U.S. patent application number 14/691281 was filed with the patent office on 2015-09-03 for recombinant dna constructs and methods for modulating expression of a target gene.
This patent application is currently assigned to Monsanto Technology LLC. The applicant listed for this patent is Monsanto Technology LLC. Invention is credited to Sergey I. Ivashuta, Barbara E. Wiggins, Yuanji Zhang.
Application Number | 20150247154 14/691281 |
Document ID | / |
Family ID | 41466319 |
Filed Date | 2015-09-03 |
United States Patent
Application |
20150247154 |
Kind Code |
A1 |
Ivashuta; Sergey I. ; et
al. |
September 3, 2015 |
Recombinant DNA Constructs and Methods for Modulating Expression of
a Target Gene
Abstract
This invention provides recombinant DNA constructs and methods
for manipulating expression of a target gene that is regulated by a
small RNA, by interfering with the binding of the small RNA to its
target gene. More specifically, this invention discloses
recombinant DNA constructs encoding cleavage blockers, 5-modified
cleavage blockers, and translational inhibitors useful for
modulating expression of a target gene and methods for their use.
Further disclosed are miRNA targets useful for designing
recombinant DNA constructs including miRNA-unresponsive transgenes,
miRNA decoys, cleavage blockers, 5-modified cleavage blockers, and
translational inhibitors, as well as methods for their use, and
transgenic eukaryotic cells and organisms containing such
constructs.
Inventors: |
Ivashuta; Sergey I.;
(Ballwin, MO) ; Wiggins; Barbara E.;
(Chesterfield, MO) ; Zhang; Yuanji; (W Idon
Spring, MO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Monsanto Technology LLC |
St. Louis |
MO |
US |
|
|
Assignee: |
Monsanto Technology LLC
St. Louis
MO
|
Family ID: |
41466319 |
Appl. No.: |
14/691281 |
Filed: |
April 20, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12999777 |
Jan 5, 2011 |
9040774 |
|
|
PCT/US09/49392 |
Jul 1, 2009 |
|
|
|
14691281 |
|
|
|
|
61077244 |
Jul 1, 2008 |
|
|
|
Current U.S.
Class: |
800/295 ;
435/320.1; 435/419; 536/23.6 |
Current CPC
Class: |
C12N 15/111 20130101;
C12N 2310/141 20130101; C12N 15/8261 20130101; Y02A 40/146
20180101; C12N 15/8216 20130101; C12N 15/8218 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82 |
Claims
1-10. (canceled)
11. A recombinant DNA construct comprising a promoter operable in a
plant cell, operably linked to DNA encoding a single-stranded
cleavage blocker RNA that binds in vivo to a target RNA transcript
at an miRNA recognition site for an endogenous mature miRNA, and
forms, through complementary base-pairing, a hybridized segment of
from 19 to 24 nucleotides in length at said miRNA recognition site
in said target RNA transcript, wherein said hybridized segment
comprises an A, G, or C in said single-stranded cleavage blocker
RNA at a position corresponding to the 5' terminus of said
endogenous mature miRNA, and matches through complementary
base-pairing between said single-stranded cleavage blocker RNA and
said miRNA recognition site at positions corresponding to positions
9, 10, and 11 in 3' to 5' direction of said endogenous mature
miRNA, and wherein said single-stranded cleavage blocker RNA
interferes with the binding of said endogenous mature miRNA to said
target RNA transcript at said miRNA recognition site.
12. The recombinant DNA construct of claim 11, wherein formation of
said hybridized segment inhibits cleavage of said target RNA
transcript mediated by said endogenous mature miRNA.
13. A method of modulating expression of at least one target gene,
comprising expressing in said plant cell the recombinant DNA
construct of claim 11, wherein said at least one target gene
encodes said target RNA transcript.
14. The method of claim 13, wherein formation of said hybridized
segment inhibits suppression of said at least one target gene by
said endogenous mature miRNA.
15. A non-natural plant chromosome or plastid comprising the
recombinant DNA construct of claim 11.
16. A non-natural transgenic plant cell having in its genome the
recombinant DNA construct of claim 11, or a non-natural transgenic
plant or a non-natural transgenic plant seed or a non-natural
transgenic pollen grain, each comprising said non-natural
transgenic plant cell.
17. A non-natural partially transgenic plant, wherein: (a) said
non-natural partially transgenic plant comprises the non-natural
transgenic plant cell of claim 16 and further comprises
non-transgenic tissue; or (b) said non-natural partially transgenic
plant comprises a transgenic rootstock comprising the non-natural
transgenic plant cell of claim 16 and further comprises a
non-transgenic scion.
18. The recombinant DNA construct of claim 11, wherein said target
RNA transcript is transcribed from at least one target gene
comprising: (a) coding sequence, non-coding sequence, or both
coding and non-coding sequence; or (b) a single target gene, or
multiple target genes; or (c) one or more of the group consisting
of: (1) an endogenous gene of a eukaryote, (2) a transgene of a
transgenic plant, (3) an endogenous gene of a pest or pathogen of a
plant, and (4) an endogenous gene of a symbiont associated with a
pest or pathogen of a plant.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS AND INCORPORATION OF
SEQUENCE LISTINGS
[0001] This application is a continuation of U.S. National Stage
application Ser. No. 12/999,777 filed on Jan. 5, 2011, which claims
the benefit of priority of U.S. Provisional Patent Application No.
61/077,244 filed on Jul. 1, 2008, which is incorporated by
reference in its entirety herein. A computer readable form of the
sequence listing is filed with this application by electronic
submission and is incorporated into this application by reference
in its entirety. The sequence listing is contained in the file
named "P34155US02_SEQLIST.txt", which is 2,674,688 bytes (measured
in operating system MS windows) and was created on Apr. 20,
2015.
FIELD OF THE INVENTION
[0002] Disclosed herein are recombinant DNA constructs with DNA
that undergoes processing to an RNA providing RNase III cleavage
resistance to a target gene transcript. Such RNAs serve as cleavage
blockers and translational inhibitors useful for modulating
expression of a target gene. Further disclosed are miRNA
recognition site sequences and their use in designing recombinant
DNA constructs including miRNA-unresponsive transgenes, miRNA
decoys, cleavage blockers, and translational inhibitors. Also
disclosed are non-natural transgenic plant cells, plants, and seeds
containing in their genome a recombinant DNA construct of this
invention. Further disclosed are methods of modulating expression
of a target gene using recombinant DNA constructs of this
invention.
BACKGROUND OF THE INVENTION
[0003] Several cellular pathways involved in RNA-mediated gene
suppression have been described, each distinguished by a
characteristic pathway and specific components. Generally,
RNA-mediated gene suppression involves a double-stranded RNA
(dsRNA) intermediate that is formed intramolecularly within a
single RNA molecule or intermolecularly between two RNA molecules.
This longer dsRNA intermediate is processed by a ribonuclease of
the RNase III family (Dicer or Dicer-like ribonuclease) to one or
more small double-stranded RNAs, one strand of which is
incorporated by the ribonuclease into the RNA-induced silencing
complex ("RISC"). Which strand is incorporated into RISC is
believed to depend on certain thermodynamic properties of the
double-stranded small RNA, such as those described by Schwarz et
al. (2003) Cell, 115:199-208, and Khvorova et al. (2003) Cell,
115:209-216.
[0004] The siRNA pathway involves the non-phased cleavage of a
longer double-stranded RNA intermediate to small interfering RNAs
("siRNAs"). The size of siRNAs is believed to range from about 19
to about 25 base pairs, but common classes of siRNAs include those
containing 21 base pairs or 24 base pairs. See, for example,
Hamilton et al. (2002) EMBO J., 21:4671-4679.
[0005] The microRNA pathway involves microRNAs ("miRNAs"),
non-protein coding RNAs generally of between about 19 to about 25
nucleotides (commonly about 20-24 nucleotides in plants) that guide
cleavage in trans of target transcripts, negatively regulating the
expression of genes involved in various regulation and development
pathways; see Ambros et al. (2003) RNA, 9:277-279. Naturally
occurring miRNAs are derived from a primary transcript
("pri-miRNA") that is naturally processed to a shorter transcript
("pre-miRNA") which itself is further processed to the mature
miRNA. For a recent review of miRNA biogenesis in both plants and
animals, see Kim (2005) Nature Rev. Mol. Cell Biol., 6:376-385.
Gene regulation of biological pathways by miRNAs can occur at
multiple levels and in different ways, including regulation of
single or multiple genes, regulation of transcriptional regulators,
and regulation of alternative splicing; see Makeyev & Maniatis
(2008) Science, 319:1789-1790. Various utilities of miRNAs, their
precursors, their recognition sites, and their promoters are
described in detail in co-assigned U.S. Patent Application
Publication 2006/0200878 A1, specifically incorporated by reference
herein, which include: (1) the expression of a native miRNA or
miRNA precursor sequence to suppress a target gene; (2) the
expression of an engineered (non-native) miRNA or miRNA precursor
sequence to suppress a target gene; (3) expression of a transgene
with a miRNA recognition site, wherein the transgene is suppressed
when the corresponding mature miRNA is expressed, either
endogenously or transgenically; and (4) expression of a transgene
driven by a miRNA promoter.
[0006] In the trans-acting siRNA ("ta-siRNA") pathway, miRNAs serve
to guide in-phase processing of siRNA primary transcripts in a
process that requires an RNA-dependent RNA polymerase for
production of a double-stranded RNA precursor; trans-acting siRNAs
are defined by lack of secondary structure, a miRNA target site
that initiates production of double-stranded RNA, requirements of
DCL4 and an RNA-dependent RNA polymerase (RDR6), and production of
multiple perfectly phased .about.21-nt small RNAs with perfectly
matched duplexes with 2-nucleotide 3' overhangs (see Allen et al.
(2005) Cell, 121:207-221; Vazquez et al. (2004) Mol. Cell,
16:69-79).
[0007] The phased small RNA ("phased sRNA") pathway (see PCT patent
application PCT/US2007/019283, published as WO 2008/027592) is
based on an endogenous locus termed a "phased small RNA locus",
which transcribes to an RNA transcript forming a single foldback
structure that is cleaved in phase in vivo into multiple small
double-stranded RNAs (termed "phased small RNAs") capable of
suppressing a target gene. In contrast to siRNAs, a phased small
RNA transcript is cleaved in phase. In contrast to miRNAs, a phased
small RNA transcript is cleaved by DCL4 or a DCL4-like orthologous
ribonuclease (not DCL1) to multiple abundant small RNAs capable of
silencing a target gene. In contrast to the ta-siRNA pathway, the
phased small RNA locus transcribes to an RNA transcript that forms
hybridized RNA independently of an RNA-dependent RNA polymerase and
without a miRNA target site that initiates production of
double-stranded RNA.
[0008] Gene suppression mediated by small RNAs processed from
natural antisense transcripts has been reported in at least two
pathways. In the natural antisense transcript small interfering RNA
("nat-siRNA") pathway (Borsani et al. (2005) Cell, 123:1279-1291),
siRNAs are generated by DCL1 cleavage of a double-stranded RNA
formed between the antisense transcripts of a pair of genes
(cis-antisense gene pairs). A similar natural anti-sense transcript
microRNA ("nat-miRNA") pathway (Lu et al. (2008) Proc. Natl. Acad.
Sci. USA, 105: 4951-4956) has also been reported. In metazoan
animals, small RNAs termed Piwi-interacting RNAs ("piRNAs") have
been reported to also have gene-silencing activity (Lau et al.
(2006) Science, 313:363-367; O'Donnell & Boeke (2007) Cell,
129:37-44).
SUMMARY OF THE INVENTION
[0009] In one aspect, this invention provides a recombinant DNA
construct including DNA that undergoes processing to an RNA
including single-stranded RNA that binds to the transcript of at
least one target gene to form a hybridized segment of at least
partially double-stranded RNA that imparts to the transcript
resistance to cleavage by an RNase III ribonuclease within or in
the vicinity of the hybridized segment.
[0010] Another aspect of this invention provides a recombinant DNA
construct encoding a "cleavage blocker" for inhibiting
double-stranded RNA-mediated suppression of the at least one target
gene, thereby increasing expression of the target gene (relative to
expression in the absence of the cleavage blocker). One embodiment
is a recombinant DNA construct including DNA that undergoes
processing to an RNA including single-stranded RNA that binds to
the transcript of at least one target gene to form a hybridized
segment of at least partially double-stranded RNA that imparts to
the transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of the hybridized segment, wherein the
binding of the single-stranded RNA to the transcript (and the
resultant formation of the hybridized segment) inhibits
double-stranded RNA-mediated suppression of the at least one target
gene.
[0011] Another aspect of this invention provides a recombinant DNA
construct encoding a a "5'-modified cleavage blocker". One
embodiment includes a recombinant DNA construct including DNA that
undergoes processing to an RNA including single-stranded RNA that
binds to the transcript of at least one target gene to form a
hybridized segment of at least partially double-stranded RNA that
imparts to the transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of the hybridized segment,
wherein the binding of the single-stranded RNA to the transcript
(and the resultant formation of the hybridized segment) inhibits
double-stranded RNA-mediated suppression of the at least one target
gene, wherein the cleavage by an RNase III ribonuclease is mediated
by binding of a mature miRNA, the binding is at a miRNA recognition
site (that is recognized by the mature miRNA) in the transcript,
the cleavage of the transcript occurs at the miRNA recognition
site, and the hybridized segment is formed at least partially
within the miRNA recognition site, and the hybridized segment
includes an A, G, or C (but not a U) at a position corresponding to
the 5' terminus of the mature miRNA that natively binds to the
recognition site, but does not require mismatches between the
single-stranded RNA and the miRNA recognition site at positions of
the miRNA recognition site corresponding to positions 9, 10, or 11
(in 3' to 5' direction) of the mature miRNA, or insertions at a
position in the single-stranded RNA at positions of the miRNA
recognition site corresponding to positions 10 or 11 (in 3' to 5'
direction) of the mature miRNA.
[0012] Another aspect of this invention provides a recombinant DNA
construct encoding a "translational inhibitor" for inhibiting
translation of the transcript, thereby decreasing expression of the
target gene (relative to expression in the absence of expression of
the construct). One embodiment is a recombinant DNA construct
including DNA that undergoes processing to an RNA including
single-stranded RNA that binds to the transcript of at least one
target gene to form a hybridized segment of at least partially
double-stranded RNA that imparts to the transcript resistance to
cleavage by an RNase III ribonuclease within or in the vicinity of
the hybridized segment, wherein the binding of the single-stranded
RNA to the transcript (and the formation of the hybridized segment)
inhibits translation of the transcript.
[0013] Other aspects of this invention provide methods for
modulating expression of miRNA target genes from plant species.
Embodiments of this invention include methods to increase or
improve yield of crop plants by expressing in such plants
recombinant DNA constructs of this invention, for example,
recombinant DNA constructs encoding a native miRNA precursor
sequence or an artificial precursor sequence, or recombinant DNA
constructs encoding a cleavage blocker or translational inhibitor
or decoy.
[0014] Further aspects of this invention provide non-natural
transgenic plant cells having in their genome a recombinant DNA
construct of this invention. Also provided are a non-natural
transgenic plant containing the transgenic plant cell of this
invention, a non-natural transgenic plant grown from the transgenic
plant cell of this invention, and non-natural transgenic seed
produced by the transgenic plants, as well as commodity products
produced from a non-natural transgenic plant cell, plant, or seed
of this invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 depicts the predicted fold-back structures of the
native miRNA miRMON1 precursor (Panel A), the synthetic miRNA
miRGL1 precursor (Panel B), the synthetic cleavage blocker
miRGL1-CB (Panel C), and the synthetic 5'-modified miRGL1 cleavage
blocker (Panel D), as well as an alignment (Panel E) of the miRNA
recognition site in the target gene GL1, the mature miRGL1, the
mature miRGL1-CB, and the artificial GL1 recognition site in the
miRGL1-sensor, as described in Examples 1 and 2.
[0016] FIG. 2 depicts a maize transformation base vector
(pMON93039, SEQ ID NO: 2065), as described in Example 5.
[0017] FIG. 3 depicts a soybean or cotton transformation base
vector (pMON82053, SEQ ID NO: 2066), as described in Example 5.
[0018] FIG. 3 depicts a cotton transformation base vector
(pMON99053, SEQ ID NO: 2067), as described in Example 5.
DETAILED DESCRIPTION OF THE INVENTION
[0019] Unless otherwise stated, nucleic acid sequences in the text
of this specification are given, when read from left to right, in
the 5' to 3' direction. Nucleic acid sequences may be provided as
DNA or as RNA, as specified; disclosure of one necessarily defines
the other, as is known to one of ordinary skill in the art. The
term "miRNA precursor", as used herein, refers to an RNA transcript
that is naturally processed to produce a mature miRNA. Where a term
is provided in the singular, the inventors also contemplate aspects
of the invention described by the plural of that term.
Recombinant DNA Constructs that are Processed to RNA Providing
Rnase III Resistance to a Target Gene Transcript
[0020] In one aspect, this invention provides a recombinant DNA
construct including DNA that undergoes processing to an RNA
including single-stranded RNA that binds to the transcript of at
least one target gene to form a hybridized segment of at least
partially double-stranded RNA that imparts to the transcript
resistance to cleavage by an RNase III ribonuclease within or in
the vicinity of the hybridized segment. The recombinant DNA
construct is made by techniques known in the art, such as those
described under the heading "Making and Using Recombinant DNA
Constructs" and illustrated in the working Examples. The
recombinant DNA construct is particularly useful for making
transgenic plant cells, transgenic plants, and transgenic seeds as
discussed below under "Making and Using Transgenic Plant Cells and
Transgenic Plants". This invention therefore includes embodiments
wherein the recombinant DNA construct is located within a vector
for transforming a plant cell (such as within a plasmid or viral
vector), or on a biolistic particle for transforming a plant cell,
or within a chromosome or plastid of a non-natural transgenic plant
cell, or within a non-natural transgenic cell, non-natural
transgenic plant tissue, non-natural transgenic plant seed,
non-natural transgenic pollen grain, or a non-natural transgenic or
partially transgenic plant. Further included are embodiments
wherein the recombinant DNA construct is in a commodity product
produced from a non-natural transgenic cell, non-natural transgenic
plant tissue, non-natural transgenic plant seed, non-natural
transgenic pollen grain, or a non-natural transgenic or partially
transgenic plant of this invention; such commodity products
include, but are not limited to harvested leaves, roots, shoots,
tubers, stems, fruits, seeds, or other parts of a plant, meals,
oils, extracts, fermentation or digestion products, crushed or
whole grains or seeds of a plant, or any food or non-food product
including such commodity products produced from a transgenic plant
cell, plant, or seed of this invention.
[0021] The processing of the DNA includes transcription of the DNA
to a primary RNA transcript, which may undergo one or more
additional natural processing steps that result in the
single-stranded RNA that binds to the transcript of at least one
target gene. In one embodiment, the processing of the DNA includes
transcription of the DNA to an RNA intermediate including one or
more double-stranded RNA stems; the double-stranded RNA stem or
stems is further processed to single-stranded RNA. A final product
of the DNA processing is the RNA including single-stranded RNA that
binds to the transcript of at least one target gene.
[0022] For example, the recombinant DNA construct includes DNA that
is transcribed to a primary transcript with a sequence derived from
a native pri-miRNA or pre-miRNA sequence that forms secondary
structure including one or more double-stranded stems, followed by
processing of the primary transcript to a shorter, at least
partially double-stranded intermediate (similar to a pre-miRNA)
which is then cleaved by an RNase III ribonuclease (ribonuclease
III, e.g., Drosha or DCL1 or a DCL1-like orthologous ribonuclease)
to a pair of single-stranded RNAs (similar to a miRNA and a
miRNA*pair). In another example, the recombinant DNA construct
includes DNA that is transcribed to a primary transcript that forms
secondary structure including one or more double-stranded stems,
followed by cleavage of the double-stranded RNA stem(s) by an RNase
III ribonuclease to one or more pairs of single-stranded small RNAs
(similar to an siRNA duplex). In another example, the recombinant
DNA construct includes DNA that is transcribed to a primary
transcript that includes one or more spliceable introns that are
removed by intronic processing. In yet another example, the
recombinant DNA construct includes DNA that is transcribed to a
primary transcript including one or more self-cleaving ribozymes
(see, e.g., Tang & Breaker (2000) Proc. Natl. Acad. Sci. USA,
97:5784-5789); removal of the ribozyme(s) results in the RNA
including single-stranded RNA that binds to the transcript of at
least one target gene.
[0023] The RNA resulting from processing of the DNA includes at
least single-stranded RNA that binds to the transcript of at least
one target gene. In one embodiment, the RNA resulting from
processing of the DNA consists of one single-stranded RNA molecule
that binds to the transcript of one target gene. In another
embodiment, the RNA resulting from processing of the DNA consists
of one single-stranded RNA molecule that binds to the transcripts
of multiple target genes. In another embodiment, the RNA resulting
from processing of the DNA consists of multiple molecules of
single-stranded RNA that bind to the transcript of at least one
target gene; this can result, e.g., from processing of a primary
RNA transcript having multiple segments, each including
single-stranded RNA that binds to the transcript of at least one
target gene, for example, where the multiple segments (which can
have the same or different sequence) are separated by self-cleaving
ribozymes and cleavage of the ribozymes yields the multiple
single-stranded RNAs. In another embodiment, the RNA resulting from
processing of the DNA includes single-stranded RNA that binds to
the transcript of at least one target gene, as well as additional
RNA elements (which may be single-stranded or double-stranded or
both), such as, but not limited to, an RNA aptamer, an RNA
riboswitch, a ribozyme, site-specific recombinase recognition
sites, or an RNA sequence that serves to regulate transcription of
the single-stranded RNA that binds to the transcript of at least
one target gene.
[0024] In various embodiments, the at least one target gene
includes: coding sequence, non-coding sequence, or both coding and
non-coding sequences; a single target gene or multiple target genes
(for example, multiple alleles of a target gene, or multiple
different target genes); or one or more of (a) an endogenous gene
of a eukaryote, (b) a transgene of a transgenic plant, (c) an
endogenous gene of a pest or pathogen of a plant, and (d) an
endogenous gene of a prokaryotic or eukaryotic symbiont associated
with a pest or pathogen of a plant. Target genes that can be
regulated by a recombinant DNA construct of this invention are
described in detail below under the heading "Target Genes".
[0025] The single-stranded RNA binds to the transcript of at least
one target gene to form a hybridized segment of at least partially
(in some cases perfectly) double-stranded RNA. In some embodiments
the percent complementarity between the single-stranded RNA and the
transcript of at least one target gene is 100%. However, it is
clear that Watson-Crick base-pairing need not be complete between
the single-stranded RNA and the transcript of at least one target
gene, but is at least sufficient so that under physiological
conditions a stably hybridized segment of at least partially
double-stranded RNA is formed between the two.
[0026] The hybridized segment of double-stranded RNA imparts to the
transcript resistance to cleavage by an RNase III ribonuclease (for
example, Drosha or Dicer or Dicer-like proteins, including, but not
limited to, DCL1, DCL2, DCL3, DCL4, DCL1-like, DCL2-like,
DCL3-like, or DCL4-like proteins) within or in the vicinity of the
hybridized segment. In many instances, the resistance imparted is
resistance to cleavage by an RNase III ribonuclease within the
hybridized segment. For example, where the single-stranded RNA
binds to the transcript of at least one target gene at a miRNA
recognition site in the transcript recognized and bound by an
endogenous miRNA, such that the hybridized segment encompasses the
miRNA recognition site, the hybridized segment of double-stranded
RNA imparts to the transcript resistance to cleavage by an RNase
III ribonuclease at the miRNA recognition site (i.e., within the
hybridized segment). In other instances, the resistance imparted is
resistance to cleavage by an RNase III ribonuclease in the vicinity
of the hybridized segment. For example, where the single-stranded
RNA binds to the transcript of at least one target gene immediately
or closely adjacent to a miRNA recognition site in the transcript
recognized and bound by an endogenous miRNA, such that the
hybridized segment does not encompass the miRNA recognition site
but is sufficiently close to prevent binding by the endogenous
miRNA to the transcript, the hybridized segment of double-stranded
RNA imparts to the transcript resistance to cleavage by an RNase
III ribonuclease at the miRNA recognition site (i.e., in the
vicinity of, but not within, the hybridized segment).
[0027] The length of the single-stranded RNA is not necessarily
equal to the length of the hybridized segment, since not all of the
single-stranded RNA necessarily binds to the transcript of at least
one target gene. In some embodiments, the length of the
single-stranded RNA is about equal to, or exactly equal to, the
length of the hybridized segment. In other embodiments, the length
of the single-stranded RNA is greater than the length of the
hybridized segment. Expressed in terms of numbers of contiguous
nucleotides, the length of the single-stranded RNA is generally
from between about 10 nucleotides to about 500 nucleotides, or from
between about 20 nucleotides to about 500 nucleotides, or from
between about 20 nucleotides to about 100 nucleotides, for example,
about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, about 30, about 35, about 40, about 45, about
50, about 60, about 70, about 80, about 90, about 100, about 120,
about 140, about 160, about 180, about 200, about 240, about 280,
about 320, about 360, about 400, or about 500 nucleotides.
Expressed in terms of numbers of contiguous nucleotides (and
recognizing that the hybridized segment can include nucleotides
that are not base-paired), the length of the hybridized segment is
generally from between about 10 nucleotides to about 100
nucleotides, or from between about 10 nucleotides to about 24
nucleotides, or from between about 20 nucleotides to about 100
nucleotides, or from between about 26 nucleotides to about 100
nucleotides, although it can be greater than about 100 nucleotides,
and in some preferred embodiments it is preferably smaller than 100
nucleotides (such as in some embodiments of translational
inhibitors, described below under the heading "Translational
Inhibitors"). In preferred embodiments, the length of the
hybridized segment is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, about 30, about 35, about
40, about 45, about 50, about 60, about 70, about 80, about 90, or
about 100 nucleotides. In one particularly preferred embodiment,
the length of the hybridized segment is between about 10 to about
24 nucleotides, e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, or 24 nucleotides.
[0028] In many embodiments, the recombinant DNA construct of this
invention includes other DNA elements in addition to the DNA that
undergoes processing to an RNA including single-stranded RNA that
binds to the transcript of at least one target gene to form a
hybridized segment of at least partially double-stranded RNA that
imparts to the transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of the hybridized segment.
These additional DNA elements include at least one element selected
from the group consisting of: [0029] (a) a promoter functional in a
eukaryotic (plant, animal, fungus, or protist) cell, such as any of
the promoters described under the heading "Promoters"; [0030] (b) a
Pol III promoter (see "Promoters", below) operably linked to the
DNA that undergoes processing to an RNA including single-stranded
RNA; [0031] (c) DNA that is processed to an RNA aptamer (as
described under the heading "Aptamers") [0032] (d) a transgene
transcription unit (as described under the heading "Transgene
Transcription Units"); [0033] (e) DNA encoding a spliceable intron
(as described under the heading "Introns"); [0034] (f) DNA encoding
a self-splicing ribozyme (as described under the heading
"Ribozymes"); [0035] (g) DNA encoding a site-specific recombinase
recognition site (as described under the heading "Recombinases");
[0036] (h) DNA encoding a gene suppression element (as described
under the heading "Gene Suppression Elements"); and [0037] (i) DNA
encoding a transcription regulatory element (as described under the
heading "Transcription Regulatory Elements").
[0038] The recombinant DNA construct of this invention is
particularly useful for providing an RNA that functions as a
"cleavage blocker" or a "translational inhibitor", according to the
RNA's interaction with the transcript of the target gene(s).
Cleavage blockers and translational inhibitors are described in
more detail below.
Cleavage Blockers
[0039] One aspect of this invention is a recombinant DNA construct
including DNA that undergoes processing to an RNA including
single-stranded RNA that binds to the transcript of at least one
target gene to form a hybridized segment of at least partially
double-stranded RNA that imparts to the transcript resistance to
cleavage by an RNase III ribonuclease within or in the vicinity of
the hybridized segment, wherein the binding of the single-stranded
RNA to the transcript (and the resultant formation of the
hybridized segment) inhibits double-stranded RNA-mediated
suppression of the at least one target gene. In this context, the
term "cleavage blocker" generally refers to the RNA including
single-stranded RNA that binds to the transcript of at least one
target gene, and more specifically refers to the portion(s) of the
single-stranded RNA that forms a hybridized segment of at least
partially double-stranded RNA with the transcript. Cleavage
blockers inhibit double-stranded RNA-mediated suppression of the at
least one target gene, thereby increasing expression of the target
gene (relative to expression in the absence of the cleavage
blocker).
[0040] Generally, the cleavage by an RNase III ribonuclease is
mediated by binding of a small RNA (most preferably a small RNA
that is associated with a silencing complex) to the transcript. In
preferred embodiments, the small RNA is selected from the group
consisting of a miRNA, an siRNA, a trans-acting siRNA, a phased
small RNA, a natural antisense transcript siRNA, and a natural
antisense transcript miRNA; however, the small RNA can be any small
RNA associated with a silencing complex such as RISC or an
Argonaute or Argonaute-like protein. In some embodiments, the small
RNA is an endogenous small RNA (e.g., an endogenous miRNA); in
other embodiments, the small RNA is a transgenic small RNA (e.g., a
transgenically expressed engineered miRNA).
[0041] In various embodiments, the length of the hybridized segment
includes between about 10 base pairs to about 100 base pairs,
although it can be greater than about 100 base pairs. In preferred
embodiments (and recognizing that the hybridized segment can
include nucleotides that are not base-paired), the length of the
hybridized segment includes between about 10 base pairs to about
100 base pairs, such as from between about 10 to about 20, or
between about 10 to about 24, or between about 10 to about 30, or
between about 10 to about 40, or between about 10 to about 50, or
between about 18 to about 28, or between about 18 to about 25, or
between about 18 to about 24, or between about 20 to about 30, or
between about 20 to about 40, or between about 20 to about 50 base
pairs. In preferred embodiments, the length of the hybridized
segment is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, about 30, about 34, about 40, about
45, about 50, about 60, about 70, about 80, about 90, or about 100
base pairs, wherein the hybridized segment optionally includes
additional nucleotides that are not base-paired and that are not
counted in the length of the hybridized segment when this is
expressed in terms of base pairs. In particularly preferred
embodiments, the length of the hybridized segment is between about
18 to about 28 base pairs (that is, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, or 28 base pairs), or between about 10 to about 24 base
pairs (that is, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, or 24 base pairs), or between about 18 to about 24 base pairs
(that is, 18, 19, 20, 21, 22, 23, or 24 base pairs) wherein the
hybridized segment optionally includes additional nucleotides that
are not base-paired and that are not counted in the length of the
hybridized segment when this is expressed in terms of base pairs.
One of skill in the art is able to determine what number of
unpaired nucleotides is acceptable for a given hybridized segment,
i.e., that will still allow formation hybridized segment that is
stable under physiological conditions and is resistant to RNase III
ribonuclease cleavage.
[0042] In some instances, the hybridized segment is completely
base-paired, that is, contains a contiguous ribonucleotide sequence
that is the same length as, and is perfectly complementary to, a
contiguous ribonucleotide sequence of the target gene transcript.
In particularly preferred embodiments, however, the hybridized
segment is not completely base-paired, and includes at least one
mismatch or at least one insertion in the hybridized segment at a
position that results in inhibiting cleavage of the transcript by
the RNase III ribonuclease.
[0043] One aspect of this invention provides a "miRNA cleavage
blocker". One preferred embodiment is a recombinant DNA construct
including DNA that undergoes processing to an RNA including
single-stranded RNA that binds to the transcript of at least one
target gene to form a hybridized segment of at least partially
double-stranded RNA that imparts to the transcript resistance to
cleavage by an RNase III ribonuclease within or in the vicinity of
the hybridized segment, wherein the binding of the single-stranded
RNA to the transcript (and the resultant formation of the
hybridized segment) inhibits double-stranded RNA-mediated
suppression of the at least one target gene, wherein the cleavage
by an RNase III ribonuclease is mediated by binding of a mature
miRNA, the binding is at a miRNA recognition site (that is
recognized by the mature miRNA) in the transcript, the cleavage of
the transcript occurs at the miRNA recognition site, and the
hybridized segment is formed at least partially within the miRNA
recognition site. In this embodiment, the recombinant DNA construct
yields a miRNA cleavage blocker RNA that binds to (or in the
vicinity of) a miRNA recognition site in a target gene transcript,
forming a hybridized segment that is itself resistant to RNase III
ribonuclease cleavage (or that prevents RNase III ribonuclease
cleavage of the transcript in the vicinity of the hybridized
segment), thus preventing the mature miRNA that normally recognizes
the miRNA recognition site from binding to the miRNA recognition
site and mediating RNase III ribonuclease cleavage of the target
gene transcript. In particularly preferred embodiments, the
hybridized segment includes: (a) at least one mismatch between the
single-stranded RNA and the miRNA recognition site at positions of
the miRNA recognition site corresponding to positions 9, 10, or 11
(in 3' to 5' direction) of the mature miRNA, or (b) at least one
insertion at a position in the single-stranded RNA at positions of
the miRNA recognition site corresponding to positions 10 or 11 (in
3' to 5' direction) of the mature miRNA. In some preferred
embodiments, the single-stranded RNA that binds to the transcript
of at least one target gene has a nucleotide sequence to allow a
stably hybridized segment to be formed between it and the target
gene transcript, but that inhibits binding of an Argonaute or
Argonaute-like protein to the hybridized segment, as described by
Mi et al. (2008) Cell, 133:1-12; for example, the single-stranded
RNA has a nucleotide sequence that includes an A, G, or C (but not
a U) at a position corresponding to the 5' terminus of the mature
miRNA that natively binds to the recognition site. Most preferably,
the binding of a miRNA cleavage blocker to the target gene
transcript results in inhibition of miRNA-mediated suppression of
the at least one target gene, thereby increasing expression of the
target gene (relative to expression in the absence of the miRNA
cleavage blocker).
[0044] Another aspect of this invention includes a "5'-modified
cleavage blocker". A preferred embodiment includes a recombinant
DNA construct including DNA that undergoes processing to an RNA
including single-stranded RNA that binds to the transcript of at
least one target gene to form a hybridized segment of at least
partially double-stranded RNA that imparts to the transcript
resistance to cleavage by an RNase III ribonuclease within or in
the vicinity of the hybridized segment, wherein the binding of the
single-stranded RNA to the transcript (and the resultant formation
of the hybridized segment) inhibits double-stranded RNA-mediated
suppression of the at least one target gene, wherein the cleavage
by an RNase III ribonuclease is mediated by binding of a mature
miRNA, the binding is at a miRNA recognition site (that is
recognized by the mature miRNA) in the transcript, the cleavage of
the transcript occurs at the miRNA recognition site, and the
hybridized segment is formed at least partially within the miRNA
recognition site, and the hybridized segment includes an A, G, or C
(but not a U) at a position corresponding to the 5' terminus of the
mature miRNA that natively binds to the recognition site, but does
not include mismatches between the single-stranded RNA and the
miRNA recognition site at positions of the miRNA recognition site
corresponding to positions 9, 10, or 11 (in 3' to 5' direction) of
the mature miRNA, or insertions at a position in the
single-stranded RNA at positions of the miRNA recognition site
corresponding to positions 10 or 11 (in 3' to 5' direction) of the
mature miRNA. Binding of such a 5'-modified cleavage blocker to the
target gene transcript results in inhibition of miRNA-mediated
suppression of the at least one target gene, thereby increasing
expression of the target gene (relative to expression in the
absence of the cleavage blocker).
[0045] One of ordinary skill in the art easily recognizes that
various aspects of this invention include analogous recombinant DNA
constructs that are processed to provide RNA including
single-stranded RNA that serve as an "siRNA cleavage blocker", a
"trans-acting siRNA cleavage blocker", a "phased small RNA cleavage
blocker", a "natural antisense transcript siRNA cleavage blocker",
or a "natural antisense transcript miRNA cleavage blocker" (or, in
general terms, a "small RNA cleavage blocker"), according to
whether the RNase III ribonuclease cleavage that is inhibited is
mediated by, respectively, an siRNA, a trans-acting siRNA, a phased
small RNA, a natural antisense transcript siRNA, or a natural
antisense transcript miRNA (or, in general terms, any small RNA
associated with a silencing complex such as RISC or an Argonaute or
Argonaute-like protein). In these cases, the formation of the RNase
III ribonuclease cleavage-resistant hybridized segment generally
prevents the respective small RNA from binding to the target gene
transcript and mediating RNase III ribonuclease cleavage of the
transcript. Most preferably, the binding of such a small RNA
cleavage blocker to the target gene transcript results in
inhibition of double-stranded RNA-mediated suppression of the at
least one target gene, thereby increasing expression of the target
gene (relative to expression in the absence of the small RNA
cleavage blocker). One of ordinary skill in the art is able to
devise a nucleotide sequence for such an RNA including
single-stranded RNA that, upon binding to the transcript of at
least one target gene, forms a hybridized segment that is stable
under physiological conditions and is resistant to RNase III
ribonuclease cleavage, for example, (1) by selecting a nucleotide
sequence that inhibits binding of an Argonaute or Argonaute-like
protein to the hybridized segment, as described by Mi et al. (2008)
Cell, doi:10.1016/j.cell.2008.02.034; (2) by selecting a nucleotide
sequence such that the difference in free energy
(".DELTA..DELTA.G", see Khvorova et al. (2003) Cell, 115, 209-216)
between the portions of the single-stranded RNA and the target gene
transcript that form the hybridized segment inhibit association
with a silencing complex such as RISC or an Argonaute or
Argonaute-like protein; or (3) by selecting a nucleotide sequence
such that mismatches or insertions at a potential small
RNA-mediated RNase III ribonuclease cleavage site prevents cleavage
of the transcript. Knowledge of the target gene itself is not
required, merely the sequence of the mature miRNA sequence or of a
miRNA precursor that is processed to the mature miRNA--or,
alternatively, knowledge of the miRNA recognition site sequence--in
combination with the teachings of this application, in order to
identify or design a cleavage blocker (or 5'-modified cleavage
blocker) for inhibiting the target gene silencing effects of a
given miRNA.
[0046] One approach to manipulating a miRNA-regulated pathway has
been disclosed (see co-assigned U.S. patent application Ser. No.
11/974,469, published as U.S. Patent Application Publication
2009-0070898 A1, which disclosure including rules for predicting or
designing a miRNA decoy sequence is specifically incorporated by
reference herein) as a novel miRNA "decoy", a sequence that can be
recognized and bound by an endogenous mature miRNA resulting in
base-pairing between the miRNA decoy sequence and the endogenous
mature miRNA, thereby forming a stable RNA duplex that is not
cleaved because of the presence of mismatches between the miRNA
decoy sequence and the mature miRNA.
[0047] The Examples of this application specifically identify miRNA
targets recognized by particular miRNAs. Provided with this
information and Applicants' teachings, one of ordinary skill in the
art would be able to design and use various additional embodiments
of this invention, including a recombinant DNA construct
transcribable in a plant cell, including a promoter that is
functional in the plant cell and operably linked to at least one
polynucleotide selected from: (a) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target; (b) DNA encoding a
5'-modified cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of at least one miRNA
target; (c) DNA encoding a translational inhibitor to prevent or
decrease small RNA-mediated cleavage of the transcript of at least
one miRNA target; (d) DNA encoding a decoy to prevent or decrease
small RNA-mediated cleavage of the transcript of at least one miRNA
target; (e) DNA encoding a miRNA-unresponsive transgene having a
nucleotide sequence derived from the native nucleotide sequence of
at least one miRNA target, wherein a miRNA recognition site in the
native nucleotide sequence is deleted or otherwise modified to
prevent miRNA-mediated cleavage; (f) DNA encoding a miRNA precursor
which is processed into a miRNA for suppressing expression of at
least one miRNA target; (g) DNA encoding double-stranded RNA which
is processed into siRNAs for suppressing expression of at least one
miRNA target; and (h) DNA encoding a ta-siRNA which is processed
into siRNAs for suppressing expression of at least one miRNA
target.
Translational Inhibitors
[0048] Another aspect of this invention is a recombinant DNA
construct including DNA that undergoes processing to an RNA
including single-stranded RNA that binds to the transcript of at
least one target gene to form a hybridized segment of at least
partially double-stranded RNA that imparts to the transcript
resistance to cleavage by an RNase III ribonuclease within or in
the vicinity of the hybridized segment, wherein the binding of the
single-stranded RNA to the transcript (and the formation of the
hybridized segment) inhibits translation of the transcript. In this
context, the term "translational inhibitor" generally refers to the
RNA including single-stranded RNA that binds to the transcript of
at least one target gene, and more specifically refers to the
portion(s) of the single-stranded RNA that forms a hybridized
segment of at least partially double-stranded RNA with the
transcript. Translational inhibitors inhibit translation of the
transcript, thereby decreasing expression of the target gene
(relative to expression in the absence of expression of the
construct).
[0049] Binding of the translational inhibitor is to a location of
the mRNA that is wholly or at least partially within the coding
sequence or in a location such that the formation of the hybridized
segment interferes with translation. In one embodiment, the binding
of the single-stranded RNA to the transcript (and the formation of
the hybridized segment) occurs at least partially within the 5'
untranslated region of the transcript; this embodiment is often
preferred where the transcript is of a plant target gene. In
another embodiment, the binding of the single-stranded RNA to the
transcript (and the formation of the hybridized segment) occurs at
least partially within the 3' untranslated region of the
transcript; this embodiment is preferred where the transcript is of
an animal target gene. In yet another embodiment, the binding of
the single-stranded RNA to the transcript occurs within or in the
vicinity of the start codon or of the 5' cap, preferably preventing
translation initiation.
[0050] In preferred embodiments, the hybridized segment is
resistant to cleavage by the RNase III ribonuclease. In preferred
embodiments, the length of the hybridized segment includes between
about 10 base pairs to about 50 base pairs, although it can be
greater than about 50 base pairs. In preferred embodiments (and
recognizing that the hybridized segment can include nucleotides
that are not base-paired), the length of the hybridized segment
includes between about 10 base pairs to about 50 base pairs, such
as from between about 10 to about 20, or between about 10 to about
30, or between about 10 to about 40, or between about 10 to about
50, or between about 18 to about 28, or between about 18 to about
25, or between about 18 to about 23, or between about 20 to about
30, or between about 20 to about 40, or between about 20 to about
50 base pairs. In preferred embodiments, the length of the
hybridized segment is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, about 30, about 34, about
40, about 45, or about 50 base pairs, wherein the hybridized
segment optionally includes additional nucleotides that are not
base-paired and that are not counted in the length of the
hybridized segment when this is expressed in terms of base pairs.
In particularly preferred embodiments, the length of the hybridized
segment is between about 18 to about 28 base pairs, that is, 18,
19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 base pairs, wherein the
hybridized segment optionally includes additional nucleotides that
are not base-paired and that are not counted in the length of the
hybridized segment when this is expressed in terms of base pairs.
One of skill in the art is able to determine what number of
unpaired nucleotides is acceptable for a given hybridized segment,
i.e., that will still allow formation hybridized segment that is
stable under physiological conditions and is resistant to RNase III
ribonuclease cleavage.
[0051] One of ordinary skill in the art is able to devise a
nucleotide sequence for such an RNA including single-stranded RNA
that, upon binding to the transcript of at least one target gene,
forms a hybridized segment that is stable under physiological
conditions and is resistant to RNase III ribonuclease cleavage, for
example, (1) by selecting a nucleotide sequence that inhibits
binding of an Argonaute or Argonaute-like protein to the hybridized
segment, as described by Mi et al. (2008) Cell,
doi:10.1016/j.cell.2008.02.034; (2) by selecting a nucleotide
sequence such that the difference in free energy
(".DELTA..DELTA.G", see Khvorova et al. (2003) Cell, 115, 209-216)
between the portions of the single-stranded RNA and the target gene
transcript that form the hybridized segment inhibit association
with a silencing complex such as RISC or an Argonaute or
Argonaute-like protein; or (3) by selecting a nucleotide sequence
such that mismatches or insertions at a potential small
RNA-mediated RNase III ribonuclease cleavage site prevents cleavage
of the transcript. In a particularly preferred embodiment, the
length of the hybridized segment includes between about 19 to about
50 base pairs, the hybridized segment includes smaller segments of
9 or fewer contiguous, perfectly complementary base pairs, and at
least one mismatch or insertion is between each pair of the smaller
segments.
Methods of Modulating Expression of a Target Gene
[0052] In another aspect, this invention provides a method of
modulating expression of a target gene, including expressing in a
cell a recombinant DNA construct of this invention, that is, a
recombinant DNA construct including DNA that undergoes processing
to an RNA including single-stranded RNA that binds to the
transcript of at least one target gene to form a hybridized segment
of at least partially double-stranded RNA that imparts to the
transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of the hybridized segment. Expressing in
vivo in a cell a recombinant DNA construct of this invention
provides an RNA that functions as a "cleavage blocker" or a
"translational inhibitor".
[0053] By "modulating expression of a target gene" is meant either:
(a) increasing expression of the target gene, e.g., where the
recombinant DNA construct expressed in the cell provides a cleavage
blocker, or (b) decreasing expression of the target gene, e.g.,
where the recombinant DNA construct expressed in the cell provides
a translational inhibitor. By "expressing in a cell" is meant
carrying out in vivo the process of transcription, as well as any
additional natural processing steps necessary to provide the RNA
including single-stranded RNA that binds to the transcript of at
least one target gene.
[0054] The cell in which the recombinant DNA construct is expressed
is in many embodiments a eukaryotic cell (such as a plant, animal,
fungus, or protist cell), and in other embodiments is a prokaryotic
cell (such as a bacterial cell). The target gene that has its
expression modulated by the method of this invention is not
necessarily an endogenous gene of the cell in which the recombinant
DNA construct is expressed. For example, this invention encompasses
a method including expressing in cells of a plant a recombinant DNA
construct including DNA that undergoes processing to an RNA
including single-stranded RNA that binds to the transcript of at
least one target gene of a pest or pathogen of the plant to form a
hybridized segment of at least partially double-stranded RNA that
imparts to the transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of the hybridized segment,
thereby either (a) increasing expression of the target gene of the
pest or pathogen, when the recombinant DNA construct provides a
cleavage blocker, or (b) decreasing expression of the target gene
of the pest or pathogen, when the recombinant DNA construct
provides a translational inhibitor. Where the target gene is not an
endogenous gene of the cell wherein the recombinant DNA construct
is transcribed (such as in cells of a plant), additional processing
steps may occur either in the cell where transcription occurred, or
in other cells (such as in cells of a pest or pathogen of the
plant).
[0055] In one embodiment of the method, the recombinant DNA
construct is expressed in a cell to provide a cleavage blocker RNA.
In this embodiment, the binding of the single-stranded RNA to the
transcript (and the formation of the hybridized segment) inhibits
double-stranded RNA-mediated suppression of the at least one target
gene, thereby increasing expression of the target gene, relative to
expression in the absence of expression of the construct.
[0056] In one embodiment of the method, the recombinant DNA
construct is expressed in a cell to provide a translational blocker
RNA. In this embodiment, the binding of the single-stranded RNA to
the transcript (and the formation of the hybridized segment)
inhibits translation of the transcript, thereby decreasing
expression of the target gene, relative to expression in the
absence of expression of the construct.
[0057] MicroRNAs (miRNAs) are believed to generally regulate gene
expression post-transcriptionally in plants by directing
sequence-specific cleavage of messenger RNAs ("mRNAs"). One aspect
of this invention is a method to control the rate of
post-transcriptional suppression of a plant gene that transcribes
to a mRNA containing a miRNA recognition site that is normally
recognized and bound by a specific miRNA in complex with Argonaute
(Ago), followed by cleavage of the resulting miRNA/mRNA hybridized
segment by an RNase III ribonuclease such as a Dicer-like
ribonuclease. This method uses a "cleavage blocker" construct to
transgenically express in planta an RNA including single-stranded
RNA that binds to the mRNA transcript of the target gene to form a
hybridized segment of at least partially double-stranded RNA that
imparts to the transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of the hybridized segment,
wherein the binding of the single-stranded RNA to the transcript
(and the resultant formation of the hybridized segment) inhibits
double-stranded RNA-mediated suppression of the at least one target
gene. The "cleavage blocker" RNA generally competes with endogenous
mature miRNAs, for binding with an mRNA that is normally regulated
by that miRNA; the cleavage blocker protects the mRNA from cleavage
by the miRNA-Ago complex by binding to the miRNA target site on the
mRNA to form a non-cleavable hybridized segment. Thus, a cleavage
blocker protects the target mRNA's cleavage site (miRNA recognition
site) from being cleaved by miRNA and prevents down-regulation of
that particular target gene. Preferably, a cleavage blocker
increases expression of the target gene (relative to its expression
in the absence of the cleavage blocker). This method allows for
regulation of gene expression in a specific manner and is a useful
alternative to upregulating the level of a gene's transcript or its
encoded protein by over-expression of the gene.
[0058] One aspect of this invention is a method for providing a
cleavage blocker by generating the cleavage blocker single-stranded
RNA in planta from a "cleavage blocker construct" based on a
recombinant miRNA-precursor-like sequence. A miRNA-precursor-like
sequence is created by placing the cleavage blocker sequence in the
backbone of a miRNA primary transcript, while maintaining the
predicted secondary structure in the transcript's fold-back in such
a way that resulting transcript is processed by Dicer-like
ribonucleases to single-stranded RNA, which is then able to
associate with the miRNA recognition site on the target mRNA and
prevent the mRNA from being cleaved by a mature miRNA. The cleavage
blocker sequence is selected such that, upon hybridization of the
cleavage blocker to the target mRNA, a hybridized segment is formed
that includes: (a) at least one mismatch between the
single-stranded RNA and the miRNA recognition site at positions of
the miRNA recognition site corresponding to positions 9, 10, or 11
of the mature miRNA, or (b) at least one insertion at a position in
the single-stranded RNA at positions of the miRNA recognition site
corresponding to positions 10-11 of the mature miRNA. In especially
preferred embodiments, the single-stranded RNA that binds to the
transcript of at least one target gene has a nucleotide sequence to
allow a stably hybridized segment to be formed between it and the
target gene transcript, but that inhibits binding of an Argonaute
or Argonaute-like protein to the hybridized segment, as described
by Mi et al. (2008) Cell, doi:10.1016/j.cell.2008.02.034; for
example, the single-stranded RNA has a nucleotide sequence that
includes an A, G, or C (but not a U) at a position corresponding to
the 5' terminus of the mature miRNA that natively binds to the
recognition site. For cleavage blockers expressed in transgenic
plants, there is in many embodiments preferably also a mismatch
between the single-stranded RNA and the miRNA recognition site at
the position of the miRNA recognition site corresponding to
positions 1 of the mature miRNA to prevent transitivity of the
suppression effect.
[0059] An alternative method for generating a cleavage blocker in
vivo or in planta is to express short single-stranded RNA from a
strong promoter such as Pol II or Pol III promoters. This
single-stranded RNA preferably includes sequence that is
complimentary to the mRNA only at the miRNA recognition site.
Because producing a cleavage blocker using this method does not
require the association of the RNA with an Argonaute or Ago
protein, mismatches at positions 10 and 11 are not required.
Target Genes
[0060] The recombinant DNA construct of this invention can be
designed to modulate the expression of any target gene or genes.
The target gene can be translatable (coding) sequence, or can be
non-coding sequence (such as non-coding regulatory sequence), or
both, and can include at least one gene selected from the group
consisting of a eukaryotic target gene, a non-eukaryotic target
gene, a microRNA precursor DNA sequence, and a microRNA promoter.
The target gene can be native (endogenous) to the cell (e.g., a
cell of a plant or animal) in which the recombinant DNA construct
is transcribed, or can be native to a pest or pathogen (or a
symbiont of the pest or pathogen) of the plant or animal in which
the recombinant DNA construct is transcribed. The target gene can
be an exogenous gene, such as a transgene in a plant. A target gene
can be a native gene targetted for suppression, with or without
concurrent expression of an exogenous transgene, for example, by
including a gene expression element in the recombinant DNA
construct, or in a separate recombinant DNA construct. For example,
it can be desirable to replace a native gene with an exogenous
transgene homologue.
[0061] The target gene can include a single gene or part of a
single gene that is targetted for suppression, or can include, for
example, multiple consecutive segments of a target gene, multiple
non-consecutive segments of a target gene, multiple alleles of a
target gene, or multiple target genes from one or more species. A
target gene can include any sequence from any species (including,
but not limited to, non-eukaryotes such as bacteria, and viruses;
fungi; plants, including monocots and dicots, such as crop plants,
ornamental plants, and non-domesticated or wild plants;
invertebrates such as arthropods, annelids, nematodes, and
molluscs; and vertebrates such as amphibians, fish, birds, domestic
or wild mammals, and even humans.
[0062] In one embodiment, the target gene is exogenous to the plant
in which the recombinant DNA construct is to be transcribed, but
endogenous to a pest or pathogen (e.g., viruses, bacteria, fungi,
oomycetes, and invertebrates such as insects, nematodes, and
molluscs), or to a symbiont of the pest or pathogen, of the plant.
The target gene can include multiple target genes, or multiple
segments of one or more genes. In one embodiment, the target gene
or genes is a gene or genes of an invertebrate pest or pathogen of
the plant. Thus, a recombinant DNA construct of this invention can
be transcribed in a plant and used to modulate the expression of a
gene of a pathogen or pest that may infest the plant. These
embodiments are particularly useful in providing non-natural
transgenic plants having resistance to one or more plant pests or
pathogens, for example, resistance to a nematode such as soybean
cyst nematode or root knot nematode or to a pest insect.
[0063] Where the target gene is that of an invertebrate pest, the
invertebrate pest is at least one or more invertebrate selected
from the group consisting of insects, arachnids (e.g., mites),
nematodes, molluscs (e.g., slugs and snails), and annelids, and can
include an invertebrate associated with an invertebrate pest in a
symbiotic relationship (e.g., the mutualistic relationship between
some ant and aphid species). The term "symbiotic" relationship as
used herein encompasses both facultative (non-obligate) and
obligate symbioses wherein at least one of the two or more
associated species benefits, and further includes mutualistic,
commensal, and parasitic relationships. Symbionts also include
non-invertebrate symbionts, such as prokaryotes and eukaryotic
protists. An invertebrate pest can be controlled indirectly by
targetting a symbiont that is associated, internally or externally,
with the invertebrate pest. For example, prokaryotic symbionts are
known to occur in the gut or other tissues of many invertebrates,
including invertebrate pests of interest. examples of a targetted
symbiont associated with an invertebrate pest include the aphid
endosymbiotic bacteria Buchnera; Wolbachia bacteria that infect
many insects; Baumannia cicadellinicola and Sulcia muelleri, the
co-symbiotic bacteria of the glassy-winged sharpshooter
(Homalodisca coagulata), which transmits the Pierce's disease
pathogen Xylella fastidiosa; and eukaryotic protist (flagellate)
endosymbionts in termites. In an alternative approach, expression
of an endogenous target gene of the invertebrate pest can be
modified in such a way as to control a symbiont of the
invertebrate, in turn affecting the host invertebrate.
[0064] The target gene can be translatable (coding) sequence, or
can be non-coding sequence (such as non-coding regulatory
sequence), or both. examples of a target gene include
non-translatable (non-coding) sequence, such as, but not limited
to, 5' untranslated regions, promoters, enhancers, or other
non-coding transcriptional regions, 3' untranslated regions,
terminators, and introns. Target genes include genes encoding
microRNAs, small interfering RNAs, and other small RNAs associated
with a silencing complex (RISC) or an Argonaute protein; RNA
components of ribosomes or ribozymes; small nucleolar RNAs; and
other non-coding RNAs. Target genes can also include genes encoding
transcription factors and genes encoding enzymes involved in the
biosynthesis or catabolism of molecules of interest (such as, but
not limited to, amino acids, fatty acids and other lipids, sugars
and other carbohydrates, biological polymers, and secondary
metabolites including alkaloids, terpenoids, polyketides,
non-ribosomal peptides, and secondary metabolites of mixed
biosynthetic origin).
[0065] In many embodiments, the target gene is an essential gene of
a plant pest or pathogen (or of a symbiont of the pest or
pathogen). Essential genes include genes that are required for
development of the pest or pathogen to a fertile reproductive
adult. Essential genes include genes that, when silenced or
suppressed, result in the death of the organism (as an adult or at
any developmental stage, including gametes) or in the organism's
inability to successfully reproduce (e.g., sterility in a male or
female parent or lethality to the zygote, embryo, or larva). A
description of nematode essential genes is found, e.g., in
Kemphues, K. "Essential Genes" (Dec. 24, 2005), WormBook, ed. The
C. elegans Research Community, WormBook,
doi/10.1895/wormbook.1.57.1, available on line at www.wormbook.org.
A description of insect genes is publicly available at the
Drosophila genome database (available on line at
flybase.bio.indiana.edu/), and 438 essential genes have been
identified for Drosophila as a representative insect; see Boutros
et al. (2004) Science, 303:832-835, and supporting material
available on line at
www.sciencemag.org/cgi/content/full/303/5659/832/DC1. A description
of bacterial and fungal essential genes is provided in the Database
of Essential Genes ("DEG", available on line at
tubic.tju.edu.cn/deg/). Essential genes include those that
influence other genes, where the overall effect is the death of the
invertebrate pest or loss of the invertebrate pest's inability to
successfully reproduce. In an example, suppression of the
Drosophila homeobox gene Caudal leads eventually to host mortality
caused by disequilibrium of the insect's commensal gut bacterial
population (Ryu et al. (2008) Science, 319:777-782) and thus Caudal
as well as the antimicrobial peptide genes directly controlled by
Caudal are both considered essential genes.
[0066] Plant pest invertebrates include, but are not limited to,
pest nematodes, pest molluscs (slugs and snails), pest annelids,
and pest insects. Plant pathogens of interest include fungi,
oomycetes, bacteria (e.g., the bacteria that cause leaf spotting,
fireblight, crown gall, and bacterial wilt), mollicutes, and
viruses (e.g., the viruses that cause mosaics, vein banding,
flecking, spotting, or abnormal growth). See also G. N. Agrios,
"Plant Pathology" (Fourth Edition), Academic Press, San Diego,
1997, 635 pp., for descriptions of fungi, bacteria, mollicutes
(including mycoplasmas and spiroplasmas), viruses, nematodes,
parasitic higher plants, and flagellate protozoans, all of which
are plant pests or pathogens of interest. See also the updated
compilation of plant pests and pathogens and the diseases caused by
such on the American Phytopathological Society's "Common Names of
Plant Diseases", available online at
www.apsnet.org/online/common/top.asp.
[0067] Examples of fungal plant pathogens of particular interest
include, e.g., the fungi that cause powdery mildew, rust, leaf spot
and blight, damping-off, root rot, crown rot, cotton boll rot, stem
canker, twig canker, vascular wilt, smut, or mold, including, but
not limited to, Fusarium spp., Phakospora spp., Rhizoctonia spp.,
Aspergillus spp., Gibberella spp., Pyricularia spp., and Alternaria
spp., and the numerous fungal species provided in Tables 4 and 5 of
U.S. Pat. No. 6,194,636, which is specifically incorporated in its
entirety by reference herein. examples of plant pathogens include
pathogens previously classified as fungi but more recently
classified as oomycetes. Specific examples of oomycete plant
pathogens of particular interest include members of the genus
Pythium (e.g., Pythium aphanidermatum) and Phytophthora (e.g.,
Phytophthora infestans, Phytophthora sojae,) and organisms that
cause downy mildew (e.g., Peronospora farinosa).
[0068] Examples of invertebrate pests include cyst nematodes
Heterodera spp. especially soybean cyst nematode Heterodera
glycines, root knot nematodes Meloidogyne spp., corn rootworms
(Diabrotica spp.), Lygus spp., aphids and similar sap-sucking
insects such as phylloxera (Daktulosphaira vitifoliae), corn
borers, cutworms, armyworms, leafhoppers, Japanese beetles,
grasshoppers, and other pest coleopterans, dipterans, and
lepidopterans.
[0069] Specific examples of suitable target genes also include
genes involved in amino acid or fatty acid synthesis, storage, or
catabolism, genes involved in multi-step biosynthesis pathways,
where it may be of interest to regulate the level of one or more
intermediate; and genes encoding cell-cycle control proteins.
Target genes can include genes encoding undesirable proteins (e.g.,
allergens or toxins) or the enzymes for the biosynthesis of
undesirable compounds (e.g., undesirable flavor or odor
components).
[0070] The recombinant DNA construct can be designed to be more
specifically modulate the expression of the target gene, for
example, by designing the recombinant DNA construct to include DNA
that undergoes processing to an RNA including single-stranded RNA
that binds to the target gene transcript, wherein the
single-stranded RNA includes a nucleotide sequence substantially
non-identical (or non-complementary) to a non-target gene sequence
(and is thus less likely to bind to a non-target gene transcript).
In one example, the recombinant DNA construct is designed to
suppress a target gene that is a gene endogenous to a single
species (e.g., Western corn rootworm, Diabrotica virgifera
virgifera LeConte) but to not suppress a non-target gene such as
genes from related, even closely related, species (e.g., Northern
corn rootworm, Diabrotica barberi Smith and Lawrence, or Southern
corn rootworm, Diabrotica undecimpunctata). In other embodiments,
the recombinant DNA construct is designed to modulate the
expression of a target gene sequence common to multiple species in
which the target gene is to be silenced. For example, a recombinant
DNA construct for modulating a target gene in corn rootworm can be
selected to be specific to all members of the genus Diabrotica. In
a further example of this embodiment, such a Diabrotica-targetted
recombinant DNA construct can be selected so as to not target any
gene sequence from beneficial insect species.
Promoters
[0071] Generally, the recombinant DNA construct of this invention
includes a promoter, functional in the cell in which the construct
is intended to be transcribed, and operably linked to the DNA that
undergoes processing to an RNA including single-stranded RNA that
binds to the transcript of at least one target gene. In various
embodiments, the promoter is selected from the group consisting of
a constitutive promoter, a spatially specific promoter, a
temporally specific promoter, a developmentally specific promoter,
and an inducible promoter.
[0072] Non-constitutive promoters suitable for use with the
recombinant DNA constructs of the invention include spatially
specific promoters, temporally specific promoters, and inducible
promoters. Spatially specific promoters can include organelle-,
cell-, tissue-, or organ-specific promoters (e.g., a
plastid-specific, a root-specific, a pollen-specific, or a
seed-specific promoter for suppressing expression of the first
target RNA in plastids, roots, pollen, or seeds, respectively). In
many cases a seed-specific, embryo-specific, aleurone-specific, or
endosperm-specific promoter is especially useful. Temporally
specific promoters can include promoters that tend to promote
expression during certain developmental stages in a plant's growth
cycle, or during different times of day or night, or at different
seasons in a year. Inducible promoters include promoters induced by
chemicals or by environmental conditions such as, but not limited
to, biotic or abiotic stress (e.g., water deficit or drought, heat,
cold, high or low nutrient or salt levels, high or low light
levels, or pest or pathogen infection). Of particular interest are
microRNA promoters, especially those having a temporally specific,
spatially specific, or inducible expression pattern; examples of
miRNA promoters, as well as methods for identifying miRNA promoters
having specific expression patterns, are provided in U.S. Patent
Application Publications 2006/0200878, 2007/0199095, and
2007/0300329, which are specifically incorporated herein by
reference. An expression-specific promoter can also include
promoters that are generally constitutively expressed but at
differing degrees or "strengths" of expression, including promoters
commonly regarded as "strong promoters" or as "weak promoters".
[0073] Promoters of particular interest include the following
examples: an opaline synthase promoter isolated from T-DNA of
Agrobacterium; a cauliflower mosaic virus 35S promoter; enhanced
promoter elements or chimeric promoter elements such as an enhanced
cauliflower mosaic virus (CaMV) 35S promoter linked to an enhancer
element (an intron from heat shock protein 70 of Zea mays); root
specific promoters such as those disclosed in U.S. Pat. Nos.
5,837,848; 6,437,217 and 6,426,446; a maize L3 oleosin promoter
disclosed in U.S. Pat. No. 6,433,252; a promoter for a plant
nuclear gene encoding a plastid-localized aldolase disclosed in
U.S. Patent Application Publication 2004/0216189; cold-inducible
promoters disclosed in U.S. Pat. No. 6,084,089; salt-inducible
promoters disclosed in U.S. Pat. No. 6,140,078; light-inducible
promoters disclosed in U.S. Pat. No. 6,294,714; pathogen-inducible
promoters disclosed in U.S. Pat. No. 6,252,138; and water
deficit-inducible promoters disclosed in U.S. Patent Application
Publication 2004/0123347 A1. All of the above-described patents and
patent publications disclosing promoters and their use, especially
in recombinant DNA constructs functional in plants are incorporated
herein by reference.
[0074] Plant vascular- or phloem-specific promoters of interest
include a rolC or rolA promoter of Agrobacterium rhizogenes, a
promoter of a Agrobacterium tumefaciens T-DNA gene 5, the rice
sucrose synthase RSs1 gene promoter, a Commelina yellow mottle
badnavirus promoter, a coconut foliar decay virus promoter, a rice
tungro bacilliform virus promoter, the promoter of a pea glutamine
synthase GS3A gene, a invCD111 and invCD141 promoters of a potato
invertase genes, a promoter isolated from Arabidopsis shown to have
phloem-specific expression in tobacco by Kertbundit et al. (1991)
Proc. Natl. Acad. Sci. USA., 88:5212-5216, a VAHOX1 promoter
region, a pea cell wall invertase gene promoter, an acid invertase
gene promoter from carrot, a promoter of a sulfate transporter gene
Sultrl; 3, a promoter of a plant sucrose synthase gene, and a
promoter of a plant sucrose transporter gene.
[0075] Promoters suitable for use with a recombinant DNA construct
of this invention include polymerase II ("pol II") promoters and
polymerase III ("pol III") promoters. RNA polymerase II transcribes
structural or catalytic RNAs that are usually shorter than 400
nucleotides in length, and recognizes a simple run of T residues as
a termination signal; it has been used to transcribe siRNA duplexes
(see, e.g., Lu et al. (2004) Nucleic Acids Res., 32:e171). Pol II
promoters are therefore preferred in certain embodiments where a
short RNA transcript is to be produced from a recombinant DNA
construct of this invention. In one embodiment, the recombinant DNA
construct includes a pol II promoter to express an RNA transcript
flanked by self-cleaving ribozyme sequences (e.g., self-cleaving
hammerhead ribozymes), resulting in a processed RNA, including
single-stranded RNA that binds to the transcript of at least one
target gene, with defined 5' and 3' ends, free of potentially
interfering flanking sequences. An alternative approach uses pol
III promoters to generate transcripts with relatively defined 5'
and 3' ends, i.e., to transcribe an RNA with minimal 5' and 3'
flanking sequences. In some embodiments, Pol III promoters (e.g.,
U6 or H1 promoters) are preferred for adding a short AT-rich
transcription termination site that results in 2 base-pair
overhangs (UU) in the transcribed RNA; this is useful, e.g., for
expression of siRNA-type constructs. Use of pol III promoters for
driving expression of siRNA constructs has been reported; see van
de Wetering et al. (2003) EMBO Rep., 4: 609-615, and Tuschl (2002)
Nature Biotechnol., 20: 446-448.
[0076] The promoter element can include nucleic acid sequences that
are not naturally occurring promoters or promoter elements or
homologues thereof but that can regulate expression of a gene.
Examples of such "gene independent" regulatory sequences include
naturally occurring or artificially designed RNA sequences that
include a ligand-binding region or aptamer (see "Aptamers", below)
and a regulatory region (which can be cis-acting). See, for
example, Isaacs et al. (2004) Nat. Biotechnol., 22:841-847, Bayer
and Smolke (2005) Nature Biotechnol., 23:337-343, Mandal and
Breaker (2004) Nature Rev. Mol. Cell Biol., 5:451-463, Davidson and
Ellington (2005) Trends Biotechnol., 23:109-112, Winkler et al.
(2002) Nature, 419:952-956, Sudarsan et al. (2003) RNA, 9:644-647,
and Mandal and Breaker (2004) Nature Struct. Mol. Biol., 11:29-35.
Such "riboregulators" could be selected or designed for specific
spatial or temporal specificity, for example, to regulate
translation of the DNA that undergoes processing to an RNA
including single-stranded RNA that binds to the transcript of at
least one target gene only in the presence (or absence) of a given
concentration of the appropriate ligand. One example is a
riboregulator that is responsive to an endogenous ligand (e.g.,
jasmonic acid or salicylic acid) produced by the plant when under
stress (e.g., abiotic stress such as water, temperature, or
nutrient stress, or biotic stress such as attach by pests or
pathogens); under stress, the level of endogenous ligand increases
to a level sufficient for the riboregulator to begin transcription
of the DNA that undergoes processing to an RNA including
single-stranded RNA that binds to the transcript of at least one
target gene.
Aptamers
[0077] In some embodiments, the recombinant DNA construct of this
invention includes DNA that is processed to an RNA aptamer, that
is, an RNA that binds to a ligand through binding mechanism that is
not primarily based on Watson-Crick base-pairing (in contrast, for
example, to the base-pairing that occurs between complementary,
anti-parallel nucleic acid strands to form a double-stranded
nucleic acid structure). See, for example, Ellington and Szostak
(1990) Nature, 346:818-822. Examples of aptamers can be found, for
example, in the public Aptamer Database, available on line at
aptamer.icmb.utexas.edu (Lee et al. (2004) Nucleic Acids Res.,
32(1):D95-100). Aptamers useful in the invention can, however, be
monovalent (binding a single ligand) or multivalent (binding more
than one individual ligand, e.g., binding one unit of two or more
different ligands).
[0078] Ligands useful in the invention include any molecule (or
part of a molecule) that can be recognized and be bound by a
nucleic acid secondary structure by a mechanism not primarily based
on Watson-Crick base pairing. In this way, the recognition and
binding of ligand and aptamer is analogous to that of antigen and
antibody, or of biological effector and receptor. Ligands can
include single molecules (or part of a molecule), or a combination
of two or more molecules (or parts of a molecule), and can include
one or more macromolecular complexes (e.g., polymers, lipid
bilayers, liposomes, cellular membranes or other cellular
structures, or cell surfaces). Examples of specific ligands include
vitamins such as coenzyme B.sub.12 and thiamine pyrophosphate,
flavin mononucleotide, guanine, adenosine, S-adenosylmethionine,
S-adenosylhomocysteine, coenzyme A, lysine, tyrosine, dopamine,
glucosamine-6-phosphate, caffeine, theophylline, antibiotics such
as chloramphenicol and neomycin, herbicides such as glyphosate and
dicamba, proteins including viral or phage coat proteins and
invertebrate epidermal or digestive tract surface proteins, and
RNAs including viral RNA, transfer-RNAs (t-RNAs), ribosomal RNA
(rRNA), and RNA polymerases such as RNA-dependent RNA polymerase
(RdRP). One class of RNA aptamers useful in the invention are
"thermoswitches" that do not bind a ligand but are thermally
responsive, that is to say, the aptamer's conformation is
determined by temperature; see, for example, Box 3 in Mandal and
Breaker (2004) Nature Rev. Mol. Cell Biol., 5:451-463.
Transgene Transcription Units
[0079] In some embodiments, the recombinant DNA construct of this
invention includes a transgene transcription unit. A transgene
transcription unit includes DNA sequence encoding a gene of
interest, e.g., a natural protein or a heterologous protein. A gene
of interest can be any coding or non-coding sequence from any
species (including, but not limited to, non-eukaryotes such as
bacteria, and viruses; fungi, protists, plants, invertebrates, and
vertebrates. Genes of interest include those genes also described
above as target genes, under the heading "Target Genes". The
transgene transcription unit can further include 5' or 3' sequence
or both as required for transcription of the transgene.
Introns
[0080] In some embodiments, the recombinant DNA construct of this
invention includes DNA encoding a spliceable intron. By "intron" is
generally meant a segment of DNA (or the RNA transcribed from such
a segment) that is located between exons (protein-encoding segments
of the DNA or corresponding transcribed RNA), wherein, during
maturation of the messenger RNA, the intron present is
enzymatically "spliced out" or removed from the RNA strand by a
cleavage/ligation process that occurs in the nucleus in eukaryotes.
The term "intron" is also applied to non-coding DNA sequences that
are transcribed to RNA segments that can be spliced out of a
maturing RNA transcript, but are not introns found between
protein-coding exons. One example of these are spliceable sequences
that that have the ability to enhance expression in plants (in some
cases, especially in monocots) of a downstream coding sequence;
these spliceable sequences are naturally located in the 5'
untranslated region of some plant genes, as well as in some viral
genes (e.g., the tobacco mosaic virus 5' leader sequence or "omega"
leader described as enhancing expression in plant genes by Gallie
and Walbot (1992) Nucleic Acids Res., 20:4631-4638). These
spliceable sequences or "expression-enhancing introns" can be
artificially inserted in the 5' untranslated region of a plant gene
between the promoter but before any protein-coding exons. Examples
of such expression-enhancing introns include, but are not limited
to, a maize alcohol dehydrogenase (Zm-Adhl), a maize Bronze-1
expression-enhancing intron, a rice actin 1 (Os-Actl) intron, a
Shrunken-1 (Sh-1) intron, a maize sucrose synthase intron, a heat
shock protein 18 (hsp18) intron, and an 82 kilodalton heat shock
protein (hsp82) intron. U.S. Pat. Nos. 5,593,874 and 5,859,347,
specifically incorporated by reference herein, describe methods of
improving recombinant DNA constructs for use in plants by inclusion
of an expression-enhancing intron derived from the 70 kilodalton
maize heat shock protein (hsp70) in the non-translated leader
positioned 3' from the gene promoter and 5' from the first
protein-coding exon.
Ribozymes
[0081] In some embodiments, the recombinant DNA construct of this
invention includes DNA encoding one or more ribozymes. Ribozymes of
particular interest include a self-cleaving ribozyme, a hammerhead
ribozyme, or a hairpin ribozyme. In one embodiment, the recombinant
DNA construct includes DNA encoding one or more ribozymes that
serve to cleave the transcribed RNA to provide defined segments of
RNA, such as the single-stranded RNA that binds to the target gene
transcript.
Recombinases
[0082] In some embodiments, the recombinant DNA construct of this
invention includes DNA encoding one or more site-specific
recombinase recognition sites. In one embodiment, the recombinant
DNA construct includes at least a pair of loxP sites, wherein
site-specific recombination of DNA between the loxP sites is
mediated by a Cre recombinase. The position and relative
orientation of the loxP sites is selected to achieve the desired
recombination; for example, when the loxP sites are in the same
orientation, the DNA between the loxP sites is excised in circular
form. In another embodiment, the recombinant DNA construct includes
DNA encoding one loxP site; in the presence of Cre recombinase and
another DNA with a loxP site, the two DNAs are recombined.
Gene Suppression Elements
[0083] In some embodiments, the recombinant DNA construct of this
invention further includes DNA encoding a gene suppression element.
Gene suppression elements include any DNA sequence (or RNA sequence
encoded therein) designed to specifically suppress a gene or genes
of interest, which can be a gene endogenous to the cell in which
the recombinant DNA construct is transcribed, or a gene exogenous
to that cell. The gene to be suppressed can be any of those
disclosed as target genes under the heading "Target Genes".
[0084] Suitable gene suppression elements are described in detail
in U.S. Patent Application Publication 2006/0200878, which
disclosure is specifically incorporated herein by reference, and
include one or more of: [0085] (a) DNA that includes at least one
anti-sense DNA segment that is anti-sense to at least one segment
of the gene to be suppressed; [0086] (b) DNA that includes multiple
copies of at least one anti-sense DNA segment that is anti-sense to
at least one segment of the gene to be suppressed e; [0087] (c) DNA
that includes at least one sense DNA segment that is at least one
segment of the gene to be suppressed; [0088] (d) DNA that includes
multiple copies of at least one sense DNA segment that is at least
one segment of the gene to be suppressed; [0089] (e) DNA that
transcribes to RNA for suppressing the gene to be suppressed by
forming double-stranded RNA and includes at least one anti-sense
DNA segment that is anti-sense to at least one segment of the gene
to be suppressed and at least one sense DNA segment that is at
least one segment of the gene to be suppressed; [0090] (f) DNA that
transcribes to RNA for suppressing the gene to be suppressed by
forming a single double-stranded RNA and includes multiple serial
anti-sense DNA segments that are anti-sense to at least one segment
of the gene to be suppressed and multiple serial sense DNA segments
that are at least one segment of the gene to be suppressed; [0091]
(g) DNA that transcribes to RNA for suppressing the gene to be
suppressed by forming multiple double strands of RNA and includes
multiple anti-sense DNA segments that are anti-sense to at least
one segment of the gene to be suppressed and multiple sense DNA
segments that are at least one segment of the gene to be
suppressed, and wherein the multiple anti-sense DNA segments and
the multiple sense DNA segments are arranged in a series of
inverted repeats; [0092] (h) DNA that includes nucleotides derived
from a plant miRNA; [0093] (i) DNA that includes nucleotides of a
siRNA; [0094] (j) DNA that transcribes to an RNA aptamer capable of
binding to a ligand; and [0095] (k) DNA that transcribes to an RNA
aptamer capable of binding to a ligand, and DNA that transcribes to
regulatory RNA capable of regulating expression of the gene to be
suppressed, wherein the regulation is dependent on the conformation
of the regulatory RNA, and the conformation of the regulatory RNA
is allosterically affected by the binding state of the RNA
aptamer.
[0096] In some embodiments, an intron is used to deliver a gene
suppression element in the absence of any protein-coding exons
(coding sequence). In one example, an intron, such as an
expression-enhancing intron (preferred in certain embodiments), is
interrupted by embedding within the intron a gene suppression
element, wherein, upon transcription, the gene suppression element
is excised from the intron. Thus, protein-coding exons are not
required to provide the gene suppressing function of the
recombinant DNA constructs disclosed herein.
Transcription Regulatory Elements
[0097] In some embodiments, the recombinant DNA construct of this
invention includes DNA encoding a transcription regulatory element.
Transcription regulatory elements include elements that regulate
the expression level of the recombinant DNA construct of this
invention (relative to its expression in the absence of such
regulatory elements). Examples of suitable transcription regulatory
elements include riboswitches (cis- or trans-acting), transcript
stabilizing sequences, and miRNA recognition sites, as described in
detail in U.S. Patent Application Publication 2006/0200878,
specifically incorporated herein by reference.
Making and Using Recombinant DNA Constructs
[0098] The recombinant DNA constructs of this invention are made by
any method suitable to the intended application, taking into
account, for example, the type of expression desired and
convenience of use in the plant in which the construct is to be
transcribed. General methods for making and using DNA constructs
and vectors are well known in the art and described in detail in,
for example, handbooks and laboratory manuals including Sambrook
and Russell, "Molecular Cloning: A Laboratory Manual" (third
edition), Cold Spring Harbor Laboratory Press, NY, 2001. An example
of useful technology for building DNA constructs and vectors for
transformation is disclosed in U.S. Patent Application Publication
2004/0115642 A1, specifically incorporated herein by reference. DNA
constructs can also be built using the GATEWAY.TM. cloning
technology (available from Invitrogen Life Technologies, Carlsbad,
Calif.), which uses the site-specific recombinase LR cloning
reaction of the Integrase/att system from bacteriophage lambda
vector construction, instead of restriction endonucleases and
ligases. The LR cloning reaction is disclosed in U.S. Pat. Nos.
5,888,732 and 6,277,608, and in U.S. Patent Application
Publications 2001/283529, 2001/282319 and 2002/0007051, all of
which are specifically incorporated herein by reference. Another
alternative vector fabrication method employs ligation-independent
cloning as disclosed by Aslandis et al. (1990) Nucleic Acids Res.,
18:6069-6074 and Rashtchian et al. (1992) Biochem., 206:91-97,
where a DNA fragment with single-stranded 5' and 3' ends is ligated
into a desired vector which can then be amplified in vivo.
[0099] In certain embodiments, the DNA sequence of the recombinant
DNA construct includes sequence that has been codon-optimized for
the plant in which the recombinant DNA construct is to be
expressed. For example, a recombinant DNA construct to be expressed
in a plant can have all or parts of its sequence (e.g., the first
gene suppression element or the gene expression element)
codon-optimized for expression in a plant by methods known in the
art. See, e.g., U.S. Pat. No. 5,500,365, incorporated by reference,
for a description of codon-optimization methodology for plants; see
also De Amicis and Marchetti (2000) Nucleic Acid Res.,
28:3339-3346.
Non-Natural Transgenic Plant Cells, Plants, and Seeds
[0100] In another aspect, this invention provides a non-natural
transgenic plant cell having in its genome a recombinant DNA
construct of this invention including DNA that undergoes processing
to an RNA including single-stranded RNA that binds to the
transcript of at least one target gene to form a hybridized segment
of at least partially double-stranded RNA that imparts to the
transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of the hybridized segment. This invention
further provides a non-natural transgenic plant including the
non-natural transgenic plant cell. In one embodiment, the
non-natural transgenic plant is wholly composed of transgenic
tissue. In another embodiment, the non-natural plant is a partially
transgenic plant and includes non-transgenic tissue; in one
example, the non-natural partially transgenic plant includes a
non-transgenic scion and a transgenic rootstock including the
non-natural transgenic plant cell. Further provided by this
invention is a non-natural transgenic seed including the
non-natural transgenic plant cell.
[0101] A non-natural transgenic plant of this invention includes
plants of any developmental stage, and includes a non-natural
regenerated plant prepared from the non-natural transgenic plant
cells disclosed herein, or a non-natural progeny plant (which can
be an inbred or hybrid progeny plant) of the regenerated plant, or
seed of such a non-natural transgenic plant. Also provided is a
non-natural transgenic seed having in its genome a recombinant DNA
construct of this invention. The non-natural transgenic plant
cells, transgenic plants, and transgenic seeds of this invention
are made by methods well-known in the art, as described below under
the heading "Making and Using Transgenic Plant Cells and Transgenic
Plants".
[0102] The non-natural transgenic plant cell can include an
isolated plant cell (e.g., individual plant cells or cells grown in
or on an artificial culture medium), or can include a plant cell in
undifferentiated tissue (e.g., callus or any aggregation of plant
cells). The non-natural transgenic plant cell can include a plant
cell in at least one differentiated tissue selected from the group
consisting of leaf (e.g., petiole and blade), root, stem (e.g.,
tuber, rhizome, stolon, bulb, and corm) stalk (e.g., xylem,
phloem), wood, seed, fruit, and flower (e.g., stamen, filament,
anther, pollen, microspore, carpel, pistil, ovary, ovules). The
non-natural transgenic plant cell or non-natural transgenic plant
of the invention can be stably transformed, e.g., fertile
transgenic plants and their non-natural transgenic seed also
containing the recombinant construct of this invention.
[0103] In some embodiments of this invention, the non-natural plant
is a non-natural transgenic plant. In such embodiments, all cells
(with the possible exception of haploid cells) and tissues of the
non-natural plant contain the recombinant DNA construct of this
invention. In other embodiments, the non-natural plant is partially
transgenic, and includes natural non-transgenic tissue (for
example, non-natural transgenic tissue grafted onto natural
non-transgenic tissue). In one embodiment, the non-natural plant
includes a natural non-transgenic scion and a non-natural
transgenic rootstock including the transgenic plant cell, wherein
the non-transgenic scion and transgenic rootstock are grafted
together. Such embodiments are particularly useful where the plant
is one that is commonly vegetatively grown as a scion grafted onto
a rootstock (wherein scion and rootstock can be of the same species
or variety or of different species or variety); examples include
grapes, apples, pears, quince, avocados, citrus, stone fruits,
kiwifruit, roses, and other plants of agricultural or ornamental
importance. Specifically claimed embodiments include embodiments
where (a) the non-natural partially transgenic plant includes a
natural non-transgenic grape scion and a non-natural transgenic
grape rootstock; and (b) the non-natural partially transgenic plant
includes a natural non-transgenic fruit tree (e.g., pear) scion and
a non-natural transgenic fruit tree (e.g., quince) rootstock.
Making and Using Transgenic Plant Cells and Transgenic Plants
[0104] Where a recombinant DNA construct of this invention is used
to produce a non-natural transgenic plant cell, plant, or seed of
this invention, ransformation can include any of the well-known and
demonstrated methods and compositions. Suitable methods for plant
transformation include virtually any method by which DNA can be
introduced into a cell. One method of plant transformation is
microprojectile bombardment, for example, as illustrated in U.S.
Pat. No. 5,015,580 (soybean), U.S. Pat. No. 5,538,880 (maize), U.S.
Pat. No. 5,550,318 (maize), U.S. Pat. No. 5,914,451 (soybean), U.S.
Pat. No. 6,153,812 (wheat), U.S. Pat. No. 6,160,208 (maize), U.S.
Pat. No. 6,288,312 (rice), U.S. Pat. No. 6,365,807 (rice), and U.S.
Pat. No. 6,399,861 (maize), and U.S. Pat. No. 6,403,865 (maize),
all of which are incorporated by reference for enabling the
production of transgenic plants.
[0105] Another useful method of plant transformation is
Agrobacterium-mediated transformation by means of Agrobacterium
containing a binary Ti plasmid system, wherein the Agrobacterium
carries a first Ti plasmid and a second, chimeric plasmid
containing at least one T-DNA border of a wild-type Ti plasmid, a
promoter functional in the transformed plant cell and operably
linked to a gene suppression construct of the invention. See, for
example, the binary system described in U.S. Pat. No. 5,159,135,
incorporated by reference. Also see De Framond (1983)
Biotechnology, 1:262-269; and Hoekema et al., (1983) Nature,
303:179. In such a binary system, the smaller plasmid, containing
the T-DNA border or borders, can be conveniently constructed and
manipulated in a suitable alternative host, such as E. coli, and
then transferred into Agrobacterium.
[0106] Detailed procedures for Agrobacterium-mediated
transformation of plants, especially crop plants, include
procedures disclosed in U.S. Pat. Nos. 5,004,863, 5,159,135, and
5,518,908 (cotton); U.S. Pat. Nos. 5,416,011, 5,569,834, 5,824,877
and 6,384,301 (soybean); U.S. Pat. Nos. 5,591,616 and 5,981,840
(maize); U.S. Pat. No. 5,463,174 (brassicas including canola), U.S.
Pat. No. 7,026,528 (wheat), and U.S. Pat. No. 6,329,571 (rice), and
in U.S. Patent Application Publications 2004/0244075 (maize) and
2001/0042257 A1 (sugar beet), all of which are specifically
incorporated by reference for enabling the production of transgenic
plants. Similar methods have been reported for many plant species,
both dicots and monocots, including, among others, peanut (Cheng et
al. (1996) Plant Cell Rep., 15: 653); asparagus (Bytebier et al.
(1987) Proc. Natl. Acad. Sci. U.S.A., 84:5345); barley (Wan and
Lemaux (1994) Plant Physiol., 104:37); rice (Toriyama et al. (1988)
Bio/Technology, 6:10; Zhang et al. (1988) Plant Cell Rep., 7:379;
wheat (Vasil et al. (1992) Bio/Technology, 10:667; Becker et al.
(1994) Plant J., 5:299), alfalfa (Masoud et al. (1996) Transgen.
Res., 5:313); and tomato (Sun et al. (2006) Plant Cell Physiol.,
47:426-431). See also a description of vectors, transformation
methods, and production of transformed Arabidopsis thaliana plants
where transcription factors are constitutively expressed by a
CaMV35S promoter, in U. S. Patent Application Publication
2003/0167537 A1, incorporated by reference. Various methods of
transformation of other plant species are well known in the art,
see, for example, the encyclopedic reference, "Compendium of
Transgenic Crop Plants", edited by Chittaranjan Kole and Timothy C.
Hall, Blackwell Publishing Ltd., 2008; ISBN 978-1-405-16924-0
(available electronically at
mrw.interscience.wiley.com/emrw/9781405181099/hpt/toc), which
describes transformation procedures for cereals and forage grasses
(rice, maize, wheat, barley, oat, sorghum, pearl millet, finger
millet, cool-season forage grasses, and bahiagrass), oilsee crops
(soybean, oilseed brassicas, sunflower, peanut, flax, sesame, and
safflower), legume grains and forages (common bean, cowpea, pea,
faba bean, lentil, tepary bean, Asiatic beans, pigeonpea, vetch,
chickpea, lupin, alfalfa, and clovers), temperate fruits and nuts
(apple, pear, peach, plums, berry crops, cherries, grapes, olive,
almond, and Persian walnut), tropical and subtropical fruits and
nuts (citrus, grapefruit, banana and plantain, pineapple, papaya,
mango, avocado, kiwifruit, passionfruit, and persimmon), vegetable
crops (tomato, eggplant, peppers, vegetable brassicas, radish,
carrot, cucurbits, alliums, asparagus, and leafy vegetables),
sugar, tuber, and fiber crops (sugarcane, sugar beet, stvia,
potato, sweet potato, cassava, and cotton), plantation crops,
ornamentals, and turf grasses (tobacco, coffee, cocoa, tea, rubber
tree, medicinal plants, ornamentals, amd turf grasses), and forest
tree species One of ordinary skill in the art has various
transformation methodologies for production of stable transgenic
plants.
[0107] Transformation methods to provide transgenic plant cells and
transgenic plants containing stably integrated recombinant DNA are
preferably practiced in tissue culture on media and in a controlled
environment. "Media" refers to the numerous nutrient mixtures that
are used to grow cells in vitro, that is, outside of the intact
living organism. Recipient cell targets include, but are not
limited to, meristem cells, callus, immature embryos or parts of
embryos, and gametic cells such as microspores, pollen, sperm, and
egg cells. Any cell from which a fertile plant can be regenerated
is contemplated as a useful recipient cell for practice of the
invention. Callus can be initiated from various tissue sources,
including, but not limited to, immature embryos or parts of
embryos, seedling apical meristems, microspores, and the like.
Those cells which are capable of proliferating as callus can serve
as recipient cells for genetic transformation. Practical
transformation methods and materials for making transgenic plants
of this invention (e.g., various media and recipient target cells,
transformation of immature embryos, and subsequent regeneration of
fertile transgenic plants) are disclosed, for example, in U.S. Pat.
Nos. 6,194,636 and 6,232,526 and U. S. Patent Application
Publication 2004/0216189, which are specifically incorporated by
reference.
[0108] In general transformation practice, DNA is introduced into
only a small percentage of target cells in any one transformation
experiment. Marker genes are generally used to provide an efficient
system for identification of those cells that are stably
transformed by receiving and integrating a transgenic DNA construct
into their genomes. Preferred marker genes provide selective
markers which confer resistance to a selective agent, such as an
antibiotic or herbicide. Any of the antibiotics or herbicides to
which a plant cell may be resistant can be a useful agent for
selection. Potentially transformed cells are exposed to the
selective agent. In the population of surviving cells will be those
cells where, generally, the resistance-conferring gene is
integrated and expressed at sufficient levels to permit cell
survival. Cells can be tested further to confirm stable integration
of the recombinant DNA. Commonly used selective marker genes
include those conferring resistance to antibiotics such as
kanamycin or paromomycin (nptll), hygromycin B (aph IV) and
gentamycin (aac3 and aacC4) or resistance to herbicides such as
glufosinate (bar or pat) and glyphosate (EPSPS). Examples of useful
selective marker genes and selection agents are illustrated in U.S.
Pat. Nos. 5,550,318, 5,633,435, 5,780,708, and 6,118,047, all of
which are specifically incorporated by reference. Screenable
markers or reporters, such as markers that provide an ability to
visually identify transformants can also be employed. Examples of
useful screenable markers include, for example, a gene expressing a
protein that produces a detectable color by acting on a chromogenic
substrate (e.g., beta glucuronidase (GUS) (uidA) or luciferase
(luc)) or that itself is detectable, such as green fluorescent
protein (GFP) (gfp) or an immunogenic molecule. Those of skill in
the art will recognize that many other useful markers or reporters
are available for use.
[0109] Detecting or measuring transcription of the recombinant DNA
construct in the transgenic plant cell of the invention can be
achieved by any suitable method, including protein detection
methods (e.g., western blots, ELISAs, and other immunochemical
methods), measurements of enzymatic activity, or nucleic acid
detection methods (e.g., Southern blots, northern blots, PCR,
RT-PCR, fluorescent in situ hybridization).
[0110] Other suitable methods for detecting or measuring
transcription of the recombinant DNA construct in the transgenic
plant cell of the invention include measurement of any other trait
that is a direct or proxy indication of the level of expression of
the target gene in the transgenic plant cell in which the
recombinant DNA construct is transcribed, relative to the level of
expression in one in which the recombinant DNA is not transcribed,
e.g., gross or microscopic morphological traits, growth rates,
yield, reproductive or recruitment rates, resistance to pests or
pathogens, or resistance to biotic or abiotic stress (e.g., water
deficit stress, salt stress, nutrient stress, heat or cold stress).
Such methods can use direct measurements of a phenotypic trait or
proxy assays (e.g., in plants, these assays include plant part
assays such as leaf or root assays to determine tolerance of
abiotic stress). Such methods include direct measurements of
resistance to an invertebrate pest or pathogen (e.g., damage to
plant tissues) or proxy assays (e.g., plant yield assays, or
bioassays such as the Western corn rootworm (Diabrotica virgifera
virgifera LeConte) larval bioassay described in International
Patent Application Publication WO2005/110068 A2 and U. S. Patent
Application Publication US 2006/0021087 A1, specifically
incorporated by reference, or the soybean cyst nematode bioassay
described by Steeves et al. (2006) Funct. Plant Biol., 33:991-999,
wherein cysts per plant, cysts per gram root, eggs per plant, eggs
per gram root, and eggs per cyst are measured.
[0111] The recombinant DNA constructs of the invention can be
stacked with other recombinant DNA for imparting additional traits
(e.g., in the case of transformed plants, traits including
herbicide resistance, pest resistance, cold germination tolerance,
water deficit tolerance, and the like) for example, by expressing
or suppressing other genes. Constructs for coordinated decrease and
increase of gene expression are disclosed in U.S. Patent
Application Publication 2004/0126845 A1, specifically incorporated
by reference.
[0112] Seeds of fertile transgenic plants can be harvested and used
to grow progeny generations, including hybrid generations, of
transgenic plants of this invention that include the recombinant
DNA construct in their genome. Thus, in addition to direct
transformation of a plant with a recombinant DNA construct of this
invention, transgenic plants of the invention can be prepared by
crossing a first plant having the recombinant DNA with a second
plant lacking the construct. For example, the recombinant DNA can
be introduced into a plant line that is amenable to transformation
to produce a transgenic plant, which can be crossed with a second
plant line to introgress the recombinant DNA into the resulting
progeny. A transgenic plant of the invention can be crossed with a
plant line having other recombinant DNA that confers one or more
additional trait(s) (such as, but not limited to, herbicide
resistance, pest or disease resistance, environmental stress
resistance, modified nutrient content, and yield improvement) to
produce progeny plants having recombinant DNA that confers both the
desired target sequence expression behavior and the additional
trait(s).
[0113] In such breeding for combining traits the transgenic plant
donating the additional trait can be a male line (pollinator) and
the transgenic plant carrying the base traits can be the female
line. The progeny of this cross segregate such that some of the
plant will carry the DNA for both parental traits and some will
carry DNA for one parental trait; such plants can be identified by
markers associated with parental recombinant DNA Progeny plants
carrying DNA for both parental traits can be crossed back into the
female parent line multiple times, e.g., usually 6 to 8
generations, to produce a homozygous progeny plant with
substantially the same genotype as one original transgenic parental
line as well as the recombinant DNA of the other transgenic
parental line.
[0114] Yet another aspect of the invention is a transgenic plant
grown from the transgenic seed of the invention. This invention
contemplates transgenic plants grown directly from transgenic seed
containing the recombinant DNA as well as progeny generations of
plants, including inbred or hybrid plant lines, made by crossing a
transgenic plant grown directly from transgenic seed to a second
plant not grown from the same transgenic seed. Crossing can
include, for example, the following steps: [0115] (a) plant seeds
of the first parent plant (e.g., non-transgenic or a transgenic)
and a second parent plant that is transgenic according to the
invention; [0116] (b) grow the seeds of the first and second parent
plants into plants that bear flowers; [0117] (c) pollinate a flower
from the first parent with pollen from the second parent; and
[0118] (d) harvest seeds produced on the parent plant bearing the
fertilized flower.
[0119] It is often desirable to introgress recombinant DNA into
elite varieties, e.g., by backcrossing, to transfer a specific
desirable trait from one source to an inbred or other plant that
lacks that trait. This can be accomplished, for example, by first
crossing a superior inbred ("A") (recurrent parent) to a donor
inbred ("B") (non-recurrent parent), which carries the appropriate
gene(s) for the trait in question, for example, a construct
prepared in accordance with the current invention. The progeny of
this cross first are selected in the resultant progeny for the
desired trait to be transferred from the non-recurrent parent "B",
and then the selected progeny are mated back to the superior
recurrent parent "A". After five or more backcross generations with
selection for the desired trait, the progeny can be essentially
hemizygous for loci controlling the characteristic being
transferred, but are like the superior parent for most or almost
all other genes. The last backcross generation would be selfed to
give progeny which are pure breeding for the gene(s) being
transferred, i.e., one or more transformation events.
[0120] Through a series of breeding manipulations, a selected DNA
construct can be moved from one line into an entirely different
line without the need for further recombinant manipulation. One can
thus produce inbred plants which are true breeding for one or more
DNA constructs. By crossing different inbred plants, one can
produce a large number of different hybrids with different
combinations of DNA constructs. In this way, plants can be produced
which have the desirable agronomic properties frequently associated
with hybrids ("hybrid vigor"), as well as the desirable
characteristics imparted by one or more DNA constructs.
[0121] In certain transgenic plant cells and transgenic plants of
the invention, it may be desirable to concurrently express a gene
of interest while also modulating expression of a target gene.
Thus, in some embodiments, the transgenic plant contains
recombinant DNA further including a gene expression element for
expressing at least one gene of interest, and transcription of the
recombinant DNA construct of this invention is preferably effected
with concurrent transcription of the gene expression element.
[0122] The recombinant DNA constructs of this invention can be
transcribed in any plant cell or tissue or in a whole plant of any
developmental stage. Transgenic plants can be derived from any
monocot or dicot plant, such as, but not limited to, plants of
commercial or agricultural interest, such as crop plants
(especially crop plants used for human food or animal feed), wood-
or pulp-producing trees, vegetable plants, fruit plants, and
ornamental plants. Examples of plants of interest include grain
crop plants (such as wheat, oat, barley, maize, rye, triticale,
rice, millet, sorghum, quinoa, amaranth, and buckwheat); forage
crop plants (such as forage grasses and forage dicots including
alfalfa, vetch, clover, and the like); oilseed crop plants (such as
cotton, safflower, sunflower, soybean, canola, rapeseed, flax,
peanuts, and oil palm); tree nuts (such as walnut, cashew,
hazelnut, pecan, almond, and the like); sugarcane, coconut, date
palm, olive, sugarbeet, tea, and coffee; wood- or pulp-producing
trees; vegetable crop plants such as legumes (for example, beans,
peas, lentils, alfalfa, peanut), lettuce, asparagus, artichoke,
celery, carrot, radish, the brassicas (for example, cabbages,
kales, mustards, and other leafy brassicas, broccoli, cauliflower,
Brussels sprouts, turnip, kohlrabi), edible cucurbits (for example,
cucumbers, melons, summer squashes, winter squashes), edible
alliums (for example, onions, garlic, leeks, shallots, chives),
edible members of the Solanaceae (for example, tomatoes, eggplants,
potatoes, peppers, groundcherries), and edible members of the
Chenopodiaceae (for example, beet, chard, spinach, quinoa,
amaranth); fruit crop plants such as apple, pear, citrus fruits
(for example, orange, lime, lemon, grapefruit, and others), stone
fruits (for example, apricot, peach, plum, nectarine), banana,
pineapple, grape, kiwifruit, papaya, avocado, and berries; plants
grown for biomass or biofuel (for example, Miscanthus grasses,
switchgrass, jatropha, oil palm, eukaryotic microalgae such as
Botryococcus braunii, Chlorella spp., and Dunaliella spp., and
eukaryotic macroalgae such as Gracilaria spp., and Sargassum spp.);
and ornamental plants including ornamental flowering plants,
ornamental trees and shrubs, ornamental groundcovers, and
ornamental grasses.
[0123] This invention also provides commodity products produced
from a non-natural transgenic plant cell, plant, or seed of this
invention, including, but not limited to, harvested leaves, roots,
shoots, tubers, stems, fruits, seeds, or other parts of a plant,
meals, oils, extracts, fermentation or digestion products, crushed
or whole grains or seeds of a plant, or any food or non-food
product including such commodity products produced from a
transgenic plant cell, plant, or seed of this invention. The
detection of one or more of nucleic acid sequences of the
recombinant DNA constructs of this invention in one or more
commodity or commodity products contemplated herein is de facto
evidence that the commodity or commodity product contains or is
derived from a non-natural transgenic plant cell, plant, or seed of
this invention.
[0124] In various embodiments, the non-natural transgenic plant
having in its genome a recombinant DNA construct of this invention
has at least one additional altered trait, relative to a plant
lacking the recombinant DNA construct, selected from the group of
traits consisting of: [0125] (a) improved abiotic stress tolerance;
[0126] (b) improved biotic stress tolerance; [0127] (c) modified
primary metabolite composition; [0128] (d) modified secondary
metabolite composition; [0129] (e) modified trace element,
carotenoid, or vitamin composition; [0130] (f) improved yield;
[0131] (g) improved ability to use nitrogen, phosphate, or other
nutrients; [0132] (h) modified agronomic characteristics; [0133]
(i) modified growth or reproductive characteristics; and [0134] (j)
improved harvest, storage, or processing quality.
[0135] In some embodiments, the non-natural transgenic plant is
characterized by: improved tolerance of abiotic stress (e.g.,
tolerance of water deficit or drought, heat, cold, non-optimal
nutrient or salt levels, non-optimal light levels) or of biotic
stress (e.g., crowding, allelopathy, or wounding); by a modified
primary metabolite (e.g., fatty acid, oil, amino acid, protein,
sugar, or carbohydrate) composition; a modified secondary
metabolite (e.g., alkaloids, terpenoids, polyketides, non-ribosomal
peptides, and secondary metabolites of mixed biosynthetic origin)
composition; a modified trace element (e.g., iron, zinc),
carotenoid (e.g., beta-carotene, lycopene, lutein, zeaxanthin, or
other carotenoids and xanthophylls), or vitamin (e.g., tocopherols)
composition; improved yield (e.g., improved yield under non-stress
conditions or improved yield under biotic or abiotic stress);
improved ability to use nitrogen, phosphate, or other nutrients;
modified agronomic characteristics (e.g., delayed ripening; delayed
senescence; earlier or later maturity; improved shade tolerance;
improved resistance to root or stalk lodging; improved resistance
to "green snap" of stems; modified photoperiod response); modified
growth or reproductive characteristics (e.g., intentional dwarfing;
intentional male sterility, useful, e.g., in improved hybridization
procedures; improved vegetative growth rate; improved germination;
improved male or female fertility); improved harvest, storage, or
processing quality (e.g., improved resistance to pests during
storage, improved resistance to breakage, improved appeal to
consumers); or any combination of these traits.
[0136] In another embodiment, non-natural transgenic seed, or seed
produced by the non-natural transgenic plant, has modified primary
metabolite (e.g., fatty acid, oil, amino acid, protein, sugar, or
carbohydrate) composition, a modified secondary metabolite
composition, a modified trace element, carotenoid, or vitamin
composition, an improved harvest, storage, or processing quality,
or a combination of these. In another embodiment, it can be
desirable to change levels of native components of the transgenic
plant or seed of a transgenic plant, for example, to decrease
levels of an allergenic protein or glycoprotein or of a toxic
metabolite.
[0137] Generally, screening a population of transgenic plants each
regenerated from a transgenic plant cell is performed to identify
transgenic plant cells that develop into transgenic plants having
the desired trait. The transgenic plants are assayed to detect an
enhanced trait, e.g., enhanced water use efficiency, enhanced cold
tolerance, increased yield, enhanced nitrogen use efficiency,
enhanced seed protein, and enhanced seed oil. Screening methods
include direct screening for the trait in a greenhouse or field
trial or screening for a surrogate trait. Such analyses are
directed to detecting changes in the chemical composition, biomass,
physiological properties, or morphology of the plant. Changes in
chemical compositions such as nutritional composition of grain are
detected by analysis of the seed composition and content of
protein, free amino acids, oil, free fatty acids, starch,
tocopherols, or other nutrients. Changes in growth or biomass
characteristics are detected by measuring plant height, stem
diameter, internode length, root and shoot dry weights, and (for
grain-producing plants such as maize, rice, or wheat) ear or seed
head length and diameter. Changes in physiological properties are
identified by evaluating responses to stress conditions, e.g.,
assays under imposed stress conditions such as water deficit,
nitrogen or phosphate deficiency, cold or hot growing conditions,
pathogen or insect attack, light deficiency, or increased plant
density. Other selection properties include days to pollen shed,
days to silking in maize, leaf extension rate, chlorophyll content,
leaf temperature, stand, seedling vigor, internode length, plant
height, leaf number, leaf area, tillering, brace roots, staying
green, stalk lodging, root lodging, plant health, fertility, green
snap, and pest resistance. In addition, phenotypic characteristics
of harvested seed may be evaluated; for example, in maize this can
include the number of kernels per row on the ear, number of rows of
kernels on the ear, kernel abortion, kernel weight, kernel size,
kernel density and physical grain quality. The following
illustrates examples of screening assays useful for identifying
desired traits in maize plants. These can be readily adapted for
screening other plants such as canola, cotton, and soybean either
as hybrids or inbreds.
[0138] Transgenic maize plants having nitrogen use efficiency are
identified by screening in fields with three levels of nitrogen
fertilizer being applied, e.g. low level (0 pounds/acre), medium
level (80 pounds/acre) and high level (180 pounds/acre). Plants
with enhanced nitrogen use efficiency provide higher yield as
compared to control plants.
[0139] Transgenic maize plants having enhanced yield are identified
by screening the transgenic plants over multiple locations with
plants grown under optimal production management practices and
maximum weed and pest control. A useful target for improved yield
is a 5% to 10% increase in yield as compared to yield produced by
plants grown from seed for a control plant. Selection methods may
be applied in multiple and diverse geographic locations and over
one or more planting seasons to statistically distinguish yield
improvement from natural environmental effects.
[0140] Transgenic maize plants having enhanced water use efficiency
are identified by screening plants in an assay where water is
withheld for period to induce stress followed by watering to revive
the plants. For example, a useful selection process imposes 3
drought/re-water cycles on plants over a total period of 15 days
after an initial stress free growth period of 11 days. Each cycle
consists of 5 days, with no water being applied for the first four
days and a water quenching on the 5th day of the cycle. The primary
phenotypes analyzed by the selection method are the changes in
plant growth rate as determined by height and biomass during a
vegetative drought treatment.
[0141] Transgenic maize plants having enhanced cold tolerance are
identified by screening plants in a cold germination assay and/or a
cold tolerance field trial. In a cold germination assay trays of
transgenic and control seeds are placed in a dark growth chamber at
9.7 degrees Celsius for 24 days. Seeds having higher germination
rates as compared to the control are identified as having enhanced
cold tolerance. In a cold tolerance field trial plants with
enhanced cold tolerance are identified from field planting at an
earlier date than conventional spring planting for the field
location. For example, seeds are planted into the ground around two
weeks before local farmers begin to plant maize so that a
significant cold stress is exerted onto the crop. As a control,
seeds also are planted under local optimal planting conditions such
that the crop has little or no exposure to cold condition. At each
location, seeds are planted under both cold and normal conditions
preferably with multiple repetitions per treatment.
[0142] The foregoing description and the examples presented in this
disclosure describe the subject matter of this invention, which
includes the following: (I) a recombinant DNA construct comprising
DNA that undergoes processing to an RNA comprising single-stranded
RNA that binds to the transcript of at least one target gene to
form a hybridized segment of at least partially double-stranded RNA
that imparts to said transcript resistance to cleavage by an RNase
III ribonuclease within or in the vicinity of said hybridized
segment; (II) a recombinant DNA construct comprising DNA that
undergoes processing to an RNA comprising single-stranded RNA that
binds to the transcript of at least one target gene to form a
hybridized segment of at least partially double-stranded RNA that
imparts to said transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of said hybridized segment,
wherein said processing of DNA to an RNA comprising single-stranded
RNA comprises transcription of said DNA to an RNA intermediate
comprising one or more double-stranded RNA stems; (III) a
recombinant DNA construct comprising DNA that undergoes processing
to an RNA comprising single-stranded RNA that binds to the
transcript of at least one target gene to form a hybridized segment
of at least partially double-stranded RNA that imparts to said
transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of said hybridized segment, wherein
length of said single-stranded RNA comprises between about 10 to
about 100 nucleotides; (IV) a recombinant DNA construct comprising
DNA that undergoes processing to an RNA comprising single-stranded
RNA that binds to the transcript of at least one target gene to
form a hybridized segment of at least partially double-stranded RNA
that imparts to said transcript resistance to cleavage by an RNase
III ribonuclease within or in the vicinity of said hybridized
segment, further comprising at least one element selected from the
group consisting of: (A) promoter functional in a eukaryotic cell;
(B) a Pol III promoter operably linked to said DNA that undergoes
processing to an RNA comprising single-stranded RNA; (C) DNA that
is processed to an RNA aptamer; (D) a transgene transcription unit;
(E) DNA encoding a spliceable intron; (F) DNA encoding a
self-splicing ribozyme; (G) DNA encoding a site-specific
recombinase recognition site; (H) DNA encoding a gene suppression
element; and (I) DNA encoding a transcription regulatory element;
(V) a recombinant DNA construct comprising DNA that undergoes
processing to an RNA comprising single-stranded RNA that binds to
the transcript of at least one target gene to form a hybridized
segment of at least partially double-stranded RNA that imparts to
said transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of said hybridized segment, wherein said
at least one target gene comprises: (A) coding sequence, non-coding
sequence, or both coding and non-coding sequence; or (B) a single
target gene, or multiple target genes; or (C) one or more of the
group consisting of: (1) an endogenous gene of a eukaryote, (2) a
transgene of a transgenic plant, (3) an endogenous gene of a pest
or pathogen of a plant, and (4) an endogenous gene of a symbiont
associated with a pest or pathogen of a plant; (VI) a recombinant
DNA construct comprising DNA that undergoes processing to an RNA
comprising single-stranded RNA that binds to the transcript of at
least one target gene to form a hybridized segment of at least
partially double-stranded RNA that imparts to said transcript
resistance to cleavage by an RNase III ribonuclease within or in
the vicinity of said hybridized segment, wherein said binding of
said single-stranded RNA to said transcript: (A) inhibits
double-stranded RNA-mediated suppression of said at least one
target gene; or (B) inhibits translation of said transcript; (VII)
a recombinant DNA construct comprising DNA that undergoes
processing to an RNA comprising single-stranded RNA that binds to
the transcript of at least one target gene to form a hybridized
segment of at least partially double-stranded RNA that imparts to
said transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of said hybridized segment, wherein said
binding of said single-stranded RNA to said transcript: (A)
inhibits double-stranded RNA-mediated suppression of said at least
one target gene; or (B) inhibits translation of said transcript;
and wherein: (1) said binding of said single-stranded RNA to said
transcript inhibits double-stranded RNA-mediated suppression of
said at least one target gene and the length of said hybridized
segment comprises between about 10 to about 100 base pairs; (2)
said binding of said single-stranded RNA to said transcript
inhibits translation of said transcript and the length of said
hybridized segment comprises between about 10 to about 50 base
pairs; or (3) said binding of said single-stranded RNA to said
transcript inhibits translation of said transcript and the length
of said hybridized segment comprises between about 19 to about 50
base pairs, said hybridized segment comprises smaller segments of 9
or fewer contiguous, perfectly complementary base pairs, and at
least one mismatch or insertion is between each pair of said
smaller segments; (VIII) a recombinant DNA construct comprising DNA
that undergoes processing to an RNA comprising single-stranded RNA
that binds to the transcript of at least one target gene to form a
hybridized segment of at least partially double-stranded RNA that
imparts to said transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of said hybridized segment,
wherein said binding of said single-stranded RNA to said
transcript: (A) inhibits double-stranded RNA-mediated suppression
of said at least one target gene; or (B) inhibits translation of
said transcript; and wherein said binding of said single-stranded
RNA to said transcript inhibits double-stranded RNA-mediated
suppression of said at least one target gene and the length of said
hybridized segment comprises between about 10 to about 100 base
pairs, and said double-stranded RNA-mediated suppression comprises
cleavage of said transcript by said RNase III ribonuclease, and
said cleavage is mediated by binding of a small RNA to said
transcript; (IX) a recombinant DNA construct comprising DNA that
undergoes processing to an RNA comprising single-stranded RNA that
binds to the transcript of at least one target gene to form a
hybridized segment of at least partially double-stranded RNA that
imparts to said transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of said hybridized segment,
wherein said binding of said single-stranded RNA to said
transcript: (A) inhibits double-stranded RNA-mediated suppression
of said at least one target gene; or (B) inhibits translation of
said transcript; and wherein said small RNA is: (1) an endogenous
small RNA or a transgenic small RNA; or (2) selected from the group
consisting of a miRNA, an siRNA, a trans-acting siRNA, a phased
small RNA, a natural antisense transcript siRNA, and a natural
antisense transcript miRNA; (X) a recombinant DNA construct
comprising DNA that undergoes processing to an RNA comprising
single-stranded RNA that binds to the transcript of at least one
target gene to form a hybridized segment of at least partially
double-stranded RNA that imparts to said transcript resistance to
cleavage by an RNase III ribonuclease within or in the vicinity of
said hybridized segment, wherein said binding of said
single-stranded RNA to said transcript: (A) inhibits
double-stranded RNA-mediated suppression of said at least one
target gene; or (B) inhibits translation of said transcript; and
wherein said binding of said single-stranded RNA to said transcript
inhibits double-stranded RNA-mediated suppression of said at least
one target gene and the length of said hybridized segment comprises
between about 10 to about 100 base pairs, and said double-stranded
RNA-mediated suppression comprises cleavage of said transcript by
said RNase III ribonuclease, and said cleavage is mediated by
binding of a small RNA to said transcript; and wherein said
hybridized segment comprises at least one mismatch or at least one
insertion in said hybridized segment at a position that results in
inhibiting cleavage of said transcript by said RNase III
ribonuclease; (XI) a recombinant DNA construct comprising DNA that
undergoes processing to an RNA comprising single-stranded RNA that
binds to the transcript of at least one target gene to form a
hybridized segment of at least partially double-stranded RNA that
imparts to said transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of said hybridized segment,
wherein said binding of said single-stranded RNA to said
transcript: (A) inhibits double-stranded RNA-mediated suppression
of said at least one target gene; or (B) inhibits translation of
said transcript; and wherein said binding of said single-stranded
RNA to said transcript inhibits double-stranded RNA-mediated
suppression of said at least one target gene and the length of said
hybridized segment comprises between about 10 to about 100 base
pairs, and said double-stranded RNA-mediated suppression comprises
cleavage of said transcript by said RNase III ribonuclease, and
said cleavage is mediated by binding of a small RNA to said
transcript; and wherein said small RNA is a mature miRNA, said
binding is at a miRNA recognition site in said transcript, said
cleavage of said transcript occurs at said miRNA recognition site,
and said hybridized segment is formed at least partially within
said miRNA recognition site; (XII) a recombinant DNA construct
comprising DNA that undergoes processing to an RNA comprising
single-stranded RNA that binds to the transcript of at least one
target gene to form a hybridized segment of at least partially
double-stranded RNA that imparts to said transcript resistance to
cleavage by an RNase III ribonuclease within or in the vicinity of
said hybridized segment, wherein said binding of said
single-stranded RNA to said transcript: (A) inhibits
double-stranded RNA-mediated suppression of said at least one
target gene; or (B) inhibits translation of said transcript; and
wherein said binding of said single-stranded RNA to said transcript
inhibits double-stranded RNA-mediated suppression of said at least
one target gene and the length of said hybridized segment comprises
between about 10 to about 100 base pairs, and said double-stranded
RNA-mediated suppression comprises cleavage of said transcript by
said RNase III ribonuclease, and said cleavage is mediated by
binding of a small RNA to said transcript; and wherein said small
RNA is a mature miRNA, said binding is at a miRNA recognition site
in said transcript, said cleavage of said transcript occurs at said
miRNA recognition site, and said hybridized segment is formed at
least partially within said miRNA recognition site; and wherein
said hybridized segment comprises: (1) at least one mismatch
between said single-stranded RNA and said miRNA recognition site at
positions corresponding to positions 9, 10, or 11 of said mature
miRNA, or (2) at least one insertion at a position in said
single-stranded RNA at positions corresponding to positions 10-11
of said mature miRNA, or (3) an A, G, or C (but not a U) at a
position corresponding to the 5' terminus of said mature miRNA, but
does not include (a) mismatches between said single-stranded RNA
and said miRNA recognition site at positions of said miRNA
recognition site corresponding to positions 9, 10, or 11 (in 3' to
5' direction) of said mature miRNA, or (b) insertions at a position
in said single-stranded RNA at positions of said miRNA recognition
site corresponding to positions 10 or 11 (in 3' to 5' direction) of
said mature miRNA; (XIII) a recombinant DNA construct comprising
DNA that undergoes processing to an RNA comprising single-stranded
RNA that binds to the transcript of at least one target gene to
form a hybridized segment of at least partially double-stranded RNA
that imparts to said transcript resistance to cleavage by an RNase
III ribonuclease within or in the vicinity of said hybridized
segment, wherein said binding of said single-stranded RNA to said
transcript: (A) inhibits double-stranded RNA-mediated suppression
of said at least one target gene; or (B) inhibits translation of
said transcript; and wherein said binding of said single-stranded
RNA to said transcript inhibits translation of said transcript, and
said binding of said single-stranded RNA to said transcript occurs:
(i) at least partially within the 5' untranslated region or 3'
untranslated region of said transcript; or (ii) within or in the
vicinity of the start codon or of the 5' cap; (XIV) a recombinant
DNA construct comprising DNA that undergoes processing to an RNA
comprising single-stranded RNA that binds to the transcript of at
least one target gene to form a hybridized segment of at least
partially double-stranded RNA that imparts to said transcript
resistance to cleavage by an RNase III ribonuclease within or in
the vicinity of said hybridized segment, wherein said binding of
said single-stranded RNA to said transcript: (A) inhibits
double-stranded RNA-mediated suppression of said at least one
target gene; or (B) inhibits translation of said transcript; and
wherein said binding of said single-stranded RNA to said transcript
inhibits translation of said transcript, and said hybridized
segment is resistant to cleavage by said RNase III ribonuclease;
(XV) a method of modulating expression of a target gene, comprising
expressing in a cell a recombinant DNA construct comprising DNA
that undergoes processing to an RNA comprising single-stranded RNA
that binds to the transcript of at least one target gene to form a
hybridized segment of at least partially double-stranded RNA that
imparts to said transcript resistance to cleavage by an RNase III
ribonuclease within or in the vicinity of said hybridized segment;
(XVI) a method of modulating expression of a target gene,
comprising expressing in a cell a recombinant DNA construct
comprising DNA that undergoes processing to an RNA comprising
single-stranded RNA that binds to the transcript of at least one
target gene to form a hybridized segment of at least partially
double-stranded RNA that imparts to said transcript resistance to
cleavage by an RNase III ribonuclease within or in the vicinity of
said hybridized segment; and wherein said binding of said
single-stranded RNA to said transcript: (A) inhibits
double-stranded RNA-mediated suppression of said at least one
target gene, thereby increasing expression of said target gene; or
(B) inhibits translation of said transcript, thereby decreasing
expression of said target gene; (XVII) a non-natural plant
chromosome or plastid comprising a recombinant DNA construct
comprising DNA that undergoes processing to an RNA comprising
single-stranded RNA that binds to the transcript of at least one
target gene to form a hybridized segment of at least partially
double-stranded RNA that imparts to said transcript resistance to
cleavage by an RNase III ribonuclease within or in the vicinity of
said hybridized segment; (XVIII) a non-natural transgenic plant
cell having in its genome a recombinant DNA construct comprising
DNA that undergoes processing to an RNA comprising single-stranded
RNA that binds to the transcript of at least one target gene to
form a hybridized segment of at least partially double-stranded RNA
that imparts to said transcript resistance to cleavage by an RNase
III ribonuclease within or in the vicinity of said hybridized
segment, or a non-natural transgenic plant or a non-natural
transgenic plant seed or a non-natural transgenic pollen grain
comprising said non-natural transgenic plant cell; (XIX) a
non-natural partially transgenic plant comprising: (A) a
non-natural transgenic plant cell having in its genome a
recombinant DNA construct comprising DNA that undergoes processing
to an RNA comprising single-stranded RNA that binds to the
transcript of at least one target gene to form a hybridized segment
of at least partially double-stranded RNA that imparts to said
transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of said hybridized segment and further
comprising non-transgenic tissue: or (B) a transgenic rootstock
comprising a non-natural transgenic plant cell having in its genome
a recombinant DNA construct comprising DNA that undergoes
processing to an RNA comprising single-stranded RNA that binds to
the transcript of at least one target gene to form a hybridized
segment of at least partially double-stranded RNA that imparts to
said transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of said hybridized segment and further
comprising a non-transgenic scion; (XX) a recombinant DNA construct
transcribable in a plant cell, comprising a promoter that is
functional in said plant cell and operably linked to at least one
polynucleotide selected from: (A) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target identified in Tables 2 or
3; (B) DNA encoding a 5
'-modified cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of at least one miRNA
target identified in Tables 2 or 3; (C) DNA encoding a
translational inhibitor to prevent or decrease small RNA-mediated
cleavage of the transcript of at least one miRNA target identified
in Tables 2 or 3; (D) DNA encoding a decoy to prevent or decrease
small RNA-mediated cleavage of the transcript of at least one miRNA
target identified in Tables 2 or 3; (E) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of at least one miRNA target
identified in Tables 2 or 3, wherein a miRNA recognition site in
said native nucleotide sequence is deleted or otherwise modified to
prevent miRNA-mediated cleavage; (F) DNA encoding a miRNA precursor
which is processed into a miRNA for suppressing expression of at
least one miRNA target identified in Tables 2 or 3; (G) DNA
encoding double-stranded RNA which is processed into siRNAs for
suppressing expression of at least one miRNA target identified in
Tables 2 or 3; and (H) DNA encoding a ta-siRNA which is processed
into siRNAs for suppressing expression of at least one miRNA target
identified in Tables 2 or 3; (XXI) a recombinant DNA construct
transcribable in a plant cell, comprising a promoter that is
functional in said plant cell and operably linked to at least one
polynucleotide selected from: (A) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target identified in Tables 2 or
3; (B) DNA encoding a 5'-modified cleavage blocker to prevent or
decrease small RNA-mediated cleavage of the transcript of at least
one miRNA target identified in Tables 2 or 3; (C) DNA encoding a
translational inhibitor to prevent or decrease small RNA-mediated
cleavage of the transcript of at least one miRNA target identified
in Tables 2 or 3; (D) DNA encoding a decoy to prevent or decrease
small RNA-mediated cleavage of the transcript of at least one miRNA
target identified in Tables 2 or 3; (E) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of at least one miRNA target
identified in Tables 2 or 3, wherein a miRNA recognition site in
said native nucleotide sequence is deleted or otherwise modified to
prevent miRNA-mediated cleavage; (F) DNA encoding a miRNA precursor
which is processed into a miRNA for suppressing expression of at
least one miRNA target identified in Tables 2 or 3; (G) DNA
encoding double-stranded RNA which is processed into siRNAs for
suppressing expression of at least one miRNA target identified in
Tables 2 or 3; and (H) DNA encoding a ta-siRNA which is processed
into siRNAs for suppressing expression of at least one miRNA target
identified in Tables 2 or 3; and wherein said at least one miRNA
target identified in Tables 2 or 3 is at least one selected from
the group consisting of a miR156 target, a miR160 target, a miR164
target, a miR166 target, a miR167 target, a miR169 target, a miR171
target, a miR172 target, a miR319 target, miR395 target, a miR396
target, a miR398 target, a miR399 target, a miR408 target, a miR444
target, a miR528 target, a miR167g target, a miR169g target, COP1
(constitutive photomorphogenesis1), GA2ox (gibberellic acid 2
oxidase), GA20ox (gibberellic acid 20 oxidase), HB2 (homeobox 2),
HB2-4 (homeobox 2 and homeobox 4), HB4 (homeobox 4), LG1
(liguleless1), SPX (SYG1, PHO81 and XPR1 domain; PFAM entry PF03105
at www.sanger.ac.uk), VIMla (variant in methlylation 1a), DHS1
(deoxyhypusine synthase), DHS2 (deoxyhypusine synthase), DHS3
(deoxyhypusine synthase), DHS4 (deoxyhypusine synthase), DHS5
(deoxyhypusine synthase), DHS6 (deoxyhypusine synthase), DHS7
(deoxyhypusine synthase), DHS8 (deoxyhypusine synthase), CRF (corn
RING finger; RNF169), G1543a (maize orthologue of Arabidopsis
thaliana homeobox 17), G1543b (maize orthologue of Arabidopsis
thaliana homeobox 17), GS3 (grain size 3), and GW2 (grain weight
2); (XXII) a recombinant DNA construct transcribable in a plant
cell, comprising a promoter that is functional in said plant cell
and operably linked to at least one polynucleotide selected from:
(A) DNA encoding a cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of at least one miRNA
target identified in Tables 2 or 3; (B) DNA encoding a 5'-modified
cleavage blocker to prevent or decrease small RNA-mediated cleavage
of the transcript of at least one miRNA target identified in Tables
2 or 3; (C) DNA encoding a translational inhibitor to prevent or
decrease small RNA-mediated cleavage of the transcript of at least
one miRNA target identified in Tables 2 or 3; (D) DNA encoding a
decoy to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target identified in Tables 2 or
3; (E) DNA encoding a miRNA-unresponsive transgene having a
nucleotide sequence derived from the native nucleotide sequence of
at least one miRNA target identified in Tables 2 or 3, wherein a
miRNA recognition site in said native nucleotide sequence is
deleted or otherwise modified to prevent miRNA-mediated cleavage;
(F) DNA encoding a miRNA precursor which is processed into a miRNA
for suppressing expression of at least one miRNA target identified
in Tables 2 or 3; (G) DNA encoding double-stranded RNA which is
processed into siRNAs for suppressing expression of at least one
miRNA target identified in Tables 2 or 3; and (H) DNA encoding a
ta-siRNA which is processed into siRNAs for suppressing expression
of at least one miRNA target identified in Tables 2 or 3; and
wherein said at least one miRNA target identified in Tables 2 or 3
is at least one selected from the group consisting of a miR156
target, a miR160 target, a miR164 target, a miR166 target, a miR167
target, a miR169 target, a miR171 target, a miR172 target, a miR319
target, miR395 target, a miR396 target, a a miR398 target, a miR399
target, a miR408 target, a miR444 target, a miR528 target, a
miR167g target, a miR169g target, COP1 (constitutive
photomorphogenesis1), GA2ox (gibberellic acid 2 oxidase), GA20ox
(gibberellic acid 20 oxidase), HB2 (homeobox 2), HB2-4 (homeobox 2
and homeobox 4), HB4 (homeobox 4), LG1 (liguleless1), SPX (SYG1,
PHO81 and XPR1 domain; PFAM entry PF03105 at www.sanger.ac.uk),
VIMla (variant in methlylation 1a), DHS1 (deoxyhypusine synthase),
DHS2 (deoxyhypusine synthase), DHS3 (deoxyhypusine synthase), DHS4
(deoxyhypusine synthase), DHS5 (deoxyhypusine synthase), DHS6
(deoxyhypusine synthase), DHS7 (deoxyhypusine synthase), DHS8
(deoxyhypusine synthase), CRF (corn RING finger; RNF169), G1543a
(maize orthologue of Arabidopsis thaliana homeobox 17), G1543b
(maize orthologue of Arabidopsis thaliana homeobox 17), GS3 (grain
size 3), and GW2 (grain weight 2); and wherein said at least one
polynucleotide is at least one selected from the group consisting
of DNA encoding a nucleotide sequence selected from SEQ ID NOs:
1120, 1121, 1122, 1248, 1257, 1313, 1314, 1364, 1387, 1478, 1489,
1490, 1491, 1492, 1493, 1585, 1597, 1598, 1599, 1713, 1752, 1753,
1801, 1802, 1820, 1927, 1929, 1931, 1971, 2006, 2007, 2008, 2010,
2012, 2014, 2016, 2018, 2022, 2023, 2025, 2027, 2029, 2031, 2033,
2035, 2037, 2039, 2041, 2043, 2045, 2047, 2049, 2051, 2053, 2055,
2056, 2057, 2059, 2060, 2061, and 2063; and (XXIII) a recombinant
DNA construct transcribable in a plant cell, comprising a promoter
that is functional in said plant cell and operably linked to at
least one polynucleotide selected from: (A) DNA encoding a cleavage
blocker to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target identified in Tables 2 or
3; (B) DNA encoding a 5'-modified cleavage blocker to prevent or
decrease small RNA-mediated cleavage of the transcript of at least
one miRNA target identified in Tables 2 or 3; (C) DNA encoding a
translational inhibitor to prevent or decrease small RNA-mediated
cleavage of the transcript of at least one miRNA target identified
in Tables 2 or 3; (D) DNA encoding a decoy to prevent or decrease
small RNA-mediated cleavage of the transcript of at least one miRNA
target identified in Tables 2 or 3; (E) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of at least one miRNA target
identified in Tables 2 or 3, wherein a miRNA recognition site in
said native nucleotide sequence is deleted or otherwise modified to
prevent miRNA-mediated cleavage; (F) DNA encoding a miRNA precursor
which is processed into a miRNA for suppressing expression of at
least one miRNA target identified in Tables 2 or 3; (G) DNA
encoding double-stranded RNA which is processed into siRNAs for
suppressing expression of at least one miRNA target identified in
Tables 2 or 3; and (H) DNA encoding a ta-siRNA which is processed
into siRNAs for suppressing expression of at least one miRNA target
identified in Tables 2 or 3; amd wherein said recombinant DNA
construct is stably integrated into a plastid or a chromosome of
said plant cell.
EXAMPLES
Example 1
[0143] This example illustrates the making and using of a "cleavage
blocker" recombinant DNA construct including DNA that undergoes
processing to an RNA including single-stranded RNA that binds to
the transcript of at least one target gene to form a hybridized
segment of at least partially double-stranded RNA that imparts to
the transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of the hybridized segment, wherein the
binding of the single-stranded RNA to the transcript (and the
resultant formation of the hybridized segment) inhibits
double-stranded RNA-mediated suppression of a target gene. More
specifically, this example describes constructs for producing in
planta an artificial or engineered miRNA or a cleavage blocker and
use of the cleavage blocker to inhibit miRNA-mediated suppression
of an Arabidopsis GL1 gene in transformed plant cells.
[0144] Target Gene:
[0145] The Arabidopsis GLABROUS1 (GL1) gene is required for
trichome synthesis; GL1 mutants lack leaf trichomes. GL1 is encoded
by the DNA sequence
TABLE-US-00001 (SEQ ID NO: 1)
ATGAGAATAAGGAGAAGAGATGAAAAAGAGAATCAAGAATACAAGAAAGG
TTTATGGACAGTTGAAGAAGACAACATCCTTATGGACTATGTTCTTAATC
ATGGCACTGGCCAATGGAACCGCATCGTCAGAAAAACTGGGCTAAAGAGA
TGTGGGAAAAGTTGTAGACTGAGATGGATGAATTATTTGAGCCCTAATGT
GAACAAAGGCAATTTCACTGAACAAGAAGAAGACCTCATTATTCGTCTCC
ACAAGCTCCTCGGCAATAGATGGTCTTTGATAGCTAAAAGAGTACCGGGA
AGAACAGATAACCAAGTCAAGAACTACTGGAACACTCATCTCAGCAAAAA
ACTCGTCGGAGATTACTCCTCCGCCGTCAAAACCACCGGAGAAGACGACG
ACTCTCCACCGTCATTGTTCATCACTGCCGCCACACCTTCTTCTTGTCAT
CATCAACAAGAAAATATCTACGAGAATATAGCCAAGAGCTTTAACGGCGT
CGTATCAGCTTCGTACGAGGATAAACCAAAACAAGAACTGGCTCAAAAAG
ATGTCCTAATGGCAACTACTAATGATCCAAGTCACTATTATGGCAATAAC
GCTTTATGGGTTCATGACGACGATTTTGAGCTTAGTTCACTCGTAATGAT
GAATTTTGCTTCTGGTGATGTTGAGTACTGCCTTTAG,
includes a miRNA recognition site, which has the sequence
CTCCACCGTCATTGTTCATCA (SEQ ID NO: 2) and which is also indicated by
the underlined text at nucleotide positions 404 to 424 of SEQ ID
NO: 1.
[0146] MicroRNA:
[0147] Selected as a scaffold or initial sequence for designing an
artificial miRNA was DNA derived from a soybean"miRMON1" precursor
having the sequence
TABLE-US-00002 (SEQ ID NO: 3)
AATTCATTACATTGATAAAACACAATTCAAAAGATCAATGTTCCACTTCA
TGCAAAGACATTTCCAAAATATGTGTAGGTAGAGGGGTTTTACAGGATCG
TCCTGAGACCAAATGAGCAGCTGACCACATGATGCAGCTATGTTTGCTAT
TCAGCTGCTCATCTGTTCTCAGGTCGCCCTTGTTGGACTGTCCAACTCCT
ACTGATTGCGGATGCACTTGCCACAAATGAAAATCAAAGCGAGGGGAAAA
GAATGTAGAGTGTGACTACGATTGCATGCATGTGATTTAGGTAATTAAGT
TACATGATTGTCTAATTGTGTTTATGGAATTGTATA,
where nucleotides of the mature miRNA ("miRMON1") are indicated by
underlined text at nucleotide positions 104 to 124 of SEQ ID NO: 3.
The encoded transcript was predicted to have the fold-back
structure depicted in FIG. 1, Panel A, and is a segment of a longer
miRMON1 precursor having the sequence
TABLE-US-00003 (SEQ ID NO: 4)
AAAATTCATTACATTGATAAAACACAATTCAAAAGATCAATGTTCCACTT
CATGCAAAGACATTTCCAAAATATGTGTAGGTAGAGGGGTTTTACAGGAT
CGTCCTGAGACCAAATGAGCAGCTGACCACATGATGCAGCTATGTTTGCT
ATTCAGCTGCTCATCTGTTCTCAGGTCGCCCTTGTTGGACTGTCCAACTC
CTACTGATTGCGGATGCACTTGCCACAAATGAAAATCAAAGCGAGGGGAA
AAGAATGTAGAGTGTGACTACGATTGCATGCATGTGATTTAGGTAATTAA
GTTACATGATTGTCTAATTGTGTTTATGGAATTGTATATTTTCAGACCAG
GCACCTGTAACTAATTATAGGTACCATACCTTAAAATAAGTCCAACTAAG
TCCATGTCTGTGATTTTTTAGTGTCACAAATCACAATCCATTGCCATTGG
TTTTTTAATTTTTCATTGTCTGTTGTTTAACTAACTCTAGCTTTTTAGCT
GCTTCAAGTACAGATTCCTCAAAGTGGAAAATGTTCTTTGAAGTCAATAA
AAAGAGCTTTGATGATCATCTGCATTGTCTAAGTTGGATAAACTAATTAG
AGAGAACTTTTGAACTTTGTCTACCAAATATCTGTCAGTGTCATCTGTCA
GTTCTGCAAGCTGAAGTGTTGAATCCACGAGGTGCTTGTTGCAAAGTTGT
GATATTAAAAGACATCTACGAAGAAGTTCAAGCAAAACTCTTTTTGGC,
where nucleotides of the mature miRMON1 are indicated by underlined
text at nucleotide positions 106 to 126 of SEQ ID NO: 4; this
longer miRMON1 precursor was previously disclosed as SEQ ID NO: 38
in U.S. patent application Ser. No. 11/303,745, published as U. S.
Patent Application Publication 2006/200878, and is specifically
incorporated herein by reference). The longer precursor (SEQ ID NO:
4) is also suitable as a scaffold.
[0148] DNA encoding an engineered "miRGL1" miRNA precursor derived
from SEQ ID NO: 3 was designed to produce an engineered miRGL1
precursor transcript that is processed to an artificial "miRGL1"
mature miRNA for suppressing the Arabidopsis endogenous gene, GL1.
The miRGL1 precursor had the sequence
TABLE-US-00004 (SEQ ID NO: 5)
AATTCATTACATTGATAAAACACAATTCAAAAGATCAATGTTCCACTTCA
TGCAAAGACATTTCCAAAATATGTGTAGGTAGAGGGGTTTTACAGGATCG
TCCTGATGAACAATGACGGTGGAGCCACATGATGCAGCTATGTTTGCTAT
CTCCACCGTCATCGTCCATCAGGTCGCCCTTGTTGGACTGTCCAACTCCT
ACTGATTGCGGATGCACTTGCCACAAATGAAAATCAAAGCGAGGGGAAAA
GAATGTAGAGTGTGACTACGATTGCATGCATGTGATTTAGGTAATTAAGT
TACATGATTGTCTAATTGTGTTTATGGAATTGTATA,
where nucleotides of the mature miRNA ("miRGL1") are indicated by
underlined text at nucleotide positions 104 to 124 of SEQ ID NO: 5
and nucleotides of the corresponding opposite strand designated
miRNA* ("miRGL1*") are indicated by italicized text at nucleotide
positions 151 to 171 of SEQ ID NO: 5. This miRGL1 precursor was
predicted to have the fold-back structure depicted in FIG. 1, Panel
B and is processed in planta to the mature miRGL1, which has the
sequence (in 5' to 3' direction) TGATGAACAATGACGGTGGAG (SEQ ID NO:
6, alternatively written in 3' to 5' direction as
GAGGTGGCAGTAACAAGTAGT).
[0149] Cleavage Blocker:
[0150] DNA encoding a cleavage blocker ("miRGL1-CB") precursor
derived from SEQ ID NO: 3 was designed to transcribe to an
engineered "cleavage blocker"-type miRNA precursor that is
processed to an RNA including single-stranded RNA that binds to the
transcript of the target gene GL1 to form a hybridized segment of
at least partially double-stranded RNA that imparts to the GL1
transcript resistance to cleavage by an RNase III ribonuclease
within or in the vicinity of the hybridized segment, wherein the
binding of the single-stranded RNA to the transcript (and the
resultant formation of the hybridized segment) inhibits
double-stranded RNA-mediated suppression of the at least one target
gene, wherein the suppression is mediated by miRGL1. The miRGL1-CB
precursor had the sequence
TABLE-US-00005 (SEQ ID NO: 7)
AATTCATTACATTGATAAAACACAATTCAAAAGATCAATGTTCCACTTCA
TGCAAAGACATTTCCAAAATATGTGTAGGTAGAGGGGTTTTACAGGATCG
TCCTGATGAACATAGACGGTGGAGCCACATGATGCAGCTATGTTTGCTAT
CTCCACCGTCTACGTCCATCAGGTCGCCCTTGTTGGACTGTCCAACTCCT
ACTGATTGCGGATGCACTTGCCACAAATGAAAATCAAAGCGAGGGGAAAA
GAATGTAGAGTGTGACTACGATTGCATGCATGTGATTTAGGTAATTAAGT
TACATGATTGTCTAATTGTGTTTATGGAATTGTATA,
where nucleotides of the mature cleavage blocker ("miRGL1-CB") are
indicated by underlined text at nucleotide positions 104 to 124 of
SEQ ID NO: 7 and nucleotides of the corresponding opposite strand
miRNA* ("miRGL1-CB*") are indicated by italicized text at
nucleotide positions 151 to 171 of SEQ ID NO: 7. Nucleotides at
positions 113 and 114 of SEQ ID NO: 7 are indicated by bold
underlined text and correspond to positions 10 and 11 (in 3' to 5'
direction) of the mature miRGL1-CB1; these two nucleotides were
selected to be intentionally mismatched to nucleotides of the miRNA
recognition site (SEQ ID NO: 2) of GL1 (SEQ ID NO: 1) to prevent
cleavage by an RNase III ribonuclease. The encoded miRGL1-CB RNA
precursor was predicted to have the fold-back structure depicted in
FIG. 1, Panel C and is processed in planta to the mature miRGL1-CB,
which has the sequence (in 5' to 3' direction)
TGATGAACATAGACGGTGGAG (SEQ ID NO: 8, alternatively written in 3' to
5' direction as GAGGTGGCAGATACAAGTAGT). FIG. 1, Panel E depicts an
alignment of the GL1 miRNA recognition site (SEQ ID NO: 2), the
mature miRGL1 in 3' to 5' direction (SEQ ID NO: 6), and the mature
miRGL1-CB in 3' to 5' direction (SEQ ID NO: 8).
[0151] miRGL1 Sensor:
[0152] DNA encoding a "miRGL1-sensor" having the sequence
TABLE-US-00006 (SEQ ID NO: 9)
TccagctgctcatttggtctcaTGATCACTGCGGCCGCAATACAgccata
gatcacttgatgtcaCGAccaccgtcattgttcatcagatttctctctgc aagcg
was designed to include an artificial miRGL1 recognition site
having the sequence GACCACCGTCATTGTTCATCA (SEQ ID NO: 10), which is
also indicated by underlined text at nucleotide positions 67 and 87
of SEQ ID NO: 9. Nucleotides at positions 67 and 68 of SEQ ID NO: 9
(or nucleotides at positions 1 and 2 of SEQ ID NO: 10) are
indicated by bold underlined text and correspond to positions 1 and
2 (in 3' to 5' direction) of the mature miRGL1; these two
nucleotides were selected to be intentionally mismatched to the
last two nucleotides on the 3' end of the mature miRGL1 (SEQ ID NO:
6) to prevent transitivity.
[0153] Three plasmids for Agrobacterium-mediated transformation
were constructed: [0154] (1) "35S/miRGL1/Term"--this plasmid
included a construct containing, in 5' to 3' direction, (a) a 35S
promoter driving expression of (b) a miRGL1 precursor (SEQ ID NO:
5), and (c) a nos terminator; [0155] (2)
"35S/GFP/miRGL1-sensor/Term"--this plasmid included a construct
containing, in 5' to 3' direction, (a) a 35S promoter operably
linked to (b) a green fluorescent protein (GFP) coding sequence,
(c) a miRGL1-sensor sequence (SEQ ID NO: 9), and (d) a nos
terminator; [0156] (3) "35S/miRGL1-CB"--this plasmid included a
construct containing, in 5' to 3' direction, (a) a 35S promoter
driving expression of (b) a miRGL1-CB precursor (SEQ ID NO: 7).
[0157] An aspect of this invention was demonstrated using protocols
described in Ko cia ska et al. (2005) Plant Mol. Biol.,
59:647-661). Nicotiana benthamiana plants were transiently
transformed using Agrobacterium with various combinations of these
plasmids and, where necessary, "filler" (null plasmid)
Agrobacterium to ensure infiltration of equal amounts of
Agrobacterium.
[0158] Nicotiana benthamiana plants transformed with plasmid (2)
exhibited GFP (green) fluorescence when visualized under UV light.
In plants transformed with plasmids (1) and (2), GFP fluorescence
was abolished with only chlorophyll (red) fluorescence observed
under UV light, indicating that the mature miRGL1 microRNA
suppressed expression of GFP. In plants transformed with plasmids
(1), (2) and (3), GFP fluorescence was restored, indicating that
the miRGL1-CB cleavage blocker inhibited double-stranded
RNA-mediated (i.e., mRGL1-mediated) suppression of the target gene
GFP by protecting the miRGL1 recognition site from being cleaved by
the mature miRGL1, resulting in increased expression (fluorescence)
of the target gene GFP relative to its expression in the absence of
the cleavage blocker.
[0159] In another demonstration of this invention, stably
transformed Arabidopsis thaliana plants were produced by
Agrobacterium-mediated transformation with a plasmid expressing a
miRGL1 precursor (SEQ ID NO: 5), which is processed in planta to a
"miRGL1" mature miRNA for suppressing the Arabidopsis endogenous
gene, GL1. The resulting transformed Arabidopsis plants exhibited
leaves without trichomes, indicating suppression of the target gene
GLABROUS1. Arabidopsis plants homozygous for miRGL1 DNA are further
transformed with a plasmid expressing a miRGL1-CB precursor (SEQ ID
NO: 7) and selected using kanamycin resistance. In these double
transformant plants, in planta expression of the mature cleavage
blocker miRGL1-CB (in 3' to 5' direction, SEQ ID NO: 8) inhibits
double-stranded RNA-mediated (i.e., mRGL1-mediated) suppression of
the target gene GLABROUS1 (GL1) by protecting the miRGL1
recognition site from being cleaved by the mature miRGL1, resulting
in restoration of trichome production (indicating increased
expression of the target gene GL1 relative to its expression in the
absence of the cleavage blocker).
Example 2
[0160] This example illustrates an alternative "cleavage blocker"
recombinant DNA construct having modification at a position
corresponding to the 5' terminus of the mature miRNA that natively
binds to the recognition site of the target gene, i.e., a
"5'-modified cleavage blocker" that is transgenically produced in
planta and a method of use of this cleavage blocker to inhibit
miRNA-mediated suppression of a target gene in transformed plant
cells.
[0161] In one example, DNA encoding an artificial miRNA (miRGL1)
precursor (SEQ ID NO: 6) was modified by a single nucleotide change
(changing the 5' terminus of the mature miRGL1 from a U to a C) to
yield the 5'-modified cleavage blocker precursor sequence
TABLE-US-00007 (SEQ ID NO: 11)
AATTCATTACATTGATAAAACACAATTCAAAAGATCAATGTTCCACTTCA
TGCAAAGACATTTCCAAAATATGTGTAGGTAGAGGGGTTTTACAGGATCG
TCCCGATGAACAATGACGGTGGAGCCACATGATGCAGCTATGTTTGCTAT
CTCCACCGTCATCGTCCATCGGGTCGCCCTTGTTGGACTGTCCAACTCCT
ACTGATTGCGGATGCACTTGCCACAAATGAAAATCAAAGCGAGGGGAAAA
GAATGTAGAGTGTGACTACGATTGCATGCATGTGATTTAGGTAATTAAGT
TACATGATTGTCTAATTGTGTTTATGGAATTGTATA,
where nucleotides of the mature 5'-modified cleavage blocker are
indicated by underlined text at nucleotide positions 104 to 124 of
SEQ ID NO: 11 (for comparison, nucleotides of SEQ ID NO: 11 that
correspond to miRGL1* nucleotides in SEQ ID NO: 6 are indicated by
italicized text at nucleotide positions 151 to 171 of SEQ ID NO:
11). This 5'-modified cleavage blocker RNA precursor was predicted
to have the fold-back structure depicted in FIG. 1, Panel D and is
processed in planta to the mature 5'-modified cleavage blocker,
which has the sequence (in 5' to 3' direction)
CGATGAACAATGACGGTGGAG (SEQ ID NO: 12, alternatively written in 3'
to 5' direction as GAGGTGGCAGTAACAAGTAGC). Nicotiana benthaminiana
was transiently transfected using procedures similar to those
described in Example 2. The resulting mature small RNA processed
from this 5'-modified cleavage blocker RNA precursor was
unexpectedly observed to function as a cleavage blocker, inhibiting
miRGL1-mediated suppression of the target gene GFP.
[0162] Two 5'-modified variants of the miRGL1-CB precursor (SEQ ID
NO: 7) were made, wherein the position corresponding to the 5'
terminus of the mature miRGL1-CB was changed from a T to an A or
from a T to a C, respectively, but wherein the mismatches
corresponding to positions 10 or 11 (in 3' to 5' direction) of the
mature miRGL1 were preserved. Both variants were predicted to have
a fold-back structure (not shown) similar to those shown in FIG. 1,
Panels A through D. The "5'-A variant" had the nucleotide
sequence
TABLE-US-00008 (SEQ ID NO: 13)
AATTCATTACATTGATAAAACACAATTCAAAAGATCAATGTTCCACTTCA
TGCAAAGACATTTCCAAAATATGTGTAGGTAGAGGGGTTTTACAGGATCG
TCCAGATGAACATAGACGGTGGAGCCACATGATGCAGCTATGTTTGCTAT
CTCCACCGTCTACGTCCATCTGGTCGCCCTTGTTGGACTGTCCAACTCCT
ACTGATTGCGGATGCACTTGCCACAAATGAAAATCAAAGCGAGGGGAAAA
GAATGTAGAGTGTGACTACGATTGCATGCATGTGATTTAGGTAATTAAGT
TACATGATTGTCTAATTGTGTTTATGGAATTGTATA
and the "5'-C variant" had the nucleotide sequence
TABLE-US-00009 (SEQ ID NO: 14)
AATTCATTACATTGATAAAACACAATTCAAAAGATCAATGTTCCACTTCA
TGCAAAGACATTTCCAAAATATGTGTAGGTAGAGGGGTTTTACAGGATCG
TCCCGATGAACATAGACGGTGGAGCCACATGATGCAGCTATGTTTGCTAT
CTCCACCGTCTACGTCCATCTGGTCGCCCTTGTTGGACTGTCCAACTCCT
ACTGATTGCGGATGCACTTGCCACAAATGAAAATCAAAGCGAGGGGAAAA
GAATGTAGAGTGTGACTACGATTGCATGCATGTGATTTAGGTAATTAAGT
TACATGATTGTCTAATTGTGTTTATGGAATTGTATA,
where nucleotides of the mature cleavage blocker are indicated by
underlined text at nucleotide positions 104 to 124 of SEQ ID NO: 13
or of SEQ ID NO: 14 (for comparison, nucleotides of SEQ ID NO: 13
or of SEQ ID NO: 14 that correspond to miRGL1* nucleotides in SEQ
ID NO: 6 are indicated by italicized text at nucleotide positions
151 to 171 of SEQ ID NO: 13 or of SEQ ID NO: 14).
[0163] The "5'-C variant" (SEQ ID NO: 14) was transiently
transfected into Nicotiana benthaminiana (using procedures similar
to those of Example 2); co-inoculation of the "5'-C" variant and
35S/miRGL1-sensor/Term (without miRGL1) resulted in GFP
fluorescence, indicating that the "5'-C variant" was unable to
cleave the miRGL1 recognition site and did not have miRNA-like
activity.
[0164] Both the "5'-A variant" (SEQ ID NO: 13) (plasmid pMON115363)
and the "5'-C variant" (SEQ ID NO: 14) (plasmid pMON115349) were
tested using transient transfection of Nicotiana benthaminiana
(similar to the experiment described in Example 2), and found to
also inhibit miRGL1-mediated suppression of the target gene GFP,
although not to as great an extent as the original cleavage blocker
miRGL1-CB (SEQ ID NO: 7).
[0165] The above example serves as guidance in making and using a
cleavage blocker (or 5'-modified cleavage blocker) useful for
inhibiting miRNA-mediated suppression of a target gene. It is clear
to one of ordinary skill in the art that knowledge of the target
gene itself is not required, merely the sequence of the mature
miRNA sequence or of a miRNA precursor that is processed to the
mature miRNA--or, alternatively, knowledge of the miRNA recognition
site sequence--in combination with the teachings of this
application, in order to devise a cleavage blocker (or 5'-modified
cleavage blocker) to inhibit the target gene silencing effects of a
given miRNA.
[0166] Thus, this application further provides and claims novel
cleavage blockers and 5'-modified cleavage blockers for all miRNA
sequences that have been publicly disclosed, including, but not
limited to, the miRNAs available at miRBase
(microrna.sanger.ac.uk), and the mature miRNAs and miRNA precursors
disclosed in U.S. patent application Ser. No. 11/303,745 (published
as U. S. Patent Application Publication 2006/0200878), Ser. No.
11/974,469 (published as U. S. Patent Application Publication
2009-0070898 A1), Ser. No. 11/868,081 (published as U. S. Patent
Application Publication 2008/0115240), Ser. No. 10/884,374
(published as U. S. Patent Application Publication 2005/0144669),
and Ser. No. 10/490,955 (now U.S. Pat. No. 7,232,806), which patent
application disclosures including the respective sequence listings
are specifically incorporated by reference herein.
Example 3
[0167] This example provides embodiments of target genes identified
as "validated miRNA targets" (i.e., containing a validated miRNA
recognition site). Recombinant DNA constructs of this invention are
useful for modulating expression of such target genes and for
making non-natural transgenic plant cells, plant tissues, and
plants (especially non-natural transgenic crop plants) having
improved yield or other desirable traits.
[0168] Prediction of a recognition site is achieved using methods
known in the art, such as sequence complementarity rules as
described by Zhang (2005) Nucleic Acids Res., 33:W701-704 and by
Rhoades et al. (2002) Cell, 110:513-520. One method to
experimentally validate predicted miRNA recognition sites is the
technique known as RNA ligase-mediated rapid amplification of cDNA
5' ends ("5' RLM-RACE" or "5' RACE"), which identifies miRNA
cleavage patterns; see, for example, Kasschau et al. (2003) Dev.
Cell, 4:205-217, and Llave et al. (2002) Science, 297:2053-2056.
This approach relies on ligation of an RNA adapter molecule to the
5' end of the cleavage site and is dependent on the 5' phosphate
left by RNase III enzymes including Ago1. The resulting PCR
products are sequenced and the relative number of clones which
align to the predicted miRNA cleavage site between nucleotides 10
and 11 relative to the miRNA 5' end provide an estimate of miRNA
activity.
[0169] While the standard for validation of a predicted miRNA
target is experimental verification of the predicted cleavage,
computational validation is also extremely useful for providing a
set of potential target genes that is of manageable or practical
size. At least two computational validation approaches based on
homology of miRNAs and predicted miRNA targets can be used. One
approach compares the predicted targets with experimentally
verified targets; the predicted target is computationally validated
if it is homologous to an experimentally validated target. This
approach is expected to identify miRNA targets with high confidence
and to become increasingly important as more experimentally
validated targets become available. The second approach compares
sequences from two species when no known miRNA target information
is available. If both miRNAs and predicted miRNA targets are
conserved in both species, then predicted targets in both species
are deemed validated.
[0170] In this example, the first approach was used, wherein
computational validation of predicted miRNA targets was based on
homology of predicted targets and known targets. A list of
experimentally verified plant miRNA target genes was created
through mining the literature on miRNA targets from rice (Sunkar et
al. (2005) Plant Cell, 17:1397-1411; Luo et al. (2006) FEBS Lett.,
580:5111-5116), moss (Physcomitrella patens) (Axtell et al. (2007)
Plant Cell, 19:1750-1769; Fattash et al. (2007) BMC Plant Biol.,
7:13), poplar (Lu et al. (2005) Plant Cell, 17:2186-2203), green
algae (Molnar et al. (2007) Nature, 447:1126-1130), and maize
(Lauter et al. (2005) Proc. Natl. Acad. Sci. USA, 102:9412-9417).
To this list were added 203 Arabidopsis thaliana loci from the
publicly accessible Arabidopsis Small RNA Project (available on
line at asrp.cgrb.oregonstate.edu/db/microRNAfamily.html). From
this list, a gene function keyword "dictionary" from the available
functional annotation was compiled, including known keyword
variants (Table 1).
[0171] Any functional annotation of a given predicted miRNA target
was searched for a match to the dictionary's keywords. A
computational algorithm was developed to match the longest keyword
first, second longest keyword second, and so on, to reduce false
positives in keyword match. Where a match was found, the predicted
target was deemed validated. This approach was applied to miRNA
targets that had been predicted from proprietary sequence databases
from various plant species; the computationally validated miRNA
targets thus identified are given in Table 2.
[0172] Identification of validated miRNA targets allows the
manipulation of the interaction between a given miRNA and its
target gene (whether a native gene or a transgene that contains a
validated miRNA recognition site). For example, over-expression of
a target gene containing a validated miRNA target (validated miRNA
recognition site) is expected to reduce the effect of that
particular miRNA in the biochemical network or networks involving
the miRNA.
[0173] Alternatively, an artificial transcript that includes the
same miRNA target sequence (or one modified to prevent cleavage by
an RNase II ribonuclease) can be used as a miRNA "decoy" (as
described in co-assigned U.S. patent application Ser. No.
11/974,469, published as U. S. Patent Application Publication
2009-0070898 A1, which disclosure is specifically incorporated by
reference herein), competing with the endogenous target gene to
bind to that particular miRNA and thereby reducing the effect of
the miRNA (e.g., suppression of the target gene and reduction of
the effect of the miRNA on other genes downstream of the target
gene) in the biochemical network or networks involving the miRNA.
Knowledge of the validated miRNA targets disclosed herein allows
one of ordinary skill in the art to use the miRNA target sequences
as scaffolds for designing artificial sequences useful as
transgenic miRNA decoys to reduce the effect of the miRNA on its
target gene(s), or to identify endogenous sequences that are
similarly useful as miRNA decoys. Thus, this application further
provides and claims miRNA decoys for the validated miRNA targets
disclosed herein, as well as miRNA decoys for all miRNA sequences
that have been publicly disclosed, including, but not limited to,
the miRNAs available at miRBase (microrna.sanger.ac.uk), and the
mature miRNAs and miRNA precursors disclosed in U.S. patent
application Ser. No. 11/303,745 (published as U.S. Patent
Application Publication 2006/0200878), Ser. No. 11/974,469
(published as U. S. Patent Application Publication 2009-0070898
A1), Ser. No. 11/868,081 (published as U. S. Patent Application
Publication 2008/0115240), Ser. No. 10/884,374 (published as U. S.
Patent Application Publication 2005/0144669), and Ser. No.
10/490,955 (now U.S. Pat. No. 7,232,806), which specifications are
specifically incorporated by reference in their entirety
herein.
[0174] In yet another embodiment, this invention further provides a
miRNA-unresponsive transgene by modifying the sequence of a
validated miRNA recognition site in the transgene to prevent
binding and/or cleavage by that particular miRNA. In one example,
increased expression of a gene that is normally modulated by an
endogenous miRNA may be achieved by expressing a recombinant DNA
construct encoding a miRNA-unresponsive transgene having a
nucleotide sequence derived from the native nucleotide sequence of
the gene but wherein a miRNA recognition site in the native
nucleotide sequence is deleted or otherwise modified to prevent
miRNA-mediated cleavage. In still another embodiment, this
invention provides a transgene sequence that is modified by the
addition of a validated miRNA recognition site in order to place
that transgene under the control of that particular miRNA; in a
variation on this, a transgenic plant is made by introducing into
its genome both the transgene as well as an exogenous precursor of
the particular miRNA that is to regulate the transgene.
TABLE-US-00010 TABLE 1 miRNA target keyword dictionary miR156
Squamosa Promoter Binding Protein, Squamosa Promoter Binding,
Squamosa Promoter-Binding, SBP-like, SPL, SPL2, SPL15, SPL9, SPL13,
SPL4, SPL10, SPL6, SPL11, SBP domain containing protein, SBP
domain, SBP-domain, teosinte glume architecture, tga1 miR157
Squamosa Promoter Binding Protein, Squamosa Promoter Binding,
Squamosa Promoter-Binding, SBP-like, SPL, SPL2, SPL15, SPL9, SPL13,
SPL4, SPL10, SPL6, SPL11, SBP domain containing protein, SBP
domain, SBP-domain, teosinte glume architecture, tga1 miR158
Pentatricopeptide repeat, pentatricopeptide (PPR), PPR, PPR-repeat,
pentatricopeptide miR159 MYB, AtMYB65, AtMYB101, AtMYB104, GAMyB,
myb domain protein, myb domain, myb protein, DUO1, MYB120, MYB97,
MYB65, MYB33, myb-like DNA- binding domain, myb-like, myb-like
DNA-binding miR160 Auxin Response Factor, ARF, ARF10, ARF16, ARF17,
B3 DNA binding domain containing protein, B3 domain, B3 DNA-binding
domain, B3 Domain-Containing miR161 Pentatricopeptide repeat,
pentatricopeptide (PPR), PPR, PPR-repeat, EMB2654, EMBRYO DEFECTIVE
2654, pentatricopeptide miR162 Dicer-like 1, Dicer-like1, Dicer
like 1, DCL, DCL1, CAF, SUS1, SIN1, ASU1, EMB76, EMB60, Dicer
miR163 S-adenosylmethionine-dependent methyltransferase, SAMT,
S-adenosyl-L- methionine:carboxyl methyltransferase,
methyltransferase miR164 Cup-shaped cotyledon, Cup shaped
cotyledon, CUC, NAM, NAC, CUC2, CUC1, NAM-like, NAC1, No Apical
Meristem, ATAF, ANAC079/ANAC080, ANAC100, ANAC092, NAC domain
protein, NAC domain, NAC domain-containing protein, NAC
domain-containing miR165 Phavoluta, Phabulosa, Revoluta, Corona,
PHB, PFV, CNA, HD-ZIPIII, HD-ZIP, HD ZIP, REV, PHV, AtHB8, AtHB15,
ICU4, ATHB-15, INCURVATA 4, IFL, IFL1, HD- ZIP class III HD-Zip
protein, HD-ZIP class III, HD-Zip protein, class III HD-Zip
protein, class III HD-Zip, homeodomain/leucine zipper, rolled leaf1
(rld1), rolled leaf 1 rolled leaf, rld1, HB1 gene, HB1, HD-ZIP III
miR166 Phavoluta, Phabulosa, Revoluta, Corona, PHB, PFV, CNA,
HD-ZIPIII, HD-ZIP, HD ZIP, REV, PHV, AtHB8, AtHB15, ICU4, ATHB-15,
INCURVATA 4, IFL, IFL1, HD- ZIP class III HD-Zip protein, HD-ZIP
class III, HD-Zip protein, class III HD-Zip protein, class III
HD-Zip, homeodomain/leucine zipper, rolled leaf1 (rld1), rolled
leaf 1 rolled leaf, rld1, HB1 gene, HB1, HD-ZIP III miR167 Auxin
Response Factor, ARF, ARF6, ARF8 miR168 Argonaute, AGO, AGO1,
PINHEAD, ZWILLE, ZLL, AGO2, AGO3, AGO4, AGO5, AGO6, AGO7, AGO8,
AGO9, AGO10, PNH/ZLL miR169 nuclear transcription factor Y, HAP2,
CCAAT, CCAAT-binding, NFYa, HAP2b, HAP2b-like, HAP2ab-like,
HAP2c-like, HAP2c, HAP2a, HAP2a-like miR170 Scarecrow/GRAS
transcription factors, GRAS, Scarecrow/GRAS, nodulation signaling
pathway 2 protein, nodulation signaling pathway 2,
Nodulation-Signaling Pathway 2, NSP2, nodulation signaling pathway,
nodulation-Signaling Pathway, NSP1 miR171 Scarecrow/GRAS
transcription factors, GRAS, Scarecrow/GRAS, nodulation signaling
pathway 2 protein, nodulation signaling pathway 2,
Nodulation-Signaling Pathway 2, NSP2, nodulation signaling pathway,
nodulation-Signaling Pathway, NSP1 miR172 Apetala, AP2, TOE1, TOE2,
TOE3, SMZ, SNZ, Target of EAT, TOE, Schnarchzapfen, SCHLAFMUTZE,
Glossy15, Glossy-15, Glossy 15, AP2 domain containing protein, AP2
domain protein, AP2 domain, Apetala floral homeotic protein
APETALA2, Apetala floral homeotic protein, Apetala protein,
APETALA2 miR173 TAS miR319 Teosinte Branched, Cycloidea, PCF, TCP,
TCP2, TCP3, TCP4, TCP 10, TCP24, TCP family transcription factor,
TCP family, TCP domain protein, TCP-domain protein, maternal effect
embryo arrest, Cyclin, CyCA, CyCB, CyCC, CyCD, CyCH, CyCT, CyCU
miR390 TAS3, TAS, Ser/Thr/Tyr protein kinase, Ser/Thr/Tyr miR393
Transport inhibitor response, TIR, TIR1, F-box, F box, F-box family
protein, F box family protein, F-box family, F box family, IPS1,
GRH1, GRR1-LIKE, ubiquitin- protein ligase, ubiquitin protein
ligase, basic helix-loop-helix (bHLH) family protein, bHLH, basic
helix-loop-helix, F-box domain containing protein, F-box domain
protein, F-box domain miR394 F-box, F box, F-box family protein, F
box family protein, F-box family, F box family, F-box domain
containing protein, F-box domain protein, F-box domain miR395 APS,
AST, ATP-sulfurylase, sulfate transporter, sulphate transporter,
AST68, APS1, APS3, APS4, ATP sulfurylase, sulfate
adenylyltransferase, Sulfate transporter miR396 Growth regulation
factor, GRL, GRF, GROWTH-REGULATING FACTOR, GROWTH REGULATING
FACTOR, AtGRF3, AtGRF4, AtGRF8, AtGRF7, AtGRF1 AtGRF2, AtGRF miR397
Laccase, LAC, PCL, plantacyanin, plastacyanin, blue copper binding
protein, IRX12, copper ion binding miR398 Copper superoxide
dismutase, superoxide dismutase 2, CSD, CSD2, COPPER/ZINC
SUPEROXIDE DISMUTASE, COPPER ZINC SUPEROXIDE DISMUTASE, COPPER-ZINC
SUPEROXIDE DISMUTASE, cytochrome c oxidase, cytochromec oxidase,
cytochrome-c oxidase miR399 E2 ubiquitin conjugating enzyme, PHO2,
ubiquitin-protein ligase, ubiquitin protein ligase, UBC24,
ubiquitin conjugating enzyme, ubiquitin conjugating miR400
Pentatricopeptide repeat, pentatricopeptide (PPR), PPR, EMB2745,
EMBRYO DEFECTIVE 2745, pentatricopeptide miR402 DML3, DEMETER-LIKE
PROTEIN 3, DEMETER-LIKE PROTEIN, DEMETER LIKE PROTEIN miR403 AGO,
Argonaute, AGO2 miR408 Laccase, LAC, LAC3, PCL, plantacyanin,
plastacyanin, blue copper binding protein, blue copper binding,
ARPN, copper ion binding, blue copper protein miR444 MADS box,
MADS-box, MADS miR447 2-phosphoglycerate kinase-related,
2-phosphoglycerate kinase, phosphoglycerate kinas miR472 RFL1,
RPS5, RPS5-LIKE 1, ATP binding, RPS5, RESISTANT TO P. SYRINGAE 5,
disease resistance protein (CC-NBS-LRR class), disease resistance
protein, CC-NBS- LRR, NBS-LRR disease resistance protein, NBS-LRR
type disease resistance protein miR473 GRAS domain-containing
protein, AtGAI, AtLAS, AtPAT1, AtRGA, AtRGL1, AtRGL2, AtRGL3,
AtSCL1, AtSCL11, AtSCL13, AtSCL14, AtSCL15, AtSCL16, AtSCL18,
AtSCL21, AtSCL22, AtSCL23, AtSCL26, AtSCL27, AtSCL28, AtSCL29,
AtSCL3, AtSCL30, AtSCL31, AtSCL32, AtSCL33, AtSCL4, AtSCL5, AtSCL6,
AtSCL7, AtSCL8, AtSCL9, AtSCR, AtSHR, REPRESSOR, RGA2, RGA-LIKE 1,
RGL, RGL1, SGR7, VHS4, VHS5 miR474 Pentatricopeptide repeat,
pentatricopeptide (PPR), PPR, PPR- repeat, EMB2654, EMBRYO
DEFECTIVE 2654, pentatricopeptide miR475 Pentatricopeptide repeat,
pentatricopeptide (PPR), PPR, PPR- repeat, EMB2654, EMBRYO
DEFECTIVE 2654, pentatricopeptide miR476 Pentatricopeptide repeat,
pentatricopeptide (PPR), PPR, PPR- repeat, EMB2654, EMBRYO
DEFECTIVE 2654, pentatricopeptide miR477 Basic helix-loop helix
(bHLH) transcription factor, transcription factor/zinc ion binding
CONSTANS-like, GRAS domain-containing protein, bHLH, GRAS,
CONSTANS- like, CONSTANS miR478 Organic anion transporter-like
protein, Organic anion transporter miR480 Proton-dependent
oligopeptide transport family protein, Proton-dependent
oligopeptide transport, Proton dependent oligopeptide transport
miR482 Putative disease resistance protein, disease resistance
protein, disease resistance miR529 Ethylene-response factor/AP2
domain transcription factor, erf/ap2, Ethylene-response factor/AP2
miR534 Ankyrin-repeat proteins, Ankyrin repeat proteins,
Ankyrin-repeat protein, Ankyrin- repeat, Ankyrin repeat miR536
F-box, F box, F-box family protein, F box family protein, F-box
family, F box family, F-box protein miR538 MADS-box, MADS miR771
eukaryotic translation initiation factor 2 family protein, eIF-2
family protein, eIF-2, eIF2 miR773 DMT02, DMT2, MET02, MET2, DNA
methyltransferase 2, DNA (cytosine-5-)- methyltransferase miR774
F-box family, F-box, F box, F-box domain containing protein, F-box
domain protein, F box domain miR775 galactosyltransferase family
protein, galactosyltransferase family, galactosyltransferase miR776
IRE, INCOMPLETE ROOT HAIR ELONGATION miR777 COP 1-interacting
protein-related, COP1-interacting protein, COP1-interacting, COP1
interacting miR778 SET-domain, SET, SUVH6, SUVH5, SU(VAR)3-9
homolog miR779 leucine-rich repeat transmembrane protein kinase,
leucine-rich repeat, leucine rich repeat, transmembrane protein
kinase, transmembrane miR780 CHX18, ATCHX18, cation/hydrogen
exchanger 18, monovalent cation:proton antiporter, proton
antiporter miR781 InterPro:IPR003169, SWIB complex BAF60b
domain-containing protein, SWIB complex BAF60b domain, SWIB,
BAF60b, plus-3 domain-containing protein, plus-3 domain, plus-3,
GYF domain-containing protein, GYF domain miR809 Mlo disease
resistant protein gene, Mlo-like, Mlo miR818 ENT domain protein
gene, ENT domain, ENT-domain miR820 DNA cytosine methyltransferase,
cytosine methyltransferase miR823 CMT3, CHROMOMETHYLASE 3,
CHROMOMETHYLASE miR824 MADS-box, MADS, AGL16, AGAMOUS-LIKE, AGAMOUS
miR827 SPX, NLA, SYG/Pho81/XPR1, zinc finger, zinc-finger,
C3HC4-type RING finger, C3HC4 miR828 MYB, myb domain protein, myb
protein, AtMYB113, MYB113, MYB-like protein, myb-like, myb-like
DNA-binding miR842 JR/MBP, jacalin lectin family protein, jacalin
lectin family, jacalin lectin, jacalin, lectin miR844 protein
kinase family protein, protein kinase family, protein kinase miR846
JR/MBP, InterPro:IPR001229, jasmonate inducible protein, jacalin
lectin family protein, jacalin lectin family, jacalin lectin,
jacalin, lectin miR856 Zinc transporter, Zinc-transporter, ACHX18,
ATCHX18 | ATCHX18, cation/hydrogen exchanger 18, cation/hydrogen
exchanger, monovalent cation:proton antiporter, proton antiporter,
antiporter miR857 LAC, LAC7, laccase 7, copper ion binding,
copper-ion binding miR858 MYB, myb domain protein, myb protein,
MYB12, AtMYB12, AtMYB83, MYB83, MYB-like protein, myb-like,
myb-like DNA-binding miR859 F-box, F box, F-box family protein, F
box family protein, F-box family, F box family, F-box protein,
InterPro:IPR006527, UDP-3-O-acyl N-acetylglycosamine deacetylase
family protein, UDP-3-O-acyl N-acetylglycosamine deacetylase
family, UDP-3-O-acyl N-acetylglycosamine deacetylase, UDP-3-O-acyl
N-acetylglycosamine, F-box domain containing protein, F-box domain
protein, F-box domain miR902 Basic helix-loop helix (bHLH)
transcription factor, bHLH miR904 AGO, Argonaute miR1029
Ethylene-response factor/AP2 domain transcription factor,
Ethylene-response factor, Ethylene response factor, erf/AP2
miR1219c Auxin Response Factors, Auxin Response Factor, arf
indicates data missing or illegible when filed
TABLE-US-00011 TABLE 2 Computationally validated miRNA targets SEQ
ID miRNA Gene Function NO: Gene ID Species of origin* miR156/157
SPL 15 PHE0014564 Arabidopsis thaliana miR156/157 SPL 16 PHE0014996
A. thaliana miR156/157 Squamosa Promoter Binding Protein 17
PHE0004508 A. thaliana miR156/157 Squamosa Promoter Binding Protein
18 PHE0004925 A. thaliana miR160 ARF 19 PHE0003525 A. thaliana
miR164 ANAC092 20 PHE0013733 A. thaliana miR164 NAC domain protein
21 PHE0001074 A. thaliana miR165/166 Revoluta 22 PHE0008129 A.
thaliana miR165/166 Revoluta 23 PHE0010493 A. thaliana miR165/166
Revoluta 24 PHE0012654 A. thaliana miR165/166 Revoluta 25
PHE0007271 A. thaliana miR165/166 Revoluta 26 PHE0007467 A.
thaliana miR165/166 Revoluta 27 PHE0007720 A. thaliana miR165/166
Revoluta 28 PHE0010355 A. thaliana miR165/166 Revoluta 29
PHE0010473 A. thaliana miR165/166 Revoluta 30 PHE0010494 A.
thaliana miR165/166 Revoluta 31 PHE0010495 A. thaliana miR165/166
Revoluta 32 PHE0010537 A. thaliana miR166 Revoluta 33 PHE0010496 A.
thaliana miR166 Revoluta 34 PHE0010497 A. thaliana miR166 Revoluta
35 PHE0010500 A. thaliana miR167 ARF 36 PHE0003428 A. thaliana
miR172 AP2 37 PHE0003881 A. thaliana miR172 AP2 domain 38
PHE0006606 A. thaliana miR393 F-box 39 PHE0007151 A. thaliana
miR393 F-box 40 PHE0007164 A. thaliana miR393 F-box 41 PHE0007167
A. thaliana miR393 Transport inhibitor response 42 PHE0004988 A.
thaliana miR396 GRL 43 PHE0004617 A. thaliana miR778 SET-domain 44
PHE0006443 A. thaliana miR779 leucine-rich repeat transmembrane 45
PHE0002993 A. thaliana protein kinase miR858 MYB 46 PHE0001073 A.
thaliana miR858 MYB 47 PHE0001093 A. thaliana miR858 MYB 48
PHE0002073 A. thaliana miR858 MYB 49 PHE0010073 A. thaliana miR858
MyB 50 PHE0011722 A. thaliana miR858 MyB 51 PHE0015935 A. thaliana
miR859 F-box 52 PHE0003311 A. thaliana miR859 F-box 53 PHE0006468
A. thaliana miR902 bHLH 54 PHE0000658 A. thaliana miR902 bHLH 55
PHE0006524 A. thaliana miR156 Squamosa Promoter Binding Protein 56
MRT3708_37334C.1 Canola (Brassica napus or Brassica rapa)
miR156/157 Squamosa Promoter Binding Protein 57 MRT3708_10628C.4
Canola miR156/157 Squamosa Promoter Binding Protein 58
MRT3708_22559C.1 Canola miR156/157 Squamosa Promoter Binding
Protein 59 MRT3708_30289C.3 Canola miR156/157 Squamosa Promoter
Binding Protein 60 MRT3708_39670C.2 Canola miR156/157 Squamosa
Promoter Binding Protein 61 MRT3708_53675C.1 Canola miR156/157
Squamosa Promoter Binding Protein 62 MRT3708_58630C.1 Canola miR159
MYB 63 MRT3708_33278C.1 Canola miR159 MYB 64 MRT3708_33279C.1
Canola miR163 methyltransferase 65 MRT3708_16440C.1 Canola miR163
methyltransferase 66 MRT3708_28174C.1 Canola miR163
methyltransferase 67 MRT3708_52155C.2 Canola miR164 NAM 68
MRT3708_39966C.1 Canola miR164 No Apical Meristem 69
MRT3708_51022C.1 Canola miR164 No Apical Meristem 70
MRT3708_7877C.4 Canola miR165/166 class III HD-Zip protein 71
MRT3708_45624C.1 Canola miR165/166 HD-Zip protein 72
MRT3708_5493C.1 Canola miR167 Auxin Response Factor 73
MRT3708_37499C.2 Canola miR167 Auxin Response Factor 74
MRT3708_50323C.1 Canola miR169 CCAAT-binding 75 MRT3708_45516C.2
Canola miR169 CCAAT-binding 76 MRT3708_46224C.1 Canola miR169
CCAAT-binding 77 MRT3708_56325C.1 Canola miR169 nuclear
transcription factor Y 78 MRT3708_42756C.1 Canola miR170/171
SCARECROW gene regulator 79 MRT3708_34048C.2 Canola miR172 AP2 80
MRT3708_39387C.1 Canola miR172 AP2 domain 81 MRT3708_36942C.2
Canola miR393 Transport inhibitor response 82 MRT3708_31301C.1
Canola miR393 Transport inhibitor response 83 MRT3708_52518C.1
Canola miR393 Transport inhibitor response 84 MRT3708_55951C.1
Canola miR394 F-box 85 MRT3708_61891C.1 Canola miR395 ATP
sulfurylase 86 MRT3708_35187C.3 Canola miR395 sulfate
adenylyltransferase 87 MRT3708_36129C.1 Canola miR395 sulfate
adenylyltransferase 88 MRT3708_55043C.1 Canola miR396
Growth-regulating factor 89 MRT3708_29578C.1 Canola miR396
Growth-regulating factor 90 MRT3708_51563C.1 Canola miR398
cytochrome c oxidase 91 MRT3708_47361C.2 Canola miR400 PPR 92
MRT3708_57455C.1 Canola miR408 blue copper protein 93
MRT3708_29149C.3 Canola miR472 ATP binding 94 MRT3708_45273C.1
Canola miR472 ATP binding 95 MRT3708_55890C.1 Canola miR472 ATP
binding 96 MRT3708_55902C.2 Canola miR824 MADS-box 97
MRT3708_59018C.1 Canola miR827 zinc finger 98 MRT3708_29390C.1
Canola miR828 myb-like DNA-binding 99 MRT3708_31708C.1 Canola
miR856 antiporter 100 MRT3708_61144C.1 Canola miR857 LAC 101
MRT3708_24461C.1 Canola miR858 MYB 102 MRT3708_31372C.1 Canola
miR858 myb-like DNA-binding 103 MRT3708_16589C.4 Canola miR858
myb-like DNA-binding 104 MRT3708_29291C.3 Canola miR858 myb-like
DNA-binding 105 MRT3708_54665C.1 Canola miR858 myb-like DNA-binding
106 MRT3708_61897C.1 Canola miR859 F-box domain 107
MRT3708_51653C.1 Canola miR167 Auxin Response Factor 108
MRT3711_1592C.1 Field mustard (Brassica rapa or Brassica
campestris) miR168 Argonaute 109 MRT3711_4500C.2 Field mustard
miR169 nuclear transcription factor Y 110 MRT3711_4547C.1 Field
mustard miR172 AP2 111 MRT3711_6838C.1 Field mustard miR319 PCF 112
MRT3711_7220C.1 Field mustard miR393 Transport inhibitor response
113 MRT3711_1771C.1 Field mustard miR395 sulfate
adenylyltransferase 114 MRT3711_3394C.1 Field mustard miR395
sulfate adenylyltransferase 115 MRT3711_4165C.1 Field mustard
miR395 sulfate adenylyltransferase 116 MRT3711_4313C.1 Field
mustard miR472 ATP binding 117 MRT3711_7972C.1 Field mustard miR827
zinc finger 118 MRT3711_10064C.1 Field mustard miR858 myb-like
DNA-binding 119 MRT3711_7980C.1 Field mustard miR156/157 SBP domain
120 MRT3847_197471C.3 Glycine max miR156/157 SBP domain 121
MRT3847_202791C.3 G. max miR156/157 SBP domain 122 MRT3847_28990C.5
G. max miR156/157 SBP domain 123 MRT3847_39715C.7 G. max miR156/157
Squamosa Promoter Binding Protein 124 MRT3847_207934C.2 G. max
miR156/157 Squamosa Promoter Binding Protein 125 MRT3847_257545C.4
G. max miR156/157 Squamosa Promoter Binding Protein 126
MRT3847_217782C.3 G. max miR156/157 Squamosa Promoter Binding
Protein 127 MRT3847_235081C.4 G. max miR156/157 Squamosa Promoter
Binding Protein 128 MRT3847_235082C.6 G. max miR156/157 Squamosa
Promoter Binding Protein 129 MRT3847_289291C.3 G. max miR156/157
Squamosa Promoter Binding Protein 130 MRT3847_335568C.1 G. max
miR156/157 Squamosa Promoter Binding Protein 131 MRT3847_350831C.1
G. max miR156/157 Squamosa Promoter Binding Protein 132
MRT3847_14683C.5 G. max miR156/157 Squamosa Promoter Binding
Protein 133 MRT3847_237444C.4 G. max miR156/157 Squamosa Promoter
Binding Protein 134 MRT3847_329752C.1 G. max miR156/157 Squamosa
Promoter Binding Protein 135 MRT3847_334134C.1 G. max miR156/157
teosinte glume architecture 136 MRT3847_338602C.1 G. max miR159
myb-like DNA-binding domain 137 MRT3847_345009C.1 G. max miR159
myb-like DNA-binding domain 138 MRT3847_346338C.1 G. max miR160 ARF
139 PHE0003526 G. max miR160 Auxin Response Factor 140
MRT3847_139013C.5 G. max miR160 Auxin Response Factor 141
MRT3847_197785C.3 G. max miR160 Auxin Response Factor 142
MRT3847_239685C.2 G. max miR160 Auxin Response Factor 143
MRT3847_269589C.4 G. max miR160 Auxin Response Factor 144
MRT3847_28328C.3 G. max miR160 Auxin Response Factor 145
MRT3847_289982C.2 G. max miR160 Auxin Response Factor 146
MRT3847_37862C.4 G. max miR160 Auxin Response Factor 147
MRT3847_41982C.5 G. max miR160 Auxin Response Factor 148
MRT3847_52071C.7 G. max miR161 pentatricopeptide 149
MRT3847_4014C.4 G. max miR161 PPR 150 MRT3847_20482C.2 G. max
miR161 PPR 151 MRT3847_227121C.4 G. max miR164 NAC domain protein
152 MRT3847_46332C.2 G. max miR164 NAC domain protein 153
MRT3847_46333C.6 G. max miR164 NAC1 154 PHE0001363 G. max miR164
NAM 155 MRT3847_244824C.2 G. max miR164 No Apical Meristem 156
MRT3847_259513C.2 G. max miR164 No Apical Meristem 157
MRT3847_270117C.3 G. max miR164 No Apical Meristem 158
MRT3847_48464C.4 G. max miR164 No Apical Meristem 159
MRT3847_48465C.6 G. max miR165/166 class III HD-Zip protein 160
MRT3847_209034C.4 G. max miR165/166 class III HD-Zip protein 161
MRT3847_233286C.5 G. max miR165/166 class III HD-Zip protein 162
MRT3847_248020C.5 G. max miR165/166 class III HD-Zip protein 163
MRT3847_288367C.4 G. max miR165/166 class III HD-Zip protein 164
MRT3847_296736C.1 G. max miR165/166 class III HD-Zip protein 165
MRT3847_326691C.1 G. max miR165/166 class III HD-Zip protein 166
MRT3847_345104C.1 G. max miR165/166 class III HD-Zip protein 167
MRT3847_348410C.1 G. max miR166 Homeobox 168 PHE0003454 G. max
miR167 ARF 169 PHE0003655 G. max miR167 Auxin Response Factor 170
MRT3847_195447C.5 G. max miR167 Auxin Response Factor 171
MRT3847_263906C.5 G. max miR167 Auxin Response Factor 172
MRT3847_305421C.4 G. max miR167 Auxin Response Factor 173
MRT3847_340154C.1 G. max miR167 Auxin Response Factor 174
MRT3847_41926C.6 G. max miR167 Auxin Response Factor 175
MRT3847_55334C.5 G. max miR169 CCAAT-binding 176 MRT3847_251095C.3
G. max miR169 CCAAT-binding 177 MRT3847_259875C.4 G. max miR169
CCAAT-binding 178 MRT3847_293871C.3 G. max miR169 CCAAT-binding 179
MRT3847_305217C.3 G. max miR169 CCAAT-binding 180 MRT3847_347487C.1
G. max miR169 CCAAT-binding 181 MRT3847_40604C.6 G. max miR169
CCAAT-binding 182 MRT3847_53466C.6 G. max miR169 CCAAT-binding 183
MRT3847_53467C.5 G. max miR169 CCAAT-binding 184 MRT3847_54675C.6
G. max miR169 NFYa 185 PHE0011547 G. max miR169 nuclear
transcription factor Y 186 MRT3847_25786C.5 G. max miR169 nuclear
transcription factor Y 187 MRT3847_289667C.3 G. max miR169 nuclear
transcription factor Y 188 MRT3847_312701C.1 G. max miR169 nuclear
transcription factor Y 189 MRT3847_335193C.1 G. max miR169 nuclear
transcription factor Y 190 MRT3847_51286C.6 G. max miR169 nuclear
transcription factor Y 191 MRT3847_54010C.4 G. max miR170/171
Scarecrow-like 192 MRT3847_41579C.4 G. max miR171 GRAS 193
MRT3847_267119C.3 G. max miR171 GRAS 194 MRT3847_270988C.3 G. max
miR171 GRAS 195 MRT3847_275596C.2 G. max miR171 GRAS 196
MRT3847_294457C.2 G. max miR171 GRAS 197 MRT3847_344862C.1 G. max
miR172 AP2 domain 198 PHE0000638 G. max miR172 AP2 domain 199
MRT3847_202930C.3 G. max miR172 AP2 domain 200 MRT3847_21933C.5 G.
max miR172 AP2 domain 201 MRT3847_235857C.3 G. max miR172 AP2
domain 202 MRT3847_257655C.4 G. max miR172 AP2 domain 203
MRT3847_289890C.3 G. max miR172 AP2 domain 204 MRT3847_289891C.3 G.
max miR172 AP2 domain 205 MRT3847_295726C.1 G. max miR172 AP2
domain 206 MRT3847_326790C.1 G. max miR172 AP2 domain 207
MRT3847_329301C.1 G. max miR172 AP2 domain 208 MRT3847_43925C.7 G.
max miR172 AP2 domain 209 MRT3847_46007C.5 G. max miR172 AP2 domain
210 MRT3847_51633C.3 G. max miR172 AP2 domain 211 MRT3847_59804C.6
G. max miR172 APETALA2 212 MRT3847_196945C.3 G. max miR319 Cyclin
213 MRT3847_238163C.3 G. max miR319 PCF 214 MRT3847_262919C.1 G.
max miR319 TCP family transcription factor 215 MRT3847_230131C.1 G.
max miR319 TCP family transcription factor 216 MRT3847_304168C.2 G.
max miR319 TCP family transcription factor 217 MRT3847_336868C.1 G.
max miR319 TCP family transcription factor 218 MRT3847_343365C.1 G.
max miR319 TCP family transcription factor 219 MRT3847_38312C.5 G.
max miR319 TCP family transcription factor 220 MRT3847_103008C.6 G.
max miR319 TCP family transcription factor 221 MRT3847_12165C.5 G.
max miR319 TCP family transcription factor 222 MRT3847_247420C.4 G.
max miR319 TCP family transcription factor 223 MRT3847_294519C.4 G.
max miR319 TCP family transcription factor 224 MRT3847_334277C.1 G.
max miR390 TAS 225 MRT3847_133706C.5 G. max miR390 TAS 226
MRT3847_298568C.2 G. max miR390 TAS 227 MRT3847_60306C.8 G. max
miR393 TIR1 228 MRT3847_238705C.4 G. max miR393 TIR1 229
MRT3847_27973C.7 G. max miR393 TIR1 230 MRT3847_313402C.3 G. max
miR393 Transport inhibitor response 231 MRT3847_329954C.2 G. max
miR393 Transport inhibitor response 232 MRT3847_335477C.1 G. max
miR393 Transport inhibitor response 233 MRT3847_44371C.6 G. max
miR394 F-box domain 234 MRT3847_249313C.3 G. max miR394 F-box
domain 235 MRT3847_260044C.4 G. max miR395 AST 236
MRT3847_118061C.7 G. max miR395 AST 237 MRT3847_120571C.4 G. max
miR395 AST 238 MRT3847_161863C.4 G. max miR395 AST 239
MRT3847_233832C.4 G. max miR395 AST 240 MRT3847_294717C.3 G. max
miR395 AST 241 MRT3847_303988C.3 G. max miR395 AST 242
MRT3847_336528C.1 G. max miR395 AST 243 MRT3847_55707C.5 G. max
miR395 ATP sulfurylase 244 MRT3847_14792C.7 G. max miR395 sulfate
adenylyltransferase 245 MRT3847_331787C.1 G. max miR395 sulfate
transporter 246 MRT3847_10451C.5 G. max miR395 sulfate transporter
247 MRT3847_245035C.3 G. max miR396 GRF 248 PHE0001215 G. max
miR396 Growth-regulating factor 249 MRT3847_183050C.6 G. max miR396
Growth-regulating factor 250 MRT3847_200704C.5 G. max
miR396 Growth-regulating factor 251 MRT3847_21877C.7 G. max miR396
Growth-regulating factor 252 MRT3847_275465C.2 G. max miR396
Growth-regulating factor 253 MRT3847_285089C.5 G. max miR396
Growth-regulating factor 254 MRT3847_307974C.3 G. max miR396
Growth-regulating factor 255 MRT3847_34351C.6 G. max miR396
Growth-regulating factor 256 MRT3847_39577C.5 G. max miR397 Laccase
257 MRT3847_148737C.1 G. max miR397 Laccase 258 MRT3847_196074C.1
G. max miR397 Laccase 259 MRT3847_240006C.2 G. max miR397 Laccase
260 MRT3847_256982C.1 G. max miR397 Laccase 261 MRT3847_25859C.5 G.
max miR397 Laccase 262 MRT3847_29767C.4 G. max miR397 Laccase 263
MRT3847_297900C.1 G. max miR397 Laccase 264 MRT3847_309594C.2 G.
max miR397 Laccase 265 MRT3847_33656C.5 G. max miR397 Laccase 266
MRT3847_347553C.1 G. max miR397 Laccase 267 MRT3847_36695C.5 G. max
miR397 Laccase 268 MRT3847_49069C.6 G. max miR397 Laccase 269
MRT3847_7864C.1 G. max miR397 Laccase 270 MRT3847_99867C.5 G. max
miR398 COPPER/ZINC SUPEROXIDE 271 MRT3847_235546C.3 G. max
DISMUTASE miR400 pentatricopeptide 272 MRT3847_12750C.4 G. max
miR400 pentatricopeptide 273 MRT3847_17367C.3 G. max miR400 PPR 274
MRT3847_10096C.3 G. max miR400 PPR 275 MRT3847_139832C.5 G. max
miR400 PPR 276 MRT3847_141759C.5 G. max miR400 PPR 277
MRT3847_218904C.2 G. max miR400 PPR 278 MRT3847_267668C.2 G. max
miR400 PPR 279 MRT3847_57083C.4 G. max miR408 blue copper protein
280 PHE0000330 G. max miR408 blue copper protein 281
MRT3847_273288C.3 G. max miR408 blue copper protein 282
MRT3847_329905C.2 G. max miR408 blue copper protein 283
MRT3847_336704C.1 G. max miR408 blue copper protein 284
MRT3847_343250C.1 G. max miR408 blue copper protein 285
MRT3847_346770C.1 G. max miR408 blue copper protein 286
MRT3847_349900C.1 G. max miR408 blue copper protein 287
MRT3847_350132C.1 G. max miR408 blue copper protein 288
MRT3847_60064C.6 G. max miR408 blue copper protein 289
MRT3847_66506C.8 G. max miR408 Laccase 290 MRT3847_296270C.2 G. max
miR408 Laccase 291 MRT3847_31127C.7 G. max miR444 MADS box 292
PHE0002647 G. max miR444 MADS box 293 PHE0002648 G. max miR444 MADS
box 294 PHE0015540 G. max miR444 MADS-box 295 MRT3847_247970C.2 G.
max miR444 MADS-box 296 MRT3847_259952C.3 G. max miR472 ATP binding
297 MRT3847_324977C.1 G. max miR472 ATP binding 298
MRT3847_335756C.1 G. max miR472 disease resistance protein 299
MRT3847_348618C.1 G. max miR472 NBS-LRR type disease resistance 300
MRT3847_292513C.3 G. max protein miR472 NBS-LRR type disease
resistance 301 MRT3847_34971C.6 G. max protein miR472/482 disease
resistance protein 302 MRT3847_159134C.1 G. max miR472/482 disease
resistance protein 303 MRT3847_208382C.4 G. max miR472/482 disease
resistance protein 304 MRT3847_229943C.2 G. max miR472/482 disease
resistance protein 305 MRT3847_262606C.4 G. max miR472/482 NBS-LRR
type disease resistance 306 MRT3847_223192C.5 G. max protein
miR472/482 NBS-LRR type disease resistance 307 MRT3847_264890C.3 G.
max protein miR475 Pentatricopeptide repeat 308 MRT3847_204627C.1
G. max miR475 Pentatricopeptide repeat 309 MRT3847_234253C.2 G. max
miR475 Pentatricopeptide repeat 310 MRT3847_289449C.2 G. max miR475
Pentatricopeptide repeat 311 MRT3847_342062C.1 G. max miR475 PPR
312 MRT3847_137370C.4 G. max miR475 PPR 313 MRT3847_196480C.3 G.
max miR475 PPR 314 MRT3847_241148C.2 G. max miR475 PPR 315
MRT3847_30662C.4 G. max miR475 PPR 316 MRT3847_44502C.5 G. max
miR475 PPR-repeat 317 MRT3847_235882C.3 G. max miR477 bHLH 318
MRT3847_117808C.5 G. max miR477 bHLH 319 MRT3847_330789C.2 G. max
miR477 GRAS 320 MRT3847_161254C.2 G. max miR477 GRAS 321
MRT3847_250541C.3 G. max miR482 disease resistance protein 322
MRT3847_216742C.1 G. max miR482 disease resistance protein 323
MRT3847_221164C.1 G. max miR482 disease resistance protein 324
MRT3847_28447C.6 G. max miR482 disease resistance protein 325
MRT3847_302802C.3 G. max miR482 disease resistance protein 326
MRT3847_146432C.5 G. max miR482 disease resistance protein 327
MRT3847_184524C.6 G. max miR482 disease resistance protein 328
MRT3847_268743C.4 G. max miR482 disease resistance protein 329
MRT3847_272693C.2 G. max miR482 disease resistance protein 330
MRT3847_297146C.2 G. max miR482 disease resistance protein 331
MRT3847_314629C.2 G. max miR482 disease resistance protein 332
MRT3847_335514C.1 G. max miR482 disease resistance protein 333
MRT3847_335735C.1 G. max miR482 disease resistance protein 334
MRT3847_337518C.1 G. max miR482 disease resistance protein 335
MRT3847_340947C.1 G. max miR482 disease resistance protein 336
MRT3847_352235C.1 G. max miR482 disease resistance protein 337
MRT3847_63055C.5 G. max miR482 disease resistance protein 338
MRT3847_66636C.5 G. max miR482 Putative disease resistance protein
339 MRT3847_184595C.4 G. max miR824 MADS box 340 PHE0001395 G. max
miR824 MADS box 341 PHE0003427 G. max miR824 MADS box 342
PHE0013854 G. max miR824 MADS-box 343 MRT3847_14550C.4 G. max
miR824 MADS-box 344 MRT3847_39202C.7 G. max miR828 MyB 345
PHE0001477 G. max miR828 MYB 346 MRT3847_346366C.1 G. max miR828
myb-like DNA-binding 347 MRT3847_215219C.3 G. max miR828 myb-like
DNA-binding 348 MRT3847_215220C.2 G. max miR828/858 myb-like
DNA-binding 349 MRT3847_22767C.2 G. max miR857 LAC 350
MRT3847_13225C.3 G. max miR858 MyB 351 PHE0000380 G. max miR858 MYB
352 PHE0001408 G. max miR858 MyB 353 PHE0004448 G. max miR858 MyB
354 PHE0012029 G. max miR858 MyB 355 PHE0015929 G. max miR858 MYB
356 MRT3847_212141C.3 G. max miR858 MYB 357 MRT3847_347736C.1 G.
max miR858 MYB 358 MRT3847_38379C.5 G. max miR858 MYB 359
MRT3847_40737C.7 G. max miR858 MYB 360 MRT3847_41334C.3 G. max
miR858 MYB12 361 MRT3847_51246C.6 G. max miR858 myb-like
DNA-binding 362 MRT3847_131164C.6 G. max miR858 myb-like
DNA-binding 363 MRT3847_137726C.5 G. max miR858 myb-like
DNA-binding 364 MRT3847_228792C.3 G. max miR858 myb-like
DNA-binding 365 MRT3847_255360C.1 G. max miR858 myb-like
DNA-binding 366 MRT3847_255362C.6 G. max miR858 myb-like
DNA-binding 367 MRT3847_260391C.1 G. max miR858 myb-like
DNA-binding 368 MRT3847_261508C.2 G. max miR858 myb-like
DNA-binding 369 MRT3847_270136C.3 G. max miR858 myb-like
DNA-binding 370 MRT3847_290332C.2 G. max miR858 myb-like
DNA-binding 371 MRT3847_294239C.3 G. max miR858 myb-like
DNA-binding 372 MRT3847_322770C.2 G. max miR858 myb-like
DNA-binding 373 MRT3847_32417C.5 G. max miR858 myb-like DNA-binding
374 MRT3847_332192C.1 G. max miR858 myb-like DNA-binding 375
MRT3847_335664C.1 G. max miR858 myb-like DNA-binding 376
MRT3847_34082C.5 G. max miR858 myb-like DNA-binding 377
MRT3847_39825C.5 G. max miR858 myb-like DNA-binding 378
MRT3847_40203C.4 G. max miR858 myb-like DNA-binding 379
MRT3847_41332C.5 G. max miR858 myb-like DNA-binding 380
MRT3847_42168C.6 G. max miR858 myb-like DNA-binding 381
MRT3847_51247C.3 G. max miR858 myb-like DNA-binding 382
MRT3847_52127C.4 G. max miR858 myb-like DNA-binding 383
MRT3847_54395C.5 G. max miR858 myb-like DNA-binding 384
MRT3847_55676C.6 G. max miR156 SBP domain 385 MRT3635_30868C.2
Gossypium hirsutum miR156/157 SBP domain 386 MRT3635_36657C.2 G.
hirsutum miR156/157 SBP domain 387 MRT3635_65765C.1 G. hirsutum
miR156/157 Squamosa Promoter Binding Protein 388 MRT3635_15791C.2
G. hirsutum miR156/157 Squamosa Promoter Binding Protein 389
MRT3635_48230C.2 G. hirsutum miR156/157 Squamosa Promoter Binding
Protein 390 MRT3635_69088C.1 G. hirsutum miR156/157 Squamosa
Promoter Binding Protein 391 MRT3635_69159C.1 G. hirsutum
miR156/157 Squamosa Promoter Binding Protein 392 MRT3635_30369C.2
G. hirsutum miR156/157 Squamosa Promoter Binding Protein 393
MRT3635_56290C.1 G. hirsutum miR156/157 teosinte glume architecture
394 MRT3635_15393C.1 G. hirsutum miR159 MYB65 395 MRT3635_249C.2 G.
hirsutum miR159 myb-like DNA-binding 396 MRT3635_54684C.2 G.
hirsutum miR160 Auxin Response Factor 397 MRT3635_36222C.2 G.
hirsutum miR162 CAF 398 MRT3635_16630C.2 G. hirsutum miR164 NAC
domain protein 399 MRT3635_24172C.2 G. hirsutum miR164 No Apical
Meristem 400 MRT3635_48601C.2 G. hirsutum miR164 No Apical Meristem
401 MRT3635_64345C.1 G. hirsutum miR165/166 class III HD-Zip
protein 402 MRT3635_4809C.2 G. hirsutum miR165/166 class III HD-Zip
protein 403 MRT3635_50942C.2 G. hirsutum miR165/166 class III
HD-Zip protein 404 MRT3635_72188C.1 G. hirsutum miR166 class III
HD-Zip protein 405 MRT3635_12880C.2 G. hirsutum miR167 Auxin
Response Factor 406 MRT3635_13510C.2 G. hirsutum miR167 Auxin
Response Factor 407 MRT3635_14893C.2 G. hirsutum miR167 Auxin
Response Factor 408 MRT3635_24556C.2 G. hirsutum miR167 Auxin
Response Factor 409 MRT3635_59443C.1 G. hirsutum miR168 AGO1 410
MRT3635_43628C.2 G. hirsutum miR168 Argonaute 411 MRT3635_68755C.1
G. hirsutum miR169 CCAAT-binding 412 MRT3635_18720C.2 G. hirsutum
miR169 CCAAT-binding 413 MRT3635_60547C.1 G. hirsutum miR169
CCAAT-binding 414 MRT3635_63602C.1 G. hirsutum miR169 CCAAT-binding
415 MRT3635_751C.2 G. hirsutum miR169 nuclear transcription factor
Y 416 MRT3635_57584C.1 G. hirsutum miR169 nuclear transcription
factor Y 417 MRT3635_63203C.1 G. hirsutum miR169 nuclear
transcription factor Y 418 MRT3635_67492C.1 G. hirsutum miR171 GRAS
419 MRT3635_41132C.2 G. hirsutum miR172 AP2 420 MRT3635_50596C.2 G.
hirsutum miR172 AP2 domain 421 MRT3635_21738C.2 G. hirsutum miR172
AP2 domain 422 MRT3635_5937C.2 G. hirsutum miR172 AP2 domain 423
MRT3635_64989C.1 G. hirsutum miR172 AP2 domain 424 MRT3635_8244C.2
G. hirsutum miR319 TCP 425 MRT3635_31917C.2 G. hirsutum miR319 TCP
family transcription factor 426 MRT3635_40862C.2 G. hirsutum miR319
TCP family transcription factor 427 MRT3635_55735C.1 G. hirsutum
miR393 TIR1 428 MRT3635_18850C.2 G. hirsutum miR393 TIR1 429
MRT3635_35639C.2 G. hirsutum miR393 TIR1 430 MRT3635_68504C.1 G.
hirsutum miR393 Transport inhibitor response 431 MRT3635_18188C.2
G. hirsutum miR393 Transport inhibitor response 432
MRT3635_49076C.2 G. hirsutum miR395 AST 433 MRT3635_73824C.1 G.
hirsutum miR395 sulfate adenylyltransferase 434 MRT3635_15903C.2 G.
hirsutum miR395 sulfate adenylyltransferase 435 MRT3635_48567C.2 G.
hirsutum miR395 sulfate transporter 436 MRT3635_64866C.1 G.
hirsutum miR396 Growth-regulating factor 437 MRT3635_10089C.2 G.
hirsutum miR396 Growth-regulating factor 438 MRT3635_18322C.2 G.
hirsutum miR396 Growth-regulating factor 439 MRT3635_43733C.2 G.
hirsutum miR396 Growth-regulating factor 440 MRT3635_44225C.2 G.
hirsutum miR396 Growth-regulating factor 441 MRT3635_67643C.1 G.
hirsutum miR396 Growth-regulating factor 442 MRT3635_71085C.1 G.
hirsutum miR396 Growth-regulating factor 443 MRT3635_7854C.2 G.
hirsutum miR397 Laccase 444 MRT3635_2612C.2 G. hirsutum miR397
Laccase 445 MRT3635_59330C.1 G. hirsutum miR397 Laccase 446
MRT3635_62379C.1 G. hirsutum miR400 PPR 447 MRT3635_14024C.2 G.
hirsutum miR400 PPR 448 MRT3635_24425C.2 G. hirsutum miR400 PPR 449
MRT3635_62540C.1 G. hirsutum miR400 PPR 450 MRT3635_71976C.1 G.
hirsutum miR408 blue copper protein 451 MRT3635_25321C.2 G.
hirsutum miR408 blue copper protein 452 MRT3635_36078C.2 G.
hirsutum miR408 blue copper protein 453 MRT3635_36080C.2 G.
hirsutum miR408 blue copper protein 454 MRT3635_54561C.2 G.
hirsutum miR408 blue copper protein 455 MRT3635_54936C.2 G.
hirsutum miR444 MADS-box 456 MRT3635_52393C.1 G. hirsutum miR472
ATP binding 457 MRT3635_16581C.2 G. hirsutum miR472/482 NBS-LRR
type disease resistance 458 MRT3635_77272C.1 G. hirsutum protein
miR475 pentatricopeptide 459 MRT3635_73944C.1 G. hirsutum miR475
Pentatricopeptide repeat 460 MRT3635_35992C.1 G. hirsutum miR475
Pentatricopeptide repeat 461 MRT3635_51055C.1 G. hirsutum miR475
PPR 462 MRT3635_36232C.2 G. hirsutum miR475 PPR 463
MRT3635_65837C.1 G. hirsutum miR475 PPR 464 MRT3635_6832C.2 G.
hirsutum miR827 SPX 465 MRT3635_71336C.1 G. hirsutum miR827 zinc
finger 466 MRT3635_61225C.1 G. hirsutum miR828 MYB 467
MRT3635_63902C.1 G. hirsutum miR828 myb-like DNA-binding 468
MRT3635_11678C.2 G. hirsutum miR828 myb-like DNA-binding 469
MRT3635_23974C.2 G. hirsutum miR828 myb-like DNA-binding 470
MRT3635_37632C.1 G. hirsutum miR828 myb-like DNA-binding 471
MRT3635_46849C.2 G. hirsutum miR828 myb-like DNA-binding 472
MRT3635_75185C.1 G. hirsutum miR828/858 MYB 473 MRT3635_12320C.2 G.
hirsutum miR828/858 myb-like DNA-binding 474 MRT3635_25669C.1 G.
hirsutum miR858 MYB 475 MRT3635_11888C.1 G. hirsutum miR858 MYB 476
MRT3635_17735C.1 G. hirsutum miR858 MYB 477 MRT3635_3345C.1 G.
hirsutum miR858 MYB 478 MRT3635_46789C.1 G. hirsutum miR858
myb-like DNA-binding 479 MRT3635_48257C.1 G. hirsutum miR858
myb-like DNA-binding 480 MRT3635_53024C.2 G. hirsutum miR858
myb-like DNA-binding 481 MRT3635_55977C.1 G. hirsutum miR858
myb-like DNA-binding 482 MRT3635_57077C.1 G. hirsutum miR858
myb-like DNA-binding 483 MRT3635_66730C.1 G. hirsutum miR858
myb-like DNA-binding 484 MRT3635_67640C.1 G. hirsutum miR858
myb-like DNA-binding 485 MRT3635_69682C.1 G. hirsutum miR858
myb-like DNA-binding 486 MRT3635_74072C.1 G. hirsutum miR156 SBP
domain 487 MRT4513_33353C.1 Hordeum vulgare
miR156/157 SBP domain 488 MRT4513_19757C.1 H. vulgare miR156/157
SBP domain, miR157 489 MRT4513_52153C.1 H. vulgare miR156/157
SBP-domain, miR157 490 MRT4513_41849C.1 H. vulgare miR156/157
Squamosa Promoter Binding Protein 491 MRT4513_4449C.1 H. vulgare
miR159 myb-like DNA-binding domain 492 MRT4513_1572C.3 H. vulgare
miR159 myb-like DNA-binding domain 493 MRT4513_55409C.1 H. vulgare
miR160 Auxin Response Factor 494 MRT4513_43004C.1 H. vulgare miR160
Auxin Response Factor 495 MRT4513_48930C.1 H. vulgare miR160 Auxin
Response Factor 496 MRT4513_51165C.1 H. vulgare miR160 Auxin
Response Factor 497 MRT4513_9322C.2 H. vulgare miR164 NAC domain
protein 498 MRT4513_51143C.2 H. vulgare miR164 NAC domain protein
499 MRT4513_7890C.1 H. vulgare miR164 No Apical Meristem 500
MRT4513_26199C.1 H. vulgare miR167 Auxin Response Factor 501
MRT4513_29483C.2 H. vulgare miR167 Auxin Response Factor 502
MRT4513_29827C.2 H. vulgare miR167 Auxin Response Factor 503
MRT4513_31779C.1 H. vulgare miR167 Auxin Response Factor 504
MRT4513_47791C.1 H. vulgare miR168 Argonaute 505 MRT4513_31835C.1
H. vulgare miR168 Argonaute 506 MRT4513_43289C.1 H. vulgare miR168
PINHEAD 507 MRT4513_28709C.1 H. vulgare miR169 CCAAT-binding 508
MRT4513_27452C.1 H. vulgare miR169 CCAAT-binding 509
MRT4513_38912C.1 H. vulgare miR169 CCAAT-binding 510
MRT4513_51394C.1 H. vulgare miR170/171 SCL 511 MRT4513_44124C.1 H.
vulgare miR172 AP2 512 MRT4513_6417C.1 H. vulgare miR172 AP2 domain
513 MRT4513_42015C.1 H. vulgare miR319 PCF 514 MRT4513_31590C.1 H.
vulgare miR319 PCF 515 MRT4513_52459C.1 H. vulgare miR393 Transport
inhibitor response 516 MRT4513_12741C.1 H. vulgare miR393 Transport
inhibitor response 517 MRT4513_38675C.1 H. vulgare miR394 F-box 518
MRT4513_23211C.1 H. vulgare miR396 Growth-regulating factor 519
MRT4513_20166C.2 H. vulgare miR396 Growth-regulating factor 520
MRT4513_26009C.2 H. vulgare miR396 Growth-regulating factor 521
MRT4513_33203C.1 H. vulgare miR396 Growth-regulating factor 522
MRT4513_4600C.1 H. vulgare miR396 Growth-regulating factor 523
MRT4513_50332C.1 H. vulgare miR397 Laccase 524 MRT4513_35926C.1 H.
vulgare miR397 Laccase 525 MRT4513_40609C.1 H. vulgare miR398
Copper/zinc superoxide dismutase 526 MRT4513_43414C.2 H. vulgare
miR398 Copper/zinc superoxide dismutase 527 MRT4513_8559C.2 H.
vulgare miR408 blue copper protein 528 MRT4513_31098C.2 H. vulgare
miR472 NBS-LRR disease resistance protein 529 MRT4513_5784C.1 H.
vulgare miR475 pentatricopeptide 530 MRT4513_47541C.1 H. vulgare
miR475 PPR 531 MRT4513_7525C.2 H. vulgare miR482 disease resistance
532 MRT4513_11673C.1 H. vulgare miR858 myb-like DNA-binding 533
MRT4513_11055C.1 H. vulgare miR858 myb-like DNA-binding 534
MRT4513_42246C.1 H. vulgare miR858 myb-like DNA-binding 535
MRT4513_4767C.1 H. vulgare miR858 myb-like DNA-binding 536
MRT4513_5642C.1 H. vulgare miR156/157 SBP domain 537
MRT3880_19943C.1 Medicago sativa miR156/157 SBP domain 538
MRT3880_34839C.1 M. sativa miR156/157 SBP domain 539
MRT3880_54023C.1 M. sativa miR156/157 Squamosa Promoter Binding
Protein 540 MRT3880_59834C.1 M. sativa miR156/157 Squamosa Promoter
Binding Protein 541 MRT3880_62151C.1 M. sativa miR159 myb-like
DNA-binding domain 542 MRT3880_51095C.1 M. sativa miR160 Auxin
Response Factor 543 MRT3880_22965C.1 M. sativa miR160 Auxin
Response Factor 544 MRT3880_28718C.1 M. sativa miR160 Auxin
Response Factor 545 MRT3880_38543C.1 M. sativa miR160 Auxin
Response Factor 546 MRT3880_44036C.1 M. sativa miR161 PPR 547
MRT3880_11000C.1 M. sativa miR161/475 Pentatricopeptide repeat 548
MRT3880_37878C.1 M. sativa miR162 Dicer 549 MRT3880_26893C.1 M.
sativa miR164 NAC domain protein 550 MRT3880_18003C.2 M. sativa
miR164 No Apical Meristem 551 MRT3880_44619C.1 M. sativa miR165/166
class III HD-Zip protein 552 MRT3880_37546C.1 M. sativa miR165/166
class III HD-Zip protein 553 MRT3880_39764C.1 M. sativa miR167
Auxin Response Factor 554 MRT3880_12926C.1 M. sativa miR167 Auxin
Response Factor 555 MRT3880_17672C.1 M. sativa miR167 Auxin
Response Factor 556 MRT3880_25270C.1 M. sativa miR167 Auxin
Response Factor 557 MRT3880_30476C.1 M. sativa miR167 Auxin
Response Factor 558 MRT3880_36150C.1 M. sativa miR167 Auxin
Response Factor 559 MRT3880_470C.1 M. sativa miR169 nuclear
transcription factor Y 560 MRT3880_16272C.2 M. sativa miR169
nuclear transcription factor Y 561 MRT3880_21811C.2 M. sativa
miR169 nuclear transcription factor Y 562 MRT3880_59679C.1 M.
sativa miR170/171 GRAS 563 MRT3880_12452C.1 M. sativa miR170/171
GRAS 564 MRT3880_29125C.1 M. sativa miR170/171 GRAS 565
MRT3880_31130C.1 M. sativa miR170/171 GRAS 566 MRT3880_40896C.1 M.
sativa miR170/171 GRAS 567 MRT3880_63440C.1 M. sativa miR172 AP2
domain 568 MRT3880_36568C.1 M. sativa miR172 AP2 domain 569
MRT3880_39959C.1 M. sativa miR172 AP2 domain 570 MRT3880_55789C.1
M. sativa miR319 TCP 571 MRT3880_2628C.1 M. sativa miR319 TCP
family transcription factor 572 MRT3880_44480C.1 M. sativa miR393
Transport inhibitor response 573 MRT3880_18564C.2 M. sativa miR393
Transport inhibitor response 574 MRT3880_38847C.1 M. sativa miR393
Transport inhibitor response 575 MRT3880_67369C.1 M. sativa miR396
Growth-regulating factor 576 MRT3880_18861C.1 M. sativa miR396
Growth-regulating factor 577 MRT3880_22460C.1 M. sativa miR396
Growth-regulating factor 578 MRT3880_41297C.1 M. sativa miR397
Laccase 579 MRT3880_43121C.1 M. sativa miR397 Laccase 580
MRT3880_56114C.2 M. sativa miR400 pentatricopeptide 581
MRT3880_53970C.1 M. sativa miR400 PPR 582 MRT3880_14263C.1 M.
sativa miR400 PPR 583 MRT3880_65540C.1 M. sativa miR400/475
Pentatricopeptide repeat 584 MRT3880_27459C.1 M. sativa miR400/475
Pentatricopeptide repeat 585 MRT3880_49876C.1 M. sativa miR400/475
PPR 586 MRT3880_44329C.1 M. sativa miR408 blue copper protein 587
MRT3880_46744C.2 M. sativa miR408 blue copper protein 588
MRT3880_53025C.1 M. sativa miR408 blue copper protein 589
MRT3880_5838C.1 M. sativa miR472 ATP binding 590 MRT3880_29560C.1
M. sativa miR472 ATP binding 591 MRT3880_30961C.1 M. sativa miR472
ATP binding 592 MRT3880_48315C.1 M. sativa miR472 ATP binding 593
MRT3880_53199C.1 M. sativa miR472 ATP binding 594 MRT3880_54030C.2
M. sativa miR472 ATP binding 595 MRT3880_57442C.1 M. sativa miR472
disease resistance protein 596 MRT3880_10080C.1 M. sativa miR472
disease resistance protein 597 MRT3880_12559C.2 M. sativa miR472
disease resistance protein 598 MRT3880_17698C.1 M. sativa miR472
disease resistance protein 599 MRT3880_21650C.1 M. sativa miR472
disease resistance protein 600 MRT3880_22933C.1 M. sativa miR472
disease resistance protein 601 MRT3880_26007C.1 M. sativa miR472
disease resistance protein 602 MRT3880_28379C.1 M. sativa miR472
disease resistance protein 603 MRT3880_3002C.1 M. sativa miR472
disease resistance protein 604 MRT3880_38354C.1 M. sativa miR472
disease resistance protein 605 MRT3880_41496C.1 M. sativa miR472
disease resistance protein 606 MRT3880_51100C.1 M. sativa miR472
disease resistance protein 607 MRT3880_5498C.1 M. sativa miR472
disease resistance protein 608 MRT3880_59891C.1 M. sativa miR472
NBS-LRR type disease resistance 609 MRT3880_45204C.1 M. sativa
protein miR472 NBS-LRR type disease resistance 610 MRT3880_52654C.1
M. sativa protein miR472 NBS-LRR type disease resistance 611
MRT3880_66600C.1 M. sativa protein miR472 NBS-LRR type disease
resistance 612 MRT3880_7642C.1 M. sativa protein miR472/482 disease
resistance protein 613 MRT3880_19707C.1 M. sativa miR472/482
disease resistance protein 614 MRT3880_19814C.1 M. sativa
miR472/482 disease resistance protein 615 MRT3880_26877C.1 M.
sativa miR472/482 disease resistance protein 616 MRT3880_2935C.1 M.
sativa miR472/482 disease resistance protein 617 MRT3880_36417C.1
M. sativa miR472/482 disease resistance protein 618
MRT3880_44875C.1 M. sativa miR472/482 disease resistance protein
619 MRT3880_5004C.1 M. sativa miR472/482 disease resistance protein
620 MRT3880_52723C.1 M. sativa miR472/482 disease resistance
protein 621 MRT3880_57846C.1 M. sativa miR472/482 disease
resistance protein 622 MRT3880_63259C.1 M. sativa miR472/482
disease resistance protein 623 MRT3880_6363C.1 M. sativa miR472/482
disease resistance protein 624 MRT3880_65083C.1 M. sativa
miR472/482, disease resistance protein, leucine rich 625
MRT3880_55187C.1 M. sativa miR779 repeat miR475 Pentatricopeptide
repeat 626 MRT3880_13183C.1 M. sativa miR475 Pentatricopeptide
repeat 627 MRT3880_42014C.1 M. sativa miR475 Pentatricopeptide
repeat 628 MRT3880_46171C.1 M. sativa miR475 PPR 629
MRT3880_12164C.1 M. sativa miR475 PPR 630 MRT3880_12471C.1 M.
sativa miR475 PPR 631 MRT3880_16503C.1 M. sativa miR475 PPR 632
MRT3880_22609C.1 M. sativa miR475 PPR 633 MRT3880_35917C.1 M.
sativa miR475 PPR 634 MRT3880_39210C.1 M. sativa miR475 PPR 635
MRT3880_55838C.1 M. sativa miR475 PPR 636 MRT3880_56789C.1 M.
sativa miR475 PPR 637 MRT3880_65802C.1 M. sativa miR475 PPR 638
MRT3880_870C.1 M. sativa miR475 PPR 639 MRT3880_9632C.1 M. sativa
miR476 Pentatricopeptide repeat 640 MRT3880_13782C.1 M. sativa
miR477 GRAS 641 MRT3880_1038C.1 M. sativa miR477 GRAS 642
MRT3880_14765C.1 M. sativa miR477 GRAS 643 MRT3880_28393C.1 M.
sativa miR477 GRAS 644 MRT3880_31231C.1 M. sativa miR477 GRAS 645
MRT3880_42028C.1 M. sativa miR477 GRAS 646 MRT3880_51782C.1 M.
sativa miR482 disease resistance protein 647 MRT3880_12508C.1 M.
sativa miR482 disease resistance protein 648 MRT3880_16156C.1 M.
sativa miR482 disease resistance protein 649 MRT3880_22305C.1 M.
sativa miR482 disease resistance protein 650 MRT3880_30579C.1 M.
sativa miR482 disease resistance protein 651 MRT3880_38019C.1 M.
sativa miR482 disease resistance protein 652 MRT3880_4159C.1 M.
sativa miR482 disease resistance protein 653 MRT3880_49695C.1 M.
sativa miR482 disease resistance protein 654 MRT3880_54965C.1 M.
sativa miR482 disease resistance protein 655 MRT3880_56400C.1 M.
sativa miR482 disease resistance protein 656 MRT3880_56673C.1 M.
sativa miR482 disease resistance protein 657 MRT3880_58830C.1 M.
sativa miR482 disease resistance protein 658 MRT3880_58849C.1 M.
sativa miR482 disease resistance protein 659 MRT3880_59857C.1 M.
sativa miR482 disease resistance protein 660 MRT3880_60136C.1 M.
sativa miR482 disease resistance protein 661 MRT3880_65552C.2 M.
sativa miR482 disease resistance protein 662 MRT3880_8722C.1 M.
sativa miR482 disease resistance protein 663 MRT3880_9618C.1 M.
sativa miR828 myb-like DNA-binding 664 MRT3880_19611C.1 M. sativa
miR858 myb-like DNA-binding 665 MRT3880_10365C.1 M. sativa miR858
myb-like DNA-binding 666 MRT3880_12267C.1 M. sativa miR858 myb-like
DNA-binding 667 MRT3880_19438C.1 M. sativa miR858 myb-like
DNA-binding 668 MRT3880_23642C.1 M. sativa miR858 myb-like
DNA-binding 669 MRT3880_33147C.1 M. sativa miR858 myb-like
DNA-binding 670 MRT3880_34889C.1 M. sativa miR858 myb-like
DNA-binding 671 MRT3880_39946C.1 M. sativa miR858 myb-like
DNA-binding 672 MRT3880_55009C.1 M. sativa miR858 myb-like
DNA-binding 673 MRT3880_56414C.1 M. sativa miR858 myb-like
DNA-binding 674 MRT3880_62538C.1 M. sativa miR858 myb-like
DNA-binding 675 MRT3880_801C.1 M. sativa miR858 myb-like
DNA-binding 676 MRT3880_8393C.1 M. sativa miR859 F-box protein 677
MRT3880_46176C.1 M. sativa miR859 F-box protein 678
MRT3880_47002C.1 M. sativa miRMON13 PPR 679 MRT3880_52640C.1 M.
sativa miRMON13 PPR 680 MRT3880_60915C.1 M. sativa miR156 SBP
domain 681 MRT4530_118092C.3 Oryza sativa miR156 SBP domain 682
MRT4530_135991C.4 O. sativa miR156 SBP domain 683 MRT4530_257640C.1
O. sativa miR156 SBP-domain 684 MRT4530_142142C.4 O. sativa miR156
Squamosa Promoter Binding Protein 685 MRT4530_195506C.2 O. sativa
miR156 Squamosa Promoter Binding Protein 686 MRT4530_220364C.2 O.
sativa miR156 Squamosa Promoter Binding Protein 687
MRT4530_236277C.1 O. sativa miR156 Squamosa Promoter Binding
Protein 688 MRT4530_53217C.5 O. sativa miR156 Squamosa Promoter
Binding Protein 689 MRT4530_6964C.4 O. sativa miR159 MYB 690
MRT4530_103606C.2 O. sativa miR159 myb-like 691 MRT4530_82994C.2 O.
sativa miR159 myb-like DNA-binding domain 692 MRT4530_103605C.3 O.
sativa miR159 myb-like DNA-binding domain 693 MRT4530_156102C.3 O.
sativa miR159 myb-like DNA-binding domain 694 MRT4530_181046C.3 O.
sativa miR159 myb-like DNA-binding domain 695 MRT4530_42135C.5 O.
sativa miR160 ARF 696 PHE0003527 O. sativa miR160 ARF 697
PHE0003528 O. sativa miR160 Auxin Response Factor 698
MRT4530_228913C.1 O. sativa miR160 Auxin Response Factor 699
MRT4530_69952C.4 O. sativa miR160 Auxin Response Factor 700
MRT4530_71017C.4 O. sativa miR160 Auxin Response Factor 701
MRT4530_75962C.5 O. sativa miR162 CAF 702 MRT4530_212066C.2 O.
sativa miR164 NAC 703 MRT4530_224181C.2 O. sativa miR164 NAC domain
protein 704 MRT4530_178256C.3 O. sativa miR164 NAC domain protein
705 MRT4530_221769C.1 O. sativa miR164 NAC1 706 MRT4530_141528C.5
O. sativa miR164 No Apical Meristem 707 MRT4530_147737C.4 O. sativa
miR164 No Apical Meristem 708 MRT4530_157393C.3 O. sativa miR166
HD-ZIP 709 MRT4530_253068C.2 O. sativa miR167 ARF 710 PHE0003657 O.
sativa miR167 Auxin Response Factor 711 MRT4530_86291C.3 O. sativa
miR168 Argonaute 712 MRT4530_147864C.3 O. sativa miR169
CCAAT-binding 713 MRT4530_156068C.3 O. sativa miR169 CCAAT-binding
714 MRT4530_52650C.3 O. sativa miR169 CCAAT-binding 715
MRT4530_98042C.6 O. sativa miR171 GRAS 716 MRT4530_157676C.3 O.
sativa miR171 GRAS 717 MRT4530_159257C.2 O. sativa miR171 GRAS 718
MRT4530_177712C.1 O. sativa miR171 GRAS 719 MRT4530_64038C.2 O.
sativa miR171 Scarecrow-like 720 MRT4530_146050C.4 O. sativa miR171
SCL 721 MRT4530_111185C.3 O. sativa miR171 SCL 722 MRT4530_12928C.2
O. sativa miR171 SCL 723 MRT4530_88963C.6 O. sativa miR172 AP2 724
PHE0003882 O. sativa miR172 AP2 domain 725 MRT4530_160275C.3 O.
sativa miR172 AP2 domain 726 MRT4530_56773C.3 O. sativa miR319 TCP
family transcription factor 727 MRT4530_154891C.2 O. sativa miR319
TCP family transcription factor 728 MRT4530_9431C.5 O. sativa
miR319 TCP3 729 MRT4530_151800C.2 O. sativa
miR393 Transport inhibitor response 730 MRT4530_241313C.2 O. sativa
miR395 ATP sulfurylase 731 MRT4530_16384C.4 O. sativa miR395
sulfate transporter 732 MRT4530_33633C.6 O. sativa miR396
Growth-regulating factor 733 PHE0000026 O. sativa miR396
Growth-regulating factor 734 MRT4530_140789C.3 O. sativa miR396
Growth-regulating factor 735 MRT4530_145151C.4 O. sativa miR396
Growth-regulating factor 736 MRT4530_147352C.3 O. sativa miR396
Growth-regulating factor 737 MRT4530_180707C.1 O. sativa miR396
Growth-regulating factor 738 MRT4530_221461C.1 O. sativa miR396
Growth-regulating factor 739 MRT4530_63308C.3 O. sativa miR396
Growth-regulating factor 740 MRT4530_73195C.3 O. sativa miR396
Growth-regulating factor 741 MRT4530_83576C.4 O. sativa miR397
Laccase 742 MRT4530_148379C.4 O. sativa miR397 Laccase 743
MRT4530_181828C.1 O. sativa miR397 Laccase 744 MRT4530_237569C.1 O.
sativa miR397 Laccase 745 MRT4530_60143C.3 O. sativa miR408 blue
copper protein 746 MRT4530_137979C.3 O. sativa miR408 blue copper
protein 747 MRT4530_260849C.1 O. sativa miR408 blue copper protein
748 MRT4530_40477C.6 O. sativa miR408 Laccase 749 MRT4530_160612C.2
O. sativa miR408 Laccase 750 MRT4530_169405C.1 O. sativa miR444
MADS 751 MRT4530_27947C.3 O. sativa miR444 MADS 752
MRT4530_78475C.3 O. sativa miR444 MADS box 753 PHE0001381 O. sativa
miR444 MADS box 754 PHE0015548 O. sativa miR444 MADS box 755
PHE0015549 O. sativa miR444 MADS-box 756 PHE0003829 O. sativa
miR444 MADS-box 757 MRT4530_196636C.3 O. sativa miR809 Mlo 758
MRT4530_59197C.5 O. sativa miR538 MADS-box 759 PHE0014613
Physcomitrella patens miR156/157 SBP domain 760 MRT4558_6587C.1
Sorghum bicolor miR156/157 SBP-domain 761 MRT4558_12680C.1 S.
bicolor miR156/157 Squamosa Promoter Binding Protein 762
MRT4558_8644C.2 S. bicolor miR159 GAMYB 763 MRT4558_37619C.1 S.
bicolor miR160 Auxin Response Factor 764 MRT4558_27799C.1 S.
bicolor miR164 NAC domain protein 765 MRT4558_43436C.1 S. bicolor
miR164 NAC domain protein 766 MRT4558_4564C.2 S. bicolor miR164
NAC1 767 MRT4558_43081C.1 S. bicolor miR164 No Apical Meristem 768
MRT4558_41467C.1 S. bicolor miR165/166 class III HD-Zip protein 769
MRT4558_27560C.1 S. bicolor miR167 Auxin Response Factor 770
MRT4558_10718C.3 S. bicolor miR167 Auxin Response Factor 771
MRT4558_1659C.2 S. bicolor miR167 Auxin Response Factor 772
MRT4558_37108C.1 S. bicolor miR169 CCAAT-binding 773
MRT4558_11671C.2 S. bicolor miR169 CCAAT-binding 774
MRT4558_13240C.2 S. bicolor miR169 CCAAT-binding 775
MRT4558_19368C.2 S. bicolor miR169 CCAAT-binding 776
MRT4558_8287C.2 S. bicolor miR170/171 SCL 777 MRT4558_7655C.1 S.
bicolor miR172 AP2 domain 778 MRT4558_25704C.2 S. bicolor miR393
Transport inhibitor response 779 MRT4558_1226C.2 S. bicolor miR393
Transport inhibitor response 780 MRT4558_20000C.2 S. bicolor miR394
F-box domain 781 MRT4558_11973C.2 S. bicolor miR395 sulfate
adenylyltransferase 782 MRT4558_11861C.1 S. bicolor miR395 Sulfate
transporter 783 MRT4558_24400C.2 S. bicolor miR396
Growth-regulating factor 784 MRT4558_13321C.2 S. bicolor miR400
Pentatricopeptide repeat 785 MRT4558_43831C.1 S. bicolor miR408
blue copper protein 786 MRT4558_16166C.2 S. bicolor miR408 blue
copper protein 787 MRT4558_8981C.2 S. bicolor miR408 Laccase 788
MRT4558_40844C.1 S. bicolor miR444 MADS-box 789 MRT4558_11440C.2 S.
bicolor miR472 ATP binding 790 MRT4558_33723C.1 S. bicolor miR475
PPR 791 MRT4558_5261C.2 S. bicolor miR536 F-box protein 792
MRT4558_34710C.1 S. bicolor miR858 myb-like DNA-binding 793
MRT4558_5881C.2 S. bicolor miR858 myb-like DNA-binding 794
MRT4558_642C.1 S. bicolor miR159 myb protein 795 MRT4565_281735C.1
Triticum aestivum miR169 CCAAT 796 MRT4565_240119C.2 T. aestivum
miR169 CCAAT 797 MRT4565_270644C.2 T. aestivum miR172 AP2 798
MRT4565_247090C.1 T. aestivum miR394 F-box 799 MRT4565_259298C.2 T.
aestivum miR444 MADS box 800 PHE0002649 T. aestivum miR444 MADS-box
801 MRT4565_247066C.1 T. aestivum miR444 MADS-box 802
MRT4565_258649C.1 T. aestivum miR529 AP2 803 MRT4565_278632C.2 T.
aestivum miR858 MYB 804 MRT4565_223049C.1 T. aestivum miR165/166
REV 805 PHE0012638 unidentified miR824 MADS box 806 PHE0015528
unidentified miR824 MADS box 807 PHE0015545 unidentified miR1029
erf 808 MRT4577_148956C.8 Zea mays miR1029 erf 809
MRT4577_267494C.5 Z. mays miR1029 erf 810 MRT4577_389477C.2 Z. mays
miR1029 erf 811 MRT4577_48700C.7 Z. mays miR1029 erf 812
MRT4577_565542C.1 Z. mays miR1029 erf 813 MRT4577_600239C.1 Z. mays
miR156 Squamosa Promoter Binding 814 MRT4577_396357C.4 Z. mays
miR156/157 SBP domain 815 MRT4577_122478C.6 Z. mays miR156/157 SBP
domain 816 MRT4577_270892C.4 Z. mays miR156/157 SBP domain 817
MRT4577_334372C.5 Z. mays miR156/157 SBP domain 818
MRT4577_532824C.3 Z. mays miR156/157 SBP domain 819
MRT4577_535297C.2 Z. mays miR156/157 SBP domain 820
MRT4577_537670C.2 Z. mays miR156/157 SBP domain 821
MRT4577_565057C.1 Z. mays miR156/157 SBP domain 822
MRT4577_568647C.1 Z. mays miR156/157 SBP domain 823
MRT4577_571545C.1 Z. mays miR156/157 SBP domain 824
MRT4577_644419C.1 Z. mays miR156/157 SBP-domain 825
MRT4577_23629C.7 Z. mays miR156/157 SBP-domain 826
MRT4577_295538C.7 Z. mays miR156/157 SBP-domain 827
MRT4577_31704C.9 Z. mays miR156/157 Squamosa Promoter Binding 828
MRT4577_427964C.4 Z. mays miR156/157 Squamosa Promoter Binding 829
MRT4577_461098C.3 Z. mays miR156/157 Squamosa Promoter Binding
Protein 830 MRT4577_137984C.6 Z. mays miR156/157 Squamosa Promoter
Binding Protein 831 MRT4577_188360C.6 Z. mays miR156/157 Squamosa
Promoter Binding Protein 832 MRT4577_205098C.7 Z. mays miR156/157
Squamosa Promoter Binding Protein 833 MRT4577_26483C.7 Z. mays
miR156/157 Squamosa Promoter Binding Protein 834 MRT4577_341149C.6
Z. mays miR156/157 Squamosa Promoter Binding Protein 835
MRT4577_383301C.4 Z. mays miR156/157 Squamosa Promoter Binding
Protein 836 MRT4577_42534C.9 Z. mays miR156/157 Squamosa Promoter
Binding Protein 837 MRT4577_564644C.1 Z. mays miR156/157 Squamosa
Promoter Binding Protein 838 MRT4577_619443C.1 Z. mays miR156/157
Squamosa Promoter-Binding 839 MRT4577_333683C.4 Z. mays miR156/157
Squamosa Promoter-Binding 840 MRT4577_38044C.8 Z. mays miR156/157
teosinte glume architecture 841 MRT4577_181019C.5 Z. mays
miR156/157 teosinte glume architecture 842 MRT4577_78773C.8 Z. mays
miR159 GAMYB 843 MRT4577_481577C.2 Z. mays miR159 MYB 844
MRT4577_210747C.5 Z. mays miR159 MYB 845 MRT4577_542744C.2 Z. mays
miR159 myb-like 846 MRT4577_298452C.5 Z. mays miR159 myb-like
DNA-binding 847 MRT4577_565447C.1 Z. mays miR159 myb-like
DNA-binding 848 MRT4577_565456C.1 Z. mays miR159 myb-like
DNA-binding domain 849 MRT4577_30813C.8 Z. mays miR159 myb-like
DNA-binding domain 850 MRT4577_390477C.4 Z. mays miR159 myb-like
DNA-binding domain 851 MRT4577_391124C.5 Z. mays miR159 myb-like
DNA-binding domain 852 MRT4577_416957C.3 Z. mays miR159 myb-like
DNA-binding domain 853 MRT4577_545477C.2 Z. mays miR159 myb-like
DNA-binding domain 854 MRT4577_582653C.1 Z. mays miR159 myb-like
DNA-binding domain 855 MRT4577_598088C.1 Z. mays miR159 myb-like
DNA-binding domain 856 MRT4577_605039C.1 Z. mays miR159 myb-like
DNA-binding domain 857 MRT4577_613992C.1 Z. mays miR159 myb-like
DNA-binding domain 858 MRT4577_622542C.1 Z. mays miR159 myb-like
DNA-binding domain 859 MRT4577_709777C.1 Z. mays miR159 myb-like
DNA-binding domain 860 MRT4577_77765C.6 Z. mays miR160 Auxin
Response Factor 861 MRT4577_256734C.4 Z. mays miR160 Auxin Response
Factor 862 MRT4577_258637C.3 Z. mays miR160 Auxin Response Factor
863 MRT4577_385317C.4 Z. mays miR160 Auxin Response Factor 864
MRT4577_400043C.5 Z. mays miR160 Auxin Response Factor 865
MRT4577_41620C.7 Z. mays miR160 Auxin Response Factor 866
MRT4577_429671C.4 Z. mays miR160 Auxin Response Factor 867
MRT4577_430512C.4 Z. mays miR160 Auxin Response Factor 868
MRT4577_448022C.1 Z. mays miR160 Auxin Response Factor 869
MRT4577_503622C.2 Z. mays miR160 Auxin Response Factor 870
MRT4577_569655C.1 Z. mays miR160 Auxin Response Factor 871
MRT4577_605037C.1 Z. mays miR161 PPR 872 MRT4577_219343C.5 Z. mays
miR161 PPR 873 MRT4577_338127C.1 Z. mays miR161 PPR 874
MRT4577_381918C.5 Z. mays miR161 PPR 875 MRT4577_549370C.2 Z. mays
miR161 PPR 876 MRT4577_653452C.1 Z. mays miR162 Dicer 877
MRT4577_226226C.4 Z. mays miR162 Dicer 878 MRT4577_50615C.6 Z. mays
miR162 Dicer 879 MRT4577_592675C.1 Z. mays miR164 NAC domain
protein 880 MRT4577_686098C.1 Z. mays miR164 NAC domain protein 881
MRT4577_98755C.5 Z. mays miR164 NAC1 882 PHE0003788 Z. mays miR164
No Apical Meristem 883 MRT4577_105083C.9 Z. mays miR164 No Apical
Meristem 884 MRT4577_16045C.7 Z. mays miR164 No Apical Meristem 885
MRT4577_256695C.4 Z. mays miR164 No Apical Meristem 886
MRT4577_29326C.8 Z. mays miR164 No Apical Meristem 887
MRT4577_317955C.5 Z. mays miR164 No Apical Meristem 888
MRT4577_370828C.5 Z. mays miR164 No Apical Meristem 889
MRT4577_394716C.4 Z. mays miR164 No Apical Meristem 890
MRT4577_586054C.1 Z. mays miR164 No Apical Meristem 891
MRT4577_625707C.1 Z. mays miR164 No Apical Meristem 892
MRT4577_629408C.1 Z. mays miR164 No Apical Meristem 893
MRT4577_705865C.1 Z. mays miR164 No Apical Meristem 894
MRT4577_9951C.8 Z. mays miR165/166 class III HD-Zip protein 895
MRT4577_197925C.4 Z. mays miR165/166 class III HD-Zip protein 896
MRT4577_200605C.3 Z. mays miR165/166 class III HD-Zip protein 897
MRT4577_320718C.6 Z. mays miR165/166 class III HD-Zip protein 898
MRT4577_43102C.9 Z. mays miR165/166 class III HD-Zip protein 899
MRT4577_535928C.2 Z. mays miR165/166 class III HD-Zip protein 900
MRT4577_568616C.1 Z. mays miR165/166 class III HD-Zip protein 901
MRT4577_613062C.1 Z. mays miR165/166 class III HD-Zip protein 902
MRT4577_659410C.1 Z. mays miR165/166 class III HD-Zip protein 903
MRT4577_673351C.1 Z. mays miR165/166 HD-ZIP 904 PHE0008043 Z. mays
miR165/166 Rev 905 PHE0007773 Z. mays miR165/166 Rev 906 PHE0012657
Z. mays miR165/166 rolled leaf 907 MRT4577_229497C.6 Z. mays
miR165/166 rolled leaf 908 MRT4577_312384C.3 Z. mays miR165/166
rolled leaf 909 MRT4577_342259C.4 Z. mays miR165/166 rolled leaf
910 MRT4577_442838C.4 Z. mays miR165/166 rolled leaf 911
MRT4577_535676C.2 Z. mays miR165/166 rolled leaf 912
MRT4577_566770C.1 Z. mays miR165/166 rolled leaf 913
MRT4577_586718C.1 Z. mays miR167 ARF 914 PHE0003656 Z. mays miR167
Auxin Response Factor 915 MRT4577_267543C.4 Z. mays miR167 Auxin
Response Factor 916 MRT4577_267545C.6 Z. mays miR167 Auxin Response
Factor 917 MRT4577_306050C.5 Z. mays miR167 Auxin Response Factor
918 MRT4577_310720C.4 Z. mays miR167 Auxin Response Factor 919
MRT4577_339989C.4 Z. mays miR167 Auxin Response Factor 920
MRT4577_35746C.4 Z. mays miR167 Auxin Response Factor 921
MRT4577_360403C.2 Z. mays miR167 Auxin Response Factor 922
MRT4577_377896C.4 Z. mays miR167 Auxin Response Factor 923
MRT4577_45522C.9 Z. mays miR167 Auxin Response Factor 924
MRT4577_509023C.3 Z. mays miR167 Auxin Response Factor 925
MRT4577_521851C.2 Z. mays miR167 Auxin Response Factor 926
MRT4577_536912C.2 Z. mays miR167 Auxin Response Factor 927
MRT4577_569979C.1 Z. mays miR167 Auxin Response Factor 928
MRT4577_650810C.1 Z. mays miR167 Auxin Response Factor 929
MRT4577_676039C.1 Z. mays miR167 Auxin Response Factor 930
MRT4577_680014C.1 Z. mays miR167 Auxin Response Factor 931
MRT4577_681088C.1 Z. mays miR167 Auxin Response Factor 932
MRT4577_681995C.1 Z. mays miR167 Auxin Response Factor 933
MRT4577_683953C.1 Z. mays miR167 Auxin Response Factor 934
MRT4577_684325C.1 Z. mays miR167 Auxin Response Factor 935
MRT4577_8821C.7 Z. mays miR168 Argonaute 936 MRT4577_247045C.8 Z.
mays miR168 Argonaute 937 MRT4577_29086C.7 Z. mays miR168 Argonaute
938 MRT4577_418712C.5 Z. mays miR168 Argonaute 939 MRT4577_57570C.9
Z. mays miR168 Argonaute 940 MRT4577_577443C.1 Z. mays miR169
CCAAT-binding 941 MRT4577_40749C.8 Z. mays miR169 CCAAT-binding 942
MRT4577_428392C.4 Z. mays miR169 CCAAT-binding 943
MRT4577_434247C.4 Z. mays miR169 CCAAT-binding 944
MRT4577_536961C.2 Z. mays miR169 CCAAT-binding 945
MRT4577_536962C.2 Z. mays miR169 CCAAT-binding 946
MRT4577_540147C.2 Z. mays miR169 CCAAT-binding 947
MRT4577_556372C.2 Z. mays miR169 CCAAT-binding 948
MRT4577_570254C.1 Z. mays miR169 CCAAT-binding 949
MRT4577_668660C.1 Z. mays miR169 CCAAT-binding 950
MRT4577_693949C.1 Z. mays miR169 CCAAT-binding 951
MRT4577_701125C.1 Z. mays miR170/171 SCL 952 PHE0006551 Z. mays
miR170/171 SCL 953 MRT4577_140896C.6 Z. mays miR170/171 SCL 954
MRT4577_234039C.6 Z. mays miR170/171 SCL 955 MRT4577_269667C.5 Z.
mays miR170/171 SCL 956 MRT4577_520619C.2 Z. mays miR170/171 SCL
957 MRT4577_617401C.1 Z. mays miR170/171 SCL 958 MRT4577_75777C.8
Z. mays miR171 GRAS 959 MRT4577_26778C.8 Z. mays miR171 GRAS 960
MRT4577_30852C.6 Z. mays miR171 GRAS 961 MRT4577_683754C.1 Z. mays
miR171 GRAS 962 MRT4577_687943C.1 Z. mays miR171 Scarecrow 963
MRT4577_569322C.1 Z. mays miR172 AP2 964 PHE0006602 Z. mays miR172
AP2 domain 965 MRT4577_12523C.7 Z. mays miR172 AP2 domain 966
MRT4577_27478C.9 Z. mays miR172 AP2 domain 967 MRT4577_304712C.4 Z.
mays miR172 AP2 domain 968 MRT4577_307553C.7 Z. mays miR172 AP2
domain 969 MRT4577_431122C.3 Z. mays miR172 AP2 domain 970
MRT4577_455774C.3 Z. mays miR172 AP2 domain 971 MRT4577_468762C.3
Z. mays
miR172 AP2 domain 972 MRT4577_548310C.2 Z. mays miR172 AP2 domain
973 MRT4577_556612C.2 Z. mays miR172 AP2 domain 974
MRT4577_597136C.1 Z. mays miR172 AP2 domain 975 MRT4577_669210C.1
Z. mays miR172 AP2 domain 976 MRT4577_676464C.1 Z. mays miR172 AP2
domain 977 MRT4577_708079C.1 Z. mays miR172 APETALA2 978
MRT4577_49517C.8 Z. mays miR172 APETALA2 979 MRT4577_700043C.1 Z.
mays miR172 Glossy15 980 PHE0000011 Z. mays miR319 Cyclin 981
PHE0001434 Z. mays miR319 PCF 982 MRT4577_427906C.4 Z. mays miR319
PCF 983 MRT4577_480991C.1 Z. mays miR319 PCF 984 MRT4577_568064C.1
Z. mays miR319 PCF 985 MRT4577_590917C.1 Z. mays miR319 PCF 986
MRT4577_679533C.1 Z. mays miR319 PCF 987 MRT4577_680167C.1 Z. mays
miR319 TCP family transcription factor 988 MRT4577_147719C.7 Z.
mays miR319 TCP family transcription factor 989 MRT4577_221733C.7
Z. mays miR319 TCP family transcription factor 990
MRT4577_275063C.6 Z. mays miR319 TCP family transcription factor
991 MRT4577_30525C.6 Z. mays miR319 TCP family transcription factor
992 MRT4577_340633C.4 Z. mays miR319 TCP family transcription
factor 993 MRT4577_557860C.2 Z. mays miR319 TCP family
transcription factor 994 MRT4577_558102C.2 Z. mays miR319 TCP
family transcription factor 995 MRT4577_568063C.1 Z. mays miR319
TCP family transcription factor 996 MRT4577_571095C.1 Z. mays
miR319 TCP family transcription factor 997 MRT4577_590269C.1 Z.
mays miR319 TCP family transcription factor 998 MRT4577_686625C.1
Z. mays miR390 TAS 999 MRT4577_306288C.5 Z. mays miR390 TAS 1000
MRT4577_325578C.3 Z. mays miR390 TAS 1001 MRT4577_687438C.1 Z. mays
miR390 TAS 1002 MRT4577_72903C.4 Z. mays miR393 F-box 1003
PHE0000546 Z. mays miR393 F-box 1004 PHE0000912 Z. mays miR393
Transport inhibitor response 1005 MRT4577_39097C.9 Z. mays miR393
Transport inhibitor response 1006 MRT4577_546333C.2 Z. mays miR393
Transport inhibitor response 1007 MRT4577_560980C.2 Z. mays miR393
Transport inhibitor response 1008 MRT4577_656737C.1 Z. mays miR393
Transport inhibitor response 1009 MRT4577_688815C.1 Z. mays miR394
F-box domain 1010 MRT4577_56429C.8 Z. mays miR394 F-box domain 1011
MRT4577_613832C.1 Z. mays miR395 AST 1012 MRT4577_293072C.7 Z. mays
miR395 AST 1013 MRT4577_57393C.8 Z. mays miR395 AST 1014
MRT4577_594643C.1 Z. mays miR395 AST 1015 MRT4577_655078C.1 Z. mays
miR395 AST 1016 MRT4577_681126C.1 Z. mays miR395 ATP sulfurylase
1017 MRT4577_118322C.5 Z. mays miR395 ATP sulfurylase 1018
MRT4577_453989C.4 Z. mays miR395 sulfate adenylyltransferase 1019
MRT4577_386324C.4 Z. mays miR395 sulfate adenylyltransferase 1020
MRT4577_57434C.9 Z. mays miR395 sulfate adenylyltransferase 1021
MRT4577_694623C.1 Z. mays miR395 sulfate adenylyltransferase 1022
MRT4577_709359C.1 Z. mays miR395 sulfate transporter 1023
MRT4577_644561C.1 Z. mays miR396 Growth-regulating factor 1024
PHE0000025 Z. mays miR396 Growth-regulating factor 1025 PHE0000289
Z. mays miR396 Growth-regulating factor 1026 PHE0001216 Z. mays
miR396 Growth-regulating factor 1027 MRT4577_215581C.4 Z. mays
miR396 Growth-regulating factor 1028 MRT4577_215583C.5 Z. mays
miR396 Growth-regulating factor 1029 MRT4577_232004C.7 Z. mays
miR396 Growth-regulating factor 1030 MRT4577_24924C.7 Z. mays
miR396 Growth-regulating factor 1031 MRT4577_266456C.6 Z. mays
miR396 Growth-regulating factor 1032 MRT4577_278593C.3 Z. mays
miR396 Growth-regulating factor 1033 MRT4577_29961C.8 Z. mays
miR396 Growth-regulating factor 1034 MRT4577_356670C.6 Z. mays
miR396 Growth-regulating factor 1035 MRT4577_359461C.1 Z. mays
miR396 Growth-regulating factor 1036 MRT4577_372672C.5 Z. mays
miR396 Growth-regulating factor 1037 MRT4577_410501C.4 Z. mays
miR396 Growth-regulating factor 1038 MRT4577_432229C.3 Z. mays
miR396 Growth-regulating factor 1039 MRT4577_534804C.2 Z. mays
miR396 Growth-regulating factor 1040 MRT4577_551090C.1 Z. mays
miR396 Growth-regulating factor 1041 MRT4577_563407C.1 Z. mays
miR396 Growth-regulating factor 1042 MRT4577_569284C.1 Z. mays
miR396 Growth-regulating factor 1043 MRT4577_597418C.1 Z. mays
miR396 Growth-regulating factor 1044 MRT4577_618948C.1 Z. mays
miR396 Growth-regulating factor 1045 MRT4577_635741C.1 Z. mays
miR397 Laccase 1046 MRT4577_233334C.7 Z. mays miR397 Laccase 1047
MRT4577_26704C.2 Z. mays miR397 Laccase 1048 MRT4577_293572C.3 Z.
mays miR397 Laccase 1049 MRT4577_602028C.1 Z. mays miR398
cytochrome c oxidase 1050 MRT4577_434356C.4 Z. mays miR398
cytochrome c oxidase 1051 MRT4577_547404C.2 Z. mays miR399 Cyclin
1052 PHE0002694 Z. mays miR400 PPR 1053 MRT4577_480700C.2 Z. mays
miR400 PPR 1054 MRT4577_593504C.1 Z. mays miR408 blue copper
protein 1055 MRT4577_325458C.1 Z. mays miR408 blue copper protein
1056 MRT4577_37590C.9 Z. mays miR408 blue copper protein 1057
MRT4577_47069C.8 Z. mays miR408 blue copper protein 1058
MRT4577_528699C.2 Z. mays miR408 blue copper protein 1059
MRT4577_550892C.1 Z. mays miR408 Laccase 1060 PHE0003380 Z. mays
miR408 Laccase 1061 MRT4577_245033C.8 Z. mays miR408 Laccase 1062
MRT4577_380413C.6 Z. mays miR408 Laccase 1063 MRT4577_388860C.4 Z.
mays miR408 Laccase 1064 MRT4577_461451C.3 Z. mays miR408 Laccase
1065 MRT4577_625157C.1 Z. mays miR408 Laccase 1066
MRT4577_629379C.1 Z. mays miR408 plantacyanin 1067 PHE0000329 Z.
mays miR444 MADS 1068 PHE0013719 Z. mays miR444 MADS box 1069
PHE0002650 Z. mays miR444 MADS box 1070 MRT4577_321664C.4 Z. mays
miR444 MADS-box 1071 MRT4577_204116C.4 Z. mays miR444 MADS-box 1072
MRT4577_537511C.2 Z. mays miR444 MADS-box 1073 MRT4577_553467C.1 Z.
mays miR444 MADS-box 1074 MRT4577_613242C.1 Z. mays miR444 MADS-box
1075 MRT4577_695496C.1 Z. mays miR472 ATP binding 1076
MRT4577_110498C.5 Z. mays miR472 ATP binding 1077 MRT4577_251486C.3
Z. mays miR472 NBS-LRR type disease resistance 1078
MRT4577_320221C.4 Z. mays protein miR475 PPR 1079 MRT4577_110120C.3
Z. mays miR475 PPR 1080 MRT4577_205728C.3 Z. mays miR475 PPR 1081
MRT4577_664698C.1 Z. mays miR477 GRAS 1082 MRT4577_278714C.7 Z.
mays miR477 GRAS 1083 MRT4577_401721C.2 Z. mays miR477 GRAS 1084
MRT4577_463199C.2 Z. mays miR477 GRAS 1085 MRT4577_526548C.1 Z.
mays miR477 GRAS 1086 MRT4577_569010C.1 Z. mays miR482 disease
resistance 1087 MRT4577_204880C.4 Z. mays miR482 disease resistance
1088 MRT4577_285745C.3 Z. mays miR482 disease resistance 1089
MRT4577_537326C.2 Z. mays miR482 disease resistance 1090
MRT4577_642390C.1 Z. mays miR482 disease resistance 1091
MRT4577_647253C.1 Z. mays miR482 disease resistance 1092
MRT4577_700169C.1 Z. mays miR776 IRE 1093 MRT4577_475418C.2 Z. mays
miR776 IRE 1094 MRT4577_569446C.1 Z. mays miR776 IRE 1095
MRT4577_668929C.1 Z. mays miR827 SYG1/Pho81/XPR1 1096
MRT4577_565044C.1 Z. mays miR844 protein kinase 1097
MRT4577_34878C.9 Z. mays miR844 protein kinase 1098
MRT4577_469768C.2 Z. mays miR857 LAC 1099 MRT4577_447458C.4 Z. mays
miR858 MYB 1100 MRT4577_230084C.4 Z. mays miR858 MYB 1101
MRT4577_28298C.7 Z. mays miR858 MYB 1102 MRT4577_365133C.3 Z. mays
miR858 MYB 1103 MRT4577_691552C.1 Z. mays miR858 myb-like 1104
MRT4577_237723C.3 Z. mays miR858 myb-like DNA-binding 1105
MRT4577_204899C.4 Z. mays miR858 myb-like DNA-binding 1106
MRT4577_229676C.2 Z. mays miR858 myb-like DNA-binding 1107
MRT4577_303539C.6 Z. mays miR858 myb-like DNA-binding 1108
MRT4577_330816C.1 Z. mays miR858 myb-like DNA-binding 1109
MRT4577_340919C.6 Z. mays miR858 myb-like DNA-binding 1110
MRT4577_549954C.1 Z. mays miR858 myb-like DNA-binding 1111
MRT4577_585620C.1 Z. mays miR858 myb-like DNA-binding 1112
MRT4577_665482C.1 Z. mays miR858 myb-like DNA-binding 1113
MRT4577_704749C.1 Z. mays miR904 AGO 1114 MRT4577_374929C.6 Z.
mays
Example 4
[0175] This example provides additional embodiments of target genes
identified as "validated miRNA targets" (i.e., containing a
validated miRNA recognition site) and representative uses of
validated miRNA recognition sites, e.g., for the design of
artificial sequences useful in making recombinant DNA constructs,
including, but not limited to, transgenes with an exogenous miRNA
recognition site added, transgenes with a native miRNA recognition
site modified or deleted, decoys, cleavage blockers, or
translational inhibitors as taught and claimed by Applicants.
Recombinant DNA constructs of this invention are useful for
modulating expression of such target genes and for making
non-natural transgenic plant cells, plant tissues, and plants
(especially non-natural transgenic crop plants) having improved
yield or other desirable traits.
[0176] Table 3 provides a list of miRNAs and miRNA targets
containing miRNA recognition sites that were identified in various
plants using techniques similar to those described in Example 2.
The miRNA targets were identified by gene name, protein domain,
function, location, or simply as a gene having a miRNA recognition
site; this information is sufficient for designing artificial
sequences including miRNA-unresponsive transgenes, cleavage
blockers, 5'-modified cleavage blockers, translational inhibitors,
and miRNA decoys. Table 3 further provides a list of miRNA
precursors (designed to be processed to a native mature miRNA), as
well as artificial sequences including miRNA precursors designed to
be processed to a synthetic mature miRNA, miRNA decoys,
miRNA-unresponsive transgenes, and miRNA cleavage blockers, all of
which are especially useful in making recombinant DNA constructs of
this invention. One of ordinary skill in the art, informed by the
teachings of this application and provided with the nucleotide
sequence of a miRNA or a miRNA recognition site in a target gene,
would be readily able to devise such artificial sequences. Such a
person of ordinary skill would further recognize that knowledge of
the target gene itself is not required, merely the sequence of the
mature miRNA sequence or of a miRNA precursor that is processed to
the mature miRNA--or, alternatively, knowledge of the miRNA
recognition site sequence--in combination with the teachings of
this application, in order to devise a cleavage blocker (or
5'-modified cleavage blocker) to inhibit the target gene silencing
effects of a given miRNA. Table 3 also provides examples of
recombinant DNA constructs which, when transgenically expressed in
a crop plant (preferably, but not limited to, maize or corn,
soybean, canola, cotton, alfalfa, sugarcane, sugar beet, sorghum,
and rice), results in improved yield by that crop plant, when
compared to the crop plant in which the construct is not expressed.
Techniques for making transgenic plants are described under the
heading "Making and Using Transgenic Plant Cells and Transgenic
Plants". "Improved yield" can be increased intrinsic yield; in
other embodiments, improved yield is yield increased under a
particular growing condition, such as abiotic or biotic stress
conditions (e.g., heat or cold stress, drought stress, or nutrient
stress), when compared to a crop lacking expression of the
recombinant DNA construct of this invention.
[0177] With the above information about miRNA targets, one of
ordinary skill in the art is able to make and use various
additional embodiments of aspects of this invention, including a
recombinant DNA construct transcribable in a plant cell, including
a promoter that is functional in the plant cell and operably linked
to at least one polynucleotide selected from: (a) DNA encoding a
cleavage blocker to prevent or decrease small RNA-mediated cleavage
of the transcript of at least one miRNA target identified in Tables
2 or 3; (b) DNA encoding a 5'-modified cleavage blocker to prevent
or decrease small RNA-mediated cleavage of the transcript of at
least one miRNA target identified in Tables 2 or 3; (c) DNA
encoding a translational inhibitor to prevent or decrease small
RNA-mediated cleavage of the transcript of at least one miRNA
target identified in Tables 2 or 3; (d) DNA encoding a decoy to
prevent or decrease small RNA-mediated cleavage of the transcript
of at least one miRNA target identified in Tables 2 or 3; (e) DNA
encoding a miRNA-unresponsive transgene having a nucleotide
sequence derived from the native nucleotide sequence of at least
one miRNA target identified in Tables 2 or 3, wherein a miRNA
recognition site in the native nucleotide sequence is deleted or
otherwise modified to prevent miRNA-mediated cleavage; (f) DNA
encoding a miRNA precursor which is processed into a miRNA for
suppressing expression of at least one miRNA target identified in
Tables 2 or 3; (g) DNA encoding double-stranded RNA which is
processed into siRNAs for suppressing expression of at least one
miRNA target identified in Tables 2 or 3; and (h) DNA encoding a
ta-siRNA which is processed into siRNAs for suppressing expression
of at least one miRNA target identified in Tables 2 or 3.
Specifically claimed are embodiments wherein the recombinant DNA
construct is stably integrated into a plastid or a chromosome of
the plant cell. Also specifically claimed are methods to improve
yield in a plant, wherein the recombinant DNA construct is
transgenically expressed in a crop plant (preferably, but not
limited to, maize or corn, soybean, canola, cotton, alfalfa,
sugarcane, sugar beet, sorghum, and rice), resulting in improved
yield by that crop plant, when compared to the crop plant in which
the construct is not expressed.
[0178] Embodiments within the scope of this invention include a
recombinant DNA construct transcribable in a plant cell, including
a promoter that is functional in the plant cell and operably linked
to at least one polynucleotide selected from: (a) DNA encoding a
cleavage blocker to prevent or decrease small RNA-mediated cleavage
of the transcript of at least one miRNA target; (b) DNA encoding a
5'-modified cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of at least one miRNA
target; (c) DNA encoding a translational inhibitor to prevent or
decrease small RNA-mediated cleavage of the transcript of at least
one miRNA target; (d) DNA encoding a decoy to prevent or decrease
small RNA-mediated cleavage of the transcript of at least one miRNA
target; (e) DNA encoding a miRNA-unresponsive transgene having a
nucleotide sequence derived from the native nucleotide sequence of
at least one miRNA target, wherein a miRNA recognition site in the
native nucleotide sequence is deleted or otherwise modified to
prevent miRNA-mediated cleavage; (f) DNA encoding a miRNA precursor
which is processed into a miRNA for suppressing expression of at
least one miRNA target; (g) DNA encoding double-stranded RNA which
is processed into siRNAs for suppressing expression of at least one
miRNA target; and (h) DNA encoding a ta-siRNA which is processed
into siRNAs for suppressing expression of at least one miRNA
target--wherein the at least one miRNA target is at least one
selected from the group consisting of a miR156 target, a miR160
target, a miR164 target, a miR166 target, a miR167 target, a miR169
target, a miR171 target, a miR172 target, a miR319 target, miR395
target, a miR396 target, a miR398 target, a miR399 target, a miR408
target, a miR444 target, a miR528 target, a miR167g target, a
miR169g target, COP1 (constitutive photomorphogenesis1), GA2ox
(gibberellic acid 2 oxidase), GA20ox (gibberellic acid 20 oxidase),
HB2 (homeobox 2), HB2-4 (homeobox 2 and homeobox 4), HB4 (homeobox
4), LG1 (liguleless1), SPX (SYG1, PH081 and XPR1 domain; PFAM entry
PF03105 at www.sanger.ac.uk), VIMla (variant in methlylation 1a),
DHS1 (deoxyhypusine synthase), DHS2 (deoxyhypusine synthase), DHS3
(deoxyhypusine synthase), DHS4 (deoxyhypusine synthase), DHS5
(deoxyhypusine synthase), DHS6 (deoxyhypusine synthase), DHS7
(deoxyhypusine synthase), DHS8 (deoxyhypusine synthase), CRF (corn
RING finger; RNF169), G1543a (maize orthologue of Arabidopsis
thaliana homeobox 17), G1543b (maize orthologue of Arabidopsis
thaliana homeobox 17), GS3 (grain size 3), and GW2 (grain weight
2). Particular embodiments that are specifically claimed by this
invention include a recombinant DNA construct transcribable in a
plant cell, including a promoter that is functional in the plant
cell and operably linked to at least one polynucleotide selected
from the group consisting of DNA encoding a nucleotide sequence
selected from SEQ ID NOs: 1120, 1121, 1122, 1248, 1257, 1313, 1314,
1364, 1387, 1478, 1489, 1490, 1491, 1492, 1493, 1585, 1597, 1598,
1599, 1713, 1752, 1753, 1801, 1802, 1820, 1927, 1929, 1931, 1971,
2006, 2007, 2008, 2010, 2012, 2014, 2016, 2018, 2022, 2023, 2025,
2027, 2029, 2031, 2033, 2035, 2037, 2039, 2041, 2043, 2045, 2047,
2049, 2051, 2053, 2055, 2056, 2057, 2059, 2060, 2061, and 2063;
also specifically claimed are embodiments wherein the recombinant
DNA construct is stably integrated into a plastid or a chromosome
of the plant cell.
[0179] Further embodiments are methods to improve yield in a plant,
wherein a recombinant DNA construct transcribable in a plant cell,
including a promoter that is functional in the plant cell and
operably linked to at least one polynucleotide selected from: (a)
DNA encoding a cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of at least one miRNA
target; (b) DNA encoding a 5'-modified cleavage blocker to prevent
or decrease small RNA-mediated cleavage of the transcript of at
least one miRNA target; (c) DNA encoding a translational inhibitor
to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target; (d) DNA encoding a decoy
to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target; (e) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of at least one miRNA target,
wherein a miRNA recognition site in the native nucleotide sequence
is deleted or otherwise modified to prevent miRNA-mediated
cleavage; (f) DNA encoding a miRNA precursor which is processed
into a miRNA for suppressing expression of at least one miRNA
target; (g) DNA encoding double-stranded RNA which is processed
into siRNAs for suppressing expression of at least one miRNA
target; and (h) DNA encoding a ta-siRNA which is processed into
siRNAs for suppressing expression of at least one miRNA
target--wherein the at least one miRNA target is at least one
selected from the group consisting of a miR156 target, a miR160
target, a miR164 target, a miR166 target, a miR167 target, a miR169
target, a miR171 target, a miR172 target, a miR319 target, miR395
target, a miR396 target, a a miR398 target, a miR399 target, a
miR408 target, a miR444 target, a miR528 target, a miR167g target,
a miR169g target, COP1 (constitutive photomorphogenesis1), GA2ox
(gibberellic acid 2 oxidase), GA20ox (gibberellic acid 20 oxidase),
HB2 (homeobox 2), HB2-4 (homeobox 2 and homeobox 4), HB4 (homeobox
4), LG1 (liguleless1), SPX (SYG1, PH081 and XPR1 domain; PFAM entry
PF03105 at www.sanger.ac.uk), VIMla (variant in methlylation 1a),
DHS1 (deoxyhypusine synthase), DHS2 (deoxyhypusine synthase), DHS3
(deoxyhypusine synthase), DHS4 (deoxyhypusine synthase), DHS5
(deoxyhypusine synthase), DHS6 (deoxyhypusine synthase), DHS7
(deoxyhypusine synthase), DHS8 (deoxyhypusine synthase), CRF (corn
RING finger; RNF169), G1543a (maize orthologue of Arabidopsis
thaliana homeobox 17), G1543b (maize orthologue of Arabidopsis
thaliana homeobox 17), GS3 (grain size 3), and GW2 (grain weight
2)--is transgenically expressed in a crop plant (preferably, but
not limited to, maize or corn, soybean, canola, cotton, alfalfa,
sugarcane, sugar beet, sorghum, and rice), resulting in improved
yield by that crop plant, when compared to the crop plant in which
the construct is not expressed. Specifically claimed are methods to
improve yield in a plant, wherein a recombinant DNA construct
transcribable in a plant cell, including a promoter that is
functional in the plant cell and operably linked to at least one
polynucleotide selected from the group consisting of DNA encoding a
nucleotide sequence selected from SEQ ID NOs: 1120, 1121, 1122,
1248, 1257, 1313, 1314, 1364, 1387, 1478, 1489, 1490, 1491, 1492,
1493, 1585, 1597, 1598, 1599, 1713, 1752, 1753, 1801, 1802, 1820,
1927, 1929, 1931, 1971, 2006, 2007, 2008, 2010, 2012, 2014, 2016,
2018, 2022, 2023, 2025, 2027, 2029, 2031, 2033, 2035, 2037, 2039,
2041, 2043, 2045, 2047, 2049, 2051, 2053, 2055, 2056, 2057, 2059,
2060, 2061, and 2063 is transgenically expressed in a crop plant
(preferably, but not limited to, maize or corn, soybean, canola,
cotton, alfalfa, sugarcane, sugar beet, sorghum, and rice),
resulting in improved yield by that crop plant, when compared to
the crop plant in which the construct is not expressed.
[0180] Additional aspects of this invention include a non-natural
transgenic plant cell including a stably integrated recombinant DNA
construct transcribable in the non-natural transgenic plant cell,
wherein the recombinant DNA construct includes a promoter
functional in the non-natural transgenic plant cell and operably
linked to at least one polynucleotide selected from DNA encoding at
least one miRNA target identified in Tables 2 or 3; the recombinant
DNA construct can be stably integrated into a plastid, a
chromosome, or the genome of the plant cell. Embodiments include a
non-natural transgenic plant cell including a stably integrated
recombinant DNA construct transcribable in the non-natural
transgenic plant cell, wherein the recombinant DNA construct
includes a promoter functional in the non-natural transgenic plant
cell and operably linked to at least one polynucleotide including a
DNA sequence selected from SEQ ID NOS: 15-2064.
TABLE-US-00012 TABLE 3 SEQ ID Nucleotide Source Rationale for plant
Construct type Name NO: Gene ID Position Organism transformation*
miRNA miR156 1115 Zea mays miRNA miR156 1116 Zea mays miR156 target
Squamosa Promoter 1117 Zea mays Binding Protein miR156 target
Squamosa Promoter 1118 Zea mays Binding Protein miR156 target
Squamosa Promoter 1119 Zea mays Binding Protein Decoy (artificial
miR156 decoy 1120 Artificial Improved sequence) sequence yield*
Decoy (artificial miR156 decoy 1121 Artificial Improved sequence)
sequence yield* miRNA- Squamosa Promoter 1122 Artificial Improved
unresponsive Binding Protein sequence yield* (miR156-unresponsive)
miR156 target Squamosa Promoter 1123 MRT4577_564644C.1 478-497 Zea
mays Binding-domain protein miR156 target Squamosa Promoter 1124
MRT4577_23629C.7 1001-1020 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1125 MRT4577_188360C.6 1571-1590 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1126
MRT4577_205098C.7 1658-1677 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1127 MRT4577_565057C.1 980-999 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1128
MRT4577_137984C.6 2097-2116 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1129 MRT4577_532824C.3 1136-1155 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1130
MRT4577_122478C.6 767-786 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1131 MRT4577_31704C.9 1125-1144 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1132
MRT4577_26483C.7 1503-1522 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1133 MRT4577_295538C.7 1433-1452 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1134
MRT4577_644419C.1 962-981 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1135 MRT4577_619443C.1 914-933 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1136
MRT4577_341149C.6 1807-1826 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1137 MRT4577_78773C.8 1202-1221 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1138
MRT4577_42534C.9 1935-1954 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1139 MRT4577_270892C.4 978-997 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1140
MRT4577_571545C.1 623-642 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1141 MRT4577_181019C.5 788-807 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1142
MRT4577_537670C.2 575-594 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1143 MRT4577_535297C.2 1840-1859 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1144
MRT4577_334372C.5 477-496 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1145 MRT4577_568647C.1 1004-1023 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1146
MRT4577_383301C.4 896-915 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1147 MRT4577_427964C.4 991-1010 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1148
MRT4577_240798C.6 769-788 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1149 MRT4577_38044C.8 951-970 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1150
MRT4577_461098C.3 469-488 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1151 MRT4577_333683C.4 643-662 Zea mays
Binding-domain protein miR156 target Squamosa Promoter 1152
MRT4577_396357C.4 647-666 Zea mays Binding-domain protein miR156
target Squamosa Promoter 1153 MRT3635_15393C.1 98-117 Gossypium
Binding-domain hirsutum protein miR156 target Squamosa Promoter
1154 MRT3635_15791C.2 990-1009 Gossypium Binding-domain hirsutum
protein miR156 target miR156 target 1155 MRT3635_23851C.2 233-252
Gossypium hirsutum miR156 target Squamosa Promoter 1156
MRT3635_28051C.1 213-232 Gossypium Binding-domain hirsutum protein
miR156 target Squamosa Promoter 1157 MRT3635_30369C.2 1511-1530
Gossypium Binding-domain hirsutum protein miR156 target Squamosa
Promoter 1158 MRT3635_30868C.2 652-671 Gossypium Binding-domain
hirsutum protein miR156 target Squamosa Promoter 1159
MRT3635_36657C.2 555-574 Gossypium Binding-domain hirsutum protein
miR156 target Squamosa Promoter 1160 MRT3635_48230C.2 857-876
Gossypium Binding-domain hirsutum protein miR156 target Squamosa
Promoter 1161 MRT3635_54380C.2 21-40 Gossypium Binding-domain
hirsutum protein miR156 target Squamosa Promoter 1162
MRT3635_59825C.1 50-69 Gossypium Binding-domain hirsutum protein
miR156 target Squamosa Promoter 1163 MRT3635_65765C.1 709-728
Gossypium Binding-domain hirsutum protein miR156 target miR156
target 1164 MRT3635_69088C.1 1238-1257 Gossypium hirsutum miR156
target Squamosa Promoter 1165 MRT3635_69159C.1 892-911 Gossypium
Binding-domain hirsutum protein miR156 target miR156 target 1166
MRT3635_71102C.1 294-313 Gossypium hirsutum miR156 target Squamosa
Promoter 1167 MRT3635_72531C.1 612-631 Gossypium Binding-domain
hirsutum protein miR156 target Squamosa Promoter 1168
MRT3702_110108C.4 1253-1272 Arabidopsis Binding-domain thaliana
protein miR156 target Squamosa Promoter 1169 MRT3702_113039C.2
757-776 Arabidopsis Binding-domain thaliana protein miR156 target
Squamosa Promoter 1170 MRT3702_115945C.3 2609-2628 Arabidopsis
Binding-domain thaliana protein miR156 target Squamosa Promoter
1171 MRT3702_11947C.6 680-699 Arabidopsis Binding-domain thaliana
protein miR156 target Squamosa Promoter 1172 MRT3702_120785C.3
1157-1176 Arabidopsis Binding-domain thaliana protein miR156 target
Squamosa Promoter 1173 MRT3702_141151C.3 1073-1092 Arabidopsis
Binding-domain thaliana protein miR156 target Squamosa Promoter
1174 MRT3702_141152C.2 1172-1191 Arabidopsis Binding-domain
thaliana protein miR156 target miR156 target 1175 MRT3702_147696C.3
1186-1205 Arabidopsis thaliana miR156 target Squamosa Promoter 1176
MRT3702_147811C.3 1446-1465 Arabidopsis Binding-domain thaliana
protein miR156 target Squamosa Promoter 1177 MRT3702_148347C.1
1118-1137 Arabidopsis Binding-domain thaliana protein miR156 target
Squamosa Promoter 1178 MRT3702_148348C.3 1121-1140 Arabidopsis
Binding-domain thaliana protein miR156 target Squamosa Promoter
1179 MRT3702_15197C.5 785-804 Arabidopsis Binding-domain thaliana
protein miR156 target Squamosa Promoter 1180 MRT3702_177137C.1
2477-2496 Arabidopsis Binding-domain thaliana protein miR156 target
Squamosa Promoter 1181 MRT3702_179579C.1 1149-1168 Arabidopsis
Binding-domain thaliana protein miR156 target Squamosa Promoter
1182 MRT3702_23035C.6 1358-1377 Arabidopsis Binding-domain thaliana
protein miR156 target Squamosa Promoter 1183 MRT3702_23765C.7
1036-1055 Arabidopsis Binding-domain thaliana protein miR156 target
Squamosa Promoter 1184 MRT3702_4036C.6 804-823 Arabidopsis
Binding-domain thaliana protein miR156 target Squamosa Promoter
1185 MRT3702_5396C.6 1297-1316 Arabidopsis Binding-domain thaliana
protein miR156 target Squamosa Promoter 1186 MRT3702_9141C.7
829-848 Arabidopsis Binding-domain thaliana protein miR156 target
Squamosa Promoter 1187 MRT3702_94277C.3 781-800 Arabidopsis
Binding-domain thaliana protein miR156 target Squamosa Promoter
1188 MRT3702_9951C.4 781-800 Arabidopsis Binding-domain thaliana
protein miR156 target miR156 target 1189 MRT3708_10628C.4 459-478
Brassica napus miR156 target Squamosa Promoter 1190
MRT3708_22559C.1 330-349 Brassica Binding-domain napus protein
miR156 target Squamosa Promoter 1191 MRT3708_53675C.1 290-309
Brassica Binding-domain napus protein miR156 target miR156 target
1192 MRT3708_58630C.1 407-426 Brassica napus miR156 target miR156
target 1193 MRT3847_14683C.5 1677-1696 Glycine max miR156 target
miR156 target 1194 MRT3847_167543C.1 486-505 Glycine max miR156
target Squamosa Promoter 1195 MRT3847_197471C.3 295-314 Glycine max
Binding-domain protein miR156 target miR156 target 1196
MRT3847_206274C.4 117-136 Glycine max miR156 target Squamosa
Promoter 1197 MRT3847_207934C.2 547-566 Glycine max Binding-domain
protein
miR156 target miR156 target 1198 MRT3847_213855C.7 701-720 Glycine
max miR156 target Squamosa Promoter 1199 MRT3847_217782C.3 851-870
Glycine max Binding-domain protein miR156 target Squamosa Promoter
1200 MRT3847_218322C.4 109-128 Glycine max Binding-domain protein
miR156 target Squamosa Promoter 1201 MRT3847_235081C.4 1980-1999
Glycine max Binding-domain protein miR156 target miR156 target 1202
MRT3847_235082C.6 915-934 Glycine max miR156 target miR156 target
1203 MRT3847_237444C.4 582-601 Glycine max miR156 target miR156
target 1204 MRT3847_252038C.4 515-534 Glycine max miR156 target
miR156 target 1205 MRT3847_268305C.4 396-415 Glycine max miR156
target miR156 target 1206 MRT3847_289291C.3 961-980 Glycine max
miR156 target Squamosa Promoter 1207 MRT3847_329752C.1 933-952
Glycine max Binding-domain protein miR156 target miR156 target 1208
MRT3847_334134C.1 1239-1258 Glycine max miR156 target miR156 target
1209 MRT3847_335568C.1 1747-1766 Glycine max miR156 target miR156
target 1210 MRT3847_338602C.1 1070-1089 Glycine max miR156 target
miR156 target 1211 MRT3847_341315C.1 47-66 Glycine max miR156
target miR156 target 1212 MRT3847_341402C.1 978-997 Glycine max
miR156 target miR156 target 1213 MRT3847_350831C.1 1280-1299
Glycine max miR156 target Squamosa Promoter 1214 MRT3880_19943C.1
633-652 Medicago Binding-domain truncatula protein miR156 target
miR156 target 1215 MRT3880_49046C.1 98-117 Medicago truncatula
miR156 target Squamosa Promoter 1216 MRT3880_54023C.1 527-546
Medicago Binding-domain truncatula protein miR156 target Squamosa
Promoter 1217 MRT3880_59834C.1 726-745 Medicago Binding-domain
truncatula protein miR156 target Squamosa Promoter 1218
MRT3880_62151C.1 1070-1089 Medicago Binding-domain truncatula
protein miR156 target Squamosa Promoter 1219 MRT4513_19757C.1
529-548 Hordeum Binding-domain vulgare protein miR156 target
Squamosa Promoter 1220 MRT4513_41849C.1 439-458 Hordeum
Binding-domain vulgare protein miR156 target Squamosa Promoter 1221
MRT4513_4449C.1 221-240 Hordeum Binding-domain vulgare protein
miR156 target Squamosa Promoter 1222 MRT4513_52153C.1 523-542
Hordeum Binding-domain vulgare protein miR156 target miR156 target
1223 MRT4530_11398C.3 696-715 Oryza sativa miR156 target Squamosa
Promoter 1224 MRT4530_118092C.3 821-840 Oryza Binding-domain sativa
protein miR156 target Squamosa Promoter 1225 MRT4530_135991C.4
710-729 Oryza Binding-domain sativa protein miR156 target Squamosa
Promoter 1226 MRT4530_142142C.4 1074-1093 Oryza Binding-domain
sativa protein miR156 target Squamosa Promoter 1227
MRT4530_195506C.2 981-1000 Oryza Binding-domain sativa protein
miR156 target Squamosa Promoter 1228 MRT4530_199837C.4 2401-2420
Oryza Binding-domain sativa protein miR156 target miR156 target
1229 MRT4530_219862C.2 146-165 Oryza sativa miR156 target Squamosa
Promoter 1230 MRT4530_220364C.2 1764-1783 Oryza Binding-domain
sativa protein miR156 target Squamosa Promoter 1231
MRT4530_230201C.3 265-284 Oryza Binding-domain sativa protein
miR156 target miR156 target 1232 MRT4530_230404C.3 2222-2241 Oryza
sativa miR156 target Squamosa Promoter 1233 MRT4530_236277C.1
728-747 Oryza Binding-domain sativa protein miR156 target Squamosa
Promoter 1234 MRT4530_257640C.1 956-975 Oryza Binding-domain sativa
protein miR156 target Squamosa Promoter 1235 MRT4530_44605C.5
1148-1167 Oryza Binding-domain sativa protein miR156 target
Squamosa Promoter 1236 MRT4530_53217C.5 858-877 Oryza
Binding-domain sativa protein miR156 target Squamosa Promoter 1237
MRT4530_6964C.4 2113-2132 Oryza Binding-domain sativa protein
miR156 target miR156 target 1238 MRT4530_95203C.4 994-1013 Oryza
sativa miR156 target Squamosa Promoter 1239 MRT4558_12680C.1 78-97
Sorghum Binding-domain bicolor protein miR156 target Squamosa
Promoter 1240 MRT4558_27285C.1 130-149 Sorghum Binding-domain
bicolor protein miR156 target Squamosa Promoter 1241
MRT4558_6587C.1 516-535 Sorghum Binding-domain bicolor protein
miR156 target Squamosa Promoter 1242 MRT4558_8644C.2 866-885
Sorghum Binding-domain bicolor protein miR156 target miR156 target
1243 MRT4565_169464C.2 296-315 Triticum aestivum miR156 target
Squamosa Promoter 1244 MRT4565_212647C.1 523-542 Triticum
Binding-domain aestivum protein miR156 target Squamosa Promoter
1245 MRT4565_239085C.1 1565-1584 Triticum Binding-domain aestivum
protein miR156 target Squamosa Promoter 1246 MRT4565_259386C.1
339-358 Triticum Binding-domain aestivum protein miR156 target
Squamosa Promoter 1247 MRT4565_272025C.1 954-973 Triticum
Binding-domain aestivum protein Decoy (artificial miR160 decoy 1248
Artificial Improved sequence) sequence yield* miR160 target Auxin
Response Factor 1249 MRT4577_429671C.3 1429-1449 Zea mays 10-like
protein miR160 target Auxin Response Factor 1250 MRT4577_400043C.4
1894-1914 Zea mays 10-like protein miR160 target Auxin Response
Factor 1251 MRT4577_385317C.3 863-883 Zea mays 10-like protein
miR160 target Auxin Response Factor 1252 MRT4577_41620C.6 756-776
Zea mays 10-like protein miR160 target Auxin Response Factor 1253
MRT4577_258637C.2 1353-1373 Zea mays 10-like protein miR160 target
Auxin Response Factor 1254 MRT4577_448022C.1 421-442 Zea mays
10-like protein miRNA miR164 1255 Zea mays miR164 target NAC1; No
Apical 1256 Zea mays Meristem, ATAF, Cup Shaped Cotyledon (NAC)
domain protein miRNA- NAC1 (miR164- 1257 Artificial Improved
unresponsive unresponsive) sequence yield* miR164 target miR164
target 1258 MRT3635_6393C.2 135-155 Gossypium hirsutum miR164
target miR164 target 1259 MRT3635_64345C.1 925-945 Gossypium
hirsutum miR164 target No Apical Meristem, 1260 MRT3702_105151C.5
843-863 Arabidopsis ATAF, Cup Shaped thaliana Cotyledon (NAC)
domain protein miR164 target CUC1; No Apical 1261 MRT3702_11937C.6
651-671 Arabidopsis Meristem, ATAF, Cup thaliana Shaped Cotyledon
(NAC) domain protein miR164 target NAC1; No Apical 1262
MRT3702_180541C.1 762-782 Arabidopsis Meristem, ATAF, Cup thaliana
Shaped Cotyledon (NAC) domain protein miR164 target NAC1; No Apical
1263 MRT3702_180670C.1 785-805 Arabidopsis Meristem, ATAF, Cup
thaliana Shaped Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1264 MRT3702_20256C.5 651-671 Arabidopsis ATAF,
Cup Shaped thaliana Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1265 MRT3702_22669C.4 765-785 Arabidopsis ATAF,
Cup Shaped thaliana Cotyledon (NAC) domain protein miR164 target
CUC2; No Apical 1266 MRT3702_24103C.6 856-876 Arabidopsis Meristem,
ATAF, Cup thaliana Shaped Cotyledon (NAC) domain protein miR164
target No Apical Meristem, 1267 MRT3702_24851C.6 809-829
Arabidopsis ATAF, Cup Shaped thaliana Cotyledon (NAC) domain
protein miR164 target No Apical Meristem, 1268 MRT3708_39966C.1
192-212 Brassica ATAF, Cup Shaped napus Cotyledon (NAC) domain
protein miR164 target No Apical Meristem, 1269 MRT3708_51022C.1
803-823 Brassica ATAF, Cup Shaped napus Cotyledon (NAC) domain
protein miR164 target No Apical Meristem, 1270 MRT3712_8777C.1
316-336 Brassica ATAF, Cup Shaped oleracea Cotyledon (NAC) domain
protein miR164 target No Apical Meristem, 1271 MRT3847_244824C.2
290-310 Glycine max ATAF, Cup Shaped Cotyledon (NAC) domain protein
miR164 target No Apical Meristem, 1272 MRT3847_259513C.2 719-739
Glycine max ATAF, Cup Shaped Cotyledon (NAC) domain protein miR164
target No Apical Meristem, 1273 MRT3847_270117C.3 784-804 Glycine
max ATAF, Cup Shaped Cotyledon (NAC) domain protein miR164 target
No Apical Meristem, 1274 MRT3847_46332C.2 714-734 Glycine max ATAF,
Cup Shaped Cotyledon (NAC) domain protein miR164 target No Apical
Meristem, 1275 MRT3847_46333C.6 731-751 Glycine max ATAF, Cup
Shaped Cotyledon (NAC) domain protein miR164 target No Apical
Meristem, 1276 MRT3847_48464C.4 1140-1160 Glycine max ATAF, Cup
Shaped Cotyledon (NAC) domain protein miR164 target No Apical
Meristem, 1277 MRT3847_48465C.6 777-797 Glycine max ATAF, Cup
Shaped Cotyledon (NAC) domain protein miR164 target No Apical
Meristem, 1278 MRT3880_18003C.2 705-725 Medicago ATAF, Cup Shaped
truncatula Cotyledon (NAC) domain protein miR164 target miR164
target 1279 MRT3880_33685C.1 278-298 Medicago truncatula miR164
target No Apical Meristem, 1280 MRT3880_44619C.1 781-801 Medicago
ATAF, Cup Shaped truncatula Cotyledon (NAC) domain protein miR164
target No Apical Meristem, 1281 MRT4513_26199C.1 809-829 Hordeum
ATAF, Cup Shaped vulgare Cotyledon (NAC)
domain protein miR164 target No Apical Meristem, 1282
MRT4513_37185C.1 17-37 Hordeum ATAF, Cup Shaped vulgare Cotyledon
(NAC) domain protein miR164 target Salicylic acid-induced 1283
MRT4513_4722C.1 251-271 Hordeum protein 19 vulgare miR164 target No
Apical Meristem, 1284 MRT4513_7890C.1 687-707 Hordeum ATAF, Cup
Shaped vulgare Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1285 MRT4530_141528C.5 890-910 Oryza ATAF, Cup
Shaped sativa Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1286 MRT4530_147737C.4 912-932 Oryza ATAF, Cup
Shaped sativa Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1287 MRT4530_157393C.3 923-943 Oryza ATAF, Cup
Shaped sativa Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1288 MRT4530_178256C.3 954-974 Oryza ATAF, Cup
Shaped sativa Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1289 MRT4530_211705C.4 1929-1949 Oryza ATAF, Cup
Shaped sativa Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1290 MRT4530_221769C.1 159-179 Oryza ATAF, Cup
Shaped sativa Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1291 MRT4530_224181C.2 790-810 Oryza ATAF, Cup
Shaped sativa Cotyledon (NAC) domain protein miR164 target No
Apical Meristem, 1292 MRT4558_11465C.1 13-33 Sorghum ATAF, Cup
Shaped bicolor Cotyledon (NAC) domain protein miR164 target
Salicylic acid-induced 1293 MRT4558_31046C.1 256-276 Sorghum
protein 19, regulation bicolor of transcription, DNA binding miR164
target No Apical Meristem, 1294 MRT4558_41467C.1 1230-1250 Sorghum
ATAF, Cup Shaped bicolor Cotyledon (NAC) domain protein miR164
target No Apical Meristem, 1295 MRT4558_43081C.1 344-364 Sorghum
ATAF, Cup Shaped bicolor Cotyledon (NAC) domain protein miR164
target No Apical Meristem, 1296 MRT4558_43436C.1 853-873 Sorghum
ATAF, Cup Shaped bicolor Cotyledon (NAC) domain protein miR164
target No Apical Meristem, 1297 MRT4558_4564C.2 691-711 Sorghum
ATAF, Cup Shaped bicolor Cotyledon (NAC) domain protein miR164
target No Apical Meristem, 1298 MRT4565_235741C.1 849-869 Triticum
ATAF, Cup Shaped aestivum Cotyledon (NAC) domain protein miR164
target No Apical Meristem, 1299 MRT4565_241295C.1 1062-1082
Triticum ATAF, Cup Shaped aestivum Cotyledon (NAC) domain protein
miR164 target SIAH1 protein-like, 1300 MRT4565_246008C.1 696-716
Triticum ubiquitin-dependent aestivum protein catabolism, nucleus,
zinc ion binding miR164 target No Apical Meristem, 1301
MRT4565_250946C.1 675-695 Triticum ATAF, Cup Shaped aestivum
Cotyledon (NAC) domain protein miR164 target No Apical Meristem,
1302 MRT4565_269060C.1 730-750 Triticum ATAF, Cup Shaped aestivum
Cotyledon (NAC) domain protein miR164 target Salicylic acid-induced
1303 MRT4565_272391C.1 765-785 Triticum protein 19, regulation
aestivum of transcription, DNA binding miR164 target No Apical
Meristem, 1304 MRT4565_279043C.1 945-965 Triticum ATAF, Cup Shaped
aestivum Cotyledon (NAC) domain protein miR164 target No Apical
Meristem, 1305 MRT4577_16045C.7 927-947 Zea mays ATAF, Cup Shaped
Cotyledon (NAC) domain protein miR164 target miR164 target 1306
MRT4577_205444C.5 524-544 Zea mays miR164 target hypothetical
protein; 1307 MRT4577_325166C.3 868-888 Zea mays putative role in
boundary specification; nam2 miR164 target hypothetical protein;
1308 MRT4577_78918C.6 893-913 Zea mays putative role in SAM
initiation and boundary specification; nam1 miR164 target miR164
target 1309 MRT4577_98755C.5 942-962 Zea mays miR164 target miR164
target 1310 MRT4577_9951C.8 930-950 Zea mays miRNA miR166 1311 Zea
mays miR166 target Revoluta 1312 Zea mays miRNA- Revoluta (miR166-
1313 Artificial Improved unresponsive unresponsive) sequence yield*
miRNA- Revoluta (miR166- 1314 Artificial Improved unresponsive
unresponsive) sequence yield* miR166 target miR166 target 1315
MRT3635_23433C.2 197-217 Gossypium hirsutum miR166 target miR166
target 1316 MRT3635_50942C.2 298-318 Gossypium hirsutum miR166
target interfascicular fiberless 1317 MRT3702_104431C.5 1262-1282
Arabidopsis 1; IFL1; HDZIPIII thaliana domain protein miR166 target
homeodomain-leucine 1318 MRT3702_104605C.6 915-935 Arabidopsis
zipper protein thaliana miR166 target homeodomain-leucine 1319
MRT3702_113325C.3 1268-1288 Arabidopsis zipper protein; ATHB-
thaliana 15 miR166 target homeodomain-leucine 1320
MRT3702_120571C.3 1281-1301 Arabidopsis zipper protein 14; thaliana
ATHB-14 miR166 target homeodomain-leucine 1321 MRT3702_18869C.5
934-954 Arabidopsis zipper protein 8; hb-8 thaliana miR166 target
Glycosyl transferase 1322 MRT3702_24778C.3 2793-2813 Arabidopsis
thaliana miR166 target CORONA; START 1323 MRT3708_45624C.1 210-230
Brassica domain; HDZIPIII napus domain transcription factor miR166
target HD-Zip protein 1324 MRT3708_5493C.1 79-99 Brassica
(Homeodomain-leucine napus zipper protein); START domain miR166
target Homeodomain-leucine 1325 MRT3712_4770C.1 229-249 Brassica
zipper protein; START oleracea domain miR166 target miR166 target
1326 MRT3847_209034C.4 506-526 Glycine max miR166 target miR166
target 1327 MRT3847_233286C.5 730-750 Glycine max miR166 target
miR166 target 1328 MRT3847_248020C.5 298-318 Glycine max miR166
target miR166 target 1329 MRT3847_251781C.4 950-970 Glycine max
miR166 target miR166 target 1330 MRT3847_288367C.4 1562-1582
Glycine max miR166 target Class III HD-Zip 1331 MRT3847_296736C.1
869-889 Glycine max protein 4 miR166 target Class III HD-Zip 1332
MRT3847_326691C.1 910-930 Glycine max protein 4 miR166 target
miR166 target 1333 MRT3847_348410C.1 912-932 Glycine max miR166
target Class III HD-Zip 1334 MRT3880_12194C.1 788-808 Medicago
protein 8 truncatula miR166 target Class III HD-Zip 1335
MRT3880_30145C.1 560-580 Medicago protein 1 truncatula miR166
target Class III HD-Zip 1336 MRT3880_37546C.1 819-839 Medicago
protein 6 truncatula miR166 target Class III HD-Zip 1337
MRT3880_39764C.1 536-556 Medicago protein 6 truncatula miR166
target homeodomain-leucine 1338 MRT4530_10527C.4 959-979 Oryza
zipper protein sativa miR166 target Homeodomain-leucine 1339
MRT4530_107863C.5 880-900 Oryza zipper protein; START sativa domain
miR166 target Homeodomain leucine- 1340 MRT4530_160340C.3 1031-1051
Oryza zipper protein Hox10; sativa START domain miR166 target
Homeodomain-leucine 1341 MRT4530_21619C.2 563-583 Oryza zipper
protein; START sativa domain miR166 target Homeodomain-leucine 1342
MRT4530_253068C.2 957-977 Oryza zipper protein; START sativa domain
miR166 target Homeodomain-leucine 1343 MRT4558_27560C.1 750-770
Sorghum zipper protein; START bicolor domain miR166 target
Homeodomain-leucine 1344 MRT4565_226777C.1 285-305 Triticum zipper
protein; START aestivum domain miR166 target Homeodomain-leucine
1345 MRT4565_232172C.1 168-188 Triticum zipper protein; START
aestivum domain miR166 target Homeodomain-leucine 1346
MRT4565_264759C.1 954-973 Triticum zipper protein; START aestivum
domain miR166 target miR166 target 1347 MRT4577_141500C.4 839-859
Zea mays miR166 target miR166 target 1348 MRT4577_200605C.3 788-808
Zea mays miR166 target rolled leaf1; RLD1; 1349 MRT4577_229497C.6
1098-1118 Zea mays class III homeodomain- leucine zipper (HD-
ZIPIII) miR166 target Rolled leaf1; 1350 MRT4577_312384C.3 563-583
Zea mays Homeobox: Homeobox domain; START domain miR166 target
miR166 target 1351 MRT4577_320718C.6 963-983 Zea mays miR166 target
miR166 target 1352 MRT4577_342259C.4 1092-1112 Zea mays miR166
target miR166 target 1353 MRT4577_442838C.4 1159-1179 Zea mays
miR166 target miR166 target 1354 MRT4577_535676C.2 560-580 Zea mays
miR166 target miR166 target 1355 MRT4577_535928C.2 1142-1162 Zea
mays miR166 target miR166 target 1356 MRT4577_566770C.1 545-565 Zea
mays miR166 target miR166 target 1357 MRT4577_568616C.1 801-821 Zea
mays miR166 target miR166 target 1358 MRT4577_586718C.1 572-592 Zea
mays miR166 target miR166 target 1359 MRT4577_659410C.1 788-808 Zea
mays miR166 target miR166 target 1360 MRT4577_673351C.1 161-181 Zea
mays miRNA miR167b 1361 Zea mays miRNA miR167b 1362 Zea mays miR167
target ARF8 1363 Zea mays miRNA- ARF8 (mir167- 1364 Artificial
Improved unresponsive unresponsive) sequence yield* miR167 target
auxin response factor 1365 MRT3702_22410C.4 4382-4402 Arabidopsis
8; ARF8; thaliana miR167 target auxin response factor 1366
MRT3708_50323C.1 89-109 Brassica domain; ARF8-like napus miR167
target miR167 target 1367 MRT3847_305421C.4 1358-1378 Glycine max
miR167 target miR167 target 1368 MRT3847_340154C.1 1586-1606
Glycine max miR167 target auxin response factor 1369
MRT3847_41926C.6 1489-1509 Glycine max domain; ARF8-like miR167
target auxin response factor 1370 MRT3880_12926C.1 365-385 Medicago
domain; ARF8-like truncatula miR167 target auxin response factor
1371 MRT3880_25270C.1 1758-1778 Medicago domain; ARF8-like
truncatula miR167 target miR167 target 1372 MRT4513_29483C.2
564-584 Hordeum vulgare miR167 target miR167 target 1373
MRT4530_178528C.2 2219-2239 Oryza sativa miR167 target auxin
response factor 1374 MRT4530_86291C.3 2659-2679 Oryza domain;
ARF8-like sativa miR167 target auxin response factor 1375
MRT4558_37108C.1 147-167 Sorghum domain; ARF8-like bicolor miR167
target miR167 target 1376 MRT4577_306050C.5 647-667 Zea mays miR167
target miR167 target 1377 MRT4577_339989C.4 2584-2604 Zea mays
miR167 target miR167 target 1378 MRT4577_377896C.4 244-264 Zea mays
miR167 target miR167 target 1379 MRT4577_521851C.2 1595-1615 Zea
mays miR167 target miR167 target 1380 MRT4577_650810C.1 1618-1638
Zea mays miR167 target miR167 target 1381 MRT4577_680014C.1 208-228
Zea mays miR167 target miR167 target 1382 MRT4577_681995C.1 230-250
Zea mays miR167 target miR167 target 1383 MRT4577_683953C.1 442-462
Zea mays miRNA miR169 1384 Zea mays miRNA miR169 1385 Zea mays
miR169 target NFY family of TFs 1386 Zea mays miRNA- NFY family of
TFs 1387 Artificial Improved unresponsive (miR169-unresponsive)
sequence yield* miR169 target HAP2, CCAAT- 1388 MRT3635_18720C.2
1123-1143 Gossypium binding transcription hirsutum factor
(CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1389 MRT3635_24490C.1
345-365 Gossypium binding transcription hirsutum factor
(CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1390 MRT3635_60547C.1
1610-1630 Gossypium binding transcription hirsutum factor
(CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1391 MRT3635_63203C.1
1353-1373 Gossypium binding transcription hirsutum factor
(CBF-B/NF-YA) miR169 target miR169 target 1392 MRT3635_63602C.1
692-712 Gossypium hirsutum miR169 target HAP2, CCAAT- 1393
MRT3635_751C.2 1156-1176 Gossypium binding transcription hirsutum
factor (CBF-B/NF-YA) miR169 target miR169 target 1394
MRT3635_7843C.2 302-322 Gossypium hirsutum miR169 target HAP2/CCAAT
1395 MRT3702_11008C.6 1183-1203 Arabidopsis transcription factor;
thaliana At3g05690 miR169 target HAP2A, CCAAT- 1396
MRT3702_145277C.3 1122-1142 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) family protein; ATHAP2A, EMBRYO
DEFECTIVE 2220 miR169 target miR169 target 1397 MRT3702_145278C.1
1870-1890 Arabidopsis thaliana miR169 target HAP2, CCAAT- 1398
MRT3702_1608C.8 1254-1274 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1399
MRT3702_167062C.2 1489-1509 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) miR169 target HAP2C, CCAAT- 1400
MRT3702_175138C.1 1412-1432 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) family protein; At1g17590 miR169
target HAP2A, CCAAT- 1401 MRT3702_176968C.1 1037-1057 Arabidopsis
binding transcription thaliana factor (CBF-B/NF-YA) family protein;
ATHAP2A, EMBRYO DEFECTIVE 2220 miR169 target HAP2, CCAAT- 1402
MRT3702_180826C.1 1610-1630 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1403
MRT3702_20139C.6 1305-1325 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1404
MRT3702_20659C.7 1428-1448 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1405
MRT3702_4133C.5 1308-1328 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1406
MRT3702_5699C.6 1504-1524 Arabidopsis binding transcription
thaliana factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1407
MRT3708_42756C.1 928-948 Brassica binding transcription napus
factor (CBF-B/NF-YA) miR169 target miR169 target 1408
MRT3708_45516C.2 1074-1094 Brassica napus miR169 target HAP2,
CCAAT- 1409 MRT3708_46224C.1 1017-1037 Brassica binding
transcription napus factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT-
1410 MRT3708_56325C.1 670-690 Brassica binding transcription napus
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1411
MRT3711_4547C.1 157-177 Brassica binding transcription rapa factor
(CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1412 MRT3712_6671C.1
481-501 Brassica binding transcription oleracea factor
(CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1413 MRT3847_251095C.3
995-1015 Glycine max binding transcription factor (CBF-B/NF-YA)
miR169 target HAP2, CCAAT- 1414 MRT3847_25786C.5 1208-1228 Glycine
max binding transcription factor (CBF-B/NF-YA) miR169 target HAP2,
CCAAT- 1415 MRT3847_278998C.2 722-742 Glycine max binding
transcription factor (CBF-B/NF-YA) miR169 target miR169 target 1416
MRT3847_305217C.3 1028-1048 Glycine max miR169 target HAP2, CCAAT-
1417 MRT3847_312701C.1 803-823 Glycine max binding transcription
factor (CBF-B/NF-YA) miR169 target miR169 target 1418
MRT3847_335193C.1 1452-1472 Glycine max miR169 target HAP2, CCAAT-
1419 MRT3847_51286C.6 801-821 Glycine max binding transcription
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1420
MRT3847_53466C.6 1490-1510 Glycine max binding transcription factor
(CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1421 MRT3847_53467C.5
902-922 Glycine max binding transcription factor (CBF-B/NF-YA)
miR169 target HAP2, CCAAT- 1422 MRT3847_54010C.4 1403-1423 Glycine
max binding transcription factor (CBF-B/NF-YA) miR169 target HAP2,
CCAAT- 1423 MRT3880_16272C.2 1496-1516 Medicago binding
transcription truncatula factor (CBF-B/NF-YA) miR169 target HAP2,
CCAAT- 1424 MRT3880_21811C.2 1054-1074 Medicago binding
transcription truncatula factor (CBF-B/NF-YA) miR169 target miR169
target 1425 MRT3880_36579C.1 90-110 Medicago truncatula miR169
target miR169 target 1426 MRT3880_48656C.1 73-94 Medicago
truncatula miR169 target miR169 target 1427 MRT3880_55431C.1
145-166 Medicago truncatula miR169 target HAP2, CCAAT- 1428
MRT3880_59679C.1 1268-1288 Medicago binding transcription
truncatula factor (CBF-B/NF-YA) miR169 target miR169 target 1429
MRT3880_9392C.1 182-202 Medicago truncatula miR169 target HAP2,
CCAAT- 1430 MRT4513_27452C.1 721-741 Hordeum binding transcription
vulgare factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1431
MRT4513_38912C.1 1037-1057 Hordeum binding transcription vulgare
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1432
MRT4513_51394C.1 631-651 Hordeum binding transcription vulgare
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1433
MRT4530_156068C.3 1715-1735 Oryza binding transcription sativa
factor (CBF-B/NF-YA) miR169 target miR169 target 1434
MRT4530_16169C.4 1389-1409 Oryza sativa miR169 target HAP2, CCAAT-
1435 MRT4530_196466C.4 2027-2047 Oryza binding transcription sativa
factor (CBF-B/NF-YA) miR169 target miR169 target 1436
MRT4530_223395C.1 653-673 Oryza sativa miR169 target RAPB protein;
rapB 1437 MRT4530_225972C.3 867-887 Oryza sativa miR169 target
miR169 target 1438 MRT4530_238300C.1 220-240 Oryza sativa miR169
target HAP2, CCAAT- 1439 MRT4530_267924C.1 1002-1022 Oryza binding
transcription sativa factor (CBF-B/NF-YA) miR169 target HAP2,
CCAAT- 1440 MRT4530_268072C.1 756-776 Oryza binding transcription
sativa factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1441
MRT4530_52650C.3 1391-1411 Oryza binding transcription sativa
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1442
MRT4530_67920C.7 1637-1657 Oryza binding transcription sativa
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1443
MRT4530_98042C.6 1170-1190 Oryza binding transcription sativa
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1444
MRT4558_11671C.2 530-550 Sorghum binding transcription bicolor
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1445
MRT4558_13240C.2 880-900 Sorghum binding transcription bicolor
factor (CBF-B/NF-YA) miR169 target HAP2, CCAAT- 1446
MRT4558_19368C.2 726-746 Sorghum binding transcription bicolor
factor (CBF-B/NF-YA) miR169 target Transcription factor 1447
MRT4558_8287C.2 346-366 Sorghum bicolor miR169 target miR169 target
1448 MRT4565_219265C.1 936-956 Triticum aestivum miR169 target
HAP2, CCAAT- 1449 MRT4565_224073C.1 1081-1101 Triticum binding
transcription aestivum factor (CBF-B/NF-YA) miR169 target miR169
target 1450 MRT4565_232474C.1 1040-1060 Triticum aestivum miR169
target miR169 target 1451 MRT4565_236768C.1 1284-1304 Triticum
aestivum miR169 target HAP2, CCAAT- 1452 MRT4565_240119C.1 934-954
Triticum binding transcription aestivum factor (CBF-B/NF-YA) miR169
target HAP2, CCAAT- 1453 MRT4565_250357C.1 1230-1250 Triticum
binding transcription aestivum factor (CBF-B/NF-YA) miR169 target
HAP2, CCAAT- 1454 MRT4565_270644C.1 1050-1070 Triticum binding
transcription aestivum factor (CBF-B/NF-YA) miR169 target miR169
target 1455 MRT4565_271488C.1 1032-1052 Triticum aestivum miR169
target HAP2, CCAAT- 1456 MRT4565_271817C.1 2171-2191 Triticum
binding transcription aestivum factor (CBF-B/NF-YA) miR169 target
miR169 target 1457 MRT4565_278167C.1 895-915 Triticum aestivum
miR169 target miR169 target 1458 MRT4577_136204C.6 573-593 Zea mays
miR169 target miR169 target 1459 MRT4577_192239C.6 1297-1317 Zea
mays miR169 target miR169 target 1460 MRT4577_270253C.7 1375-1395
Zea mays miR169 target miR169 target 1461 MRT4577_321589C.4
1051-1071 Zea mays miR169 target miR169 target 1462
MRT4577_35015C.6 1679-1699 Zea mays miR169 target miR169 target
1463 MRT4577_40749C.8 1361-1381 Zea mays miR169 target miR169
target 1464 MRT4577_411247C.4 1445-1465 Zea mays miR169 target
miR169 target 1465 MRT4577_428392C.4 1583-1603 Zea mays miR169
target miR169 target 1466 MRT4577_434247C.4 671-691 Zea mays miR169
target miR169 target 1467 MRT4577_536961C.2 920-940 Zea mays miR169
target miR169 target 1468 MRT4577_536962C.2 1836-1856 Zea mays
miR169 target miR169 target 1469 MRT4577_540147C.2 1327-1347 Zea
mays miR169 target miR169 target 1470 MRT4577_556372C.2 1417-1437
Zea mays miR169 target miR169 target 1471 MRT4577_570253C.1 340-360
Zea mays miR169 target miR169 target 1472 MRT4577_570254C.1
1391-1411 Zea mays miR169 target miR169 target 1473
MRT4577_668660C.1 1292-1312 Zea mays miR169 target miR169 target
1474 MRT4577_693949C.1 400-420 Zea mays miR169 target miR169 target
1475 MRT4577_701125C.1 471-491 Zea mays miR169 target miR169 target
1476 MRT4577_72313C.1 262-282 Zea mays miRNA miR171b 1477 Zea mays
miRNA osa-MIR171b 1478 Oryza Improved precursor for (precursor)
sativa yield* overexpression of mature miR171 miR171 target
Scarecrow-like Scl1 1479 MRT4577_520619C.1 106-126 Zea mays protein
(3e-37); GRAS family transcription factor miR171 target
Scarecrow-like Scl1 1480 MRT4577_139132C.5 1336-1356 Zea mays
protein (3e-37); GRAS family transcription factor miR171 target
Scarecrow-like Scl1 1481 MRT4577_75777C.7 640-660 Zea mays protein
(3e-37); GRAS family transcription factor miR171 target
Scarecrow-like Scl1 1482 MRT4577_234039C.5 771-791 Zea mays protein
(3e-37); GRAS family transcription factor miR171 target
Scarecrow-like Scl1 1483 MRT4577_57336C.8 1274-1294 Zea mays
protein (3e-37); GRAS family transcription factor miR171 target
Scarecrow-like Scl1 1484 MRT4577_140896C.5 507-527 Zea mays protein
(3e-37); GRAS family transcription factor miR171 target
Scarecrow-like Scl1 1485 MRT4577_30852C.5 800-820 Zea mays protein
(3e-37); GRAS family transcription factor miRNA miR172 1486 Zea
mays miRNA miR172 1487 Zea mays miR172 target Glossy15 1488 Zea
mays Decoy miR172 decoy 1489 Artificial Improved sequence yield*
Decoy miR172 decoy 1490 Artificial Improved sequence yield* Decoy
miR172 decoy 1491 Artificial Improved sequence yield* miRNA
miRMON18 1492 Zea mays Cleavage mirR172 cleavage 1493 Artificial
Improved blocker blocker sequence yield* miR172 target AP2 domain
1494 MRT3635_50596C.2 622-642 Gossypium transcription factor;
hirsutum SCHNARCHZAPFEN; SNZ miR172 target AP2 domain 1495
MRT3635_64291C.1 246-266 Gossypium transcription factor; hirsutum
SCHNARCHZAPFEN; SNZ miR172 target AP2 domain 1496 MRT3635_64989C.1
1102-1122 Gossypium transcription factor; hirsutum SCHNARCHZAPFEN;
SNZ miR172 target miR172 target 1497 MRT3635_65450C.1 241-261
Gossypium hirsutum miR172 target miR172 target 1498
MRT3635_70864C.1 646-666 Gossypium hirsutum miR172 target AP2
domain 1499 MRT3635_8244C.2 1657-1677 Gossypium transcription
factor; hirsutum SCHNARCHZAPFEN; SNZ miR172 target AP2 domain 1500
MRT3702_103726C.5 1044-1064 Arabidopsis transcription factor;
thaliana SCHNARCHZAPFEN; SNZ miR172 target AP2 domain containing
1501 MRT3702_103748C.5 1560-1580 Arabidopsis protein RAP2.7
thaliana miR172 target AP2 domain 1502 MRT3702_14904C.2 1095-1115
Arabidopsis transcription factor; thaliana SCHLAFMUTZE; SMZ miR172
target AP2 domain 1503 MRT3702_150241C.1 947-967 Arabidopsis
transcription factor-like thaliana miR172 target AP2 domain 1504
MRT3702_156728C.3 1030-1050 Arabidopsis transcription factor-like
thaliana miR172 target APETALA2; AP2 1505 MRT3702_168284C.1
1271-1291 Arabidopsis thaliana miR172 target AP2 domain- 1506
MRT3702_175574C.1 1630-1650 Arabidopsis containing transcription
thaliana factor RAP2.7 miR172 target AP2 domain 1507
MRT3702_179746C.1 263-283 Arabidopsis transcription factor;
thaliana SCHNARCHZAPFEN; SNZ miR172 target AP2 domain 1508
MRT3702_19267C.5 1368-1388 Arabidopsis transcription factor-like
thaliana miR172 target elongation factor 2-like 1509
MRT3702_4319C.8 1045-1065 Arabidopsis thaliana miR172 target AP2
domain 1510 MRT3702_76733C.6 1663-1683 Arabidopsis transcription
factor; thaliana SCHNARCHZAPFEN; SNZ miR172 target AP2 domain 1511
MRT3708_36942C.2 411-431 Brassica transcription factor-like napus
miR172 target AP2 domain 1512 MRT3708_39387C.1 366-386 Brassica
transcription factor-like napus miR172 target AP2 domain 1513
MRT3711_6838C.1 137-157 Brassica transcription factor-like rapa
miR172 target miR172 target 1514 MRT3847_196945C.3 667-687 Glycine
max miR172 target AP2 domain 1515 MRT3847_202930C.3 1630-1650
Glycine max transcription factor-like miR172 target AP2 domain 1516
MRT3847_235857C.3 1789-1809 Glycine max transcription factor-like
miR172 target miR172 target 1517 MRT3847_257655C.4 1984-2004
Glycine max miR172 target AP2 domain 1518 MRT3847_289890C.3
2213-2233 Glycine max transcription factor-like miR172 target
miR172 target 1519 MRT3847_289891C.3 529-549 Glycine max miR172
target AP2 domain 1520 MRT3847_295726C.1 1539-1559 Glycine max
transcription factor-like miR172 target AP2 domain 1521
MRT3847_326790C.1 1269-1289 Glycine max transcription factor-like
miR172 target AP2 domain 1522 MRT3847_329301C.1 775-795 Glycine max
transcription factor-like miR172 target miR172 target 1523
MRT3847_344570C.1 564-584 Glycine max miR172 target AP2 domain 1524
MRT3847_43925C.7 811-831 Glycine max transcription factor-like
miR172 target AP2 domain 1525 MRT3847_46007C.5 1544-1564 Glycine
max transcription factor-like miR172 target AP2 domain 1526
MRT3847_51633C.3 910-930 Glycine max transcription factor-like
miR172 target miR172 target 1527 MRT3847_59804C.6 2369-2389 Glycine
max miR172 target AP2 domain 1528 MRT3880_19283C.1 558-578 Medicago
transcription factor-like truncatula miR172 target AP2 domain 1529
MRT3880_32459C.1 311-331 Medicago transcription factor-like
truncatula miR172 target AP2 domain 1530 MRT3880_36568C.1 1424-1444
Medicago transcription factor-like truncatula miR172 target AP2
domain 1531 MRT3880_39959C.1 1689-1709 Medicago transcription
factor-like truncatula miR172 target AP2 domain 1532
MRT3880_55789C.1 1241-1261 Medicago transcription factor-like
truncatula miR172 target AP2 domain 1533 MRT4513_42015C.1 1464-1484
Hordeum transcription factor-like vulgare miR172 target AP2 domain
1534 MRT4513_6417C.1 632-652 Hordeum transcription factor-like
vulgare miR172 target miR172 target 1535 MRT4530_140532C.4
1358-1378 Oryza sativa miR172 target AP2 domain 1536
MRT4530_146548C.4 669-689 Oryza transcription factor; sativa
SCHNARCHZAPFEN; SNZ miR172 target AP2 domain 1537 MRT4530_160275C.3
1405-1425 Oryza transcription factor-like sativa miR172 target
miR172 target 1538 MRT4530_16723C.7 804-824 Oryza sativa miR172
target AP2 domain 1539 MRT4530_209082C.4 1976-1996 Oryza
transcription factor; sativa SCHNARCHZAPFEN; SNZ miR172 target AP2
domain 1540 MRT4530_212672C.3 187-207 Oryza transcription
factor-like sativa miR172 target miR172 target 1541
MRT4530_238241C.2 1481-1501 Oryza sativa miR172 target AP2 domain
1542 MRT4530_263068C.2 1768-1788 Oryza transcription factor; sativa
SCHNARCHZAPFEN; SNZ miR172 target miR172 target 1543
MRT4530_266671C.1 2391-2411 Oryza sativa miR172 target miR172
target 1544 MRT4530_272652C.1 378-398 Oryza sativa miR172 target
miR172 target 1545 MRT4530_274692C.1 236-256 Oryza sativa miR172
target AP2 domain 1546 MRT4530_56773C.3 1148-1168 Oryza
transcription factor-like sativa miR172 target Zinc finger (C3HC4-
1547 MRT4530_57252C.7 41-61 Oryza type RING sativa
finger)protein-like, transport, nucleus, metal ion binding miR172
target miR172 target 1548 MRT4558_24999C.3 298-318 Sorghum bicolor
miR172 target AP2 domain 1549 MRT4558_25704C.2 512-532 Sorghum
transcription factor; bicolor SCHNARCHZAPFEN; SNZ miR172 target
miR172 target 1550 MRT4565_108668C.1 220-240 Triticum aestivum
miR172 target AP2 domain 1551 MRT4565_118657C.1 354-374 Triticum
transcription factor-like aestivum miR172 target AP2 domain 1552
MRT4565_235388C.1 572-592 Triticum transcription factor-like
aestivum miR172 target AP2 domain 1553 MRT4565_245146C.1 1148-1168
Triticum transcription factor-like aestivum miR172 target AP2
domain 1554 MRT4565_247090C.1 1462-1482 Triticum transcription
factor-like aestivum miR172 target miR172 target 1555
MRT4565_249252C.1 551-571 Triticum aestivum miR172 target AP2
domain 1556 MRT4565_256056C.1 810-830 Triticum transcription
factor-like aestivum miR172 target AP2 domain 1557
MRT4565_273183C.1 1152-1172 Triticum transcription factor-like
aestivum miR172 target AP2 domain 1558 MRT4565_279009C.1 1155-1175
Triticum transcription factor-like aestivum miR172 target miR172
target 1559 MRT4565_83602C.3 26-46 Triticum aestivum miR172 target
Glycosyltransferase 1560 MRT4565_88032C.3 361-381 Triticum aestivum
miR172 target miR172 target 1561 MRT4577_12523C.7 2414-2434 Zea
mays miR172 target miR172 target 1562 MRT4577_243746C.1 140-160 Zea
mays miR172 target miR172 target 1563 MRT4577_27478C.9 1546-1566
Zea mays miR172 target miR172 target 1564 MRT4577_304712C.4
1326-1346 Zea mays miR172 target miR172 target 1565
MRT4577_307553C.7 1508-1528 Zea mays miR172 target AP2 domain 1566
MRT4577_39951C.8 1611-1631 Zea mays transcription factor-like
miR172 target miR172 target 1567 MRT4577_431122C.3 1359-1379 Zea
mays miR172 target miR172 target 1568 MRT4577_431125C.4 824-844 Zea
mays miR172 target miR172 target 1569 MRT4577_455774C.3 963-983 Zea
mays miR172 target miR172 target 1570 MRT4577_468762C.3 2414-2434
Zea mays miR172 target miR172 target 1571 MRT4577_49516C.9 408-428
Zea mays miR172 target AP2 domain 1572 MRT4577_49517C.8 1652-1672
Zea mays transcription factor-like miR172 target miR172 target 1573
MRT4577_548310C.2 1451-1471 Zea mays miR172 target miR172 target
1574 MRT4577_556612C.2 1352-1372 Zea mays miR172 target miR172
target 1575 MRT4577_597136C.1 551-571 Zea mays miR172 target miR172
target 1576 MRT4577_616573C.1 670-690 Zea mays miR172 target miR172
target 1577 MRT4577_668951C.1 270-290 Zea mays miR172 target miR172
target 1578 MRT4577_669210C.1 1031-1051 Zea mays miR172 target
miR172 target 1579 MRT4577_676464C.1 1308-1328 Zea mays miR172
target miR172 target 1580 MRT4577_679724C.1 157-177 Zea mays miR172
target miR172 target 1581 MRT4577_700043C.1 147-167 Zea mays miR172
target miR172 target 1582 MRT4577_701524C.1 136-156 Zea mays miR172
target miR172 target 1583 MRT4577_708079C.1 540-560 Zea mays miRNA
miR319 1584 Zea mays miRNA osa-MIR319 1585 Oryza Improved precursor
for (precursor) sativa yield* overexpression of mature miR319
miR319 target TCP family 1586 MRT4577_275782C.5 1673-1692 Zea mays
transcription factor miR319 target TCP family 1587
MRT4577_558102C.1 949-968 Zea mays transcription factor miR319
target TCP family 1588 MRT4577_30525C.5 1316-1335 Zea mays
transcription factor miR319 target TCP family 1589
MRT4577_275060C.2 818-836 Zea mays transcription factor miR319
target TCP family 1590 MRT4577_22397C.4 943-961 Zea mays
transcription factor miR319 target TCP family 1591
MRT4577_275063C.5 1247-1265 Zea mays transcription factor miR319
target TCP family 1592 MRT4577_480991C.1 150-169 Zea mays
transcription factor miR319 target TCP family 1593
MRT4577_427906C.3 1557-1576 Zea mays transcription factor miR319
target TCP family 1594 MRT4577_213173C.3 1594-1613 Zea mays
transcription factor miRNA miR396 1595 Zea mays miR396 target
Zm-GRF1 1596 Zea mays Decoy miR396 decoy 1597 Artificial Improved
construct yield* Decoy miR396 decoy 1598 Artificial Improved
sequence yield* Decoy miR396 decoy 1599 Artificial Improved
sequence yield* miR396 target miR396 target 1600 MRT3635_67262C.1
6-25 Gossypium hirsutum miR396 target miR396 target 1601
MRT3635_70418C.1 147-166 Gossypium hirsutum miR396 target miR396
target 1602 MRT3635_71272C.1 414-433 Gossypium hirsutum miR396
target miR396 target 1603 MRT3635_71696C.1 37-56 Gossypium hirsutum
miR396 target ATP-dependent RNA 1604 MRT3702_15262C.6 1141-1160
Arabidopsis helicase-like protein thaliana miR396 target subtilase
family 1605 MRT3702_17628C.6 1886-1905 Arabidopsis
protein, contains Pfam thaliana profile: PF00082 subtilase family
miR396 target miR396 target 1606 MRT3702_18069C.6 2763-2782
Arabidopsis thaliana miR396 target miR396 target 1607
MRT3702_2454C.7 1387-1406 Arabidopsis thaliana miR396 target miR396
target 1608 MRT3708_59476C.1 194-213 Brassica napus miR396 target
miR396 target 1609 MRT3708_61891C.1 236-255 Brassica napus miR396
target Cysteine proteinase 1610 MRT3847_115000C.2 180-199 Glycine
max precursor, proteolysis; cysteine-type endopeptidase activity
miR396 target miR396 target 1611 MRT3847_249313C.3 1165-1184
Glycine max miR396 target Putative fimbriata, 1612
MRT3847_260044C.4 1337-1356 Glycine max ubiquitin cycle, nucleus,
protein binding miR396 target miR396 target 1613 MRT3847_282324C.5
578-597 Glycine max miR396 target Microsomal 1614 MRT3847_32554C.3
245-264 Glycine max cytochrome b5, electron transport,
mitochondrial inner membrane, iron ion binding miR396 target
BRASSINOSTEROID 1615 MRT3847_60193C.5 1967-1986 Glycine max
INSENSITIVE 1- associated receptor kinase 1 precursor (EC 2.7.11.1)
(BRI1- associated receptor kinase 1) (Somatic embryogenesis
receptor-like kinase 3), protein amino acid phosphorylation,
integral to membrane, protein serine/threonine kinase activity
miR396 target miR396 target 1616 MRT3847_72393C.1 34-53 Glycine max
miR396 target Putative AFG1-like 1617 MRT4513_2056C.1 294-313
Hordeum ATPase vulgare miR396 target Putative fimbriata, cell 1618
MRT4513_23211C.1 721-740 Hordeum differentiation, nucleus, vulgare
protein binding miR396 target Cryptochrome 2, DNA 1619
MRT4513_24452C.1 19-38 Hordeum repair, DNA vulgare photolyase
activity miR396 target miR396 target 1620 MRT4513_32857C.1 621-640
Hordeum vulgare miR396 target S-locus protein 5 1621
MRT4513_48780C.1 84-103 Hordeum vulgare miR396 target miR396 target
1622 MRT4530_139664C.5 2371-2390 Oryza sativa miR396 target
Putative RNA 1623 MRT4530_171648C.2 1063-1082 Oryza polymerase III,
sativa RNA_pol_Rpb2_1: RNA polymerase beta subunit, RNA_pol_Rpb2_3:
RNA polymerase Rpb2, domain 3, RNA_pol_Rpb2_4: RNA polymerase Rpb2,
domain 4, RNA_pol_Rpb2_5: RNA polymerase Rpb2, domain 5,
RNA_pol_Rpb2_6: RNA polymerase Rpb2, domain 6, RNA_pol_Rpb2_7: RNA
polymerase Rpb2, domain 7; transcription; nucleus; metal ion
binding miR396 target miR396 target 1624 MRT4530_267934C.1 467-486
Oryza sativa miR396 target miR396 target 1625 MRT4530_268027C.1
95-114 Oryza sativa miR396 target miR396 target 1626
MRT4530_27400C.6 682-701 Oryza sativa miR396 target miR396 target
1627 MRT4530_59122C.7 573-591 Oryza sativa miR396 target miR396
target 1628 MRT4530_62393C.7 2341-2360 Oryza sativa miR396 target
miR396 target 1629 MRT4530_81835C.6 1243-1262 Oryza sativa miR396
target Hypothetical protein 1630 MRT4530_98651C.4 271-290 Oryza
P0698A04.3; GRP: sativa Glycine rich protein family miR396 target
Putative fimbriata, F- 1631 MRT4558_11973C.2 1234-1253 Sorghum box:
F-box domain bicolor miR396 target Methyltransferase, 1632
MRT4558_29180C.1 101-120 Sorghum putative, cell wall bicolor (sensu
Magnoliophyta), methyltransferase activity miR396 target miR396
target 1633 MRT4558_34091C.1 266-285 Sorghum bicolor miR396 target
Putative receptor-like 1634 MRT4558_9324C.2 375-394 Sorghum kinase;
Pkinase_Tyr: bicolor Protein tyrosine kinase, protein amino acid
phosphorylation, integral to membrane, protein-tyrosine kinase
activity miR396 target Acyl-CoA 1635 MRT4565_127266C.2 27-46
Triticum dehydrogenase, aestivum putative miR396 target miR396
target 1636 MRT4565_162831C.1 1134-1153 Triticum aestivum miR396
target Ribulose-1,5- 1637 MRT4565_200090C.1 1047-1066 Triticum
bisphosphate aestivum carboxylase/oxygenase small subunit miR396
target Putative fimbriata 1638 MRT4565_230957C.1 450-469 Triticum
aestivum miR396 target Dirigent-like protein 1639 MRT4565_234418C.1
1427-1446 Triticum aestivum miR396 target putative F-box protein
1640 MRT4565_242541C.1 1472-1491 Triticum aestivum miR396 target
Putative 1641 MRT4565_244837C.1 918-937 Triticum folylpolyglutamate
aestivum synthetase, folic acid and derivative biosynthesis,
extracellular space, ATP binding miR396 target miR396 target 1642
MRT4565_248632C.1 625-644 Triticum aestivum miR396 target miR396
target 1643 MRT4565_249453C.1 108-127 Triticum aestivum miR396
target Folylpolyglutamate 1644 MRT4565_253149C.1 616-635 Triticum
synthetase, putative, aestivum folic acid and derivative
biosynthesis, ATP binding (4e-99) miR396 target Phytochrome/protein
1645 MRT4565_253747C.1 894-913 Triticum kinase-like, protein
aestivum amino acid phosphorylation, protein-tyrosine kinase
activity miR396 target Putative fimbriata 1646 MRT4565_259298C.1
1362-1381 Triticum aestivum miR396 target Putative fimbriata 1647
MRT4565_260134C.1 414-433 Triticum aestivum miR396 target miR396
target 1648 MRT4565_273137C.1 137-156 Triticum aestivum miR396
target Putative 1649 MRT4577_130243C.1 12-31 Zea mays
dihydrolipoamide S- acetyltransferase; Biotin_lipoyl: Biotin-
requiring enzyme, metabolism, mitochondrion, dihydrolipoyllysine-
residue acetyltransferase activity miR396 target miR396 target 1650
MRT4577_165771C.1 95-114 Zea mays miR396 target miR396 target 1651
MRT4577_213750C.1 60-79 Zea mays miR396 target miR396 target 1652
MRT4577_26483C.7 805-824 Zea mays miR396 target miR396 target 1653
MRT4577_341149C.6 1110-1129 Zea mays miR396 target miR396 target
1654 MRT4577_355112C.1 159-177 Zea mays miR396 target Putative
gag-pol 1655 MRT4577_406214C.1 376-395 Zea mays miR396 target
beta-keto acyl 1656 MRT4577_416676C.5 1463-1482 Zea mays reductase;
cuticular wax biosynthesis; glossy8 miR396 target miR396 target
1657 MRT4577_521629C.3 555-574 Zea mays miR396 target miR396 target
1658 MRT4577_540304C.2 1355-1374 Zea mays miR396 target miR396
target 1659 MRT4577_540948C.2 1095-1114 Zea mays miR396 target
miR396 target 1660 MRT4577_548836C.1 467-486 Zea mays miR396 target
Retrotransposon 1661 MRT4577_555855C.1 148-167 Zea mays protein,
putative, unclassified; Retrotrans_gag: Retrotransposon gag
protein, RNA- dependent DNA replication, nucleus, RNA-directed DNA
polymerase activity miR396 target miR396 target 1662
MRT4577_557678C.2 344-363 Zea mays miR396 target miR396 target 1663
MRT4577_561121C.1 956-975 Zea mays miR396 target miR396 target 1664
MRT4577_564288C.1 290-309 Zea mays miR396 target miR396 target 1665
MRT4577_56429C.8 1315-1334 Zea mays miR396 target miR396 target
1666 MRT4577_595828C.1 63-82 Zea mays miR396 target miR396 target
1667 MRT4577_613832C.1 1029-1048 Zea mays miR396 target miR396
target 1668 MRT4577_619443C.1 394-413 Zea mays miR396 target miR396
target 1669 MRT4577_635169C.1 602-621 Zea mays miR396 target miR396
target 1670 MRT4577_638921C.1 172-191 Zea mays miR396 target miR396
target 1671 MRT4577_664914C.1 581-600 Zea mays miRNA miR393 1672
Zea mays miR393 target TIR1-like transport 1673 MRT3635_18188C.2
746-766 Gossypium inhibitor response-like hirsutum protein miR393
target TIR1-like transport 1674 MRT3635_18850C.2 171-191 Gossypium
inhibitor response-like hirsutum protein miR393 target TIR1-like
transport 1675 MRT3635_35639C.2 1049-1069 Gossypium inhibitor
response-like hirsutum protein miR393 target TIR1-like transport
1676 MRT3635_49076C.2 373-393 Gossypium inhibitor response-like
hirsutum protein miR393 target TIR1-like transport 1677
MRT3635_68504C.1 1996-2016 Gossypium inhibitor response-like
hirsutum protein miR393 target TIR1-like transport 1678
MRT3702_13118C.8 2015-2035 Arabidopsis inhibitor response-like
thaliana protein; At3g26830 miR393 target TIR1-like transport 1679
MRT3702_145409C.1 1508-1528 Arabidopsis inhibitor response-like
thaliana protein miR393 target TIR1-like transport 1680
MRT3702_15703C.8 1738-1758 Arabidopsis inhibitor response-like
thaliana protein miR393 target TIR1-like transport 1681
MRT3702_16076C.7 1587-1607 Arabidopsis inhibitor response-like
thaliana protein miR393 target TIR1-like transport 1682
MRT3702_92498C.6 1898-1918 Arabidopsis inhibitor response-like
thaliana protein; At1g12820 miR393 target TIR1-like transport 1683
MRT3708_31301C.1 259-280 Brassica inhibitor response-like napus
protein miR393 target TIR1-like transport 1684 MRT3708_52518C.1
250-270 Brassica inhibitor response-like napus protein
miR393 target TIR1-like transport 1685 MRT3708_55951C.1 93-113
Brassica inhibitor response-like napus protein miR393 target
TIR1-like transport 1686 MRT3711_1771C.1 103-123 Brassica inhibitor
response-like rapa protein miR393 target TIR1-like transport 1687
MRT3847_238705C.4 1172-1192 Glycine max inhibitor response-like
protein miR393 target TIR1-like transport 1688 MRT3847_27973C.7
1339-1359 Glycine max inhibitor response-like protein miR393 target
miR393 target 1689 MRT3847_313402C.3 958-978 Glycine max miR393
target miR393 target 1690 MRT3847_329954C.2 1740-1760 Glycine max
miR393 target miR393 target 1691 MRT3847_335477C.1 1715-1735
Glycine max miR393 target miR393 target 1692 MRT3847_338734C.1
1474-1494 Glycine max miR393 target TIR1-like transport 1693
MRT3847_44371C.6 2345-2365 Glycine max inhibitor response-like
protein miR393 target miR393 target 1694 MRT3880_18564C.2 3116-3136
Medicago truncatula miR393 target TIR1-like transport 1695
MRT3880_38847C.1 139-159 Medicago inhibitor response-like
truncatula protein miR393 target TIR1-like transport 1696
MRT4513_12741C.1 197-217 Hordeum inhibitor response-like vulgare
protein miR393 target TIR1-like transport 1697 MRT4513_38675C.1
419-439 Hordeum inhibitor response-like vulgare protein miR393
target miR393 target 1698 MRT4530_113561C.5 5590-5610 Oryza sativa
miR393 target TIR1-like transport 1699 MRT4530_237446C.2 2221-2241
Oryza inhibitor response-like sativa protein miR393 target
TIR1-like transport 1700 MRT4530_241313C.2 1706-1726 Oryza
inhibitor response-like sativa protein miR393 target TIR1-like
transport 1701 MRT4558_1226C.2 167-187 Sorghum inhibitor
response-like bicolor protein miR393 target TIR1-like transport
1702 MRT4558_20000C.2 412-432 Sorghum inhibitor response-like
bicolor protein miR393 target TIR1-like transport 1703
MRT4565_141193C.1 43-63 Triticum inhibitor response-like aestivum
protein miR393 target TIR1-like transport 1704 MRT4565_226582C.1
486-506 Triticum inhibitor response-like aestivum protein miR393
target TIR1-like transport 1705 MRT4565_247449C.1 28-48 Triticum
inhibitor response-like aestivum protein miR393 target TIR1-like
transport 1706 MRT4565_274399C.1 1499-1519 Triticum inhibitor
response-like aestivum protein miR393 target miR393 target 1707
MRT4577_262597C.7 2373-2393 Zea mays miR393 target miR393 target
1708 MRT4577_39097C.9 1716-1736 Zea mays miR393 target miR393
target 1709 MRT4577_546333C.2 1349-1369 Zea mays miR393 target
miR393 target 1710 MRT4577_656737C.1 1325-1345 Zea mays miRNA
miR395 1711 Zea mays miR395 target ATP sulfurylase 1712 Zea mays
domain protein Decoy miR395 decoy 1713 Artificial Improved sequence
yield* miR395 target ATP sulfurylase 1714 MRT3635_15903C.2 410-429
Gossypium domain protein hirsutum miR395 target ATP sulfurylase
1715 MRT3635_48567C.2 480-499 Gossypium domain protein hirsutum
miR395 target ATP sulfurylase 1716 MRT3702_166264C.1 202-221
Arabidopsis domain protein thaliana miR395 target Sulfate
transporter 1717 MRT3702_169467C.1 107-126 Arabidopsis thaliana
miR395 target ATP sulfurylase 1718 MRT3702_17054C.8 470-489
Arabidopsis domain protein thaliana miR395 target ATP sulfurylase
1719 MRT3702_177422C.1 340-359 Arabidopsis domain protein thaliana
miR395 target Sulfate transporter 1720 MRT3702_20451C.6 125-144
Arabidopsis thaliana miR395 target ATP sulfurylase 1721
MRT3702_23086C.8 544-563 Arabidopsis domain protein thaliana miR395
target ATP sulfurylase 1722 MRT3702_57141C.1 331-350 Arabidopsis
domain protein thaliana miR395 target ATP sulfurylase 1723
MRT3708_36129C.1 403-422 Brassica domain protein napus miR395
target ATP sulfurylase 1724 MRT3708_4492C.1 316-335 Brassica domain
protein napus miR395 target ATP sulfurylase 1725 MRT3708_55043C.1
400-419 Brassica domain protein napus miR395 target ATP sulfurylase
1726 MRT3711_3394C.1 356-375 Brassica domain protein rapa miR395
target ATP sulfurylase 1727 MRT3711_4165C.1 383-402 Brassica domain
protein rapa miR395 target ATP sulfurylase 1728 MRT3711_4313C.1
384-403 Brassica domain protein rapa miR395 target Sulfate
transporter 1729 MRT3712_1686C.1 124-143 Brassica oleracea miR395
target Sulfate transporter 1730 MRT3847_10451C.5 125-144 Glycine
max miR395 target Sulfate transporter 1731 MRT3847_131987C.4
153-172 Glycine max miR395 target ATP sulfurylase 1732
MRT3847_14792C.7 641-660 Glycine max domain protein miR395 target
Sulfate transporter 1733 MRT3847_245035C.3 64-83 Glycine max miR395
target ATP sulfurylase 1734 MRT3847_331787C.1 381-400 Glycine max
domain protein miR395 target ATP sulfurylase 1735 MRT4530_16384C.4
560-579 Oryza domain protein sativa miR395 target Sulfate
transporter 1736 MRT4530_33633C.6 746-765 Oryza sativa miR395
target ATP sulfurylase 1737 MRT4558_11861C.1 474-493 Sorghum domain
protein bicolor miR395 target Sulfate transporter 1738
MRT4558_24400C.2 275-294 Sorghum bicolor miR395 target Sulfate
transporter 1739 MRT4565_219452C.1 259-278 Triticum aestivum miR395
target ATP sulfurylase 1740 MRT4565_223839C.1 541-560 Triticum
domain protein aestivum miR395 target ATP sulfurylase 1741
MRT4565_232080C.1 462-481 Triticum domain protein aestivum miR395
target ATP sulfurylase 1742 MRT4565_236093C.1 542-561 Triticum
domain protein aestivum miR395 target ATP sulfurylase 1743
MRT4565_254783C.1 482-501 Triticum domain protein aestivum miR395
target miR395 target 1744 MRT4565_35429C.3 207-226 Triticum
aestivum miR395 target ATP sulfurylase 1745 MRT4577_118322C.5
455-474 Zea mays domain protein miR395 target ATP sulfurylase 1746
MRT4577_386324C.4 465-484 Zea mays domain protein miR395 target ATP
sulfurylase 1747 MRT4577_57434C.9 528-547 Zea mays domain protein
miR395 target miR395 target 1748 MRT4577_644561C.1 27-46 Zea mays
miR395 target miR395 target 1749 MRT4577_694623C.1 449-468 Zea mays
miRNA miR398 1750 Zea mays miR398 target SODs and cytochrome 1751
Zea mays c oxidase Decoy miR398 decoy 1752 Artificial Improved
sequence yield* Decoy miR398 decoy 1753 Artificial Improved
sequence yield* miR398 target miR398 target 1754 MRT3702_118804C.3
1651-1671 Arabidopsis thaliana miR398 target Copper/zinc superoxide
1755 MRT3708_22683C.2 117-137 Brassica dismutase (SODC) napus
domain protein miR398 target Las1-like 1756 MRT3847_22858C.5
2306-2326 Glycine max miR398 target Copper/zinc superoxide 1757
MRT3847_235546C.3 112-132 Glycine max dismutase (SODC) domain
protein miR398 target Copper/zinc superoxide 1758 MRT4530_151653C.4
66-86 Oryza dismutase (SODC) sativa domain protein miR398 target
miR398 target 1759 MRT4530_201873C.4 1720-1740 Oryza sativa miR398
target Copper/zinc superoxide 1760 MRT4530_20521C.4 152-172 Oryza
dismutase (SODC) sativa domain protein miR398 target Copper/zinc
superoxide 1761 MRT4558_3896C.2 103-123 Sorghum dismutase (SODC)
bicolor domain protein miR398 target Copper/zinc superoxide 1762
MRT4558_9962C.2 176-196 Sorghum dismutase (SODC) bicolor domain
protein miR398 target miR398 target 1763 MRT4565_118267C.1 66-86
Triticum aestivum miR398 target miR398 target 1764
MRT4565_122618C.1 14-34 Triticum aestivum miR398 target Copper/zinc
superoxide 1765 MRT4565_123037C.3 94-114 Triticum dismutase (SODC)
aestivum domain protein miR398 target miR398 target 1766
MRT4565_129871C.1 54-74 Triticum aestivum miR398 target Copper/zinc
superoxide 1767 MRT4565_133338C.1 172-192 Triticum dismutase (SODC)
aestivum domain protein miR398 target Copper/zinc superoxide 1768
MRT4565_162003C.1 144-164 Triticum dismutase (SODC) aestivum domain
protein miR398 target miR398 target 1769 MRT4565_16358C.1 66-86
Triticum aestivum miR398 target miR398 target 1770
MRT4565_187852C.1 194-214 Triticum aestivum miR398 target
Copper/zinc superoxide 1771 MRT4565_201143C.1 93-113 Triticum
dismutase (SODC) aestivum domain protein miR398 target Copper/zinc
superoxide 1772 MRT4565_201144C.1 85-105 Triticum dismutase (SODC)
aestivum domain protein miR398 target Cytochrome c oxidase 1773
MRT4565_221067C.1 153-173 Triticum subunit Vb aestivum miR398
target Cytochrome c oxidase 1774 MRT4565_223829C.1 139-159 Triticum
subunit Vb aestivum miR398 target Cytochrome c oxidase 1775
MRT4565_230710C.1 303-323 Triticum subunit Vb aestivum miR398
target Copper/zinc superoxide 1776 MRT4565_236346C.1 91-111
Triticum dismutase (SODC) aestivum domain protein miR398 target
Copper/zinc superoxide 1777 MRT4565_244294C.1 69-89 Triticum
dismutase (SODC) aestivum domain protein miR398 target Cytochrome c
oxidase 1778 MRT4565_246005C.1 160-180 Triticum subunit Vb aestivum
miR398 target Copper/zinc superoxide 1779 MRT4565_248858C.1 69-89
Triticum dismutase (SODC) aestivum domain protein miR398 target
Copper/zinc superoxide 1780 MRT4565_72209C.2 105-125 Triticum
dismutase (SODC) aestivum domain protein miR398 target Copper/zinc
superoxide 1781 MRT4577_19020C.8 92-112 Zea mays dismutase (SODC)
domain protein miR398 target Copper/zinc superoxide 1782
MRT4577_211709C.6 85-105 Zea mays dismutase (SODC) domain protein
miR398 target Copper/zinc superoxide 1783 MRT4577_329847C.3 89-109
Zea mays dismutase (SODC) domain protein miR398 target Copper/zinc
superoxide 1784 MRT4577_329851C.4 114-134 Zea mays dismutase (SODC)
domain protein miR398 target Copper/zinc superoxide 1785
MRT4577_335011C.2 7-27 Zea mays dismutase (SODC) domain protein
miR398 target Copper/zinc superoxide 1786 MRT4577_339810C.4 174-194
Zea mays dismutase (SODC) domain protein miR398 target Copper/zinc
superoxide 1787 MRT4577_339813C.4 233-253 Zea mays dismutase (SODC)
domain protein miR398 target Copper/zinc superoxide 1788
MRT4577_358061C.1 120-140 Zea mays dismutase (SODC) domain protein
miR398 target Copper/zinc superoxide 1789 MRT4577_388896C.4 200-220
Zea mays dismutase (SODC) domain protein miR398 target Copper/zinc
superoxide 1790 MRT4577_401904C.1 49-69 Zea mays dismutase (SODC)
domain protein miR398 target Copper/zinc superoxide 1791
MRT4577_54564C.7 147-167 Zea mays dismutase (SODC) domain protein
miR398 target miR398 target 1792 MRT4577_561629C.1 222-242 Zea mays
miR398 target miR398 target 1793 MRT4577_570532C.1 129-149 Zea mays
miR398 target Copper/zinc superoxide 1794 MRT4577_571443C.1 184-204
Zea mays dismutase (SODC) domain protein miR398 target miR398
target 1795 MRT4577_648609C.1 83-103 Zea mays miRNA miR399 1796 Zea
mays miRNA miR399 1797 Zea mays miRNA miR399 1798 Zea mays miRNA
miR399 1799 Zea mays miR399 target pho2 and inorganic 1800 Zea mays
phosphate transporter Decoy miR399 decoy 1801 Artificial Improved
sequence yield* Cleavage miR399 cleavage 1802 Artificial Improved
blocker blocker (in miRMON1 sequence yield* backbone) miR399 target
E2, ubiquitin- 1803 MRT3702_9137C.7 607-627 Arabidopsis conjugating
enzyme; thaliana At2g33770 PHO2 miR399 target PHO2-like (phosphate)
1804 MRT3847_4521C.5 139-159 Glycine max E2 ubiquitin- conjugating
enzyme miR399 target Phosphate transporter 1805 MRT3847_51499C.6
381-401 Glycine max miR399 target PHO2-like (phosphate) 1806
MRT3880_39637C.1 33-53 Medicago E2 ubiquitin- truncatula
conjugating enzyme miR399 target miR399 target 1807
MRT3880_45031C.1 512-532 Medicago truncatula miR399 target miR399
target 1808 MRT3880_48872C.1 5-25 Medicago truncatula miR399 target
miR399 target 1809 MRT3880_54972C.1 5-25 Medicago truncatula miR399
target Phosphate transporter 1810 MRT3880_64645C.1 245-265 Medicago
truncatula miR399 target miR399 target 1811 MRT4530_189375C.1
502-522 Oryza sativa miR399 target Phosphate transporter 1812
MRT4530_40506C.4 292-312 Oryza sativa miR399 target miR399 target
1813 MRT4530_53090C.4 821-841 Oryza sativa miR399 target miR399
target 1814 MRT4530_7904C.4 1144-1164 Oryza sativa miR399 target
miR399 target 1815 MRT4558_16475C.1 693-713 Sorghum bicolor miR399
target miR399 target 1816 MRT4558_34625C.1 171-191 Sorghum bicolor
miR399 target miR399 target 1817 MRT4565_160343C.1 481-501 Triticum
aestivum miRNA miR408 1818 Zea mays miR408 target laccase and 1819
Zea mays plantacyanin Decoy miR408 decoy 1820 Artificial Improved
sequence yield* miR408 target Laccase (Diphenol 1821
MRT3635_36078C.2 61-80 Gossypium oxidase); Multicopper hirsutum
oxidase Plantacyanin miR408 target Laccase (Diphenol 1822
MRT3635_36080C.2 61-80 Gossypium oxidase); Multicopper hirsutum
oxidase Plantacyanin miR408 target Laccase (Diphenol 1823
MRT3702_153631C.1 42-61 Arabidopsis oxidase); Multicopper thaliana
oxidase Plantacyanin miR408 target Laccase (Diphenol 1824
MRT3702_20027C.5 108-127 Arabidopsis oxidase); Multicopper thaliana
oxidase Plantacyanin miR408 target Laccase (Diphenol 1825
MRT3702_20202C.5 99-118 Arabidopsis oxidase); Multicopper thaliana
oxidase Plantacyanin miR408 target Laccase (Diphenol 1826
MRT3702_6668C.5 71-90 Arabidopsis oxidase); Multicopper thaliana
oxidase Plantacyanin miR408 target miR408 target 1827
MRT3708_48434C.2 137-156 Brassica napus miR408 target Laccase
(Diphenol 1828 MRT3711_7108C.1 9-28 Brassica oxidase); Multicopper
rapa oxidase Plantacyanin miR408 target miR408 target 1829
MRT3847_133008C.1 25-44 Glycine max miR408 target miR408 target
1830 MRT3847_166855C.1 17-36 Glycine max miR408 target Laccase
(Diphenol 1831 MRT3847_261984C.4 181-200 Glycine max oxidase);
Multicopper oxidase Plantacyanin miR408 target Laccase (Diphenol
1832 MRT3847_273040C.3 702-721 Glycine max oxidase); Multicopper
oxidase Plantacyanin miR408 target miR408 target 1833
MRT3847_273288C.3 114-133 Glycine max miR408 target Laccase
(Diphenol 1834 MRT3847_296270C.2 189-208 Glycine max oxidase);
Multicopper oxidase Plantacyanin miR408 target miR408 target 1835
MRT3847_31127C.7 232-251 Glycine max miR408 target miR408 target
1836 MRT3847_329905C.2 137-156 Glycine max miR408 target miR408
target 1837 MRT3847_336704C.1 58-77 Glycine max miR408 target
miR408 target 1838 MRT3847_343250C.1 286-305 Glycine max miR408
target miR408 target 1839 MRT3847_346770C.1 38-57 Glycine max
miR408 target miR408 target 1840 MRT3847_349900C.1 68-87 Glycine
max miR408 target miR408 target 1841 MRT3847_66506C.8 33-52 Glycine
max miR408 target miR408 target 1842 MRT3847_66508C.1 12-31 Glycine
max miR408 target miR408 target 1843 MRT3880_52991C.2 96-115
Medicago truncatula miR408 target Laccase (Diphenol 1844
MRT3880_53025C.1 96-115 Medicago oxidase); Multicopper truncatula
oxidase Plantacyanin miR408 target Laccase (Diphenol 1845
MRT3880_58299C.2 659-678 Medicago oxidase); Multicopper truncatula
oxidase Plantacyanin miR408 target Laccase (Diphenol 1846
MRT3880_5838C.1 37-56 Medicago oxidase); Multicopper truncatula
oxidase Plantacyanin miR408 target Laccase (Diphenol 1847
MRT3880_61178C.1 715-734 Medicago oxidase); Multicopper truncatula
oxidase Plantacyanin miR408 target miR408 target 1848
MRT4513_31098C.2 106-125 Hordeum vulgare miR408 target Laccase
(Diphenol 1849 MRT4513_36864C.1 93-112 Hordeum oxidase);
Multicopper vulgare oxidase Plantacyanin miR408 target Laccase
(Diphenol 1850 MRT4513_43046C.1 113-132 Hordeum oxidase);
Multicopper vulgare oxidase Plantacyanin miR408 target Laccase
(Diphenol 1851 MRT4513_47240C.1 630-649 Hordeum oxidase);
Multicopper vulgare oxidase Plantacyanin miR408 target Laccase
(Diphenol 1852 MRT4513_8677C.1 71-90 Hordeum oxidase); Multicopper
vulgare oxidase Plantacyanin miR408 target Laccase (Diphenol 1853
MRT4530_137979C.3 929-948 Oryza oxidase); Multicopper sativa
oxidase Plantacyanin miR408 target miR408 target 1854
MRT4530_148564C.5 1091-1110 Oryza sativa miR408 target Laccase
(Diphenol 1855 MRT4530_160612C.2 220-239 Oryza oxidase);
Multicopper sativa oxidase Plantacyanin miR408 target Laccase
(Diphenol 1856 MRT4530_169405C.1 105-124 Oryza oxidase);
Multicopper sativa oxidase Plantacyanin miR408 target miR408 target
1857 MRT4530_247839C.2 360-379 Oryza sativa miR408 target Laccase
(Diphenol 1858 MRT4530_260849C.1 658-677 Oryza oxidase);
Multicopper sativa oxidase Plantacyanin miR408 target Laccase
(Diphenol 1859 MRT4530_26787C.5 611-630 Oryza oxidase); Multicopper
sativa oxidase Plantacyanin miR408 target miR408 target 1860
MRT4530_274369C.1 112-131 Oryza sativa miR408 target miR408 target
1861 MRT4530_275579C.1 108-127 Oryza sativa miR408 target miR408
target 1862 MRT4530_36958C.6 99-118 Oryza sativa miR408 target
Laccase (Diphenol 1863 MRT4530_40477C.6 182-201 Oryza oxidase);
Multicopper sativa oxidase Plantacyanin miR408 target Laccase
(Diphenol 1864 MRT4530_69716C.6 162-181 Oryza oxidase); Multicopper
sativa oxidase Plantacyanin miR408 target miR408 target 1865
MRT4558_23167C.3 713-732 Sorghum bicolor miR408 target Laccase
(Diphenol 1866 MRT4558_2496C.2 104-123 Sorghum oxidase);
Multicopper bicolor oxidase Plantacyanin miR408 target Laccase
(Diphenol 1867 MRT4558_26802C.1 87-106 Sorghum oxidase);
Multicopper bicolor oxidase Plantacyanin miR408 target Laccase
(Diphenol 1868 MRT4558_37109C.1 109-128 Sorghum oxidase);
Multicopper bicolor oxidase Plantacyanin miR408 target Laccase
(Diphenol 1869 MRT4558_40844C.1 217-236 Sorghum oxidase);
Multicopper bicolor oxidase Plantacyanin miR408 target Laccase
(Diphenol 1870 MRT4558_5019C.2 102-121 Sorghum oxidase);
Multicopper bicolor oxidase Plantacyanin miR408 target Laccase
(Diphenol 1871 MRT4558_8981C.2 180-199 Sorghum oxidase);
Multicopper bicolor oxidase Plantacyanin miR408 target Laccase
(Diphenol 1872 MRT4565_100542C.3 91-110 Triticum oxidase);
Multicopper aestivum oxidase Plantacyanin miR408 target Laccase
(Diphenol 1873 MRT4565_130135C.1 10-29 Triticum oxidase);
Multicopper aestivum oxidase Plantacyanin miR408 target Hsp70
domain protein 1874 MRT4565_198220C.1 1221-1240 Triticum aestivum
miR408 target miR408 target 1875 MRT4565_202586C.1 51-70 Triticum
aestivum miR408 target Laccase (Diphenol 1876 MRT4565_216408C.1
206-225 Triticum oxidase); Multicopper aestivum oxidase
Plantacyanin miR408 target Ammonium 1877 MRT4565_219732C.1 742-761
Triticum transporter; basic helix- aestivum loop-helix domain
(bHLH) miR408 target Laccase (Diphenol 1878 MRT4565_229783C.1
98-117 Triticum oxidase); Multicopper aestivum oxidase Plantacyanin
miR408 target Laccase (Diphenol 1879 MRT4565_235378C.1 116-135
Triticum oxidase); Multicopper aestivum oxidase Plantacyanin miR408
target Laccase (Diphenol 1880 MRT4565_250808C.1 652-671 Triticum
oxidase); Multicopper aestivum oxidase Plantacyanin miR408 target
Laccase (Diphenol 1881 MRT4565_257176C.1 91-110 Triticum oxidase);
Multicopper aestivum oxidase Plantacyanin miR408 target Laccase
(Diphenol 1882 MRT4565_263239C.1 102-121 Triticum oxidase);
Multicopper aestivum oxidase Plantacyanin miR408 target Laccase
(Diphenol 1883 MRT4565_263949C.1 94-113 Triticum oxidase);
Multicopper aestivum oxidase Plantacyanin miR408 target miR408
target 1884 MRT4565_267955C.1 84-103 Triticum aestivum miR408
target Laccase (Diphenol 1885 MRT4565_274907C.1 720-739 Triticum
oxidase); Multicopper aestivum oxidase Plantacyanin miR408 target
Laccase (Diphenol 1886 MRT4565_276632C.1 172-191 Triticum oxidase);
Multicopper aestivum oxidase Plantacyanin
miR408 target miR408 target 1887 MRT4565_278866C.1 365-384 Triticum
aestivum miR408 target Laccase (Diphenol 1888 MRT4565_66211C.2
36-55 Triticum oxidase); Multicopper aestivum oxidase Plantacyanin
miR408 target Laccase (Diphenol 1889 MRT4565_67059C.3 133-152
Triticum oxidase); Multicopper aestivum oxidase Plantacyanin miR408
target Laccase (Diphenol 1890 MRT4565_87146C.2 314-333 Triticum
oxidase); Multicopper aestivum oxidase Plantacyanin miR408 target
Laccase (Diphenol 1891 MRT4577_137208C.1 94-113 Zea mays oxidase);
Multicopper oxidase Plantacyanin miR408 target miR408 target 1892
MRT4577_191445C.5 696-715 Zea mays miR408 target miR408 target 1893
MRT4577_234909C.4 331-350 Zea mays miR408 target miR408 target 1894
MRT4577_245033C.8 117-136 Zea mays miR408 target Laccase (Diphenol
1895 MRT4577_264839C.3 102-121 Zea mays oxidase); Multicopper
oxidase Plantacyanin miR408 target miR408 target 1896
MRT4577_30771C.9 282-301 Zea mays miR408 target miR408 target 1897
MRT4577_325201C.6 619-638 Zea mays miR408 target Laccase (Diphenol
1898 MRT4577_325458C.1 59-78 Zea mays oxidase); Multicopper oxidase
Plantacyanin miR408 target Laccase (Diphenol 1899 MRT4577_327865C.2
113-132 Zea mays oxidase); Multicopper oxidase Plantacyanin miR408
target miR408 target 1900 MRT4577_341887C.5 132-151 Zea mays miR408
target miR408 target 1901 MRT4577_37590C.9 800-819 Zea mays miR408
target miR408 target 1902 MRT4577_380413C.6 208-227 Zea mays miR408
target miR408 target 1903 MRT4577_387021C.4 151-170 Zea mays miR408
target miR408 target 1904 MRT4577_388860C.4 117-136 Zea mays miR408
target miR408 target 1905 MRT4577_427804C.4 729-748 Zea mays miR408
target Laccase (Diphenol 1906 MRT4577_446604C.1 67-86 Zea mays
oxidase); Multicopper oxidase Plantacyanin miR408 target miR408
target 1907 MRT4577_456053C.1 66-85 Zea mays miR408 target miR408
target 1908 MRT4577_461451C.3 463-482 Zea mays miR408 target miR408
target 1909 MRT4577_46308C.7 273-292 Zea mays miR408 target Laccase
(Diphenol 1910 MRT4577_517561C.1 883-902 Zea mays oxidase);
Multicopper oxidase Plantacyanin miR408 target Laccase (Diphenol
1911 MRT4577_528699C.2 636-655 Zea mays oxidase); Multicopper
oxidase Plantacyanin miR408 target miR408 target 1912
MRT4577_536494C.2 151-170 Zea mays miR408 target Laccase (Diphenol
1913 MRT4577_550892C.1 659-678 Zea mays oxidase); Multicopper
oxidase Plantacyanin miR408 target miR408 target 1914
MRT4577_572693C.1 101-120 Zea mays miR408 target miR408 target 1915
MRT4577_602288C.1 5-24 Zea mays miR408 target miR408 target 1916
MRT4577_603948C.1 206-225 Zea mays miR408 target miR408 target 1917
MRT4577_603999C.1 226-245 Zea mays miR408 target miR408 target 1918
MRT4577_610458C.1 111-130 Zea mays miR408 target miR408 target 1919
MRT4577_623809C.1 153-172 Zea mays miR408 target miR408 target 1920
MRT4577_625157C.1 254-273 Zea mays miR408 target miR408 target 1921
MRT4577_629379C.1 269-288 Zea mays miR408 target miR408 target 1922
MRT4577_645720C.1 236-255 Zea mays miR408 target miR408 target 1923
MRT4577_650403C.1 788-807 Zea mays miR408 target miR408 target 1924
MRT4577_686202C.1 160-179 Zea mays miR408 target miR408 target 1925
MRT4577_710942C.1 48-67 Zea mays miR444 miR444 1926 Zea mays miRNA
miR444 1927 Zea mays Improved precursor yield* miR444 target
Os.ANR1 1928 Oryza sativa miRNA- Os.ANR1 (miR444 1929 Artificial
Improved unresponsive unresponsive) construct yield* miR444 target
AGL17, AGL21, 1930 Zea mays ANR1 Decoy miR444 decoy 1931 Artificial
Improved construct yield* miR444 target MADS-box 1932
MRT3847_247970C.2 471-491 Glycine max transcription factor protein
miR444 target MADS-box 1933 MRT3847_259952C.3 453-473 Glycine max
transcription factor protein miR444 target MADS-box 1934
MRT3880_12754C.1 75-95 Medicago transcription factor truncatula
protein miR444 target miR444 target 1935 MRT4513_18691C.1 73-93
Hordeum vulgare miR444 target miR444 target 1936 MRT4513_36208C.1
320-340 Hordeum vulgare miR444 target miR444 target 1937
MRT4530_101813C.4 1164-1184 Oryza sativa miR444 target MADS-box
1938 MRT4530_196636C.3 539-559 Oryza transcription factor sativa
protein miR444 target miR444 target 1939 MRT4530_197829C.2 585-605
Oryza sativa miR444 target miR444 target 1940 MRT4530_223119C.3
610-630 Oryza sativa miR444 target miR444 target 1941
MRT4530_244375C.1 208-228 Oryza sativa miR444 target miR444 target
1942 MRT4530_251481C.2 1234-1254 Oryza sativa miR444 target miR444
target 1943 MRT4530_272160C.1 571-591 Oryza sativa miR444 target
miR444 target 1944 MRT4530_274638C.1 337-357 Oryza sativa miR444
target miR444 target 1945 MRT4530_275771C.1 97-117 Oryza sativa
miR444 target MADS-box 1946 MRT4530_78475C.3 305-325 Oryza
transcription factor sativa protein miR444 target MADS-box 1947
MRT4558_10090C.1 400-420 Sorghum transcription factor bicolor
protein miR444 target MADS-box 1948 MRT4558_11440C.2 434-454
Sorghum transcription factor bicolor protein miR444 target miR444
target 1949 MRT4558_3598C.3 1024-1044 Sorghum bicolor miR444 target
miR444 target 1950 MRT4558_37372C.1 1355-1375 Sorghum bicolor
miR444 target MADS-box 1951 MRT4565_247066C.1 375-395 Triticum
transcription factor aestivum protein miR444 target MADS-box 1952
MRT4565_39318C.3 416-436 Triticum transcription factor aestivum
protein miR444 target miR444 target 1953 MRT4565_98921C.1 352-372
Triticum aestivum miR444 target miR444 target 1954
MRT4577_166928C.8 1146-1166 Zea mays miR444 target miR444 target
1955 MRT4577_204116C.4 475-495 Zea mays miR444 target miR444 target
1956 MRT4577_296919C.6 475-495 Zea mays miR444 target MADS-box 1957
MRT4577_321664C.4 1029-1049 Zea mays transcription factor protein
miR444 target miR444 target 1958 MRT4577_417091C.4 1757-1777 Zea
mays miR444 target miR444 target 1959 MRT4577_502196C.3 468-488 Zea
mays miR444 target miR444 target 1960 MRT4577_537511C.2 364-384 Zea
mays miR444 target miR444 target 1961 MRT4577_538474C.2 451-471 Zea
mays miR444 target miR444 target 1962 MRT4577_5433C.4 473-493 Zea
mays miR444 target miR444 target 1963 MRT4577_543434C.2 377-397 Zea
mays miR444 target MADS-box 1964 MRT4577_553467C.1 17-37 Zea mays
transcription factor protein miR444 target miR444 target 1965
MRT4577_581326C.1 388-408 Zea mays miR444 target miR444 target 1966
MRT4577_590710C.1 509-529 Zea mays miR444 target miR444 target 1967
MRT4577_613242C.1 18-38 Zea mays miR444 target miR444 target 1968
MRT4577_672581C.1 430-450 Zea mays miRNA miR528 1969 Zea mays
miR528 target SOD 1970 Zea mays Decoy miR528 decoy 1971 Artificial
Improved construct yield* miR528 target Salicylic acid-binding 1972
MRT3847_26249C.5 98-118 Glycine max protein miR528 target Laccase
(Diphenol 1973 MRT4513_36138C.1 838-858 Hordeum oxidase);
Multicopper vulgare oxidase Plantacyanin miR528 target Laccase
(Diphenol 1974 MRT4513_39686C.1 35-55 Hordeum oxidase); Multicopper
vulgare oxidase Plantacyanin miR528 target Laccase (Diphenol 1975
MRT4513_5560C.1 506-525 Hordeum oxidase); Multicopper vulgare
oxidase Plantacyanin miR528 target Laccase (Diphenol 1976
MRT4530_128077C.2 269-289 Oryza oxidase); Multicopper sativa
oxidase Plantacyanin miR528 target Laccase (Diphenol 1977
MRT4530_139238C.4 2152-2172 Oryza oxidase); Multicopper sativa
oxidase Plantacyanin miR528 target Laccase (Diphenol 1978
MRT4530_155994C.3 247-267 Oryza oxidase); Multicopper sativa
oxidase Plantacyanin miR528 target VIP2-like protein; 1979
MRT4530_237311C.1 632-652 Oryza PHD-zinc finger sativa miR528
target Laccase (Diphenol 1980 MRT4530_275240C.1 24-44 Oryza
oxidase); Multicopper sativa oxidase Plantacyanin miR528 target
Laccase (Diphenol 1981 MRT4530_68465C.5 687-706 Oryza oxidase);
Multicopper sativa oxidase Plantacyanin miR528 target VIP2-like
protein; 1982 MRT4530_85016C.5 215-235 Oryza PHD-zinc finger sativa
miR528 target Laccase (Diphenol 1983 MRT4558_8881C.1 101-121
Sorghum oxidase); Multicopper bicolor oxidase Plantacyanin miR528
target Laccase (Diphenol 1984 MRT4565_204482C.1 212-231 Triticum
oxidase); Multicopper aestivum oxidase Plantacyanin miR528 target
Laccase (Diphenol 1985 MRT4565_219247C.1 923-943 Triticum oxidase);
Multicopper aestivum oxidase Plantacyanin miR528 target Laccase
(Diphenol 1986 MRT4565_22497C.4 806-826 Triticum oxidase);
Multicopper aestivum oxidase Plantacyanin miR528 target Major
Facilitator 1987 MRT4565_260315C.1 584-604 Triticum Superfamily
aestivum miR528 target Laccase (Diphenol 1988 MRT4565_276632C.1
219-239 Triticum oxidase); Multicopper aestivum oxidase
Plantacyanin miR528 target miR528 target 1989 MRT4565_278866C.1
412-432 Triticum aestivum miR528 target Laccase (Diphenol 1990
MRT4565_6214C.4 548-567 Triticum oxidase); Multicopper aestivum
oxidase Plantacyanin miR528 target Laccase (Diphenol 1991
MRT4577_302078C.5 115-135 Zea mays oxidase); Multicopper oxidase
Plantacyanin miR528 target Laccase (Diphenol 1992 MRT4577_327865C.2
163-183 Zea mays oxidase); Multicopper oxidase Plantacyanin miR528
target Laccase (Diphenol 1993 MRT4577_338803C.6 189-209 Zea mays
oxidase); Multicopper oxidase Plantacyanin miR528 target miR528
target 1994 MRT4577_574203C.1 48-68 Zea mays miRNA miR827 1995 Zea
mays miR827 target SPX 1996 MRT3702_118660C.4 258-278 Arabidopsis
(SYG1/Pho81/XPR1) thaliana domain-containing protein; RING domain
ubiquitin ligase miR827 target SPX 1997 MRT3702_165543C.2 253-273
Arabidopsis (SYG1/Pho81/XPR1) thaliana domain-containing protein;
MFS_1: Major Facilitator Superfamily miR827 target SPX 1998
MRT3702_4781C.6 153-173 Arabidopsis (SYG1/Pho81/XPR1) thaliana
domain-containing protein; MFS_1: Major Facilitator Superfamily
miR827 target SPX 1999 MRT3708_29390C.1 32-52 Brassica
(SYG1/Pho81/XPR1) napus domain-containing protein; RING domain
ubiquitin ligase miR827 target miR827 target 2000 MRT3711_10064C.1
155-175 Brassica rapa miR827 target SPX 2001 MRT3712_6456C.1 96-116
Brassica (SYG1/Pho81/XPR1) oleracea domain-containing protein
miR827 target SPX 2002 MRT4530_236774C.2 395-415 Oryza
(SYG1/Pho81/XPR1) sativa domain-containing protein; MFS_1: Major
Facilitator Superfamily miR827 target SPX 2003 MRT4530_45193C.6
335-355 Oryza (SYG1/Pho81/XPR1) sativa domain-containing protein;
MFS_1: Major Facilitator Superfamily miR827 target miR827 target
2004 MRT4577_197256C.1 135-155 Zea mays miR827 target miR827 target
2005 MRT4577_235663C.3 559-579 Zea mays
miRNA miRCOP1_1227-1247 2006 Artificial Improved sequence yield*
miRNA miRCOP1_653-673 2007 Artificial Improved sequence yield*
miRNA miRCOP1_1417-1437 2008 Artificial Improved sequence yield*
miRCOP1 target COP1 (constitutive 2009 Zea mays photomorphogenesis
1) miRNA miRGA2_945-965 2010 Artificial Improved sequence yield*
miRGA2 target zm-GA2ox (gibberellic 2011 Zea mays acid 2 oxidase)
miRNA miRGA20_852-872 2012 Artificial Improved sequence yield*
miRGA20 target zm-GA20ox (gibberellic 2013 Zea mays acid 20
oxidase) miRNA miRHB2-4_700-720 2014 Artificial Improved sequence
yield* miRHB2-4 target ZmHB2-4 (homeobox 2015 Zea mays 2 and
homeobox 4) miRNA miRHB4_84-104 2016 Artificial Improved sequence
yield* miRHB4 target ZmHB-4 (homeobox 4) 2017 Zea mays miRNA
miRLG1_899-919 2018 Artificial Improved sequence yield* miRLG1
target LG1 (Liguleless1) 2019 Zea mays miRNA miRMON18 2020 Glycine
max miRMON18 SPX 2021 Zea mays target (SYG1, PHO81 and XPR1 domain;
PFAM entry PF03105 at www.sanger.ac.uk) Decoy miRMON18 decoy 2022
Artificial Improved sequence yield* miRNA miRVIM1a 2023 Artificial
Improved precursor sequence yield* (synthetic) miRVIM1a VIM1a
(Variant in 2024 Zea mays target Methylation1a) miRNA miRDHS1 2025
Artificial Improved precursor sequence yield* (synthetic) miRDHS1
DHS1 (Deoxyhypusine 2026 Zea mays target synthase) miRNA miRDHS2
2027 Artificial Improved precursor sequence yield* (synthetic)
miRDHS2 DHS2 (Deoxyhypusine 2028 Zea mays target synthase) miRNA
miRDHS3 2029 Artificial Improved precursor sequence yield*
(synthetic) miRDHS3 DHS3 (Deoxyhypusine 2030 Zea mays target
synthase) miRNA miRDHS4 2031 Artificial Improved precursor sequence
yield* (synthetic) miRDHS4 DHS4 (Deoxyhypusine 2032 Zea mays target
synthase) Synthetic DHS5 ta-siRNA 2033 Artificial Improved tasiRNA
sequence yield* DHS5 ta-siRNA DHS5 (Deoxyhypusine 2034 Zea mays
target synthase) Synthetic DHS6 ta-siRNA 2035 Artificial Improved
tasiRNA sequence yield* DHS6 ta-siRNA DHS6 (Deoxyhypusine 2036 Zea
mays target synthase) Synthetic DHS7 ta-siRNA 2037 Artificial
Improved tasiRNA sequence yield* DHS7 ta-siRNA DHS7 (Deoxyhypusine
2038 Zea mays target synthase) Synthetic DHS8 ta-siRNA 2039
Artificial Improved tasiRNA sequence yield* DHS8 ta-siRNA DHS8
(Deoxyhypusine 2040 Zea mays target synthase) Synthetic DHS
ta-siRNA 2041 Artificial Improved tasiRNA sequence yield* DHS
ta-siRNA DHS (Deoxyhypusine 2042 Zea mays target synthase) miRNA
miRCRF_804-824 2043 Artificial Improved precursor sequence yield*
(synthetic) miRCRF target CRF (corn RING 2044 Zea mays ringer; also
RNF169) miRNA miRMON18 2045 Zea mays Improved precursor yield*
miRMON18 SPX 2046 Zea mays target miRNA miRZmG1543a 2047 Artificial
Improved precursor sequence yield* (synthetic) miRZmG1543a ZmG1543a
(maize 2048 Zea mays target orthologue of Arabidopsis thaliana
homeobox 17) miRNA miRZmG1543 2049 Artificial Improved precursor
sequence yield* (synthetic) miRZmG1543 ZmG1543a (maize 2050 Zea
mays target orthologue of Arabidopsis thaliana homeobox 17) miRNA
miRZmG1543b 2051 Artificial Improved precursor sequence yield*
(synthetic) miRZmG1543b ZmG1543b (maize 2052 Zea mays target
orthologue of Arabidopsis thaliana homeobox 17) miRNA miRHB2 2053
Artificial Improved precursor sequence yield* (synthetic) miRHB2
target HB2 (homeobox 2) 2054 Zea mays miRNA Os.MIR169g 2055 Oryza
Improved precursor sativa yield* miRNA Zm.MIR167g 2056 Artificial
Improved precursor sequence yield* miRNA miRGS3 2057 Artificial
Improved precursor sequence yield* (synthetic) miRGS3 target GS3
(grain size 3) 2058 Zea mays miRNA Zm_GW2_miR1 2059 Artificial
Improved precursor sequence yield* (synthetic) miRNA Zm_GW2_miR2
2060 Artificial Improved precursor sequence yield* (synthetic)
miRNA Zm_GW2_miR3 2061 Artificial Improved precursor sequence
yield* (synthetic) GW2_miR1/2/3 GW2 (grain weight 2) 2062 Zea mays
target miRNA miR-IPS 2063 Artificial Improved precursor construct
yield* (synthetic) miR-IPS target Zm_2-isopropylmalate 2064 Zea
mays synthase *Particularly preferred crop plants are maize,
soybean, canola, cotton, alfalfa, sugarcane, sugar beet, sorghum,
and rice
Example 5
[0181] This example illustrates various aspects of the invention
relating to transgenic plant cells and transgenic plants. More
specifically, this example illustrates transformation vectors and
techniques useful with different crop plants for providing
non-natural transgenic plant cells, plants, and seeds having in
their genome any of this invention's recombinant DNA constructs
transcribable in a plant cell, including a promoter that is
functional in the plant cell and operably linked to at least one
polynucleotide as disclosed herein, including: (1) a recombinant
DNA construct transcribable in a plant cell, including a promoter
that is functional in the plant cell and operably linked to at
least one polynucleotide selected from: (a) DNA encoding a cleavage
blocker to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target identified in Tables 2 or
3; (b) DNA encoding a 5'-modified cleavage blocker to prevent or
decrease small RNA-mediated cleavage of the transcript of at least
one miRNA target identified in Tables 2 or 3; (c) DNA encoding a
translational inhibitor to prevent or decrease small RNA-mediated
cleavage of the transcript of at least one miRNA target identified
in Tables 2 or 3; (d) DNA encoding a decoy to prevent or decrease
small RNA-mediated cleavage of the transcript of at least one miRNA
target identified in Tables 2 or 3; (e) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of at least one miRNA target
identified in Tables 2 or 3, wherein a miRNA recognition site in
the native nucleotide sequence is deleted or otherwise modified to
prevent miRNA-mediated cleavage; (f) DNA encoding a miRNA precursor
which is processed into a miRNA for suppressing expression of at
least one miRNA target identified in Tables 2 or 3; (g) DNA
encoding double-stranded RNA which is processed into siRNAs for
suppressing expression of at least one miRNA target identified in
Tables 2 or 3; and (h) DNA encoding a ta-siRNA which is processed
into siRNAs for suppressing expression of at least one miRNA target
identified in Tables 2 or 3; (2) a recombinant DNA construct
transcribable in a plant cell, including a promoter that is
functional in the plant cell and operably linked to at least one
polynucleotide selected from: (a) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of at least one miRNA target; (b) DNA encoding a
5'-modified cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of at least one miRNA
target; (c) DNA encoding a translational inhibitor to prevent or
decrease small RNA-mediated cleavage of the transcript of at least
one miRNA target; (d) DNA encoding a decoy to prevent or decrease
small RNA-mediated cleavage of the transcript of at least one miRNA
target; (e) DNA encoding a miRNA-unresponsive transgene having a
nucleotide sequence derived from the native nucleotide sequence of
at least one miRNA target, wherein a miRNA recognition site in the
native nucleotide sequence is deleted or otherwise modified to
prevent miRNA-mediated cleavage; (f) DNA encoding a miRNA precursor
which is processed into a miRNA for suppressing expression of at
least one miRNA target; (g) DNA encoding double-stranded RNA which
is processed into siRNAs for suppressing expression of at least one
miRNA target; and (h) DNA encoding a ta-siRNA which is processed
into siRNAs for suppressing expression of at least one miRNA
target--wherein the at least one miRNA target is at least one
selected from the group consisting of a miR156 target, a miR160
target, a miR164 target, a miR166 target, a miR167 target, a miR169
target, a miR171 target, a miR172 target, a miR319 target, miR395
target, a miR396 target, a miR398 target, a miR399 target, a miR408
target, a miR444 target, a miR528 target, a miR167g target, a
miR169g target, COP1 (constitutive photomorphogenesis1), GA2ox
(gibberellic acid 2 oxidase), GA20ox (gibberellic acid 20 oxidase),
HB2 (homeobox 2), HB2-4 (homeobox 2 and homeobox 4), HB4 (homeobox
4), LG1 (liguleless1), SPX (SYG1, PH081 and XPR1 domain; PFAM entry
PF03105 at www.sanger.ac.uk), VIMla (variant in methlylation 1a),
DHS1 (deoxyhypusine synthase), DHS2 (deoxyhypusine synthase), DHS3
(deoxyhypusine synthase), DHS4 (deoxyhypusine synthase), DHS5
(deoxyhypusine synthase), DHS6 (deoxyhypusine synthase), DHS7
(deoxyhypusine synthase), DHS8 (deoxyhypusine synthase), CRF (corn
RING finger; RNF169), G1543a (maize orthologue of Arabidopsis
thaliana homeobox 17), G1543b (maize orthologue of Arabidopsis
thaliana homeobox 17), GS3 (grain size 3), and GW2 (grain weight
2); (3) a recombinant DNA construct transcribable in a plant cell,
including a promoter that is functional in the plant cell and
operably linked to at least one polynucleotide selected from the
group consisting of DNA encoding a nucleotide sequence selected
from SEQ ID NOs: 1120, 1121, 1122, 1248, 1257, 1313, 1314, 1364,
1387, 1478, 1489, 1490, 1491, 1492, 1493, 1585, 1597, 1598, 1599,
1713, 1752, 1753, 1801, 1802, 1820, 1927, 1929, 1931, 1971, 2006,
2007, 2008, 2010, 2012, 2014, 2016, 2018, 2022, 2023, 2025, 2027,
2029, 2031, 2033, 2035, 2037, 2039, 2041, 2043, 2045, 2047, 2049,
2051, 2053, 2055, 2056, 2057, 2059, 2060, 2061, and 2063; (4) a
recombinant DNA construct transcribable in a plant cell, including
a promoter functional in the non-natural transgenic plant cell and
operably linked to at least one polynucleotide selected from DNA
encoding at least one miRNA target identified in Tables 2 or 3; and
(5) a recombinant DNA construct transcribable in a plant cell,
including a promoter functional in the non-natural transgenic plant
cell and operably linked to at least one polynucleotide including a
DNA sequence selected from SEQ ID NOS: 15-2064). It is clear that
the polynucleotide to be expressed using these recombinant DNA
vectors in the non-natural transgenic plant cells, plants, and
seeds can encode a transcript that prevents or decreases small
RNA-mediated cleavage of the transcript of at least one miRNA
target identified in Tables 2 or 3 (including the specific miRNA
targets identified by name in this paragraph), or a transcript that
suppresses expression of at least one miRNA target identified in
Tables 2 or 3 (including the specific miRNA targets identified by
name in this paragraph), or a transcript encoding at least one
miRNA target identified in Tables 2 or 3, or encodes DNA sequence
selected from SEQ ID NOS: 15-2064.
Transformation Vectors and Protocols
[0182] The following sections describe examples of a base vector
for preparing transformation vectors including recombinant DNA
constructs of this invention for transformation of a specific crop
plant. The recombinant DNA constructs are transcribable in a plant
cell and include a promoter that is functional in the plant cell
and operably linked to at least one polynucleotide, which encodes a
transcript that prevents or decreases small RNA-mediated cleavage
of the transcript of at least one miRNA target identified in Tables
2 or 3 (including the specific miRNA targets identified by name in
this paragraph), or a transcript that suppresses expression of at
least one miRNA target identified in Tables 2 or 3 (including the
specific miRNA targets identified by name in this paragraph), or a
transcript encoding at least one miRNA target identified in Tables
2 or 3, or encodes DNA sequence selected from SEQ ID NOS: 15-2064.
Also provided are detailed examples of crop-specific transformation
protocols for using these vectors including recombinant DNA
constructs of this invention to generate a non-natural transgenic
plant cell, non-natural transgenic tissue, or non-natural
transgenic plant. Additional transformation techniques are known to
one of ordinary skill in the art, as reflected in the "Compendium
of Transgenic Crop Plants", edited by Chittaranjan Kole and Timothy
C. Hall, Blackwell Publishing Ltd., 2008; ISBN 978-1-405-16924-0
(available electronically at
mrw.interscience.wiley.com/emrw/9781405181099/hpt/toc). Such
transformation methods are useful in producing a non-natural
transgenic plant cell having a transformed nucleus. Non-natural
transgenic plants, seeds, and pollen are subsequently produced from
such a non-natural transgenic plant cell having a transformed
nucleus, and screened for an enhanced trait (e.g., increased yield,
enhanced water use efficiency, enhanced cold tolerance, enhanced
nitrogen or phosphate use efficiency, enhanced seed protein, or
enhanced seed oil, or any trait such as those disclosed above under
the heading "Making and Using Transgenic Plant Cells and Transgenic
Plants").
Transformation of Maize
[0183] A base transformation vector pMON93039 (SEQ ID NO: 2065),
illustrated in Table 4 and FIG. 2, is used in preparing recombinant
DNA constructs for Agrobacterium-mediated transformation of maize
cells. A transformation vector for expressing each of the
recombinant DNA constructs of this invention is constructed by
inserting a polynucleotide of this invention into the base vector
pMON93039 (SEQ ID NO: 2065) in the gene of interest expression
cassette at an insertion site, i.e., between the intron element
(coordinates 1287-1766) and the polyadenylation element
(coordinates 1838-2780). For example, a transformation vector for
expression of a miR399 cleavage blocker is prepared by inserting
the DNA of SEQ ID NO: 1802 (see Table 3) into the gene of interest
expression cassette at an insertion site between the intron element
(coordinates 1287-1766) and the polyadenylation element
(coordinates 1838-2780) of pMON93039 (SEQ ID NO: 2065).
[0184] For Agrobacterium-mediated transformation of maize embryo
cells, maize plants of a transformable line are grown in the
greenhouse and ears are harvested when the embryos are 1.5 to 2.0
mm in length. Ears are surface sterilized by spraying or soaking
the ears in 80% ethanol, followed by air drying. Immature embryos
are isolated from individual kernels from sterilized ears. Prior to
inoculation of maize cells, cultures of Agrobacterium each
containing a transformation vector for expressing each of the
recombinant DNA constructs of this invention are grown overnight at
room temperature. Immature maize embryo cells are inoculated with
Agrobacterium after excision, incubated at room temperature with
Agrobacterium for 5 to 20 minutes, and then co-cultured with
Agrobacterium for 1 to 3 days at 23 degrees Celsius in the dark.
Co-cultured embryos are transferred to a selection medium and
cultured for approximately two weeks to allow embryogenic callus to
develop. Embryogenic callus is transferred to a culture medium
containing 100 mg/L paromomycin and subcultured at about two week
intervals. Multiple events of transformed plant cells are recovered
6 to 8 weeks after initiation of selection.
[0185] Transgenic maize plants are regenerated from transgenic
plant cell callus for each of the multiple transgenic events
resulting from transformation and selection. The callus of
transgenic plant cells of each event is placed on a medium to
initiate shoot and root development into plantlets which are
transferred to potting soil for initial growth in a growth chamber
at 26 degrees Celsius, followed by growth on a mist bench before
transplanting to pots where plants are grown to maturity. The
regenerated plants are self-fertilized. First generation ("R1")
seed is harvested. The seed or plants grown from the seed is used
to select seeds, seedlings, progeny second generation ("R2")
transgenic plants, or hybrids, e.g., by selecting transgenic plants
exhibiting an enhanced trait as compared to a control plant (a
plant lacking expression of the recombinant DNA construct).
[0186] The above process is repeated to produce multiple events of
transgenic maize plant cells that are transformed with separate
recombinant DNA constructs of this invention, i.e., a construct
transcribable in a maize plant cell, including a promoter that is
functional in the maize plant cell and operably linked to each
polynucleotide selected from: (a) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (b)
DNA encoding a 5'-modified cleavage blocker to prevent or decrease
small RNA-mediated cleavage of the transcript of each miRNA target
identified in Tables 2 and 3; (c) DNA encoding a translational
inhibitor to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of each miRNA target identified in
Tables 2 and 3; (e) DNA encoding a miRNA-unresponsive transgene
having a nucleotide sequence derived from the native nucleotide
sequence of each miRNA target identified in Tables 2 and 3, wherein
a miRNA recognition site in the native nucleotide sequence is
deleted or otherwise modified to prevent miRNA-mediated cleavage;
(f) DNA encoding a miRNA precursor which is processed into a miRNA
for suppressing expression of each miRNA target identified in
Tables 2 and 3; (g) DNA encoding double-stranded RNA which is
processed into siRNAs for suppressing expression of each miRNA
target identified in Tables 2 and 3; and (h) DNA encoding a
ta-siRNA which is processed into siRNAs for suppressing expression
of each miRNA target identified in Tables 2 and 3.
[0187] The above process is repeated to produce multiple events of
transgenic maize plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a maize plant cell, including a promoter
that is functional in the maize plant cell and operably linked to a
polynucleotide selected from: (a) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of the miRNA target; (b) DNA encoding a 5'-modified
cleavage blocker to prevent or decrease small RNA-mediated cleavage
of the transcript of the miRNA target; (c) DNA encoding a
translational inhibitor to prevent or decrease small RNA-mediated
cleavage of the transcript of the miRNA target; (d) DNA encoding a
decoy to prevent or decrease small RNA-mediated cleavage of the
transcript of the miRNA target; (e) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of the miRNA target, wherein a
miRNA recognition site in the native nucleotide sequence is deleted
or otherwise modified to prevent miRNA-mediated cleavage; (f) DNA
encoding a miRNA precursor which is processed into a miRNA for
suppressing expression of the miRNA target; (g) DNA encoding
double-stranded RNA which is processed into siRNAs for suppressing
expression the miRNA target; and (h) DNA encoding a ta-siRNA which
is processed into siRNAs for suppressing expression of the miRNA
target--wherein separate constructs are made for each of the miRNA
targets enumerated in Table 5.
[0188] The above process is repeated to produce multiple events of
transgenic maize plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a maize plant cell, including a promoter
that is functional in the maize plant cell and operably linked to
each polynucleotide provided in Table 6, wherein separate
constructs are made for each polynucleotide.
[0189] The above process is repeated to produce multiple events of
transgenic maize plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a maize plant cell, including a promoter
that is functional in the plant cell and operably linked to a
polynucleotide selected from DNA encoding each miRNA target
identified in Tables 2 and 3.
[0190] The above process is repeated to produce multiple events of
transgenic maize plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a maize plant cell, including a promoter
that is functional in the plant cell and operably linked to each
polynucleotide of SEQ ID NOS: 15-2064.
[0191] The regenerated transgenic maize plants, or progeny
transgenic maize plants or maize seeds, produced from the
regenerated transgenic maize plants, are screened for an enhanced
trait (e.g., increased yield), as compared to a control plant or
seed (a plant or seed lacking expression of the recombinant DNA
construct). From each group of multiple events of transgenic maize
plants with a specific recombinant construct of this invention, the
event that produces the greatest enhanced trait (e.g., greatest
enhancement in yield) is identified and progeny maize seed is
selected for commercial development.
TABLE-US-00013 TABLE 4 Coordinates of SEQ ID NO: Function Name
Annotation 2065 Agrobacterium B-AGRtu.right Agro right border
sequence, essential for 11364-11720 T-DNA border transfer of T-DNA.
transfer Gene of E-Os.Act1 Upstream promoter region of the rice
actin 19-775 interest 1 gene expression E-CaMV.35S.2xA1-
Duplicated35S A1-B3 domain without 788-1120 cassette B3 TATA box
P-Os.Act1 Promoter region of the rice actin 1 gene 1125-1204
L-Ta.Lhcb1 5' untranslated leader of wheat major 1210-1270
chlorophyll a/b binding protein I-Os.Act1 First intron and flanking
UTR exon 1287-1766 sequences from the rice actin 1 gene T-St.Pis4
3' non-translated region of the potato 1838-2780 proteinase
inhibitor II gene which functions to direct polyadenylation of the
mRNA Plant P-Os.Act1 Promoter from the rice actin 1 gene 2830-3670
selectable L-Os.Act1 First exon of the rice actin 1 gene 3671-3750
marker I-Os.Act1 First intron and flanking UTR exon 3751-4228
expression sequences from the rice actin 1 gene cassette
TS-At.ShkG-CTP2 Transit peptide region of Arabidopsis 4238-4465
EPSPS CR-AGRtu.aroA- Coding region for bacterial strain CP4
4466-5833 CP4.nat native aroA gene. T-AGRtu.nos A 3' non-translated
region of the nopaline 5849-6101 synthase gene of Agrobacterium
tumefaciens Ti plasmid which functions to direct polyadenylation of
the mRNA. Agrobacterium B-AGRtu.left border Agro left border
sequence, essential for 6168-6609 T-DNA transfer of T-DNA. transfer
Maintenance OR-Ec.oriV-RK2 The vegetative origin of replication
from 6696-7092 in E. coli plasmid RK2. CR-Ec.rop Coding region for
repressor of primer from 8601-8792 the ColE1 plasmid. Expression of
this gene product interferes with primer binding at the origin of
replication, keeping plasmid copy number low. OR-Ec.ori-ColE1 The
minimal origin of replication from the 9220-9808 E. coli plasmid
ColE1. P-Ec.aadA- Promoter for Tn7 adenylyltransferase 10339-10380
SPC/STR (AAD(3'')) CR-Ec.aadA- Coding region for Tn7
adenylyltransferase 10381-11169 SPC/STR (AAD(3'')) conferring
spectinomycin and streptomycin resistance. T-Ec.aadA- 3' UTR from
the Tn7 adenylyltransferase 11170-11227 SPC/STR (AAD(3'')) gene of
E. coli.
TABLE-US-00014 TABLE 5 miRNA Targets a miR156 target, a miR160
target, a miR164 target, a miR166 target, a miR167 target, a miR169
target, a miR171 target, a miR172 target, a miR319 target, miR395
target, a miR396 target, a a miR398 target, a miR399 target, a
miR408 target, a miR444 target, a miR528 target, a miR167g target,
a miR169g target, COP1 (constitutive photomorphogenesis1), GA2ox
(gibberellic acid 2 oxidase), GA20ox (gibberellic acid 20 oxidase),
HB2 (homeobox 2), HB2-4 (homeobox 2 and homeobox 4), HB4 (homeobox
4), LG1 (liguleless1), SPX (SYG1, PHO81 and XPR1 domain; PFAM entry
PF03105 at www.sanger.ac.uk), VIM1a (variant in methlylation 1a),
DHS1 (deoxyhypusine synthase), DHS2 (deoxyhypusine synthase), DHS3
(deoxyhypusine synthase), DHS4 (deoxyhypusine synthase), DHS5
(deoxyhypusine synthase), DHS6 (deoxyhypusine synthase), DHS7
(deoxyhypusine synthase), DHS8 (deoxyhypusine synthase), CRF (corn
RING finger; RNF169), G1543a (maize orthologue of Arabidopsis
thaliana homeobox 17), G1543b (maize orthologue of Arabidopsis
thaliana homeobox 17), GS3 (grain size 3), and GW2 (grain weight
2)
TABLE-US-00015 TABLE 6 Polynucleotides Expressed by Constructs of
This Invention SEQ ID NOs: 1120, 1121, 1122, 1248, 1257, 1313,
1314, 1364, 1387, 1478, 1489, 1490, 1491, 1492, 1493, 1585, 1597,
1598, 1599, 1713, 1752, 1753, 1801, 1802, 1820, 1927, 1929, 1931,
1971, 2006, 2007, 2008, 2010, 2012, 2014, 2016, 2018, 2022, 2023,
2025, 2027, 2029, 2031, 2033, 2035, 2037, 2039, 2041, 2043, 2045,
2047, 2049, 2051, 2053, 2055, 2056, 2057, 2059, 2060, 2061, and
2063
Transformation of Soybean
[0192] A base transformation vector pMON82053 (SEQ ID NO: 2066),
illustrated in Table 7 and FIG. 3, is used in preparing recombinant
DNA constructs of this invention for Agrobacterium-mediated
transformation into soybean cells or tissue. To construct a
transformation vector for expressing any of the recombinant DNA
constructs of this invention, nucleotides encoding the at least one
polynucleotide are inserted into the base vector pMON82053 (SEQ ID
NO: 2066) in the gene of interest expression cassette at an
insertion site, i.e., between the promoter element (coordinates
1-613) and the polyadenylation element (coordinates 688-1002). For
example, a transformation vector for expression of a miR399
cleavage blocker is prepared by inserting the DNA of SEQ ID NO:
1802 (see Table 3) into the gene of interest expression cassette at
an insertion site between the promoter element (coordinates 1-613)
and the polyadenylation element (coordinates 688-1002) of pMON82053
(SEQ ID NO: 2066).
[0193] For Agrobacterium-mediated transformation, soybean seeds are
imbided overnight and the meristem explants excised and placed in a
wounding vessel. Cultures of induced Agrobacterium cells each
containing a transformation vector for expressing each of the
recombinant DNA constructs of this invention are mixed with
prepared explants. Inoculated explants are wounded using
sonication, placed in co-culture for 2-5 days, and transferred to
selection media for 6-8 weeks to allow selection and growth of
transgenic shoots. Resistant shoots are harvested at approximately
6-8 weeks and placed into selective rooting media for 2-3 weeks.
Shoots producing roots are transferred to the greenhouse and potted
in soil.
[0194] The above process is repeated to produce multiple events of
transgenic soybean plant cells that are transformed with separate
recombinant DNA constructs of this invention, i.e., a construct
transcribable in a soybean plant cell, including a promoter that is
functional in the soybean plant cell and operably linked to each
polynucleotide selected from: (a) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (b)
DNA encoding a 5'-modified cleavage blocker to prevent or decrease
small RNA-mediated cleavage of the transcript of each miRNA target
identified in Tables 2 and 3; (c) DNA encoding a translational
inhibitor to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of each miRNA target identified in
Tables 2 and 3; (e) DNA encoding a miRNA-unresponsive transgene
having a nucleotide sequence derived from the native nucleotide
sequence of each miRNA target identified in Tables 2 and 3, wherein
a miRNA recognition site in the native nucleotide sequence is
deleted or otherwise modified to prevent miRNA-mediated cleavage;
(f) DNA encoding a miRNA precursor which is processed into a miRNA
for suppressing expression of each miRNA target identified in
Tables 2 and 3; (g) DNA encoding double-stranded RNA which is
processed into siRNAs for suppressing expression of each miRNA
target identified in Tables 2 and 3; and (h) DNA encoding a
ta-siRNA which is processed into siRNAs for suppressing expression
of each miRNA target identified in Tables 2 and 3.
[0195] The above process is repeated to produce multiple events of
transgenic soybean plant cells that are transformed with each of
the following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a soybean plant cell, including a
promoter that is functional in the soybean plant cell and operably
linked to a polynucleotide selected from: (a) DNA encoding a
cleavage blocker to prevent or decrease small RNA-mediated cleavage
of the transcript of the miRNA target; (b) DNA encoding a
5'-modified cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of the miRNA target; (c)
DNA encoding a translational inhibitor to prevent or decrease small
RNA-mediated cleavage of the transcript of the miRNA target; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of the miRNA target; (e) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of the miRNA target, wherein a
miRNA recognition site in the native nucleotide sequence is deleted
or otherwise modified to prevent miRNA-mediated cleavage; (f) DNA
encoding a miRNA precursor which is processed into a miRNA for
suppressing expression of the miRNA target; (g) DNA encoding
double-stranded RNA which is processed into siRNAs for suppressing
expression the miRNA target; and (h) DNA encoding a ta-siRNA which
is processed into siRNAs for suppressing expression of the miRNA
target--wherein separate constructs are made for each of the miRNA
targets enumerated in Table 5.
[0196] The above process is repeated to produce multiple events of
transgenic soybean plant cells that are transformed with each of
the following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a soybean plant cell, including a
promoter that is functional in the soybean plant cell and operably
linked to each polynucleotide provided in Table 6, wherein separate
constructs are made for each polynucleotide.
[0197] The above process is repeated to produce multiple events of
transgenic soybean plant cells that are transformed with each of
the following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a soybean plant cell, including a
promoter that is functional in the plant cell and operably linked
to a polynucleotide selected from DNA encoding each miRNA target
identified in Tables 2 and 3.
[0198] The above process is repeated to produce multiple events of
transgenic soybean plant cells that are transformed with each of
the following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a soybean plant cell, including a
promoter that is functional in the plant cell and operably linked
to each polynucleotide of SEQ ID NOS: 15-2064.
[0199] The regenerated transgenic soybean plants, or progeny
transgenic soybean plants or soybean seeds, produced from the
regenerated transgenic soybean plants, are screened for an enhanced
trait (e.g., increased yield), as compared to a control plant or
seed (a plant or seed lacking expression of the recombinant DNA
construct). From each group of multiple events of transgenic
soybean plants with a specific recombinant construct of this
invention, the event that produces the greatest enhanced trait
(e.g., greatest enhancement in yield) is identified and progeny
soybean seed is selected for commercial development.
Transformation of Canola
[0200] A base transformation vector pMON82053 (SEQ ID NO: 2066),
illustrated in Table 7 and FIG. 3, is used in preparing recombinant
DNA constructs of this invention for Agrobacterium-mediated
transformation into canola cells or tissue. To construct a
transformation vector for expressing any of the recombinant DNA
constructs of this invention, nucleotides encoding the at least one
polynucleotide are inserted into the base vector pMON82053 (SEQ ID
NO: 2066) in the gene of interest expression cassette at an
insertion site, i.e., between the promoter element (coordinates
1-613) and the polyadenylation element (coordinates 688-1002). For
example, a transformation vector for expression of a miR399
cleavage blocker is prepared by inserting the DNA of SEQ ID NO:
1802 (see Table 3) into the gene of interest expression cassette at
an insertion site between the promoter element (coordinates 1-613)
and the polyadenylation element (coordinates 688-1002) of pMON82053
(SEQ ID NO: 2066).
[0201] Overnight-grown cultures of Agrobacterium cells each
containing a transformation vector for expressing each of the
recombinant DNA constructs of this invention are used to inoculate
tissues from in vitro-grown canola seedlings. Following
co-cultivation with Agrobacterium, the infected tissues are grown
on selection to promote growth of transgenic shoots, followed by
growth of roots from the transgenic shoots, potting of the selected
plantlets in soil, and transfer of the potted plants to the
greenhouse. Molecular characterization is performed to confirm the
presence of a recombinant DNA construct of this invention and its
expression in transgenic plants.
[0202] The above process is repeated to produce multiple events of
transgenic canola plant cells that are transformed with separate
recombinant DNA constructs of this invention, i.e., a construct
transcribable in a canola plant cell, including a promoter that is
functional in the canola plant cell and operably linked to each
polynucleotide selected from: (a) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (b)
DNA encoding a 5'-modified cleavage blocker to prevent or decrease
small RNA-mediated cleavage of the transcript of each miRNA target
identified in Tables 2 and 3; (c) DNA encoding a translational
inhibitor to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of each miRNA target identified in
Tables 2 and 3; (e) DNA encoding a miRNA-unresponsive transgene
having a nucleotide sequence derived from the native nucleotide
sequence of each miRNA target identified in Tables 2 and 3, wherein
a miRNA recognition site in the native nucleotide sequence is
deleted or otherwise modified to prevent miRNA-mediated cleavage;
(f) DNA encoding a miRNA precursor which is processed into a miRNA
for suppressing expression of each miRNA target identified in
Tables 2 and 3; (g) DNA encoding double-stranded RNA which is
processed into siRNAs for suppressing expression of each miRNA
target identified in Tables 2 and 3; and (h) DNA encoding a
ta-siRNA which is processed into siRNAs for suppressing expression
of each miRNA target identified in Tables 2 and 3.
[0203] The above process is repeated to produce multiple events of
transgenic canola plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a canola plant cell, including a
promoter that is functional in the canola plant cell and operably
linked to a polynucleotide selected from: (a) DNA encoding a
cleavage blocker to prevent or decrease small RNA-mediated cleavage
of the transcript of the miRNA target; (b) DNA encoding a
5'-modified cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of the miRNA target; (c)
DNA encoding a translational inhibitor to prevent or decrease small
RNA-mediated cleavage of the transcript of the miRNA target; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of the miRNA target; (e) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of the miRNA target, wherein a
miRNA recognition site in the native nucleotide sequence is deleted
or otherwise modified to prevent miRNA-mediated cleavage; (f) DNA
encoding a miRNA precursor which is processed into a miRNA for
suppressing expression of the miRNA target; (g) DNA encoding
double-stranded RNA which is processed into siRNAs for suppressing
expression the miRNA target; and (h) DNA encoding a ta-siRNA which
is processed into siRNAs for suppressing expression of the miRNA
target--wherein separate constructs are made for each of the miRNA
targets enumerated in Table 5.
[0204] The above process is repeated to produce multiple events of
transgenic canola plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a canola plant cell, including a
promoter that is functional in the canola plant cell and operably
linked to each polynucleotide provided in Table 6, wherein separate
constructs are made for each polynucleotide.
[0205] The above process is repeated to produce multiple events of
transgenic canola plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a canola plant cell, including a
promoter that is functional in the plant cell and operably linked
to a polynucleotide selected from DNA encoding each miRNA target
identified in Tables 2 and 3.
[0206] The above process is repeated to produce multiple events of
transgenic canola plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a canola plant cell, including a
promoter that is functional in the plant cell and operably linked
to each polynucleotide of SEQ ID NOS: 15-2064.
[0207] The regenerated transgenic canola plants, or progeny
transgenic canola plants or canola seeds, produced from the
regenerated transgenic canola plants, are screened for an enhanced
trait (e.g., increased yield), as compared to a control plant or
seed (a plant or seed lacking expression of the recombinant DNA
construct). From each group of multiple events of transgenic canola
plants with a specific recombinant construct of this invention, the
event that produces the greatest enhanced trait (e.g., greatest
enhancement in yield) is identified and progeny canola seed is
selected for commercial development.
Transformation of Cotton
[0208] A base transformation vector pMON99053 (SEQ ID NO: 2067),
illustrated in Table 8 and FIG. 4, is used in preparing recombinant
DNA constructs of this invention for Agrobacterium-mediated
transformation into maize cells or tissue. To construct a
transformation vector for expressing any of the recombinant DNA
constructs of this invention, nucleotides encoding the at least one
polynucleotide are inserted into the base vector pMON99053 (SEQ ID
NO: 2067) in the gene of interest expression cassette at an
insertion site, i.e., between the promoter element (coordinates
388-1091) and the polyadenylation element (coordinates
1165-1791).
[0209] Methods for transformation of cotton are known in the art,
see, for example, the techniques described in U. S. Patent
Application Publications 2004/0087030A1 2008/0256667A1,
2008/0280361A1, and 2009/0138985A1, which are incorporated by
reference. In an example of a cotton transformation protocol, seeds
of transformable cotton genotypes (e.g., nectarless, DP393, 00SO4,
07W610F, STN474, Delta Pearl, DP5415, SureGrow501, or SureGrow747)
are surface sterilized, rinsed, and hydrated in CSM medium
(containing carbenicillin, cefotaxime, BRAVO, and Captan 50) for 14
to 42 hours in the dark. Meristematic explants are processed from
seeds as described in U. S. Patent Application Publications
2008/0256667A1. Cultures of Agrobacterium cells each containing a
transformation vector for expressing each of the recombinant DNA
constructs of this invention are used to inoculate the explants
using sonication. The inoculum is removed and the inoculated
explants transferred to INO medium and incubated for 2 to 5 days
using a 16-hour light photoperiod. Following co-cultivation,
explants are transferred onto semi-solid selection medium (modified
Lloyd & McCown Woody Plant Medium supplemented with 200 mg/L
cefotaxime, 200 mg/L carbenicillin and 100-200 mg/L spectinomycin)
with or without plant growth regulators or other additives to
promote multiple shoot formation and growth. The explants are
cultured in a 16-hour light photoperiod. After 4 to 6 weeks on the
selection medium those explants that have developed green shoots
are transferred to plugs and placed in liquid medium containing
0.25 mg/L IBA for shoot growth and rooting under plastic domes for
3 to 4 weeks. Tissues are assayed for molecular characterization by
one or more molecular assay methods (e.g., PCR, or Southern
blots).
[0210] The above process is repeated to produce multiple events of
transgenic cotton plant cells that are transformed with separate
recombinant DNA constructs of this invention, i.e., a construct
transcribable in a cotton plant cell, including a promoter that is
functional in the cotton plant cell and operably linked to each
polynucleotide selected from: (a) DNA encoding a cleavage blocker
to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (b)
DNA encoding a 5'-modified cleavage blocker to prevent or decrease
small RNA-mediated cleavage of the transcript of each miRNA target
identified in Tables 2 and 3; (c) DNA encoding a translational
inhibitor to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of each miRNA target identified in
Tables 2 and 3; (e) DNA encoding a miRNA-unresponsive transgene
having a nucleotide sequence derived from the native nucleotide
sequence of each miRNA target identified in Tables 2 and 3, wherein
a miRNA recognition site in the native nucleotide sequence is
deleted or otherwise modified to prevent miRNA-mediated cleavage;
(f) DNA encoding a miRNA precursor which is processed into a miRNA
for suppressing expression of each miRNA target identified in
Tables 2 and 3; (g) DNA encoding double-stranded RNA which is
processed into siRNAs for suppressing expression of each miRNA
target identified in Tables 2 and 3; and (h) DNA encoding a
ta-siRNA which is processed into siRNAs for suppressing expression
of each miRNA target identified in Tables 2 and 3.
[0211] The above process is repeated to produce multiple events of
transgenic cotton plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a cotton plant cell, including a
promoter that is functional in the cotton plant cell and operably
linked to a polynucleotide selected from: (a) DNA encoding a
cleavage blocker to prevent or decrease small RNA-mediated cleavage
of the transcript of the miRNA target; (b) DNA encoding a
5'-modified cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of the miRNA target; (c)
DNA encoding a translational inhibitor to prevent or decrease small
RNA-mediated cleavage of the transcript of the miRNA target; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of the miRNA target; (e) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of the miRNA target, wherein a
miRNA recognition site in the native nucleotide sequence is deleted
or otherwise modified to prevent miRNA-mediated cleavage; (f) DNA
encoding a miRNA precursor which is processed into a miRNA for
suppressing expression of the miRNA target; (g) DNA encoding
double-stranded RNA which is processed into siRNAs for suppressing
expression the miRNA target; and (h) DNA encoding a ta-siRNA which
is processed into siRNAs for suppressing expression of the miRNA
target--wherein separate constructs are made for each of the miRNA
targets enumerated in Table 5.
[0212] The above process is repeated to produce multiple events of
transgenic cotton plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a cotton plant cell, including a
promoter that is functional in the cotton plant cell and operably
linked to each polynucleotide provided in Table 6, wherein separate
constructs are made for each polynucleotide.
[0213] The above process is repeated to produce multiple events of
transgenic cotton plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a cotton plant cell, including a
promoter that is functional in the plant cell and operably linked
to a polynucleotide selected from DNA encoding each miRNA target
identified in Tables 2 and 3.
[0214] The above process is repeated to produce multiple events of
transgenic cotton plant cells that are transformed with each of the
following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a cotton plant cell, including a
promoter that is functional in the plant cell and operably linked
to each polynucleotide of SEQ ID NOS: 15-2064.
[0215] The regenerated transgenic cotton plants, or progeny
transgenic cotton plants or cotton seeds, produced from the
regenerated transgenic cotton plants, are screened for an enhanced
trait (e.g., increased yield), as compared to a control plant or
seed (a plant or seed lacking expression of the recombinant DNA
construct). From each group of multiple events of transgenic cotton
plants with a specific recombinant construct of this invention, the
event that produces the greatest enhanced trait (e.g., greatest
enhancement in yield) is identified and progeny cotton seed is
selected for commercial development.
TABLE-US-00016 TABLE 7 Coordinates of SEQ ID NO: Function Name
Annotation 2066 Agrobacterium T- B-AGRtu.left Agro left border
sequence, essential for 6144-6585 DNA transfer border transfer of
T-DNA. Plant selectable P-At.Act7 Promoter from the Arabidopsis
actin 7 6624-7861 marker gene expression L-At.Act7 5'UTR of
Arabidopsis Act7 gene cassette I-At.Act7 Intron from the
Arabidopsis actin7 gene TS-At.ShkG-CTP2 Transit peptide region of
Arabidopsis 7864-8091 EPSPS CR-AGRtu.aroA- Synthetic CP4 coding
region with dicot 8092-9459 CP4.nno_At preferred codon usage.
T-AGRtu.nos A 3' non-translated region of the nopaline 9466-9718
synthase gene of Agrobacterium tumefaciens Ti plasmid which
functions to direct polyadenylation of the mRNA. Gene of interest
P-CaMV.35S-enh Promoter for 35S RNA from CaMV 1-613 expression
containing a duplication of the -90 to -350 cassette region.
T-Gb.E6-3b 3' untranslated region from the fiber 688-1002 protein
E6 gene of sea-island cotton. Agrobacterium T- B-AGRtu.right Agro
right border sequence, essential for 1033-1389 DNA transfer border
transfer of T-DNA. Maintenance in OR-Ec.oriV-RK2 The vegetative
origin of replication from 5661-6057 E. coli plasmid RK2. CR-Ec.rop
Coding region for repressor of primer 3961-4152 from the ColE1
plasmid. Expression of this gene product interferes with primer
binding at the origin of replication, keeping plasmid copy number
low. OR-Ec.ori-ColE1 The minimal origin of replication from
2945-3533 the E. coli plasmid ColE1. P-Ec.aadA- Promoter for Tn7
adenylyltransferase 2373-2414 SPC/STR (AAD(3'')) CR-Ec.aadA- Coding
region for Tn7 1584-2372 SPC/STR adenylyltransferase (AAD(3''))
conferring spectinomycin and streptomycin resistance. T-Ec.aadA- 3'
UTR from the Tn7 adenylyltransferase 1526-1583 SPC/STR (AAD(3''))
gene of E. coli.
TABLE-US-00017 TABLE 8 Coordinates of SEQ ID NO: Function Name
Annotation 2067 Agrobacterium B-AGRtu.right Agro right border
sequence, essential for 1-357 T-DNA border transfer of T-DNA.
transfer Gene of Exp-CaMV.35S- Enhanced version of the 35S RNA
388-1091 interest enh + Ph.DnaK promoter from CaMV plus the petunia
expression hsp70 5' untranslated region cassette T-Ps.RbcS2-E9 The
3' non-translated region of the pea 1165-1797 RbcS2 gene which
functions to direct polyadenylation of the mRNA. Plant selectable
Exp-CaMV.35S Promoter and 5' untranslated region from 1828-2151
marker the 35S RNA of CaMV expression CR-Ec.nptII-Tn5 Coding region
for neomycin 2185-2979 cassette phosphotransferase gene from
transposon Tn5 which confers resistance to neomycin and kanamycin.
T-AGRtu.nos A 3' non-translated region of the nopaline 3011-3263
synthase gene of Agrobacterium tumefaciens Ti plasmid which
functions to direct polyadenylation of the mRNA. Agrobacterium
B-AGRtu.left Agro left border sequence, essential for 3309-3750
T-DNA border transfer of T-DNA. transfer Maintenance in
OR-Ec.oriV-RK2 The vegetative origin of replication from 3837-4233
E. coli plasmid RK2. CR-Ec.rop Coding region for repressor of
primer from 5742-5933 the ColE1 plasmid. Expression of this gene
product interferes with primer binding at the origin of
replication, keeping plasmid copy number low. OR-Ec.ori-ColE1 The
minimal origin of replication from the 6361-6949 E. coli plasmid
ColE1. P-Ec.aadA- Promoter for Tn7 adenylyltransferase 7480-7521
SPC/STR (AAD(3'')) CR-Ec.aadA- Coding region for Tn7
adenylyltransferase 7522-8310 SPC/STR (AAD(3'')) conferring
spectinomycin and streptomycin resistance. T-Ec.aadA- 3' UTR from
the Tn7 adenylyltransferase 8311-8368 SPC/STR (AAD(3'')) gene of E.
coli.
Transformation of Sugarcane
[0216] Sugarcane transformation techniques are known in the art;
see, for example, the procedures describedfor sugarcane by Brumbley
et al. in "Sugarcane" (available electronically at
mrw.interscience.wiley.com/emrw/9781405181099/hpt/article/k0701/current/p-
df), published in: "Compendium of Transgenic Crop Plants", edited
by Chittaranjan Kole and Timothy C. Hall, Blackwell Publishing
Ltd., 2008; ISBN 978-1-405-16924-0 (available electronically at
mrw.interscience.wiley.com/emrw/9781405181099/hpt/toc), and in PCT
International Patent Application Publications WO2007/003023
(sugarcane) and WO2008/049183 (sugarcane). In one example of
sugarcane transformaiton (see Example 3 of PCT International Patent
Application Publication W02007003023A2), embryonic sugarcane callus
cultures are established from apical meristem and primordial leafs
of sugarcane (Saccharum spp. hybrid). Eight-week old calli are
co-bombarded with an equimolar mixture of either
UBI-1::Bar::NOSpolyA and UBI-1::Oas::NOSpolyA or
UBI-1::Bar::NOSpolyA and UBI-1::CPs::NOSpolyA expression cassettes
(10 pg DNAI3/mg particle) by particle bombardment as described
previously (Sanford (1990) Plant Physiol., 79:206-209). After
bombardment, calli are transferred to MS medium containing 1 mg/L
PPT and 1 mg/L BAP to promote shoot regeneration and inhibit
development of non transgenic tissue. Two weeks later, calli are
transferred to MS medium containing 1 mg/L PPT and 1 mg/L Affi for
shoot elongation and to induce root formation. After two weeks,
plantlets are placed into magenta boxes for acclimatization and 2
weeks later, shoots (10-15 cm) with well developed roots are
transferred to potting soil and placed in the greenhouse.
[0217] The above process is repeated to produce multiple events of
transgenic sugarcane plant cells that are transformed with separate
recombinant DNA constructs of this invention, i.e., a construct
transcribable in a sugarcane plant cell, including a promoter that
is functional in the sugarcane plant cell and operably linked to
each polynucleotide selected from: (a) DNA encoding a cleavage
blocker to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (b)
DNA encoding a 5'-modified cleavage blocker to prevent or decrease
small RNA-mediated cleavage of the transcript of each miRNA target
identified in Tables 2 and 3; (c) DNA encoding a translational
inhibitor to prevent or decrease small RNA-mediated cleavage of the
transcript of each miRNA target identified in Tables 2 and 3; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of each miRNA target identified in
Tables 2 and 3; (e) DNA encoding a miRNA-unresponsive transgene
having a nucleotide sequence derived from the native nucleotide
sequence of each miRNA target identified in Tables 2 and 3, wherein
a miRNA recognition site in the native nucleotide sequence is
deleted or otherwise modified to prevent miRNA-mediated cleavage;
(f) DNA encoding a miRNA precursor which is processed into a miRNA
for suppressing expression of each miRNA target identified in
Tables 2 and 3; (g) DNA encoding double-stranded RNA which is
processed into siRNAs for suppressing expression of each miRNA
target identified in Tables 2 and 3; and (h) DNA encoding a
ta-siRNA which is processed into siRNAs for suppressing expression
of each miRNA target identified in Tables 2 and 3.
[0218] The above process is repeated to produce multiple events of
transgenic sugarcane plant cells that are transformed with each of
the following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a sugarcane plant cell, including a
promoter that is functional in the sugarcane plant cell and
operably linked to a polynucleotide selected from: (a) DNA encoding
a cleavage blocker to prevent or decrease small RNA-mediated
cleavage of the transcript of the miRNA target; (b) DNA encoding a
5'-modified cleavage blocker to prevent or decrease small
RNA-mediated cleavage of the transcript of the miRNA target; (c)
DNA encoding a translational inhibitor to prevent or decrease small
RNA-mediated cleavage of the transcript of the miRNA target; (d)
DNA encoding a decoy to prevent or decrease small RNA-mediated
cleavage of the transcript of the miRNA target; (e) DNA encoding a
miRNA-unresponsive transgene having a nucleotide sequence derived
from the native nucleotide sequence of the miRNA target, wherein a
miRNA recognition site in the native nucleotide sequence is deleted
or otherwise modified to prevent miRNA-mediated cleavage; (f) DNA
encoding a miRNA precursor which is processed into a miRNA for
suppressing expression of the miRNA target; (g) DNA encoding
double-stranded RNA which is processed into siRNAs for suppressing
expression the miRNA target; and (h) DNA encoding a ta-siRNA which
is processed into siRNAs for suppressing expression of the miRNA
target--wherein separate constructs are made for each of the miRNA
targets enumerated in Table 5.
[0219] The above process is repeated to produce multiple events of
transgenic sugarcane plant cells that are transformed with each of
the following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a sugarcane plant cell, including a
promoter that is functional in the sugarcane plant cell and
operably linked to each polynucleotide provided in Table 6, wherein
separate constructs are made for each polynucleotide.
[0220] The above process is repeated to produce multiple events of
transgenic sugarcane plant cells that are transformed with each of
the following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a sugarcane plant cell, including a
promoter that is functional in the plant cell and operably linked
to a polynucleotide selected from DNA encoding each miRNA target
identified in Tables 2 and 3.
[0221] The above process is repeated to produce multiple events of
transgenic sugarcane plant cells that are transformed with each of
the following recombinant DNA constructs of this invention, i.e., a
construct transcribable in a sugarcane plant cell, including a
promoter that is functional in the plant cell and operably linked
to each polynucleotide of SEQ ID NOS: 15-2064.
[0222] The regenerated transgenic sugarcane plants, or progeny
transgenic sugarcane plants or sugarcane seeds, produced from the
regenerated transgenic sugarcane plants, are screened for an
enhanced trait (e.g., increased yield), as compared to a control
plant or seed (a plant or seed lacking expression of the
recombinant DNA construct). From each group of multiple events of
transgenic sugarcane plants with a specific recombinant construct
of this invention, the event that produces the greatest enhanced
trait (e.g., greatest enhancement in yield) is identified and
progeny sugarcane seed is selected for commercial development.
Further Embodiments
[0223] A miRNA decoy competes with the endogenous target gene to
bind to that particular miRNA and thus reduces the effect of the
miRNA in the biochemical network or networks involving the miRNA.
Decoys include endogenous (native) miRNA decoy sequences, decoys
created by manipulating an endogenous sequence (e.g., by chemical
or other mutagenesis or site-directed recombination), and synthetic
miRNA decoy sequences. A recombinant DNA construct can be designed
to express multiple miRNA decoys. The advantages of a miRNA decoy
approach include the fact that no protein is expressed, and because
miRNAs often belong to multi-gene families (wherein each miRNA gene
produces a unique miRNA primary transcript) that a single miRNA
decoy is useful for binding to a mature miRNA that is derived from
more than one miRNA gene or primary transcript.
[0224] However, an alternative to a miRNA decoy is sometimes
preferred, as it is possible for a miRNA decoy that binds to mature
miRNAs from more than one miRNA gene to unintentionally affect the
expression of a non-target gene. Applicants have disclosed herein
additional novel approaches for manipulating a miRNA-regulated
pathway by interfering with the binding of the mature miRNA to its
target. These approaches generally involve the in vivo (e.g., in
planta) expression and processing of a recombinant DNA construct of
this invention, and are especially useful for regulating the
expression of single (or, where desired, multiple) target genes,
and in manipulating gene expression in transgenic plants, resulting
in improved phenotypes such as increased yield or biotic or abiotic
stress tolerance.
[0225] One approach is by using a "cleavage blocker" or
"5'-modified cleavage blocker" that is transgenically expressed in
a eukaryotic cell and that binds to a miRNA recognition site of a
target gene's transcript in a manner that does not lead to
cleavage, thereby preventing or decreasing miRNA-mediated cleavage
of the transcript by competing with the miRNA for binding to the
recognition site. This method controls the rate of
post-transcriptional suppression of miRNA target genes by
protecting them from being cleaved by miRNA-Ago complex, and
decreases or prevents down-regulation of the miRNA target gene. The
invention includes analogous cleavage blockers that compete with
other small RNAs involved in silencing, e.g., si-RNAs, trans-acting
siRNAs, phased RNAs, natural antisense transcript siRNAs, natural
antisense transcript miRNAs, or indeed any small RNA associated
with a silencing complex such as RISC or an Argonaute or
Argonaute-like protein.
[0226] Another approach is by using a "translational inhibitor"
that is transgenically expressed in a eukaryotic cell and that
binds to and inhibit translation of the target gene's transcript,
thereby decreasing expression of the target gene. The nucleotide
sequence of the translational inhibitor is designed so that the
hybridized segment formed between the translational inhibitor and
the target gene's transcript imparts to the transcript resistance
to cleavage by an RNase III ribonuclease within or in the vicinity
of the hybridized segment. Translational inhibitors provide the
advantages of reducing the likelihood of transitive small RNAs
forming (as can occur in miRNA-mediated degradation of a target
gene), and achievement of more controlled regulation of target
suppression because the translational inhibitor remains associated
with the target gene's transcript (unlike miRNAs, which dissociate
from the cleaved transcript and can then bind another transcript
molecule). Translational inhibitors can be based on sequences
selected from any small RNA associated with a silencing complex
such as RISC or an Argonaute or Argonaute-like protein.
[0227] One of ordinary skill in the art easily recognizes that the
above procedures are equally applicable to situations where the
double-stranded RNA that mediates the target gene suppression is
other than a miRNA. Thus, various aspects of this invention include
analogous recombinant DNA constructs that are processed in vivo or
in planta to provide RNA including single-stranded RNA that serve
as an "siRNA cleavage blocker", a "trans-acting siRNA cleavage
blocker", a "phased small RNA cleavage blocker", a "natural
antisense transcript siRNA cleavage blocker", or a "natural
antisense transcript miRNA cleavage blocker" (or, in general terms,
a "small RNA cleavage blocker"), according to whether the RNase III
ribonuclease cleavage that is inhibited is mediated by,
respectively, an siRNA, a trans-acting siRNA, a phased small RNA, a
natural antisense transcript siRNA, or a natural antisense
transcript miRNA (or, in general terms, any small RNA associated
with a silencing complex such as RISC or an Argonaute or
Argonaute-like protein).
[0228] All of the materials and methods disclosed and claimed
herein can be made and used without undue experimentation as
instructed by the above disclosure. Although the materials and
methods of this invention have been described in terms of preferred
embodiments and illustrative examples, it will be apparent to those
of skill in the art that variations can be applied to the materials
and methods described herein without departing from the concept,
spirit and scope of the invention. All such similar substitutes and
modifications apparent to those skilled in the art are deemed to be
within the spirit, scope and concept of the invention as defined by
the appended claims.
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20150247154A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20150247154A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References