U.S. patent application number 14/579979 was filed with the patent office on 2015-07-23 for methods of isolating and culturing stem cells.
This patent application is currently assigned to TISSUETECH, INC.. The applicant listed for this patent is TISSUETECH, INC.. Invention is credited to Szu-Yu CHEN, Scheffer TSENG, Suzhen ZHANG.
Application Number | 20150203814 14/579979 |
Document ID | / |
Family ID | 49212015 |
Filed Date | 2015-07-23 |
United States Patent
Application |
20150203814 |
Kind Code |
A1 |
TSENG; Scheffer ; et
al. |
July 23, 2015 |
METHODS OF ISOLATING AND CULTURING STEM CELLS
Abstract
Provided herein are methods of isolating and expanding a
plurality of multipotent stem cells. Also described are methods of
expanding stem cells on a substrate comprising an HC-HA complex.
Also described are isolated and expanded stem cells produced by the
methods and uses thereof, including stem cell therapy, as niche
cells for supporting other types of stem cells, or as bioreactors
for the production of HC-HA complexes. Also described are uses of
HC-HA complexes as a carrier for stem cells.
Inventors: |
TSENG; Scheffer; (Pinecrest,
FL) ; CHEN; Szu-Yu; (Miami, FL) ; ZHANG;
Suzhen; (Miami, FL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
TISSUETECH, INC. |
Doral |
FL |
US |
|
|
Assignee: |
TISSUETECH, INC.
Doral
FL
|
Family ID: |
49212015 |
Appl. No.: |
14/579979 |
Filed: |
December 22, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13782968 |
Mar 1, 2013 |
8940294 |
|
|
14579979 |
|
|
|
|
61767223 |
Feb 20, 2013 |
|
|
|
61606309 |
Mar 2, 2012 |
|
|
|
Current U.S.
Class: |
435/402 |
Current CPC
Class: |
C12N 2500/34 20130101;
C12N 2501/40 20130101; C12N 5/0665 20130101; C12N 5/0667 20130101;
C12N 2533/90 20130101; C12N 2501/115 20130101; C12N 2501/235
20130101; C12N 2501/998 20130101; C12N 5/0607 20130101; C12N
2533/80 20130101 |
International
Class: |
C12N 5/074 20060101
C12N005/074 |
Goverment Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under award
by RO1EY06819. The government has certain rights in the invention.
Claims
1. A method for expanding a stem cell population comprising:
expanding one or more isolated stem cells of claim 1 in a culture
comprising a two-dimensional substrate, thereby forming a plurality
of expanding stem cells.
2. The method of claim 1, wherein the two-dimensional substrate
comprises an HC-HA complex.
3. The method of claim 2, wherein the HC-HA complex is
immobilized.
4. The method of claim 2, wherein the HC-HA complex is a native
HC-HA complex or is a reconstituted HC-HA complex.
5. The method of claim 2, wherein the native HC-HA complex is an
amniotic membrane HC-HA complex.
6. The method of claim 2, wherein the HC-HA complex comprises
TSG-6.
7. The method of claim 2, wherein the HC-HA complex comprises
PTX3.
8. The method of claim 2, wherein the HC-HA complex comprises a
small leucine-rich proteoglycan.
9. The method of claim 8, wherein the small leucine-rich
proteoglycan is selected from among decorin, biglycan,
fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, osteoadherin, epipycan, and
osteoglycin.
10. The method of claim 2, wherein the HC-HA complex comprises
TSG-6, PTX3, and a SLRP.
11. The method of claim 1, wherein the culture comprises bFGF or
LIF.
12. A method for expanding a stem cell population comprising:
expanding one or more stem cells in a culture comprising a
two-dimensional substrate comprising an HC-HA complex, thereby
forming a plurality of expanding stem cells.
13. The method of claim 12, wherein at least one of the expanding
stem cells does not pass the Hayflick limit.
14. The method of claim 12, wherein the HC-HA complex is
immobilized.
15. The method of claim 12, wherein the HC-HA complex is a native
HC-HA complex or is a reconstituted HC-HA complex.
16. The method of claim 12, wherein the native HC-HA complex is an
amniotic membrane HC-HA complex.
17. The method of claim 4816, further comprising purifying the
native HC-HA complex by performing ultracentrifugation on an
amniotic membrane extract or an umbilical cord extract.
18. The method of claim 17, further comprising performing two,
three or four rounds of ultracentifugation.
19. The method of claim 17, further comprising performing four
rounds of ultracentifugation.
20. The method of claim 12, wherein the HC-HA complex comprises
TSG-6.
21. The method of claim 12, wherein the HC-HA complex comprises
PTX3.
22. The method of claim 12, wherein the HC-HA complex comprises a
small leucine-rich proteoglycan.
23. The method of claim 22, wherein the small leucine-rich
proteoglycan is selected from among decorin, biglycan,
fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, osteoadherin, epipycan, and
osteoglycin.
24. The method of claim 12, wherein the HC-HA complex comprises
TSG-6, PTX3, and a SLRP.
25. The method of claim 12, wherein the stem cell is an embryonic
stem cell, an adult stem cell, a fetal stem cell, or an induced
progenitor cell.
26. The method of claim 12, wherein the stem cell is a limbal
stromal niche cell, an umbilical cord stem cell, an amniotic
membrane stem cell or an adipose stem cell.
27. The method of claim 12, wherein the stem cell is a mesenchymal
stem cell.
28. The method of claim 12, wherein the stem cell is a stem cell
derived from an adult differentiated cell.
29. The method of claim 12, wherein the stem cell is a stem cell
derived from a fibroblast.
30. The method of claim 29, wherein the stem cell is derived from a
conjunctivochalasis fibroblast.
31. A method for expanding a stem cell comprising: (a) separating a
plurality of cells of a tissue sample from components of an
extracellular matrix in the tissue sample, to form a mixed cell
population; (b) culturing the mixed cell population in a first
culture comprising supplemented hormonal epithelial medium (SHEM)
on a plastic tissue culture dish, thereby producing a population of
non-adherent cells; (c) isolating the population of non-adherent
cells; and (d) expanding at least one cell of the population of
non-adherent cells in a second culture comprising a two-dimensional
substrate, thereby forming a plurality of expanding stem cells.
32. The method of claim 31, wherein at least one of the expanding
stem cells does not pass the Hayflick limit.
33. The method of claim 32, wherein the tissue is an amniotic
membrane, an umbilical cord, a limbal tissue or an adipose
tissue.
34. The method of claim 32, wherein the stem cell is a limbal
stromal niche cell, an umbilical cord stem cell, an amniotic
membrane stem cell or an adipose stem cell.
35. The method of claim 32, wherein the stem cell is a mesenchymal
stem cell.
36. The method of claim 32, wherein the two-dimensional substrate
comprises Matrigel, laminin, fibronectin, collagen or entactin.
37. The method of claim 32, wherein the two-dimensional substrate
comprises an HC-HA complex.
38. The method of claim 37, wherein the HC-HA complex is a native
HC-HA complex or is a reconstituted HC-HA complex.
39. The method of claim 38, wherein the native HC-HA complex is an
amniotic membrane HC-HA complex.
40. The method of claim 38, further comprising purifying the native
HC-HA complex by performing ultracentrifugation on an amniotic
membrane extract or an umbilical cord extract.
41. The method of claim 40, further comprising performing two,
three or four rounds of ultracentifugation.
42. The method of claim 40, further comprising performing four
rounds of ultracentifugation.
43. The method of claim 37, wherein the HC-HA complex comprises
TSG-6.
44. The method of claim 37, wherein the HC-HA complex comprises
PTX3.
45. The method of claim 37, wherein the HC-HA complex comprises a
small leucine-rich proteoglycan.
46. The method of claim 45, wherein the small leucine-rich
proteoglycan is selected from among decorin, biglycan,
fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, osteoadherin, epipycan, and
osteoglycin.
47. The method of claim 37, wherein the HC-HA complex comprises
TSG-6, PTX3, and a SLRP.
48. A composition comprising a plurality of expanded stem cells of
claim 1 and a pharmaceutically acceptable excipient.
49. A composition comprising: (a) a stem cell; (b) an HC-HA
complex; and (c) a tissue culture plate.
50. The composition of claim 49, wherein the HC-HA complex is
immobilized to the tissue culture plate.
51. The composition of claim 49, wherein the stem cell is an
isolated or expanded stem cell of claim 1.
52. The composition of claim 49, wherein the stem cell is an
embryonic stem cell, an adult stem cell, a fetal stem cell, or an
induced progenitor cell.
53. The composition of claim 49, wherein the stem cell is a limbal
stromal niche cell, an umbilical cord stem cell, an amniotic
membrane stem cell or an adipose stem cell.
54. The composition of claim 49, wherein the stem cell is a
mesenchymal stem cell.
55. The composition of claim 49, wherein the stem cell is an
induced pluripotent stem cell derived from an adult differentiated
cell.
56. The composition of claim 49, wherein the stem cell is an
induced pluripotent stem cell derived from a fibroblast.
57. The composition of claim 49, wherein the stem cell is an
induced pluripotent stem cell derived from a conjunctivochalasis
fibroblast.
58. The composition of claim 49, wherein the HC-HA complex is a
native HC-HA complex or is a reconstituted HC-HA complex.
Description
CROSS-REFERENCE
[0001] This application is divisional of U.S. applicaiton Ser. No.
13/782,968, filed Mar. 1, 2013, now U.S. Pat. No. 8,940,294, issued
on Jan. 27, 2015, which claims the benefit under 35 U.S.C.
.sctn.119(e) of U.S. Provisional Patent Application No. 61/606,309,
filed Mar. 2, 2012, and U.S. Provisional Patent Application No.
61/767,223, filed Feb. 20, 2013, all of which are expressly
incorporated herein by reference in their entireties.
SEQUENCE LISTING
[0003] The present application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
Dec. 15, 2014, is named "34157831401Seqlist" and is 5,075 bytes in
size.
BACKGROUND OF THE INVENTION
[0004] Stem cells have the ability to differentiate into multiple
diverse cell types and self-renew to produce more stem cells. In
mammals, there are two broad types of stem cells: embryonic stem
cells, which are isolated from the inner cell mass of blastocysts,
and adult stem cells, which are found in various tissues, including
fetal tissues. Generally, adult stem cells are lineage-restricted
(multipotent) and are generally referred to by their tissue origin.
Multipotent stem cells have been isolated from several tissues
including bone marrow, peripheral blood, adipose tissue, liver,
skin, amniotic fluid, placenta and umbilical cord. Included among
such cells are mesenchymal stem cells, adipose-derived stem cells,
and endothelial stem cells. Human mesenchymal stem cells (MSC) have
been shown to differentiate into multiple mesoderm-type lineages,
including chondrocytes, osteoblasts, and adipocytes and into
ectodermal and endodermal origin. Because of their ability for
self-renewal and multilineage differentiation potential,
multipotent stem cells are useful for cell-based therapies and
tissue engineering applications. Multipotent stem cells also
exhibit immunomodulatory and paracrine effects.
SUMMARY OF THE INVENTION
[0005] Provided herein are methods for the isolation and expansion
of stem cells.
[0006] Described herein, in certain embodiments, are methods for
isolating an E-cadherin positive stem cell, comprising contacting a
mixed cell population comprising one or more stem cells with an
agent that binds to E-cadherin, thereby isolating an E-cadherin
positive stem cell. In some embodiments, the mixed cell population
is substantially free of epithelial cells. In some embodiments, the
methods further comprise removing one or more epithelial cells from
the mixed cell population. In some embodiments, the methods further
comprise removing one or more epithelial cells from the mixed cell
population prior to contacting the mixed cell population with the
agent. In some embodiments, the agent is an antibody. In some
embodiments, the methods further comprise isolating the E-cadherin
positive stem cell by fluorescence activated cell sorting or
magnetic activated cell sorting. In some embodiments, the mixed
cell population comprises an embryonic stem cell, an adult stem
cell, a fetal stem cell, or an induced pluripotent stem cell. In
some embodiments, the mixed cell population comprises a limbal
stromal niche cell, an umbilical cord stem cell, an amniotic
membrane stem cell or an adipose stem cell. In some embodiments,
the methods further comprise deriving the mixed cell population
from an umbilical cord. In some embodiments, the umbilical cord is
a human, non-human primate, cow or pig umbilical cord. In some
embodiments, the methods further comprise (a) mechanically or
enzymatically removing the amniotic membrane epithelial cells from
an umbilical cord, thereby producing remaining umbilical cord
tissue; and (b) contacting the remaining umbilical cord tissue with
collagenase for a period of time sufficient to separate one or more
stem cells from other bound cells and components of the stromal
matrix of the remaining umbilical cord tissue. In some embodiments,
the methods further comprise removing an umbilical cord blood
vessel from the remaining umbilical cord tissue prior to digestion
of the remaining umbilical cord tissue. In some embodiments, the
methods further comprise deriving the mixed cell population from
adipose tissue. In some embodiments, the methods further comprise
digesting the adipose tissue with collagenase, thereby producing
collagenase-digested adipose tissue. In some embodiments, the
methods further comprise digesting the adipose tissue in modified
ESC medium. In some embodiments, the methods further comprise
fractionating the collagenase-digested adipose tissue by
centrifugation, thereby producing a floating cell fraction (FC) and
a sedimented stromal vascular fraction (SVF). In some embodiments,
the methods further comprise selecting the FC as the mixed cell
population. In some embodiments, the methods further comprise
selecting the sedimented SVF as the mixed cell population. In some
embodiments, the methods further comprise filtering the sedimented
SVF on a mesh filter, thereby producing a filtered SVF and a
remaining cell fraction (RC) remaining on the filter. In some
embodiments, the methods further comprise selecting the filtered
SVF as the mixed cell population. In some embodiments, the methods
further comprise selecting the RC as the mixed cell population. In
some embodiments, the filter has a pore size of about 40 .mu.m to
about 250 .mu.m. In some embodiments, the methods further comprise
deriving the mixed cell population from amniotic membrane. In some
embodiments, the methods further comprise (a) contacting the
amniotic membrane with collagenase, thereby producing
collagenase-digested amniotic membrane; and (b) contacting the
collagenase-digested amniotic membrane with dispase. In some
embodiments, the methods further comprise (a) contacting the
amniotic membrane with dispase, thereby producing dispase-digested
amniotic membrane; and (b) contacting the dispase-digested amniotic
membrane with collagenase.
[0007] Described herein, in certain embodiments are methods for
expanding a stem cell population comprising: expanding one or more
isolated stem cells of of any of the methods provided herein in a
culture comprising a two-dimensional substrate, thereby forming a
plurality of expanding stem cells. In some embodiments, at least
one of the expanding stem cells does not pass the Hayflick limit.
In some embodiments, the two-dimensional substrate comprises
Matrigel, laminin, fibronectin, collagen or entactin. In some
embodiments, the two-dimensional substrate comprises an HC-HA
complex. In some embodiments, the HC-HA complex is immobilized. In
some embodiments, the HC-HA complex is a native HC-HA complex or is
a reconstituted HC-HA complex. In some embodiments, the native
HC-HA complex is an amniotic membrane HC-HA complex. In some
embodiments, the native HC-HA complex is an umbilical cord HC-HA
complex. In some embodiments, the HC-HA complex comprises TSG-6. In
some embodiments, the HC-HA complex comprises PTX3. In some
embodiments, the HC-HA complex comprises a small leucine rich
proteoglycan (SLRP). In some embodiments, the HC-HA complex
comprises TSG-6, PTX3, and a small leucine rich proteoglycan
(SLRP). In some embodiments, the small leucine-rich proteoglycan is
selected from among decorin, biglycan, fibromodulin, lumican, PRELP
(proline arginine rich end leucine-rich protein), keratocan,
osteoadherin, epipycan, and osteoglycin. In some embodiments, the
HC-HA complex comprises TSG-6, PTX3, and a small leucine rich
proteoglycan (SLRP). In some embodiments, the culture comprises
supplemental hormonal epithelial media or embryonic stem cell
media. In some embodiments, the culture comprises bFGF or LIF. In
some embodiments, the culture comprises an inhibitor of
Rho-associated kinase (ROCK). In some embodiments, the methods
further comprise (a) isolating at least one expanding stem cell
from the plurality of expanding stem cells, thereby producing an
isolated expanded stem cell; and (b) culturing the isolated
expanded stem cell in a second culture comprising a
three-dimensional substrate. In some embodiments, the
three-dimensional substrate comprises Matrigel, laminin,
fibronectin, collagen or entactin. In some embodiments, the second
culture comprises supplemental hormonal epithelial media or
embryonic stem cell media.
[0008] Described herein, in certain embodiments are methods for
expanding a stem cell population comprising: expanding one or more
stem cells in a culture comprising a two-dimensional substrate
comprising an HC-HA complex, thereby forming a plurality of
expanding stem cells. In some embodiments, at least one of the
expanding stem cells does not pass the Hayflick limit. In some
embodiments, the HC-HA complex is immobilized. In some embodiments,
the HC-HA complex is a native HC-HA complex or is a reconstituted
HC-HA complex. In some embodiments, the native HC-HA complex is an
amniotic membrane HC-HA complex. In some embodiments, the native
HC-HA complex is an umbilical cord HC-HA complex. In some
embodiments, the methods further comprise purifying the native
HC-HA complex by performing ultracentrifugation on an amniotic
membrane extract. In some embodiments, the methods further comprise
purifying the native HC-HA complex by performing
ultracentrifugation on an umbilical cord extract. In some
embodiments, the umbilical cord extract comprises umbilical cord
stroma and/or Wharton's jelly. In some embodiments, the methods
further comprise performing two, three or four rounds of
ultracentifugation. In some embodiments, the methods further
comprise performing four rounds of ultracentifugation. In some
embodiments, the HC-HA complex comprises TSG-6. In some
embodiments, the HC-HA complex comprises PTX3. In some embodiments,
the HC-HA complex comprises PTX3. In some embodiments, the HC-HA
complex comprises a small leucine rich proteoglycan (SLRP). In some
embodiments, the HC-HA complex comprises TSG-6, PTX3, and a small
leucine rich proteoglycan (SLRP). In some embodiments, the small
leucine-rich proteoglycan is selected from among decorin, biglycan,
fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, osteoadherin, epipycan, and
osteoglycin. In some embodiments, the HC-HA complex comprises
TSG-6, PTX3, and a small leucine rich proteoglycan (SLRP). In some
embodiments, the stem cell is an embryonic stem cell, an adult stem
cell, a fetal stem cell, or an induced progenitor cell. In some
embodiments, the stem cell is a limbal stromal niche cell, an
umbilical cord stem cell, an amniotic membrane stem cell or an
adipose stem cell. In some embodiments, the stem cell is a
mesenchymal stem cell. In some embodiments, the stem cell is an
induced pluripotent stem cell derived from an adult differentiated
cell. In some embodiments, the stem cell is an induced pluripotent
stem cell derived from a fibroblast. In some embodiments, the stem
cell is an induced pluripotent stem cell derived from a
conjunctivochalasis fibroblast. In some embodiments, the methods
further comprise deriving the mixed cell population from an
umbilical cord. In some embodiments, the umbilical cord is a human,
non-human primate, cow or pig umbilical cord. In some embodiments,
the methods further comprise (a) mechanically or enzymatically
removing the amniotic membrane epithelial cells from an umbilical
cord, thereby producing remaining umbilical cord tissue; and (b)
contacting the remaining umbilical cord tissue with collagenase for
a period of time sufficient to separate one or more stem cells from
other bound cells and components of the stromal matrix of the
remaining umbilical cord tissue. In some embodiments, the methods
further comprise removing an umbilical cord blood vessel from the
remaining umbilical cord tissue prior to digestion of the remaining
umbilical cord tissue. In some embodiments, the methods further
comprise deriving the mixed cell population from adipose tissue. In
some embodiments, the methods further comprise digesting the
adipose tissue with collagenase, thereby producing
collagenase-digested adipose tissue. In some embodiments, the
methods further comprise digesting the adipose tissue in modified
ESC medium. In some embodiments, the methods further comprise
fractionating the collagenase-digested adipose tissue by
centrifugation, thereby producing a floating cell fraction (FC) and
a sedimented stromal vascular fraction (SVF). In some embodiments,
the methods further comprise selecting the FC as the mixed cell
population. In some embodiments, the methods further comprise
selecting the sedimented SVF as the mixed cell population. In some
embodiments, the methods further comprise filtering the sedimented
SVF on a mesh filter, thereby producing a filtered SVF and a
remaining cell fraction (RC) remaining on the filter. In some
embodiments, the methods further comprise selecting the filtered
SVF as the mixed cell population. In some embodiments, the methods
further comprise selecting the RC as the mixed cell population. In
some embodiments, the filter has a pore size of about 40 .mu.m to
about 250 .mu.m. In some embodiments, the methods further comprise
deriving the mixed cell population from amniotic membrane. In some
embodiments, the methods further comprise (a) contacting the
amniotic membrane with collagenase, thereby producing
collagenase-digested amniotic membrane; and (b) contacting the
collagenase-digested amniotic membrane with dispase. In some
embodiments, the methods further comprise (a) contacting the
amniotic membrane with dispase, thereby producing dispase-digested
amniotic membrane; and (b) contacting the dispase-digested amniotic
membrane with collagenase. In some embodiments, the two-dimensional
substrate comprises Matrigel, laminin, fibronectin, collagen or
entactin. In some embodiments, the culture comprises supplemental
hormonal epithelial media or embryonic stem cell media. In some
embodiments, the culture comprises bFGF or LIF. In some
embodiments, the culture comprises an inhibitor of Rho-associated
kinase (ROCK). In some embodiments, the methods further comprise
(a) isolating at least one expanding stem cell from the plurality
of expanding stem cells, thereby producing an isolated expanded
stem cell; and (b) culturing the isolated expanded stem cell in a
second culture comprising a three-dimensional substrate. In some
embodiments, the three-dimensional substrate comprises Matrigel,
laminin, fibronectin, collagen or entactin. In some embodiments,
the second culture comprises supplemental hormonal epithelial media
or embryonic stem cell media. In some embodiments, the methods
further comprise (a) separating a plurality of cells of a tissue
sample from components of an extracellular matrix in the tissue
sample, to form a mixed cell population; (b) culturing the mixed
cell population in a first culture comprising supplemented hormonal
epithelial medium (SHEM) on a plastic tissue culture dish, thereby
producing a population of non-adherent cells; (c) isolating the
population of non-adherent cells; and (d) expanding at least one
cell of the population of non-adherent cells in a second culture
comprising a two-dimensional substrate, thereby forming a plurality
of expanding stem cells. In some embodiments, at least one of the
expanding stem cells does not pass the Hayflick limit. In some
embodiments, the tissue is an amniotic membrane, an umbilical cord,
a limbal tissue or an adipose tissue. In some embodiments, the stem
cell is a limbal stromal niche cell, an umbilical cord stem cell,
an amniotic membrane stem cell or an adipose stem cell. In some
embodiments, the stem cell is a mesenchymal stem cell. In some
embodiments, the two-dimensional substrate comprises Matrigel,
laminin, fibronectin, collagen or entactin. In some embodiments,
the two-dimensional substrate comprises an HC-HA complex. In some
embodiments, the HC-HA complex is a native HC-HA complex or is a
reconstituted HC-HA complex. In some embodiments, the native HC-HA
complex is an amniotic membrane HC-HA complex. In some embodiments,
the native HC-HA complex is an umbilical cord HC-HA complex. In
some embodiments, the methods further comprise purifying the native
HC-HA complex by performing ultracentrifugation on an amniotic
membrane extract. In some embodiments, the methods further comprise
purifying the native HC-HA complex by performing
ultracentrifugation on an umbilical cord extract. In some
embodiments, the umbilical cord extract comprises umbilical cord
stroma and/or Wharton's jelly. In some embodiments, the methods
further comprise performing two, three or four rounds of
ultracentifugation. In some embodiments, the methods further
comprise performing four rounds of ultracentifugation. In some
embodiments, the HC-HA complex comprises TSG-6. In some
embodiments, the HC-HA complex comprises PTX3. In some embodiments,
the HC-HA complex comprises PTX3. In some embodiments, the HC-HA
complex comprises a small leucine rich proteoglycan (SLRP). In some
embodiments, the HC-HA complex comprises TSG-6, PTX3, and a small
leucine rich proteoglycan (SLRP). In some embodiments, the small
leucine-rich proteoglycan is selected from among decorin, biglycan,
fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, osteoadherin, epipycan, and
osteoglycin. In some embodiments, the HC-HA complex comprises
TSG-6, PTX3, and a small leucine rich proteoglycan (SLRP). In some
embodiments, the second culture comprises supplemental hormonal
epithelial media or embryonic stem cell media. In some embodiments,
the second culture comprises bFGF or LIF. In some embodiments, the
second culture comprises an inhibitor of Rho-associated kinase
(ROCK). In some embodiments, the tissue is an amniotic membrane. In
some embodiments, the methods further comprise (i) contacting the
amniotic membrane with collagenase, thereby producing
collagenase-digested amniotic membrane; and (ii) contacting the
collagenase-digested amniotic membrane with dispase. In some
embodiments, the methods further comprise (i) contacting the
amniotic membrane with dispase, thereby producing dispase-digested
amniotic membrane; and (ii) contacting the dispase-digested
amniotic membrane with collagenase. In some embodiments, the
methods further comprise (a) isolating at least one expanding stem
cell from the plurality of expanding stem cells, thereby producing
an isolated expanding stem cell; and (b) culturing the isolated
expanding stem cell in a second culture comprising a
three-dimensional substrate. In some embodiments, the
three-dimensional substrate comprises Matrigel, laminin,
fibronectin, collagen or entactin. In some embodiments, the methods
of producing an isolated or expanding stem cell provided herein
further comprise the method further comprises isolating an HC-HA
complex from the stem cell.
[0009] Described herein, in certain embodiments, are methods for
inducing or maintaining pluripotency in a cell, comprising
culturing the cell with an HC-HA complex, thereby inducing or
maintaining pluripotency in a cell. In some embodiments, the cell
heterogeneously expresses a protein selected from among Sox2, myc,
Oct4 and KLF4. In some embodiments, the cell heterogeneously
expresses one, two, or three proteins selected from among Sox2,
myc, Oct4 and KLF4. In some embodiments, the HC-HA complex is
immobilized. In some embodiments, the cell is an adult
differentiated cell. In some embodiments, the cell is a fibroblast.
In some embodiments, the cell is a conjunctivochalasis fibroblast.
In some embodiments, the cell is an embryonic stem cell, an adult
stem cell, a fetal stem cell, or an induced pluripotent stem cell.
In some embodiments, the cell is a limbal epithelial progenitor
cell, a limbal stromal niche cell, an umbilical cord stem cell, an
amniotic membrane stem cell or an adipose stem cell. In some
embodiments, the HC-HA complex is a native HC-HA complex or is a
reconstituted HC-HA complex. In some embodiments, the native HC-HA
complex is an amniotic membrane HC-HA complex. In some embodiments,
the native HC-HA complex is an umbilical cord HC-HA complex. In
some embodiments, the methods further comprise purifying the native
HC-HA complex by performing ultracentrifugation on an amniotic
membrane extract. In some embodiments, the methods further comprise
purifying the native HC-HA complex by performing
ultracentrifugation on an umbilical cord extract. In some
embodiments, the umbilical cord extract comprises umbilical cord
stroma and/or Wharton's jelly. In some embodiments, the methods
further comprise performing two, three or four rounds of
ultracentifugation. In some embodiments, the methods further
comprise performing four rounds of ultracentifugation. In some
embodiments, the HC-HA complex comprises TSG-6. In some
embodiments, the HC-HA complex comprises PTX3. In some embodiments,
the HC-HA complex comprises PTX3. In some embodiments, the HC-HA
complex comprises a small leucine rich proteoglycan (SLRP). In some
embodiments, the HC-HA complex comprises TSG-6, PTX3, and a small
leucine rich proteoglycan (SLRP). In some embodiments, the small
leucine-rich proteoglycan is selected from among decorin, biglycan,
fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, osteoadherin, epipycan, and
osteoglycin. In some embodiments, the HC-HA complex comprises
TSG-6, PTX3, and a small leucine rich proteoglycan (SLRP).
[0010] Described herein, in certain embodiments, are methods for
producing an isolated native HC-HA complex comprising: (a)
culturing an amniotic membrane stem cell, thereby producing a
cultured amniotic membrane stem cell; and (b) isolating an HC-HA
complex from the cultured stem cell, thereby producing an isolated
native HC-HA complex. In some embodiments, the amniotic membrane is
from a placenta or an umbilical cord. In some embodiments, the stem
cell is an amniotic stem cell or an umbilical cord stem cell. In
some embodiments, the umbilical cord stem cell is from the
umbilical cord stromal layer or Wharton's jelly layer.
[0011] Described herein, in certain embodiments, are methods for
treating an individual in need of a stem cell therapy, comprising
administering to the individual a plurality of isolated or expanded
stem cells produced by any of the methods provided herein for
isolating and expanding stem cells. In some embodiments, the
individual has a disease or condition selected from among
non-healing wounds, diabetes, arthritis, inflammatory bowel
disease, Crohn's disease, myocardial infarction, stroke, traumatic
brain injury, spinal cord injury, learning defects, Alzheimer's
disease, Parkinson's disease, baldness, missing teeth,
osteoarthritis, rheumatoid arthritis, muscular dystrophy, cancer,
amyotrophic lateral sclerosis. In some embodiments, the methods
comprise transplanting the isolated or expanded stem cells into the
bone marrow of the individual.
[0012] Described herein, in certain embodiments, are methods for
expanding a stem cell comprising culturing the stem cell in the
presence of one or more isolated or expanded stem cells produced by
any of the methods provided herein for isolating and expanding stem
cells..
[0013] Described herein, in certain embodiments, are compositions
comprising a plurality of expanded stem cells produced by any of
the methods provided herein for isolating and expanding stem cells
and a pharmaceutically acceptable excipient.
[0014] Described herein, in certain embodiments, are compositions
comprising (a) a stem cell; (b) an HC-HA complex; and (c) a tissue
culture plate. In some embodiments, HC-HA complex is immobilized to
the tissue culture plate. In some embodiments, the stem cell is an
isolated or expanded stem cell produced by any of the methods
provided herein for isolating and expanding stem cells. In some
embodiments, the stem cell is an embryonic stem cell, an adult stem
cell, a fetal stem cell, or an induced progenitor cell. In some
embodiments, the stem cell is a limbal stromal niche cell, an
umbilical cord stem cell, an amniotic membrane stem cell or an
adipose stem cell. In some embodiments, the stem cell is a
mesenchymal stem cell. In some embodiments, the stem cell is an
induced pluripotent stem cell derived from an adult differentiated
cell. In some embodiments, stem cell is an induced pluripotent stem
cell derived from a fibroblast. In some embodiments, stem cell is
an induced pluripotent stem cell derived from a conjunctivochalasis
fibroblast. In some embodiments, HC-HA complex is a native HC-HA
complex or is a reconstituted HC-HA complex. In some embodiments,
HC-HA complex comprises TSG-6. In some embodiments, HC-HA complex
comprises PTX3. In some embodiments, the HC-HA complex comprises
PTX3. In some embodiments, the HC-HA complex comprises a small
leucine rich proteoglycan (SLRP). In some embodiments, the HC-HA
complex comprises TSG-6, PTX3, and a small leucine rich
proteoglycan (SLRP). In some embodiments, the small leucine-rich
proteoglycan is selected from among decorin, biglycan,
fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, osteoadherin, epipycan, and
osteoglycin. In some embodiments, the HC-HA complex comprises
TSG-6, PTX3, and a small leucine rich proteoglycan (SLRP).
[0015] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention may be obtained by
reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIG. 1 illustrates a cross section of anatomy of the
amniotic membrane (AM) demonstrating expression of PCK/VIM, E-cad,
CXCR4/SDF1, matrix components, embryonic stem cell (ESC),
angiogenic and differentiation markers.
[0017] FIG. 2 illustrates the percentage of cell purity (left) and
the presence of ESC and angiogenesis markers (right) in isolated
hAMECs after collagenase followed by dispase digestion method.
[0018] FIG. 3A-F illustrates the effects of different culture
conditions on hAMEC, SHEM versus ESCM on percentage of cell
attachment.
[0019] FIG. 4A-B illustrates the relative expression of ESC and
angiogenesis markers and immunostaining in adherent and
non-adherent hAMEC with or without 5% coated matrigel. hAMEC were
manually scrapped after enzymatic digestion in 10 mg/ml dispase for
3 h. Total hAMEC were seeded at density 5.times.104/cm2 in SHEM on
6-well plastic (PL) for 72 h, the cell lysate and cytospin of
attached (A-PL-SHEM) and non-attached cells (NA-SHEM) cells were
collected and labeled as A-PL-SHEM and NA-SHEM. Similarly, hAMEC
were seeded directly on 5% MG in ESCM for 72h, the cell lysate and
cytospin of attached (A-MG-ESCM) and non-attached cells (NA-ESCM)
were collected in similar fashion. Percentage of attachment cells
or non-attachment cells of total seeding were calculated (A).
Relative RNA expression of ESC and angiogenic markers were compared
(B). Immunostaining of ESC markers, Nanog and Oct4.
[0020] FIG. 5A-N illustrates the effect of EGF on hAMEC in SHEM and
ESCM medium (A) and relative ESC and angiogenic marker expression
(B-N).
[0021] FIG. 6A-B illustrates cell morphology of hAMEC cultured in
SHEM during successive passages and the relative ESC and angiogenic
and MSSC marker expression. (A) Phase contrast photographs of hAMEC
cultured over successive passages in DMEM/FBS 10% on plastic, SHEM
on plastic, or ESCM+EGF on plastic, (B) relative expression of ESC
and angiogenesis markers as determined by qPCR in hAMEC cultured in
DMEM/10% FBS on plastic, SHEM+EGF on plastic, or ESCM+EGF on 5%
MG.
[0022] FIG. 7A-D illustrates immediately isolated cells from
collagenase followed by dispase enzymatic digestion (C/D) yields
higher percentage of angiogenic progenitors from human amniotic
membrane.
[0023] FIG. 8A-D illustrates that angiogenic progenitors exhibit
improved expansion on 5% MG than PL in SHEM.
[0024] FIG. 9A-D illustrates that angiogenic progenitors can be
expanded on 5% MG in SHEM but cannot be expanded on PL in DMEM/10%
FBS.
[0025] FIG. 10 illustrates cross sections showing the anatomy of
the umbilical cord (UC), which consists of five distinct zones and
the distribution of basement membrane components and matrix.
[0026] FIG. 11 illustrates a cross section of the anatomy of UC and
immunolocalization of HA (hyaluronan), TSG-6 (Tumor necrosis factor
a-stimulated gene 6), HC1 (heavy chain of inter-.alpha.-inhibitor
(I.alpha.I)), bikunin and PTX3 (Pentraxin 3) in UC AM. HA, TSG-6,
bikunin are expressed from the epithelial layer to vessels, while
PTX3 (Pentraxin 3) is expressed more abundantly in zone 3 and 4 of
UC (i.e., not in Zone 2). Frozen sections of human AM were probed
with biotinylated HABP with or without HAase digestion and with
chain-specific antibodies against I.alpha.I and P.alpha.I
components as indicated. Nonimmune rabbit serum was used as a
control. Nuclei were counterstained with Hoechst 33342 (blue). Ep,
epithelium; St, stroma; Ch, chorion. Scale bar, 25 .mu.m.
[0027] FIG. 12 illustrates a cross section of the anatomy of UC and
immunolocalization of vimentin, PCK, E-cadherin, p63 alpha, SDF-1
and CXCR4. Vimentin expressing stromal cells in Zone 2 express
epithelial phenotypes such as PCK, E-cadherin and p63 alpha. Those
stromal cells also are uniquely expressed both SDF-1 and CXCR4.
[0028] FIG. 13 illustrates a cross section of the anatomy of UC and
immunolocalization of ESC markers.
[0029] FIG. 14 illustrates a cross section of the anatomy of UC and
immunolocalization of angiogenic markers.
[0030] FIG. 15 provides a table of comparison of the ECM and ESC
and Angiogenic Markers between AM versus UC in vivo.
[0031] FIG. 16 provides a table of published methods of isolation,
characterization, and expansion of MSCs/SCs from human umbilical
cord. (Wang et al. (2004) Stem Cells 22:1330-1337, Weiss et al.
(2006) Stem Cells 24:781-792, Sarugasar et al. (2005) Stem Cells
23:220-229, Lu et al. (2006) Haematologica 91:1017-1026, Seshareddy
et al. (2008) Methods Cell Biol 86:101-119, Schugar et al. (2009) J
Biomed Biotechnol. 2009:789526, Koliakos et al. (2011) Journal of
Biological Research-Thessaloniki 16:194-201, Zhao et al. (2011)
Tissue Eng Part A. 17:969-979, Montanucci et al. (2011) Tissue Eng
Part A. 2011;17:2651-2661, Tong et al. (2011) Cell Biol Int.
35:221-226, and Tsagias et al. (2011) Transfus Med.
21:253-261).
[0032] FIG. 17 provides a table of ES, MSC markers expressed in
cultured UC according to published methods (references provided
above).
[0033] FIG. 18 illustrates immunostaining of SDF-1 and PCK
expression in stromal cells isolated from UC.
[0034] FIG. 19 illustrates of ESC and angiogenic markers in
E-cad(+) cells positively selected from digested UC stroma.
[0035] FIG. 20 illustrates an exemplary experimental flow chart for
adipose stem cell isolation (left) and phase contrast microscopy
images from three fractions derived from human orbital fat
following collagenase digestion (right).
[0036] FIG. 21 illustrates expression of ESC markers in RC, FC and
SVF fractions derived from human orbital fat following collagenase
digestion. Patient #1 (age 63) exhibited an RC fraction that has a
significantly higher relative expression of ESC markers than FC or
SVF fractions as determined by qPCR when digested in either
collagenase in DMEM/10% FBS or MESCM. The FC and SVF fractions also
exhibit significantly higher expression of ESC markers in Patient
#2 (age 58) and Patient #3 (age 49), respectively.
[0037] FIG. 22 illustrates that the RC fractions consistently show
a significantly higher expression of angiogenic markers as
determined by qPCR than FC or SVF fractions among all three
patients.
[0038] FIG. 23 illustrates phase contrast microscopy and
immunofluorescence analysis showing Oct4, Sox2, CD31 and CD34
expression enriched in RC fractions compared to FC or SVF fractions
after digestion in collagenase in MESCM. Bars represent 50
.mu.m.
[0039] FIG. 24 illustrates phase contrast microscopy of adipose
tissue cells of SVF versus RC fractions plated on plastic or 5%
Matrigel (MG) at Days 1, 5, and 8 post-seeding.
[0040] FIG. 25 illustrates that the RC fraction showed a
significantly higher expression of ESC or angiogenic markers as
determined by qPCR in SVF 5% Matrigel (MG) than on plastic at Days
10 post-seeding
[0041] FIG. 26 illustrates phase contrast images of ASCs (adipose
stem cells) from FC, RC and SVF fractions after day 9 in culture in
MESCM on control PL alone, immobilized HA, immobilized nHC-HA/PTX3
(Water Soluble) or nHC-HA/PTX3 (Water Insoluble) at 2 h, 18 h, 3
days and 7 days. The control SVF fraction seeded in DMEM/10% FBS on
PL also is shown.
[0042] FIG. 27 illustrates relative ESC marker gene expression as
determined by qPCR for cells isolated from adipose tissue of
patient #090761 (age 52) and #120254 (age 58). Data is shown for
cells cultured in MESCM on PL alone, immobilized HA, immobilized
nHC-HA/PTX3 (Water Soluble) or nHC-HA/PTX3 (Water Insoluble) at 8
days post seeding. (n=3, * p<0.01).
[0043] FIG. 28 illustrates angiogenic marker gene expression as
determined by qPCR for cells isolated from adipose tissue of
patient #090761 (age 52) and #120254 (age 58). Data is shown for
cells cultured in MESCM on PL alone, immobilized HA, immobilized
nHC-HA/PTX3 (Water Soluble) or nHC-HA/PTX3 (Water Insoluble) at 8
days post seeding. (n=3, * p<0.01).
[0044] FIG. 29 illustrates marker gene expression as determined by
qPCR for cells isolated from adipose tissue of patient #090761 (age
52) and #120254 (age 58). Immobilized HA, immobilized nHC-HA/PTX3
(Water Soluble) or nHC-HA/PTX3 (Water Insoluble) promote RC
expression of relative SDF-1 and CXCR4 marker gene expression for
cells isolated from adipose tissue of patient #090761 and #120254.
Data is shown for cells cultured in MESCM on PL alone, immobilized
HA, immobilized nHC-HA/PTX3 (Water Soluble) or nHC-HA/PTX3 (Water
Insoluble) at 8 days post seeding. (n=3, *p<0.01).
[0045] FIG. 30 illustrates relative TGF.beta.1, TGF.beta.2 and
TGF.beta.3 marker gene expression as determined by qPCR for cells
isolated from adipose tissue of patient #090761 (age 52) and
#120254 (age 58). Data is shown for cells cultured in MESCM on PL
alone, immobilized HA, immobilized nHC-HA/PTX3 (Water Soluble) or
nHC-HA/PTX3 (Water Insoluble) at 8 days post seeding. (n=3,
*p<0.01).
[0046] FIG. 31 illustrates relative BMP2, BMP4, BMP6, BMP7 and
VEGF.alpha. marker gene expression as determined by qPCR for cells
isolated from adipose tissue of patient #090761 (age 52). Data is
shown for cells cultured in MESCM on PL alone, immobilized HA,
immobilized nHC-HA/PTX3 (Water Soluble) or nHC-HA/PTX3 (Water
Insoluble) at 8 days post seeding. (n=3, *p<0.01).
[0047] FIG. 32 illustrates immunofluorescence of Oct4, Nanog, CD34
and CD in cells cultured on plastic versus nHC-HA/PTX3 in DMEM or
MESCM.
[0048] FIG. 33 illustrates phase contrast microscopy of [[(A)]]
cells of FC, SVF or RC fractions from rabbit adipose tissue
digested in collagenase in MESCM (Bar indicates 50 .mu.m).
[0049] FIG. 34 illustrates relative expression of ESC markers and
angiogenic markers in FC, SVF or RC fractions as determined by qPCR
for Rabbit adipose tissue samples digested in collagenase in
DMEM/10% FBS versus MESCM.
[0050] FIG. 35 illustrates phase images of cells of FC, SVF or RC
fractions plated in DMEM/10% FBS or MESCM on PL or immobilized
HA
[0051] FIG. 36 illustrates relative ESC and angiogenic marker gene
expression as determined by qPCR for cells isolated from Rabbit
adipose tissue. Data is shown for cells cultured in MESCM on PL
alone, immobilized HA, immobilized nHC-HA/PTX3 (Water Soluble) or
nHC-HA/PTX3 (Water Insoluble) at 8 days post seeding.
[0052] FIG. 37 illustrates phase images of limbal niche cells
treated with the CXCR4 chemokine receptor antagonist AMD3100.
AMD3100 inhibits initiation of aggregation on Day 0 but not affect
on cell aggregation on Day 5.
[0053] FIG. 38 illustrates marker gene expression of limbal niche
cells treated with AMD3100. AMD3100 did not affect expression of
SDF-1/CXCR4 signaling in limbal niche cells cultured from passage 0
or passage 3 on plastic only, Matrigel, immobilized HA, or
immobilized HC-HA complexes purified from AM (2nd or 4th
fraction)
[0054] FIG. 39 illustrates marker gene expression of limbal niche
cells treated with AMD3100. AMD3100 did not inhibit expression of
ESC markers in limbal niche cells cultured from passage 0 or
passage 3 on plastic only, Matrigel, immobilized HA, or immobilized
HC-HA complexes purified from AM (2nd or 4th fraction).
[0055] FIG. 40 illustrates marker gene expression of limbal niche
cells treated with AMD3100. AMD3100 did not inhibit expression of
CD31 in limbal niche cells cultured from passage 0 or passage 3 on
plastic only, Matrigel, immobilized HA, or immobilized HC-HA
complexes purified from AM (2nd or 4th fraction).
[0056] FIG. 41 illustrates marker gene expression of limbal niche
cells treated with AMD3100. AMD3100 significantly downregulated
expression of BMPs and ICAM, but not that of VEGF and IGF-1 in
limbal niche cells from passage 0 or passage 3 on immobilized 4X
HC-HA.
[0057] FIG. 42 illustrates marker gene expression of limbal niche
cells treated with AMD3100. Immobilized 4th HC-HA decreases
proMMP1, proMMP3 and PTX3 protein level in culture medium of CCh
Fibroblasts.
[0058] FIG. 43 illustrates presence of I.alpha.I, P.alpha.I,
individual HCs, bikunin, and TSG-6 in AM extract. Purified
I.alpha.I, urinary trypsin inhibitor (i.e. bikunin), TSG-6, and AM
extract (AME) were treated with or without 50 mm NaOH at 25.degree.
C. for 1 h or chondroitinase ABC (Cabc) at 37.degree. C. for 2 h
before Western blotting using antibodies as indicated. Individual
HC1, HC2, HC3, bikunin, and TSG-6 species were found in AM extract.
M, protein ladder markers.
[0059] FIG. 44A-E illustrates constitutive expression of HC1, HC2,
HC3, and bikunin mRNA and proteins by AMECs and AMSCs. RNA and
protein were extracted from AM tissue and both AMECs and AMSCs
cultured in SHEM with or without 20 ng/ml TNF for 4 h (for RT-PCR)
or 24 h (for Western blotting). Expression of HC1, HC2, HC3, and
bikunin transcripts was compared with liver total RNA using GAPDH
as the loading control (A), whereas that of HC1, HC2, HC3, and
bikunin proteins was compared with control I.alpha.I and serum
using .beta.-actin as the loading control (B, C, D, and E,
respectively).
[0060] FIG. 45A-C illustrates expression of I.alpha.I family
proteins in serum-free AMECs and AMSCs. Primary AMECs and AMSCs
were cultured in serum-free SHEM with or without siRNA to HC1, HC2,
bikunin, or HC3. mRNA expression was quantified by RT-PCR using
GAPDH as the loading control (A). Total proteins were extracted and
subjected to Western blot analysis using antibodies against human
HC1, HC2, bikunin (B) and HC3 (C) as indicated. Ctl, control.
[0061] FIG. 46A-E illustrates constitutive expression of TSG-6 mRNA
and protein by AMECs and AMSCs. RNA and protein were extracted from
AM tissue, human skin fibroblasts (Skin Fib.), and both AMECs and
AMSCs cultured in DMEM/F12 plus 10% FBS with or without 20 ng/ml
TNF for 4 h (for RT-PCR) or 24 h (for Western blotting). Expression
of TSG-6 mRNA (A) and protein in cell lysates (B) and supernatants
(C) was compared. TSG-6 siRNA transfection was performed to verify
the expression of TSG-6 in AMECs and AMSCs (D and E). Ctl,
control.
[0062] FIG. 47A-B illustrates production of HC-HA complex in
serum-free cultures. Primary AMECs and AMSCs cultured in serum-free
SHEM were treated with or without HC1 siRNA or TSG-6 siRNA.
Guanidine-HC1 extract of AM cells was subjected to two successive
ultracentrifugations with CsCl density gradient and 6 m guanidine
HC1 (A). The HA-rich and protein-absent fractions were pooled
essentially as reported previously for isolation of HC-HA complex
from AM extract. Cell HC-HA complex and AM HC-HA complex with or
without HAase digestion were analyzed by Western blotting using
anti-HC1, anti-HC2 (N-terminal and C-terminal) and anti-I.alpha.I
antibodies (B); purified I.alpha.I with or without NaOH treatment
was included as a control.
[0063] FIG. 48 illustrates effect of Matrigel and immobilized HC-HA
on cell morphology and differentiation of native limbal niche
cells. Cells were cultured on plastic only, Matrigel, immobilized
HA, or immobilized HC-HA complexes purified from AM (2.sup.nd or
4.sup.th fraction) and observed at 1, 24, 48, and 96 h after
seeding by phase contrast microscopy.
[0064] FIG. 49 illustrates relative ESC and angiogenesis marker
expression as determined by qPCR in native limbal niche cells
cultured on plastic only, Matrigel, immobilized HA, or immobilized
HC-HA complexes purified from AM (2.sup.nd or 4.sup.th
fraction).
[0065] FIG. 50 illustrates effect of Matrigel and immobilized HC-HA
on cell morphology and differentiation of limbal epithelial
progenitor cells (LEPC). Cells were cultured on plastic only,
Matrigel, immobilized HA, or immobilized HC-HA complexes purified
from AM (2.sup.nd or 4.sup.th fraction) and observed at 1, 24, 48,
and 96 h after seeding by phase contrast microscopy.
[0066] FIG. 51 illustrates relative ESC and angiogenesis marker
expression as determined by qPCR in limbal epithelial progenitor
cells (LEPC) cultured on plastic only, Matrigel, immobilized HA, or
immobilized HC-HA complexes purified from AM (2.sup.nd or 4.sup.th
fraction).
[0067] FIG. 52 illustrates effect of HC-HA on cell morphology and
differentiation of conjunctivochalasis (CCh) fibroblasts. Cells
were cultured on plastic only, immobilized HA, or immobilized HC-HA
complexes purified from AM (2.sup.nd or 4.sup.th fraction) in
either SHEM, DMEM/0.5% FBS, or DMEM/0.5% FBS+IL1.beta. and observed
over 2, 4 and/or 48 after seeding by phase contrast microscopy.
[0068] FIG. 53A-B illustrates relative expression of MMP1, MMP3,
TFG-6 and PTX3 as determined by qPCR in CCh fibroblasts cultured on
plastic only, immobilized HA, or immobilized HC-HA complexes
purified from AM (2.sup.nd or 4.sup.th fraction) (A, B).
[0069] FIG. 54 illustrates relative expression of ESC and
angiogenesis markers as determined by qPCR in CCh fibroblasts
cultured DMEM/0.5% FBS, or DMEM/0.5% FBS+IL1.beta. on plastic only,
immobilized HA, or immobilized HC-HA complexes purified from AM
(2.sup.nd or 4.sup.th fraction).
[0070] FIG. 55 illustrates relative expression of ESC and
angiogenesis markers by immunofluorescence in hAMSC and vascular
network formation on 100% matrigel.
DETAILED DESCRIPTION
Certain Terminology
[0071] As used herein, "amniotic membrane" (AM), and/or amnion,
means the thin, tough membrane that encloses the embryo and/or
fetus. It is the innermost layer of the placenta. AM is also found
in the umbilical cord. AM has multiple layers, including an
epithelial layer, a basement membrane; a compact layer; a
fibroblast layer; and a spongy layer.
[0072] As used herein, "basement membrane" means a thin sheet of
fibers that underlies epithelium and/or endothelium. The primary
function of the basement membrane is to anchor the epithelium and
endothelium to tissue. This is achieved by cell-matrix adhesions
through substrate adhesion molecules (SAMs). The basement membrane
is the fusion of two lamina, the basal lamina and the lamina
reticularis. The basal lamina layer is divided into two layers--the
lamina lucida and the lamina densa. The lamina densa is made of
reticular collagen (type IV) fibrils coated in perlecan. The lamina
lucida is made up of laminin, integrins, entactins, and
dystroglycans. The lamina reticularis is made of type III collagen
fibers. Basement membrane is found in, amongst other locations,
amniotic membrane, adipose tissue, and the corneal limbus.
[0073] As used herein, the term "stem cell niche" means the
microenvironment in which stem cells are found. The stem cell niche
regulates stem cell fate. It generally maintains stem cells in a
quiescent state to avoid their depletion. However, signals from
stem cell niches also signal stem cells to differentiate. Control
over stem cell fate results from, amongst other factors, cell-cell
interactions, adhesion molecules, extracellular matrix components,
oxygen tension, growth factors, cytokines, and the physiochemical
nature of the niche.
[0074] As used herein, a stem cell encompasses any type of stem
cell, including embryonic stem cells, adult stem cell and stem
cells derived from fetal tissues.
[0075] As used herein, a multipotent stem cell refers to a stem
cell derived from an adult or fetal tissue that can differentiate
into a number of cell types.
[0076] As used herein, an embryonic stem cell refers to a stem cell
isolated from the inner cell mass of a blastocyst that is
pluripotent (i.e. can differentiate into almost all cell
types).
[0077] As used herein, a mesenchymal stem cell refers to a
multipotent stem cell capable of differentiating into the
mesenchymal cell lineages (i.e., osteoblasts, chondroblasts and
adipocytes).
[0078] As used herein, multipotent stem cells isolated from adipose
tissue are referred to as adipose-derived stem cells (ASC).
[0079] As used herein, mechanical removal of amniotic membrane from
an umbilical cord refers to physical manipulation, such as peeling,
to separate the amniotic layer of the umbilical cord from the
underlying umbilical cord stroma and blood vessels.
[0080] As used herein, the term "HC-HA complex" refers to a complex
comprising hyaluronan (HA) and the heavy chain of
inter-.alpha.-inhibitor (I.alpha.I). The term HC-HA complex
encompasses native HC-HA complexes (also called nHC-HA) or
reconstituted HC-HA complexes comprising native or recombinant
proteins. The term HC-HA complex is not limiting and includes HC-HA
complexes comprising one or more additional components, such as
pentraxin 3 (PTX3), Tumor necrosis factor .alpha.-stimulated gene 6
(TSG-6), or a small leucine-rich proteoglycan (SLRP). In some
examples, HC-HA complex complexes comprising PTX3 are referred to
herein as HC-HA/PTX3.
[0081] As used herein, a purified native HC-HA (nHC-HA) complex
refers to an HC-HA complex that is purified from a biological
source such as a cell, a tissue or a biological fluid. Such
complexes are generally assembled in vivo in a subject or ex vivo
in cells, tissues, or biological fluids from a subject, including a
human or other animal. In some examples, native HC-HA complexes are
purified by successive rounds of ultracentrifugation of an amniotic
membrane extract (AME) an umbilical cord extract and are referred
to herein by the round in which the complex was purified (e.g.
nHC-HA 2.sup.nd or nHC-HA 4.sup.th). In some embodiments, the
umbilical cord extract comprises umbilical cord stroma and/or
Wharton's jelly. In some embodiments, ultracentrifugation is
performed on a extract obtained by homogenization of a tissue in
PBS and isolation of the soluble fraction by centrifugation. As
used herein, nHC-HA complexes purified by ultracentrifugation of a
PBS-extracted tissue are referred to herein as nHC-HA soluble
complexes. In some embodiments, ultracentrifugation is performed on
a extract obtained by homogenization of a tissue in PBS, removal of
the soluble fraction and further extraction of the insoluble
fraction in guanidine HC1. As used herein, nHC-HA complexes
purified by ultracentrifugation of a guanidine HC1-extracted tissue
are referred to herein as nHC-HA insoluble complexes.
[0082] As used herein, a reconstituted HC-HA complex or rcHC-HA is
an HC-HA complex that is formed by assembly of the component
molecules of the complex in vitro. The process of assembling the
rcHC-HA includes reconstitution with purified native proteins or
molecules from biological source, recombinant proteins generated by
recombinant methods, or synthesis of molecules by in vitro
synthesis. In some instances, the purified native proteins used for
assembly of the rcHC-HA are proteins in a complex with other
proteins (i.e. a multimer, a multichain protein or other
complex).
[0083] The terms "patient", "subject" and "individual" are used
interchangeably. As used herein, both terms mean any animal,
preferably a mammal, including a human and/or non-human. None of
the terms are to be interpreted as requiring the supervision of a
medical professional (e.g., a doctor, nurse, physician's assistant,
orderly, hospice worker).
[0084] The terms "treat," "treating" or "treatment," as used
herein, include alleviating, abating and/or ameliorating a disease
and/or condition symptoms, preventing additional symptoms,
ameliorating and/or preventing the underlying metabolic causes of
symptoms, inhibiting the disease and/or condition, e.g., arresting
the development of the disease and/or condition, relieving the
disease and/or condition, causing regression of the disease and/or
condition, relieving a condition caused by the disease and/or
condition, and/or stopping the symptoms of the disease and/or
condition either prophylactically or therapeutically.
Overview
[0085] Described herein, in certain embodiments, are methods for
the isolation and expansion a variety of stem cells, including, but
not limited to, adult stem cells derived from fetal tissues (e.g.
placenta and umbilical cord), adipose tissue, limbal tissue and
other tissue sources. Such stem cells can be employed to regenerate
tissues and restore physiologic and anatomic functionality.
[0086] Mesenchymal Stem Cells (MSCs) are multipotent stem cells
that have the ability to differentiate into a variety of cell
types, including: osteoblasts, chondrocytes, adipocytes, pericytes.
MSCs have a large capacity for self-renewal while maintaining their
multipotency. MSCs have been isolated from placenta, umbilical cord
tissue, namely Wharton's jelly and the umbilical cord blood,
amniotic membrane (AM), amniotic fluid, adipose tissue, the corneal
limbus, bone marrow, peripheral blood, liver, skin, and the corneal
limbus. Currently, efforts to isolate MSCs focus on the
perivascular space and the pericytes. Described herein, in certain
embodiments, cells adjacent to basement membranes are an
alternative source of MSCs. For example, in the limbus, an
excellent source of MSCs is not the perivascular area but the
basement membrane subadjacent to the limbal epithelium. MSCs also
have been isolated from the avascular stroma of the amniotic
membrane.
[0087] Human AM contains two different cell types derived from two
different embryological origins: amniotic membrane epithelial cells
(hAMEC) are derived from the embryonic ectoderm, while human
amniotic membrane stromal cells (hAMSC) are derived from the
embryonic mesoderm and are sparsely distributed in the stroma
underlying the amnion epithelium. Phenotypically, hAMEC uniformly
express epithelial markers, for example CK 8, CK14, CK17, CK18,
CK19, SSEA3, SSEA4, Tra-1-60, Tra-1-81, Oct4, Nanog, and Sox2.
hAMECs also express the mesenchymal marker vimentin (Vim) in some
scattered clusters. hAMSCs express the mesenchymal cell marker
vimentin (Vim) but not pancytokeratins (PCK), .alpha.-smooth muscle
actin (.alpha.-SMA) and/or desmin. MSCs also express Oct4, Sox2,
Nanog, Rexl, SSEA4, Nestin, N-cadherin, and CD34. Little is known
whether the avascular property of AM contain angiogenic expressing
cells in hAMEC and/or hAMSC in vivo and whether the AM expressing
ESC markers might represent a subset that might be different from
those not expressing ESC markers and angiogenic markers, and if so,
whether they can be separately isolated. It also remains unclear
whether these markers were also expressed in AM stroma. MSCs have
been expanded from both hAMEC and hAMSC.
[0088] Current isolation and culturing techniques for adult stem
cells are crude and result in low yields of stem cells. For
example, hAMECs have been isolated from the AM stroma by use of
trypsin/EDTA (T/E) and/or dispase (D), and collagenase digestion
has been used later to release hAMSC. However, protocols have not
clearly defined nor documented whether stem cells are derived from
hAMECs or hAMSCs during isolation or both. Further, these methods
result in high yield of hAMEC (<2% vim+ cells) and low
epithelial contamination of hAMSC (<1% of cytokeratin+). Current
isolation and expansion methods for stem cells are carried out in a
basal nutrient medium supplemented with fetal bovine serum. There
is a need for new methods of preferentially isolating and expanding
stem cells.
[0089] In some embodiments, the methods provided herein are
performed for the isolation and expansion of a variety of stem cell
types and for the induction of pluripotency in differentiated
cells. In some embodiments, the isolated stems cells are embryonic
stem cells. In some embodiments, the isolated stems cells are adult
or fetal stem cells. As described herein and in the examples
provided herein, methods are provided for the isolation and
expansion of stem cells from a variety of exemplary tissues
including, but not limited to, amniotic membrane, umbilical cord,
adipose tissue, and limbal tissues.
[0090] Among the methods provided herein are methods of isolation
of multipotent cells from a cell population using a cell surface
marker, such as E-cadherin, which is expressed in a subpopulation
of stem cells. In exemplary methods, stem cells are isolated from
the stroma of the umbilical cord by mechanical or enzymatic removal
of amniotic membrane (AM) prior to digestion of the stroma and
subsequent purification of the cells. In an exemplary method,
mechanical removal or enzymatic digestion of the AM epithelium
prior to digestion of the stroma reduces the epithelial cell
contamination of the sample and permits isolation of multipotent
cells by targeting specific cell surface markers, such as
E-cadherin.
[0091] Also among the methods provided herein are methods of
enriching or selecting stem cells from a mixed cell population by
removal of cells that adhere to plastic followed by culturing of
the remainder cells (i.e. non-adherent) on a suitable two
dimensional substrate. In some embodiments, the suitable two
dimensional substrate is 5% Matrigel. In exemplary embodiments, a
mixed cell population is first prepared by enzymatic digestion of a
tissue. In exemplary embodiments, a mixed cell population is plated
on plastic following enzymatic digestion of a tissue. In exemplary
embodiments, the non-adherent cells of such cultures are enriched
for stem cell markers. In some embodiments, the non-adherent cells
are subsequently cultured on a suitable substrate for expansion of
the isolated stem cell population. The methods thus provide for an
enriched stem cell population.
[0092] Also among the methods provided herein are improved methods
of expanding and maintaining stem cells by culturing the stem cells
on a substrate containing a complex of hyaluronan (HA) and the
heavy chain of inter-a-inhibitor HC1 (HC-HA). In certain instances,
the expansion of stem cells on a substrate comprising a HC-HA
complex promotes aggregation, prevents differentiation of the stem
cells, and preserves the expression of stem cell markers.
[0093] Further, in some embodiments, HC-HA promotes pluripotency in
differentiated or partially differentiated cells, such as adult
fibroblasts. Accordingly, in some embodiments, methods are provided
herein for the induction of pluripotency in differentiated or
partially differentiated cells, such as adult fibroblasts.
Methods of Isolation Stem Cells and Enrichment of Stem Cell
Populations
[0094] Described herein, in certain embodiments, are methods for
isolating and enriching a stem cell from a mixed cell population to
generate an isolated stem cell. In some embodiments, the mixed cell
population comprises one or more stem cells. In some embodiments,
the mixed cell population comprises one or more stem cells and one
or more non-stem cells. In some embodiments, the mixed cell
population is obtained from an adult tissue or a fetal tissue. In
non-limiting examples, the mixed cell population is obtained from
an amniotic membrane tissue, an umbilical cord tissue, a limbal
tissue or an adipose tissue. In some embodiments, culturing of the
mixed cell population in a supplemented hormonal epithelial medium
(SHEM) prior to plating on a substrate enriches for cells
expressing stem cell markers. In some embodiments, a stem cell is
isolated from the mixed cell population by cell sorting based on
E-cadherin expression. E-cadherin marker expression in multipotent
stem cells promotes 3D aggregation, which is important for
maintaining multipotency of the stem cells.
[0095] In some embodiments, the methods further comprise expanding
the isolated stem cell using any of the methods of expansion
provided herein. For example, in some embodiments, the methods
comprise expanding the isolated stem cells in a first culture
comprising a suitable two-dimensional substrate without passing the
Hayflick limit to form a plurality of expanding stem cells. In some
embodiments, the two-dimensional substrate comprises an HC-HA
complex. In some embodiments, the methods comprise expanding the
isolated stem cell using a conventional method of stem cell
expansion, such as culturing on feeder cells and/or use of modified
media comprising various growth factors (see, e.g. U.S. Pat. Nos.
5,399,493, 5,612,211, 5,435,151, 5,728,581, 7,297,539, 7,067,316,
and 7,312,078).
[0096] In some embodiments, the isolated stem cell is an embryonic
stem cell. In some embodiments, the isolated stem cell is an adult
stem cell. In some embodiments, the isolated stem cell is a fetal
stem cell. In some embodiments, the isolated stem cell is an
induced pluripotent cell (iPS).
[0097] In some embodiments, the isolated stem cell is a mesenchymal
stem cell (MSC). In some embodiments, the isolated stem cell is an
adipose stem cell (ASC). In some embodiments, the isolated stem
cell is an umbilical cord stem cell. In some embodiments, the
isolated stem cell is an amniotic membrane stem cell. In some
embodiments, the isolated stem cell is a limbal cell, such as a
limbal niche cell or a limbal epithelial progenitor cell. In some
embodiments, the isolated stem cell is an endothelial stem cell. In
some embodiments, the isolated stem cell is a hematopoietic stem
cell. In some embodiments, the isolated stem cell is a bone marrow
stem cell. In some embodiments, the isolated stem cell is a neural
stem cell. In some embodiments, the isolated stem cell is an
endothelial progenitor cell. In some embodiments, the isolated stem
cell is a skeletal muscle stem cell. In some embodiments, the
isolated stem cell is a mammary stem cell. In some embodiments, the
isolated stem cell is an intestinal stem cell.
[0098] In some embodiments, the isolated stem cell is an induced
pluripotent stem cell (iPS). In some embodiments, the isolated stem
cell is an induced pluripotent stem cell derived from a an adult
differentiated or partially differentiated cell. In some
embodiments, the isolated stem cell is an induced pluripotent stem
cell derived from a fibroblast. In some embodiments, the isolated
stem cell is an induced pluripotent stem cell derived from a
Conjunctivochalasis (CCh) fibroblast.
[0099] In some embodiments, the mixed cell population is derived
from a fetal tissue, such as placental tissue or an umbilical cord
tissue. In some embodiments, the mixed cell population is derived
from amniotic membrane. In some embodiments, the mixed cell
population is derived from adipose tissue. In some embodiments, the
mixed cell population is derived from limbal tissue. In some
embodiments, the mixed cell population is derived from bone marrow.
In some embodiments, the mixed cell population is derived from
limbal tissue. In some embodiments, the mixed cell population is
derived from endothelial tissue. In some embodiments, the mixed
cell population is derived from limbal tissue. In some embodiments,
the mixed cell population is derived from neural tissue. In some
embodiments, the mixed cell population is derived from skeletal
muscle. In some embodiments, the mixed cell population is derived
from the skin. In some embodiments, the mixed cell population is
derived from the digestive system. In some embodiments, the mixed
cell population is derived from the pancreas. In some embodiments,
the mixed cell population is derived from the liver. In some
embodiments, the mixed cell population is derived from the
olfactory mucosa. In some embodiments, the mixed cell population is
derived from a germ cell population. In some embodiments, the mixed
cell population is derived from blood. In some embodiments, the
mixed cell population is derived from umbilical cord blood.
[0100] Isolation Based on Expression of E-Cadherin (E-cad)
[0101] Described herein, in certain embodiments are stem cell
populations that express the cell surface marker E-cadherin. In
some embodiments, methods are provided for isolating a stem cell
from a mixed cell population comprising selecting cells that
express E-cadherin.
[0102] In some embodiments, isolation comprises contacting the
mixed cell population with an agent that binds to E-cadherin. In
some embodiments, isolation comprises contacting the mixed cell
population with an agent that binds to the extracellular portion of
E-cadherin. In some embodiments, isolation comprises contacting the
mixed cell population with an agent that binds to one or more of
the five extracellular cadherin repeats of E-cadherin.
[0103] In some embodiments, the agent is an E-cadherin antibody. In
some embodiments, the antibody is conjugated to a moiety permits
identification and/or sorting of cells bound to a primary antibody.
In some embodiments, the moiety is a fluorophore, radioactive
isotope, chromophore or magnetic particle.
[0104] In some embodiments, a secondary antibody that binds to a
primary E-cadherin antibody is employed to identify and/or permit
cell sorting of cells bound to the E-cadherin antibody. In some
embodiments, the secondary antibody is conjugated to a moiety
permits identification and/or sorting of cells bound to a primary
antibody. In some embodiments, the moiety is a fluorophore,
radioactive isotope, chromophore or magnetic particle.
[0105] In some embodiments, the agent is an E-cadherin ligand (e.g.
an integrin or a subunit thereof or portion thereof that binds to
E-cadherin). In some embodiments, the ligand is conjugated to a
moiety that permits identification and/or sorting of cells bound to
the ligand. In some embodiments, the moiety a fluorophore,
radioactive isotope, chromophore or magnetic particle.
[0106] In some embodiments, the stem cells are isolated from the
mixed cell population by flow cytometry, for example, fluorescence
activated cell sorting (FACS), or magnetic activated cell sorting
(MACS). In some embodiments, magnetic activated cell sorting is
performed using Dynabeads.
[0107] In exemplary isolation methods, the methods comprise mixing
the mixed cell population with paramagnetic beads, which exhibit
magnetic properties when placed within a magnetic field and are
coated with an antibody (e.g. an anti-E-cadherin antibody). In an
exemplary tube-based method, target-bead complexes are removed from
the cell suspension using an external magnet that draws the
complexes to the inner edge of the tube, allowing supernatant to be
removed. Removing the tube from the magnetic field enables
resuspension of the target-bead complexes. Separation is gentle and
does not require centrifugation or columns.
[0108] In the another exemplary method, a column-based method is
used where target-bead complexes pass through a separation column,
which is placed in a strong, permanent magnet. The column matrix
serves to create a high-gradient magnetic field that retains
bead-bound complexes while non-labeled cells flow through.
Following removal of the column from the magnetic field, the
retained cells may be eluted.
[0109] Media Based Enrichment
[0110] In certain embodiments, as described herein, culturing cells
in a mixed cell population separated from a tissue in supplemented
hormonal epithelial medium (SHEM) and selection of non-adherent
cells for re-plating on diluted Matrigel enriches a population of
stem cells that express embryonic stem cell (ESC) markers and
angiogenesis markers as compared to plating on diluted Matrigel
directly. Such methods enrich for cells that preferentially adhere
to a two dimensional substrate, such as Matrigel.
[0111] In some embodiments, the methods comprise (a) culturing the
mixed cell population in a first culture comprising supplemented
hormonal epithelial medium (SHEM) on a plastic tissue culture dish
for a period of time; (b) isolating non-adherent cells of the first
culture to form a plurality of isolated non-adherent cells; and (c)
expanding the plurality of isolated non-adherent cells in a second
culture, to form a plurality of expanding stem cells. In some
embodiments the second culture comprises a suitable two-dimensional
substrate. In some embodiments, the expanding stem cells do not
pass the Hayflick limit. In some embodiments, the substrate
comprises an HC-HA complex. In some embodiments, the second culture
comprises embryonic stem cell medium (ESCM) or modified embryonic
stem cell medium (MESCM, ESCM supplemented with bFGF and LIF).
[0112] In some embodiments, the methods further comprise culturing
the expanded stem cells of the first culture in a second culture
comprising a suitable three-dimensional substrate. In some
embodiments, the methods comprise (a) expanding an isolated stem
cell in a first culture comprising a suitable two-dimensional
substrate without passing the Hayflick limit to form a plurality of
expanding stem cells,; and (b) isolating and expanding at least one
expanding stem cell from the plurality of expanding stem cells in a
second culture comprising a suitable three-dimensional substrate.
In some examples, the two dimensional substrate comprises an HC-HA
complex.
[0113] In some embodiments, the methods comprise (a) separating a
plurality of cells from other components of an extracellular matrix
in a tissue sample, to form a mixed cell population; (b) culturing
the mixed cell population in a first culture comprising
supplemented hormonal epithelial medium (SHEM) on a plastic tissue
culture dish for a period of time; (c) isolating non-adherent cells
of the first culture, to form a plurality of isolated non-adherent
cells; and (d) expanding the plurality of isolated non-adherent
cells in a second culture comprising a suitable two-dimensional
substrate to form a plurality of expanding stem cells. In some
embodiments, the expanding stem cells do not pass the Hayflick
limit. In some embodiments, the second culture comprises embryonic
stem cell medium (ESCM) or modified embryonic stem cell medium
(MESCM, ESCM supplemented with bFGF and LIF). In some embodiments,
the method further comprises isolating and expanding at least one
expanding stem cell from the plurality of expanding stem cells in a
second culture comprising a suitable three-dimensional
substrate.
[0114] Preparation of Mixed Cell Populations from Tissues
[0115] Provide herein are methods of preparing mixed cell
populations from tissues for use in the isolation methods provided
herein. The methods provided herein are exemplary and not intended
to limit the types of tissues that can be used for the production
of mixed cell populations for use in the methods provided herein.
Any of a variety of tissues and methods of preparation of a mixed
cell population may be employed in combination with the methods
provided herein. In some embodiments, the mixed cell population
comprises at least one stem cell and at least one non-stem cell. In
some embodiments, the mixed cell population comprises about 5%,
10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, or 95% stem cells of the total number of cells
in the mixed cell population.
[0116] In some embodiments, the mixed cell population is
substantially free of epithelial cells. In some embodiments, the
mixed cell population is less than 10%, less than 9%, less than 8%,
less than 7%, less than 6%, less than 5%, less than 4%, less than
3%, less than 2%, less than 1%, or fewer epithelial cells. In some
embodiments, the epithelial cells are removed from a mixed cell
population. In some embodiments, the epithelial cells are removed
from a mixed cell population prior to application of an isolation
or expansion method provided herein. In some embodiments, the
epithelial cells are removed from a mixed cell population by cell
sorting method such as flow cytometry or magnetic sorting.
[0117] In some embodiments, the mixed cell population for use in
the methods is derived from cells found in contact with a basement
membrane of a tissue. In some embodiments, the mixed cell
population for use in the methods is derived from cells found in
the stroma. In some embodiments, the mixed cell population for use
in the methods is derived from cells found in the umbilical cord
stroma. In some embodiments, the mixed cell population for use in
the methods is derived from cells found in the amniotic membrane,
for example in the avascular stroma. In some embodiments, the mixed
cell population for use in the methods is derived from cells found
in adipose stromal tissue. In some embodiments, the mixed cell
population for use in the methods is derived from cells found in
the corneal limbus.
[0118] In some embodiments, the preparation of the mixed cell
population is performed in a suitable medium. In some embodiments,
the medium is embryonic stem cell medium, modified embryonic stem
cell medium, supplemented hormonal epithelial medium, and/or a
combination thereof. In some embodiments, the medium is
supplemented with one or more growth factors. In some embodiments,
the medium is supplemented with EGF, bFGF and/or LIF. In some
embodiments, the medium is supplemented with an inhibitor of
Rho-associated kinase (ROCK inhibitor).
[0119] In some embodiments, the mixed cell population is separated
from a tissue sample by contacting the tissue sample with a
protease. In some embodiments, the protease degrades and/or
hydrolyzes components of the basement membrane (e.g., collagens,
heparan sulfate proteoglycans, laminin, and nidogen-1/2
(entactin)), but not components of the interstitial space (e.g.,
stroma). In some embodiments, the protease is a dispase. In some
embodiments, the dispase is added to the tissue sample for a period
of time, such as for example, about 10, 20, 30, 40, 50, 60, 70, 80,
90, 100, 110, 120 minutes or longer. In some embodiments, the
tissue is digested at 37.degree. C. In some embodiments, dispase is
used in combination with a hyaluronidase.
[0120] In some embodiments, the mixed cell population is separated
from a tissue sample by contacting the tissue sample with an enzyme
that hydrolyzes and/or degrades interstitial (e.g., stromal)
collagen but not basement membrane collagen. In some embodiments,
the mixed cell population is separated from a tissue sample by
contacting the tissue sample with a collagenase. In some
embodiments, the mixed cell population is separated from a tissue
sample by contacting the tissue sample with collagenase A,
collagenase B, collagenase D, and/or a combination thereof. In some
embodiments, the mixed cell population is separated from a tissue
sample by contacting the tissue sample with collagenase A. In some
embodiments, the collagenase is used in combination with
hyaluronidase. In some embodiments, the collagenase is added to the
tissue sample for a period of time, such as for example, about 10,
20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 minutes or longer. In
some embodiments, the tissue is digested at 37.degree. C. In some
embodiments, the cells of the mixed cell sample are further
separated from one another by contacting the cells with a protease,
such as trypsin.
[0121] In some embodiments, the mixed cell population is isolated
from a tissue sample by contacting the tissue sample with a
collagenase and dispase. In some embodiments, the mixed cell
population is isolated from a tissue sample by contacting the
tissue sample with dispase and collagenase A. In some embodiments
the collagenase and dispase are added sequentially. For example, in
some embodiments, the mixed cell population is isolated from a
tissue sample by contacting the tissue sample with a collagenase
for a period of time and then contacting the tissue sample with
dispase for a period of time. In some embodiments the dispase and
collagenase are added sequentially. For example, in some
embodiments, the mixed cell population is isolated from a tissue
sample by contacting the tissue sample with a dispase for a period
of time and then contacting the tissue sample with collagenase for
a period of time. In some embodiments, the dispase is used in
combination with a hyaluronidase. In some embodiments, the loose
cells are removed following collagenase digestion and prior to
dispase digestion. In some embodiments, the loose cells are not
removed following collagenase digestion and prior to dispase
digestion. In some embodiments, the collagenase is added to the
tissue sample for a period of time, such as for example, about 10,
20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 minutes or longer. In
some embodiments, the tissue is digested at 37.degree. C. In some
embodiments, the dispase is added to the tissue sample for a period
of time, such as for example, about 10, 20, 30, 40, 50, 60, 70, 80,
90, 100, 110, 120 minutes or longer. In some embodiments, the
tissue is digested at 37.degree. C. In some embodiments, the cells
of the mixed cell sample are further separated from one another by
contacting the cells with a protease, such as trypsin.
[0122] Described herein, in certain embodiments, are methods of
separating a mixed cell population from an umbilical cord tissue.
In exemplary methods, the mixed cell population is separated from
an umbilical cord by: (a) mechanically or enzymatically removing
the amniotic membrane epithelial cells from an umbilical cord; and
(b) contacting the remaining umbilical cord tissue with collagenase
for a period of time sufficient to separate mixed cell population
from the tissue. In some embodiments, the methods further comprise
isolating stem cells from the mixed cell population by selecting
cells that express E-cadherin. In some embodiments, the blood
vessels of the umbilical cord are removed prior to digestion. In
exemplary methods, enzymatic removal of the amniotic membrane is
performed by digesting the tissue with dispase. In exemplary
methods, enzymatic removal of the remaining amniotic membrane
stroma is performed by digesting the tissue with collagenase and
hyaluronidase. In some embodiments, the cells of the mixed cell
sample are further separated from one another by contacting the
cells with a protease, such as trypsin.
[0123] As described herein, in certain embodiments, the mixed cell
population from the stroma of the umbilical cord can be isolated
with minimal epithelial cell contamination by mechanical removal of
the epithelial layer of the amniotic membrane (AM) of the umbilical
cord and digestion of the underlying stromal tissue. In addition,
because the epithelial tissue has been removed, isolation of stem
cells by selecting E-cadherin positive stromal cells can be
achieved by cell sorting. Thus, in certain embodiments, the
epithelial layer of the AM is mechanically removed without
enzymatic digestion.
[0124] Described herein, in certain embodiments, are methods of
separating a mixed cell population from an adipose tissue. As
described herein, fractionation collagenase-digested adipose tissue
by centrifugation and filtration results in adipose stem cell (ASC)
populations that differ in their ability to express stem cell
markers. Conventional methods of separation methods of isolating
ASCs involves the following steps: (1) digesting adipose tissue
with collagenase I in DMEM/10% FBS, (2) separating the stromal
vascular fraction (SVF) cells, and discarding the floating cells
that contain mature adipose cells, and (3) filtering the SVF via a
250 .mu.m mesh filter and collecting cell flow through.
Problematically, collecting the cell flow through results in the
loss of any cells attached to basement membrane. As discussed
above, many multipotent stem cells are attached to basement
membrane. Thus, the current methods of isolating ASCs results in
the loss of a significant fraction of ASCs. In some embodiments,
the cells remaining on the filter (RC fraction) are enriched for
the expression of ESC and angiogenic markers and are thus can be an
additional source of ASCs. Similarly, in some embodiments, the
cells in FC that is normally discarded can also be another source
of ASCs.
[0125] In some embodiments, cell aggregation during expansion is
maintained when ASCs are isolated in human embryonic stem cell
medium supplemented with bFGF and LIF MESCM. In some embodiments,
cell aggregation during expansion is maintained when ASCs are
cultured on a substrate comprising an HC-HA complex.
[0126] In exemplary methods, the mixed cell population is separated
from an adipose tissue by: (1) digesting adipose tissue with
collagenase, to create digested adipose tissue; (2) separating the
stromal vascular fraction (SVF) cells of the digested adipose
tissue from other cells (e.g., floating cells that contain mature
adipose cells and other cells, some of which include stem-like
cells (FC fraction)), to create isolated SVF; and (3) isolating
ASCs attached to basement membrane other bound cells and components
of an extracellular matrix in the isolated SVF. In some
embodiments, isolation of the ASCs is performed in human embryonic
stem cell medium supplemented with bFGF and LIF (MESCM). In some
embodiments, isolating ASCs attached to basement membrane comprises
filtering the SVF via a mesh filter and collecting the non-cell
flow through (remaining cell or RC fraction). In some embodiments,
the mesh filter has pore size of about 40 .mu.m to about 250 .mu.m.
In some embodiments, the mesh filter has pore size of about 40, 50,
60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190,
200, 210, 220, 230, 240, or 250 .mu.m.
[0127] The methods provide herein for the isolation and expansion
of stem cells are not limited to application to the RC. The methods
provide herein for the isolation and expansion of stem cells are
not limited to application to the RC. In some embodiments, one or
more stem cells are isolated and/or expanded from the RC fraction.
In some embodiments, one or more stem cells are isolated and/or
expanded from the SVF fraction. In some embodiments, one or more
stem cells are isolated and/or expanded from the FC fraction.
[0128] In some embodiments, the methods for isolating stem cells
provided herein are performed using the FC fraction as the mixed
cell population. In some embodiments, the methods for isolating
stem cells provided herein are performed using the SVF fraction as
the mixed cell population. In some embodiments, the methods for
isolating stem cells provided herein are performed using the RC
fraction as the mixed cell population. In some embodiments, the
methods further comprise isolating stem cells from the mixed cell
population by selecting cells that express E-cadherin. In some
embodiments, the methods further comprised expanding the stem cells
using a conventional method or a method of expansion provided
herein.
[0129] In some embodiments, separating the mixed cell population
from adipose tissue comprises contacting the adipose tissue with a
protease. In some embodiments, separating the mixed cell population
from adipose tissue comprises contacting the adipose tissue with a
protease that does degrade and/or hydrolyze components of the
basement membrane (e.g., collagens, heparan sulfate proteoglycans,
laminin, and nidogen-1/2 (entactin)). In some embodiments, the
protease is collagenase.
Methods of Expanding Isolated Stem Cells
[0130] Described herein are methods for expanding a stem cell, such
as, but not limited to, a stem cell isolated by a method provided
herein or any other suitable method. Exemplary methods of expansion
include, but are not limited to, expansion of the isolated stem
cells on a substrate comprising HC-HA and/or matrigel.
[0131] Expansion on HC-HA
[0132] Disclosed herein, in certain embodiments, are methods of
expanding an isolated stem cell on a substrate that comprises a
complex comprising hyaluronan (HA) and the heavy chain 1 (HC1) of
inter-.alpha.-inhibitor (I.alpha.I), (i.e. HC-HA). As described
herein, HC-HA complexes promote the aggregation of stem cells,
prevent differentiation of the cells and preserve expression of
stem cell markers.
[0133] In some embodiments, the expansion on HC-HA preserves
expression of one or more of embryonic stem cell (ESC) markers
(e.g. Oct4, Nanog, Sox2 (SRY (sex determining region Y)-box 2),
Rex1 (Zfp42), SSEA4 (stage-specific embryonic antigen-4), MYC/c-Myc
and KLF4, pericyte markers (e.g. NG2 (neuron-glial antigen 2/
Chondroitin sulfate proteoglycan 4(CSPG4)), PDGFR-.beta.
(Platelet-derived growth factor receptor B), and .alpha.-SMA
(.alpha.-smooth muscle actin)), and angiogenic markers (e.g.
CD133/2, FLK-1 (VEGF-R2, Ly-73), vWF (von Willebrand factor), CD34,
CD31 (PECAM-1) and CD146). In some embodiments, the expression of
the stem cell marker is determined by conventional methods, such as
for example, protein expression analysis (e.g. Western blotting,
immunofluorescence, immunohistochemistry, fluorescence activated
cell sorting) or mRNA analysis (e.g. polymerase chain reaction
(PCR) or Northern).
[0134] In some embodiments, the isolated stem cell cultured on
HC-HA is an embryonic stem cell. In some embodiments, the isolated
stem cell cultured on HC-HA is an adult stem cell. In some
embodiments, the isolated stem cell cultured on HC-HA is a fetal
stem cell. In some embodiments, the isolated stem cell cultured on
HC-HA is an induced pluripotent cell (iPS).
[0135] In some embodiments, the isolated stem cell cultured on
HC-HA is a mesenchymal stem cell. In some embodiments, the isolated
stem cell cultured on HC-HA is an adipose stem cell (ASC). In some
embodiments, the isolated stem cell cultured on HC-HA is an
umbilical cord stem cell. In some embodiments, the isolated stem
cell cultured on HC-HA is an amniotic membrane stem cell. In some
embodiments, the isolated stem cell cultured on HC-HA is a limbal
cell, such as a limbal niche cell or a limbal epithelial progenitor
cell. In some embodiments, the isolated stem cell cultured on HC-HA
is an endothelial stem cell. In some embodiments, the isolated stem
cell cultured on HC-HA is a hematopoietic stem cell. In some
embodiments, the isolated stem cell is a bone marrow stem cell. In
some embodiments, the isolated stem cell cultured on HC-HA is a
neural stem cell. In some embodiments, the isolated stem cell
cultured on HC-HA is an endothelial progenitor cell. In some
embodiments, the isolated stem cell cultured on HC-HA is a skeletal
muscle stem cell. In some embodiments, the isolated stem cell
cultured on HC-HA is a mammary stem cell. In some embodiments, the
isolated stem cell cultured on HC-HA is an intestinal stem
cell.
[0136] In some embodiments, the isolated stem cell cultured on
HC-HA is an induced pluripotent stem cell (iPS). In some
embodiments, the isolated stem cell cultured on HC-HA is an induced
pluripotent stem cell derived from an adult differentiated or
partially differentiated cell. In some embodiments, the isolated
stem cell cultured on HC-HA is an induced pluripotent stem cell
derived from a fibroblast. In some embodiments, the isolated stem
cell cultured on HC-HA is an induced pluripotent stem cell derived
from a Conjunctivochalasis (CCh) fibroblast.
[0137] In some embodiments, the isolated stem cell cultured on
HC-HA is derived from a fetal tissue, such as placental tissue or
an umbilical cord tissue. In some embodiments, the isolated stem
cell cultured on HC-HA is derived from amniotic membrane. In some
embodiments, the isolated stem cell cultured on HC-HA is derived
from adipose tissue. In some embodiments, the isolated stem cell
cultured on HC-HA is derived from limbal tissue. In some
embodiments, the isolated stem cell cultured on HC-HA is derived
from bone marrow. In some embodiments, the isolated stem cell
cultured on HC-HA is derived from endothelial tissue. In some
embodiments, the isolated stem cell cultured on HC-HA is derived
from limbal tissue. In some embodiments, the isolated stem cell
cultured on HC-HA is derived from neural tissue, In some
embodiments, the isolated stem cell cultured on HC-HA is derived
from limbal tissue. In some embodiments, the isolated stem cell
cultured on HC-HA is derived from skeletal muscle. In some
embodiments, the isolated stem cell cultured on HC-HA is derived
from the skin. In some embodiments, the isolated stem cell cultured
on HC-HA is derived from the digestive system. In some embodiments,
the isolated stem cell cultured on HC-HA is derived from the
pancreas. In some embodiments, the isolated stem cell cultured on
HC-HA is derived from the liver. In some embodiments, the isolated
stem cell cultured on HC-HA is derived from the olfactory mucosa.
In some embodiments, the isolated stem cell cultured on HC-HA is
derived from a germ cell population. In some embodiments, the
isolated stem cell cultured on HC-HA is derived from blood. In some
embodiments, the isolated stem cell cultured on HC-HA is derived
from umbilical cord blood.
[0138] In some embodiments, the HC-HA complex is a native HC-HA
complex (nHC-HA) isolated from amniotic membrane or umbilical cord.
In some embodiments, the HC-HA complex is a reconstituted HC-HA
complex. In some embodiments, HA is covalently linked to HC. In
some embodiments, the HC of I.alpha.I is heavy chain 1 (HC1). In
some embodiments, the HC-HA complex comprises Tumor necrosis factor
a-stimulated gene 6 (TSG-6). In some embodiments, the HC-HA complex
comprises pentraxin 3 (PTX3) (also called HC-HA/PTX3). In some
embodiments, the HC-HA complex comprises TSG-6 and PTX3. In some
embodiments, the HC-HA complex is a native HC-HA complex comprising
PTX3, or nHC-HA/PTX3. In some embodiments, the HC-HA complex is a
reconstituted HC-HA complex comprising PTX3, or rcHC-HA/PTX3.
[0139] In some embodiments, the HC-HA complex comprises a small
leucine rich proteoglycan (SLRP). In some embodiments, the HC-HA
complex comprises a class I, class II or class II SLRP. In some
embodiments, the HC-HA complex comprises TSG-6, PTX3, and a small
leucine rich proteoglycan (SLRP). In some embodiments, the small
leucine-rich proteoglycan is selected from among class I SLRPs,
such as decorin and biglycan. In some embodiments, the small
leucine-rich proteoglycan is selected from among class II SLRPs,
such as fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, and osteoadherin. In some
embodiments, the small leucine-rich proteoglycan is selected from
among class III SLRPs, such as epipycan and osteoglycin. In some
embodiments, the HC-HA complex comprises TSG-6, PTX3, and a small
leucine rich proteoglycan (SLRP).
[0140] In some embodiments, the isolated stem cell is expanded on a
substrate comprising immobilized HC-HA. In some embodiments, the
isolated stem cell is expanded in a culture medium comprising HC-HA
complex. In some embodiments, the medium is embryonic stem cell
medium, modified embryonic stem cell medium, supplemented hormonal
epithelial medium, and/or a combination thereof. In some
embodiments, the medium is supplemented with one or more growth
factors. In some embodiments, the medium is supplemented with EGF,
bFGF and/or LIF. In some embodiments, the medium is supplemented
with an inhibitor of Rho-associated kinase (ROCK inhibitor).
[0141] Sources of HC-HA
[0142] Isolated HC-HA complexes for use in the methods provided are
described in, including methods of isolation and preparation of,
for example in U.S. Patent Pub. Nos. US2012-0083445,
US2012-0083445, and International PCT Pub. No. WO 2012/170905, all
of which are expressly incorporated herein by reference. In some
embodiments, the isolated HC-HA complex is derived from fresh,
frozen or previously frozen placental amniotic membrane (PAM),
fresh, frozen or previously frozen umbilical cord amniotic membrane
(UCAM), fresh, frozen or previously frozen placenta, fresh, frozen
or previously frozen umbilical cord, fresh, frozen or previously
frozen chorion, fresh, frozen or previously frozen amnion-chorion,
or any combinations thereof. Such tissues can be obtained from any
mammal, such as, for example, but not limited to a human, non-human
primate, cow or pig.
[0143] In some embodiments, the HC-HA is purified by any suitable
method. In some embodiments, the HC-HA complex is purified by
centrifugation (e.g., ultracentrifugation, gradient
centrifugation), chromatography (e.g., ion exchange, affinity, size
exclusion, and hydroxyapatite chromatography), gel filtration, or
differential solubility, ethanol precipitation or by any other
available technique for the purification of proteins (See, e.g.,
Scopes, Protein Purification Principles and Practice 2nd Edition,
Springer-Verlag, New York, 1987; Higgins, S. J. and Hames, B. D.
(eds.), Protein Expression: A Practical Approach, Oxford Univ
Press, 1999; and Deutscher, M. P., Simon, M. I., Abelson, J. N.
(eds.), Guide to Protein Purification: Methods in Enzymology
(Methods in Enzymology Series, Vol 182), Academic Press, 1997, all
incorporated herein by reference).
[0144] In some embodiments, the HC-HA complex is purified by
immunoaffinity chromatography. In some embodiments, anti HC1
antibodies, anti-HC2 antibodies, or both are generated and affixed
to a stationary support. In some embodiments, the unpurified HC-HA
complex (i.e., the mobile phase) is passed over the support. In
certain instances, the HC-HA complex binds to the antibodies (e.g.,
via interaction of (a) an HC1 antibody and HC1, (b) an HC2 antibody
and HC2, or (c) both). In some embodiments the support is washed
(e.g., with PBS) to remove any unbound or loosely bound molecules.
In some embodiments, the support is then washed with a solution
that enables elution of the HC-HA complex from the support (e.g.,
1% SDS, 6M guanidine-HC1, or 8M urea).
[0145] In some embodiments, the HC-HA complex is purified by
affinity chromatography. In some embodiments, HABP is generated and
affixed to a stationary support. In some embodiments, the
unpurified HC-HA complex (i.e., the mobile phase) is passed over
the support. In certain instances, the HC-HA complex binds to the
HABP. In some embodiments the support is washed (e.g., with PBS) to
remove any unbound or loosely bound molecules. In some embodiments,
the support is then washed with a solution that enables elution of
the HC-HA complex from the support.
[0146] In some embodiments, the HC-HA complex is purified by a
combination of HABP affinity chromatography, and immunoaffinity
chromatography using anti HC1 antibodies, anti-HC2 antibodies, or
both.
[0147] In some embodiments, the extract is prepared from an
amniotic membrane extract. In some embodiments, the extract is
prepared from an umbilical cord extract. In some embodiments, the
umbilical cord extract comprises umbilical cord stroma and/or
Wharton's jelly. In some embodiments, the HC-HA complex is
contained in an extract that is prepared by ultracentrifugation. In
some embodiments, the HC-HA complex is contained in an extract that
is prepared by ultracentrifugation using a CsCl/4-6M guanidine HC1
gradient. In some embodiments, the extract is prepared by at least
2 rounds of ultracentrifugation. In some embodiments, the extract
is prepared by more than 2 rounds of ultracentrifugation (i.e.
nHC-HA 2.sup.nd). In some embodiments, the extract is prepared by
at least 4 rounds of ultracentrifugation (i.e. nHC-HA 4.sup.th). In
some embodiments, the nHC-HA complex comprises TSG-6, PTX3 and/or a
small leucine-rich proteoglycan. In some embodiments, the nHC-HA
insoluble complex comprises TSG-6, PTX3 and/or a small leucine-rich
proteoglycan.
[0148] In some embodiments, ultracentrifugation is performed on an
extract prepared by PBS extraction. For example, in some
embodiments the tissue is homogenized in PBS to produce a
homogenized sample. The homogenized sample is then separated into a
soluble portion and insoluble portion by centrifugation. In some
embodiments, ultracentrifugation is performed on the soluble
portion of the PBS-extracted tissue. In such embodiments, the
nHC-HA purified by ultracentrifugation of the PBS-extracted tissue
called an nHC-HA soluble complex.
[0149] In some embodiments, ultracentrifugation is performed on an
extract prepared by further guanidine HC1 extraction of the
insoluble portion of the PBS-extracted tissue. For example, in some
embodiments the tissue is homogenized in PBS to produce a
homogenized sample. The homogenized sample is then separated into a
soluble portion and insoluble portion by centrifugation. The
insoluble portion is then further extracted in guanidine HC1 (e.g.
4 M GnHC1) and centrifuged to produce a guanidine HC1 soluble and
insoluble portions. In some embodiments, ultracentrifugation is
performed on the guanidine HC1 soluble portion. In such
embodiments, the nHC-HA purified by ultracentrifugation of the
guanidine HC1-extracted tissue is called an nHC-HA insoluble
complex.
[0150] In some embodiments, the method of purifying the isolated
HC-HA extract comprises: (a) dissolving the isolated extract (e.g.
prepared by the soluble or insoluble method described herein) in
CsCl/4-6M guanidine HC1 at the initial density of 1.35 g/ml, to
generate a CsCl mixture, (b) centrifuging the CsCl mixture at
125,000.times.g for 48 h at 15.degree. C., to generate a first
purified extract, (c) extracting the first purified extract and
dialyzing it against distilled water to remove CsCl and guanidine
HC1, to generate a dialysate. In some embodiments, the method of
purifying the isolated extract further comprises (d) mixing the
dialysate with 3 volumes of 95% (v/v) ethanol containing 1.3% (w/v)
potassium acetate at 0.degree. C. for 1 h, to generate a first
dialysate/ethanol mixture, (e) centrifuging the first
dialysate/ethanol mixture at 15,000.times.g, to generate a second
purified extract, and (f) extracting the second purified extract.
In some embodiments, the method of purifying the isolated extract
further comprises: (g) washing the second purified extract with
ethanol (e.g., 70% ethanol), to generate a second purified
extract/ethanol mixture; (h) centrifuging the second purified
extract/ethanol mixture, to generate a third purified extract; and
(i) extracting the third purified extract. In some embodiments, the
method of purifying the isolated extract further comprises: (j)
washing the third purified extract with ethanol (e.g., 70%
ethanol), to generate a third purified extract/ethanol mixture; (k)
centrifuging the third purified extract/ethanol mixture, to
generate a forth purified extract; and (l) extracting the forth
purified extract. In some embodiments, the purified extract
comprises an HC-HA complex.
[0151] In some embodiments, the HC-HA complex is obtained by a
process comprising: (a) providing a reaction mixture comprising:
(i) HA (e.g., HMW HA); (ii) I.alpha.I, wherein the I.alpha.I is
optionally in serum or isolated from serum; (iii) TSG-6, wherein
the TSG-6 is optionally recombinant; and (iv) PTX3, wherein the
PTX3 is optionally recombinant; wherein at least one of HA,
I.alpha.I, TSG-6, or PTX3 is optionally generated by a plurality of
cells present in the reaction mixture; (b) incubating the reaction
mixture for a period of time sufficient to produce HC-HA complex;
and (c) isolating and purifying the HC-HA complex. In some
embodiments, the HC-HA complex is formed by incubating the mixture
for at least 6 hours, at least 12 hours, at least 24 hours, at
least 36 hours, at least 48 hours, at least 60 hours, or at least
72 hours.
[0152] In some embodiments, the HC-HA complex is obtained by a
process comprising: (a) providing a reaction mixture comprising:
(i) HA (e.g., HMW HA); (ii) I.alpha.I, wherein the I.alpha.I is
optionally in serum or isolated from serum; (iii) TSG-6, wherein
the TSG-6 is optionally recombinant; (iv) PTX3, wherein the PTX3 is
optionally recombinant and (v) one or more small leucine-rich
proteoglycans; wherein at least one of HA, I.alpha.I, TSG-6, or
PTX3 is optionally generated by a plurality of cells present in the
reaction mixture; (b) incubating the reaction mixture for a period
of time sufficient to produce HC-HA complex; and (c) isolating and
purifying the HC-HA complex. In some embodiments, the HC-HA complex
is formed by incubating the mixture for at least 6 hours, at least
12 hours, at least 24 hours, at least 36 hours, at least 48 hours,
at least 60 hours, or at least 72 hours. In some embodiments, the
one or more small leucine-rich proteoglycans is selected from among
decorin, biglycan, fibromodulin, lumican, PRELP (proline arginine
rich end leucine-rich protein), keratocan, osteoadherin, epipycan,
and osteoglycin.
[0153] In some embodiments, the method further comprises
immobilizing HA (e.g., HMW HA) to a stationary support (e.g., by
cross-linking). In some embodiments, the stationary support
comprising HA (e.g., HMW HA) is contacted with I.alpha.I (e.g.,
I.alpha.I purified from serum, I.alpha.I in serum), TSG-6 (or,
recombinant TSG-6), and PTX3 (or, recombinant PTX3). In some
embodiments, the contacting occurs for at least 6 hours, at least
12 hours, at least 24 hours, at least 36 hours, at least 48 hours,
at least 60 hours, or at least 72 hours. In some embodiments, the
stationary support is washed to remove any unbound components.
[0154] Additional Methods of Expansion
[0155] In some embodiments, isolated stem cells are subjected to a
first expansion on a substrate. In some embodiments, the first
expansion occurs on a coated and/or two-dimensional substrate. In
some embodiments, the substrate is coated in composition that
mimics the basement membrane and/or comprises components of the
basement membrane, such as such as laminin, type IV collagen and
heparan sulfate proteoglycan. In some embodiments, the substrate is
coated in a gelatinous protein mixture secreted by
Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells. In some
embodiments, the substrate is coated in Matrigel. In some
embodiments, the two-dimensional substrate mimics the basement
membrane and/or comprises components of the basement membrane, such
as such as laminin, type IV collagen and heparan sulfate
proteoglycan. In some embodiments, the two-dimensional substrate is
a gelatinous protein mixture secreted by Engelbreth-Holm-Swarm
(EHS) mouse sarcoma cells. In some embodiments, the two-dimensional
substrate is Matrigel. In some embodiments, expansion on a coated
and/or two-dimensional substrate (e.g., a Matrigel coated and/or 2D
substrate) results in proliferation of isolated stem cells. In some
embodiments, expansion on a coated and/or two-dimensional substrate
(e.g., a Matrigel coated and/or 2D substrate) results in
proliferation of isolated stem cells and transient loss of
expression of embryonic stem cell (ESC) markers. In some
embodiments, the two-dimensional substrate comprises an HC-HA
complex.
[0156] In some embodiments, the first expansion of the isolated
stem cells is performed in the presence of a substrate that
prevents differentiation. In some embodiments, the first expansion
of the isolated stem cells is performed in the presence of a
substrate that preserves expression of one or more stem cell
markers. In some embodiments, the first expansion occurs in the
presence of a substrate that preserves expression of one or more of
embryonic stem cell (ESC) markers (e.g. Oct4, Nanog, Sox2 (SRY (sex
determining region Y)-box 2), Rex1 (Zfp42) and SSEA4
(stage-specific embryonic antigen-4), pericyte markers (e.g. NG2
(neuron-glial antigen 2/Chondroitin sulfate proteoglycan 4(CSPG4)),
PDGFR-.beta. (Platelet-derived growth factor receptor B), and
.alpha.-SMA (.alpha.-smooth muscle actin)), and angiogenic markers
(e.g. CD133/2, FLK-1 (VEGF-R2, Ly-73), vWF (von Willebrand factor),
CD34, CD31 (PECAM-1) and CD146). In some embodiments, the
expression of the stem cell marker is determined by conventional
methods, such as for example, protein expression analysis (e.g.
Western blotting, immunofluorescence, immunohistochemistry,
fluorescence activated cell sorting) or mRNA analysis (e.g.
polymerase chain reaction (PCR) or Northern).
[0157] In some embodiments, the expanded stem cell is an embryonic
stem cell. In some embodiments, the expanded stem cell is an adult
stem cell. In some embodiments, the expanded stem cell is a fetal
stem cell. In some embodiments, the expanded stem cell is an
induced pluripotent cell (iPS).
[0158] In some embodiments, the expanded stem cell is a mesenchymal
stem cell. In some embodiments, the expanded stem cell is an
adipose stem cell (ASC). In some embodiments, the expanded stem
cell is an umbilical cord stem cell. In some embodiments, the
expanded stem cell is an amniotic membrane stem cell. In some
embodiments, the expanded stem cell is a limbal cell, such as a
limbal niche cell or a limbal epithelial progenitor cell. In some
embodiments, the expanded stem cell is an endothelial stem cell. In
some embodiments, the expanded stem cell is a hematopoietic stem
cell. In some embodiments, the isolated stem cell is a bone marrow
stem cell. In some embodiments, the expanded stem cell is a neural
stem cell. In some embodiments, the expanded stem cell is an
endothelial progenitor cell. In some embodiments, the expanded stem
cell is a skeletal muscle stem cell. In some embodiments, the
expanded stem cell is a mammary stem cell. In some embodiments, the
expanded stem cell is an intestinal stem cell.
[0159] In some embodiments, the expanded stem cell is an induced
pluripotent stem cell (iPS). In some embodiments, the expanded stem
cell is an induced pluripotent stem cell derived from an adult
differentiated or partially differentiated cell. In some
embodiments, the expanded stem cell is an induced pluripotent stem
cell derived from a fibroblast. In some embodiments, the expanded
stem cell is an induced pluripotent stem cell derived from a
Conjunctivochalasis (CCh) fibroblast.
[0160] In some embodiments, the expanded stem cell is derived from
a fetal tissue, such as placental tissue or an umbilical cord
tissue. In some embodiments, the expanded stem cell is derived from
amniotic membrane. In some embodiments, the expanded stem cell is
derived from adipose tissue. In some embodiments, the expanded stem
cell is derived from limbal tissue. In some embodiments, the
expanded stem cell is derived from bone marrow. In some
embodiments, the expanded stem cell is derived from endothelial
tissue. In some embodiments, the expanded stem cell is derived from
limbal tissue. In some embodiments, the expanded stem cell is
derived from neural tissue, In some embodiments, the expanded stem
cell is derived from limbal tissue. In some embodiments, the
expanded stem cell is derived from skeletal muscle. In some
embodiments, the expanded stem cell is derived from the skin. In
some embodiments, the expanded stem cell is derived from the
digestive system. In some embodiments, the expanded stem cell is
derived from the pancreas. In some embodiments, the expanded stem
cell is derived from the liver. In some embodiments, the expanded
stem cell is derived from the olfactory mucosa. In some
embodiments, the expanded stem cell is derived from a germ cell
population. In some embodiments, the expanded stem cell is derived
from blood. In some embodiments, the expanded stem cell is derived
from umbilical cord blood.
[0161] In some embodiments, expanded stem cells are subjected to a
second expansion following the first expansion. In some
embodiments, the second expansion occurs on a three-dimensional
substrate. In the exemplary methods, a first expansion on Matrigel
coated substrate and/or 2D Matrigel, followed by a second expansion
in 3D Matrigel enables optimal expansion of isolated stem cells. In
some embodiments, the three-dimensional substrate mimics the
basement membrane and/or comprises components of the basement
membrane, such as such as laminin, type IV collagen and heparan
sulfate proteoglycan. In some embodiments, the three-dimensional
substrate is a gelatinous protein mixture secreted by
Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells. In some
embodiments, the three-dimensional substrate is Matrigel. In some
embodiments, expansion on a three-dimensional substrate (e.g., a
Matrigel 3D substrate) results in the isolated stem cells from the
first expansion regaining expression of ESC markers. In some
embodiments, expansion of isolated stem cells on a
three-dimensional substrate (e.g., a Matrigel 3D substrate) in the
presence epithelial cells of results in the formation of
epithelial/stem cells spheres/aggregates.
[0162] In some embodiments, the expansion of the isolated stem
cells is performed in a suitable medium. In some embodiments, the
medium is embryonic stem cell medium, modified embryonic stem cell
medium (ESCM supplemented with bFGF and LIF), supplemented hormonal
epithelial medium, and/or a combination thereof. In some
embodiments, the medium is supplemented with one or more growth
factors. In some embodiments, the medium is supplemented with EGF,
bFGF and/or LIF. In some embodiments, the medium is supplemented
with an inhibitor of Rho-associated kinase (i.e. a ROCK inhibitor).
In some embodiments, kinase activity is inhibited by the
intramolecular binding between the C-terminal cluster of RBD domain
and the PH domain to the N-terminal kinase domain of ROCK. Thus,
the kinase activity is off when ROCK is intramolecularly
folded.
[0163] In some embodiments, the methods comprise (a) expanding at
least one of the plurality of isolated stem cells in a first
culture comprising a suitable two-dimensional substrate without
passing the Hayflick limit to form a plurality of expanding stem
cells; and (b) isolating and expanding at least one expanding stem
cell from the plurality of expanding stem cell in a second culture
comprising a suitable three-dimensional substrate.
[0164] In some embodiments, the methods comprise (a) expanding at
least one of the plurality of isolated stem cells in a first
culture comprising a suitable two-dimensional substrate without
passing the Hayflick limit to form a plurality of expanding stem
cells, wherein the substrate comprises an HC-HA complex; and (b)
isolating and expanding at least one expanding multipotent cell
from the plurality of expanding stem cell in a second culture
comprising a suitable three-dimensional substrate.
Methods of Inducing and Maintaining Pluripotency
[0165] Disclosed herein, in certain embodiments, are methods of
inducing pluripotency in a cell or maintaining pluripotency of a
stem cell on a substrate that comprises an HC-HA complex. As
described herein, HC-HA complexes assist in the maintenance of stem
cell marker expression and prevent differentiation of the cells
over successive passages of a stem cell population. In addition, as
described herein, HC-HA complexes promote the induction of stem
cell properties in a differentiated or partially differentiated
population of cells.
[0166] In certain embodiments, an HC-HA complex promotes or induces
pluripotency of a differentiated or partially differentiated cell.
In certain embodiments, an HC-HA complex promotes or induces
pluripotency of a differentiated or partially differentiated cell
compared to a differentiated or partially differentiated cell
cultured in the absence of an HC-HA complex. In an exemplary
method, a differentiated cell or partially differentiated cell is
cultured on a substrate comprising HC-HA, whereby pluripotency is
induced in the cell.
[0167] In certain embodiments, an HC-HA complex further promotes or
induces pluripotency of a stem cell. In certain embodiments, an
HC-HA complex further promotes or induces pluripotency of a stem
cell compared to a stem cultured in the absence of an HC-HA
complex. In an exemplary method, a stem cell is cultured on a
substrate comprising HC-HA, whereby pluripotency is maintained in
the stem cell. In an exemplary method, a stem cell is cultured on a
substrate comprising HC-HA, whereby pluripotency is further induced
in the stem cell.
[0168] Using genetic reprogramming with protein transcription
factors, pluripotent stem cells equivalent to embryonic stem cells
have been derived from human adult skin tissue. iPS cells are
typically derived by transfection of certain stem cell-associated
genes into non-pluripotent cells, such as adult fibroblasts.
Transfection is typically achieved through viral vectors, such as
retroviruses. Four key pluripotency genes essential for the
production of pluripotent stem cells are Oct-3/4 (Pou5f1), Sox2,
c-Myc, and Klf4. Other genes can enhance the efficiency of
induction. In some studies, Oct4, Sox2, Nanog, and Lin28 have been
employed to induce pluripotency. In certain instances, after 3-4
weeks, small numbers of transfected cells begin to become
morphologically and biochemically similar to pluripotent stem
cells, and are typically isolated through morphological selection,
doubling time, or through a reporter gene and antibiotic
selection.
[0169] In some embodiments, methods are provided for inducing
pluripotency in a differentiated or partially differentiated cell
using heterologous expression of fewer than four of the essential
transcription factors Oct-3/4 (Pou5f1), Sox2, c-Myc, and Klf4. In
some embodiments, a method for inducing pluripotency is provided
where use of an HC-HA enhances the induction of pluripotency of a
differentiated or partially differentiated cell that expresses at
least one of Oct-3/4 (Pou5f1), Sox2, c-Myc, and/or Klf4 by
heterologous gene transfer. In some embodiments, a method for
inducing pluripotency is provided where use of an HC-HA enhances
the induction of pluripotency of a differentiated or partially
differentiated cell that expresses one, two or three factors
selected from among Oct-3/4 (Pou5f1), Sox2, c-Myc, and/or Klf4 by
heterologous gene transfer.
[0170] In some embodiments, a differentiated or partially
differentiated cell is transduced to express one or more of Oct-3/4
(Pou5f1), SOX2, c-Myc, and Klf4; and the transduced cell is
cultured on a substrate comprising an HC-HA complex. In some
embodiments, a differentiated or partially differentiated cell is
transduced to express at least one of Oct-3/4 (Pou5f1), SOX2,
c-Myc, and Klf4; and the transduced cell is cultured on a substrate
comprising an HC-HA complex. In some embodiments, a differentiated
or partially differentiated cell is transduced to express one, two
or three of Oct-3/4 (Pou5f1), SOX2, c-Myc, and Klf4; and the
transduced cell is cultured on a substrate comprising an HC-HA
complex. In some embodiments, a differentiated or partially
differentiated cell is transduced to express Oct-3/4 (Pou5f1),
SOX2, c-Myc, and Klf4; and the transduced cell is cultured on a
substrate comprising an HC-HA complex.
[0171] In some embodiments, a differentiated or partially
differentiated cell is transduced with a viral vector containing
one or more genes encoding one or more of Oct-3/4 (Pou5f1), SOX2,
c-Myc, and Klf4. In some embodiments, a differentiated or partially
differentiated cell is transduced with two or more viral vectors
containing one or more genes encoding one or more of Oct-3/4
(Pou5f1), SOX2, c-Myc, and Klf4.
[0172] In some embodiments, the HC-HA complex reduces to time of
induction of pluripotency in the transduced cell compared to a
transduced cell cultured in the absence of HC-HA. In some
embodiments, the HC-HA complex increases the percentage of
transduced cells that are induced to pluripotency in a population
of transduced cells compared to transduced cells cultured in the
absence of HC-HA compared to a transduced cell cultured in the
absence of HC-HA. In some embodiments, the HC-HA complex enhances
the level of pluripotency in the transduced cell. In some
embodiments, the HC-HA complex decreases the number of heterologous
transcription factors required for induction of pluripotency in the
transduced cell.
Uses of Multipotent Stem Cells
[0173] Therapeutic Uses
[0174] For any or all of the following uses, the isolated or
expanded stem cells obtained by any of the methods provided herein
are administered by any suitable means. For example, they are
administered by infusion (e.g., into an organ or bone marrow) or
they are administered by a wound covering or bandage. Exemplary
methods for the transplantation of stem cells are known in the art,
including combination therapies to limit the rejection of the
administered stem cells. In some embodiments, such methods are
employed in combination with the therapeutic uses provided
herein.
[0175] In some embodiments, the isolated or expanded stem cells are
administered in combination with a pharmaceutically acceptable
excipient. In some embodiments, the isolated or expanded stem cells
are administered in combination with a carrier. In some
embodiments, the isolated or expanded stem cells are administered
in combination with an HC-HA complex as a carrier. In some
embodiment the HC-HA complex is a native HC-HA complex or is a
reconstituted HC-HA complex. Exemplary HC-HA complexes are
described elsewhere herein. In some embodiments, such HC-HA
complexes are administered in combination with an isolated of
expanded stem cell provided herein.
[0176] In some embodiments, the isolated or expanded stem cells
obtained by any of the methods described herein are used for
transplantation into an individual in need thereof. In some
embodiments, the isolated or expanded stem cells obtained by any of
the methods described herein are used for transplantation into an
individual in need of a stem cell therapy. In some embodiments, the
isolated or expanded stem cells obtained by any of the methods
described herein are used for transplantation into an individual in
need of a stem cell therapy to regenerated a damaged tissue.
[0177] In some embodiments, the cells are isolated from one
individual and transplanted into another individual. In some
embodiments, such transplantation is used to regenerate a damaged
tissue.
[0178] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into the bone marrow of an
individual whose bone marrow does not produce an adequate supply of
stem cells. In some embodiments, the isolated or expanded stem
cells disclosed herein are transplanted into an individual whose
bone marrow does not produce an adequate supply of white blood
cells. In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual whose bone
marrow does not produce an adequate supply of red blood cells. In
some embodiments, the isolated or expanded stem cells disclosed
herein are transplanted into an individual whose bone marrow does
not produce an adequate supply of platelets. In some embodiments,
the isolated or expanded stem cells disclosed herein are
transplanted into an individual that suffers from anemia. In some
embodiments, the isolated or expanded stem cells disclosed herein
are transplanted into the bone marrow of an individual following
chemotherapy and/or radiation therapy.
[0179] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual suffering from
neurological damage. In some embodiments, the isolated or expanded
stem cells disclosed herein are transplanted into an individual to
regenerate neurons.
[0180] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual suffering from
a neurodegenerative disease. In some embodiments, the isolated or
expanded stem cells disclosed herein are transplanted into an
individual to treat Parkinson's disease. In some embodiments, the
isolated or expanded stem cells disclosed herein are transplanted
into an individual to treat Alzheimer's disease.
[0181] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat a
stroke.
[0182] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat
traumatic brain injury.
[0183] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into the spinal cord of an
individual suffering from a spinal cord injury. In some
embodiments, the isolated or expanded stem cells disclosed herein
are transplanted into the spinal cord of an individual to treat
paralysis (e.g., due to a spinal cord injury). In some embodiments,
the isolated or expanded stem cells disclosed herein are
transplanted into an individual to treat amyotrophic lateral
sclerosis (ALS). In some embodiments, the isolated or expanded stem
cells disclosed herein are transplanted into an individual to treat
multiple sclerosis.
[0184] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat heart
damage. In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to
treat/regenerate damaged heart muscle. In some embodiments, the
isolated or expanded stem cells disclosed herein are transplanted
into an individual to treat/regenerate damaged blood vessels (i.e.,
to promote angiogenesis).
[0185] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat
deafness. In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to regenerate
hair cells of the auditory system.
[0186] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat
blindness.
[0187] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat a
skin wound. In some embodiments, the isolated or expanded stem
cells disclosed herein are transplanted into an individual to treat
a chronic skin wound. In some embodiments, the isolated or expanded
stem cells disclosed herein are administered to the individual via
a wound covering or bandage.
[0188] In some embodiments, the isolated or expanded stem cells
disclosed herein are used to treat an autoimmune disease. In some
embodiments, the isolated or expanded stem cells disclosed herein
are administered to an individual with an autoimmune disease. In
some embodiments, the autoimmune disease is selected from diabetes
mellitus, psoriasis, Crohn's disease, or any combination
thereof.
[0189] In some embodiments, the isolated or expanded stem cells
disclosed herein are used to treat or prevent transplant rejection,
for example they are administered to an individual receiving a bone
marrow transplant, a kidney transplant, a liver transplant, a lung
transplant. In some embodiments, the isolated or expanded stem
cells disclosed herein are administered to the individual with
psoriasis via a wound covering or bandage. In some embodiments, the
isolated or expanded stem cells disclosed herein are used to treat
or prevent Graft-versus-Host disease.
[0190] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat
idiopathic pulmonary fibrosis.
[0191] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat a
cancer.
[0192] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat
aplastic anemia.
[0193] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to
reconstitute the immune system of an HIV positive individual.
[0194] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat liver
cirrhosis.
[0195] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to treat an
inflammatory disorder.
[0196] In some embodiments, the isolated or expanded stem cells
disclosed herein are transplanted into an individual to generate or
regenerate epithelial tissue. In some embodiments, the isolated or
expanded stem cells disclosed herein are transplanted into an
individual to generate or regenerate skin, bone, teeth or hair. In
some embodiments, the isolated or expanded stem cells disclosed
herein are transplanted into an individual to treat baldness. In
some embodiments, the isolated or expanded stem cells disclosed
herein are transplanted into an individual to regenerate missing
teeth.
[0197] Niche for Stem Cell Culture
[0198] In some embodiments, the isolated or expanded stem cells
disclosed herein are used as niche cells to support the growth of
epithelial progenitor cells. In some embodiments, the isolated or
expanded stem cells disclosed herein are used as niche cells in
vivo to support the growth of epithelial progenitor cells, for
example to treat a disease, disorder and/or condition characterized
by epithelial progenitor cell failure. In some embodiments, the
isolated or expanded stem cells disclosed herein are used as niche
cells to support the growth of epithelial progenitor cells in vitro
(i.e., in cell culture). In some embodiments, the isolated or
expanded stem cells disclosed herein are used as niche cells to
support the growth of epithelial progenitor cells into tissue
grafts.
[0199] Bioreactor for Generation of HC-HA Complex Containing TSG-6,
PTX3, and/or Small Leucine-Rich Lroteins (SLRPS)
[0200] In some embodiments, the isolated or expanded stem cells
disclosed herein are used as a bioreactor source for the isolation
of HC-HA complexes. As described herein, the amniotic membrane
epithelial cells (hAMEC) and amniotic membrane stromal cells
(hAMSC) express both I.alpha.I and TSG-6 to produce HC-HA
complexes. In some embodiments, stem cells are isolated from the
amniotic membrane and employed for the production of HC-HA
complexes. In some embodiments, the amniotic membrane is derived
from the placental or the umbilical cord. In some embodiments, the
stem employed for the production of HC-HA complexes is an amniotic
membrane stem cell. In some embodiments, the stem employed for the
production of HC-HA complexes is an umbilical cord stem cell
derived from the umbilical cord stroma and/or Wharton's jelly.
[0201] Non-limiting examples of methods of isolation of HC-HA
complexes are disclosed herein and, for example, in U.S. Patent
Pub. Nos. US2012-0083445, US2012-0083445, and International PCT
Pub. No. WO 2012/170905, all of which are expressly incorporated
herein by reference. In some embodiments, the isolated HC-HA
complexes are employed for in vitro or in vivo methods. In some
embodiments, the isolated HC-HA complexes are employed for
treatment of a disease or disorder. Methods comprising
administration of an HC-HA complexes for therapy are disclosed, for
example, in U.S. Patent Pub. Nos. US2012-0083445, US2012-0083445,
and International PCT Pub. No. WO 2012/170905, all of which are
expressly incorporated herein by reference. In some embodiments, an
HC-HA complex isolated from an isolated or expanded stem cell
disclosed herein is used to inhibit at least one of the following:
scarring, inflammation, immune reaction leading to autoimmune or
immune rejection, adhesion, angiogenesis or is used to treat
conditions requiring cell or tissue regeneration.
[0202] In some embodiments, the isolated HC-HA complexes comprise
TSG-6. In some embodiments, the isolated HC-HA complexes comprise
PTX3. In some embodiments, the isolated HC-HA complex comprises a
small leucine rich proteoglycan (SLRP). In some embodiments, the
isolated HC-HA complex comprises TSG-6, PTX3, and a small leucine
rich proteoglycan (SLRP). In some embodiments, the small
leucine-rich proteoglycan is selected from among decorin, biglycan,
fibromodulin, lumican, PRELP (proline arginine rich end
leucine-rich protein), keratocan, osteoadherin, epipycan, and
osteoglycin. In some embodiments, the isolated HC-HA complex
comprises TSG-6, PTX3, and a small leucine rich proteoglycan
(SLRP).
EXAMPLES
Example 1
Expression of Markers of ESC and Angiogenesis Progenitors in AM In
Vivo
[0203] Isolation of multi-potent stem cells (SCs) with highest
purity and cell numbers from a given tissue is the first step
toward cell expansion in vitro. Before devising a method for
isolation and expansion of amniotic membrane (AM) cells, it was
important to identify key factors for maintaining SCs in order to
gauge the success of such expansion. The conventional method of
isolating and expanding functional mesenchymal stem cells (MSCs)
are defined by the International Society for Cellular Therapy
(ISCT) as meeting the following set of minimal criteria: (1)
adherent to plastic (PL) in a basal medium containing serum, while
non-adherent cells are normally discarded, (2) expression of
surface marker profile comprising CD105.sup.+, CD73.sup.+,
CD90.sup.+, CD45.sup.-, CD34.sup.-, CD14.sup.- or
CD11b.sup.-,CD79a.sup.- or CD19.sup.-, and HLA-DR.sup.-, and (3)
tri-lineage differentiation potential to osteoblast, adipocyte, or
chondrocyte developmental pathways. Isolation of MSCs from
different parts of organs and tissues has been demonstrated based
on the above criteria. Several other studies have demonstrated that
cells isolated from tissue such as limbus, placenta, and bone
marrow can be expanded on coated substrate in serum-free medium or
in reduced serum containing medium, yet such cells demonstrated
more differential potential for vascular endothelial cells,
neuronal cells or hepatocytes. Perivascular pericytes have been
regarded as a key source of MSC in different tissues and in in
vitro studies have demonstrated potential to differentiate into
vascular endothelial cells. Although AM is transparent and
avascular, cells isolated from human AM (hAM) have previously been
shown with differential potential into endothelial cells. In this
experiment, the expression of embryonic stem cell (ESC) and
angiogenic markers in the AM was examined.
[0204] AM consists of a single layer of epithelial cells (hAMEC),
and a compacted and a spongy stromal layer. 1.times.1 cm.sup.2
square pieces of intact human amnion/chorion tissue from at least
two different donors were embedded and sectioned to 6 .mu.m
thickness. Immunohistochemistry was performed using standard
protocols on the cross sectioned tissue using antibodies against
embryonic stem cell (ESC) markers (Oct4, Nanog, Sox2 (SRY (sex
determining region Y)-box 2), Rex1 (Zfp42) and SSEA4
(stage-specific embryonic antigen-4), pericyte markers (NG2
(neuron-glial antigen 2/Chondroitin sulfate proteoglycan 4(CSPG4)),
PDGFR-.beta. (Platelet-derived growth factor receptor B), and
.alpha.-SMA (.alpha.-smooth muscle actin)), and angiogenic markers
(CD133/2, FLK-1 (VEGF-R2, Ly-73), vWF (von Willebrand factor),
CD34, CD31 (PECAM-1) and CD146. Staining with pan-cytokeratin (PCK)
and vimentin (vim) was used to distinguish the hAMEC from the
stromal layer.
[0205] hAMECs uniformly express embryonic markers, Oct4, Sox2,
Rex1, and heterogeneously express Nanog (FIG. 1). hAMECs also
uniformly express pericyte markers, NG2 and PDGF-.beta. but
heterogeneously express .alpha.-SMA. Positive expression of
angiogenic markers FLK-1, vWF, CD34, and CD31 but negative
expression of CD133 and CD146 also was observed. The data suggest
that native hAMECs express ESC, angiogenic markers in vivo.
[0206] Presence of ESC and Angiogenic Expressing Cells in hAMEC by
Cytospin.
[0207] The purity of hAMEC from collagenase follow by dispase
method was confirmed by cytospin, double immunostaining and showed
that the percentage of PCK+ expression was 98.11.+-.0.53% and
Vim+/PCK- expressing cells was 1.89.+-.0.53% (FIG. 2). Cytospin
confirmed PCK positive cells coexpress uniformly with SSEA4,
occasionally express Oct4 and weakly express Nanog, very few PCK
positive cells coexpress with FLK-1+, very few cells expressing in
PDGFR-.beta., vWF and negative expression to CD31.
Example 2
[0208] Populations of hAMEC Expressing ESC and Angiogenesis Markers
Preferentially Isolated on 5% Matrigel
[0209] The extracellular matrix (ECM), once thought to function
only as a scaffold to maintain tissue and organ structure,
regulates many aspects of cell behavior, including cell
proliferation and growth, survival, change in cell shape,
migration, and differentiation. The ECM serves directly as a stem
cell niche or indirectly in conjunction with niche cells in
regulating ESC and other adult stem cells (SCs). In vitro, isolated
limbal SCs along with niche cells can be maintained on 3D Matrigel
(MG). In addition, studies have shown that bone marrow derived
mesenchymal stem cells co-cultured on ECM improves proliferation
and differentiation capacity compare to plastic alone. In this
experiment, whether MG selectively preserves not only mesenchymal
stem cells (MSC) but also other progenitor cells was examined.
[0210] Our previous data demonstrated that isolated limbal SCs
along with its niche cells can be maintained on 3D matrigel (Xie et
al. (2012) Invest Ophthalmol Vis Sci. 53:279-286). Other studies
also reported bone marrow derived mesenchymal stem cells
co-cultured on ECM improves proliferation and differentiation
capacity compared to plastic (see Lindner et al. (2010) Cytotherapy
12:992-1005; Matsubara et al. (2004) Oncogene 23:2694-2702). It
remains unclear whether MG selectively preserves not only MSC but
also other progenitor cells as a result. Isolation of hAMEC from
placenta in the past has followed the MSC standard protocol with
modification of addition of different growth factors such as EGF.
We speculated that the discarded fraction of non-adherent cells,
may contain progenitors that prefer to adhere to some matrix
components. Our preliminary data showed that a population subset of
progenitors from hAMEC can be maintained on coated MG in embryonic
stem cell culture medium (ESCM)on plastic tissue culture dishes
(PL) expressing high amounts of ESC markers, such as Oct4, Nanog,
Sox2, and Nestin and CD34+ expression when compared to the control
hAMEC cultured in supplemental hormonal epithelial medium on PL in
SHEM for 14 days (Xie et al. (2011) Stem Cells 29(11):1874-85)
(ESCM is made of knockout Dulbecco's modified Eagle medium (DMEM)
supplemented with 20% knockout serum, 5 .mu.g/ml insulin, 5
.mu.g/ml transferrin, 5 ng/ml selenium, 1 mM L-glutamine, 0.1 mM
.beta.-mercaptoethanol, 1% nonessential amino acid, 50 .mu.g/ml
gentamicin, and 1.25 .mu.g/ml amphotericin B; SHEM is made of
Dulbecco's Modified Eagle Medium/Ham' s F12 nutrient mixture (1:1,
v/v) (Invitrogen), 5% (v/v) fetal bovine serum (FBS) (Invitrogen),
0.5% (v/v) dimethyl sulfoxide (DMSO), 2 ng/ml EGF, 5 .mu.g/ml
insulin, 5 .mu.g/ml transferrin, 5 ng/ml sodium selenite, 0.5
.mu.g/ml hydrocortisone, 0.1 nM cholera toxin, 50 .mu.g/ml
gentamicin, 1.25 .mu.g/ml amphotericin B). Cells expressing CD34
had not previously been identified from MSC expanded from either AM
or non-AM tissues. qPCR expression of ESC markers under different
culture conditions in adherent and non-adherent cells was further
investigated.
[0211] Fresh AM sheets were gently peeled off from placenta using
forceps and washed three times with Hank's Balanced Salt Solution
(HBSS)xl to remove remaining blood. AM was then transferred to a
nylon paper with AM epithelial side up and cut into 5.times.5
cm.sup.2 sheets. The sheets were digested with 10 mg/ml dispase at
37.degree. C. for 30-60 min followed by manual removal of
epithelial cells (i.e. hAMEC) by a cement spatula under a
dissecting microscope. All epithelial cells were collected and
treated with hyaluronidase (HAase; Seikagaku Biobusiness
Corporation (Tokyo, Japan)) (200 .mu.g/ml) and collagenase (2
mg/ml) for 2 h at 37.degree. C. and separated into single cells by
treatment with TrypLE.TM. (Invitrogen) for 10 min.
[0212] Total hAMECs AM epithelium and stroma cells, respectively,
were counted and samples of the cell lysates were collected for
protein and RNA analysis. A sample of total hAMECs was subjected to
cytospin and immunostaining to determine the % of ES positive cells
(FIG. 2).
[0213] To test whether the non-adherent cells in SHEM contains
cells that express ESC markers and preferentially to adhere on 5%
Matrigel (MG), the isolated total hAMEC(a) were seeded at
1.times.10.sup.5/cm.sup.2 in SHEM without (b, B) or with 5% MG (e)
and ESCM+EGF(g, D) on coated 5% MG in triplicate of 6 well culture
dish for 72 h under a humidified atmosphere of 5% CO.sub.2 at
37.degree. C. (A) At 72 h, the non-adherent cells from each culture
condition were collected (c, f, h) in which non-adherent cells from
SHEM further culture in ESCM+EGF medium on 5% MG (d, C) for
additional 72 h. Cell lysates from both adherent and non-adherent
cells were harvested for RNA analysis (FIG. 3). Non-adherent cells
from (c, f, h) and adherent cells (b, e, g) were collected by
cytospin to confirm positive staining of Oct4 and Nanog positive
cells are enriched in non-adherent (c) and adherent (b, g) when
compare to total cells. Immunostaining of PCK and vimentin staining
showed the percentage of hAMECs fraction were 99.6% of PCK+ cells
(data not shown) When the percentage of cell attachment was
compared, it was found that the number of cells that attached to
plastic (PL) in ESCM+EGF was significantly higher than in SHEM.
Compare the relative RNA expression of HAEC cells on D0, the
adherent hAMEC on either PL in SHEM (FIG. 4A, A-PL-SHEM) exhibited
significantly low expression of ESC markers in contrast to the
adherent cells on 5% MG in ESCM+EGF (A-MG-ESCM) showed a
significantly higher expression of ESC (Oct4, Nanog, Sox2) and
pericyte markers (NG2, PDGF-B).(n=3, p<0.05). The non-adherence
cells in both SHEM(NA-SHEM) and ESMC+EGF(NA-ESCM) showed a
significantly higher expression of angiogenic markers indicating
that Matrigel and ESCM synergistically promote expression of these
markers.
[0214] When compared to total hAMEC, A-PL-SHEM preserved expression
of CD34, while non-adherent cells maintain expression of the other
markers tested (FIG. 4). In addition, compared to A-PL-SHEM,
non-adherent hAMEC cultured in SHEM that were subsequently cultured
on 5% MG in ESCM consistently showed marked upregulation of the all
markers tested except for CD34. These data indicate that
non-adherent cells cultured in SHEM on PL can better preserve
expression of these markers by subsequent culturing on 5% MG in
ESCM. In addition, compared to cells directly seeded on 5% MG in
ESCM, non-adherent cells from PL cultured in SHEM that were
subsequently seeded on 5% MG in ESCM expressed more of the above
markers except for CD34 and NG2, indicating that non-adherent cells
on PL in SHEM are a different subpopulation that retains the
expression of these markers. Immunostaining of protein expression
of Nanog expressed in nucleus and cytoplasm.
[0215] When cultured in SHEM on PL (FIG. 4B, A-PL-SHEM), Nanog was
expressed in cytosol in adherent cells while the non-adherent
cells(NA-SHEM) were expressed in nucleus. Interestingly, Nanog
expression was mostly found in nucleus of adherent cells in ESCM on
5% MG (FIG. 4B, A-MG-ESCM) suggesting Nanog expressing cells in
nucleus can be isolated from ESCM on 5% MG. When compared to Oct4
expression, A-PL-SHEM contain less Oct4+ cells than in A-MG-ESCM.
The expression of Oct4 was preferentially found in cells isolated
from non-adherent fraction than adherent fraction in PL-SHEM;
enriched of Oct4 expressing cells can be achieved by culture in
ESCM on 5% MG.
Example 3
Conventional Adherent Cells on Plastic Promotes Cells to an
Angiogenic Phenotype in Serum Containing Medium
[0216] Use of a reduced level of serum (FBS) and addition of growth
factors such as EGF in isolating SC and MSC from non-AM tissues
have been shown to extend passage number of the culture. This is
consistent with our previous success of expanding hAMEC to P8 in
serum-reduced media. In this experiment, the induction of
angiogenesis in hAMEC cultured in SHEM media was compared to that
in DMEM/10% FBS with EGF (Miki et al. 2005 Stem Cells
23:1549-1559).
[0217] Isolation of hAMEC was performed as described in the
previous Example. Total isolated hAMEC were seeded at density of
5.times.10.sup.5/cm.sup.2in 6 well plates in SHEM, DMEM/10% FBS,
ESCM+10 ng/ml EGF or ESCM+10 ng/ml EGF on 5% MG. On day 8 of each
passage, cell numbers were determined and cumulative numbers of
cell doublings (NCD) were calculated by comparing to the cell
number at P0. Cells were continually passaged every 8 days until
cell number showed no increment of cell doubling times. Medium were
changed every 3 days. Samples of cells were collected at day 0 and
at each passage for analysis of expression of ESC Markers (Oct4,
Nanog, Sox2, Nestin, ST3GAL2 and Rex1), angiogenic markers (Flk-1,
CD133, CD31 and CD34,PDGF-R, .alpha.-SMA, NG2, and CD146) and MSC
markers CD73, CD90, CD105 and CD44 as determined by qPCR. Cell
morphology was assayed by phase contrast microscopy at each passage
(FIG. 5).
[0218] At P0, both SHEM and DMEM/10% FBS cultures generated
uniformly monolayer of cobblestone epithelial cells (FIG. 5). The
cell size from culturing in DMEM/10% FBS was enlarged during
passages; however, the cells ceased proliferation at P2. In
contrast, monolayers of small cobblestone epithelial cells were
maintained in SHEM until P2. At P3, heterogeneous mesenchymal
clones emerged from large cobblestone epithelial cells and turned
into more homogenous mesenchymal morphology at P3-P6. These results
indicated that SHEM containing EGF and reduced serum promotes
prolonged cell passage. In contrast, DMEM/10% FBS may require
additional growth factors to promote cell proliferation.
[0219] Compared to day 0, the expression of all the ESC markers,
except the ST3GAL2 and Rex1, derived from cells cultured in either
DMEM/10% FBS or SHEM was significantly less at p1, indicating that
neither DMEM/10% FBS nor SHEM promote ESC marker expression at
early passage.
[0220] Compared to day 0, the expression of angiogenic markers,
FLK-1 CD31, a-SMA, PDGFR-B were promoted in the DMEM/10% FBS
cultured cells while expression of CD133, CD34 were lost at p1.
Thus, DMEM/10% FBS promote angiogenic differentiation; however, the
cells could not be passaged beyond p2. In comparison, the
expression of angiogenic markers, FLK-1, .alpha.-SMA and PDGFR-B
were promoted in SHEM cultured cells, while CD133, CD34, CD31, NG2
were lost at early passages. Thus, SHEM also promotes angiogenic
differentiation and also can be further passaged until p6.
[0221] All ESC markers were significantly upregulated on PL in
ESCM+EGF cultured cells compared to serum containing DMEM/10% FBS
and SHEM cultured cells. However, ESCM+EGF with 5% MG did not
promote ESC marker expression. Thus, ESCM better preserves ESC
marker expression on PL compared to serum containing medium,
DMEM/10% FBS and SHEM on PL, but not on MG.
[0222] When compared to control DMEM/10% FBS without MG on passage
2, all angiogenic markers including, FLK-1, a-SMA, NG2, PDGFR-B
were maintained while CD133, CD31, CD34 were significantly
diminished. Thus, expression of angiogenic markers better
maintained in serum free medium on PL and can be only further
passage until p2.
[0223] In summary, when hAMEC are cultured in both serum containing
media (DMEM/10% FBS or SHEM) on PL, expression of ES markers were
significantly decreased with increasing angiogenic markers. When
compared to DMEM/10% FBS on PL, ES markers and angiogenic markers
in serum free ESCM+EGF can be better maintained. Additional coated
MG in ESCM did not improve ES or angiogenic marker expression.
[0224] Compared to P0, all ESC markers tested were significantly
promoted during serial passages in SHEM on PL (FIG. 6). Compared to
P0, all angiogenic markers, except CD31, which ceased after P4,
also were significantly upregulated during serial passages in SHEM
on PL. Thus, all angiogenic markers are promoted in SHEM on PL
although all angiogenic marker expression was significantly lower
in adherent cells cultured in SHEM on PL compared to non-adherent
cells. The enrichment of mRNA levels in angiogenic markers was
greatly increased over successive passages (>20-fold except for
NG2, CD31 and CD146). Compared to P0, all MSC markers except CD73
were significantly promoted during serial passages in SHEM on PL,
indicating that cells cultured in SHEM on PL are promoted into MSC
phenotype.
[0225] Compared to P0 in SHEM on PL, all ESC markers were
significantly promoted during serial passages. ESC markers can be
maintained in SHEM at RNA levels, compared to P0 in SHEM on PL, all
angiogenic markers, except CD31, which ceased after P4, were
significantly upregulated during serial passages. All angiogenic
markers were promoted in SHEM on PL although all angiogenic marker
expression was significantly lower adherent cells in SHEM on PL.
The enrichment of mRNA levels in angiogenic markers was greatly
20-folded greater except NG2, CD31 and CD146 suggesting positive
protein staining by IF may be observed. Compared to P0 in SHEM on
PL, all MSC markers except CD73 were significantly promoted during
serial
[0226] In summary adherent non-ES, non-angiogenic expressing hAMECs
on PL at p0 can be promoted into angiogenic cells by culturing in
SHEM. Such cells also express MSC markers.
Example 4
[0227] Expression of Angiogenesis Markers in hAMSC
[0228] Mesenchymal stem cells (MSC), a subset of stromal cells
present at low frequency in most adult connective tissues, have
been extensively studied for their multiple differentiation
capabilities. Perivascular pericytes have been regarded as a key
source of MSC in different tissues. MSC have been expanded from AM
stroma, which is avascular, though it was undetermined whether
there are vascular progenitors in hAM stroma. The hAM stroma can be
subdivided into a compact layer subjacent to the basement membrane,
which contains mostly mesenchymal cells, and a spongy layer with
sparse mesenchymal cells. It also was undetermined whether hAMSC
derived from these two layers are different. We hypothesized that
cells isolated from the compact layer preferentially express
angiogenesis markers. In this experiment, the expression of
angiogenesis markers in hAMSC was determined.
[0229] 1.times.1 cm.sup.2 pieces of intact amnion/chorion tissue
was embedded and sectioned to 6 .mu.m thickness using standard
protocols. The tissues were fixed and analyzed by
immunohistochemistry using antibodies against basement membrane
components (laminin 5, CollIV, FN, keratin sulfate and lumican),
ESC markers (Nanog, Sox2, Rex1 and SSEA4) and angiogenic markers
(NG2, PDGFR-B, .alpha.-SMA, CD133/2, FLK-1, vWF, CD34, CD31 and
CD146). The expression of components of the HC-HA complex, which
comprises hyaluronan and the heavy chain of inter-.alpha.-inhibitor
along with TSG-6 and PTX3, also was examined.
[0230] AM consists of a single layer of hAMEC and compact and
spongy stromal layers. Two rows of mesenchymal cells were noted in
the interface between the compact and the spongy layers (FIG. 1A
labeled C and S). Double staining of pancytokeratins (PCK) and
vimentin (vim) confirmed their coexpression in hAMEC with strong
vim+ in stromal region. The basement membrane stained by an
antibody to laminin 5 separates hAMEC from the remaining stroma,
which expressed Vim. Within the AM stroma, the spongy layer
preferentially stained from Coll Type IV and fibronectin, while the
compact layer preferentially stained for keratin sulfate, express
strong lumican in the extracellular matrix and in hAMEC and
hAMSC.
[0231] hAMSC uniformly expressed ESC markers Sox2 and Rex lwhile
Oct4, Nanog, Nestin, were weakly expressed in compact layers. Cells
in the spongy layer did not express Nanog, SSEA4 or Oct4. For the
pericyte markers, NG2 was uniformly expressed, while PDGFR-.beta.
and .alpha.-SMA were preferentially expressed in the compact but
not spongy layer. For the EPC markers, FLK-1, vWF, and CD31 were
preferentially expressed in the compact layer. No staining for
CD133/2, CD34, CD 144 and CD 146 was observed. For the MSC markers,
CD73 and CD 105 were uniformly expressed in compact and spongy
layer, while CD90 was preferentially expressed in compact but not
spongy layers. For the myofibroblast markers, FSP-1(s100A4) showed
strong uniformly expression in stroma, while no SMMHC expression
was found in stromal cells.
[0232] For components related to HC-HA, the spongy layer was
enriched for HC1 and Bikunin. The cells between the two layers were
strongly positive to TSG-6, while the compact layers were enriched
for PTX3 .
[0233] These data suggest the presence of hAMSC expressing
angiogenesis markers between the compact and the spongy layers.
These cells preferentially expressed ESC markers, including Sox2
and Rex1, angiogenesis markers, such as NG2, PDGFR.beta.,
.alpha.-SMA, FLK-1, vWF, and CD31, and HC-HA components TSG-6 and
PTX3.
Example 5
Isolation of AM Stromal Cells Expressing Angiogenesis Markers
[0234] The previous study suggested the presence of angiogenesis
expressing cells between the compact and the spongy layers of the
stroma. To confirm the presence of two different subpopulations of
hAMSC, an isolation method was developed to separate the upper
region of AM stroma from lower region of spongy layer. The stromal
surface of the remaining scraped tissue was scraped for a second
time to obtain additional spongy layer. The second scraped sample
was digested with collagenase.
Enzymatic Digestion
[0235] Samples were prepared by enzymatic digestion. Ten pieces of
5.times.5 cm.sup.2 and three pieces of 1.times.1 cm.sup.2 from
fresh hAM were cut. One sample 1.times.1 cm.sup.2 was set aside for
IF analysis.
[0236] Enzymatic digestion by the D/C method was performed as
follows: The intact epithelial sheet was transferred to another
dish containing 10 mg/ml dispase at 37.degree. C. for 20 mins. All
epithelial cells were collected and treated and rendered into
single cells by TrypLE for 10 min. The remaining stroma was then
digested with collagenase A (2 mg/ml) and HAase (1:500, 200 ug/ml)
in a DMEM/2% FBS at 37.degree. C. for 10 h.
[0237] Enzymatic digestion by the C/D method was performed as
follows: The intact epithelial sheet was transferred to 2 mg/ml of
collagenase and 250 ug/ml of HAase for 8 h. After digestion a
floating sheet, which had loose spindle cells at the edge (see FIG.
7 white arrow, inset) was obtained and transferred to a new dish.
10 mg/ml of dispase were added to the dish for another 15-20 mins
incubation at 37.degree. C. Immunofluorescence analysis was
employed to examine the relative expression of angiogenesis markers
(FLK-1, vWF, PDGF-B, a-SMA, CD31and NG2) by the D/C versus C/D
method.
[0238] Results
[0239] Enzymatic digestion: Collagenase followed by dispase
enzymatic digestion (C/D) yielded a high percentage of angiogenic
progenitors. After collagenase digestion, some loose cells were
observed underneath the epithelial sheet. FIG. 7 shows a phase
image a flat mount preparation of an epithelial sheet labeled with
Hoechst nucleus 33342 staining (A). While treating with enzymatic
dispase digestion, loose cells were gradually released (indicated
in white arrow, A). Double staining of laminin 5 showed the loose
cells were vim+and that some of them express FLK-1. Cells were
further shown positive stained for angiogenic markers, NG2,
PDGFR-.beta., FLK-1, vWF and .alpha.-SMA from C/D (C). Marker
expression was confirmed by qPCR.
[0240] Double staining of PCK and Vim confirmed that less than 1%
of PCK+ cells present HAMSCs isolated from C/D and D/C methods. C/D
derived cells exhibited positive expression of angiogenic markers,
including FLK-1, PDGFR.beta., NG2, .alpha.-SMA, vWF, and CD31. Low
CD34 positive cells were detected in C/D derived cells. When
compared to D/C derived hAMSC, mRNA expression of ES (Oct4, Nanog,
Sox2), angiogenic(FLK1, PDGFR-13, NG2, .alpha.-SMA, CD146, CD31)
were significantly higher in C/D than D/C method. C/D derived cells
also showed strong expression of S100A4 (a marker of
myofibroblasts), but no expression of SMMHC (a marker of smooth
muscle cells). The C/D derived cells also included PTX3 and TSG-6
expressing cells. In summary, these data suggested the avascular AM
stroma contains cells with angiogenic potential. These cells can be
preferentially isolated from C/D method rather than D/C.
Example 6
[0241] Maintenance and Expansion of hAMSC Angiogenic Progenitors
Culture in SHEM on Either Coated Matrigel or Plastic
[0242] In previous experiments, we have successfully isolated and
expanded angiogenic progenitor cells on coated Matrigel (MG). These
progenitor cells, which are located adjacent to basement membrane,
serve as a niche in supporting limbal stem cells (SC). In this
experiment, the expansion properties of angiogenic cells derived
from the C/D method above on coated MG versus plastic (PL) was
examined.
[0243] Experimental Design:
[0244] Single cells derived from C/D isolated cells were cultured
in SHEM on coated 5% MG or plastic (PL). Initial seeding density
was 1.times.10.sup.4/cm.sup.2. Cells were passaged every 8 days.
The expanded cells were subpassaged until the cells diminished
proliferation. Samples for mRNA expression and cytospin analysis
were collected at each passage.
[0245] 1) Differentiation of C/D Derived Cells into Mature
Endothelial Cells by Dil-Ac-LDL Uptake Assay:
[0246] C/D derived cells previously cultured in SHEM or DMEM/10%
FBS cells were seeded at the density of 5.times.10.sup.4 cells per
cm.sup.2 in 24-well plastic plates for 3 days in the Endothelial
Cell Growth Medium 2 (EGM2) supplemented with 10 ng/ml vascular
endothelial growth factor-1 (VEGF-A). In parallel, HUVEC (human
umbilical vein endothelial cells) were used as the positive
control. When the cells reached 80-90% confluence, the cells were
incubated with 10.mu.g/ml Dil-Ac-LDL (Invitrogen, USA) for 4-10 h
at 37.degree. C. in the humidified 5% CO.sub.2 incubator or fixed
with 4% paraformaldehyde for immunofluorescence detection of CD31,
vWF, FLK-1 and Dil-Ac-LDL label uptake.
[0247] 2) Formation of Vascular Tube Like Structures and Ability to
Stabilize Vascular Network in CID Isolated Cells:
[0248] Plates were prepared by adding 50 .mu.l of 100% Matrigel
into 24 well plates for 30 min before experiment. HUVEC cells were
prelabeled with red fluorescent nanocrystals according
manufacturer's protocol (Qtracker.RTM. cell labeling kits,
Invitrogen). C/D cells were prelabeled with green fluorescent
nanocrystals or co-culture with HUVEC at ratio of 1:1 at density of
10.sup.5 cells per cm.sup.2 on Matrigel. The cells were cultured in
EGM2 supplement with vascular endothelial growth factor-1 (VEGF-A)
for 24 hours to elicit vascular tube-like network formation. The
stability of vascular network was monitored on 0 h, 2 h, 4 h, 6 h,
8 h, 12 h and Day 2.
[0249] Results:
[0250] Angiogenic Expressing Cells are Preferentially Expanded on
5% MG Rather PL in SHEM.
[0251] Single cells from C/D seeded on 5% MG or PL were passaged
until p6. Cells derived from coated 5% MG generated smaller cells
in size and greater accumulative cell doublings until p5. C/D
isolated cells generated total cell expansion to 2.4.times.10.sup.6
cells. Thus, better cell expansion can be achieved when cells
seeded on coated 5% MG rather than PL. When cultured on 5% MG at p6
in SHEM, immunostaining suggested the C/D expanded cells expressed
strong angiogenic markers FLK-1+, PDGFR-.beta., vWF, .alpha.-SMA
and some CD146. Thus, C/D isolated cells expanded on 5% MG in SHEM
promote angiogenic cell expansion.
[0252] When mRNA of C/D cells cultured on PL vs. 5% MG was
compared, cells cultured on PL generated high levels of angiogenic
gene expression, similar to 5% MG (FIG. 8). This data suggests that
angiogenic expression from C/D can be better expanded on 5% MG
rather than PL but does not affect its angiogenic expression.
[0253] When C/D cells was compared to MSC, MSC express high levels
of PDGFR-.beta., .alpha.-SMA, CD73, CD90 and CD105 but does not
express FLK-1. This data suggests that C/D cells may possess
angiogenic potential where MSC derived from BM does not possess
angiogenic potential.
[0254] Analysis of protein expression show positive expression of
TSG-6 in nucleus with some spotted PTX3 expressing cells, which is
consistent to our previous finding that TSG-6 is constitutively
expressed in hAMSC and hAMEC.
Example 7
[0255] Expansion of hAMSC on Coated Matrigel in SHEM Compared to
DMEM/FBS on PL
[0256] Isolation of multi-potent SCs with highest purity and cell
numbers from a given tissue is the first step toward cell expansion
in vitro. Therefore, the importance in improving cell proliferative
capacity without loss of stem cell characteristics is the ultimate
goal for cellular therapeutic in clinical application. A MSC
conventional expansion method has been developed to expand hAMSC on
PL in DMEM/10% FBS; however, poor replication capacity and short
proliferative longevity is a recurring problem. Our preliminary
data show hAMSC cannot be expanded in serum free medium and we have
found the optimal culture medium to expand hAMSC in SHEM. We thus
examined whether SHEM medium can be better preserve angiogenic
progenitors better than conventional methods of expanding MSC using
DMEM/10% FBS on PL.
[0257] In the previous Example, we demonstrated the success of
isolating enriched angiogenic progenitors from C/D method,
separated the upper region of hAM from lower stroma. Because colony
forming unit-fibroblasts (CFU-Fs) have previously been demonstrated
from MSCs derived from hAM stroma, we examined whether the
angiogenic cells enriched by C/D method contribute in generating
CFU-Fs or whether such cells may be different from the defined MSC.
One way to test this is to measure cells with ability to form
CFU-Fs, which where a single derived cell can generate stem like
cells
[0258] Experimental Design:
[0259] In this example, we investigated two isolation methods, one
is to isolate cells by mechanical scraping and the other will be
based on pure enzymatic digestion. In the first method, called
method D/C, hAM were treated with 60 mins of trypsin/EDTA follow by
additional 30 minutes treatment of 10 mg/ml dispase to release
epithelial cells by scraping. The remaining stroma sheet was
subjected to 2 mg/ml collagenase with HAse (250 ug/ml) overnight to
release total stromal cells (called hAMSC-A). The second method,
called method C/D, hAM was digested with collagenase and HAase 6-18
h to release spongy layers of stromal cells (called hAMSC-L)
released in the medium. The remaining epithelial sheets were picked
out and subjected to 10 mg/ml dispase for 20 mins to release the
compact layers stromal cells (called hAMSC-U) associated with the
basement membrane.
[0260] C/D cells were seeded at density 100 cells/cm.sup.2 in 1)
DMEM/10% FBS on plastic or 2) SHEM on 5% MG for 12 days. During the
expansion, CFU morphology derived from each layer was determined
and defined by its clonal size according to the guidelines
previously published (Chong et al. (2011) Cell Stem Cell
9:527-540). The colony forming efficiency (CFE) was determined by
whether the compact fraction generates greater CFU than spongy
layers. The resultant of CFU morphology will be stained with
crystal violet.
[0261] Results
[0262] Angiogenic Expressing Cells are Preferred Expanded in SHEM
Rather Than DMEM/10% FBS (D/F) Medium.
[0263] When C/D derived cells cultured on 5% MG in SHEM were
compared to conventional culture conditions, cells cultured in
DMEM/10% FBS on PL could not be further passaged past p3. At p3,
cells cultured in DMEM/10% FBS on PL were enlarged and ceased
proliferation. Neither DMEM/10% FBS nor SHEM maintained the ES
expressing cells.
[0264] Compared to expression in vivo, cells cultured in DMEM/10%
FBS showed significantly lower expression in all angiogenic
markers, except CD34, .alpha.-SMA, CD146 while cells cultured in
SHEM on 5% MG, exhibited significant upregulation of FLK-1,
PDGFR-.beta., .alpha.-SMA and CD146. Thus, cells expressing
angiogenic markers such as FLK-1 and PDGFR-.beta. can be further
expanded in SHEM but not DMEM/10% FBS.
[0265] Comparison of protein expression by antibody staining
confirmed that cells cultured in DMEM/10% FBS expressed
significantly less angiogenic markers at p2 compared to cell
cultured in SHEM, indicating that SHEM was superior to DMEM/10% FBS
for expansion of cells expressing angiogenic markers.
[0266] For the CFU-F experiment, it was observed that cells
cultured in DMEM/10% FBS on PL did not generate CFU-F. In contrast,
cells cultured on 5% MG in SHEM did generate CFU-F (FIG. 9).
[0267] Preferential Expansion of hAMSC-U on Coated Matrigel in
SHEM
[0268] When hAMSC-A were cultured in traditional MSC medium
DMEM/10% FBS on PL, the cells quickly enlarged in size,
differentiated and reached senescence at p3. In comparison, when
hAMSC-A were cultured in SHEM on PL, cells could be passaged up to
p8 before reaching senescence. Thus, SHEM medium is better than MSC
medium DMEM/10% FBS in expanding hAMSC-A on PL.
[0269] When cultured on 5% MG, cells derived from hAMSC-U reached
confluence by D6 while cells derived from hAMSC-L remained rounded,
indicating the hAMSC-U derived cells are preferentially expanded on
5% MG compared to hAMSC-L. For accumulative doubling time (number
of cell doubling (NCD)=log.sub.10(y/x)/log.sub.102, where "y" is
the final density of the cells and "x" is the initial seeding
density of the cells.). hAMSC-U cultured on PL or 5% MG generated
significantly higher accumulated cell doubling times (NCD) 10.43,
18.02 , respectively, compared to control hAMSC-A.
[0270] qPCR and immunofluorescence data revealed that hAMSC-U
expanded cells cultured on 5% MG in SHEM exhibited expression of ES
markers Sox2, Rex1 and SSEA4, but were negative for Oct4 and Nanog.
hAMSC-U strongly expressed some angiogenic markers, FLK-1, vWR,
PDGFR-.beta., .alpha.-SMA, weakly expressed CD146, but were
negative for CD31, CD34, CD144 and NG2. These data suggested that
angiogenic expressing cells derived from hAMSC-U can be further
expanded in vitro on 5% MG in SHEM. Protein expression also showed
positive expression of TSG-6 in nucleus with some spotted PTX3
expressing cells, which is consistent with our previous finding
that TSG-6 is constitutively expressed in hAMSC and hAMEC.
Example 8
Expression of Markers and Matrix Components of Human Umbilical
Cord
[0271] In this example, expression of ESC or angiogenesis markers
in umbilical cord (UC) tissue was examined by cross section.
Hematoxylin and eosin (H&E) staining showed the anatomy of UC
is defined consist of five distinct zones (1) amniotic membrane
epithelium (zone 1), (2) Sub-amnion cord lining (zone 2) (3)
Wharton's Jelly (WJ, zone 3) a surrounding matrix of mucous
connective tissue, (4) adventitia (perivascular zone, zone 4), and
(5) UC vessels (two arteries and one vein, zone 5))(FIG. 11). No
visible borders can be distinguished from Zone 2 to Zones 3 and 4.
However, cell density is the lowest in Zone 3 and the highest in
Zone 4. The amniotic membrane and subamnion region of UC (Zones 1
and 2) are the continuation of amniotic membrane and chorion,
respectively, from the fetal membrane. A key finding of the study
was the presence of small PCK+, E-cad+, p63+, SDF-1+ stromal cells
in Zone 2 (FIG. 12). Double immunostaining of PCK and Vimentin
(Vim) on a cross section of UC tissue showed Vim+ cells in zone 2
and zone 3 interestingly are heterogeneously coexpress with
PCK,E-cadherin and p63 alpha. A higher magnification further
suggested that PCK+/E-cad+ stromal cells are a subset of smaller
cells in Zone 2, and there are some PCK-/E-cad+ cells.
[0272] Double staining of SDF-1 and CXCR4 showed that SDF-1+ cells
were uniquely found in Zone 2 and Zone 5 (close to the blood
vessels) (FIG. 12). However, CXCR4 was expressed by epithelial
cells as well as Zone 2 cells. Hence, stromal cells in Zone 2 also
uniquely express both SDF-1 and CXCR4. This result also suggested
that double staining of SDF-1+/PCK+ can be used to distinguish
stroma cells from SDF-1-/PCK++ epithelial cells in UC.
[0273] Immunostaining further showed the expression of matrix
components, Coll IV is abundantly found in the stroma while laminin
5 is only noted in basement membrane between zone 1 and zone 2
(FIG. 10). Keratan sulfate proteoglycans are found in the entire
stroma. As reported, little expression of keratocan or lumican is
found. TSP-1 is also noted in zone 1 while osteopontin is
preferentially found in Zone 1 and 2
[0274] Cross sections of the umbilical cord showed abundant
expression of HA, TSG6, HC1 and bikunin from the epithelial layer
to vessels, except that PTX3 is expressed more abundantly in WJ and
the perivascular region of UC (i.e., not in Zone 2), suggesting
that other components than HC-HA/PTX3 might be present in Zone 2
(FIG. 11).
[0275] Immunostaining further showed expression of ESC markers
(Oct4, Sox2, Nanog, SSEA4, Rexl and Nestin) also noted in UC
stromal cells and other angiogenesis progenitor markers (CD34,
CD31, FLK-1, PDGFR-.beta., NG2, a-SMA) (FIGS. 13, 14). Regarding
the angiogenic progenitor markers, FLK-1 was not expressed in the
UC. CD31 was negative throughout the entire length of the UC except
some positive staining of inner wall vessel. CD34 was positive from
epithelial to perivascular zones but negative in UC vessels.
Pericyte markers, NG2, PDGFR-.beta., .alpha.-SMA were expressed
throughout the entire length of the US and strongest expression was
observed in vessels. vWF was expressed from epithelial to
perivascular zone and strong positive expression only in the inner
wall vessel. CD146 was negative in epithelial and subamnion zones
but gradually positive in WJ and strongest in vessels. The
myofibroblast differentiation markers S 100A4 and SMMHC express
strongest at zone 1 and 5.
[0276] A summary of the expression data is presented in Table 3 and
FIG. 15.
TABLE-US-00001 TABLE 3 Comparison of Expression ESC and Angiogenic
Markers Between AM vs. UC in vivo hAMSC hAMSC Zone Zone ECM hAMEC
(compact) (spongy) 1 Zone 2 Zone 3 Zone 4 5 Collagen -- .+-. + + +
+ ++ + Type IV Lumican + + + .+-. .+-. .+-. .+-. .+-. Keratan -- +
+ + + + + + Sulfate PTX3 ++ ++ + -- + + ++ -- TSG6 ++ + + + + + + +
HA + + + + + + + + HC1 + + + .+-. + + + -- HC2 + + + -- -- -- -- --
HC23 + + -- .+-. -- -- -- -- Bikunin + + + + + + + + PCK + -- -- ++
+ + + +/-- E-cadherin ++ + + + +/-- Vimentin + + + + + + + + ESC
Oct4 + + -- + + + + + Nanog -- + -- -- -- -- -- -- Sox2 + + + + + +
+ + Nestin + + + -- -- -- -- + SSEA4 + -- -- + + .+-. -- -- Rex1 +
+ + + + + + + Angiogenesis FLK1 + + -- -- -- -- -- -- CD31 nd + --
-- -- -- -- + CD34 + -- -- + + + .+-. -- PDGFR-b + + -- .+-. + + +
++ NG2 + + + + + + + ++ a-SMA -- + -- + + + + ++ CD146 -- -- + --
-- -- + ++ vWF + + -- + .+-. .+-. .+-. + S100A4 ++ + -- + + + + ++
SMMHC -- -- -- + + + + ++ SDF-1 ++ -- -- -- ++ .+-. .+-. ++ CXCR4 +
.+-. .+-. .+-. +
Example 9
[0277] Comparison of Collagenase/HAase Digestion versus Mechanical
Stripping for Isolation of Umbilical Cord Multipotent Cells
[0278] Current Methods of Isolation, Characterization and Expansion
of MSCs/SCs from Human Umbilical Cord (Subamniotic Region) and
Wharton's Jelly
[0279] Two conventional ways of isolating MSCs from UC are either
by cells generated from explants or by cells dissociated by
enzymatic digestion. Because the former does not allow one to
clearly identify the zone from which MSCs or SCs are derived from
UC, we summarize 11 studies that were reported between 2004 and
2011 using enzymatic isolation (FIGS. 16 and 17).
[0280] None of the previous studies have successfully isolated
SCs/MSCs from Zones 2 and 3 of the UC. Five studies (Lu et al.
(2006) Haematologica 91:1017-1026; Koliakos et al. (2011) Journal
of Biological Research-Thessaloniki 16:194-201, Seshareddy et al.
(2008) Methods Cell Biol 86:101-119, Schugar et al. (2009) J Biomed
Biotechnol. 2009: 789526, and Tsagias et al. (2011) Transfus Med.
21:253-261) did not clearly exclude contamination of amniotic
epithelial cells. Three studies (Lu et al. (2006) Haematologica
91:1017-1026, Schugar et al. (2009) J Biomed Biotechnol. 2009:
789526, and Tsagias et al. (2011) Transfus Med. 21:253-261) did not
exclude blood vessels. Because collagenase cleaves interstitial but
not basement membrane collagens, thus leaving aggregates of cells
closely associated with the basement membrane, one may lose cells
from basement membrane-rich Zones 2 and 3 if trypsin is not used to
cleave the basement membrane while filtration is used as shown in
studies by Schugar et al. ((2009) J Biomed Biotechnol. 2009:
789526) and Tong et al. (2011) Cell Biol Int. 35:221-226, MSC/SCs.
Except Tong (2011), all others may have obtained MSCs along with
epithelial cell contamination. Except Weiss et al. (2006) Stem
Cells and Montanucci et al. (2011), all used polystyrene surface to
culture the MSCs. Weiss 2005 and Montanucci (2011) used HA coated
surface and their passage number was high. It is unclear whether HA
coated surface is better for isolation and culture of MSCs while
preserving their characteristics. DMEM with low serum is used to
seed and culture MSCs by all except Sarugaser 2005, who used
alpha-MEM with a higher serum concentration. The percentage of
serum and glucose concentration is the crucial factor for culturing
MSCs. Weiss et al. (2006) and Lu et al. (2006), added growth
factors in the culture medium to promote a relatively higher
passage number. It is unclear that higher passage number is caused
by the use of a medium containing low serum (2-15%) and growth
factors. All studies characterized expression of cell markers by
flow-cytometry.
[0281] Enzymatic digestion is the first step of conventional
isolation of MSCs from hUC. Previous isolation methods used the
whole UC without removing vessels throughout isolation (Schugar et
al. (2009) J Biomed Biotechnol. 2009:789526, Koliakos et al. (2011)
Journal of Biological Research-Thessaloniki 16:194-201, Tsagias et
al. (2011) Transfus Med. 21:253-261, Lu et al. (2006) Haematologica
91:1017-1026) or removing the blood vessels and then performing the
enzyme digestion (Wang et al. (2004) Stem Cells 22:1330-1337, Weiss
et al. (2006) Stem Cells 24:781-792), suggesting that collagenase
digestion does not remove the entire vessels. In the previous
example, we identified a subset of stromal cells expressing a
dotted pattern of PCK+ at perinucleus that is different from the
cytoplasm expression of PCK in UC epithelial cells. It was unclear
whether such PCK expression pattern can be differentiate between
stromal cells and UC epithelial cells, and if so, whether stromal
PCK+ cells are coexpressed with E-cadherin as well as other ESC
markers.
[0282] Time-Dependent Collagenase/HAase Digestion Versus Mechanical
Stripping for Isolation of Cells from Zones 2 and 3 Without
Amniotic Epithelial Contamination
[0283] In this example, it was examined whether it is possible to
eliminate epithelial cells contamination by the following two
methods: 1) to remove the epithelium mechanically or 2) to follow a
modified method reported by Montanucci et al. (2011) Tissue Eng
Part A. 2011; 17:2651-2661 via injection of collagenase/HAase but
with the modification of adding time-dependent digestion 3)
directly digest tissue with 2 mg/ml collagenase and 1 mg/ml
hyaluronidase (Coll+HA)then pick out the epithelial cells under
microscope.
[0284] Immediately after procurement, the fresh UC was placed and
washed in PBS to remove red blood cells (RBCs). The length and
weight of the UC was recorded. The UC was cut into 3-5 cm segments
with a sterile blade. The first two (smaller) segments were
subjected to (M1) Mechanical Removal of Epithelium using the
following steps:
[0285] a) A shallow cut was made along the length of the segment by
a scalpel.
[0286] b) The overlying epithelium was peeled mechanically from its
edge. (Additional cuts of the epithelium can be made to achieve
this objective).
[0287] c) The removed epithelial tissue was cut into several lxlcm
pieces. One piece was embedded and sectioned for
immunohistochemistry. The remaining pieces were subjected to 10
mg/ml collagenase and HAase (250 ug/ml-1000 ug/ml) digestion to
generate a epithelial sheet and a digested fraction. Both samples
were prepared for cytospin and mRNAs analysis.
[0288] d) For the remaining UC, the blood vessels were removed by
teasing into WJ and using a forceps. If this could not be
accomplished, the second segment went straight to digestion and
blood vessels were removed later.
[0289] e) The stromal tissue was then digested with collagenase (2
mg/ml) and HAase (200 .mu.g/ml) in DMEM-LG with 2% FBS for up to 16
h at 37.degree. C. in 100 mm dish with periodical microscopic
monitoring to determine extent of dissolution of the stromal
matrix.
[0290] f) At three time points, the mixture was centrifuged in a
conical tube at a low speed (e.g., 500.times.g for 3 min) to remove
the undigested portion. The digested solution was neutralized by
adding DMEM-LG with 20% FBS and collected for cytospin and mRNA
analysis.
[0291] g) The undigested matrix remaining in the conical tube was
then continuously digested by adding the same enzymatic solution
for the next period of time, and centrifuged in the same tube to
collect the next fraction of cells for cytospin and mRNA
analysis.
[0292] The remaining three (large) segments were subjected to (M2)
Injection of enzymes into the UC matrix (Montanucci et al. (2011)
Tissue Eng Part A. 2011; 17:2651-2661) using the following
steps:
[0293] a) The two ends of the UC segment were ligated with 2-0 silk
suture at 0.5 cm away from edge.
[0294] b) 12 ml of collagenase (2 mg/ml) and HAase (200 .mu.g/ml)
in DMEM-LG with 2% FBS in a 26G syringe were injected into the
middle of UC into the Wharton's jelly zone from one end 0.5 cm from
the ligation point toward the other end.
[0295] c) The injected UC was placed for up to 16 h at 37.degree.
C. in a 50 ml conical tube by keeping the injected end up with
periodical digital palpation. Attention was given to the extent of
dissolution of the stromal matrix, which was determined by the
"softness" of the tissue.
[0296] d) At three time points, one for each segment, the ligated
tube was opened by a scalpel. After removing the blood vessels, the
digested matrix was obtained by rinsing with DMEM-LG with 2% FBS.
Cells were collected by centrifuging the rinse in a conical tube at
a low speed (e.g., 500.times.g for 3 min). Cells were collected for
cytospin and mRNA analysis.
[0297] Cells from both methods were subjected to Immunostaining
with PCK and SDF-1 to determine epithelial contamination.
[0298] For M1 method, epithelium was able to be removed by
mechanical peeling of the epithelium from each UC segment, taking
roughly 5-10 min for each segment. Vessels were not removed at the
time of isolation in this particular example. At 3.5 h, the tissue
was visible. Therefore, the stromal tissue underwent enzymatic
digestion for 16 h at 37.degree. C. as describe above.
[0299] For the M2 method, UC segments were successfully sutured at
both ends. After 2 h digestion, the enzymatic liquid started to
leak out from the tissue. At 16 h, 37 C, the entire tissue
disintegrated.
[0300] Because neither method tested removed the blood vessels,
cord blood contamination was observed at the time of the isolation.
Although the blood vessels can be observed after digestion, blood
vessels along with other slimy matrix components are removed,
suggesting that some perivascular or WJ components might also be
removed. The mixtures from both methods were subjected to 40 um
filtration to remove large pieces of epithelial cells.
[0301] Double staining of PCK/SDF-1 verified that large
PCK.sup.bright "epithelial" cells were mostly in the range from
15-30 .mu.m and did not express SDF-1 (FIG. 18). Cell counting
analysis further showed the percentage of large
PCK.sup.bright/SDF-1-cells is significantly lower in M1 (1.+-.0.6%,
n=1719) than M2 (5.9.+-.2.3%, n=1007) suggesting removal of
epithelium prior digestion can significant reduce the contamination
of epithelial cells.
[0302] Consistent with the previous example, we observed
co-localization of PCK.sup.bright/SDF-1.sup.bright+ in perinucleus
(FIG. 18, white arrows) and PCK+/SDF-1+ in cytoplasm (FIG. 18B). We
also observed a small percentage of very small cells that does not
express both PCK and SDF-1(FIG. 18C, white arrows). These data
suggested that stroma cells heterogeneously express PCK and SDF-1;
the coexpression of PCK/SDF-1 is expressed in a similar pattern.
SDF-1+/PCK+cells may also co-express with SSEA4 while Oct4 is
expressed throughout the entire tissue, suggesting that
SDF1+/PCK+/SSEA4+/Oct4+ cells can be separated from
SDF-1-/PCK-/SSEA4-/Oct4 expressing cells.
Example 10
[0303] Isolation and Characterization of E-cadherin+ Stromal Cells
from UC by Dyna Beads
[0304] Previous studies have shown that 3D aggregation formed by
MSC derived from UC depends on the expression of E-cadherin (E-cad)
(Lee et al. (2012) Mol Ther. 20:1424-1433). Expression of E-cad may
signify pluripotency and self-renewal in induced pluripotent stem
(iPS) cells (review in Soncin (2011) Genes 2(1):229-259). In
Examples 8 and 9, we observed a subset of small UC stromal cells
uniquely expressing E-cad in Zone 2. In this example, we aim to
isolate E-cad+ stromal cells and to compare their expression of
p63, SDF-1, CXCR4, ESC (Oct4, SSEA4) and angiogenic (PDGFR, CD34,
NG2) and .alpha.-SMA to those by E-cad- cells.
[0305] Isolation of stromal cells from umbilical cord was performed
as described above. In brief, UC was cut into 5 cm segments with a
sterile blade. A shallow cut was made along the length of the
segment by a scalpel. Umbilical cord tissue was digested with
collagenase (2 mg/ml) and HAase (200 mg/ml) in SHEM for up to 16 h
at 37.degree. C. in 100 mm dish with periodical microscopic
monitoring. Blood vessels and epithelium layer were removed by
forceps under a dissecting microscope. All stromal cells were
trypsinized into single cells by 0.25% T/E for 10 mins. E-cadherin
antibodies were biotinylated with DSB-X. Cells were incubated with
E-cadherin/DSB-X antibodies for 20 mins at 4.degree. C. Dynabeads
were then added to antibodies bound to E-cadherin positive for
positive selection of E-cadherin expressing cells by a magnet.
E-cadherin+ cells and E-cadherin- cells (non selected) were
collected for further RNA, protein, cytospin analysis.
[0306] qPCR results showed E-cadherin positive fraction can be
significantly enriched from total UC stromal cells through magnetic
isolation. E-cadherin (+) fractions are significantly enriched with
ESC markers (Oct4, Sox2, Nestin) and CXCR4 expressing cells than
E-cad(-).(n=3) (FIG. 19). In contrast, aside from NG2, E-cad(+)
cells contain a significantly less angiogenic markers, CD31, CD34,
FLK-1 and SDF-1 than E-cad(-) fraction.
Example 11
Effect of C/D Derived Cells on Human Limbal Epithelial Progenitor
Cell (LEPC) Differentiation on 3D Matrigel
[0307] Limbal native niche cells can be isolated and expanded to
support limbal epithelial progenitor cells (LEPC) from
differentiation on 3D matrigel (Xie et al. (2011) Stem Cells
9(11):1874-85; Xie et al. (2012) Invest Ophthalmol Vis Sci.
53(1):279-86). Our current data show bone marrow (BM)-derived MSC
other than its native niche has similar function (Li et al. (2012)
Invest Ophthalmol Vis Sci. 53(9):5686-97) to prevent LEPC from
differentiation. In this experiment, whether cells isolated from
C/D of hAMSC has similar function in preventing LEPC from
differentiation will be examined.
[0308] Single cells derived from dispase-isolated limbal epithelial
sheets (LEPC) are mixed at a ratio of 4:1 with candidate niche
cells (NCs) according to Table 2. The cells are serially passaged
at the total density of 5.times.10.sup.4 per cm.sup.2 in 3D
Matrigel to generate sphere growth. On D10 in modified embryonic SC
medium (MESCM), the resultant spheres are collected by 10 mg/ml
dispase digestion at 37.degree. C. for 2 h to dissolve Matrigel.
Samples of cells will be collected for further analysis by mRNA,
cytospin and protein analysis.
TABLE-US-00002 TABLE 2 Exp Candidate SCs Growth Group NCs/Medium
source surface Medium Cell density 1 -- LEPC 3D MG MESCM 5 .times.
10.sup.4/cm.sup.2 2 C/D LEPC 3D MG MESCM 5 .times.
10.sup.4/cm.sup.2 hAMSC/SHEM 3 native LEPC 3D MG MESCM 5 .times.
10.sup.4/cm.sup.2 NCs/MESCM 4 MSC/DF LEPC 3D MG MESCM 5 .times.
10.sup.4/cm.sup.2 5 C/D LEPC 3D MG MESCM 5 .times.
10.sup.4/cm.sup.2 hAMSC/SHEM 6 hAMSC/DF LEPC 3D MG MESCM 5 .times.
10.sup.4/cm.sup.2 DF: DMEN/10% FBS
Example 12
[0309] Isolation of Adipose Stem Cells (AS Cs) from Human Orbital
Fat
[0310] The conventional method of isolating ASCs involves the
following steps: (1) Wash adipose tissue 3 times with cold PBS, (2)
Cut it into fine pieces, and (3) Subject fine pieces to 1 mg/ml of
collagenase I in DMEM/10% FBS for 2 h at 37.degree. C., (4)
Centrifuge the digest at 300.times.g for 10 min to collect the
pellet that contains the majority of stromal vascular fraction
(SVF) cells, and discard the floating cells that contain mature
adipose cells, (5) Resuspend pellet cells in DMEM/10% FBS, (6)
Filter the cell suspension via a filter 40-250 .mu.m and collect
cell flow through, (7) Lysis of RBC by adding the RBC lysis buffer,
(8) Centrifuge at 300.times.g for 10 min to collect cells for
further cell expansion. In this example, a modified method of
isolation is presented. The modified method uses modified embryonic
SC medium (MESCM) during collagenase digestion and resuspension of
cells because it preserves expression of ESC markers. MESCM has the
following components: DMEM/F-12 (1:1) supplemented with 10%
knockout serum, 5 .mu.g/mL insulin, 5 .mu.g/mL transferrin, 5 ng/mL
sodium selenite, 4 ng/mL bFGF, 10 ng/mL hLIF, 50 .mu.g/mL
gentamicin, and 1.25 .mu.g/mL amphotericin B.
[0311] This example compared the modified method to the
conventional method to demonstrate improved properties in
preserving the progenitor status during isolation. In addition,
cells flowing through the 40-250 .mu.m filter from Step (6) were
also compared to those that did not in order to analyze the
properties of cells associated with the basement membrane that is
not digested by collagenase.
[0312] Experimental Design:
[0313] Orbital adipose tissues obtained from patients after
blepharoplasty were digested with 1 mg/ml collagenase A in DMEM/10%
FBS or a serum-free modified ESC medium (MESCM) for 16 h at
37.degree. C. After centrifugation at 300.times.g for 5 min to
remove floating cells (FC), the remaining cell pellet was
resuspended and filtered through a 250 .mu.m mesh to yield cells
retained on the filter (RC) and flowing through (SVF). Single cells
from FC, RC and SVF were cultured on 5% coated matrigel or
immobilized nHC-HA PTX3 purified from amniotic membrane in MESCM
for 8 days (FIG. 20). Expression of ESC markers (Oct4, Nanog, Rexl,
Sox2, Nestin, ALP, and SSEA4) and angiogenic markers (CD34, CD31,
VWF, .alpha.-SMA, PDGFRI3, CD146, and NG-2) was determined by qPCR
or immunostaining.
TABLE-US-00003 TABLE 3 Digestion Collagenase Exp Group Medium Cell
Fraction 1 DMEM/10% FBS FC (floating cells) 2 DMEM/10% FBS SVF
(flow through) 3 DMEM/10% FBS RC (Remaining Cells) 4 MESCM FC
(floating cells) 5 MESCM SVF (flow through and not) 6 MESCM RC
(Remaining Cells)
[0314] Whether the FC fraction is enriched with cells expressing
markers of both ESC and angiogenic progenitors in younger patients
compared to older patients also was analyzed. Adipose tissue
derived from 3 patients with age of 63, 58, and 49, designated as
patient #1, patient #2 and patient #3, were processed according to
the above protocol with MESCM used for digestion. Three fractions,
i.e., FC, SVF and RC, were collected for qRT-PCR analysis of the
following transcripts: ESC (Oct4, Nanog) and other markers such as
CD34, CD31, vWF, .alpha.-SMA, PDGFR.beta., CD146, NG-2 and
CD29.
[0315] For the experiment, one large brown adipose tissue was cut
in half. One half (1.times.1 cm.sup.2) was fixed by 10% formalin
for 15 min and embedded for immunostaining for basement membrane
(Collagen IV and laminin 5). The other half (1.times.1 cm.sup.2)
was digested with 3 ml 1 mg/ml collagenase A to obtain FC, SVF, and
RC fractions, which was then dissociated by T/E to generate single
cell for cytospin preparation and immunostaining of Collagen IV,
Oct4, CD34, and CD31. Fractions that were analyzed are summarized
in the table below.
TABLE-US-00004 TABLE 4 Exp Digestion Collagenase Group Patient Age
Medium Cell Fraction 1 Patient #1 (63) MESCM FC (floating cells) 2
Patient #1 (63) MESCM SVF (flow through) 3 Patient #1 (63) MESCM RC
(Remaining Cells) 4 Patient #2 (58) MESCM FC (floating cells) 5
Patient #2 (58) MESCM SVF (flow through) 6 Patient #2 (58) MESCM RC
(Remaining Cells) 7 Patient #3 (49) MESCM FC (floating cells) 8
Patient #3 (49) MESCM SVF (flow through) 9 Patient #3 (49) MESCM RC
(Remaining Cells)
[0316] Results:
[0317] Regarding expression of ESC markers in patients of different
ages, qPCR showed that ESC markers, Oct4, Nanog, and Sox2, were
significantly higher in RC in Patient #1, but not statistically
significant in Patient #3. In contrast, Patient #2 showed
significantly higher expression of Oct4, Nanog, and Sox2 in FC
(FIG. 21). Expression of Nestin transcripts was consistently
significantly higher in RC than SVF and FC in all 3 patients. The
trend of expression of Rex1 and SSEA4 transcripts was also higher
in RC except in #2, in which there was no statistical significance
between three fractions. Expression of ALP transcript was highest
in FC. This data suggested that ESC markers can be enriched in RC
or in FC fractions rather than in the SVF fraction, which is the
conventional fraction for isolating ASC. The overall expression of
Oct4, Sox2 and Nanog transcripts in all fractions digested in
DMEM/10% FBS was higher than MESCM, but that of Nestin and Rex1
transcript in MESCM was higher than DMEM/10% FBS.
[0318] When compared to the FC fraction, expression of CXCR4 was
significantly enriched in RC and SVF fractions. In contrast, cells
in FC fractions had a significantly higher SDF-1 expression.
[0319] Regarding expression of angiogenesis markers, qPCR showed
that RC had a significantly higher expression of CD31, CD34, FLK-1,
CD146, .alpha.-SMA, and PDGFR.beta. than SVF and FC in all 3
patients (FIG. 22). Expression of .alpha.-SMA and FLK-1 was higher
in MESCM than in DMEM/10% FBS, while the expression of CD31, CD34,
CD146, PDGFR.beta. and NG2 was higher in MESCM than in DMEM/10%
FBS. These result suggested that cells expressing angiogenic
markers in RC may not be the same as cells expressing ESC
markers.
[0320] Expression of CD34 was the highest in SVF in both media
suggesting SVF cells may indeed come from the outer adventitial
stromal ring, and in agreement with the published reports they
express CD34. The retaining non-flow through (RC) fraction
contained high expression of CD31 expressing cells, which usually
indicate EPC. Expression of NG2 was the highest in FC in both media
and in all patients, suggesting that some pericytes might be around
FC. In conclusion, expression of most angiogenesis markers was also
significantly higher in RC than SVF in both media and all patients.
Collectively, these results supported our hypothesis that RC is a
better source than the conventional SVF to provide progenitor cells
expressing both ESC and angiogenesis progenitors. The above results
also suggested the conventional method can be improved by using RC
rather than SVF as the source of generating ASCs.
[0321] Phase contrast images of the cytospin preparation showed
large cells greater than 60 .mu.m and small cells 10 .mu.m in
diameter in the FC fraction, of which the latter showed positive
staining to Oct4 and Sox2 (FIG. 23). Cells in SVF were overall
larger than those in RC fraction. SVF cells contains mixture of
positive Oct4 expression in cytoplasm and nucleus while RC cells
contain Oct4+ expression in cytoplasm. RC than that of SVF, of
which sox2 was expressed in the nucleus. SVF contained cells that
expressed highest CD34+/CD31-, while cells in RC coexpressed
CD34+/CD31+. FC showed no expression of CD31 and CD34.
[0322] In summary, RC contained cells that express the most ESC and
angiogenesis progenitor markers than the fraction SVF and the FC
fractions when seeded in either DMEM/10% FBS or MESCM. The overall
expression of these markers was better preserved in MESCM than
DMEM/10% FBS group
Example 13
[0323] Method of Expanding ASCs from Orbital Fat Tissues Using RC
as the Source on Coated Matrigel in MESCM
[0324] In the previous example, it was found that the RC fraction
retained progenitor cells better than SVF. Because the RC fraction
retains the basement membrane that is resistant to collagenase
digestion, we further digested the RC fraction by dispase, which
cleaves the basement membrane. These cells from this digestion can
be further characterized by cytospin and double immunostaining
against various markers to determine the homogeneity of cells
within such fraction. The ability of ASC to adhere to tissue
culture plastic has been commonly used as an enrichment method.
This adhesive property of ASC is mediated largely by CD29 (integrin
.beta.1), which is a surface marker commonly used to identify
ASC.
[0325] Experimental Design:
[0326] Digestion of adipose tissue with collagenase was performed
in DMEM/10% FBS or MESCM and fractionated as described in the
previous example. Both SVF and RC fractions were then digested by
10 mg/ml dispase followed by Trypsin EDTA for 10 min for cytospin
and double immunostaining. Single cells derived from both SVF and
RC fractions were also seeded at 2.times.10.sup.4/cm.sup.2 on
plastic in DMEM/10% FBS or on coated Matrigel in MESCM, and
serially passaged while their morphology monitored by phase
contrast microscopy. Resultant cells were collected for qPCR
analysis of marker expression as performed in the previous example.
Cell doubling time and numbers of passage were also determined and
compared with the control SVF in DMEM/10% FBS. Samples that were
analyzed are summarized in the table below.
TABLE-US-00005 TABLE 5 Digestion Exp Collagenase Group Medium Cell
Fraction Substrate 1 ctrl DMEM/10% FBS SVF (flow through) PL 2
DMEM/10% FBS RC (Remaining Cells) PL or MG 3 MESCM SVF (flow
through and not) PL or MG 4 MESCM RC (Remaining Cells) PL or MG
[0327] Results:
[0328] In the present experiment, due to a small amount of tissue
and hence a smaller yield of cells, we were not able to determine
the seeding density. By D3, SVF cells on PL in DMEM/10% FBS showed
predominant spindle cells, and the same morphology was noted in SVF
cells seeded on 5% MG in DMEM/10% FBS (FIG. 24). In contrast, SVF
cells on 5% MG in MESCM exhibited two types of morphology. RC cells
on 5% MG in MESCM showed many small round cells with few spindle
cells, though the overall difference in number of cells may be
caused by intrinsic difference in cell density used. No cells were
observed from RC on 5% MG in DMEM/10% FBS. By D5, all cells turned
into spindle cells except that much smaller spindle cells were
noted in RC cells. By day 8, more numbers of cells were noted for
each condition except that clonal growth was noted in RC cells.
[0329] qPCR consistently showed that RC seeded on 5% MG in MESCM
expressed significantly higher Oct4, Nanog, Sox2, Rex1 and Nestin
(i.e., ESC markers), than SVF cultured conventionally on PL in
DMEM/10% FBS or on 5% MG in DMEM/10% FBS (FIG. 25). SVF cells
cultured on 5% MG in MESCM expressed higher levels such markers,
but not to the same extent as RC, especially REX1. 5% MG is not as
critical as MESCM in promoting ESC expression for SVF.
[0330] qPCR also showed that RC cells seeded on 5% MG in MESCM
expressed significantly higher angiogenesis markers such as FLK-1,
CD31, PDGFR-B and NG2 but not CD34 and a-SMA than SVF cells
cultured on either PL or 5% MG in DMEM/10% FBS. Thus, RC cells
cultured on 5% MG in MESCM turn into progenitors expressing a
pericyte phenotype, a finding similar to what we have observed in
human limbal NCs.
[0331] On 5% MG and in MESCM, SVF still exhibited significant less
expression of FLK-1, CD31, PDGFR-B and NG than RC cells, indicating
that RC cells contain more progenitors than SVF and such cells are
best maintained on coated Matrigel in MESCM.
[0332] In summary, RC derived cells contain younger progenitors
than SVF and such progenitors can be better expanded on 5% MG in
MESCM with smaller cells and more clonal growth and expressing more
ESC and angiogenesis markers.
Example 14
[0333] Method of Expanding ASCs from Orbital Fat Tissues by
Culturing on Immobilized nHC-HA in MESCM
[0334] The ability of ASC to adhere to tissue culture plastic has
been commonly used as an enrichment method. We have previously
demonstrated limbal NCs form aggregates when seeded on immobilized
nHC-HA and express ESC and CD31 in MESCM. In this example, a method
of expanding ASCs by culturing on immobilized HC-HA in MESCM was
examined.
[0335] Experimental Design:
[0336] Cells were isolated from adipose tissue of human.
[0337] Adipose tissue derived from human patients (patient ID
#090761 (age 52) and #120254 (age 58)) was digested with
collagenase and fractionated into FC, RC, SVF using the protocol
described in Example 12, except that the size of filter was changed
from 150 .mu.m to 70 .mu.m. Cells in each fraction were then
subjected to trypsin/EDTA for 10 min to yield single cells. The
cells were then seeded at 4.times.10.sup.4/96 wells on different
substrates: plastic or plastic with immobilized HA, 4.times.
nHC-HA/PTX3 water soluble (S; isolated in PBS), and 4.times.
nHC-HA/PTX3 water insoluble (IS; isolated in guanidine) in MESCM
(see procedure below). SVF cells were seeded on plastic in DMEM/10%
FBS as a control. Cell aggregates were observed at 2 h, 18 h, 2
days, 4 days and 7 day post-seeding. Total RNAs were extracted on
day 8 and used for qRT-PCR analysis of the following transcript
expression: ESC markers (Oct4, Nanog, Sox2 and Nestin) and other
markers such as CD34, CD31, PDGFR-.beta., vWF and .alpha.-SMA.
Immunostaining was used to confirm the gene expression.
[0338] Immobilization of HA and nHC-HA/PTX3: The covalent coupling
of substrates on the surface of Covalink-NH 96 well (Nunc) was
similar as described as in He et al. (2009) J. Biol. Chem., 284
(30):20136-20146. In brief, Covalink-NH plates were sterilized in
70% alcohol for 1 h, washed 3 times with distilled water, and added
with 100 .mu.l of 0.184 mg/ml Sulfo-NHS and 0.123 mg/ml of EDAC in
distilled water containing 20 .mu.g/ml HA or nHC-HA/PTX3 per
96-well plate Control wells contained all reagents except for HA
and nHC-HA/PTX3. The plate was incubated at 4.degree. C. overnight
or at 25.degree. C. for 2 h before the coupling solution was
removed, washed 3 times with PBS containing 2 M NaCl and 50 mM
MgSO4, and followed by 3 washes with PBS.
TABLE-US-00006 TABLE 6 Experimental 96 Well Plate, P0 1 2 3 4 5 6 7
8 9 10 11 12 Medium A PBS HA nHC-HA/PTX3 nHC-HA/PTX3 (S) Water
Soluble (IS) Insoluble B FC RC SVF FC RC SVF FC RC SVF FC RC SVF C
X X X X X X X X X X X X MESCM D X X X X X X X X X X X X E X F X
DMEM/ G 10% FBS H Total FC: 2.4 .times. 10.sup.5, RC: 2.4 .times.
10.sup.5, SVF: 3 .times. 10.sup.5 cells
[0339] Results:
[0340] Phase Image Observations:
[0341] At 2 h, all cells from FC, RC, SVF were seeded evenly
distributed on plastic (PL), immobilized HA, nHC-HA/PTX3 S,
nHC-HA/PTX3 IS (FIG. 26). At 18h, cell aggregations were observed
both patients from FC on PL, immobilized HA, nHC-HA/PTX3 S,
nHC-HA/PTX3 IS. At D3 and D7, except in control in DMEM/10% FBS
group, all fractions in all immobilized substrates form
aggregations. Quantitative counting on cell aggregations showed
that both FC and SVF generates high numbers of aggregations while
RC generates lowest aggregation count on all immobilized
substrates. Aggregates sizes are formed largest in FC and SVF (in
patient #120254 only) while smaller sizes were observed in RC. At
D7 and D9, cells began to migrate out from aggregates in SVF on
immobilized HA and PL as compared to FC and RC fraction. All other
fractions on immobilized nHC-HA PTX3 S and nHC-HA PTX3 IS remain
aggregated. This result is similar to rabbit inguinal fat data (see
Example 15) which showed cell migrations are observed more in PL
and HA.
[0342] qPCR Comparison:
[0343] In both patients, compared to the control SVF in DMEM/10%
FBS on plastic, expression of ESC markers, Oct4, Sox2, Nanog,
Nestin, were significantly higher in all RC fractions, especially
on immobilized nHC-HA PTX3 S and nHC-HA (FIG. 27). In contrast,
expression of Rexl is significantly promoted in SVF on plastic and
HA but gradually down regulated in nHC-HA PTX3 S and nHC-HA PTX3
IS. This finding is consistent with DO finding (Example 12), in
which RC fraction contains cells expressing the highest amount of
ESC markers. Furthermore, it also suggests that immobilized nHC-HA
PTX3 S and nHC-HA PTX3 can further promote their ES expression.
[0344] For both patients, SVF in DMEM/10% FBS promote more
angiogenic marker expression than respective fraction in MESCM
(FIG. 28). In the patient #120254 sample in MESCM, control SVF
fraction preferential expressed CD34, PDGFRI3 and .alpha.-SMA on
all substrates. RC preferential expressed FLK-1 and CD31 on all
substrate where FC cells exhibited the lowest angiogenic
expression. In patient #090761 in MESCM, control SVF contain are
preferential express highest angiogenic markers than RC and FC on
plastic and HA. When seeded on immobilized nHC-HA PTX3 S and IS,
both RC and SVF were significantly down regulated. Overall,
immobilized HA contain mixture appeared to promote angiogenic
action but downregulated CD34 expression. nHC-HA PTX3 S down
regulated angiogenic expression in RC and FC while nHC-HA PTX3 IS
downregulated angiogenic expression in RC and SVF.
[0345] Two patients displayed different SDF-1 and CXCR4 expression
in the cell fractions (FIG. 29). In the age 52 patient sample, RC
has the highest SDF-1 and CXCR4 expression, and both markers were
significantly increased on nHC-HA PTX3 S and IS. In the age 58
patient sample, the SVF fraction on plastic in DMEM/10% FBS had
highest SDF-1 expression when compared to SVF in MESCM. In MESCM,
SDF-1 expression was highest in SVF than RC and SVF. CXCR4
expression was highest in SVF on plastic and HA, and was
significantly promoted in RC when seeded on immobilized nHC-HAPTX3
S and IS. Overall, nHC-HA PTX3S and IS can promote SDF-1 and CXCR4
expression in RC but not SVF or FC.
[0346] When compared to the control SVF on plastic in DMEM/10% FBS,
SVF exhibited significantly higher expression of TGF.beta.1,
TGF.beta.2 and TGF.beta.3 than RC and FC on plastic (FIG. 30). No
significant differences in substrates was observed.
[0347] When compared to the control SVF fraction cultured on
plastic in DMEM/10% FBS, cells cultured on plastic in MESCM
significantly promoted expression BMP2, 4, 6 and 7 in all fractions
(FIG. 31). This suggested that MESCM can promote expression of
BMP2, 4, 6 and 7 even when cells were seeded on different
substrates.
[0348] Compared to each fraction cultured on plastic, cells
cultured on immobilized HA downregulated all BMPs from FC, but
upregulated all BMPs from RC and SVF. Similarly, cells from SVF but
not FC and RC, showed similar upregulation of all BMPs when
cultured on immobilized nHC-HA PTX3 S and nHC-HA PTX3 IS, except
BMP7, which was promoted in RC. It has been previously report that
BMP7 increases the production of "good" brown fat cells, while
keeping their levels of the normal white fat cells constant. In
addition, BMP-7 triggers commitment of mesenchymal progenitor cells
to brown adipocyte lineage in vitro and in vivo.
[0349] Immunostaining of human adipose cells on nHC-HA PTX3 or
control PL/SVF in DMEM from Patient #120254 demonstrated that most
cells derived from express Oct4, Nanog. Oct4 was strongly expressed
in RC than in FC and SVF. In RC, the Oct4 expression was the
strongest on nHC-HA PTX3 compared to PL. In FC, the Oct4 expression
was the strongest on PL/FC compared to nHC-HA PTX3. This is
consistent with the PCR data which showed that Oct4 is expressed
more in RC than SVF and FC. No significant differences of Nanog
expression were observed between substrates. Immunostaining of
expression angiogenesis markers and CD31, demonstrated expression
in the center of clusters where CD34 are weakly expressed in vitro
(FIG. 32).
Example 15
[0350] Modified Method of Isolating Progenitor Cells from Rabbit
Inguinal Fat Pads
[0351] In this example, methods of isolating and expanding ASCs
from adipose tissues from Rabbit inguinal fats pads was
examined.
[0352] Experimental Design:
[0353] Inguinal white fat pads (identified as WAT) derived from
rabbits were minced into 2 mm.sup.2 pieces to achieve a homogenous
sampling in a 150 cm.sup.2 large petri dish. They were then
subdivided into two parts, and digested in 1 mg/ml of collagenase A
in either DMEM/10% FBS and or MESCM for 18 h at 37.degree. C.
Actual weights of the samples used were as follows:
[0354] Female Rabbit 1: 39.7 g fat pad, 8.3 g aliquot used for each
tube, 2 tubes for either DMEM or MESCM containing 10 ml solution,
each 0.83 g/ml.
[0355] Female Rabbit 2: 29.4 g fat pad, 6.2 g aliquot used and
split, 2 tubes DMEM, 2 tubes MESCM containing 10 ml solution, 0.62
g/ml.
[0356] Female Rabbit 3: 25.0 g fat pad, 6.9 g aliquot used and
split, 2 tubes DMEM, 2 tubes MESCM containing 10 ml solution, 0.69
g/ml.
[0357] Male Rabbit 4: 1.times.1 cm of fat pieces weighted at 5.4 g
and digested in 22 ml s MESCM+Coll (.about.0.4 g/ml)
[0358] Male Rabbit 5: lxlcm of fat pieces weighted at 6.3 g and
digested in 23 mL of MESCM+Coll (.about.0.3 g/ml)
[0359] After digestion, the cell suspensions were gently pipetted
and centrifuged at 300.times.g for 10 min to collect floating fat
cells (FC) and cell pellet. The cell pellets were resuspended in
either DMEM/10% FBS (the first part) or MESCM (the second part),
respectively. The suspension was then filtered via a 250 .mu.m mesh
to collect cells flowing through (designated as SVF) and those not
(designated as RC). RBC lysis buffer was then added to the SVF
fraction and centrifuged at 300.times.g for 10 min to collect
cells. For the FC fraction, the cell suspension was subdivided into
two, one was labeled as FC1. The other half was subjected to 10
mg/ml of dispase digestion in MESCM for 2 h at 37.degree. C. The
cell suspensions were then centrifuged at 300.times.g and the
collected cell pellet (designated as FC2). For the above cell
fractions, i.e., SVF, FC1, FC2 and RC, total RNAs were extracted
and used for qRT-PCR analysis of the following transcript
expression: ESC markers (Oct4, Nanog, Sox2 and Nestin) and other
marker such as CD34, CD31, vWF and a-SMA. FIG. 33 shows phase
contract microscopy of the fractions.
TABLE-US-00007 TABLE 7 Digestion Collagenase Exp Group Medium Cell
Fraction 1 DMEM/10% FBS SVF (flow through) 2 DMEM/10% FBS RC 3
DMEM/10% FBS FC (floating cells) 4 MESCM SVF (flow through and not)
5 MESCM RC 6 MESCM FC (FC1 or FC2)
[0360] Results:
[0361] Unlike human adipose tissues (Example 14), we noted that
little tissue was obtained from the RC fraction after filtration in
rabbit #1, #2. Also unlike human adipose tissues, qPCR showed that
the FC fraction has significantly higher expression of Oct4, Nanog,
Sox2, and Nestin than SVF and RC fractions (FIG. 34). The overall
expression of Oct4, Nanog, and Sox2 in FC was significantly higher
in DMEM/10% FBS than that in MESCM, but no difference was noted in
expression of Nestin transcript. Regarding the expression of
angiogenic markers, similar to human adipose tissues, qPCR showed
that the transcripts of FLK-1, CD34, and .alpha.-SMA were
preferentially retained in RC fraction. The same result was found
in Rabbit #1 and Rabbit #3. Overall, in WAT with very few blood
vessels, most ESC markers can be obtained from FC fraction while
the RC fraction retains cells expressing angiogenesis markers. This
result is different from human adipose tissues. We did not note any
significant difference of gene expression in these two different
media during isolation.
[0362] In addition, adipose tissue from Rabbit #4 were derived from
vascular fat zone without mincing, the result showed similar to
human adipose tissue, some vessels like tissue were observed after
filtration. Similarly, qPCR showed the transcript of Oct4, Nanog,
Sox2 and Nestin were significantly higher in both RC and FC. FLK-1
was significantly higher in RC but not in FC1 and FC2 fraction.
CD34 was preferentially expressed in SVF fraction and in FC2 but
not in FC1 and RC fraction. .alpha.-SMA is significantly enriched
in FC1 and FC2 but not RC. Overall, in WAT containing blood
vessels, ESC expressing cells can be found in both RC and FC1. Such
cells cannot be further isolated by dispase, FC2. CD34 cells can be
consistently isolated from SVF where other angiogenic markers such
FLK-1 or .alpha.-SMA are enriched more in RC or FC fraction
suggesting the some ESC expressing progenitor can be isolated from
other fractions rather than SVF.
Example 16
[0363] Expanding ASCs from Inguinal Fat Tissues by Culturing on
Immobilized nHC-HA in MESCM
[0364] In this example, a method of expanding rabbit ASCs from
inguinal fat tissue by culturing on immobilized HC-HA in MESCM was
examined.
[0365] Experimental Design:
[0366] Inguinal white fat pads (identified as WAT) derived from
rabbits were obtained and subjected to digestion and fractionation
of FC, RC, SVF procedures as described in Example 15. Cells were
treated with trypsin/EDTA for 10 minutes to separate cells into
single cells.
[0367] Weight and digestion medium ratio were calculated as
following:
[0368] Female Rabbit #6 (labeled rabbit #1): 11.2 g in 22.4 ml of
Coll/MESCM,
[0369] Female Rabbit #7 (labeled rabbit #2): 10.7 g in 21.4 ml of
Coll/MESCM.
[0370] Both Rabbit #6, #7 samples were digested in 2 mg/ml of
collagenase 16 h, 37.degree. C. During the filtration step, we
decreased the filter size to 70 .mu.m. When we retrieved the RC
fraction, Rabbit #7 exhibited many vessels retained on the filter
compared Rabbit #6. Total cell counts derived from each fraction of
Rb#7 was calculated as RC: 7.5.times.10.sup.6 cells and SVF
12.2.times.10.sup.6 cells.
[0371] Cells derived from FC, RC and SVF fractions were seeded in
at density of 2.times.10.sup.4 /96 on different substrates: plastic
or plastic with immobilized HA, 4.times. nHC-HA/PTX3 water soluble
(S), and 4.times. nHC-HA/PTX3 water insoluble (IS) in MESCM (see
procedure below). SVF cells were seeded on plastic in DMEM/10% FBS
as a control. Cell aggregates were observed at 6 h, 24 h, 4 days
and 7 days post-seeding. Total RNAs were extracted on day 4 and day
7 and used for qRT-PCR analysis of the following transcript
expression: ESC markers (Oct4, Nanog, Sox2 and Nestin) and other
markers such as CD34, CD31, PDGFR-13, vWF and a-SMA. Immunostaining
was used to confirm the gene expression. Immobilization of HA and
nHC-HA/PTX3 to culture plates is described above (Example 14).
TABLE-US-00008 TABLE 8 Experimental 96 Well Plate, P0 1 2 3 4 5 6 7
8 9 10 11 12 Medium A PBS HA nHC-HA/PTX3 nHC-HA/PTX3 (S) Water
Soluble (IS) Insoluble B FC RC SVF FC RC SVF FC RC SVF FC RC SVF C
X X X X X X X X X X X X MESCM D X X X X X X X X X X X X E X X X X X
X X X X X X X F X DMEM/ G X 10% H X FBS Total FC: 2.4 .times.
10.sup.5, RC: 2.4 .times. 10.sup.5, SVF: 3 .times. 10.sup.5
cells
[0372] Results:
[0373] Cell size and morphology of each fraction, FC, RC, SVF are
presented in FIG. 35. RC cells contains mixture of large and small
cells in size and cell surface appear to be smooth with bright
oil-like cluster. Like RC, FC cells also contain mixture of large
and small sizes while SVF cells are mostly uniform.
[0374] Compared to control SVF cells in DMEM/10% FBS at 6 h, FC,
RC, SVF cells in MESCM are observed evenly distributed on plastic,
immobilized HA, nHC-HA/PTX3 (S), and nHC-HA/PTX3 (IS). At 24 h,
with exception on plastic in DMEM and MESCM, cell aggregations were
first observed in all RC and SVF cells on HA, nHC-HA/PTX3 (S), and
nHC-HA/PTX3 (IS), and more profoundly on D4 and D7. FC cells did
not form aggregates on plastic throughout culture but began to form
aggregates on D4 on immobilized HA, nHC-HA/PTX3 (S), nHC-HA/PTX3
(IS). At D7, cell spreading was observed in all RC and SVF cells on
PL and HA. The cell spreading is more prominently in SVF than in
RC, and more in PBS than in HA. All cells on nHC-HA/PTX3 (S),
nHC-HA/PTX3 (IS) remained as aggregates. For FC cells, nHC-HA/PTX3
(S), nHC-HA/PTX3 (IS) promote cell aggregation and prevents cells
from spreading.
[0375] Overall, RC, SVF cells on plastic did not form aggregated
cells. Instead, the cells began to spread and proliferate. FC cell
did not exhibit cell spreading in MESCM. All cells on immobilized
HA, nHC-HA/PTX3 (S), and nHC-HA/PTX3 (IS) exhibit aggregation, but
only on immobilized HA did cells begin spreading and proliferating
on D7. The above data suggested in normal rabbit adipose, both
nHC-HA/PTX3 (S) and (IS) promote cell aggregations in all FC, RC
SVF fractions. qPCR data for stem cell marker expression is
presented in FIG. 36.
Example 17
Effect of AMD3100 Treatment on Expression of Embryonic SC Markers
and SDF-1/CXCR4-VEGF/BMP Signaling
[0376] Our previous study demonstrated that disruption of reunion
between PCK+ and Vim+ cells by AMD3100 added on Day 0 resulted in
more spheres with a smaller size, but did not perturb their
expression of Sox2 and Nanog as well as that of SDF-1 and CXCR4
(Xie et al. (2011) Stem Cells 9(11):1874-85). In addition, the
resultant spheres became more differentiated as evidenced by less
DNp63a and CK15 transcripts, and more CK12 transcript and proteins,
and by the absence of holoclone formation on 3T3 fibroblasts (Xie
et al. (2011) Stem Cells 9(11):1874-85). Our results above indicate
that 4.times. HC-HA activates SDF1/CXCR4-VEGF/BMP and integrin
signaling. This experiment examined how signal pathways may be
linked. We used a disrupting agent of SDF1/CXCR4 signaling AMD3100
to determine which signaling molecule is upstream or downstream of
SDF1/CXCR4 signaling and whether AMD3100 affects the expression of
those molecules, as well as SDF1, CXCR4, and ESC markers.
[0377] Experimental Design:
[0378] Experimental groups: plastic (control), 3D Matrigel
(control), immobilized nHC-HA (positive control), and immobilized
nHC-HA+AMD3100 (experimental, added at 0-day and 5-day of culture).
Limbal niche cells (LNCs) were cultured in MESCM for 10 days on
immobilized HC-HA with or without AMD3100 for 10 days (20 ug/ml,
added on day 0 and day 5) (Xie et al. (2011) Stem Cells
9(11):1874-85). Cells cultured on matrigel were digested with
dispase on D10.
[0379] The samples were collected for determination of mRNA levels
by qPCR. Specifically, mRNA was collected from10.sup.5 cells, and
qPCR was performed for SDF1, CXCR4, Nanog, Oct-4, Rex-1, Sox-2,
CD31, VEGF, BMP-2, BMP-4, BMP-7, IGF-1, ICAM, and HIF-113. Cell
morphology was observed by phase contrast microscopy.
[0380] Results:
[0381] The cell morphology results indicated that the sphere
formation could be altered by inhibiting SDF1-CXCR4 signaling by a
specific CXCR4 antagonist AMD3100 on Day 0 but not on Day 5 (FIG.
37). The results also indicated that AMD3100 added on Day 0 but not
day 5 resulted in more spheres with a smaller size.
[0382] From the qPCR analysis, it was observed that interrupting
SDF1/CXCR4 signaling by AMD3100 treatment did not affect increased
gene expression of SDF-1 and CXCR-4 induced by 4.times. HC-HA in
LNCs (p0), indicating that disruption of SDF-1/CXCR-4 signaling
does not affect gene expression of SDF-1 and CXCR-4. (FIG. 38 upper
*p<0.05 when compared to the plastic control). Similarly,
interrupting SDF1/CXCR4 signaling by AMD3100 treatment also did not
affect increased gene expression of SDF-1 and CXCR-4 induced by 4X
HC-HA in LNCs (p3), indicating that disruption of SDF-1/CXCR-4
signaling does not affect gene expression of SDF-1 and CXCR-4 (FIG.
38 lower; *p<0.05).
[0383] In addition, AMD3100 did not affect increased gene
expression of Nanog, Oct-4, Rex-1, Sox-2 induced by 4.times. HC-HA
in LNCs (p0) (FIG. 39 upper; *p<0.05). AMD3100 also did not
affect increased gene expression of Nanog, Oct-4, Rex-1, Sox-2
induced by 4.times. HC-HA in LNCs (p3) (FIG. 39 lower).
[0384] The qPCR results also indicated that expression of CD31 was
notably upregulated by 4.times. HC-HA in LNCs (p0) and in LNCs
(p3), which is consistent previous data from reseeding the cells on
3D Matrigel (Li et al. (2012) Invest Ophthalmol Vis Sci.
53(7):3357-67). Addition of AMD3100 did not affect expression of
CD31, indicating that CD31 is not downstream of SDF-1/CXCR-4
signaling (FIG. 40; *p<0.05).
[0385] The results also indicated that addition of AMD3100 to the
cultures of LNCs (p0) on immobilized 4.times. HC-HA significantly
downregulated expression of all BMPs (BMP-2, BMP-4 and BMP-7) and
ICAM, but not that of VEGF and IGF-1 induced by 4.times. HC-HA,
indicating that BMPs and ICAM are downstream of SDF-1/CXCR-4
signaling (FIG. 41 upper; *p<0.05, **p<0.01 when compared to
the plastic control, #p<0.05 when compared to the 4.times. HC-HA
control). Similar results were observed for the cultures of LNCs
(p3) (FIG. 41 lower; *p<0.05 when compared to the plastic
control, #p<0.05 when compared to the 4.times. HC-HA control).
These results suggest that activation of SDF-1 and CXCR-4 signaling
is through BMPs network, similar to a report demonstrating that
cardiogenic induction of pluripotent stem cells is through the
SDF-1/VEGF/BMP2 network (Chiriac et al. (2010) PLoS One 5:e9943),
and that integrin signaling is downstream of SDF-1/CXCR-4
signaling, that is, integrin signaling is controlled by
SDF-1/CXCR-4 signaling. Since expression of VEGF and IGF-1 is not
affected by AMD3100, this suggests that VEGF and IGF-1 signaling
are not downstream of SDF-1 and CXCR-4 signaling.
[0386] In summary, interruption of SDF1/CXCR4 signaling by AMD3100
did not affect increased gene expression of SDF-1 and CXCR-4
induced by 4.times. HC-HA in LNCs, indicating that disruption of
SDF-1/CXCR-4 signaling does not affect gene expression of SDF-1 and
CXCR-4. Similarly, AMD3100 did not affect increased gene expression
of Nanog, Oct-4, Rex-1, Sox-2 induced by 4.times. HC-HA in LNCs.
Expression of CD31 was notably upregulated by 4.times. HC-HA,
indicating that 4.times. HC-HA promotes angiogenesis since CD31 is
the key marker of EPC and mature VEC, operating as a regulator of
adhesion, migration, and activation (Feng et al. (2004) J Histochem
Cytochem.52:87-101). Addition of AMD3100 did not affect expression
of CD31, indicating that CD31 is not downstream of SDF-1/CXCR-4
signaling. Addition of AMD3100 to the cultures of LNCs (p3) on
immobilized 4.times. HC-HA significantly downregulated expression
of all BMPs (BMP-2, BMP-4 and BMP-7) and ICAM, but not that of VEGF
and IGF-1 induced by 4.times. HC-HA, indicating that BMPs and ICAM
are likely downstream of SDF-1/CXCR-4 signaling. The results also
suggest that activation of SDF-1 and CXCR-4 signaling is through
BMPs network, similar to a report demonstrating that cardiogenic
induction of pluripotent stem cells is through the SDF-1/VEGF/BMP2
network (Chiriac et al. (2010) PLoS One 5:e9943). Our results also
indicated that ICAM or integrin signaling is downstream of
SDF-1/CXCR-4 signaling, and controlled by SDF-1/CXCR-4 signaling.
Since expression of VEGF and IGF-1 is not affected by AMD3100, VEGF
and IGF-1 signaling are likely upstream or independent of SDF-1 and
CXCR-4 signaling.
Example 18
[0387] Detection of MMP1, MMP3, TSG-6 and PTX3 Expression in Cell
Lysates and Culture Media of CCh Fibroblast Cultured on Immobilized
nHC-HA
[0388] Conjunctivochalasis (CCH) is a common eye surface disease
characterized by the presence of excess folds of the conjunctiva
located between the globe of the eye and the eye-lid margin. The
loose, excess conjunctiva may mechanically irritate the eye and
disrupt the tear film and its outflow, leading to dry eye and
excess tearing. It has been thought that inflammation may play a
pathogenic role in CCH development, because a elevated levels of
such pro-inflammatory cytokines as TNF-.alpha., IL-1 .beta., IL-6,
and IL-8 are found in CCH patients (Acera et al. (2008) Ophthalmic
Res. 40:315-321; Erdogan-Poyraz et al. (2009) Cornea 28:189-193;
Ward et al. (2010) Invest Ophthalmol Vis Sci. 51:1994-2002). Our
previous work found that conjunctival fibroblasts from CCH
overexpress extracellular matrix-degrading enzymes MMP-1 and MMP-3
(Li et al. (2000) Invest Ophthalmol Vis Sci. 41:404-410), and that
such overexpression of MMP-1 and MMP-3 is further upregulated by
TNF-.alpha. and IL-1 .beta. (Meller et al. (2000) Invest Ophthalmol
Vis Sci. 41:2922-2929). Others have used immunohistochemical
staining to reveal a significantly higher number of cells positive
for MMP-3 and MMP-9 in CCH patients. These data indicate that CCH
manifests excessive degradation of conjunctival matrix and Tenon
capsule.
[0389] We detected higher TSG-6 and PTX3 expression in
subconjunctival stroma and Tenon in CCH patients. Furthermore,
there is a higher level of MMP1 and MMP3 transcripts and proteins,
and a higher level of actMMP1 expressed by CCH conjunctival
fibroblasts, and their expression is further promoted by TSG-6 or
PTX3 siRNA (Guo et al. (2012) Invest Ophthalmol Vis Sci.
53(7):3414-23). Of note is that knockdown TSG-6 or PTX3 by specific
siRNA led to more conversion of proMMP1 to actMMP1, and more
apoptosis of normal and CCH conjunctival fibroblasts. It remains
unknown how TSG-6 and PTX3 might be involved in transcriptional
control of MMP-1 and MMP-3 as well as activation of MMP-1.
[0390] Immobilized 4th nHC-HA decreased PTX3 expression, but
increased TSG-6 transcript level in CCh fibroblasts, and also
decreased the increasing extent of MMP1, MMP3, TSG-6 and PTX3 mRAN
stimulated by IL-1.beta., but whether their protein expressions
have the same changes as their mRNA was not known. In this example,
we determined the protein level in cell lysates and culture medium
of CCh fibroblasts cultured on 4th nHC-HA by Western blot.
[0391] Experimental Design
[0392] CCh fibroblasts were obtained as described in Guo et al.
(2012) Invest Ophthalmol Vis Sci. 53(7):3414-23. The cells were
cultured in DMEM+0.5% FBS on tissue cultures dishes containing no
substrate (control) or immobilized HA, 2nd HC-HA or 4th HC-HA (see
Example 19). Samples of the tissue culture media were obtained at
passage 0 and passage 2, concentrated, and analyzed for expression
of proMMP1, actMMP1, proMMP3 and PTX3 by Western blot.
[0393] Results
[0394] Immobilized 4th HC-HA Decreased proMMP1, proMMP3 and PTX3
Protein Level in Culture Medium of CCh Fibroblasts
[0395] For MMP1 and MMP3, Western blot analysis of CCh fibroblast
culture media showed that both p2 and p0 control (Plate) rest CCh
fibroblasts expressed proMMP1 and proMMP3 protein and released them
to culture media, while both active MMP1 and MMP3 proteins were
detected in P0 CCh fibroblasts in culture media but only active
MMP3 in p2 culture media (FIG. 42).
[0396] IL-1.beta. did not induce more pro- and active-MMP1 and MMP3
in p2 culture, but p0 medium showed increased active MMP1 level.
Prior studies reported more active MMP1 were detected than proMMP1
in culture medium upon IL-1.beta. stimulation (Guo et al. (2012)
Invest Ophthalmol Vis Sci. 53(7):3414-23). Immobilized HA decreased
pro-MMP1 and MMP3 level in p2 medium and no effect in p0 medium,
but IL-1 .beta. still induced more pro-MMP1 and MMP3 in p2 medium
and active-MMP1 in p0 medium. Without IL-1.beta., immobilized 2nd
HC-HA have the similar result as immobilized HA, but IL-1.beta. did
not increase proMMP1 and proMMP3 compared with control in p2 but
increase active-MMP1 in p0. Immobilized 4th HC-HA significantly
decreased pro- and active-MMP1 and MMP3 proteins level regardless
IL-1.beta. stimulation.
[0397] For PTX3, control rest p2 CCh fibroblasts expressed low
level of 45 kD PTX3 protein and p0 CCh fibroblasts expressed both
45 kD and 90 kD PTX3 at low level. IL-1.beta. stimulated more 45 kD
PTX3 protein expression, and a 90 kD PTX3 was also appeared in p2
but decreased in p0, consistent with previous results in the case
of p2 cells (Guo et al. (2012) Invest Ophthalmol Vis Sci.
53(7):3414-23). When cells were cultured on HA and 2nd HC-HA, PTX3
was not detectable, and the inducible expression level by
IL-1.beta. were decreased gradually. Importantly, 4th HC-HA
diminished PTX3 protein expression with or without IL-1.beta.
stimulation. These results suggested that immobilized 4th HC-HA
downregulates MMP1, MMP3 and PTX3 protein expression. No TSG-6
protein was detected in both p0 and p2 culture medium. In addition,
immobilized 4th HC-HA promoted primary CCh fibroblasts to aggregate
and form spheres, while immobilized 2nd HC-HA and HA did not.
Example 19
[0398] Constitutive Expression of Inter-.alpha.-inhibitor
(I.alpha.I) Family Proteins and Tumor Necrosis Factor-Stimulated
Gene-6 (TSG-6) by Human Amniotic Membrane Epithelial and Stromal
Cells Supporting Formation of the Heavy Chain-Hyaluronan (HC-HA)
Complex
[0399] In our previous studies, we reported HC-HA, a covalent
complex formed between heavy chains (HCs) of inter-a-inhibitor
(I.alpha.I) and hyaluronan (HA) by the catalytic action of tumor
necrosis factor (TNF)-stimulated gene-6 (TSG-6), is responsible for
human amniotic membrane (AM) anti-inflammatory, anti-scarring, and
anti-angiogenic actions. The study presented in this example showed
that AM epithelial and stromal cells and stromal matrix all stained
positively for HA, HC 1, 2, and 3, bikunin, and TSG-6. TSG-6 mRNA
and protein were constitutively expressed by cultured AM epithelial
and stromal cells without being up-regulated by TNF. In serum-free
conditions, these cells expressed I.alpha.I, leading to the
formation of HC-HA complex that contained both HC1 and HC2. In
contrast, only HC1 was found in the HC-HA complex purified from AM.
Local production of I.alpha.I, the HC-TSG-6 intermediate complex,
and HC-HA were abolished when cells were treated with siRNA to HC1,
HC2, bikunin (all of which impair the biosynthesis of I.alpha.I),
or TSG-6 but not to HC3. Collectively, these results indicate that
AM is another tissue in addition to the liver to constitutively
produce I.alpha.I and that the HC-HA complex made by this tissue is
different from that found at inflammatory sites (e.g. in asthma and
arthritis) and in the matrix of the cumulus oocyte complex.
[0400] Materials
[0401] Guanidine hydrochloride, cesium chloride, EDTA, anhydrous
alcohol, potassium acetate, sodium acetate, sodium chloride, sodium
hydroxide, Tris, Triton X-100, 3-(N,N-dimethyl palmityl ammonio)
propanesulfonate (Zwittergent3-16), protease inhibitor mixture
(including 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochloride,
aprotinin, bestatin hydrochloride, E-64, leupeptin, and pepstatin
A) and phenylmethanesulfonyl fluoride were obtained from
Sigma-Aldrich. Streptomyces hyaluronidase (HAase), chondroitinase
ABC, and biotinylated HA-binding protein (HABP) were from Seikagaku
Biobusiness Corporation (Tokyo, Japan). DMEM, Ham's F12 nutrient
mixture, FBS, Hanks' balanced salt solution, gentamicin,
amphotericin B, and radioimmuneprecipitation assay buffer were
purchased from Invitrogen. Slide-A-Lyzer dialysis cassettes (3.5K
MWCO) were from Fisher Scientific. The BCA protein assay kit was
from Pierce. The HA Quantitative Test kit was from Corgenix
(Westminster, CO). 4-15% gradient acrylamide ready gels and
nitrocellulose membranes were from Bio-Rad. I.alpha.I and urinary
trypsin inhibitor (i.e. bikunin) were prepared in our laboratory
from human plasma and urine, respectively, according to the
published methods. Recombinant human TNF and human/mouse TSG-6 mAb
(MAB2104) were from R&D Systems (Minneapolis, Minn.). Mouse
anti-human ITIH1 polycolonal antibody against full-length ITIH1 and
rabbit anti-human bikunin polyclonal antibody against full-length
bikunin were from Abcam (Cambridge, Mass.). The recombinant human
TSG-6 protein (TSG-6Q) and rabbit antisera against the C-terminal
peptide of human TSG-6 (RAH-1, TSTGNKNFLAGRFSHL (SEQ ID NO: 1)),
the N-terminal peptides of human HC2 (SLPGESEEMM (SEQ ID NO: 2))
and HC3 (SLPEGVANGI (SEQ ID NO: 3)), and the C-terminal peptide of
human HC2 (ESTPPPHVMRVE (SEQ ID NO: 4)) were as described
previously. PepMute.TM. siRNA Transfection Reagent was from
SignaGen Laboratories (Rockville, Md.). The RNeasy Mini RNA
isolation kit, small interfering RNA (siRNA) oligonucleotides for
targeting endogenous human HC1 (UAAUGUUCUGAGGAGUCACTT (SEQ ID NO:
5)) and HC3 (UUGACUAUCUGCACGUUGCCA (SEQ ID NO: 6)), and
nontargeting siRNA control oligonucleotides (scrambled RNA) were
from Qiagen (Valencia, Calif.). siRNA oligonucleotide for targeting
endogenous human TSG-6 (GGUUUCCAAAUCAAAUAUGUUGCAA (SEQ ID NO: 7)),
HC2 (GGAUCAAAUAGAGAGCGUUAUCACG (SEQ ID NO: 8)), and bikunin
(GGUAUUUCUAUAAUGGUACAUCCAT (SEQ ID NO: 9)) were from OriGene
Technologies (Rockville, Md.). Western LightingTM Chemiluminesence
Reagent was from PerkinElmer Life Sciences. The ultracentrifuge
(LM8 model, SW41 rotor) was from Beckman Coulter.
[0402] Cell Cultures
[0403] Human tissue was handled according to the Declaration of
Helsinki. The fresh human placenta was obtained from healthy
mothers after elective cesarean deliveries in the Baptist Hospital
(Miami, Fla.) via an approval (Protocol 03-028) by the Baptist
Health South Florida Institutional Review Board. Primary human AM
epithelial and stromal cells (designated as AMECs and AMSCs,
respectively) were isolated from fresh placenta and cultured in
supplemental hormonal epithelial medium (SHEM, which consisted of
DMEM/F12 (1:1, v/v), 5% (v/v) FBS, 0.5% (v/v) dimethyl sulfoxide, 2
ng/ml EGF, 5 .mu.g/ml insulin, 5 .mu.g/ml transferrin, 5 ng/ml
sodium selenite, 0.5 .mu.g/ml hydrocortisone, 0.1 nm cholera toxin,
50 .mu.g/ml gentamicin, 1.25 .mu.g/ml amphotericin B) under a
humidified atmosphere of 5% CO2 at 37.degree. C. The culture medium
was changed every 2 days. At subconfluence, cells were incubated in
SHEM containing 20 ng/ml TNF for 4 or 24 h prior to RT-PCR or
Western blot analysis. In experiments for TSG-6 detection, AMECs,
AMSCs, and human skin fibroblasts were cultured in DMEM/F12
containing 10% FBS medium (i.e. to prevent the influence of other
components such as EGF in SHEM on TSG-6 expression). To exclude
serum I.alpha.I, serum-free cultures were established with
secondary cultures. After seeding and attachment, cells were washed
three times with Hanks' balanced salt solution and switched to
fresh SHEM without serum, and the serum-free medium was changed
every 2 days until experimental manipulation.
[0404] siRNA Transfection
[0405] AMECs and AMSCs were cultured in serum-free SHEM in 6-well
plates until 50-60% confluence, when cells were transfected with
PepMuteTM siRNA Transfection Reagent with or without 10 nm HC1
siRNA, HC2 siRNA, bikunin siRNA, HC3 siRNA, or scrambled (sc) RNA.
After 48 h, cells were harvested and subjected to RT-PCR and
Western blot analysis. For TSG-6 detection, AMECs and AMSCs were
cultured in DMEM/F12 containing 10% FBS medium and transfected with
TSG-6 siRNA or scRNA.
[0406] Purification of HC-HA Complex from AM and Serum-Free
Cultures by Ultracentrifugation
[0407] HC-HA complex was purified from AM and serum-free cultures.
For purification of HC-HA complex from AM, cryopreserved human AM,
obtained from Bio-tissue (Miami, Fla.), was sliced into small
pieces, frozen in liquid nitrogen, and ground to fine powder by a
BioPulverizer. The powder was mixed with cold PBS at 1:1 (g/ml).
The mixture was kept at 4.degree. C. for 1 h with gentle stirring
and then centrifuged at 48,000.times.g for 30 min at 4.degree. C.
The supernatant (designated as AM extract) was then mixed with a 8
m guanidine HC1/PBS solution (at 1:1 ratio of v/v) containing 10 mm
EDTA, 10 mm aminocaproic acid, 10 mm N-ethylmaleimide, and 2 mm
PMSF. For purification of HC-HA complex from serum-free cultures,
cells were washed three times with Hanks' balanced salt solution
and extracted with 6 m guanidine HC1, 0.2 m Tris-HC1 (pH 8.0), 0.1%
(w/v) Zwittergent3-16 containing protein inhibitors (10 mm EDTA, 10
mm aminocaproic acid, 10 mm N-ethylmaleimide, and 2 mm PMSF). The
cell extract was kept at 4.degree. C. overnight with gentle
stirring before removing the insoluble materials by centrifuging at
14,000.times.g for 30 min at 4.degree. C. The above extracts were
adjusted to a density of 1.35 g/ml (AM extract) or 1.40 g/ml (cell
extract) with cesium chloride, respectively, and subjected to
isopycnic centrifugation at 35,000 rpm, 15.degree. C., for 48 h.
The resultant density gradients were fractioned into 12 tubes (1
ml/tube), in which the contents of HA and proteins were measured
using HA Quantitative Test kit and BCA protein assay kit,
respectively. Fractions from the first ultracentrifugation, which
contained most HA, were pooled, brought to a density of 1.40 g/ml
(AM extract) or 1.45 g/ml (cell extract) by addition of CsCl,
ultracentrifuged, and fractionated in the same manner as described
above. Fractions from the second ultracentrifugation, which
contained HA but no detectable proteins, were pooled and dialyzed
in distilled water and then precipitated twice with 3 volumes of
95% (v/v) ethanol containing 1.3% (w/v) potassium acetate at
0.degree. C. for 1 h. After centrifugation at 15,000.times.g, the
pellet was briefly dried by air, stored at -80.degree. C., and
designated as AM HC-HA complex and cell HC-HA complex,
respectively.
[0408] Immunofluorescence Analysis
[0409] Human fetal membrane containing AM and chorion was
cryosectioned to 5-.mu.m thickness, fixed with 4% paraformaldehyde
at room temperature for 15 min, and permeabilized with 0.2% (v/v)
Triton X-100 in PBS for 20 min. After blocking with 0.2% (w/v) BSA
in PBS for 1 h, sections were incubated with biotinylated HABP (for
HA, 5 .mu.g/ml) or different primary antibodies specific for HC1,
HC2, HC3, bikunin, and TSG-6 (all diluted 1:200 in blocking
solution) overnight in a humidity chamber at 4.degree. C. For HC2,
we used an anti-N-terminal HC2 antibody throughout unless mentioned
otherwise. For TSG-6, we used MAB2104 throughout unless mentioned
otherwise. After washing with PBS, they were incubated with Alexa
Fluor 488 streptavidin (for HA, diluted 1:100), or respective
secondary antibodies (i.e. FITC-conjugated anti-mouse IgG, or
FITC-conjugated anti-rabbit IgG) for 1 h at room temperature.
Isotype-matched nonspecific IgG antibodies were used as a control.
Alternatively, sections were treated with 50 units/ml Streptomyces
HAase at 37.degree. C. for 4 h before fixation. Nuclei were stained
by Hoechst 33342, and images were obtained using a Zeiss LSM700
confocal laser scanning microscope (Zeiss, Germany).
[0410] RT-PCR
[0411] Total RNA was extracted from AM tissue and cell cultures
using a RNeasy Mini RNA isolation kit. The cDNA was
reverse-transcribed from 1 .mu.g of total RNA using a Cloned AMW
First-Strand cDNA synthesis kit with gene-specific antisense primer
(for HC1-3 and bikunin) (Table 9) or oligo(dT) primer (for TSG-6).
First-strand cDNAs were amplified by PCR using AmpliTaq Gold Fast
PCR Master Mix and the specific gene primers (Table 9).
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression
was used to normalize the amounts of the amplified products. The
PCR products were electrophoresed on a 2% (w/v) agarose gel with
ethidium bromide staining, photographed using the UVP Biolmaging
system, and analyzed using the ImageJ software (Java).
TABLE-US-00009 TABLE 9 PCR Primers Sense/ Production Protein
antisense Primer sequence size bp HC1 Sense
5'-CCACCCCATCGGTTTTGAAGTGTCT-3' 138 (SEQ ID NO: 10) Antisense
5'-TGCCACGGGTCCTTGCTGTAGTCT-3' (SEQ ID NO: 11) HC2 Sense
5'-ATGAAAAGACTCACGTGCTTTTTC-3' 127 (SEQ ID NO: 12) Antisense
5'-ATTTGCCTGGGGCCAGT-3' (SEQ ID NO: 13) HC3 Sense
5'-TGAGGAGGTGGCCAACCCACT-3' 318 (SEQ ID NO: 14) Antisense
5'-CGCTTCTCCAGCAGCTGCTC-3' (SEQ ID NO: 15) Bikunin Sense
5'-GTCCGGAGGGCTGTGCTACC-3' 294 (SEQ ID NO: 16) Antisense
5'-GATGAAGGCTCGGCAGGGGC-3' (SEQ ID NO: 17) TSG-6 Sense
5'-CCAGGCTTCCCAAATGAGTA-3' 284 (SEQ ID NO: 18) Antisense
5'-TTGATTTGGAAACCTCCAGC-3' (SEQ ID NO: 19) GAPDH Sense
5'-ACCACAGTCCATGCCATCAC-3' 452 (SEQ ID NO: 20) Antisense
5'-TCCACCACCCTGTTGCTGTA-3' (SEQ ID NO: 21)
[0412] Western Blotting
[0413] Culture supernatants were collected, and cell lysates were
obtained by washing cells six times with cold PBS followed by
incubating in radioimmuneprecipitation assay buffer at 4.degree. C.
for 1 h with gentle stiffing and centrifugation at 14,000.times.g
for 30 min at 4.degree. C. Protein concentrations in culture
supernatants and cell lysates were quantified with a BCA protein
assay kit. For alkaline treatment of AM extract, samples were
incubated in 50 mm NaOH for 1 h at 25.degree. C. For HAase
digestion of the HC-HA complex, samples were dissolved in 0.1 m
sodium acetate buffer (pH 6.0) and incubated at 60.degree. C. for 1
h with or without 20 units/ml Streptomyces HAase. The above samples
were resolved by SDS-PAGE on 4-15% (w/v) gradient acrylamide ready
gels under denaturing and reducing conditions and transferred to a
nitrocellulose membrane. The membrane was then blocked with 5%
(w/v) fat-free milk in 50 mm Tris-HC1 (pH 7.5) buffer containing
150 mm NaC1 and 0.05% (v/v) Tween 20 followed by sequential
incubation with different primary antibodies followed by their
respective HRP-conjugated secondary antibodies. Immunoreactive
proteins were visualized by Western Lighting.TM. Chemiluminesence
reagent.
[0414] Results
[0415] Immunolocalization of HA, HCs, Bikunin, and TSG-6 in Human
AM
[0416] To address whether the AM could produce its own I.alpha.I to
form HC-HA complex, we first investigated whether the required
components, i.e. HA, each individual HC, bikunin, and TSG-6, were
actually present in human AM in vivo. Frozen sections of the fetal
membrane revealed AM consisting of a simple epithelium and an
avascular stroma and subjacent cell-rich chorion (FIG. 11, Phase).
Consistent with what has been reported previously, strong positive
HA immunostaining was noted in AM stroma and relatively weak
staining in AM epithelium using a biotinylated HABP (FIG. 11, HA).
This staining was lost when the tissue section was predigested by
HAase (FIG. 11, HA(+HAase)) indicating that HA staining is
specific. Immunostaining of each individual HC using specific
antibodies also revealed a positive staining in AM epithelium,
stromal cells, and/or stromal matrix (FIG. 11, HC1, HC2, and HC3).
Positive bikunin immunostaining was found in the apical surface of
the epithelium, the basement membrane zone, and the stroma (FIG.
11, Bikunin). TSG-6 immunostaining with two different anti-TSG-6
antibodies, i.e. MAB2104 (FIG. 11, TSG-6) and RAH-1 (data not
shown) showed the same pattern with positive staining associated
with AMECs, AMSCs, and stromal matrix. The lack of immunoreactivity
by nonimmune control serum indicates that the staining described
above is specific. Collectively, these results suggested the
presence of all components in AM required for forming I.alpha.I,
P.alpha.I, and HC-HA.
[0417] Presence of Individual HCs, Bikunin, TSG-6, P.alpha.I, and
I.alpha.I in AM-Soluble Extract
[0418] To investigate further the presence of the above components
in AM, we performed Western blotting analyses of proteins extracted
by an isotonic salt buffer before and after 50 mm NaOH treatment to
cleave ester bonds. Using anti-HC1, HC2, or bikunin antibodies,
purified I.alpha.I was found to contain a major 250-kDa species
corresponding to intact I.alpha.I and several weak species of
smaller molecular mass most likely representing intermediate
species (FIG. 43, lanes 2, 4, and 6), including a free HC1 species
of 75 kDa (lane 2). NaOH treatment of the I.alpha.I preparation
released HC1 (75 kDa, lane 3), HC2 (80 kDa, lane 5), and bikunin as
35-kDa and 22-kDa species (lane 7). The latter two species likely
correspond to bikunin with and without an attached CS chain. When
purified I.alpha.I was treated with chondroitinase ABC lyase, only
the 22-kDa species was observed with the anti-bikunin antibody
(lane 8). Purified bikunin, which appeared as a 35-kDa species
(lane 9), yielded both 35-kDa and 22-kDa species after the same
NaOH treatment (lane 10), but gave rise to only the 22-kDa species
after chondroitinase ABC treatment (lane 11). These results
confirmed that both 35-kDa and 22-kDa bikunin species formed after
mild NaOH treatment of I.alpha.I (i.e. with partial release of the
CS chain). Based on the profile generated by both I.alpha.I and
bikunin controls, we detected the 250-kDa I.alpha.I species and its
components, HC1, HC2, and bikunin in AM-soluble extract (lanes 12,
14, and 18). The anti-bikunin antibody also reacted with a 130-kDa
species (lane 18), which was likely P.alpha.I because it was
detected by an anti-HC3 antibody that also recognized a free HC3
species of 80 kDa (lane 16). The identity of I.alpha.I and
P.alpha.I was further verified by the NaOH treatment, which
released corresponding HCs and bikunin species that were detected
by the various chain-specific antibodies (lanes 13, 15, 17, and
19). A similar result was also obtained with an anti-I.alpha.I
antibody (data not shown). Because I.alpha.I/P.alpha.I
chain-specific antibodies and the anti-I.alpha.I antibody all
reacted with a 50-kDa species, which was also detected by normal
mouse or rabbit serum (data not shown), we concluded that this
50-kDa species was nonspecific.
[0419] Analysis of the AM extract with an anti-TSG-6 antibody
(MAB2104) revealed a species of .about.35 kDa (lane 21), which
corresponds to the expected size of native TSG-6, which is slightly
larger than the size of recombinant TSG-6 (TSG-6Q, 32 kDa) (lane
20) that has a lower level of glycosylation. This antibody also
detected a major 50-kDa species, where neither this nor the
.about.35-kDa species was affected by NaOH treatment (i.e. in
agreement with our previous report using three different anti-TSG-6
antibodies). Again, the detection of the 50-kDa species is likely
nonspecific. Taken together, these results demonstrated that the
soluble AM extract indeed contained I.alpha.I, P.alpha.I, HC1, HC2,
HC3, bikunin, and TSG-6.
[0420] Constitutive Expression of HC1, HC2, HC3, and Bikunin mRNA
and Proteins by AMECs and AMSCs in Serum-containing Media
[0421] To provide data on the cellular sources of HC1, HC2, HC3,
and bikunin, we established primary cultures of AMECs and AMSCs in
SHEM, which was found to be the optimal medium in our prior study,
and extracted total RNA for RT-PCR and proteins for Western blot
analysis. The positive control of human liver RNA yielded PCR
products with the expected sizes of 138 by (HC1), 127 by (HC2), 318
by (HC3), and 294 by (bikunin) (FIG. 44A). These four RT-PCR
products were all present in AM tissue as well as both AMECs and
AMSCs. The expression of HCs and bikunin transcripts was not
greatly up-regulated by TNF in AMECs and AMSCs. Western blotting of
AMEC and AMSC lysates showed that a 265-kDa and a 200-kDa species
were recognized by the chain-specific antibodies against HC1, HC2,
and bikunin (FIG. 44, B, C, and D) but not by anti-HC3 (FIG. 44E),
suggesting that these two species were I.alpha.I-related. Anti-HC1,
anti-HC2, and anti-HC3 antibodies all recognized .about.75-kDa
species (FIGS. 44, B, C, and E); the anti-bikunin antibody detected
a 35-kDa species (FIG. 44D). Thus, based on our comparison with
purified I.alpha.I and a serum control (as a source of Pal), and
with published data, AMECs and AMSCs can be concluded to express
HC1, HC2, HC3, and bikunin proteins. In addition, both anti-HC1
(FIG. 44B) and anti-HC2 antibodies (FIG. 44C) also recognized
120-kDa species that are likely HC1-TSG-6 and HC2-TSG-6 complexes,
respectively. Based on prior reports, the 100-kDa species revealed
by anti-HC1, anti-HC2, and anti-HC3 antibodies were likely HC1,
HC2, and HC3 precursors, respectively. Approximately 45-90-kDa
species revealed by anti-bikunin are likely to be bikunin precursor
(i.e. .alpha.1-microglobuin/bikunin tandem protein) with or without
glycosaminoglycan attached, a finding also observed in primary rat
hepatocytes. The identities of HC1- and HC2-positive species at 65
and 50 kDa (FIGS. 44, B and C) and the faint HC3-positive species
at 50 kDa (FIG. 44E) are not clear because these species were also
present in serum-free AMEC and AMSC lysates (see below); they were
likely not derived from serum. Interestingly, the intensities of
the various HC and I.alpha.I species were not notably affected by
addition of TNF. Overall, these results indicate that AMEC and AMSC
produce individual HC1, HC2, and bikunin chains that are assembled
into I.alpha.I proteins.
[0422] Production of I.alpha.I Family Proteins in Serum-Free AMEC
and AMSC Cultures
[0423] To avoid undue influence by serum I.alpha.I and to provide
further evidence for the cellular production of I.alpha.I family
proteins by AMECs and AMSCs, we harvested cell lysates from their
respective serum-free cultures. We also treated these two
serum-free cultures with HC1 siRNA, HC2 siRNA, and bikunin siRNA
(i.e. because HC1, HC2, and bikunin are components of I.alpha.I);
as a comparison, we also treated cells with HC3 siRNA because HC3
is not a part of I.alpha.I. RT-PCR analysis confirmed the
efficiency of these siRNAs to down-regulate their respective
transcripts in these two cultures (FIG. 45A). Western blot analysis
showed that the 265-kDa and 200-kDa species were significantly
reduced by HC1 siRNA, HC2 siRNA, and bikunin siRNA (FIG. 45B), but
not by HC3 siRNA (FIG. 45C). The production of HC1, HC2, and
bikunin (and their putative precursors) was notably down-regulated
by their respective siRNA (FIG. 45B). In addition, the 120-kDa
species recognized by anti-HC1 and anti-HC2 antibodies that likely
corresponded to respective HC1-TSG-6 and HC2-TSG-6 complexes was
decreased by HC1 siRNA and HC2 siRNA, respectively (FIG. 45B). The
HC3 siRNA decreased the HC3 species but did not affect the
aforementioned species (FIG. 45C), consistent with the inhibitory
effects of the siRNAs against HC1, HC2, and bikunin, shown in FIG.
45B, being specific. Essentially the same results were obtained
using AMSCs (data not shown). These results collectively provided
further evidence that AMECs and AMSCs produced HC1, HC2, and
bikunin proteins, which assemble to form I.alpha.I.
[0424] Constitutive Expression of TSG-6 mRNA and Protein by AMECs
and AMSCs
[0425] Previous studies have shown that adult skin fibroblasts and
peripheral blood mononuclear cells, myeloid dendritic cell, renal
tubular epithelial cells, articular chondrocytes, as well as
cervical smooth muscle cells express TSG-6 mRNA and protein only
under the stimulation of pro-inflammatory cytokine such as TNF and
IL-1. To provide further evidence for the cellular sources of
TSG-6, we cultured AMECs and AMSCs in DMEM/F12 with 10% FBS to
prevent the influence of other components such as EGF in SHEM on
TSG-6 expression. As expected, expression of TSG-6 mRNA by human
skin fibroblasts was negative but significantly up-regulated by 20
ng/ml TNF (FIG. 46A). In contrast, there was constitutive
expression of TSG-6 mRNA by AMECs and AMSCs without being affected
by TNF (FIG. 46A). TSG-6 mRNA was also detected in RNAs extracted
from fresh AM tissue (FIG. 46A). Western blot analyses of lysates
detected four species, i.e. 35, 50, 100, and 120 kDa, in both AMECs
and AMSCs, but only 35 kDa and two faint species of 50 and 100 kDa
in skin fibroblasts (FIG. 46B). Addition of TNF did not change any
species in AMECs and AMSCs, but up-regulated the 35-kDa species
(but not the 50- or 100-kDa species) in skin fibroblasts (FIG.
46B). In supernatants, we detected 35-, 100-, 120-, and 150-kDa
species (but not 50 kDa) in skin fibroblasts (FIG. 46C); after TNF
stimulation, the 100- and 150-kDa species did not change, but 35-
and 120-kDa species became intensified. All of these species were
also detected in AMEC and AMSC supernatants, where 35- and 120-kDa
species were unaffected by TNF.
[0426] TSG-6 siRNA transfection greatly reduced both 35- and
120-kDa species in both lysates and supernatants of AMEC but did
not affect the 50- and 100-kDa species in cell lysates (FIG. 46D)
or the 100- and 150-kDa species in supernatants (FIG. 46E). The
same result was observed in AMSCs (data not shown). From these
experiments we concluded that the 35-kDa species corresponded to
TSG-6 secreted by AMECs and AMSCs, where its production was induced
by TNF in skin fibroblasts but was constitutive in AMECs and AMSCs.
On the basis of earlier reports, the 120-kDa species likely
corresponded to the covalent complexes of TSG-6 with HCs. Because
the 50-, 100-, and 150-kDa species were not affected by TSG-6 siRNA
and because the amounts of these species were not altered by TNF in
skin fibroblasts, they were concluded to be nonspecific.
[0427] Cellular Production of HC-HA Complex Containing Both HC1 and
HC2 Whereas AM HC-HA Complex Contains Only HC1
[0428] Previous studies have shown that HC1 and HC2 of I.alpha.I
and HC3 of Pal can covalently bind to HA in vivo and in vitro to
form HC-HA complex. Our prior study showed that a HC-HA complex can
be purified from the AM-soluble extract. However, it remained
unclear whether bikunin or TSG-6 was also present and which HC
isotypes were present in AM HC-HA complex. Because AMECs and AMSCs
were found here to synthesize their own I.alpha.I and TSG-6
proteins (FIGS. 43 and 44), we aimed to determine further whether
they could also produce their own HC-HA complex.
[0429] We used two successive ultracentrifugations to isolate the
HC-HA complex from the AM extract as reported previously and from
both cellular extracts (FIG. 47A). Western blot analysis using the
anti-HC1 antibody showed that AM HC-HA complex presented as a high
molecular mass species at the bottom of the loading well and free
HC1 (FIG. 47B, lane 3) by comparison with purified I.alpha.I
treated with NaOH (FIG. 47B, lanes 1 and 2). HAase digestion
completely eliminated the high molecular mass species, resulting in
a notable increase in the intensity of the HC1 species (FIG. 47B,
lane 4), confirming that the high molecular mass species
represented a HC-HA complex. The presence of free HC1 in the AM
HC-HA complex might be due to the degradation of HA that lead to
release of some HC1 during purification and storage of the complex.
Interestingly, the anti-HC2 antibody (raised against the N-terminal
peptide) did not detect any species in the AM HC-HA complex with or
without HAase digestion (FIG. 47B, lanes 9 and 10) but did detect a
HC2 species in I.alpha.I (FIG. 47B, lane 8). The same result was
obtained using an alternative anti-HC2 antibody raised against the
C-terminal peptide (FIG. 47B, lanes 13-16). Preliminary mass
spectrometric analysis of the AM HC-HA complex following digestion
with HAase and trypsin detected peptides from HC1 but not from HC2
consistent with the absence of HC2 in AM HC-HA complex.4
Furthermore, by Western blotting we did not find HC3, bikunin, or
TSG-6 in the AM HC-HA complex (data not shown); the absence of
bikunin and TSG-6 in the HC-HA complex is in agreement with our
previous data.
[0430] Overall, the above results indicate that the HC-HA complex
from AM only contains HC1. However, Western blot analysis of the
aforementioned cell HC-HA revealed the presence of both HC1 and HC2
after HAase digestion of material purified from both AMSCs (FIG.
47B, lanes 5, 6, 11, 12, 17, and 18) and AMECs (data not shown)
although the amount increased for HC1 was not as dramatic as HC2.
These results indicated that both cells primarily make HC2-HA. We
also did not detect HC3, bikunin, and TSG-6 in the cell HC-HA
complex (data not shown). The formation of this HC-HA complex was
abolished when cells were treated by HC1 siRNA (FIG. 47B, lanes 21
and 22) and TSG-6 siRNA (FIG. 47B, lanes 23 and 24). Available
evidence suggests that the covalent coupling of HCs to the CS chain
of bikunin to form intact I.alpha.I is a prerequisite for the
subsequent transfer of HCs to HA. We found that HC1-siRNA was
specific for HC1 but did not affect HC2 and bikunin mRNA expression
and their protein synthesis in AMEC and AMSC (data not shown), but
prevented the formation of intact I.alpha.I. So, HC1-siRNA
treatment prevents any type of HC-HA formation due to the
inhibition of I.alpha.I biosynthesis caused by HC1 knockdown.
Example 20
[0431] Effect of HC-HA Purified from AM on Expression of ESC, MSC,
Pericyte and Angiogenesis Markers in Native Limbal Niche Cells.
[0432] Cryopreserved human amniotic membrane (AM) has been applied
to surgical or injury sites to reduce the inflammation and
scarring. Application of human AM as a temporary graft induces
rapid regression of corneal stromal edema and inflammation. Our
studies also have demonstrated that amniotic membrane extract (AME)
and HC-HA purified from AM retains anti-inflammatory and
anti-scarring activities of AM, and HC-HA exerts a more potent
antiangiogenic action than does HA by inhibiting viability,
proliferation, migration, and differentiation without promoting the
detachment or death of cultured HUVECs. In this experiment, the
effect of HC-HA complexes isolated from AM on gene expression of
markers for cell angiogenesis and differentiation was examined.
[0433] To characterize the effect of HC-HA complexes on ESC, EPC,
MSC and angiogenesis markers, passage 4 of limbal niche cells were
cultured on plastic, plastic coated with 5% matrigel, HA, 2nd
purified HC-HA and 4th purified HC-HA (see Example 19 for HC-HA
extract purification). Limbal NCs cells (P4/3D) and limbal
epithelial progenitor cells (LEPC) were seeded in 96 well plastic
plates at a density of 5000/well in modified embryonic SC medium
(MESCM), culture for 4 days, and the morphology of the cells was
monitored by phase contrast microscopy and photographed daily. At
Day 4, the cells were rinsed and mRNA was isolated for qPCR for the
expression of markers ESC, EPC, MSC and angiogenesis.
[0434] It was observed that 4th HC-HA, not 2nd HC-HA and HA,
promotes aggregation of limbal niche cells (FIG. 48). In addition,
it was demonstrated that HA and HC-HA promoted expression of ESC,
EPC and angiogenesis progenitor markers in limbal niche cells, but
not differentiation in limbal niche cells.
[0435] After 96 h of culture, the cells cultured in HA, 2nd HC-HA
and 4th HC-HA expressed 2-3 times more Sox-2, Flk-1 and CD 31 (in
case of 4th HC-HA), the markers of ESC, EPC and angiogenesis
progenitors, indicating that HA and HC-HA promote anti-inflammatory
and anti-scaring properties by altering the phenotype of the niche
cells (FIG. 49). The cells cultured on 4th HC-HA expressed 2.5
times higher CD31, indicating that 4th HC-HA is the most effective
form of HA. There is no detectable SMMHC in all groups of cells,
indicating that the differentiation of the cells were not promoted
by HA and HC-HA. 4th HC-HA inhibited the expression of PTX-3 by
.about.80%, indicating that downregulation of PTX3 by 4th HC-HA may
be related to its anti-inflammatory and anti-scaring effect.
[0436] The attachment and growth of LEPC on plastic or plastic
coated with Matrigel were poor, and HA and HC-HA did not support
the attachment and growth of LEPC (FIG. 50). The cells were mostly
rounded at the beginning of 24 h of culture. After 48 h of culture,
a small portion of the cells began to grow in a spindle and
fibroblastic-like shape. The addition of HA and HC-HA did not
improve the attachment and growth of LEPC on plastic for the 96 h
duration of the test.
[0437] HA and HC-HA also did not affect expression of epithelial
stem cell markers of Oct-4 and ANp63a, but decreased expression of
epithelial marker CK12. 4th HC-HA also induced a less significant
reduction of PTX-3 (by 60%) (FIG. 51).
Example 21
[0438] Effect of HC-HA Purified from AM on Expression of ESC, MSC,
Pericytes and Angiogenesis Markers from Conjunctivochalasis
Fibroblasts Derived from Diseased Patients
[0439] In this example, the ability of HC-HA to induced a stem cell
like phenotype in fibroblasts was examined. Conjunctivochalasis
(CCh) fibroblasts were obtained as described in Guo et al. (2012)
Invest Ophthalmol Vis Sci. 53(7):3414-23. The cells were cultured
in DMEM+0.5% FBS on tissue cultures dishes containing no substrate
(control) or immobilized HA, 2nd HC-HA or 4th HC-HA (see Example
20). The cell were cultured for 48 hours and added with or without
20 ng/mL IL-1.beta. for 4 or 24 hours before being harvested for
total RNAs or proteins, respectively.
[0440] 1. Effects of Immobilized HC-HA Complex on CCh Fibroblasts
Morphology
[0441] Immobilized 4th HC-HA promoted CCh fibroblasts to aggregate
and form spheres (FIG. 52). The cells maintained this morphology
even with IL-1.beta. treatment after cultured in DMEM+0.5% FBS for
48 h, but the control, immobilized HA and 2nd HC-HA did not. These
results indicated that 4th HC-HA promoted cells back into quiet
state, and possibly into stem cell-like state and decreased cell
sensitivity to stimulation.
[0442] 2. Effects of Immobilized HC-HA Complex on the Expression of
MMP1, MMP3, TSG-6 and PTX3 mRNA in CCh Fibroblasts
[0443] The 4th HC-HA decreased PTX3 expression in CCh fibroblasts,
and downregulated MMP1, MMP3, TSG-6 and PTX3 expression under
inflammatory cytokine stimulation (FIG. 53).
[0444] 3. Effects of Immobilized HC-HA Complex on Expression of
Stem Cell Markers in CCh Fibroblasts
[0445] 4th HC-HA increased EPC marker CD31 expression but decreased
.alpha.-SMA, SMMHC expression, suggesting 4th HC-HA likely promoted
CCh fibroblasts into an endothelial progenitor state, consistent
with the cell morphology results (FIG. 54). The ESC markers, MSC
markers and other EPC markers did not show any significant
difference among these conditions.
Example 22
Angiogenic Potential of C/D Derived Cells
[0446] To confirm that C/D isolated cells expressing FLK-1+,vWF+
and CD31- are indeed cells that possess angiogenic potential, that
ability of angiogenic progenitor to differentiate into mature
vascular endothelial cells is examined. Previous studies reported
that defined endothelial progenitor cells (EPCs) should follow
differential potential by demonstrating (1) positive expression of
FLK-1, CD31 and vWF when cultured on plastic in EGM2 with VEGF,
bFGF (Park et al. (2010) Int J Cardiol. 145:261-262) 2) ability to
uptake Dil-Ac-LDL(Voyta et al. (1984) J Cell Biol. 99:2034-2040),
and 3) form temporary vascular network on 100% Matrigel (Gargett et
al. (2000) Hum Reprod. 15:293-301; Ieronimakis et al. (2008) PLoS
One 3:e0001753; Park et al. (2010) Int J Cardiol. 145:261-262).
Because previous studies reported pericyte and/or its progenitors
stabilize vessel and function through paracrine and cell-cell
contact with endothelial cells Song (2005) Chin Med J (Engl)
118:927-935; Traktuev et al. (2008) Circ Res. 102:77-85; Stratman
et al. (2009) Blood 114:5091-5101). C/D derived cells (see examples
5 and 6) expressing pericyte-like markers were examined for similar
function.
[0447] Results in FIG. 55 show that C/D isolated hAMSC at P3
culture in EGM with VEGF, bFGF medium, exhibit angiogenic potential
and can be differentiated into mature vascular endothelial cells
with ability to uptake Dil-Ac-LDL. These hAMSC also demonstrate
similar expression of the mature vascular endothelial phenotype
(FLK-1, vWR, a-SMA, CD31 and CD146). Similar to human umbilical
vascular endothelial cells (HUVEC), hAMSCs were able to form
network formation on 100% matrigel within 24 hours but the network
formation diminished after 36 hours.
Example 23
[0448] Presence of Small Leucine-Rich Proteoglycans (SLRPs) in
Native HC-HA Complexes Isolated from Amniotic Membrane and
Umbilical Cord
[0449] The small leucine-rich proteoglycans (SLRPs) are a family of
proteins that are present in the extracellular matrix. This family
includes decorin (36 kD), biglycan (38 kD), fibromodulin (42 kD),
lumican (38 kD), keratocan (40 kD), epiphycan (Pg-Lb), osteoglycin
(25 kD), PRELP (55-62 kD), and osteoadherin (60 kD). All members of
the SLRP family consist of a protein core with multiple
leucine-rich repeats and one or more glycosaminoglycan side chains,
which include chondroitin sulfate, dermatan sulfate or keratan
sulfate. SLRPs appear to interact in many cases with collagen,
modifying the deposition and arrangement of collagen fibers in the
extracellular matrix, and also with cells and with soluble growth
factors like TGF-beta regulating cell function. Previously, we have
purified lumican from human AM and demonstrated that AM contains
abundant lumican that appeared as a non-keratan sulfated
glycoprotein (50 kD) in both soluble and insoluble forms, which is
different from that in cornea, where it present as a keratan
sulfate proteoglycan (MW 70-90 kDa). Decorin and biglycan have also
been found in human AM as chondroitin sulfate proteoglycans by
Western blotting and immunostaining. These findings suggested that
AM produces SLRPs.
[0450] In HC-HA 4th purified from an guanidine HC1 extract of AM,
we detected a broad and strong 140 kDa band and relatively weaker
705 kDa, doublet 55 kDa and 20 kDa bands that were not found in
4.times. HC-HA purified from PBS extract of AM. Because the 140 kDa
band is not sharp suggesting the content of sugar moieties, we
speculated that they were proteoglycans. We have detected positive
immunostaining of keratan sulfate in AM, especially localized in
the stromal compact layer, a similar distribution pattern as PTX3
in AM. We also found positive immunostaining of keratan sulfate in
UC subamnion and Wharton's jelly. In this example, the presence of
SLRPs in HC-HA complexes purified by extraction in PBS or guanidine
HC1 were compared.
[0451] AM, CH and UC Extraction by PBS.
[0452] According to the method described in He et al. (2009) J Biol
Chem. 284(30):20136-46, amniotic membrane (AM) and umbilical cord
(UC) tissues were homogenized with a blender in cold PBS at 1:1
(g/ml) for AM or 1:1.5 (g/ml) for UC, and mixed at 4.degree. C. for
1 h. The mixture was centrifuged at 48,000 g at 4.degree. C. for 30
min. The supernatants of PBS extract were designated as AME, and
UCE, respectively. In addition, a Wharton's jelly mixture from UC
was also extracted by PBS and such extract was named UJE.
Ultracentrifugation was performed on the extracted samples as
described above to obtain nHC-HA 4.sup.th complexes for analysis.
The sample were lyophilized and stored at -20.degree. C.
[0453] AM and UC Extraction by GnHC1 After PBS Extraction.
[0454] The insoluble pellet of AM, UC and UC jelly mixture after
PBS extract were further extracted by 4 M GnHC1 buffer (100 mM
sodium acetate, pH 5.8, 4M GnHC1, 10 mM EDTA, 1% Triton X-100) at
4.degree. C. for 24 h. After centrifugation at 48,000 g, at
4.degree. C. for 30 min, the supernatants were collected and named
AMGnE, UCGnE and UJGnE, respectively. The HA and protein
concentrations in each extraction were detected by HA ELISA and BCA
assay, respectively. Ultracentrifugation was performed on the
extracted samples as described above to obtain nHC-HA 4.sup.th
complexes for analysis. The sample were lyophilized and stored at
-20.degree. C.
[0455] Deglycosylation Treatment of HC-HA Samples:
[0456] (1) Chemical deglycosylation with TFMSA: Lyophilized HC-HA
complexes (containing 30 .mu.g HA) were incubated with 50 .mu.l
TFMS and 20 .mu.l anisole on ice for 3 h. TFMS was neutralize with
125 .mu.l N-ethylmorpholine. The sample was then precipitated with
5-10 volumes of acetone overnight at -20.degree. C. or for 1 h at
-80 C. The samples were centrifuged and dried. The dried pellets
were dissolved in SDS sample loading buffer for
electrophoresis.
[0457] (2) Enzymatic deglycosylation with keratanase
(Endo-.beta.-galactosidase) to remove keratan sulfate chain and
N-linked oligosaccharides, or with Chondroitinase (Cabc) to remove
chondroitin sulfate chain: HC-HA complexes (containing 30 .mu.g HA)
were incubated with 0.1 U/ml keratanase in 50 mM sodium acetate, pH
5.8, at 37 C for 2 h, or incubated with 5 U/ml Cabc in PBS at 37 C
for 2 h.
[0458] Samples were analyzed SDS-Page and Western blotting for
Keratan sulfate, osteoadherin, Keratocan, PRELP, and
osteoglycin.
[0459] Results:
[0460] For the AM HC-HA samples, it was found that keratan sulfate
and osteoadherin are present in AM GnHC1 HC-HA, but not in PBS
HC-HA. AM GnHC1 HC-HA contains abundant decorin and biglycan that
are bound to HC-HA, but PBS HC-HA contains only faint decorin and
no biglycan. AM GnHC1 HC-HA also contains osteoadherin and keratan
sulfate-containing species, while PBS HC-HA does not. In addition,
a small amount of decorin and biglycan in AM GnHC1 HC-HA contains
chondroitin sulfate chain. No fibromodulin, lumican, keratocan,
PRELP, osteoglycin, epiphycan, periostin, TSG-6 or Bikunin was
detected in AM GnHC1 HC-HA.
[0461] For the UC HC-HA samples, it was found that decorin and
biglycan are abundantly present in UC GnHC1 HC-HA, but not in PBS
HC-HA. Decorin and biglycan in UC GnHC1 HC-HA further appear to be
attached to a chondroitin sulfate chain. Osteoadherin and bikunin
are also present in UC GnHC1 HC-HA, but not in PBS HC-HA. Keratan
sulfate was present in GnHC1 HC-HA and PBS HC-HA. No fibromodulin,
lumican, keratocan, PRELP, osteoglycin, epiphycan, periostin or
TSG-6 was detected in UC GnHC1 HC-HA.
[0462] While preferred embodiments have been shown and described
herein, it will be obvious to those skilled in the art that such
embodiments are provided by way of example only. Numerous
variations, changes, and substitutions may now occur. It should be
understood that various alternatives to the embodiments described
herein may be employed in practicing the described methods. It is
intended that the following claims define the scope of the
embodiments and that methods and structures within the scope of
these claims and their equivalents be covered thereby.
Sequence CWU 1
1
21116PRTHomo sapiens 1Thr Ser Thr Gly Asn Lys Asn Phe Leu Ala Gly
Arg Phe Ser His Leu 1 5 10 15 210PRTHomo sapiens 2Ser Leu Pro Gly
Glu Ser Glu Glu Met Met 1 5 10 310PRTHomo sapiens 3Ser Leu Pro Glu
Gly Val Ala Asn Gly Ile 1 5 10 412PRTHomo sapiens 4Glu Ser Thr Pro
Pro Pro His Val Met Arg Val Glu 1 5 10 521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5uaauguucug aggagucact t 21621RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 6uugacuaucu gcacguugcc a 21725RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 7gguuuccaaa ucaaauaugu ugcaa 25825RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 8ggaucaaaua gagagcguua ucacg 25925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 9gguauuucua uaaugguaca uccat 251025DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10ccaccccatc ggttttgaag tgtct 251124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11tgccacgggt ccttgctgta gtct 241224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
12atgaaaagac tcacgtgctt tttc 241317DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13atttgcctgg ggccagt 171421DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 14tgaggaggtg gccaacccac t
211520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15cgcttctcca gcagctgctc 201620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16gtccggaggg ctgtgctacc 201720DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 17gatgaaggct cggcaggggc
201820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 18ccaggcttcc caaatgagta 201920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
19ttgatttgga aacctccagc 202020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 20accacagtcc atgccatcac
202120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 21tccaccaccc tgttgctgta 20
* * * * *