U.S. patent application number 14/623490 was filed with the patent office on 2015-08-20 for method of producing a low molecular weight organic compound in a cell.
The applicant listed for this patent is EVOLVA SA. Invention is credited to Thomas Hvid Andersen, Joergen Hansen, Finn Thyge Okkels.
Application Number | 20150232889 14/623490 |
Document ID | / |
Family ID | 33553834 |
Filed Date | 2015-08-20 |
United States Patent
Application |
20150232889 |
Kind Code |
A1 |
Hansen; Joergen ; et
al. |
August 20, 2015 |
Method of Producing a Low Molecular Weight Organic Compound in a
Cell
Abstract
A method of producing a low molecular weight organic compound
(e.g. a plant or bacteria secondary metabolite) in increased yields
involving use of a microorganism cell, which comprises a gene
involved in the biosynthesis pathway leading to a low molecular
weight organic aglycon compound and a glycosyltransferase gene
capable of glycosylating the produced aglycon.
Inventors: |
Hansen; Joergen;
(Frederiksberg, DK) ; Andersen; Thomas Hvid;
(Frederiksberg, DK) ; Okkels; Finn Thyge;
(Roskilde, DK) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
EVOLVA SA |
Reinach |
|
CH |
|
|
Family ID: |
33553834 |
Appl. No.: |
14/623490 |
Filed: |
February 16, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13205288 |
Aug 8, 2011 |
8986950 |
|
|
14623490 |
|
|
|
|
12909088 |
Oct 21, 2010 |
8105786 |
|
|
13205288 |
|
|
|
|
10561823 |
Dec 19, 2005 |
7846697 |
|
|
PCT/EP2004/051104 |
Jun 14, 2004 |
|
|
|
12909088 |
|
|
|
|
Current U.S.
Class: |
435/147 |
Current CPC
Class: |
C12N 9/1051 20130101;
A23L 27/24 20160801; C12P 13/004 20130101; C12P 19/44 20130101;
C12P 7/24 20130101; C12P 19/18 20130101 |
International
Class: |
C12P 7/24 20060101
C12P007/24; C12N 9/10 20060101 C12N009/10 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 19, 2003 |
EP |
03101801.3 |
Aug 26, 2003 |
EP |
03102650.3 |
Claims
1. A method of producing a low molecular weight organic aglycon
compound comprising following steps: a) fermenting a microorganism
cell in a suitable medium where the microorganism is capable of
growing, which comprises a gene encoding a product involved in the
biosynthesis pathway leading to a low molecular weight organic
aglycon compound and a glycosyltransferase gene encoding a
glycosyltransferase capable of glycosylating the produced aglycon,
under suitable conditions wherein the cell produces the aglycon and
the corresponding glycosylated form of the aglycon; b)
deglycosylating the glycosylated form of the aglycon; and c)
recovering the aglycon compound; (i) wherein the low molecular
weight organic aglycon compound has a molecular weight from 50 to
3000, and (ii) wherein the glycosyltransferase is a
glycosyltransferase capable of conjugating a sugar to the aglycon
compound.
2. The method of claim 1, wherein the microorganism cell with the
glycosyltransferase during culture fermentation is capable of
producing higher amounts of the glycosylated form of the aglycon as
compared to the amounts of the corresponding aglycon produced by
the same microorganism cell without the glycosyltransferase.
3. The method of claim 2, wherein the microorganism cell is a yeast
cell.
4. The method of claim 3, wherein the yeast cell is a Saccharomyces
spp. cell or a Pichia spp. cell.
5. The method of claim 2, wherein the microorganism cell is a
prokaryotic cell.
6. The method of claim 5, wherein the prokaryotic cell is an E.
coli cell.
7. The method of claim 1, wherein the glycosyltransferase gene is a
heterologous glycosyltransferase gene.
8. The method of claim 1, wherein the glycosyltransferase is an
UDPG glycosyltransferase, preferably an
UDPG-glucosyltransferase.
9. The method of claim 1, wherein the low molecular weight organic
aglycon compound is an organic aglycon compound that comprises a
compound that contains a Hydroxy-, Amino-, Sulfide-, or Carboxy
functional group that can be glycosylated by use of the
glycosyltransferase.
10. The method of claim 9, wherein the low molecular weight organic
aglycon compound is an organic aglycon compound that comprises a
compound that contains Hydroxy-functional group, or an alcohol,
that can be glycosylated by use of the glycosyltransferase.
11. The method of claim 9, wherein the aglycon compound has a
molecular weight from 50 to 1000 kilodaltons.
12. The method of claim 11, wherein the aglycon compound is a
secondary metabolite compound.
13. The method of claim 12, wherein secondary metabolite compound
is a plant secondary metabolite compound selected from the group
consisting of Terpenoids, Alkaloids, Phenylpropanoids, Phenyl
derivatives, Hexanol derivatives, Flavonoids, Coumarins, Stilbenes,
Cyanohydrins, and Glucosinolates.
14. The method of claim 13, wherein the plant secondary metabolite
organic aglycon compound is vanillin.
15. The method of claim 14, wherein the microorganism cell is a
yeast cell.
16. The method of claim 15, wherein the yeast cell is a
Saccharomyces spp. cell or a Pichia spp. cell.
17. The method of claim 14, wherein the microorganism cell is a
prokaryotic cell.
18. The method of claim 17, wherein the prokaryotic cell is an E.
coli cell.
19. The method of claim 1, wherein the deglycosylating step b)
takes place outside the growing cell following excretion or
extraction of the glycosylated form of the aglycon produced in step
a) and wherein the deglycosylating is an enzymatic process mediated
by a beta-glucosidase.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 13/205,288, filed Aug. 8, 2011, which is a continuation of U.S.
application Ser. No. 12/909,088, filed Oct. 21, 2010 (now U.S. Pat.
No. 8,105,786), which is a divisional of U.S. application Ser. No.
10/561,823, filed Dec. 19, 2005 (now U.S. Pat. No. 7,846,697),
which is a section 371 national filing of PCT/EP2004/051104, filed
Jun. 14, 2004, which claims priority to EP 03102650.3, filed Aug.
26, 2003 and EP 031018013 filed Jun. 19, 2003, all of which are
hereby incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to a method of producing a low
molecular weight organic compound (e.g. a plant or bacteria
secondary metabolite) in increased yields involving use of a cell
(e.g. a plant or microorganism cell), which comprises a gene
involved in the biosynthesis pathway leading to a low molecular
weight organic aglycon compound and a glycosyltransferase gene
capable of glycosylating the produced aglycon.
BACKGROUND OF THE INVENTION
[0003] Plants and microbes synthesize a large number of natural
substances, in particular secondary metabolites, with diverse and
generally unclear function. In contrast to the primary metabolites
e g. amino acids, sugars, fatty acids), which are involved in
fundamental functions like metabolism, growth, maintenance and
survival, secondary metabolites are not required for fundamental
functions. Many secondary metabolites from plants are known to act
as repellents or natural pesticides in defense against herbivore
animals or as sexual attractants to pollinating insects (Grisebach,
1988, In: European Conference on Biotechnology, Scientific,
technical and industrial challenges, Verona, Italy, 7-8 Nov. 1988,
pages 23-27), whereas fungal secondary metabolites often act as
phytotoxins (Osbourn, 2001, Proceedings of the National Academy of
the USA 98: 14187-14188).
[0004] Various secondary metabolites from more than 100 different
plant species have been shown to exert antimicrobial activity
(Cowan, 1999, Clinical Microbiology Reviews 12: 564-582) and a
large number of secondary metabolites from common food plants are
not only responsible for the taste and color but are also believed
to have health promoting activities (Eastwood, 2001, Quarterly
Journal of Medicine 94: 45-48; Drewnowski & Gomez-Cameros,
2000, American Journal of Clinical Nutrition 72:1424-1435).
Accordingly, these natural substances are economically important in
such different fields as drugs, food additives, fragrances,
pigments, and pesticides.
[0005] Secondary metabolites often accumulate in small quantities
and sometimes only in specialized cells. Hence their extraction can
be difficult and inefficient. In spite of the progress in organic
chemical synthesis, a large number of these metabolites have such
complex structures that they are virtually impossible to synthesize
at economic levels. Moreover, the natural product is generally more
acceptable to consumers than an artificially produced one.
Consequently, industrial application of these substances and their
functional analogues often relies on natural extraction from
plants.
[0006] Secondary metabolites may generally be structurally
qualified as low molecular weight organic compounds.
[0007] Industrial production of secondary metabolites or other
natural and non natural low molecular weight organic compounds can
be facilitated by a biotechnological approach By transformation of
genes involved in the biosynthesis of a desired natural product,
plants or microbes can e.g. be manipulated to produce a compound
not previously present in the plant or organism.
[0008] Glycosyltransferase may be defined as an enzyme which
transfers residues of sugars (galactose, xylose, rhamnose, glucose,
arabinose, glucuronic acid, etc) to acceptor molecules. Acceptor
molecules may be other sugars, proteins, lipids and other organic
substrates. The acceptor molecule may be termed an aglycon
(aglucone if sugar is glucose). An aglycon may be defined as the
non-carbohydrate part of a glycoside. A glycoside may be defined as
an organic molecule with a glycosyl group (organic chemical group
derived from a sugar or polysaccharide molecule) connected to it by
way of e.g. an intervening oxygen, nitrogen or sulphur atom.
[0009] These glycosylated molecules take part in diverse metabolic
pathways and processes. The transfer of a glycosyl moiety can alter
the acceptor's bioactivity, solubility, stability, taste, scent and
transport properties e.g. within a plant or microbial cell and
throughout the plant.
[0010] The art describes a number of glycosyltransferases that can
glycosylate compounds such as secondary metabolites from e.g.
plants and fungi (Paquette, S. et al, Phytochemistry 62 (2003)
399-413).
[0011] WO01/07631, WO01/40491 and (Arend, J et al., Biotech. &
Bioeng (2001) 78:126-131) describe that at least some of these
glycosyltransferases are capable of glycosylating a number of
different structurally related secondary metabolites and other
structurally related low molecular weight organic compounds.
[0012] Accordingly, the skilled person has at his disposal a number
of different glycosyltransferases capable of glycosylating numerous
different secondary metabolites and other structurally related low
molecular weight organic compounds.
[0013] Tattersall, D B et al, Science (2001) 293:1826-8 describes
that the entire pathway for synthesis of the tyrosine-derived
cyanogenic glucoside dhurrin [a seconday metabolite] has been
transferred from the plant Sorghum bicolor to the plant Arabidopsis
thaliana. The entire pathway for synthesis included two genes
involved in the biosynthesis pathway (CYP79A1 and CYP71E1) and a
glucosyltransferase (sbHMNGT) capable of glucosylating the last
intermediate p-hydroxymandelonitrile) to get the glucoside dhurrin
(see FIG. 1 herein). It was demonstrated that the transgenic
Arabidopsis thaliana plant was capable of producing 4 mg of dhurrin
per gram of fresh weight.
[0014] Arend, J et al., Biotech. & Bioeng (2001) 78:126-131 and
WO01/07631 describes cloning of a glucosyltransferase from the
plant Rauvolfia serpentina. The cloned glucosyltransferase was
inserted into E. coli bacteria. When the aglucones hydroquinone,
vanillin and p-hydroxyacetophenone were added to the medium of
cultivated cells of the engineered E. coli, the corresponding
glucosides, arbutin, vanillin-D-glucoside and picein were
synthesized. They also were released from the cells into the
surrounding medium.
[0015] Moehs, C P et al, Plant Journal (1997) 11:227-236 describes
that a cDNA encoding a solanidine glucosyltransferase (SGT) was
isolated from potato. The cDNA was selected from a yeast expression
library using a positive selection based on the higher toxicity of
steroidal alkaloid aglycon relatively to their corresponding
glycosylated forms. The activity of the cloned SGT was tested in an
in vitro assay based on isolated recombinant produced SGT.
[0016] U.S. Pat. No. 6,372,461 describes a method for making the
secondary metabolite vanillin by use of an E. coli cell where there
has been introduced genes involving in the biosynthesis pathway
starting from glucose and leading to vanillic acid. The recombinant
E. coli can produce vanillic acid when cultured in a medium
comprising glucose. The produced vanillic acid is recovered from
the fermentation broth and reduced to vanillin with aryl-aldehyde
dehydrogenase.
SUMMARY OF THE INVENTION
[0017] The problem to be solved by the present invention is to
provide a new method of producing in particular low molecular
weight organic compounds of interest, wherein the method provides
the possibility of obtaining the compound in higher yields.
[0018] Among other things, the solution is based on that the
present inventors have investigated and compared the following two
cultivated microorganisms. [0019] (i) a microorganism comprising a
gene involved in the biosynthesis pathway leading to a low
molecular weight aglycon compound; and [0020] (ii) the same
microorganism but where there is also introduced a
glycosyltransferase gene capable of glycosylating the produced
aglycon to get the associated glycosylated form of the aglycon.
[0021] The inventors found that the microorganism with the
glycosyltransferase during culture fermentation is capable of
producing higher amounts of the glycosylated form of the aglycon as
compared to the amounts of the corresponding aglycon produced by
the microorganism without the glycosyltransferase. See working
examples herein for an illustrative examples where [0022] (a) an E.
coli cell of type (ii) above produces higher amounts of vanillin
glucoside as compared to the amounts of the corresponding vanillin
aglucone produced in a corresponding E. coli without the
glycosyltransferase (E. coli cell of type (i) above); [0023] (b) a
yeast cell of type (ii) above produces higher amounts of vanillin
glucoside as compared to the amounts of the corresponding vanillin
aglucone produced in a corresponding yeast cell without the
glycosyltransferase (yeast cell of type (i) above); [0024] (c) a
yeast cell of type (ii) above produces higher amounts of
protocatechuic acid-.beta.-D-glucoside (PAG) as compared to the
amounts of the corresponding protocatechuic acid (PA) aglucone
produced in a corresponding yeast cell without the
glycosyltransferase (yeast cell of type (i) above); [0025] (d) a
yeast cell of type (ii) above produces higher amounts of dhurrin as
compared to the amounts of the p-hydroxymandelonitrile (aglycone of
dhurrin. See FIG. 1) produced in a corresponding yeast cell without
the glycosyltransferase (yeast cell of type (i) above); [0026] (e)
a yeast cell of type (ii) above produces higher amounts of
glucosylated compounds (such as e.g. p-glucosyloxy-phenylethanol,
p-glucosyloxy-phenylacetonitrile, p-glucosyloxy-benzaldehyde or
glucosyl p-hydroxybenzoate) derived from the Dhurrin biosynthesis
pathway as compared to the amounts of corresponding aglycons
produced in a corresponding yeast cell without the
glycosyltransferase (yeast cell of type (i) above).
[0027] Accordingly, a microorganism cell of the type (ii) above may
then be used to obtain the glycosylated form of the corresponding
aglycon in high amounts. However, it may also be used in a process
to make the aglycon in higher amounts simply by e.g. first making
the glycosylated form of the aglycon, recovering it and
deglycosylate it according to standard protocols (e.g.
enzymatically by use of a (.beta.-glucosidase or by adequate
chemical hydrolysis.)
[0028] Accordingly, a first aspect of the invention relates to a
method of producing a low molecular weight organic compound
comprising following steps: [0029] a) fermenting a microorganism
cell or a filamentous fungi cell, which comprises a gene encoding a
product involved in the biosynthetic pathway leading to a low
molecular weight organic aglycon compound and a heterologous
glycosyltransferase gene encoding a glycosyltransferase capable of
glycosylating the produced aglycon, in a suitable medium, wherein
the cell produces the aglycon and the corresponding glycosylated
form of the aglycon; and [0030] b) recovering the glycosylated form
of the aglycon compound; [0031] (i) wherein the low molecular
weight organic aglycon compound has a molecular weight from 50 to
3000 g/mol, and [0032] (ii) wherein the glycosyltransferase is a
glycosyltransferase capable of conjugating a sugar to the aglycon
compound, wherein the sugar is a sugar selected from the group
consisting of galactose, glucosamine, N-acetylglucosamine, xylose,
glucuronic acid, rhamnose and glucose.
[0033] A second aspect of the invention relates to a microorganism
cell or a filamentous fungi cell that comprises a gene encoding a
product involved in the biosynthetic pathway leading to a low
molecular weight organic aglycon compound and a heterologous
glycosyltransferase gene encoding a glycosyltransferase capable of
glycosylating the produced aglycon, wherein the cell, when
fermented in a suitable medium, produces the aglycon and the
corresponding glycosylated form of the aglycon, and wherein the
glycosyltransferase is a glycosyltransferase capable of conjugating
a sugar to the aglycon compound, wherein the sugar is a sugar
selected from the group consisting of galactose, glucosamine,
N-acetylglucosamine, xylose, glucuronic acid, rhamnose and
glucose.
[0034] As said above, the basic principle behind the method
described above may be used to produce an aglycon of interest in
higher yields (overproduction of the aglycon of interest).
[0035] Accordingly, a third aspect of the invention relates to a
method of producing a low molecular weight organic aglycon compound
comprising following steps: [0036] a) growing a cell, which
comprises a gene encoding a product involved in the biosynthesis
pathway leading to a low molecular weight organic aglycon compound
and a glycosyltransferase gene encoding a glycosyltransferase
capable of glycosylating the produced aglycon, under suitable
conditions wherein the cell produces the aglycon and the associated
glycosylated form of the aglycon; [0037] b) deglycosylating the
glycosylated form of the aglycon; and [0038] c) recovering the
aglycon compound; [0039] (i) wherein the low molecular weight
organic aglycon compound has a molecular weight from 50 to 3000,
and [0040] (ii) wherein the glycosyltransferase is a
glycosyltransferase capable of conjugating a sugar to the aglycon
compound.
[0041] An advantage of using a glycosyltransferase in a method as
described herein may further be to use the different specificities
of known glycosyltransferases. For instance, it is known that some
glycosyltransferases are enantiomer specific (see e.g. Jones, P et
al, J. of Biological Chemistry (1999), 274:35483-35491 and
WO03/023035). Consequently, if one for instance wants to make a
specific enantiomer for e.g. an aglycon then one could choose to
use such an enantiomer specific glycosyltransferase.
[0042] A fourth aspect of the invention relates to a method for
selecting a cell with increased production of a glycosylated form
of a low molecular weight organic aglycon compound comprising
following steps: [0043] a) growing a cell, which comprises a gene
encoding a product involved in the biosynthesis pathway leading to
a low molecular weight organic aglycon compound and a
glycosyltransferase gene encoding a glycosyltransferase capable of
glycosylating the produced aglycon, under suitable conditions
wherein the cell produces the aglycon and the corresponding
glycosylated form of the aglycon; [0044] b) treating the cell in a
way that changes the expression level of at least one gene involved
in the biosynthesis pathway leading to a low molecular weight
organic aglycon and/or the glycosyltransferase gene capable of
glycosylating the produced aglycon in order to make a library of
cells with different expression levels of the genes; and [0045] c)
selecting a cell that produces a higher amount of the glycosylated
form of the aglycon as compared to the cell of step a); [0046] (i)
wherein the low molecular weight organic aglycon compound has a
molecular weight from 50 to 3000, and [0047] (ii) wherein the
glycosyltransferase is a glycosyltransferase capable of conjugating
a sugar to the aglycon compound.
[0048] Example 8 herein describes how this method is used to make
an Arabidopsis thaliana plant capable of producing increased mg of
the glucoside dhurrin per gram of fresh weight. The starting cell
of step a) is the Arabidopsis thaliana transgenic cell described in
Tattersall, D B et al, Science (2001) 293:1826-8. As explained
above the Arabidopsis thaliana transgenic cell comprises the entire
pathway for synthesis of the cyanogenic glucoside dhurrin. It was
demonstrated that the transgenic Arabidopsis thaliana plant was
capable of producing 4 mg of dhurrin per gram of fresh weight.
After performing the selecting method as described in example 8 an
Arabidopsis thaliana transgenic cell is selected in step c) that
produces more than 6 mg of dhurrin per gram of fresh weight.
[0049] Without being limited to theory, it is believed to be the
first time that a transgenic plant has been provided that is
capable of producing more than 4 mg per gram of fresh weight of a
glycosylated form of a low molecular weight organic aglycon
compound.
[0050] Accordingly, a fifth aspect of the invention relates to a
transgenic plant capable of producing more than 5 mg per gram of
fresh weight of a glycosylated form of a low molecular weight
organic aglycon compound, [0051] (i) wherein the low molecular
weight organic aglycon compound has a molecular weight from 50 to
3000.
DEFINITIONS
[0052] Prior to a discussion of the detailed embodiments of the
invention is provided a definition of specific terms related to the
main aspects of the invention.
[0053] The term "aglycon" denotes non-carbohydrate part of the
corresponding glycosylated form of the aglycon. It may also be
defined as an acceptor compound capable of being conjugated to a
sugar. In a number of relevant examples, the aglycon is an alcohol
with a hydroxy group suitable for being glycosylated. An example of
this is p-hydroxymandelonitrile (see FIG. 1) which has a hydroxy
group that can be conjugated (glycosylated) with glucose to get
dhurrin. (dhurrin is here the corresponding glycosylated form of
the aglyconp-hydroxymandelonitrile). In this example, wherein the
sugar is glucose the aglycon may be termed aglucone. Further, when
the sugar is glucose the term glucosylated may be used instead of
glycosylated.
[0054] An aglycon may also be glycosylated at different group than
a hydroxy group, in particular at other nucleophilic groups such as
a carboxylic acid, SH--, nitrogen, amine, imine or C--C group.
[0055] The term "gene encoding a product involved in the
biosynthesis pathway leading to a low molecular weight aglycon
compound" should be understood according to the art as a gene
encoding a product involved in the biosynthesis pathway leading to
a low molecular weight aglycon compound. The gene encoded product
is normally a polypeptide. However the product may also for
instance be a RNA molecule affecting the expression of a gene. The
encoded product of the gene may be directly involved in the
biosynthesis pathway or indirectly via e.g. other precursors or
intermediated. The important issue, independently of the precise
mechanism behind it, is that the gene makes it possible for the
cell to synthesize the aglycon compound of interest as described
herein. The art describes numerous suitable examples of such genes.
Just for illustration one example could be CYP71E1 from Sorghum
bicolor that starting from p-hydroxyphenylacetonitrile is involved
the biosynthesis pathway leading to a low molecular weight aglycon
compound p-hydroxymandelonitrile (see FIG. 1 herein and Tattersall,
D B et al, Science (2001) 293:1826-8). Further examples are the
genes involved in the biosynthesis pathway leading to a low
molecular weight aglycon compound vanillin as described in working
examples herein.
[0056] The term "glycoside" denotes a compound which on hydrolysis
gives a sugar and a non-sugar (aglycon) residue, e.g. glucosides
give glucose, galactosides give galactose.
[0057] The term "glycosyltransferase" denotes a glycosyltransferase
capable of conjugating a sugar to an aglycon as described herein.
The sugar may e.g. be D and L isomers of galactose, glucosamine,
N-acetylglusamine, xylose, glucuronic acid, rhamnose, arabinose,
mannose or glucose. Alternatively the sugar may be a carbohydrate
derivative such as e.g. inositol, D-olivose, rhodinose and etc
available as nucleotide diphosphates. Further the sugar may for
instance be e.g. a monosaccharide, a disaccharide or a
trisaccharide. In the case of oligo- and polysaccharides the sugars
are linked one by one, by e.g. involving use of one or several
glucosyltransferases. Further, a list of suitable sugars can be
seen in US2003/0130205A1 paragraphs [0029] to [0036]. If the sugar
is glucose the glycosyltransferase may be termed a
glucosyltransferase.
[0058] The term "growing a cell" in relation to step a) of the
third aspect should be understood broadly in the sense of growing a
cell under suitable conditions (temperature, nutrients etc.) that
allows growth of the cell. If the cell is e.g. a plant cell this
means e.g. growth of the plant cell under conditions where e.g. a
mature plant is obtained. If the cell is a microorganism this could
e.g. be fermenting of the microorganism cell in a suitable medium
where the microorganism is capable of growing.
[0059] The term "recovering" in relation to "recovering the
glycosylated form of the aglycon compound" of step b) of the first
aspect of the invention and "recovering the aglycon compound" of
step c) of third aspect of the invention should be understood
broadly in the sense that the compound is recovered from the cell
or from e.g. the supernatant of the medium where the cell for
instance is fermented in order to get the compound in a higher
purity than before the recovery step. The recovery step may include
more or less detailed purification steps. Preferably the compound
is at some point after the recovery step present in a composition
where the composition comprises at least 4% (w/w) of the compound,
more preferably at least 10% (w/w) of the compound, even more
preferably at least 20% (w/w) of the compound and most preferably
at least 50% (w/w) of the compound. The skilled person is aware of
suitable purification protocols (e.g. by using adequate
purification columns) to obtain the desired purity. Preferably
after recovering there is recovered at least 10 mg compound, more
preferably there is recovered at least 1 g compound, even more
preferably there is recovered at least 10 g compound, and most
preferably there is recovered at least 500 g compound. Preferably
there is recovered from 10 mg to 100 kg compound.
[0060] Embodiment(s) of the present invention is described below,
by way of example(s) only
DRAWINGS
[0061] FIG. 1: Shows the pathway for synthesis of the
tyrosine-derived cyanogenic glucoside dhurrin (a secondary
metabolite). The pathway for synthesis included two genes involved
in the biosynthesis pathway (CYP79A1 and CYP71E1) and a
glucosyltransferase (sbHMNGT) capable of glucosylating the last
intermediate (p-hydroxymandelonitrile) to get the glucoside
dhurrin.
DETAILED DESCRIPTION OF THE INVENTION
Cell
[0062] The cell suitable to growth as specified under step a) of
the method of the third aspect of the invention may be any suitable
cell such as any eukaryotic or prokaryotic cell. Preferably the
cell is a cell selected from the group consisting of a plant cell,
a filamentous fungal cell and a microorganism cell.
[0063] As explained above one of the primary advantages of use of
the cell as described herein is that one can use it to get higher
yields (get overproduction) of the glycosylated form of the aglycon
or, after a suitable step of deglycosylating the glycosylated form
of the aglycon, get higher yields (get overproduction) of the
aglycon.
[0064] Accordingly a preferred cell is a cell wherein the cell with
the glycosyltransferase during growing is capable of producing
higher amounts of the glycosylated form of the aglycon as compared
to the amounts of the corresponding aglycon produced by the cell
without the glycosyltransferase.
[0065] When the cell is a microorganism cell this may e.g. be
expressed as, wherein the microorganism cell with the
glycosyltransferase during culture fermentation is capable of
producing higher amounts of the glycosylated form of the aglycon as
compared to the amounts of the corresponding aglycon produced by
the same microorganism cell without the glycosyltransferase.
[0066] Preferably the cell (in particular a microorganism cell)
should, when it comprises the glycosyltransferase, produce at least
1.1 times higher amounts of the glycosylated form of the aglycon as
compared to the amounts of the corresponding aglycon produced by
the same microorganism cell without the glycosyltransferase, more
preferably at least 1.25 times higher amounts of the glycosylated
form of the aglycon, even more preferably at least 1.5 times higher
amounts of the glycosylated form of the aglycon and most preferably
at least 2 times higher amounts of the glycosylated form of the
aglycon.
[0067] A main advantage of the present invention relates to this
overproduction of the glycosylated form of the aglycon and the term
relating to higher production Of the glycosylated form of the
aglycon should therefore be understood in view of this and as
generally understood by the skilled person. Consequently, the
higher amounts of the glycosylated form of the aglycon may be
accumulated within the cell where it can be recovered e.g. after
lysis of the cell. Alternatively, the glycosylated form of the
aglycon may e.g. be secreted from the cell and therefore
accumulates in e.g. the culture media. The latter is particular
relevant when the cell is a microorganism cell.
[0068] Plants which include a plant cell according to the invention
are also provided as are seeds produced by said plants.
[0069] In a preferred embodiment of the invention said plant is
selected from: corn (Zea. mays), canola (Brassica napus, Brassica
rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye
(Secale cerale), sorghum (Sorghum bicolor, Sorghum vulgare),
sunflower (helianthus annuas), wheat (Tritium aestivum and other
species), Triticale, Rye (Secale) soybean (Glycine max), tobacco
(Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis
hypogaea), cotton (Gossypium hirsutum), sweet potato (Impomoea
batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut
(Cocos nucifera), pineapple (Anana comosus), citrus (Citrus spp.)
cocoa (Theobroma cacao), tea (Camellia senensis), banana (Musa
spp.), avacado (Persea americana), fig (Ficus casica), guava
(Psidium guajava), mango (Mangifer indica), olive (Olea europaea),
papaya (Carica papaya), cashew (Anacardium occidentale), macadamia
(Macadamia intergrifolia), almond (Primus amygdalus), apple (Malus
spp), Pear (Pyres spp), plum and cherry tree (Prunus spp), Ribes
(currant etc.), Vitis, Jerusalem artichoke (Helianthemum spp),
non-cereal grasses (Grass family), sugar and fodder beets (Beta
vulgaris), chicory, oats, barley, vegetables, and ornamentals.
[0070] Preferably, plants of the present invention are crop plants
(for example, cereals and pulses, maize, wheat, potatoes, tapioca,
rice, sorghum, millet, cassava, barley, pea, sugar beets, sugar
cane, soybean, oilseed rape, sunflower and other root, tuber or
seed crops. Other important plants maybe fruit trees, crop trees,
forest trees or plants grown for their use as spices or
pharmaceutical products (Mentha spp, clove, Artemesia spp, Thymus
spp, Lavendula spp, Allium spp., Hypericum, Catharanthus spp, Vinca
spp, Papaver spp., Digitalis spp, Rawoffia spp., Vanilla spp.,
Petrusilium spp., Eucalyptus, tea tree, Picea spp, Pinus spp, Abies
spp, Juniperus spp., Horticultural plants to which the present
invention may be applied may include lettuce, endive, and vegetable
brassicas including cabbage, broccoli, and cauliflower, carrots,
and carnations and geraniums.
[0071] The present invention may be applied in tobacco, cucurbits,
carrot, strawberry, sunflower, tomato, pepper, Chrysanthemum.
[0072] Grain plants that provide seeds of interest include oil-seed
plants and leguminous plants. Seeds of interest include grain
seeds, such as corn, wheat, barley, nee, sorghum, rye, etc.
Oil-seed plants include cotton soybean, safflower, sunflower,
Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants
include beans and peas. Beans include guar, locust bean, fenugreek,
soybean, garden beans, cowpea, mungbean, lima bean, fava been,
lentils, chickpea.
[0073] In a further preferred embodiment of the invention said
plant is selected from the following group: maize, rice, wheat,
sugar beet, sugar cane, tobacco, oil seed rape, potato and
soybean.
[0074] The whole genome of Arabidopsis thaliana plant has been
sequenced (Paquette, S. et al, Phytochemistry 62 (2003) 399-413).
Consequently, very detailed knowledge is available for this plant
and it may therefore be a preferred plant cell to work with.
[0075] Accordingly, a very preferred plant cell is an Arabidopsis
cell and in particular an Arabidopsis thaliana cell.
[0076] Filamentous fungi includes all filamentous forms of the
subdivision Eumycota and Oomycota (as defined by Hawksworth et al.,
1995, supra). The filamentous fungi are characterized by a
vegetative mycelium composed of chitin, cellulose, glucan,
chitosan, mannan, and other complex polysaccharides. Vegetative
growth is by hyphal elongation and carbon catabolism is obligately
aerobic. In contrast, vegetative growth by yeasts such as
Saccharomyces cerevisiae is by budding of a unicellular thallus and
carbon catabolism may be fermentative.
[0077] In a more preferred embodiment, the filamentous fungal cell
is a cell of a species of, but not limited to, Acremonium,
Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora,
Penicillium, Thielavia, Tolypodadium, and Trichoderma or a
teleomorph or synonym thereof.
[0078] A preferred microorganism cell suitable to be used in a
method as described herein is a microorganism cell selected from
the group consisting of a yeast cell and prokaryotic cell.
[0079] A preferred yeast cell is a yeast cell selected from the
group consisting of Ascomycetes, Basidiomycetes and fungi
imperfecti. Preferably a yeast cell selected from the group
consisting of Ascomycetes
[0080] Preferred Ascomycetes yeast cell selected from the group
consisting of Ashbya, Botryoascus, Debaryomyces, Hansenula,
Kluveromyces, Lipomyces, Saccharomyces spp e.g. Saccharomyces
cerevisiae, Pichia spp., Schizosaccharomyces, spp.
[0081] A preferred yeast cell is a yeast cell selected from the
group consisting of Saccharomyces spp e.g. Saccharomyces
cerevisiae, and Pichia spp.
[0082] In a method as described herein a very preferred cell is a
prokaryotic cell. A preferred prokaryotic cell is selected from the
group consisting of Bacillus, Streptomyces, Corynebacterium,
Pseudomonas, lactic acid bacteria and in particular an E. coli
cell.
[0083] A preferred Bacillus cell is B. subtilis, B.
amyloliquefaciens or B. licheniformis.
[0084] A preferred Streptomyces cell is S. setonii.
[0085] A preferred Corynebacterium cell is C. glutamicum.
[0086] A preferred Pseudomonas cell is P. putida or P.
fluorescens
[0087] A preferred cell is a cell without active at least some of
the genes encoding a beta-glycosidase that deglycosylates the
glycosylated form of the aglycon compound of interest to be
produced as described herein. Further, it is preferred that the
cell comprises a permease or other transport protein enabling the
cell to release or secrete the glycoside to the medium or to an
internal compartment than the one where it is glycosylated.
[0088] Transformation of suitable DNA containing vectors into the
cells described above is routine work for the skilled person.
Suitable vectors can be constructed, containing appropriate
regulatory sequences, including promoter sequences, terminator
fragments, polyadenylation sequences, enhancer sequences, marker
genes and other sequences as appropriate. For further details see,
for example Sambrook et al. (1989) Molecular cloning: A laboratory
manual, Cold Spring Harbor lab., Cold Spring Harbor, N.Y.; Ausubel,
F. M. et al. (eds.) "Current protocols in Molecular Biology". John
Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.)
"Molecular Biological Methods for Bacillus". John Wiley and Sons,
1990).
[0089] In relation to examples of suitable plant cell vectors and
suitable plant transformation techniques reference is made to
WO02/103022. In relation to filamentous fungi cells reference is
made to EP869167.
[0090] Preferably, the cell is a cell wherein the cell expresses a
heterologous glycosyltransferase gene as described herein, in
particular a microorganism cell or a filamentous fungi cell that
expresses a heterologous glycosyltransferase gene as described
herein.
[0091] In this connection, the term "heterologous
glycosyltransferase gene" should be understood according to the art
as a glycosyltransferase gene that has been introduced into a cell
that, before the introduction, did not express the
glycosyltransferase gene.
[0092] Alternatively, the glycosyltransferase gene may be an
endogenous glycosyltransferase gene naturally produced by the
cell.
Glycosyltransferase:
[0093] As described above, the art describes a number of
glycosyltransferases that can glycosylate a low molecular weight
organic compound of interest such as secondary metabolites from
e.g. plants and fungi. Based on DNA sequence homology of the
sequenced genome of the plant Arabidopsis thaliana it is believed
to contain around 100 different glycosyltransferases. These and
numerous others have been analyzed in Paquette, S. et al,
Phytochemistry 62 (2003) 399-413. FIG. 1 of this article is a
so-called multiorganism tree providing names of numerous suitable
glycosyltransferases.
[0094] WO01/07631, WO01/40491 and (Arend, J. et al., Biotech. &
Bioeng (2001) 78:126-131) describe that at least some of these
glycosyltransferases are capable of glycosylating a number of
different structurally related secondary metabolites and other
structurally related low molecular weight organic compounds.
[0095] Further, numerous suitable sequences of glycosyltransferases
may be found on the Carbohydrate-Active enZYmes (CAZY)
database.
[0096] In the CAZY database, there can de found suitable
glycosyltransferase sequences from virtually all species including,
animal, insects, plant, microorganisms.
[0097] Accordingly, the skilled person has at his disposal a number
of different glycosyltransferases capable of glycosylating numerous
different secondary metabolites and other low molecular weight
organic compounds. This fact is described in further details below
by way of some illustrative specific examples.
[0098] Although glucosyltransferases are generally thought to be
relatively substrate specific it has been shown that other
substrates can be processed at significant levels if they are
presented to the enzyme. It has been shown that expression of the
sorghum CYP79A1 in Arabidopsis resulted in the production of large
amounts p-hydroxybenzylglucosinolate, which is not a naturally
occurring glucosinolate (S-glucoside) of Arabidopsis (Bak et al,
2000, Plant Physiology 123:1437-1448). The new glucosinolate is
produced from p-hydroxyphenylacetaldoxime, which is formed from
tyrosine by CYP79A1 and subsequently channeled into the
pre-existing glucosinolate biosynthetic pathway and to the
associated glucosyltransferases.
[0099] Moreover, a glucosyl transferase, arbutin synthase, isolated
from the medicinal plant Rauvolfia serpentina was shown to have
considerable activity to other substrates than the native
hydroquinone (Arend et al, 2001, Biotechnology and Bioengineering
76:126-131). When some of these substrates, like vanillin or
p-hydroxyacetophenone, were fed to cultures of E. coli that had
been engineered to express the plant glucosyl transferase the
substances were taken up and converted to their corresponding
glucosides, vanillin-.beta.-D-glucoside and picein. These two
products, both of which are of commercial interest, were
subsequently released from the bacteria.
[0100] These examples show that glucosyl transferases can act on
substrates that are normally not present in the metabolic pathway
and that this can lead to the formation of novel glucosides of
natural products.
[0101] As said above the skilled person has at his disposal a
number of different glycosyltransferases capable of glycosylating
numerous different secondary metabolites and other low molecular
weight organic compounds. Further, he may by use of known routine
methods easily identify further suitable glycosyltransferases
capable of glycosylating specific low molecular weight organic
compounds of interest. Below are given some examples of such
suitable methods.
[0102] The numerous known DNA glycosyltransferase sequences may be
used to make appropriate PCR primers to done new
glycosyltransferases. This could e.g. be done by a method
comprising following steps: [0103] (a) preparing a cDNA library
from a cell (e.g. plant tissue cell) expressing
glucosyltransferases, [0104] (b) using relevant known DNA
glycosyltransferase sequences to make appropriate PCR primers to
amplify part of the glucosyltransferase cDNA from the cDNA [0105]
(c) using the DNA obtained in steps (b) as a probe to screen the
DNA library prepared from cell expressing glucosyltransferases, and
[0106] (e) identifying and purifying vector DNA comprising an open
reading frame encoding a glucosyltransferase of interest.
[0107] Alternatively, a suitable glucosyltransferase may be
identified by use of a so-called expression cloning strategy. A
suitable expression cloning strategy could be a method comprising
following steps: [0108] (a) preparing a cDNA library from a cell
(e.g. plant tissue cell) expressing glucosyltransferases; [0109]
(b) introducing the cDNA library into expression cells by use of an
expressing vector that gives expression (transcription and
translation) of the cDNA in a growing expression cell of interest;
[0110] (c) growing the cell in a medium comprising a toxic amount
of a low molecular weight organic aglycon compounds of interest
(i.e. only specific individual cells comprising an expressed
glucosyltransferase capable of glycosylating the aglycon of
interest will be able to grow); [0111] (d) isolating one or more of
the growing cells and identify one that expresses the
glucosyltransferase of interest.
[0112] As described in Moehs, C P et al, Plant Journal (1997)
11:227-236 this expression cloning strategy may be done by use of a
yeast cell. The teaching of the present invention demonstrates that
the glycosylated form of the aglycon is less toxic to bacteria as
compared to the corresponding aglycon as such. Consequently, this
expression cloning strategy may be done by use of bacterial cells
such as E. coli.
[0113] Accordingly, a separate aspect of the invention relates to
expression cloning method for obtaining a glucosyltransferase of
interest comprising following steps:
(a) preparing a cDNA library from a cell (e.g. plant tissue cell)
expressing glucosyltransferases; (b) introducing the cDNA library
into bacterial expression cells by use of an expression vector that
gives expression (transcription and translation) of the cDNA in a
growing expression cell of interest; (c) growing the cell in a
medium comprising a toxic amount of a low molecular weight organic
aglycon compounds of interest (i.e. only specific individual cells
comprising an expressed glucosyltransferase capable of
glycosylating the aglycon of interest will be able to grow); (d)
isolating one or more of the growing cells and identify one that
expresses the glucosyltransferase of interest.
[0114] Preferably, the bacterial expression cells of step (b) are
E. coli cells.
[0115] An advantage of an expression cloning strategy as described
above it that one directly gets a glucosyltransferase capable of
glycosylating the aglycon of interest.
[0116] Preferably, the glycosyltransferase is a capable of
conjugating a sugar to the aglycon compound, wherein the sugar is a
sugar selected from the group consisting of galactose, glucosamine,
N-acetylglucosamine, xylose, glucuronic acid, rhamnose, arabinose,
mannose and glucose.
[0117] In a further preferred embodiment, the glycosyltransferase
is a NDG-glycosyltransferase. Such glycosyltransferases have been
identified in plants, animals, fungi, bacteria and viruses. These
glycosyltransferases are characterized by utilization of
NDP-activated sugar moieties as the donor molecule and contain a
conserved UGT-defining sequence motif near the C-terminus.
[0118] In a more preferred embodiment, the glycosyltransferase is a
UDPG-glycosyltransferase (UGT). UGTs have been identified in
plants, animals, fungi, bacteria and viruses. These
glycosyltransferases are characterized by utilization of
UDP-activated sugar moieties as the donor molecule and contain a
conserved UGT-defining sequence motif near the C-terminus. See
(Paquette, S. et al, Phytochemistry 62 (2003) 399-413) for further
details in relation to the definition of this
UDPG-glycosyltransferase family.
[0119] Preferably, the glycosyltransferase is a glycosyltransferase
that conjugates a monosaccharide or a disaccharide sugar to an
aglycon as described herein. Most preferably glycosyltransferase is
a glycosyltransferase that conjugates a monosaccharide sugar to an
aglycon as described herein.
[0120] In a preferred embodiment, the glycosyltransferase is a
glucosyltransferase.
[0121] Below are described examples of some suitable
glycosyltransferases.
[0122] WO01/40491 describes cloning of a glycosyltransferase from
the plant Sorghum bicolor named sbHMNGT. This and the related
homologous glycosyltransferases as described in WO01/40491 are
capable of glycosylating at least following low molecular weight
organic aglycon compounds (see Table 3 of WO01/40491):
Cyanohydrins
[0123] 1) mandelonitrile p-hydroxymandelonitrile 3) acetone
cyanohydrin benzyl derivatives 4) hydroquinone 5) benzyl alcohol 6)
p-hydroxybenzyl alcohol 7) benzoic acid 8) p-hydroxybenzoic acid 9)
p-hydroxybenzaldehyde 10) gentisic acid 11) caffeic acid 12)
2-hydroxy cinnamic acid 13) resveratrol (stilbene) 14) salicylic
acid 15) p-hydroxymandelic acid 16) vanillic acid 17) vanillin 18)
2-hydroxy methoxybenzylalcohol flavonoids 19) quercetin (flavonol)
20) cyanidin (anthocyanidin) 21) biochanin A (isoflavone) 22)
naringenin (flavanone) 23) apigenin (flavone) hexanol derivatives
24) 1-hexanol 25) trans hexen-1-ol 26) cis hexen-1-ol 27) 3-methyl
hexen-1-ol 28) 3-methyl hexen-1-ol 29) indole acetic acid (plant
hormone) 30) geraniol (monterpenoid) 31) tomatidine (alkaloid) 32)
nerol 33) p-citronellol
[0124] Arend, J et al., Biotech. & Bioeng (2001) 78:126-131
describes cloning of a glycosyltransferase from the plant Rauvolfia
seipentina. It is capable of glycosylating at least following low
molecular weight organic phenolic aglycon compounds (see table
1):
[0125] Hydroquinone, Vanillin, Saligerin, Resorcinol, Thymol,
Phenol, Methylvanillin, p-Hydroxyacetophenone, Vanillic add,
p-Methoxyphenol, 3,4-Dimethoxyphenol, Coniferyl alcohol, o-Coumaric
Acid, p-Coumaric Acid.
[0126] WO01/59140 describes a glycosyltransferase from the plant
Arabidopsis thaliana. It is capable of glycosylating at least
following low molecular weight organic aglycon compounds: caffeic
acid, luteolin, quercitin-, catechin1-, syadinin.
[0127] WO02/103022 describes a glycosyltransferase from the plant
Arabidopsis thaliana. It is capable of glycosylating at least
following low molecular weight organic aglycon compounds: Benzoate
substrates, in particular p-hydroxybenzoic acid.
[0128] WO03/02035: describes a glycosyltransferase from the plant
Arabidopsis thaliana. It is capable of glycosylating at least
following low molecular weight organic aglycon phytohormone
compound: Abscisic acid.
[0129] Below are described suitable assays to measure the activity
of a glycosyltransferase of interest. 15 The assays are described
for a glucosyltransferase. However when sugar is not glucose, one
just has to use the adequate sugar (e.g. galactose) in stead of the
glucose.
[0130] The ability of a glucosyltransferase to conjugate an aglycon
of interest to glucose can for example be determined in an assay
comprising the following steps.
a) Incubation of a reaction mixture comprising
.sup.14C_UPD-glucose, aglycon and
UDPglucose:aglycon-glucosyltransferase at 30.degree. C. between 2
minutes and 2 hours b) terminating the reaction, and c) chemical
identification and quantification of the glucoside produced.
[0131] Typically the reaction mixture has a volume of 5 to 2000
.mu.l but preferably 20 .mu.l and includes 10-200 mM TrisHCI (pH
7.9); .mu.M .sup.144C-UDP-glucose (about 11.0 GBq mmol-1); 0-300
.mu.M UDP-glucose; 0-20 mM aglycone; 25 mM .gamma.-gluconolactone;
0-2 .mu.g/.mu.l BSA and 0-10 ng/.mu.l
UDP-glucose:aglycon-glucosyltransferase. .beta. glucosidase
inhibitors other than y-.gamma.-gluconolactone and protein
stabilizers other than BSA may be included as appropriate. One
possibility to terminate the reaction is to acidify the reaction
mixture for example by adding 1/10 volume of 10% acetic acid.
[0132] Chemical identification and quantification of the glucoside
formed in the reaction mixture may be achieved using a variety of
methodologies including NHR spectroscopy, TLC analysis, HPLC
analyses or GLC analysis in proper combinations with mass
spectrometric analysis of the glucoside.
[0133] Reaction mixtures for analysis by NIVIR. spectroscopy
usually have a total volume of 0.5-1 ml, are incubated for 2 hours
and include 0-10 mM aglycon, e.g. 2 mM p-hydroxy-mandelonitrile or
6.5 mM geraniol, 3 mM UDP-glucose, 2.5 .mu.g gluceryltransferease,
and 0.5 mg BSA. Glucosides are extracted for example with ethyl
acetate and lyophillized prior to NMR analysis.
[0134] For TLC analysis the reaction mixtures are applied to Silica
Gel 60 F254 plates (Merck), dried and eluted in a solvent such as
ethyl acetate:acetone:dichloromethane:methanol H.sub.2O
(40:30:12:10:8, v/v). Plates are dried for one hour at room
temperature and exposed to storage phosphor imaging plates prior to
scanning on a PhosphorImager. Based on the specific radioactivity
of the radiolabelled UDIP-glucose, the amount of glucoside formed
is quantified. The radioactivity may also be determined by liquid
scintillation counting (LSC analysis). In some cases, where the
glucoside formed is derived from a very hydrophobic aglycon, e.g.
mandelonitrile, the glucoside can be extracted into an ethyl
acetate phase and thereby be separated from unincorporated
.sup.14C-UDP-glucose. 2 ml of scintillation cocktail are added to
250 IA of each ethyl acetate extract and analyzed using a liquid
scintillation counter. During column fractionation, those fractions
containing gluceryltransferase activity can be identified using the
aglycon substrate of interest and ethyl acetate extraction of the
glucoside formed.
[0135] A glycosyltransferase gene as described herein may be
introduced into a cell in order to make a cell wherein the cell
expresses a heterologous glycosyltransferase gene as described
herein, in particular a microorganism cell or a filamentous fungi
cell that expresses a heterologous glycosyltransferase gene as
described herein.
[0136] Alternatively, the glycosyltransferase gene may be an
endogenous glycosyltransferase gene 30 naturally produced by the
cell.
[0137] In addition genes giving raise to increased expression of
the glycosyltransferase or increased yield of the glycoside may be
introduced, such genes may encode regulatory proteins, protease
inhibitors, repressors of protease gene, genes increasing the level
or precursors, especially the relevant NDP-sugars, genes involved
in NDP-metabolism, permeases and other transporters, genes reducing
the metabolism of the aglycone etc.
A Gene Involved in the Biosynthesis Pathway
[0138] As said above, the term a "gene encoding a product involved
in the biosynthesis pathway leading to a low molecular weight
aglycon compound" should be understood according to the art as a
gene encoding a product involved in the biosynthesis pathway
leading to a low molecular weight aglycon compound.
[0139] The art describes numerous suitable examples of such genes
and the numbers are exponentially increasing since a number of
whole genomes of different plant and microorganisms are
continuously published.
[0140] Reference may for example be made to the textbook
"Biochemistry & Molecular Biology of Plants", edited by Bob B.
Buchanan et al, ISBN 0-943088-37-2. Chapter 24: "Natural Product
(Secondary Metabolites)" describes examples of a number of
different suitable genes involved in the biosynthesis pathway
leading to a low molecular weight aglycon compound.
[0141] Just for illustration one example could be CYP71E1 from
Sorghum bicolor that starting from p-hydroxyphenylacetonitrile is
involved the biosynthesis pathway leading to a low molecular weight
aglycon compound p-hydroxymandelonitrile (see FIG. 1 and
Tattersall, D B et al, Science (2001) 293:1826-8).
[0142] Further examples are the genes involved in the biosynthesis
pathway leading to a low molecular weight aglycon compound vanillin
as described in working examples herein. Even further examples are
given in Szczebara et al., Nature Biotechnology (2003), 21:143-149.
This article describes a recombinant yeast cell capable of
producing hydrocortisone from a simple carbon source. The yeast
cell comprised eight recombinantly introduced genes involved in the
biosynthesis pathway.
[0143] As said above the skilled person has at his disposal a
number of different biosynthesis pathway genes. Further, he may by
use of known routine methods easily identify further suitable
biosynthesis pathway genes. For instance, the numerous biosynthesis
pathway gene sequences may be used to make appropriate PCR primers
to done new suitable biosynthesis pathway genes. This could e.g. be
done by a method comprising following steps:
(a) preparing a cDNA library from a cell (e.g. plant tissue cell)
expressing biosynthesis pathway genes of interest, (b) using
relevant known biosynthesis pathway gene sequences to make
appropriate PCR primers at to amplify part of the biosynthesis
pathway gene encoding cDNA from the cDNA library, (c) using the DNA
obtained in steps (b) as a probe to screen the DNA library prepared
from cell expressing the biosynthesis pathway genes of interest,
and (e) identifying and purifying vector DNA comprising an open
reading frame encoding a biosynthesis pathway gene of interest.
[0144] As explained above a cell used in a method as described
herein comprises a gene encoding a product involved in the
biosynthesis pathway. The cell may comprise more than one gene
encoding a product involved in the biosynthesis pathway.
[0145] A suitable example is the transgenic Arabidopsis thaliana
cell described in Tattersall, D B et al, Science (2001) 293:1826-8.
It comprises the two biosynthesis pathway genes CYP79A1 and CYP71E1
and can therefore make aglycon compound p-hydroxymandelonitrile
from tyrosine (see FIG. 1 herein).
[0146] A further example is the E coil cell described in working
examples herein that comprises sufficient biosynthesis pathway
genes to make the aglycon vanillin from glucose.
[0147] A gene encoding a product involved in the biosynthesis
pathway as described herein may be introduced into a cell in order
to make a cell wherein the cell expresses a heterologous gene
encoding a product involved in the biosynthesis pathway as
described herein, in particular a microorganism cell or a
filamentous fungi cell that expresses a heterologous gene encoding
a product involved in the biosynthesis pathway as described
herein.
[0148] Alternatively, the gene encoding a product involved in the
biosynthesis pathway may be an endogenous gene naturally produced
by the cell.
Low Molecular Weight Organic Aglycon Compound
[0149] As said above, the low molecular weight organic aglycon
compound, as described herein, has a molecular weight from 50 to
3000. Preferably, the low molecular weight organic aglycon compound
has a molecular weight from 50 to 2000, more preferably a molecular
weight from 50 to 1000, and even more preferably a molecular weight
from 50 to 750. The molecular weight is the mass of one molecule in
atomic mass units.
[0150] Further, the low molecular weight organic aglycon compound
is preferably a compound selected from the group consisting of more
or less saturated Alkyl-, Cycloalkyl-, Cycloalkylalkyl-, Arallyl-
and Aryl, with 1 to 50 C-atoms and 0 to 20 heteroatoms and
optionally substituted, in particular with Hydroxy-, Amino-,
Sulfide-, Carboxy-, or Nitro groups, at the 1 to 56 C-atoms and/or
0 to 20 Heteroatoms; more preferably a compound selected from the
group consisting of more or less saturated Alkyl-, Cycloalkyl-,
Cycloalkylalkyl-, Arallyl- and Aryl, with 1 to 32 C-atoms and 0 to
10 heteroatoms and optionally substituted, in particular with
Hydroxy-, Amino-, Sulfide-, Carboxy-, or Nitro groups, at the 1 to
32 C-atoms and/or 0 to 10 Heteroatoms.
[0151] In a preferred embodiment, the low molecular weight organic
aglycon compound is an alcohol, in particular an aromatic alcohol.
An alcohol should herein be understood in relation to the technical
objective of glycosylating the aglycon. Accordingly an aglycon
defined as an alcohol is herein a compound that contains a
hydroxyl- (--OH) functional group that can be glycosylated by use
of a glycosyltransferase as described herein. A non limiting
example of a preferred aglycon compound which is an aromatic
alcohol is vanillin or p-hydroxymandelonitrile.
[0152] Alcohols also include e.g. some ketones, aldehydes and other
compounds being in equilibrium with an alcohol, e.g. enols,
furanosider, pyranosider, lactames and lactones etc.
[0153] In line of above, a preferred organic aglycon compound is an
organic aglycon compound that comprises a compound that contains
Hydroxy-, Amino-, Imino-, Thiol-Sulfite, Sulfate, Phosphate or
Phosphonate or Carboxy functional group that can be glycosylated by
use of a glycosyltransferase as described herein. It may also be
corresponding boron and selenium groups and compounds containing
group being in equilibrium with the mentioned groups. Aglycons that
comprises a hydroxyl-group is discussed immediately above.
[0154] In a preferred embodiment the organic aglycon compound is an
organic aglycon compound that comprises a compound that contains a
carboxy functional group that can be glycosylated by use of a
glycosyltransferase as described herein to form an ester glycoside.
A non limiting example of such aglycon compounds is vanillic acid
or p-hydroxybenzoic acid.
[0155] In a preferred embodiment the low molecular weight organic
aglycon compound is a pharmaceutical compound or a chemical
intermediate of a pharmaceutical compound. A suitable
pharmaceutical compound may be pharmaceutical compound produced
naturally in an animal, a plant, a filamentous fungi or a
microorganism.
[0156] A preferred pharmaceutical compound is a pharmaceutical
compound selected from the list consisting of budesonide,
raloxifine, tamoxifine, dopamine, steroids.
[0157] Further a description of suitable preferred pharmaceutical
compounds can be found in US2003/0130205A1 and
US2003/0119761A1.
[0158] In a preferred embodiment the low molecular weight organic
aglycon compound is an aglycon compound selected from the list
consisting of vitamin, amino acids, fatty acids, oligopeptide,
oligosaccharide, oligonucleotide, PNA, LNA, and functional
equivalents thereof. For this group of aglycon compounds the size
of the compounds may have a bigger molecular weight than 3000.
Plants may be seen as the organic chemists per excellence in
nature. More than 200.000 different natural products are known from
plants. These enable plants to deter herbivores and pests, attract
pollinators, communicate with other plants and constantly adapt to
climatic changes. As explained before the majority of these
compounds may be termed secondary metabolites.
[0159] The term "secondary metabolite" relates to that plants and
microbes synthesize a large number of natural substances, in
particular secondary metabolites, with diverse and generally
unclear function. In contrast to the primary metabolites (eg amino
acids, sugars, fatty acids), which are involved in fundamental
functions like metabolism, growth, maintenance and survival,
secondary metabolites are not required for fundamental functions.
The term secondary metabolite should herein be understood in view
of such, according to the art, standard description of the term. In
a preferred embodiment the low molecular weight organic aglycon
compound is a secondary metabolite compound, preferably a plant
secondary metabolite compound.
[0160] Examples of preferred secondary metabolite compound classes
are: [0161] Terpenoids [0162] Alkaloids [0163] Phenylpropanoids
[0164] Phenyl derivatives [0165] Hexanol derivatives [0166]
Flavonoids [0167] Coumarins, stilbenes [0168] Cyanohydrins [0169]
Glucosinolates [0170] Sterols [0171] Saponin aglycones [0172]
Steroids [0173] Hormones [0174] Antibiotics [0175] and
Herbicides.
[0176] Of the list above, the more preferred secondary metabolite
compound classes are: [0177] Terpenoids [0178] Alkaloids [0179]
Phenylpropanoids [0180] Phenyl derivatives [0181] Hexanol
derivatives [0182] Flavonoids [0183] Coumarins, stilbenes [0184]
Cyanohydrins [0185] and Glucosinolates.
[0186] Examples of preferred individual low molecular weight
organic aglycon compounds is a compound selected from the list
consisting of:
[0187] mandelonitrile, p-hydroxymandelonitrile, acetone
cyanohydrin, hydroquinone, benzyl alcohol, p-hydroxybenzyl alcohol,
benzoic acid, p-hydroxybenzoic acid, p-hydroxybenzaldehyde,
gentisic acid, caffeic acid, 2-hydroxy cinnamic acid, resveratrol
(stilbene), salicylic acid, p-hydroxymandelic acid, vanillic acid,
vanillin, 2-hydroxy methoxybenzylalcohol, quercetin, cyanidin
(anthocyanidin), biochanin A (isoflavone), =ingrain (flavanone),
apigenin (flavone), 1-hexanol, trans hexen-1-ol, cis hexen-1-ol,
3-methyl hexen-1-ol, 3-methyl hexen-1-ol, indole acetic acid (plant
hormone), geraniol (monoterpenoid), tomatidine (alkaloid), neral,
p-citronellol, saligerin, resorcinol, thymol, phenol,
methylvanillin, p-hydroxyacetophenone, p-methoxyphenol,
3,4-dimethoxyphenol, coniferyl alcohol, o-coumaric acid, p-coumaric
acid, caffeic acid, luteolin, quercitin-, catechin1-, cyadinin,
p-hydroxybenzoic acid, abscisic acid (phytohormone),
2,4,5-trichlorophenol (TCP), pentachlorophenol, 4-nitrophenol,
3,5-dibromo4-hydrobenzoic acid, tetracycline, protocatechuic acid,
2-phenylethanol and 2,2-bis-(4-chlorophenyl)-acetic acid.
Growing a Cell
[0188] In a method as described herein, the cell should be grown
under conditions where it produces the aglycon and the
corresponding glycosylated form of the aglycon. An important point
in relation to the growth of the cell is that adequate intermediate
compounds must be available to the cell. This means for example
that if the cell is e.g. an E. coli cell comprising adequate genes
involved in the biosynthesis pathway leading e.g. to the aglycon
compound vanillin from e.g. glucose, then the E. coli cell should
be fermented under conditions where glucose is available to the
cell.
[0189] If the cell is e.g. a plant cell comprising adequate genes
involved in the biosynthesis pathway leading to the aglycon
compound from e.g. tyrosine then the plant cell should be grown
under conditions where suitable amount of tyrosine is present to
the growing plant.
[0190] The skilled person knows how to grow a specific cell of
interest to ensure this.
A Method of Producing a Low Molecular Weight Organic Aglycon
Compound
[0191] As described above the third aspect of the invention relates
to a method of producing a low molecular weight organic aglycon
compound comprising following steps: [0192] a) growing a cell,
which comprises a gene encoding a product involved in the
biosynthesis pathway leading to a low molecular weight organic
aglycon compound and a glycosyltransferase gene encoding a
glycosyltransferase capable of glycosylating the produced aglycon,
under suitable conditions wherein the cell produces the aglycon and
the associated glycosylated form of the aglycon; [0193] b)
deglycosylating the glycosylated form of the aglycon; and [0194] c)
recovering the aglycon compound; [0195] (i) wherein the low
molecular weight organic aglycon compound has a molecular weight
from 50 to 3000, and [0196] (ii) wherein the glycosyltransferase is
a glycosyltransferase capable of conjugating a sugar to the aglycon
compound.
[0197] All embodiments above are also embodiments of this third
aspect. An essential step of this method is the deglycosylating
step b). This step is further described below, where some
non-limiting examples are included to illustrate a number of
technical advantages in relation to this deglycosylating step.
Though glucosides are often desirable natural products and attempts
to use transgenic glucosyl transferases to produce them have been
taken (e.g. Arend et al, 2001, Biotechnology and Bioengineering 76:
126-131) the corresponding aglucone can be more commercially
interesting. One example is vanillin, a natural flavour of
significant commercial interest. Vanillin is a phenolic compound
that accumulates in the fruits of the orchid Vanilla sp. in a
glucosylated form, gluco-vanillin. In order to obtain the desired
natural flavour, gluco-vanillin must be deglucosylated.
[0198] This is achieved by fermentation (curing) of the fruits,
so-called vanilla beans, whereby endogenous beta-glucosidases are
activated.
[0199] In the step b) of the method of the third aspect of the
invention, the glycosylated intermediate of the desired natural
product is subjected to a deglycosylating step. This may be done by
chemical hydrolysis according to known methods in the art or
enzymatically by e.g. use an enzyme with beta-glycosidase activity.
Numerous suitable beta-glycosidases are known to the skilled
person. This can e.g. be achieved first by recovering glycosylated
form of the aglycon for instance by extracting the glucosylated
intermediate in a suitable solvent, e.g. methanol, or by collecting
it after excretion from the producing organism or plant. Secondly,
the glucosylated intermediate is purified and exposed to a
beta-glucosidase in vitro or to an adequate chemical
hydrolysis.
[0200] Alternatively, the stabilized glucosylated intermediate can
be let alone in the plant and be allowed to accumulate in cellular
compartments or tissues where it is protected from endogenous
beta-glucosidase activity. In such a protected spatial environment
the glucosylated intermediate is no longer exposed to enzymatic
activity that could further metabolize its deglucosylated
equivalent.
[0201] The glycoside may also be modified e.g. by acetylation or
other modifications and in that way be protected from glycosidases.
It could, however, also be protected in time, if the desired
natural product was kept in its glucosylated form until
developmental changes in the plant had led to a significant
decrease in the activity of the enzymes that could otherwise
metabolize its deglucosylated form.
[0202] It is preferred for the present invention that glycosylation
of the desired aglycon is uncoupled from its subsequent
deglycosylation, since the aglycon would otherwise be subject to
further metabolic processing. As indicated above, this uncoupling
can be either in time or space. Preferably it is in space.
[0203] In the final step c) of the method of the third aspect of
invention, the desired aglycon is recovered.
[0204] The present method will address at least three problems
related to biotechnological production of organic molecules. First,
it will allow for increased production of organic molecules that
are stable and constitute the final product of the respective
biosynthetic pathway of the production organism. Second, it will
allow for increased yield of organic molecules that are not the end
product of the respective biosynthetic pathway and are consequently
further metabolized by the production organism Third, it will allow
for increased production of organic molecules that are toxic to the
production organism.
[0205] Regarding toxicity is show in examples 1 and 2 that the
presence of a heterologous UDPG-glucosyltransferase in a
microorganism can increase its tolerance to vanillin through
glucosylation. This principle is evidently not limited to vanillin
but can be applied to any toxic substance that can be converted
into a less toxic glucoside by the heterologous
UDPG-glucosyltransferase, including e.g. taxol.
[0206] This approach can be helpful in increasing tolerance to a
desired organic molecule, which is the end product of its
biosynthetic pathway and is therefore accumulated in the production
organism to concentrations that might be limiting production.
However, the approach might also address detoxification of
substances that are structurally or biosynthetically unrelated to
the desired molecule. Such substances could be byproducts of the
desired biosynthetic pathway or contaminants in the growth
medium.
[0207] In the industrial fermentation of ethanol from
lignocellulose, vanillin has been reported to be one of the
strongest inhibitors among the hydrolysis byproducts (Delgenes et
al, 1996, Enzyme Microb Technol, 19: 220) and it acts as a strong
growth inhibitor at concentrations of 5 el in the medium (Pfeifer
et al, 1984, Biotechnol Lett 6: 541). Accordingly, fermentation of
lignocellulose using microorganisms expressing a heterologous
UDPG-glucosyltransferase might not only increase the yield of
ethanol but could potentially also lead to a means for parallel
production of commercially valuable vanillin after recovery and
deglucosylation of non-toxic vanillin glucoside.
[0208] The method as described herein are of direct importance to
biotechnological production of several organic molecules, since it
can increase yield of organic molecules that are stable and
constitute the final product of the respective biosynthetic pathway
of the production organism. The feasibility of this approach is
shown in examples 3 and 4 using production of vanillin in a
microbial system as an example. However, it is obvious for those
skilled in the art that this principle is not limited to production
of vanillin from ferulic acid, but can be applied in virtually any
biosynthetic pathway where the desired organic molecule is the end
product and opposes at least some inhibition to production.
[0209] When the desired organic molecule is the end product of its
biosynthetic pathway it will itself in many cases be a limiting
factor in the rate of production. This is due to product inhibition
of enzymes in the biosynthetic pathway and thus leads to reduced
production rate. Instead of achieving high levels of the desired
end product, an intermediate product might build up and either
accumulate or be directed into other metabolic pathways and
consequently become lost for the desired biosynthetic pathway.
[0210] The method will overcome this product inhibition by adding
an additional step to the biosynthetic pathway, so the inhibiting
product is removed and thereby is no longer able to inhibit the
enzyme. When biosynthesis is no longer suppressed by product
inhibition the turnover of the initial substrates and their
conversion into first the desired product and subsequently into its
glucosylated derivative will substantially increase. According to
the method, the glucosylated derivative is then extracted and
converted back into the desired aglucone by e.g. beta-glucosidase
activity.
[0211] The desired organic molecule might, however, not always be
the end product of its biosynthetic pathway in the production
organism. In such cases, it is further metabolized and might
eventually be lost for commercial recovery. In examples 5 and 6 is
demonstrated how the method can be applied to rescue such
intermediates. In the examples, an aldehyde oxime is rescued by
glucosylation of a heterologous UDPG-glucosyltransferase, but it is
evident for those skilled in the art that the principle is general
and can be used for any intermediate product of desire that can be
glucosylated. The examples address a molecule of desire, the oxime
aldehyde, which is not naturally produced in the production
organism, but in other examples the organic molecule of desire
might as well be a substance that is produced naturally.
[0212] The sorghum cytochrome P450 enzyme complex CYP79 catalyses
the conversion of the amino acid tyrosine into an aldehyde oxime,
p-hydroxyphenylacetaldoxime (Bak et al, 2000, Plant Physiol 123:
1437). Attempts to transfer the sorghum CYP79 gene to other plants
or microorganisms leads to very low production of the oxime, since
it is toxic and is being further metabolised to at least two
presently unidentified substances, X and Y, that might be nitrile
and alcohol derivates (Halkier al, 1995, Arch Biochem Biophys 322:
369; Bak et al, 2000, Plant Physiol 123: 1437). In plants, e.g.
tobacco and Arabidopsis, the oxime is also glucosylated into
p-hydroxyphenyl-(acetaldoxime glucoside) by an oxime specific
UDPG-glucosyl transferase.
[0213] It is a general principle of the method that a glucosylated
form of the desired organic molecule becomes the final product
produced in the production organism. In addition to the advantages
this principle can have in yield, it might also posses some
benefits during purification or extraction of the desired organic
molecule. This is demonstrated in example 7, where it is exploited
that the solubility of the desired molecule changes after
glucosylation.
[0214] This principle can be useful if the desired molecule is
difficult to separate from other substances present in the
production organism or the growth medium. The glucosylated form
could e.g. be exported to another compartment than the
contaminating molecule, thereby facilitating purification.
Alternatively, it could be excreted to the growth medium, whereas
the contaminating molecule is left alone within the organism.
Moreover, the purification process could utilize that the
glucosylated form of the desired molecule has novel chemical
properties, including not only solubility but also chromatographic
properties etc.
Method to Selecting Transgenic Organisms with Increased
Biosynthesis Flow
[0215] In example 6, is shown an example of how the method of the
third aspect of the invention can be utilized to establish
commercial production of p-hydroxyphenylacetaldoxime in
microorganisms. This is achieved by transferring both the sorghum
CYP79 gene and the oxime specific UDPG-glucosyltransferase (see
FIG. 1) into the microorganism. This results in the production of
p-hydroxyphenyl-(acetaldwdme glucoside), which is stable and
non-toxic. Moreover, this glucoside can be extracted and converted
into the desired p-hydroxyphenylacetaldoxime by e.g. in vitro
beta-glucosidase activity.
[0216] Using this approach, the method not only makes the
production of the desired molecule, the oxime, possible. It also
allows for the selection of transgenic microorganisms with high
expression levels of the sorghum CYP79 in a very active form, since
the toxic product of the enzyme is readily detoxified by
glucosylation. If the oxime specific UDPG-glucosyl transferase was
not present, natural selection would favor microorganisms harboring
the CYP79 gene in a low expressing state and in a mutated form with
less activity.
[0217] The example discussed above, illustrates how the method can
be utilized to obtain, through selection, more efficient production
organisms. This principle is not restricted to the example above,
but will obviously apply for many other biosynthetic pathways and
production organisms.
[0218] Accordingly, as said above a fourth aspect of the invention
relates to a method for selecting a cell with increased production
of a glycosylated form of a low molecular weight organic aglycon
compound comprising following steps: [0219] a) growing a cell,
which comprises a gene encoding a product involved in the
biosynthesis pathway leading to a low molecular weight organic
aglycon compound and a glycosyltransferase gene encoding a
glycosyltransferase capable of glycosylating the produced aglycon,
under suitable conditions wherein the cell produces the aglycon and
the corresponding glycosylated form of the aglycon; [0220] b)
treating the cell in a way that changes the expression level of at
least one gene involved in the biosynthesis pathway leading to a
low molecular weight organic aglycon and/or the glycosyltransferase
gene capable of glycosylating the produced aglycon in order to make
a library of cells with different expression levels of the genes;
and [0221] c) selecting a cell that produces a higher amount of the
glycosylated form of the aglycon as compared to the cell of step
a); [0222] (i) wherein the low molecular weight organic aglycon
compound has a molecular weight from 50 to 3000, and [0223] (ii)
wherein the glycosyltransferase is a glycosyltransferase capable of
conjugating a sugar to the aglycon compound.
[0224] The term "library of cells" may herein also be termed
"population of cells". The library of cells may comprise as little
as two different cells.
[0225] The term "different expression levels of the genes" may be a
library comprising individual cells with both increased or
decreased expression levels of the genes. Preferably, the library
mainly comprises individual cells with increased expression levels
of the genes.
[0226] Wherein the cell is within a plant the library will comprise
a library of different plants. Preferably the library comprises
10.sup.2 plants, more preferably 10.sup.3 plants, even more
preferably 10.sup.5 plants, even more preferably 10.sup.6
plants.
[0227] When the cell is a microorganism the library may normally
easily be made relatively bigger. Consequently, when the cell is a
microorganism the library comprises 10.sup.5 cells, more preferably
10.sup.7 cells, even more preferably 10.sup.8 cells, even more
preferably 10.sup.9 cells.
[0228] The selected cell of this method may be a preferred cell to
use in a method of producing a low molecular weight organic
compound of the first aspect of the invention or a method of
producing a low molecular weight organic aglycon compound of the
third aspect of the inventions or in relation to the different
embodiments of these methods to make a low molecular weight organic
compound.
[0229] Accordingly, an embodiment of the invention relates to a
method where there is first selected a cell as described in the
fourth aspect above and thereafter this cell is used in a method of
producing a low molecular weight organic compound of the first
aspect of the invention or a method of producing a low molecular
weight organic aglycon compound of the third aspect of the
inventions or in relation to the different embodiments of these
methods to make a low molecular weight organic compound.
[0230] The treating of the cell step b) above may be done by
numerous different strategies known to the skilled person. Examples
are mutagenesis such as UV treatment, adequate chemical treatment
to make DNA mutations, random mutagenesis of e.g. specific
promoters of the relevant genes, shuffling of cells to make a
library of shuffled cells and etc.
[0231] The selected cell of step c) should preferably produce 1.25
times higher amounts of the glycosylated form of the aglycon as
compared to the cell of step a), more preferably the selected cell
of step c) should preferably produce 1.5 times higher amounts of
the glycosylated form of the aglycon as compared to the cell of
step a), even more preferably the selected cell of step c) should
preferably produce 2 times higher amounts of the glycosylated form
of the aglycon as compared to the cell of step a), and most
preferably the selected cell of step c) should preferably produce 3
times higher amounts of the glycosylated form of the aglycon as
compared to the cell of step a).
[0232] The selecting may be done in a number of ways according to
the art. For instance in a micro titer assay where each well
comprises a sample of a specific cell and there is measured amounts
of the glycosylated form of the aglycon. There are numerous other
ways of doing this according to the general knowledge of the
skilled person.
[0233] Example 8 describes how this method is used to make an
Arabidopsis thaliana plant capable of producing increased mg of
dhurrin per gram of fresh weight. The starting cell of step a) is
the Arabidopsis thaliana transgenic cell described in Tattersall, D
B et al, Science (2001) 293:18268. As explained above the
Arabidopsis thaliana transgenic cell comprises the entire pathway
for synthesis of the cyanogenic glucoside dhurrin. It was
demonstrated that the transgenic Arabidopsis thaliana plant was
capable of producing 4 mg of dhurrin per gram of fresh weight.
After performing the method as described in example 8 an
Arabidopsis thaliana transgenic cell is selected in step c) that
produces more than 6 mg of dhurrin per gram of fresh weight.
[0234] Without being limited to theory, it is believed to be the
first time that a plant has been provided that is capable of
producing more than 4 mg per gram of fresh weight of a glycosylated
form of a low molecular weight organic aglycon compound.
[0235] Accordingly, as said above a fifth aspect of the invention
relates to a plant capable of producing more than 5 mg per gram of
fresh weight of a glycosylated form of a low molecular weight
organic aglycon compound, [0236] (i) wherein the low molecular
weight organic aglycon compound has a molecular weight from 50 to
3000.
[0237] Preferably, the plant is capable of producing more than 6 mg
per gram of fresh weight of a glycosylated form of a low molecular
weight organic aglycon compound, more preferably the plant is
capable of producing more than 8 mg per gram of fresh weight of a
glycosylated form of a low molecular weight organic aglycon
compound. Preferably, the plant produces from 5 mg to 40 mg per
gram of fresh weight of a glycosylated form of a low molecular
weight organic aglycon compound.
[0238] Preferably, the plant is a transgenic plant.
EXAMPLES
General Molecular Biology Methods
[0239] Unless otherwise mentioned the DNA manipulations and
transformations were performed using standard methods of molecular
biology (Sambrook et al. (1989) Molecular cloning A laboratory
manual, Cold Spring Harbor lab., Cold Spring Harbor, N.Y.; Ausubel,
F. M. et al. (eds.) "Current protocols in Molecular Biology". John
Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.)
"Molecular Biological Methods for Bacillus". John Wiley and Sons,
1990). Enzymes for DNA manipulations were used according to the
specifications of the suppliers.
Example 1
Analysis of Increased Tolerance to Vanillin in Microorganisms
Expressing a UDPG-Glucosyl Transferase
[0240] Vanillin sensitivity is determined in a number of
microorganisms. The microorganisms includes the Escherichia coli
strains DH5-alpha, TOP10, JM109 and KO1418; the Pseudomonas
fluorescens strains DSM 50091, DSM 50108 and DSM 50124; the
Bacillus subtilis strain DSM 704; and the Corynebacterium
glutamicum strain DSM 20300. The microorganisms also include
strains of Saccharomyces cervisiae, S. uvarum, S. bayanus, S.
paradoxus, S. kudriavzevii, S. mikatae, S. cadocanus, S. seivazzii,
S. castellii, S. kluyverii, Kluyveromyces lactis, Zygosaccharomyces
fermentatii, Torulaspora delbruekii Debaromyces odentalis and
Schizosaccharomyces pombe.
[0241] The minimum inhibitory concentration of vanillin is
determined by the two-fold serial dilution assay (Hufford et al,
1975, J Pharm Sci 4: 789). Furthermore, the concentration of
vanillin necessary to inhibit growth by more than 50% is
determined. Once the sensitivity of vanillin has been determined in
the various bacterial and yeast strains a few of these are selected
in order to obtain microbial strains displaying a broad range of
vanillin sensitivity.
[0242] The selected strains are transformed with a UDPG-glucosyl
transferase gene, e.g. Sorghum bicolor UDPG-glucosyl transferase
UGT85B1 (Jones et al, 1999, J Biol Chem 274: 35483), Arabidopsis
thaliana UDPG-glucosyl transferase UGT89B1 (Lim et al, 2002, J Biol
Chem 277: 586) and Rauvolfia serpentina arbutin synthase (Arend et
al, 2001, Biotechnol Bioeng 76:126).
[0243] For expression of UDPG-glucosyl transferase in E. coli, the
IPTG-inducible expression vectors pSP19g1OL, pKK223-3 and
pET101D/Topo are employed. In addition, the newly constructed E.
coli expression vectors using constitutive E. coli glycolytic gene
promoters are used. For expression in P. fluorescens, the BHR
expression vector pYanni3 are used. For expression of UDPG-glucosyl
transferase in yeast, the genes are PCR amplified and inserted into
plasmid pJH259, in which the genes are expressed from the
constitutive and strong glycolytic TPI1 promoter. Alternatively,
the TPI1 promoter is exchanged with a PCR-amplified MET25 promoter,
which is repressible by methionine.
[0244] The UDPG-glucosyl transferase expressing microorganisms are
subjected to analysis of their sensitivity to vanillin in the
growth medium as described above. An increased tolerance to
vanillin, determined as an increase in either the minimum
inhibitory concentration or the concentration necessary to inhibit
growth by more than 50%, means that transgenic UDPG glucosyl
transferase activity has converted some or most of the applied
vanillin into vanillin glucoside, which is considerably less
toxic.
Example 2
Identification of Glucosides in Microorganisms Expressing a
UDPG-Glucosyl Transferase
[0245] Microorganisms expressing a heterologous UDPG-glucosyl
transferase are grown in medium containing appropriate levels of
vanillin or ethylvanillin. The microorganisms are harvested and
their content of glucosides is extracted in methanol or other
suitable solvents. The presence of vanillin glucoside or
ethylvanillin glucoside will be established and their levels will
be quantified. The content of vanillin glucoside and ethylvanillin
glucoside are compared in transgenic and non-transgenic
microorganisms as well as in microorganisms grown in medium with
and without vanillin or ethylvanillin.
[0246] The presence of increased amounts of vanillin glucoside or
ethylvanillin glucoside in UDPG-glucosyl transferase expressing
microorganisms grown in medium containing vanillin or ethylvanillin
indicates that the aglucones are taken up and glucosylated by the
transgenic organism.
Example 3
Increased Uptake and Turnover Offerulic Acid in Microorganisms
Expressing a UDPG-Glucosyl Transferase
[0247] Microorganisms capable of converting ferulic acid into
vanillin are genetically modified to express a heterologous
UDPG-glucosyl transferase. Streptomyces setonii strain ATCC 39116
is used for these studies since it has previously been employed for
industrial production of vanillin from ferulic acid (Muheim &
Lerch, 1999, Appl Microbiol Biotechnol 51: 456; Muheim et al, 1998,
EP 0885968A1). Alternatively, Pseudomonas putida strain AN103
(Narbad & Gasson, 1998, Microbiol 144: 1397; Narbad et al,
1997, WO 97/35999), or Amycolatopsis sp. HR167 (Rabenhorst &
Hopp, 1997, EP 0761817A2) are used. The microorganisms are
transformed with the appropriate construct so as to express Sorghum
bicolor UDPG-glucosyl transferase UGT85B1, Arabidopsis thaliana
UDPG-glucosyl transferase UGT89B1 or Rauvolfia serpentina arbutin
synthase
[0248] The genetically modified microorganisms are grown in medium
containing appropriate concentrations of ferulic acid. The uptake
of ferulic acid is determined by following its concentration in the
medium and its metabolic turnover are determined by analysis of the
concentration of vanillin and vanillin glucoside in the
microorganisms and the growth medium. These values are compared to
similar analysis from experiments carried out with non-transgenic
microorganisms.
[0249] An increased uptake of ferullic acid by microorganisms
expressing heterologous UDPG-glucosyl transferase and their
accumulation of vanillin glucoside demonstrate that the glucosyl
transferase has increased the conversion of ferulic acid into
vanillin, which is then subsequently converted into vanillin
glucoside.
Example 4
Increased Yield of Vanillin Through Deglucosylation of Vanillin
Glucoside Produced in Microorganisms Expressing a UDPG-Glucosyl
Transferase
[0250] Microorganisms capable of converting ferulic acid into
vanillin are transformed with a gene encoding a UDPG-glucosyl
transferase and are grown in the presence of ferulic acid. The
concentration of ferulic acid in the growth medium is monitored and
kept at constant level in order to compensate for the amount taken
up by the microorganisms and used for the synthesis of vanillin.
After a period of several days, vanillin is extracted from the
microorganisms and quantified. In addition, vanillin glucoside will
be extracted and converted into vanillin through deglucosylation by
beta-glucosidase activity in vitro. The amount of recovered
vanillin will be quantified.
[0251] Similar experiments and quantification of vanillin
synthesised as an end product as well as vanillin recovered from in
vivo deglucosylation of vanillin glucoside are performed in
non-transformed microorganisms.
[0252] A greater amount of total vanillin extracted and recovered
from UDPG-glucosyl transferase expressing microorganisms as
compared to non-transformed microorganisms demonstrates that the
presence of a heterologous UDPG-glucosyl transferase can lead to
more ferulic acid being channeled into the synthesis of vanillin
and its glucosylated form, from which vanillin can later be
recovered. Consequently, total yield of vanillin can be increased
through expression of a UDPG-glucosyl transferase.
Example 7
Facilitating Purification of an Organic Molecule by
Glucosylation
[0253] The cell used in this example is the E. coli cell of Example
13, capable of producing vanillin glucoside.
[0254] In continuous fermentation the fermentor is inoculated with
media for growth and the fermentation is started under aerobic
conditions.
[0255] The first 12-18 hours is run for cell growth and after 12-18
hours the fermentor is fed with glucose for production of vanillin
glucoside. During this part of the fermentation the growth rate is
linear and it is anticipated that the limiting factor is the
solubility of vanillin glucoside. From other corresponding
glucosides it is known that the solubility is app. 100 g/l at STP
and increases at higher temperatures.
[0256] After approximately 30 hours the high concentration is
reached and harvesting is started. The cells are separated and
recycled to the fermentor.
[0257] The supernatant is either concentrated to the limit of
vanillin glucoside solubility or directly passed through a column
with beta-glucosidase. The supernatant is re-circulated to the
fermentor. If other products should be present, the vanillin
solution can be passed over a cleaning column before recirculation.
It is anticipated to have a row of columns where one is being used
in the process while the others are leaned and regenerated.
[0258] The product is recovered as crystals from the enzymatic
treatment. In order to decrease the amount of re-circulated
vanillin the temperature is lowered in connection with enzyme
treatment.
Example 9
Vanillin Sensitivity of Various Strains of E. coli
[0259] The three different E. coli strains TOP10, JM109, and KO1418
were grown for 18 hours in the appropriate media, after which
serial dilutions in growth medium (dilution factors 1,1/100,
1/10000 and 1/1000000) were made. Droplets of these cell
suspensions were applied to Petri dishes containing solid LB growth
medium with various concentrations of vanillin, and the plates were
incubated at the appropriate growth temperature for 24 hours (E.
coli), after which they were photographed. The percentual (w/v)
concentration of vanillin at which growth of a given microorganism
at the 1/10000 dilution was not detectable, and at which growth at
the 1/100 dilution was severely inhibited, was recorded. This
number constituted the STV (Sensitivity To Vanillin) level. The STV
numbers for the different microorganisms studied can be seen in
Table 9.1.
TABLE-US-00001 TABLE 9.1 Vanillin sensitivity for various E. coli
strains on solid growth medium Strain Genotype STV TOP10 F- mcrA
Delta (mrr-hsdRMS-mcrBC) Phi8OlacZ Delta-M15 Delta-lacX74 0.12
recAl deoR araD139 Delta (ara-leu)7697 galU galK rpsL (StrR) endAl
nupG JM109 F'traD36 lacIq Delta (lacZ) M15 proA+B+/ e14- (McrA-)
Delta (lac- 0.14 proAB) thi gyrA96 (NaIR) endAl hsdR17 (rK- mK-)
relAl supE44 recA1 K01418 F- Delta (codB-lacI) 3 relAl?
bglA677::Tn10 spoT1 bgLB676::Lambda-lacZ 0.18 bglGo-67 thi-1
Example 10
PCR Amplification of S. bicolor UGT85B1, A. thaliana UGT89B1 and R.
serpentina Arbutin Synthase (AS) Genes
[0260] Roche Pwo polymerise and a DNA Engine Thermocycler were used
for all PCR amplifications. The oligonucleotides referred to in the
text are described in Table 10.1.
TABLE-US-00002 TABLE 10.1 Oligonucleotides used in this study Oligo
SEQ JH# Name Sequence (5'-3') ID NO 1 SB_GT_KK_F
ATTAGAATTCATGGGCAGCAA 1 CGCGCCGCCGCCG 2 SB_GT_KK_R
ATTAAAGCTTTTACTGCTTGC 2 CCCCGACCAGCAG 3 SB_GT_p ET_F
CACCATGGGCAGCAACGCGCC 3 GCCGCCG 4 SB_GT_p ET_R
TTACTGCTTGCCCCCGACCAG 4 CAG 5 SB_GT_S_F1 ATGGGCAGCAACGCGCCGCCT 5 6
SB_GT_S_F2 CGCAGCTGCCAGGGAGGCCGG 6 7 SB_GT_S_F3
GCCTCCGCCGGCCTCGCCGCC 7 8 SB_GT_S_F4 CAGACCACCAACTGCAGGCAG 8 9
SB_GT_S_R1 GAGAGGGAGAGGCCGTCGTCG 9 10 AT_GT_KK_F
ATTAGAATTCATGAAAGTGAA 10 CGAAGAAAACAAC 11 AT_GT_KK_R
ATTAAAGCTTTTATTTGTTTA 11 GTCCTAAACTAACGAC 12 AT_GT_pET_F
ATGAAAGTGAACGAAGAAAAC 12 AAC 13 AT_GT_pET_R TTATTTGTTTAGTCCTAAACT
13 AACGAC 14 AT_GT_S_F1 ATGAAAGTGAACGAGGAAAAC 14 15 AT_GT_S_F2
GAATCCCTCGTTTCGATTTCT 15 16 AT_GT_S_F3 CTTGACGCACGTGAGGATAAC 16 17
AT_GT_S_F4 CCTGACACGGTGCCTGACCCG 17 18 AT_GT_S_R1
CGGAGGGGATTGAAGGGTGGG 18 19 AS_GT_EC_KK_F ATTAGAATTCATGGAACATAC 19
CCCGCACATT 20 AS_GT_EC_KK_R ATTAGAATTCTTATGTACTGG 20 AAATTTTGTTC 21
AS_GT_EC_pET_F CACCATGGAACATACCCCGCA 21 CATT 22 AS_GT_EC_pET_R
TTATGTACTGGAAATTTTGTT 22 C 23 AS_GT_S_F1 ATGGAGCATACACCTCACAT 23 24
AS_GT_S_F2 GACGGCCATGTGCCTGTCTC 24 25 AS_GT_S_F3
GGGGCAGTCTCCCATAATCA 25 26 AS_GT_S_F4 AGGGTCTTAAAGTGGCCCTG 26 27
AS_GT_S_R1 TACGGGTCTCTATCCTAACA 27 28 Pfba_F ATTAGAATTCAAAAATCACAG
28 GGCAGGGAAAC 29 Pfba_R ATTAGGCGCGCCTCTAGAGTC 29
TCTTGTCCTGTATCGTCGGG 30 PpfkA_F ATTAGAATTCTCAGTATAAAA 30
GAGAGCCAGAC 31 PpfkA_R ATTAGGCGCGCCTCTAGAGAC 31 TACCTCTGAACTTTGGAAT
32 PgapA_F ATTAGAATTCTTGCTCACATC 32 TCACTTTAATC 33 PgapA_R
ATTAGGCGCGCCTCTAGAATA 33 TTCCACCAGCTATTTGTTA 34 PtpiA_F
ATTAGAATTCCAAAAAGCAAA 34 GCCTTTGTGCC 35 PtpiA_R
ATTAGGCGCGCCTCTAGATTT 35 AATTCTCCACGCTTATAAG 36 TcysB_F
ATTAGGCGCGCCGGATCCTTT 36 CTTGCGTTATTTTCGGCACC 37 TcysB_R
ATTAAAGCTTGAAAAACCGCC 37 AGCCAGGCTTT 38 SB_GT_EC_NP_F
ATTATCTAGAATGGGCAGCAA 38 CGCGCCGCCGCCG 39 SB_GT_EC_NP_R
ATTAGGATCCTTACTGCTTGC 39 CCCCGACCAGCAG 40 AT_GT_EC_NP_F
ATTATCTAGAATGAAAGTGAA 40 CGAAGAAAACAAC 41 AT_GT_EC_NP_R
ATTAGGATCCTTACCACCGTT 41 CTATCTCCATCTTC 42 RS_GT_EC_NP_F
ATTATCTAGAATGGAACATAC 42 CCCGCACATT 43 RS_GT_EC_NP_R
ATTAGGATCCTTATGTACTGG 43 AAATTTTGTTC
UGT85B1, UGT89B1 and AS for IPTG-Controlled Expression in E.
coli
[0261] For amplification of UGT85B1 for use in the E. coli vector
pKK223-3 (Amersham-Pharmacia Biotech), the oligonucleotides JH#1
and JH#2 (Table 10.1) were used, with the plasmid pSP19g10L-UGT85B1
(Jones et al., 1999, J Biol Chem 274: 35483) as template for the
reaction. The reaction conditions employed were 94.degree. C., 2
min., 1 cycle, 94.degree. C., 30 sec., gradient 50-60.degree. C., 1
min., 72.degree. C., 2 min., 30 cycles, followed by 72.degree. C.,
7 min., 1 cycle. The reaction contained 5% DMSO. Reaction samples
containing a fragment of the expected size of 1.5 kb were combined,
and used for ligation into the pCR-Blunt II-Topo vector. Clones
containing EcoRI inserts of 1.5 kb were sequenced with the primers
JH#5-9. A clone with a correct DNA sequence was identified and
named pJH400. The UGT85B1 ORF was liberated from pJH 400 with
EcoRI-HindII (these restriction sites were included at the
5-termini of the primers) and inserted in an EcoRI-HindII digested
pKK223-3 plasmid. A clone with a correct UGT85B1 insert was
identified and named pJH401.
[0262] For amplification of UGT85B1 for use in the E. coli vector
pET101-D/Topo, an identical PCR reaction was performed, only using
the primers JH#3 and 4. The same PCR program was employed, and a
fragment of the correct size of 1.5 kb was directionally inserted
in the expression vector pET101-D/Topo. The inserts of several
clones were sequenced using primers JH#5-9. One correct clone was
named pJH402.
[0263] For amplification of UGT89B1 for use in the E. coli vector
pKK223-3, the oligonucleotides JH#10 and JH#11 (Table 10.1) were
used, with genomic Arabidopsis thaliana DNA (var. Columbia Col-0)
as template for the reaction. The reaction conditions employed were
94.degree. C., 2 min., 1 cycle, 94.degree. C., 30 sec., gradient
50-60.degree. C., 1 min., 72.degree. C., 2 min., 30 cycles,
followed by 72.degree. C., 7 min., 1 cycle. Reaction samples
containing a fragment of the expected size of 1.4 kb were combined,
and used for ligation into the pCR-Blunt II-Topo vector. Clones
containing EcoRI inserts of 1.4 kb were sequenced with the primers
JH#14-18. A clone with a correct DNA sequence was identified and
named pJH462. The UGT89B1 ORF was liberated from pJH 462 with
EcoRI-HindII (these restriction sites were included at the
5'-termini of the primers) and inserted in an EcoRI-HindIII
digested pKK223-3 plasmid. A clone with a correct UGT89B1 insert
was identified and named pJH463.
[0264] For amplification of UGT89B1 for use in the E. coli vector
pET101-D/Topo, an identical PCR reaction was performed, only using
the primers JH#12 and 13. The same PCR program was employed, and a
fragment of the correct size of 1.4 kb was directionally inserted
in the expression vector pET101-D/Topo. The inserts of several
clones were sequenced using primers JH#14-18. One correct clone was
named pJH406.
[0265] For amplification of AS for use in the E. coli vector
pKK223-3, the oligonucleotides JH#19 and JH#20 (Table 10.1) were
used, with the plasmid pQE60-AS (Arend et al., 2001, Biotechnol
Bioeng 76:126) as template for the reaction. The reaction
conditions employed were 94.degree. C., 2 min., 1 cycle, 94.degree.
C., 30 sec., gradient 48-55.degree. C., 1 min., 72.degree. C., 2
min, 30 cycles, followed by 72.degree. C., 7 min., 1 cycle.
Reaction samples containing a fragment of the expected size of 1.4
kb were combined, and used for ligation into the pCR-Blunt
II-Topovector. Clones containing EcoRI inserts of 1.5 kb were
sequenced with the primers JH#23-27. A clone with a correct DNA
sequence was identified and named pJH409. The AS ORF was liberated
from pJH409 with EcoRI (EcoRI sites were included at the 5'-termini
of both primers) and inserted in an EcoRI digested pKK223-3
plasmid. A done with a correct AS insert in the correct orientation
was identified and named pJH410.
[0266] For amplification of AS for use in the E. coli vector
pET101-D/Topo, an identical PCR reaction was performed, only using
the primers JH#21 and 22. The same PCR program was employed, and a
fragment of the correct size of 1.4 kb was directionally inserted
in the expression vector pET101-D/Topo. The inserts of several
clones were sequenced using primers JH#23-27. One correct clone was
named pJH411.
UGT85B1, UGT89B1 and AS for Constitutive Expression in E. coli
[0267] A series of tailored expression systems for UGT85B1 and AS
were constructed in which the glucosyl transferase genes were
controlled by one of four glycolytic E. coli gene promoters: fba
(primers JH#28 and 29), pfkA (311#30 and 31), tpiA (JH#32 and 33)
and gapA (JH#34 and 35) promoters, and all by the E. coli cysB
terminator (primers JH#27 and 28) sequences. All constructions were
based on the following scheme: The promoter fragment was PCR
amplified from E. coli DH5a genomic DNA, inserted BamHI-Asa (these
sites were present in the primers) in pKOL30 (Olesen et al., 2000,
Yeast 16: 1035). In the resulting construct the cysB fragment was
then inserted AscI-HindIII (sites present in primers). Finally, in
the resulting construct, PCR amplified UGT85B1 (primers JH#38 and
39), UGT89B1 (primers JH#40 and 41) or AS (JH#42 and 43) were then
inserted XbaI-EcoRI (these sites were present inside the AscI sites
in the 3'-end primer used for promoter amplification and in the
5'-end primer used for the terminator amplification, as well as in
the primers used for amplification of the UGT and AS genes). The
PCR reaction conditions employed were 94.degree. C., 2 min., 1
cycle, 94.degree. C., 30 sec., 55.degree. C., 1 min. (for promoter
and terminator fragments, as well as UGT fragments) or 48.degree.
C., 1 min (for AS fragment), 72.degree. C., 2 min, 30 cycles,
followed by 72.degree. C., 7 min., 1 cycle. For amplification of
UGT85B1, 5% DMSO was included. Reaction samples containing a
fragment of the expected sizes were combined, gel purified and used
for cloning experiments as described above.
[0268] The resulting plasmids were pJH430 (fba-UGT85B1), pJH431
(pfkA-UGT85B1), pJH432(gapAA-UGT85B1), pJH433 (tpiA-UGT85B1),
pJH-1434 (fba-UGT89B1), pJH435 (pfkA-UGT89B1), Pjh436
(gapA-UGT89B1), pJH437 (tpiA-UGT89B1), pJH438 (fba-AS), pJH439
(pfkA-AS), pJH440 (gapA-AS) and pJH441 (tpiA-AS).
Example 11
Vanillin Detoxification by Expression of UGT or AS Genes E.
coli
[0269] The E. coli strains TOP10, JM109, and KO1418 were all
transformed with the constructed plasmids pJH401, pJH402, pJH411
and pJH412, and pKK223-3 as control, employing standard
transformation protocols. Transformants were selected for
ampicillin resistance, and two transformants of each E. coli strain
with each plasmid were kept for expression experiments. The E. coli
transformants were inoculated from plate cultures into 2 ml liquid
growth medium (LB medium containing ampicillin at 100 .mu.g/ml),
and allowed to grow for 20 hours at 37.degree. C. The precultures
were diluted 100 times 10.sup.4 times and 10.sup.6 times in growth
medium, and 4 .mu.l droplets of these cell suspensions were applied
to the surface of Petri dishes containing solid LB-ampicillin
medium containing varying concentrations of vanillin (based on the
STV determinations described above), and without or with (to induce
gene expression) 1 mM isopropyl thiogalactoside (IPTG). The plates
were incubated at 37.degree. C. for 24 hours, after which growth on
the various concentrations of vanillin was monitored and recorded.
The results are summarized in Table 11.1.
TABLE-US-00003 TABLE 11.1 Effect of IPTG-induced expression of S.
bicolor UGT85B1 or R. serpentina AS on the toxicity of vanillin on
three different strains of E. coli. -: No growth; +: weak growth;
++ good growth. E. coli strain\ IPTG % Vanillin 0% 0.08% 0.12%
0.16% 0.2% induction JM109 [pKK223-3] ++ ++ ++ - - No ++ ++ ++ - -
Yes JM109 [pJH401] ++ ++ ++ - - No ++ ++ ++ - - Yes JM109 [pJH402]
++ ++ ++ + - No ++ ++ ++ ++ - Yes JM109 [pJH410] ++ ++ ++ ++ - No
++ ++ ++ ++ - Yes KO1418 [pKK223-3] ++ ++ ++ - - No ++ ++ ++ ++ -
Yes K01418 [Pjh401] ++ ++ ++ ++ - No ++ ++ ++ ++ - Yes K01418
[pJH402] ++ ++ ++ ++ - No ++ ++ ++ ++ - Yes K01418 [pJH410] ++ ++
++ ++ - No ++ ++ ++ ++ ++ Yes
[0270] From these experiments we conclude that expression of S.
bicolor UGT85B1 is possible in some E. coli strains and with some
types of IPTG-inducible gene promoters, and that a stronger
vanillin detoxification can be obtained by expression of the AS
gene, but only in an E. coli strain in which the
phospho-.beta.-glucosidase encoding bgl locus has been inactivated
(strain KO1418).
[0271] For experimentation with constitutive expression of UGT85B1
and AS, the E. coli strains JM109, and KO1418 were transformed with
the constructed plasmids pJH 430, pJH431, pJH432, pJH433, pJH434,
pJH435, pJH436, pJH437, pJH438, pJH439, pJH440, and pJH441, and
pKOL30 as control, employing standard transformation protocols.
Transformants were selected for ampicillin resistance, and two
transformants of each E. coli strain with each plasmid were kept
for expression experiments. The E. coli transformants were
inoculated from plate cultures into 2 ml liquid growth medium (LB
medium containing ampicillin at 100 .mu.g/ml), and allowed to grow
for 20 hours at 37.degree. C. The precultures were diluted 100
times 10.sup.4 times and 10.sup.6 times in growth medium, and 4
.mu.l droplets of these cell suspensions were applied to the
surface of Petri dishes containing solid LB-ampicillin medium
containing varying concentrations of vanillin (based on the STV
determinations described above). The plates were incubated at
37.degree. C. for 24 hours, after which growth on the various
concentrations of vanillin was monitored and recorded. The results
are summarized in Table 11.2. The results with E. coli strains
JM109 and KO1418 with the plasmids pJH430, pJH431, pJH432 and
pJH433 are summarized in Table 10.2 below.
TABLE-US-00004 TABLE 11.2 Effect of constitutive expression of S.
bicolor UGT85B1 or R. serpentina AS on the toxicity of vanillin on
two different strains of E. coli. % Vanillin E. coli strain 0%
0.08% 0.12% 0.16% JM109 [pKOL30] +++ +++ ++ - JM109 [pJH 430] +++
+++ +++ ++ JM109 [pJH 431] +++ +++ +++ ++ JM109 [pJH 432] +++ +++
+++ + JM109 [pJH 433] +++ +++ +++ + KO1418 [pKOL30] +++ +++ ++ +
KO1418 [pJH430] +++ +++ +++ +++ KO1418 [pJH431] +++ +++ +++ +++
KO1418 [pJH432] +++ +++ +++ + KO1418 [pJH433] +++ +++ +++ +++ - No
growth; + weak growth; ++ growth; +++ strong growth.
[0272] From these experiments we conclude that constitutive
expression of glucosyl transferase genes in 15 E. coli strain JM109
results in vanillin detoxification
Example 12
Vanillin Glucoside (VG) Production in UGT85B1-, UGT89B1- or
AS-Expressing Strains of E. coli
[0273] Several E. coli strains expressing UGT85B1 or AS are tested
for VG production by growth in liquid growth medium containing
sublethal vanillin concentrations. The strains tested are JM109 and
KO1418 containing either of the following plasmids: pKK223-3,
pJH401, pJH402, pJH406, pJH463, pJH410, pKOL30, pJH430, p311431,
pJH432, pJH433, pJH434, pJH435, pJH436, pJH437, pJH438, pJH439,
pJH440 and pJH441.
[0274] The E. coli strains are inoculated over night at 37.degree.
C. in 2 ml LB medium containing 100 .mu.g/ml ampicillin, and then
diluted into 50 ml of the same growth medium (0.1 ml o.n. culture).
Growth proceeds at 37.degree. C. for 2 hours, and then IPTG is
added to a concentration of 1 mM (0.5 ml 100 mM stock) to those
strains containing IPTG-inducible UGT/AS-expression plasmids. The
cell suspensions are then incubated at 28.degree. C. for 1 hour,
after which vanillin is added to a concentration of 0.05% (83 .mu.l
30% ethanol stock). Growth then proceeds at 28.degree. C. for 24
hours. Cultures are centrifuged LC-MS are employed to determine VG
content in growth supernatant as well as lysates of cell
pellets.
[0275] In another set of experiments, the same E. coli strains are
grown in a similar way, but instead of vanillin, .sup.14C-labelled
vanillin (5 mCi of 50 mCi/mol) is added to the growing cultures,
after which growth proceeds 28.degree. C. for 1-24 hours.
Supernatant samples are taken regularly as are cell samples. Cell
lysates are produced and both growth supernatants and cell lysates
are subjected to TLC (thin layer chromatography) as described
(Jones et al., 1999, J Biol Chem 274: 35483). Employing
autoradiography, radioactive vanillin and radioactive vanillin
glucoside are detected.
[0276] By both of the above described analyses we are able to
detect the presence of vanillin glucoside from cells expressing UGT
or AS genes while no vanillin glucoside can be detected from growth
of cells not expressing UGT or AS genes.
Example 13
Establishment of a De Novo Biosynthesis Pathway for the Supply of
Vanillin to Microbial Expressed Glucosytransferases
[0277] To establish a microbial pathway for the conversion of
glucose to vanillin three heterologous enzymatic activities are
expressed in the UDPG-glucosyltransferase expressing
microorganism.
[0278] The first enzymatic activity is a 3-dehydroshikimate
dehydratase, which "taps" out a distant vanillin precursor from the
common aromatic amino acid biosynthetic pathway, namely
3-dehydroshikimate, and converts it to protocatechuic acid.
3-Dehydroshikimate dehydratase (3DHD) genes are known from
Neurospora crassa (Ruthledge, 1984, Gene 32: 275), Aspergillus
nidulans (Hawkins et al, 1985, Curr Genet 9: 305), Podospora
pauciseta (GenBank accession # AL627362) and Acinetobacter
cakoaceticus (Elsemore & Ornston, 1995, J Bacteriol 177: 5971).
The next enzyme necessary is an aromatic carboxylic acid reductase
(ACAR) that can convert protocatechuic acid to
protocatechualdehyde. ATP-dependent ACAR activities are found in
certain actinomycetes (Nocardia sp.) (use of Nocardia ACAR
patented: Rosazza & Li, 2001, U.S. Pat. No. 6,261,814B1), in
Neurospora crassa (Gross & Zenk, 1969, Eur J Biochem 8: 413)
(use of ACAR enzyme preparation patented: Frost, 2002, U.S. Pat.
No. 6,372,461B1) and in a range of basidiomycetes, so called
"white-rot" fungi, which are lignin degraders (e.g. Trametes,
Dichomitus, Bjerkandera and Pleurotus ("Oyster mushroom") sp. (Hage
et al., 1999, Appl Microbiol Biotechnol 52: 834). Data for a short
N-terminal protein sequence from the Nocardia enzyme is available
(Li & Rosazza, 1997, J. Bacteriol 179: 3482), and the full
nucleotide sequence of the gene has recently been published (He et
al., 2004, Appl Env Microbiol 70:1874-1881). Finally, a
3-amethylation is necessary for the final conversion to vanillin.
The candidate enzyme for this purpuse is a strawberry
S-adenosylmethionine:furaneol O-methyltransferase gene (FaOMT)
(Wein et al., 2002, Plant J 31: 755), as this enzyme rather
specifically methylates protocatechuic aldehyde at the 3-Oposition.
Alternative methylases include aspen (Bugos et al., 1991), Plant
Mol Biol 17: 1203), almond (Garcia-Mas et al, 1995, Plant Phys
108:1341) and Vanilla planifolia (Pak et al., 2004, Plant Cell Rep:
11) OMTs. To avoid the accumulation of toxic intermediates the
first gene expressed in a functional UGT-expressing microbial
strain will be the methyl transferase gene. When this has been seen
to work (i.e. producing vanillin glucoside from
protocatechualdehyde), the aldehyde dehydrogenase is introduced,
etc., until the intrinsic 3-dehydroshikimate-producing pathway is
reached.
[0279] The strawberry FaOMT gene is isolated by PCR, using
Fragrada.times.ananassa (strawberry) cDNA as template DNA. The cDNA
is isolated from maturing F. ananassa var. Elanta using the
QBiogene Fastprep Pro Green kit, and from the resulting total RNA
preparation cDNA is synthesized employing the Invitrogen
Superscript II Reverse transcriptase. This cDNA preparation is used
for PCR amplification using FaOMT ORF-specific primers and Pwo
polymerase (Roche Biochemicals). The resulting 1.1 kb
FaOMT-containing DNA fragment is isolated and inserted between the
XbaI and BamHI sites in the inducible E. coli expression vector
pJFI-X1, resulting in plasmid pJH-X2.
[0280] E. coli strain JH1, which corresponds to E. coli JM109
containing plasmid pJH430 (expressing UGT85B1 from the E. coli fba
promoter) is transformed with plasmid pJH-X2. The resulting E. coli
strain JH2 is grown in liquid LB growth medium to which
protocatechualdehyde is added. Expression is induced. The culture
supernatant of the outgrown culture is subjected to LC-MS, and
vanillin glucoside is identified, meaning that a biosynthetic
pathway that can convert protocatechualdehyde to vanillin glucoside
has been established.
[0281] An ACAR gene that is effective in the conversion of
protocatechualdehyde to vanillin is isolated in the following
manner cDNA is synthesized from total RNA extracted from either of
the white rot fungi Pleurotus osfreatus or Trametes gibbosa by the
use of Invitrogen Superscript II Reverse transcriptase. A phagemid
cDNA library is produced using the Stratagene cDNA library
construction system. DNA prepared from these libraries is used to
isolate the 5'-region of white rot ACAR genes, taking advantage of
the Nocardia ACAR nucleotide sequence information. The forward
primer is identical to vector sequences present immediately
upstream of the cDNA insertion location. The reverse primer is
homologous to the area of the Nocardia ACAR. gene that has the
highest degree of evolutionary conservation, when the deduced amino
acid sequence of this gene is compared to the deduced amino acid
sequence of other putative ACAR genes found in the public sequence
databases (by comparison with Nocardia ACAR). Several such primers
with "base wobbling" at various nucleotide positions (i.e.
degenerate primers) are used together with the forward primer in a
PCR reaction using cDNA library DNA from either of the two
libraries described above, and High Fidelity Plus polymerase (Roche
Biocehmicals).
[0282] Optimizing for annealing temperature and magnesium ion
concentration, a PCR fragment of appr. 0.8 kb is isolated. By
subcloning and nucleotide sequence analysis, this fragment is shown
to encode the 5'-region of R. ostreatus or T. gibbosa ACAR. The
obtained sequence information is used to define an ACAR-internal
forward oligonucleotide primer that can be used together with a
reverse primer identical to library vector sequences present distal
to the 3'end of the cDNA inserts, to amplify the 3'-end of the P.
ostreatus or T. gibbosa ACAR genes. After sequencing of the gene
fragments thus isolated, a ACAR 3'-end specific oligonucleotide
primer is defined, and employed together with a 5'-end specific
primer, to obtain full length P. ostreatus or T. gibbosa ACAR, in a
final PCR reaction. The cDNA insert of this clone is subjected to
DNA sequencing analysis, and after confirmation of the ACAR. gene
sequence, the gene is inserted into the An ACAR gene that is
effective in the conversion of protocatechualdehyde to vanillin is
isolated in the following manner: cDNA is synthesized from total
RNA extracted from either of the white rot fungi Pleurotus
ostreatus or Trametes gibbosa by the use of Invitrogen Superscript
II Reverse transcriptase. A phagemid cDNA library is produced using
the Stratagene cDNA library construction system. DNA prepared from
these libraries is used to isolate the 5'-region of white rot ACAR
genes, taking advantage of the Nocardia ACAR nucleotide sequence
information. The forward primer is identical to vector sequences
present immediately upstream of the cDNA insertion location. The
reverse primer is homologous to the area of the Nocardia ACAR gene
that has the highest degree of evolutionary conservation, when the
deduced amino 20 acid sequence of this gene is compared to the
deduced amino acid sequence of other putative ACAR genes found in
the public sequence databases (by comparison with Nocardia ACAR).
Several such primers with "base wobbling" at various nucleotide
positions (i.e. degenerate primers) are used together with the
forward primer in a PCR reaction using cDNA library DNA from either
of the two libraries described above, and High Fidelity Plus
polymerase (Roche Biocehmicals). Optimizing for annealing
temperature and magnesium ion concentration, a PCR fragment of
appr. 0.8 kb is isolated. By subcloning and nucleotide sequence
analysis, this fragment is shown to encode the 5'-region of P.
ostreatus or T. gibbosa ACAR. The obtained sequence information is
used to define an ACAR-internal forward oligonucleotide primer that
can be used together with a reverse primer identical to library
vector sequences present distal to the 3'end of the cDNA inserts,
to amplify the 3'-end of the P. ostreatus or T. gibbosa ACAR genes.
After sequencing of the gene fragments thus isolated, a ACAR 3'-end
specific oligonucleotide primer is defined, and employed together
with a 5'-end specific primer, to obtain full length P. ostreatus
or T. gibbosa ACAR, in a final PCR reaction. The cDNA insert of
this done is subjected to DNA sequencing analysis, and after
confirmation of the ACAR gene sequence, the gene is inserted into
the S. cerevisiae expression vector pJH413, resulting in plasmid
pJH413-X1, the E. coli expression vector pJH-X2, resulting in
plasmid pJH-X3. E. coli strain JH1 (expressing UGT85B1) is
transformed with plasmid pJH-X3. The resulting E. coli strain JH3
is grown in liquid LB growth medium to which protocatechuic acid is
added. Expression is induced. The culture supernatant of the
outgrown culture is subjected to LC-MS, and vanillin glucoside is
identified, meaning that a biosynthetic pathway that can convert
protocatechuic acid to vanillin glucoside has been established.
[0283] A 3DHD gene is isolated from Podospora pauciseta in the
following manner: Genomic DNA is isolated from P. pauciseta using
the QBiogene Fastprep DNA system, and the 3DHD gene is PCR
amplified using this genomic DNA as template from the reaction with
P. pauciseta 3DHD-specific primers, and the Pwo polymerase (Roche
Biochemicals). The resulting 1.1 Id, 3DBD gene fragment is inserted
between the BamHI and XbaI sites of the E. coli expression vector
pJH-X3, resulting in plasmid pJH Van. E. coli strain JH1
(expressing UGT85B1) is transformed with plasmid pJH-Van.
[0284] The resulting E. coli strain JH4 is grown in liquid LB
growth medium. Expression is induced. The culture supernatant of
the outgrown culture is subjected to LC-MS, and vanillin glucoside
is identified, meaning that a biosynthetic pathway that can convert
glucose to vanillin glucoside has been established.
[0285] E. coli strain JM109 is now transformed with plasmid
pJH-Van. The resulting strain, JH5 now contains a biosynthesis
pathway for vanillin production from glucose, while strain JH4
contains a biosynthesis pathway for vanillin production in addition
to the glucosyl transferase-encoding UGT85B1 gene. Strains JH4 and
JH5 are both grown in liquid LB growth medium, and gene expression
is induced. By the means described above we compare vanillin
production in strain JH5 with vanillin glucoside production in
strain JH4.
[0286] We observe that the E. coli strain containing a biosynthesis
pathway for vanillin production in addition to a glucosyl
transferase gene (strain JH4) produces higher amounts (on a molar
basis) of vanillin glucoside as compared to the amounts of the
corresponding vanillin aglucone.
Example 14
Establishment of a Vanillin De Novo Biosynthesis Pathway in
Saccharomyces cerevisiae Yeast
[0287] To establish a microbial pathway for the conversion of
glucose to vanillin three heterologous 10 enzymatic activities are
obtained by molecular genetic techniques and expressed in
Saccharomyces cerevisiae.
[0288] The first enzymatic activity is a 3-dehydroshikimate
dehydratase, which "taps" out a distant vanillin precursor from the
common aromatic amino acid biosynthetic pathway, namely
3-dehydroshikimate, and converts it to protocatechuic acid.
3-Dehydroshikimate dehydratase (3DHD) genes are known from
Neurospora crassa (Ruthledge, 1984, Gene 32: 275), Aspergillus
nidulans (Hawkins et al., 1985, Curr Genet 9: 305), Podospora
pauciseta (GenBank accession # AL627362) and Acinetobacter
calcoaceticus (Elsemore & Ornston, 1995, J Bacteriol 177:
5971). The next enzyme necessary is an aromatic carboxylic acid
reductase (ACAR) that can convert protocatechuic acid to
protocatechualdehyde. ATP-dependent ACAR. activities are found in
certain actinomycetes (Nocardia sp.) (use of Nocardia ACAR
patented: Rosazza & Li, 2001, U.S. Pat. No. 6,261,814B1), in
Neurospora crassa (Gross & Zenk, 1969, Eur J Biochem 8: 413)
(use of ACAR enzyme preparation patented: Frost, 2002, U.S. Pat.
No. 6,372,461B1) and in a range of basidiomycetes, so-called
"white-rot" fungi, which are lignin degraders (e.g. Trametes,
Dichomitus, Bjerkandera and Pleurotus ("Oyster mushroom") sp. (Hage
et al., 1999, Appl Microbiol Biotechnol 52: 834). Data for a short
N-terminal protein sequence from the Nocardia enzyme is available
(Li & Rosazza, 1997, J Bacteriol 179: 3482), and the full
nucleotide sequence of the gene has recently been published (He et
al., 2004, Appl Env Microbiol 70:1874-1881). Finally, a
3-O-methylation is necessary for the final conversion to vanillin.
The candidate enzyme for this purpuse is a strawberry
S-adenosylmethionine:furaneol O-methyltransferase gene (FaOMT)
(Wein et al., 2002, Plant J 31:755), as this enzyme rather
specifically methylates protocatechuic aldehyde at the 3-O
position. Alternative methylases include aspen (Bugos et al.,
1991), Plant Mol Biol 17: 1203), almond (Garcia-Mas et al., 1995,
Plant Phys 108:1341) and Vanilla planifolia (Pak et al., 2004,
Plant Cell Rep: 11) OMTs.
[0289] The strawberry FaOMT gene was isolated by PCR, using
Fragraria.times.ananassa (strawberry) cDNA as template DNA. The
cDNA was isolated from maturing F. ananassa var. Elanta using the
QBiogene Fastprep Pro Green kit, and from the resulting total
RNApreparation cDNA was synthesized employing the Invitrogen
Superscript II Reverse transcriptase. This cDNA preparation is used
for PCR amplification using primers #1 and #2 (Table 14.1) and Pwo
polymerase (Roche Biochemicals). The resulting 1.1 kb
FaOMT-containing DNA fragment was isolated and inserted between the
XbaI and BamHI sites of the S. cerevisiae expression vector pJH413,
resulting in plasmid pJH471. The expression cassette
(Ptpi1-FaOMT-Tpi1) from pJH471 was then transferred NotI-NotI to
the yeast integration vector pYC050 (Hansen et al., 2003, FEMS
Yeast Res 4:323-327), resulting in the plasmid 011494. Ten .mu.g of
plasmid pJH494 was linearized by restriction digestion with PsiI,
and the resulting preparation was used to transform S. cerevisiae
yeast strain JH1 to NOURSEOTHRICIN resistance, resulting in yeast
strain FSC58.
[0290] A 3DHD gene was isolated from Podospora pauciseta in the
following manner: Genomic DNA was isolated from P. pauciseta using
the QBiogene Fastprep DNA system, and the 3DHD gene was PCR
amplified using this genomic DNA as template from the reaction with
P. pauciseta 3DHD-specific primers #3 and #4 (Table14.1), and the
Pwo polymerase (Roche Biochemicals). The resulting 1.1 kb 3DHD gene
fragment was inserted between the BamHI and XbaI sites of the S.
cerevisiae expression vector pJH413, resulting in plasmid pJH485.
The expression cassette (Ptpi1-3DSD-Ttpi1) from pJH485 was then
transferred NotI-Noti to the yeast integration vector pYC070
(Hansen et al., 2003, FEMS Yeast Res 4:323-327), resulting in the
plasmid Pjh500. Ten .mu.g of plasmid Pjh500 was linearized by
restriction digestion with Bsu36I, and the resulting preparation
was used to transform S. cerevisiae yeast strain FSC58 to
aureobasidin A resistance, resulting in yeast strain FSC67.
[0291] Synthetic complete yeast medium (50 ml, in 250 ml Erlenmeyer
flasks) was inoculated with 50 .mu.l of an over night culture of S.
cerevisiae yeast strain FSC67 grown in the same medium, and the
cultures allowed to grow at 30.degree. C., 150 rpm shaking. One ml
samples were taken at 24 h, and 500 .mu.l of the cell-free growth
supernatants precipitated with an equal volume of 100%
methanol.
[0292] The resulting supernatants were subjected to HPLC analysis
on an Agilent 1100 Series HPLC system, using a Zorbax SB-C18 column
(3.5 .mu.m), and an elution profile as follows: A gradient of
H.sub.2O (pH 2.3 with 112SO4)-acetonitrile from 0 to 40%
acetonitrile in 3 min., 40% acetonitrile for 1 min., a gradient
from 40 to 80% acetonitrile for 2 min., and a gradient from 80 to
90% acetonitrile for 1 min., followed by 90% acetonitrile for 1
min. Protocatechuic acid and vanillic acid were detected by a diode
array detector at 250 nm and 210 nm, and the following elution
times were found: protocatechuic acid, 5.3 min, and vanillic acid,
5.9 min. The result of the experiment was that strain FSC67 was
able to produce 0.3 g/l of protocatechuic acid and 0.01 g/l of
vanillic acid, with no other precursor than glucose. It is
anticipated that the FaOMT methyltransferase is much more efficient
with protocatechuic aldehyde than with protocatechuic acid as
substrate, and hence that incorporation of a carboxylic acid
reductase (ACAR) enzyme in strain FSC67 will result in a much
better conversion ratio of the formed protocatechuic acid as well
as the de novo formation of vanillin from glucose.
[0293] An ACAR. gene that is effective in the conversion of
protocatechualdehyde to vanillin is isolated in the following
manner cDNA is synthesized from total RNA extracted from either of
the white rot fungi Pleurotus ostreatus or Trametes gibbosa by the
use of Invitrogen Superscript II Reverse transcriptase. A phagemid
cDNA library is produced using the Stratagene cDNA library
construction system. DNA prepared from these libraries is used to
isolate the 5'-region of white rot ACAR genes, taking advantage of
the Nocardia ACAR nucleotide sequence information.
[0294] The forward primer is identical to vector sequences present
immediately upstream of the cDNA insertion location. The reverse
primer is homologous to the area of the Nocardia ACAR gene that has
the highest degree of evolutionary conservation, when the deduced
amino acid sequence of this gene is compared to the deduced amino
acid sequence of other putative ACAR genes found in the public
sequence databases (by comparison with Nocardia ACAR). Several such
primers with "base wobbling" at various nucleotide positions (i.e.
degenerate primers) are used together with the forward primer in a
PCR reaction using cDNA library DNA from either of the two
libraries described above, and High Fidelity Plus polymerase (Roche
Biocehmicals). Optimizing for annealing temperature and magnesium
ion concentration, a PCR fragment of appr. 0.8 kb is isolated. By
subcloning and nucleotide sequence analysis, this fragment is shown
to encode the 5'-region of P. ostreatus or T. gibbosa ACAR. The
obtained sequence information is used to define an ACAR-internal
forward oligonucleotide primer that can be used together with a
reverse primer identical to library vector sequences present distal
to the 3'end of the cDNA inserts, to amplify the 3'-end of the P.
ostreatus or T. gibbosa ACAR genes. After sequencing of the gene
fragments thus isolated, a ACAR 3'-end specific oligonucleotide
primer is defined, and employed together with a 5'-end specific
primer, to obtain full length P. ostreatus or T. gibbosa ACAR, in a
final PCR reaction. The cDNA insert of this clone is subjected to
DNA sequencing analysis, and after confirmation of the ACAR gene
sequence, the gene is inserted into the S. cerevisiae expression
vector pJH413, resulting in plasmid pJH413-X1. The Notl-Notl
expression cassette is transferred to pYC040 (Hansen et al., 2003,
FEMS Yeast Res 4:323-327), thus creating plasmid pJH413-X2. Ten
.mu.g of this plasmid is linearized using an appropriate
restriction enzyme, and the preparation used to transform S.
cerevisiae strain FSC67 to hygromycin B-resistance, thus creating
yeast strain FSC67-X1.
[0295] Finally, synthetic complete medium (50 ml, in 250 ml
Erlenmeyer flasks) is inoculated with 50 of an over night culture
of S. cerevisiae yeast strain FSC67-X1 grown in the same medium,
and the cultures allowed to grow at 30.degree. C., 150 rpm shaking.
One ml samples are taken at 0 h, 24 h, and 48 h, and 500 .mu.l of
the cell-free growth supernatants precipitated with an equal volume
of 100% methanol. The resulting supernatants are subjected to HPLC
analysis. We observe the formation of significant amounts of
vanillin from glucose as precursor with yeast strain FSC67-X1, and
thus we conclude that a de novo vanillin biosynthesis pathway has
been obtained.
TABLE-US-00005 TABLE 14.1 Oligonucleotides used in example 14.
Oligonudeotide 5'-3' Sequence #1, SEQ ID NO: 44 ATTATCTAGAATGGGTTC
CACCGGCGAGACTCAG #2, SEQ ID NO: 45 ATTAGGATCCTCAGATCT
TCTTAAGAAACTCAATG #3, SEQ ID NO: 46 ATTATCTAGAATGCCTTC
CAAACTCGCCATCACTTC #4, SEQ ID NO: 47 ATTAGGATCCTTACAAAG
CCGCTGACAGCGACAG
Example 15
In Vivo Production of Vanillin Glucoside in Saccharomyces
cerevisiae Yeast
[0296] A S. cerevisiae yeast strain expressing AS was tested for VG
production by fed-batch growth in a 2 liter fermentor vessel, in
liquid growth medium containing a sublethal vanillin concentration.
5 The strain tested was JH6 (adh6 adh7) containing plasmid pJH413
(JH6 [pJH413]).
[0297] Plasmid pJH413 was constructed in the following way: The
arbutin synthase (AS) gene was amplified using the oligonucleotide
primers #1 and #2 (Table 15.1), with the plasmid pQE60-AS (Arend et
al., 2001, Biotechnol Bioeng 76:126) as template for the reaction.
The reaction conditions employed were 94.degree. C., 2 min., 1
cycle, 94.degree. C., 30 sec., gradient 48-55.degree. C., 1 min.,
72.degree. C., 2 min., 30 cycles, followed by 72.degree. C., 7 min,
1 cycle. Reaction samples containing a fragment of the expected
size of 1.4 kb were combined, and used for ligation into the
pCR-Blunt II-Topo vector. Clones containing EcoRI inserts of 1.5 kb
were sequenced with the primers JH#23-27 (Table 10.1 in Example
10). A clone with a correct DNA sequence was identified and from
this plasmid the AS ORF was liberated XbaI and BamHI (such sites
were included at the 5'-termini of the PCR amplification primers)
and inserted into the corresponding sites of the yeast expression
vector p111259 (derivative of plasmid pJH235; Hansen et al., 2003,
FEMS Yeast Res 2:137-149). A clone with a correct AS insert was
identified and named pJH413.
[0298] Strain JH6 was transformed with plasmid pJH413 and
inoculated for 48 h at 30.degree. C. in 2 ml SC-ura medium
containing, and then all of this culture is diluted into 1.8 liter
of the same growth medium. The culture was grown with oxygenation
for 24 hours, after which more glucose (20g/l) was added, along
with 5 mM of vanillin. At T=48 h another 10 g/l of glucose and 5 mM
vanillin was added. A 10 ml sample was taken at T=72 h, and the
cellular as well as extracellular content of vanillin and its
derivatives was extracted with hot ethanol The resulting extract
was concentrated ten times under vacuum, and the concentrated
culture extract subjected to LC-MS analysis. A part of the
concentrated culture sample was treated with almond
.beta.-glucosidase, and then subjected to LC-MS analysis. The
culture content of the .beta.-glucosides of vanillin, vanillic acid
and vanillyl alcohol was determined by LC-MS analysis.
[0299] The conclusion is that vanillin glucoside can be formed in
vivo in Saccharomyces cerevisiae by the glucosylation of vanillin.
As vanillin glucoside is much less toxic to microbial organisms
than is the aglycon vanillin, we conclude that expression of
appropriate UDP-glucose glycosyltransferases in Saccharomyces yeast
allows for overproduction of vanillin.
TABLE-US-00006 TABLE 15.1 Oligonucleotides used in example 15.
Oligonucleotide 5'-3' Sequence #1, SEQ ID NO: 48 ATTATCTAGAATGGAA
CATACACCTCACATT #2, SEQ ID NO: 49 ATTAGGATCCTTATGT
ACTGGAAATTTTGTTC
Example 16
Overproduction of Protocatechuic Acid in Saccharomyces cerevisiae
by Expression of the Arabidopsis thaliana UGT89B1
Glucosyltransferase
[0300] A Saccharomyces cerevisiae strain producing protocatechuic
acid due to expression of the Podospora pauciseta
3-dehydroshikimate dehydratase (3DSD) gene was constructed, and
used to show overproduction of protocatechuic acid due to
expression of the Arabidopsis thaliana UGT89B1
glucosyltransferase.
[0301] S. cerevisiae strain JH1 was transformed with linearized
plasmid pJH500 (as described in example 14) in order to allow for
overexpression of the P. pauciseta 3-dehydroshikimate dehydratase,
in the manner described in Example 14. The resulting yeast strain
was denoted FSC59, and this strain was used for transformation with
the UGT89B1 yeast expression plasmid pJH468.
[0302] Plasmid pJH468 was constructed in the following way: The
UGT89B1 gene was PCR amplified using the oligonucleotides #1 and #2
(Table 16.1), with genomic Arabidopsis thaliana DNA (var. Columbia
Col-0) as template for the reaction. The reaction conditions
employed were 94.degree. C., 2 min., 1 cycle, 94.degree. C., 30
sec., gradient 50-60.degree. C., 1 min., 72.degree. C., 2 min., 30
cycles, followed by 72.degree. C., 7 min., 1 cycle. Reaction
samples containing a fragment of the expected size of 1.4 kb were
combined, and used for ligation into the pCR-Blunt II-Topo vector.
Clones containing EcoRI inserts of 1.4 kb were sequenced with the
primers JH#14-18 (Table 10.1, Example 10). A done with a correct
DNA sequence was identified and named pJH407. The UGT89B1 ORF was
liberated from pJH407 with XbaI-BamHI (these restriction sites were
included at the 5'-termini of the primers) and inserted in an
XbaI-BamHI digested pJH259 plasmid. A done with a correct UGT89B1
insert was identified and named pJH408. The URA3 selection marker
of this plasmid was exchanged with the G418R selection marker (from
plasmid pYC030, see Olesen et al., 2000, Yeast 16:1035), and the
yeast "origin of replication region" was removed by restriction
digestion with Fsel, followed by relegation, thus creating the
yeast integration plasmid pJH468.
[0303] Ten .mu.g of plasmid pJH468 was linearized by restriction
digestion with PsiI, and the resulting preparation was used to
transform S. cerevisiae yeast strain JFSC59 to nourseothricin
resistance, resulting in yeast strain FSC60.
[0304] Synthetic complete yeast medium (50 ml, in 250 ml Erlenmeyer
flasks) was inoculated with 50 of an over night culture of S.
cerevisiae yeast strain JH1, FSC59 and FSC60 grown in the same
medium, and the cultures allowed to grow at 30.degree. C., 150 rpm
shaking. One ml samples were taken at 48 h, and 500 .mu.l of the
cell-free growth supernatants precipitated with an equal volume of
100% methanol. The resulting supernatants were subjected to HPLC
analysis on an Agilent 1100 Series HPLC system, using a Zorbax
SB-C18 column (3.5 .mu.m), and an elution profile as follows: A
gradient of H.sub.2O (pH 2.3 with H.sub.2SO.sub.4)-acetonitrile
from 0 to 40% acetonitrile in 3 min., 40% acetonitrile for 1 min.,
a gradient from 40 to 80% acetonitrile for 2 min., and a gradient
from 80 to 90% acetonitrile for 1 min., followed by 90%
acetonitrile for 1 min. Protocatechuic acid (PA) and protocatechuic
acid-.beta.-D-glucoside (PAG) were detected by a diode array
detector at 250 nm and 210 nm, and the following elution times were
found: protocatechuic acid, 5.4 min, and protocatechuic
acid-.beta.-D-glucoside, 4.7 min. The identity of PAG was confirmed
by LC-MS analysis.
[0305] The result of the experiment was that strain FSC59 was able
to produce 0.43 g/l of PA while strain FSC60 produced 0.28 g/l of
PA and 0.69 g/l of PAG. When the sample from strain FSC60 were
treated with almond .beta.-glucosidase, the result was an increase
in the PA content to 0.62 g/l acid, corresponding to an
overproduction in strain FSC60 of PA of more than 40%, as compared
to strain FSC59, in which the UGT89B1 glucosyl transferase was not
expressed.
[0306] Thus we conclude that overproduction of protocatechuic acid
is possible in yeast by the expression of A. thaliana UGT89B1
glucosyltransferase.
TABLE-US-00007 TABLE 16.1 Oligonuoleotides used in example 16.
Oligonucleotide 5'-3' Sequence #1, SEQ ID NO: 50 ATTATCTAGAATGAAAGT
TAACGAAGAAAACAAC #2, SEQ ID NO: 51 ATTAGGATCCTTACCACC
GTTCTATCTCCATCTTC
Example 17
Construction of S. cerevisiae Expression Vectors Containing S.
bicolor CYP79A1, CYP71E1 and UGT85B1
[0307] In order to facilitate correct subcloning into the yeast
expression vectors, the three genes were PCR amplified using
primers with extensions which provided the DNA fragments with
appropriate restrictions sites. CYP79A1 (using the plasmid
CYP79A1PRT101 as template) was amplified with the primer pair
SbC79F1S and SbC79R1E. CYP71E1 (using the plasmid CYP71E1pcDNAII as
template) was amplified with the primer pair SbC71F1 S and
SbC71R1E. Finally, UGT85B1 (using the plasmid pcDNAII-UGT85B1 as
template) was amplified with the primer pair SbUDPF1S and SbUDPR1E.
Oligonucleotide primers are described in Table 17.1.
[0308] PCR was performed in the following way: Template DNA was
used in the amount of 10 ng per reaction (volume of 50 .mu.l).
Primers and dNTPs were used in a final concentration of .mu.M The
three genes were amplified using 5 U of pfu polymerase (Stratagene)
in a final MgSO.sub.4 concentration of 2 mM. The following PCR
conditions were used for the amplification: initially 95.degree. C.
for 5 minutes, thereafter 35 cycles of 95.degree. C. for 45
seconds, Tm for 30 seconds and 72.degree. C. for 90 seconds.
Finally, 72.degree. C. for 10 minutes. Tm for CYP79A1 was
62.degree. C., Tm for CYP71E1 was 65.degree. C. and Tm for UGT85B 1
was 64.degree. C.
[0309] The three amplified genes were initially cloned into
pCR-Blunt II TOPO (Invitrogen). Following transformation into E.
coli strain DH5.alpha. and plasmid isolation using the QIAGEN
system (QIAGEN), the integrity of the three genes was verified by
DNA sequencing using appropriate sequencing primers.
[0310] Prior to subcloning into yeast expression vectors the above
mentioned three genes were released from the TOPO vectors by
cutting with the restriction enzymes EcoRI and SpeI followed by
agarose gel-electrophoresis and DNA recovery using the QIAex system
(Qiagen) according to manufactures instructions Similarly, the
yeast expressions vectors were cut with EcoRI and SpeI, treated
with SAP and also recovered using the QIAex system.
[0311] Standard T4 DNA ligase (New England Biolabs) ligation was
performed over night at 16.degree. C., according to manufactures
instructions. Following transformation into E. coli strain
DH5.alpha. and plasmid isolation using the QIAGEN system according
to manufactures instruction, the integrity of the yeast expression
constructions was verified by cutting with appropriate restriction
enzymes and gel-electrophoresis.
[0312] CYP79A1 was cloned into the following plasmid vectors
(Mumberg et al. 1995, Gene 156:119122): p416-GPD (resulting in
p#33A), p426-GPD (resulting in p#34A), p416-TEF (resulting in
p#41A) and p426-TEF (resulting in p#42A). CYP71E1 was cloned into
the following vectors: p413-GPD (resulting in p#27A), p423-GPD
(resulting in p#28A), p413-TEF (resulting in p#35A) and p413-ADH
(resulting in p#43A). UGT85B1 was cloned into the vector p415-GPD
(resulting in p#S31B).
TABLE-US-00008 TABLE 17.1 Oligonucleotide sequence for primers used
for cloning. Name Primer sequence SEQ ID NO: SbC79F1S
5'-agcactagtatggcgacaa 52 tggaggtagaggcc-3' SbC79R1E
5'-agcgaattctcagatggag 53 atggacgggtagagg-3' SbC71F1S
5'-agcactagtatggccacca 54 ccgccaccccgcagctcc-3' SbC71R1E
5'-agcgaattcctaggcggcg 55 cggcggttcttgtatttgg-3' SbUDPR1E
5'-agcgaattctcactgcttg 56 cccccgaccagcagc-3' SbUDPF1S
5-cagcactagtatgggcagca 57 acgcgccgcctcc-3'
Example 18
Construction of S. cerevisiae Strains Expressing S. bicolor
CYP79A1, CYP71E1 and UGT85B1 and of Strains Containing Mock
Plasmids
[0313] Standard yeast transformation by electroporation (Becker and
Guarente, 1991, Methods in Enzymology 194:182-187) was done in the
yeast strain BY4741 (mata his3D1 leu2D0 met15D0 ura3D0)
(EUROSCARF).
[0314] The following yeast strains (expressing the three S. bicolor
genes) were constructed by transformation with the above mentioned
plasmid and selected on SC-His,Ura,Leu media: [0315] Y0109 by
transformation of BY4741 with the plasmids p#27A, p#33A and p#S31B.
[0316] Y0113 by transformation of BY4741 with the plasmids p#28A,
p#34A and p#S31B. [0317] Y0117 by transformation of BY4741 with the
plasmids p#35A, p#41A and p#S31B. [0318] Y0121 by transformation of
BY4741 with the plasmids p#43A, p#42A and p#S31B.
[0319] The following yeast strains (containing mock plasmids) were
constructed by transformation with the above mentioned plasmid and
selected on SC-His,Ura,Leu media: [0320] Y0084 by transformation of
BY4741 with the plasmids p413-GPD, p416-GPD and p415-GPD [0321]
Y0085 by transformation of BY4741 with the plasmids p423-GPD,
p426-GPD and p415-GPD. [0322] Y0086 by transformation of BY4741
with the plasmids p413-TEF, p416-TEF and p415-GPD. [0323] Y0087 by
transformation of BY4741 with the plasmids p413-ADH, p426-TEF and
p415-GPD.
[0324] The following yeast strains (expressing the two S. bicolor
genes CYP79A1 and CYP71E1) were constructed by transformation with
the above mentioned plasmid and selected on SC-His,Ura media:
[0325] Y0091 by transformation of BY4741 with the plasmids p#27A
and p#33A. [0326] Y0092 by transformation of BY4741 with the
plasmids p#28A and p#34A. [0327] Y0093 by transformation of BY4741
with the plasmids p#35A and p#41A. [0328] Y0094 by transformation
of BY4741 with the plasmids p#43A and p#42A.
[0329] The following yeast strains (containing mock plasmids) were
constructed by transformation with the above mentioned plasmid and
selected on SC-His,Ura media: [0330] Y0071 by transformation of
BY4741 with the plasmids p413-GPD and p416-GPD. [0331] Y0072 by
transformation of BY4741 with the plasmids p423-GPD and p426-GPD.
[0332] Y0073 by transformation of BY4741 with the plasmids p413-TEE
and p416-TEE. [0333] Y0074 by transformation of BY4741 with the
plasmids p413-ADH and p426-TEE
[0334] The following yeast strains (expressing the two S. bicolor
genes CYP79A1 and UGT85B1) were 15 constructed by transformation
with the above mentioned plasmid and selected on SC-Ura,Leu media:
[0335] Y0103 by transformation of BY4741 with the plasmids p#33A
and p#S31B. [0336] Y0104 by transformation of BY4741 with the
plasmids p#34A and p#S31B. [0337] Y0105 by transformation of BY4741
with the plasmids p#41A and p#S31B. [0338] Y0106 by transformation
of BY4741 with the plasmids p#42A and p#S31B.
[0339] The following yeast strains (containing mock plasmids) were
constructed by transformation with the above mentioned plasmid and
selected on SC-Ura, Leu media: [0340] Y0078 by transformation of
BY4741 with the plasmids p416-GPD and p415-GPD. [0341] Y0079 by
transformation of BY4741 with the plasmids p426-GPD and p415-GPD.
[0342] Y0080 by transformation of BY4741 with the plasmids p416-TEF
and p415-GPD. [0343] Y0081 by transformation of BY4741 with the
plasmids p426-TEF and p415-GPD.
Example 19
Propagation of S. cerevisiae Strains Expressing S. bicolor CYP79A1,
CYP71E1 and UGT85B1 and of Strains Containing Mock Plasmids
[0344] The above mentioned yeast strains were propagated in
appropriate synthetic growth omission media lacking the same amino
acids as used for selection of transformed cells. Cells were grown
at 28.degree. C., 175 RPM in a volume of 3 ml, until stationary
phase. Liquid propagation was performed in 15 ml culture tubes.
[0345] Prior to glucose fermentation, the cells of the outgrown
cultures were recovered by centrifugation (4000 RPM for ten
minutes), separated from the spent media, washed once in synthetic
glucose minimal (SD+) drop in media (see below), again recovered by
centrifugation and finally resuspended in 3 ml of appropriated SD+
media.
[0346] Strains originally selected on SC-His, Ura, Leu were
resuspended in SD+Lys, Met. Strains originally selected on SC-His
Um were resuspended in SD+Lys, Met, Leu. Strains originally
selected on SC-Ura, Leu were resuspended in SD+Lys, Met, His.
[0347] After resuspension of cells in SD+ media, liquid cultures
were kept at 28.degree. C., 175 RPM and samples were collected, as
described below, for subsequent LC-MS analysis.
Example 20
Metabolite Analysis of S. cerevisiae Strains Expressing S. bicolor
CYP79A1, CYP71E1 and UGT85B1 and of Strains Containing Mock
Plasmids
[0348] In order to analyze the composition of secondary metabolites
produced by the above mentioned yeast strains, samples of 0.5 ml
were collected at the following time points after resuspension in
SD+ media: 24 hours, 48 hours, 72 hours and 92 hours. In the case
of analysis for dhurrin, only the time points of 24 and 48 hours
were collected.
[0349] Samples to be analyzed for total content of a given
secondary metabolite (amount of glycosylated and non-glycosylated
molecules) will be treated with p-glucosidase (Fluka) prior to
LC-MS.
[0350] Cells were separated from media by centrifugation (4000 RPM
for ten minutes). 333 .mu.l of the liquid phase from each sample
was dried down in vacua, and resuspended in 50 .mu.l of 50.degree.
A) MeOH. After centrifugation, at 15000 RPM for ten minutes of the
MeOH resuspension, 25 was used for characterization by LC-MS.
Samples were stored at -20.degree. C. prior to LC/MS analysis.
[0351] Appropriate reference samples were manufactured by adding
known amounts of the given reference compound to 0.5 ml of media
(sampled 48 hours after resuspension in SD+ media) obtained from
the corresponding yeast strain carrying mock plasmids. After adding
the reference compound to media the reference samples were treated
as described immediately above. In order to be able to quantify the
amount of a given secondary metabolite, the corresponding reference
samples were manufactured in triplicate, varying only in
concentration of the reference compound (0.1 .mu.g/ml, 1 .mu.g/ml
and 10 .mu.g/ml). Finally, in order to uniquely identify the
retention time for each particular molecule searched for, one
reference sample containing only the given compound was prepared (1
.mu.g/ml in 50% MeOH).
[0352] Analytical LC-MS was carried out using an Agilent 1100
Series LC (Agilent Technologies, Germany) coupled to a Bruker
Esquire 3000+ ion trap mass spectrometer (Bruker Daltonics, Bremen,
Germany). An XTerra MS C18 column (Waters, Milford, Mass., 3.5
.mu.M, 2.1.times.100 mm) was used at a flow rate of 0.2 mL
min.sup.-1. The mobile phases were: A, 0.1% (v/v) HCOOH and 50
.mu.M Nag B, 0.1% (v/v) HCOOH and 80% (v/v) MeCN. The gradient
program was: 0 to 3 min, isocratic 3% (v/v) B; 2 to 30 min, linear
gradient 3 to 50% B; 30 to 35 min, linear gradient 50% to 100%
(v/v) B; 35 to 40 min, isocratic 100% B. The mass spectrometer was
configured for electrospray ionization (ESI) in positive ion mode.
Total ion current and ion traces for specific [M+Na]+ adduct ions
were used for locating compounds. In the case of aglycone detection
the mass spectrometer was configured for Atmospheric Pressure
Chemical Ionization (APCI) in positive ion mode. Spectra were
analyzed using Bruker Daltonics Dataanalysis v. 3.1 software
(Bruker GmBH)
[0353] Quantification of a given secondary metabolite (aglycone or
glycosylated version thereof) was done by integration of the area
of the mass peak (LC-MS) and comparing obtained values to that of
the standard curve from the three corresponding reference samples
spiked with known amounts of that particular substance in
question.
Example 21
Production of p-Hydroxymancielonitrile-.beta.-D-Glucoside (Dhurrin)
by Glucose 5 Fermentation of S. cerevisiae Strains Expressing S.
bicolor CYP79A1, CYP71E1 and UGT85B1
[0354] The amount of Dhurrin produced by the yeast strains Y0109,
Y0113, Y0117 and Y0121 was measured at the following time points.
Quantification of Dhurrin was done by regression according to the
equation [Dhurrin (ng/ml)]=6E-171.sup.2,5218 (R4:0,92) were I is
the area of the 10 mass peak. This equation was derived from three
spiked samples as described above.
TABLE-US-00009 TABLE 21.1 Dhurrin produced in S. cerevisiae strains
expressing S. bicolor CYP79A1, CYP71E1 and UGT85B1. Strain Y0109
Y0113 Y0117 Y0121 Time-point ng/ml ng/ml ng/ml ng/ml 24 hours 22.7
562 90.6 0.10 48 hours 57.7 945 356 0.06
[0355] Retention time for Dhurrin (m/z=334) was 13.6 minutes.
[0356] Tracer experiments by use of radio-labeled tyrosine
demonstrated that the aglucone of dhurrin (p-hydroxymandelonitrile)
was not present. It is accordance with prior art knowledge that
explains that the aglucone of dhurrin is highly unstable in aqueous
solutions (Halkier and Molelr, 1989, Plant Journal 90:1552-1559).
The glucosylation performed by UGT85B1 results in a virtual
unlimited overproduction of this unstable aromatic nitrile. No peak
of m/z=334 at 13.6 minutes, exceeding the background noise was
found in the case of yeast strains carrying mock plasmids (strains
Y0084, Y0085, Y0086 and Y0087). In the case of strains (Y0094,
Y0095, Y0096 and Y0097) carrying expression plasmids of CYP79A1
together with CYP71E1 no peak of m/z=334 at 13.6 minutes exceeding
10 ng/ml was found at any time point. Therefore the 945 ng/ml of
Dhurrin found in the case of strain Y0113 after 48 hours of
fermentation amounts to a least 94-fold overproduction, as a result
of the expression of the glucosyltransferase UGT85B1.
Example 22
Production of Compounds Derived from the Dhurrin Biosynthesis
Pathway by Expression of S. bicolor CYP79A1, CYP71E1 and
UGT85B1
[0357] Mass spectra from samples derived from strains expressing S.
bicolor CYP79A1, CYP71E1 and UGT85B1 in non-equimolar amounts of
gene products displays production of glucosylated molecules derived
from intermediates of the Dhurrin biosynthesis pathway. It is
therefore believed that glycosylation mediated by
glycosyltransferases (here UGT85B1 as an example) can result in the
continuous removal of intermediates from biosynthesis pathways
thereby achieving overproduction of a given aglycone. In Table 22.1
the amounts of various putatively assigned glucosylated compounds
derived from the Dhurrin biosynthesis pathway are listed.
Quantification was performed similarly to that of the Dhurrin
measurements described above, using the same equation.
TABLE-US-00010 TABLE 22.1 Glucosylated compounds, other than
Dhurrin produced in S. cerevisiae strains expressing S. bicolor
CYP79A1, CYP71E1 and UGT85B1. Y010 Y011 Y011 Y012 Y010 Y011 Y011
Y012 Y010 Y011 Y011 Y012 9 3 7 1 9 3 7 1 9 3 7 1 ng/ml ng/ml ng/ml
Strain p-glucosyloxy- p-glucosyloxy- p-glucosyloxy- Time
phenylethanol a) phenylacetonitrile benzaldehyde point m/z = 323
zn/z = 318 m/z = 307 24 361 226 165 408 4.2 4.7 1.7 6.0 23 0.7 1.5
0.4 hours 48 2606 1134 1830 2759 52 38 98 84 22 5.9 7.8 3.2 hours
72 6424 3125 1649 12497 269 118 74 371 65 32 16 18 hours 96 hours
4979 4407 2952 15428 288 198 151 784 62 31 22 23
[0358] a) Alternatively the m/z=323 ion corresponds to
p-glucosyloxy-benzoic acid or glucosyl p-hydroxybenzoate. Retention
time of p-glucosyloxy-phenylethanol was 14.4 minutes. Retention
time of p-glucosyloxy-phenylacetonitrile was 14.4 minutes.
Retention time of p-glucosyloxy-benzaldehyde was 19.7 minutes
Example 23
Overproduction of Compounds Derived from Intermediates of the
Dhurrin Biosynthesis Pathway by Expression of the S. bicolor Genes
CYP79A1, CYP71E1 and UGT85B1 in S. cerevisiae
[0359] Unambiguous identification of the above mentioned glucosides
are achieved similarly to the method described for dhurrin
identification using authentic standards for
p-glucosyloxy-phenylethanol, p-glucosyloxy-benzoic acid, glucosyl
p-hydroxybenzoate, p-glucosyloxy-phenylacetonitrile and
p-glucosyloxy-benzaldehyde.
[0360] Identification and quantification of aglycone molecules are
performed in the following way:
[0361] growth media from strains expressing the Dhurrin
biosynthesis genes or from strains carrying mock plasmids are
collected at the same time points and by the same methods as
described above. Thereafter the spent media are treated with
p-glucosidase (to release the aglycones from theirs glycoside
forms). Again, in order to be able to quantify the amount of a
given aglycone, the corresponding reference samples are
manufactured in triplicate, varying only in concentration of the
reference compound (0.1 .mu.g/ml, 1 .mu.g/ml and 10 .mu.g/ml).
Finally, in order to uniquely identifying the retention time for
each particular molecule searched for, one of each reference sample
containing only the given compound is prepared (1 .mu.g/ml in 50%
MeOH).
[0362] Demonstration of overproduction by glucosylation is done by
comparison of the produced amount of the given aglucone (after
.beta.-glucosidase treatment) from strains expressing UGT85B1
together with CYP79A1 (and in some cases also CYP71E1) to that of
strains expressing only CYP79A1 (and in some cases also CYP71E1).
This procedure demonstrates at least 1.5 times overproduction.
REFERENCES
[0363] The references mentioned below are a selection of the
references that are considered most pertinent with respect to the
present invention. [0364] Paquette, S. et al, Phytochemistry 62
(2003) 399-413. WO01/07631. [0365] WO01/40491 [0366] Arend, J et
al., Biotech. & Bioeng (2001) 78:126-131 [0367] Tattersall, D B
et al, Science (2001) 293:1826-8 Moehs, C P et al, Plant Journal
(1997) 11:227-236 U.S. Pat. No. 6,372,461
Sequence CWU 1
1
57134DNAArtificialPCR primer 1attagaattc atgggcagca acgcgccgcc gccg
34234DNAArtificialPCR Primer 2attaaagctt ttactgcttg cccccgacca gcag
34328DNAArtificialPCR Primer 3caccatgggc agcaacgcgc cgccgccg
28424DNAArtificialPCR Primer 4ttactgcttg cccccgacca gcag
24521DNAArtificialPCR Primer 5atgaaagtga acgaggaaaa c
21621DNAArtificialPCR Primer 6cgcagctgcc agggaggccg g
21721DNAArtificialPCR Primer 7gcctccgccg gcctcgccgc c
21821DNAArtificialPCR Primer 8cagaccacca actgcaggca g
21921DNAArtificialPCR Primer 9gagagggaga ggccgtcgtc g
211034DNAArtificialPCR Primer 10attagaattc atgaaagtga acgaagaaaa
caac 341137DNAArtificialPCR Primer 11attaaagctt ttatttgttt
agtcctaaac taacgac 371224DNAArtificialPCR Primer 12atgaaagtga
acgaagaaaa caac 241327DNAArtificialPCR Primer 13ttatttgttt
agtcctaaac taacgac 271421DNAArtificialPCR Primer 14atgaaagtga
acgaggaaaa c 211521DNAArtificialPCR Primer 15gaatccctcg tttcgatttc
t 211621DNAArtificialPCR Primer 16cttgacgcac gtgaggataa c
211721DNAArtificialPCR Primer 17cctgacacgg tgcctgaccc g
211821DNAArtificialPCR Primer 18cggaggggat tgaagggtgg g
211931DNAArtificialPCR Primer 19attagaattc atggaacata ccccgcacat t
312032DNAArtificialPCR Primer 20attagaattc ttatgtactg gaaattttgt tc
322125DNAArtificialPCR Primer 21caccatggaa cataccccgc acatt
252222DNAArtificialPCR Primer 22ttatgtactg gaaattttgt tc
222320DNAArtificialPCR Primer 23atggagcata cacctcacat
202420DNAArtificialPCR Primer 24gacggccatg tgcctgtctc
202520DNAArtificialPCR Primer 25ggggcagtct cccataatca
202620DNAArtificialPCR Primer 26agggtcttaa agtggccctg
202720DNAArtificialPCR Primer 27tacgggtctc tatcctaaca
202832DNAArtificialPCR Primer 28attagaattc aaaaatcaca gggcagggaa ac
322941DNAArtificialPCR Primer 29attaggcgcg cctctagagt ctcttgtcct
gtatcgtcgg g 413032DNAArtificialPCR Primer 30attagaattc tcagtataaa
agagagccag ac 323140DNAArtificialPCR Primer 31attaggcgcg cctctagaga
ctacctctga actttggaat 403232DNAArtificialPCR Primer 32attagaattc
ttgctcacat ctcactttaa tc 323340DNAArtificialPCR Primer 33attaggcgcg
cctctagaat attccaccag ctatttgtta 403432DNAArtificialPCR Primer
34attagaattc caaaaagcaa agcctttgtg cc 323540DNAArtificialPCR Primer
35attaggcgcg cctctagatt taattctcca cgcttataag
403641DNAArtificialPCR Primer 36attaggcgcg ccggatcctt tcttgcgtta
ttttcggcac c 413732DNAArtificialPCR Primer 37attaaagctt gaaaaaccgc
cagccaggct tt 323834DNAArtificialPCR Primer 38attatctaga atgggcagca
acgcgccgcc gccg 343934DNAArtificialPCR Primer 39attaggatcc
ttactgcttg cccccgacca gcag 344034DNAArtificialPCR Primer
40attatctaga atgaaagtga acgaagaaaa caac 344135DNAArtificialPCR
Primer 41attaggatcc ttaccaccgt tctatctcca tcttc
354231DNAArtificialPCR Primer 42attatctaga atggaacata ccccgcacat t
314332DNAArtificialPCR Primer 43attaggatcc ttatgtactg gaaattttgt tc
324434DNAArtificialPrimer 44attatctaga atgggttcca ccggcgagac tcag
344535DNAArtificialPrimer 45attaggatcc tcagatcttc ttaagaaact caatg
354636DNAArtificialPrimer 46attatctaga atgccttcca aactcgccat cacttc
364734DNAArtificialPrimer 47attaggatcc ttacaaagcc gctgacagcg acag
344831DNAArtificialPrimer 48attatctaga atggaacata cacctcacat t
314932DNAArtificialPrimer 49attaggatcc ttatgtactg gaaattttgt tc
325034DNAArtificialPrimer 50attatctaga atgaaagtta acgaagaaaa caac
345135DNAArtificialPrimer 51attaggatcc ttaccaccgt tctatctcca tcttc
355233DNAArtificialPrimer 52agcactagta tggcgacaat ggaggtagag gcc
335334DNAArtificialPrimer 53agcgaattct cagatggaga tggacgggta gagg
345437DNAArtificialPrimer 54agcactagta tggccaccac cgccaccccg
cagctcc 375538DNAArtificialPrimer 55agcgaattcc taggcggcgc
ggcggttctt gtatttgg 385634DNAArtificialPrimer 56agcgaattct
cactgcttgc ccccgaccag cagc 345732DNAArtificialPrimer 57agcactagta
tgggcagcaa cgcgccgcct cc 32
* * * * *