U.S. patent application number 14/688871 was filed with the patent office on 2015-08-06 for modulation of exon recognition in pre-mrna by interfering with the secondary rna structure.
The applicant listed for this patent is Academisch Ziekenhuis Leiden. Invention is credited to Annemieke Aartsma-Rus, Johannes Theodorus den DUNNEN, Judith Christina Theodora Van DEUTEKOM, Garrit-Jan Boudewijn Van Ommen.
Application Number | 20150218559 14/688871 |
Document ID | / |
Family ID | 33028995 |
Filed Date | 2015-08-06 |
United States Patent
Application |
20150218559 |
Kind Code |
A1 |
Van DEUTEKOM; Judith Christina
Theodora ; et al. |
August 6, 2015 |
MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE
SECONDARY RNA STRUCTURE
Abstract
The invention relates to oligonucleotides for inducing skipping
of exon 53 of the dystrophin gene. The invention also relates to
methods of inducing exon 53 skipping using the
oligonucleotides.
Inventors: |
Van DEUTEKOM; Judith Christina
Theodora; (Dordrecht, NL) ; Van Ommen; Garrit-Jan
Boudewijn; (Amsterdam, NL) ; Aartsma-Rus;
Annemieke; (Hoofddorp, NL) ; den DUNNEN; Johannes
Theodorus; (Rotterdam, NL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Academisch Ziekenhuis Leiden |
Leiden |
|
NL |
|
|
Family ID: |
33028995 |
Appl. No.: |
14/688871 |
Filed: |
April 16, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14295298 |
Jun 3, 2014 |
|
|
|
14688871 |
|
|
|
|
13718666 |
Dec 18, 2012 |
|
|
|
14295298 |
|
|
|
|
13550210 |
Jul 16, 2012 |
|
|
|
13718666 |
|
|
|
|
12976381 |
Dec 22, 2010 |
8759507 |
|
|
13550210 |
|
|
|
|
12198007 |
Aug 25, 2008 |
7534879 |
|
|
12976381 |
|
|
|
|
11233507 |
Sep 21, 2005 |
|
|
|
12198007 |
|
|
|
|
11233495 |
Sep 21, 2005 |
|
|
|
11233507 |
|
|
|
|
PCT/NL2003/000214 |
Mar 21, 2003 |
|
|
|
11233495 |
|
|
|
|
Current U.S.
Class: |
514/44A ;
435/320.1; 435/375; 536/24.5 |
Current CPC
Class: |
C12N 2310/3233 20130101;
A61K 48/00 20130101; A61K 38/00 20130101; A61K 48/0016 20130101;
C12N 2320/33 20130101; C12N 2320/30 20130101; C07H 21/02 20130101;
C12N 2310/321 20130101; C12N 2310/315 20130101; C12N 2310/111
20130101; C12N 2310/321 20130101; C12N 2310/314 20130101; C12N
2310/11 20130101; C12Q 1/6883 20130101; C12N 2310/3231 20130101;
C12N 15/85 20130101; A61P 21/00 20180101; C12N 2310/346 20130101;
C12N 2310/31 20130101; C12N 15/113 20130101; A61P 21/04 20180101;
G01N 33/6887 20130101; A61P 43/00 20180101; C12N 2310/3521
20130101; C12N 2310/3181 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. An isolated antisense oligonucleotide of 15 to 80 nucleotides in
length wherein said oligonucleotide is capable of binding to a
sequence internal to exon 55 of the human dystrophin pre-mRNA and
inducing skipping of said exon, said oligonucleotide comprising a
modification.
2. The oligonucleotide of claim 1, wherein said oligonucleotide is
16 to 50 nucleotides in length.
3. The oligonucleotide of claim 2, said oligonucleotide being less
than 50 nucleotides in length.
4. The oligonucleotide of claim 3, wherein said oligonucleotide is
16 to 24 nucleotides in length.
5. The oligonucleotide of claim 2, wherein said oligonucleotide is
complementary to said sequence internal to exon 55 of the human
dystrophin pre-mRNA.
6. The oligonucleotide of claim 5, wherein said oligonucleotide is
fully complementary to said sequence internal to exon 55 of the
human dystrophin pre-mRNA.
7. The oligonucleotide of claim 1, wherein the oligonucleotide
comprises a 2'-O-methyl-phosphorothioate oligonucleotide
modification.
8. The oligonucleotide of claim 1, wherein the oligonucleotide
consists of a 2'-O-methyl oligonucleotide or a
2''-O-methyl-phosphorothioate oligonucleotide.
9. The oligonucleotide of claim 1, wherein the oligonucleotide
comprises a morpholine ring.
10. The oligonucleotide of claim 9, wherein the oligonucleotide
further comprises a phosphorodiamidate linkage.
11. The oligonucleotide of claim 1, wherein the oligonucleotide
comprises a peptide nucleic acid and/or locked nucleic acid.
12. The oligonucleotide of claim 1, wherein said oligonucleotide is
capable of binding said sequence internal to exon 55 of the human
dystrophin pre-mRNA and inducing skipping of said exon in primary
human myotubes upon transfection of at least 100 nM of said
oligonucleotide to said myotubes and incubation of transfected
myotubes for at least 16 hours.
13. The oligonucleotide of claim 12, wherein skipping is detectable
by RT-PCR and nucleic acid sequencing.
14. An expression vector encoding an oligonucleotide of 15 to 80
nucleotides wherein said oligonucleotide is capable of binding to a
sequence internal to exon 55 of the human dystrophin pre-mRNA and
inducing skipping of said exon.
15. A gene delivery vehicle comprising the expression vector of
claim 14.
16. An antisense oligonucleotide of 15 to 80 nucleotides in length,
wherein said oligonucleotide is complementary to a consecutive part
of between 16 and 50 nucleotides of an sequence internal to exon 55
of the human dystrophin pre-mRNA and said oligonucleotide is
capable of inducing skipping of exon 55 in a muscle cell, said
oligonucleotide comprising a modification.
17. The antisense oligonucleotide of claim 16, wherein said
oligonucleotide is between 16 and 50 nucleotides in length.
18. The oligonucleotide of claim 5, wherein said sequence internal
to exon 55 comprises is predicted by the m-Fold RNA
structure-modeling program to assume both a double-stranded stretch
and a single-stranded stretch of nucleotides, said double-stranded
stretch comprising two single-stranded nucleic acid stretches of
exon 55 that form a duplex.
19. A method for inducing skipping of exon 55 of the human
dystrophin pre-mRNA in a muscle cell, the method comprising
contacting said cell with an oligonucleotide of claim 1 for a time
and under conditions which permit induction of exon 55
skipping.
20. A method for inducing skipping of exon 55 of the human
dystrophin pre-mRNA in a human subject, the method comprising
administering an oligonucleotide of claim 1 to said subject in an
amount and for a time which permits induction of exon 55 skipping.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of patent application
Ser. No. 14/295,298 filed Jun. 3, 2014 and a continuation of patent
application Ser. No. 13/718,666 filed Dec. 18, 2012, the latter of
which is a continuation of patent application Ser. No. 13/550,210,
filed Jul. 16, 2012, which is a continuation of U.S. Pat. No.
8,759,507 (formerly U.S. patent application Ser. No. 12/976,381,
filed Dec. 22, 2010, which is a continuation of U.S. Pat. No.
7,534,879 (formerly U.S. patent application Ser. No. 12/198,007,
filed Aug. 25, 2008), which is a continuation of patent application
Ser. No. 11/233,507, filed on Sep. 21, 2005, and a continuation of
patent application Ser. No. 11/233,495, filed on Sep. 21, 2005, the
latter of which claims the benefit of International Patent
Application No. PCT/NL2003/000214, filed Mar. 21, 2003, the
contents of all of which are hereby incorporated by reference in
their entirety.
SEQUENCE LISTING
[0002] The attached sequence listing is hereby incorporated by
reference.
TECHNICAL FIELD
[0003] The invention relates to the fields of molecular biology and
medicine. More in particular, the invention relates to the
restructuring of mRNA produced from pre-mRNA, and therapeutic uses
thereof.
BACKGROUND
[0004] The central dogma of bio logy is that genetic information
resides in the DNA of a cell and is expressed upon transcription of
this information, where after production of the encoded protein
follows by the translation machinery of the cell. This view of the
flow of genetic information has prompted the predominantly
DNA-based approach for interfering with the protein content of a
cell. This view is slowly changing and alternatives for interfering
at the DNA level are being pursued.
[0005] In higher eukaryotes, the genetic information for proteins
in the DNA of the cell is encoded in exons that are separated from
each other by intronic sequences. These introns are in some cases
very long. The transcription machinery generates a pre-mRNA that
contains both exons and introns, while the splicing machinery,
often already during the production of the pre-mRNA, generates the
actual coding region for the protein by splicing together the exons
present in the pre-mRNA,
[0006] Although much is known about the actual processes involved
in the generation of an mRNA from a pre-mRNA, much also remains
hidden. In the invention it has been shown possible to influence
the splicing process such that a different mRNA is produced. The
process allows for the predictable and reproducible restructuring
of mRNA produced by a splicing machinery. An oligonucleotide
capable of hybridizing to pre-mRNA at a location of an exon that is
normally included in the mature mRNA can direct the exclusion of
the thus targeted exon or a part thereof.
SUMMARY OF THE INVENTION
[0007] In the invention, means and methods are provided for the
design of appropriate complementary oligonucleotides. To this end,
the invention provides a method for generating an oligonucleotide
comprising determining, from a (predicted) secondary structure of
RNA from an exon, a region that assumes a structure that is
hybridized to another part of the RNA (closed structure) and a
region that is not hybridized in the structure (open structure),
and subsequently generating an oligonucleotide, which at least in
part is complementary to the closed structure and which at least in
part is complementary to the open structure. RNA molecules exhibit
strong secondary structures, mostly due to base pairing of
complementary or partly complementary stretches within the same
RNA. It has long since been thought that structures in the RNA play
a role in the function of the RNA. Without being bound by theory,
it is believed that the secondary structure of the RNA of an exon
plays a role in structuring the splicing process. Through its
structure, an exon is recognized as a part that needs to be
included in the pre-mRNA. Herein, this signaling function is
referred to as an "exon inclusion signal."A complementary
oligonucleotide of the invention is capable of interfering with the
structure of the exon and thereby capable of interfering with the
exon inclusion signal of the exon. It has been found that many
complementary oligonucleotides indeed comprise this capacity, some
more efficiently than others. Oligonucleotides of the invention,
i.e., those with the overlap directed toward open and closed
structures in the native exon RNA, are a selection from all
possible oligonucleotides. The selection encompasses
oligonucleotides that can efficiently interfere with an exon
inclusion signal.
[0008] Without being bound by theory, it is thought that the
overlap with an open structure improves the invasion efficiency of
the oligonucleotide (i.e., increases the efficiency with which the
oligonucleotide can enter the structure), whereas the overlap with
the closed structure subsequently increases the efficiency of
interfering with the secondary structure of the RNA of the exon,
and thereby interfere with the exon inclusion signal. It is found
that the length of the partial complementarity to both the dosed
and the open structure is not extremely restricted. We have
observed high efficiencies with oligonucleotides with variable
lengths of complementarily in either structure. The term
"complementarity" is used herein to refer to a stretch of nucleic
acids that can hybridize to another stretch of nucleic acids under
physiological conditions. It is thus not absolutely required that
all the bases in the region of complementarity are capable of
pairing with bases in the opposing strand. For instance, when
designing the oligonucleotide, one may want to incorporate, for
example, a residue that does not base pair with the base on the
complementary strand. Mismatches may to some extent be allowed, if
under the circumstances in the cell, the stretch of nucleotides is
capable of hybridizing to the complementary part. In a preferred
embodiment, a complementary part (either to the open or to the
closed structure) comprises at least three and more preferably, at
least four, consecutive nucleotides. The complementary regions are
preferably designed such that when combined, they are specific for
the exon in the pre-RNA. Such specificity may be created with
various lengths of complementary regions as this depends on the
actual sequences in other mRNA or pre-mRNA in the system. The risk
that also one or more other pre-mRNA. will be able to hybridize to
the oligonucleotide decreases with increasing size of the
oligonucleotide. It is clear that oligonucleotides comprising
mismatches in the region of complementarity but that retain the
capacity to hybridize to the targeted region(s) in the pre-mRNA,
can be used in the invention, However, preferably at least the
complementary parts do not comprise such mismatches as these
typically have a higher efficiency and a higher specificity, than
oligonucleotides having such mismatches in one or more
complementary regions. It is thought that higher hybridization
strengths (i.e., increasing number of interactions with the
opposing strand), are favorable in increasing the efficiency of the
process of interfering with the splicing machinery of the
system.
[0009] The secondary structure is best analyzed in the context of
the pre-mRNA wherein the exon resides. Such structure may be
analyzed in the actual RNA. However, it is currently possible to
predict the secondary structure of an RNA molecule (at lowest
energy costs) quite well using structure-modeling programs. A
non-limiting example of a suitable program is RNA mfold version 3.1
server (Mathews et al., 1999, J. Mol. Biol., 288:911-940). A person
skilled in the art will be able to predict, with suitable
reproducibility, a likely structure of the exon, given the
nucleotide sequence. Best predictions are obtained when providing
such modeling programs with both the exon and flanking intron
sequences. It is typically not necessary to model the structure of
the entire pre-mRNA.
[0010] The open and closed structure to which the oligonucleotide
is directed, are preferably adjacent to one another. It is thought
that in this way, the annealing of the oligonucleotide to the open
structure induces opening of the closed structure, and annealing
progresses into this closed structure. Through this action, the
previously closed structure assumes a different conformation. The
different conformation may result in the disruption of the exon
inclusion signal. However, when potential (cryptic) splice acceptor
and/or donor sequences are present within the targeted exon,
occasionally a new exon inclusion signal is generated defining a
different (neo) exon, e.g, with a different 5' end, a different 3'
end, or both. This type of activity is within the scope of the
invention as the targeted exon is excluded from the mRNA. The
presence of a new exon, containing part of the targeted exon, in
the mRNA does not alter the fact that the targeted exon, as such,
is excluded. The inclusion of a neo-exon can be seen as a side
effect which occurs only occasionally. There are two possibilities
when exon skipping is used to restore (part of) an open reading
frame that was disrupted as a result of a mutation. One is that the
neo-exon is functional in the restoration of the reading frame,
whereas in the other case the reading frame is not restored. When
selecting oligonucleotides fur restoring reading frames by means of
exon-skipping, it is, of course, clear that under these conditions,
only those oligonucleotides are selected that indeed result in
exon-skipping that restores the open reading frame, with or without
a neo-exon.
[0011] Pre-mRNA can be subject to various splicing events, for
instance, through alternative splicing. Such events may be induced
or catalyzed by the environment of a cell or artificial splicing
system. Thus, from the same pre-mRNA, several different mRNAs may
be produced. The different mRNAs all included exonic sequences, as
that is the definition of an exon. However, the fluidity of the
mRNA content necessitates a definition of the term "exon" in the
invention. An "exon," according to the invention, is a sequence
present in both the pre-mRNA and mRNA produced thereof, wherein the
sequence included in the mRNA is, in the pre-rriRNA, flanked on one
side (first and last exon) or both sides (any exon other than the
first and the last exon) by sequences not present in the mRNA. In
principle, any rnRNA produced from the pre-mRNA qualifies for this
definition. However, for the invention, so-called dominant mRNAs
are preferred, i.e., mRNA that makes up at least 5% of the mRNA
produced from the pre-mRNA. under the set conditions. Human
immunodeficiency virus, in particular, uses alternative splicing to
an extreme. Some very important protein products are produced from
mRNA making up even less than 5% of the total mRNA produced from
the virus. The genomic RNA of retroviruses can be seen as pre-mRNA
for any spliced product derived from it. As alternative splicing
may vary in different cell types, the exons are defined as exons in
the context of the splicing conditions used in that system. As a
hypothetical example, an mRNA in a muscle cell may contain an exon
that is absent in an mRNA produced from the same pre-mRNA in a
nerve cell. Similarly, mRNA in a cancer cell may contain an exon
not present in mRNA produced from the same mRNA in a normal
cell.
[0012] Alternative splicing may occur by splicing from the same
pre-mRNA. However, alternative splicing may also occur through a
mutation in the pre-mRNA, for instance, generating an additional
splice acceptor and/or splice donor sequence. Such alternative
splice sequences are often referred to as cryptic splice
acceptor/donor sequences. Such cryptic splice sites can result in
new exons neo-exons). Inclusion of neo-exons into produced mRNA can
be prevented, at least in part, using a method of the invention. In
case a neo-exon is flanked by a cryptic and a "normal" splice
donor/acceptor sequence, the neo-exon encompasses the old (paleo)
exon. If in this case the original splice donor/acceptor sequence,
for which the cryptic splice donor/acceptor has taken its place, is
still present in the pre-mRNA, it is possible to enhance the
production of mRNA containing the paleo-exon by interfering with
the exon-recognition signal of the neo-exon. This interference can
be both in the part of the neo-exon corresponding to the
paleo-exon, or the additional part of such neo-exons. This type of
exon skipping can be seen as splice correction.
[0013] The exon skipping technique can be used for many different
purposes. Preferably, however, exon skipping is used for
restructuring mRNA that is produced from pre-mRNA exhibiting
undesired splicing in a subject. The restructuring may be used to
decrease the amount of protein produced by the cell. This is useful
when the cell produces a particular undesired protein. In a
preferred embodiment, however, restructuring is used to promote the
production of a functional protein in a cell, i.e., restructuring
leads to the generation of a coding region for a functional
protein. The latter embodiment is preferably used to restore an
open reading frame that was lost as a result of a mutation.
Preferred genes comprise a Duchenne muscular dystrophy gene, a
collagen VI alpha 1 gene (COL6A1), a myotubular myopathy 1 gene
(MTM1), a dysferlin gene (DYSF), a laminin-alpha 2 gene (LAMA2), an
emery-dreyfuss muscular dystrophy gene (EMD), and/or a Calpain 3
gene (CAPN3). The invention is further delineated by means of
examples drawn from the Duchenne muscular dystrophy gene. Although
this gene constitutes a particularly preferred gene in the
invention, the invention is not limited to this gene.
[0014] Duchenne muscular dystrophy (DMD) and Becker muscular
dystrophy (BMD) are both caused by mutations in the DMD gene that
is located on the X chromosome and codes for dystrophin (1-6). DMD
has an incidence of 1:3500 newborn males. Patients suffer from
progressive muscle weakness, are wheelchair bound before the age of
13 and often die before the third decade of their life (7). The
generally milder BMD has an incidence of 1:20,000. BMD patients
often remain ambulant for over 40 years and have longer life
expectancies when compared to DMD patients (8).
[0015] Dystrophin is an essential component of the
dystrophin-glycoprotein complex (DGC), which, amongst others,
maintains the membrane stability of muscle fibers (9, 10).
Frame-shifting mutations in the DMD gene result in dystrophin
deficiency in muscle cells. This is accompanied by reduced levels
of other DGC proteins and results in the severe phenotype found in
DMD patients (11, 12). Mutations in the DMD gene that keep the
reading frame intact, generate shorter, but partly functional
dystrophins, associated with the less severe BMD (13,14).
[0016] Despite extensive efforts, no clinically applicable and
effective therapy for DMD patients has yet been developed (15),
although a delay of the onset and/or progression of disease
manifestations can be achieved by glucocorticoid therapy (16).
Promising results have recently been reported by us and others on a
genetic therapy aimed at restoring the reading frame of the
dystrophin pre-mRNA in cells from the mdx mouse model and DMD
patients (17-23). By the targeted skipping of a specific exon, a
DMD phenotype can be converted into a milder BMD phenotype. The
skipping of an exon can be induced by the binding of antisense
oligoribonucleotides ("AONs"), targeting either one or both of the
splice sites or exon-internal sequences. Since an exon will only be
included in the mRNA when both the splice sites are recognized by
the spliceosome complex, splice sites are obvious targets for AONs.
This was shown to be successful, albeit with variable efficacy and
efficiency (17, 18, 20, 21).
[0017] We hypothesized that targeting exon-internal sequences might
increase specificity and reduce interference with the splicing
machinery itself Some exons have weak splice sites and appear to
require binding of an SR protein to an exon recognition sequence
(ERS) or an exonic splicing enhancer (ESE) to be properly
recognized by the splicing machinery (24). SR proteins are a highly
conserved family of arginine-serine-rich, spliceosome-associated
phosphoproteins essential for pre-mRNA splicing (50, 51). SR
proteins appear to act early in splicing by promoting splice site
recognition and spliceosome assembly. SR proteins also play a
regulatory role, because they can determine alternative splice site
usage in vivo and in vitro. SR proteins appear to be recruited from
nuclear "speckles" in which they are concentrated, to sites of
transcription in order to spatially coordinate transcription and
pre-mRNA splicing within the cell nucleus (49, 52). Disruptive
point mutations or AONs that block these sequences have been found
to result in exon skipping (19, 22, 24-28). Using exon-internal
AONs specific for an ERS-like sequence in exon 46, we were
previously able to modulate the splicing pattern in cultured
myotubes from two different DMD patients with an exon 45 deletion
(19). Following AON treatment, exon 46 was skipped, which resulted
in a restored reading frame and the induction of dystrophin
synthesis in at least 75% of the cells. We have recently shown that
exon skipping can also efficiently be induced in human control
muscle cells fix 15 different DMD exons using exon-internal AONs
(23, unpublished results).
[0018] In contrast to the previous opinion that skipping can only
be achieved with weak splice sites or exons containing ERS-like
sequences, we have seen that of the exons that were skipped in the
invention, most do not have weak splice sites nor do they contain
ERS-like sequences. Thus, binding of the AONs to the targeted exon
per se is sufficient to cause exon skipping, either by interfering
with one or more components of the splicing machinery or by
altering the secondary structure of the RNA in such a manner that
the splicing machinery no longer recognizes the exon. In a
preferred embodiment, the exon to be skipped comprises exons 2, 8,
9, 17, 19, 29, 40-46, 49-53, 55 or 59; more preferably, exons 2, 8,
9, 17, 40, 41, 42, 44, 49-52 or 59. In yet another embodiment, the
exon to be skipped comprises exons 2, 29, 40, 41, 42, 43, 44, 45,
46, 49, 50, 51 or 53.
[0019] Any oligonucleotide fulfilling the requirements of the
invention may be used to induce exon skipping in the DMD gene. In a
preferred embodiment, an oligonucleotide comprises a sequence as
depicted as active in exon-skipping in Table 2, or a functional
equivalent thereof comprising a similar, preferably the same,
hybridization capacity in kind, not necessarily in amount.
Preferably, an oligonucleotide comprising a sequence as depicted in
Table 2, derived from the exons 2, 40, 41, 42, 43, 44, 45, 49, 50.
51 or 53, demonstrably active in exon skipping.
[0020] Reading frame correction can be achieved by skipping one or
two exons flanking a deletion, by skipping in-frame exons
containing a nonsense mutation, or by skipping duplicated exons.
This results in proteins similar to those found in various EMD
patients (2, 29). A survey of the Leiden DMD mutation database
(WorldWideWeb.dmd.n1; (30)) evinces that we can thus correct over
75% of DMD-causing mutations (see Table 4). We show the actual
therapeutic effect of exon skipping for seven different mutations.
In all patient muscle cell cultures, we were able to restore
dystrophin synthesis in 75% to 80% of treated cells.
[0021] The complementary oligonucleotide generated through a method
of the invention is preferably complementary to a consecutive part
of between 16 and 50 nucleotides of the exon RNA. Different types
of nucleic acid may be used to generate the oligonucleotide.
Preferably, the oligonucleotide comprises RNA, as RNA/RNA hybrids
are very stable. Since one of the aims of the exon skipping
technique is to direct splicing in subjects, it is preferred that
the oligonucleotide RNA comprises a modification providing the RNA
with an additional property, for instance, resistance to
endonucleases and RNaseH, additional hybridization strength,
increased stability (for instance, in a bodily fluid), increased or
decreased flexibility, reduced toxicity, increased intracellular
transport, and/or tissue-specificity, etc. Preferably, the
modification comprises a 2'-0-methyl-phosphorothioate
oligoribonucleotide modification.
[0022] With the advent of nucleic acid-mimicking technology, it has
become possible to generate molecules that have a similar,
preferably the same, hybridization characteristics, in kind, not
necessarily in amount, as nucleic acid itself Such equivalents are,
of course, also part of the invention. Examples of such mimics
equivalents are peptide nucleic acid, locked nucleic acid and/or a
morpholino phosphorodiamidate. Suitable but non-limiting examples
of equivalents of oligonucleotides of the invention can be found in
C. Wahlestedt et al., Potent and non-toxic antisense
oligonucleotides containing locked nucleic acids, Proc. Natl. Acad.
Sci, US.A. 97:5633-8 (2000); A. N. Elayadi and D. R. Corey,
Application of PNA and LNA oligomers to chemotherapy, Curr. Opin,
Investig. Drugs 2:558-61 (2001); H.J. Larsen, T. Bentin, and P. E.
Nielsen, Antisense properties of peptide nucleic acid, Chem.
Biophys, Acta 1489:159-66 (1999); D. A. Braasch and D. R. Corey,
Novel antisense and peptide nucleic acid strategies for controlling
gene expression, Biochemistry 41:4503-10 (2002); J. Summerton and
D. Weller, Morpholino antisense oligomers: design, preparation, and
properties, Antisense Nucleic Acid Drug Der. 7:187-95 (1997).
Hybrids between one or more of the equivalents among each other
and/or together with nucleic acid are, of course, also part of the
invention. In a preferred embodiment, an equivalent comprises
locked nucleic acid, as locked nucleic acid displays a higher
target affinity and reduced toxicity and, therefore, shows a higher
efficiency of exon skipping.
[0023] An oligonucleotide of the invention typically does not have
to overlap with a splice donor or splice acceptor of the exon.
[0024] An oligonucleotide of the invention, or equivalent thereof,
may, of course, be combined with other methods for interfering with
the structure of an mRNA. It is, for instance, possible to include
in a method at least one other oligonucleotide that is
complementary to at least one other exon in the pre-mRNA. This can
be used to prevent inclusion of two or more exons of a pre-mRNA in
MRNA produced from this pre-mRNA. In a preferred embodiment, at
least one other oligonucleotide is an oligonucleotide, or
equivalent thereof, generated through a method of the invention.
This part of the invention is further referred to as double- or
multi-exon skipping. In most cases, double-exon skipping results in
the exclusion of only the two targeted (complementary) exons from
the pre-mRNA. However, in other cases, it was found that the
targeted exons and the entire region in between the exons in the
pre-mRNA were not present in the produced mRNA even when other
exons (intervening exons) were present in such region. This
multi-skipping was notably so for the combination of
oligonucleotides derived from the DMD gene, wherein one
oligonucleotide for exon 45 and one oligonucleotide for exon 51 was
added to a cell transcribing the DMD gene. Such a set-up resulted
in mRNA being produced that did not contain exons 45 to 51.
Apparently, the structure of the pre-mRNA in the presence of the
mentioned oligonucleotides was such that the splicing machinery was
stimulated to connect exons 44 and 52 to each other.
[0025] It has now also been found possible to specifically promote
the skipping of the intervening exons by providing a linkage
between the two complementary oligonucleotides. To this end,
provided is a compound capable of hybridizing to at least two exons
in a pre-mRNA encoded by a gene, the compound comprising at least
two parts, wherein a first part comprises an oligonucleotide having
at least eight consecutive nucleotides that are complementary to a
first of at least two exons, and wherein a second part comprises an
oligonucleotide having at least eight consecutive nucleotides that
are complementary to a second exon in the pre-mRNA. The at least
two parts are linked in the compound so as to form a single
molecule. The linkage may be through any means but is preferably
accomplished through a nucleotide linkage. In the latter case, the
number of nucleotides that do not contain an overlap between one or
the other complementary exon can be zero, but is preferably between
4 to 40 nucleotides. The linking moiety can be any type of moiety
capable of linking oligonucleotides. Currently, many different
compounds are available that mimic hybridization characteristics of
oligonucleotides. Such a compound is also suitable for the
invention if such equivalent comprises similar hybridization
characteristics in kind, not necessarily in amount. Suitable
equivalents were mentioned earlier in this description. One, or
preferably more, of the oligonucleotides in the compound are
generated by a method fix generating an oligonucleotide of the
invention. As mentioned, oligonucleotides of the invention do not
have to consist of only oligonucleotides that contribute to
hybridization to the targeted exon. There may be additional
material and/or nucleotides added.
[0026] As mentioned, a preferred gene for restructuring mRNA is the
DMD gene. The DMD gene is a large gene, with many different exons.
Considering that the gene is located on the X-chromosome, it is
mostly boys that are affected, although girls can also be affected
by the disease, as they may receive a bad copy of the gene from
both parents, or are suffering from a particularly biased
inactivation of the functional allele due to a particularly biased
X chromosome inactivation in their muscle cells. The protein is
encoded by a plurality of exons (79) over a range of at least 2.6
Defects may occur in any part of the DMD gene. Skipping of a
particular exon or particular exons can very often result in a
restructured mRNA that encodes a shorter than normal, but at least,
partially functional, dystrophin protein. A practical problem in
the development of a medicament based on exon-skipping technology
is the plurality of mutations that may result in a deficiency in
functional dystrophin protein in the cell. Despite the fact that
already multiple different mutations can be corrected for by the
skipping of a single exon, this plurality of mutations requires the
generation of a large number of different pharmaceuticals; as fix
different mutations, different exons need to be skipped.
[0027] An advantage of a compound capable of inducing skipping of
two or more exons, is that more than one exon can be skipped with a
single (pharmaceutical This property is practical and very useful
in that only a limited number of pharmaceuticals need to be
generated for treating many different Duchenne or Becker mutations.
Another option now open to the person skilled in the art is to
select particularly functional restructured dystrophin proteins and
produce compounds capable of generating these preferred dystrophin
proteins. Such preferred end results are further referred to as
mild phenotype dystrophins. The structure of the normal dystrophin
protein can be schematically represented as two endpoints having
structural function (the beads), which are connected to each other
by a long, at least partly flexible, rod. This rod is shortened in
many Becker patients.
[0028] This led the field to the conclusion that not so mach the
length of the rod, but the presence of a rod and the composition
thereof (with respect to particular hinge regions in the protein),
is crucial to the function per se of the dystrophin protein. Though
the size of the rod may have an impact on the amount of
functionality of the resulting (Becker) protein, there are many
notable exceptions. These exceptions will be detailed below. There
are especially benign mutations that can have a very short rod. It
was noted by the inventors that many more different types of Becker
patients should have been detected in the patient population.
However, some types of shortened dystrophin proteins, that
according to this hypothesis should have a Becker phenotype, are
not detected in human population. For some of these "theoretical"
Becker forms, this could just be a matter of chance. However, in
the invention, it has been found that at least some of these
"potential" Becker patients have such a benign phenotype that
subjects having these types of mutations do not present themselves
to a doctor or are not diagnosed as suffering from Becker's
disease. With a compound of the invention, it is possible to
restructure DMD pre-mRNA of many different Duchenne and even Becker
patients such that a mild phenotype dystrophin is generated after
translation of the restructured mRNA.
[0029] Thus provided is a particularly preferred compound, wherein
the parts of the compounds at least comprise a first part
comprising an oligonucleotide or equivalent thereof, complementary
to exon 17, and a second part comprising an oligonucleotide or
equivalent thereof, complementary to exon 48. The resulting
restructured mRNA encodes an in-frame shortened dystrophin protein,
lacking all exons from 17 to 48. This shortened dystrophin protein
mimics a mild phenotype dystrophin as mentioned above. The compound
(referred to as the 17-48 compound) should, according to current
databases, be able to deal with as much as 20% of the patients
having a DMD mutation currently characterized. Another preferred
compound is the 45-55 compound. This compound should, according to
the same calculations, be able to deal with 38% of the patients
having a DMD mutation thus far characterized.
[0030] In yet another embodiment, the compound comprises a 42-55
compound or a 49-59 compound capable of dealing with, respectively,
65% and 18% of the currently characterized DMD patients. Preferred
are a 45-49 compound and a 45-51 compound, preferably in the form
as disclosed in the experimental part, having the potential to
treat, respectively, 4% and 8% of the DMD patients characterized
thus far.
[0031] Another aspect of the invention is a compound capable of
hybridizing to one exon in a pre-mRNA encoded by a gene, the
compound comprising at least two parts, wherein a first part
comprises an oligonucleotide of which at least a part of the
oligonucleotide is complementary to the closed structure and
wherein a second part comprises an oligonucleotide of which at
least part is complementary to the open structure. The open and
closed structures are, of course, determined from a secondary
structure of RNA from the exon. A compound having two
distinguishable parts complementary to a single exon may comprise
an oligonucleotide, or equivalent thereof, or combination thereof,
as mentioned herein in the method for generating the
oligonucleotide.
[0032] A transcription system containing a splicing system can be
generated in vitro. The art has suitable systems available.
However, the need for mRNA restructuring is, of course,
predominantly felt for the manipulation of living cells,
preferably, cells in which a desired effect can be achieved through
the restructuring of an mRNA. Preferred mRNAs that are restructured
are listed hereinabove. Preferably, genes active in muscle cells
are used in the invention. Muscle cells (e.g., myotubes) are
multinucleated cells in which many, but not all, muscle
cell-specific genes are transcribed via long pre-mRNA. Such long
pre-mRNAs are preferred for the invention, as restructuring of
MRNAs produced from such long mRNAs is particularly efficient. It
is thought, though it need not necessarily be so, that the
relatively long time needed to generate the full pre-mRNA aids the
efficiency of restructuring using a method or means of the
invention, as more time is allowed for the process to proceed. The
preferred group of genes of which the mRNA is preferably
restructured in a method of the invention comprises: COL6A1 causing
Bethlem myopathy, MTM1 causing myotubular myopathy, DYSE (dysferlin
causing Miyoshi myopathy), and LGMD, LAMA2 (Laminin alpha 2)
causing Merosin-deficient muscular dystrophy, EMD (emerin) causing
Emery-Dreyfuss muscular dystrophy, the DML) gene causing Duchenne
muscular dystrophy and Becker muscular dystrophy, and CAPN3
(calpain) causing LGMD2A. Any cell may be used, however, as
mentioned, a preferred cell is a cell derived from a DMD patient.
Cells can be manipulated in vitro, i.e., outside the subject's
body. However, ideally, the cells are provided with a restructuring
capacity in vivo. Suitable means fur providing cells with an
oligonucleotide, equivalent or compound of the invention are
present in the art. Improvements in these techniques are
anticipated considering the progress that has already thus far been
achieved. Such future improvements may, of course, be incorporated
to achieve the mentioned effect on restructuring of mRNA using a
method of the invention. At present, suitable means for delivering
an oligonucleotide, equivalent or compound of the invention to a
cell in vivo comprises polyethylenimine (PEI) or synthetic
amphiphils (SAINT-18) suitable fur nucleic acid transfections. The
amphiphils show increased delivery and reduced toxicity, also when
used for in rho delivery. Preferably, compounds mentioned in
Smisterova, A. Wagenaar, M. C. A. Stuart, E. Polushkin, G. ten
Bunke, R. Hulst, J. B. F. N. Engberts, and D. Hoekstra, "Molecular
shape of the Cationic Lipid Controls the Structure of the Cationic
Lipid/Dioleylphosphatidylethanolomine-DNA Complexes and the
Efficiency of Gene Delivery," J. Biol Chem. 2001, 276:47615. The
synthetic amphiphils preferably used are based upon the easily
synthetically available "long-tailed" pyridinium head group-based
materials. Within the large group of amphiphils synthesized,
several show a remarkable transfection potential combined with a
low toxicity in terms of overall cell survival. The ease of
structural modification can be used to allow further modifications
and the analysis of their further (in vivo) nucleic acid transfer
characteristics and toxicity.
[0033] An oligonucleotide, equivalent thereof, or a compound
according to the invention may be used for, at least in part,
altering recognition of the exon in a pre-mRNA. In this embodiment,
the splicing machinery is at least in part prevented from linking
the exon boundaries to the mRNA. The oligonucleotide, equivalent or
compound of the invention is at least in part capable of altering
exon recognition in a pre-mRNA. This use is thus also provided in
the invention. The prevention of inclusion of a targeted exon in an
mRNA is also provided as a use for, at least in part, stimulating
exon skipping in a pre-mRNA. As mentioned above, the targeted exon
is not included in the resulting mRNA. However, part of the exon (a
neo-exon) may occasionally be retained in the produced mRNA. This
sometimes occurs when the targeted exon contains a potential splice
acceptor and/or splice donor sequence. In this embodiment, the
splicing machinery is redirected to utilize a previously unused (or
underused) splice acceptor/donor sequence, thereby creating a new
exon (neo-exon). The neo-exon may have one end in common with the
paleo-exon, although this does not always have to be the case.
Thus, in one aspect, an oligonucleotide, equivalent or compound of
the invention is used for altering the efficiency with which a
splice donor or splice acceptor is used by a splicing
machinery.
[0034] In view of the foregoing, further provided is the use of an
oligonucleotide, an equivalent thereof; or a compound of the
invention for the preparation of a medicament. Further provided is
a pharmaceutical preparation comprising an oligonucleotide,
equivalent thereof or a compound according to the invention. An
oligonucleotide, an equivalent thereof or a compound of the
invention can be used for the preparation of a medicament for the
treatment of an inherited disease. Similarly provided is a method
for altering the efficiency with which an exon in a pre-mRNA is
recognized by a splicing machinery, the pre-mRNA being encoded by a
gene comprising at least two exons and at least one intron, the
method comprising providing a transcription system comprising the
splicing machinery and the gene, with an oligonucleotide,
equivalent thereof or a compound according to the invention,
wherein the oligonucleotide, equivalent thereof or compound is
capable of hybridizing to at least one of the exons, and allowing
for transcription and splicing to occur in the transcription
system. The gene may comprise at least three exons.
[0035] An oligonucleotide of the invention may be provided to a
cell in the form of an expression vector, wherein the expression
vector encodes a transcript comprising the oligonucleotide. The
expression vector is preferably introduced into the cell via a gene
delivery vehicle. A delivery vehicle may be a viral vector such as
an adenoviral vector and, more preferably, an adeno-associated
virus vector. Also provided are such expression vectors and
delivery vehicles. It is within the skill of the artisan to design
suitable transcripts. Preferred for the invention are PolIII-driven
transcripts, preferably in the form of a fusion transcript with a
U1 or U7 transcript. Such fusions may be generated as described in
references 53 and 54,
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] FIGS. 1A-1F show RT-PCR and sequence analysis of dystrophin
mRNA fragments of the AON-treated DMD patient myotube cultures
(patient DL 515.2 (1A); patient DL363.2 (1B); patient 50685.1 (1C);
patient DL 589.2 (1D); patient 53914.1 (1E); patient 50423.1 (1F)),
focusing on the regions encompassing the exons targeted for
skipping. Shorter novel transcripts were observed when compared to
the untransfected myotube cultures (NT). Sequence analysis
confirmed the precise skipping of the targeted exons. An
alternatively spliced product, detected for patient 50685.1 (1C)
was sequenced and found to be derived from activation of a cryptic
splice site in exon 51. Shorter fragments, detected in
untransfected myotube cultures from DL 363.2 (1B), DL 589.2 (1D)
and 53914,1 (1E), were sequenced and found to be the result of the
spontaneous skipping of exons 44, 50 and 53, respectively. Note
that in some analyses, additional fragments, slightly shorter than
the wild-type products, were present. This was due to heteroduplex
formation. 100 bp: size marker, -RT-PCR: negative control.
[0037] FIGS. 2A-2F illustrate immuno-histochemical analysis of the
AON-treated myotube cultures from the six different DMD patients
(patient DL 515.2. (2A); patient DL363.2 (2B); patient 50685.1
(2C); patient DL 589.2 (2D); patient 53914.1 (2E); patient 50423.1
(2F)). Cells were stained for myosin to identify hilly
differentiated myotubes (not shown). Monoclonal antibodies MANDYS1
(middle panel) and Dys2 (right panel) were used to detect
dystrophin one to four days post-transfection. No dystrophin
signals could be detected in untreated cells stained with MANDYS1
(left panel) nor Dys2 (not shown), whereas clear, mainly
cytoplasmic dystrophin signals could be detected for each patient
upon the induced exon skipping. In patients DL 363.2 (2B), DL 589.2
(2D) and 53914.1 (2E), dystrophin membrane signals could be
observed. Note that membrane signals were more often found for
Dys2, which recognizes the full-length dystrophin. MANDYS1
recognizes an internal part of dystrophin and is more prone to
generate cytoplasmic signals, since it also detects dystrophin in
the first stages of synthesis. Magnification 63.times..
[0038] FIGS. 3A-3F are Western blot analyses of the AON-treated
myotube cultures from six different patients (patient DL 515.2
(3A); patient DL363.2 (3B); patient 53914.1 (3C); patient 50685.1
(3D); patient DI, 589.2(3E); patient 50423.1 (3F)). Monoclonal
antibody DY4 was used to detect dystrophin. Protein extracts
isolated from human control myotube cultures (HC) were used as a
positive control (3C and 3F). To avoid over-exposure, this sample
was 1 to 10 diluted. To demonstrate equal loading of protein
samples, blots were additionally stained with an antibody against
myosin. No, or, as a result of spontaneous exon skipping, very low
(3E and 3C) levels of dystrophin were detected in non-transfected
Myotube cultures (NT). Clear dystrophin signals were observed in
AON-treated myotube cultures for each of the patients. For 50685.1
and DL 363.2, a time-course experiment was performed. Dystrophin
could be detected 16 hours post-transfection and was found at
increasing levels at 24 hours and 48 hours post-transfection for
50685.1 (3D). For DL 363.2, dystrophin could be detected in
increasing levels up to seven days post-transfection (3B). For
patients DL 515.2 (3A), DL 363.2 (3B) and DL 589.2 (3E), the
detected dystrophin was significantly shorter than the control
dystrophin. This is due to the size of the deletions in these
patients.
[0039] FIGS. 4A-4B show immuno-histochemical analysis of four DGC
proteins from treated myotube cultures from patient DL 363.2. Cells
were stained for myosin to identify sufficiently differentiated
myotubes (not shown). Monoclonal antibodies NCL-a-SARC, NCL-b-SARC,
NCL-g-SARC and NCL-b-DG were used to detect .alpha.-sarooglycan,
.beta.-sarcogilycan, .gamma.-sarcoglycan and .beta.-dystroglycan,
respectively. These proteins were detected in reduced percentages
(.sup.-40%) in untreated myotubes, and were mainly located in the
cytoplasm (4A). Following AON treatment, however,
.alpha.-sarcoglycan was detected in 70%, B-sarcoglycan was detected
in 90%, .gamma.-sarcoglycan was detected in 90% and
.beta.-dystroglycan was detected in 80% of the myotubes, and the
proteins were mostly membrane-bound (4B), Magnification
63.times..
[0040] FIGS. 5A-5I are RT-PCR analyses of human dystrophin mRNA in
the regions encompassing the exons targeted for skipping. Exon
skipping was assessed using AONs directed to exon 2 (5A and 5B),
exon 29 (5C), exon 40, 41 or 42 (5D), exon 43, 44 or 45 (5E), exon
46 (5F), exon 47, 48, 49 or 50 (5G), exon 51 (5H) and exon 53 (5I).
Shorter novel transcript fragments were observed following
transfection with the different AONs when compared to
non-transfected myotube cultures (NT). Sequence analysis (not
shown) confirmed the skipping of the targeted exons, as indicated
by the labels adjacent to the images. Alternatively spliced
products, detected in the regions around exon 2 (b), exon 29 (c),
and exon 51 (h), were sequenced and !build to be derived from
either co-skipping of adjacent exons or usage of a cryptic splice
site. No specific (RT-) PCR products were obtained. In some
analyses, additional fragments, lightly shorter than the wild-type
products, were present. This was due to heteroduplex formation.
[0041] FIG. 6 illustrates double-exon skipping in DMD patient
DL90.3 carrying a nonsense mutation in the out-of-frame exon 43.
RT-PCR analysis of dystrophin mRNA fragments of AON-treated
myotubes from this patient showed a shorter, novel transcript not
present in untransfected myotubes (NT). Sequence analysis confirmed
the precise skipping of the targeted exons 43 and 44, Besides this
double-skip, we also detected a single-exon 44 skip. Note that the
additional fragment, slightly shorter than the wild-type product,
is due to heteroduplex formation. 100 bp: size marker, -RT-PCR:
negative control.
[0042] FIGS. 7A-7D illustrate double- and multi-exon skipping in
human control myotubes (KM 109), DMD) (7A) patient DL 470.2 (7B),
carrying a deletion of exons 46 to 50, and DMD patient 50685,1,
carrying a deletion of exons 48 to 50 (7C). FIG. 7D is RT-PCR
analysis of dystrophin mRNA fragments in the myotube cultures
treated with either a mixture of h45A0N5 and h51A0N2 (mix) or with
a U-linked combination of AONs (U: h45AON5 linked to h51AON2 by ten
uracil nucleotides). In all samples treated with either the mix of
AONs or the U-linker AON, a shorter transcript fragment was
detected that contained exon 44 spliced to exon 52, and that was
not present in untreated rnyotubes (NT). This novel, in-frame
transcript arose from double-exon skipping in patient AL 470.2 (the
targeted exons 45 and 51 are directly flanking the deletion), but
from multi-exon skipping in both the human control and patient
50685.1. In the treated patient myotube cultures, additional
shorter fragments were observed due to single-exon 45 and
single-exon 51 skipping. Note that in some lanes, other fragments,
slightly shorter than the wild-type products, were present. This
was due to heteroduplex formation. 100 bp: size marker, -RT-PCR:
negative control. FIG. 7D shows that all fragments were quantified
using the DNA 7500 LABCHIP.RTM. and the BIOANALYZER.TM. (Agilent).
The percentage of double- or multi-exon 45 to 51 skipping was
determined by the ratio of this fragment to the total of transcript
fragments, The U-combined AON seems less efficient in AL 470.2, but
more efficient in KM 109 and 50685.1, when compared to the mixture
of AONs.
DETAILED DESCRIPTION
EXAMPLES
Example 1
Results
[0043] This study includes six DMD patients affected by different
mutations (Table 1). Patient DL 515.2 carries an exon 45-50
deletion; hence exon 51 skipping would be frame correcting. Patient
DL 363.2. has a deletion of exon 45-54; the reading frame for this
patient would be corrected by an exon 44 skip. For patient 50685.1,
who is affected by an exon 48-50 deletion, reading frame correction
requires an exon 51 skip. Patient DL 5892 has an exon 51-55
deletion; the reading frame would be corrected by an exon 50 skip.
Patient 53914A carries a single-exon 52 deletion. Notably, in this
case, both the skipping of exon 51 or exon 53 would be frame
correcting. Finally, patient 50423.1 has a deletion of a single
base pair in exon .49, at position 7389 on cDNA. level, resulting
in a frame-shift and a premature stop codon in exon 49. Since exon
49 is an in-frame exon, skipping of this exon would correct the
reading frame fix this patient.
[0044] We have previously identified AONs with which the skipping
of the mentioned target exons 44, 49, 50, 51 and 53 can be induced
at concentrations of 1 .mu.M (23). In subsequent dose-response
experiments, however, we have obtained substantial skipping
efficiencies with lower concentrations of 500 nM or 200 nM, and
even 100 nM for most AONs (data not shown). This had the extra
advantageous effect of lower doses of PEI required for
transfection, which significantly reduced the levels of
cytotoxicity as found in our earlier transfection experiments.
Myotube cultures from the six DMD patients were transfected with
the relevant AONs. On average, 70% to 90% of cells showed specific
nuclear uptake of fluorescent AONs. RNA was isolated 24 hours
post-transfection and analyzed by RT-PCR (FIGS. 1A-1F). In all
patients, the targeted exons were skipped at high efficiencies, and
precisely at the exon boundaries, as confirmed by sequence analysis
of the novel shorter transcripts (FIGS. 1A-1F). For patient
50685.1, an additional transcript fragment was found (FIG. 1C).
Sequence analysis showed that this was generated by the activation
of a cryptic splice site in exon 51, This was previously also
observed in human control cells treated with the same AON (23).
Remarkably, low levels of spontaneous exon skipping were observed
in untreated cells derived from patients DL 363.2 (exon 44 skip),
DL 589.2 (exon 50 skip), and 53914,1 (exon 53 skip). RT-PCR
analysis on several larger areas of the DMD gene transcript did not
reveal additional, unexpected, aberrant splicing patterns induced
by the AON-treatment.
[0045] The resulting in-frame transcripts should restore dystrophin
synthesis. Indeed, immuno-histochemical analysis of transfected
myotube cultures detected dystrophin in the majority of myotubes
for each patient (FIGS. 2A-2F). The therapeutic efficiency was
determined by double staining, using antibodies against myosin, to
identify sufficiently differentiated myotubes and dystrophin. On
average, 75% to 80% of myosin-positive myotubes showed dystrophin
expression. We observed clear membrane-bound dystrophin for
patients DL 363.2, DL 589.2 and 53914.1 two days post-transfection
(FIGS. 2B, 2D, and 2E). The presence of dystrophin was confirmed
tier each patient by Western blot analysis (FIGS. 3A-3F). For
patients 50685.1 and DL 363.2, we performed time course
experiments, which indicated that dystrophin can be detected as
soon as 16 hours post-transfection (FIG. 3D) and at increasing
levels up to seven days post-transfection (FIG. 3B). The dystrophin
proteins from patients DL515.2, DL 363.2 and DL 589.2 are
significantly shorter than the human control, which is due to the
size of the deletion.
[0046] For one patient, DL 363.2, we also assessed whether the
induction of the dystrophin synthesis resulted in the restoration
of the DGC (FIGS. 4A-4B). Prior to AON treatment, we found reduced,
mainly cytoplasmatic alpha, beta, gamma sarcoglycan and
beta-dystroglycan signals (30%, 30%, 40% and 80%, respectively)
(FIG. 4A). Following AON transfection, increased levels of mainly
membrane-bound alpha-, beta- and gamma-sarcoglycans and
beta-dystroglycan were detected in 70%, 90%, 90% and 80% of the
treated myotube cultures, respectively (FIG. 4B).
Discussion
[0047] The reading frame correction strategy for DMD patients is
aimed at antisense-induced, targeted exon skipping. This would
convert a severe DMD phenotype into a mostly milder BMD phenotype.
We determined the broad applicability in six patients, carrying
five different deletions and a point mutation in an exon 49 (Table
I). Following AON treatment, we show for each patient the precise
skipping of the targeted exon on the RNA level, and a. dystrophin
protein in 75% to 80% of the treated myotubes. In particular, we
here report, for the first time, the application of a single AON
treatment (i.e., the induced skipping of exon 51) to correct the
reading frame for several different deletions.
[0048] Interestingly, the levels of exon skipping observed in the
DMD patient cells are significantly higher than those previously
obtained in human control cells (23). Typically, the novel skip
transcript is the major product. This can be explained by the
action of the nonsense-mediated decay (NMD) process (25, 32). In
control cells, the skip of an out-of-frame exon results in an
out-of-frame transcript, which will be susceptible to NMD. In
patient cells, the skip of a target exon results in an in-frame
transcript that would be resistant to NMD and thus more stable than
the out-of-frame transcript originally present.
[0049] For three of the patients (DL 363.2, DL 589,2 and 53914.1),
we detected low levels of spontaneous skipping of exons 44, 50 and
53 in untreated cells. This phenomenon has previously also been
described for so-called revertant muscle fibers (33-35). These
dystrophin-positive fibers are present in low amounts (2% to 10%)
in DMD muscles and are considered to be the result of secondary
somatic mutations and/or alternative splicing that restore the
reading frame. The existence of revertant fibers has been suggested
to correlate with the severity of the disease (36, 37)
[0050] Restoration of the dystrophin synthesis could be detected as
soon as 16 hours post-transfection. At two days post-transfection,
dystrophin was detected at the membrane, indicating that these
novel BMD-like proteins are likely in part functional. Furthermore,
we show that restoration of the dystrophin synthesis appears to
re-establish the formation of the dystrophin-glycoprotein
complex.
[0051] In patients DL 363.2 and DL 589.2, the targeted exon
skipping enlarged the deletions to span exons 44-54 and 50-55,
respectively. So far, these deletions have not been reported in DMD
or BMD patients. This means that they either do not exist or
generate a very mild phenotype not diagnosed as BMD. Considering
both the large variety of BMD mutations and the markedly lower
incidence of BMD observed, we consider the last explanation more
plausible than the first. The out-of-frame deletions from patients
DL 515,1, 50685.1 and 50423.1 were converted into in-frame
deletions as observed in BMD patients carrying deletions of exon
45-51, exon 48-51 and exon 49 (30, 38-40); noteworthy, the exon
48-51 deletion has even been described in an asymptomatic person
(40). On the other hand, however, there are also DMD patients
carrying such deletions (38, 41-43). Since most of these
theoretical in-frame deletions have been detected on the DNA level
only, we hypothesize that the dystrophin deficiency in these DMD
patients may be caused by additional aberrant splicing patterns on
the RNA level, resulting in an out-of-frame transcript.
[0052] It is feasible to correct over 75% of the mutations reported
in the Leiden DMD-mutation database (30). Our results indicate that
antisense-induced reading frame correction will be a (promising
therapeutic approach for many DMD patients carrying different
deletions and point mutations. Towards the establishment of
clinical trials, we are currently investigating and optimizing
delivery methods in muscle tissue of mice in vivo.
Material and Methods
AONs and Primers
[0053] The AONs applied (Table 1) were previously described (23).
They contain a 5' fluorescein group (6-FAM), a full-length
phosphorothioate backbone and 2'-O-methyl modified ribose molecules
(Eurogentec, BE). To avoid interference with the fluorescent
signals of the secondary antibodies, unlabelled AONs were used for
immuno-histochemical. analyses. Primers for RT-PCR analysis
(sequences available upon request) were synthesized by Eurogentec
(BE) or by isogen Bioscience BV (NL).
Myogenic Cell Cultures and AON Transfections
[0054] Primary human myoblasts from patients DL 515.2. (deletion
exon 45-50). DL 363.2 (deletion exon 45-54), 50685.1 (deletion exon
48-50), DL 589.2 (deletion exon 51-55) and 53914.1 (deletion exon
52) were isolated from a muscle biopsy and cultured as described
(44). Cultures were seeded in collagen pre-coated flasks and plates
(Vitrogen 100, Cohesion). Myotubes were obtained from confluent
myoblast cultures, following 7 to 14 days of serum deprivation.
They were subsequently transfixed using polyethylenimine (PEI) for
three hours in low-serum medium, according to the manufacturer's
instructions (ExGen500; MBI Fermentas), and with 3.5 .mu.l. applied
per .mu.g of transfected AON. For RT-PCR analysis, concentrations
of 500 nM AON were used. At this concentration, the highest
skipping levels can be obtained, albeit with moderate levels of
cell death. Because more viable myotubes are required for
immunohistochemical and western blot analysis, concentrations of
200 nM were applied.
[0055] For patient 50423.1, who carries a point mutation in exon
49, only fibroblasts were available. Following infection (MOI
50-100) with an adenoviral vector containing the MyoD gene
(Ad50MyoD), the fibroblasts were forced into myogenesis according
to protocols described previously (45-47). Two hours
post-infection, the medium was replaced by low-serum medium, and
cells were incubated for eight to ten days until myotubes were
formed. Transfection conditions were identical to those described
above.
RNA Isolation and RT-PCR Analysis
[0056] At 24 hours post-transfection, total RNA was isolated from
the myotube cultures (RNA-Bee RNA isolation solvent, Campro
Scientific, NL), 300 ng of total RNA was used for RT-PCR analysis
using C. therm polymerase (Roche Diagnostics, NL) in a 20 .mu.l.
reaction at 60.degree. C. for 30 minutes, primed with different DMD
gene-specific reverse primers (Table 1). Primary PCRs were
performed by 20 cycles of 94.degree. C. (40 seconds), 60.degree. C.
(40 seconds) and 72.degree. C. (60 seconds). One .mu.l of these
reactions was then reamplified in nested PCRs by 32 cycles of
94.degree. C. (40 seconds), 60.degree. C. (40 seconds) and
72.degree. C. (60 seconds). PCR products were analyzed on 1.5% or
2% agarose gels. Noteworthy, no evidence kw a significant
preference for the amplification of shorter fragments was obtained
in PCR analyses on a defined series of mixtures of known quantities
of the normal and shorter transcript fragments (data not
shown).
Sequence Analysis
[0057] RT-PCR products were isolated from agarose gels using the
QIAQUICK.RTM. Gel Extraction Kit (Qiagen). Direct DNA sequencing
was carried out by the Leiden Genome. Technology Center (LGTC)
using the BigDye Terminator Cycle Sequencing Ready Reaction kit (PE
Applied Biosystems) and analyzed on an ABI 3700 Sequencer (PE
Applied Biosystems).
Protein Isolation and Western Blot Analysis
[0058] Protein extracts were isolated from treated myotube cultures
(25 cm.sup.2 flasks), using 150 .mu.l of treatment buffer (75 mM
Tris-HCl pH 6.8, 15% SDS, 5% B-mercaptoethanol, 2% glycerol, 0.001%
bromophenol blue), at two to four days post-transfection, depending
on the survival rate of the myotubes, For the time course
experiments, protein extracts were isolated 4 hours, 8 hours, 16
hours, 24 hours and 48 hours post-transfection (for patient
50685.1) or at 2 days, 4 days and 7 days post-transfection (for
patient DL 3632).
[0059] Polyacrylamide gel electrophoresis and Western blotting were
performed as described by Anderson et al., with some minor
adjustments (48). Briefly, samples (75 .mu.l) were run overnight at
4.degree. C. on a 4% to 7% polyacrylamide gradient gel. Gels were
blotted to nitrocellulose for five to six hours at 4.degree. C.
Blots were blocked for one hour with 5% non-fat dried milk in TBST
buffer (10 niM Tris-HCl, 0.15 M NaCl, 0.5% Tween 20, pH 8),
followed by an overnight incubation with INCL-DYS2 (which
recognizes dystrophin) diluted 1:50, HRP-conjugated anti-mouse
(Santa Cruz) diluted 1:10,000 was used as a secondary antibody.
Immuno-reactive bands were visualized using Lumi-Lightplus Western
Blotting Substrate and scanned with a Lumi-Imager (Roche
Diagnostics, NL).
Immunohistochemical Analysis
[0060] Treated myotube cultures were fixed in -20.degree. C.
methanol at one to four days post-transfection, depending of the
survival rate of the myotubes. Prior to reaction with the different
antibodies, the oncells were incubated for one hour in a blocking
solution containing 5% horse serum (Gibco BRL) and 0.05% Tween-20
(Sigma) in PBS (Gibco BRL). All antibodies used were diluted in
this blocking solution. The following antibodies were applied:
desmin polyclonal antibody (ICN Biomedicals) diluted 1:100, myosin
monoclonal antibody diluted 1:100 (MF20; Developmental Studies
Hybridoma Bank, University of Iowa), myosin polyclonal antibody L53
diluted 1:100 (a gift from Dr. M. van den Hoff, AMC, NL), MANDYS1
(a gift from Dr. G, Morris, North East Wales institute, UK) diluted
1:110 and NCL-DYS2 (Novacastra Laboratories Ltd) diluted 1:10 to
detect dystrophin, NCL-a-SARC (Novacastra Laboratories Ltd) diluted
1:75, NCL-b-SARC (Novacastra Laboratories Ltd) diluted 1:50,
NCL-g-SARC (Novacastra Laboratories Ltd) diluted 1;50 and NCL-b-DG
(Novacastra Laboratories Ltd) diluted 1:50 to detect
.alpha.-sarcoglycan, .beta.-sarcoglycan, .gamma.-sarcoglycan and
.beta.-dystroglycan, respectively. After one hour incubation,
slides were rinsed and incubated for one hour with the secondary
antibodies Alexa Fluor 594 goat anti-rabbit conjugate diluted
1:1000 or Alexa Fluor 488 goat anti-mouse conjugate diluted 1:250
(Molecular Probes Inc). The slides were analyzed using a Leica
confocal microscope equipped with epifluorescence optics. Digital
images were captured using a CCD camera (Photometrics).
Example 2
Materials and Methods
AONs and Primers
[0061] A series of AONs (two per exon, see Table 2) was designed to
hind to exon-internal target sequences showing a relatively high
purine-content and, preferably, an open secondary pre-mRNA
structure (at 37.degree. C.), as predicted by the RNA refold
version 3.1 server [22]. The AONs varied in length between 15 and
24 bp, with G/C contents between 26 and 67%. They were synthesized
with the following chemical modifications: a 51-fluorescein group
(6-FAM), a 1141-length phosphorothioate backbone and
21-0-methyl-modified ribose molecules (Eurogentec, BE). The primers
used for reverse transcription polymerase chain reaction (RT PCR)
analysis (Table 3) were synthesized by Eurogentec (BE) or by Isogen
Bioscience BY (NL).
In vitro Experiments
[0062] Primary human myoblasts were isolated from a muscle biopsy
from a non-affected individual (KM108) by enzymatic dissociation.
Briefly, the tissue was homogenized in a solution containing 5
mg/ml collagenase type VIII (Sigma), 5 mg/ml bovine albumin
fraction V (Sigma), 1% trypsin (Gibco BRE) in PBS (Gibco BRE).
Following serial incubation steps of 15 minutes at 37.degree. C.,
suspensions containing the dissociated cells were added to, and
pooled in, an equal volume of proliferation medium (Nut.Mix F-10
(HAM) with GlutaMax-1, Gibco BRL) supplemented with 20% fetal
bovine serum (Gibco BRL) and 1% penicillin/streptomycin solution
(Gibco BRL), After centrifugation, the cells were plated and
further cultured in proliferation medium, using flasks that were
pre-coated with purified bovine dermal collagen (Vitrogen 100;
Cohesion).
[0063] The myogenic cell content of the culture, as determined by
the percentage of desmin-positive cells in an immunohistochemical
assay, was improved to 58% by repetitive pre-plating [23]. Myotubes
were obtained from confluent myoblast cultures following 7 to 14
days of incubation in low-serum medium (DMEM (Gibco BRL),
supplemented with 2% GlutaMax-1, 1% glucose, 2% fetal bovine serum
and 1% penicillin/streptomycin solution). For transfection of the
myotube cultures, we used polyethylenimine (PEI; Ex, Gen 500)
according to the manufacturer's instructions (MBI Ferrnentas). The
cultures were transfected for three hours in low-serum medium with
1 mM of each AON linked to PEI at a ratio-equivalent of 3.5.
[0064] RNA isolation and RT-PCR analysis at 24 hours
post-transfection, total RNA was isolated from the myotube cultures
using RNAzol B according to the manufacturer's instructions (Campro
Scientific, NL). One microgram of RNA was then used for RT-PCR
analysis using C. therm polymerase (Roche Diagnostics) in a 20
.mu.l reaction at 60.degree. C. for 30 minutes, primed with
different DMD gene-specific reverse (RI') primers ('Table 3).
Primary PCRs were carried out with outer primer sets (see Table 3),
for 20 cycles of 94.degree. C. (40 seconds), 60.degree. C. (40
seconds), and 72.degree. C. (90 seconds), One microliter of this
reaction was then reamplified in nested PCRs using the appropriate
primer combinations (Table 3) for 32 cycles of 94.degree. C. (40
seconds), 60.degree. C. (40 seconds), and 72.degree. C. (60
seconds). PCR products were analyzed on 1.5 or 2% agarose gels.
[0065] Sequence analysis RT-PCR products were isolated from agarose
gels using the QIAQUICK.RTM. Gel Extraction kit (Qiagen). Direct
DNA sequencing was carried out by the Leiden Genome Technology
Center (LGTC) using the BIGDYE.RTM. Terminator Cycle Sequencing
Ready Reaction kit (RE Applied Biosystems), and analyzed on an ABI
3700 Sequencer (PE Applied Biosystems).
Results
[0066] In vitro Exon Skipping
[0067] AONs were empirically analyzed for the induction of exon
skipping following transfection into human control myotube
cultures, using the cationic polymer polyethylenimine (PEI), As
determined by the nuclear uptake of the fluorescent AONs, average
transfection efficiencies of 60-80% were Obtained. At 24 hours
post-transfection, transcripts were analyzed by RT-PCR using
different primer combinations encompassing the targeted exons
(Table 3). Of the 30 AONs tested, a total of 21(70%) reproducibly
generated shorter transcript fragments with sizes corresponding to
the specific skipping of the targeted exons (FIG. 5A-1 and Table
2). In fact, as confirmed by sequence analysis of the shorter
transcripts (data not shown), we could induce the specific skipping
of 13 out of the 15 exons targeted (five out of the seven in-frame
exons, and eight out of the eight out-of-frame exons). No skipping
of exons 47 and 48 was detected (FIG. 5E and G).
[0068] In the specific transcript regions that were screened in
these experiments, we, observed in the non-transfected control
myotubes, alternative splicing patterns around exons 2 and 29
(FIGS. 5B and C). The alternative products were sequenced and found
to be due to the skipping of exons 2-7 (in-frame), exons 3-7
(out-of-frame), exons 28-29 (in-frame), and exons 27-29 (in-frame).
This genuinely occurring exon skipping was also detected previously
in human skeletal muscle [24, 25]. Remarkably, the level of the
alternative splicing was significantly enhanced by the AON
treatment of the transfected myotube cultures, Also noteworthy is
the observation that h2AON1 not only induced exon 2 skipping in the
normal transcript, but also in one of the alternative transcripts
consisting of exons 1 and 2 spliced to exon 8 (FIG. 5B).
[0069] The majority of AONs induced the precise skipping of the
targeted exons, using the original splice sites of the adjacent
exons. However, in response to h51AON2, an in-frame cryptic splice
site was used in exon 51 (FIG. 5H). The level of this alternatively
spliced product was variable in serial transfection experiments.
Finally, in some of the transfection experiments, additional
aberrant splicing fragments were detected due to the co-skipping of
adjacent exons. Their incidence, however, was inconsistent, and at
very low levels.
[0070] References to Example 2 (numbering in this part refers
strictly to numbering used in Example 2)
[0071] [1] Hoffman E. P., R H, Brown Jr., and L. M. Kunkel.
Dystrophin: the protein product of the Duchenne muscular dystrophy
locus. Cell 1987,51:919-928.
[0072] [2] Monaco A. P., C. J. Bertelson, S. Liechti-Gailati, H.
Moser, and L. M. Kunkel. An explanation for the phenotypic
differences between patients bearing partial deletions of the DMD
locus. Genotmics 11988, 2:90-95.
[0073] [3] Koenig M,, A. H. Beggs, and M. Moyer, et al. The
molecular basis for Duchenne versus Becker muscular dystrophy:
correlation of severity with type of deletion. Am, J. Hum. Genet,
1989, 45:498-506.
[0074] [4] Zubrzycka-Gaam E. E.; D. E. Bulman, and G. Karpati, et
al. The Duchenne muscular dystrophy gene product is localized in
sarcolemma of human skeletal muscle. Nature 1988, 333:466469.
[0075] [5] Yoshida M. and E. Ozawa, Glycoprotein complex anchoring
dystrophin to sarcolemma. J. Biochem, (Tokyo) 1990,
108:748-752.
[0076] [6] Ervasti J. M. and K. P. Campbell, Membrane organization
of the dystrophin-glycoprotein complex. Cell 1991,
66:1121-1131.
[0077] [7] Koenig M., A. P. Monaco and L M. Kunkel. The complete
sequence of dystrophin predicts a rod-shaped cytoskeletal protein.
Cell 1988, 53:219-226.
[0078] [8] van Deutekom S. S. Floyd and D. K. Booth, et at.
Implications of maturation for viral gene delivery to skeletal
muscle. Neuromuscul. Disord. 1998, 8:135-148.
[0079] [9] Mayeda A., Y. Hayase, H. Inoue, E. Ohtsuka and Y.
Ohshima, Surveying cis-acting sequences of pre-mRNA by adding
antisense 20-O-methyl oligoribonucleotides to a splicing reaction.
J. Biochem. (Tokyo) 11990, 108:399-405.
[0080] [10] Galderisi U., A. Casein and A. Giordano, Antisense
oligonucleotides as therapeutic agents, J. Cell. Physic!. 1999,
181:251-257.
[0081] [11] Baker 13.F. and B. P. Monia. Novel mechanisms for
antisense-mediated regulation of gene expression. Biochem. Biophys.
Acta 1999, 1489:348.
[0082] [12] Kole R. and R Sazani. Antisense effects in the cell
nucleus: modification of splicing. Cum Opin, Mol, Ther. 2001,
3:229-234.
[0083] [13] Sicinski P., Y. Geng, A. S. Ryder-Cook, E. A. Barnard,
M. G. Daxlison and P. J. Barnard. The molecular basis of muscular
dystrophy in the mdx mouse: a point mutation. Science 1989,
244:15784580.
[0084] [14] Dunckley M. G., M. Manoharan, P. Villiet, L C. Eperon
and G. Dickson. Modification of splicing in the dystrophin gene in
cultured Mdx muscle cells by antisense oligoribonucleotides. Hum,
Mal. Genet. 1998, 7:1083-4090.
[0085] [15] Mann C J., K. Honeyman and Al. Cheng, et at.
Antisense-induced exon skipping and synthesis of dystrophin in the
mdx mouse. Proc. Natl, Acad. Sci. U.S.A. 2001. 98:42-47.
[0086] [16] Wilton S. D., F. Lloyd and K. Canine, et at. Specific
removal of the nonsense mutation from the mdx dystrophin mRNA using
anti-sense oligonucleotides. Neuromuscul. Disord, 1999,
9:330-338.
[0087] [17] Takeshima Y., H. Wada, M. Yagi, et al. Oligonucleotides
against a splicing enhancer sequence led to dystrophin production
in muscle cells from a Duchenne muscular dystrophy patient, Brain
Dev. 2001, 23:788-790.
[0088] [18] Pramono Z. A., Y. Takeshima, H. Alimsardjono, A. Ishii,
S. Takeda and M. Matsuo. Induction of exon skipping of the
dystrophin transcript in lymphoblastoid cells by transfecting an
antisense oligodeoxynucleotide complementary to an exon recognition
sequence. Biochem. Blophys. Res. Commun, 1996, 226:445-449.
[0089] [19] Watakabe A., K. Tanaka and Y. Shimura. The role of exon
sequences in splice site selection. Genes Dev. 1993, 7:407-418.
[0090] [20] Tanaka K., A. Watakabe and Y. Shimura. Polypurine
sequences within a downstream exon function as a splicing enhancer.
Mol. Cell Biol. 1994, 14:1347-1354.
[0091] [21] van Deutekom J. C., M. Bremmar-Bout, A. A. Janson, et
al. Antisense-induced exon skipping restores dystrophin expression
in DMD patient-derived muscle cells. Hum, Mol. Genet. 2001,
10:1547-1554.
[0092] [22] Mathews D E., I Sabina, M. Zuker and D. H. Turner.
Expanded sequence dependence of thermodynamic parameters improves
prediction of RNA secondary structure. A. J. Mol. Biol. 1999,
288:911-940.
[0093] [23] Richter C. and D. Yaffe. The in vitro cultivation and
differentiation capacities of myogenic cell lines. Dev. Biol. 1970,
23:1-22.
[0094] [24] Surono A., Y. Takeshima, T. Wibawa, Z. A. Pramono and
M. Mafsuo. Six novel transcripts that remove a huge intron ranging
from 250 to 800 kb are produced by alternative splicing of the 50
region of the dystrophin gene in human skeletal muscle, Biochem.
Biophys. Res. Commun. 1997,239:895-899.
[0095] [25] Shiga N. Y. Takeshima, H. Sakamoto, et al. Disruption
of the splicing enhancer sequence within exon 27 of the dystrophin
gene by a nonsense mutation induces partial skipping of the exon
and is responsible for Becker muscular dystrophy. J. Clin. Invest.
1997, 100:2204-2210.
[0096] [26] Wells D. S., K B. Wells, E A. Asante, et al. Expression
of human full-length and minidystrophin in transgenic mdx mice:
implications for gene therapy of Duchenne muscular dystrophy. Hum.
Mol. Genet. 1995,4:1945-1250.
[0097] [27] Sironi M., U. Pozzoli, R, Cagliani, G. P. Comi, A.
Barden' and N. Bresolin. Analysis of splicing parameters in the
dystrophin gene: relevance for physiological and pathogenetic
splicing mechanisms. Hum. Genet., 2001, 109:73-84.
[0098] A. Aartsma-Rus et al., Neuromuscular Disorders 12(2002)
871-S77.
EXAMPLE 3
Results
Double-Exon Skipping in Two DMD Patients
[0099] This study includes two DMD patients affected by different
frame disrupting mutations in the DIVED gene that require the skip
of two exons for correction of the reading frame (Table 5). Patient
DL 90.3 carries a nonsense mutation in exon 43. Considering that
this single exon is out-of-frame, the skipping of exon 43 would
remove the nonsense mutation but not restore the reading frame.
[0100] Since the combination with exon 44 is in-frame, in this
patient, we aimed at double-exon skipping, targeting both these
exons. Patient DL 470.2 is affected by a deletion of exons 46 to
50. Frame restoration would require a double-exon skipping of both
exons flanking the deletion. Myotube cultures from both patients
were transfected with a mixture of exon 43- and 44-specific AONs
(DL90.3) or exon 45- and 51-specific AONs (DL470.2). The individual
AONs (Table were previously highly effective in single-exon
skipping. Transfection efficiencies were typically over 80%, as
indicated by the number of cells with specific nuclear uptake of
the fluorescent AONs. RT-PCR analysis at 24 to 48 hours
post-transfection, indeed demonstrated the feasibility of specific
double-exon skipping in both samples (FIGS. 6 and 7A-C). This was
confirmed by sequence analysis (data not shown). Additional shorter
transcript fragments were obtained due to single-exon skipping: in
patient DL90.3, exon 44 skipping (FIG. 6), and in patient DL470.2,
exon 51 skipping (FIG. 7B).
Multi-Exon Skipping
[0101] The splicing of exon 44 directly to exon 52 (as induced in
DL470.2) generates an in-frame transcript. We hypothesized that by
inducing the skipping of the entire stretch of exons in between,
i.e., multi-exon skipping, we would induce a BMD-like deletion
(45-51) that covers and restores several known, smaller, DMD
mutations. This would further enlarge the group of DMD patients
that would benefit from one type of frame correction. The
feasibility of multi-exon skipping was first shown in human control
myotubes that were treated with a mixture of the exon 45- and
51-specific AONs (FIG. 7A; KM 109). We then applied it to myotubes
from a third DMD patient carrying an exon 48-50 deletion (50685.1).
By the AON-induced skipping of the (remaining) stretch of exons in
between and including exons 45 and 51, we obtained the anticipated
smaller in-frame transcript with exon 44 spliced to exon 52 (FIG.
7C),
Double- and Multi-Exon Skipping Using a U-Linked AON
Combination
[0102] The skipping of more than one exon from one pre-mRNA
molecule requires that both AONs are present in the same nucleus,
targeting the same molecule. To enlarge this chance, we here
studied the feasibility of one combined AON carrying both AONs
specific for exons 45 and 51 (h45A0N5 and h51A0N2) linked by ten
uracil nucleotides (Table 5). Following transfection of this
"U-linker AON" into myotubes from human control and the DMD
patients DL470.2 and 50685.1, RT-PCR analysis demonstrated its
efficacy to generate the anticipated in-frame transcript with exon
44 spliced to exon 52 (FIGS. 7B-7C). This multi-exon skipping
occurred specifically and precisely at the exon boundaries as
confirmed by sequence analysis (data not shown). In contrast to
patient DL 470.2, the U-linker AON was a slightly more efficient
than the mixture of AONs in the human control and in patient
50685.1.
Materials and Methods
AONs and Primers
[0103] AONs ('Table 5) targeting exons 43, 44 and 51 were
previously described (Aartsma-Rus, 2002), AONs targeting exon 45
were newly designed (sequences upon request). All AONs contain a 5
fluorescein group (6-FAM), a full-length phosphorothioate backbone
and 2'-O-methyl modified ribose molecules (Eurogentec, BE). To
avoid interference with the fluorescent signals of the secondary
antibodies, unlabelled AONs were used for immuno-histochemical
analyses. Primers for RT-PCR analysis (Table 5, sequences available
upon request) were synthesized by Eurogentec (BE).
RNA Isolation and RT-PCR Analysis
[0104] At 24 to 48 hours post-transfection, total RNA was isolated
from the myotube cultures (RNA-Bee RNA isolation solvent, Campro
Scientific, NL). 300 ng of total RNA were used for RT-PCR analysis
using C. therm. polymerase (Roche Diagnostics, NL) in a 20 .mu.l
reaction at 60.degree. C. for 30 minutes, primed with different DMD
gene-specific reverse primers (Table 5). Primary PCRs were
performed by 20 cycles of 94.degree. C. (40 seconds), 60.degree. C.
(40 seconds) and 72.degree. C. (60 seconds). One .mu.l of these
reactions was then re-amplified in nested PCRs by 32 cycles of
94.degree. C. (40 seconds), 60.degree. C. (40 seconds) and
72.degree. C. (60 seconds), PCR products were analyzed on 1.5% or
2% agarose gels. For quantification of the transcript products,
nested PCRs were performed using 24 cycles, PCR products were
analyzed using the DNA 7500 LabChip.RTM. Kit and the Agilent 2100
Bioanalyzer (Agilent Technologies, NL).
Sequence Analysis
[0105] RT-PCR products were isolated from agarose gels using the
QIAquick Gel Extraction Kit (Qiagen). Direct DNA sequencing was
carried out by the Leiden Genome Technology Center (Lure) using the
BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied
Biosystems) and analyzed on an ABI 3700 Sequencer (PE Applied
Biosystems)
Example 4
Expression Vectors Encoding a Transcript Comprising an
Oligonucleotide of the Invention
[0106] Due to the defined turnover rate of both the dystrophin
pre-mRNA and the AONs, our DMD frame-correction therapy would
require repetitive administrations of AONs. In addition, relatively
high levels of antisense RNA will be necessary within the nucleus,
where transcription and splicing of the dystrophin pre-mRNA occur.
Therefore, we have set up a vector system in which specific AON
sequences are incorporated into a modified gene. In this example,
this embodiment is described for U7 small nuclear RNA (U7snRNA).
U7snRNA is the RNA component of the U7 ribonucleoprotein particle
(U7snRNP) that is involved in the processing of the 3' end of
histone pre-mRNAs. Inherent to its function, U7snRNA is efficiently
transported back from the cytoplasm to the nucleus in which it gets
subsequently incorporated into very stable U7snRNP complexes. A
similar approach was successfully applied in AON-based gene therapy
studies on B-thalassemia (53, 54). In these studies, different
plasmids were engineered containing a modified U7sn_RNA gene from
which the natural antisense sequence directed to the histone
pre-mRNA was replaced with antisense sequences targeted to
different B-thalassemia-associated aberrant splicing sites in the
.B-globin gene. Following transfection of these plasmids, correct
splicing and expression of the full-length B-globin protein could
be restored with an efficiency of up to 65% in cultured cells
expressing the different mutant B-globin genes.
[0107] Various U7snRNA gene constructs were engineered as described
in reference 53 with the modification that the B-globin sequences
were exactly replaced by the antisense sequences derived from the
different AONs. In this Example, the sequences were replaced by the
antisense sequences of m46A0N4, 6, 9, or 11 that were effective in
inducing the skipping of mouse exon 46. A sense construct was
included as negative control (m46SON6). Following construct
validation by sequencing, the plasmids were tested in vitro by
transfection into cultured C2C12 mouse myoblasts. The
U7snRNA-m46A0N6 construct was most efficient.
[0108] To enhance delivery of the AON-U7snRNA gene constructs, we
have cloned them into recombinant adeno-associated viral (rAAV)
vectors, AAV is a single-stranded DNA parvovirus that is
non-pathogenic and shows a helper-dependent life cycle. In contrast
to other viruses (adenovirus, retrovirus, and herpes simplex
virus), rAAV vectors have demonstrated to be very efficient in
transducing mature skeletal muscle. Because application of rAAV in
classical DMD "gene addition" studies has been hindered by its
restricted packaging limits <5 kb), we applied rAAV fur the
efficient delivery of the much smaller U7snRNA antisense constructs
(<600 bp) to mature murine skeletal muscle. The rAAV-U7-AON
vectors also contain the gene for green fluorescence protein
(GFF-cDNA), which allows analysis of transduction efficiencies in
muscle post-injection. High titer virus productions were effective
in inducing exon skipping.
REFERENCES (to the general part, excluding Example 2)
[0109] 1. Hoffman E. P, R. H. Brown Jr., and L. M. Kunkel (1987)
Dystrophin: the protein product of the Duchenne muscular dystrophy
locus. Cell 51:919-928. [0110] 2. Hoffman E. P, K. H. Fischbeck, R.
H. Brown, M. Johnson, R Medori, J. D. Loike, J. B. Harris, R.
Waterston, M. Brooke, L. Specht, et al. (1988) Characterization of
dystrophin in muscle-biopsy specimens from patients with Duchenne's
or Becker's muscular dystrophy. N. Engl. J. Med. 318:1363-1368.
[0111] 3. Den Dunnen J. T., P. M. Grootscholten, E. Bakker, L. A.
Blonden, H. B. Ginjaar, Wapenaar, H. M. van Paassen, C, van
Broeckhovm, P. L. Pearson, and G. J. van ommen (1989) Topography of
the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis
of 194 cases reveals 115 deletions and 13 duplications. Am. J. Hum.
Genet. 45:835-847. [0112] 4. Koenig M., A. H. Beggs, M. Moyer, S.
Scherpf, K. Heindrich, T. Bettecken, G. Meng, C. R. Muller, M.
Lindlof, H. Kaariainen, et al, (1989) The molecular basis for
Duchenne versus Becker muscular dystrophy: correlation of severity
with type of deletion. Am. J. Hum. Genet. 45:498-506. [0113] 5.
Tuffery-Giraud S., S. Chambert, J. Demaille, and M. Claustres
(1999) Point mutations in the dystrophin gene: evidence for
frequent use of cryptic splice sites as a result of splicing
defects. Hum. Mutat. 14:359-368. [0114] 6. Prior T. W., C. Bartolo,
D. K. Pearl, A C, Papp, P J. Snyder, M S, Sedra, A. H. Burghes, and
J R. Mendell (1995) Spectrum of small mutations in the dystrophin
coding region. Am. of. Hum. Genet. 57:22-33. [0115] 7. Moser H.
(1984) Duchenne muscular dystrophy: pathogenetic aspects and
genetic prevention. Hum. Genet, 66:17-40. [0116] 8. Emery A. B.
(2002) The muscular dystrophies. Lancet 359:687-695. [0117] 9.
Yoshida M. and E. Ozawa (1990) Glycoprotein complex anchoring
dystrophin to sarcolemma. J. Biochem. (Tokyo), 108:748-752. [0118]
10. Ervasti J. M. and K. P. Campbell (1991) Membrane organization
of the dystrophin-glycoprotein complex. Cell 66:1121-1131. [0119]
11. Di .Blasi C., L. Moran.di, R. Barresi, F. Blasevich, F.
Comelio, and M. Mora (199 6)
[0120] Dystrophin-associated protein abnormalities in
dystrophin-deficient muscle fibers from symptomatic and
asymptomatic Duchenne/Becker muscular dystrophy carriers. Acta
Neuropathol. (Berl), 92:369-377. [0121] 12. Ervasti J. M., K.
Ohlendieck, S. D. Kahl., M. G. Gayer, and K. P. Campbell (1990)
[0122] Deficiency of a glycoprotein component of the dystrophin
complex in dystrophic muscle. Nature 345:315-319. [0123] 13.
Matsumura K,, All. Burghes, M. Mora, F. M. Tome, L. Morandi, F.
Cornell.degree., F. Letureq, M. Jeanpierre, J. C. Kaplan, P.
Reinert, et al. (1994) Immunohistochemical analysis of
dystrophin-associated proteins in Becker/Duchenne muscular
dystrophy with huge in-frame deletions in the NH2-terminal and rod
domains of dystrophin. J. Clin. Invest. 93:99-105. [0124] 14.
Monaco A R, C. J. Bertelson, S. Liechti-Galiati, H. Moser, L. M.
Kunkel (1988) An explanation for the phenotypic differences between
patients bearing partial deletions of the DMD locus. Genomics
2:90-95. [0125] 15. Clemens P. R. and P I Duncan (2001) Progress in
gene therapy for Duchenne muscular dystrophy. Curr. Neural.
Neurosci, Rep, 1:89-96. [0126] 16. Khan M. A. (1993) Corticosteroid
therapy in Duchenne muscular dystrophy, J. Neurol. Sci, 120:8-14.
[0127] 17. De Angelis F. G., O. Sthandier, B. Berarducci, S. Toso,
G. Galluzzi, E. Ricci, G. COSSII and I. Bozzoni (2002) Chimeric
snRNA molecules carrying antisense sequences against the splice
junctions of exon 51 of the dystrophin pre-mRNA induce exon
skipping and restoration of a dystrophin synthesis in Delta 48-50
DMD cells Proc. Natl. Acad. Sci. USA 99:9456-94,61. [0128] 18. Mann
C. J., K. Honeyman, A. J., Cheng, T. Ly, F. Lloyd, S. Fletcher, J.
E. Morgan, T. A. Partridge and S D. Wilton (2001) Antisense-induced
exon skipping and synthesis of dystrophin in the mdx mouse. Proc.
Natl. Acad. Sci. USA, 98:42-47. [0129] 19. van Derutekom J. C., M.
Bremmer-Bout, A. A. Janson, I. B., Ginjaar, F. Baas, J. T., den
Dunnen and G. J. van Ommen (2001) Antisense-induced exon skipping
restores dystrophin expression in DMD patient-derived muscle cells.
Hum. Mol. Genet. 110:1547-1554. [0130] 20. Wilton S. D., F. Lloyd,
K. Carville, S. Fletcher, K. Honeyman, S. Agrawal and R. Kole
(1999) Specific removal of the nonsense mutation from the mdx
dystrophin mRNA using antisense oligonucleotides. Neuromuscul.
Disord 9:330-338, [0131] 21. Dunckley M. G., M. Manoharan, Eperon
and G. Dickson (1998) Modification of splicing in the dystrophin
gene in cultured Mdx muscle cells by antisense
oligoribonucleotides. Hum. Mal. Genet. 7:1083-1090. [0132] 22.
Takeshima Y., H. Wada, M. Yagi, Y. Ishikawa, R. Minami, H. Nakamura
and M. Matsu.
[0133] (2001) Oligonucleotides against a splicing enhancer sequence
led to dystrophin production in muscle cells from a Duchenne
muscular dystrophy patient. Brain Dev, 23:788-790. [0134] 23.
Aartsma-Rus A., M. Bremmer-Bout, A. Janson, J. den Dunnen G, van
Ommen and J. van Deutekom. (2002) Targeted exon skipping as a
potential gene correction therapy for Duchenne muscular dystrophy.
Neuromuscul. Disord. 12, S71. [0135] 24. Shiga N., Y. Takeshima, H.
Sakamoto, K. Inoue, Y. Yokota, M. Yokoyama and M. Matsuo (1997)
Disruption of the splicing enhancer sequence within exon 27 of the
dystrophin gene by a nonsense mutation induces partial skipping of
the exon and is responsible for Becker muscular dystrophy. J. Clin.
Invest. 100:2204-2210. [0136] 25. Cartegni L. S. L. Chew and A. R.
Krainer (2002) Listening to silence and understanding nonsense:
exonic mutations that affect splicing. Nat. Rev. Genet. 3:285-298,
[0137] 26. Schaal T. D. and T. Mafflatis (1999) Multiple distinct
splicing enhancers in the protein-coding sequences of a
constitutively spliced pre-mRNA. Mol. Cell. Blot 19:261-273. [0138]
27. Takeshima Y., H. Nishio, H. Saka,moto, H. Nakamura and M.
Matsuo (1995) Modulation of in vitro splicing of the upstream
intron by modifying an intra-exon sequence which is deleted from
the dystrophin gene in dystrophin Kobe. J. Main Invest. 95:515-520.
[0139] 28. Pramono Z. A., Y. Takeshima, H. Alimsardjono, A. Ishii,
S. Takeda, and M. Matsu (1996) Induction of exon skipping of the
dystrophin transcript in lymphoblastoid cells by transfecting an
antisense oligodeoxynueleotide complementary to an exon recognition
sequence. Biochem. Biophys. Res. Commun. 226:445-449. [0140] 29.
Koenig M., A. P. Monaco and L. M. Kunkel (1988) The complete
sequence of dystrophin predicts a rod-shaped eytoskeletal protein.
Cell 53:219-226. [0141] 30. Den Dunnen J. (1996) The Leiden
Muscular Dystrophy pages; http://www.dmd.nl. [0142] 31. Mann C J.
K. Honeyman, G. McCloroy, S. Fletcher and S. D. Wilton (2002)
Improved antisense oligonucleotide-induced exon skipping in the mdx
mouse model of muscular dystrophy. J. Gene Med. 4:644-654. [0143]
32. Kerr T. P., C. A. Sewry, S. A. Robb and R. G. Roberts (2001)
Long mutant dystrophins and variable phenotypes: evasion of
nonsense-mediated decay? Hum. Genet. 109:402-407. [0144] 33. Klein
C. J. D. D. Coovert, D. E. Bulman, P. N. Ray, J. R. Mendell and A.
H. Burghes (1992) Somatic reversion/suppression in Duchenne
muscular dystrophy (DMD): evidence supporting a frame-restoring
mechanism in rare dystrophin-positive fibers. Am. J. Hum. Genet.
50;950-959, [0145] 34. Sherratt T. G., T. Vulliamy, V. Dubowitz, C
A. Sewry and P. N. Strong (1993) Exon skipping and translation in
patients with frameshift deletions in the dystrophin gene, Am. J.
Hum. Genet. 53:1007-1015. [0146] 35. Lu Q. L., G. E. Morris, S. D.
Wilton, T. Ly, O. V. Artem'yeva, P. Strong and T. A. Partridge
(2000) Massive idiosyncratic exon skipping corrects the nonsense
mutation in dystrophic mouse muscle and produces functional
revertant fibers by clonal expansion. J. Cell Biol. 148:985-996.
[0147] 36. Nicholson L. V., M. A. Johnson, K. M. Bushby and D.
Gardner-Medwin (1993) Functional significance of
dystrophin-positive fibers in Duchenne muscular dystrophy. Arch.
Dis. Child 68:632-636, [0148] 37. Vainzof M., M. R. Passos-Bueno,
R. I. Takata, C. Pavanelio Rde and M. Zatz (1993) Intrafamilial
variability in dystrophin abundance correlated with difference in
the severity of the phenotype. J. Neurol, Sci. 119:38-42. [0149]
38. Singh V., S. Shina, S. Mishra, L. S. Chaturvedi, S. Pradhan, R.
D. Mittal and B. Mittal (1997) Proportion and pattern of dystrophin
gene deletions in north Indian Duchenne and Becker muscular
dystrophy patients. Hum. Genet. 99:206-208. [0150] 39. Melacini P.,
M. Fanin, G. A. Daniell, G. Fasoli, C. Villanova, C. Angelini, L.
Vitiello, M. Miorelli, G. F. Buja, M. L. Mostaccitrolo, et al,
(1993) Cardiac involvement in Becker muscular dystrophy. J. Am.
Coll. Cardiol, 22:1927-1934. [0151] 40. Melis M. A., M. Cau, F.
Muntoni, A. Mateddu, R. Galanello, L. Boccone, F. Deidda, D. Loi
and A. Cao (1998) Elevation of serum creatine kinase as the only
manifestation of an intragenic deletion of the dystrophin gene in
three unrelated families. Europ. J. Paediatr. Neurol. 2:255-261.
[0152] 41. Onengut, S., G. N. Kavaslar, E. Battaloglu, P.
Serdaroglu, F. Deymeer, C. Ozdernir, F. Calafell and A. Tolun
(2000) Deletion pattern in the dystrophin gene in Turks and a
comparison with Europeans and Indians. Ann. Hum. Genet. 64:33-40.
[0153] 42. Rosenberg C., L. Navajas, D. F. Vagenas, E. Bakker, M.
Vainzof M. R. Passos-Bueno, Rd, Takata, G. J. Van Ommen, M. Zatz
and J. T. Den Dunnen (1998) Clinical diagnosis of heterozygous
dystrophin gene deletions by fluorescence in situ hybridization.
Neuromuscul. Disord. 8:447-452. [0154] 43. Sertic J., N. Barisic,
M. Sostarko, Z. Brzovic and A. Stavljenic-Rukavina (1997) Deletion
screening of the Ducherme/Becker muscular dystrophy gene in
Croatian population, Coll. Anthropol. 21:151456. [0155] 44. Randa
T. A. and H. M. Blau (1994) Primary mouse myoblast purification,
characterization, and transplantation for cell-mediated gene
therapy. J. Cell Biol. 125:1275-1287. [0156] 45. Murry C E., M. A.
Kay, T. Bartosek, SD. Hauschka and S. M, Schwartz (1996) Muscle
differentiation during repair of myocardial necrosis in rats via
gene transfer with MyoD. J. Clin. Invest. 98:2209-2217. [0157] 46.
Roest P A., A. C. van der Tuljn, H. B. Ginjaar; R C. Hoeben, F. B.
Hoger-Vorst, E. Bakker, J. T. den Dunnen and G. J. van Ommen (1996)
Application of in vitro Myo-differentiation of non-muscle cells to
enhance gene expression and facilitate analysis of muscle proteins.
Neuromuscul. Disord. 6:195-202. [0158] 47. Havenga A. A. Lemckert,
O. J. Ophorst, M. van Meijer, W. T. Germeraad, J. Grimbergen, M. A.
van Den Doe, R. Vogels, J. van Deutekorn and A. A. Janson, et al.
(2002) Exploiting the natural diversity in adenovirus tropism for
therapy and prevention of disease. J. Virol. 76:4612-4620. [0159]
48. Anderson L. V. and K. Davison (1999) Multiplex Western blotting
system for the analysis of muscular dystrophy proteins. Am. J.
Pathol. 154:1017-1022. [0160] 49. Neugebauer K M et al., J. Cell.
Biol. 129:899-908 (1995). [0161] 50. Tacke R, and J. L. Manley,
Proc. Soc. Exp. Biol. Med. 220:59-63 (1999) [0162] 51. Graveley B.
R. et al., Curr Biol. 9:R6-7 (1999). [0163] 52. Misteli T et al.,
Nature 387:523-527 (1997). [0164] 53. Gorman L, Suter D, Emerick V,
et al. Stable alteration of pre mRNA splicing patterns by modified
U7 small nuclear RNAs. Proc. Natl. Acad. Sci. USA 1998, 4929-4934.
[0165] 54. Suter D, Tomasini R, Reber U, et al. Double target
antisense U7 snRNAs promote efficient skipping of an aberrant exon
in three human beta thalassemic mutations. Hum Mol. Genet. 1999,
8:2415-2423.
TABLE-US-00001 [0165] TABLE 1 Overview of the patients, the AONs
and the primer sets used in this study Patients Mutations Targeted
exons AONs.sup.a RT-primers.sup.b Primary PCK sets.sup.b Nested PCR
sets.sup.b DL 515.2 Deletion exon 45-50 Exon 51 h51AON1 h53r
h41f-h53r h42f-h52r DL 363.2 Deletion exon 45-54 Exon 44 h44AON1
h55r2 h42f4-h55r2 h44f-h55r 50685.1 Deletion exon 48-50 Exon 51
h51AON1 h53r h46f-h53r h47f-h52r DL 589.2 Deletion exon 51-55 Exon
50 h50AON1 h58r h47f-h58r h49f-h57r 53914.1 Deletion exon 52 Exon
51 h51AON1 h55r h49f-h55r h50f-h54r '' Exon 53 h53AON1 '' '' ''
50423.1 Point mutation exon 49 Exon 49 h49AON1 h52r h46f-h52r
h47f-h51r .sup.aAON sequences were published previously (23).
.sup.bPrimer sequences available upon request.
TABLE-US-00002 TABLE 2 Characteristics of the AONs used to study
the targeted skipping of 15 different DMD exons.sup.a SEQ ID NO:
Name Antisense sequence (5'-3') Length (bp) G/C % U/C % Exon skip
Transcript 1 h2AON 1 cccauuuugugaauguuuucuuuu 24 29 75 + OF 2 h2AON
2 uugugcauuuacccauuuugug 22 36 68 - OF 3 h29AON 1
Uauccucugaaugucgcauc 20 45 65 + IF 4 h29AON 2 gguuauccucugaaugucgc
20 50 60 + IF 5 h40AON 1 Gagccuuuuuucuucuuug 19 37 79 + IF 6 h40AON
2 Uccuuucgucucugggcuc 19 58 79 + IF 7 h41AON 1 Cuccucuuucuucuucugc
19 47 95 + IF 8 h41AON 2 Cuucgaaacugagcaaauuu 20 35 50 + IF 9
h42AON 1 cuugugagacaugagug 17 47 41 + IF 10 h42AON 2
cagagacuccucuugcuu 18 50 67 + IF 11 h43AON 1 ugcugcugucuucuugcu 18
50 78 - OF 12 h43AON 2 Uuguuaacuuuuucccauu 19 26 79 + OF 13 h44AON
1 cgccgccauuucucaacag 19 58 63 + OF 14 h44AON 2
uuuguauuuagcauguuccc 20 35 70 + OF 15 h45AON 1 gcugaauuauuucuucccc
19 42 74 - OF 16 h45AON 5 gcccaaugccauccugg 17 65 58 + OF 17 h46AON
4b cugcuuccuccaacc 15 60 80 + OF 18 h46AON 8b gcuuuucuuuuaguugcugc
20 40 75 + OF 19 h47AON 1 ucuugcucuucugggcuu 18 50 78 - IF 20
h47AON 2 cuugagcuuauuuucaaguuu 21 29 67 - IF 21 h48AON 1
uuucuccuuguuucuc 16 38 94 - IF 22 h48AON 2 ccauaaauuuccaacugauuc 21
33 62 - IF 23 h49AON 1 Cuuccacauccgguuguuu 19 47 74 + IF 24 h49AON
2 Guggcugguuuuuccuugu 19 47 68 + IF 25 h50A0N 1 cucagagcucagaucuu
17 47 59 + OF 26 h50AON 2 ggcugcuuugcccuc 15 67 73 - OF 27 h51AON 1
Ucaaggaagauggcauuucu 20 40 45 + OF 28 h51AON 2
ccucugugauuuuauaacuugau 23 30 65 + OF 29 h53AON 1
cuguugccuccgguucug 18 61 72 + OF 30 h53AON 2 uuggcucuggccuguccu 18
61 72 - OF .sup.aTwo AONs were tested per exon. Their different
lengths and G/C contents (%) did not correlate to their effectivity
in exon skipping (1, induced skipping, 2, no skipping). The AONs
were directed to purine (A/G) -rich sequences as indicated by their
(antisense) U/C content (%). Skipping of the target exons resulted
in either an in-frame (IF) or an out-of-frame (OF) transcript.
bvan. Deutekom et al., 2001 [21].
TABLE-US-00003 TABLE 3 Primer sets used for the RT--PCR analyses to
detect the skipping of the targeted exons.sup.a Primary PCR Nested
PCR Target exon RT-primer primer set primer set 2 h4r h1f1-h4r
h1f2-h3r 2 h9r h1f1-h9r h1f2-h8r 29 h31r h25f-h31r h26f-h30r 40
h44r h38f-h44r h39f-h43r 41 h44r h38f-h44r h39f-h43r 42 h44r
h38f-h44r h39f-h43r 43 h47r h41f-h47r h42f-h46r 44 h47r h41f-h47r
h42f-h46r 45 h47r h41f-h47r h42f-h46r 46 h48r h44f-h48r h45f-h47r
47 h52r h44f-h52r h46f-h51r 48 h52r h44f-h52r h46f-h51r 49 h52r
h44f-h52r h46f-h51r 50 h52r h44f-h52r h46f-h51r 51 h53r h47f-h53r
h49f-h52r 53 h55r h50f-h55r h51f-h54r .sup.aPrimer sequences are
available upon request
TABLE-US-00004 TABLE 4 Overview and frequency of the DMD-causing
mutations in the Leiden DMD (LDMD) Database, theoretically
correctable by skipping one of the 12 exons sucessfully targeted in
this study Skippable exon Therapeutic for DMD-mutations: No. of %
of % of nonsense Deletions deletions Dupli- duplications mutations
(exons) in LDMD cations in LDMD in LDMD (exons) Database (exons)
Database Database 2 3-7, 3-19, 3-21 2.9 2 9.0 29 5 40 1 41 4 42 0
43 44, 44-47, 44-49, 3.7 43 3.0 44-51 44 5-43, 14-43, 19-43, 7.8 44
3.0 30-43, 35-43, 36-43, 40-43, 42-43, 45, 45-54 46 21-45, 45,
47-54, 5.6 47-56 49 1 50 51, 51-53, 51-55 5.2 50 3.0 51 45-50,
47-50, 17.5 51 1.5 48-50, 49-50, 50, 52, 52-63 53 10-52, 45-52, 7.5
46-52, 47-52, 48-52, 49-52, 50-52, 52
TABLE-US-00005 TABLE 5 Overview of the patients, the AONs and the
primer sets used in Example 3 Targeted Primary PCR Nested PCR
Patients Mutations exons AONs RT-primers.sup.b primer sets.sup.b
primer sets.sup.b DL 90.3 Nonsense mutation exon 43 Exon 43
h43AON2.sup.a h48r h41f-h48r h42f-h47r Exon 44 h44AON1.sup.a DL
470.2 Deletion exon 46-50 Exon 45 H45AON5 h53r h42f-h53r h43-h52r
Exon 51 h51AON2.sup.a Exon 45 U-linker h53r h42f-h53r h43f-h52r
Exon 51 AON.sup.c .sup.aSeparate AON sequences were published
previously (Aartsma-Rus, 2002). .sup.bPrimer sequences available
upon request .sup.cU linker AON consists of h45AON5 linked to h51
AON2 by ten uracils.
Sequence CWU 1
1
30117RNAArtificial SequenceDescription of Artificial Sequence
h45AON5 1gcccaaugcc auccugg 17224RNAArtificial SequenceDescription
of Artificial Sequence h2AON1 2cccauuuugu gaauguuuuc uuuu
24322RNAArtificial SequenceDescription of Artificial Sequence
h2AON2 3uugugcauuu acccauuuug ug 22420RNAArtificial
SequenceDescription of Artificial Sequence h29AON1 4uauccucuga
augucgcauc 20520RNAArtificial SequenceDescription of Artificial
Sequence h29AON2 5gguuauccuc ugaaugucgc 20619RNAArtificial
SequenceDescription of Artificial Sequence h40AON1 6gagccuuuuu
ucuucuuug 19719RNAArtificial SequenceDescription of Artificial
Sequence h40AON2 7uccuuucguc ucugggcuc 19819RNAArtificial
SequenceDescription of Artificial Sequence h41AON1 8cuccucuuuc
uucuucugc 19920RNAArtificial SequenceDescription of Artificial
Sequence h41AON2 9cuucgaaacu gagcaaauuu 201017RNAArtificial
SequenceDescription of Artificial Sequence h42AON1 10cuugugagac
augagug 171118RNAArtificial SequenceDescription of Artificial
Sequence h42AON2 11cagagacucc ucuugcuu 181218RNAArtificial
SequenceDescription of Artificial Sequence h43AON1 12ugcugcuguc
uucuugcu 181319RNAArtificial SequenceDescription of Artificial
Sequence h43AON2 13uuguuaacuu uuucccauu 191419RNAArtificial
SequenceDescription of Artificial Sequence h44AON1 14cgccgccauu
ucucaacag 191520RNAArtificial SequenceDescription of Artificial
Sequence h44AON2 15uuuguauuua gcauguuccc 201619RNAArtificial
SequenceDescription of Artificial Sequence h45AON1 16gcugaauuau
uucuucccc 191715RNAArtificial SequenceDescription of Artificial
Sequence h46AON4b 17cugcuuccuc caacc 151820RNAArtificial
SequenceDescription of Artificial Sequence h46AON8b 18gcuuuucuuu
uaguugcugc 201918RNAArtificial SequenceDescription of Artificial
Sequence h47AON1 19ucuugcucuu cugggcuu 182021RNAArtificial
SequenceDescription of Artificial Sequence h47AON2 20cuugagcuua
uuuucaaguu u 212116RNAArtificial SequenceDescription of Artificial
Sequence h48AON1 21uuucuccuug uuucuc 162221RNAArtificial
SequenceDescription of Artificial Sequence h48AON2 22ccauaaauuu
ccaacugauu c 212319RNAArtificial SequenceDescription of Artificial
Sequence h49AON1 23cuuccacauc cgguuguuu 192419RNAArtificial
SequenceDescription of Artificial Sequence h49AON2 24guggcugguu
uuuccuugu 192517RNAArtificial SequenceDescription of Artificial
Sequence h50AON1 25cucagagcuc agaucuu 172615RNAArtificial
SequenceDescription of Artificial Sequence h50AON2 26ggcugcuuug
cccuc 152720RNAArtificial SequenceDescription of Artificial
Sequence h51AON1 27ucaaggaaga uggcauuucu 202823RNAArtificial
SequenceDescription of Artificial Sequence h51AON2 28ccucugugau
uuuauaacuu gau 232918RNAArtificial SequenceDescription of
Artificial Sequence h53AON1 29cuguugccuc cgguucug
183018RNAArtificial SequenceDescription of Artificial Sequence
h53AON2 30uuggcucugg ccuguccu 18
* * * * *
References