U.S. patent application number 14/435065 was filed with the patent office on 2015-09-24 for transcription activator-like effector (tale) - lysine-specific demethylase 1 (lsd1) fusion proteins.
The applicant listed for this patent is THE GENERAL HOSPITAL CORPORATION. Invention is credited to Bradley E. Bernstein, Jae Keith Joung, Eric M. Mendenhall, Deepak Reyon.
Application Number | 20150267176 14/435065 |
Document ID | / |
Family ID | 50477918 |
Filed Date | 2015-09-24 |
United States Patent
Application |
20150267176 |
Kind Code |
A1 |
Joung; Jae Keith ; et
al. |
September 24, 2015 |
TRANSCRIPTION ACTIVATOR-LIKE EFFECTOR (TALE) - LYSINE-SPECIFIC
DEMETHYLASE 1 (LSD1) FUSION PROTEINS
Abstract
Fusion proteins comprising a DNA binding domain, e.g., a TAL
effector repeat array (TALE) or zinc finger array, and a catalytic
domain comprising a sequence that catalyzes histone demethylation,
and methods of use thereof.
Inventors: |
Joung; Jae Keith;
(Winchester, MA) ; Mendenhall; Eric M.; (Madison,
AL) ; Bernstein; Bradley E.; (Cambridge, MA) ;
Reyon; Deepak; (Malden, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE GENERAL HOSPITAL CORPORATION |
Boston |
MA |
US |
|
|
Family ID: |
50477918 |
Appl. No.: |
14/435065 |
Filed: |
October 11, 2013 |
PCT Filed: |
October 11, 2013 |
PCT NO: |
PCT/US2013/064511 |
371 Date: |
April 10, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61865432 |
Aug 13, 2013 |
|
|
|
61776039 |
Mar 11, 2013 |
|
|
|
61713098 |
Oct 12, 2012 |
|
|
|
Current U.S.
Class: |
424/94.3 ;
435/189; 435/375 |
Current CPC
Class: |
C12N 9/22 20130101; C12N
15/1093 20130101; C12Y 105/00 20130101; C07K 2319/80 20130101; C12N
15/63 20130101; A61K 38/00 20130101; C12N 9/0026 20130101; C12N
9/0004 20130101; C07K 14/195 20130101 |
International
Class: |
C12N 9/02 20060101
C12N009/02; C07K 14/195 20060101 C07K014/195 |
Goverment Interests
FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with Government support under the
National Human Genome Research Institute's ENCODE Project (Grant
Nos. U54 HG004570, U54 HG006991) and Grant Nos. DPI GM105378 and
NIH P50 HG005550 awarded by the National Institutes of Health. The
Government has certain rights in the invention.
Claims
1. A fusion protein comprising an engineered DNA-binding domain
that binds specifically to a preselected target sequence, and a
catalytic domain comprising a sequence that catalyzes histone
demethylation.
2. The fusion protein of claim 1, further comprising a linker
between the DNA binding domain and the catalytic domain.
3. The fusion protein of claim 1, wherein the DNA-binding domain is
or comprises an engineered transcription activator-like (TAL)
effector repeat array, zinc finger, triplex-forming
oligonucleotide, peptide nucleic acid, or a DNA-binding domain from
a homing meganuclease (preferably a catalytically inactive homing
meganuclease), or a catalytically inactive Cas9 nuclease.
4. The fusion protein of claim 1, wherein the catalytic domain
comprises full length LSD1, or a catalytic domain of LSD1.
5. The fusion protein of claim 4, wherein the catalytic domain
comprises amino acids 172-833 of the human LSD1 variant 2.
6. The fusion protein of claim 1, comprising a plurality of
catalytic domains, optionally with linkers therebetween.
7. A method of reducing methylation of histones associated with a
selected DNA sequence in a mammalian cell, the method comprising
contacting the cell with a fusion protein comprising an engineered
DNA-binding domain that binds specifically to a target sequence,
wherein the target sequence is within about 10 kb, 5 kb, 2 kb, or 1
kb, 500 bp, 250 bp, 100 bp, 50 bp, 40 bp, 30 bp, or 20 bp, of the
selected DNA sequence, and a catalytic domain comprising a sequence
that catalyzes histone demethylation.
8. A method of reducing methylation of histones associated with a
selected DNA sequence in a mammalian cell, the method comprising
contacting the cell with a nucleic acid encoding a fusion protein
comprising an engineered DNA-binding domain that binds specifically
to a target sequence, wherein the target sequence is within about
10 kb, 5 kb, 2 kb, 1 kb, 500 bp, 250 bp, 100 bp, 50 bp, 40 bp, 30
bp, or 20 bp, of the selected DNA sequence, and a catalytic domain
comprising a sequence that catalyzes histone demethylation.
9. The method of claim 7, wherein the fusion protein further
comprises a linker between the DNA binding domain and the catalytic
domain.
10. The method of claim 7, wherein the DNA-binding domain is or
comprises an engineered transcription activator-like (TAL) effector
repeat array, zinc finger, triplex-forming oligonucleotide, peptide
nucleic acid, or a DNA-binding domain from a homing meganuclease
(preferably a catalytically inactive homing meganuclease), or a
catalytically inactive Cas9 nuclease.
11. The method of claim 7, wherein the catalytic domain comprises a
full-length LSD1 or a catalytic domain of LSD1.
12. The method of claim 11, wherein the catalytic domain comprises
amino acids 172-833 of the human LSD1 variant 2.
13. The method of claim 7, wherein the cell is a human cell.
14. The method of claim 7, wherein the cell is in a living
mammal.
15. The method of claim 7, wherein the selected DNA sequence is a
sequence of a p14.sup.ARF gene.
16. The method of claim 8, wherein the fusion protein further
comprises a linker between the DNA binding domain and the catalytic
domain.
17. The method of claim 8, wherein the DNA-binding domain is or
comprises an engineered transcription activator-like (TAL) effector
repeat array, zinc finger, triplex-forming oligonucleotide, peptide
nucleic acid, or a DNA-binding domain from a homing meganuclease
(preferably a catalytically inactive homing meganuclease), or a
catalytically inactive Cas9 nuclease.
18. The method of claim 8, wherein the catalytic domain comprises a
full-length LSD1 or a catalytic domain of LSD1.
19. The method of claim 18, wherein the catalytic domain comprises
amino acids 172-833 of the human LSD1 variant 2.
20. The method of claim 8, wherein the cell is a human cell.
21. The method of claim 8, wherein the cell is in a living
mammal.
22. The method of claim 8, wherein the selected DNA sequence is a
sequence of a p14.sup.ARF gene.
23. The method of claim 7, wherein the fusion protein comprises a
plurality of catalytic domains, optionally with linkers
therebetween.
Description
CLAIM OF PRIORITY
[0001] This application claims the benefit of, and incorporates by
reference, U.S. Provisional Patent Applications Nos. 61/713,098,
filed on Oct. 12, 2012; 61/776,039, filed on Mar. 11, 2013, and
61/865,432, filed on Aug. 13, 2013.
TECHNICAL FIELD
[0003] This invention relates to fusion proteins comprising a DNA
binding domain, e.g., a TAL effector repeat array (TALE) or zinc
finger, and a catalytic domain comprising a sequence that catalyzes
histone demethylation, and methods of use thereof.
BACKGROUND
[0004] Mammalian gene regulation is dependent on tissue-specific
enhancers that can act across large distances to influence
transcriptional activity.sup.1-3. Mapping experiments have
identified hundreds of thousands of putative enhancers whose
functionality is supported by cell type-specific chromatin
signatures and striking enrichments for disease-associated sequence
variants.sup.4-11. However, these studies do not address the in
vivo functions of the putative elements or their chromatin states,
and cannot determine which genes, if any, a given enhancer
regulates.
SUMMARY
[0005] The present invention is based, at least in part, on the
development of fusions between transcription activator-like
effector (TALE) repeat domains and a histone demethylase, e.g.,
Lysine-Specific Demethylase 1 (LSD1). As shown herein, these
TALE-histone demethylase fusion proteins efficiently remove
enhancer-associated chromatin modifications from target loci,
without affecting control regions. Inactivation of enhancer
chromatin by these fusions frequently causes down-regulation of
proximal genes. These `epigenome editing` tools can be used, e.g.,
to characterize a critical class of functional genomic elements, or
to modulate (e.g., decrease) expression of selected genes).
[0006] Thus, provided herein are fusion proteins comprising an
engineered DNA-binding domain that binds specifically to a
preselected target sequence, and a catalytic domain comprising a
sequence that catalyzes histone demethylation.
[0007] In another aspect, the invention provides methods for
reducing methylation of histones associated with a selected DNA
sequence in a mammalian cell. The methods include contacting the
cell with a fusion protein comprising an engineered DNA-binding
domain that binds specifically to a target sequence, wherein the
target sequence is within about 10 kb, 5 kb, 2 kb, or 1 kb, 500 bp,
250 bp, 100 bp, 50 bp, 40 bp, 30 bp, or 20 bp, of the selected DNA
sequence, and a catalytic domain comprising a sequence that
catalyzes histone demethylation.
[0008] In another aspect, the invention provides methods for
reducing methylation of histones associated with a selected DNA
sequence in a mammalian cell. The methods include contacting the
cell with a nucleic acid encoding a fusion protein comprising an
engineered DNA-binding domain that binds specifically to a target
sequence, wherein the target sequence is within about 10 kb, 5 kb,
2 kb, 1 kb, 500 bp, 250 bp, 100 bp, 50 bp, 40 bp, 30 bp, or 20 bp,
of the selected DNA sequence, and a catalytic domain comprising a
sequence that catalyzes histone demethylation.
[0009] In some embodiments, the fusion proteins comprise a linker
between the DNA binding domain and the catalytic domain.
[0010] In some embodiments, the DNA-binding domain is or comprises
an engineered transcription activator-like (TAL) effector repeat
array, zinc finger, triplex-forming oligonucleotide, peptide
nucleic acid, or a DNA-binding domain from a homing meganuclease
(preferably a catalytically inactive homing meganuclease), or a
catalytically inactive Cas9 nuclease.
[0011] In some embodiments, the catalytic domain comprises full
length LSD1, or a catalytic domain of LSD1, e.g., amino acids
172-833 of the human LSD1 variant 2.
[0012] In some embodiments, the fusion proteins comprise a
plurality of catalytic domains, optionally with linkers
therebetween.
[0013] In some embodiments, the cell is a human cell.
[0014] In some embodiments, the cell is in a living mammal.
[0015] In some embodiments, the selected DNA sequence is a sequence
of a p14ARF gene.
[0016] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Methods
and materials are described herein for use in the present
invention; other, suitable methods and materials known in the art
can also be used. The materials, methods, and examples are
illustrative only and not intended to be limiting. All
publications, patent applications, patents, sequences, database
entries, and other references mentioned herein are incorporated by
reference in their entirety. In case of conflict, the present
specification, including definitions, will control.
[0017] Other features and advantages of the invention will be
apparent from the following detailed description and figures, and
from the claims.
DESCRIPTION OF DRAWINGS
[0018] FIGS. 1a-f. Programmable TALE-LSD1 fusion modulates
chromatin at an endogenous enhancer. (a) Schematic depicts workflow
for identification of nucleosome-free target sequence (black
stripe) within enhancer (peaks of histone modification) and design
of corresponding TALE fusion. TALE arrays comprising .about.18
repeats (ovals) that each bind a single DNA base are fused to the
LSD1 histone H3K4 demethylase. Upon transient transfection, we
assayed for binding to the target site, induced chromatin changes
and altered gene expression. (b) ChIP-seq signal tracks show
H3K4me2, H3K27ac and TALE binding in K562 cells across a targeted
enhancer in the SCL locus. Control tracks show anti-FLAG ChIP-seq
signals in mCherry transfected cells and input chromatin. The
target sequence of the TALE is indicated below. (c) ChIP-qPCR data
show fold-change of H3K4me2 and H3K27ac enrichment in cells
transfected with constructs encoding TALE-LSD1, the same TALE but
lacking LSD1, or a `nontarget` TALE-LSD1 whose cognate sequence is
not present in the human genome. Data are presented as log 2 ratios
normalized to mCherry plasmid transfected control (error bars
represent+s.e.m. n=4 biological replicates). (d) ChIP-seq tracks
show H3K4me2 and H3K27ac signals across the target SCL locus for
K562 cells transfected with TALE-LSD1 or control mCherry plasmid.
(e) ChIP-qPCR to test for off target effects of TALE-LSD1.
ChIP-qPCR for H3K4me2 (lighter grey) and H3K27ac (darker grey) at
two non-target control enhancers. For comparison, the data from the
target enhancer is shown. (f) ChIP-qPCR values for the non-target
control TALE-LSD1. A TALE-LSD1 construct targeting a sequence not
present in the human genome was transfected into K562 cells as a
control for non-specific effects. Data is shown as ratio of
enrichment to mCherry plasmid control for a subset of enhancers
shown in FIG. 2. For comparison, an `on target` TALE-LSD1 construct
at its targeted enhancer is shown (TALE-LSD1 #4).
[0019] FIG. 2. TALE-LSD1 fusions targeting 40 candidate enhancers
in K562 cells. The FLASH assembly method was used to engineer 40
TALE-LSD1 fusions that recognize 17-20 base sequences in
nucleosome-free regions of candidate enhancers. These reagents were
transfected into K562 cells and evaluated by ChIP-qPCR.
Bi-directional plot shows fold change of H3K4me2 (lighter grey,
left) and H3K27ac (darker grey, right) at the target locus for each
of the 40 fusions, which are ordered by strength of effect and
labeled by their target genomic site. Most target sites were
evaluated using two qPCR primer sets. Data are presented as log 2
ratios normalized to mCherry plasmid transfected control (error
bars represent+s.e.m., n=3 biological replicates). The solid lines
(indicated at the bottom by arrows) define a 2-fold difference (log
2=-1). The horizontal dashed line demarcates constructs that induce
a 2-fold reduction in histone modification levels for two or more
of the four values shown. Regulated genes for 9 tested fusions are
shown at right (see Examples and FIG. 3). The data indicate that
TALE-LSD1 reagents provide a general means for modulating chromatin
state at endogenous enhancers.
[0020] FIGS. 3a-c. TALE-LSD1 fusions to endogenous enhancers affect
proximal gene expression. (a) Nine TALE-LSD1 fusions that robustly
alter chromatin state (see FIG. 2) were evaluated for their effects
on gene expression by RNA-seq (see Methods). For each of the nine
fusions, a bar graph shows normalized gene expression values for
the closest expressed upstream and downstream genes (error bars
represent SEM, n=2 biological replicates). The light and dark grey
bars (middle and right bars in each grouping) indicate the mean
expression in cells transfected with the corresponding `on-target`
TALE-LSD1 construct, while the black bars (leftmost in each
grouping) indicate the mean expression in cells transfected with
control `off-target` TALE constructs (error bars represent standard
deviations, * indicates p<0.05). (b) ChIP-seq tracks show
H3K4me2 and H3K27ac signals across the Zfpm2 locus. TALE-LSD1
fusions were designed to target candidate enhancers (black bars) in
the first intron. (c) Bar graph shows relative ZFPM2 expression in
K562 cells transfected with the indicated combinations of TALE-LSD1
constructs. Error bars indicate +s.e.m of 4 RT-qPCR measurements).
The data suggest that these enhancers act redundantly in K562 cells
to maintain ZFPM2 expression.
[0021] FIGS. 4a-c. ChIP-qPCR to test for effects of TALE-LSD1. (a)
ChIP-qPCR enrichment of H3K4me3 for three target enhancers,
selected based on prior evidence of H4K4me3 (#4, #25) and one
typical enhancer (#3) lacking K4me3. For comparison, data from a
H3K4me3 enriched promoter is shown. (b) ChIP-qPCR for H3K4me3 (dark
grey) at the two TALE-LSD1 targeted enhancers that showed some
H3K4me3 enrichment. The data represent the decrease in enrichment
at the target enhancer. (c) ChIP-qPCR enrichment of H3K4me1 for
target enhancers of three TALE-LSD1 fusions. The data represent the
decrease in enrichment at the target enhancer.
[0022] FIG. 5. ChIP-qPCR for H3K4me2 and H3K27ac at non-target
sites. Data is shown for all 40 TALE-LSD1 constructs used in FIG.
2. Four primers sets were used to measure ChIP enrichment at two
non-target enhancer loci for each TALE construct. No non-target
enhancer showed a significant decrease (>2 fold decrease in 2/4
primer sets) in ChIP enrichment.
[0023] FIG. 6. ChIP-seq maps for H3K4me2 and H3K27ac for control
cells and cells transfected independently with 2 TALE-LSD1
fusions.
[0024] FIG. 7. Mean normalized 3' Digital Gene Expression Values
for the 10-25 genes nearest the TALE target enhancer. Genes with
values below 10 were considered unexpressed in K562 cells. Data
points indicated with arrows and filled circles represent genes
with a significant decrease in the TALE-LSD1 transfected cells.
Significant decrease was considered if both biological replicates
represented the two outlying values across all 22 RNA-seq datasets
(see Methods).
[0025] FIGS. 8A-B. Quantitative PCR confirmation of 3' DGE. (a)
RT-qPCR expression analysis for genes near two TALE-LSD1 target
sites. (b) RT-qPCR data showing gene expression for Zfpm2 in cells
transfected with a TALE #25 control plasmid that lacks the LSD1
protein, with data from the TALE-LSD1 for comparison. Error bars
represent+SEM, n=2 biological replicates.
DETAILED DESCRIPTION
[0026] Active enhancers are marked by histone H3 K4 mono- and
di-methylation (H3K4me1 and H3K4me2) and K27 acetylation
(H3K27ac).sup.4,6,9,12,13. The present inventors hypothesized that
a given enhancer could be inactivated by removal of these chromatin
marks. To test this hypothesis, monomeric fusions between TALE
repeat arrays and the lysine-specific demethylase 1 (LSD1).sup.14
were engineered. TALE repeats are modular DNA-binding domains that
can be designed to bind essentially any genomic sequence of
interest.sup.15,16. LSD1 catalyzes the removal of H3 K4 and H3 K9
methylation.sup.1-3,14. Although prior studies have used TALE
nucleases to edit specific genomic regions to disrupt coding
sequences.sup.4-11,17,18 it was hypothesized that TALE-LSD1 fusions
might provide a more versatile means for modulating the activity of
noncoding elements and evaluating the significance of their
chromatin states.
[0027] Described herein are fusion proteins comprising a
DNA-binding domain (i.e., an engineered custom DNA-binding domain),
and a catalytic domain (from a different protein) comprising a
sequence that catalyzes histone demethylation (e.g., LSD1), with an
optional linker between the two domains, such as a linker
comprising 2-20, e.g., 10-12, amino acids, preferably a flexible
linker (i.e., comprising amino acids such as Glycine and Serine
that allow freedom in rotation). An exemplary linker comprises
GGSGGSGGS (SEQ ID NO:5). Linkers are known in the art, see, Chen et
al., e.g., Adv Drug Deliv Rev. 2012 Sep. 29. pii:
50169-409X(12)00300-6. As described herein, expression of a TAL
effector repeat array-LSD1 (TAL-LSD1) fusion protein in human cells
results in efficient removal of enhancer-associated chromatin
modifications from target loci in close proximity to the target
site bound by the TAL effector repeat array part of the
protein.
[0028] Exemplified is a hybrid protein consisting of an engineered
transcription activator-like (TAL) effector repeat array fused to a
full length LSD1 protein, e.g., comprising the shorter variant 2 as
set forth below, or a truncated form that retains the catalytic
function of LSD1, e.g., as described herein. DNA-binding
specificity is defined by the engineered TAL effector repeat array.
These DNA-binding proteins can be engineered to bind to essentially
any DNA sequence and published work from various labs, as well as
the inventors' published and unpublished data, has demonstrated
that these customizable domains can efficiently target a variety of
fused domains to specific genomic locations (Reyon et al., FLASH
assembly of TALENs for high-throughput genome editing. Nat
Biotechnol (2012).doi:10.1038/nbt.2170; Moscou and Bogdanove,
Science 326, 1501-1501 (2009); Boch et al., Science 326, 1509-1512
(2009); Miller et al., Nat Biotechnol 29, 143-148 (2010)). For
example, engineered TAL effector repeat arrays have been fused to
the cleavage domain of the FokI endonuclease as well as activators
and repressors and act to target these domains to a user-defined
sequence within the context of the genome.
DNA-Binding Domains
[0029] The fusion proteins described herein can include any DNA
Binding Domain (DBD) known in the art or engineered for a specific
binding site. Exemplary DBDs include engineered or native TAL
effector repeat arrays, engineered or native zinc fingers, modified
variants (e.g., catalytically inactive) of homing meganucleases,
modified variants (e.g., catalytically inactive) nucleases from the
CRISPR-Cas system, chemical nucleases, and other native DBDs.
[0030] TAL Effector Repeat Arrays
[0031] TAL effectors of plant pathogenic bacteria in the genus
Xanthomonas play important roles in disease, or trigger defense, by
binding host DNA and activating effector-specific host genes.
Specificity depends on an effector-variable number of imperfect,
typically .about.33-35 amino acid repeats. Polymorphisms are
present primarily at repeat positions 12 and 13, which are referred
to herein as the repeat variable-diresidue (RVD). The RVDs of TAL
effectors correspond to the nucleotides in their target sites in a
direct, linear fashion, one RVD to one nucleotide, with some
degeneracy and no apparent context dependence. In some embodiments,
the polymorphic region that grants nucleotide specificity may be
expressed as a triresidue or triplet.
[0032] Each DNA binding repeat can include a RVD that determines
recognition of a base pair in the target DNA sequence, wherein each
DNA binding repeat is responsible for recognizing one base pair in
the target DNA sequence. In some embodiments, the RVD can comprise
one or more of: HA for recognizing C; ND for recognizing C; HI for
recognizing C; HN for recognizing G; NA for recognizing G; SN for
recognizing G or A; YG for recognizing T; and NK for recognizing G,
and one or more of: HD for recognizing C; NG for recognizing T; NI
for recognizing A; NN for recognizing G or A; NS for recognizing A
or C or G or T; N* for recognizing C or T, wherein * represents a
gap in the second position of the RVD; HG for recognizing T; H* for
recognizing T, wherein * represents a gap in the second position of
the RVD; and IG for recognizing T.
[0033] TALE proteins may be useful in research and biotechnology as
targeted chimeric nucleases that can facilitate homologous
recombination in genome engineering (e.g., to add or enhance traits
useful for biofuels or biorenewables in plants). These proteins
also may be useful as, for example, transcription factors, and
especially for therapeutic applications requiring a very high level
of specificity such as therapeutics against pathogens (e.g.,
viruses) as non-limiting examples.
[0034] Methods for generating engineered TALE arrays are known in
the art, see, e.g., the fast ligation-based automatable solid-phase
high-throughput (FLASH) system described in U.S. Ser. No.
61/610,212, and Reyon et al., Nature Biotechnology 30, 460-465
(2012); as well as the methods described in Bogdanove & Voytas,
Science 333, 1843-1846 (2011); Bogdanove et al., Curr Opin Plant
Biol 13, 394-401 (2010); Scholze & Boch, J. Curr Opin Microbiol
(2011); Boch et al., Science 326, 1509-1512 (2009); Moscou &
Bogdanove, Science 326, 1501 (2009); Miller et al., Nat Biotechnol
29, 143-148 (2011); Morbitzer et al., T. Proc Natl Acad Sci USA
107, 21617-21622 (2010); Morbitzer et al., Nucleic Acids Res 39,
5790-5799 (2011); Zhang et al., Nat Biotechnol 29, 149-153 (2011);
Geissler et al., PLoS ONE 6, e19509 (2011); Weber et al., PLoS ONE
6, e19722 (2011); Christian et al., Genetics 186, 757-761 (2010);
Li et al., Nucleic Acids Res 39, 359-372 (2011); Mahfouz et al.,
Proc Natl Acad Sci USA 108, 2623-2628 (2011); Mussolino et al.,
Nucleic Acids Res (2011); Li et al., Nucleic Acids Res 39,
6315-6325 (2011); Cermak et al., Nucleic Acids Res 39, e82 (2011);
Wood et al., Science 333, 307 (2011); Hockemeye et al. Nat
Biotechnol 29, 731-734 (2011); Tesson et al., Nat Biotechnol 29,
695-696 (2011); Sander et al., Nat Biotechnol 29, 697-698 (2011);
Huang et al., Nat Biotechnol 29, 699-700 (2011); and Zhang et al.,
Nat Biotechnol 29, 149-153 (2011); all of which are incorporated
herein by reference in their entirety.
[0035] Zinc Fingers
[0036] Zinc finger proteins are DNA-binding proteins that contain
one or more zinc fingers, independently folded zinc-containing
mini-domains, the structure of which is well known in the art and
defined in, for example, Miller et al., 1985, EMBO J., 4:1609;
Berg, 1988, Proc. Natl. Acad. Sci. USA, 85:99; Lee et al., 1989,
Science. 245:635; and Klug, 1993, Gene, 135:83. Crystal structures
of the zinc finger protein Zif268 and its variants bound to DNA
show a semi-conserved pattern of interactions, in which typically
three amino acids from the alpha-helix of the zinc finger contact
three adjacent base pairs or a "subsite" in the DNA (Pavletich et
al., 1991, Science, 252:809; Elrod-Erickson et al., 1998,
Structure, 6:451). Thus, the crystal structure of Zif268 suggested
that zinc finger DNA-binding domains might function in a modular
manner with a one-to-one interaction between a zinc finger and a
three-base-pair "subsite" in the DNA sequence. In naturally
occurring zinc finger transcription factors, multiple zinc fingers
are typically linked together in a tandem array to achieve
sequence-specific recognition of a contiguous DNA sequence (Klug,
1993, Gene 135:83).
[0037] Multiple studies have shown that it is possible to
artificially engineer the DNA binding characteristics of individual
zinc fingers by randomizing the amino acids at the alpha-helical
positions involved in DNA binding and using selection methodologies
such as phage display to identify desired variants capable of
binding to DNA target sites of interest (Rebar et al., 1994,
Science, 263:671; Choo et al., 1994 Proc. Natl. Acad. Sci. USA,
91:11163; Jamieson et al., 1994, Biochemistry 33:5689; Wu et al.,
1995 Proc. Natl. Acad. Sci. USA, 92: 344). Such recombinant zinc
finger proteins can be fused to functional domains, such as
transcriptional activators, transcriptional repressors, methylation
domains, and nucleases to regulate gene expression, alter DNA
methylation, and introduce targeted alterations into genomes of
model organisms, plants, and human cells (Carroll, 2008, Gene
Ther., 15:1463-68; Cathomen, 2008, Mol. Ther., 16:1200-07; Wu et
al., 2007, Cell. Mol. Life Sci., 64:2933-44).
[0038] Widespread adoption and large-scale use of zinc finger
protein technology have been hindered by the continued lack of a
robust, easy-to-use, and publicly available method for engineering
zinc finger arrays. One existing approach, known as "modular
assembly," advocates the simple joining together of pre-selected
zinc finger modules into arrays (Segal et al., 2003, Biochemistry,
42:2137-48; Beerli et al., 2002, Nat. Biotechnol., 20:135-141;
Mandell et al., 2006, Nucleic Acids Res., 34:W516-523; Carroll et
al., 2006, Nat. Protoc. 1:1329-41; Liu et al., 2002, J. Biol.
Chem., 277:3850-56; Bae et al., 2003, Nat. Biotechnol., 21:275-280;
Wright et al., 2006, Nat. Protoc., 1:1637-52). Although
straightforward enough to be practiced by any researcher, recent
reports have demonstrated a high failure rate for this method,
particularly in the context of zinc finger nucleases (Ramirez et
al., 2008, Nat. Methods, 5:374-375; Kim et al., 2009, Genome Res.
19:1279-88), a limitation that typically necessitates the
construction and cell-based testing of very large numbers of zinc
finger proteins for any given target gene (Kim et al., 2009, Genome
Res. 19:1279-88).
[0039] Combinatorial selection-based methods that identify zinc
finger arrays from randomized libraries have been shown to have
higher success rates than modular assembly (Maeder et al., 2008,
Mol. Cell, 31:294-301; Joung et al., 2010, Nat. Methods, 7:91-92;
Isalan et al., 2001, Nat. Biotechnol., 19:656-660). In preferred
embodiments, the zinc finger arrays are described in, or are
generated as described in, WO 2011/017293 and WO 2004/099366.
Additional suitable zinc finger DBDs are described in U.S. Pat.
Nos. 6,511,808, 6,013,453, 6,007,988, and 6,503,717 and U.S. patent
application 2002/0160940.
[0040] Native DBDs
[0041] In some embodiments, a native DBD (e.g., a portion of a
wild-type, non-engineered DNA binding protein that binds to a
specific target sequence) can be used. For example, the DBD from a
transcription factor, nuclease, histone, telomerase, or other DNA
binding protein can be used. Typically DBDs include a structure
that facilitates specific interaction with a target nucleic acid
sequence; common DBD structures include helix-turn-helix; zinc
finger; leucine zipper; winged helix; winged helix turn helix;
helix-loop-helix; and hmg-box. The native DBD can be from any
organism. See, e.g., Kummerfeld & Teichmann, Nucleic Acids Res.
34 (Database issue): D74-81 (2006). The residues in a DNA binding
protein that contact DNA, and thus form part of the DBD, can be
determined empirically or predicted computationally, e.g., as
described in Tjong and Zhou, Nucl. Acids Res. 35:1465-1477 (2007).
A database of DNA binding proteins can be used to identify DNA
binding proteins and DBDs for use in the present compositions and
methods; see, e.g., Harrison, Nature, 353, 715-719 (1991);
Karmirantzou and Hamodrakas, Protein Eng. 14(7): 465-472 (2001);
Kumar et al., BMC Bioinformatics. 8:463 (2007); Kumar et al., J
Biomol Struct Dyn. 26(6):679-86 (2009); Lin et al., PLoS One.
6(9):e24756 (2011).
[0042] Where a native DBD is used in a fusion protein described
herein, the catalytic domain is from a different protein.
[0043] Homing Meganucleases
[0044] Meganucleases are sequence-specific endonucleases
originating from a variety of organisms such as bacteria, yeast,
algae and plant organelles. Endogenous meganucleases have
recognition sites of 12 to 30 base pairs; customized DNA binding
sites with 18 bp and 24 bp-long meganuclease recognition sites have
been described, and either can be used in the present methods and
constructs. See, e.g., Silva, G., et al., Current Gene Therapy,
11:11-27, (2011); Arnould et al., Journal of Molecular Biology,
355:443-58 (2006); Arnould et al., Protein Engineering Design &
Selection, 24:27-31 (2011); and Stoddard, Q. Rev. Biophys. 38, 49
(2005); Grizot et al., Nucleic Acids Research, 38:2006-18 (2010).
In some embodiments, catalytically inactive versions of the homing
meganucleases are used, e.g., a mutant of I-Seel, e.g., comprising
the mutation D44S, wherein the catalytically active aspartate from
the first LAGLIDADG motif is mutated to serine to make the enzyme
inactive; N152K, reported to have .about.80% of the wt-activity; or
the double variant D150C/N152K, which decreases the activity of the
enzyme even further, e.g., as described in Gruen et al., Nucleic
Acids Res. 2002; 30:e29; Fonfara et al., Nucleic Acids Res. 2012
January; 40(2): 847-860; and Lippow et al., Nucleic Acids Res. 2009
May; 37(9):3061-73.
[0045] Nucleases from the CRISPR-Cas System
[0046] Catalytically inactive versions of the Cas9 nuclease can
also be used as DBDs in the fusion proteins described herein; these
fusion proteins are used in combination with a single guide RNA or
a crRNA/tracrRNA pair for specificity. A number of bacteria express
Cas9 protein variants. The Cas9 from Streptococcus pyogenes is
presently the most commonly used; some of the other Cas9 proteins
have high levels of sequence identity with the S. pyogenes Cas9 and
use the same guide RNAs. Others are more diverse, use different
gRNAs, and recognize different PAM sequences as well (the 2-5
nucleotide sequence specified by the protein which is adjacent to
the sequence specified by the RNA). Chylinski et al. classified
Cas9 proteins from a large group of bacteria (RNA Biology 10:5,
1-12; 2013), and a large number of Cas9 proteins are listed in
supplementary FIG. 1 and supplementary table 1 thereof, which are
incorporated by reference herein. The constructs and methods
described herein can include the use of any of those Cas9 proteins,
and their corresponding guide RNAs or other guide RNAs that are
compatible. The Cas9 from Streptococcus thermophilus LMD-9 CRISPR1
system has also been shown to function in human cells in Cong et al
(Science 339, 819 (2013)). Additionally, Jinek et al. showed in
vitro that Cas9 orthologs from S. thermophilus and L. innocua, (but
not from N. meningitidis or C. jejuni, which likely use a different
guide RNA), can be guided by a dual S. pyogenes gRNA to cleave
target plasmid DNA, albeit with slightly decreased efficiency.
These proteins are preferably mutated such that they retain their
ability to be guided by the single guide RNA or a crRNA/tracrRNA
pair and thus retain target specificity, but lack nuclease
activity.
[0047] In some embodiments, the present system utilizes the Cas9
protein from S. pyogenes, either as encoded in bacteria or
codon-optimized for expression in mammalian cells, containing D10A
and H840A mutations to render the nuclease portion of the protein
catalytically inactive; see, e.g., Jinek et al., Science 2012;
337:816-821; Qi et al., Cell 152, 1173-1183 (2013).
[0048] Chemical Nucleases
[0049] DNA binding domains from the so-called "chemical nucleases,"
(Pingoud and Silva, Nat Biotechnol. 25:743-4 (2007)), e.g.,
triplex-forming oligonucleotides or peptide nucleic acids can also
be utilized in the present compositions and methods; see, e.g.,
Schleifman et al., Methods Mol Biol. 2008; 435:175-90; Arimondo et
al., Mol Cell Biol. 2006 January; 26(1):324-33; Majumdar et al., J
Biol Chem. 2008 Apr. 25; 283(17):11244-52; Simon et al., Nucleic
Acids Res. 2008 June; 36(11):3531-8; or Eisenschmidt et al.,
Nucleic Acids Res. 2005; 33(22):7039-47.
Catalytic Domains
[0050] The fusion proteins include a catalytic domain comprising a
sequence that catalyzes histone demethylation. Exemplary proteins
include the lysine (K)-specific demethylase 1A (KDM1A, also
referred to herein as LSD1), a flavin adenine
dinucleotide-dependent amino oxidase that catalyzes the removal of
H3K4me1 and H3K4me2 (Shi et al., Cell 119:941-953 (2004); Metzger
et al., Nature. 437(7057):436-9 (2005)).
[0051] Sequences for human LSD1 are known in the art and are shown
in the following table:
TABLE-US-00001 GenBank Accession Nos. Gene Nucleic Acid Amino Acid
LSD1- variant 1 NM_001009999.2 (isoform a) NP_001009999A 1
mlsgkkaaaaaaaaaaaatg teagpgtaggsengsevaaq paglsgpaevgpgavgertp 61
rkkepprasppgglaeppgs agpqagptvvpgsatpmetg iaetpegrrtsrrkrakvey 121
remdeslanlsedeyyseee rnakaekekklpppppqapp eeenesepeepsgqagglqd 181
dssggygdgqasgvegaafq srlphdrmtsqeaacfpdii sgpqqtqkvflfirnrtlql 241
wldnpkiqltfeatlqqlea pynsdtvlvhrvhsylerhg linfgiykrikplptkktgk 301
viiigsgvsglaaarqlqsf gmdvtlleardrvggrvatf rkgnyvadlgamvvtglggn 361
pmavvskqvnmelakikqkc plyeangqadtvkvpkekde mvegefnrlleatsylshql 421
dfnvinnkpvslgqalevvi qlqekhvkdeqiehwkkivk tqeelkellnkmvnlkekik 481
elhqqykeasevkpprdita eflvkskhrdltalckeyde laetqgkleeklqeleanpp 541
sdvylssrdrqildwhfanl efanatplstlslkhwdqdd dfeftgshltvrngyscvpv 601
alaegldiklntavrqvryt asgceviavntrstsqtfly kcdavlctlplgvlkqqppa 661
vqfvpplpewktsavqrmgf gnlnkvvlcfdrvfwdpsvn lfghvgsttasrgelflfwn 721
lykapillalvageaagime nisddvivgrclailkgifg ssavpqpketvvsrwradpw 781
argsysyvaagssgndydlm aqpitpgpsipgapqpiprl ffagehtirnypatvhgall 841
sglreagriadqflgamytl prqatpgvpaqqspsm (SEQ ID NO: 2) LSD1- variant
2* NM_015013.3 (isoform b) NP_055828.2 1 mlsgkkaaaaaaaaaaaatg
teagpgtaggsengsevaaq paglsgpaevgpgavgertp 61 rkkepprasppgglaeppgs
agpqagptvvpgsatpmetg iaetpegrrtsrrkrakvey 121 remdeslanlsedeyyseee
rnakaekekklpppppqapp eeenesepeepsgvegaafq 181 srlphdrmtsqeaacfpdil
sgpqqtqkvflfirnrtlql wldnpkiqltfeatlqqlea 241 pynsdtvlvhrvhsylerhg
linfgiykrikplptkktgk viiigsgvsglaaarqlqsf 301 gmdvtlleardrvggrvatf
rkgnyvadlgamvvtglggn pmavvskqvnmelakikqkc 361 plyeangqavpkekdemveq
efnrlleatsylshqldfnv lnnkpvslgqalevviqlqe 421 khvkdeqiehwkkivktqee
lkellnkmvnlkekikelhq qykeasevkpprditaeflv 481 kskhrdltalckeydelaet
qgkleeklqeleanppsdvy lssrdrqildwhfanlefan 541 atplstlslkhwdqdddfef
tgshltvrngyscvpvalae gldiklntavrqvrytasgc 601 eviavntrstsqtflykoda
vlctlplgvlkqqppavqfv pplpewktsavqrmgfgnln 661 kvvlcfdrvfwdpsvnlfgh
vgsttasrgelflfwnlyka pillalvageaagimenisd 721 dvivgrclailkgifgssav
pqpketvvsrwradpwargs ysyvaagssgndydlmaqpi 781 tpgpsipgapqpiprlffag
ehtirnypatvhgallsglr eagriadqflgamytlprqa 841 tpgvpaqqspsm (SEQ ID
NO: 1)
Variant 2, which was used in the exemplary fusion proteins
described herein, lacks two alternate in-frame exons, compared to
variant 1. The encoded protein (isoform b) is shorter than isoform
a. LSD1 sequences from other species can also be used. See, e.g.,
FIG. 1 of Chen et al., PNAS Sep. 19, 2006 vol. 103 no. 38
13956-13961. In some embodiments, a fragment of LSD1 corresponding
to residues 172-833 of the human LSD1 variant 2 (NP.sub.--055828.2)
is used (Id.).
Construction of Fusion Proteins
[0052] To generate a functional recombinant protein, the DNA
binding domain is fused to at least one catalytic domain. Fusing
catalytic domains to DBD to form functional fusion proteins
involves only routine molecular biology techniques that are
commonly practiced by those of skill in the art, see for example,
U.S. Pat. Nos. 6,511,808, 6,013,453, 6,007,988, 6,503,717 and U.S.
patent application 2002/0160940). Catalytic domains can be
associated with the DBD domain at any suitable position, including
the C- or N-terminus of the DBD.
[0053] In some embodiments, the fusion proteins can include
multiple catalytic domains, e.g., on one or both ends of the DBD,
e.g., concatenated together with an optional intervening linker;
thus there can be one or more catalytic domains on each end of the
DBD.
[0054] Alternatively, the catalytic domains, e.g., LSD1 units,
could be multimerized through specific TALE DBD fused to
concatenated protein-protein interaction domains (such as leucine
zipper domains or ClonTech's iDimerize system, homodimerization and
heterodimerization systems and ligands (e.g. AP20187, AP21967)
which were previously provided by ARIAD under the brand name
ARGENT. The B/B Homodimerizer (AP20187) induces dimerization of two
proteins that each contain the DmrB homodimerization domain. The
A/C Heterodimerizer (AP21967) induces dimerization of a protein
possessing the DmrA domain and a second protein containing the DmrC
domain. The D/D Solubilizer (alternative to AP21998) induces
dissociation/disaggregation of proteins possessing DmrD domains.
DmrD causes automatic self-association of proteins fused to it;
see, e.g., Burnett et al., J. Leukoc. Biol. 75(4):612-623 (2004);
Freeman et al., Cancer Res. 63(23):8256-8563 (2003); Castellano et
al., Curr. Biol. 9(7): 351-360 (1999); Crabtree and Schreiber,
Trends Biochem. Sci. 21(11): 418-422 (1996); Graef et al., Embo. J.
16(18): 5618-5628 (1997); Muthuswamy et al., Mol. Cell. Biol.
19(10): 6845-6857 (1999)). Thus, the catalytic domains fused to a
DmrB, DmrA, or DmrD domains could be induced to interact with the
TALE DBD in multiple copies. Alternatively, multimerization could
be achieved through the use of split-inteins, a class of
autocatyltic intein peptides that allow for the seamless covalent
splicing of two separate proteins in a predictable and efficient
manner (d'Avignon, et al., Biopolymers. 2006 Oct. 15; 83(3):255-67;
Zitzewitz, et al., Biochemistry. 1995 Oct. 3; 34(39):12812-9; Li et
al., Hum Gene Ther. 2008 September; 19(9):958-64). Both the
protein-protein interaction and intein approaches could be
optimized to produce very long multimerized strings of catalytic
domains. FIGS. 6A-D show exemplary schemes for multimerization.
Methods of Use of the Fusion Proteins
[0055] The programmable DBD-LSD1 fusion proteins described herein
can be used to modulate the chromatin state and regulatory activity
of individual enhancers with high specificity. These reagents are
generally useful for evaluating candidate enhancers identified in
genomic mapping studies with higher throughput than direct genetic
manipulations, particularly when combined with high-throughput
methods for engineered TALE-based proteins.sup.24. Moreover, the
fusion proteins can be used to modulate (e.g., decrease) expression
of developmental or disease-associated genes in specific contexts
by inactivating their tissue-specific enhancers, and thus
ultimately yield new therapeutic strategies. In some embodiments,
the fusion proteins modulate the activity of an enhancer that only
regulates a gene in a very specific context or cell type, rather
than simply activating or repressing transcription by directly
targeting a promoter. Unlike a promoter that would act in all
tissues in which a gene is expressed, genes often have multiple
enhancers that switch them on in different cell types or context.
Thus the fusion proteins described herein can be designed to target
enhancers that regulate the inappropriate expression (or
repression) of a particular disease-associated gene in the disease
context, and thereby correct the gene in that cell type (but leave
it untouched in other cell types). For example, this could be used
to regulate a gene that controls immune cell differentiation only
in the correct immune cell type, and thus be a very specific way to
alter the immune system and correct an autoimmune disorder. For
example, BMP4 has tissue specific enhancers that regulate its
expression in different tissues; see, e.g., Jumlongras et al., PLoS
One. 2012; 7(6):e38568. See also Ong and Corces, Nature Rev.
Genetics 12:283-293 (2011). In some embodiments, the gene is
described in Xie et al., Nature Genetics 45, 836-841(2013); Gillies
et al., Cell 33(3):717-728 (1983); Hoivik et al., Endocrinology.
2011 May; 152(5):2100-12; Xu et al., Proc Natl Acad Sci USA.
104(30): 12377-12382 (2007).
[0056] The fusion proteins can be useful for the treatment of
disease; for example, the fusion proteins can be targeted to a
region of a gene that is overexpressed in a disease state, e.g., as
a result of histone hypermethylation. See, e.g., Biancotto et al.,
Adv Genet. 2010; 70:341-86 (cancer); Dreidax et al., Hum Mol Genet.
2013 May 1; 22(9):1735-45) (p14.sup.ARF in neuroblastoma); Copeland
et al., Oncogene. 2013 Feb. 21; 32(8):939-46 (cancer); Chase et
al., Schizophr Res. 2013 Jun. 28. pii: S0920-9964(13)00321-6
(schizophrenia); and Gavin et al., J Psychiatry Neurosci. 2009 May;
34(3):232-7 (schizophrenia). Genes that are associated with
hypermethylated histones can be identified using methods known in
the art, e.g., chromatin immunoprecipitation (see, e.g., Dreidax et
al., Hum Mol Genet. 2013 May 1; 22(9):1735-45). In some
embodiments, the methods include administering a fusion protein as
described herein that comprises a DBD that targets p14.sup.ARF for
the treatment of cancer, e.g., neuroblastoma.
[0057] In some embodiments, e.g., for the treatment of cancer or
schizophrenia, a fusion protein as described herein that targets a
gene that is underexpressed or overexpressed as a result of histone
hypermethylation is administered, optionally in combination with a
histone methyltransferase (HMT) inhibitor, e.g., BRD4770
(Methyl-2-benzamido-1-(3-phenylpropyl)-1H-benzo[d]imidazole-5-carboxylate-
); BIX 01294
(2-(Hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-6,7-dimethoxy-N-[1-(phenylme-
thyl)-4-piperidinyl]-4-quinazolinamine trihydrochloride hydrate;
Chaetocin (from Chaetomium minutum, PubChem Substance ID 24893002);
or UNCO224
(7-[3-(dimethylamino)propoxy]-2-(hexahydro-4-methyl-1H-1,4-diazepin-1-yl)-
-6-methoxy-N-(1-methyl-4-piperidinyl)-4-quinazolinamine). See also
Yost et al., Curr Chem Genomics. 2011; 5(Suppl 1):72-84.
[0058] The fusion proteins of the present invention are also useful
as research tools; for example, in performing either in vivo or in
vitro functional genomics studies (see, for example, U.S. Pat. No.
6,503,717, WO 2001019981, and U.S. patent publication
2002/0164575).
Polypeptide Expression Systems
[0059] In order to use the fusion proteins described, it may be
desirable to express the engineered proteins from a nucleic acid
that encodes them. This can be performed in a variety of ways. For
example, the nucleic acid encoding the fusion protein can be cloned
into an intermediate vector for transformation into prokaryotic or
eukaryotic cells for replication and/or expression. Intermediate
vectors are typically prokaryote vectors, e.g., plasmids, or
shuttle vectors, or insect vectors, for storage or manipulation of
the nucleic acid encoding the fusion protein or for production of
the fusion protein. The nucleic acid encoding the fusion protein
can also be cloned into an expression vector, for administration to
a plant cell, animal cell, preferably a mammalian cell or a human
cell, fungal cell, bacterial cell, or protozoan cell.
[0060] To obtain expression, the fusion protein is typically
subcloned into an expression vector that contains a promoter to
direct transcription. Suitable bacterial and eukaryotic promoters
are well known in the art and described, e.g., in Sambrook et al.,
Molecular Cloning, A Laboratory Manual (3d ed. 2001); Kriegler,
Gene Transfer and Expression: A Laboratory Manual (1990); and
Current Protocols in Molecular Biology (Ausubel et al., eds.,
2010). Bacterial expression systems for expressing the engineered
TALE repeat protein are available in, e.g., E. coli, Bacillus sp.,
and Salmonella (Palva et al., 1983, Gene 22:229-235). Kits for such
expression systems are commercially available. Eukaryotic
expression systems for mammalian cells, yeast, and insect cells are
well known in the art and are also commercially available.
[0061] The promoter used to direct expression of the fusion protein
nucleic acid depends on the particular application. For example, a
strong constitutive promoter is typically used for expression and
purification of fusion proteins. In contrast, when the fusion
protein is to be administered in vivo for gene regulation, either a
constitutive or an inducible promoter can be used, depending on the
particular use of the fusion protein. In addition, a preferred
promoter for administration of the fusion protein can be a weak
promoter, such as HSV TK or a promoter having similar activity. The
promoter can also include elements that are responsive to
transactivation, e.g., hypoxia response elements, Gal4 response
elements, lac repressor response element, and small molecule
control systems such as tetracycline-regulated systems and the
RU-486 system (see, e.g., Gossen & Bujard, 1992, Proc. Natl.
Acad. Sci. USA, 89:5547; Oligino et al., 1998, Gene Ther.,
5:491-496; Wang et al., 1997, Gene Ther., 4:432-441; Neering et
al., 1996, Blood, 88:1147-55; and Rendahl et al., 1998, Nat.
Biotechnol., 16:757-761).
[0062] In addition to the promoter, the expression vector typically
contains a transcription unit or expression cassette that contains
all the additional elements required for the expression of the
nucleic acid in host cells, either prokaryotic or eukaryotic. A
typical expression cassette thus contains a promoter operably
linked, e.g., to the nucleic acid sequence encoding the fusion
protein, and any signals required, e.g., for efficient
polyadenylation of the transcript, transcriptional termination,
ribosome binding sites, or translation termination. Additional
elements of the cassette may include, e.g., enhancers, and
heterologous spliced intronic signals.
[0063] The particular expression vector used to transport the
genetic information into the cell is selected with regard to the
intended use of the fusion protein, e.g., expression in plants,
animals, bacteria, fungus, protozoa, etc. Standard bacterial
expression vectors include plasmids such as pBR322 based plasmids,
pSKF, pET23D, and commercially available tag-fusion expression
systems such as GST and LacZ. A preferred tag-fusion protein is the
maltose binding protein, "MBP." Such tag-fusion proteins can be
used for purification of the engineered TALE repeat protein.
Epitope tags can also be added to recombinant proteins to provide
convenient methods of isolation, for monitoring expression, and for
monitoring cellular and subcellular localization, e.g., c-myc or
FLAG.
[0064] Expression vectors containing regulatory elements from
eukaryotic viruses are often used in eukaryotic expression vectors,
e.g., SV40 vectors, papilloma virus vectors, and vectors derived
from Epstein-Barr virus. Other exemplary eukaryotic vectors include
pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any
other vector allowing expression of proteins under the direction of
the SV40 early promoter, SV40 late promoter, metallothionein
promoter, murine mammary tumor virus promoter, Rous sarcoma virus
promoter, polyhedrin promoter, or other promoters shown effective
for expression in eukaryotic cells.
[0065] Some expression systems have markers for selection of stably
transfected cell lines such as thymidine kinase, hygromycin B
phosphotransferase, and dihydrofolate reductase. High yield
expression systems are also suitable, such as using a baculovirus
vector in insect cells, with the fusion protein encoding sequence
under the direction of the polyhedrin promoter or other strong
baculovirus promoters.
[0066] The elements that are typically included in expression
vectors also include a replicon that functions in E. coli, a gene
encoding antibiotic resistance to permit selection of bacteria that
harbor recombinant plasmids, and unique restriction sites in
nonessential regions of the plasmid to allow insertion of
recombinant sequences.
[0067] Standard transfection methods are used to produce bacterial,
mammalian, yeast or insect cell lines that express large quantities
of protein, which are then purified using standard techniques (see,
e.g., Colley et al., 1989, J. Biol. Chem., 264:17619-22; Guide to
Protein Purification, in Methods in Enzymology, vol. 182
(Deutscher, ed., 1990)). Transformation of eukaryotic and
prokaryotic cells are performed according to standard techniques
(see, e.g., Morrison, 1977, J. Bacteriol. 132:349-351;
Clark-Curtiss & Curtiss, Methods in Enzymology 101:347-362 (Wu
et al., eds, 1983).
[0068] Any of the known procedures for introducing foreign
nucleotide sequences into host cells may be used. These include the
use of calcium phosphate transfection, polybrene, protoplast
fusion, electroporation, nucleofection, liposomes, microinjection,
naked DNA, plasmid vectors, viral vectors, both episomal and
integrative, and any of the other well-known methods for
introducing cloned genomic DNA, cDNA, synthetic DNA or other
foreign genetic material into a host cell (see, e.g., Sambrook et
al., supra). It is only necessary that the particular genetic
engineering procedure used be capable of successfully introducing
at least one gene into the host cell capable of expressing the
protein of choice.
[0069] In some embodiments, the fusion protein includes a nuclear
localization domain which provides for the protein to be
translocated to the nucleus. Several nuclear localization sequences
(NLS) are known, and any suitable NLS can be used. For example,
many NLSs have a plurality of basic amino acids, referred to as a
bipartite basic repeats (reviewed in Garcia-Bustos et al, 1991,
Biochim. Biophys. Acta, 1071:83-101). An NLS containing bipartite
basic repeats can be placed in any portion of chimeric protein and
results in the chimeric protein being localized inside the nucleus.
In preferred embodiments a nuclear localization domain is
incorporated into the final fusion protein, as the ultimate
functions of the fusion proteins described herein will typically
require the proteins to be localized in the nucleus. However, it
may not be necessary to add a separate nuclear localization domain
in cases where the DBD domain itself, or another functional domain
within the final chimeric protein, has intrinsic nuclear
translocation function.
Use of Fusion Proteins in Gene Therapy
[0070] The fusion proteins described herein can be used to regulate
gene expression or alter gene sequence in gene therapy
applications. See for example U.S. Pat. No. 6,511,808, U.S. Pat.
No. 6,013,453, U.S. Pat. No. 6,007,988, U.S. Pat. No. 6,503,717,
U.S. patent application 2002/0164575, and U.S. patent application
2002/0160940. The methods can include administering nucleic acids
encoding one or more of the fusion proteins described herein
targeted to one or more genes. Since multiple histones across
hundreds of basepairs of DNA in promoters or imprinted regions can
influence gene expression, it may be desirable to reduce
methylation of multiple histones, across longer sequences. If
multiple histones, e.g., associated with a larger region of the
genome (e.g., a large gene or gene cluster), are desired to be
demethylated, a plurality of fusion proteins that target different
positions on the same gene or general genomic region, e.g.,
targeting multiple positions tiled 1000, 500, 300, 250, 100, 50, or
20 bp of the central locus that will target each histone that is to
be demethylated, can be administered. Alternatively or in addition,
one or a plurality of fusion proteins that are multimerized as
described herein can be administered.
[0071] Conventional viral and non-viral based gene transfer methods
can be used to introduce nucleic acids encoding the fusion protein
into mammalian cells or target tissues. Such methods can be used to
administer nucleic acids encoding fusion proteins to cells in
vitro. Preferably, the nucleic acids encoding the fusion proteins
are administered for in vivo or ex vivo gene therapy uses.
Non-viral vector delivery systems include DNA plasmids, naked
nucleic acid, and nucleic acid complexed with a delivery vehicle
such as a liposome. Viral vector delivery systems include DNA and
RNA viruses, which have either episomal or integrated genomes after
delivery to the cell. For a review of gene therapy procedures, see
Anderson, 1992, Science, 256:808-813; Nabel & Felgner, 1993,
TIBTECH, 11:211-217; Mitani & Caskey, 1993, TIBTECH,
11:162-166; Dillon, 1993, TIBTECH, 11:167-175; Miller, 1992,
Nature, 357:455-460; Van Brunt, 1988, Biotechnology, 6:1149-54;
Vigne, 1995, Restorat. Neurol. Neurosci., 8:35-36; Kremer &
Perricaudet, 1995, Br. Med. Bull., 51:31-44; Haddada et al., in
Current Topics in Microbiology and Immunology Doerfler and Bohm
(eds) (1995); and Yu et al., 1994, Gene Ther., 1:13-26.
[0072] Methods of non-viral delivery of nucleic acids encoding the
fusion proteins include lipofection, microinjection, biolistics,
virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic
acid conjugates, naked DNA or RNA, artificial virions, and
agent-enhanced uptake of DNA or RNA. Lipofection is described in
e.g., U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787; and U.S.
Pat. No. 4,897,355) and lipofection reagents are sold commercially
(e.g., Transfectam.TM. and Lipofectin.TM.). Cationic and neutral
lipids that are suitable for efficient receptor-recognition
lipofection of polynucleotides include those of Felgner, WO
91/17424, WO 91/16024. Delivery can be to cells (ex vivo
administration) or target tissues (in vivo administration).
[0073] The preparation of lipid:nucleic acid complexes, including
targeted liposomes such as immunolipid complexes, is well known to
one of skill in the art (see, e.g., Crystal, 1995, Science,
270:404-410; Blaese et al., 1995, Cancer Gene Ther., 2:291-297;
Behr et al., 1994, Bioconjugate Chem. 5:382-389; Remy et al., 1994,
Bioconjugate Chem., 5:647-654; Gao et al., Gene Ther., 2:710-722;
Ahmad et al., 1992, Cancer Res., 52:4817-20; U.S. Pat. Nos.
4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728,
4,774,085, 4,837,028, and 4,946,787).
[0074] The use of RNA or DNA viral based systems for the delivery
of nucleic acids encoding the fusion proteins takes advantage of
highly evolved processes for targeting a virus to specific cells in
the body and trafficking the viral payload to the nucleus. Viral
vectors can be administered directly to patients (in vivo) or they
can be used to treat cells in vitro and the modified cells are
administered to patients (ex vivo). Conventional viral based
systems for the delivery of fusion proteins could include
retroviral, lentivirus, adenoviral, adeno-associated, Sendai, and
herpes simplex virus vectors for gene transfer. Viral vectors are
currently the most efficient and versatile method of gene transfer
in target cells and tissues. Integration in the host genome is
possible with the retrovirus, lentivirus, and adeno-associated
virus gene transfer methods, often resulting in long term
expression of the inserted transgene. Additionally, high
transduction efficiencies have been observed in many different cell
types and target tissues.
[0075] The tropism of a retrovirus can be altered by incorporating
foreign envelope proteins, expanding the potential target
population of target cells. Lentiviral vectors are retroviral
vectors that are able to transduce or infect non-dividing cells and
typically produce high viral titers. Selection of a retroviral gene
transfer system would therefore depend on the target tissue.
Retroviral vectors are comprised of cis-acting long terminal
repeats with packaging capacity for up to 6-10 kb of foreign
sequence. The minimum cis-acting LTRs are sufficient for
replication and packaging of the vectors, which are then used to
integrate the therapeutic gene into the target cell to provide
permanent transgene expression. Widely used retroviral vectors
include those based upon murine leukemia virus (MuLV), gibbon ape
leukemia virus (GaLV), Simian Immuno deficiency virus (SIV), human
immuno deficiency virus (HIV), and combinations thereof (see, e.g.,
Buchscher et al., 1992, J. Virol., 66:2731-39; Johann et al., 1992,
J. Virol., 66:1635-40; Sommerfelt et al., 1990, Virololgy,
176:58-59; Wilson et al., 1989, J. Virol., 63:2374-78; Miller et
al., 1991, J. Virol., 65:2220-24; WO 94/26877).
[0076] In applications where transient expression of the fusion
protein is preferred, adenoviral based systems can be used.
Adenoviral based vectors are capable of very high transduction
efficiency in many cell types and do not require cell division.
With such vectors, high titer and levels of expression have been
obtained. This vector can be produced in large quantities in a
relatively simple system. Adeno-associated virus ("AAV") vectors
are also used to transduce cells with target nucleic acids, e.g.,
in the in vitro production of nucleic acids and peptides, and for
in vivo and ex vivo gene therapy procedures (see, e.g., West et
al., 1987, Virology 160:38-47; U.S. Pat. No. 4,797,368; WO
93/24641; Kotin, 1994, Hum. Gene Ther., 5:793-801; Muzyczka, 1994,
J. Clin. Invest., 94:1351). Construction of recombinant AAV vectors
are described in a number of publications, including U.S. Pat. No.
5,173,414; Tratschin et al., 1985, Mol. Cell. Biol. 5:3251-60;
Tratschin et al., 1984, Mol. Cell. Biol., 4:2072-81; Hermonat &
Muzyczka, 1984, Proc. Natl. Acad. Sci. USA, 81:6466-70; and
Samulski et al., 1989, J. Virol., 63:3822-28.
[0077] In particular, at least six viral vector approaches are
currently available for gene transfer in clinical trials, with
retroviral vectors by far the most frequently used system. All of
these viral vectors utilize approaches that involve complementation
of defective vectors by genes inserted into helper cell lines to
generate the transducing agent.
[0078] pLASN and MFG-S are examples are retroviral vectors that
have been used in clinical trials (Dunbar et al., 1995, Blood,
85:3048; Kohn et al., 1995, Nat. Med., 1:1017; Malech et al., 1997,
Proc. Natl. Acad. Sci. USA, 94:12133-38). PA317/pLASN was the first
therapeutic vector used in a gene therapy trial. (Blaese et al.,
1995, Science, 270:475-480). Transduction efficiencies of 50% or
greater have been observed for MFG-S packaged vectors (Ellem et
al., 1997, Immunol Immunother., 44:10-20; Dranoff et al., 1997,
Hum. Gene Ther., 1:111-112).
[0079] Recombinant adeno-associated virus vectors (rAAV) are a
promising alternative gene delivery systems based on the defective
and nonpathogenic parvovirus adeno-associated type 2 virus.
Typically, the vectors are derived from a plasmid that retains only
the AAV 145 bp inverted terminal repeats flanking the transgene
expression cassette. Efficient gene transfer and stable transgene
delivery due to integration into the genomes of the transduced cell
are key features for this vector system (Wagner et al., 1998,
Lancet, 351:1702-1703; Kearns et al., 1996, Gene Ther.,
9:748-55).
[0080] Replication-deficient recombinant adenoviral vectors (Ad)
are predominantly used for colon cancer gene therapy, because they
can be produced at high titer and they readily infect a number of
different cell types. Most adenovirus vectors are engineered such
that a transgene replaces the Ad E1a, E1b, and E3 genes;
subsequently the replication defector vector is propagated in human
293 cells that supply deleted gene function in trans. Ad vectors
can transduce multiple types of tissues in vivo, including
nondividing, differentiated cells such as those found in the liver,
kidney and muscle system tissues. Conventional Ad vectors have a
large carrying capacity. An example of the use of an Ad vector in a
clinical trial involved polynucleotide therapy for antitumor
immunization with intramuscular injection (Sterman et al., 1998,
Hum. Gene Ther. 7:1083-89). Additional examples of the use of
adenovirus vectors for gene transfer in clinical trials include
Rosenecker et al., 1996, Infection, 24:15-10; Sterman et al., 1998,
Hum. Gene Ther., 9:7 1083-89; Welsh et al., 1995, Hum. Gene Ther.,
2:205-218; Alvarez et al., 1997, Hum. Gene Ther. 5:597-613; Topf et
al., 1998, Gene Ther., 5:507-513; Sterman et al., 1998, Hum. Gene
Ther., 7:1083-89.
[0081] Packaging cells are used to form virus particles that are
capable of infecting a host cell. Such cells include 293 cells,
which package adenovirus, and .PSI.2 cells or PA317 cells, which
package retrovirus. Viral vectors used in gene therapy are usually
generated by producer cell line that packages a nucleic acid vector
into a viral particle. The vectors typically contain the minimal
viral sequences required for packaging and subsequent integration
into a host, other viral sequences being replaced by an expression
cassette for the protein to be expressed. The missing viral
functions are supplied in trans by the packaging cell line. For
example, AAV vectors used in gene therapy typically only possess
ITR sequences from the AAV genome which are required for packaging
and integration into the host genome. Viral DNA is packaged in a
cell line, which contains a helper plasmid encoding the other AAV
genes, namely rep and cap, but lacking ITR sequences. The cell line
is also infected with adenovirus as a helper. The helper virus
promotes replication of the AAV vector and expression of AAV genes
from the helper plasmid. The helper plasmid is not packaged in
significant amounts due to a lack of ITR sequences. Contamination
with adenovirus can be reduced by, e.g., heat treatment to which
adenovirus is more sensitive than AAV.
[0082] In many gene therapy applications, it is desirable that the
gene therapy vector be delivered with a high degree of specificity
to a particular tissue type. A viral vector is typically modified
to have specificity for a given cell type by expressing a ligand as
a fusion protein with a viral coat protein on the viruses outer
surface. The ligand is chosen to have affinity for a receptor known
to be present on the cell type of interest. For example, Han et
al., 1995, Proc. Natl. Acad. Sci. USA, 92:9747-51, reported that
Moloney murine leukemia virus can be modified to express human
heregulin fused to gp70, and the recombinant virus infects certain
human breast cancer cells expressing human epidermal growth factor
receptor. This principle can be extended to other pairs of virus
expressing a ligand fusion protein and target cell expressing a
receptor. For example, filamentous phage can be engineered to
display antibody fragments (e.g., Fab or Fv) having specific
binding affinity for virtually any chosen cellular receptor.
Although the above description applies primarily to viral vectors,
the same principles can be applied to nonviral vectors. Such
vectors can be engineered to contain specific uptake sequences
thought to favor uptake by specific target cells.
[0083] Gene therapy vectors can be delivered in vivo by
administration to an individual patient, typically by systemic
administration (e.g., intravenous, intraperitoneal, intramuscular,
subdermal, or intracranial infusion) or topical application, as
described below. Alternatively, vectors can be delivered to cells
ex vivo, such as cells explanted from an individual patient (e.g.,
lymphocytes, bone marrow aspirates, tissue biopsy) or stem cells
(e.g., universal donor hematopoietic stem cells, embryonic stem
cells (ES), partially differentiated stem cells, non-pluripotent
stem cells, pluripotent stem cells, induced pluripotent stem cells
(iPS cells) (see e.g., Sipione et al., Diabetologia, 47:499-508,
2004)), followed by reimplantation of the cells into a patient,
usually after selection for cells which have incorporated the
vector.
[0084] Ex vivo cell transfection for diagnostics, research, or for
gene therapy (e.g., via re-infusion of the transfected cells into
the host organism) is well known to those of skill in the art. In a
preferred embodiment, cells are isolated from the subject organism,
transfected with nucleic acid (gene or cDNA), encoding the fusion
protein, and re-infused back into the subject organism (e.g.,
patient). Various cell types suitable for ex vivo transfection are
well known to those of skill in the art (see, e.g., Freshney et
al., Culture of Animal Cells, A Manual of Basic Technique (5th ed.
2005)) and the references cited therein for a discussion of how to
isolate and culture cells from patients).
[0085] In one embodiment, stem cells (e.g., universal donor
hematopoietic stem cells, embryonic stem cells (ES), partially
differentiated stem cells, non-pluripotent stem cells, pluripotent
stem cells, induced pluripotent stem cells (iPS cells) (see e.g.,
Sipione et al., Diabetologia, 47:499-508, 2004)) are used in ex
vivo procedures for cell transfection and gene therapy. The
advantage to using stem cells is that they can be differentiated
into other cell types in vitro, or can be introduced into a mammal
(such as the donor of the cells) where they will engraft in the
bone marrow. Methods for differentiating CD34+ cells in vitro into
clinically important immune cell types using cytokines such a
GM-CSF, IFN-gamma and TNF-alpha are known (see Inaba et al., 1992,
J. Exp. Med., 176:1693-1702).
[0086] Stem cells can be isolated for transduction and
differentiation using known methods. For example, stem cells can be
isolated from bone marrow cells by panning the bone marrow cells
with antibodies which bind unwanted cells, such as CD4+ and CD8+(T
cells), CD45+(panB cells), GR-1 (granulocytes), and lad
(differentiated antigen presenting cells) (see Inaba et al., 1992,
J. Exp. Med., 176:1693-1702).
[0087] Vectors (e.g., retroviruses, adenoviruses, liposomes, etc.)
containing nucleic acids encoding the fusion protein can be also
administered directly to the organism for transduction of cells in
vivo. Alternatively, naked DNA can be administered. Administration
is by any of the routes normally used for introducing a molecule
into ultimate contact with blood or tissue cells. Suitable methods
of administering such nucleic acids are available and well known to
those of skill in the art, and, although more than one route can be
used to administer a particular composition, a particular route can
often provide a more immediate and more effective reaction than
another route. Alternatively, stable formulations of the fusion
protein can also be administered.
[0088] Pharmaceutically acceptable carriers are determined in part
by the particular composition being administered, as well as by the
particular method used to administer the composition. Accordingly,
there is a wide variety of suitable formulations of pharmaceutical
compositions available, as described below (see, e.g., Remington:
The Science and Practice of Pharmacy, 21st ed., 2005).
Delivery Vehicles
[0089] An important factor in the administration of polypeptide
compounds, such as the fusion proteins of the present invention, is
ensuring that the polypeptide has the ability to traverse the
plasma membrane of a cell, or the membrane of an intra-cellular
compartment such as the nucleus. Cellular membranes are composed of
lipid-protein bilayers that are freely permeable to small, nonionic
lipophilic compounds and are inherently impermeable to polar
compounds, macromolecules, and therapeutic or diagnostic agents.
However, proteins and other compounds such as liposomes have been
described, which have the ability to translocate polypeptides such
as fusion protein across a cell membrane.
[0090] For example, "membrane translocation polypeptides" have
amphiphilic or hydrophobic amino acid subsequences that have the
ability to act as membrane-translocating carriers. In one
embodiment, homeodomain proteins have the ability to translocate
across cell membranes. The shortest internalizable peptide of a
homeodomain protein, Antennapedia, was found to be the third helix
of the protein, from amino acid position 43 to 58 (see, e.g.,
Prochiantz, 1996, Curr. Opin. Neurobiol., 6:629-634). Another
subsequence, the h (hydrophobic) domain of signal peptides, was
found to have similar cell membrane translocation characteristics
(see, e.g., Lin et al., 1995, J. Biol. Chem., 270:14255-58).
[0091] Examples of peptide sequences that can be linked to a
protein, for facilitating uptake of the protein into cells,
include, but are not limited to: peptide fragments of the tat
protein of HIV (Endoh et al., 2010, Methods Mol. Biol.,
623:271-281; Schmidt et al., 2010, FEBS Lett., 584:1806-13; Futaki,
2006, Biopolymers, 84:241-249); a 20 residue peptide sequence which
corresponds to amino acids 84-103 of the p16 protein (see Fahraeus
et al., 1996, Curr. Biol., 6:84); the third helix of the 60-amino
acid long homeodomain of Antennapedia (Derossi et al., 1994, J.
Biol. Chem., 269:10444); the h region of a signal peptide, such as
the Kaposi fibroblast growth factor (K-FGF) h region (Lin et al.,
supra); the VP22 translocation domain from HSV (Elliot &
O'Hare, 1997, Cell, 88:223-233); or supercharged proteins or
intraphilins, e.g., as described in US20120100569; US20110112040;
Thompson et al., Methods in Enzymology, 503:293-319 (2012);
Cronican et al (2011) Chem Biol. 18, 833; Cronican et al (2010) ACS
Chem. Biol. 5, 747; McNaughton et al (2009) Proc. Natl. Acad. Sci.
USA 106, 6111; and Lawrence et al (2007) J. Am. Chem. Soc. 129,
10110. See also, e.g., Caron et al., 2001, Mol Ther., 3:310-318;
Langel, Cell-Penetrating Peptides: Processes and Applications (CRC
Press, Boca Raton Fla. 2002); El-Andaloussi et al., 2005, Curr.
Pharm. Des., 11:3597-3611; and Deshayes et al., 2005, Cell. Mol.
Life Sci., 62:1839-49. Other suitable chemical moieties that
provide enhanced cellular uptake may also be chemically linked to
the Fusion proteins described herein.
[0092] Toxin molecules also have the ability to transport
polypeptides across cell membranes. Often, such molecules are
composed of at least two parts (called "binary toxins"): a
translocation or binding domain or polypeptide and a separate toxin
domain or polypeptide. Typically, the translocation domain or
polypeptide binds to a cellular receptor, and then the toxin is
transported into the cell. Several bacterial toxins, including
Clostridium perfringens iota toxin, diphtheria toxin (DT),
Pseudomonas exotoxin A (PE), pertussis toxin (PT), Bacillus
anthracis toxin, and pertussis adenylate cyclase (CYA), have been
used in attempts to deliver peptides to the cell cytosol as
internal or amino-terminal fusions (Arora et al., 1993, J. Biol.
Chem., 268:3334-41; Perelle et al., 1993, Infect. Immun.,
61:5147-56; Stenmark et al., 1991, J. Cell Biol., 113:1025-32;
Donnelly et al., 1993, Proc. Natl. Acad. Sci. USA, 90:3530-34;
Carbonetti et al., 1995, Abstr. Annu. Meet. Am. Soc. Microbiol.
95:295; Sebo et al., 1995, Infect. Immun., 63:3851-57; Klimpel et
al., 1992, Proc. Natl. Acad. Sci. USA, 89:10277-81; and Novak et
al., 1992, J. Biol. Chem., 267:17186-93).
[0093] Such subsequences can be used to translocate fusion proteins
across a cell membrane. The fusion proteins can be conveniently
fused to or derivatized with such sequences. Typically, the
translocation sequence is provided as part of a fusion protein.
Optionally, a linker can be used to link the fusion protein and the
translocation sequence. Any suitable linker can be used, e.g., a
peptide linker.
[0094] The fusion protein can also be introduced into an animal
cell, preferably a mammalian cell, via liposomes and liposome
derivatives such as immunoliposomes. The term "liposome" refers to
vesicles comprised of one or more concentrically ordered lipid
bilayers, which encapsulate an aqueous phase. The aqueous phase
typically contains the compound to be delivered to the cell, i.e.,
the fusion protein.
[0095] The liposome fuses with the plasma membrane, thereby
releasing the compound into the cytosol. Alternatively, the
liposome is phagocytosed or taken up by the cell in a transport
vesicle. Once in the endosome or phagosome, the liposome either
degrades or fuses with the membrane of the transport vesicle and
releases its contents.
[0096] In current methods of drug delivery via liposomes, the
liposome ultimately becomes permeable and releases the encapsulated
compound (e.g., the fusion protein or a nucleic acid encoding the
same) at the target tissue or cell. For systemic or tissue specific
delivery, this can be accomplished, for example, in a passive
manner wherein the liposome bilayer degrades over time through the
action of various agents in the body. Alternatively, active
compound release involves using an agent to induce a permeability
change in the liposome vesicle. Liposome membranes can be
constructed so that they become destabilized when the environment
becomes acidic near the liposome membrane (see, e.g., Proc. Natl.
Acad. Sci. USA, 84:7851 (1987); Biochemistry, 28:908 (1989)). When
liposomes are endocytosed by a target cell, for example, they
become destabilized and release their contents. This
destabilization is termed fusogenesis.
Dioleoylphosphatidylethanolamine (DOPE) is the basis of many
"fusogenic" systems.
[0097] Such liposomes typically comprise the fusion protein and a
lipid component, e.g., a neutral and/or cationic lipid, optionally
including a receptor-recognition molecule such as an antibody that
binds to a predetermined cell surface receptor or ligand (e.g., an
antigen). A variety of methods are available for preparing
liposomes as described in, e.g., Szoka et al., 1980, Annu. Rev.
Biophys. Bioeng., 9:467, U.S. Pat. Nos. 4,186,183, 4,217,344,
4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028,
4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028,
4,946,787, PCT Publication. No. WO 91/17424, Deamer & Bangham,
1976, Biochim. Biophys. Acta, 443:629-634; Fraley, et al., 1979,
Proc. Natl. Acad. Sci. USA, 76:3348-52; Hope et al., 1985, Biochim.
Biophys. Acta, 812:55-65; Mayer et al., 1986, Biochim. Biophys.
Acta, 858:161-168; Williams et al., 1988, Proc. Natl. Acad. Sci.
USA, 85:242-246; Liposomes (Ostro (ed.), 1983, Chapter 1); Hope et
al., 1986, Chem. Phys. Lip., 40:89; Gregoriadis, Liposome
Technology (1984) and Lasic, Liposomes: from Physics to
Applications (1993)). Suitable methods include, for example,
sonication, extrusion, high pressure/homogenization,
microfluidization, detergent dialysis, calcium-induced fusion of
small liposome vesicles and ether-fusion methods, all of which are
well known in the art.
[0098] In certain embodiments, it is desirable to target liposomes
using targeting moieties that are specific to a particular cell
type, tissue, and the like. Targeting of liposomes using a variety
of targeting moieties (e.g., ligands, receptors, and monoclonal
antibodies) has been previously described (see, e.g., U.S. Pat.
Nos. 4,957,773 and 4,603,044).
[0099] Examples of targeting moieties include monoclonal antibodies
specific to antigens associated with neoplasms, such as prostate
cancer specific antigen and MAGE. Tumors can also be diagnosed by
detecting gene products resulting from the activation or
over-expression of oncogenes, such as ras or c-erbB2. In addition,
many tumors express antigens normally expressed by fetal tissue,
such as the alphafetoprotein (AFP) and carcinoembryonic antigen
(CEA). Sites of viral infection can be diagnosed using various
viral antigens such as hepatitis B core and surface antigens (HBVc,
HBVs) hepatitis C antigens, Epstein-Barr virus antigens, human
immunodeficiency type-1 virus (HIV1) and papilloma virus antigens.
Inflammation can be detected using molecules specifically
recognized by surface molecules which are expressed at sites of
inflammation such as integrins (e.g., VCAM-1), selectin receptors
(e.g., ELAM-1) and the like.
[0100] Standard methods for coupling targeting agents to liposomes
can be used. These methods generally involve incorporation into
liposomes lipid components, e.g., phosphatidylethanolamine, which
can be activated for attachment of targeting agents, or derivatized
lipophilic compounds, such as lipid derivatized bleomycin. Antibody
targeted liposomes can be constructed using, for instance,
liposomes which incorporate protein A (see Renneisen et al., 1990,
J. Biol. Chem., 265:16337-42 and Leonetti et al., 1990, Proc. Natl.
Acad. Sci. USA, 87:2448-51).
Dosages
[0101] For therapeutic applications, the dose of the fusion protein
to be administered to a patient can be calculated in a similar way
as has been described for zinc finger proteins, see for example
U.S. Pat. No. 6,511,808, U.S. Pat. No. 6,492,117, U.S. Pat. No.
6,453,242, U.S. patent application 2002/0164575, and U.S. patent
application 2002/0160940. In the context of the present disclosure,
the dose should be sufficient to effect a beneficial therapeutic
response in the patient over time. In addition, particular dosage
regimens can be useful for determining phenotypic changes in an
experimental setting, e.g., in functional genomics studies, and in
cell or animal models. The dose will be determined by the efficacy,
specificity, and K.sub.D of the particular fusion protein employed,
the nuclear volume of the target cell, and the condition of the
patient, as well as the body weight or surface area of the patient
to be treated. The size of the dose also will be determined by the
existence, nature, and extent of any adverse side-effects that
accompany the administration of a particular compound or vector in
a particular patient.
Pharmaceutical Compositions and Administration
[0102] Appropriate pharmaceutical compositions for administration
of the fusion proteins of the present invention can be determined
as described for zinc finger proteins, see for example U.S. Pat.
No. 6,511,808, U.S. Pat. No. 6,492,117, U.S. Pat. No. 6,453,242,
U.S. patent application 2002/0164575, and U.S. patent application
2002/0160940. Fusion proteins, and expression vectors encoding
fusion proteins, can be administered directly to the patient for
modulation of histone methylation patterns, e.g., and gene
expression, and for therapeutic or prophylactic applications, for
example, for treatment of diseases listed in associated with
histone-mediated inhibition, including cancer (e.g., bladder, brain
(e.g., glioma, or glioblastoma), breast, cervical, colon,
colorectal, esophagus, head/neck, kidney, leukemia, liver, lung,
lymphoma, myeloma, ovary, pancreas, prostate, rhabdomyosarcoma, and
uterus cancer); schizophrenia; memory formation; and
atherosclerosis. Thus the methods can include identifying a subject
who has a disease associated with histone hypermethylation (e.g.,
optionally including obtaining a sample and detecting methylation
of histones, e.g., of histones associated with a disease-associated
gene, e.g., p14.sup.ARF and selecting the subject if their sample
includes hypermethylated histones), and administering a
therapeutically effective amount of a fusion protein, or a nucleic
acid encoding a fusion protein, as described herein, to the
subject.
[0103] Administration of therapeutically effective amounts is by
any of the routes normally used for introducing fusion proteins
into ultimate contact with the tissue to be treated. The fusion
proteins are administered in any suitable manner, preferably with
pharmaceutically acceptable carriers. Suitable methods of
administering such modulators are available and well known to those
of skill in the art, and, although more than one route can be used
to administer a particular composition, a particular route can
often provide a more immediate and more effective reaction than
another route.
[0104] Pharmaceutically acceptable carriers are determined in part
by the particular composition being administered, as well as by the
particular method used to administer the composition. Accordingly,
there is a wide variety of suitable formulations of pharmaceutical
compositions that are available (see, e.g., Remington: The Science
and Practice of Pharmacy, 21st ed., 2005).
[0105] The fusion proteins, alone or in combination with other
suitable components, can be made into aerosol formulations (i.e.,
they can be "nebulized") to be administered via inhalation. Aerosol
formulations can be placed into pressurized acceptable propellants,
such as dichlorodifluoromethane, propane, nitrogen, and the
like.
[0106] Formulations suitable for parenteral administration, such
as, for example, by intravenous, intramuscular, intradermal, and
subcutaneous routes, include aqueous and non-aqueous, isotonic
sterile injection solutions, which can contain antioxidants,
buffers, bacteriostats, and solutes that render the formulation
isotonic with the blood of the intended recipient, and aqueous and
non-aqueous sterile suspensions that can include suspending agents,
solubilizers, thickening agents, stabilizers, and preservatives.
The disclosed compositions can be administered, for example, by
intravenous infusion, orally, topically, intraperitoneally,
intravesically or intrathecally. The formulations of compounds can
be presented in unit-dose or multi-dose sealed containers, such as
ampules and vials. Injection solutions and suspensions can be
prepared from sterile powders, granules, and tablets of the kind
previously described.
Examples
[0107] The invention is further described in the following
examples, which do not limit the scope of the invention described
in the claims.
[0108] Methods
[0109] The following materials and methods were used in the
examples set forth below.
[0110] Construction of TALE Fusions.
[0111] The open reading frame for LSD1 was amplified from a cDNA
library from K562 cells using primers
(F:gttcaagatctttatctgggaagaaggcgg (SEQ ID NO:3),
R:gaccttaattaaatgggcctcttcccttagaa (SEQ ID NO:4)). The PCR product
was cloned into a TALE compatible expression vector.sup.27 using
Pact and BamHI/BglII such that LSD1 was fused to the C-terminal end
of the TALE. TALE repeat array monomers were designed and assembled
using FLASH as described.sup.24. These assembled DNA fragments were
cloned into the expression vector using BsmBI sites and verified by
restriction enzyme digestion and sequencing. The mCherry control
vector was created by incorporating an mCherry open reading frame
in place of the TALE array using NotI and PacI. Control TALE
vectors lacking LSD1 were constructed using BamHI and Pact to
remove LSD1, followed by blunt end ligation. The 3X Flag Tagged
TALE vector was created by designing a gBlock (IDT) encoding a 29
amino acid Glycine:Serine linker followed by the 3X Flag sequence
and cloning into the BamHI and Pact sites at the C-terminal end of
the TALE repeat. Plasmids for construction of LSD1 and 3X Flag
fusions will be available from Addgene.
[0112] Cell Culture and Transfection.
[0113] The human erythroleukemia cell line, K562 (ATCC, CLL-243),
was cultured in RPMI with 10% FBS, 1% Pen/Strep (Life
Technologies). For transfection, 5.times.10.sup.6 cells per
transfection were washed once with PBS. Cells were then transfected
with 20 ug of TALE plasmid DNA or control mCherry plasmid by
nucleofection with Lonza Kit V, as described by the manufacturer
(Program T-016). Cells were immediately resuspended in K562 media
at a cell density of 0.25.times.10.sup.6 cells/ml. Cells were
harvested at 72 hours for ChIP or RNA extraction. For ZFPM2 gene
expression analysis, the total amount of DNA per transfection was
standardized by cotransfecting either 10 ug of a single TALE-LSD1
plasmid plus 10 ug of a scrambled TALE-LSD1 plasmid, or 10 ug each
of two TALE-LSD1 plasmids. Transfection efficiency was determine by
flow cytometry analysis of mCherry control transfected cells and
ranged from 89-94% across multiple biological replicates.
[0114] Flag Tagged ChIP.
[0115] TALE-3X Flag transfected K562 cells were crosslinked with
0.5% formaldehyde for 5 minutes at room temperature. Nuclei were
isolated and lysed as described.sup.28. After sonication,
solubilized chromatin was incubated with protein G Dynabeads
(Invitrogen) and 0.5 ug anti-FLAG M2 antibody (Sigma) at 4.degree.
C. overnight. Samples were washed with TBS-T, low salt (150 mM
NaCl, 2 mM Tris-HCl, 1% Triton-X), LiCl (250 mM LiCl, 1 mM
Tris-HCl, 1% Triton-X), and high salt (750 mM NaCl, 2 mM Tris-HCl,
1% Triton-X) buffers at room temperature. Enriched chromatin was
eluted (1% SDS, 5 mM DTT) at 65.degree. C. for 20 minutes, purified
and used directly for Illumina library prep. A control library was
made from input DNA diluted to 50 picograms. Reads were aligned
using Bowtie, and peak analysis was done using MACS with input
controls, and masking genomic regions repetitive in Hg19 or
K56229.
[0116] Native ChIP.
[0117] Quantitative measurements of histone modification levels
were performed in parallel using native ChIP. 0.01 U of MNase
(ThermoScientific) was added to 1 ml lysis buffer (50 mM Tris-HCl,
150 mM NaCl, 1% Triton X-100, 0.1% sodium deoxycholate, 1 mM CaCl2)
with EDTA free proteinase inhibitor. For each transfected sample,
260 ul of MNase:Lysis buffer was added and incubated for 15 minutes
at 25.degree. C., and 20 minutes at 37.degree. C. MNase was
inactivated by adding 20 mM EGTA. The lysed sample was split into
96 well plate format for ChIP with H3K4me2 (abcam ab32356) or
H3K27ac (Active Motif 39133). Antibody binding, bead washing, DNA
elution and sample clean-up were performed as described.sup.30.
ChIP DNA was analyzed by RT-PCR using FastStart Universal SYBR
Green Master (Applied Biosystems), and enrichment ratios were
calculated by comparison to equal amount of input DNA. Enrichment
was normalized across ChIP samples to two standard off-target
control enhancers (Table 2), and fold-ratios were calculated
relative to mCherry plasmid transfected cells assayed in parallel.
Each TALE ChIP experiment was performed in a minimum of 3
biological replicates. TALE-LSD1 reagents were scored based on the
fold-changes of K4me2 and K27ac for two primers flanking the target
sequence. A given reagent was scored as `effective` if it induced a
2-fold or greater reduction in modification signal for at least 2
of these 4 values, with a pvalue<0.05 using a one-tailed t-test.
For ChIP-seq maps, 5 ng of ChIP DNA was used for library
preparation as described.sup.30.
[0118] Gene Expression Analysis.
[0119] Genome-wide RNA expression analysis was performed using
3'DGE RNA-seq. Total RNA from 1 million TALE-LSD1 transfected or
control (K562 alone or mCherry plasmid transfected) cells in
biological replicate using RNeasy Mini kit (Qiagen). 2 ug of total
RNA was fragmented and the 3' ends of polyA mRNAs were isolated
using Dynabeads (Invitrogen), and used to generate Illumina
sequencing libraries, as described.sup.25. To precisely quantify
the gene expression, a 3' DGE analysis pipeline was used. The
pipeline estimates gene expression based on the maximum number of
reads in any 500 basepair window within 10 kb of the annotated 3'
gene end. This approach compensates for the fact that annotated
ends for some genes are imprecise and may be cell type dependent
and yields accurate quantifications. We then normalized the gene
expression levels, scaling samples by the median gene inter-sample
variation, as described in.sup.26. This approach controls for
differences in sequencing depth between libraries and in the
overall transcript abundance distribution.
[0120] The 22 RNA-seq datasets were then normalized based on their
negative binomial distributions. Libraries with extreme
normalization coefficients below 0.7 or above 1.5 were excluded. To
identify candidate regulated genes, the three closest upstream and
three closest downstream genes were examined. A gene was
specifically scored as regulated if (i) it was detected in control
K562 cells with a normalized RNA-seq value >10, i.e. the top
50.sup.th percentile of expression; (ii) its mean expression value
was at least 1.5-fold lower in the corresponding on-target
TALE-LSD1 libraries compared to all other libraries, p<0.05
calculated using DESeq.sup.26 and (iii) its normalized 3'DGE values
in the on-target TALE-LSD1 libraries were the two lowest over all
22 datasets. To simulate the 1000 random binding sites, we sample
genomic positions uniformly at random and use rejection sampling to
ensure that the random set has a similar distribution relative to
genomic annotations (intergenic, promoter, gene body, UTR) to the
actual TALE binding sites. We then used significance testing
criteria identical to that applied to the actual TALE
experiments.
[0121] For RT-PCR based expression analysis, total RNA was
extracted and reverse transcribed into cDNA using Superscript III
First-Strand Synthesis system for RT-PCR (Invitrogen). Quantitative
PCR was performed with FastStart Universal SYBR Green Master
(Invitrogen) with primer sequences listed in Table 2 on an ABI 7500
machine. Gene expression values are presented as log 2 Ct ratios
relative to 2 housekeeping control genes (TBP and SDHA), and
represents an average of four independent biological replicates
each assayed in two technical replicates.
TABLE-US-00002 TABLE 2 Primer Sequences Used ChIP qPCR SEQ SEQ TALE
Primer ID ID ID # Set F NO: R NO: 1 1.1 GGAATCGTGAATACCCCTGA 47
AACATGCAGGTCTGCTTTCC 48 1 1.2 GGAATTGGCCTGCAGAATTA 49
GTACACCATTGGCTGGCTCT 50 2 2.1 TACTGACCCATGAGCACAGC 51
CCCCACTGCCATCCTACTTA 52 2 2.2 GAGTGTTGGCAGAATGAGCA 53
TGTGCGTATGCATTTTGTTCT 54 3 3.1 AGCACACAATTTTGCTCATCA 55
ACGTGCACATGGAACAAGAC 56 3 3.2 CTGCCAAGTTTCTGGTTGGT 57
GAGACAAAATAGCGGGGACA 58 4 4.1 AAGAGGACATTCTGGGCTGA 59
CCTGCCTCCTAAGCTTCCTT 60 4 4.2 GACCTGACTCGAACCCACTC 61
GCCTCTGCTAAGGCACAAAC 62 5 5.1 TGCCTAGGAAGGCACTTGTC 63
GGCTGGAGATCAGCTTTTTG 64 5 5.1 TGTCCTGGAACGGTTTCACT 65
TTTCTCCTTTGGGCATCTTG 66 6 6.1 AAGAGGACATTCTGGGCTGA 67
CCTGCCTCCTAAGCTTCCTT 68 6 6.2 GACCTGACTCGAACCCACTC 69
GCCTCTGCTAAGGCACAAAC 70 7 7.1 CCCTTGACCAGGTAGGTTCA 71
AAGGAGGGCTCCAGTTTCAT 72 7 7.2 TGGTGGAATGAGTAGCAGAGC 73
GGGGATTTTCACACTTGGTG 74 8 8.1 TGTCTGCACAAATTGCTGTG 75
CTTGGGAGGGGTTCAGAGAC 76 8 8.2 ACTCAAAGGTGGGTGTGAGG 77
TCCGATAATCTGGTCCAAGG 78 9 9.1 CCCAGGAAACTTGATGAGAGA 79
TGTGGAAGGAGTGAGTGAACA 80 9 9.2 GGGTTTTCATGAAGCTTTGAA 81
TTTCGTATTGCATCCCATCA 82 10 10.1 GCTGAGCTTTTCAGGTAGGC 83
GCTCCCAAAAAGATGCAAGT 84 10 10.2 GGGCCCTCCTTATACTTGGA 85
TGGACTGGGAGGAACATAGC 86 11 11.1 TGCTACGTGCAGCGTATTCT 87
TGCAACGCTATTTCTCAGGA 88 11 11.2 AGCATTTTCAGCCTCAGTGG 89
CCTTGTAGCACCTCTGTCCA 90 12 12.1 CAGACTTCTGGAACGCAGTG 91
TGTGACAGGCCAAGTCTCAG 92 12 12.2 CTGACGGTTTATGAGCAGCA 93
GTTTCCCACAGTTCCCTGAA 94 13 13.1 TGAAGTCCACATGTTTAGCTCCT 95
TGGAAGGAATGTGATTCCACT 96 13 13.2 TTCAACAGCAACCAGGAATG 97
AAGCTCAAAAAGAAAAACTTCAACA 98 14 14.1 CCATTTTCCGTACATGGTGA 99
CTGGCTGTAGGGCTCTGTTC 100 14 14.2 GACGGGGAAGGAAGAAAGAA 101
TCCCAGCTCTCGCAGCTT 102 15 15.1 TACACAACAGCACCCACACA 103
CCCCATTTCAGTTCTTTCTCA 104 15 15.2 TCTTCTGGGTTTGTTGGCTA 105
GGCACCATGTGAACTCTCCT 106 16 16.1 TCCAACTCAATGCCTTTTCTG 107
CACAGGCAAGATTCCCATTT 108 16 16.2 AATGGCTCTGGAGAAAAGCA 109
GCATGCCAGTCTGAAGATGA 110 17 17.1 TGTGAACCTCGAGAAGTGTGA 111
TTGTTGAGGTGTGCATGAGG 112 17 17.2 GTCATGTCCAGCAGGATGC 113
ATGCAGCTGACCCATTGTTT 114 18 18.1 ACGATGGAGGACATTGGAAG 115
TGAAGGCTTTTCAGGAGCTT 116 18 18.2 CTGCAAACAAGGTCTTTGGAC 117
AGGCAGCTACCTGGTTAAGG 118 19 19.1 GTGACCTTGGAGACGTTGCT 119
AGCCTCTTGAACCAGAGCAG 120 19 19.2 AAGAGAAGGAGAACCAAGCCTTA 121
CACACCAGCAAAGAGCAAAA 122 20 20.1 GATTCCGGGTCACTGTGAGT 123
TTTTACGGCGAGATGGTTTC 124 21 21.1 GGAAGAAAGGAAGGTAGGAAGG 125
AGGGCACTCTCCTCTCCTCT 126 21 21.2 GCTGAGACCACCCACTCTTC 127
CCCAGAAGGAATTACCCACA 128 22 22.1 TCACACATCACTTGCGTTCA 129
TGGCTTGATAACCCAACCAT 130 22 22.2 AGGGAGCACTCTAGGGATGG 131
CAGGGGAAACAGGAAGTGAG 132 23 23.1 CCACTAAACCGCAACCAAAG 133
GGAAACTCCCAGCTTTCAAAC 134 23 23.2 CGTTTCTCCCTGGGTTCTTT 135
ATTTTTCTGCCTCCCAAACC 136 24 24.1 CTGCCCCCAAAGAAAGGTAT 137
TTGGCATACTTCATGCTCACA 138 24 24.2 TTGACATTAGGTCCAGGTTTGA 139
TATTTTAGGGCAGGCACACC 140 25 25.1 TCATTTTGGTAGCCTTTCTGC 141
CACTCAAGTCCCAGGTTGGT 142 25 25.2 GATGATTTGGCTTTTGCGATA 143
CTTGTGGGAGCTCGACATTA 144 26 26.1 GACGTGTTGGTGCATACCTG 145
ATGAGGCTCCTCCCTCATTT 146 26 26.2 TCAAGAGTACGGCAATCACG 147
GGGAAACCGAAGGATTGATT 148 27 27.1 GACCACCGGTCTTCTCATGT 149
GCAGCTGATGAAGAGCAGAA 150 27 27.2 TAGGGTGTGGATGTGGAACA 151
TGGGAAATTGCTGTGTTGAG 152 28 28.1 TCCTGTAAAGTCCTCAGATCAACA 153
GCCAGCTTCTAAGGATGCAC 154 28 28.2 TTGGTCTTTGGCCTTCTAGG 155
AATGGGGAAGTGACAAGGAA 156 29 29.1 CAGCCTTTCTAGGAATCACAAA 157
GGATGATGAGGAACTGGCTTT 158 30 30.1 GTGAACCACCAAGCACAGC 159
AGCAGGGGTGGAGAGAAAAT 160 30 30.2 GGCTACAGCGTCTTCCTGTG 161
CACACACCACACCCACAACT 162 31 31.1 TAAGGCCGGTCTATCACAGC 163
GCAGTCTCAGCACCTCAACC 164 31 31.2 ACTGCCTGCCTGGAGTCTAC 165
TCGCTCACTGAGGAATGATG 166 32 32.1 TACACCGCGAAGGGATAGTC 167
TGGGGGTCAGAGAGAGAATG 168 33 33.1 GGGCCCCAGACTTTAATTTG 169
GCCTCTGGAGTGCAGTACCT 170 33 33.2 CCCAGATATTTCCTGCTCCA 171
CCCCCAAATTCCATTATTCC 172 34 34.1 GAGGGAGCGAGCCATAGTG 173
ACAATGGGGCTGCCTGAG 174 34 34.2 GGAGGAGGGTGGTCTCTCAT 175
TCGAAAGCTACACGGCTCTT 176 35 35.1 TGGGTGAGGAAGGAGAAAGA 177
AAACCCCTATGGGCAACTCT 178 36 36.1 CTGGCCCTCTTCTCCTTTCT 179
CAATCATTTGCCAACACAGG 180 36 36.2 GTCTGAGGAAAGGCACCTGA 181
TCGCACCTGTGTGAGAGGTA 182 37 37.1 AGCGACAAAAGGTCAACAGA 183
GGTGTTGCGGAAAACACTTT 184 37 37.2 CCTAAGAATCAGAAACGCAATG 185
CAGTCTGGGCAACAGAACAA 186 38 38.1 AACGAAACACAACCTGCACA 187
CTGTAACCCTACCCCCAACC 188 38 38.2 CAGAACAAAATGGAGTCTTAGCC 189
TCAGAAGGTGTGGGGAAAAG 190 39 39.1 ATGGCTTTCATGAAGCTGGA 191
CGTCTGTGCGAAGAGAAGC 192 39 39.2 AAAGCATTTTTGCCATCCAG 193
TTCCCGGTTAGATGAGTTGG 194 40 40.1 GCCCTCCCTTGATAAGAACC 195
TGGGAACCTCTCCATCTCAC 196 40 40.1 CCAAAGTCACATGGATGACAG 197
GGCTAAATGAGGCAGATGCT 198 cDNA qPCR SEQ SEQ TALE Primer ID ID ID #
Set F NO: R NO: #14 GPKOW CTGAGGGAAGACATGCTGGA 199
AGTGAAGCTCCACCACCTGA 200 MAGIX CCCAGCTCCACCTGGTTATT 201
CTAGGGAAGTGCTGCTGCTG 202 PLP2 ATGTGTGACCTGCACACCAA 203
CTTTACCCCTGCGACGATTT 204 PRICKLE3 GGCACCAGCACAGAGTTAGC 205
GACGACCGAAGGCACTATCA 206 #25 LRP12 GAAGCTCCTCCCTCGTATGG 207
TCCAAGCTGAGATCGTACCG 208 ZFPM2.1 ATCAGATTTCCAGCCTGTGC 209
TGATCACGGAATCAGCAGTG 210 ANGPT1 CTGGGACAGCAGGAAAACAG 211
TAGATTGGAGGGGCCACAAG 212 ZFPM2.2 GGCCTGAAAATCTGAGCTGC 213
CAGTCGTCTGTCTCAACTCCA 214 ZFPM2.3 GTACAGCAAAGGGGGTCAGC 215
GACTGGCAGCTTGTAGCCTT 216 ZFPM2.4 GTTTTATCTTTTGAAAGGCACAGTC 217
TTGTGATCACCAGGTGCAGT 218 ZFPM2.5 TCAATTCAGCTGCTTCCTCA 219
CTGGAAATCTGATGGGCACT 220 SDHA TCTGCACTCTGGGGAAGAAG 221
CAAGAATGAAGCAAGGGACA 222 TBP TTCCCCATGAACCACAGTTT 223
TGCAATACTGGAGAGGTGGA 224
Example 1
[0122] Initial experiments focused on a candidate enhancer in the
stem cell leukemia (SCL) locus that is enriched for H3K4me2 and
H3K27ac in K562 erythroleukemia cells.sup.4,6,9,12,13,19. SCL
encodes a developmental transcription factor with critical
functions in hematopoiesis that is expressed in K562 cells. A TALE
array was designed to bind an 18 base sequence in a segment of this
enhancer predicted to be nucleosome-free based on DNase
hypersensitivity (FIG. 1A). Since the binding specificity of
monomeric TALEs has yet to be thoroughly characterized, an
expression construct encoding this TALE array fused to a 3X FLAG
epitope was first created. This construct was transfected into K562
cells, expression confirmed by Western blot, and genome-wide
binding mapped by chromatin immunoprecipitation and sequencing
(ChIP-seq). The top ranked binding site corresponded precisely to
the target sequence within the SCL locus (FIG. 1B, Table 3). No
other ChIP-seq peaks were reproducibly detected in the two
biological replicates.
TABLE-US-00003 TABLE 3 TALE-3X Flag ChIP-seq Peaks ##STR00001##
Peak calls using MACS in two biologically independent replicates
along with reads falling within a 1 kb window around the peak. Grey
shading indicates the target locus. P-values calculated by
comparison of both biological replicates to the input control
library.
[0123] The genome was scanned for sequence motifs with one or two
mismatches from the TALE recognition motif, but no significant
ChIP-seq enrichments were detected at these sites either (Table
4).
TABLE-US-00004 TABLE 4 TALE-3X Flag ChIP Input tags Target Sequence
tags per 1 kb bin per 1 kb bin 18/18 Target (n = 1) 17.5 1 17/18
Targets (n = 2) 0.5 0.5 16/18 Targets (n = 52) 0.40 0.58 The
sequence read count at 54 genomic loci with 1 or 2 mismatches
compared to the perfect match target locus for the TALE-3X
Flag.
[0124] These data support the specificity of TALE binding and are
consistent with prior demonstrations of TALE activator domain
fusions that selectively induce target genes.sup.14,18,20.
Example 2
[0125] To modulate chromatin state at the SCL enhancer, the
corresponding TALE was combined with the LSD1 demethylase. K562
cells were transfected with a construct encoding this TALE-LSD1
fusion or a control mCherry vector, the cells cultured for three
days and histone modification levels measured by ChIPqPCR.
[0126] The fusion reduced H3K4me2 signals at the target locus by
.about.3-fold relative to control, but had no effect at several
non-target control enhancers (FIGS. 1C and 1E). In addition to its
enzymatic activity, LSD1 physically interacts with other chromatin
modifying enzymes, including histone deacetylases.sup.21. Therefore
changes in H3K27ac, another characteristic enhancer mark, were also
assayed. The fusion reduced H3K27ac levels by >4-fold,
suggesting that LSD1 recruitment leads to generalized chromatin
inactivation at the target enhancer.
Example 3
[0127] To eliminate the possibility that the chromatin changes
reflect displacement of other transcription factors by the TALE, a
construct encoding the TALE without LSD1 was tested. A TALE-LSD1
fusion with a scrambled target sequence not present in the human
genome was also examined to control for non-specific effects of
LSD1 overexpression. Neither construct altered H3K4me2 or H3K27ac
levels at the SCL locus (FIGS. 1C and 1F).
[0128] Lastly, to evaluate the specificity of the fusion
comprehensively, ChIP-seq was used to map H3K4me2 and H3K27ac
genome-wide in TALE-LSD1 and control transfected K562 cells. These
data confirmed loss of H3K4me2 and H3K27ac across a 2 kb region
surrounding the target sequence within the SCL locus (FIG. 1D).
[0129] These results indicate that directed LSD1 recruitment
results in locus-specific reduction of H3K4me2 and H3K27ac. The
generalized effect on chromatin state may be a direct consequence
of H3K4 demethylation or, alternatively, may depend on partner
proteins that associate with LSD1.sup.15,16,22,23. Regardless,
prior studies indicate that sequence elements enriched for H3K4me2
and H3K27ac exhibit enhancer activity in corresponding cell types,
while elements lacking these marks are rarely active.sup.4,6,12.
Hence, these results suggest that this TALE-LSD1 fusion efficiently
and selectively inactivates its target enhancer.
Example 4
[0130] The study was expanded to investigate a larger set of
candidate enhancers with active chromatin in K562 cells. These
include nine elements in developmental loci, sixteen additional
highly cell type-specific elements, and fifteen intergenic
elements. TALE repeat arrays were designed and produced for
sequences in these 40 enhancers using the Fast Ligation-based
Automatable Solid-phase High-throughput (FLASH) assembly method'
(Table 1). LSD1 fusion constructs were then cloned for each TALE
and transfected individually into K562 cells, alongside mCherry
control plasmid transfected separately into cells. At three days
post transfection, H3K4me2 and H3K27ac were measured by ChIPqPCR
using two primer sets per target enhancer.
[0131] 26 of the 40 TALE-LSD1 constructs (65%) significantly
reduced levels of these modifications at their target loci,
relative to control transfected cells (FIG. 2). An additional 8
constructs caused more modest reductions at their targets,
suggesting that the strategy can be effective at most enhancers
(FIG. 2). ChIP-qPCR measurements of H3K4me1 and H3K4me3 confirm
that the reagents also reduce these alternative H3K4 methylation
states (FIGS. 4A-C). The induced changes were specific to the
target loci, as analogous measurements at non-target enhancers did
not reveal substantial changes (FIG. 5). Furthermore, genome-wide
ChIP-seq analysis of two TALE-LSD1 fusions that were positive by
ChIPqPCR confirmed the robustness and specificity with which they
reduce chromatin signals at target loci (FIG. 6). These results
suggest that TALE-LSD1 fusions can provide an effective means for
inactivating chromatin at any target enhancer.
TABLE-US-00005 TABLE 1 TALE Array Target Sequences TALE SEQ ID #
chr # TALE Target Sequence ID NO: 1 chr12:25,845,475
TTCAGTTGTGGTATCTG 6 2 chr7:16,532,432 TACCATGTCTTTCTAAG 7 3
chr3:141,765,325 TTTACAGAGCTGTGGTCACT 8 4 chr1:47,647,018
TCCGTGGCTGCCAGTCTG 9 5 chr9:5,839,284 TGCATATACTTTTTAATG 10 6
chr1:47,646,996 TCCAGGAGCGCGCCTGAG 11 7 chr7:129,598,655
TGCCTGTGAGGAACAGCTGT 12 8 chr2:169,708,409 TGCAGACATCTCCAGGCTCT 13
9 chr9:102,832,599 TAATTTGTACATGGTTACAT 14 10 chr15:38,894,009
TGTTAGTTACCATATTGTGG 15 11 chr8:106,347,824 TCCAGTCCCTGGCTCCCATG 16
12 chr16:10,832,743 TGGCTAATTTTTGGTATTTT 17 13 chr4:145,245,496
TGGCTTTCCTTCCCTTTG 18 14 chrX:49,023,709 TAGCCGCGAGGAAGGCG 19 15
chr5:162,806,718 TAAAGACCTGTTACCCAATT 20 16 chr4:145,050,452
TCGTTTTTCTTTTTTGGAAG 21 17 chr7:129,515,859 TTCTAAATTGAGGTGCTG 22
18 chr10:11,183,638 TCAATCATTGCATGTTTATT 23 19 chr17:8,323,819
TTGCATCTGGGACAGATG 24 20 chr11:5,245,852 TTGATGGTAACACTATG 25 21
chr1:182,269,308 TTATCTCCCTCACCCAG 26 22 chr1:198,568,183
TGGTTAGAAACACAGCTGCC 27 23 chr6:138,240,975 TTCATGGTTCAATAAAGACT 28
24 chr3:150,169,053 TACATAAAATTTTTAAGG 29 25 chr8:106,341,287
TTAAGCTTCTGAAGTCAG 30 26 chrX:119,619,445 TGATCTTCATTTTTAAAG 31 27
chr21:15,825,632 TGGTATGAGTTGAAAATG 32 28 chr8:106,376,850
TAAGTCTACATATAGTATCC 33 29 chr11:16,617,852 TAAAATGCACTCACAATG 34
30 chr19:14,496,304 TCTCTGAATCCCCTGGTGAC 35 31 chr6:119,634,206
TTAAACAGATAAGGGAG 36 32 chr1:47,646,977 TGGTGCGTTATCAGCCTT 37 33
chr8:106,256,324 TCAATACCCCACAAAGAAGC 38 34 chr20:36,007,695
TCTCTACCTTGGAGGCTG 39 35 chr1:166,674,281 TAGAAAATACAACCTCAG 40 36
chr11:48,082,936 TCCTGGAAAAGCCCTCTATG 41 37 chr14:23,030,549
TAAGTTTGCAAACAAGCTCC 42 38 chr19:23,907,083 TGGCTTTCCTAGGCAGAAGT 43
39 chr10:80,948,325 TCACGCCTTTGTGGCCAGAG 44 40 chr18:32,630,094
TCACTGTGTACCTTTTTATG 45 non- N/A TGCAGTGCTTCAGCCGCT 46 Target
Example 5
[0132] Next, whether reduced chromatin activity at specific
enhancers affects the transcriptional output of nearby genes was
considered. These experiments initially focused on 9 TALE-LSD1
fusions that robustly alter chromatin state (FIG. 2), and
systematically screened for regulated genes using a modified
RNA-seq procedure termed 3' Digital Gene Expression (3'DGE). By
only sequencing the 3' ends of mRNAs, this procedure enables
quantitative analysis of transcript levels at modest sequencing
depths.sub.25 as described above. A gene was scored as regulated if
(i) it was detected in control K562 cells with a normalized RNA-seq
value >10, i.e. the top 50.sup.th percentile of expression; (ii)
its mean expression value was at least 1.5-fold lower in the
corresponding on-target TALE-LSD1 libraries compared to all other
libraries, p<0.05 calculated using DESeq.sup.26 and (iii) its
normalized 3'DGE values in the on-target TALE-LSD1 libraries were
the two lowest over all 22 datasets.
[0133] The 9 TALEs were transfected individually into K562 cells,
alongside with control mCherry plasmids and measured mRNA levels in
biological replicate. Each 3'DGE dataset was normalized based on a
negative binomial distribution and excluded any libraries that did
not satisfy quality controls as described above and in.sup.26.
Whether any of the TALE-LSD1 reagents significantly altered the
expression of genes in the vicinity of its target enhancer was then
examined.
[0134] Four of the nine tested fusions (44%) caused a nearby gene
to be down-regulated by at least 1.5-fold, with both biological
replicates representing the two outlying values across all 22
RNA-seq datasets (see Methods, FIG. 3A, FIG. 7). The significance
of these transcriptional changes is supported by a simulated
analysis of a random sampling of 1000 genomic locations that did
not yield any false-positives in which an adjacent gene scored as
regulated (FDR<0.1%). The expression changes were also confirmed
by quantitative RT-PCR (FIG. 8A). Two of the enhancers that
significantly regulated genes are intergenic, while a third
coincides with the 3' end of a gene, but affects the activity of
the next downstream gene. The fourth scoring enhancer resides in
the first intron of ZFPM2. A TALE lacking the demethylase did not
affect ZFPM2 expression, confirming that ZFPM2 down-regulation
requires LSD1 recruitment (FIG. 8B). It was not possible to
distinguish whether the other five putative enhancers have weak
transcriptional effects below the detection threshold or,
alternatively, do not regulate any genes in K562 cells. Regardless,
these results indicate that TALE-LSD1 fusions can alter enhancer
activity in a targeted, loss-of-function manner, and thereby enable
identification and modulation of their target genes.
Example 6
[0135] The high prevalence of putative enhancers in the genome
suggests that many act redundantly or function only in specific
contexts, which could explain our inability to assign target genes
to roughly half of the tested elements. To address the former,
three putative enhancers were examined within the developmental
locus encoding ZFPM2 (FIG. 3B). In addition to the TALE-LSD1 fusion
targeted to the intronic enhancer described above (FIG. 3A, 3B;
enhancer+10), TALE-LSD1 fusions were designed and validated that
reduced modification levels at two additional intronic ZFPM2
enhancers (enhancers+16, +45) (FIG. 2, 3B). First, each TALE-LSD1
fusion was transfected individually and their effects on ZFPM2
expression tested by qPCR. While the fusion targeting the
original+10 enhancer reduced ZFPM2 expression by .about.2-fold, the
fusions targeting the +16 and +45 enhancers showed only modest
reductions of .about.13% and .about.22%, respectively, which did
not reach statistical significance (FIG. 3C). To determine if these
enhancers act additively or synergistically, the fusions were
transfected in pairwise combinations. Although targeting pairs of
enhancers tended to reduce gene expression more than hitting a
single enhancer, the cumulative effects were substantially less
than the sum of the two individual effects. This suggests that the
multiple enhancers in this locus function redundantly to maintain
ZFPM2 expression in K562 cells. These results indicate the
potential of programmable TALE-LSD1 fusions to shed light on
complex regulatory interactions among multiple enhancers and genes
in a locus.
REFERENCES
[0136] 1. Bulger, M. & Groudine, M. Functional and mechanistic
diversity of distal transcription enhancers. Cell 144, 327-339
(2011). [0137] 2. Visel, A., Rubin, E. M. & Pennacchio, L. A.
Genomic views of distant-acting enhancers. Nature 461, 199-205
(2009). [0138] 3. Noonan, J. P. & McCallion, A. S. Genomics of
long-range regulatory elements. Annu Rev Genomics Hum Genet 11,
1-23 (2010). [0139] 4. Heintzman, N. D. et al. Histone
modifications at human enhancers reflect global cell-type-specific
gene expression. Nature 459, 108-112 (2009). [0140] 5. Boyle, A. P.
et al. High-resolution mapping and characterization of open
chromatin across the genome. Cell 132, 311-322 (2008). [0141] 6.
Ernst, J. et al. Mapping and analysis of chromatin state dynamics
in nine human cell types. Nature 473, 43-49 (2011). [0142] 7.
Consortium, T. E. P. et al. An integrated encyclopedia of DNA
elements in the human genome. Nature 488, 57-74 (2012). [0143] 8.
Maurano, M. T. et al. Systematic localization of common
disease-associated variation in regulatory DNA. Science 337,
1190-1195 (2012). [0144] 9. Calo, E. & Wysocka, J. Modification
of Enhancer Chromatin: What, How, and Why? MOLCEL 49, 825-837
(2013). [0145] 10. Stadler, M. B. et al. DNA-binding factors shape
the mouse methylome at distal regulatory regions. Nature 480,
490-495 (2011). [0146] 11. Ng, J.-H. et al. In vivo epigenomic
profiling of germ cells reveals germ cell molecular signatures. Dev
Cell 24, 324-333 (2013). [0147] 12. Creyghton, M. P. et al. Histone
H3K27ac separates active from poised enhancers and predicts
developmental state. Proceedings of the National Academy of
Sciences 107, 21931-21936 (2010). [0148] 13. Rada-Iglesias, A. et
al. A unique chromatin signature uncovers early developmental
enhancers in humans. Nature 470, 279-283 (2011). [0149] 14. Shi, Y.
et al. Histone Demethylation Mediated by the Nuclear Amine Oxidase
Homolog LSD1. Cell 119, 941-953 (2004). [0150] 15. Boch, J. et al.
Breaking the Code of DNA Binding Specificity of TAL-Type III
Effectors. Science 326, 1509-1512 (2009). [0151] 16. Moscou, M. J.
& Bogdanove, A. J. A simple cipher governs DNA recognition by
TAL effectors. Science 326, 1501 (2009). [0152] 17. Mussolino, C.
& Cathomen, T. TALE nucleases: tailored genome engineering made
easy. Curr Opin Biotechnol 23, 644-650 (2012). [0153] 18. Joung, J.
K. & Sander, J. D. TALENs: a widely applicable technology for
targeted genome editing. Nat. Rev. Mol. Cell Biol. 14, 49-55
(2013). [0154] 19. Dhami, P. et al. Genomic Approaches Uncover
Increasing Complexities in the Regulatory Landscape at the Human
SCL (TALI) Locus. PLoS ONE 5, e9059 (2010). [0155] 20. Zhang, F. et
al. Efficient construction of sequence-specific TAL effectors for
modulating mammalian transcription. Nat Biotechnol 29, 149-153
(2011). [0156] 21. Lee, M. G., Wynder, C., Cooch, N. &
Shiekhattar, R. An essential role for CoREST in nucleosomal histone
3 lysine 4 demethylation. Nature (2005). doi:10.1038/nature04021
[0157] 22. Whyte, W. A. et al. Enhancer decommissioning by LSD1
during embryonic stem cell differentiation. Nature 1-5 (2012).
doi:10.1038/nature10805 [0158] 23. Reyon, D. et al. FLASH assembly
of TALENs for high-throughput genome editing. Nat Biotechnol 30,
460-465 (2012). [0159] 24. Yoon, 0. K. & Brem, R. B.
Noncanonical transcript forms in yeast and their regulation during
environmental stress. RNA 16, 1256-1267 (2010). [0160] 25. Anders,
S. & Huber, W. Differential expression analysis for sequence
count data. Genome Biol. 11, R106 (2010). [0161] 26. Maeder, M. L.
et al. Robust, synergistic regulation of human gene expression
using TALE activators. Nat Meth 10, 243-245 (2013). [0162] 27. Ku,
M. et al. Genomewide analysis of PRC1 and PRC2 occupancy identifies
two classes of bivalent domains. PLoS Genet. 4, e1000242 (2008).
[0163] 28. Ram, O. et al. Combinatorial Patterning of Chromatin
Regulators Uncovered by Genome-wide Location Analysis in Human
Cells. Cell 147, 1628-1639 (2011).
Other Embodiments
[0164] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
* * * * *