for example liquid, semi-solid, and solid
dosage forms, but the preferred form depends on the intended mode
of administration and therapeutic application. Typical preferred
compositions are in the form of injectable or infusible solutions.
The preferred mode of administration is parenteral (e.g.
intravenous, intramuscular, intraperinoneal, subcutaneous). In a
preferred embodiment, the compositions of the invention are
administered intravenously as a bolus or by continuous infusion
over a period of time. In another preferred embodiment, they are
injected by intramuscular, subcutaneous, intra-articular,
intrasynovial, intratumoral, peritumoral, intralesional, or
perilesional routes, to exert local as well as systemic therapeutic
effects.
[0414] Sterile compositions for parenteral administration can be
prepared by incorporating the antibody, antibody fragment or
antibody conjugate of the present invention in the required amount
in the appropriate solvent, followed by sterilization by
microfiltration. As solvent or vehicle, there may be used water,
saline, phosphate buffered saline, dextrose, glycerol, ethanol, and
the like, as well as a combination thereof. In many cases, it will
be preferable to include isotonic agents, such as sugars,
polyalcohols, or sodium chloride in the composition. These
compositions may also contain adjuvants, in particular wetting,
isotonizing, emulsifying, dispersing and stabilizing agents.
Sterile compositions for parenteral administration may also be
prepared in the form of sterile solid compositions which may be
dissolved at the time of use in sterile water or any other
injectable sterile medium.
[0415] The antibody, antibody fragment or antibody conjugate of the
present invention may also be orally administered. As solid
compositions for oral administration, tablets, pills, powders
(gelatine capsules, sachets) or granules may be used. In these
compositions, the active ingredient according to the invention is
mixed with one or more inert diluents, such as starch, cellulose,
sucrose, lactose or silica, under an argon stream. These
compositions may also comprise substances other than diluents, for
example one or more lubricants such as magnesium stearate or talc,
a coloring, a coating (sugar-coated tablet) or a glaze.
[0416] As liquid compositions for oral administration, there may be
used pharmaceutically acceptable solutions, suspensions, emulsions,
syrups and elixirs containing inert diluents such as water,
ethanol, glycerol, vegetable oils or paraffin oil. These
compositions may comprise substances other than diluents, for
example wetting, sweetening, thickening, flavoring or stabilizing
products.
[0417] The doses depend on the desired effect, the duration of the
treatment and the route of administration used; they are generally
between 5 mg and 1000 mg per day orally for an adult with unit
doses ranging from 1 mg to 250 mg of active substance.
[0418] In general, the doctor will determine the appropriate dosage
depending on the age, weight and any other factors specific to the
subject to be treated.
[0419] Therapeutic Methods of Use
[0420] In another embodiment, the present invention provides a
method for inhibiting the EphA2 receptor activity by administering
an antibody which antagonizes said EphA2 receptor, to a patient in
need thereof. Any of the type of antibodies, antibody fragments, or
cytotoxic conjugates of the invention, may be used therapeutically.
The invention thus includes the use of antagonistic anti-EphA2
antibodies, fragments thereof, or cytotoxic conjugates thereof as
medicaments.
[0421] In a preferred embodiment, antibodies, antibody fragments,
or cytotoxic conjugates of the invention are used for the treatment
of a hyperproliferative disorder in a mammal. In a more preferred
embodiment, one of the pharmaceutical compositions disclosed above,
and which contains an antibody, antibody fragment, or cytotoxic
conjugate of the invention, is used for the treatment of a
hyperproliferative disorder in a mammal. In one embodiment, the
disorder is a cancer. In particular, the cancer is a metastatic
cancer. The antibodies, antibody fragments, and cytotoxic
conjugates of the invention can also be used to treat the
neovascularization of said cancer tumor.
[0422] Accordingly, the pharmaceutical compositions of the
invention are useful in the treatment or prevention of a variety of
cancers, including (but not limited to) the following: carcinoma,
including that of the bladder, breast, colon, kidney, liver, lung,
ovary, pancreas, stomach, cervix, thyroid and skin; including
squamous cell carcinoma; hematopoietic tumors of lymphoid lineage,
including leukemia, acute lymphocytic leukemia, acute lymphoblastic
leukemia, B-cell lymphoma, T-cell lymphoma, Burkitt's lymphoma;
hematopoietic tumors of myeloid lineage, including acute and
chronic myelogenous leukemias and promyelocytic leukemia; tumors of
mesenchymal origin, including fibrosarcoma and rhabdomyoscarcoma;
other tumors, including melanoma, seminoma, tetratocarcinoma,
neuroblastoma and glioma; tumors of the central and peripheral
nervous system, including astrocytoma, neuroblastoma, glioma, and
schwannomas; tumors of mesenchymal origin, including fibrosarcoma,
rhabdomyoscarama, and osteosarcoma; and other tumors, including
melanoma, xeroderma pigmentosum, keratoactanthoma, seminoma,
thyroid follicular cancer and teratocarcinoma, and other cancers
yet to be determined in which EphA is expressed predominantly. In a
preferred embodiment, the cancer is a cancer of the lung, breast,
colon, prostate, kidney, pancreas, uterus, ovary, cervix and
lymphatic organs, osteosarcoma, synovial carcinoma, a sarcoma, head
and neck, a glioma, gastric, liver or other carcinomas in which
EphA is expressed. In another embodiment, said pharmaceutical
composition relates to other disorders such as, for example,
autoimmune diseases, such as systemic lupus, rheumatoid arthritis,
and multiple sclerosis; graft rejections, such as renal transplant
rejection, liver transplant rejection, lung transplant rejection,
cardiac transplant rejection, and bone marrow transplant rejection;
graft versus host disease; viral infections, such as mV infection,
HIV infection, AIDS, etc.; and parasite infections, such as
giardiasis, amoebiasis, schistosomiasis, and others as determined
by one of ordinary skill in the art.
[0423] Similarly, the present invention provides a method for
inhibiting the growth of selected cell populations comprising
contacting target cells, or tissue containing target cells, with an
effective amount of an antibody, antibody fragment or antibody
conjugate of the present invention, or an antibody, antibody
fragment or a therapeutic agent comprising a cytotoxic conjugate,
either alone or in combination with other cytotoxic or therapeutic
agents.
[0424] The method for inhibiting the growth of selected cell
populations can be practiced in vitro, in vivo, or ex vivo. As used
herein, "inhibiting growth" means slowing the growth of a cell,
decreasing cell viability, causing the death of a cell, lysing a
cell and inducing cell death, whether over a short or long period
of time.
[0425] Examples of in vitro uses include treatments of autologous
bone marrow prior to their transplant into the same patient in
order to kill diseased or malignant cells; treatments of bone
marrow prior to its transplantation in order to kill competent T
cells and prevent graft-versus-host-disease (GVHD); treatments of
cell cultures in order to kill all cells except for desired
variants that do not express the target antigen; or to kill
variants that express undesired antigen.
[0426] The conditions of non-clinical in vitro use are readily
determined by one of ordinary skill in the art.
[0427] Examples of clinical ex vivo use are to remove tumor cells
or lymphoid cells from bone marrow prior to autologous
transplantation in cancer treatment or in treatment of autoimmune
disease, or to remove T cells and other lymphoid cells from
autologous or allogeneic bone marrow or tissue prior to transplant
in order to prevent graft versus host disease (GVHD). Treatment can
be carried out as follows. Bone marrow is harvested from the
patient or other individual and then incubated in medium containing
serum to which is added the cytotoxic agent of the invention.
Concentrations range from about 10 .mu.M to 1 pM, for about 30
minutes to about 48 hours at about 37.degree. C. The exact
conditions of concentration and time of incubation, i.e., the dose,
are readily determined by one of ordinary skill in the art. After
incubation the bone marrow cells are washed with medium containing
serum and returned to the patient by i.v. infusion according to
known methods. In circumstances where the patient receives other
treatment such as a course of ablative chemotherapy or total-body
irradiation between the time of harvest of the marrow and
reinfusion of the treated cells, the treated marrow cells are
stored frozen in liquid nitrogen using standard medical
equipment.
[0428] For clinical in vivo use, the antibody, the epitope-binding
antibody fragment, or the cytotoxic conjugate of the invention will
be supplied as solutions that are tested for sterility and for
endotoxin levels. Examples of suitable protocols of cytotoxic
conjugate administration are as follows. Conjugates are given
weekly for 4 weeks as an i.v. bolus each week. Bolus doses are
given in 50 to 100 ml of normal saline to which 5 to 10 ml of human
serum albumin can be added. Dosages will be 10 .mu.g to 100 mg per
administration, i.v. (range of 100 ng to 1 mg/kg per day). More
preferably, dosages will range from 50 .mu.g to 30 mg. Most
preferably, dosages will range from 1 mg to 20 mg. After four weeks
of treatment, the patient can continue to receive treatment on a
weekly basis. Specific clinical protocols with regard to route of
administration, excipients, diluents, dosages, times, etc., can be
determined by one of ordinary skill in the art as the clinical
situation warrants.
[0429] Diagnostic
[0430] The antibodies or antibody fragments of the invention can
also be used to detect EphA2 in a biological sample in vitro or in
vivo. In one embodiment, the anti-EphA2 of the invention are used
to determine the level of EphA2 in a tissue or in cells derived
from the tissue. In a preferred embodiment, the tissue is a
diseased tissue. In a preferred embodiment of the method, the
tissue is a tumor or a biopsy thereof. In a preferred embodiment of
the method, a tissue or a biopsy thereof is first excised from a
patient, and the levels of EphA2 in the tissue or biopsy can then
be determined in an immunoassay with the antibodies or antibody
fragments of the invention. The tissue or biopsy thereof can be
frozen or fixed. The same method can be used to determine other
properties of the EphA2 protein, such as its level of tyrosine
phosphorylation, cell surface levels, or cellular localization.
[0431] The above-described method can be used to diagnose a cancer
in a subject known to or suspected to have a cancer, wherein the
level of EphA2 measured in said patient is compared with that of a
normal reference subject or standard. Said method can then be used
to determine whether a tumor expresses EphA2, which may suggest
that the tumor will respond well to treatment with the antibodies,
antibody fragments or antibody conjugates of the present invention.
Preferrably, the tumor is a cancer of the lung, breast, colon,
prostate, kidney, pancreas, uterus, ovary, cervix and lymphatic
organs, osteosarcoma, synovial carcinoma, a sarcoma, a glioma,
gastric, liver, head and neck or other carcinomas in which EphA2 is
expressed, and other cancers yet to be determined in which EphA2 is
expressed predominantly.
[0432] The present invention further provides for monoclonal
antibodies, humanized antibodies and epitope-binding fragments
thereof that are further labeled for use in research or diagnostic
applications. In preferred embodiments, the label is a radiolabel,
a fluorophore, a chromophore, an imaging agent or a metal ion.
[0433] A method for diagnosis is also provided in which said
labeled antibodies or epitope-binding fragments thereof are
administered to a subject suspected of having a cancer, and the
distribution of the label within the body of the subject is
measured or monitored.
[0434] Kit
[0435] The present invention also includes kits, e.g., comprising a
described cytotoxic conjugate and instructions for the use of the
cytotoxic conjugate for killing of particular cell types. The
instructions may include directions for using the cytotoxic
conjugates in vitro, in vivo or ex vivo.
[0436] Typically, the kit will have a compartment containing the
cytotoxic conjugate. The cytotoxic conjugate may be in a
lyophilized form, liquid form, or other form amendable to being
included in a kit. The kit may also contain additional elements
needed to practice the method described on the instructions in the
kit, such a sterilized solution for reconstituting a lyophilized
powder, additional agents for combining with the cytotoxic
conjugate prior to administering to a patient, and tools that aid
in administering the conjugate to a patient.
EXAMPLES
Example 1
Generation of Anti-EphA2 Monoclonal Antibody Hybridomas
[0437] Four BALB/c VAF mice were immunized with human
EphA2-transfected 300-19 cells, a pre-B cell line derived from a
BALB/c mouse. The stably transfected cells over-expressing the
antigen were generated by transfection of 300-19 cells with the
full-length human EphA2 cDNA and selected for the high expression
clones by flow cytometry. Clone 4-6, a clone that highly expresses
the human EphA2 receptor on the cell surface, was selected as
immunogen for immunization of mice and for antibody screening of
hybridomas. The EphA2-transfected cells were maintained in the
selection medium containing G418 at a final concentration of 1
mg/mL and were tested for the EphA2 expression regularly using a
commercially available antibody.
[0438] The Balb/c mice were subcutaneously injected with
approximately 5.times.10.sup.6 EphA2-transfected 300-19 cells in
200 .mu.L of phosphate buffered saline (PBS) per mouse. The
injections are performed every 2-3 weeks by standard immunization
protocols used at ImmunoGen, Inc. Three days before cell fusion,
the mice were intraperitoneally boosted one more time with the same
dose of antigen, and sacrificed for the preparation of spleen cells
according to the standard protocols for animal use procedures on
the day of cell fusion.
[0439] The spleen was collected from the immunized mouse under
sterilized surgical conditions and was ground between two sterile
and frosted microscopic slides to obtain single cell suspension in
RPMI-1640 medium. The splenocytes were pelleted and washed twice
with RPMI-1640 medium before cell fusion. The spleen cells were
mixed and fused with murine myeloma P3X63Ag8.653 cells (Kearney, J.
F. et al., 1979. J. Immunol., 123: 1548-1550) using polyethylene
glycol-1500 as fusogen (Roche 783 641). After cell fusion and
centrifugation, the cells were suspended in complete RPMI-1640
medium (200 mL) containing hypoxanthine-aminopterin-thymidine (HAT)
supplement (Sigma H-0262), and were plated into ten 96-well
flat-bottomed plates (Corning-Costar 3596, 200 .mu.L of cell
suspension per well). Following incubation at 37.degree. C., 5%
CO.sub.2 for 5 days, 100 .mu.L of culture supernatant were removed
from each well of the plates and replaced with an equal volume of
complete RPMI-1640 medium containing hypoxanthine-thymidine (HT)
supplement (Sigma H-0137). The incubation (in an atmosphere of 5%
CO.sub.2 at 37.degree. C.) was continued until hybridoma clones had
grown large enough colonies for antibody screening.
[0440] On day 10 post-fusion when hybridoma cells had grown to half
confluence in the wells and the supernatant had changed to an
orange color, hybridoma supernatants were sampled from the fusion
plates for antibody screening by immunoassays. For preliminary
screening, hybridoma supernatants were tested on EphA2-transfected
cells vs. the parental 300-19 cells by flow cytometry. Cells were
stained with 50 .mu.L of hybridoma supernatant, followed by
incubation with fluorescein-goat anti-mouse IgG (H+L) conjugate,
and analyzed by flow cytometry with Becton Dickinson FACSCalibur or
FACSArray machine. Hybridoma clones that analyzed positive for
EphA2-transfected cells but negative for 300-19 cells were
selected, expanded, frozen for storage, or subcloned by limiting
dilutions to attain a monoclonal population. The specific
antibodies secreted by hybridoma cells were isotyped using
commercially available isotyping reagents (Roche 1493027).
[0441] Based on flow cytometric data, 29 hybridoma clones, which
were specifically reactive with human EphA2-transfected cells but
not with the parental 300-19 cells, were identified and selected
from the immunization of mice with human EphA2 antigens.
Example 2
Binding Characterization of Anti-EphA2 Antibodies, 37.3D7, 37.1F5,
53.2H11, EphA2-N1 and EphA2-N2
[0442] The specific binding of each of the purified anti-EphA2
antibodies, 37.3D7, 37.1F5 and 53.2H11 was demonstrated by
fluorescence activated cell sorting (FACS) using cells
overexpressing human EphA2 and by using cells that do not express
EphA2 (FIGS. 1A, B, and C). Incubation of 37.3D7 antibody, or
37.1F5 antibody or 53.2H11 antibody (60 nM) in 100 .mu.l cold FACS
buffer (1 mg/mL BSA in Dulbecco's MEM medium) was performed using
cells overexpressing EphA2 and cells that do not express EphA2 in a
round-bottom 96-well plate on ice. After 1 h, the cells were
pelleted by centrifugation and washed with cold FACS buffer and
then incubated with goat-anti-mouse IgG-antibody-FITC conjugate
(100 .mu.L, 6 .mu.g/ml in FACS buffer) on ice for 1 h. The cells
were then pelleted, washed, and resuspended in 200 .mu.L of 1%
formaldehyde solution in PBS. The cell samples were then analyzed
using a FACSCalibur reader (BD Biosciences).
[0443] A strong fluorescence shift was obtained upon incubation of
human EphA2-overexpressing cells with 37.3D7, 37.1F5, or 53.2H11
antibody, in contrast to an insignificant shift upon incubation of
cells that do not express human EphA2 with 37.3D7, 37.1F5, or
53.2H11 antibody (FIGS. 1A, 1B, and 1C), which demonstrates that
the 37.3D7, 37.1F5 and 53.2H11 antibodies were selectively binding
to human EphA2. The positive control anti-EphA2 antibody, B2D6
(Upstate), showed a similar fluorescence shift upon incubations
with cells that over-expressed human EphA2 (FIG. 1A). A strong
fluorescence shift was also observed by FACS assay using 37.3D7 and
human cancer cells, such as human breast cancer MDA-MB-231 cells,
human colon cancer HT-29 cells, human pancreatic cancer BxPC3
cells, which shows that 37.3D7 antibody binds to human EphA2 on the
surface of human tumor cells (FIG. 2). Similar data were also
obtained using 37.1F5 and 53.2H11 antibodies with human tumor cell
lines.
[0444] The apparent dissociation constants (K.sub.D) for the
binding of 37.3D7, 37.1F5 and 53.2H11 antibodies with human EphA2
on the surface of cells was determined by FACS assays of the
binding of antibody at several concentrations to cells over
expressing human EphA2 and human breast cancer MDA-MB-231 cells
(FIGS. 3A-3C). The values of K.sub.D were estimated by non-liner
regression for one-site binding. The binding curves yielded the
apparent K.sub.D values of 0.3 nM for 37.3D7 antibody, 0.07 nM for
37.1F5 antibody, and 0.14 nM for 53.2H11 antibody (FIGS. 3A, 3B,
and 3C).
[0445] Using the same experimental protocol, apparent kD values of
0.18 nM and 0.05 nM were determined for EphA2-N1 and EphA2-N2,
respectively.
[0446] A strong fluorescence shift was obtained upon incubation of
cells that over-express murine EphA2 or rat EphA2 with 37.3D7
antibody or 53.2H11 antibody, in contrast to an insignificant shift
upon incubation of cells that do not express murine EphA2 or rat
EphA2 with 37.3D7 antibody or 53.2H11 antibody (FIG. 4), which
demonstrates that the 37.3D7 and 53.2H11 antibodies bind also to
murine EphA2 and rat EphA2. A strong fluorescence shift was also
observed by FACS assay using 37.3D7 or 37.1F5 or 53.2H11 antibody
with monkey (Cercopithecus aethiops) epithelial VERO cells (FIG.
5A), which shows that 37.3D7, 37.1F5 and 53.2H11 bind to monkey
EphA2 as well. The apparent values of K.sub.D were estimated by
non-liner regression for one-site binding. The binding curves by
FACS assay yielded K.sub.D values of 0.15 nM for 37.3D7, 0.05 nM
for 37.1F5, and 0.07 nM for 53.2H11 on monkey cells (FIGS. 5B, 5D
and 5F).
Example 3
Inhibition of Binding of EphrinA1 to MDA-MB-231 cells by 37.3D7,
37.1F5, 53.2H11, EphA2-N1 and EphA2-N2 Antibodies
[0447] The binding of ephrinA1 to MDA-MB-231 human breast cancer
cells was inhibited by 37.3D7, 37.1F5 and 53.2H11 antibodies (FIG.
6). MDA-MB-231 cells were incubated with or without 5 .mu.g/mL
37.3D7, 37.1F5, or 53.2H11 antibody for 2 h, followed by incubation
with 100 ng/mL biotinylated ephrinA1 for 30 min at 4.degree. C. The
cells were then washed twice with serum-free medium to remove
unbound biotin-ephrinA1, and were then lysed in 50 mM HEPES buffer,
pH 7.4, containing 1% NP-40 and protease inhibitors. An Immulon-2HB
ELISA plates were coated with a mouse monoclonal anti-EphA2
antibody (D7, Upstate) and were used to capture the EphA2 and bound
biotin-ephrinA1 from the lysate. The binding of the coated antibody
to the cytoplasmic C-terminal domain of the EphA2 did not interfere
with the binding of biotin-ephrinA1 to the extracellular domain of
EphA2. The wells were washed, incubated with
streptavidin-horseradish peroxidase conjugate, washed again, and
then developed with ABTS/H.sub.2O.sub.2 substrate. The inhibition
of ephrinA1 binding to MDA-MB-231 cells by 5 .mu.g/mL 37.3D7,
37.1F5, or 53.2H1 antibody was essentially quantitative; the signal
was almost equivalent to that of the ELISA background signal
obtained using a control lacking biotin-ephrinA1 (FIGS. 6A, 6B and
6C).
[0448] Both EphA2-N1 and Epha2-N2 were capable of inhibiting
binding of human ephrinA1 to MDA-MB-231 cells to the same extent as
37.3D7.
Example 4
Inhibition of EphA2 Mediated Cell Signaling by 37.3D7, 37.1F5,
53.2H11, EphA2-N1 and EphA2-N2 Antibodies
[0449] Treatment of MDA-MB-231 human breast cancer cells with
37.3D7, or 37.1F5 antibody completely inhibited intracellular EphA2
receptor signaling as shown by the inhibition of EphA2 receptor
autophosphorylation (FIG. 7A) and by the inhibition of
phosphorylation of its downstream effectors such as Akt (FIG. 7B).
Treatment of pancreatic cancer CFPAC-1 cells with 37.3D7 antibody
or 53.2H11 antibody completely inhibited intracellular EphA2
receptor signaling as shown by the inhibition of EphA2 receptor
autophosphorylation (FIG. 7C).
[0450] In FIGS. 7A and 7C, the mammary MDA-MB-231 cells or the
pancreatic CFPAC-1 cells were grown in regular medium (as suggested
from ATCC for each cell line) with serum for 3 days, then cultured
in serum-free medium for 12-14 h. Serum-starved cells were treated
with 15 .mu.g/mL 37.3D7, 37.1F5, or 53.2H11 antibody or control
IgG.sub.1 for 2 h, followed by stimulation with 1 .mu.g/mL ephrin
A1-Fc (R&D) for 10 min at 37.degree. C. The cells were then
lysed in ice-cold lysis buffer containing protease and phosphatase
inhibitors (50 mM HEPES buffer, pH 7.4, 1% NP-40, 1 mM sodium
orthovanadate, 100 mM sodium fluoride, 10 mM sodium pyrophosphate,
2.5 mM EDTA, 10 .mu.M leupeptin, 5 .mu.M pepstatin, 1 mM PMSF, 5 mM
benzamidine, and 5 .mu.g/mL aprotinin). The lysates were
immunoprecipitated with anti-EphA2 antibody D7 (Upstate) coupled to
protein A/G beads. The immunoprecipitated EphA2 was resolved on an
SDS-polyacrylamide gel and Western blotted with phosphotyrosine
specific monoclonal antibody, 4G10 (Cell Signaling Technology). To
evaluate the EphA2 protein level in each immunoprecipated sample,
the same membrane was re-blotted with anti-EphA2 antibody, D7
(Upstate). Use of a control antibody showed no inhibition of the
ephrin A1-stimulated autophosphorylation of EphA2 receptor (FIG.
7C). In contrast, a complete inhibition of the ephrinA1-stimulated
autophosphorylation of EphA2 receptor was obtained upon treatment
with 37.3D7, 37.1F5, or 53.2H11 antibody (FIGS. 7A and 7C). The
ephrin A1-stimulated activation of the downstream effectors, such
as Akt, was also inhibited in MDA-MB-231 cells by 37.3D7 or 37.1F5
antibody, as shown using Western blots of lysates and rabbit
polyclonal anti-phospho-Ser.sup.473 Akt antibody (Cell Signaling
Technology) (FIG. 7B).
[0451] The 37.3D7 and 53.2H11 antibodies by themselves did not
stimulate EphA2 autophosphorylation in human breast cancer
MDA-MB-231 cells, in contrast to the stimulatory effect of ephrinA1
on EphA2 autophosphorylation in MDA-MB-231 cells (FIGS. 8A and 8B).
Similar data were obtained for the 37.1F5 antibody using MDA-MB-231
cells. In FIG. 8, the MDA-MB-231 cells were grown in regular medium
with serum for 3 days, then cultured in serum-free medium for 12-14
h. Serum-starved cells were treated with 1 .mu.g/mL ephrinA1-Fc or
15 .mu.g/mL 37.3D7 or 53.2H11 antibody for 10 min. The cell lysates
were subjected to immunoprecipitation with anti-EphA2 antibody, D7
(Upstate). After separation on a SDS-polyacrylamide gel, the blot
was probed with anti-phosphotyrosine antibody, 4G10 (Cell Signaling
Technology) and anti-EphA2 antibody D7 (Upstate). Similar results
were obtained with both EphA2-N1 and EphA2-N2 in human breast
cancer MDA-MB-231 cells, as neither antibody stimulates EphA2
autophosphorylation by itself, whereas each of them prevents
ephrinA1-dependent phosphorylation of the EphA2 receptor.
[0452] The 37.3D7, 37.1F5, 53.2H11, EphA2-N1, and EphA2-N2
antibodies are therefore unique among all known anti-EphA2
antibodies in their effectiveness to inhibit ephrinA1-stimulated
EphA2 intracellular signaling.
Example 5
Inhibition of Serum-Stimulated Growth and Survival of Human Tumor
Cells by 37.3D7 and 53.2H11 Antibodies
[0453] Several human tumor cell lines were tested in serum-free
conditions for their growth and survival response to serum in the
presence of 37.3D7 or 53.2H11 antibody. Approximately 3000
cells/well were plated in a 96-well plate in regular medium (as
suggested from ATCC for each cell line) with serum, which was
replaced with serum-free medium the following day.
[0454] After one day of growth in serum-free medium, the cells were
incubated with 15 .mu.g/mL 37.3D7 antibody or 53.2H11 antibody or
control IgG.sub.1 followed by the addition of serum to obtain a
final concentration of 1% or 1.5% serum. The cells were then
allowed to grow for another 3 days. A solution of MTT
[3-(4,5)-dimethylthiazol-2-yl-2,3-diphenyltetrazolium bromide; 25
.mu.L of a 5 mg/mL solution in PBS] was then added and the cells
were returned to the incubator for 2-3 h. The medium was then
removed and replaced by 100 .mu.L DMSO, mixed, and the absorbance
of the plate was measured at 545 nm. Several human tumor cell lines
showed a growth and survival response upon addition of serum that
was significantly inhibited by 37.3D7 or 53.2H11 antibody. As
examples, the findings with the colon tumor cell lines, HT-29,
LoVo; the pancreatic tumor cell line, CFPAC-2, BxPC3; and melanoma
UACC-257 are shown.
[0455] The 37.3D7 antibody strongly inhibited serum-stimulated
growth and survival of human colon cancer HT-29 cells (FIG. 9A). In
another experiment, the 37.3D7 antibody strongly inhibited
serum-stimulated growth and survival of BxPC3 human pancreatic
cancer cells in a dose-dependent manner with an IC.sub.50 value of
4 nM (FIG. 10A). In addition, the 37.3D7 or 53.2H11 antibody
strongly inhibited serum-stimulated growth and survival of LoVo
human colon cancer cells (FIG. 9B), CFPAC-1 human pancreatic cancer
cells (FIG. 9C) and UACC-257 melanoma cancer cells (FIG. 9D) and
the 53.2H11 antibody inhibited serum or EGF-stimulated growth and
survival of LoVo cells in a dose-dependent manner with an IC.sub.50
value of 2 nM (FIGS. 10B and 10C). In FIG. 10, OD.sub.545 values
for 0% serum-treated samples were set to 100% inhibition and 0%
inhibition was set using samples treated with 1.5% serum or 10
ng/ml EGF. None of the previous reported anti-EphA2 antibodies have
inhibitory activities on the anchorage-dependent (monolayer) growth
of human tumor cells. Therefore, 37.3D7 and 53.2H11 antibodies are
unique in their ability to inhibit anchorage-dependent growth
(monolayer growth) of human tumor cells.
Example 6
Inhibition of VEGF-Mediated Cell Signaling and VEGF-Stimulated
Growth and Survival of Human Umbilical Vein Endothelial Cells
(HUVECs) by 37.3D7, 37.1F5, and 53.2H11 Antibody
[0456] A strong fluorescence shift was obtained upon incubation of
HUVEC cells with 37.3D7, 37.1F5, or 53.2H11 antibody by FACS
analysis, indicating that 37.3D7, 37.1F5 and 53.2H11 antibodies
bind to EphA2 receptors expressed on HUVEC cells. The apparent
dissociation constants (K.sub.D) for the binding of 37.3D7, 37.1F5,
and 53.2H11 antibodies with EphA2 on the surface of the cells were
determined from the binding curves established with FACS binding
assays performed at several concentrations and shown in FIG. 11. A
value of K.sub.D=0.3 nM for the 37.3D7 antibody was estimated by
non-liner regression for one-site binding (FIG. 11), which is
similar to the K.sub.D value of the binding of 37.3D7 antibody to
human cancer cells. A value of K.sub.D=0.01 nM for the 37.1F5
antibody and a value of K.sub.D=0.06 nM for the 53.2H11 antibody
were similarly obtained. This indicates that 37.3D7, 37.1F5 and
53.2H11 antibodies specifically bind to HUVEC cells through the
EphA2 receptor.
[0457] The 37.3D7 antibody strongly inhibited VEGF-induced HUVEC
growth and survival. The activity is similar or better than that of
Avastin.RTM., an anti-VEGF blocking antibody (Genentech) (FIG. 12).
An agonistic anti-EphA2 antibody did not inhibit VEGF-induced HUVEC
growth and survival (FIG. 12). In FIG. 12, HUVEC cells were grown
in EBM-2 medium with serum and endothelial cell (EC) supplements
(Clonetics) for 3 days. Cells were cultured in serum-free medium
plus EC growth supplements lacking VEGF for 12-14 h. Following
serum starvation, cells were stimulated with 5 ng/mL VEGF plus 0.4%
serum with or without indicated antibodies (100 .mu.g/mL). The
effects of the antibodies on VEGF-induced HUVEC cell growth and
survival was determined 3 days after addition of antibodies and
VEGF using the MTT assay as described in Example 5. The percent
inhibition of VEGF-mediated growth and survival by antibodies is
shown in FIG. 12. OD.sub.545 values for vehicle-treated samples
were set to 0% inhibition and 100% inhibition was set using samples
lacking VEGF.
[0458] That treatment of HUVEC cells with 37.3D7 antibody inhibits
intracellular EphA2 receptor signaling was shown by measuring the
inhibition of phosphorylation of its downstream effectors such as
Akt.
[0459] The inhibition is similar to that of Avastin.RTM., an
anti-VEGF blocking antibody (Genentech) (FIG. 13). agonistic
anti-EphA2 antibody did not inhibit VEGF-induced Akt
phosphorylation in HUVEC cells. In FIG. 13, HUVEC cell were starved
for 12-14 h in serum-free medium plus EC supplements lacking VEGF.
Cells were treated with antibodies (20 .mu.g/mL) for 1 h before
addition of VEGF (100 ng/mL). Cells were lysed 15 min after VEGF
addition and immunoblots were probed with the indicated
antibodies.
Example 7
Suppression of Growth of Human Colon Cancer HT-29 Xenograft in Mice
by 37.3D7 Antibody (FIG. 14)
[0460] Human colon cancer HT-29 xenografts were established in SCID
mice by subcutaneous injection of 2.times.10.sup.6 HT-29 cells.
When the mice showed palpable (50 mm.sup.3) HT-29 xenograft tumors,
they were treated with 37.3D7 antibody or a control antibody
(IgG.sub.1) (1 mg/mouse, i. v., two times per week) or PBS alone
(100 .mu.L/mouse, i. v., two times per week). The growth of tumors
was significantly slowed by 37.3D7 antibody treatment compared to a
control antibody treatment or PBS alone. No toxicity of 37.3D7
antibody was observed, based on measurements of the weights of the
mice.
Example 8
Inhibition of Early Mammary MDA-MB-231 Metastasis by the Anti-EphA2
Antibody hu53.2H11
[0461] Anti-tumor activity of the anti-EphA2 antibody hu532H11 was
evaluated at one dose level against early mammary MDA-MB-231 tumor
implanted subcutaneously in female SCID mice. The effect of this
antibody on the MDA-MB-231 tumor invasion in the superficial axial
and inguinal lymph nodes was also investigated. To do so, hu532H11
was administered at 40 mg/kg/adm by iv route, on days 1, 5, 8, 12,
15, 19, 22 and 26 post tumor implantation. Control group was left
untreated.
[0462] For the evaluation of anti-tumor activity of hu532H11,
animals were weighed daily and tumors were measured 2-3 times
weekly by caliper. Tumor weights were calculated using the formula
mass (mg)=[length (mm).times.width (mm).sup.2]/2. Antitumor
activity was evaluated according to 3 criteria: 1) including T/C,
defined as median tumor weight (mg) of a treated group divided by
median tumor weight of the nontreated control; 2) the determination
of tumor growth delay (T-C), where T is defined as the median time
in days required for treatment group tumors to reach 750 mg and C
is the median time for the control group tumors to reach the same
size, and 3) tumor cell kill is defined as log 10 cell kill
(gross)=[T-C value in days]/(Td.times.3.32). T-C is defined above,
and Td is the tumor volume doubling time in days of the control
tumors, which is estimated from the best fit straight line from a
log-linear growth plot of the control group tumors in exponential
growth (100-1,000 mg range).
[0463] In a parallel study, animals were treated as described
before, and on day 28 post tumor implantation all mice were
sacrificed and axillary and inguinal lymph nodes were collected
(median tumor size in the control group=1558 mg). The human Ki67
antibody was used in order to specifically identify MDA-MB-231
tumor cells in the lymph nodes by immunostaining. The surface area
of metastases in lymph nodes was calculated (mean of 2 sections) as
S=human Ki67 surface area.times.100/lymph node surface area.
[0464] Efficacy on Primary Tumor: [0465] hu532H11 was well
tolerated at 40 mg/kg/adm (total dose 320 mg/kg) with +8.9% body
weight change on day 27. This dose delayed tumor growth of the
primary tumor (T/C=27% and 1.0 log cell kill gross), even though
the tumor escaped under therapy.
[0466] Anti-Metastatic Activity: [0467] hu532H11 induced a
reduction of metastases surface (>50%) in both axilliary and
inguinal lymph nodes.
[0468] In conclusion in mice bearing mammary tumor MDA-MB-231,
hu532H11 delays the growth of the primary tumor treated at an early
stage of tumor development (T/C=27% and 1.0 log cell kill gross),
and reduces the metastases surface (>50%) in both axillary and
inguinal lymph nodes.
[0469] In another study, the activity of an anti-EphA2 antibody can
be evaluated in the human colon HT29 liver "metastasis" model. The
murine anti-EphA2 antibody 53.2H11 is administered iv, twice
weekly, from day 4 post intrasplenic implantation of HT29 cells in
SCID female mice (n=20 mice per group for non-tumor bearing animals
(NTBA), treated and control). On day 50, 3 days post the 13.sup.th
anti-EphA2 administration, the mice are necropsied and their spleen
and liver are weighed in order to evaluate tumor mass either at the
primary tumor site (spleen) or at site of metastasis (liver).
Number of metastases is also evaluated. Data is analysed using the
statistical tools known to the person skilled in the art. [0470]
Treatment with anti-EphA2 at 40 mg/kg/inj (total dose of 520 mg/kg)
is well tolerated. [0471] Primary tumor weight (spleen): A
significant difference of spleen weight is observed between NTBA
and control-implanted mice, the latter being bigger. There is no
significant difference between spleen weight of control implanted
mice and the one of anti-EphA2 treated mice. [0472] Metastases
weight (liver): the liver weight of control-implanted mice is
significantly bigger than the liver weight of NTBA; on the other
hand, it is significantly smaller in anti-EphA2 treated mice than
in control-implanted mice. [0473] Number of liver metastases: no
statistical difference is observed between control implanted and
anti-EphA2 treated mice.
[0474] In conclusion, intrasplenic implantation of human colic
adenocarcinoma HT-29 significantly induces an increase in liver
weight due to the metastatic tumor burden. Anti-EphA2 treatment is
able to significantly decrease metastatic tumor burden as observed
by the reduction of the liver weight of implanted mice without
affecting the number of metastases counted on the liver.
Example 9
Cloning and Sequencing of the Light and Heavy Chains of 37.1F5
Antibody
[0475] RNA Preparation from Hybridoma Cells that Produces the
37.1F5 Antibody
[0476] Preparations of total RNA were obtained from
5.times.10.sup.6 hybridoma cells, which produce 37.1F5 antibody,
using Qiagen's RNeasy miniprep kit. Briefly, 5.times.10.sup.6 cells
were pelleted and resuspended in 350 .mu.L RLT buffer (containing
1% .beta.-mercaptoethanol). The suspension was homogenized by
passing it through a 21.5 gauge needle and syringe roughly 10-20
times or until it was no longer viscous. Ethanol (350 .mu.L of 70%
aqueous ethanol) was added to the homogenate, which was mixed well.
The solution was transferred to a spin column, placed in a 2-mL
collection tube and spun at >8000.times.g for 15 seconds. The
column was washed twice with 500 .mu.L RPE buffer, then transferred
to a fresh tube and eluted with 30 .mu.L RNase free water and a
1-minute spin. The eluate (30 .mu.L) was placed back on the column
for a second 1-minute elution spin. An aliquot of the 30 .mu.L
eluate was diluted with water and used to measure the UV absorption
at 260 nm for RNA quantitation.
[0477] cDNA Preparation with Reverse Transcriptase (RT)
Reaction
[0478] The variable region 37.1F5 antibody cDNA was generated from
the total RNA using Invitrogen's SuperscriptII kit. The kit
protocols were followed closely, utilizing up to 5 .mu.g of total
RNA from the Qianeasy mini preps. Briefly, the RNA, 1 .mu.L random
primers, and 1 .mu.L dNTP mix were brought up to 12 .mu.L with
RNase free sterile distilled water and incubated at 65.degree. C.
for 5 minutes. The mix was then put on ice for at least 1 minute.
Next 4 .mu.L of 5.times.reaction buffer, 2 .mu.L 0.1 M DTT, and 1
.mu.L RNaseOUT were added and the mix was incubated at 25.degree.
C. for 2 minutes in an MJ Research thermalcycler. The thermalcycler
was paused so that 1 .mu.L of SuperscriptII enzyme could be added
and then restarted for an additional 10 minutes at 25.degree. C.
before shifting to 55.degree. C. for 50 minutes. The reaction was
heat inactivated by heating to 70.degree. C. for 15 min and the RNA
was removed by adding 1 .mu.L RNase H and incubating at 37.degree.
C. for 20 minutes.
[0479] Degenerate PCR Reactions
[0480] The procedure for the first round degenerate PCR reaction on
the cDNA derived from hybridoma cells was based on methods
described in Wang et al. (2000; J Immunol Methods.;
233(1-2):167-77) and Co et al. (1992; J Immunol.; 148(4):1149-54).
The primers for this round (Table 2) contain restriction sites to
facilitate cloning into the pBluescriptII plasmids.
[0481] The PCR reaction components (Table 3) were mixed on ice in
thin walled PCR tubes and then transferred to an MJ research
thermalcycler preheated and paused at 94.degree. C. The reactions
were performed using a program derived from Wang et al. (2000; J
Immunol Methods.; 233(1-2):167-77), as follows:
[0482] Name: Wang45 [0483] 1) 94.degree. C. 3:00 min [0484] 2)
94.degree. C. 0:15 sec [0485] 3) 45.degree. C. 1:00 min [0486] 4)
72.degree. C. 2:00 min [0487] 5) Go to 2 29 times [0488] 6)
72.degree. C. 6:00 min [0489] 7) 4.degree. C. for ever [0490] 8)
end
[0491] The PCR reaction mixtures were then run on a 1% low melt
agarose gel, the 300 to 400 bp bands were excised, purified using
Zymo DNA mini columns, and sent to Agencourt biosciences for
sequencing. The respective 5' and 3' PCR primers were used as
sequencing primers to generate the 37.1F5 variable region cDNAs
from both directions.
[0492] Cloning the 5' End Sequence
[0493] Since the degenerate primers used to clone the 37.1F5
variable region light chain and heavy chain cDNA sequences alters
the 5'end sequences, additional sequencing efforts were needed to
decipher the complete sequences. The preliminary cDNA sequence from
the methods described above were used to search the NCBI IgBlast
site (http://www.ncbi.nlm.nih.gov/igblast/) for the murine germline
sequences from which the 37.1F5 sequence is derived. PCR primers
were designed (Table 4) to anneal to the leader sequence of the
murine antibody so that a new PCR reaction could yield the complete
variable region cDNA, unaltered by the PCR primers. The PCR
reactions, band purifications, and sequencing were performed as
described above. The germline sequences from which the light chain
and heavy chain of mu37.1F5 are likely derived, are accessible
under the Genbank accession numbers MUSIGKVR3 and AF303839,
respectively.
[0494] Peptide Analysis for Sequence Confirmation
[0495] The cDNA sequence information for the variable region was
combined with the germline constant region sequence to obtain full
length antibody cDNA sequences. The molecular weights of the heavy
chain and light chain were then calculated and compared with the
molecular weights obtained by LC/MS analyses of the murine 37.1F5
antibody.
[0496] Table 5 gives the calculated mass from the cDNA sequences
for 37.1F5 LC and HC together with the values measured by LC/MS.
The molecular weight measurements are consistent with the cDNA
sequences for both the 37.1F5 light and heavy chain.
[0497] Essentially the same method was used for cloning of the
light and heavy chains of 37.3D7 and 53.2H11. The Genbank accession
numbers of the germline sequences from which the light chain and of
the heavy chain of 37.3D7 are likely derived, are respectively
MMU231217 and AF303868. For 53.2H11, they are respectively
MMU231196 and AF303833; for EphA2-N1, K02161 and J00488
respectively; and for EphA2-N2, AJ231222 and J00488
respectively.
Example 10
Inhibition of the Growth of EphA2 Expressing Tumor Cells by
Humanized-37.3D7-SPDB-DM4 and Humanized-53.2H11-SPDB-DM4
[0498] Humanized 37.3D7 and humanized 53.2H11 antibodies were
conjugated to L-DM4
N.sup.2'deacetyl-N.sup.2'(4-methyl-4-mercapto-1-oxopentyl)-mayta-
nsine using SPDB (4-[2-pyridyldithio]butanoic acid
N-hydroxsuccinimde ester) linker. Briefly, the antibody was
modified at 8 mg/mL with 5.5 or 6.5 folds molar excess of SPDB for
hu53.2H11 and hu37.3D7 respectively. The reaction was carried out
in Buffer A (50 mM KP.sub.i/50 mM NaCl/2 mM EDTA, pH 6.5, 95% v/v)
with EtOH (5% v/v) for 90 minutes at room temperature. The modified
antibody was then purified by SephadexG25 desalting column with
Buffer A. Next, the modified antibody was reacted with a 1.7-fold
molar excess of DM4 over SPDB linker. The reaction was carried out
at 2.5 mg/mL antibody in Buffer A (97% v/v) and DMA
(dimethylacetamide, 3% v/v) at room temperature for 20 hours. The
conjugate was purified by SephadexG25 desalting column with 10 mM
Histidine, 130 mM Glycine, 5% sucrose, pH5.5. The drug to antibody
ratio was 4.0 for hu37.3D7-SPDB-DM4 and 3.1 for
hu53.2H11-SPDB-DM4.
[0499] The effects of hu37.3D7-SPDB-DM4 and hu53.2H11-SPDB-DM4 on
the growth of EphA2 expressing tumor cells were first tested using
the in vitro cell proliferation WST-8
((2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H--
tetrazolium, monosodium salt) assay (Catalog# CK04-11, Dojindo
Molecular Technogies, Inc). Several human tumor cell lines were
tested. Approximately 2000 cells/well were plated in a 96-well
plate in regular medium (as suggested from ATCC for each cell line)
with 10% serum in the presence of a variety of concentration of
hu37.3D7-SPDB-DM4 or hu53.2H11-SPDB-DM4. The cells were then
allowed to grow for 5 days. A solution of WST-8 [20 .mu.L solution]
was then added and the cells were returned to the incubator for 2-3
h. The absorbance of the plate was measured at 450 nm and 650 nm.
Two control groups were used in the experiments. 0% survival is the
medium only control. 100% survival is the cells only control. For
data analysis, the A650 nm (reference wavelength) values were first
subtracted from the corresponding A450 nm values. Then, A450 nm
values of each sample were normalized by subtraction of A450 nm
values of the background control (medium only). The survival
fractions were calculated by the normalized A450 values of the
samples divided by the normalized A450 values from the cells only
controls (100% survival-0% survival). Log [Ab-DM4] values were
plotted on the x-axis and survival fractions were plotted on
y-axis.
[0500] Hu37.3D7-SPDB-DM4 and hu53.2H11-SPDB-DM4 significantly
inhibited the growth of EphA2 expressing human tumor cells,
including PC3 prostate tumor cells, MDA-MDA-MB-231 breast tumor
cells, WM-115 melanoma cells, A375 melanoma cells and LoVo colon
tumor cells. As an example, the findings with the PC3 prostate
tumor cells are shown. The hu37.3D7-SPDB-DM4 or hu53.2H11-SPDB-DM4
strongly inhibited the growth of PC3 cells in a dose-dependent
manner with an similar IC.sub.50 value of 0.02 nM (FIGS. 15A &
15B). The potency of conjugates correlated with the EphA2
expression levels. More than 50-fold higher concentration of
hu37.3D7-SPDB-DM4 or hu53.2H11-SPDB-DM4 was required to inhibit the
growth of the SK-MeI28 cells (IC50 values: 1.3 nM and >5 nM,
respectively; FIGS. 15A & 15B), which expressed almost
undetectable level of EphA2 on cell surface (measured by FACS data
not shown) (FIGS. 15A & 15B). Therefore, results of the in
vitro growth inhibition assays demonstrated the ability of
antagonist anti-EphA2 antibody-conjugates to specifically inhibit
the growth of EphA2 expressing tumor cell lines.
[0501] The effects of hu37.3D7-SPDB-DM4 and hu53.2H11-SPDB-DM4 on
the growth of EphA2 expressing tumor xenografts were tested. A
study using MDA-MB-231 breast tumor xenograft model is shown as one
example. Human breast cancer MDA-MB-231 xenografts were established
in female CB17 SCID mice 5 weeks of age by subcutaneous injection
of 1.times.10.sup.7 MDA-MB-231 cells. When MDA-MB-231 xenograft
tumors were established (average size of 83 mm.sup.3), mice were
treated with a single i. v injection of hu3D7-SPDB-DM4 or
hu2H11-SPDB-DM4 or PBS. The doses of antibodies were 15 mg/kg of
mouse body weight, 7.5 mg/kg of mouse body weight and 3.25 mg/kg of
mouse body weight. The growths of MDA-MB-231 tumors were completely
inhibited by either hu3D7-SPDB-DM4 or hu2H11-SPDB-DM4
antibody-conjugates at all of the tested concentrations except at
3.25 mg/kg of hu2H11-SPDB-DM4, which shows marked delay of tumor
cell growth relative to PBS control (FIGS. 16A & 16B). The
median tumor volumes in each group (6 mice per group) are shown in
the FIGS. 16A & B. In summary, both hu3D7-SPDB-DM4 and
hu2H11-SPDB-DM4 have potent growth inhibitory activities on EphA2
expressing tumors in vivo. No toxicities of both
antibody-conjugates were observed, based on the body weight
measurements.
TABLES
TABLE-US-00001 [0502] TABLE 1A The mu37.3D7 light chain framework
surface residues and corresponding residues at the same Kabat
position in the human 28E4 antibody. The residues that are
different and therefore changed in the hu37.3D7 antibody are in
grayed boxes. mu37.3D7 Light Chain Framework Surface Residues And
Corresponding Residues In The Human 28E4 Antibody ##STR00017##
TABLE-US-00002 TABLE 1B The mu37.3D7 heavy chain framework surface
residues and corresponding residues at the same Kabat position in
the human 28E4 antibody. The residues that are different and
therefore changed in the hu37.3D7 antibody are in grayed boxes. The
starred (*) residues are back mutated to the mu37.3D7 residue in
one or more hu37.3D7 variants. mu37.3D7 Heavy Chain Framework
Surface Residues And Corresponding Residues In The Human 28E4
Antibody ##STR00018##
TABLE-US-00003 TABLE 2 Primers used for the degenerate PCR
reactions are based on those in Wang et al., 2000 except HindKL
(SEQ ID NO: 58) which is based on Co et al. 1992. Mixed bases are
defined as follows: H = A + T + C, S = g + C, Y = C + T, K = G + T,
M = A + C, R = A + g, W = A + T, V = A + C + G. Primer Sequence
BamIgG1 GGAGGATCCATAGACAGATGGGG (SEQ ID NO: 53) GTGTCGTTTTGGC
IgG2Abam GGAGGATCCCTTGACCAGGCATC (SEQ ID NO: 54) CTAGAGTCA EcoMH1
CTTCCGGAATTCSARGTNMAGCT (SEQ ID NO: 55) GSAGSAGTC EcoMH2
CTTCCGGAATTCSARGTNMAGCT (SEQ ID NO: 56) GSAGSAGTCWGG SacIMK
GGAGCTCGAYATTGTGMTSACMC (SEQ ID NO: 57) ARWCTMCA HindKL
TATAGAGCTCAAGCTTGGATGGT (SEQ ID NO: 58) GGGAAGATGGATACAGTTGGTGC
TABLE-US-00004 TABLE 3 The light and heavy chain PCR reaction mixes
for cloning of the 37.1F5 variable region cDNA sequences. Light
Chain Reaction Mix Heavy Chain Reaction Mix 5 .mu.l 10 X PCR
reaction buffer 5 .mu.l 10 X PCR reaction buffer (Roche) (Roche) 4
.mu.l 10 mM dNTP mix (2.5 mM 4 .mu.l 10 mM dNTP mix (2.5 mM each)
each) 2 .mu.l Template (RT reaction) 2 .mu.l Template (RT reaction)
5 .mu.l 10 .mu.M Sac1MK left primer 2.5 .mu.l 10 .mu.M EcoMH1 left
primer 5 .mu.l 10 .mu.M HindKL right primer 2.5 .mu.l 10 .mu.M
EcoMH2 left primer 5 .mu.l DMSO 5 .mu.l 10 .mu.M BamIgG1 right
primer 0.5 .mu.l Taq Polymerase (Roche) 5 .mu.l DMSO 23.5 .mu.l
sterile distilled H.sub.2O 0.5 .mu.l Taq Polymerase (Roche) 23.5
.mu.l sterile distilled H.sub.2O 50 .mu.l Total 50 .mu.l Total
TABLE-US-00005 TABLE 4 The 5'end murine leader sequence primers
used for the 37.1F5 second round PCR reactions. The 3'end primers
are identical to those used in the first round reactions since they
prime to the respective constant region sequences. Primer Sequence
Light Chain GACAGACACACTCCTGCTATGGG 38SB13 LC Leader (SEQ ID NO:
59) Heavy Chain GCAGAATTCATGGGATGGAGCYG 5F85 HC Leader GATCTTTCT
(SEQ ID NO: 60)
TABLE-US-00006 TABLE 5 The cDNA calculated and LC/MS measured
molecular weights of the murine 37.1 F5 antibody light and heavy
chains. Light Chain Heavy Chain Differ- Differ- cDNA LC/MS ence
cDNA LC/MS ence 37.1 F5 24031 Da 24029 Da 2 Da 49316 Da 49333 Da 17
Da
Sequence CWU 1
1
8015PRTMus sp. 1Ser Tyr Trp Met His 1 5 217PRTMus sp. 2Asn Ile Tyr
Pro Gly Thr Gly Asn Thr Asn Tyr Asp Glu Lys Phe Met 1 5 10 15 Asn
312PRTMus sp. 3Trp Gly Leu Val Arg Tyr Phe Phe Ala Met Asp Tyr 1 5
10 412PRTMus sp. 4Thr Val Ser Ser Ser Val Asn Ser Ser Tyr Leu His 1
5 10 57PRTMus sp. 5Ser Thr Ser Asn Leu Pro Ser 1 5 610PRTMus sp.
6His Gln Tyr His Arg Ser Pro Gln Phe Thr 1 5 10 75PRTMus sp. 7Gly
Tyr Thr Met Asn 1 5 817PRTMus sp. 8Leu Ile Asn Pro His Asn Gly Gly
Ser Ser Tyr Asn Leu Lys Phe Lys 1 5 10 15 Gly 99PRTMus sp. 9Trp Gly
Asp Tyr Gly Ser Phe Ala Tyr 1 5 1015PRTMus sp. 10Arg Ala Ser Glu
Ser Val Asp Thr Phe Gly Tyr Ser Phe Ile Tyr 1 5 10 15 117PRTMus sp.
11Arg Ala Ser Asn Leu Glu Ser 1 5 129PRTMus sp. 12Gln Gln Ser Asn
Glu Asp Pro Pro Thr 1 5 135PRTMus sp. 13Ala Tyr Tyr Met His 1 5
1417PRTMus sp. 14Leu Val Asn Pro Tyr Asn Gly Phe Ser Ser Tyr Asn
Gln Asn Phe Glu 1 5 10 15 Asp 1510PRTMus sp. 15Glu Phe Tyr Gly Tyr
Arg Tyr Phe Asp Val 1 5 10 1616PRTMus sp. 16Lys Ser Ser Gln Ser Leu
Ile His Ser Asp Gly Lys Thr Tyr Leu Asn 1 5 10 15 177PRTMus sp.
17Leu Val Ser Arg Leu Asp Ser 1 5 189PRTMus sp. 18Trp Gln Gly Ser
His Phe Pro Arg Thr 1 5 19363DNAMus sp.CDS(1)..(363) 19cag gtc caa
ctg caa caa cct ggg tct gaa ctg gtg agg cct gga gct 48Gln Val Gln
Leu Gln Gln Pro Gly Ser Glu Leu Val Arg Pro Gly Ala 1 5 10 15 tca
gtg cag ctg tcc tgt aag gct tct ggc tac tca ttc acc agc tac 96Ser
Val Gln Leu Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ser Tyr 20 25
30 tgg atg cac tgg gtg aga cag agg cct gga caa ggc ctt caa tgg att
144Trp Met His Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Gln Trp Ile
35 40 45 gga aat att tat cct ggt act ggt aat act aat tac gat gag
aaa ttc 192Gly Asn Ile Tyr Pro Gly Thr Gly Asn Thr Asn Tyr Asp Glu
Lys Phe 50 55 60 atg aac aag gcc aca ctg act gta gac aca tat tcc
agc aca acc tac 240Met Asn Lys Ala Thr Leu Thr Val Asp Thr Tyr Ser
Ser Thr Thr Tyr 65 70 75 80 atg cag ctc agc agc ctg aca tct gag gac
tct gcg gtc tat tac tgt 288Met Gln Leu Ser Ser Leu Thr Ser Glu Asp
Ser Ala Val Tyr Tyr Cys 85 90 95 gca aga tgg ggg tta gta cgg tat
ttc ttt gca atg gac tac tgg ggt 336Ala Arg Trp Gly Leu Val Arg Tyr
Phe Phe Ala Met Asp Tyr Trp Gly 100 105 110 caa gga acc tca gtc acc
gtc tcc tca 363Gln Gly Thr Ser Val Thr Val Ser Ser 115 120
20121PRTMus sp. 20Gln Val Gln Leu Gln Gln Pro Gly Ser Glu Leu Val
Arg Pro Gly Ala 1 5 10 15 Ser Val Gln Leu Ser Cys Lys Ala Ser Gly
Tyr Ser Phe Thr Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Arg
Pro Gly Gln Gly Leu Gln Trp Ile 35 40 45 Gly Asn Ile Tyr Pro Gly
Thr Gly Asn Thr Asn Tyr Asp Glu Lys Phe 50 55 60 Met Asn Lys Ala
Thr Leu Thr Val Asp Thr Tyr Ser Ser Thr Thr Tyr 65 70 75 80 Met Gln
Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95
Ala Arg Trp Gly Leu Val Arg Tyr Phe Phe Ala Met Asp Tyr Trp Gly 100
105 110 Gln Gly Thr Ser Val Thr Val Ser Ser 115 120 21354DNAMus
sp.CDS(1)..(354) 21gag gtc cag ctg caa cag tct gga cct gag ctg gtg
aag cct gga gct 48Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val
Lys Pro Gly Ala 1 5 10 15 tca atg aag att tcc tgc agg gct tct ggt
tac tca ttc act ggc tac 96Ser Met Lys Ile Ser Cys Arg Ala Ser Gly
Tyr Ser Phe Thr Gly Tyr 20 25 30 acc atg aac tgg gtg agg cag agc
cat gga aag aac ctt gag tgg att 144Thr Met Asn Trp Val Arg Gln Ser
His Gly Lys Asn Leu Glu Trp Ile 35 40 45 gga ctt att aat cct cac
aat ggt ggt tct agc tac aac ctg aag ttc 192Gly Leu Ile Asn Pro His
Asn Gly Gly Ser Ser Tyr Asn Leu Lys Phe 50 55 60 aag ggc aag gcc
aca tta act gta gac aag tca tcc agc aca gcc tac 240Lys Gly Lys Ala
Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 atg gag
ctc ctc agt ctg aca tct gaa gac tct gca gtc tat tac tgt 288Met Glu
Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95
gta aga tgg ggt gac tac ggc tct ttt gct tac tgg ggc caa ggg act
336Val Arg Trp Gly Asp Tyr Gly Ser Phe Ala Tyr Trp Gly Gln Gly Thr
100 105 110 ctg gtc act gtc tct gca 354Leu Val Thr Val Ser Ala 115
22118PRTMus sp. 22Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val
Lys Pro Gly Ala 1 5 10 15 Ser Met Lys Ile Ser Cys Arg Ala Ser Gly
Tyr Ser Phe Thr Gly Tyr 20 25 30 Thr Met Asn Trp Val Arg Gln Ser
His Gly Lys Asn Leu Glu Trp Ile 35 40 45 Gly Leu Ile Asn Pro His
Asn Gly Gly Ser Ser Tyr Asn Leu Lys Phe 50 55 60 Lys Gly Lys Ala
Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu
Leu Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95
Val Arg Trp Gly Asp Tyr Gly Ser Phe Ala Tyr Trp Gly Gln Gly Thr 100
105 110 Leu Val Thr Val Ser Ala 115 23357DNAMus sp.CDS(1)..(357)
23gag gtc cag ctg caa cag tct gga cct gag ctg gtg aag cct ggg gct
48Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1
5 10 15 tca gtg aag att tcc tgc aag gct tct ggt tac tca ttc act gcc
tac 96Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ala
Tyr 20 25 30 tac atg cac tgg gtg aag caa agt cat gta aag agt ctt
gag tgg att 144Tyr Met His Trp Val Lys Gln Ser His Val Lys Ser Leu
Glu Trp Ile 35 40 45 gga ctt gtt aat cct tac aat ggt ttt agt agc
tac aac cag aat ttc 192Gly Leu Val Asn Pro Tyr Asn Gly Phe Ser Ser
Tyr Asn Gln Asn Phe 50 55 60 gag gac aag gcc agc ttg act gta gat
aag ttc tcc agc acc gcc tac 240Glu Asp Lys Ala Ser Leu Thr Val Asp
Lys Phe Ser Ser Thr Ala Tyr 65 70 75 80 atg gaa ctc cac agc ctg aca
tct gag gac tct gca gtc tat tac tgt 288Met Glu Leu His Ser Leu Thr
Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 gca aga gaa ttc tac
ggc tac cgg tac ttc gat gtc tgg ggc gca ggg 336Ala Arg Glu Phe Tyr
Gly Tyr Arg Tyr Phe Asp Val Trp Gly Ala Gly 100 105 110 acc gcg gtc
acc gtc tcc tca 357Thr Ala Val Thr Val Ser Ser 115 24119PRTMus sp.
24Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1
5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ala
Tyr 20 25 30 Tyr Met His Trp Val Lys Gln Ser His Val Lys Ser Leu
Glu Trp Ile 35 40 45 Gly Leu Val Asn Pro Tyr Asn Gly Phe Ser Ser
Tyr Asn Gln Asn Phe 50 55 60 Glu Asp Lys Ala Ser Leu Thr Val Asp
Lys Phe Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu His Ser Leu Thr
Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Phe Tyr
Gly Tyr Arg Tyr Phe Asp Val Trp Gly Ala Gly 100 105 110 Thr Ala Val
Thr Val Ser Ser 115 25333DNAMus sp.CDS(1)..(333) 25caa att gtt ctc
acc cag tct cca gca atc atg tct gca tct cta ggg 48Gln Ile Val Leu
Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Leu Gly 1 5 10 15 gaa cgg
gtc acc atg acc tgc act gtc agc tca agt gtg aat tcc agt 96Glu Arg
Val Thr Met Thr Cys Thr Val Ser Ser Ser Val Asn Ser Ser 20 25 30
tac ttg cac tgg tac cag cag aag cca gga tcc tcc ccc aaa ctc tgg
144Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Leu Trp
35 40 45 att tat agc aca tcc aac ctg cct tct gga gtc cca gct cgc
ttc agt 192Ile Tyr Ser Thr Ser Asn Leu Pro Ser Gly Val Pro Ala Arg
Phe Ser 50 55 60 ggc agt gga tct ggg acc tct tac tct ctc aca atc
agc acc ata gag 240Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile
Ser Thr Ile Glu 65 70 75 80 tct gaa gat gct gcc act tat tac tgt cac
cag tat cat cgt tcc cca 288Ser Glu Asp Ala Ala Thr Tyr Tyr Cys His
Gln Tyr His Arg Ser Pro 85 90 95 caa ttc acg ttc ggc tcg ggg aca
aag ttg gag ata aaa cgg gct 333Gln Phe Thr Phe Gly Ser Gly Thr Lys
Leu Glu Ile Lys Arg Ala 100 105 110 26111PRTMus sp. 26Gln Ile Val
Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Leu Gly 1 5 10 15 Glu
Arg Val Thr Met Thr Cys Thr Val Ser Ser Ser Val Asn Ser Ser 20 25
30 Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Leu Trp
35 40 45 Ile Tyr Ser Thr Ser Asn Leu Pro Ser Gly Val Pro Ala Arg
Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile
Ser Thr Ile Glu 65 70 75 80 Ser Glu Asp Ala Ala Thr Tyr Tyr Cys His
Gln Tyr His Arg Ser Pro 85 90 95 Gln Phe Thr Phe Gly Ser Gly Thr
Lys Leu Glu Ile Lys Arg Ala 100 105 110 27336DNAMus
sp.CDS(1)..(336) 27gac att gtg ctg acc caa tct cca gct tct ttg gct
gtg tct cta ggg 48Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala
Val Ser Leu Gly 1 5 10 15 cag agg gcc acc ata tcc tgc aga gcc agt
gaa agt gtt gat act ttt 96Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser
Glu Ser Val Asp Thr Phe 20 25 30 ggc tat agt ttt ata tac tgg tac
cag cag aag cca gga cag cca ccc 144Gly Tyr Ser Phe Ile Tyr Trp Tyr
Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45 aga ctc ctc atc tat cgt
gca tcc aac cta gaa tct ggg atc cct gcc 192Arg Leu Leu Ile Tyr Arg
Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala 50 55 60 agg ttc agt ggc
agt ggg tct agg aca gac ttc acc ctc acc att aat 240Arg Phe Ser Gly
Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn 65 70 75 80 cct gtg
gag gct gat gat gtt gca acc tat tac tgt cag caa agt aat 288Pro Val
Glu Ala Asp Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser Asn 85 90 95
gag gat cct ccg acg ttc ggt gga ggc acc aag ctg gaa atc aaa cgg
336Glu Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105 110 28112PRTMus sp. 28Asp Ile Val Leu Thr Gln Ser Pro Ala
Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala Thr Ile Ser Cys
Arg Ala Ser Glu Ser Val Asp Thr Phe 20 25 30 Gly Tyr Ser Phe Ile
Tyr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45 Arg Leu Leu
Ile Tyr Arg Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala 50 55 60 Arg
Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn 65 70
75 80 Pro Val Glu Ala Asp Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser
Asn 85 90 95 Glu Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu
Ile Lys Arg 100 105 110 29339DNAMus sp.CDS(1)..(339) 29gat gtt gtg
atg tcc cag att cca ctc act ttg tcg gtc acc att gga 48Asp Val Val
Met Ser Gln Ile Pro Leu Thr Leu Ser Val Thr Ile Gly 1 5 10 15 caa
cca gcc tcc atc tct tgc aag tca agt cag agc ctc ata cat agt 96Gln
Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Ile His Ser 20 25
30 gat gga aag aca tat ttg aat tgg ttg tta cag agg cca ggc cag tct
144Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser
35 40 45 cca aag cgc cta att tat ctg gtg tct aga ctg gac tct gga
gtc cct 192Pro Lys Arg Leu Ile Tyr Leu Val Ser Arg Leu Asp Ser Gly
Val Pro 50 55 60 gac agg ttc act ggc agt gga tca ggg aca gat ttc
aca ctg aaa atc 240Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile 65 70 75 80 agc aga gtg gag gct gag gat ttg gga gtt
tat tat tgc tgg caa ggt 288Ser Arg Val Glu Ala Glu Asp Leu Gly Val
Tyr Tyr Cys Trp Gln Gly 85 90 95 tca cat ttt cct cgg acg ttc ggt
gga ggc acc aag ctg gaa atc aaa 336Ser His Phe Pro Arg Thr Phe Gly
Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110 cgg 339Arg 30113PRTMus
sp. 30Asp Val Val Met Ser Gln Ile Pro Leu Thr Leu Ser Val Thr Ile
Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu
Ile His Ser 20 25 30 Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln
Arg Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu Ile Tyr Leu Val Ser
Arg Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe Thr Gly Ser Gly
Ser Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala
Glu Asp Leu Gly Val Tyr Tyr Cys Trp Gln Gly 85 90 95 Ser His Phe
Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110 Arg
31363DNAArtificialHumanized antibody 31cag gtt cag ctt gtc cag cct
gga gct gaa gtg gta aag cca gga gcc 48Gln Val Gln Leu Val Gln Pro
Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 tct gtg aag ctc tct
tgt aaa gca agc ggc tac aac ttc acc agc tat 96Ser Val Lys Leu Ser
Cys Lys Ala Ser Gly Tyr Asn Phe Thr Ser Tyr 20 25 30 tgg atg cac
tgg gtg cgt cag cgt ccc ggc cag gga ctc cag tgg ata 144Trp Met His
Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Gln Trp Ile 35 40 45 ggc
aac atc tac ccc ggc acc ggt aat aca aac tat gac cag aag ttc 192Gly
Asn Ile Tyr Pro Gly Thr Gly Asn Thr Asn
Tyr Asp Gln Lys Phe 50 55 60 caa ggc aag gct acc ctt aca gtt gac
acc tct acc agc act act tat 240Gln Gly Lys Ala Thr Leu Thr Val Asp
Thr Ser Thr Ser Thr Thr Tyr 65 70 75 80 atg caa ttg tcc agc ctg act
agc gag gat tcc gcc gtg tat tat tgt 288Met Gln Leu Ser Ser Leu Thr
Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 gcc agg tgg ggc ctt
gtt agg tac ttc ttc gct atg gat tac tgg ggg 336Ala Arg Trp Gly Leu
Val Arg Tyr Phe Phe Ala Met Asp Tyr Trp Gly 100 105 110 cag ggt act
agc gtt aca gtt tcc agt 363Gln Gly Thr Ser Val Thr Val Ser Ser 115
120 32121PRTArtificialSynthetic Construct 32Gln Val Gln Leu Val Gln
Pro Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu
Ser Cys Lys Ala Ser Gly Tyr Asn Phe Thr Ser Tyr 20 25 30 Trp Met
His Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Gln Trp Ile 35 40 45
Gly Asn Ile Tyr Pro Gly Thr Gly Asn Thr Asn Tyr Asp Gln Lys Phe 50
55 60 Gln Gly Lys Ala Thr Leu Thr Val Asp Thr Ser Thr Ser Thr Thr
Tyr 65 70 75 80 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val
Tyr Tyr Cys 85 90 95 Ala Arg Trp Gly Leu Val Arg Tyr Phe Phe Ala
Met Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Ser Val Thr Val Ser Ser
115 120 33363DNAArtificialHumanized antibody 33cag gtg cag ctc gtc
cag ccc ggt gcc gaa gtg gtg aaa ccc ggt gct 48Gln Val Gln Leu Val
Gln Pro Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 tct gtg aag
ctg tca tgc aag gcc tca ggc tat agt ttc acc tca tat 96Ser Val Lys
Leu Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ser Tyr 20 25 30 tgg
atg cat tgg gtc cgc cag agg cca ggc cag ggc ctc caa tgg atc 144Trp
Met His Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Gln Trp Ile 35 40
45 gga aac atc tac cct ggc aca gga aat acc aat tat gac cag aaa ttc
192Gly Asn Ile Tyr Pro Gly Thr Gly Asn Thr Asn Tyr Asp Gln Lys Phe
50 55 60 caa ggt aag gcc act ctg acc gtg gac act agc aca tca acc
aca tac 240Gln Gly Lys Ala Thr Leu Thr Val Asp Thr Ser Thr Ser Thr
Thr Tyr 65 70 75 80 atg cag ctg tct tct ctc act tca gaa gac agt gct
gtc tac tac tgc 288Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala
Val Tyr Tyr Cys 85 90 95 gca cga tgg ggc ctc gtt cgt tat ttc ttc
gca atg gat tat tgg ggt 336Ala Arg Trp Gly Leu Val Arg Tyr Phe Phe
Ala Met Asp Tyr Trp Gly 100 105 110 caa ggc aca tca gtt acc gtg tcc
tct 363Gln Gly Thr Ser Val Thr Val Ser Ser 115 120
34121PRTArtificialSynthetic Construct 34Gln Val Gln Leu Val Gln Pro
Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser
Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ser Tyr 20 25 30 Trp Met His
Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Gln Trp Ile 35 40 45 Gly
Asn Ile Tyr Pro Gly Thr Gly Asn Thr Asn Tyr Asp Gln Lys Phe 50 55
60 Gln Gly Lys Ala Thr Leu Thr Val Asp Thr Ser Thr Ser Thr Thr Tyr
65 70 75 80 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg Trp Gly Leu Val Arg Tyr Phe Phe Ala Met
Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Ser Val Thr Val Ser Ser 115
120 35363DNAArtificialHumanized antibody 35cag gtg cag ctg gtg cag
ccc ggg gct gag gtg gta aag cca gga gcc 48Gln Val Gln Leu Val Gln
Pro Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 agt gtg aag ttg
tcc tgc aag gcc tcc ggg tac aat ttc acc tct tac 96Ser Val Lys Leu
Ser Cys Lys Ala Ser Gly Tyr Asn Phe Thr Ser Tyr 20 25 30 tgg atg
cat tgg gtg cgt cag cgg cct ggg caa gga ctt caa tgg atc 144Trp Met
His Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Gln Trp Ile 35 40 45
ggg aat att tac ccc ggt acc ggc aat aca aat tat gat cag aag ttc
192Gly Asn Ile Tyr Pro Gly Thr Gly Asn Thr Asn Tyr Asp Gln Lys Phe
50 55 60 cag ggc aag gct aca ttg acc gtg gat acc tac act tct act
act tac 240Gln Gly Lys Ala Thr Leu Thr Val Asp Thr Tyr Thr Ser Thr
Thr Tyr 65 70 75 80 atg caa ctg agc tca ctg acc tcc gag gac tca gcc
gtg tac tat tgc 288Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala
Val Tyr Tyr Cys 85 90 95 gca cgc tgg gga ctc gtc agg tat ttc ttt
gcc atg gat tac tgg gga 336Ala Arg Trp Gly Leu Val Arg Tyr Phe Phe
Ala Met Asp Tyr Trp Gly 100 105 110 cag ggg acc tct gtc acc gtg agc
agt 363Gln Gly Thr Ser Val Thr Val Ser Ser 115 120
36121PRTArtificialSynthetic Construct 36Gln Val Gln Leu Val Gln Pro
Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser
Cys Lys Ala Ser Gly Tyr Asn Phe Thr Ser Tyr 20 25 30 Trp Met His
Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Gln Trp Ile 35 40 45 Gly
Asn Ile Tyr Pro Gly Thr Gly Asn Thr Asn Tyr Asp Gln Lys Phe 50 55
60 Gln Gly Lys Ala Thr Leu Thr Val Asp Thr Tyr Thr Ser Thr Thr Tyr
65 70 75 80 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
Tyr Cys 85 90 95 Ala Arg Trp Gly Leu Val Arg Tyr Phe Phe Ala Met
Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Ser Val Thr Val Ser Ser 115
120 37118PRTArtificialHumanized antibody 37Glu Val Gln Leu Leu Gln
Ser Gly Gly Glu Leu Val Gln Pro Gly Ala 1 5 10 15 Ser Met Arg Ile
Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr Gly Tyr 20 25 30 Thr Met
Asn Trp Val Arg Gln Ser Pro Gly Lys Asn Leu Glu Trp Ile 35 40 45
Gly Leu Ile Asn Pro His Asn Gly Gly Ser Ser Tyr Asn Asp Ser Phe 50
55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala
Tyr 65 70 75 80 Met Glu Leu Leu Ser Leu Thr Ala Glu Asp Ser Ala Val
Tyr Tyr Cys 85 90 95 Val Arg Trp Gly Asp Tyr Gly Ser Phe Ala Tyr
Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115
38118PRTArtificialHumanized antibody 38Glu Val Gln Leu Leu Gln Ser
Gly Gly Glu Leu Val Gln Pro Gly Ala 1 5 10 15 Ser Met Arg Ile Ser
Cys Ala Ala Ser Gly Tyr Ser Phe Thr Gly Tyr 20 25 30 Thr Met Asn
Trp Val Arg Gln Ser Pro Gly Lys Asn Leu Glu Trp Ile 35 40 45 Gly
Leu Ile Asn Pro His Asn Gly Gly Ser Ser Tyr Asn Asp Ser Phe 50 55
60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80 Met Glu Leu Leu Ser Leu Thr Ala Glu Asp Ser Ala Val Tyr
Tyr Cys 85 90 95 Val Arg Trp Gly Asp Tyr Gly Ser Phe Ala Tyr Trp
Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115
39357DNAArtificialHumanized antibody 39cag gtg caa ctg gtg caa tcc
ggt gcc gag gtc gtc aaa ccc gga gca 48Gln Val Gln Leu Val Gln Ser
Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 tct gtg aag ata tcc
tgt aag gcc tcc ggc tac act ttt aca gcc tac 96Ser Val Lys Ile Ser
Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ala Tyr 20 25 30 tat atg cat
tgg gtt aaa cag agt ccc gtg cag tcc ctg gaa tgg atc 144Tyr Met His
Trp Val Lys Gln Ser Pro Val Gln Ser Leu Glu Trp Ile 35 40 45 ggc
ttg gtg aac cct tat aac gga ttc tca agt tac aat caa aag ttt 192Gly
Leu Val Asn Pro Tyr Asn Gly Phe Ser Ser Tyr Asn Gln Lys Phe 50 55
60 cag ggc aag gct tcc ctg act gta gac aag agc agt tcc aca gcc tac
240Gln Gly Lys Ala Ser Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr
65 70 75 80 atg gag ctc cat tca ctg aca tca gaa gac agc gcc gta tac
tat tgc 288Met Glu Leu His Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr
Tyr Cys 85 90 95 gca cgt gag ttc tac ggc tat aga tac ttt gac gtc
tgg ggc caa ggc 336Ala Arg Glu Phe Tyr Gly Tyr Arg Tyr Phe Asp Val
Trp Gly Gln Gly 100 105 110 aca gcc gtc aca gtg agc tct 357Thr Ala
Val Thr Val Ser Ser 115 40119PRTArtificialSynthetic Construct 40Gln
Val Gln Leu Val Gln Ser Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10
15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ala Tyr
20 25 30 Tyr Met His Trp Val Lys Gln Ser Pro Val Gln Ser Leu Glu
Trp Ile 35 40 45 Gly Leu Val Asn Pro Tyr Asn Gly Phe Ser Ser Tyr
Asn Gln Lys Phe 50 55 60 Gln Gly Lys Ala Ser Leu Thr Val Asp Lys
Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu His Ser Leu Thr Ser
Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Phe Tyr Gly
Tyr Arg Tyr Phe Asp Val Trp Gly Gln Gly 100 105 110 Thr Ala Val Thr
Val Ser Ser 115 41357DNAArtificialHumanized antibody 41cag gtc cag
ttg gtg cag tct gga gca gag gtt gtg aaa cca ggc gca 48Gln Val Gln
Leu Val Gln Ser Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 agt
gtc aaa atc agc tgt aag gct agc gga tac tcc ttt aca gca tat 96Ser
Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ala Tyr 20 25
30 tat atg cac tgg gtg aag cag agc cct gtt cag agc ctg gaa tgg atc
144Tyr Met His Trp Val Lys Gln Ser Pro Val Gln Ser Leu Glu Trp Ile
35 40 45 ggt ctc gtc aac cct tat aat gga ttt tct tct tat aac caa
aag ttc 192Gly Leu Val Asn Pro Tyr Asn Gly Phe Ser Ser Tyr Asn Gln
Lys Phe 50 55 60 cag ggc aaa gcc agc ctg aca gtg gat aag agt agc
agc act gcc tat 240Gln Gly Lys Ala Ser Leu Thr Val Asp Lys Ser Ser
Ser Thr Ala Tyr 65 70 75 80 atg gaa ctg cat tct ctc acc tct gaa gat
agt gca gtg tac tat tgt 288Met Glu Leu His Ser Leu Thr Ser Glu Asp
Ser Ala Val Tyr Tyr Cys 85 90 95 gct cgc gag ttc tac ggt tat cga
tat ttc gac gtg tgg ggc cag ggt 336Ala Arg Glu Phe Tyr Gly Tyr Arg
Tyr Phe Asp Val Trp Gly Gln Gly 100 105 110 act gcc gtg aca gta agc
agt 357Thr Ala Val Thr Val Ser Ser 115 42119PRTArtificialSynthetic
Construct 42Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Val Lys Pro
Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser
Phe Thr Ala Tyr 20 25 30 Tyr Met His Trp Val Lys Gln Ser Pro Val
Gln Ser Leu Glu Trp Ile 35 40 45 Gly Leu Val Asn Pro Tyr Asn Gly
Phe Ser Ser Tyr Asn Gln Lys Phe 50 55 60 Gln Gly Lys Ala Ser Leu
Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu His
Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg
Glu Phe Tyr Gly Tyr Arg Tyr Phe Asp Val Trp Gly Gln Gly 100 105 110
Thr Ala Val Thr Val Ser Ser 115 43119PRTArtificialHumanized
antibody 43Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Val Lys Pro
Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr
Phe Thr Ala Tyr 20 25 30 Tyr Met His Trp Val Lys Gln Ser Pro Gly
Gln Ser Leu Glu Trp Ile 35 40 45 Gly Leu Val Asn Pro Tyr Asn Gly
Phe Ser Ser Tyr Asn Gln Lys Phe 50 55 60 Gln Gly Lys Ala Ser Leu
Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu His
Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg
Glu Phe Tyr Gly Tyr Arg Tyr Phe Asp Val Trp Gly Gln Gly 100 105 110
Thr Ala Val Thr Val Ser Ser 115 44357DNAArtificialHumanized
antibody 44cag gtt caa ctg gtt cag agt ggg gca gaa gtc gta aag ccc
gga gct 48Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Val Lys Pro
Gly Ala 1 5 10 15 tcc gtt aag att agc tgt aaa gcc tcc ggc tat agc
ttt aca gct tac 96Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ser
Phe Thr Ala Tyr 20 25 30 tat atg cac tgg gtc aag caa tct cct ggg
cag agc ctg gag tgg atc 144Tyr Met His Trp Val Lys Gln Ser Pro Gly
Gln Ser Leu Glu Trp Ile 35 40 45 ggc ctg gtc aat cca tac aat ggc
ttc tct agt tac aac caa aaa ttt 192Gly Leu Val Asn Pro Tyr Asn Gly
Phe Ser Ser Tyr Asn Gln Lys Phe 50 55 60 cag gga aaa gcc tcc ctt
aca gta gac aag tca tct tcc act gcc tac 240Gln Gly Lys Ala Ser Leu
Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 atg gaa ctt cac
tcc ctt aca agc gag gat agc gcc gtt tat tat tgt 288Met Glu Leu His
Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 gcc aga
gaa ttt tac gga tat cgg tat ttc gat gtc tgg ggg cag ggg 336Ala Arg
Glu Phe Tyr Gly Tyr Arg Tyr Phe Asp Val Trp Gly Gln Gly 100 105 110
act gcc gtg acc gtc agt tct 357Thr Ala Val Thr Val Ser Ser 115
45119PRTArtificialSynthetic Construct 45Gln Val Gln Leu Val Gln Ser
Gly Ala Glu Val Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser
Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ala Tyr 20 25 30 Tyr Met His
Trp Val Lys Gln Ser Pro Gly Gln Ser Leu Glu Trp Ile 35 40 45 Gly
Leu Val Asn Pro Tyr Asn Gly Phe Ser Ser Tyr Asn Gln Lys Phe 50
55 60 Gln Gly Lys Ala Ser Leu Thr Val Asp Lys Ser Ser Ser Thr Ala
Tyr 65 70 75 80 Met Glu Leu His Ser Leu Thr Ser Glu Asp Ser Ala Val
Tyr Tyr Cys 85 90 95 Ala Arg Glu Phe Tyr Gly Tyr Arg Tyr Phe Asp
Val Trp Gly Gln Gly 100 105 110 Thr Ala Val Thr Val Ser Ser 115
46330DNAArtificialHumanized antibody 46gag atc gtt ctc aca cag tca
cca gcc acc atg agc gcc tct ccc ggg 48Glu Ile Val Leu Thr Gln Ser
Pro Ala Thr Met Ser Ala Ser Pro Gly 1 5 10 15 gaa cga gtg acc atg
act tgt aca gta tcc tcc tct gtg aac tct tct 96Glu Arg Val Thr Met
Thr Cys Thr Val Ser Ser Ser Val Asn Ser Ser 20 25 30 tac ctg cat
tgg tac cag cag aag cct ggt tcc agc ccc aaa ctc tgg 144Tyr Leu His
Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Leu Trp 35 40 45 atc
tac agt aca agc aat ctg ccc tca ggc gtt ccc gct agg ttc tcc 192Ile
Tyr Ser Thr Ser Asn Leu Pro Ser Gly Val Pro Ala Arg Phe Ser 50 55
60 ggt tca ggt tct ggc act agt tac tct ctg acc atc agc acc atc gaa
240Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Thr Ile Glu
65 70 75 80 tcc gaa gat gct gca aca tac tac tgt cac cag tat cac agg
tcc ccc 288Ser Glu Asp Ala Ala Thr Tyr Tyr Cys His Gln Tyr His Arg
Ser Pro 85 90 95 cag ttt aca ttc ggt ggc ggc acc aaa ctt gag att
aag cgt 330Gln Phe Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105 110 47110PRTArtificialSynthetic Construct 47Glu Ile Val Leu
Thr Gln Ser Pro Ala Thr Met Ser Ala Ser Pro Gly 1 5 10 15 Glu Arg
Val Thr Met Thr Cys Thr Val Ser Ser Ser Val Asn Ser Ser 20 25 30
Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Lys Leu Trp 35
40 45 Ile Tyr Ser Thr Ser Asn Leu Pro Ser Gly Val Pro Ala Arg Phe
Ser 50 55 60 Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser
Thr Ile Glu 65 70 75 80 Ser Glu Asp Ala Ala Thr Tyr Tyr Cys His Gln
Tyr His Arg Ser Pro 85 90 95 Gln Phe Thr Phe Gly Gly Gly Thr Lys
Leu Glu Ile Lys Arg 100 105 110 48112PRTArtificialHumanized
antibody 48Asp Ile Val Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser
Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser
Val Asp Thr Phe 20 25 30 Gly Tyr Ser Phe Ile Tyr Trp Tyr Gln Gln
Lys Pro Gly Gln Pro Pro 35 40 45 Arg Leu Leu Ile Tyr Arg Ala Ser
Asn Leu Glu Ser Gly Ile Pro Asp 50 55 60 Arg Phe Ser Gly Ser Gly
Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn 65 70 75 80 Pro Val Glu Ala
Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser Asn 85 90 95 Glu Asp
Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 100 105 110
49112PRTArtificialHumanized antibody 49Asp Ile Val Leu Thr Gln Ser
Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile
Ser Cys Arg Ala Ser Glu Ser Val Asp Thr Phe 20 25 30 Gly Tyr Ser
Phe Ile Tyr Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro 35 40 45 Arg
Leu Leu Ile Tyr Arg Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala 50 55
60 Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn
65 70 75 80 Pro Val Glu Ala Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln
Ser Asn 85 90 95 Glu Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu
Glu Ile Lys Arg 100 105 110 50112PRTArtificialHumanized antibody
50Asp Ile Val Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1
5 10 15 Glu Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Thr
Phe 20 25 30 Gly Tyr Ser Phe Ile Tyr Trp Tyr Gln Gln Lys Pro Gly
Gln Pro Pro 35 40 45 Arg Leu Leu Ile Tyr Arg Ala Ser Asn Leu Glu
Ser Gly Ile Pro Asp 50 55 60 Arg Phe Ser Gly Ser Gly Ser Arg Thr
Asp Phe Thr Leu Thr Ile Asn 65 70 75 80 Pro Val Glu Ala Asp Asp Val
Ala Thr Tyr Tyr Cys Gln Gln Ser Asn 85 90 95 Glu Asp Pro Pro Thr
Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 100 105 110
51339DNAArtificialHumanized antibody 51gac gtc gtg atg aca caa acc
cct ctg tcc ctg agc gtc act ctg gga 48Asp Val Val Met Thr Gln Thr
Pro Leu Ser Leu Ser Val Thr Leu Gly 1 5 10 15 caa ccc gct tcc att
agc tgc aaa tca tca caa tct ctc atc cac tca 96Gln Pro Ala Ser Ile
Ser Cys Lys Ser Ser Gln Ser Leu Ile His Ser 20 25 30 gac ggc aaa
aca tac ctc aat tgg ctg ctg cag aga cca gga cag tcc 144Asp Gly Lys
Thr Tyr Leu Asn Trp Leu Leu Gln Arg Pro Gly Gln Ser 35 40 45 cct
aaa agg ctt atc tac ctg gtc tct cgt ttg gac tct ggt gta cca 192Pro
Lys Arg Leu Ile Tyr Leu Val Ser Arg Leu Asp Ser Gly Val Pro 50 55
60 gac cgg ttt act ggt tcc ggg gcc gga acc gat ttc act ctg aag att
240Asp Arg Phe Thr Gly Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80 tcc agg gtg gaa gct gaa gat ctc gga gtg tat tat tgc tgg
cag ggc 288Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Trp
Gln Gly 85 90 95 agc cat ttc ccc cgt act ttt ggt ggg ggt acc aaa
ttg gaa att aag 336Ser His Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys
Leu Glu Ile Lys 100 105 110 cgt 339Arg 52113PRTArtificialSynthetic
Construct 52Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Ser Val Thr
Leu Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser
Leu Ile His Ser 20 25 30 Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu
Gln Arg Pro Gly Gln Ser 35 40 45 Pro Lys Arg Leu Ile Tyr Leu Val
Ser Arg Leu Asp Ser Gly Val Pro 50 55 60 Asp Arg Phe Thr Gly Ser
Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu
Ala Glu Asp Leu Gly Val Tyr Tyr Cys Trp Gln Gly 85 90 95 Ser His
Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110
Arg 5336DNAMus sp. 53ggaggatcca tagacagatg ggggtgtcgt tttggc
365432DNAMus sp. 54ggaggatccc ttgaccaggc atcctagagt ca 325532DNAMus
sp.misc_feature(1)..(32)mixed bases are defined as follows H=A+T+C,
S=G+C, Y=C+T, K= G+T, M=A+C, R=A+G, W=A+T, V = A+C+G, N = A+C+G+T
55cttccggaat tcsargtnma gctgsagsag tc 325635DNAMus
sp.misc_feature(18)..(18)n is a, c, g, or t 56cttccggaat tcsargtnma
gctgsagsag tcwgg 355731DNAMus sp.misc_feature(1)..(31)mixed bases
are defined as follows H=A+T+C, S=G+C, Y=C+T, K= G+T, M=A+C, R=A+G,
W=A+T, V = A+C+G, N = A+C+G+T 57ggagctcgay attgtgmtsa cmcarwctmc a
315846DNAMus sp. 58tatagagctc aagcttggat ggtgggaaga tggatacagt
tggtgc 465923DNAMus sp. 59gacagacaca ctcctgctat ggg 236032DNAMus
sp.misc_feature(1)..(32)mixed bases are defined as follows H=A+T+C,
S=G+C, Y=C+T, K= G+T, M=A+C, R=A+G, W=A+T, V = A+C+G, N = A+C+G+T
60gcagaattca tgggatggag cyggatcttt ct 32615PRTMus sp. 61Glu Tyr Asn
Met His 1 5 6217PRTMus sp. 62Tyr Ile Tyr Pro Tyr Asn Gly Asp Thr
Gly Tyr Arg Gln Lys Phe Lys 1 5 10 15 Asn 6311PRTMus sp. 63Trp Gly
Tyr Gly Ser Gly Gly Gly Phe Thr Tyr 1 5 10 6415PRTMus sp. 64Arg Ala
Ser Glu Ser Val Asp Thr Tyr Gly Asn Ser Phe Met His 1 5 10 15
657PRTMus sp. 65Arg Ala Ser Asn Leu Glu Ser 1 5 669PRTMus sp. 66Gln
Gln Ser Asn Glu Asp Pro Leu Thr 1 5 675PRTMus sp. 67Asp Tyr Asn Met
His 1 5 6817PRTMus sp. 68Phe Ile Tyr Pro Tyr Asn Gly Gly Thr Gly
Tyr Asn Gln Arg Phe Lys 1 5 10 15 Asn 6910PRTMus sp. 69Gly Tyr Tyr
Tyr Gly Arg His Phe Asp Tyr 1 5 10 7010PRTMus sp. 70Ser Ala Ser Ser
Ser Val Ser Tyr Met Tyr 1 5 10 717PRTMus sp. 71Ile Thr Ser Asn Leu
Ala Ser 1 5 729PRTMus sp. 72Gln Gln Trp Ser Ser Asn Pro Pro Thr 1 5
73360DNAMus sp.CDS(1)..(360) 73gag gtc cag ctt cag cag tca gga cct
gac ctg gtg aaa cct ggg gcc 48Glu Val Gln Leu Gln Gln Ser Gly Pro
Asp Leu Val Lys Pro Gly Ala 1 5 10 15 tca gtg aag ata tcc tgc aag
gct tct gga tac aga ttc act gaa tac 96Ser Val Lys Ile Ser Cys Lys
Ala Ser Gly Tyr Arg Phe Thr Glu Tyr 20 25 30 aat atg cac tgg atg
aag cag agc cat gga gag agc ctt gag tgg att 144Asn Met His Trp Met
Lys Gln Ser His Gly Glu Ser Leu Glu Trp Ile 35 40 45 gga tat att
tat cct tac aat ggt gat act ggc tac agg cag aaa ttc 192Gly Tyr Ile
Tyr Pro Tyr Asn Gly Asp Thr Gly Tyr Arg Gln Lys Phe 50 55 60 aag
aac atg gcc aca ttg act gca gac att tcc tcc aat aca gcc tac 240Lys
Asn Met Ala Thr Leu Thr Ala Asp Ile Ser Ser Asn Thr Ala Tyr 65 70
75 80 atg gaa ctc cgc agc ctg aca tct gac gac tct gca gtc tat ttc
tgt 288Met Glu Leu Arg Ser Leu Thr Ser Asp Asp Ser Ala Val Tyr Phe
Cys 85 90 95 gca aga tgg ggc tac ggt agt ggc ggg ggg ttt act tac
tgg ggc caa 336Ala Arg Trp Gly Tyr Gly Ser Gly Gly Gly Phe Thr Tyr
Trp Gly Gln 100 105 110 ggg act ctg gtc act gtc tct gca 360Gly Thr
Leu Val Thr Val Ser Ala 115 120 74120PRTMus sp. 74Glu Val Gln Leu
Gln Gln Ser Gly Pro Asp Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val
Lys Ile Ser Cys Lys Ala Ser Gly Tyr Arg Phe Thr Glu Tyr 20 25 30
Asn Met His Trp Met Lys Gln Ser His Gly Glu Ser Leu Glu Trp Ile 35
40 45 Gly Tyr Ile Tyr Pro Tyr Asn Gly Asp Thr Gly Tyr Arg Gln Lys
Phe 50 55 60 Lys Asn Met Ala Thr Leu Thr Ala Asp Ile Ser Ser Asn
Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Asp Asp Ser
Ala Val Tyr Phe Cys 85 90 95 Ala Arg Trp Gly Tyr Gly Ser Gly Gly
Gly Phe Thr Tyr Trp Gly Gln 100 105 110 Gly Thr Leu Val Thr Val Ser
Ala 115 120 75357DNAMus sp.CDS(1)..(357) 75gag gtc cag ctt cag cag
tca gga cct gag ctg gtg aaa cct ggg gcc 48Glu Val Gln Leu Gln Gln
Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 tca gtg aag ata
tcc tgc aag gct tct gga tac aca ttc act gac tac 96Ser Val Lys Ile
Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 aac atg
cac tgg gtg aaa cag agc cat gga aag agc ctt gag tgg att 144Asn Met
His Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile 35 40 45
gga ttt att tat cct tac aat ggt ggt act ggc tac aac cag agg ttc
192Gly Phe Ile Tyr Pro Tyr Asn Gly Gly Thr Gly Tyr Asn Gln Arg Phe
50 55 60 aag aac aag gcc aca ttg act gta gac act tcc tcc agc aca
gcc tac 240Lys Asn Lys Ala Thr Leu Thr Val Asp Thr Ser Ser Ser Thr
Ala Tyr 65 70 75 80 atg gag gtc cgc agc ctg aca tct gag gac tct gca
gtc tat ttc tgt 288Met Glu Val Arg Ser Leu Thr Ser Glu Asp Ser Ala
Val Tyr Phe Cys 85 90 95 gca agg gga tat tac tac ggt agg cac ttt
gac tac tgg ggc caa ggc 336Ala Arg Gly Tyr Tyr Tyr Gly Arg His Phe
Asp Tyr Trp Gly Gln Gly 100 105 110 acc act ctc aca gtc tcc tca
357Thr Thr Leu Thr Val Ser Ser 115 76119PRTMus sp. 76Glu Val Gln
Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser
Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25
30 Asn Met His Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile
35 40 45 Gly Phe Ile Tyr Pro Tyr Asn Gly Gly Thr Gly Tyr Asn Gln
Arg Phe 50 55 60 Lys Asn Lys Ala Thr Leu Thr Val Asp Thr Ser Ser
Ser Thr Ala Tyr 65 70 75 80 Met Glu Val Arg Ser Leu Thr Ser Glu Asp
Ser Ala Val Tyr Phe Cys 85 90 95 Ala Arg Gly Tyr Tyr Tyr Gly Arg
His Phe Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Thr Leu Thr Val Ser
Ser 115 77336DNAMus sp.CDS(1)..(336) 77gac att gtg ctg acc caa tct
cca ggt tct ttg gct gtg tct cta ggg 48Asp Ile Val Leu Thr Gln Ser
Pro Gly Ser Leu Ala Val Ser Leu Gly 1 5 10 15 cag agg gcc acc ata
tcc tgc aga gcc agt gaa agt gtt gac act tat 96Gln Arg Ala Thr Ile
Ser Cys Arg Ala Ser Glu Ser Val Asp Thr Tyr 20 25 30 ggc aat agt
ttc atg cac tgg tac cag cag aaa gca gga cag ccg ccc 144Gly Asn Ser
Phe Met His Trp Tyr Gln Gln Lys Ala Gly Gln Pro Pro 35 40 45 aga
ctc ctc atc tat cgt gca tcc aac cta gaa tct ggg atc cct gcc 192Arg
Leu Leu Ile Tyr Arg Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala 50 55
60 agg ttc agt ggc agt ggg tct agg aca gac ttc acc ctc acc att aat
240Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn
65 70 75 80 cct gtg gag gct gat gat gtt gca acc tat tac tgt cag caa
agt aat 288Pro Val Glu Ala Asp Asp Val Ala Thr Tyr Tyr Cys Gln Gln
Ser Asn 85 90 95 gag gat cct ctc acg ttc ggt gct ggg acc aag ctg
gag ctg aaa cgg 336Glu Asp Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu
Glu Leu Lys Arg 100 105 110 78112PRTMus sp. 78Asp Ile Val Leu Thr
Gln Ser Pro Gly Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala
Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Thr Tyr 20 25 30 Gly
Asn Ser Phe Met His Trp Tyr Gln Gln Lys Ala Gly Gln Pro Pro 35 40
45 Arg
Leu Leu Ile Tyr Arg Ala Ser Asn Leu Glu Ser Gly Ile Pro Ala 50 55
60 Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn
65 70 75 80 Pro Val Glu Ala Asp Asp Val Ala Thr Tyr Tyr Cys Gln Gln
Ser Asn 85 90 95 Glu Asp Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu
Glu Leu Lys Arg 100 105 110 79321DNAMus sp.CDS(1)..(321) 79caa att
gtt ctc acc cag tct cca gca ctc atg tct gca tct cca ggg 48Gln Ile
Val Leu Thr Gln Ser Pro Ala Leu Met Ser Ala Ser Pro Gly 1 5 10 15
gag aag gtc acc atg acc tgc agt gcc agc tca agt gtg agt tac atg
96Glu Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met
20 25 30 tac tgg tac cag cag aag cca aga tcc tcc ccc aaa ccc tgg
att tat 144Tyr Trp Tyr Gln Gln Lys Pro Arg Ser Ser Pro Lys Pro Trp
Ile Tyr 35 40 45 atc aca tcc aac ctg gct tct gga gtc cct gct cgc
ttc agt ggc agt 192Ile Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg
Phe Ser Gly Ser 50 55 60 ggg tct ggg acc tct tac tct ctc aca atc
agc agc atg gag gct gaa 240Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile
Ser Ser Met Glu Ala Glu 65 70 75 80 gat gct gcc act tat tac tgc cag
cag tgg agt agt aac cca ccc acg 288Asp Ala Ala Thr Tyr Tyr Cys Gln
Gln Trp Ser Ser Asn Pro Pro Thr 85 90 95 ttc gga ggg ggg acc aag
ctg gaa ata aaa cgg 321Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg
100 105 80107PRTMus sp. 80Gln Ile Val Leu Thr Gln Ser Pro Ala Leu
Met Ser Ala Ser Pro Gly 1 5 10 15 Glu Lys Val Thr Met Thr Cys Ser
Ala Ser Ser Ser Val Ser Tyr Met 20 25 30 Tyr Trp Tyr Gln Gln Lys
Pro Arg Ser Ser Pro Lys Pro Trp Ile Tyr 35 40 45 Ile Thr Ser Asn
Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser 50 55 60 Gly Ser
Gly Thr Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Ala Glu 65 70 75 80
Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Pro Thr 85
90 95 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg 100 105
* * * * *
References