U.S. patent application number 14/479029 was filed with the patent office on 2015-07-16 for antisense-induced exon2 inclusion in acid alpha-glucosidase.
The applicant listed for this patent is Murdoch University, Sarepta Therapeutics, Inc.. Invention is credited to Richard Keith Bestwick, Sue Fletcher, Gunnar James Hanson, Stephen Donald Wilton.
Application Number | 20150197534 14/479029 |
Document ID | / |
Family ID | 51541398 |
Filed Date | 2015-07-16 |
United States Patent
Application |
20150197534 |
Kind Code |
A1 |
Wilton; Stephen Donald ; et
al. |
July 16, 2015 |
ANTISENSE-INDUCED EXON2 INCLUSION IN ACID ALPHA-GLUCOSIDASE
Abstract
The present disclosure relates to antisense oligomers and
related compositions and methods for inducing exon inclusion as a
treatment for glycogen storage disease type II (GSD-II) (also known
as Pompe disease, glycogenosis II, acid maltase deficiency (AMD),
acid alpha-glucosidase deficiency, and lysosomal alpha-glucosidase
deficiency), and more specifically relates to inducing inclusion of
exon 2 and thereby restoring levels of enzymatically active acid
alpha-glucosidase (GAA) protein encoded by the GAA gene.
Inventors: |
Wilton; Stephen Donald;
(Applecross, AU) ; Fletcher; Sue; (Bayswater,
AU) ; Hanson; Gunnar James; (Cambridge, MA) ;
Bestwick; Richard Keith; (Corvallis, OR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Sarepta Therapeutics, Inc.
Murdoch University |
Cambridge
Murdoch |
MA
WA |
US
US |
|
|
Family ID: |
51541398 |
Appl. No.: |
14/479029 |
Filed: |
September 5, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61874261 |
Sep 5, 2013 |
|
|
|
61932195 |
Jan 27, 2014 |
|
|
|
Current U.S.
Class: |
514/90 ;
544/84 |
Current CPC
Class: |
A61P 43/00 20180101;
C12Y 302/0102 20130101; C12N 2310/3181 20130101; C12N 2310/321
20130101; C07F 9/6533 20130101; C12N 15/1137 20130101; A61P 3/10
20180101; C12N 2310/3145 20130101; A61P 3/08 20180101; C12N
2310/3233 20130101; C12N 2320/33 20130101; C12N 2310/3513 20130101;
C12N 2310/315 20130101; C12N 2310/3231 20130101; C12N 2310/11
20130101 |
International
Class: |
C07F 9/6533 20060101
C07F009/6533 |
Claims
1. An antisense oligomer compound of 10 to 40 nucleotides or
nucleotide analogs, comprising: a non-natural chemical backbone
selected from a phosphoramidate or phosphorodiamidate morpholino
oligomer (PMO), a peptide nucleic acid (PNA), a locked nucleic acid
(LNA), a phosphorothioate oligomer, a tricyclo-DNA oligomer, a
tricyclo-phosphorothioate oligomer, a 2'O-Me-phosphorothioate
oligomer, or any combination of the foregoing; and a targeting
sequence complementary to a region within intron 1 (SEQ ID. NO: 1),
intron 2 (SEQ ID. NO: 2), or exon 2 (SEQ ID. NO: 3) of a pre-mRNA
of the human acid alpha-glucosidase (GAA) gene.
2. The compound of claim 1, wherein the targeting sequence is
selected from SEQ ID NOS: 4 to 120, wherein X is selected from
uracil (U) or thymine (T).
3. A compound of formula (I): ##STR00029## or a pharmaceutically
acceptable salt thereof, wherein: each Nu is a nucleobase which
taken together forms a targeting sequence; x is an integer from 8
to 38; each Y is independently selected from O or --NR.sup.a,
wherein R.sup.a is selected from the group consisting of hydrogen,
-T.sup.1-NR.sup.cR.sup.dR.sup.e, and a cell penetrating peptide,
wherein: R.sup.c is selected from the group consisting of hydrogen,
C.sub.1-C.sub.6 alkyl, aralkyl, and --C(.dbd.NH)NH.sub.2, R.sup.d
is selected from the group consisting of hydrogen, aralkyl, and
C.sub.1-C.sub.6 alkyl, or R.sup.c and R.sup.d taken together with
the nitrogen atom to which they are attached form a 5-7 membered
ring when R.sup.c and R.sup.d are each independently
C.sub.1-C.sub.6 alkyl or aralkyl, where the ring is optionally
substituted with a substituent selected from the group consisting
of C.sub.1-C.sub.6 alkyl, phenyl, halogen, and aralkyl, and R.sup.c
is selected from the group consisting of an electron pair,
hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl; each L is
independently selected from the group consisting of: ##STR00030##
and a cell penetrating peptide, wherein w is an integer selected
from 3-20, and S is an integer selected from 1 to 8; n is an
integer from 0 to 3; each R.sup.1 is independently selected from
the group consisting of --N(CH.sub.3).sub.2, NR.sup.5R.sup.6,
OR.sup.7, a moiety of formula (II): ##STR00031## wherein: R.sup.8
is selected from the group consisting of hydrogen, methyl,
--C(.dbd.NH)NH.sub.2, --Z-T.sup.2-NHC(.dbd.NH)NH.sub.2, and a cell
penetrating peptide, where Z is carbonyl or a direct bond, R.sup.9
is selected from the group consisting of an electron pair,
hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl; each R.sup.10 is
independently selected from hydrogen or methyl; and a moiety of
formula (III): ##STR00032## wherein: q is an integer from 0 to 2,
R.sup.11 is selected from the group consisting of hydrogen,
C.sub.1-C.sub.6 alkyl, aralkyl, and --C(.dbd.NH)NH.sub.2, R.sup.12
is selected from the group consisting of hydrogen, aralkyl, and
C.sub.1-C.sub.6 alkyl, or R.sup.11 and R.sup.12 taken together with
the nitrogen atom to which they are attached form a 5-7 membered
ring where the ring is optionally substituted with a substituent
selected from the group consisting of C.sub.1-C.sub.6 alkyl,
phenyl, halogen, and aralkyl, and R.sup.13 is selected from the
group consisting of an electron pair, hydrogen, C.sub.1-C.sub.6
alkyl, and aralkyl; R.sup.2 is selected from the group consisting
of hydrogen, OH, a nucleotide, a cell-penetrating peptide, a moiety
of formula: ##STR00033## trityl, --C(.dbd.O)OR.sup.f, and acyl,
wherein R.sup.f is C.sub.1-C.sub.30 alkyl optionally substituted by
one or more oxygen or hydroxyl moieties, or R.sup.2 is absent;
R.sup.3 is selected from the group consisting of hydrogen, a
C.sub.1-C.sub.6 alkyl, a nucleotide, a cell penetrating peptide,
--C(.dbd.NH)NH.sub.2, trityl, --C(.dbd.O)OR.sup.g, acyl, and a
moiety of formula: ##STR00034## wherein R.sup.g is C.sub.1-C.sub.30
alkyl optionally substituted by one or more oxygen or hydroxyl
moieties; R.sup.4 is selected from the group consisting of an
electron pair, hydrogen, a C.sub.1-C.sub.6 alkyl, and acyl R.sup.5
is independently selected from hydrogen or methyl; R.sup.6 and
R.sup.7 is independently selected from hydrogen or
-T.sup.3-NR.sup.cR.sup.dR.sup.e; and each of T.sup.1, T.sup.2, and
T.sup.3 is independently an optional linker of up to 18 atoms in
length comprising alkyl, alkoxy, or alkylamino groups, or
combinations thereof, wherein the targeting sequence is
complementary to a region within intron 1 (SEQ ID. NO: 1), intron 2
(SEQ ID. NO: 2), or exon 2 (SEQ ID. NO: 3) of a pre-mRNA of the
human acid alpha-glucosidase (GAA) gene.
4. The compound of claim 3, wherein each Nu is independently
selected from the group consisting of adenine, guanine, thymine,
uracil, cytosine, hypoxanthine, 2,6-diaminopurine, 5-methyl
cytosine, C5-propynyl-modified pyrimidines, and
10-(9-(aminoethoxy)phenoxazine).
5. The compound of claim 3, wherein each R.sup.1 is
--N(CH.sub.3).sub.2.
6. The compound of claim 5, wherein the targeting sequence is
selected from SEQ. ID NOS: 4 to 120, wherein X is selected from
uracil (U) or thymine (T).
7. The compound of claim 3, wherein at least one R' is selected
from the group consisting of: ##STR00035##
8. The compound of claim 3, wherein 50-90% of the R.sup.1 groups
are --N(CH.sub.3).sub.2.
9. The compound of claim 3, wherein 66% of the R.sup.1 groups are
--N(CH.sub.3).sub.2.
10. The compound of claim 3, wherein: n is 2; R.sup.2 and L taken
together are of the formula: ##STR00036## and Y is O at each
occurrence.
11. A compound of formula (IV): ##STR00037## or a pharmaceutically
acceptable salt thereof, wherein: each Nu is a nucleobase which
taken together form a targeting sequence; x is an integer from 15
to 25; each Y is O; each R.sup.1 is independently selected from the
group consisting of: ##STR00038## wherein at least one R.sup.1 is
--N(CH.sub.3).sub.2, and wherein the targeting sequence is selected
from SEQ ID NOS: 4-120, wherein X is selected from uracil (U) or
thymine (T).
12. A pharmaceutical composition, comprising an antisense oligomer
compound of 10 to 40 nucleotides or nucleotide analogs and a
pharmaceutically acceptable carrier, the compound comprising: a
non-natural chemical backbone selected from a phosphoramidate or
phosphorodiamidate morpholino oligomer (PMO), a peptide nucleic
acid (PNA), a locked nucleic acid (LNA), a phosphorothioate
oligomer, a tricyclo-DNA oligomer, a tricyclo-phosphorothioate
oligomer, a 2'O-Me-phosphorothioate oligomer, or any combination of
the foregoing; and a targeting sequence complementary to a region
within intron 1 (SEQ ID. NO: 1), intron 2 (SEQ ID. NO: 2), or exon
2 (SEQ ID. NO: 3) of a pre-mRNA of the human acid alpha-glucosidase
(GAA) gene.
13. The pharmaceutical composition of claim 12, wherein the
targeting sequence is selected from SEQ ID NOS: 4 to 120, wherein X
is selected from uracil (U) or thymine (T).
14. A pharmaceutical composition, comprising a compound of formula
(I): ##STR00039## or a pharmaceutically acceptable salt thereof,
wherein: each Nu is a nucleobase which taken together forms a
targeting sequence; x is an integer from 8 to 38; each Y is
independently selected from O or --NR.sup.a, wherein R.sup.a is
selected from the group consisting of hydrogen,
-T.sup.1-NR.sup.cR.sup.dR.sup.e, and a cell penetrating peptide,
wherein: R.sup.c is selected from the group consisting of hydrogen,
C.sub.1-C.sub.6 alkyl, aralkyl, and --C(.dbd.NH)NH.sub.2, R.sup.d
is selected from the group consisting of hydrogen, aralkyl, and
C.sub.1-C.sub.6 alkyl, or R.sup.c and R.sup.d taken together with
the nitrogen atom to which they are attached form a 5-7 membered
ring when R.sup.c and R.sup.d are each independently
C.sub.1-C.sub.6 alkyl or aralkyl, where the ring is optionally
substituted with a substituent selected from the group consisting
of C.sub.1-C.sub.6 alkyl, phenyl, halogen, and aralkyl, and R.sup.e
is selected from the group consisting of an electron pair,
hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl; each L is
independently selected from the group consisting of: ##STR00040##
and a cell penetrating peptide, wherein w is an integer selected
from 3-20, and S is an integer selected from 1 to 8; n is an
integer from 0 to 3; each R.sup.1 is independently selected from
the group consisting of --N(CH.sub.3).sub.2, --NR.sup.5R.sup.6,
--OR.sup.7, a moiety of formula (II): ##STR00041## wherein: R.sup.8
is selected from the group consisting of hydrogen, methyl,
--C(.dbd.NH)NH.sub.2, --Z-T.sup.2-NHC(.dbd.NH)NH.sub.2, and a cell
penetrating peptide, where Z is carbonyl or a direct bond, R.sup.9
is selected from the group consisting of an electron pair,
hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl; each R.sup.10 is
independently selected from hydrogen or methyl; and a moiety of
formula (III): ##STR00042## wherein: q is an integer from 0 to 2,
R.sup.11 is selected from the group consisting of hydrogen,
C.sub.1-C.sub.6 alkyl, aralkyl, and --C(.dbd.NH)NH.sub.2, R.sup.12
is selected from the group consisting of hydrogen, aralkyl, and
C.sub.1-C.sub.6 alkyl, or R.sup.11 and R.sup.12 taken together with
the nitrogen atom to which they are attached form a 5-7 membered
ring where the ring is optionally substituted with a substituent
selected from the group consisting of C.sub.1-C.sub.6 alkyl,
phenyl, halogen, and aralkyl, and R.sup.13 is selected from the
group consisting of an electron pair, hydrogen, C.sub.1-C.sub.6
alkyl, and aralkyl; R.sup.2 is selected from the group consisting
of hydrogen, OH, a nucleotide, a cell-penetrating peptide, a moiety
of formula: ##STR00043## trityl, --C(.dbd.O)OR.sup.f, and acyl,
wherein R.sup.f is C.sub.1-C.sub.30 alkyl optionally substituted by
one or more oxygen or hydroxyl moieties, or R.sup.2 is absent;
R.sup.3 is selected from the group consisting of hydrogen, a
C.sub.1-C.sub.6 alkyl, a nucleotide, a cell penetrating peptide,
--C(.dbd.NH)NH.sub.2, trityl, acyl, and a moiety of formula:
##STR00044## R.sup.g is C.sub.1-C.sub.30 alkyl optionally
substituted by one or more oxygen or hydroxyl moieties; R.sup.4 is
selected from the group consisting of an electron pair, hydrogen, a
C.sub.1-C.sub.6 alkyl, and acyl R.sup.5 is independently selected
from hydrogen or methyl; R.sup.6 and R.sup.7 is independently
selected from hydrogen or -T.sup.3-NR.sup.cR.sup.dR.sup.e; and each
of T.sup.1, T.sup.2, and T.sup.3 is independently an optional
linker of up to 18 atoms in length comprising alkyl, alkoxy, or
alkylamino groups, or combinations thereof; wherein the targeting
sequence is complementary to a region within intron 1 (SEQ ID. NO:
1), intron 2 (SEQ ID. NO: 2), or exon 2 (SEQ ID. NO: 3) of a
pre-mRNA of the human acid alpha-glucosidase (GAA) gene, and a
pharmaceutically acceptable carrier.
15. The pharmaceutical composition of claim 14, wherein each
R.sup.1 is --N(CH.sub.3).sub.2.
16. The pharmaceutical composition of claim 15, wherein the
targeting sequence is selected from SEQ. ID NOS: 4 to 120, wherein
X is selected from uracil (U) or thymine (T).
17. The pharmaceutical composition of claim 14, wherein: n is 2;
R.sup.2 and L taken together are of the formula: ##STR00045## and Y
is O at each occurrence.
18. A method of treating glycogen storage disease type II in a
subject in need thereof, comprising administering to the subject an
effective amount of an antisense oligomer compound of 10 to 40
nucleotides or nucleotide analogs comprising: a non-natural
chemical backbone selected from a phosphoramidate or
phosphorodiamidate morpholino oligomer (PMO), a peptide nucleic
acid (PNA), a locked nucleic acid (LNA), a phosphorothioate
oligomer, a tricyclo-DNA oligomer, a tricyclo-phosphorothioate
oligomer, a 2'O-Me-phosphorothioate oligomer, or any combination of
the foregoing; and a targeting sequence complementary to a region
within intron 1 (SEQ ID. NO: 1), intron 2 (SEQ ID. NO: 2), or exon
2 (SEQ ID. NO: 3) of a pre-mRNA of the human acid alpha-glucosidase
(GAA) gene.
19. The method of claim 18, wherein the targeting sequence is
selected from SEQ ID NOS: 4 to 120, wherein X is selected from
uracil (U) or thymine (T).
20. A method of treating glycogen storage disease type II in a
subject in need thereof, comprising administering to the subject an
effective amount of an antisense oligomer compound of formula (I):
##STR00046## or a pharmaceutically acceptable salt thereof,
wherein: each Nu is a nucleobase which taken together forms a
targeting sequence; x is an integer from 8 to 38; each Y is
independently selected from O or --NR.sup.a, wherein R.sup.a is
selected from the group consisting of hydrogen,
-T.sup.1-NR.sup.cR.sup.dR.sup.e, and a cell penetrating peptide,
wherein: R.sup.c is selected from the group consisting of hydrogen,
C.sub.1-C.sub.6 alkyl, aralkyl, and --C(.dbd.NH)NH.sub.2, R.sup.d
is selected from the group consisting of hydrogen, aralkyl, and
C.sub.1-C.sub.6 alkyl, or R.sup.c and R.sup.d taken together with
the nitrogen atom to which they are attached form a 5-7 membered
ring when R.sup.c and R.sup.d are each independently
C.sub.1-C.sub.6 alkyl or aralkyl, where the ring is optionally
substituted with a substituent selected from the group consisting
of C.sub.1-C.sub.6 alkyl, phenyl, halogen, and aralkyl, and R.sup.c
is selected from the group consisting of an electron pair,
hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl; each L is
independently selected from the group consisting of ##STR00047##
and a cell penetrating peptide, wherein w is an integer selected
from 3-20, and S is an integer selected from 1 to 8; n is an
integer from 0 to 3; each R.sup.1 is independently selected from
the group consisting of --N(CH.sub.3).sub.2, NR.sup.5R.sup.6,
OR.sup.7, a moiety of formula (II): ##STR00048## wherein: R.sup.8
is selected from the group consisting of hydrogen, methyl,
--C(.dbd.NH)NH.sub.2, --Z-T.sup.2-NHC(.dbd.NH)NH.sub.2, and a cell
penetrating peptide, where Z is carbonyl or a direct bond, R.sup.9
is selected from the group consisting of an electron pair,
hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl; each R.sup.10 is
independently selected from hydrogen or methyl; and a moiety of
formula (III): ##STR00049## wherein: q is an integer from 0 to 2,
R.sup.11 is selected from the group consisting of hydrogen,
C.sub.1-C.sub.6 alkyl, aralkyl, and --C(.dbd.NH)NH.sub.2, R.sup.12
is selected from the group consisting of hydrogen, aralkyl, and
C.sub.1-C.sub.6 alkyl, or R.sup.11 and R.sup.12 taken together with
the nitrogen atom to which they are attached form a 5-7 membered
ring where the ring is optionally substituted with a substituent
selected from the group consisting of C.sub.1-C.sub.6 alkyl,
phenyl, halogen, and aralkyl, and R.sup.13 is selected from the
group consisting of an electron pair, hydrogen, C.sub.1-C.sub.6
alkyl, and aralkyl; R.sup.2 is selected from the group consisting
of hydrogen, OH, a nucleotide, a cell-penetrating peptide, a moiety
of formula: ##STR00050## trityl, --C(.dbd.O)OR.sup.f, and acyl,
wherein R.sup.f is C.sub.1-C.sub.30 alkyl optionally substituted by
one or more oxygen or hydroxyl moieties or R.sup.2 is absent;
R.sup.3 is selected from the group consisting of hydrogen, a
C.sub.1-C.sub.6 alkyl, a nucleotide, a cell penetrating peptide,
--C(.dbd.NH)NH.sub.2, trityl, acyl, and a moiety of formula:
##STR00051## R.sup.g is C.sub.1-C.sub.30 alkyl optionally
substituted by one or more oxygen or hydroxyl moieties; R.sup.4 is
selected from the group consisting of an electron pair, hydrogen, a
C.sub.1-C.sub.6 alkyl, and acyl R.sup.5 is independently selected
from hydrogen or methyl; R.sup.6 and R.sup.7 is independently
selected from hydrogen or -T.sup.3-NR.sup.cR.sup.dR.sup.e; and each
of T.sup.1, T.sup.2, and T.sup.3 is independently an optional
linker of up to 18 atoms in length comprising alkyl, alkoxy, or
alkylamino groups, or combinations thereof, wherein the targeting
sequence is complementary to a region within intron 1 (SEQ ID. NO:
1), intron 2 (SEQ ID. NO: 2), or exon 2 (SEQ ID. NO: 3) of a
pre-mRNA of the human acid alpha-glucosidase (GAA) gene.
21. The method of claim 20, wherein each R.sup.1 is
--N(CH.sub.3).sub.2.
22. The method of claim 21, wherein the targeting sequence is
selected from SEQ. ID NOS: 4 to 120, wherein X is selected from
uracil (U) or thymine (T).
23. The method of claim 20, wherein: n is 2; R.sup.2 and L taken
together are of the formula: ##STR00052## and Y is O at each
occurrence.
24. An antisense oligomer, comprising a targeting sequence of
sufficient length and complementarity to specifically hybridize to
a region within intron 1 (SEQ ID NO:1), exon 2 (SEQ ID NO:2), or
intron 2 (SEQ ID NO:3) of the pre-mRNA of the human acid
alpha-glucosidase (GAA) gene.
25. The antisense oligomer of claim 24, wherein the targeting
sequence comprises at least 10 contiguous nucleotides of a
targeting sequence selected from SEQ ID. NOS: 4 to 120, wherein X
is selected from uracil (U) or thymine (T).
26. The antisense oligomer of claim 24, wherein the targeting
sequence comprises 80% sequence identity to a targeting sequence
selected from SEQ ID. NOS: 4 to 120, wherein X is selected from
uracil (U) or thymine (T).
27. The antisense oligomer of claim 4, wherein R.sup.2, L, and n
taken together are of a formula selected from: ##STR00053##
28. The pharmaceutical composition of claim 14, wherein R.sup.2, L,
and n taken together are of a formula selected from:
##STR00054##
29. The method of claim 20, wherein R.sup.2, L, and n taken
together are of a formula selected from: ##STR00055##
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority under 35 U.S.C.
.sctn.119(e) to U.S. Application No. 61/874,261, filed Sep. 5,
2013; and U.S. Application No. 61/932,195, filed Jan. 27, 2014;
each of which is incorporated by reference in its entirety.
STATEMENT REGARDING SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
provided in text format in lieu of a paper copy, and is hereby
incorporated by reference into the specification. The name of the
text file containing the Sequence Listing is
SATH.sub.--001.sub.--02US_ST25.txt. The text file is about 62 KB,
was created on Sep. 5, 2014, and is being submitted electronically
via EFS-Web.
BACKGROUND
[0003] 1. Field of the Disclosure
[0004] The present disclosure relates to antisense oligomers and
related compositions and methods for inducing exon inclusion as a
treatment for glycogen storage disease type II (GSD-II) (also known
as Pompe disease, glycogenosis II, acid maltase deficiency (AMD),
acid alpha-glucosidase deficiency, and lysosomal alpha-glucosidase
deficiency), and more specifically relates to inducing inclusion of
exon 2 and thereby restoring levels of enzymatically active acid
alpha-glucosidase (GAA) protein encoded by the GAA gene.
[0005] 2. Description of the Related Art
[0006] Alternative splicing increases the coding potential of the
human genome by producing multiple proteins from a single gene.
Inappropriate alternative splicing is also associated with a
growing number of human diseases.
[0007] GSD-II is an inherited autosomal recessive lysosomal storage
disorder caused by deficiency of an enzyme called acid
alpha-glucosidase (GAA). The role of GAA within the body is to
break down glycogen. Reduced or absent levels of GAA activity leads
to the accumulation of glycogen in the affected tissues, including
the heart, skeletal muscles (including those involved with
breathing), liver, and nervous system. This accumulation of
glycogen is believed to cause progressive muscle weakness and
respiratory insufficiency in individuals with GSD-II. GSD-II can
occur in infants, toddlers, or adults, and the prognosis varies
according to the time of onset and severity of symptoms.
Clinically, GSD-II may manifest with a broad and continuous
spectrum of severity ranging from severe (infantile) to milder late
onset adult form. The patients eventually die due to respiratory
insufficiency. There is a good correlation between the severity of
the disease and the residual acid alpha-glucosidase activity, the
activity being 10-20% of normal in late onset and less than 2% in
early onset forms of the disease. It is estimated that GSD-II
affects approximately 5,000 to 10,000 people worldwide.
[0008] The most common mutation associated with the adult onset
form of disease is IVS1-13T>G. Found in over two thirds of adult
onset GSD-II patients, this mutation may confer a selective
advantage in heterozygous individuals or is a very old mutation.
The wide ethnic variation of adult onset GSD-II individuals with
this mutation argues against a common founder.
[0009] The GAA gene consists of 20 exons spanning some 20 kb. The
3.4 kb mRNA encodes a protein with a molecular weight of
approximately 105 kD. The IVS1-13T>G mutation leads to the loss
of exon 2 (577 bases) which contains the initiation AUG codon.
[0010] Treatment for GSD-II has involved drug treatment strategies,
dietary manipulations, and bone marrow transplantation without
significant success. In recent years, enzyme replacement therapy
(ERT) has provided new hope for GSD-II patients. For example,
Myozyme.RTM., a recombinant GAA protein drug, received approval for
use in patients with GSD-II disease in 2006 in both the U.S. and
Europe. Myozyme.RTM. depends on mannose-6-phosphates (M6P) on the
surface of the GAA protein for delivery to lysosomes.
[0011] Antisense technology, used mostly for RNA down regulation,
recently has been adapted to alter the splicing process. Processing
the primary gene transcripts (pre-mRNA) of many genes involves the
removal of introns and the precise splicing of exons where a donor
splice site is joined to an acceptor splice site. Splicing is a
precise process, involving the coordinated recognition of donor and
acceptor splice sites, and the branch point (upstream of the
acceptor splice site) with a balance of positive exon splice
enhancers (predominantly located within the exon) and negative
splice motifs (splice silencers are located predominantly in the
introns).
[0012] Effective agents that can alter splicing of GAA pre-mRNAs
are likely to be useful therapeutically for improved treatment of
GSD-II.
SUMMARY
[0013] Embodiments of present disclosure relate to antisense
oligomers and related compositions and methods for increasing the
levels of exon 2-containing GAA-coding mRNA in a cell, comprising
contacting the cell with an antisense oligomer of sufficient length
and complementarity to specifically hybridize to a region within
the pre-mRNA of the GAA gene, wherein binding of the antisense
oligomer to the region increases the levels of exon 2-containing
GAA-coding mRNA in the cell.
[0014] Accordingly, in some embodiments, the instant disclosure
relates to an antisense oligomer of 10 to 40 nucleotides or
nucleotide analogs, comprising a targeting sequence of sufficient
length and complementarity to specifically hybridize to a region
within intron 1 (SEQ ID NO:1), exon 2 (SEQ ID NO:2), or intron 2
(SEQ ID NO:3) of the pre-mRNA of the human acid alpha-glucosidase
(GAA) gene.
[0015] In certain embodiments, the instant disclosure relates to an
antisense oligomer compound, comprising:
[0016] a non-natural chemical backbone selected from a
phosphoramidate or phosphorodiamidate morpholino oligomer (PMO), a
peptide nucleic acid (PNA), a locked nucleic acid (LNA), a
phosphorothioate oligomer, a tricyclo-DNA oligomer, a
tricyclo-phosphorothioate oligomer, a 2'O-Me-modified oligomer, or
any combination of the foregoing; and
[0017] a targeting sequence complementary to a region within intron
1 (SEQ ID. NO. 1), intron 2 (SEQ ID. NO. 2), or exon 2 (SEQ ID. NO.
3) of a pre-mRNA of the human acid alpha-glucosidase (GAA)
gene.
[0018] In some embodiments, the antisense oligomer specifically
hybridizes to a region within the intron 1, exon 2, and/or intron 2
GAA sequence(s) set forth in Table 1. In some embodiments, the
antisense oligomer specifically hybridizes to an intronic splice
silencer element or an exonic splice silencer element. In certain
embodiments, the antisense oligomer comprises a targeting sequence
set forth in Table 2, a fragment of at least 10 contiguous
nucleotides of a targeting sequence in Table 2, or variant having
at least 80% sequence identity to a targeting sequence in Table 2.
In specific embodiments, the antisense oligomer consists or
consists essentially of a targeting sequence set forth in Table
2.
[0019] In certain embodiments, the antisense oligomer is a
phosphoramidate or phosphorodiamidate morpholino oligomer (PMO), a
PMO-X, a PPMO, a peptide nucleic acid (PNA), a locked nucleic acid
(LNA), a phosphorothioate oligomer, a tricyclo-DNA oligomer, a
tricyclo-phosphorothioate oligomer, a 2'O-Me-modified oligomer, or
any combination of the foregoing.
[0020] In some embodiments, the antisense oligomer contains about,
at least about, or no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, or
10 cationic internucleoside linkages. In certain embodiments, the
antisense oligomer contains about or at least about 10%, 15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, or 100% cationic internucleoside linkages. In certain
embodiments, the antisense oligomer contains about, at least about,
or no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
internucleoside linkages that exhibits a pKa between about 4.5 and
about 12. In some embodiments, the antisense oligomer contains
about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,
50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%
internucleoside linkages that exhibit a pKa between about 4.5 and
about 12. In some embodiments, the antisense oligomer has an
internucleoside linkage containing both a basic nitrogen and an
alkyl, aryl, or aralkyl group. In some embodiments, the antisense
oligomer comprises a morpholino.
[0021] In certain embodiments, the antisense oligomer of the
disclosure is a compound of formula (I):
##STR00001##
or a pharmaceutically acceptable salt thereof, wherein:
[0022] each Nu is a nucleobase which taken together forms a
targeting sequence;
[0023] x is an integer from 8 to 38;
[0024] each Y is independently selected from O or --NR.sup.a,
wherein R.sup.a is selected from the group consisting of hydrogen,
-T.sup.1-NR.sup.cR.sup.dR.sup.e, and --[(C(O)CHR'NH).sub.m]R'',
wherein:
[0025] R' is a side chain of a naturally occurring amino acid or a
one- or two-carbon homolog thereof, R'' is selected from Hydrogen
or acyl, m is an integer from 1 to 60, R.sup.c is selected from the
group consisting of hydrogen, C.sub.1-C.sub.6 alkyl, aralkyl, and
--C(.dbd.NH)NH.sub.2, R.sup.d is selected from the group consisting
of hydrogen, aralkyl, and C.sub.1-C.sub.6 alkyl, or R.sup.c and
R.sup.d taken together with the nitrogen atom to which they are
attached form a 5-7 membered ring when R.sup.c and R.sup.d are each
independently C.sub.1-C.sub.6 alkyl or aralkyl, where the ring is
optionally substituted with a substituent selected from the group
consisting of C.sub.1-C.sub.6 alkyl, phenyl, halogen, and aralkyl,
and R.sup.e is selected from the group consisting of an electron
pair, hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl;
[0026] each L is independently selected from the group consisting
of --P(O).sub.2OH--, --P(O).sub.2R.sup.1--, a piperazinyl group, a
carbonyl group, H(O(CH.sub.2).sub.sO).sub.w--,
--(OCH.sub.2CH.sub.2O).sub.w, and --[(C(O)CHR'NH).sub.m]R'',
wherein w is an integer selected from 3-20, S is an integer
selected from 1 to 8;
[0027] n is an integer from 0 to 3;
[0028] each R.sup.1 is independently selected from the group
consisting of --N(CH.sub.3).sub.2, --NR.sup.5R.sup.6, --OR.sup.7, a
moiety of formula (II):
##STR00002##
[0029] wherein R.sup.8 is selected from the group consisting of
hydrogen, methyl, --C(.dbd.NH)NH.sub.2,
--Z-T.sup.2-NHC(.dbd.NH)NH.sub.2, and --[(C(O)CHR'NH).sub.m]R'',
where Z is carbonyl or a direct bond, R.sup.9 is selected from the
group consisting of an electron pair, hydrogen, a C.sub.1-C.sub.6
alkyl, and aralkyl, and each R.sup.10 is independently selected
from hydrogen or methyl; and
[0030] a moiety of formula (III):
##STR00003##
[0031] wherein q is an integer from 0 to 2, R.sup.11 is selected
from the group consisting of hydrogen, C.sub.1-C.sub.6 alkyl,
aralkyl, and --C(.dbd.NH)NH.sub.2, R.sup.12 is selected from the
group consisting of hydrogen, aralkyl, and C.sub.1-C.sub.6 alkyl,
or R.sup.11 and R.sup.12 taken together with the nitrogen atom to
which they are attached form a 5-7 membered ring where the ring is
optionally substituted with a substituent selected from the group
consisting of C.sub.1-C.sub.6 alkyl, phenyl, halogen, and aralkyl,
and R.sup.13 is selected from the group consisting of an electron
pair, hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl;
[0032] R.sup.2 is selected from the group consisting of hydrogen,
OH, a nucleotide, --(CH.sub.2).sub.mC(O)NR.sup.fR.sup.g wherein
R.sup.f and R.sup.g are independently selected from H, acyl,
C.sub.1-C.sub.6 alkyl, and --[(C(O)CHR'NH).sub.m]R'',
--[(C(O)CHR'NH).sub.m]R'', H(O(CH.sub.2).sub.sO).sub.w--,
H(OCH.sub.2CH.sub.2O).sub.w--, trityl, --C(.dbd.O)OR.sup.f, and
acyl, wherein R.sup.f is C.sub.1-C.sub.30 alkyl comprising one or
more oxygen or hydroxyl moieties or combinations thereof, or
R.sup.2 is absent;
[0033] R.sup.3 is selected from the group consisting of hydrogen, a
C.sub.1-C.sub.6 alkyl, a nucleotide, --[(C(O)CHR'NH).sub.m]R'',
--C(.dbd.NH)NH.sub.2, trityl, --C(.dbd.O)OR.sup.g, acyl,
--C(O)(CH.sub.2).sub.mC(P), and
T.sup.4-(4-(4,6-(NR.sub.2)-1,3,5-triazin-2-yl)piperazin-1-yl,
wherein R.sup.g is C.sub.1-C.sub.30 alkyl comprising one or more
oxygen or hydroxyl moieties or combinations thereof, T.sup.4 is
selected from --C(O)(CH.sub.2).sub.6C(O)-- or
--C(O)(CH.sub.2).sub.2S.sub.2(CH.sub.2).sub.2C(O)--, and R is
--(CH.sub.2)OC(O)NH(CH.sub.2).sub.6NHC(NH)NH.sub.2;
[0034] R.sup.4 is selected from the group consisting of an electron
pair, hydrogen, a C.sub.1-C.sub.6 alkyl, and acyl, and
[0035] each R.sup.5 is independently selected from hydrogen or
methyl;
[0036] each R.sup.6 and each R.sup.7 is independently selected from
hydrogen or -T3-NR.sup.cR.sup.dR.sup.e; and
[0037] each of T.sup.1, T.sup.2, and T.sup.3 is independently an
optional linker of up to 18 atoms in length comprising alkyl,
alkoxy, or alkylamino groups, or combinations thereof,
[0038] wherein the targeting sequence is complementary to a region
within intron 1 (SEQ ID. NO. 1), intron 2 (SEQ ID. NO. 2), or exon
2 (SEQ ID. NO. 3) of a pre-mRNA of the human acid alpha-glucosidase
(GAA) gene.
[0039] In certain embodiments, the antisense oligomer of the
disclosure is a compound of formula (IV):
##STR00004##
or a pharmaceutically acceptable salt thereof, wherein:
[0040] each Nu is a nucleobase which taken together form a
targeting sequence;
[0041] x is an integer from 15 to 25;
[0042] each Y is O;
[0043] each R.sup.1 is independently selected from the group
consisting of:
##STR00005##
wherein at least one R.sup.1 is --N(CH.sub.3).sub.2, and
[0044] wherein the targeting sequence is selected from SEQ ID NOS:
4-120, wherein X is selected from uracil (U) or thymine (T).
[0045] In certain embodiments, the antisense oligomer further
comprises a peptide moiety which enhances cellular uptake.
[0046] Also included within the scope of the disclosure are
antisense oligomer, comprising a targeting sequence of sufficient
length and complementarity to specifically hybridize to a region
within intron 1 (SEQ ID NO:1), exon 2 (SEQ ID NO:2), or intron 2
(SEQ ID NO:3) of the pre-mRNA of the human acid alpha-glucosidase
(GAA) gene, as set forth in Table 2. In some embodiments, the
targeting sequence comprises at least 10 contiguous nucleotides of
a targeting sequence selected from SEQ ID. NOS: 4 to 120, wherein X
is selected from uracil (U) or thymine (T). In certain embodiments,
the targeting sequence comprises 80% sequence identity to a
targeting sequence selected from SEQ ID. NOS: 4 to 120, wherein X
is selected from uracil (U) or thymine (T).
[0047] In particular embodiments, the antisense oligomer is a
phosphoramidate or phosphorodiamidate morpholino oligomer (PMO), a
PMO-X, a PPMO, a peptide nucleic acid (PNA), a locked nucleic acid
(LNA), a phosphorothioate oligomer, a tricyclo-DNA oligomer, a
tricyclo-phosphorothioate oligomer, a 2'O-Me-modified oligomer, or
any combination of the foregoing.
[0048] Also included are pharmaceutical compositions, comprising a
physiologically-acceptable carrier and an antisense oligomer
described herein.
[0049] Certain embodiments also include methods of increasing the
level of exon 2-containing acid alpha-glucosidase (GAA) mRNA in a
cell, comprising contacting the cell with an antisense oligomer of
sufficient length and complementarity to specifically hybridize to
a region within the pre-mRNA of the GAA gene, wherein binding of
the antisense oligomer to the region increases the level of exon
2-containing GAA mRNA in the cell.
[0050] In some embodiments, the level of exon 2-containing GAA mRNA
in the cell is increased by at least about 10% relative to a
control. In certain embodiments, the level of functional GAA
protein in the cell is increased by at least about 10% relative to
a control. In certain embodiments, the cell has an IVS1-13T>G
mutation in one or more alleles of its genome which (in the absence
of antisense treatment) causes reduced expression of exon
2-containing GAA mRNA.
[0051] In some embodiments, the cell is in a subject in need
thereof, and the method comprises administering the antisense
oligomer to the subject. In some embodiments, the subject has or is
at risk for having glycogen storage disease type II (GSD-II). Some
embodiments of the disclosure relate to methods of treating
glycogen storage disease type II (GSD-II; Pompe disease) in a
subject in need thereof, comprising administering to the subject an
effective amount of an antisense oligomer of the disclosure. While
certain embodiments relate to antisense oligomers for use in the
preparation of a medicament for the treatment of glycogen storage
disease type II (GSD-II; Pompe disease).
[0052] In certain embodiments, the subject has or is at risk for
having infantile GSD-II. In particular embodiments, the subject has
or is at risk for having late onset GSD-II. In certain embodiments,
the method comprises reducing the glycogen levels in one or more
tissues of the subject by at least about 10% relative to a
control.
[0053] In addition, the instant disclosure also includes a method
of detecting exon 2 inclusion in a human acid alpha-glucosidase
(GAA) gene mRNA, the method comprising:
[0054] amplifying the GAA mRNA with at least one polymerase chain
reaction primer comprising a base sequence selected from the group
consisting of SEQ ID NOS: 121, 122, or 123.
[0055] These and other aspects of the present disclosure will
become apparent upon reference to the following detailed
description and attached drawings. All references disclosed herein
are hereby incorporated by reference in their entirety as if each
was incorporated individually.
BRIEF DESCRIPTION OF THE DRAWINGS
[0056] FIG. 1 illustrates one mechanism by which steric-blocking
antisense oligomers can enhance the level of exon 2-containing GAA
mRNA relative to exon-deleted GAA mRNA.
[0057] FIG. 2 shows the .about.1177 base PCR amplification product
from the wild-type GAA gene containing exon 2, using primers
directed to exon1 (forward) and exon3 (reverse) (see Example
2).
[0058] FIGS. 3A-3C show the results for the 2'-O-methyl modified
antisense oligomers from Table E1 of Example 2. FIG. 3A shows that
oligomers 9 (GAA-IVS1 (-74-55)) and 12 GAA-IVS1 (-158-140)) induced
exon 2-inclusion in human cells carrying the IVS1-13G>T
mutation, as evidenced by reduced amplification of the .about.600
base amplicon (relative to the full-length .about.1177 base
amplicon). FIG. 3B shows that oligomer 14 (GAA-IVS2 (-53-72))
induced exon-2 inclusion, and FIG. 3C shows that oligomers 20
(GAA-IVS2 (-173-192)) and 22 (GAA-IVS2 (-338-364)) likewise induced
a degree of exon-2 inclusion.
[0059] FIGS. 4A-4C show the RT-PCR results for the PMO antisense
oligomers of Table 4A.
DETAILED DESCRIPTION
I. Definitions
[0060] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by those
of ordinary skill in the art to which the disclosure belongs.
Although any methods and materials similar or equivalent to those
described herein can be used in the practice or testing of the
subject matter of the present disclosure, preferred methods and
materials are described. For the purposes of the present
disclosure, the following terms are defined below.
[0061] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0062] By "about" is meant a quantity, level, value, number,
frequency, percentage, dimension, size, amount, weight or length
that varies by as much as 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3,
2 or 1% to a reference quantity, level, value, number, frequency,
percentage, dimension, size, amount, weight or length.
[0063] By "coding sequence" is meant any nucleic acid sequence that
contributes to the code for the polypeptide product of a gene. By
contrast, the term "non-coding sequence" refers to any nucleic acid
sequence that does not directly contribute to the code for the
polypeptide product of a gene.
[0064] Throughout this disclosure, unless the context requires
otherwise, the words "comprise," "comprises," and "comprising" will
be understood to imply the inclusion of a stated step or element or
group of steps or elements but not the exclusion of any other step
or element or group of steps or elements.
[0065] By "consisting of" is meant including, and limited to,
whatever follows the phrase "consisting of:" Thus, the phrase
"consisting of" indicates that the listed elements are required or
mandatory, and that no other elements may be present. By
"consisting essentially of" is meant including any elements listed
after the phrase, and limited to other elements that do not
interfere with or contribute to the activity or action specified in
the disclosure for the listed elements. Thus, the phrase
"consisting essentially of" indicates that the listed elements are
required or mandatory, but that other elements are optional and may
or may not be present depending upon whether or not they materially
affect the activity or action of the listed elements.
[0066] As used herein, the terms "contacting a cell", "introducing"
or "delivering" include delivery of the oligomers of the disclosure
into a cell by methods routine in the art, e.g., transfection
(e.g., liposome, calcium-phosphate, polyethyleneimine),
electroporation (e.g., nucleofection), microinjection).
[0067] As used herein, the term "alkyl" is intended to include
linear (i.e., unbranched or acyclic), branched, cyclic, or
polycyclic non aromatic hydrocarbon groups, which are optionally
substituted with one or more functional groups. Unless otherwise
specified, "alkyl" groups contain one to eight, and preferably one
to six carbon atoms. C.sub.1-C.sub.6 alkyl, is intended to include
C.sub.1, C.sub.2, C.sub.3, C.sub.4, C.sub.5, and C.sub.6 alkyl
groups. Lower alkyl refers to alkyl groups containing 1 to 6 carbon
atoms. Examples of Alkyl include, but are not limited to, methyl,
ethyl, n-propyl, isopropyl, cyclopropyl, butyl, isobutyl,
sec-butyl, tert-butyl, cyclobutyl, pentyl, isopentyl tert-pentyl,
cyclopentyl, hexyl, isohexyl, cyclohexyl, etc. Alkyl may be
substituted or unsubstituted. Illustrative substituted alkyl groups
include, but are not limited to, fluoromethyl, difluoromethyl,
trifluoromethyl, 2-fluoroethyl, 3-fluoropropyl, hydroxymethyl,
2-hydroxyethyl, 3-hydroxypropyl, benzyl, substituted benzyl,
phenethyl, substituted phenethyl, etc.
[0068] As used herein, the term "Alkoxy" means a subset of alkyl in
which an alkyl group as defined above with the indicated number of
carbons attached through an oxygen bridge. For example, "alkoxy"
refers to groups --O-alkyl, wherein the alkyl group contains 1 to 8
carbons atoms of a linear, branched, cyclic configuration. Examples
of "alkoxy" include, but are not limited to, methoxy, ethoxy,
n-propoxy, i-propoxy, t-butoxy, n-butoxy, s-pentoxy and the
like.
[0069] As used herein, the term "aryl" used alone or as part of a
larger moiety as in "aralkyl", "aralkoxy", or "aryloxy-alkyl",
refers to aromatic ring groups having six to fourteen ring atoms,
such as phenyl, 1-naphthyl, 2-naphthyl, 1-anthracyl and
2-anthracyl. An "aryl" ring may contain one or more substituents.
The term "aryl" may be used interchangeably with the term "aryl
ring". "Aryl" also includes fused polycyclic aromatic ring systems
in which an aromatic ring is fused to one or more rings.
Non-limiting examples of useful aryl ring groups include phenyl,
hydroxyphenyl, halophenyl, alkoxyphenyl, dialkoxyphenyl,
trialkoxyphenyl, alkylenedioxyphenyl, naphthyl, phenanthryl,
anthryl, phenanthro and the like, as well as 1-naphthyl,
2-naphthyl, 1-anthracyl and 2-anthracyl. Also included within the
scope of the term "aryl", as it is used herein, is a group in which
an aromatic ring is fused to one or more non-aromatic rings, such
as in a indanyl, phenanthridinyl, or tetrahydronaphthyl, where the
radical or point of attachment is on the aromatic ring.
[0070] The term "acyl" means a C(O)R group (in which R signifies H,
alkyl or aryl as defined above). Examples of acyl groups include
formyl, acetyl, benzoyl, phenylacetyl and similar groups.
[0071] The term "homolog" as used herein means compounds differing
regularly by the successive addition of the same chemical group.
For example, a homolog of a compound may differ by the addition of
one or more --CH.sub.2-- groups, amino acid residues, nucleotides,
or nucleotide analogs.
[0072] The terms "cell penetrating peptide" (CPP) or "a peptide
moiety which enhances cellular uptake" are used interchangeably and
refer to cationic cell penetrating peptides, also called "transport
peptides", "carrier peptides", or "peptide transduction domains".
The peptides, as shown herein, have the capability of inducing cell
penetration within about or at least about 30%, 40%, 50%, 60%, 70%,
80%, 90%, or 100% of cells of a given cell culture population and
allow macromolecular translocation within multiple tissues in vivo
upon systemic administration. In some embodiments, the CPPs are of
the formula --[(C(O)CHR'NH).sub.m]R'' wherein R' is a side chain of
a naturally occurring amino acid or a one- or two-carbon homolog
thereof, R'' is selected from Hydrogen or acyl, and m is an integer
up to 50. Additional CPPs are well-known in the art and are
disclosed, for example, in U.S. Application No. 2010/0016215, which
is incorporated by reference in its entirety. In other embodiments,
m is an integer selected from 1 to 50 where, when m is 1, the
moiety is a single amino acid or derivative thereof.
[0073] As used herein, "amino acid" refers to a compound consisting
of a carbon atom to which are attached a primary amino group, a
carboxylic acid group, a side chain, and a hydrogen atom. For
example, the term "amino acid" includes, but is not limited to,
Glycine, Alanine, Valine, Leucine, Isoleucine, Asparagine,
Glutamine, Lysine and Arginine. Additionally, as used herein,
"amino acid" also includes derivatives of amino acids such as
esters, and amides, and salts, as well as other derivatives,
including derivatives having pharmacoproperties upon metabolism to
an active form. Accordingly, the term "amino acid" is understood to
include naturally occurring and non-naturally occurring amino
acids.
[0074] "An electron pair" refers to a valence pair of electrons
that are not bonded or shared with other atoms.
[0075] "Homology" refers to the percentage number of amino acids
that are identical or constitute conservative substitutions.
Homology may be determined using sequence comparison programs such
as GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395).
In this way sequences of a similar or substantially different
length to those cited herein could be compared by insertion of gaps
into the alignment, such gaps being determined, for example, by the
comparison algorithm used by GAP.
[0076] By "isolated" is meant material that is substantially or
essentially free from components that normally accompany it in its
native state. For example, an "isolated polynucleotide," "isolated
oligonucleotide," or "isolated oligomer" as used herein, may refer
to a polynucleotide that has been purified or removed from the
sequences that flank it in a naturally-occurring state, e.g., a DNA
fragment that is removed from the sequences that are adjacent to
the fragment in the genome. The term "isolating" as it relates to
cells refers to the purification of cells (e.g., fibroblasts,
lymphoblasts) from a source subject (e.g., a subject with a
polynucleotide repeat disease). In the context of mRNA or protein,
"isolating" refers to the recovery of mRNA or protein from a
source, e.g., cells.
[0077] The terms "modulate" includes to "increase" or "decrease"
one or more quantifiable parameters, optionally by a defined and/or
statistically significant amount. By "increase" or "increasing,"
"enhance" or "enhancing," or "stimulate" or "stimulating," refers
generally to the ability of one or more antisense compounds or
compositions to produce or cause a greater physiological response
(i.e., downstream effects) in a cell or a subject relative to the
response caused by either no antisense compound or a control
compound. Relevant physiological or cellular responses (in vivo or
in vitro) will be apparent to persons skilled in the art, and may
include increases in the inclusion of exon 2 in a GAA-coding
pre-mRNA, or increases in the expression of functional GAA enzyme
in a cell, tissue, or subject in need thereof. An "increased" or
"enhanced" amount is typically a "statistically significant"
amount, and may include an increase that is 1.1, 1.2, 2, 3, 4, 5,
6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more times (e.g., 500, 1000
times), including all integers and decimal points in between and
above 1 (e.g., 1.5, 1.6, 1.7. 1.8), the amount produced by no
antisense compound (the absence of an agent) or a control compound.
The term "reduce" or "inhibit" may relate generally to the ability
of one or more antisense compounds or compositions to "decrease" a
relevant physiological or cellular response, such as a symptom of a
disease or condition described herein, as measured according to
routine techniques in the diagnostic art. Relevant physiological or
cellular responses (in vivo or in vitro) will be apparent to
persons skilled in the art, and may include reductions in the
symptoms or pathology of a glycogen storage disease such as Pompe
disease, for example, a decrease in the accumulation of glycogen in
one or more tissues. A "decrease" in a response may be
"statistically significant" as compared to the response produced by
no antisense compound or a control composition, and may include a
1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%,
16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease, including all
integers in between.
[0078] As used herein, an "antisense oligonucleotide," "antisense
oligomer" or "oligonucleotide" refers to a linear sequence of
nucleotides, or nucleotide analogs, which allows the nucleobase to
hybridize to a target sequence in an RNA by Watson-Crick base
pairing, to form an oligomer:RNA heteroduplex within the target
sequence. The terms "antisense oligonucleotide", "antisense
oligomer", "oligomer" and "compound" may be used interchangeably to
refer to an oligomer. The cyclic subunits may be based on ribose or
another pentose sugar or, in certain embodiments, a morpholino
group (see description of morpholino oligomers below). Also
contemplated are peptide nucleic acids (PNAs), locked nucleic acids
(LNAs), tricyclo-DNA oligomers, tricyclo-phosphorothioate
oligomers, and 2'-O-Methyl oligomers, among other antisense agents
known in the art.
[0079] Included are non-naturally-occurring oligomers, or
"oligonucleotide analogs," including oligomers having (i) a
modified backbone structure, e.g., a backbone other than the
standard phosphodiester linkage found in naturally-occurring oligo-
and polynucleotides, and/or (ii) modified sugar moieties, e.g.,
morpholino moieties rather than ribose or deoxyribose moieties.
Oligomer analogs support bases capable of hydrogen bonding by
Watson-Crick base pairing to standard polynucleotide bases, where
the analog backbone presents the bases in a manner to permit such
hydrogen bonding in a sequence-specific fashion between the
oligomer analog molecule and bases in a standard polynucleotide
(e.g., single-stranded RNA or single-stranded DNA). Preferred
analogs are those having a substantially uncharged, phosphorus
containing backbone.
[0080] A "nuclease-resistant" oligomer refers to one whose backbone
is substantially resistant to nuclease cleavage, in non-hybridized
or hybridized form; by common extracellular and intracellular
nucleases in the body (for example, by exonucleases such as
3'-exonucleases, endonucleases, RNase H); that is, the oligomer
shows little or no nuclease cleavage under normal nuclease
conditions in the body to which the oligomer is exposed. A
"nuclease-resistant heteroduplex" refers to a heteroduplex formed
by the binding of an antisense oligomer to its complementary
target, such that the heteroduplex is substantially resistant to in
vivo degradation by intracellular and extracellular nucleases,
which are capable of cutting double-stranded RNA/RNA or RNA/DNA
complexes. A "heteroduplex" refers to a duplex between an antisense
oligomer and the complementary portion of a target RNA.
[0081] As used herein, "nucleobase" (Nu), "base pairing moiety" or
"base" are used interchangeably to refer to a purine or pyrimidine
base found in native DNA or RNA (uracil, thymine, adenine,
cytosine, and guanine), as well as analogs of the naturally
occurring purines and pyrimidines, that confer improved properties,
such as binding affinity to the oligomer. Exemplary analogs include
hypoxanthine (the base component of the nucleoside inosine);
2,6-diaminopurine; 5-methyl cytosine; C5-propynyl-modified
pyrimidines; 9-(aminoethoxy)phenoxazine (G-clamp) and the like.
[0082] Further examples of base pairing moieties include, but are
not limited to, uracil, thymine, adenine, cytosine, guanine and
hypoxanthine having their respective amino groups protected by acyl
protecting groups, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil,
5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs
such as pseudoisocytosine and pseudouracil and other modified
nucleobases such as 8-substituted purines, xanthine, or
hypoxanthine (the latter two being the natural degradation
products). The modified nucleobases disclosed in Chiu and Rana,
RNA, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research,
1994, 22, 2183-2196 and Revankar and Rao, Comprehensive Natural
Products Chemistry, vol. 7, 313, are also contemplated.
[0083] Further examples of base pairing moieties include, but are
not limited to, expanded-size nucleobases in which one or more
benzene rings has been added. Nucleic base replacements described
in the Glen Research catalog (www.glenresearch.com); Krueger A T et
al, Acc. Chem. Res., 2007, 40, 141-150; Kool, E T, Acc. Chem. Res.,
2002, 35, 936-943; Benner S. A., et al., Nat. Rev. Genet., 2005, 6,
553-543; Romesberg, F. E., et al., Curr. Opin. Chem. Biol., 2003,
7, 723-733; Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627,
are contemplated as useful for the synthesis of the oligomers
described herein. Examples of expanded-size nucleobases are shown
below:
##STR00006##
[0084] A nucleobase covalently linked to a ribose, sugar analog or
morpholino comprises a nucleoside. "Nucleotides" are composed of a
nucleoside together with one phosphate group. The phosphate groups
covalently link adjacent nucleotides to one another to form an
oligomer.
[0085] An oligomer "specifically hybridizes" to a target
polynucleotide if the oligomer hybridizes to the target under
physiological conditions, with a Tm substantially greater than
40.degree. C. or 45.degree. C., preferably at least 50.degree. C.,
and typically 60.degree. C.-80.degree. C. or higher. Such
hybridization preferably corresponds to stringent hybridization
conditions. At a given ionic strength and pH, the Tm is the
temperature at which 50% of a target sequence hybridizes to a
complementary polynucleotide. Such hybridization may occur with
"near" or "substantial" complementarity of the antisense oligomer
to the target sequence, as well as with exact complementarity.
[0086] As used herein, "sufficient length" refers to an antisense
oligomer that is complementary to at least 8, more typically 8-40,
contiguous nucleobases in a region of GAA intron 1, exon 2, or
intron 2, or a region spanning any of the foregoing. An antisense
oligomer of sufficient length has at least a minimal number of
nucleotides to be capable of specifically hybridizing to a region
of the GAA pre-mRNA repeat in the mutant RNA. Preferably an
oligomer of sufficient length is from 8 to 30 nucleotides in
length. More preferably, an oligomer of sufficient length is from 9
to 27 nucleotides in length.
[0087] The terms "sequence identity" or, for example, comprising a
"sequence 50% identical to," as used herein, refer to the extent
that sequences are identical on a nucleotide-by-nucleotide basis or
an amino acid-by-amino acid basis over a window of comparison.
Thus, a "percentage of sequence identity" may be calculated by
comparing two optimally aligned sequences over the window of
comparison, determining the number of positions at which the
identical nucleic acid base (e.g., A, T, C, G, I) or the identical
amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile,
Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met)
occurs in both sequences to yield the number of matched positions,
dividing the number of matched positions by the total number of
positions in the window of comparison (i.e., the window size), and
multiplying the result by 100 to yield the percentage of sequence
identity. Optimal alignment of sequences for aligning a comparison
window may be conducted by computerized implementations of
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin
Genetics Software Package Release 7.0, Genetics Computer Group, 575
Science Drive Madison, Wis., USA) or by inspection and the best
alignment (i.e., resulting in the highest percentage homology over
the comparison window) generated by any of the various methods
selected. Reference also may be made to the BLAST family of
programs as for example disclosed by Altschul et al., Nucl. Acids
Res. 25:3389, 1997.
[0088] A "subject" or a "subject in need thereof" includes a
mammalian subject such as a human subject. Exemplary mammalian
subjects have or are at risk for having GSD-II (or Pompe disease).
As used herein, the term "GSD-II" refers to glycogen storage
disease type II (GSD-II or Pompe disease), a human autosomal
recessive disease that is often characterized by under expression
of GAA protein in affected individuals. In certain embodiments, a
subject has reduced expression and/or activity of GAA protein in
one or more tissues, for example, heart, skeletal muscle, liver,
and nervous system tissues. In some embodiments, the subject has
increased accumulation of glycogen in one or more tissues, for
example, heart, skeletal muscle, liver, and nervous system tissues.
In specific embodiments, the subject has a IVS1-13T>G mutation
or other mutation that leads to reduced expression of functional
GAA protein (see, e.g., Zampieri et al., European J. Human
Genetics. 19:422-431, 2011).
[0089] As used herein, the term "target" refers to a RNA region,
and specifically, to a region identified by the GAA gene. In a
particular embodiment the target is a region within intron 1 or
intron 2 of the GAA-coding pre-mRNA, which is responsible for
suppression of a signal that promotes exon 2 inclusion. In another
embodiment the target region is a region of the mRNA of GAA exon
2.
[0090] The term "target sequence" refers to a portion of the target
RNA against which the oligomer analog is directed, that is, the
sequence to which the oligomer analog will hybridize by
Watson-Crick base pairing of a complementary sequence.
[0091] The term "targeting sequence" is the sequence in the
oligomer or oligomer analog that is complementary (meaning, in
addition, substantially complementary) to the "target sequence" in
the RNA genome. The entire sequence, or only a portion, of the
antisense oligomer may be complementary to the target sequence. For
example, in an oligomer having 20-30 bases, about 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, or 29 may be targeting sequences that are complementary to the
target region. Typically, the targeting sequence is formed of
contiguous bases in the oligomer, but may alternatively be formed
of non-contiguous sequences that when placed together, e.g., from
opposite ends of the oligomer, constitute sequence that spans the
target sequence.
[0092] A "targeting sequence" may have "near" or "substantial"
complementarity to the target sequence and still function for the
purpose of the present disclosure, that is, still be
"complementary." Preferably, the oligomer analog compounds employed
in the present disclosure have at most one mismatch with the target
sequence out of 10 nucleotides, and preferably at most one mismatch
out of 20. Alternatively, the antisense oligomers employed have at
least 90% sequence homology, and preferably at least 95% sequence
homology, with the exemplary targeting sequences as designated
herein.
[0093] As used herein, the term "quantifying", "quantification" or
other related words refer to determining the quantity, mass, or
concentration in a unit volume, of a nucleic acid, polynucleotide,
oligomer, peptide, polypeptide, or protein.
[0094] As used herein, "treatment" of a subject (e g a mammal, such
as a human) or a cell is any type of intervention used in an
attempt to alter the natural course of the individual or cell.
Treatment includes, but is not limited to, administration of a
pharmaceutical composition, and may be performed either
prophylactically or subsequent to the initiation of a pathologic
event or contact with an etiologic agent. Also included are
"prophylactic" treatments, which can be directed to reducing the
rate of progression of the disease or condition being treated,
delaying the onset of that disease or condition, or reducing the
severity of its onset. "Treatment" or "prophylaxis" does not
necessarily indicate complete eradication, cure, or prevention of
the disease or condition, or associated symptoms thereof.
II. Sequences for Splice Modulation of GAA
[0095] Certain embodiments relate to methods for enhancing the
level of exon 2-containing GAA-coding mRNA relative to exon-2
deleted GAA mRNA in a cell, comprising contacting the cell with an
antisense oligomer of sufficient length and complementarity to
specifically hybridize to a region within the GAA gene, such that
the level of exon 2-containing GAA mRNA relative to exon-2 deleted
GAA mRNA in the cell is enhanced. In some embodiments, the cell is
in a subject, and the method comprises administering to the
antisense oligomer to the subject.
[0096] An antisense oligomer can be designed to block or inhibit or
modulate translation of mRNA or to inhibit or modulate pre-mRNA
splice processing, or induce degradation of targeted mRNAs, and may
be said to be "directed to" or "targeted against" a target sequence
with which it hybridizes. In certain embodiments, the target
sequence includes a region including a 3' or 5' splice site of a
pre-processed mRNA, a branch point, or other sequence involved in
the regulation of splicing. The target sequence may be within an
exon or within an intron or spanning an intron/exon junction.
[0097] In certain embodiments, the antisense oligomer has
sufficient sequence complementarity to a target RNA (i.e., the RNA
for which splice site selection is modulated) to block a region of
a target RNA (e.g., pre-mRNA) in an effective manner. In exemplary
embodiments, such blocking of GAA pre-mRNA serves to modulate
splicing, either by masking a binding site for a native protein
that would otherwise modulate splicing and/or by altering the
structure of the targeted RNA. In some embodiments, the target RNA
is target pre-mRNA (e.g., GAA gene pre-mRNA).
[0098] An antisense oligomer having a sufficient sequence
complementarity to a target RNA sequence to modulate splicing of
the target RNA means that the antisense agent has a sequence
sufficient to trigger the masking of a binding site for a native
protein that would otherwise modulate splicing and/or alters the
three-dimensional structure of the targeted RNA. Likewise, an
oligomer reagent having a sufficient sequence complementary to a
target RNA sequence to modulate splicing of the target RNA means
that the oligomer reagent has a sequence sufficient to trigger the
masking of a binding site for a native protein that would otherwise
modulate splicing and/or alters the three-dimensional structure of
the targeted RNA.
[0099] In certain embodiments, the antisense oligomer has
sufficient length and complementarity to a sequence in intron 1 of
the human GAA pre-mRNA, exon 2 of the human GAA pre-mRNA, or intron
2 of the human GAA pre-mRNA. Also included are antisense oligomers
which are complementary to a region that spans intron 1/exon 2 of
the human GAA pre-mRNA, or a region that spans exon 2/intron 2 of
the human GAA pre-mRNA. The intron 1 (SEQ ID NO:1), exon 2 (SEQ ID
NO:2), and intron 2 (SEQ ID NO:3) sequences for human the GAA gene
are shown in Table 1 below (The highlighted T/G near the 3' end of
SEQ ID NO:1 is the IVS1-13T>G mutation described above; the
nucleotide at this position is either T or G).
TABLE-US-00001 TABLE 1 Target sequences for GAA-targeted oligomers
(from NG_009822) SEQ Name Sequence (5'-3') ID NO GAA-
GTGAGACACCTGACGTCTGCCCCGCGCTGCCGGCGGTAACATCCCAGAAGCGGGTTTGAA 1 IVS1
CGTGCCTAGCCGTGCCCCCAGCCTCTTCCCCTGAGCGGAGCTTGAGCCCCAGACCTCTAG
TCCTCCCGGTCTTTATCTGAGTTCAGCTTAGAGATGAACGGGGAGCCGCCCTCCTGTGCT
GGGCTTGGGGCTGGAGGCTGCATCTTCCCGTTTCTAGGGTTTCCTTTCCCCTTTTGATCG
ACGCAGTGCTCAGTCCTGGCCGGGACCCGAGCCACCTCTCCTGCTCCTGCAGGACGCACA
TGGCTGGGTCTGAATCCCTGGGGTGAGGAGCACCGTGGCCTGAGAGGGGGCCCCTGGGCC
AGCTCTGAAATCTGAATGTCTCAATCACAAAGACCCCCTTAGGCCAGGCCAGGGGTGACT
GTCTCTGGTCTTTGTCCCTGGTTGCTGGCACATAGCACCCGAAACCCTTGGAAACCGAGT
GATGAGAGAGCCTTTTGCTCATGAGGTGACTGATGACCGGGGACACCAGGTGGCTTCAGG
ATGGAAGCAGATGGCCAGAAAGACCAAGGCCTGATGACGGGTTGGGATGGAAAAGGGGTG
AGGGGCTGGAGATTGAGTGAATCACCAGTGGCTTAGTCAACCATGCCTGCACAATGGAAC
CCCGTAAGAAACCACAGGGATCAGAGGGCTTCCCGCCGGGTTGTGGAACACACCAAGGCA
CTGGAGGGTGGTGCGAGCAGAGAGCACAGCATCACTGCCCCCACCTCACACCAGGCCCTA
CGCATCTCTTCCATACGGCTGTCTGAGTTTTATCCTTTGTAATAAACCAGCAACTGTAAG
AAACGCACTTTCCTGAGTTCTGTGACCCTGAAGAGGGAGTCCTGGGAACCTCTGAATTTA
TAACTAGTTGATCGAAAGTACAAGTGACAACCTGGGATTTGCCATTGGCCTCTGAAGTGA
AGGCAGTGTTGTGGGACTGAGCCCTTAACCTGTGGAGTCTGTGCTGACTCCAGGTAGTGT
CAAGATTGAATTGAATTGTAGGACACCCAGCCGTGTCCAGAAAGTTGCAGAATTGATGGG
TGTGAGAAAAACCCTACACATTTAATGTCAGAAGTGTGGGTAAAATGTTTCACCCTCCAG
CCCAGAGAGCCCTAATTTACCAGTGGCCCACGGTGGAACACCACGTCCGGCCGGGGGCAG
AGCGTTCCCAGCCAAGCCTTCTGTAACATGACATGACAGGTCAGACTCCCTCGGGCCCTG
AGTTCACTTCTTCCTGGTATGTGACCAGCTCCCAGTACCAGAGAAGGTTGCACAGTCCTC
TGCTCCAAGGAGCTTCACTGGCCAGGGGCTGCTTTCTGAAATCCTTGCCTGCCTCTGCTC
CAAGGCCCGTTCCTCAGAGACGCAGACCCCTCTGATGGCTGACTTTGGTTTGAGGACCTC
TCTGCATCCCTCCCCCATGGCCTTGCTCCTAGGACACCTTCTTCCTCCTTTCCCTGGGGT
CAGACTTGCCTAGGTGCGGTGGCTCTCCCAGCCTTCCCCACGCCCTCCCCATGGTGTATT
ACACACACCAAAGGGACTCCCCTATTGAAATCCATGCATATTGAATCGCATGTGGGTTCC
GGCTGCTCCTGGGAGGAGCCAGGCTAATAGAATGTTTGCCATAAAATATTAATGTACAGA
GAAGCGAAACAAAGGTCGTTGGTACTTGTTAACCTTACCAGCAGAATAATGAAAGCGAAC
CCCCATATCTCATCTGCACGCGACATCCTTGTTGTGTCTGTACCCGAGGCTCCAGGTGCA
GCCACTGTTACAGAGACTGTGTTTCTTCCCCATGTACCTCGGGGGCCGGGAGGGGTTCTG
ATCTGCAAAGTCGCCAGAGGTTAAGTCCTTTCTCTCTTGTGGCTTTGCCACCCCTGGAGT
GTCACCCTCAGCTGCGGTGCCCAGGATTCCCCACTGTGGTATGTCCGTGCACCAGTCAAT
AGGAAAGGGAGCAAGGAAAGGTACTGGGTCCCCCTAAGGACATACGAGTTGCCAGAATCA
CTTCCGCTGACACCCAGTGGACCAAGCCGCACCTTTATGCAGAAGTGGGGCTCCCAGCCA
GGCGTGGTCACTCCTGAAATCCCAGCACTTCGGAAGGCCAAGGGGGGTGGATCACTTGAG
CTCAGGAGTTCGAGACCAGCCTGGGTAACATGGCAAAATCCCGTCTCTACAAAAATACAG
AAAATTAGCTGGGTGCGGTGGTGTGTGCCTACAGTCCCAGCTACTCAGGAGGCTGAAGTG
GGAGGATTGCTTGAGTCTGGGAGGTGGAGGTTGCAGTGAGCCAGGATCTCACCACAGCAC
TCTGGCCCAGGCGACAGCTGTTTGGCCTGTTTCAAGTGTCTACCTGCCTTGCTGGTCTTC
CTGGGGACATTCTAAGCGTGTTTGATTTGTAACATTTTAGCAGACTGTGCAAGTGCTCTG
CACTCCCCTGCTGGAGCTTTTCTCGCCCTTCCTTCTGGCCCTCTCCCCAGTCTAGACAGC
AGGGCAACACCCACCCTGGCCACCTTACCCCACCTGCCTGGGTGCTGCAGTGCCAGCCGC
GGTTGATGTCTCAGAGCTGCTTTGAGAGCCCCGTGAGTGCCGCCCCTCCCGCCTCCCTGC
TGAGCCCGCTTT/GCTTCTCCCGCAG GAA-
GCCTGTAGGAGCTGTCCAGGCCATCTCCAACCATGGGAGTGAGGCACCCGCCCTGCTCCC 2
exon2 ACCGGCTCCTGGCCGTCTGCGCCCTCGTGTCCTTGGCAACCGCTGCACTCCTGGGGCACA
TCCTACTCCATGATTTCCTGCTGGTTCCCCGAGAGCTGAGTGGCTCCTCCCCAGTCCTGG
AGGAGACTCACCCAGCTCACCAGCAGGGAGCCAGCAGACCAGGGCCCCGGGATGCCCAGG
CACACCCCGGCCGTCCCAGAGCAGTGCCCACACAGTGCGACGTCCCCCCCAACAGCCGCT
TCGATTGCGCCCCTGACAAGGCCATCACCCAGGAACAGTGCGAGGCCCGCGGCTGTTGCT
ACATCCCTGCAAAGCAGGGGCTGCAGGGAGCCCAGATGGGGCAGCCCTGGTGCTTCTTCC
CACCCAGCTACCCCAGCTACAAGCTGGAGAACCTGAGCTCCTCTGAAATGGGCTACACGG
CCACCCTGACCCGTACCACCCCCACCTTCTTCCCCAAGGACATCCTGACCCTGCGGCTGG
ACGTGATGATGGAGACTGAGAACCGCCTCCACTTCACG GAA-
GTGGGCAGGGCAGGGGCGGGGGCGGCGGCCAGGGCAGAGGGTGCGCGTGGACATCGACAC 3 IVS2
CCACGCACCTCACAAGGGTGGGGTGCATGTTGCACCACTGTGTGCTGGGCCCTTGCTGGG
AGCGGAGGTGTGAGCAGACAATGGCAGCGCCCCTCGGGGAGCAGTGGGGACACCACGGTG
ACAGGTACTCCAGAAGGCAGGGCTCGGGGCTCATTCATCTTTATGAAAAGGTGGGTCAGG
TAGAGTAGGGCTGCCAGAGGTTGCGAATGAAAACAGGATGCCCAGTAAACCCGAATTGCA
GATACCCCAGGCATGACTTTGTTTTTTTGTGTAAGGATGCAAAATTTGGGATGTATTTAT
ACTAGAAAAGCTGCTTGTTGTTTATCTGAAATTCAGAGTTATCAGGTGTTCTGTATTTTA
CCTCCATCCTGGGGGAGGCGTCCTCCTCCTGGCTCTGCAGATGAGGGAGCCGAGGCTCAG
AGAGGCTGAATGTGCTGCCCATGGTCCCACATCCATGTGTGGCTGCACCAGGACCTGACC
TGTCCTTGGCGTGCGGGTTGTTCTCTGGAGAGTAAGGTGGCTGTGGGGAACATCAATAAA
CCCCCATCTCTTCTAG
[0100] In certain embodiments, antisense targeting sequences are
designed to hybridize to a region of one or more of the target
sequences listed in Table 1. Selected antisense targeting sequences
can be made shorter, e.g., about 12 bases, or longer, e.g., about
40 bases, and include a small number of mismatches, as long as the
sequence is sufficiently complementary to effect splice modulation
upon hybridization to the target sequence, and optionally forms
with the RNA a heteroduplex having a Tm of 45.degree. C. or
greater.
[0101] In certain embodiments, the degree of complementarity
between the target sequence and antisense targeting sequence is
sufficient to form a stable duplex. The region of complementarity
of the antisense oligomers with the target RNA sequence may be as
short as 8-11 bases, but can be 12-15 bases or more, e.g., 10-40
bases, 12-30 bases, 12-25 bases, 15-25 bases, 12-20 bases, or 15-20
bases, including all integers in between these ranges. An antisense
oligomer of about 14-15 bases is generally long enough to have a
unique complementary sequence. In certain embodiments, a minimum
length of complementary bases may be required to achieve the
requisite binding Tm, as discussed herein.
[0102] In certain embodiments, oligomers as long as 40 bases may be
suitable, where at least a minimum number of bases, e.g., 10-12
bases, are complementary to the target sequence. In some
embodiments, facilitated or active uptake in cells is optimized at
oligomer lengths of less than about 30 bases. For PMO oligomers,
described further herein, an optimum balance of binding stability
and uptake generally occurs at lengths of 18-25 bases. Included in
the disclosure are antisense oligomers (e.g., PMOs, PMO-X, PNAs,
LNAs, 2'-OMe) that consist of about 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, or 40 bases, in which at least about 6, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40
contiguous or non-contiguous bases are complementary to the target
sequences of Table 1 (e.g., SEQ ID NOS:1-3, a sequence that spans
SEQ ID NOS:1/2 or SEQ ID NOS:2/3).
[0103] The antisense oligomers typically comprises a base sequence
which is sufficiently complementary to a sequence or region within
or adjacent to intron 1, exon 2, or intron 2 of the pre-mRNA
sequence of the human GAA gene. Ideally, an antisense oligomer is
able to effectively modulate aberrant splicing of the GAA pre-mRNA,
and thereby increase expression of active GAA protein. This
requirement is optionally met when the oligomer compound has the
ability to be actively taken up by mammalian cells, and once taken
up, form a stable duplex (or heteroduplex) with the target mRNA,
optionally with a Tm greater than about 40.degree. C. or 45.degree.
C.
[0104] In certain embodiments, antisense oligomers may be 100%
complementary to the target sequence, or may include mismatches,
e.g., to accommodate variants, as long as a heteroduplex formed
between the oligomer and target sequence is sufficiently stable to
withstand the action of cellular nucleases and other modes of
degradation which may occur in vivo. Hence, certain oligomers may
have substantial complementarity, meaning, about or at least about
70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%,
76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%
sequence complementarity, between the oligomer and the target
sequence. Oligomer backbones that are less susceptible to cleavage
by nucleases are discussed herein. Mismatches, if present, are
typically less destabilizing toward the end regions of the hybrid
duplex than in the middle. The number of mismatches allowed will
depend on the length of the oligomer, the percentage of G:C base
pairs in the duplex, and the position of the mismatch(es) in the
duplex, according to well understood principles of duplex
stability. Although such an antisense oligomer is not necessarily
100% complementary to the v target sequence, it is effective to
stably and specifically bind to the target sequence, such that
splicing of the target pre-RNA is modulated.
[0105] The stability of the duplex formed between an oligomer and a
target sequence is a function of the binding Tm and the
susceptibility of the duplex to cellular enzymatic cleavage. The Tm
of an oligomer with respect to complementary-sequence RNA may be
measured by conventional methods, such as those described by Hames
et al., Nucleic Acid Hybridization, IRL Press, 1985, pp. 107-108 or
as described in Miyada C. G. and Wallace R. B., 1987, Oligomer
Hybridization Techniques, Methods Enzymol. Vol. 154 pp. 94-107. In
certain embodiments, antisense oligomers may have a binding Tm,
with respect to a complementary-sequence RNA, of greater than body
temperature and preferably greater than about 45.degree. C. or
50.degree. C. Tm's in the range 60-80.degree. C. or greater are
also included. According to well-known principles, the Tm of an
oligomer, with respect to a complementary-based RNA hybrid, can be
increased by increasing the ratio of C:G paired bases in the
duplex, and/or by increasing the length (in base pairs) of the
heteroduplex. At the same time, for purposes of optimizing cellular
uptake, it may be advantageous to limit the size of the oligomer.
For this reason, compounds that show high Tm (45-50.degree. C. or
greater) at a length of 25 bases or less are generally preferred
over those requiring greater than 25 bases for high Tm values.
[0106] Table 2 below shows exemplary targeting sequences (in a
5'-to-3' orientation) that are fully complementary to the intron 1,
exon 2, or intron 2 pre-mRNA sequences of the human GAA gene.
TABLE-US-00002 TABLE 2 Antisense oligomer sequences for
GAA-targeted oligomers SEQ ID Name Sequence (5'-3') NO GAA Intron 1
Antisense Sequences GAA-IVS1(-39-20) GCXCAGCAGGGAGGCGGGAG 4
GAA-IVS1(-74-55) GGCXCXCAAAGCAGCXCXGA 5 GAA-IVS1(-99-75)
GACAXCAACCGCGGCXGGCACXGCA 6 GAA-IVS1(-139-115)
GGGXAAGGXGGCCAGGGXGGGXGXX 7 GAA-IVS1(-158-140) GCCCXGCXGXCXAGACXGG
8 GAA-IVS1(-179-160) GAGAGGGCCAGAAGGAAGGG 9 GAA-IVS1.4.20
GGGGCAGACGXCAGGXGXCX 26 GAA-IVS1.6.20 GCGGGGCAGACGXCAGGXGX 27
GAA-IVS1.8.20 GCGCGGGGCAGACGXCAGGX 28 GAA-IVS1.10.20
CAGCGCGGGGCAGACGXCAG 29 GAA-IVS1.12.20 GGCAGCGCGGGGCAGACGXC 30
GAA-IVS1.14.20 CCGGCAGCGCGGGGCAGACG 31 GAA-IVS1.15.20
GCCGGCAGCGCGGGGCAGAC 32 GAA-IVS1.17.20 CCGCCGGCAGCGCGGGGCAG 33
GAA-IVS1.21.20 GXXACCGCCGGCAGCGCGGG 34 GAA-IVS1.24.20
GAXGXXACCGCCGGCAGCGC 35 GAA-IVS1.26.20 GGGAXGXXACCGCCGGCAGC 36
GAA-IVS1.28.20 CXGGGAXGXXACCGCCGGCA 37 GAA-IVS1.30.20
XXCXGGGAXGXXACCGCCGG 38 GAA-IVS1.32.20 GCXXCXGGGAXGXXACCGCC 39
GAA-IVS1.2013.20 GCAACXCGXAXGXCCXXAGG 40 GAA-IVS1.2015.20
XGGCAACXCGXAXGXCCXXA 41 GAA-IVS1.2017.20 XCXGGCAACXCGXAXGXCCX 42
GAA-IVS1.2019.20 AXXCXGGCAACXCGXAXGXC 43 GAA-IVS1.2022.20
GXGAXXCXGGCAACXCGXAX 44 GAA-IVS1.2024.20 AAGXGAXXCXGGCAACXCGX 45
GAA-IVS1.2037.20 XGGGXGXCAGCGGAAGXGAX 46 GAA-IVS1.2041.20
CCACXGGGXGXCAGCGGAAG 47 GAA-IVS1.2043.20 GXCCACXGGGXGXCAGCGGA 48
GAA-IVS1.2045.20 XGGXCCACXGGGXGXCAGCG 49 GAA-IVS1.2048.20
GCXXGGXCCACXGGGXGXCA 50 GAA-IVS1.2069.20 CCACXXCXGCAXAAAGGXGC 51
GAA-IVS1.2071.20 CCCCACXXCXGCAXAAAGGX 52 GAA-IVS1.2073.20
AGCCCCACXXCXGCAXAAAG 53 GAA-IVS1.2075.20 GGAGCCCCACXXCXGCAXAA 54
GAA-IVS1.2077.20 XGGGAGCCCCACXXCXGCAX 55 GAA-IVS1.2079.20
GCXGGGAGCCCCACXXCXGC 56 GAA-IVS1.2081.20 XGGCXGGGAGCCCCACXXCX 57
GAA-IVS1.2088.20 CCACGCCXGGCXGGGAGCCC 58 GAA-IVS1.2115.20
XCCGAAGXGCXGGGAXXXCA 59 GAA-IVS1.2132.20 XCCACCCCCCXXGGCCXXCC 60
GAA-IVS1.2135.20 XGAXCCACCCCCCXXGGCCX 61 GAA-IVS1.2140.20
XCAAGXGAXCCACCCCCCXX 62 GAA-IVS1.2143.20 AGCXCAAGXGAXCCACCCCC 63
GAA-IVS1.2152.20 GAACXCCXGAGCXCAAGXGA 64 GAA-IVS1.2156.20
XCXCGAACXCCXGAGCXCAA 65 GAA-IVS1.2163.20 AGGCXGGXCXCGAACXCCXG 66
GAA-IVS1.2165.20 CCAGGCXGGXCXCGAACXCC 67 GAA-IVS1.2178.20
XXXGCCAXGXXACCCAGGCX 68 GAA-IVS1.2183.20 GGGAXXXXGCCAXGXXACCC 69
GAA-IVS1.2185.20 ACGGGAXXXXGCCAXGXXAC 70 GAA-IVS1.2188.20
GAGACGGGAXXXXGCCAXGX 71 GAA-IVS1.2190.20 XAGAGACGGGAXXXXGCCAX 72
GAA-IVS1.2195.20 XXXXGXAGAGACGGGAXXXX 73 GAA-IVS1.2200.20
XGXAXXXXXGXAGAGACGGG 74 GAA-IVS1.2202.20 XCXGXAXXXXXGXAGAGACG 75
GAA-IVS1.2204.20 XXXCXGXAXXXXXGXAGAGA 76 GAA-IVS1.2206.20
AXXXXCXGXAXXXXXGXAGA 77 GAA-IVS1.2208.20 XAAXXXXCXGXAXXXXXGXA 78
GAA-IVS1.2210.20 GCXAAXXXXCXGXAXXXXXG 79 GAA-IVS1(-74-55)
GGCXCXCAAAGCAGCXCXGA 104 GAA-IVS1(-79-55) GGCXCXCAAAGCAGCXCXGAGACAX
105 GAA-IVS1(-74-50) CACGGGGCXCXCAAAGCAGCXCXGA 106 GAA-IVS1(-79-60)
XCAAAGCAGCXCXGAGACAX 107 GAA-IVS1(-69-55) CACGGGGCXCXCAAAGCAGC 108
GAA-IVS1(-158-140) GCCCXGCXGXCXAGACXGG 109 GAA-IVS1(-163-140)
GCCCXGCXGXCXAGACXGGGGAGA 110 GAA-IVS1(-158-135)
GXGXXGCCCXGCXGXCXGGACXGG 111 GAA-IVS1(-163-145) GCXGXCXAGACXGGGGAGA
112 GAA-IVS1(-153-135) GXGXXGCCCXGCXGXCXAG 113 GAA-IVS2(-173-192)
CXGGAGXACCXGXCACCGXG 114 GAA-IVS2(-168-192)
CXGGAGXACCXGXCACCGXGGXGXC 115 GAA-IVS2(-173-197)
GCCXXCXGGAGXACCXGXCACCGXG 116 GAA-IVS2(-168-187)
GXACCXGXCACCGXGGXGXC 117 GAA-IVS2(-178-197) GCCXXCXGGAGXACCXGXCA
118 GAA Exon 2 Antisense Sequences GAAEx2A(+202+226)
GGCCCXGGXCXGCXGGCXCCCXGCX 24 GAAEx2A(+367+391)
GCXCCCXGCAGCCCCXGCXXXGCAG 25 GAA Intron 2 Antisense Sequences
GAA-IVS2(-4-20) CCCGCCCCXGCCCXGCC 10 GAA-IVS2(-14-30)
XGGCCGCCGCCCCCGCCC 11 GAA-IVS2(-33-52) XGXCCACGCGCACCCXCXGC 12
GAA-IVS2(-53-72) GXGAGGXGCGXGGGXGXCGA 13 GAA-IVS2(-73-92)
GCAACAXGCACCCCACCCXX 14 GAA-IVS2(-93-112) AGGGCCCAGCACACAGXGGX 15
GAA-IVS2(-113-132) XCACACCXCCGCXCCCAGCA 16 GAA-IVS2(-133-150)
GGCGCXGCCAXXGXCXGC 17 GAA-IVS2(-153-172) GXGXCCCCACXGCXCCCCGA 18
GAA-IVS2(-173-192) CXGGAGXACCXGXCACCGXG 19 GAA-IVS2(-193-212)
XGAGCCCCGAGCCCXGCCXX 20 GAA-IVS2(-213-237)
XGACCCACCXXXXCAXAAAGAXGAA 21 GAA-IVS2(-234-258)
CXCXGGCAGCCCXACXCXACCXGAC 22 GAA-IVS2(-338-364)
CXAGXAXAAAXACAXCCCAAAXXXXGC 23 GAA-IVS2.1.20 CCCGCCCCXGCCCXGCCCAC
80 GAA-IVS2.6.20 CCGCCCCCGCCCCXGCCCXG 81 GAA-IVS2.9.20
CCGCCGCCCCCGCCCCXGCC 82 GAA-IVS2.12.20 XGGCCGCCGCCCCCGCCCCX 83
GAA-IVS2.18.20 CXGCCCXGGCCGCCGCCCCC 84 GAA-IVS2.24.20
CACCCXCXGCCCXGGCCGCC 85 GAA-IVS2.27.20 GCGCACCCXCXGCCCXGGCC 86
GAA-IVS2.40.20 XGXCGAXGXCCACGCGCACC 87 GAA-IVS2.45.20
GXGGGXGXCGAXGXCCACGC 88 GAA-IVS2.48.20 XGCGXGGGXGXCGAXGXCCA 89
GAA-IVS2.54.20 GXGAGGXGCGXGGGXGXCGA 90 GAA-IVS2.67.20
GCACCCCACCCXXGXGAGGX 91 GAA-IVS2.72.20 AACAXGCACCCCACCCXXGX 92
GAA-IVS2.431.20 AGGAGGAGGACGCCXCCCCC 93 GAA-IVS2.446.20
CXCAXCXGCAGAGCCAGGAG 94 GAA-IVS2.448.20 CCCXCAXCXGCAGAGCCAGG 95
GAA-IVS2.450.20 CXCCCXCAXCXGCAGAGCCA 96 GAA-IVS2.451.20
GCXCCCXCAXCXGCAGAGCC 97 GAA-IVS2.452.20 GGCXCCCXCAXCXGCAGAGC 98
GAA-IVS2.453.20 CGGCXCCCXCAXCXGCAGAG 99 GAA-IVS2.454.20
XCGGCXCCCXCAXCXGCAGA 100 GAA-IVS2.455.20 CXCGGCXCCCXCAXCXGCAG 101
GAA-IVS2.456.20 CCXCGGCXCCCXCAXCXGCA 102 GAA-IVS2.457.20
GCCXCGGCXCCCXCAXCXGC 103 For any of the sequences in Table 2, each
X is independently selected from thymine (T) or uracil (U)
[0107] Certain antisense oligomers thus comprise, consist, or
consist essentially of a sequence in Table 1 (e.g., SEQ ID
NOS:4-120) or a variant or contiguous or non-contiguous portion(s)
thereof. For instance, certain antisense oligomers comprise about
or at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26, or 27 contiguous or non-contiguous
nucleotides of any of SEQ ID NOS:4-120. For non-contiguous
portions, intervening nucleotides can be deleted or substituted
with a different nucleotide, or intervening nucleotides can be
added. Additional examples of variants include oligomers having
about or at least about 70% sequence identity or homology, e.g.,
70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, 99% or 100% sequence identity or homology, over the
entire length of any of SEQ ID NOS:4-120.
[0108] The activity of antisense oligomers and variants thereof can
be assayed according to routine techniques in the art. For example,
splice forms and expression levels of surveyed RNAs and proteins
may be assessed by any of a wide variety of well-known methods for
detecting splice forms and/or expression of a transcribed nucleic
acid or protein. Non-limiting examples of such methods include
RT-PCR of spliced forms of RNA followed by size separation of PCR
products, nucleic acid hybridization methods e.g., Northern blots
and/or use of nucleic acid arrays; nucleic acid amplification
methods; immunological methods for detection of proteins; protein
purification methods; and protein function or activity assays.
[0109] RNA expression levels can be assessed by preparing mRNA/cDNA
(i.e., a transcribed polynucleotide) from a cell, tissue or
organism, and by hybridizing the mRNA/cDNA with a reference
polynucleotide that is a complement of the assayed nucleic acid, or
a fragment thereof. cDNA can, optionally, be amplified using any of
a variety of polymerase chain reaction or in vitro transcription
methods prior to hybridization with the complementary
polynucleotide; preferably, it is not amplified. Expression of one
or more transcripts can also be detected using quantitative PCR to
assess the level of expression of the transcript(s).
III. Antisense oligomer Chemistries
[0110] A. General Characteristics
[0111] Certain antisense oligomers of the instant disclosure
specifically hybridize to an intronic splice silencer element or an
exonic splice silencer element. Some antisense oligomers comprise a
targeting sequence set forth in Table 2, a fragment of at least 10
contiguous nucleotides of a targeting sequence in Table 2, or
variant having at least 80% sequence identity to a targeting
sequence in Table 2. Specific antisense oligomers consist or
consist essentially of a targeting sequence set forth in Table 2.
In some embodiments, the oligomer is nuclease-resistant.
[0112] In certain embodiments, the antisense oligomer comprises a
non-natural chemical backbone selected from a phosphoramidate or
phosphorodiamidate morpholino oligomer (PMO), a peptide nucleic
acid (PNA), a locked nucleic acid (LNA), a phosphorothioate
oligomer, a tricyclo-DNA oligomer, a tricyclo-phosphorothioate
oligomer, a 2'O-Me-modified oligomer, or any combination of the
foregoing, and a targeting sequence complementary to a region
within intron 1 (SEQ ID. NO: 1), intron 2 (SEQ ID. NO: 2), or exon
2 (SEQ ID. NO: 3) of a pre-mRNA of the human acid alpha-glucosidase
(GAA) gene. For example, in some embodiments, the targeting
sequence is selected from SEQ ID NOS: 4 to 120, wherein X is
selected from uracil (U) or thymine (T).
[0113] Antisense oligomers of the disclosure generally comprise a
plurality of nucleotide subunits each bearing a nucleobase which
taken together form or comprise a targeting sequence, for example,
as discussed above. Accordingly, in some embodiments, the antisense
oligomers range in length from about 10 to about 40 subunits, more
preferably about 10 to 30 subunits, and typically 15-25 subunits.
For example, antisense compounds of the disclosure may be 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 subunits in
length, or range from 10 subunits to 40 subunits, 10 subunits to 30
subunits, 14 subunits to 25 subunits, 15 subunits to 30 subunits,
17 subunits to 30 subunits, 17 subunits to 27 subunits, 10 subunits
to 27 subunits, 10 subunits to 25 subunits, and 10 subunits to 20
subunits. In certain embodiments, the antisense oligomer is about
10 to about 40 or about 5 to about 30 nucleotides in length. In
some embodiments, the antisense oligomer is about 14 to about 25 or
about 17 to about 27 nucleotides in length.
[0114] In some embodiments, the backbone of the antisense oligomer
is substantially uncharged, and is optionally recognized as a
substrate for active or facilitated transport across the cell
membrane. In some embodiments, all the internucleoside linkages are
uncharged. The ability of the oligomer to form a stable duplex with
the target RNA may also relate to other features of the backbone,
including the length and degree of complementarity of the antisense
oligomer with respect to the target, the ratio of G:C to A:T base
matches, and the positions of any mismatched bases. The ability of
the antisense oligomer to resist cellular nucleases may promote
survival and ultimate delivery of the agent to the cell cytoplasm.
Exemplary antisense oligomer targeting sequences are listed in
Table 2 (supra).
[0115] In certain embodiments, the antisense oligomer has at least
one internucleoside linkage that is positively charged or cationic
at physiological pH. In some embodiments, the antisense oligomer
has at least one internucleoside linkage that exhibits a pKa
between about 5.5 and about 12. Optionally, the antisense oligomer
has at least one internucleoside linkage with both a basic nitrogen
and an alkyl, aryl, or aralkyl group. In particular embodiments,
the cationic internucleoside linkage or linkages comprise a
4-aminopiperidin-1-yl (APN) group, or a derivative thereof. While
not being bound by any one theory, it is believed that the presence
of a cationic linkage or linkages (e.g., APN group or APN
derivative) in the oligomer facilitates binding to the negatively
charged phosphates in the target nucleotide. Thus, the formation of
a heteroduplex between mutant RNA and the cationic
linkage-containing oligomer may be held together by both an ionic
attractive force and Watson-Crick base pairing.
[0116] In some embodiments, the number of cationic linkages is at
least 2 and no more than about half the total internucleoside
linkages, e.g., about or no more than about 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 cationic linkages. In
some embodiments, however, up to all of the internucleoside
linkages are cationic linkages, e.g., about or at least about 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,
38, 39, or 40 of the total internucleoside linkages are cationic
linkages. In specific embodiments, an oligomer of about 19-20
subunits may have 2-10, e.g., 4-8, cationic linkages, and the
remainder uncharged linkages. In other specific embodiments, an
oligomer of 14-15 subunits may have 2-7, e.g., 2, 3, 4, 5, 6, or 7
cationic linkages and the remainder uncharged linkages. The total
number of cationic linkages in the oligomer can thus vary from
about 1 to 10 to 15 to 20 to 30 or more (including all integers in
between), and can be interspersed throughout the oligomer.
[0117] In some embodiments, an antisense oligomer may have about or
up to about 1 cationic linkage per every 2-5 or 2, 3, 4, or 5
uncharged linkages, such as about 4-5 or 4 or 5 per every 10
uncharged linkages.
[0118] Certain embodiments include antisense oligomers that contain
about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, or 100% cationic linkages. In certain
embodiments, optimal improvement in antisense activity may be seen
if about 25% of the backbone linkages are cationic. In certain
embodiments, enhancement may be seen with a small number e.g.,
10-20% cationic linkages, or where the number of cationic linkages
are in the range 50-80%, such as about 60%.
[0119] In some embodiments, the cationic linkages are interspersed
along the backbone. Such oligomers optionally contain at least two
consecutive uncharged linkages; that is, the oligomer optionally
does not have a strictly alternating pattern along its entire
length. In specific instances, each one or two cationic linkage(s)
is/are separated along the backbone by at least 1, 2, 3, 4, or 5
uncharged linkages.
[0120] Also included are oligomers having blocks of cationic
linkages and blocks of uncharged linkages. For example, a central
block of uncharged linkages may be flanked by blocks of cationic
linkages, or vice versa. In some embodiments, the oligomer has
approximately equal-length 5', 3' and center regions, and the
percentage of cationic linkages in the center region is greater
than about 50%, 60%, 70%, or 80% of the total number of cationic
linkages.
[0121] In certain antisense oligomers, the bulk of the cationic
linkages (e.g., 70, 75%, 80%, 90% of the cationic linkages) are
distributed close to the "center-region" backbone linkages, e.g.,
the 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 centermost linkages. For
example, a 16, 17, 18, 19, 20, 21, 22, 23, or 24-mer oligomer with
may have at least 50%, 60%, 70%, or 80% of the total cationic
linkages localized to the 8, 9, 10, 11, or 12 centermost
linkages.
[0122] B. Backbone Chemistry Features
[0123] The antisense oligomers can employ a variety of antisense
chemistries. Examples of oligomer chemistries include, without
limitation, peptide nucleic acid (PNA), locked nucleic acid (LNA),
phosphorothioate, 2'O-Me-modified oligomers, morpholino, PMO, PPMO,
PMOplus, and PMO-X chemistries, including combinations of any of
the foregoing. In general, PNA and LNA chemistries can utilize
shorter targeting sequences because of their relatively high target
binding strength relative to PMO and 2'O-Me oligomers.
Phosphorothioate and 2'O-Me-modified chemistries are often combined
to generate a 2'O-Me-phosphorothioate backbone. See, e.g., PCT
Publication Nos. WO/2013/112053 and WO/2009/008725, incorporated
herein by reference in their entireties.
[0124] In some instances, antisense oligomers such as PMOs can be
conjugated to cell penetrating peptides (CPPs) to facilitate
intracellular delivery. Peptide-conjugated PMOs are called PPMOs
and certain embodiments include those described in PCT Publication
No. WO/2012/150960, incorporated herein by reference in its
entirety.
[0125] 1. Peptide Nucleic Acids (PNAs)
[0126] Peptide nucleic acids (PNAs) are analogs of DNA in which the
backbone is structurally homomorphous with a deoxyribose backbone,
consisting of N-(2-aminoethyl)glycine units to which pyrimidine or
purine bases are attached. PNAs containing natural pyrimidine and
purine bases hybridize to complementary oligomers obeying
Watson-Crick base-pairing rules, and mimic DNA in terms of base
pair recognition (Egholm, Buchardt et al. 1993). The backbone of
PNAs is formed by peptide bonds rather than phosphodiester bonds,
making them well-suited for antisense applications (see structure
below). The backbone is uncharged, resulting in PNA/DNA or PNA/RNA
duplexes that exhibit greater than normal thermal stability. PNAs
are not recognized by nucleases or proteases. A non-limiting
example of a PNA is depicted below:
##STR00007##
[0127] Despite a radical structural change to the natural
structure, PNAs are capable of sequence-specific binding in a helix
form to DNA or RNA. Characteristics of PNAs include a high binding
affinity to complementary DNA or RNA, a destabilizing effect caused
by single-base mismatch, resistance to nucleases and proteases,
hybridization with DNA or RNA independent of salt concentration and
triplex formation with homopurine DNA. PANAGENE.TM. has developed
its proprietary Bts PNA monomers (Bts; benzothiazole-2-sulfonyl
group) and proprietary oligomerization process. The PNA
oligomerization using Bts PNA monomers is composed of repetitive
cycles of deprotection, coupling and capping. PNAs can be produced
synthetically using any technique known in the art. See, e.g., U.S.
Pat. Nos. 6,969,766, 7,211,668, 7,022,851, 7,125,994, 7,145,006 and
7,179,896. See also U.S. Pat. Nos. 5,539,082; 5,714,331; and
5,719,262 for the preparation of PNAs. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 254:1497-1500,
1991. Each of the foregoing is incorporated by reference in its
entirety.
[0128] 2. Locked Nucleic Acids (LNAs)
[0129] Antisense oligomer compounds may also contain "locked
nucleic acid" subunits (LNAs). "LNAs" are a member of a class of
modifications called bridged nucleic acid (BNA). BNA is
characterized by a covalent linkage that locks the conformation of
the ribose ring in a C30-endo (northern) sugar pucker. For LNA, the
bridge is composed of a methylene between the 2'-O and the 4'-C
positions. LNA enhances backbone preorganization and base stacking
to increase hybridization and thermal stability.
[0130] The structures of LNAs can be found, for example, in Wengel,
et al., Chemical Communications (1998) 455; Tetrahedron (1998)
54:3607, and Accounts of Chem. Research (1999) 32:301); Obika, et
al., Tetrahedron Letters (1997) 38:8735; (1998) 39:5401, and
Bioorganic Medicinal Chemistry (2008) 16:9230. A non-limiting
example of an LNA is depicted below:
##STR00008##
[0131] Compounds of the disclosure may incorporate one or more
LNAs; in some cases, the compounds may be entirely composed of
LNAs. Methods for the synthesis of individual LNA nucleoside
subunits and their incorporation into oligomers are described, for
example, in U.S. Pat. Nos. 7,572,582, 7,569,575, 7,084,125,
7,060,809, 7,053,207, 7,034,133, 6,794,499, and 6,670,461, each of
which is incorporated by reference in its entirety. Typical
intersubunit linkers include phosphodiester and phosphorothioate
moieties; alternatively, non-phosphorous containing linkers may be
employed. One embodiment is an LNA containing compound where each
LNA subunit is separated by a DNA subunit. Certain compounds are
composed of alternating LNA and DNA subunits where the intersubunit
linker is phosphorothioate.
[0132] 3. Phosphorothioates
[0133] "Phosphorothioates" (or S-oligos) are a variant of normal
DNA in which one of the nonbridging oxygens is replaced by a
sulfur. A non-limiting example of a phosphorothioate is depicted
below:
##STR00009##
[0134] The sulfurization of the internucleotide bond reduces the
action of endo- and exonucleases including 5' to 3' and 3' to 5'
DNA POL 1 exonuclease, nucleases S1 and P1, RNases, serum nucleases
and snake venom phosphodiesterase. Phosphorothioates are made by
two principal routes: by the action of a solution of elemental
sulfur in carbon disulfide on a hydrogen phosphonate, or by the
method of sulfurizing phosphite triesters with either
tetraethylthiuram disulfide (TETD) or 3H-1,2-benzodithiol-3-one
1,1-dioxide (BDTD) (see, e.g., Iyer et al., J. Org. Chem. 55,
4693-4699, 1990). The latter methods avoid the problem of elemental
sulfur's insolubility in most organic solvents and the toxicity of
carbon disulfide. The TETD and BDTD methods also yield higher
purity phosphorothioates.
[0135] 4. Triclyclo-DNAs and Tricyclo-Phosphorothioate
Nucleotides
[0136] Tricyclo-DNAs (tc-DNA) are a class of constrained DNA
analogs in which each nucleotide is modified by the introduction of
a cyclopropane ring to restrict conformational flexibility of the
backbone and to optimize the backbone geometry of the torsion angle
.gamma.. Homobasic adenine- and thymine-containing tc-DNAs form
extraordinarily stable A-T base pairs with complementary RNAs.
Tricyclo-DNAs and their synthesis are described in International
Patent Application Publication No. WO 2010/115993. Compounds of the
disclosure may incorporate one or more tricycle-DNA nucleotides; in
some cases, the compounds may be entirely composed of tricycle-DNA
nucleotides.
[0137] Tricyclo-phosphorothioate nucleotides are tricyclo-DNA
nucleotides with phosphorothioate intersubunit linkages.
Tricyclo-phosphorothioate nucleotides and their synthesis are
described in International Patent Application Publication No. WO
2013/053928. Compounds of the disclosure may incorporate one or
more tricycle-DNA nucleotides; in some cases, the compounds may be
entirely composed of tricycle-DNA nucleotides. A non-limiting
example of a tricycle-DNA/tricycle-phosphothioate nucleotide is
depicted below:
##STR00010##
[0138] 5. 2' O-Methyl Oligomers
[0139] "2'O-Me oligomers" molecules carry a methyl group at the
2'-OH residue of the ribose molecule. 2'-O-Me-RNAs show the same
(or similar) behavior as DNA, but are protected against nuclease
degradation. 2'-O-Me-RNAs can also be combined with phosphothioate
oligomers (PTOs) for further stabilization. 2'O-Me oligomers
(phosphodiester or phosphothioate) can be synthesized according to
routine techniques in the art (see, e.g., Yoo et al., Nucleic Acids
Res. 32:2008-16, 2004). A non-limiting example of a 2' O-Me
Oligomer is depicted below:
##STR00011##
2' O-Me oligomers may also comprise a phosphorothioate linkage (2'
O-Me phosphorothioate oligomers).
[0140] 6. Morpholino Oligomers
[0141] A "morpholino oligomer" or "PMO" refers to an oligomer
having a backbone which supports a nucleobase capable of hydrogen
bonding to typical polynucleotides, wherein the polymer lacks a
pentose sugar backbone moiety, but instead contains a morpholino
ring. Thus, in a PMO a morpholino ring structure supports a base
pairing moiety, to form a sequence of base pairing moieties which
is typically designed to hybridize to a selected antisense target
in a cell or in a subject being treated. An exemplary "morpholino"
oligomer comprises morpholino subunit structures linked together by
phosphoramidate or phosphorodiamidate linkages, joining the
morpholino nitrogen of one subunit to the 4' exocyclic carbon of an
adjacent subunit, each subunit comprising a purine or pyrimidine
nucleobase effective to bind, by base-specific hydrogen bonding, to
a base in a polynucleotide. Morpholino oligomers (including
antisense oligomers) are detailed, for example, in U.S. Pat. Nos.
5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,185,444;
5,521,063; 5,506,337 and pending U.S. patent application Ser. Nos.
12/271,036; 12/271,040; and PCT publication numbers WO/2009/064471
and WO/2012/043730, all of which are incorporated herein by
reference in their entirety.
[0142] Within the oligomer structure, the phosphate groups are
commonly referred to as forming the "internucleoside linkages" of
the oligomer. The naturally occurring internucleoside linkage of
RNA and DNA is a 3' to 5' phosphodiester linkage. A
"phosphoramidate" group comprises phosphorus having three attached
oxygen atoms and one attached nitrogen atom, while a
"phosphorodiamidate" group comprises phosphorus having two attached
oxygen atoms and two attached nitrogen atoms. In the uncharged or
the cationic intersubunit linkages of the PMO and/or PMO-X
oligomers described herein, one nitrogen is always pendant to the
backbone chain. The second nitrogen, in a phosphorodiamidate
linkage, is typically the ring nitrogen in a morpholino ring
structure.
[0143] "PMO-X" refers to phosphorodiamidate morpholino oligomers
(PMOs) having a phosphorus atom with (i) a covalent bond to the
nitrogen atom of a morpholino ring and (ii) a second covalent bond
to the ring nitrogen of a 4-aminopiperidin-1-yl (i.e., APN) or a
derivative of 4-aminopiperidin-1-yl. Exemplary PMO-X oligomers are
disclosed in PCT application No. PCT/US2011/38459 and PCT
Publication No. WO/2013/074834, each of which is herein
incorporated by reference in its entirety. "PMO-apn" or "APN"
refers to a PMO-X oligomer which comprises at least one
internucleoside linkage where a phosphorus atom is linked to a
morpholino group and to the ring nitrogen of a
4-aminopiperidin-1-yl (i.e., APN). In specific embodiments, an
antisense oligomer comprising a targeting sequence as set forth in
Table 2 comprises at least one APN-containing linkage or APN
derivative-containing linkage. Specific embodiments include PMOs
that have about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% APN/APN
derivative-containing linkages, where the remaining linkages (if
less than 100%) are uncharged linkages, e.g., about or at least
about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, or 40 of the total internucleoside linkages are
APN/APN derivative-containing linkages.
[0144] In some embodiments, the antisense oligomer is a compound of
formula (I):
##STR00012##
or a pharmaceutically acceptable salt thereof, wherein:
[0145] each Nu is a nucleobase which taken together forms a
targeting sequence;
[0146] x is an integer from 8 to 38;
[0147] each Y is independently selected from O or --NR.sup.a,
wherein R.sup.a is selected from the group consisting of hydrogen,
-T.sup.1-NR.sup.cR.sup.dR.sup.e, and --[(C(O)CHR'NH).sub.m]R'',
wherein:
[0148] R' is a side chain of a naturally occurring amino acid or a
one- or two-carbon homolog thereof, R'' is selected from Hydrogen
or acyl, m is an integer from 1 to 60, R.sup.c is selected from the
group consisting of hydrogen, C.sub.1-C.sub.6 alkyl, aralkyl, and
--C(.dbd.NH)NH.sub.2, R.sup.d is selected from the group consisting
of hydrogen, aralkyl, and C.sub.1-C.sub.6 alkyl, or R.sup.c and
R.sup.d taken together with the nitrogen atom to which they are
attached form a 5-7 membered ring when R.sup.C and R.sup.d are each
independently C.sub.1-C.sub.6 alkyl or aralkyl, where the ring is
optionally substituted with a substituent selected from the group
consisting of C.sub.1-C.sub.6 alkyl, phenyl, halogen, and aralkyl,
and Re is selected from the group consisting of an electron pair,
hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl;
[0149] each L is independently selected from the group consisting
of --P(O).sub.2OH--, --P(O).sub.2R.sup.1--,
--P(O).sub.2(N(CH.sub.3).sub.3--N(CH.sub.3)CH.sub.2C(O)NH.sub.2, a
piperazinyl group, a carbonyl group, H(O(CH.sub.2).sub.sO).sub.w--,
--(OCH.sub.2CH.sub.2O).sub.w, and --[(C(O)CHR'NH).sub.m]R'',
wherein w is an integer selected from 3-20, S is an integer
selected from 1 to 8;
[0150] n is an integer from 0 to 3;
[0151] each R.sup.1 is independently selected from the group
consisting of --N(CH.sub.3).sub.2, --NR.sup.5R.sup.6, --OR.sup.7, a
moiety of formula (II):
##STR00013##
[0152] wherein R.sup.8 is selected from the group consisting of
hydrogen, methyl, --C(.dbd.NH)NH.sub.2,
--Z-T.sup.2-NHC(.dbd.NH)NH.sub.2, and --[(C(O)CHR'NH).sub.m]R'',
where Z is carbonyl or a direct bond, R.sup.9 is selected from the
group consisting of an electron pair, hydrogen, a C.sub.1-C.sub.6
alkyl, and aralkyl, and each R.sup.10 is independently selected
from hydrogen or methyl; and
[0153] a moiety of formula (III):
##STR00014##
[0154] wherein q is an integer from 0 to 2, R.sup.11 is selected
from the group consisting of hydrogen, C.sub.1-C.sub.6 alkyl,
aralkyl, and --C(.dbd.NH)NH.sub.2, R.sup.12 is selected from the
group consisting of hydrogen, aralkyl, and C.sub.1-C.sub.6 alkyl,
or R.sup.11 and R.sup.12 taken together with the nitrogen atom to
which they are attached form a 5-7 membered ring where the ring is
optionally substituted with a substituent selected from the group
consisting of C.sub.1-C.sub.6 alkyl, phenyl, halogen, and aralkyl,
and R.sup.13 is selected from the group consisting of an electron
pair, hydrogen, C.sub.1-C.sub.6 alkyl, and aralkyl;
[0155] R.sup.2 is selected from the group consisting of hydrogen,
OH, a nucleotide, --(CH.sub.2).sub.mC(O)NR.sup.fR.sup.g wherein
R.sup.f and R.sup.g are independently selected from H, acyl,
C.sub.1-C.sub.6 alkyl, and --[(C(O)CHR'NH).sub.m]R'',
--[(C(O)CHR'NH).sub.m]R'', H(O(CH.sub.2).sub.sO).sub.w--,
H(OCH.sub.2CH.sub.2O).sub.w--, trityl, --C(.dbd.O)OR.sup.f, and
acyl, wherein R.sup.f is C.sub.1-C.sub.30 alkyl comprising one or
more oxygen or hydroxyl moieties or combinations thereof, or
R.sup.2 is absent;
[0156] R.sup.3 is selected from the group consisting of hydrogen, a
C.sub.1-C.sub.6 alkyl, a nucleotide, --[(C(O)CHR'NH).sub.m]R'',
--C(.dbd.NH)NH.sub.2, trityl, --C(.dbd.O)OR.sup.g, acyl,
--C(O)(CH.sub.2).sub.mC(O), and
T.sup.4-(4-(4,6-(NR.sub.2)-1,3,5-triazin-2-yl)piperazin-1-yl,
wherein R.sup.g is C.sub.1-C.sub.30 alkyl comprising one or more
oxygen or hydroxyl moieties or combinations thereof, T.sup.4 is
selected from --C(O)(CH.sub.2).sub.6C(O)-- or
--C(O)(CH.sub.2).sub.2S.sub.2(CH.sub.2).sub.2C(O)--, and R is
--(CH.sub.2)OC(O)NH(CH.sub.2).sub.6NHC(NH)NH.sub.2;
[0157] R.sup.4 is selected from the group consisting of an electron
pair, hydrogen, a C.sub.1-C.sub.6 alkyl, and acyl, and
[0158] each R.sup.5 is independently selected from hydrogen or
methyl;
[0159] each R.sup.6 and each R.sup.7 is independently selected from
hydrogen or -T3-NR.sup.cR.sup.dR.sup.e; and
[0160] each of T.sup.1, T.sup.2, and T.sup.3 is independently an
optional linker of up to 18 atoms in length comprising alkyl,
alkoxy, or alkylamino groups, or combinations thereof,
[0161] wherein the targeting sequence is complementary to a region
within intron 1 (SEQ ID. NO. 1), intron 2 (SEQ ID. NO. 2), or exon
2 (SEQ ID. NO. 3) of a pre-mRNA of the human acid alpha-glucosidase
(GAA) gene.
[0162] In some embodiments, R.sup.3 is a moiety
T.sup.4-(4-(4,6-(NR.sub.2)-1,3,5-triazin-2-yl)piperazin-1-yl,
wherein T.sup.4 is selected from --C(O)(CH.sub.2).sub.6C(O)-- or
--C(O)(CH.sub.2).sub.2S.sub.2(CH.sub.2).sub.2C(O)--, and R is
--(CH.sub.2)OC(O)NH(CH.sub.2).sub.6NHC(NH)NH.sub.2. Such moieties
are further described in U.S. Pat. No. 7,935,816 incorporated
herein by reference in its entirety.
[0163] In certain embodiments, R.sup.3 may comprise a moiety
depicted below:
##STR00015##
[0164] In certain embodiments, each R.sup.1 is --N(CH.sub.3).sub.2.
In some embodiments, about 50-90% of the R.sub.1 groups are
dimethylamino (i.e. --N(CH.sub.3).sub.2). In certain embodiments,
about 66% of the R.sub.1 groups are dimethylamino
[0165] In some embodiments, the targeting sequence is selected from
SEQ. ID NOS: 4 to 120, wherein X is selected from uracil (U) or
thymine (T). In some embodiments, each R.sup.1 is
--N(CH.sub.3).sub.2 and the targeting sequence is selected from
SEQ. ID NOS: 4 to 120, wherein X is selected from uracil (U) or
thymine (T).
[0166] In some embodiments of the disclosure, R.sub.1 may be
selected from the group consisting of:
##STR00016## ##STR00017##
[0167] In some embodiments, at least one R.sup.1 is:
##STR00018##
[0168] In certain embodiments, n is 2, R.sup.2 and L taken together
are of the formula:
##STR00019##
and Y is O at each occurrence.
[0169] In other embodiments, the antisense oligomer is a compound
of formula (IV):
##STR00020##
or a pharmaceutically acceptable salt thereof, wherein: each Nu is
a nucleobase which taken together forms a targeting sequence; x is
an integer from 8 to 38; each L is independently selected from the
group consisting of --P(O).sub.2OH--, --P(O).sub.2R.sup.1--,
--P(O).sub.2(N(CH.sub.3).sub.3--N(CH.sub.3)CH.sub.2C(O)NH.sub.2, a
piperazinyl group, a carbonyl group, H(O(CH.sub.2).sub.sO).sub.w--,
--(OCH.sub.2CH.sub.2O).sub.w, and --[(C(O)CHR'NH).sub.m]R'',
wherein w is an integer selected from 3-20, S is an integer
selected from 1 to 8, R' is a side chain of a naturally occurring
amino acid or a one- or two-carbon homolog thereof, R'' is selected
from Hydrogen or acyl, m is an integer from 1 to 60;
[0170] n is an integer from 0 to 3;
[0171] R.sup.2 is selected from the group consisting of hydrogen,
OH, a nucleotide, --(CH.sub.2).sub.mC(O)NR.sup.fR.sup.g wherein
R.sup.f and R.sup.g are independently selected from H, acyl,
C.sub.1-C.sub.6 alkyl, and --[(C(O)CHR'NH).sub.m]R'',
--[(C(O)CHR'NH).sub.m]R'', H(O(CH.sub.2).sub.sO).sub.w--,
H(OCH.sub.2CH.sub.2O).sub.w--, trityl, --C(.dbd.O)OR.sup.f, and
acyl, wherein R.sup.f is C.sub.1-C.sub.30 alkyl comprising one or
more oxygen or hydroxyl moieties or combinations thereof, or
R.sup.2 is absent;
[0172] R.sup.3 is selected from the group consisting of hydrogen, a
C.sub.1-C.sub.6 alkyl, a nucleotide, --[(C(O)CHR'NH).sub.m]R'',
--C(.dbd.NH)NH.sub.2, and acyl; and
[0173] R.sup.4 is selected from the group consisting of an electron
pair, hydrogen, a C.sub.1-C.sub.6 alkyl, and acyl,
[0174] wherein the targeting sequence is complementary to a region
within intron 1 (SEQ ID. NO: 1), intron 2 (SEQ ID. NO: 2), or exon
2 (SEQ ID. NO: 3) of a pre-mRNA of the human acid alpha-glucosidase
(GAA) gene.
[0175] In some embodiments, n is 2; R.sup.2 and L taken together
are of the formula:
##STR00021##
[0176] R.sup.3 is hydrogen; and R.sup.4 is an electron pair.
In some embodiments, the antisense oligomer is a compound of
formula (V):
##STR00022##
or a pharmaceutically acceptable salt thereof, wherein:
[0177] each Nu is a nucleobase which taken together forms a
targeting sequence;
[0178] x is an integer from 8 to 38; each L is independently
selected from the group consisting of --P(O).sub.2OH--,
--P(O).sub.2R.sup.1--,
--P(O).sub.2(N(CH.sub.3).sub.3--N(CH.sub.3)CH.sub.2C(O)NH.sub.2, a
piperazinyl group, a carbonyl group, H(O(CH.sub.2).sub.sO).sub.w--,
--(OCH.sub.2CH.sub.2O).sub.w, and --[(C(O)CHR'NH).sub.m]R'',
wherein w is an integer selected from 3-20, S is an integer
selected from 1 to 8, R' is a side chain of a naturally occurring
amino acid or a one- or two-carbon homolog thereof, R'' is selected
from Hydrogen or acyl, and m is an integer from 1 to 60;
[0179] n is an integer from 0 to 3; and
[0180] R.sup.2 is selected from the group consisting of hydrogen,
OH, a nucleotide, --(CH.sub.2).sub.mC(O)NR.sup.fR.sup.g wherein
R.sup.f and R.sup.g are independently selected from H, acyl,
C.sub.1-C.sub.6 alkyl,
and --[(C(O)CHR'NH).sub.m]R'', --[(C(O)CHR'NH).sub.m]R'',
H(O(CH.sub.2).sub.sO).sub.w--, H(OCH.sub.2CH.sub.2O).sub.w--,
trityl, --C(.dbd.O)OR.sup.f, and acyl, wherein R.sup.f is
C.sub.1-C.sub.30 alkyl comprising one or more oxygen or hydroxyl
moieties or combinations thereof, or R.sup.2 is absent, wherein the
targeting sequence is complementary to a region within intron 1
(SEQ ID. NO: 1), intron 2 (SEQ ID. NO: 2), or exon 2 (SEQ ID. NO:
3) of a pre-mRNA of the human acid alpha-glucosidase (GAA)
gene.
[0181] In some embodiments, n is 2; and
[0182] R.sup.2 and L taken together are of the formula:
##STR00023##
[0183] In certain embodiments, the antisense oligomer of the
disclosure is a compound of formula (VI):
##STR00024##
or a pharmaceutically acceptable salt thereof, wherein:
[0184] each Nu is a nucleobase which taken together form a
targeting sequence;
[0185] x is an integer from 15 to 25;
[0186] each Y is O;
[0187] each R.sup.1 is independently selected from the group
consisting of:
##STR00025##
wherein at least one R.sup.1 is --N(CH.sub.3).sub.2, and wherein
the targeting sequence is selected from SEQ ID NOS: 4-120, wherein
X is selected from uracil (U) or thymine (T). In some embodiments,
each R' is --N(CH.sub.3).sub.2.
[0188] In some embodiments, each Nu of the antisense oligomers of
the disclosure, including compounds of formula (I), (IV), (V), and
(VI), is independently selected from the group consisting of
adenine, guanine, thymine, uracil, cytosine, hypoxanthine,
2,6-diaminopurine, 5-methyl cytosine, C5-propynyl-modified
pyrimidines, and 9-(aminoethoxy)phenoxazine. In some embodiments,
the targeting sequence of the antisense oligomers of the
disclosure, including compounds of formula (I), (IV), (V), and
(VI), is selected from SEQ. ID NOS: 4 to 120, wherein X is selected
from uracil (U) or thymine (T).
[0189] In certain embodiments, the antisense oligomer is a compound
of formula (VII):
##STR00026##
or a pharmaceutically acceptable salt thereof, wherein:
[0190] each Nu is a nucleobase which taken together form a
targeting sequence; and
[0191] x is an integer from 8 to 38;
[0192] wherein the targeting sequence is selected from SEQ ID NOS:
4-120, wherein X is selected from uracil (U) or thymine (T).
[0193] Additional antisense oligomers/chemistries that can be used
in accordance with the present disclosure include those described
in the following patents and patent publications, the contents of
which are incorporated herein by reference: PCT Publication Nos.
WO/2007/002390; WO/2010/120820; and WO/2010/148249; U.S. Pat. No.
7,838,657; and U.S. Application No. 2011/0269820.
[0194] C. The Preparation of PMO-X with Basic Nitrogen
Internucleoside Linkers
[0195] Morpholino subunits, the modified intersubunit linkages, and
oligomers comprising the same can be prepared as described, for
example, in U.S. Pat. Nos. 5,185,444, and 7,943,762, which are
incorporated by reference in their entireties. The morpholino
subunits can be prepared according to the following general
Reaction Scheme I.
##STR00027##
[0196] Referring to Reaction Scheme 1, wherein B represents a base
pairing moiety and PG represents a protecting group, the morpholino
subunits may be prepared from the corresponding ribonucleoside (1)
as shown. The morpholino subunit (2) may be optionally protected by
reaction with a suitable protecting group precursor, for example
trityl chloride. The 3' protecting group is generally removed
during solid-state oligomer synthesis as described in more detail
below. The base pairing moiety may be suitably protected for sold
phase oligomer synthesis. Suitable protecting groups include
benzoyl for adenine and cytosine, phenylacetyl for guanine, and
pivaloyloxymethyl for hypoxanthine (I). The pivaloyloxymethyl group
can be introduced onto the N1 position of the hypoxanthine
heterocyclic base. Although an unprotected hypoxanthine subunit,
may be employed, yields in activation reactions are far superior
when the base is protected. Other suitable protecting groups
include those disclosed in co-pending U.S. application Ser. No.
12/271,040, which is hereby incorporated by reference in its
entirety.
[0197] Reaction of 3 with the activated phosphorous compound 4,
results in morpholino subunits having the desired linkage moiety 5.
Compounds of structure 4 can be prepared using any number of
methods known to those of skill in the art. For example, such
compounds may be prepared by reaction of the corresponding amine
and phosphorous oxychloride. In this regard, the amine starting
material can be prepared using any method known in the art, for
example those methods described in the Examples and in U.S. Pat.
No. 7,943,762.
[0198] Compounds of structure 5 can be used in solid-phase
automated oligomer synthesis for preparation of oligomers
comprising the intersubunit linkages. Such methods are well known
in the art. Briefly, a compound of structure 5 may be modified at
the 5' end to contain a linker to a solid support. For example,
compound 5 may be linked to a solid support by a linker comprising
L.sup.11 and L.sup.15. An exemplary method is demonstrated in FIGS.
1 and 2. Once supported, the protecting group (e.g., trityl) is
removed and the free amine is reacted with an activated phosphorous
moiety of a second compound of structure 5. This sequence is
repeated until the desired length of oligo is obtained. The
protecting group in the terminal 5' end may either be removed or
left on if a 5'-modification is desired. The oligo can be removed
from the solid support using any number of methods, for example
treatment with DTT followed by ammonium hydroxide as depicted in
FIGS. 3 and 4.
[0199] The preparation of modified morpholino subunits and
morpholino oligomers are described in more detail in the Examples.
The morpholino oligomers containing any number of modified linkages
may be prepared using methods described herein, methods known in
the art and/or described by reference herein. Also described in the
examples are global modifications of morpholino oligomers prepared
as previously described (see e.g., PCT publication
WO2008036127).
[0200] The term "protecting group" refers to chemical moieties that
block some or all reactive moieties of a compound and prevent such
moieties from participating in chemical reactions until the
protective group is removed, for example, those moieties listed and
described in T. W. Greene, P. G. M. Wuts, Protective Groups in
Organic Synthesis, 3rd ed. John Wiley & Sons (1999). It may be
advantageous, where different protecting groups are employed, that
each (different) protective group be removable by a different
means. Protective groups that are cleaved under totally disparate
reaction conditions allow differential removal of such protecting
groups. For example, protective groups can be removed by acid,
base, and hydrogenolysis. Groups such as trityl, dimethoxytrityl,
acetal and tert-butyldimethylsilyl are acid labile and may be used
to protect carboxy and hydroxy reactive moieties in the presence of
amino groups protected with Cbz groups, which are removable by
hydrogenolysis, and Fmoc groups, which are base labile. Carboxylic
acid moieties may be blocked with base labile groups such as,
without limitation, methyl, or ethyl, and hydroxy reactive moieties
may be blocked with base labile groups such as acetyl in the
presence of amines blocked with acid labile groups such as
tert-butyl carbamate or with carbamates that are both acid and base
stable but hydrolytically removable.
[0201] Carboxylic acid and hydroxyl reactive moieties may also be
blocked with hydrolytically removable protective groups such as the
benzyl group, while amine groups may be blocked with base labile
groups such as Fmoc. A particularly useful amine protecting group
for the synthesis of compounds of Formula (I) is the
trifluoroacetamide. Carboxylic acid reactive moieties may be
blocked with oxidatively-removable protective groups such as
2,4-dimethoxybenzyl, while co-existing amino groups may be blocked
with fluoride labile silyl carbamates.
[0202] Allyl blocking groups are useful in the presence of acid-
and base-protecting groups since the former are stable and can be
subsequently removed by metal or pi-acid catalysts. For example, an
allyl-blocked carboxylic acid can be deprotected with a
palladium(0)-catalyzed reaction in the presence of acid labile
t-butyl carbamate or base-labile acetate amine protecting groups.
Yet another form of protecting group is a resin to which a compound
or intermediate may be attached. As long as the residue is attached
to the resin, that functional group is blocked and cannot react.
Once released from the resin, the functional group is available to
react.
[0203] Typical blocking/protecting groups are known in the art and
include, but are not limited to the following moieties:
##STR00028##
[0204] Unless otherwise noted, all chemicals were obtained from
Sigma-Aldrich-Fluka. Benzoyl adenosine, benzoyl cytidine, and
phenylacetyl guanosine were obtained from Carbosynth Limited,
UK.
[0205] Synthesis of PMO, PMO+, PPMO, and PMO-X containing further
linkage modifications as described herein was done using methods
known in the art and described in pending U.S. application Ser.
Nos. 12/271,036 and 12/271,040 and PCT publication number
WO/2009/064471, which are hereby incorporated by reference in their
entirety.
[0206] PMO with a 3' trityl modification are synthesized
essentially as described in PCT publication number WO/2009/064471
with the exception that the detritylation step is omitted.
IV. Formulations
[0207] The compounds of the disclosure may also be admixed,
encapsulated, conjugated or otherwise associated with other
molecules, molecule structures or mixtures of compounds, as for
example, liposomes, receptor-targeted molecules, oral, rectal,
topical or other formulations, for assisting in uptake,
distribution and/or absorption. Representative United States
patents that teach the preparation of such uptake, distribution
and/or absorption-assisting formulations include, but are not
limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016;
5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721;
4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170;
5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854;
5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is herein incorporated by
reference.
[0208] The antisense compounds of the disclosure encompass any
pharmaceutically acceptable salts, esters, or salts of such esters,
or any other compound which, upon administration to an animal,
including a human, is capable of providing (directly or indirectly)
the biologically active metabolite or residue thereof. Accordingly,
for example, the disclosure is also drawn to prodrugs and
pharmaceutically acceptable salts of the compounds of the
disclosure, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents.
[0209] The term "prodrug" indicates a therapeutic agent that is
prepared in an inactive form that is converted to an active form
(i.e., drug) within the body or cells thereof by the action of
endogenous enzymes or other chemicals and/or conditions. In
particular, prodrug versions of the oligomers of the disclosure are
prepared as SATE [(S-acetyl-2-thioethyl)phosphate]derivatives
according to the methods disclosed in WO 93/24510 to Gosselin et
al., published Dec. 9, 1993 or in WO 94/26764 and U.S. Pat. No.
5,770,713 to Imbach et al.
[0210] The term "pharmaceutically acceptable salts" refers to
physiologically and pharmaceutically acceptable salts of the
compounds of the disclosure: i.e., salts that retain the desired
biological activity of the parent compound and do not impart
undesired toxicological effects thereto. For oligomers, examples of
pharmaceutically acceptable salts and their uses are further
described in U.S. Pat. No. 6,287,860, which is incorporated herein
in its entirety.
[0211] The present disclosure also includes pharmaceutical
compositions and formulations which include the antisense compounds
of the disclosure. The pharmaceutical compositions of the present
disclosure may be administered in a number of ways depending upon
whether local or systemic treatment is desired and upon the area to
be treated. Administration may be topical (including ophthalmic and
to mucous membranes including vaginal and rectal delivery),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal), oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; or
intracranial, e.g., intrathecal or intraventricular,
administration. Oligomers with at least one 2'-O-methoxyethyl
modification are believed to be particularly useful for oral
administration. Pharmaceutical compositions and formulations for
topical administration may include transdermal patches, ointments,
lotions, creams, gels, drops, suppositories, sprays, liquids and
powders. Conventional pharmaceutical carriers, aqueous, powder or
oily bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful.
[0212] The pharmaceutical formulations of the present disclosure,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general, the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0213] The compositions of the present disclosure may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
disclosure may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension may also contain stabilizers.
[0214] Pharmaceutical compositions of the present disclosure
include, but are not limited to, solutions, emulsions, foams and
liposome-containing formulations. The pharmaceutical compositions
and formulations of the present disclosure may comprise one or more
penetration enhancers, carriers, excipients or other active or
inactive ingredients.
[0215] Emulsions are typically heterogeneous systems of one liquid
dispersed in another in the form of droplets usually exceeding 0.1
.mu.m in diameter. Emulsions may contain additional components in
addition to the dispersed phases, and the active drug which may be
present as a solution in either the aqueous phase, oily phase or
itself as a separate phase. Microemulsions are included as an
embodiment of the present disclosure. Emulsions and their uses are
well known in the art and are further described in U.S. Pat. No.
6,287,860, which is incorporated herein in its entirety.
[0216] Formulations of the present disclosure include liposomal
formulations. As used in the present disclosure, the term
"liposome" means a vesicle composed of amphiphilic lipids arranged
in a spherical bilayer or bilayers. Liposomes are unilamellar or
multilamellar vesicles which have a membrane formed from a
lipophilic material and an aqueous interior that contains the
composition to be delivered. Cationic liposomes are positively
charged liposomes which are believed to interact with negatively
charged DNA molecules to form a stable complex. Liposomes that are
pH-sensitive or negatively-charged are believed to entrap DNA
rather than complex with it. Both cationic and noncationic
liposomes have been used to deliver DNA to cells.
[0217] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome comprises one or more glycolipids or is
derivatized with one or more hydrophilic polymers, such as a
polyethylene glycol (PEG) moiety. Liposomes and their uses are
further described in U.S. Pat. No. 6,287,860, which is incorporated
herein in its entirety.
[0218] The pharmaceutical formulations and compositions of the
present disclosure may also include surfactants. The use of
surfactants in drug products, formulations and in emulsions is well
known in the art. Surfactants and their uses are further described
in U.S. Pat. No. 6,287,860, which is incorporated herein in its
entirety.
[0219] In some embodiments, the present disclosure employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly oligomers. In addition to aiding the diffusion
of non-lipophilic drugs across cell membranes, penetration
enhancers also enhance the permeability of lipophilic drugs.
Penetration enhancers may be classified as belonging to one of five
broad categories, i.e., surfactants, fatty acids, bile salts,
chelating agents, and non-chelating non-surfactants. Penetration
enhancers and their uses are further described in U.S. Pat. No.
6,287,860, which is incorporated herein in its entirety.
[0220] One of skill in the art will recognize that formulations are
routinely designed according to their intended use, i.e. route of
administration.
[0221] Formulations for topical administration include those in
which the oligomers of the disclosure are in admixture with a
topical delivery agent such as lipids, liposomes, fatty acids,
fatty acid esters, steroids, chelating agents and surfactants.
Lipids and liposomes include neutral (e.g. dioleoylphosphatidyl
DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC,
distearolyphosphatidyl choline) negative (e.g.
dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g.
dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl
ethanolamine DOTMA).
[0222] For topical or other administration, oligomers of the
disclosure may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, oligomers may be complexed to lipids, in particular
to cationic lipids. Fatty acids and esters, pharmaceutically
acceptable salts thereof, and their uses are further described in
U.S. Pat. No. 6,287,860, which is incorporated herein in its
entirety. Topical formulations are described in detail in U.S.
patent application Ser. No. 09/315,298 filed on May 20, 1999, which
is incorporated herein by reference in its entirety.
[0223] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable. Oral formulations are those in which oligomers of
the disclosure are administered in conjunction with one or more
penetration enhancers surfactants and chelators. Surfactants
include fatty acids and/or esters or salts thereof, bile acids
and/or salts thereof. Bile acids/salts and fatty acids and their
uses are further described in U.S. Pat. No. 6,287,860, which is
incorporated herein in its entirety. In some embodiments, the
present disclosure provides combinations of penetration enhancers,
for example, fatty acids/salts in combination with bile
acids/salts. An exemplary combination is the sodium salt of lauric
acid, capric acid and UDCA. Further penetration enhancers include
polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
Oligomers of the disclosure may be delivered orally, in granular
form including sprayed dried particles, or complexed to form micro
or nanoparticles. Oligomer complexing agents and their uses are
further described in U.S. Pat. No. 6,287,860, which is incorporated
herein in its entirety. Oral formulations for oligomers and their
preparation are described in detail in U.S. application Ser. No.
09/108,673 (filed Jul. 1, 1998), Ser. No. 09/315,298 (filed May 20,
1999) and Ser. No. 10/071,822, filed Feb. 8, 2002, each of which is
incorporated herein by reference in their entirety.
[0224] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0225] Certain embodiments of the disclosure provide pharmaceutical
compositions containing one or more oligomeric compounds and one or
more other chemotherapeutic agents which function by a
non-antisense mechanism. Examples of such chemotherapeutic agents
include but are not limited to cancer chemotherapeutic drugs such
as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin,
idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide,
cytosine arabinoside, bis-chloroethylnitrosurea, busulfan,
mitomycin C, actinomycin D, mithramycin, prednisone,
hydroxyprogesterone, testosterone, tamoxifen, dacarbazine,
procarbazine, hexamethylmelamine, pentamethylmelamine,
mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea,
nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine,
6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea,
deoxyco-formycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil
(5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX),
colchicine, taxol, vincristine, vinblastine, etoposide (VP-16),
trimetrexate, irinotecan, topotecan, gemcitabine, teniposide,
cisplatin and diethylstilbestrol (DES). When used with the
compounds of the disclosure, such chemotherapeutic agents may be
used individually (e.g., 5-FU and oligomer), sequentially (e.g.,
5-FU and oligomer for a period of time followed by MTX and
oligomer), or in combination with one or more other such
chemotherapeutic agents (e.g., 5-FU, MTX and oligomer, or 5-FU,
radiotherapy and oligomer). Anti-inflammatory drugs, including but
not limited to nonsteroidal anti-inflammatory drugs and
corticosteroids, and antiviral drugs, including but not limited to
ribivirin, vidarabine, acyclovir and ganciclovir, may also be
combined in compositions of the disclosure. Combinations of
antisense compounds and other non-antisense drugs are also within
the scope of this disclosure. Two or more combined compounds may be
used together or sequentially.
[0226] In another related embodiment, compositions of the
disclosure may contain one or more antisense compounds,
particularly oligomers, targeted to a first nucleic acid and one or
more additional antisense compounds targeted to a second nucleic
acid target. Alternatively, compositions of the disclosure may
contain two or more antisense compounds targeted to different
regions of the same nucleic acid target. Numerous examples of
antisense compounds are known in the art. Two or more combined
compounds may be used together or sequentially.
V. Methods of Use
[0227] Certain embodiments relate to methods of increasing
expression of exon 2-containing GAA mRNA and/or protein using the
antisense oligomers of the present disclosure for therapeutic
purposes (e.g., treating subjects with GSD-II). Accordingly, in
some embodiments, the present disclosure provides methods of
treating an individual afflicted with or at risk for developing
GSD-II, comprising administering an effective amount of an
antisense oligomer of the disclosure to the subject. In some
embodiments, the antisense oligomer comprising a nucleotide
sequence of sufficient length and complementarity to specifically
hybridize to a region within the pre-mRNA of the acid
alpha-glucosidase (GAA) gene, wherein binding of the antisense
oligomer to the region increases the level of exon 2-containing GAA
mRNA in a cell and/or tissue of the subject. Exemplary antisense
targeting sequences are shown in Table 2.
[0228] Also included are antisense oligomers for use in the
preparation of a medicament for the treatment of glycogen storage
disease type II (GSD-II; Pompe disease), comprising a nucleotide
sequence of sufficient length and complementarity to specifically
hybridize to a region within the pre-mRNA of the acid
alpha-glucosidase (GAA) gene, wherein binding of the antisense
oligomer to the region increases the level of exon 2-containing GAA
mRNA.
[0229] In some embodiments of the method of treating GSD-II or the
medicament for the treatment of GSD-II, the antisense oligomer
compound comprises:
[0230] a non-natural chemical backbone selected from a
phosphoramidate or phosphorodiamidate morpholino oligomer (PMO), a
peptide nucleic acid (PNA), a locked nucleic acid (LNA), a
phosphorothioate oligomer, a tricyclo-DNA oligomer, a
tricyclo-phosphorothioate oligomer, a 2'O-Me-modified oligomer, or
any combination of the foregoing; and
[0231] a targeting sequence complementary to a region within intron
1 (SEQ ID. NO: 1), intron 2 (SEQ ID. NO: 2), or exon 2 (SEQ ID. NO:
3) of a pre-mRNA of the human acid alpha-glucosidase (GAA)
gene.
[0232] As noted above, "GSD-II" refers to glycogen storage disease
type II (GSD-II or Pompe disease), a human autosomal recessive
disease that is often characterized by under expression of GAA
protein in affected individuals. Included are subjects having
infantile GSD-II and those having late onset forms of the
disease.
[0233] In certain embodiments, a subject has reduced expression
and/or activity of GAA protein in one or more tissues (for example,
relative to a healthy subject or an earlier point in time),
including heart, skeletal muscle, liver, and nervous system
tissues. In some embodiments, the subject has increased
accumulation of glycogen in one or more tissues (for example,
relative to a healthy subject or an earlier point in time),
including heart, skeletal muscle, liver, and nervous system
tissues. In specific embodiments, the subject has at least one
IVS1-13T>G mutation (also referred to as c.336-13T>G),
possibly in combination with other mutation(s) that leads to
reduced expression of functional GAA protein. A summary of
molecular genetic testing used in GSD-II is shown in Table 3
below.
TABLE-US-00003 TABLE 3 Mutation Detection Gene Frequency by Test
Test Symbol Test Method Mutations Detected Method Availability GAA
Sequence analysis p.Arg854* ~50%-60% Clinical p.Asp645Glu ~40%-80%
IVS1-13T > G ~50%-85% Other sequence variants in the .sup.
83%-93% gene Sequence analysis of select Sequence variants in the
.sup. 83%-93% exons select exons Targeted mutation analysis
Sequence variants in targeted 100% of for variants sites among the
targeted mutations Deletion/duplication Exonic and whole-gene .sup.
5%-13% analysis deletions/duplications
[0234] Certain embodiments relate to methods of increasing
expression of exon 2-containing GAA mRNA or protein in a cell,
tissue, and/or subject, as described herein. In some instances,
exon-2 containing GAA mRNA or protein is increased by about or at
least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%,
17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, or 100% relative to a control, for
example, a control cell/subject, a control composition without the
antisense oligomer, the absence of treatment, and/or an earlier
time-point. Also included are methods of maintaining the expression
of containing GAA mRNA or protein relative to the levels of a
healthy control.
[0235] Some embodiments relate to methods of increasing expression
of functional/active GAA protein a cell, tissue, and/or subject, as
described herein. In certain instances, the level of
functional/active GAA protein is increased by about or at least
about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%,
18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%, 80%, 85%, 90%, 95%, or 100% relative to a control, for
example, a control cell/subject, a control composition without the
antisense oligomer, the absence of treatment, and/or an earlier
time-point. Also included are methods of maintaining the expression
of functional/active GAA protein relative to the levels of a
healthy control.
[0236] Particular embodiments relate to methods of reducing the
accumulation of glycogen in one or more cells, tissues, and/or
subjects, as described herein. In certain instances, the
accumulation of glycogen is reduced by about or at least about 5%,
6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%, 95%, or 100% relative to a control, for example, a
control cell/subject, a control composition without the antisense
oligomer, the absence of treatment, and/or an earlier time-point.
Also included are methods of maintaining normal or otherwise
healthy glycogen levels in a cell, tissue, and/or subject (e.g.,
asymptomatic levels or levels associated with reduced symptoms of
GSD-II).
[0237] Also included are methods of reducing one or more symptoms
of GSD-II in a subject in need thereof. Particular examples include
symptoms of infantile GSD-II such as cardiomegaly, hypotonia,
cardiomyopathy, left ventricular outflow obstruction, respiratory
distress, motor delay/muscle weakness, and feeding
difficulties/failure to thrive. Additional examples include
symptoms of late onset GSD-II such as muscle weakness (e.g.,
skeletal muscle weakness including progressive muscle weakness),
impaired cough, recurrent chest infections, hypotonia, delayed
motor milestones, difficulty swallowing or chewing, and reduced
vital capacity or respiratory insufficiency.
[0238] The antisense oligomers of the disclosure can be
administered to subjects to treat (prophylactically or
therapeutically) GSD-II. In conjunction with such treatment,
pharmacogenomics (i.e., the study of the relationship between an
individual's genotype and that individual's response to a foreign
compound or drug) may be considered. Differences in metabolism of
therapeutics can lead to severe toxicity or therapeutic failure by
altering the relation between dose and blood concentration of the
pharmacologically active drug.
[0239] Thus, a physician or clinician may consider applying
knowledge obtained in relevant pharmacogenomics studies in
determining whether to administer a therapeutic agent as well as
tailoring the dosage and/or therapeutic regimen of treatment with a
therapeutic agent.
[0240] Effective delivery of the antisense oligomer to the target
nucleic acid is one aspect of treatment. Routes of antisense
oligomer delivery include, but are not limited to, various systemic
routes, including oral and parenteral routes, e.g., intravenous,
subcutaneous, intraperitoneal, and intramuscular, as well as
inhalation, transdermal and topical delivery. The appropriate route
may be determined by one of skill in the art, as appropriate to the
condition of the subject under treatment. Vascular or extravascular
circulation, the blood or lymph system, and the cerebrospinal fluid
are some non-limiting sites where the RNA may be introduced. Direct
CNS delivery may be employed, for instance, intracerebral
ventribular or intrathecal administration may be used as routes of
administration.
[0241] In particular embodiments, the antisense oligomer(s) are
administered to the subject by intramuscular injection (IM), i.e.,
they are administered or delivered intramuscularly. Non-limiting
examples of intramuscular injection sites include the deltoid
muscle of the arm, the vastus lateralis muscle of the leg, and the
ventrogluteal muscles of the hips, and dorsogluteal muscles of the
buttocks. In specific embodiments, a PMO, PMO-X, or PPMO is
administered by IM.
[0242] In certain embodiments, the subject in need thereof as
glycogen accumulation in central nervous system tissues. Examples
include instances where central nervous system pathology
contributes to respiratory deficits in GSD-II (see, e.g.,
DeRuisseau et al., PNAS USA. 106:9419-24, 2009). Accordingly, the
antisense oligomers described herein can be delivered to the
nervous system of a subject by any art-recognized method, e.g.,
where the subject has GSD-II with involvement of the CNS. For
example, peripheral blood injection of the antisense oligomers of
the disclosure can be used to deliver said reagents to peripheral
neurons via diffusive and/or active means. Alternatively, the
antisense oligomers can be modified to promote crossing of the
blood-brain-barrier (BBB) to achieve delivery of said reagents to
neuronal cells of the central nervous system (CNS). Specific recent
advancements in antisense oligomer technology and delivery
strategies have broadened the scope of antisense oligomer usage for
neuronal disorders (see, e.g., Forte, A., et al. 2005. Curr. Drug
Targets 6:21-29; Jaeger, L. B., and W. A. Banks. 2005. Methods Mol.
Med. 106:237-251; Vinogradov, S. V., et al. 2004. Bioconjug. Chem.
5:50-60; the foregoing are incorporated herein in their entirety by
reference). For example, the antisense oligomers of the disclosure
can be generated as peptide nucleic acid (PNA) compounds. PNA
reagents have each been identified to cross the BBB (Jaeger, L. B.,
and W. A. Banks. 2005. Methods Mol. Med. 106:237-251). Treatment of
a subject with, e.g., a vasoactive agent, has also been described
to promote transport across the BBB (Id). Tethering of the
antisense oligomers of the disclosure to agents that are actively
transported across the BBB may also be used as a delivery
mechanism. Administration of antisense agents together with
contrast agents such as iohexol (e.g., separately, concurrently, in
the same formulation) can also facilitate delivery across the BBB,
as described in PCT Publication No. WO/2013/086207, incorporated by
reference in its entirety.
[0243] In certain embodiments, the antisense oligomers of the
disclosure can be delivered by transdermal methods (e.g., via
incorporation of the antisense oligomers into, e.g., emulsions,
with such antisense oligomers optionally packaged into liposomes).
Such transdermal and emulsion/liposome-mediated methods of delivery
are described for delivery of antisense oligomers in the art, e.g.,
in U.S. Pat. No. 6,965,025, the contents of which are incorporated
in their entirety by reference herein.
[0244] The antisense oligomers described herein may also be
delivered via an implantable device. Design of such a device is an
art-recognized process, with, e.g., synthetic implant design
described in, e.g., U.S. Pat. No. 6,969,400, the contents of which
are incorporated in their entirety by reference herein.
[0245] Antisense oligomers can be introduced into cells using
art-recognized techniques (e.g., transfection, electroporation,
fusion, liposomes, colloidal polymeric particles and viral and
non-viral vectors as well as other means known in the art). The
method of delivery selected will depend at least on the oligomer
chemistry, the cells to be treated and the location of the cells
and will be apparent to the skilled artisan. For instance,
localization can be achieved by liposomes with specific markers on
the surface to direct the liposome, direct injection into tissue
containing target cells, specific receptor-mediated uptake, or the
like.
[0246] As known in the art, antisense oligomers may be delivered
using, e.g., methods involving liposome-mediated uptake, lipid
conjugates, polylysine-mediated uptake, nanoparticle-mediated
uptake, and receptor-mediated endocytosis, as well as additional
non-endocytic modes of delivery, such as microinjection,
permeabilization (e.g., streptolysin-O permeabilization, anionic
peptide permeabilization), electroporation, and various
non-invasive non-endocytic methods of delivery that are known in
the art (refer to Dokka and Rojanasakul, Advanced Drug Delivery
Reviews 44, 35-49, incorporated by reference in its entirety).
[0247] The antisense oligomers may be administered in any
convenient vehicle or carrier which is physiologically and/or
pharmaceutically acceptable. Such a composition may include any of
a variety of standard pharmaceutically acceptable carriers employed
by those of ordinary skill in the art. Examples include, but are
not limited to, saline, phosphate buffered saline (PBS), water,
aqueous ethanol, emulsions, such as oil/water emulsions or
triglyceride emulsions, tablets and capsules. The choice of
suitable physiologically acceptable carrier will vary dependent
upon the chosen mode of administration. "Pharmaceutically
acceptable carrier" is intended to include any and all solvents,
dispersion media, coatings, antibacterial and antifungal agents,
isotonic and absorption delaying agents, and the like, compatible
with pharmaceutical administration. The use of such media and
agents for pharmaceutically active substances is well known in the
art. Except insofar as any conventional media or agent is
incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions
[0248] The compounds (e.g., antisense oligomers) of the present
disclosure may generally be utilized as the free acid or free base.
Alternatively, the compounds of this disclosure may be used in the
form of acid or base addition salts. Acid addition salts of the
free amino compounds of the present disclosure may be prepared by
methods well known in the art, and may be formed from organic and
inorganic acids. Suitable organic acids include maleic, fumaric,
benzoic, ascorbic, succinic, methanesulfonic, acetic,
trifluoroacetic, oxalic, propionic, tartaric, salicylic, citric,
gluconic, lactic, mandelic, cinnamic, aspartic, stearic, palmitic,
glycolic, glutamic, and benzenesulfonic acids.
[0249] Suitable inorganic acids include hydrochloric, hydrobromic,
sulfuric, phosphoric, and nitric acids. Base addition salts
included those salts that form with the carboxylate anion and
include salts formed with organic and inorganic cations such as
those chosen from the alkali and alkaline earth metals (for
example, lithium, sodium, potassium, magnesium, barium and
calcium), as well as the ammonium ion and substituted derivatives
thereof (for example, dibenzylammonium, benzylammonium,
2-hydroxyethylammonium, and the like). Thus, the term
"pharmaceutically acceptable salt" is intended to encompass any and
all acceptable salt forms.
[0250] In addition, prodrugs are also included within the context
of this disclosure. Prodrugs are any covalently bonded carriers
that release a compound in vivo when such prodrug is administered
to a patient. Prodrugs are generally prepared by modifying
functional groups in a way such that the modification is cleaved,
either by routine manipulation or in vivo, yielding the parent
compound. Prodrugs include, for example, compounds of this
disclosure wherein hydroxy, amine or sulfhydryl groups are bonded
to any group that, when administered to a patient, cleaves to form
the hydroxy, amine or sulfhydryl groups. Thus, representative
examples of prodrugs include (but are not limited to) acetate,
formate and benzoate derivatives of alcohol and amine functional
groups of the antisense oligomers of the disclosure. Further, in
the case of a carboxylic acid (--COOH), esters may be employed,
such as methyl esters, ethyl esters, and the like.
[0251] In some instances, liposomes may be employed to facilitate
uptake of the antisense oligomer into cells (see, e.g., Williams,
S. A., Leukemia 10(12):1980-1989, 1996; Lappalainen et al.,
Antiviral Res. 23:119, 1994; Uhlmann et al., antisense oligomers: a
new therapeutic principle, Chemical Reviews, Volume 90, No. 4, 25
pages 544-584, 1990; Gregoriadis, G., Chapter 14, Liposomes, Drug
Carriers in Biology and Medicine, pp. 287-341, Academic Press,
1979). Hydrogels may also be used as vehicles for antisense
oligomer administration, for example, as described in WO 93/01286.
Alternatively, the oligomers may be administered in microspheres or
microparticles. (See, e.g., Wu, G. Y. and Wu, C. H., J. Biol. Chem.
262:4429-4432, 30 1987). Alternatively, the use of gas-filled
microbubbles complexed with the antisense oligomers can enhance
delivery to target tissues, as described in U.S. Pat. No.
6,245,747. Sustained release compositions may also be used. These
may include semipermeable polymeric matrices in the form of shaped
articles such as films or microcapsules.
[0252] In one embodiment, the antisense oligomer is administered to
a mammalian subject, e.g., human or domestic animal, exhibiting the
symptoms of a lysosomal storage disorder, in a suitable
pharmaceutical carrier. In one aspect of the method, the subject is
a human subject, e.g., a patient diagnosed as having GSD-II (Pompe
disease). In one preferred embodiment, the antisense oligomer is
contained in a pharmaceutically acceptable carrier, and is
delivered orally. In another preferred embodiment, the oligomer is
contained in a pharmaceutically acceptable carrier, and is
delivered intravenously (i.v.).
[0253] In one embodiment, the antisense compound is administered in
an amount and manner effective to result in a peak blood
concentration of at least 200-400 nM antisense oligomer. Typically,
one or more doses of antisense oligomer are administered, generally
at regular intervals, for a period of about one to two weeks.
Preferred doses for oral administration are from about 1-1000 mg
oligomer per 70 kg. In some cases, doses of greater than 1000 mg
oligomer/patient may be necessary. For i.v. administration,
preferred doses are from about 0.5 mg to 1000 mg oligomer per 70
kg. The antisense oligomer may be administered at regular intervals
for a short time period, e.g., daily for two weeks or less.
However, in some cases the oligomer is administered intermittently
over a longer period of time. Administration may be followed by, or
concurrent with, administration of an antibiotic or other
therapeutic treatment. The treatment regimen may be adjusted (dose,
frequency, route, etc.) as indicated, based on the results of
immunoassays, other biochemical tests and physiological examination
of the subject under treatment.
[0254] An effective in vivo treatment regimen using the antisense
oligomers of the disclosure may vary according to the duration,
dose, frequency and route of administration, as well as the
condition of the subject under treatment (i.e., prophylactic
administration versus administration in response to localized or
systemic infection). Accordingly, such in vivo therapy will often
require monitoring by tests appropriate to the particular type of
disorder under treatment, and corresponding adjustments in the dose
or treatment regimen, in order to achieve an optimal therapeutic
outcome.
[0255] Treatment may be monitored, e.g., by general indicators of
disease known in the art. The efficacy of an in vivo administered
antisense oligomer of the disclosure may be determined from
biological samples (tissue, blood, urine etc.) taken from a subject
prior to, during and subsequent to administration of the antisense
oligomer. Assays of such samples include (1) monitoring the
presence or absence of heteroduplex formation with target and
non-target sequences, using procedures known to those skilled in
the art, e.g., an electrophoretic gel mobility assay; (2)
monitoring the amount of a mutant mRNA in relation to a reference
normal mRNA or protein as determined by standard techniques such as
RT-PCR, Northern blotting, ELISA or Western blotting.
[0256] In some embodiments, the antisense oligomer is actively
taken up by mammalian cells. In further embodiments, the antisense
oligomer may be conjugated to a transport moiety (e.g., transport
peptide or CPP) as described herein to facilitate such uptake.
VI. Dosing
[0257] The formulation of therapeutic compositions and their
subsequent administration (dosing) is believed to be within the
skill of those in the art. Dosing is dependent on severity and
responsiveness of the disease state to be treated, with the course
of treatment lasting from several days to several months, or until
a cure is effected or a diminution of the disease state is
achieved. Optimal dosing schedules can be calculated from
measurements of drug accumulation in the body of the patient.
Persons of ordinary skill can easily determine optimum dosages,
dosing methodologies and repetition rates. Optimum dosages may vary
depending on the relative potency of individual oligomers, and can
generally be estimated based on EC50s found to be effective in in
vitro and in vivo animal models. In general, dosage is from 0.01
.mu.g to 100 g per kg of body weight, and may be given once or more
daily, weekly, monthly or yearly, or even once every 2 to 20 years.
Persons of ordinary skill in the art can easily estimate repetition
rates for dosing based on measured residence times and
concentrations of the drug in bodily fluids or tissues. Following
successful treatment, it may be desirable to have the patient
undergo maintenance therapy to prevent the recurrence of the
disease state, wherein the oligomer is administered in maintenance
doses, ranging from 0.01 .mu.g to 100 g per kg of body weight, once
or more daily, to once every 20 years.
[0258] While the present disclosure has been described with
specificity in accordance with certain of its embodiments, the
following examples serve only to illustrate the disclosure and are
not intended to limit the same. Each of the references, patents,
patent applications, GenBank accession numbers, and the like
recited in the present application are incorporated herein by
reference in its entirety.
VII. Examples
Example 1
Design of Antisense Targeting Sequences
[0259] Antisense oligomer targeting sequences were designed for
therapeutic splice-switching applications related to the
IVS1-13T>G mutation in the human GAA gene. Here, it is expected
that splice-switching oligomers will suppress intronic and exonic
splice silencer elements (ISS and ESS elements, respectively) and
thereby promote exon 2 retention in the mature GAA mRNA.
Restoration of normal or near-normal GAA expression would then
allow functional enzyme to be synthesized, thereby providing a
clinical benefit to GSD-II patients.
[0260] Certain antisense targeting sequences were thus designed to
mask splice silencer elements, either within exon 2 of the GAA gene
or within its flanking introns. Non-limiting examples of potential
silencer element targets include hnRNPA1 motifs (TAGGGA),
Tra2-.beta. motifs, and 9G8 motifs. In silico secondary structure
analysis (mFold) of introns 1 and 2 (IVS1 and IVS2, respectively)
mRNAs was also employed to identify long distance interactions that
could provide suitable antisense target sequences. The antisense
targeting sequences resulting from this analysis are shown in Table
2 (see also SEQ ID NOS:4-120).
[0261] Exemplary oligomers comprising a targeting sequence as set
forth in Table 2 are prepared in this example as 2'-O-methyl
modified antisense oligomers having a phosphorothioate backbone.
These antisense oligomers are complexed with a cationic delivery
agent (Lipofectamine 2000, Lipofectin or similar) and transfected
into GSD-II patient-derived fibroblasts and/or lymphocytes carrying
the IVS1-13T>G mutation, as described in Example 2 below.
[0262] In further experiments, other exemplary oligomers comprising
a targeting sequence as set forth in
[0263] Table 2 are prepared as PMOs. These antisense oligomers are
introduced into the patient-derived fibroblasts and/or lymphocytes
using a nucleofection protocol as also described in Example 2
below.
Example 2
Antisense Oligomers Induce Exon 2 Inclusion in GSD-II
Patient-Derived Fibroblasts
[0264] Experiments are performed to test the ability of antisense
oligomers to induce exon 2 inclusion in fibroblasts and/or
lymphocytes derived from individuals with GSD-II. In one set of
experiments, 2'-O-methyl modified antisense oligomers are prepared
according to standard protocols and transfected into GSD-II
patient-derived fibroblasts and/or lymphocytes carrying the
IVS1-13G>T mutation. In another set of experiments, PMOs are
prepared according to standard protocols and introduced into these
same cells by nucleofection. Levels of exon 2-containing mRNAs are
then measured by RT-PCR.
[0265] GSD-II Cells.
[0266] Patient-derived fibroblasts or lymphocytes from individuals
with GSD-II (Coriell cell lines GM00443, GM11661, GM14463 and/or
GM14484) are cultured according to standard protocols in Eagle's
MEM with 10% FBS. Cells are passaged about 3-5 days before the
experiments and are approximately 80% confluent at transfection or
nucleofection.
[0267] GM00443 fibroblasts are from a 30 year old male. Adult form;
onset in third decade; normal size and amount of mRNA for GAA, GAA
protein detected by antibody, but only 9 to 26% of normal
acid-alpha-1,4 glucosidase activity; passage 3 at CCR; donor
subject is heterozygous with one allele carrying a T>G
transversion at position -13 of the acceptor site of intron 1 of
the GAA gene, resulting in alternatively spliced transcripts with
deletion of the first coding exon [exon 2 (IVS1-13T>G)].
[0268] GM11661 fibroblasts are from a 38 year old male. Abnormal
liver function tests; occasional charley-horse in legs during
physical activity; morning headaches; intolerance to greasy foods;
abdominal cyst; deficient fibroblast and WBC acid-alpha-1,4
glucosidase activity; donor subject is a compound heterozygote:
allele one carries a T>G transversion at position -13 of the
acceptor site of intron 1 of the GAA gene (IVS1-13T>G); the
resulting alternatively spliced transcript has an in frame deletion
of exon 2 which contains the initiation codon; allele two carries a
deletion of exon 18.
[0269] GM14463 lymphocytes are from a 26 year old female.
Clinically affected; adult onset; severe generalized muscle
weakness and wasting; severe respiratory insufficiency; muscle
biopsy showed acid maltase deficiency; donor subject is a compound
heterozygote: one allele has a T>G transversion at position -13
of the acceptor site of intron 1 of the GAA gene (IVS1-13T>G)
resulting in alternatively spliced transcripts with deletion of the
first coding exon, exon 2; the second allele has a 1 bp deletion at
nucleotide 366 in exon 2 (c.366delT) resulting in a frameshift and
protein truncation [Gln124SerfsX18).
[0270] GM14484 lymphocytes are from a 61 year old male. Clinically
affected; adult onset); donor subject is a compound heterozygote:
one allele has a T>G transversion at position -13 of the
acceptor site of intron 1 of the GAA gene (IVS1-13T>G) resulting
in alternatively spliced transcripts with deletion of the first
coding exon, exon 2; the second allele has a C>T transition at
nucleotide 172 in exon 2 (c.172C>T) resulting in a stop at codon
58 [Gln58Ter (Q58X)].
[0271] Upon arrival, GSD-II patient cells are expanded and aliquots
frozen for long-term storage. Cells are then propagated and RT-PCR
is performed on total RNA extracted from the cells to confirm exon
2 is missing from the mature GAA-coding transcript.
[0272] Transfection Protocol.
[0273] Briefly, 2'-O-methyl modified antisense oligomers are mixed
with a cationic liposome preparation such as Lipofectamine 2000 and
added to cultured cells over the concentration range 0, 2.5, 5, 10,
25, 50, 100 and 200 nM. Five hours after transfection, the media is
replaced and the cells incubated in 5% CO.sub.2 at 37.degree. C.
for 24 to 72 hours. A sham transfection and untreated cells are
included as negative controls. Total RNA is extracted from the cell
preparations and used as the template in RT-PCR assays for monitor
the changes in GAA expression, in particular looking at the
increased inclusion/retention of exon 2 in the mature GAA
transcript. The transfected 2'-O-methyl modified antisense
oligomers are shown in Table E1 below. For this example, each X for
SEQ ID NOS: 119 and 120 was uracil (U).
TABLE-US-00004 TABLE E1 No. SEQ on ID Gel Name Sequence NO 1
GAA-IVS2(-4-20) CCCGCCCCUGCCCUGCC 10 2 GAA-IVS2(-14-30)
UGGCCGCCGCCCCCGCCC 11 3 GAA-IVS2(-33-52) UGUCCACGCGCACCCUCUGC 12 4
GAA-IVS2(-213-237) UGACCCACCUUUUCAUAAAG 21 AUGAA 5
GAA-IVS2(-234-258) CUCUGGCAGCCCUACUCUAC 22 CUGAC 6
GGCCCXGGXCXGCXGGCXCC 119 CXGCX 7 GCXCCCXGCAGCCCCXGCXX 120 XGCAG 8
GAA-IVS1(-39-20) GCUCAGCAGGGAGGCGGGAG 4 9 GAA-IVS1(-74-55)
GGCUCUCAAAGCAGCUCUGA 5 10 GAA-IVS1(-99-75) GACAUCAACCGCGGCUGGCA 6
CUGCA 11 GAA-IVS1(-139-115) GGGUAAGGUGGCCAGGGUGG 7 GUGUU 12
GAA-IVS1(-158-140) GCCCUGCUGUCUAGACUGG 8 13 GAA-IVS1(-179-160)
GAGAGGGCCAGAAGGAAGGG 9 14 GAA-IVS2(-53-72) GUGAGGUGCGUGGGUGUCGA 13
15 GAA-IVS2(-73-92) GCAACAUGCACCCCACCCUU 14 16 GAA-IVS2(-93-112)
AGGGCCCAGCACACAGUGGU 15 17 GAA-IVS2(-113-132) UCACACCUCCGCUCCCAGCA
16 18 GAA-IVS2(-133-150) GGCGCUGCCAUUGUCUGC 17 19
GAA-IVS2(-153-172) GUGUCCCCACUGCUCCCCGA 18 20 GAA-IVS2(-173-192)
CUGGAGUACCUGUCACCGUG 19 21 GAA-IVS2(-193-212) UGAGCCCCGAGCCCUGCCUU
20 22 GAA-IVS2(-338-364) CUAGUAUAAAUACAUCCCAA 23 AUUUUGC For any of
the sequences in Table E1, the uracil bases (U) can be substituted
with thymine bases (T) and vice versa, and each X is independently
selected from thymine (T) or uracil (U).
[0274] Nucleofection Protocol.
[0275] Antisense PMOs are prepared as 1-2 mM stock solutions in
nuclease-free water (not treated with DEPC) from which appropriate
dilutions are made for nucleofection. GSD-II cells are trypsinized,
counted, centrifuged at 90 g for 10 minutes, and 1-5.times.10.sup.5
cells per well are resuspended in nucleofection Solution P2
(Lonza). Antisense PMO solution and cells are then added to each
well of a Nucleocuvette 16-well strip, and pulsed with program
EN-100. Cells are incubated at room temperature for 10 minutes and
transferred to a 12-well plate in duplicate. Total RNA is isolated
from treated cells after 48 hours using the GE Illustra 96 Spin kit
following the manufacturer's recommended protocol. Recovered RNA is
stored at -80.degree. C. prior to analysis.
[0276] GAA RT-PCR.
[0277] For PCR detection of exon 2-containing mRNAs, primer
sequences are chosen from exon 1(forward) to exon 3(reverse).
RT-PCR across exons 1-3 will generate a full length amplicon of
around 1177 bases (see FIG. 2 for the full-length amplicon from
normal human cells). The size difference between the intact
amplicon (.about.1177 bases) and the .about.600 base transcript
that is missing exon 2 (exon 2 is .about.578 bases) means there
will be substantial preferential amplification of the shorter
product. This will set a high benchmark in assaying the efficacy of
antisense oligomers to induce splicing of the full-length
transcript or exon2-containing transcript.
[0278] Reverse transcriptase PCR is performed to amplify the GAA
allele using the SuperScript III One-Step RT-PCR system
(Invitrogen). 400 ng total RNA isolated from nucleofected cells is
reverse transcribed and amplified with the gene-specific
primers.
[0279] The amplification solution provided in the One-Step kit is
supplemented with Cy5-labeled dCTP (GE) to enable band
visualization by fluorescence. Digested samples are run on a
pre-cast 10% acrylamide/TBE gel (Invitrogen) and visualized on a
Typhoon Trio (GE) using the 633 nm excitation laser and 670 nm BP
30 emission filter with the focal plane at the platen surface. Gels
are analyzed with ImageQuant (GE) to determine the intensities of
the bands. Intensities from all bands containing exon 2 are added
together to represent the full exon 2 transcript levels in the
inclusion analysis.
[0280] Alternatively, PCR amplification products are analyzed on a
Caliper bioanalyzer or Agilent 2200 Tape Station for determination
of % exon inclusion.
[0281] The results for the 2'-O-methyl modified antisense oligomers
of Table E1 are shown in FIGS. 3A-3C. FIG. 3A shows that oligomers
9 (GAA-IVS1 (-74-55)) and 12 GAA-IVS1 (-158-140)) induced exon
2-inclusion in human cells carrying the IVS1-13G>T mutation, as
evidenced by reduced amplification of the .about.600 base amplicon
(relative to the full-length .about.1177 base amplicon). FIG. 3B
shows that oligomer 14 (GAA-IVS2 (-53-72)) induced exon-2
inclusion, and FIG. 3C shows that oligomers 20 (GAA-IVS2
(-173-192)) and 22 (GAA-IVS2 (-338-364)) likewise induced a degree
of exon-2 inclusion
Example 3
Antisense Oligomers Induce Elevated Levels of Enzymatically Active
Acid Alpha-Glucosidase in GSD-II Patient-Derived Fibroblasts
[0282] GSD-II patient cells treated with the antisense oligomers of
the disclosure (as described above) are shown to have elevated
levels of functional/active GAA due to increased expression of exon
2-containing GAA mRNA. Treated cells are prepared and protein is
extracted using standard protocols. Protein concentration is
determined and defined quantities of extracted protein are measured
for GAA enzyme activity. Antisense oligomers that induce higher
levels of GAA are preferred embodiments of the disclosure.
Example 4
Antisense PMO-Induced Dose-Dependent Exon 2 Inclusion in GSD-II
Patient-Derived Fibroblasts
[0283] GM00443 fibroblasts were treated using the above-described
nucleofection procedure and antisense sequences made as PMOs based
on the initial GAA exon 2 inclusion results described above in
Example 2. 20 uM PMOs, according to formula (VII) above with
targeting sequences identified in Table 4A below, were nucleofected
as previously described, and cells incubated at 37.degree. C. with
5% CO.sub.2 for 24 hours before total RNA isolation. RT-PCR
amplification of RNA with primers FWD124 (SEQ ID NO: 121), FWD645
(SEQ ID NO: 122) and REV780 (SEQ ID NO: 123) of Table 4B was
analyzed using a Caliper LabChip to determine percent exon 2
inclusion, the results of which are shown in FIGS. 4A (intron 1
targeted PMOs), 4B (exon 2 targeted PMOs), and 4C (intron 2
targeted PMOs).
TABLE-US-00005 TABLE 4A Nucleofected PMO targeting sequences SEQ
Name Sequence (5'-3') ID NO GAA Intron 1 Antisense Sequences: FIG.
4A GAA-IVS1(-39-20) GCUCAGCAGGGAGGCGGGAG 4 GAA-IVS1(-74-55)
GGCUCUCAAAGCAGCUCUGA 5 GAA-IVS1(-99-75) GACAUCAACCGCGGCUGGCACUGCA 6
GAA-IVS1(-139-115) GGGUAAGGUGGCCAGGGUGGGUGUU 7 GAA-IVS1(-158-140)
GCCCUGCUGUCUAGACUGG 8 GAA-IVS1(-179-160) GAGAGGGCCAGAAGGAAGGG 9
GAA-IVS1.6.20 GCGGGGCAGACGTCAGGTGT 27 GAA-IVS1.10.20
CAGCGCGGGGCAGACGTCAG 29 GAA-IVS1.14.20 CCGGCAGCGCGGGGCAGACG 31
GAA-IVS1.17.20 CCGCCGGCAGCGCGGGGCAG 33 GAA-IVS1.24.20
GATGTTACCGCCGGCAGCGC 35 GAA-IVS1.28.20 CTGGGATGTTACCGCCGGCA 37
GAA-IVS1.32.20 GCTTCTGGGATGTTACCGCC 39 GAA-IVS1.2015.20
TGGCAACTCGTATGTCCTTA 41 GAA-IVS1.2019.20 ATTCTGGCAACTCGTATGTC 43
GAA-IVS1.2024.20 AAGTGATTCTGGCAACTCGT 45 GAA-IVS1.2037.20
TGGGTGTCAGCGGAAGTGAT 46 GAA-IVS1.2043.20 GTCCACTGGGTGTCAGCGGA 48
GAA-IVS1.2048.20 GCTTGGTCCACTGGGTGTCA 50 GAA-IVS1.2071.20
CCCCACTTCTGCATAAAGGT 52 GAA-IVS1.2075.20 GGAGCCCCACTTCTGCATAA 54
GAA-IVS1.2079.20 GCTGGGAGCCCCACTTCTGC 56 GAA-IVS1.2088.20
CCACGCCTGGCTGGGAGCCC 58 GAA-IVS1.2115.20 TCCGAAGTGCTGGGATTTCA 59
GAA-IVS1.2132.20 TCCACCCCCCTTGGCCTTCC 60 GAA-IVS1.2135.20
TGATCCACCCCCCTTGGCCT 61 GAA-IVS1.2140.20 TCAAGTGATCCACCCCCCTT 62
GAA-IVS1.2152.20 GAACTCCTGAGCTCAAGTGA 64 GAA-IVS1.2156.20
TCTCGAACTCCTGAGCTCAA 65 GAA-IVS1.2165.20 CCAGGCTGGTCTCGAACTCC 67
GAA-IVS1.2178.20 TTTGCCATGTTACCCAGGCT 68 GAA-IVS1.2185.20
ACGGGATTTTGCCATGTTAC 70 GAA-IVS1.2190.20 TAGAGACGGGATTTTGCCAT 72
GAA-IVS1.2195.20 TTTTGTAGAGACGGGATTTT 73 GAA-IVS1.2202.20
TCTGTATTTTTGTAGAGACG 75 GAA-IVS1.2206.20 ATTTTCTGTATTTTTGTAGA 77
GAA-IVS1.2210.20 GCTAATTTTCTGTATTTTTG 79 GAA Exon 2 Antisense
Sequences: FIG. 4B GAAEx2A(+202+226) GGCCCUGGUCUGCUGGCUCCCUGCU 24
GAAEx2A(+367+391) GCUCCCUGCAGCCCCUGCUUUGCAG 25 GAA Intron 2
Antisense Sequences: FIG. 4C GAA-IVS2(-4-20) CCCGCCCCUGCCCUGCC 10
GAA-IVS2(-14-30) UGGCCGCCGCCCCCGCCC 11 GAA-IVS2(-33-52)
UGUCCACGCGCACCCUCUGC 12 GAA-IVS2(-53-72) GUGAGGUGCGUGGGUGUCGA 13
GAA-IVS2(-73-92) GCAACAUGCACCCCACCCUU 14 GAA-IVS2(-93-112)
AGGGCCCAGCACACAGUGGU 15 GAA-IVS2(-113-132) UCACACCUCCGCUCCCAGCA 16
GAA-IVS2(-133-150) GGCGCUGCCAUUGUCUGC 17 GAA-IVS2(-153-172)
GUGUCCCCACUGCUCCCCGA 18 GAA-IVS2(-173-192) CUGGAGUACCUGUCACCGUG 19
GAA-IVS2(-193-212) UGAGCCCCGAGCCCUGCCUU 20 GAA-IVS2(-213-237)
UGACCCACCUUUUCAUAAAGAUGAA 21 GAA-IVS2(-234-258)
CUCUGGCAGCCCUACUCUACCUGAC 22 GAA-IVS2(-338-364)
CUAGUAUAAAUACAUCCCAAAUUUU 23 GC GAA-IVS2.6.20 CCGCCCCCGCCCCTGCCCTG
81 GAA-IVS2.9.20 CCGCCGCCCCCGCCCCTGCC 82 GAA-IVS2.12.20
TGGCCGCCGCCCCCGCCCCT 83 GAA-IVS2.18.20 CTGCCCTGGCCGCCGCCCCC 84
GAA-IVS2.24.20 CACCCTCTGCCCTGGCCGCC 85 GAA-IVS2.27.20
GCGCACCCTCTGCCCTGGCC 86 GAA-IVS2.40.20 TGTCGATGTCCACGCGCACC 87
GAA-IVS2.48.20 TGCGTGGGTGTCGATGTCCA 89 GAA-IVS2.67.20
GCACCCCACCCTTGTGAGGT 91 GAA-IVS2.72.20 AACATGCACCCCACCCTTGT 92
GAA-IVS2.431.20 AGGAGGAGGACGCCTCCCCC 93 GAA-IVS2.446.20
CTCATCTGCAGAGCCAGGAG 94 GAA-IVS2.451.20 GCTCCCTCATCTGCAGAGCC 97
GAA-IVS2.454.20 TCGGCTCCCTCATCTGCAGA 100 GAA-IVS2.457.20
GCCTCGGCTCCCTCATCTGC 103
TABLE-US-00006 TABLE 4B RT-PCR primer sequences for RNA
amplification SEQ ID Name Sequence (5'-3') NO FWD124
CGTTGTTCAGCGAGGGA 121 FWD645 CTCCTCTGAAATGGGCTACAC 122 REV780
ACCTCGTAGCGCCTGTTA 123
[0284] Thus, the disclosure also includes a method of detecting
exon 2 inclusion in a human acid alpha-glucosidase (GAA) gene mRNA,
the method comprising:
[0285] amplifying the GAA mRNA with at least one polymerase chain
reaction primer comprising a base sequence selected from the group
consisting of SEQ ID NOS: 121, 122, or 123.
Sequence CWU 1
1
12312664DNAHomo sapiensmisc_feature(2652)..(2652)n is t or u
1gtgagacacc tgacgtctgc cccgcgctgc cggcggtaac atcccagaag cgggtttgaa
60cgtgcctagc cgtgccccca gcctcttccc ctgagcggag cttgagcccc agacctctag
120tcctcccggt ctttatctga gttcagctta gagatgaacg gggagccgcc
ctcctgtgct 180gggcttgggg ctggaggctg catcttcccg tttctagggt
ttcctttccc cttttgatcg 240acgcagtgct cagtcctggc cgggacccga
gccacctctc ctgctcctgc aggacgcaca 300tggctgggtc tgaatccctg
gggtgaggag caccgtggcc tgagaggggg cccctgggcc 360agctctgaaa
tctgaatgtc tcaatcacaa agaccccctt aggccaggcc aggggtgact
420gtctctggtc tttgtccctg gttgctggca catagcaccc gaaacccttg
gaaaccgagt 480gatgagagag ccttttgctc atgaggtgac tgatgaccgg
ggacaccagg tggcttcagg 540atggaagcag atggccagaa agaccaaggc
ctgatgacgg gttgggatgg aaaaggggtg 600aggggctgga gattgagtga
atcaccagtg gcttagtcaa ccatgcctgc acaatggaac 660cccgtaagaa
accacaggga tcagagggct tcccgccggg ttgtggaaca caccaaggca
720ctggagggtg gtgcgagcag agagcacagc atcactgccc ccacctcaca
ccaggcccta 780cgcatctctt ccatacggct gtctgagttt tatcctttgt
aataaaccag caactgtaag 840aaacgcactt tcctgagttc tgtgaccctg
aagagggagt cctgggaacc tctgaattta 900taactagttg atcgaaagta
caagtgacaa cctgggattt gccattggcc tctgaagtga 960aggcagtgtt
gtgggactga gcccttaacc tgtggagtct gtgctgactc caggtagtgt
1020caagattgaa ttgaattgta ggacacccag ccgtgtccag aaagttgcag
aattgatggg 1080tgtgagaaaa accctacaca tttaatgtca gaagtgtggg
taaaatgttt caccctccag 1140cccagagagc cctaatttac cagtggccca
cggtggaaca ccacgtccgg ccgggggcag 1200agcgttccca gccaagcctt
ctgtaacatg acatgacagg tcagactccc tcgggccctg 1260agttcacttc
ttcctggtat gtgaccagct cccagtacca gagaaggttg cacagtcctc
1320tgctccaagg agcttcactg gccaggggct gctttctgaa atccttgcct
gcctctgctc 1380caaggcccgt tcctcagaga cgcagacccc tctgatggct
gactttggtt tgaggacctc 1440tctgcatccc tcccccatgg ccttgctcct
aggacacctt cttcctcctt tccctggggt 1500cagacttgcc taggtgcggt
ggctctccca gccttcccca cgccctcccc atggtgtatt 1560acacacacca
aagggactcc cctattgaaa tccatgcata ttgaatcgca tgtgggttcc
1620ggctgctcct gggaggagcc aggctaatag aatgtttgcc ataaaatatt
aatgtacaga 1680gaagcgaaac aaaggtcgtt ggtacttgtt aaccttacca
gcagaataat gaaagcgaac 1740ccccatatct catctgcacg cgacatcctt
gttgtgtctg tacccgaggc tccaggtgca 1800gccactgtta cagagactgt
gtttcttccc catgtacctc gggggccggg aggggttctg 1860atctgcaaag
tcgccagagg ttaagtcctt tctctcttgt ggctttgcca cccctggagt
1920gtcaccctca gctgcggtgc ccaggattcc ccactgtggt atgtccgtgc
accagtcaat 1980aggaaaggga gcaaggaaag gtactgggtc cccctaagga
catacgagtt gccagaatca 2040cttccgctga cacccagtgg accaagccgc
acctttatgc agaagtgggg ctcccagcca 2100ggcgtggtca ctcctgaaat
cccagcactt cggaaggcca aggggggtgg atcacttgag 2160ctcaggagtt
cgagaccagc ctgggtaaca tggcaaaatc ccgtctctac aaaaatacag
2220aaaattagct gggtgcggtg gtgtgtgcct acagtcccag ctactcagga
ggctgaagtg 2280ggaggattgc ttgagtctgg gaggtggagg ttgcagtgag
ccaggatctc accacagcac 2340tctggcccag gcgacagctg tttggcctgt
ttcaagtgtc tacctgcctt gctggtcttc 2400ctggggacat tctaagcgtg
tttgatttgt aacattttag cagactgtgc aagtgctctg 2460cactcccctg
ctggagcttt tctcgccctt ccttctggcc ctctccccag tctagacagc
2520agggcaacac ccaccctggc caccttaccc cacctgcctg ggtgctgcag
tgccagccgc 2580ggttgatgtc tcagagctgc tttgagagcc ccgtgagtgc
cgcccctccc gcctccctgc 2640tgagcccgct tncttctccc gcag
26642578DNAHomo sapiens 2gcctgtagga gctgtccagg ccatctccaa
ccatgggagt gaggcacccg ccctgctccc 60accggctcct ggccgtctgc gccctcgtgt
ccttggcaac cgctgcactc ctggggcaca 120tcctactcca tgatttcctg
ctggttcccc gagagctgag tggctcctcc ccagtcctgg 180aggagactca
cccagctcac cagcagggag ccagcagacc agggccccgg gatgcccagg
240cacaccccgg ccgtcccaga gcagtgccca cacagtgcga cgtccccccc
aacagccgct 300tcgattgcgc ccctgacaag gccatcaccc aggaacagtg
cgaggcccgc ggctgttgct 360acatccctgc aaagcagggg ctgcagggag
cccagatggg gcagccctgg tgcttcttcc 420cacccagcta ccccagctac
aagctggaga acctgagctc ctctgaaatg ggctacacgg 480ccaccctgac
ccgtaccacc cccaccttct tccccaagga catcctgacc ctgcggctgg
540acgtgatgat ggagactgag aaccgcctcc acttcacg 5783616DNAHomo sapiens
3gtgggcaggg caggggcggg ggcggcggcc agggcagagg gtgcgcgtgg acatcgacac
60ccacgcacct cacaagggtg gggtgcatgt tgcaccactg tgtgctgggc ccttgctggg
120agcggaggtg tgagcagaca atggcagcgc ccctcgggga gcagtgggga
caccacggtg 180acaggtactc cagaaggcag ggctcggggc tcattcatct
ttatgaaaag gtgggtcagg 240tagagtaggg ctgccagagg ttgcgaatga
aaacaggatg cccagtaaac ccgaattgca 300gataccccag gcatgacttt
gtttttttgt gtaaggatgc aaaatttggg atgtatttat 360actagaaaag
ctgcttgttg tttatctgaa attcagagtt atcaggtgtt ctgtatttta
420cctccatcct gggggaggcg tcctcctcct ggctctgcag atgagggagc
cgaggctcag 480agaggctgaa tgtgctgccc atggtcccac atccatgtgt
ggctgcacca ggacctgacc 540tgtccttggc gtgcgggttg ttctctggag
agtaaggtgg ctgtggggaa catcaataaa 600cccccatctc ttctag
616420DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 4gcncagcagg gaggcgggag 20520DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
5ggcncncaaa gcagcncnga 20625DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 6gacancaacc gcggcnggca
cngca 25725DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 7gggnaaggng gccagggngg gngnn 25819DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
8gcccngcngn cnagacngg 19920DNAArtificial SequenceAntisense oligomer
- GAA intron 1 targeting sequence 9gagagggcca gaaggaaggg
201017DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 10cccgccccng cccngcc 171118DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
11nggccgccgc ccccgccc 181220DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 12ngnccacgcg cacccncngc
201320DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 13gngaggngcg ngggngncga 201420DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
14gcaacangca ccccacccnn 201520DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 15agggcccagc acacagnggn
201620DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 16ncacaccncc gcncccagca 201718DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
17ggcgcngcca nngncngc 181820DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 18gngnccccac ngcnccccga
201920DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 19cnggagnacc ngncaccgng 202020DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
20ngagccccga gcccngccnn 202125DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 21ngacccaccn nnncanaaag
angaa 252225DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 22cncnggcagc ccnacncnac cngac
252327DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 23cnagnanaaa nacancccaa annnngc
272425DNAArtificial SequenceAntisense oligomer - GAA exon 2
targeting sequence 24ggcccnggnc ngcnggcncc cngcn
252525DNAArtificial SequenceAntisense oligomer - GAA exon 2
targeting sequence 25gcncccngca gccccngcnn ngcag
252620DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 26ggggcagacg ncaggngncn 202720DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
27gcggggcaga cgncaggngn 202820DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 28gcgcggggca gacgncaggn
202920DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 29cagcgcgggg cagacgncag 203020DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
30ggcagcgcgg ggcagacgnc 203120DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 31ccggcagcgc ggggcagacg
203220DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 32gccggcagcg cggggcagac 203320DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
33ccgccggcag cgcggggcag 203420DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 34gnnaccgccg gcagcgcggg
203520DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 35gangnnaccg ccggcagcgc 203620DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
36gggangnnac cgccggcagc 203720DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 37cngggangnn accgccggca
203820DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 38nncngggang nnaccgccgg 203920DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
39gcnncnggga ngnnaccgcc 204020DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 40gcaacncgna ngnccnnagg
204120DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 41nggcaacncg nangnccnna 204220DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
42ncnggcaacn cgnangnccn 204320DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 43anncnggcaa cncgnangnc
204420DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 44gnganncngg caacncgnan 204520DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
45aagnganncn ggcaacncgn 204620DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 46ngggngncag cggaagngan
204720DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 47ccacngggng ncagcggaag 204820DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
48gnccacnggg ngncagcgga 204920DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 49nggnccacng ggngncagcg
205020DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 50gcnnggncca cngggngnca 205120DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
51ccacnncngc anaaaggngc 205220DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 52ccccacnncn gcanaaaggn
205320DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 53agccccacnn cngcanaaag 205420DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
54ggagccccac nncngcanaa 205520DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 55ngggagcccc acnncngcan
205620DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 56gcngggagcc ccacnncngc 205720DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
57nggcngggag ccccacnncn 205820DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 58ccacgccngg cngggagccc
205920DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 59nccgaagngc ngggannnca 206020DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
60nccacccccc nnggccnncc 206120DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 61nganccaccc cccnnggccn
206220DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 62ncaagnganc caccccccnn 206320DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
63agcncaagng anccaccccc 206420DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 64gaacnccnga gcncaagnga
206520DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 65ncncgaacnc cngagcncaa 206620DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
66aggcnggncn cgaacnccng 206720DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 67ccaggcnggn cncgaacncc
206820DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 68nnngccangn nacccaggcn 206920DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
69gggannnngc cangnnaccc 207020DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 70acgggannnn gccangnnac
207120DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 71gagacgggan nnngccangn 207220DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
72nagagacggg annnngccan 207320DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 73nnnngnagag acgggannnn
207420DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 74ngnannnnng nagagacggg 207520DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
75ncngnannnn ngnagagacg 207620DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 76nnncngnann nnngnagaga
207720DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 77annnncngna nnnnngnaga 207820DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
78naannnncng nannnnngna 207920DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 79gcnaannnnc ngnannnnng
208020DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 80cccgccccng cccngcccac 208120DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
81ccgcccccgc cccngcccng 208220DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 82ccgccgcccc cgccccngcc
208320DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 83nggccgccgc ccccgccccn 208420DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
84cngcccnggc cgccgccccc 208520DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 85cacccncngc ccnggccgcc
208620DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 86gcgcacccnc ngcccnggcc 208720DNAArtificial
SequenceAntisense oligomer - GAA Intron 2
targeting sequence 87ngncgangnc cacgcgcacc 208820DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
88gngggngncg angnccacgc 208920DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 89ngcgngggng ncgangncca
209020DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 90gngaggngcg ngggngncga 209120DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
91gcaccccacc cnngngaggn 209220DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 92aacangcacc ccacccnngn
209320DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 93aggaggagga cgccnccccc 209420DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
94cncancngca gagccaggag 209520DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 95cccncancng cagagccagg
209620DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 96cncccncanc ngcagagcca 209720DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
97gcncccncan cngcagagcc 209820DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 98ggcncccnca ncngcagagc
209920DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 99cggcncccnc ancngcagag 2010020DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
100ncggcncccn cancngcaga 2010120DNAArtificial SequenceAntisense
oligomer - GAA Intron 2 targeting sequence 101cncggcnccc ncancngcag
2010220DNAArtificial SequenceAntisense oligomer - GAA Intron 2
targeting sequence 102ccncggcncc cncancngca 2010320DNAArtificial
SequenceAntisense oligomer - GAA Intron 2 targeting sequence
103gccncggcnc ccncancngc 2010420DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 104ggcncncaaa gcagcncnga
2010525DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 105ggcncncaaa gcagcncnga gacan
2510625DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 106cacggggcnc ncaaagcagc ncnga
2510720DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 107ncaaagcagc ncngagacan 2010820DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
108cacggggcnc ncaaagcagc 2010919DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 109gcccngcngn cnagacngg
1911024DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 110gcccngcngn cnagacnggg gaga
2411124DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 111gngnngcccn gcngncngga cngg
2411219DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 112gcngncnaga cnggggaga 1911319DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
113gngnngcccn gcngncnag 1911420DNAArtificial SequenceAntisense
oligomer - GAA intron 1 targeting sequence 114cnggagnacc ngncaccgng
2011525DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 115cnggagnacc ngncaccgng gngnc
2511625DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 116gccnncngga gnaccngnca ccgng
2511720DNAArtificial SequenceAntisense oligomer - GAA intron 1
targeting sequence 117gnaccngnca ccgnggngnc 2011820DNAArtificial
SequenceAntisense oligomer - GAA intron 1 targeting sequence
118gccnncngga gnaccngnca 2011925DNAArtificial SequenceAntisense
oligomer - GAA targeting sequence 119ggcccnggnc ngcnggcncc cngcn
2512025DNAArtificial SequenceAntisense oligomer - GAA targeting
sequence 120gcncccngca gccccngcnn ngcag 2512117DNAHomo sapiens
121cgttgttcag cgaggga 1712221DNAHomo sapiens 122ctcctctgaa
atgggctaca c 2112318DNAHomo sapiens 123acctcgtagc gcctgtta 18
* * * * *