U.S. patent application number 14/409148 was filed with the patent office on 2015-08-13 for gene targeting in plants using dna viruses.
This patent application is currently assigned to Regents of the University of Minnesota. The applicant listed for this patent is Regents of the University of Minnesota. Invention is credited to Nicholas Baltes, Daniel F. Voytas.
Application Number | 20150225734 14/409148 |
Document ID | / |
Family ID | 49769321 |
Filed Date | 2015-08-13 |
United States Patent
Application |
20150225734 |
Kind Code |
A1 |
Voytas; Daniel F. ; et
al. |
August 13, 2015 |
GENE TARGETING IN PLANTS USING DNA VIRUSES
Abstract
Systems and methods for gene targeting in plants, including
systems and methods that include the use of geminiviruses and
customizable endonucleases.
Inventors: |
Voytas; Daniel F.; (Falcon
Heights, MN) ; Baltes; Nicholas; (New Brighton,
MN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Regents of the University of Minnesota |
Minneapolis |
MN |
US |
|
|
Assignee: |
Regents of the University of
Minnesota
Minneapolis
MN
|
Family ID: |
49769321 |
Appl. No.: |
14/409148 |
Filed: |
June 19, 2013 |
PCT Filed: |
June 19, 2013 |
PCT NO: |
PCT/US2013/046495 |
371 Date: |
December 18, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61661542 |
Jun 19, 2012 |
|
|
|
61772704 |
Mar 5, 2013 |
|
|
|
61790581 |
Mar 15, 2013 |
|
|
|
Current U.S.
Class: |
435/468 |
Current CPC
Class: |
C12N 15/902 20130101;
C12N 2750/12043 20130101; C12N 9/22 20130101; C12N 2999/007
20130101; C12N 15/8203 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12N 15/90 20060101 C12N015/90 |
Goverment Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under
DBI-0923827 awarded by the National Science Foundation. The
government has certain rights in the invention.
Claims
1. A method for modifying the genetic material of a plant cell,
comprising: (a) introducing into the cell a virus nucleic acid
comprising a donor sequence that is heterologous to the virus and
is targeted to a first sequence that is endogenous to the plant
cell; and (b) inducing a double strand break at or near the
sequence to which the donor sequence is targeted, wherein said
double strand break is generated by an endonuclease targeted to a
second endogenous plant sequence at or near the first sequence that
is targeted by the donor sequence, wherein homologous recombination
occurs between the first endogenous plant sequence and the donor
sequence.
2. The method of claim 1, wherein the virus nucleic acid is a plant
DNA virus nucleic acid.
3. The method of claim 1, wherein the virus nucleic acid is a
geminivirus nucleic acid.
4. The method of claim 1, wherein the endonuclease is a zinc finger
nuclease, a transcription activator-like effector nuclease, a
meganuclease, or a CRISPR/Cas system endonuclease.
5. The method of claim 1, wherein the endonuclease is encoded by a
transgene sequence stably integrated into the genetic material of
the plant, or is expressed transiently.
6. The method of claim 5, wherein the transgene encoding the
endonuclease is operably linked to a promoter that is constitutive,
cell specific, inducible, or activated by alternative splicing of a
suicide exon.
7. The method of claim 1, wherein the virus nucleic acid comprises
a sequence encoding the endonuclease.
8. The method of claim 1, further comprising introducing into the
plant cell an RNA virus nucleic acid comprising a nucleotide
sequence encoding the endonuclease.
9. The method of claim 8, wherein the RNA virus nucleic acid is
introduced into the plant cell after or simultaneous with step
(a).
10. The method of claim 8, wherein the RNA virus nucleic acid is
from a tobacco rattle virus, a potato virus X, a pea early browning
virus, or a barley stripe mosaic virus.
11. The method of claim 1, wherein the plant is
monocotyledonous.
12. The method of claim 11, wherein the plant is wheat, maize, or
Setaria.
13. The method of claim 1, wherein the plant is dicotyledonous.
14. The method of claim 13, wherein the plant is tomato, soybean,
tobacco, potato, or Arabidopsis.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of priority from U.S.
Provisional Application Ser. No. 61/790,581, filed on Mar. 15,
2013, U.S. Provisional Application Ser. No. 61/772,704, filed on
Mar. 5, 2013, and U.S. Provisional Application No. 61/661,542,
filed on Jun. 19, 2012, all of which are incorporated herein by
reference in their entirety.
TECHNICAL FIELD
[0003] This document relates to materials and methods for gene
targeting in plants, and particularly to methods for gene targeting
that include using geminiviruses and customizable
endonucleases.
BACKGROUND
[0004] The precise modification of higher eukaryotic genomes,
including plant genomes, is a highly sought after technology for
basic research and biotechnology applications. Precise genome
modification--referred to herein as gene targeting (GT)--relies on
the DNA-repair machinery of the target cell, and on an exogenously
supplied repair template (also referred to as a "donor sequence").
Through the activity of the homologous recombination (HR) pathway,
homologous sequences carried by the repair template can recombine
with a chromosomal target. Consequently, any modified sequence
carried by the repair template will be stably integrated into the
genome. Attempts to implement GT in plants often are plagued by
extremely low HR frequencies. The majority of the time, donor DNA
molecules integrate illegitimately via non-homologous end joining
(NHEJ). This process occurs regardless of the size of the
homologous "arms," as increasing the length of homology to
approximately 22 kb results in no significant enhancement in GT
(Thykjaer et al., Plant Mol. Biol., 35:523-530, 1997).
[0005] Other studies have aimed at increasing the efficiency of GT
in plants. Some methods are based on the use of customizable
endonucleases, such as zinc finger nucleases (ZFN5), meganucleases
(MN5), and transcription activator-like (TAL) effector nucleases
(TALE nucleases). A targeted DNA double-strand break (DSB) can
stimulate recombination by a factor of 100 between transforming
T-DNA and a native chromosomal locus (Puchta et al., Proc. Natl.
Acad. Sci. USA, 93:5055-5060, 1996). Through the coordinated
delivery of a repair template and a customizable endonuclease,
high-frequency GT may be achieved in plants (Townsend et al.,
Nature, 459:442-445, 2009). Such methods are designed for use in
protoplasts, which enables direct delivery of repair templates and
nuclease-expressing plasmids to individual cells though PEG
transformation or electroporation. However, the ability to practice
GT is limited to labs with the expertise and equipment for tissue
culturing and plant regeneration.
SUMMARY
[0006] Gene targeting in plant cells has been performed primarily
by two techniques: (1) direct transfer of DNA into plant cells by
either electroporation/PEG transformation of protoplasts, or by
biolistic bombardment of DNA into various plant tissues; and (2) by
Agrobacterium-mediated transformation. In these methods, the
exogenously supplied DNA is either T-DNA, PCR-derived, or
plasmid-derived.
[0007] This document is based in part on the development of a novel
and effective in planta method for gene targeting that combines the
use of geminiviral-based gene targeting vectors and a targeted DNA
double strand break engineered by a co-delivered endonuclease. This
is the first account demonstrating concurrent use of these
techniques as a gene targeting methodology, which is likely to have
vast implications in all areas of plant biology. For example, this
technology can be used to accelerate the rate of functional genetic
studies in plants. The technology also can be used to engineer
plants with improved characteristics, including enhanced
nutritional quality, increased resistance to disease and stress,
and heightened production of commercially valuable compounds.
[0008] There are several benefits to using geminiviruses and
endonucleases for gene targeting in plants, including (i) the
ability of the virus to stably propagate the gene targeting vector
from cell-to-cell within the plant, (ii) the ability of the virus
to replicate the gene targeting vector to high copy numbers within
plant cell nuclei (on average 1000 copies per cell, but numbers can
reach up to 30,000), and (iii) the circular nature of the
geminivirus genome, as circular DNA is thought to participate less
frequently in illegitimate recombination. These properties
contribute to an effective, reliable and reproducible procedure for
gene targeting in plant cells.
[0009] The methods provided herein enable practitioners to achieve
high frequency gene targeting by creating a chromosome break in a
target locus while simultaneously using the viral replication
machinery to make repair templates to achieve gene targeting. The
viral repair templates can be generated either by infecting plants
with engineered viruses or by using deconstructed viral vectors.
The latter vectors replicate viral DNA and thereby produce the
repair template, but they do not generate a productive
infection.
[0010] In a first aspect, this disclosure features a method for
modifying the genetic material of a plant cell. The method can
include (a) introducing into the cell a virus nucleic acid
comprising a repair template that is heterologous to the virus and
is targeted to a first sequence that is endogenous to the plant
cell; and (b) inducing a double strand break at or near the
sequence to which the repair template is targeted, wherein said
double strand break is generated by an endonuclease targeted to a
second endogenous plant sequence at or near the first sequence that
is targeted by the repair template, wherein homologous
recombination occurs between the first endogenous plant sequence
and the repair template.
[0011] The virus nucleic acid can be a plant DNA virus nucleic
acid. The virus nucleic acid can be a geminivirus nucleic acid. The
endonuclease can be a zinc finger nuclease, a transcription
activator-like effector nuclease, a meganuclease, or a CRISPR/Cas
system endonuclease. The endonuclease can be encoded by a transgene
sequence stably integrated into the genetic material of the plant,
or can be expressed transiently. When the endonuclease is encoded
by a transgene, the transgene can be operably linked to a promoter
that is constitutive, cell specific, inducible, or activated by
alternative splicing of a suicide exon. The virus nucleic acid can
include a sequence encoding the endonuclease. The method can
further include introducing into the plant cell an RNA virus
nucleic acid comprising a nucleotide sequence encoding the
endonuclease. The RNA virus nucleic acid can be introduced into the
plant cell after or simultaneous with step (a). The RNA virus
nucleic acid can be from a tobacco rattle virus, a potato virus X,
a pea early browning virus, or a barley stripe mosaic virus. The
plant can be a monocotyledonous plant (e.g., wheat, maize, a grass
such as purple false brome (Brachypodium distachyon), Haynaldia
villosa, or Setaria), or a dicotyledonous plant (e.g., tomato,
soybean, tobacco, potato, or Arabidopsis).
[0012] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used to practice the invention, suitable
methods and materials are described below. All publications, patent
applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In case of conflict,
the present specification, including definitions, will control. In
addition, the materials, methods, and examples are illustrative
only and not intended to be limiting.
[0013] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF DRAWINGS
[0014] FIG. 1 is an illustration of the cabbage leaf curl virus
(CaLCuV) genome. CaLCuV contains a bipartite genome, with the DNA A
component encoding proteins necessary for viral replication and
encapsidation, and the DNA B component encoding proteins necessary
for cell-to-cell movement. The coat protein nucleotide sequence
(CP) can be replaced by up to 800 nucleotides of repair template
DNA sequence. See, Gutierrez, Physiol. Mol. Plant Pathol.
6060:219-230, 2002.
[0015] FIG. 2 is a schematic of an experimental approach for gene
targeting using engineered geminiviruses and transgenic Arabidopsis
plants encoding a stably integrated zinc finger nuclease (ZFN)
transgene. Repair of the ZFN-induced DSB using a repair template on
the CaLCuV A genome results in the stable incorporation of a unique
18 bp sequence into the ADH1 gene.
[0016] FIG. 3 is an illustration of a nested PCR method that can be
used to detect gene-targeted ADH1 alleles. Genomic DNA from somatic
Arabidopsis cells--exposed to estradiol and infected with
CaLCuV--is used as a template for PCR amplification of the ADH1
locus. Amplicons are gel purified and used as templates for a
second PCR, with one primer specific for the GT modification.
Dashed lines represent the outer limit of homology carried by the
repair template.
[0017] FIG. 4A is a diagram of pCPCbLCVA.007, which contains the
entire genome of the CaLCuV A component flanked by direct repeats
of the common region for viral excision from the plasmid. To modify
pCPCbLVCA.007 for carrying gene fragments, the coding region of the
coat protein gene, AR1, was replaced with a polylinker. The AR1
promoter, the translational start (ATG) and the putative
polyadenylation sites are retained. To initiate infection, this
plasmid is co-transformed with pCPCbLCVB.002. Virus derived from
these vectors moves from cell-to-cell within Arabidopsis plants
but, without the coat protein gene, it is not transmissible.
[0018] FIG. 4B is a diagram of pCPCbLCVB.002, which contains the
entire genome of the CaLCuV B component flanked by direct repeats
of the common region for viral excision from the plasmid.
Bombardment of the B component alone can be used as a negative
control for DNA contamination (no virus should be replicated). See,
Muangsan and Robertson, Meth. Mol. Biol. 265:101-15, 2004.
[0019] FIG. 5 is a picture of gels with amplicons generated from an
enrichment PCR designed to detect ZFN-induced mutations at the ADH1
gene after induction by .beta.-estradiol. DNA was assessed for NHEJ
mutations from (i) non-induced and non-infected plants (-Estradiol,
-Virus), (ii) induced and non-infected plants (+Estradiol, -Virus),
(iii) non-induced and infected plants (-Estradiol, +Virus), and
(iv) induced and infected plants (+Estradiol, +Virus). D, digested;
UD, undigested.
[0020] FIG. 6 is a diagram of the CaLCuV A plasmid (left panel) and
a series of pictures of gels showing the stability of repair
template sequences in infected plants (right panels). Genomic DNA
from infected plants was used as a template for PCR amplification
of the repair template sequence. Primers NB153 and NB158 (left
panel) recognize sequences in the viral genome and amplify across
the repair template. Five differently sized repair templates were
analyzed. Repair templates with sizes 400 nt, 600 nt, 800 nt, and
1000 nt contained ADH1 homology sequences, while 715 nt contained
gus::nptII homology sequence. PCR amplicons (right panel) were run
out on a 1% agarose gel. Controls for 1000 nt and 800 nt used
plasmid DNA as a template for PCR (CaLCuVA.ADH1-1000 and
CaLCuVA.ADH1-800, respectively).
[0021] FIG. 7 is a series of pictures of agarose gels showing PCR
detection of amplicons from modified ADH1 loci. Genomic DNA from
infected plants exposed to .beta.-estradiol (left panels; +Virus,
+Estradiol) or not exposed to .beta.-estradiol (right panel;
+Virus, -Estradiol) was subjected to nested PCR using primers
designed to detect the 5' modification junction (5' check), the 3'
modification junction (3' check), and amplification of the starting
template (input).
[0022] FIG. 8 is a series of pictures showing evidence of GT at the
gus::nptII gene. Co-infected plants (CaLCuVA.GUS-FIX and CaLCuVB
with TRV-Zif268) were stained in X-Gluc and chlorophyll was
removed. Images of selected plants are shown. Arrows point to
blue-staining cells.
[0023] FIG. 9 is an illustration of a strategy for creating a
geminivirus replicon (GVR) system for transient protein expression,
and subsequently transient genome editing, in plants. LSL T-DNA
functions as a template for Rep-assisted replicative release of
replicons (top). LIR, SIR, and Rep/RepA nucleotide sequences were
derived from Bean yellow dwarf virus (BeYDV, GenBank accession
number DQ458791.1). Following delivery of LSL T-DNA to plant cell
nuclei by Agrobacterium, Rep protein mediates replicational release
of single-stranded DNA (ssDNA) replicons (middle). Complementary
strand synthesis is carried out by host polymerases, resulting in
transcriptionally-competent double-stranded DNA (dsDNA) replicons
(bottom). Transcription of protein coding sequence is driven by the
nearby LIR and further promoted with an upstream 2.times.35S
promoter. SD, DEM2 splice donor; SA, DEM2 splice acceptor, LB, left
border; RB, right border.
[0024] FIG. 10A is an illustration of an approach for cloning
customizable endonucleases into pLSL. The pZHY013 entry vector,
encodes unique restriction enzyme sites (XbaI, BamHI, NheI and
BglII) for sequential cloning of nucleotide sequences for TALE or
ZF binding domains.
[0025] FIG. 10B is an illustration of vectors for Gateway cloning
of customizable endonucleases and repair templates into pLSL. FokI
nucleotide sequences encode obligate heterodimeric proteins
(EL-KK). Noteworthy, an AatII enzyme site permits cloning of Cas9
or MN nucleotide sequences upstream of Nos terminator sequence
(Nos-T).
[0026] FIG. 10C is the full sequence of the LSL region (SEQ ID
NO:78) located between the left and right T-DNA borders in pLSL.
The hygromycin resistance gene, located between the left border and
the upstream LIR, is not shown. The highly-conserved nonanucleotide
sequence (TAATATTAC), required for Rep-initiated rolling circle
replication, is underlined in both LIR elements.
[0027] FIG. 11 is an illustration showing the general structure of
the replicase expressing T-DNA plasmids used in the experiments
described herein. Rep/RepA nucleotide sequences (both wild type and
LxCxQ) were cloned into pMDC32 (2.times.35S promoter) or pFZ19 (XVE
promoter).
[0028] FIG. 12 is an image of plant tissue expressing GUS enzyme.
LSL T-DNA, encoding NLS-tagged beta-glucuronidase (pLSLGUS), was
delivered to Nicotiana tabacum var. xanthi leaf tissue with p35SREP
(right side of leaf) or without p35SREP (left side of leaf) by
syringe infiltration of Agrobacterium. Transformed leaf tissue was
stained seven days post infiltration (dpi) with X-Gluc, and
chlorophyll was removed to better visualize staining.
[0029] FIG. 13 is a series of images of plant tissue expressing
GFP. Leaf tissue transformed with pLSLGFP, with and without
delivery of p35SREP, or transformed with pLSLGUS with delivery of
p35SREP, was visualized 3, 7, and 12 dpi.
[0030] FIG. 14 is an image of a representative leaf seven dpi,
demonstrating tissue health. Leaf tissue from WT Nicotiana tabacum
plants was syringe infiltrated with Agrobacterium containing
pLSLGUS (right), or coinfiltrated with Agrobacterium containing
pLSLGUS and p35SREP. Leaf tissue was removed from the plant seven
dpi and imaged. Slight browning in tissue transformed with p35SREP
was observed.
[0031] FIG. 15 is an illustration (top) and example (bottom) of
detecting GVRs encoding GUS and GFP nucleotide sequences in plant
cells. To assay for the presence of GVRs, genomic DNA was extracted
three dpi and used as template for PCR. Primers were designed to
amplify LIR sequence contained on the replicon. Amplicons were
present only when p35SREP was co-transformed with pLSL, suggesting
the presence of GVRs.
[0032] FIG. 16 is an illustration of target loci for Zif268::FokI,
the T30 TALE nuclease pair, and the CRISPR/Cas system. ZFN target
sequence is present within a stably integrated, and defective
gus::nptII reporter gene (top). The T30 TALE nuclease and
CRISPR/Cas target sequences are present within the endogenous
acetolactate synthase genes (ALS), SuRA (middle) and SuRB (bottom).
AI, artificial intron IV of ST-LS1 gene from Solanum tuberosum.
[0033] FIG. 17 is an image of a gel from a PCR designed to detect
GVRs containing ZFN (pLSLZ.D), TALE nuclease (pLSLT), and
CRISPR/Cas (pLSLC) sequences.
[0034] FIG. 18 is an image of a gel (middle) from a PCR-digest
(top) designed to detect ZFN-induced mutations at the gus::nptII
gene. Plant DNA was isolated from leaf tissue seven dpi. Amplicons
encompassing the ZFN target site were digested overnight with MseI
and separated on an agarose gel. Cleavage-resistant bands were
cloned into pJet1.2 and sequenced (bottom).
[0035] FIG. 19 is an image of a gel (middle) from an enrichment PCR
(top) designed to detect TALE nuclease-induced mutations at the ALS
loci. Plant DNA was pre-digested overnight with AluI before PCR
amplification of SuRA and SurB loci. Amplicons were digested
overnight with AluI, separated on an agarose gel, and
cleavage-resistant bands were cloned into pJet1.2 and sequenced
(bottom).
[0036] FIG. 20 is an image of a gel (middle) from a PCR-digest
(top) designed to detect Cas9-included mutations at the ALS loci.
Plant DNA was isolated from leaf tissue five dpi and the CRISPR/Cas
target site was amplified by PCR. The resulting amplicons were
digested with AlwI, separated on an agarose gel, and cleavage
resistant bands were cloned and sequenced (bottom).
[0037] FIG. 21 is a schematic outlining the approach to correct a
non-functional gus::nptII reporter. Repair template sequence,
present within pLSLZ.D, encodes 1 kb homology arms isogenic to
gus::nptII sequence, as well as 600 bp of sequence designed to
restore gus::nptII protein function.
[0038] FIG. 22 shows selected images leaf tissue with
GUS-expressing cells. To visualize cells expressing functional GUS
protein, leaf tissue was stained in X-Gluc solution for 24 to 48
hours at 37.degree. C., and chlorophyll was removed. Images shown
are selected examples from tissue transformed with p35SZ.D (left),
pLSLZ.D (center), and both pLSLZ.D and p35SREP (right).
[0039] FIG. 23 is an image of a gel (bottom) from a PCR (top)
designed to detect GUS::NPTII genes. PCR was performed on genomic
DNA extracted from leaf tissue seven dpi. Primers were designed to
be complementary to sequence downstream of the NPTII coding
sequence and homologous to the sequence within the repair template
(top). A high number of amplicons of the expected size (1.078 kb)
were observed only from genomic DNA isolated from tissue
transformed with pLSLZ.D and p35SREP.
[0040] FIG. 24 is a graph plotting the density of GUS-expressing
cells across multiple transgenic lines (identified as 1.7, 4.3,
9.1, and 11.3). Error bars represent SEM of at least three
biological replicates.
[0041] FIG. 25 is a series of graphs plotting the density of
GUS-expressing cells with different transformed vectors. Error bars
represent SEM of at least three biological replicates.
[0042] FIG. 26 is a series of images of leaf tissue with
GUS-expressing cells following Agrobacterium-mediated delivery of
pLSLZ.D and p35SREP to transgenic lines 1.7, 4.3, and 11.3, as
indicated.
[0043] FIG. 27 is a series of images of leaf tissue with
GUS-expressing cells following Agrobacterium-mediated delivery of
pLSLZ.D to transgenic lines 1.7 and 11.3, as indicated.
[0044] FIG. 28 is a series of images of leaf tissue with
GUS-expressing cells following Agrobacterium-mediated delivery of
p35SREP to transgenic lines 1.7, 4.3, and 11.3, as indicated.
[0045] FIG. 29 is a series of images of leaf tissue with
GUS-expressing cells following Agrobacterium-mediated delivery of
pLSLD and p35SREP to transgenic lines 1.7, 4.3, and 11.3, as
indicated.
[0046] FIG. 30 is a series of images of leaf tissue with
GUS-expressing cells following Agrobacterium-mediated delivery of
p35SZ.D and p35SREP to transgenic lines 1.7, 4.3, and 11.3, as
indicated.
[0047] FIG. 31 is an illustration of the approach used to create a
SuRB::NPTII fusion protein (top) and an image of two gels from PCRs
designed to genotype candidate recombinant plants (bottom). Primers
were designed to detect the 5' modification junction (5' check) and
the 3' modification junction (3' check).
[0048] FIG. 32 is an image of a gel from a PCR designed to detect
BeYDV-based GVRs in potato cells. Genomic DNA from plants
co-transformed with p35SREP and pLSLGFP was evaluated for
replicational release (top), and for the presence of Rep/RepA
nucleotide sequence (bottom).
[0049] FIG. 33 is an image of a gel from a PCR designed to detect
Rep/RepA RNA transcripts in potato plants transformed with
p35SREP.
[0050] FIG. 34 is a pair of images of potato leaves expressing GUS
enzyme. Potato leaves were transformed with Agrobacterium
containing pLSLGUS (left) or a mixture of Agrobacterium containing
pLSLGUS and p35SREP (right). Leaf tissue was stained in X-Gluc
solution and chlorophyll was removed.
[0051] FIG. 35 is a series of images of tomato leaf tissue with
GUS-expressing cells. Tomato leaf tissue was infiltrated with
Agrobacterium containing pLSLGUS (right) or a mixture of
Agrobacterium containing pLSLGUS and p35SREP (left and middle). To
visualize cells expressing functional GUS protein, infected leaf
tissue was stained in X-Gluc solution for 24 hours at 37.degree.
C., and chlorophyll was removed. Black arrows indicate areas of GUS
activity.
[0052] FIG. 36 is an illustration showing the general structure of
the Wheat dwarf virus LSL T-DNA. Rep/RepA nucleotide sequence is
present within the LIR elements. Rep/RepA gene expression is
initiated from the complementary sense LIR promoter.
[0053] FIG. 37 is a pair of images of wheat calli tissue expressing
GFP. GFP sequence was delivered to calli by particle bombardment of
plasmid DNA containing BeYDV LSL sequences (left) or WDV LSL
sequences (right). Images were taken three dpi.
[0054] FIG. 38 is a set of images of Setaria calli expressing GFP.
GFP sequence was delivered to calli by particle bombardment of
plasmid DNA containing BeYDV LSL sequences (left) or WDV LSL
sequences (right). Images were taken three dpi.
[0055] FIG. 39 is a set of images of corn embryos expressing GFP.
GFP sequence was delivered to calli by particle bombardment of
plasmid DNA containing BeYDV LSL sequences (left), WDV LSL
sequences (middle), or control (right). Images were taken three
dpi.
[0056] FIG. 40 is an illustration describing an approach to correct
a non-functional gus::nptII reporter gene in rice (top) and
pictures of GUS activity in rice leaves (bottom).
DETAILED DESCRIPTION
[0057] This document provides a highly efficient, virus-based
system and methods for targeted modification of plant genomes. The
in planta system and methods for GT include the use of customizable
endonucleases in combination with plant DNA viruses. Plant DNA
viruses, including geminiviruses, have many attributes that may be
advantageous for in planta GT, including their ability to replicate
to high copy numbers in plant cell nuclei. Importantly, these
viruses can be modified to encode a desired nucleotide sequence,
such as a repair template sequence targeted to a particular
sequence in a plant genome. First generation geminiviruses, or
"full viruses" (viruses that retain only the useful "blocks" of
sequence), can carry up to about 800 nucleotides (nt), while
deconstructed geminiviruses (viruses that encode only the proteins
needed for viral replication) have a much larger cargo capacity.
This document describes how customizable nucleases and plant DNA
viruses enable in planta GT, and provides materials and methods for
achieving such GT. The methods can be used with both
monocotyledonous plants (e.g., banana, grasses (e.g., Brachypodium
distachyon), wheat, oats, barley, maize, Haynaldia villosa, palms,
orchids, onions, pineapple, rice, and sorghum) and dicotyledonous
plants (e.g., Arabidopsis, beans, Brassica, carnations,
chrysanthemums, citrus plants, coffee, cotton, eucalyptus,
impatiens, melons, peas, peppers, Petunia, poplars, potatoes,
roses, soybeans, squash, strawberry, sugar beets, tobacco,
tomatoes, and woody tree species).
[0058] In general, the system and methods described herein include
two components: a plant DNA virus (e.g., geminivirus) vector
containing a repair template targeted to an endogenous plant
sequence, and an endonuclease that also is targeted to a site near
or within the target sequence. The endonuclease can be activated to
create targeted DNA double-strand breaks at the desired locus, and
the plant cell can repair the double-strand break using the repair
template present in the geminivirus, thereby incorporating the
modification stably into the plant genome.
[0059] Geminiviruses are a large family of plant viruses that
contain circular, single-stranded DNA genomes. Examples of
geminiviruses include the cabbage leaf curl virus, tomato golden
mosaic virus, bean yellow dwarf virus, African cassava mosaic
virus, wheat dwarf virus, miscanthus streak mastrevirus, tobacco
yellow dwarf virus, tomato yellow leaf curl virus, bean golden
mosaic virus, beet curly top virus, maize streak virus, and tomato
pseudo-curly top virus. As described herein, geminivirus sequences
can be used as gene targeting vectors. For example, the geminivirus
genome can be engineered to contain a desired modification flanked
by sequences of homology to a target locus. In some cases, this can
be accomplished by replacing non-essential geminivirus nucleotide
sequence (e.g., CP sequence) with a desired repair template. Other
methods for adding sequence to viral vectors include, without
limitation, those discussed in Peretz et al. (Plant Physiol.,
145:1251-1263, 2007).
[0060] The repair template contains homology to a particular
sequence within the genome of a plant. Typically, a repair template
includes a nucleic acid that will replace an endogenous target
sequence within the plant, flanked by sequences homologous to
endogenous sequences on either side of the target. When a
non-essential (e.g., CP) sequence within a geminivirus vector is
replaced with a repair template, the repair template can have a
length up to about 800 nt (e.g., 100 nt, 200 nt, 300 nt, 400 nt,
500 nt, 600 nt, 700 nt, 800 nt, or any length between about 100 nt
and about 800 nt). Within the repair template, the flanking
homologous sequences can have any suitable length (e.g., about 25
nt, 50 nt, 75 nt, 100 nt, 150 nt, 200 nt, 250 nt, 300 nt, 350 nt,
400 nt, or any length between about 25 nt and about 400 nt). Repair
templates and DNA virus plasmids can be prepared using techniques
that are standard in the art, including those described below.
[0061] The second component of the system and methods described
herein is an endonuclease that can be customized to target a
particular nucleotide sequence and generate a double strand break
at or near that sequence. Examples of such customizable
endonucleases include ZFNs, MNs, and TALE nucleases, as well as
Clustered Regularly Interspersed Short Palindromic
Repeats/CRISPR-associated (CRISPR/Cas) systems. See, for example,
Sander et al., Nature Methods, 8:67-69, 2011; Jacoby et al., Nucl.
Acids Res., 10.1093/nar/gkr1303, 2012); Christian et al., Genetics,
186:757-761, 2010; U.S. Publication No. 2011/0145940; Cong et al.,
Science 339:819-823, 2013; and Mali et al., Science 339:823-826,
2013, for a discussion of each. In particular, CRISPR/Cas molecules
are components of a prokaryotic adaptive immune system that is
functionally analogous to eukaryotic RNA interference, using RNA
base pairing to direct DNA or RNA cleavage. Directing DNA DSBs
requires two components: the Cas9 protein, which functions as an
endonuclease, and CRISPR RNA (crRNA) and tracer RNA (tracrRNA)
sequences that aid in directing the Cas9/RNA complex to target DNA
sequence (Makarova et al., Nat Rev Microbiol, 9(6):467-477, 2011).
The modification of a single targeting RNA can be sufficient to
alter the nucleotide target of a Cas protein. In some cases, crRNA
and tracrRNA can be engineered as a single cr/tracrRNA hybrid to
direct Cas9 cleavage activity (Jinek et al., Science,
337(6096):816-821, 2012). Like TALE nucleases, for example, the
components of a CRISPR/Cas system (the Cas9 endonuclease and the
crRNA and tracrRNA, or the cr/tracrRNA hybrid) can be delivered to
a cell in a geminivirus construct.
[0062] In some embodiments of the systems and methods provided
herein, the sequence encoding the endonuclease can be stably
integrated into the plant genome that will be infected with a
geminivirus containing a repair template. See, for example, FIG. 2,
which depicts a plant genome into which a sequence encoding an ADH1
targeted ZFN has been stably integrated. The coding sequence can be
operably linked to a promoter that is inducible, constitutive, cell
specific, or activated by alternative splicing of a suicide exon.
For example, as shown in FIG. 2, the ADH1 ZFN coding sequence is
operably linked to an XVE promoter, which can be activated by
estradiol. The plant can be infected with a geminivirus containing
a repair template (indicated by the black bar flanked by white bars
in the "CaLCuV"), and expression of the ZFN can be activated by
treating the plant with estradiol. The ZFN protein then can cleave
the DNA at the target sequence, facilitating HR on either side of
the repair template to be integrated.
[0063] Alternatively, the endonuclease coding sequence can be
contained in the same geminivirus construct as the repair template,
or can be present in a second plasmid that is separately delivered
to the plant, either sequentially or simultaneously with the
geminivirus construct. For example, in some embodiments, plants can
be transfected or infected with a second viral vector, such as an
RNA virus vector (e.g., a tobacco rattle virus (TRV) vector, a
potato virus X vector, a pea early browning virus vector, or a
barley stripe mosaic virus vector) that encodes the endonuclease.
As an example, TRV is a bipartite RNA plant virus that can be used
to transiently deliver protein coding sequences to plant cells. For
example, the TRV genome can be modified to encode a ZFN or TALE
nuclease by replacing TRV nucleotide sequence with a subgenomic
promoter and the ORF for the endonuclease. The inclusion of a TRV
vector can be useful because TRV infects dividing cells and
therefore can modify germ line cells specifically. In such cases,
expression of the endonuclease encoded by the TRV can occur in germ
line cells, such that HR at the target site is heritable.
[0064] In embodiments in which a geminivirus vector contains both a
repair template and an endonuclease encoding sequence, it is noted
that that the geminivirus can be deconstructed such that it encodes
only the proteins needed for viral replication. Since a
deconstructed geminivirus vector has a much larger capacity for
carrying sequences that are heterologous to the virus, it is noted
that the repair template may be longer than 800 nt. An exemplary
system using a deconstructed vector is described in the Example
below.
[0065] The construct(s) containing the repair template and, in some
cases, the endonuclease encoding sequence, can be delivered to a
plant cell using, for example, biolistic bombardment.
Alternatively, the repair template and endonuclease sequences can
be delivered using Agrobacterium-mediated transformation, insect
vectors, grafting, or DNA abrasion, according to methods that are
standard in the art, including those described herein.
[0066] After a plant is infected or transfected with a repair
template (and, in some cases, an endonuclease encoding sequence),
any suitable method can be used to determine whether GT has
occurred at the target site. In some embodiments, a phenotypic
change can indicate that a repair template sequence has been
integrated into the target site. Such is the case for the
gus::nptII plants that were repaired with a geminivirus containing
a GUS sequence, as described below. PCR-based methods also can be
used to ascertain whether a genomic target site contains a repair
template sequence, and/or whether precise recombination has
occurred at the 5' and 3' ends of the repair template. A schematic
depicting an example of such a technique is provided in FIG. 3, and
the work described below also demonstrates GT in Arabidopsis using
PCR-based techniques. In some of these experiments, plants
expressing a ZFN were infected with geminiviruses producing repair
templates (also referred to herein as donor molecules), and
recombination between the repair template and the target gene on
the plant chromosome was observed in somatic cell genomic DNA from
infected plants expressing an active endonuclease. In particular,
following systemic infection of an engineered geminivirus
containing a unique 18 bp modification flanked by 400 bases of
homology to the ADH1 target locus, ZFN expression was induced.
Following ZFN expression, genomic DNA from somatic cells was
extracted and assessed for GT events. Results from the enrichment
PCR suggested successful GT of the ADH1 loci using geminiviruses
and ZFNs. Additional experiments are described that involve
quantifying the frequency of gene targeting in somatic cells, and
demonstrating gene targeting by phenotypic analysis.
[0067] The invention will be further described in the following
examples, which do not limit the scope of the invention described
in the claims.
Examples
Cloning of Genetic Elements into pCPCbLCVA.007
[0068] The cabbage leaf curl virus (CaLCuV) is a bipartite,
circular single-stranded DNA virus that can infect Arabidopsis
plants when delivered by microprojectile bombardment. Initiating
viral infection requires the delivery of two plasmids containing
sequence for both genomes (A and B components; FIG. 1). The viral
sequences are partially duplicated, containing two direct repeats
of the origin of replication flanking the viral genome.
Consequently, delivery of these plasmids to plant cell nuclei
results in replicational release of full-length, circular
geminivirus genomes.
[0069] To construct CaLCuV A components encoding repair template
sequence, the coat protein (AR-1) coding sequence was replaced with
desired sequence. AR-1 is required for insect-transmission of the
virus, but it is not required for viral amplification and systemic
spreading. Because of this, approximately 800 nucleotides can be
added to the A component genome without preventing its ability to
infect. Viral vectors encoding repair templates targeting the ADH1
and gus::nptII loci use the pCPCbLCVA.007 backbone. pCPCbLCVA.007
is a plasmid initially designed for viral induced gene silencing
(VIGS). It encodes a partially duplicated A component with the AR-1
nucleotide sequence replaced with a multicloning site (MCS).
Co-bombardment of Arabidopsis plants with pCPCbLCVA.007 (FIG. 4A)
and pCPCbLCVB.002 (FIG. 4B) (encoding a partially duplicated B
genome) results in a high-frequency of successful infection
(75-100%).
Constructing First Generation Viral Vectors with Repair Templates
Targeting ADH1
[0070] An ADH1-targeting repair template was constructed for
ligation into pCPCbLCVA.007. The template for amplifying the ADH1
repair template was genomic DNA from Arabidopsis thaliana (ecotype
Columbia). To isolate genomic DNA, about 100 mg of leaf tissue was
frozen in liquid nitrogen and ground to a fine powder. 500 .mu.l of
CTAB buffer (2.0 g hexadecyl trimethyl-ammonium bromide (CTAB)), 10
mL 1M tris pH 8.0, 4 mL 0.5M ethylenediaminetetraacetic acid
di-sodium salt (EDTA), 28 mL 5M NaCl, 40 mL dH.sub.2O, pH adjusted
to 5.0 per 100 mL of solution) was added and the samples were
incubated at 65.degree. C. for 20 min. Samples were centrifuged for
5 minutes at 12,000 RPM and the supernatant was transferred to a
clean microfuge tube. 500 .mu.A of chloroform was added and the
samples were inverted for 5 minutes at room temperature. Samples
were centrifuged for 1 minute at 12,000 RPM and the supernatant was
transferred to a clean microfuge tube. 800 .mu.l of ice-cold 100%
ethanol was added and the samples were centrifuged for 1 minute at
15,000 RPM. The supernatant was decanted and the genomic DNA pellet
was washed once in 75% ethanol. Samples were centrifuged for 30
seconds at 13,000 RPM and the supernatant was completely removed.
Last, the genomic DNA was resuspended in 50 .mu.l of dH.sub.2O.
Repair templates targeting ADH1 were designed to encode a unique 18
bp modification sequence (5'-GAGCTCAGTACTGC ATGC-3'; SEQ ID NO:1)
flanked by arms of homology to the ADH1-ZFN target site. Several
repair templates were constructed with varying lengths of homology
for each arm. In total, four repair templates were made with 491,
391, 291, or 191 nucleotides of homology in each arm. Notably, the
modification was designed to remove the native ZFN binding site,
which prevents cleavage of the repair template before and after GT.
To generate ADH1 repair templates for cloning into pCPCbLCVA.007,
left and right homology sequences were amplified from Arabidopsis
genomic DNA using primers NB177+NB128 and NB178+NB129 for 491 bp
homology arms, NB104+NB128 and NB112+NB129 for 391 bp homology
arms, NB105+NB207 and NB113+NB208 for 291 bp homology arms, and
NB106+NB207 and NB114+NB208 for 191 bp homology arms, respectively.
Primer sequences are provided in Table 1. Importantly, the reverse
primers for the left homology arm and the forward primers for the
right homology arm contained complementary 18 bp linkers encoding
the modification sequence. Also, the forward primers for the left
homology arm and the reverse primer for the right homology arm
contained linkers encoding XbaI and BglII restriction enzyme sites,
respectively. PCR reactions were performed in a 25 .mu.l PCR mix
composed of 2.5 .mu.l of 10.times.NEB Standard Taq buffer, 0.5
.mu.l of 10 mM dNTPs, 0.5 .mu.l of 10 .mu.M primer 1, 0.5 .mu.l of
10 .mu.M primer 2, 18.8 .mu.l of dH.sub.2O, 0.2 .mu.l of Taq
polymerase, and 2 .mu.l of genomic DNA (.about.200 ng). The PCR
conditions were 5 minutes at 94.degree. C. followed by 30 cycles of
30 seconds at 94.degree. C., 30 seconds at 55.degree. C., and 1
minute at 72.degree. C. The resulting amplicons were resolved by
agarose electrophoresis using a 1% gel. DNA bands of expected sizes
were excised from the agarose gel and purified using the QIAquick
Gel Extraction Kit (Qiagen) following manufacturer's protocols.
Purified DNA fragments containing the left and right homology arms
were then fused together in an overlap-extension PCR (OE-PCR).
Fusion reactions were performed in a 24 .mu.l PCR mix composed of
2.5 .mu.l of 10.times. cloned Pfu buffer, 0.5 .mu.l of 10 mM dNTPs,
14.5 .mu.l of dH.sub.2O, 0.5 .mu.l of Pfu enzyme, and 3 .mu.l each
of the purified amplicons. Fusion conditions were 5 minutes at
94.degree. C. followed by 10 cycles of 30 seconds at 94.degree. C.,
30 seconds at 50.degree. C., and 1 minute at 72.degree. C.
Following the fusion PCR, 0.5 .mu.l of 10 .mu.M primer 1 and 0.5
.mu.l of 10 .mu.M primer 2 were added and the samples were run in
another PCR. The PCR conditions were 5 minutes at 94.degree. C.
followed by 30 cycles of 30 seconds at 94.degree. C., 30 seconds at
56.degree. C., and 1 minute at 72.degree. C. Following OE-PCR, 10
.mu.l of the PCR solution and 1 .mu.g of pCPCbLCVA.007 were
digested with XbaI and BglII following standard procedures. The
resulting digested amplicons and vector were resolved by agarose
electrophoresis using a 1% gel. DNA bands of expected sizes were
excised from the agarose gel and purified and ligated together in a
10 .mu.l reaction using T4 DNA ligase (New England Biolabs)
following the manufacturer's procedures. DH5.alpha. E. coli were
transformed with 2 .mu.l of the ligation mix following standard
procedures and plated onto LB media containing 50 .mu.g/ml of
carbenicillin. DNA sequences of resulting clones were confirmed by
sequencing to encode the expected repair template. These vectors
are henceforth referred to as CaLCuVA.ADH1-1000, CaLCuVA.ADH1-800,
CaLCuVA.ADH1-600, and CaLCuVA.ADH1-400.
Constructing First Generation Viral Vectors with Repair Templates
Targeting Gus::nptII
[0071] The following describes methods for constructing GUS-FIX
repair templates for ligation into pCPCbLCVA.007. The chromosomal
target for the repair template is a GUS transgene with .about.300
bp of nucleotide sequence removed from the 3' end and replaced with
a Zif268 target site. GUS-FIX repair templates were designed to
contain flanking arms of homology to the target locus (200 bp each)
and a 300 bp modification sequence. As a consequence of GT, the
coding sequence of GUS is restored. Cells actively expressing GUS
can be phenotypically detected by an enzymatic assay. To generate
GUS-FIX repair templates for cloning into pCPCbLCVA.007, the left
homology arm (also containing the 300 bp of GUS-FIX sequence) and
the right homology arm were amplified from pDW1269 plasmid DNA
using primers NB274+NB271 and NB272+NB275, respectively.
Importantly, the left and right homology arms contained
complementary sequences to enable their fusion in OE-PCR. PCR
reactions to generate the fragments were performed in a 25 .mu.l
mix composed of 2.5 .mu.l of 10.times.NEB Standard Taq buffer, 0.5
.mu.l of 10 mM dNTPs, 0.5 .mu.l of 10 .mu.M primer 1, 0.5 .mu.l of
10 .mu.M primer 2, 18.8 .mu.l of dH.sub.2O, 0.2 .mu.l of Taq
polymerase, and 2 .mu.l of genomic DNA (.about.200 ng). The PCR
conditions were 5 minutes at 94.degree. C. followed by 30 cycles of
30 seconds at 94.degree. C., 30 seconds at 55.degree. C., and 1
minute at 72.degree. C. The resulting amplicons were resolved by
agarose electrophoresis using a 1% gel. DNA bands of expected sizes
were purified and ligated together in an OE-PCR. Fusion reactions
were performed in a 24 .mu.l mix composed of 2.5 .mu.l of 10.times.
cloned Pfu buffer, 0.5 .mu.l of 10 mM dNTPs, 14.5 .mu.l of
dH.sub.2O, 0.5 .mu.l of Pfu enzyme, and 3 .mu.l each of the
purified amplicons. Fusion conditions were 5 minutes at 94.degree.
C. followed by 10 cycles of 30 seconds at 94.degree. C., 30 seconds
at 50.degree. C., and 1 minute at 72.degree. C. Next, 0.5 .mu.l of
10 .mu.M primer NB274 and 0.5 .mu.l of 10 .mu.M primer NB275 were
directly added to the fusion reactions and immediately run in
another PCR. The PCR conditions were 5 minutes at 94.degree. C.
followed by 30 cycles of 30 seconds at 94.degree. C., 30 seconds at
56.degree. C., and 1 minute at 72.degree. C. Following OE-PCR, 10
.mu.l of solution and 1 .mu.g of pCPCbLCVA.007 were digested with
XbaI and BglII following standard procedures. The resulting
digested amplicons and vector were resolved by agarose
electrophoresis using a 1% gel. DNA bands of expected sizes were
purified and ligated in a 10 .mu.l reaction using T4 DNA ligase.
DH5.alpha. E. coli were transformed with 2 .mu.l of the ligation
mix following standard procedures, and plated onto LB media
containing 50 .mu.g/ml of carbenicillin. The DNA sequence of a
resulting clone was confirmed to encode the GUS-FIX repair template
sequence. This vector is referred to as CaLCuVA.GUS-FIX.
Growing Arabidopsis Plants
[0072] To prepare Arabidopsis plants for biolistic bombardment,
500-1,000 Arabidopsis seeds (10-20 mg) were stratified in 0.1%
agarose for 3 days at 4.degree. C. Seeds were dispensed onto the
surface of BM2 soil (J.R. Johnson Supply; Minneapolis, Minn.) in
each of the four corners of 2.5.times.2.5 inch pots. Pots were
placed in a plastic flat and 1 L of 10-20-10 Peters Professional
(Scotts) fertilizer solution was added. Flats were covered with a
clear plastic dome and moved to a growth chamber under 12 h
light/12 h dark conditions. Plants were grown at 22-24.degree. C.
for 2 weeks before removing the dome, and then grown for an
additional 1-2 weeks with watering when needed. Watering was
stopped approximately 7 days before bombardment. Plants were
bombarded when they reached the five- to six-leaf-stage
(approximately four weeks).
Infecting Arabidopsis Plants by Biolistic Bombardment
[0073] Biolistic bombardment was carried out closely following the
protocol described by Muangsan et al., Meth. Mol. Biol.,
265:101-115, 2004. Briefly, to prepare microprojectile particles
for five bombardments, 5 .mu.g of each plasmid (CaLCuVA and
CaLCuVB) was added to a tube containing 50 .mu.l of 60 mg/mL gold
beads and briefly vortexed. 50 .mu.l of 2.5 M CaCl.sub.2 was
directly added to the samples and immediately pipetted in and out
of a tip to break up conglomerates. 20 .mu.l of 0.1 M spermidine
was added and the samples were immediately vortexed for 5 min. The
samples were centrifuged at 10,000 RPM for 10 seconds and the
supernatant was removed. The gold-bead pellet was resuspended in
250 .mu.l of 100% ethanol and then centrifuged at 10,000 rpm for 10
sec. Supernatants were removed and the samples were resuspended in
65 .mu.l of 100% ethanol. The particles were then stored on ice
until bombardment. To prepare the assembly for the microprojectile
particles, macrocarrier holders and macrocarriers were soaked in
95% ethanol, air-dried, and assembled. 10 .mu.l of resuspended
particles were then spotted onto the center of the macrocarrier and
allowed to air-dry.
[0074] Biolistic bombardment was carried out in a horizontal
laminar flow hood using a PDS-1000 He system (Bio-Rad). To prepare
the PDS-1000 He system, a non-sterile rupture disk (1100 psi) was
dipped in 100% isopropanol and placed into the upper assembly. The
macrocarrier launch assembly (MCLA) was then prepared by dipping a
metal stopping screen in 95% ethanol, and then placing the dried
screen onto the opening of the lower assembly. The macrocarrier and
macrocarrier holder were inverted and placed above the stopping
screen. The retaining ring was screwed in, and the MCLA was placed
into the top rack of the chamber. A single pot containing four
plants was then placed in the chamber directly beneath the MCLA. A
vacuum of 28 in was created, and helium was added to the upper
chamber until the rupture disk burst. Bombarded plants were then
removed from the chamber and returned to a covered flat. Between
bombardments of different constructs, the chamber was cleaned with
70% ethanol. This procedure was repeated for additional infections.
By following these methods, infection was successfully initiated in
majority of the bombarded plants (75-100%).
Growing Infected Arabidopsis Plants
[0075] Immediately after bombardment, infected Arabidopsis plants
were placed in a flat with approximately 1 L of fertilizer solution
and moved back to the growth chamber. A clear plastic dome was used
to cover the plants for seven days post infection. Infection was
noticeable 8-10 dpi by curling of rosette leaves. At 14 dpi, plants
containing an XVE ADH1-ZFN transgene were induced by exposure to
.beta.-estradiol (Sigma E2758) by spraying and watering. The spray
contained 0.01% Silwet L-77 (Vac-In-Stuff) and 20 .mu.M
.beta.-estradiol, while the water contained only 20 .mu.M
.beta.-estradiol. Induction was carried out by continuously
spraying (approximately once a day) and watering (approximately
twice a week) for 10-14 days.
Isolating Genomic DNA from Infected Arabidopsis Plants
[0076] About two weeks after induction, genomic DNA was extracted
from somatic plant tissue. A single rosette leaf and cauline leaf
were collected from each infected plant. Care was taken when
choosing leaves in order to minimize the likelihood of detecting
recombination between plasmid molecules and genomic DNA. Criteria
for choosing rosette leaves were 1) healthy leaf tissue with no
obvious necrotic lesions, and 2) leaves growing on the periphery of
the pot--away from damage caused by biolistic bombardment. Plant
genomic DNA was extracted following the CTAB procedure as described
above.
Assessing .beta.-Estradiol Induction of the ADH1-ZFN Transgene
[0077] To determine if induction of nuclease expression by
.beta.-estradiol was successful, enrichment PCR was performed on
purified genomic DNA. Enrichment PCR is designed to detect
ZFN-induced NHEJ mutations at the ADH1 target locus--an indirect
assay for verifying nuclease activity. This procedure relies on a
restriction enzyme site positioned in or near the target site
spacer sequence. In essence, if the nuclease is not active, then
target site amplicons will be completely digested by the
restriction enzyme. On the other hand, if the nuclease is active
there will be a population of target site amplicons with destroyed
restriction enzymes sites that will not be digested by the
restriction enzyme. Thus, detection of a digestion-resistant band
suggests that the nuclease was actively creating DSBs.
[0078] For these assays, 1 .mu.g of genomic DNA from induced and
non-induced plants was digested with BstXI (NEB) in a 10 .mu.l
solution following standard procedures. Immediately following
digestion, 2 .mu.l of the solution was used as a template for PCR
in a reaction containing of 2.5 .mu.l of 10.times.NEB Standard Taq
buffer, 0.5 .mu.l of 10 mM dNTPs, 0.5 .mu.l of 10 .mu.M primer
NB161, 0.5 .mu.l of 10 .mu.M primer NB154, 18.8 .mu.l of dH.sub.2O,
0.2 .mu.l of Taq polymerase, and 2 .mu.l of the digested solution
(.about.200 ng genomic DNA). The PCR conditions were 5 minutes at
94.degree. C. followed by 35 cycles of 30 seconds at 94.degree. C.,
30 seconds at 55.degree. C., and 1 minute at 72.degree. C. 10 .mu.l
of the PCR reaction was then digested with BstXI. The entire
digested sample and the corresponding PCR sample were loaded
side-by-side onto a 1.2% agarose gel. In general, plants that were
not exposed to estradiol had very faint, or undetectable,
digestion-resistant amplicons (FIG. 5, bottom row, digested ("D")
lanes). Conversely, plants exposed to .beta.-estradiol had much
stronger resistant bands (FIG. 5, top row, digested ("D") lanes).
From these data, it was concluded that the timing of ADH1-targeted
DSBs was controlled by .beta.-estradiol.
Assessing Repair Template Stability in Infected Plants
[0079] To ensure that the repair template was stably replicated in
infected plants, PCR was performed on purified genomic DNA.
Notably, DNA isolated from infected plants is a mixture of plant
genomic DNA and virus genomic DNA. Primers were designed to
recognize viral sequence (non-repair template sequence) in the
CaLCuV A plasmid (FIG. 6, left panel), and to amplify across the
entire repair template sequence. PCR reactions contained 2.5 .mu.l
of 10.times.NEB Standard Taq buffer, 0.5 .mu.l of 10 mM dNTPs, 0.5
.mu.l of 10 .mu.M primer NB153, 0.5 .mu.l of 10 .mu.M primer NB158,
18.8 .mu.l of dH.sub.2O, 0.2 .mu.l of Taq polymerase, and 2 .mu.l
of purified genomic DNA (.about.200 ng). The PCR conditions were 5
minutes at 94.degree. C. followed by 35 cycles of 30 seconds at
94.degree. C., 30 seconds at 55.degree. C., and 1 minute at
72.degree. C. 10 .mu.l of the PCR sample was loaded onto a 1.0%
agarose gel. FIG. 6 (right panel) shows the resulting amplicons
from infected plants carrying repair templates ranging from 400 nt
to 1000 nt. These results suggested that repair templates equal to
or less than 715 bp were stably replicated in plant cells. For this
reason, only viruses carrying repair templates equal or less than
715 bp were assessed in the subsequent experiments. Based on these
experiments, it was concluded that first generation geminiviral
vectors effectively amplified and disseminated repair templates in
Arabidopsis plants.
Detecting GT at the ADH1 Locus
[0080] Nested PCR was performed to detect modified ADH1 loci.
Primers were designed to amplify the ADH1 locus approximately 700
bp upstream and downstream of the ZFN target sequence. The
resulting amplicons were then used as a template for a nested PCR,
with primers that specifically recognize the unique 18 bp
modification sequence and ADH1 sequence outside the homology arms
carried by the virus. In detail, the ADH1 locus was amplified in a
PCR reaction containing 2.5 .mu.l of 10.times.NEB Standard Taq
buffer, 0.5 .mu.l of 10 mM dNTPs, 0.5 .mu.l of 10 .mu.M primer
NB257, 0.5 .mu.l of 10 .mu.M primer NB258, 18.8 .mu.l of dH.sub.2O,
0.2 .mu.l of Taq polymerase, and 2 .mu.l of purified genomic DNA
(.about.200 ng). The PCR conditions were 5 minutes at 94.degree. C.
followed by 15 cycles of 30 seconds at 94.degree. C., 30 seconds at
55.degree. C., and 1 minute at 72.degree. C. Amplicons were column
purified using the QIAquick Gel Extraction Kit. Purified amplicons
were then used as templates for three nested PCRs. The first PCR
checked for the 5' modification junction using primers NB154 and
NB264. The second PCR checked for the 3' modification junction
using primers NB263 and NB155. The third PCR was a control for
template amplification and used primers NB155 and NB154. To
minimize template switching, PCR was performed using Expand Long
Template PCR system (Roche) in a reaction containing 2.5 .mu.l
buffer 1, 0.5 .mu.l 10 mM dNTPs, 0.5 .mu.l of 10 .mu.M primer 1,
0.5 .mu.l of 10 .mu.M primer 2, 0.2 .mu.l of the Taq/Tgo polymerase
mix, 17.8 .mu.l dH.sub.2O, and 3 .mu.l of purified amplicons. The
PCR conditions were 5 minutes at 94.degree. C. followed by 30
cycles of 30 seconds at 94.degree. C., 30 seconds at 55.degree. C.,
and 1 minute at 72.degree. C. Amplicons were run on a 1% agarose
gel. In select plants (KU70 -/-, ADH1-ZFN +1+ background) that were
infected with virus and exposed to .beta.-estradiol, a noticeable
amplicon band was present in both the 5' and 3' junction PCRs (FIG.
7). Importantly, plants (Columbia background) that were only
infected with the virus did not have detectable amplicons for the
5' and 3' junction PCR. From these results it was concluded that
geminiviruses and ZFNs can stimulate GT at an endogenous locus in
somatic leaf tissue.
Delivery of Zif268-ZFN for GT at the Gus::nptII Locus
[0081] GT was stimulated at the gus::nptII transgene. To detect GT
by phenotype, plants containing a stably integrated gus::nptII
transgene were infected with CaLCuVA.GUS-FIX and CaLCuVB following
the procedures described above. Notably, immediately following the
truncated GUS nucleotide sequence was a target site for Zif268. For
these experiments, Zif268::FokI was transiently delivered to plants
8 dpi by TRV. TRV is a bipartite RNA plant virus that can be used
to transiently deliver protein coding sequences to plant cells. In
the present experiments, TRV was modified to express Zif268::FokI
by replacing the 2b and 2c nucleotide sequences with a subgenomic
promoter and the ORF for the Zif268::FokI. Infection was carried
out by syringe infiltration of Agrobacterium carrying T-DNA coding
for both TRV genomes. Briefly, GV3101 Agrobacterium carrying T-DNA
encoding for TRV1 and TRV2-Zif268 were grown overnight at
28.degree. C. in 3 mL of LB medium containing 50 .mu.g/mL kanamycin
and 50 .mu.g/mL gentamycin. One mL of the culture was transferred
to 100 mL LB medium containing 50 .mu.g/mL kanamycin and 50
.mu.g/mL gentamycin and grown overnight at 28.degree. C. until they
reached an OD of approximately 1.0. Solutions were then centrifuged
at 7000 RPM for 10 minutes and resuspended in 50 mL of MMAi
solution (0.5 g MS salts, 0.195 g MES, 2 g sucrose, 100 .mu.l of
200 mM acetosyringone per 100 mL at pH 5.6) followed by shaking at
50 rpm for 2 hours. Solutions of Agrobacterium containing TRV1 and
TRV2-Zif268 were mixed in a 1:1 ratio and syringe infiltrated into
three rosette leaves per plant. TRV and geminivirus infected plants
were moved to a growth chamber under 12 h light/12 h dark
conditions at 22-24.degree. C. for 15 days.
Detecting GT at the Gus::nptII Locus
[0082] To detect evidence for GT at the gus::nptII locus, plants
were analyzed for cells expressing functional GUS protein. Fifteen
days after TRV infection and 23 days after geminivirus infection,
plants were stained overnight at 37.degree. C. in an X-Gluc
solution (0.052 g X-Gluc (GoldBio), 5 mL 1M sodium phosphate, 0.1
mL Triton X per 100 mL). Plants were removed from the stain and
incubated in 75% ethanol for 2-3 days to remove chlorophyll (which
helped with visualizing the blue staining) Plants were visualized
using a stereoscope. If GT occurred, spots of blue were observed
where one or multiple cells had reconstituted GUS expression. Such
blue spots also were observed in tissue that developed after
biolistic bombardment. FIG. 8 shows images of plants co-infected
with CaLCuVA.GUS-FIX and CaLCuVB (or with either plasmid alone)
that were stained in X-gluc. The spotty patches of blue staining in
the rosette leaves and in the newly developed tissue suggested that
GT had occurred. These results indicated that geminiviruses and
ZFNs can stimulate GT at a gus::nptII transgene in plant somatic
tissue.
Approach for Generating Bean Yellow Dwarf Virus Replicon
Vectors
[0083] An exemplary method for generating bean yellow dwarf virus
(BeYDV) replicons in plant cells involves delivery of one or two
plasmids or T-DNA molecules that encode the trans-acting
replication-associated proteins, Rep/RepA, and direct duplications
of the large intergenic region (LIR) flanking sequence encoding the
small intergenic region (SIR; FIGS. 9-10). Normally, virus
replication is initiated by Rep protein binding to LIR sequence on
a circular dsDNA genome. However, if the geminivirus genome is
linearized and contains flanking LIR sequences (also referred to as
an LSL vector), Rep proteins bind to the LIR sequences and release
circularized, single-stranded geminiviral replicons (GVRs).
Replicons can then be used as a template for replicase-mediated
genome amplification. Consequently, any sequence present inside the
flanking LIRs will be present in the replicon. Eliminating coat
protein and movement protein sequence abolishes cell-cell movement,
but significantly lessens genome-size restraints imposed by
plasmodesmata. To compensate for loss of cell-cell movement,
Agrobacterium was used to direct GVR production in specific cells.
To facilitate cloning of endonuclease and repair template sequence
into an LSL destination vector, MultiSite Gateway cloning
technology (Invitrogen) was implemented.
Constructing an LSL Destination T-DNA Plasmid
[0084] The following describes methods for constructing a
BeYDV-derived LSL destination T-DNA plasmid (pLSL; FIGS. 9-10).
Assembly of the complete LSL nucleotide sequence was accomplished
by cloning smaller "blocks" of LSL sequence into pBluescript KS+
plasmids before cloning into a pCAMBIA1300 T-DNA backbone. The
first block was designed to contain LIR::DEM2 splice acceptor (last
62 nt of the DEM2 intron)::tobacco etch virus (TEV) 5' UTR (last 93
nt of the TEV 5' UTR)::attR1::chloramphenicol resistance gene
(CmR). The second block contained ccdB::attR2::SIR. The third block
contained 2.times.35S::TEV 5' UTR (first 38 nt of the TEV 5'
UTR)::DEM2 splice donor (first 32 nt of the DEM2 intron)::LIR. LIR
and SIR sequences were obtained from the mild BeYDV isolate
(GenBank accession number DQ458791.1). To generate attR1::CmR
sequence for block 1, pFZ19 was used as a template for PCR
amplification using primers NB326 and NB327. PCR solutions
contained 2.5 .mu.l of 10.times. cloned Pfu buffer, 0.5 .mu.l of 10
mM dNTPs, 0.5 .mu.l of 10 .mu.M primer NB326, 0.5 .mu.l of 10 .mu.M
primer NB327, 18.5 .mu.l of dH.sub.2O, 0.5 .mu.l of Pfu enzyme, and
2 .mu.l of plasmid DNA (.about.20 ng). PCR cycling included 5
minutes at 94.degree. C., followed by 30 cycles of 30 seconds at
94.degree. C., 30 seconds at 55.degree. C., and 2 minutes at
72.degree. C. PCR amplicons were column purified using the QIAquick
gel extraction kit. Purified amplicons were then used in an OE-PCR
with NB330 and NB331 to generate the complete nucleotide sequence
for block 1. OE-PCR solutions contained 2.5 .mu.l of 10.times.
cloned Pfu buffer, 0.5 .mu.l of 10 mM dNTPs, 0.5 .mu.l of 10 .mu.M
primer NB327, 0.5 .mu.l of 10 .mu.M primer NB325, 14.5 .mu.l of
dH.sub.2O, 0.5 .mu.l of Pfu enzyme, and 2 .mu.l of purified
amplicons, NB330 (2 ng) and NB331 (2 ng). PCR cycling consisted of
5 minutes at 94.degree. C., followed by 30 cycles of 30 seconds at
94.degree. C., 30 seconds at 55.degree. C., and 4 minutes at
72.degree. C. Amplicons and 1 .mu.g of pBluescript KS+ vector were
digested with Kpnl and XbaI. Digested fragments were purified and
ligated following standard procedures. The resulting ligation was
transformed into DH5.alpha. E. coli cells following standard
procedures. Herein, the sequence verified plasmid containing block
1 is termed pBlock1. Blocks 2 and 3 were constructed using similar
methods. Construction of Block 2 first required amplification and
purification of ccdB::attR2 from pFZ19 using primers NB328 and
NB332. Purified amplicons were added to an OE-PCR with NB344 and
primers NB328+NB329 to generate the complete nucleotide sequence
for block 2. Purified amplicons were ligated into pBluescript KS+
with XbaI and SacI and transformed into ccdB-resistant XL-1 Blue
cells to generate pBlock2. Construction of block 3 first required
PCR amplification of 2.times.35S sequence from pMDC32 using primers
NB333+NB334. To generate the complete nucleotide sequence for block
3, purified amplicons were used in an OE-PCR with NB335 and NB336
using primers NB333 and NB337. Purified amplicons were ligated into
pBluescript KS+ with XhoI and SacI, and transformed into DH5.alpha.
cells to generate pBlock3. Nucleotide sequences for the two LIR
elements in pBlock1 and pBlock3 were designed to contain inverted
homodimeric BsaI to facilitate cloning of the conserved hairpin
structure. To complete the hairpin structure, pBlock1 and pBlock3
were digested with BsaI and gel purified. Primers NB338 and NB339
were dephosphorylated, annealed, ligated into pBlock1 and pBlock3
vector backbones, and transformed into DH5.alpha. to generate
pBlock1 HP and pBlock3HP. To construct the final LSL vector,
pBlock1HP, pBlock2, pBlock3HP, pCAMBIA1300 were digested with
SbfI+XbaI, XbaI+XhoI, XhoI+SbfI, and SbfI, respectively. Fragments
of the expected sizes were gel purified, ligated, and transformed
into ccdB-resistant XL-1 Blue cells following standard protocols
for 4-way ligations. The resulting plasmid (pLSL, FIG. 10C) was
sequence verified and used as a destination vector for MultiSite
Gateway cloning.
Constructing a Nuclease-Entry Plasmid
[0085] A nuclease-entry vector was constructed for MultiSite
Gateway cloning into pLSL (pNJB091; FIG. 10B). Four unique
restriction enzyme sites immediately upstream of two FokI coding
sequences allows for sequential cloning of custom-designed DNA
binding domains. To construct pNJB091, pZHY013 (a modified pCR8
entry vector encoding FokI heterodimer sequences; FIG. 10A) and
NB318 were digested with BsmI and EcoRV. Digested fragments were
gel purified, ligated and transformed into DH5.alpha. cells
following standard protocols.
Constructing a Donor-Entry Plasmid
[0086] A donor-entry vector was constructed for MultiSite Gateway
cloning into pLSL (pNJB080; FIG. 10B). Two unique pairs of
restriction enzyme sites flanking ccdB and CmR selection markers
permit efficient cloning of repair templates. To construct pNJB80,
sequence encoding the CmR and ccdB genes was amplified by PCR from
pFZ19 using NB316+NB317 primers. Amplicons were purified and used
in an OE-PCR with NB314 and primers NB315 and NB317. PCR solutions
contained 2.5 .mu.l of 10.times. cloned Pfu buffer, 0.5 .mu.l of 10
mM dNTPs, 0.5 .mu.l of 10 .mu.M NB315, 0.5 .mu.l of 10 .mu.M NB317,
16.5 .mu.l of dH.sub.2O, 0.5 .mu.l of Pfu enzyme, 2 .mu.l of
purified amplicons, and 2 .mu.l of 10 .mu.M NB314. PCR cycling
included 5 minutes at 94.degree. C., followed by 30 cycles of 30
seconds at 94.degree. C., 30 seconds at 55.degree. C., and 3
minutes at 72.degree. C. Resulting amplicons were gel purified
following standard procedures. Amplicons and pZHY558 were digested
with ApaI and BsrGI, ligated, and transformed into ccdB-resistant
cells following standard procedures. MultiSite Gateway
recombination with pNEL1R5 into pLSL positions repair template
sequence between two transcriptional-termination sequences
(upstream Nos-T sequence and downstream SIR sequence). The studies
herein may benefit from flanking termination sequences. For
example, transcriptional gene silencing is facilitated through
production of RNA molecules with homology to an endogenous gene.
Reducing read-through transcription of repair template sequence may
decrease unintentional silencing of targeted genes.
Constructing Replicase-Expressing T-DNA Plasmids
[0087] To initiate replicational release of GVRs from LSL T-DNA,
trans-acting Rep/RepA proteins must be expressed. Here, two
Rep/RepA T-DNA expression plasmids were constructed. The first
plasmid encodes the Rep/RepA coding sequence downstream of an
estradiol-inducible XVE promoter (pXVEREP), such that when
integrated into the plant genome, Rep/RepA expression can be
induced by exposing plant tissue to .beta.-estradiol. The second
plasmid encodes Rep/RepA downstream of a 2.times.35S promoter
(p35SREP). For each plasmid, WT RepA and mutant RepA (RepA LxCxQ;
Liu et al., Virology 256:270-279, 1999) versions are created
(pXVEREPLxCxQ and p35SREPLxCxQ). Normally, RepA interacts with the
host cell's retinoblastoma (RB) protein, sequestering its
repressive activity on E2F. This promotes entry into S phase, and,
in turn, provides the invading geminivirus with replication
machinery needed to amplify its genome. The studies described
herein may benefit from a RepA protein that does not interact with
RB. For example, in actively dividing meristem cells or germline
cells, factors required for replicon amplification should already
be present. Thus, there may be little need to inactivate RB in
these cell types. Furthermore, expression of RepA LxCxQ may result
in decreased toxicity in these cell types--which may facilitate
recovery of modified seeds.
[0088] To generate pXVEREP, p35SREP, pXVEREPLxCxQ, and p35SREPLxCxQ
(FIG. 11), WT and mutant Rep/RepA coding sequences were amplified
by OE-PCR using NB319, NB320, and NB322, and primers NB323 and
NB324 (WT Rep/RepA), or using NB319, NB321, and NB322, and primers
NB323 and NB324 (mutant Rep/RepA). PCR solutions consisted of 2.5
.mu.l of 10.times. cloned Pfu buffer, 0.5 .mu.l of 10 mM dNTPs, 0.5
.mu.l of 10 .mu.M NB323, 0.5 .mu.l of 10 .mu.M NB324, 14.5 .mu.l of
dH.sub.2O, 0.5 .mu.l of Pfu enzyme, and 2 .mu.l of each DNA
component. PCR cycling included 5 minutes at 94.degree. C.,
followed by 30 cycles of 30 seconds at 94.degree. C., 30 seconds at
55.degree. C., and 3 minutes at 72.degree. C. Resulting amplicons
were purified using the QIAquick gel extraction kit. One .mu.l of
purified amplicons was combined with 150 ng of pFZ19 or pMDC32
(2.times.35S Ti-DNA vector) and recombination was stimulated using
LR clonase (Invitrogen) as described by the manufacturer's
protocol. Plasmid from the resulting solution was transformed into
DH5.alpha., and cells were plated on LB plates containing 50
.mu.g/mL kanamycin.
Demonstrating Transient Delivery of Reporter Proteins in Nicotiana
tabacum Leaf Tissue Using GVRs
[0089] Functionality of the system was tested by attempting to
transiently express reporter proteins in somatic leaf tissue. To
this end, pLSL was modified to encode NLS-tagged green fluorescent
protein (pLSLGFP) or beta-glucuronidase (pLSLGUS). GFP and GUS
nucleotide sequence were amplified from, respectively, pTC23 and
pNB67 using primers NB362 and NB363, and primers NB448 and NB449.
Forward and reverse primers contained XbaI and AatII restriction
enzyme sites, respectively for cloning into pNB091. The resulting
vectors were used in a MultiSite Gateway recombination reaction
with pLSL and pNB098 (a modified version of pNB080 with a repair
template to correct a non-functional gus::nptII transgene) to
generate pLSLGFP and pLSLGUS. These vectors were sequence verified
and transformed into Agrobacterium tumefaciens GV3101 by the
freeze-thaw method. Single colonies of transformed Agrobacterium
were grown overnight in a shaker at 28.degree. C. in 5 mL of LB
starter culture with 50 .mu.g/ml kanamycin and 50 .mu.g/ml
gentamicin. The next day, 1 ml was used to inoculate 50 mL of LB
culture with 50 .mu.g/ml kanamycin and 50 .mu.g/ml gentamicin.
After reaching an OD.sub.600 of 1 (approximately 16 hours), cells
were pelleted, and resuspended to an OD.sub.600 of 0.2 in
infiltration buffer (10 mM 2-(N-morpholino) ethanesulfonic acid
(MES), and 10 mM MgSO.sub.4, pH 5.6). Resuspended cultures were
incubated at room temperature for 2 hours before infiltration. To
demonstrate transient expression of GUS, half leaves were fully
infiltrated with Agrobacterium containing pLSLGUS or a 1:1 mixture
of Agrobacterium containing pLSLGUS and p35SREP. Seven dpi infected
leaf tissue was excised from the plant and stained in X-Gluc for 24
hours at 37.degree. C. Chlorophyll was removed using 80% ethanol,
and leaf images were taken (FIG. 12). To demonstrate transient
expression of GFP, three leaves were syringe infiltrated with
Agrobacterium containing pLSLGFP, or infiltrated with a 1:1 mixture
of Agrobacterium containing pLSLGFP and p35SREP or pLSLGUS and
p35SREP. Images capturing GFP fluorescence were taken 3, 7, and 12
dpi (FIG. 13). Both GUS and GFP expression were markedly enhanced
when p35SREP was co-delivered. Notably, a slight browning of leaf
tissue was observed 7 dpi due to replicase expression (FIG. 14). To
correlate enhanced protein expression with replicon production,
Rep-assisted replicational release was evaluated by PCR (FIG. 15,
top). To this end, DNA was extracted from leaf tissue infiltrated
with Agrobacterium containing pLSLGFP or pLSLGUS, or infiltrated
with a 1:1 mixture of Agrobacterium containing pLSLGFP or pLSLGUS
and p35SREP. Circular replicons were detected by PCR using primers
NB415 and NB416. Template switching was minimized by using the
Expand Long Template PCR mix (Roche) following manufacturer's
protocols. Strong amplification of LIR sequence only from samples
co-transformed with p35SREP suggests that GVRs were present in the
transformed cells (FIG. 15, bottom). Taken together, these data
illustrate that GVRs can facilitate transient delivery of reporter
proteins.
Demonstrating Targeted Mutagenesis by Delivery of ZFNs in Nicotiana
tabacum Leaf Tissue Using GVRs
[0090] To demonstrate targeted mutagenesis, pLSL was modified to
encode a Zif268::FokI ZFN. Zif268::FokI sequence was amplified from
pDW1345 using primers NB379 and NB380. Forward and reverse primers
contained XbaI and AatII restriction enzyme sites for cloning into
pNJB091. The resulting vector was used in a MultiSite Gateway
recombination reaction with pLSL and pNB098 to generate pLSLZ.D.
The resulting vectors were sequence verified and transformed into
Agrobacterium tumefaciens GV3101 by the freeze-thaw method. Target
sequence for Zif268 is present within a gus::nptII reporter gene
that is stably integrated in the genome of N. tabacum plants (FIG.
16). Leaf tissue was syringe infiltrated with Agrobacterium
containing pLSLZ.D, or coinfiltrated with Agrobacterium containing
pLSLZ.D and p35SREP. Plant DNA was extracted seven dpi,
replicational release was verified (FIG. 17), and Zif268 target
sequence was analyzed for ZFN-induced non-homologous end joining
(NHEJ) mutations. To this end, a 484 bp DNA sequence, encoding the
Zif268 target sequence, was amplified by PCR using primers NB422
and NB424. The resulting amplicons were purified and used as a
template in a second PCR with primers NB396 and NB307 (FIG. 18).
The PCR product was digested overnight with MseI and separated on
an agarose gel. Cleavage-resistant products, present only in the
pLSLZD and p35SREP lane, were cloned and sequenced (FIG. 18). Six
out of eight sequenced clones contained mutations at the Zif268
target sequence. Five out of the six sequences encoded distinct
NHEJ mutations suggesting GVR-mediated delivery of Zif268:FokI
occurred in multiple somatic cells. Furthermore, densitometry
analysis of cleavage-resistant amplicons indicates approximately
10% of reporter genes encode NHEJ mutations. Together, these
results suggest GVRs enable targeted mutagenesis by the transient
delivery of ZFN protein.
Demonstrating Targeted Mutagenesis by Delivery of TALE Nucleases in
Nicotiana tabacum Leaf Tissue Using GVRs
[0091] Replicon-mediated expression of a ZFN monomer is predicted
to be efficient due to its relatively small coding sequence (the
Zif268::FokI gene is 897 nt) and minimal sequence repeats. To
assess whether GVRs can facilitate delivery of large and repetitive
TALE nuclease sequence, pLSL was modified to encode two TALE
nuclease sequences separated by a T2A translational-skipping
sequence (pLSLT). Target sequence for the TALE nuclease pair is
present within two endogenous ALS genes, SuRA and SuRB (Zhang et
al., Plant Physiol. 161:20-27, 2012, FIG. 16). WT N. tabacum leaves
were syringe infiltrated with Agrobacterium containing pLSLT, or
coinfiltrated with Agrobacterium containing pLSLT and p35SREP.
Plant DNA was extracted seven dpi, replicational release was
verified (FIG. 17), and SuRA and SuRB loci were amplified following
an initial digestion of genomic DNA with AluI. Resulting amplicons
were digested with AluI overnight and separated on an agarose gel
(FIG. 19). Sequencing of cleavage-resistant amplicons confirmed
TALE nuclease-induced NHEJ mutations in seven out of eleven clones.
These results suggest GVR-mediated TALE nuclease expression can be
achieved.
Demonstrating Targeted Mutagenesis by Delivery of CRISPR/Cas
Elements in Nicotiana tabacum Leaf Tissue Using GVRs
[0092] The CRISPR/Cas system functions to protect bacteria and
archaea against invading foreign nucleic acid. It was previously
demonstrated that targeted DNA double-strand breaks (DSBs) could be
created in mammalian cells by expression of the Cas9 endonuclease
and a programmable guide RNA (gRNA). We tested whether the
CRISPR/Cas system is functional in plant cells using GVRs to
deliver the components necessary for targeted DNA cleavage. The LSL
T-DNA was modified to encode a plant codon-optimized Cas9 followed
by gRNA driven by an AtU6 RNA polymerase III promoter. The gRNA was
designed to recognize a site in SuRA and SuRB approximately 100 bp
downstream of the T30 TALEN target (FIG. 16). Genomic DNA was
extracted five dpi, replicational release was verified (FIG. 17;
pLSLC), and PCR products encompassing the gRNA target were
subjected to AlwI digestion (FIG. 20). DNA sequencing of AlwI
resistant products derived from the sample transformed with pLSLC
and p35SREP confirmed the presence of mutations at the predicted
target site in five out of seven clones. Notably, one of the mutant
amplicons contained an intact AlwI site but also had a four by
deletion; recovery of this mutant was likely due to incomplete
digestion of the PCR amplicon. The data demonstrate that the
CRISPR/Cas system can be used to make targeted modifications to
plant genomes and that GVRs can simultaneously deliver gRNA and the
Cas9 endonuclease.
Demonstrating GT in Nicotiana tabacum Using GVRs
[0093] GVRs were assessed for their ability to achieve GT through
the coordinated delivery of nucleases and repair templates. The
target for modification was the defective gus::nptII gene, which
can be repaired by correcting a 600 bp deletion that removes part
of the coding sequences of both GUS and NPTII. Following
Zif268::FokI in pLSLZ.D is a us::NPTII repair template (FIG. 21).
Cells having undergone GT will stain blue when incubated in a
solution with the GUS substrate X-Gluc. Random integration of the
repair template or read-through transcription from viral promoters
should not produce functional GUS protein due to 703 nt missing
from the 5' coding sequence. This was confirmed by delivering
pLSLZ.D and p35SREP to non-transgenic leaf tissue; no GUS activity
was observed (data not shown). To compare the performance of GVRs
with the delivery of conventional T-DNA technology, a T-DNA vector
was engineered to encode Zif268::FokI and a us:NPTII repair
template (p35SZ.D). To this end, Multisite Gateway recombination
was performed using plasmids pMDC32, pNB098 and pNB091. Due to the
two-component design GVRs--requiring co-delivery of pLSLZD and
p35SREP, a direct comparison of GT frequencies with p35SZD results
in a performance bias, favoring the system that requires transfer
of the least number of T-DNAs. While this may be an influencing
factor, co-transformation of T-DNA in Nicotiana species is
efficient (McCormac et al., Transgenic Res. 25:549-561, 2001),
likely leading to minimal loss of performance with GVRs. Five to
seven dpi, infiltrated leaf tissue was stained in X-Gluc and
chlorophyll was removed. Relative to p35SZ.D, a substantial
enhancement in the number of GUS-expressing cells in leaf tissue
transformed with pLSLZD and p35SREP (FIG. 22) was observed. To
molecularly verify repair of reporter gene coding sequences, PCR
was performed using primers NB394 and NB423, which bind to sequence
within the 600 bp modification and are complementary to sequence
downstream of the homology encoded on the repair template. A
.about.1,000 bp product, present only in the lane with p35SREP and
pLSLZ.D suggested the presence of repaired reporter genes (FIG.
23). To quantify the relative enhancement of GT, the density of
blue sectors was quantified from four transgenic plant lines (1.7,
4.3, 9.1, and 11.3). A significant enhancement in blue sectors with
pLSLZ.D and p35SREP was observed across all four plant lines (FIG.
24) was observed. Table 2 indicates the total number of blue
sectors in leaf tissue transgenic lines.
Exploring Elements of GVRs Necessary for High frequency GT
[0094] There are several features of GVRs that may promote GT,
including high levels of nuclease expression, high levels of repair
template production and pleotropic Rep and RepA activity. To
individually test these features, we paired two experimental
samples on a single leaf to minimize variation caused by
differences in leaf age and health, and quantified the density of
blue sectors that result from GT. To determine the contribution of
ZFN expression on GT, the coding sequence Zif268::FokI was replaced
with GFP. Consistent with the stimulatory effect DSBs have on
recombination, we observed a significant decrease in blue sectors
when Zif268::FokI was removed (FIG. 25, top left). To determine if
Rep-mediated replication of the GVRs contributes to GT, we compared
the co-delivery of pLSLZ.D and p35SREP with the co-delivery of
p35SZ.D and p35SREP. The decrease in blue sectors observed after
removing the cis-acting LIR and SIR elements suggests that GVR
replication contributes to enhanced rates of GT (FIG. 25, top
right). Finally, to determine if there are pleotropic consequences
of Rep and RepA expression on GT, we compared frequencies of GT
using our standard T-DNA vector (p35SZ.D) with and without p35SREP.
Here, we observed a significant increase in blue sectors when
p35SREP was delivered, suggesting that pleotropic Rep and/or RepA
activity promotes GT (FIG. 25, bottom left). See also FIGS. 26-30
for additional images of leaf tissue with GUS activity.
[0095] Mastrevirus RepA is known to interact with plant cell
proteins, including the retinoblastoma-related protein pRBR. By
sequestering pRBR's repressive activity against E2F, S-phase
progression is promoted, providing the necessary factors for genome
replication. One explanation for our results showing a pleotropic
activity of replicase proteins on GT is that, in somatic leaf
tissue, RepA promotes cell-cycle progression from G0/G1 to S phase
and thereby provides improved cellular conditions for homologous
recombination. To test this hypothesis, we introduced a single
amino acid substitution within the conserved pRBR-interacting
domain of RepA (designated LxCxQ) which reduces binding affinity to
pRBR. A significant decrease in GT was observed when LxCxQ RepA
T-DNA was delivered (FIG. 25, bottom right), suggesting that
progression into S-phase stimulates GT.
Demonstrating Methods for Regeneration of Recombinant Nicotiana
tabacum Plants
[0096] To regenerate modified Nicotiana tabacum plants, the leaf
disc transformation protocol was implemented (Horsch et al.,
Science 227:1229-31, 1985). The target gene was the endogenous SuRB
gene. A repair template, present downstream of the T30 TALEN pair
on pLSLT, contained 1 kb of sequence homologous to the SuRB locus
flanking NPTII coding sequence. As a consequence of GT, the NPTII
coding sequence is placed in-frame with the SuRB coding sequence,
resulting in the production of a SuRB::NPTII fusion protein.
Agrobacterium containing pLSLT and p35SREP were grown overnight at
28.degree. C. in LB with 50 .mu.g/ml kanamycin and 50 .mu.g/ml
gentamycin. Cells were pelleted and resuspended to an OD.sub.600 of
1 in LB. Leaf discs from WT tobacco plants were transferred into
the Agrobacterium cultures for 10 minutes and then plated onto
co-cultivation media as described elsewhere (Gallois and Marinho,
Methods Mol. Biol. 49:39-48, 1995). Three days after
transformation, discs were transferred to regeneration plates
containing 50 .mu.g/ml kanamycin and 1 mg/L 6-Benzylaminopurine.
Shoots that appear about four weeks after transformation were
assessed for the presence of the SuRB:NPTII fusion gene by PCR
(FIG. 31). Amplification of a .about.1.2 kb product (plant #6)
suggests this plant was produced from a cell that has undergone GT.
Amplification of the 5' junction may suggest that the GT event was
`one-sided` (e.g. following invasion of the repair template by a
free 3' end of the chromosomal DNA, the NPTII sequence is copied
and then the break is sealed by illegitimate recombination).
Demonstrating Replicational Release in Potato
[0097] Functionality of BeYDV replicons in economically-valuable
crops was investigated. To this end, experiments were first
undertaken to demonstrate replicational release in potato cells
(Solanum tuberosum cultivar Deseree). Potato leaf tissue was
excised from aseptically-growing plants, and co-transformed with
Agrobacterium containing p35SREP and pLSLGFP. Following
co-transformation, leaf tissue was plated on cocultivation media
for 2 days to allow for T-DNA transfer and integration. Leaf tissue
was then washed in MS media containing 250 .mu.g/mL cefotaxime, and
plated on regeneration media containing 50 .mu.g/mL hygromycin.
Genomic DNA from several lines of hygromycin-resistant potato
plants (Line 1, 3, 4, 5, 9, 10, 11, 12) was isolated and assessed
for the presence of p35SREP T-DNA and circular replicons.
Amplification of a 440 bp sequence from Rep/RepA and a 714 bp
sequence from replicon nucleotide sequence from plant line 10
suggests GVRs are present in potato cells (FIG. 32). Interestingly,
expression of Rep/RepA does not elicit an observable hypersensitive
response. This was demonstrated by verifying expression of Rep/RepA
in phenotypically-normal hygromycin-resistant plants by RT-PCR
using primers that detect Rep/RepA RNA sequence (FIG. 33).
Demonstrating Transient Delivery of Reporter Proteins in Tomato
Leaf Tissue Using GVRs
[0098] To demonstrate functionality of BeYDV-based GVRs in tomato
(Solarium lycopersicum cv. M82), pLSLGUS and p35SREP were
transformed into Agrobacterium tumefaciens (AGL1) by the
freeze-thaw method. Agrobacterium was grown overnight at 28.degree.
C. to an OD.sub.600 of 1 and diluted in LB media to an OD.sub.600
of 0.2. Half leaves were fully infiltrated with Agrobacterium
encoding pLSLGUS or coinfiltrated with pLSLGUS and p35SREP. To
detect cells expressing GUS enzyme, leaf tissue was stained eleven
dpi in X-Gluc solution. Chlorophyll was removed using 80% ethanol,
and leaf images were taken (FIG. 34). The presence of
GUS-expressing cells only in tissue transformed with pLSLGUS and
p35SREP (FIG. 35) suggested GVRs can drive transient protein
expression in tomato leaf tissue.
Demonstrating Functionality of Wheat Dwarf Virus Replicons in
Wheat, Setaria, and Maize
[0099] To expand the use of GVRs for genome editing in
monocotyledonous plants, an LSL T-DNA was constructed with
cis-acting replication sequences from the Wheat dwarf virus (WDV)
(FIG. 36). Rep/RepA coding sequence was positioned inside the
flanking LIR sequences, just downstream of the complementary sense
LIR promoter. To demonstrate transient protein expression, WDV LSL
plasmids containing the GFP gene (WDV-GFP) were delivered to wheat
(Triticum aestivum cultivar Bobwhite), Setaria (Setaria viridis)
and maize (Zea mays cultivar A188), by particle bombardment. Three
days post bombardment, tissue was assessed for GFP expression.
Enhanced expression of GFP was observed in wheat calli (FIG. 37),
Setaria calli (FIG. 38), and corn embryos (FIG. 39) when delivered
WDV-GFP. One explanation for these results may be that WDV
replicons are replicating and promoting GFP expression.
Demonstrating GT in Rice Using WDV Replicons
[0100] To determine if WDV can facilitate the delivery of TALENs
and repair templates for GT in rice, a WDV replicon was engineered
to contain the T30 TALEN pair followed by a repair template
designed to correct the non-functional gus::nptII gene (FIG. 40,
top). Leaf tissue from transgenic rice plants, containing a stably
integrated gus::nptII gene, was exposed to Agrobacterium containing
WDV T-DNA plasmids with or without repair template sequence.
Transformation conditions were performed as previously described by
Andrieu et al. (Rice, 5:23, 2012). Leaf tissue also was transformed
with conventional T-DNA containing the T30 TALEN pair followed by
the us::NPTII repair template. Blue sectors observed in leaf tissue
delivered GVR T-DNA and conventional T-DNA suggests that gus::nptII
gene function was restored through GT in a subset of leaf cells
(FIG. 40, bottom).
OTHER EMBODIMENTS
[0101] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
TABLE-US-00001 TABLE 1 Primer Sequence SEQ ID NO NB104
gcggtaccctcgagtctagatctgtctttttccaaatatttattg 2 NB105
gcggtaccctcgagtctagatttttgtggtggttgcagc 3 NB106
gcggtaccctcgagtctagacaagattctcttcacttctc 4 NB112
aggctagcgagctcagatctccttgtcaagaggagcatc 5 NB113
aggctagcgagctcagatcttttgccattaatggagaatcttg 6 NB114
aggctagcgagctcagatctcaatgacgacactccccac 7 NB128
gcatgcagtactgagctcgccgaagatacgtggaaac 8 NB129
gagctcagtactgcatgcgctggagggtaatagaaac 9 NB153
gattaggctagcgagctcagatct 10 NB154 cggacagattattcgatgcaaagg 11 NB155
gacaaaccacaactgacaatacaga 12 NB158 gcggtaccctcgagtctaga 13 NB161
tcaccatcgtgaatcatccctcct 14 NB177
tcgagtctagacacaatcacacaaaactaacaaaag 15 NB178
gctcagatctgcaccaagaccaaaaatggcaac 16 NB207
gcatgcagtactgagctcacgtggaaacaacggtgtttg 17 NB208
gagctcagtactgcatgctaatagaaacactaatcttc 18 NB257
tgccacgtggacgaatactagcaa 19 NB258 gcttgaatcatggcctgaacgctt 20 NB263
gagctcagtactgcat 21 NB264 gcatgcagtactgagc 22 NB271
ttacggtttttcaccgaagttcat 23 NB272
ttcggtgaaaaaccgtaaaccgacctgtccggtgccctg 24 NB274
actgatctagacactggcggaagcaacgcgta 25 NB275
tcagtagatctgccatgatggatactttctcg 26 NB307 gccatgatggatactttctcg 27
NB314
caacttttgtatacaaagttggcattataaaaaagcattgctcatcaatttgttgcaacgaacaggtc-
actatcagtcaaaataaa 28 atcattatt NB315
aagctcgggcccaataatgattttattttg 29 NB316
ctttgtatacaaaagttgccgagctcgcggccgcattaggcaccccag 30 NB317
aactttgtacaagaaagctgggtcgtcgacctgcagactggctgtg 31 NB318
aggaagtgagacggaaatttaataacggcgagataaacttttaataggacgtccgatcgttcaaacat-
ttggcaataaagtttct 32
taagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaat-
aattaacatg
taatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatag-
aaaacaaaat
atagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcgggaattgatcccccct-
cgacagctt
ccggaaagggcgaattcgcaactttgtatacaaaagttgaacgagaaacgtaaaatgatataaatatcaatat-
attaaattag
attttgcataaaaaacagactacataatactgtaaaacacaacatatccagtcactatgccatccagctgata-
tcccctat NB319
cgacggccagtcttaagctcgggccccaaataatgattttattttgactgatagtgacctgttcgttg-
caacaaattgatgagca 33
atgcttttttataatgccaactttgtacaaaaaagcaggctccgaattcatgccttctgctagtaagaacttc-
agactccaat
ctaaatatgttttccttacctatcccaagtgctcatctcaaagagatgatttattccagtttctctgggagaa-
actcacacct
tttcttattttcttccttggtgttgcttctgagcttcatcaagatggcactacccactatcatgctcttctcc-
agcttgataa
aaaaccttgtattagggatccttcttttttcgattttgaaggaaatcaccctaatatccagccagctagaaac-
tctaaacaag
tccttgattacatatcaaaggacggagatattaaaaccagaggagatttccgagatcataaggtctctcctcg-
caaatctgac NB320
attaaaaccagaggagatttccgagatcataaggtctctcctcgcaaatctgacgcacgatggagaac-
tattatccagactgca 34
acgtctaaggaggaatatcttgacatgatcaaggaagaattccctcatgaatgggcaacaaagcttcaatggc-
tggaatattc
agccaacaaattattccctccacaacctgaaccgtatgtgtcgcccttcacagaatcagatcttcgctgccac-
gaagatctac
actcctggagggaaacccatctataccatgtaagcatagacgcttatacttacatacatcctgtctcatacca-
acaagctcaa
tctgaccttgaatggatggccgatttaaccaggacaatggaaggaatggaatccgacaccccagcctctacat-
ctgcggacca
actcgtaccggaaagaccacctgggctagaagtctcggacgacacaactattggaacggtaccatcgatttca-
ccaactacgat NB321
attaaaaccagaggagatttccgagatcataaggtctctcctcgcaaatctgacgcacgatggagaac-
tattatccagactgcaa 35
cgtctaaggaggaatatcttgacatgatcaaggaagaattccctcatgaatgggcaacaaagcttcaatggct-
ggaatattca
gccaacaaattattccctccacaacctgaaccgtatgtgtcgcccttcacagaatcagatcttcgctgccacc-
aagatctaca
ctcctggagggaaacccatctataccatgtaagcatagacgcttatacttacatacatcctgtctcataccaa-
caagctcaat
ctgaccttgaatggatggccgatttaaccaggacaatggaaggaatggaatccgacaccccagcctctacatc-
tgcggaccaac
tcgtaccggaaagaccacctgggctagaagtctcggacgacacaactattggaacggtaccatcgatttcacc-
aactacgat NB322
gtaccggaaagaccacctgggctagaagtctcggacgacacaactattggaacggtaccatcgatttc-
accaactacgatgaaca 36
cgccacctataatatcatcgacgacatccccttcaagttcgtcccattgtggaagcaattaataggttgccag-
tctgatttca
ctgtcaaccctaaatatggaaaaaagaagaaaataaaaggtgggatcccttctataattctttgcaatcctga-
cgaagactgg
atgttatcaatgacaagtcaacagaaggattactttaaagataattgcgtcacccactacatgtgtgacgggg-
agactttttt
tgctcgggaatcgtcgagtcactgaacgtgcctgaattcgacccagctttcttgtacaaagttggcattataa-
aaaataatt
gctcatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattatttgccatccagctgatat-
cccctatagtg NB323 cgacggccagtcttaagctc 37 NB324
cactataggggatatcagct 38 NB325 agcttggtacccctgcaggtagcagaaggcatg 39
NB326 ataagcacaagttttatccggc 40 NB327 ggatcctctagattacgccccgcctgc
41 NB328 cgtaatctagaggatccggcttactaaaagc 42 NB329
tgttgaccgagctcctgcagaagcttctcgag 43 NB330
cctgcaggtagcagaaggcatgttgttgtgactccgaggggttgcctcaaactctatcttataaccgg-
cgtggaggcatggagg 44
caggggtattttggtcattttaatagatagtggaaaatgacgtggaatttacttaaagacgaagtcgagacct-
ttgcgactct
agaggtctcaaatttaatattaccggcgtggcccccccttatcgcgagtgctttagcacgagcggtccagatt-
taaagtagaa
aatttcccgcccactagggttaaaggtgttcacactataaaagcatatacgatgtgatggtatttgatggagc-
gtatattgta
tcaggtatttccgttggatacgaattattcgtacgaccctccctaagattcttgattgtttataaaaccaaat-
ctcattgtct
ttgttgtgtattgtttgcaggacgtcgagagttctcaacacaacatatacaaaacaaacgaatctcaagca
NB331
acaaaacaaacgaatctcaagcaatcaagcattctacttctattgcagcaatttaaatcatttctaca-
agtttgtacaaaaaag 45
ctgaacgagaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagactacata-
atactgtaaa
acacaacatatccagtcactatggcggccgcattaggcaccccaggctttacactttatgcttccggctcgta-
taatgtgtgg
attttgagttaggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatata-
ccaccgttga
tatatcccaatggcatcgtaaagaacattttgaggcattttcagtcagttgctcaatgtacctataaccagac-
cgttcagctgg
atattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcaca
NB332 ctatggtcgacctgcagactggctgtg 46 NB333
gggatcccactcgagggtcaacatggtggagcacg 47 NB334 ctagagtcgaggtcctctcca
48 NB335
aggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgaca-
gtggtcccaaagatgg 49
acccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgt-
gatatctcca
ctgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttca-
tttggagagg
acctcgactctagccttcctctatataaggaagttcatttcatttggagaggtaagtttcacttcacacatta-
ttactgtctt
ctaatacaaggttttttatcaagctggagaagagcatgatagtgggtagtgccatcttgatgaagctcagaag-
caacaccaag
gaagaaaataagaaaaggtgtgagtttctcccagagaaactggaataaatcatctctttgagatgagcacttg-
ggataggtaag NB336
tgagatgagcacttgggataggtaaggaaaacatatttagattggagtctgaagttcttactagcaga-
aggcatgttgttgtga 50
ctccgaggggttgcctcaaactctatcttataaccggcgtggaggcatggaggcaggggtattttggtcattt-
taatagatag
tggaaaatgacgtggaatttacttaaagacgaagtcgagacctttgcgactctagaggtctcaatttaatatt-
accggcgtgg
cccccccttatcgcgagtgctttagcacgagcggtccagatttaaagtagaaaatttcccgcccactagggtt-
aaaggtgttca
cactataaaagcatatacgatgtgatggtatttgatggagcgtatattgtatcaggtatttccgttggatacg-
aattattcg
tacgaccctcatagtttaaactgaaggcgggaaacgacaatctgatccaagctcaagctaagcttgcatgcct-
gcaggatatcg NB337 cgatatcctgcaggcatgcaagcttagc 51 NB338
aagtctttgcgacaagggggggcccacgccg 52 NB339
aattcggcgtgggcccccccttgtcgcaaag 53 NB344
cacagccagtctgcaggtcgaccatagtgactggatatgttgtgttttacagtattatgtagtctgtt-
ttttatgcaaaatcta 54
atttaatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtgagtgtactt-
caagtcagtg
ggaaatcaataaaatgattattttatgaatatatttcattgtgcaagtagatagaaattacatatgttacata-
acacacgaaa
taaacaaaaaaagacaatccaaaaacaaacaccccaaaaaaaataatcactttagataaactcgtatgaggag-
aggcacgttc
agtgactcgacgattcccgagcaaaaaaagtctccccgtcacacatgtagtgggtgacgcaattatctttaaa-
gtaatccttc
tgttgacttgtcattgataacatccagtcttcgtcaggattgcaaagaattatagaagggatcccactcgaga-
agcttctgcag NB362 acctcgactctagaatgaagactaatctttttctctttc 55 NB363
gaacgatcggacgtcttaaagctcatcatgtttgtatag 56 NB379
gcccttcaccatggcttcctcccctccaaagaaaaag 57 NB380
gaacgatcggacgtcctattaaaagtttatctcaccgtta 58 NB394
tgccgccgtgttccggctgtcagc 59 NB396 aaggtgcacgggaatatttcgcgc 60 NB415
gtttcacttcacacattattactg 61 NB416 tgttgagaactctcgacgtcctgc 62 NB422
gtgtgaacaacgaactgaactggc 63 NB423 agagcgcccaatacgcaaaccgc 64 NB424
cagcgagtcagtgagcgaggaagc 65 NB448 agctagtctagaatgttacgtcctgtagaaacc
66 NB449 gtacgtgacgtctcattgtttgcctccctgc 67 NB478
gacggtgcagaaagtgaagta 68 NB479 tatggcccaggagtgtctaa 69
NB488 caagctaagcttgcatgcctgcagggtgtttgacaggatatattggcg 70 NB489
tccatgccgcctcctttagc 71 NB490 gctaaaggaggcggcatgga 72 NB491
accacttcaagaactctgtagc 73 NB492 gctacagagttcttgaagtggtg 74 NB493
aggcacgttcagtgactcgacgaagtagatgccgaccggatctgtcg 75 NB494
gaagttcttactagcagaaggcatcggatctgcgaaagctcgagag 76 NB495
gtcacaacaacatgccttctgctacctgcaggcgtaatcatggtcatagc 77
TABLE-US-00002 TABLE 2 Delivered T-DNA: p35SZ.D pLSLZ.D + p35SREP
pLSLD + p35SREP Transgenic plant line ID: 1.7 4.3 9.1 11.3 1.7 4.3
9.1 11.3 1.7 4.3 11.3 Leaf 1 (blue sectors/cm.sup.2) 0.00 1.85 0.93
0.56 479.26 85.37 218.89 372.96 0.19 7.41 1.11 Leaf 2 (blue
sectors/cm.sup.2) 1.48 7.78 13.89 2.96 160.93 96.67 77.22 147.96
0.00 0.00 Leaf 3 (blue sectors/cm.sup.2) 0.93 22.96 0.00 1.48
170.19 68.15 120.37 61.67 2.04 Leaf 4 (blue sectors/cm.sup.2) 0.74
1.11 287.22 25.00 38.15 2.22 Leaf 5 (blue sectors/cm.sup.2) 1.11
6.11 101.48 70.37 109.07 Leaf 6 (blue sectors/cm.sup.2) 10.00 13.33
90.74 96.48 Leaf 7 (blue sectors/cm.sup.2) 36.67 74.63 Leaf 8 (blue
sectors/cm.sup.2) 27.96 p35SZ.D + Delivered T-DNA: pLSLZ.D p35SZ.D
+ p35SREP p35SREPLxCxQ Transgenic plant line ID: 1.7 9.1 11.3 1.7
4.3 9.1 11.3 1.7 9.1 11.3 Leaf 1 (blue sectors/cm.sup.2) 7.04 47.96
5.00 16.11 19.26 4.26 67.41 3.89 0.00 0.00 Leaf 2 (blue
sectors/cm.sup.2) 7.04 16.48 19.81 0.93 Leaf 3 (blue
sectors/cm.sup.2) 0.93 6.67 7.04 0.00 Leaf 4 (blue
sectors/cm.sup.2) 23.15 0.00 Leaf 5 (blue sectors/cm.sup.2) 3.70
0.00 Leaf 6 (blue sectors/cm.sup.2) 2.22 Leaf 7 (blue
sectors/cm.sup.2) 11.11 Leaf 8 (blue sectors/cm.sup.2) 0.19 Leaf 9
(blue sectors/cm.sup.2) 0.93 Leaf 10 (blue sectors/cm.sup.2) 8.15
Sequence CWU 1
1
94118DNAArtificial Sequencesynthetic oligonucleotide 1gagctcagta
ctgcatgc 18245DNAArtificial Sequenceprimer 2gcggtaccct cgagtctaga
tctgtctttt tccaaatatt tattg 45339DNAArtificial Sequenceprimer
3gcggtaccct cgagtctaga tttttgtggt ggttgcagc 39440DNAArtificial
Sequenceprimer 4gcggtaccct cgagtctaga caagattctc ttcacttctc
40539DNAArtificial Sequenceprimer 5aggctagcga gctcagatct ccttgtcaag
aggagcatc 39643DNAArtificial Sequenceprimer 6aggctagcga gctcagatct
tttgccatta atggagaatc ttg 43739DNAArtificial Sequenceprimer
7aggctagcga gctcagatct caatgacgac actccccac 39837DNAArtificial
Sequenceprimer 8gcatgcagta ctgagctcgc cgaagatacg tggaaac
37937DNAArtificial Sequenceprimer 9gagctcagta ctgcatgcgc tggagggtaa
tagaaac 371024DNAArtificial Sequenceprimer 10gattaggcta gcgagctcag
atct 241124DNAArtificial Sequenceprimer 11cggacagatt attcgatgca
aagg 241225DNAArtificial Sequenceprimer 12gacaaaccac aactgacaat
acaga 251320DNAArtificial Sequenceprimer 13gcggtaccct cgagtctaga
201424DNAArtificial Sequenceprimer 14tcaccatcgt gaatcatccc tcct
241536DNAArtificial Sequenceprimer 15tcgagtctag acacaatcac
acaaaactaa caaaag 361633DNAArtificial Sequenceprimer 16gctcagatct
gcaccaagac caaaaatggc aac 331739DNAArtificial Sequenceprimer
17gcatgcagta ctgagctcac gtggaaacaa cggtgtttg 391838DNAArtificial
Sequenceprimer 18gagctcagta ctgcatgcta atagaaacac taatcttc
381924DNAArtificial Sequenceprimer 19tgccacgtgg acgaatacta gcaa
242024DNAArtificial Sequenceprimer 20gcttgaatca tggcctgaac gctt
242116DNAArtificial Sequenceprimer 21gagctcagta ctgcat
162216DNAArtificial Sequenceprimer 22gcatgcagta ctgagc
162324DNAArtificial Sequenceprimer 23ttacggtttt tcaccgaagt tcat
242439DNAArtificial Sequenceprimer 24ttcggtgaaa aaccgtaaac
cgacctgtcc ggtgccctg 392532DNAArtificial Sequenceprimer
25actgatctag acactggcgg aagcaacgcg ta 322632DNAArtificial
Sequenceprimer 26tcagtagatc tgccatgatg gatactttct cg
322721DNAArtificial Sequenceprimer 27gccatgatgg atactttctc g
212895DNAArtificial Sequenceprimer 28caacttttgt atacaaagtt
ggcattataa aaaagcattg ctcatcaatt tgttgcaacg 60aacaggtcac tatcagtcaa
aataaaatca ttatt 952930DNAArtificial Sequenceprimer 29aagctcgggc
ccaataatga ttttattttg 303048DNAArtificial Sequenceprimer
30ctttgtatac aaaagttgcc gagctcgcgg ccgcattagg caccccag
483146DNAArtificial Sequenceprimer 31aactttgtac aagaaagctg
ggtcgtcgac ctgcagactg gctgtg 4632497DNAArtificial Sequenceprimer
32aggaagtgag acggaaattt aataacggcg agataaactt ttaataggac gtccgatcgt
60tcaaacattt ggcaataaag tttcttaaga ttgaatcctg ttgccggtct tgcgatgatt
120atcatataat ttctgttgaa ttacgttaag catgtaataa ttaacatgta
atgcatgacg 180ttatttatga gatgggtttt tatgattaga gtcccgcaat
tatacattta atacgcgata 240gaaaacaaaa tatagcgcgc aaactaggat
aaattatcgc gcgcggtgtc atctatgtta 300ctagatcggg aattgatccc
ccctcgacag cttccggaaa gggcgaattc gcaactttgt 360atacaaaagt
tgaacgagaa acgtaaaatg atataaatat caatatatta aattagattt
420tgcataaaaa acagactaca taatactgta aaacacaaca tatccagtca
ctatgccatc 480cagctgatat cccctat 49733500DNAArtificial
Sequenceprimer 33cgacggccag tcttaagctc gggccccaaa taatgatttt
attttgactg atagtgacct 60gttcgttgca acaaattgat gagcaatgct tttttataat
gccaactttg tacaaaaaag 120caggctccga attcatgcct tctgctagta
agaacttcag actccaatct aaatatgttt 180tccttaccta tcccaagtgc
tcatctcaaa gagatgattt attccagttt ctctgggaga 240aactcacacc
ttttcttatt ttcttccttg gtgttgcttc tgagcttcat caagatggca
300ctacccacta tcatgctctt ctccagcttg ataaaaaacc ttgtattagg
gatccttctt 360ttttcgattt tgaaggaaat caccctaata tccagccagc
tagaaactct aaacaagtcc 420ttgattacat atcaaaggac ggagatatta
aaaccagagg agatttccga gatcataagg 480tctctcctcg caaatctgac
50034500DNAArtificial Sequenceprimer 34attaaaacca gaggagattt
ccgagatcat aaggtctctc ctcgcaaatc tgacgcacga 60tggagaacta ttatccagac
tgcaacgtct aaggaggaat atcttgacat gatcaaggaa 120gaattccctc
atgaatgggc aacaaagctt caatggctgg aatattcagc caacaaatta
180ttccctccac aacctgaacc gtatgtgtcg cccttcacag aatcagatct
tcgctgccac 240gaagatctac actcctggag ggaaacccat ctataccatg
taagcataga cgcttatact 300tacatacatc ctgtctcata ccaacaagct
caatctgacc ttgaatggat ggccgattta 360accaggacaa tggaaggaat
ggaatccgac accccagcct ctacatctgc ggaccaactc 420gtaccggaaa
gaccacctgg gctagaagtc tcggacgaca caactattgg aacggtacca
480tcgatttcac caactacgat 50035500DNAArtificial Sequenceprimer
35attaaaacca gaggagattt ccgagatcat aaggtctctc ctcgcaaatc tgacgcacga
60tggagaacta ttatccagac tgcaacgtct aaggaggaat atcttgacat gatcaaggaa
120gaattccctc atgaatgggc aacaaagctt caatggctgg aatattcagc
caacaaatta 180ttccctccac aacctgaacc gtatgtgtcg cccttcacag
aatcagatct tcgctgccac 240caagatctac actcctggag ggaaacccat
ctataccatg taagcataga cgcttatact 300tacatacatc ctgtctcata
ccaacaagct caatctgacc ttgaatggat ggccgattta 360accaggacaa
tggaaggaat ggaatccgac accccagcct ctacatctgc ggaccaactc
420gtaccggaaa gaccacctgg gctagaagtc tcggacgaca caactattgg
aacggtacca 480tcgatttcac caactacgat 50036500DNAArtificial
Sequenceprimer 36gtaccggaaa gaccacctgg gctagaagtc tcggacgaca
caactattgg aacggtacca 60tcgatttcac caactacgat gaacacgcca cctataatat
catcgacgac atccccttca 120agttcgtccc attgtggaag caattaatag
gttgccagtc tgatttcact gtcaacccta 180aatatggaaa aaagaagaaa
ataaaaggtg ggatcccttc tataattctt tgcaatcctg 240acgaagactg
gatgttatca atgacaagtc aacagaagga ttactttaaa gataattgcg
300tcacccacta catgtgtgac ggggagactt tttttgctcg ggaatcgtcg
agtcactgaa 360cgtgcctgaa ttcgacccag ctttcttgta caaagttggc
attataaaaa ataattgctc 420atcaatttgt tgcaacgaac aggtcactat
cagtcaaaat aaaatcatta tttgccatcc 480agctgatatc ccctatagtg
5003720DNAArtificial Sequenceprimer 37cgacggccag tcttaagctc
203820DNAArtificial Sequenceprimer 38cactataggg gatatcagct
203933DNAArtificial Sequenceprimer 39agcttggtac ccctgcaggt
agcagaaggc atg 334022DNAArtificial Sequenceprimer 40ataagcacaa
gttttatccg gc 224127DNAArtificial Sequenceprimer 41ggatcctcta
gattacgccc cgcctgc 274231DNAArtificial Sequenceprimer 42cgtaatctag
aggatccggc ttactaaaag c 314332DNAArtificial Sequenceprimer
43tgttgaccga gctcctgcag aagcttctcg ag 3244487DNAArtificial
Sequenceprimer 44cctgcaggta gcagaaggca tgttgttgtg actccgaggg
gttgcctcaa actctatctt 60ataaccggcg tggaggcatg gaggcagggg tattttggtc
attttaatag atagtggaaa 120atgacgtgga atttacttaa agacgaagtc
gagacctttg cgactctaga ggtctcaaat 180ttaatattac cggcgtggcc
cccccttatc gcgagtgctt tagcacgagc ggtccagatt 240taaagtagaa
aatttcccgc ccactagggt taaaggtgtt cacactataa aagcatatac
300gatgtgatgg tatttgatgg agcgtatatt gtatcaggta tttccgttgg
atacgaatta 360ttcgtacgac cctccctaag attcttgatt gtttataaaa
ccaaatctca ttgtctttgt 420tgtgtattgt ttgcaggacg tcgagagttc
tcaacacaac atatacaaaa caaacgaatc 480tcaagca 48745482DNAArtificial
Sequenceprimer 45acaaaacaaa cgaatctcaa gcaatcaagc attctacttc
tattgcagca atttaaatca 60tttctacaag tttgtacaaa aaagctgaac gagaaacgta
aaatgatata aatatcaata 120tattaaatta gattttgcat aaaaaacaga
ctacataata ctgtaaaaca caacatatcc 180agtcactatg gcggccgcat
taggcacccc aggctttaca ctttatgctt ccggctcgta 240taatgtgtgg
attttgagtt aggatccgtc gagattttca ggagctaagg aagctaaaat
300ggagaaaaaa atcactggat ataccaccgt tgatatatcc caatggcatc
gtaaagaaca 360ttttgaggca tttcagtcag ttgctcaatg tacctataac
cagaccgttc agctggatat 420tacggccttt ttaaagaccg taaagaaaaa
taagcacaag ttttatccgg cctttattca 480ca 4824627DNAArtificial
Sequenceprimer 46ctatggtcga cctgcagact ggctgtg 274735DNAArtificial
Sequenceprimer 47gggatcccac tcgagggtca acatggtgga gcacg
354821DNAArtificial Sequenceprimer 48ctagagtcga ggtcctctcc a
2149500DNAArtificial Sequenceprimer 49aggtggctcc tacaaatgcc
atcattgcga taaaggaaag gccatcgttg aagatgcctc 60tgccgacagt ggtcccaaag
atggaccccc acccacgagg agcatcgtgg aaaaagaaga 120cgttccaacc
acgtcttcaa agcaagtgga ttgatgtgat atctccactg acgtaaggga
180tgacgcacaa tcccactatc cttcgcaaga cccttcctct atataaggaa
gttcatttca 240tttggagagg acctcgactc tagccttcct ctatataagg
aagttcattt catttggaga 300ggtaagtttc acttcacaca ttattactgt
cttctaatac aaggtttttt atcaagctgg 360agaagagcat gatagtgggt
agtgccatct tgatgaagct cagaagcaac accaaggaag 420aaaataagaa
aaggtgtgag tttctcccag agaaactgga ataaatcatc tctttgagat
480gagcacttgg gataggtaag 50050500DNAArtificial Sequenceprimer
50tgagatgagc acttgggata ggtaaggaaa acatatttag attggagtct gaagttctta
60ctagcagaag gcatgttgtt gtgactccga ggggttgcct caaactctat cttataaccg
120gcgtggaggc atggaggcag gggtattttg gtcattttaa tagatagtgg
aaaatgacgt 180ggaatttact taaagacgaa gtcgagacct ttgcgactct
agaggtctca atttaatatt 240accggcgtgg ccccccctta tcgcgagtgc
tttagcacga gcggtccaga tttaaagtag 300aaaatttccc gcccactagg
gttaaaggtg ttcacactat aaaagcatat acgatgtgat 360ggtatttgat
ggagcgtata ttgtatcagg tatttccgtt ggatacgaat tattcgtacg
420accctcatag tttaaactga aggcgggaaa cgacaatctg atccaagctc
aagctaagct 480tgcatgcctg caggatatcg 5005128DNAArtificial
Sequenceprimer 51cgatatcctg caggcatgca agcttagc 285231DNAArtificial
Sequenceprimer 52aagtctttgc gacaaggggg ggcccacgcc g
315331DNAArtificial Sequenceprimer 53aattcggcgt gggccccccc
ttgtcgcaaa g 3154500DNAArtificial Sequenceprimer 54cacagccagt
ctgcaggtcg accatagtga ctggatatgt tgtgttttac agtattatgt 60agtctgtttt
ttatgcaaaa tctaatttaa tatattgata tttatatcat tttacgtttc
120tcgttcagct ttcttgtaca aagtggtgag tgtacttcaa gtcagtggga
aatcaataaa 180atgattattt tatgaatata tttcattgtg caagtagata
gaaattacat atgttacata 240acacacgaaa taaacaaaaa aagacaatcc
aaaaacaaac accccaaaaa aaataatcac 300tttagataaa ctcgtatgag
gagaggcacg ttcagtgact cgacgattcc cgagcaaaaa 360aagtctcccc
gtcacacatg tagtgggtga cgcaattatc tttaaagtaa tccttctgtt
420gacttgtcat tgataacatc cagtcttcgt caggattgca aagaattata
gaagggatcc 480cactcgagaa gcttctgcag 5005539DNAArtificial
Sequenceprimer 55acctcgactc tagaatgaag actaatcttt ttctctttc
395639DNAArtificial Sequenceprimer 56gaacgatcgg acgtcttaaa
gctcatcatg tttgtatag 395737DNAArtificial Sequenceprimer
57gcccttcacc atggcttcct cccctccaaa gaaaaag 375840DNAArtificial
Sequenceprimer 58gaacgatcgg acgtcctatt aaaagtttat ctcaccgtta
405924DNAArtificial Sequenceprimer 59tgccgccgtg ttccggctgt cagc
246024DNAArtificial Sequenceprimer 60aaggtgcacg ggaatatttc gcgc
246124DNAArtificial Sequenceprimer 61gtttcacttc acacattatt actg
246224DNAArtificial Sequenceprimer 62tgttgagaac tctcgacgtc ctgc
246324DNAArtificial Sequenceprimer 63gtgtgaacaa cgaactgaac tggc
246423DNAArtificial Sequenceprimer 64agagcgccca atacgcaaac cgc
236524DNAArtificial Sequenceprimer 65cagcgagtca gtgagcgagg aagc
246633DNAArtificial Sequenceprimer 66agctagtcta gaatgttacg
tcctgtagaa acc 336731DNAArtificial Sequenceprimer 67gtacgtgacg
tctcattgtt tgcctccctg c 316821DNAArtificial Sequenceprimer
68gacggtgcag aaagtgaagt a 216920DNAArtificial Sequenceprimer
69tatggcccag gagtgtctaa 207048DNAArtificial Sequenceprimer
70caagctaagc ttgcatgcct gcagggtgtt tgacaggata tattggcg
487120DNAArtificial Sequenceprimer 71tccatgccgc ctcctttagc
207220DNAArtificial Sequenceprimer 72gctaaaggag gcggcatgga
207322DNAArtificial Sequenceprimer 73accacttcaa gaactctgta gc
227423DNAArtificial Sequenceprimer 74gctacagagt tcttgaagtg gtg
237547DNAArtificial Sequenceprimer 75aggcacgttc agtgactcga
cgaagtagat gccgaccgga tctgtcg 477646DNAArtificial Sequenceprimer
76gaagttctta ctagcagaag gcatcggatc tgcgaaagct cgagag
467750DNAArtificial Sequenceprimer 77gtcacaacaa catgccttct
gctacctgca ggcgtaatca tggtcatagc 50783971DNAArtificial
Sequenceplasmid 78aagcagaagg catgttgttg tgactccgag gggttgcctc
aaactctatc ttataaccgg 60cgtggaggca tggaggcagg ggtattttgg tcattttaat
agatagtgga aaatgacgtg 120gaatttactt aaagacgaag tctttgcgac
aagggggggc ccacgccgaa tttaatatta 180ccggcgtggc ccccccttat
cgcgagtgct ttagcacgag cggtccagat ttaaagtaga 240aaatttcccg
cccactaggg ttaaaggtgt tcacactata aaagcatata cgatgtgatg
300gtatttgatg gagcgtatat tgtatcaggt atttccgttg gatacgaatt
attcgtacga 360ccctccctaa gattcttgat tgtttataaa accaaatctc
attgtctttg ttgtgtattg 420tttgcaggac gtcgagagtt ctcaacacaa
catatacaaa acaaacgaat ctcaagcaat 480caagcattct acttctattg
cagcaattta aatcatttct acaagtttgt acaaaaaagc 540tgaacgagaa
acgtaaaatg atataaatat caatatatta aattagattt tgcataaaaa
600acagactaca taatactgta aaacacaaca tatccagtca ctatggcggc
cgcattaggc 660accccaggct ttacacttta tgcttccggc tcgtataatg
tgtggatttt gagttaggat 720ccgtcgagat tttcaggagc taaggaagct
aaaatggaga aaaaaatcac tggatatacc 780accgttgata tatcccaatg
gcatcgtaaa gaacattttg aggcatttca gtcagttgct 840caatgtacct
ataaccagac cgttcagctg gatattacgg cctttttaaa gaccgtaaag
900aaaaataagc acaagtttta tccggccttt attcacattc ttgcccgcct
gatgaatgct 960catccggaat tccgtatggc aatgaaagac ggtgagctgg
tgatatggga tagtgttcac 1020ccttgttaca ccgttttcca tgagcaaact
gaaacgtttt catcgctctg gagtgaatac 1080cacgacgatt tccggcagtt
tctacacata tattcgcaag atgtggcgtg ttacggtgaa 1140aacctggcct
atttccctaa agggtttatt gagaatatgt ttttcgtctc agccaatccc
1200tgggtgagtt tcaccagttt tgatttaaac gtggccaata tggacaactt
cttcgccccc 1260gttttcacca tgggcaaata ttatacgcaa ggcgacaagg
tgctgatgcc gctggcgatt 1320caggttcatc atgccgtttg tgatggcttc
catgtcggca gaatgcttaa tgaattacaa 1380cagtactgcg atgagtggca
ggcggggcgt aatctagagg atccggctta ctaaaagcca 1440gataacagta
tgcgtatttg cgcgctgatt tttgcggtat aagaatatat actgatatgt
1500atacccgaag tatgtcaaaa agaggtatgc tatgaagcag cgtattacag
tgacagttga 1560cagcgacagc tatcagttgc tcaaggcata tatgatgtca
atatctccgg tctggtaagc 1620acaaccatgc agaatgaagc ccgtcgtctg
cgtgccgaac gctggaaagc ggaaaatcag 1680gaagggatgg ctgaggtcgc
ccggtttatt gaaatgaacg gctcttttgc tgacgagaac 1740aggggctggt
gaaatgcagt ttaaggttta cacctataaa agagagagcc gttatcgtct
1800gtttgtggat gtacagagtg atattattga cacgcccggg cgacggatgg
tgatccccct 1860ggccagtgca cgtctgctgt cagataaagt cccccgtgaa
ctttacccgg tggtgcatat 1920cggggatgaa agctggcgca tgatgaccac
cgatatggcc agtgtgccgg tctccgttat 1980cggggaagaa gtggctgatc
tcagccaccg cgaaaatgac atcaaaaacg ccattaacct 2040gatgttctgg
ggaatataaa tgtcaggctc ccttatacac agccagtctg caggtcgacc
2100atagtgactg gatatgttgt gttttacagt attatgtagt ctgtttttta
tgcaaaatct 2160aatttaatat attgatattt atatcatttt acgtttctcg
ttcagctttc ttgtacaaag 2220tggtgagtgt acttcaagtc agtgggaaat
caataaaatg attattttat gaatatattt 2280cattgtgcaa gtagatagaa
attacatatg ttacataaca cacgaaataa acaaaaaaag 2340acaatccaaa
aacaaacacc ccaaaaaaaa taatcacttt agataaactc gtatgaggag
2400aggcacgttc agtgactcga cgattcccga gcaaaaaaag tctccccgtc
acacatgtag 2460tgggtgacgc aattatcttt aaagtaatcc ttctgttgac
ttgtcattga taacatccag 2520tcttcgtcag gattgcaaag aattatagaa
gggatcccac tcgagggtca acatggtgga 2580gcacgacaca cttgtctact
ccaaaaatat caaagataca gtctcagaag accaaagggc 2640aattgagact
tttcaacaaa gggtaatatc cggaaacctc ctcggattcc attgcccagc
2700tatctgtcac tttattgtga agatagtgga aaaggaaggt ggctcctaca
aatgccatca 2760ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc
gacagtggtc ccaaagatgg 2820acccccaccc acgaggagca tcgtggaaaa
agaagacgtt ccaaccacgt cttcaaagca 2880agtggattga tgtgataaca
tggtggagca cgacacactt gtctactcca aaaatatcaa 2940agatacagtc
tcagaagacc aaagggcaat tgagactttt caacaaaggg taatatccgg
3000aaacctcctc ggattccatt gcccagctat ctgtcacttt attgtgaaga
tagtggaaaa 3060ggaaggtggc tcctacaaat gccatcattg cgataaagga
aaggccatcg ttgaagatgc 3120ctctgccgac agtggtccca aagatggacc
cccacccacg aggagcatcg tggaaaaaga 3180agacgttcca accacgtctt
caaagcaagt ggattgatgt gatatctcca
ctgacgtaag 3240ggatgacgca caatcccact atccttcgca agacccttcc
tctatataag gaagttcatt 3300tcatttggag aggacctcga ctctagagga
tcccccttcc tctatataag gaagttcatt 3360tcatttggag aggtaagttt
cacttcacac attattactg tcttctaata caaggttttt 3420tatcaagctg
gagaagagca tgatagtggg tagtgccatc ttgatgaagc tcagaagcaa
3480caccaaggaa gaaaataaga aaaggtgtga gtttctccca gagaaactgg
aataaatcat 3540ctctttgaga tgagcacttg ggataggtaa ggaaaacata
tttagattgg agtctgaagt 3600tcttactagc agaaggcatg ttgttgtgac
tccgaggggt tgcctcaaac tctatcttat 3660aaccggcgtg gaggcatgga
ggcaggggta ttttggtcat tttaatagat agtggaaaat 3720gacgtggaat
ttacttaaag acgaagtctt tgcgacaagg gggggcccac gccgaattta
3780atattaccgg cgtggccccc ccttatcgcg agtgctttag cacgagcggt
ccagatttaa 3840agtagaaaat ttcccgccca ctagggttaa aggtgttcac
actataaaag catatacgat 3900gtgatggtat ttgatggagc gtatattgta
tcaggtattt ccgttggata cgaattattc 3960gtacgaccct c
39717934DNAArtificial Sequencesynthetic oligonucleotide
79cgcccacgca ttaaagcgtg ggcgaaccga cctg 348030DNAArtificial
Sequencesynthetic oligonucleotide 80cgcccacgca tgcgtgggcg
aaccgacctg 308129DNAArtificial Sequencesynthetic oligonucleotide
81cgcccacgca gcgtgggcga accgacctg 298226DNAArtificial
Sequencesynthetic oligonucleotide 82cgcccacgcg tgggcgaacc gacctg
268333DNANicotiana tabacum 83tcatgaatgt gcaggagcta gcaactatta agg
338435DNAArtificial Sequencesynthetic oligonucleotide 84tcatgaatgt
gcaggagcgc tagcaactat taagg 358532DNAArtificial Sequencesynthetic
oligonucleotide 85tcatgaatgt gcaggagtag caactattaa gg
328629DNAArtificial Sequencesynthetic oligonucleotide 86tcatgaatgt
gcaggagcaa ctattaagg 298728DNAArtificial Sequencesynthetic
oligonucleotide 87tcatgaatgt gcagggcaac tattaagg
288817DNAArtificial Sequencesynthetic oligonucleotide 88tcatgcaact
attaagg 178915DNAArtificial Sequencesynthetic oligonucleotide
89tcatgaatgt gcagg 159016DNAArtificial Sequencesynthetic
oligonucleotide 90tcatgaatgt gcagga 169136DNANicotiana tabacum
91ggatcggttc tataaggcta acagagcaca cacata 369232DNAArtificial
Sequencesynthetic oligonucleotide 92ggatcggtta aggctaacag
agcacacaca ta 329329DNAArtificial Sequencesynthetic oligonucleotide
93ggatataagg ctaacagagc acacacata 299425DNAArtificial
Sequencesynthetic oligonucleotide 94ataaggctaa cagagcacac acata
25
* * * * *