U.S. patent application number 14/667455 was filed with the patent office on 2015-07-16 for bifunctional protein anchors.
The applicant listed for this patent is Applied Nanosystems B.V.. Invention is credited to Tjibbe BOSMA, Cornelis Johannes LEENHOUTS, Maarten Leonardus VAN ROOSMALEN.
Application Number | 20150196659 14/667455 |
Document ID | / |
Family ID | 35005648 |
Filed Date | 2015-07-16 |
United States Patent
Application |
20150196659 |
Kind Code |
A1 |
LEENHOUTS; Cornelis Johannes ;
et al. |
July 16, 2015 |
BIFUNCTIONAL PROTEIN ANCHORS
Abstract
The disclosure relates to the areas of immunology and vaccine
delivery. More specifically, it relates to a bacterial vaccine
delivery technology with built-in immunostimulatory properties
which allow the immobilization of any antigen of interest, without
prior antigen modification. Provided is an antigen-loaded
immunogenic carrier complex comprising at least one bifunctional
polypeptide attached to an immunogenic carrier, the bifunctional
polypeptide comprising a peptidoglycan binding domain (PBD) through
which the polypeptide is attached to the carrier, fused to an
antigen binding domain (ABD) to which at least one antigen of
interest is bound. Also described is a pharmaceutical (e.g.,
vaccine) composition comprising an antigen-loaded immunogenic
carrier complex.
Inventors: |
LEENHOUTS; Cornelis Johannes;
(Haren, NL) ; VAN ROOSMALEN; Maarten Leonardus;
(Groningen, NL) ; BOSMA; Tjibbe; (Lippenhuizen,
NO) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Applied Nanosystems B.V. |
Groningen |
|
NL |
|
|
Family ID: |
35005648 |
Appl. No.: |
14/667455 |
Filed: |
March 24, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11989118 |
Mar 25, 2008 |
9011870 |
|
|
PCT/NL06/00382 |
Jul 20, 2006 |
|
|
|
14667455 |
|
|
|
|
Current U.S.
Class: |
435/69.3 ;
530/391.7 |
Current CPC
Class: |
A61K 2039/6068 20130101;
C07K 16/18 20130101; A61K 2039/6056 20130101; A61K 2039/622
20130101; A61P 33/00 20180101; A61P 35/00 20180101; A61K 39/385
20130101; A61K 2039/541 20130101; C07K 2319/705 20130101; C07K
14/335 20130101; A61P 31/00 20180101; A61K 47/68 20170801; A61P
37/00 20180101; C07K 2319/70 20130101; A61K 2039/55555
20130101 |
International
Class: |
A61K 47/48 20060101
A61K047/48; A61K 39/385 20060101 A61K039/385 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 20, 2005 |
EP |
05076680.7 |
Claims
1-7. (canceled)
8. A method for providing an antigen-loaded immunogenic carrier
complex comprising: at least one bifunctional polypeptide attached
to an immunogenic carrier, wherein the bifunctional polypeptide
comprises a peptidoglycan binding domain (PBD) through which the
bifunctional polypeptide is attached to the carrier, fused to an
antigen binding domain (ABD) able to bind an antigen of interest,
wherein the PBD comprises a peptide selected from the group
consisting of a LysM domain, a peptide retrieved from a homology
search in a peptide database with a LysM domain in the C-terminus
of Lactococcus lactis cell wall hydrolase AcmA ("AcmA LysM domain")
and a peptide having at least 70% sequence identity to an AcmA LysM
domain, provided that the PBD is able to a Gram-positive
microorganism's cell wall; and wherein at least one antigen of
interest is bound to the ABD, the method comprising: providing an
immunogenic carrier; providing a bifunctional polypeptide
comprising a peptidoglycan binding domain (PBD) fused to an antigen
binding domain (ABD) allowing attachment of said polypeptide to
said immunogenic carrier; contacting said immunogenic carrier and
said polypeptide; and contacting said polypeptide with an antigen
of interest.
9. The method according to claim 8, wherein providing an
immunogenic carrier comprises preparing non-viable spherical
peptidoglycan particles from a Gram-positive bacterium.
10. The method according to claim 9, wherein providing said
bifunctional polypeptide comprises selecting an antigen binding
domain from a random peptide or antibody library.
11. The method according to claim 10, comprising producing the
bifunctional polypeptide in a host cell by recombinant expression
of a nucleic acid construct encoding said polypeptide.
12. The method according to claim 11, wherein said host cell
secretes the polypeptide in culture medium.
13-17. (canceled)
18. The method according to claim 10, wherein selecting the ABD
from a random peptide or antibody library utilizes phage display
technology.
19. The method according to claim 8, wherein the bifunctional
polypeptide comprises an ABD selected from a random peptide or
antibody library.
20. The method according to claim 19, comprising producing the
bifunctional polypeptide in a host cell by recombinant expression
of a nucleic acid construct encoding the polypeptide.
21. The method according to claim 20, wherein the host cell
secretes the polypeptide in culture medium.
22. The method according to claim 19, wherein selecting an ABD from
a random peptide or antibody library utilizes phage display
technology.
23. The method according to claim 8, comprising producing the
bifunctional polypeptide in a host cell by recombinant expression
of a nucleic acid construct encoding the polypeptide.
24. The method according to claim 23, wherein the host cell
secretes the polypeptide in culture medium.
25. A method of providing an antigen-loaded immunogenic carrier
complex, the method comprising: contacting an immunogenic carrier
with a bifunctional polypeptide comprising a peptidoglycan binding
domain fused to an antigen binding domain (ABD) so as to attach the
bifunctional polypeptide to the immunogenic carrier; and contacting
the bifunctional polypeptide with an antigen of interest.
26. The method according to claim 25, wherein the immunogenic
carrier comprises non-viable spherical peptidoglycan particles from
a Gram-positive bacterium.
27. The method according to claim 25, wherein the ABD has been
selected by phage display.
28. The method according to claim 25, further comprising: producing
the bifunctional polypeptide in a host cell by recombinant
expression of a nucleic acid construct encoding the polypeptide
before contact with the immunogenic carrier.
29. The method according to claim 28, wherein the host cell
secretes the polypeptide in culture medium associated with the host
cell.
30. A method of providing an antigen-loaded immunogenic carrier
complex, the method comprising: recombinantly expressing a
bifunctional polypeptide comprising a peptidoglycan binding domain
fused to an antigen binding domain (ABD) in a host cell by
expressing a nucleic acid construct encoding the bifunctional
polypeptide; contacting an immunogenic carrier with the
bifunctional polypeptide so as to attach the bifunctional
polypeptide to the immunogenic carrier, wherein the immunogenic
carrier comprises non-viable spherical peptidoglycan particles from
a Gram-positive bacterium; and contacting the polypeptide with an
antigen of interest.
31. The method according to claim 25, wherein the ABD has been
selected by phage display.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a divisional of co-pending U.S. patent
application Ser. No. 11/989,118, filed Mar. 25, 2008, now U.S.
patent, which is a National Stage Entry under 35 U.S.C. .sctn.371
of International Patent Application No. PCT/NL2006/000382 filed
Jul. 20, 2006, published in English as International Patent
Publication WO 2007/011216 A2 on Jan. 25, 2007, which itself claims
priority under Article 8 of the Patent Cooperation Treaty to EP
05076680.7 filed Jul. 20, 20015, the disclosures of each which are
hereby incorporated herein by this reference in their entirety.
TECHNICAL FIELD
[0002] The application relates to the areas of immunology and
vaccine delivery. More specifically, it relates to a bacterial
vaccine delivery technology with built-in immunostimulatory
properties, which allows the immobilization of any antigen of
interest, without prior antigen modification.
BACKGROUND
[0003] Vaccine delivery or immunization via attenuated bacterial
vector strains expressing distinct antigenic determinants against a
wide variety of diseases is now commonly being developed. Mucosal
(for example nasal or oral) vaccination using such vectors has
received a great deal of attention. For example, both systemic and
mucosal antibody responses against an antigenic determinant of the
hornet venom were detected in mice orally colonized with a
genetically engineered human oral commensal Streptococcus gordonii
expressing the antigenic determinant on its surface (Medaglini et
al., PNAS 1995, 2:6868-6872).
[0004] Also, a protective immune response could be elicited by oral
delivery of a recombinant bacterial vaccine wherein tetanus toxin
fragment C was expressed constitutively in Lactococcus lactis
(Robinson et al., Nature Biotechnology 1997, 15:653-657).
Especially mucosal immunization as a means of inducing IgG and
secretory IgA antibodies directed against specific pathogens of
mucosal surfaces is considered an effective route of vaccination.
Immunogens expressed by bacterial vectors are presented in
particulate form to the antigen-presenting cells (for example
M-cells) of the immune system and should therefore be less likely
to induce tolerance than soluble antigens. In addition, the
existence of a common mucosal immune system permits immunization on
one specific mucosal surface to induce secretion of
antigen-specific IgA, and other specific immune responses at
distant mucosal sites. A drawback to this approach is the potential
of the bacterial strain to cause inflammation and disease in
itself, potentially leading to fever and bacteremia. An alternative
approach avoids the use of attenuated bacterial strains that may
become pathogenic themselves by choosing recombinant commensal
bacteria as vaccine carriers, such as Lactobacillus ssp. and
Lactococcus ssp.
[0005] However, a drawback of the use of such recombinant organisms
is that they may colonize the mucosal surfaces, thereby generating
a long term exposure to the target antigens expressed and released
by these recombinant micro-organisms. Such long term exposure can
cause immune tolerance. In addition, the mere fact alone that such
organisms are genetically modified and contain recombinant nucleic
acid(s) is meeting considerable opposition from the (lay) public as
a whole, stemming from a low level of general acceptance for
products containing recombinant DNA or RNA. Similar objections
exist against the use of (even attenuated) strains of a pathogenic
nature or against proteins or parts of proteins derived from
pathogenic strains.
[0006] As explained above, commonly used techniques of heterologous
surface display of proteins in general entail the use of anchoring
or targeting proteins that are specific and selective for a limited
set of micro-organisms which in general are of recombinant or
pathogenic nature, thereby greatly restricting their potential
applications.
[0007] This issue was previously addressed in patent applications
WO 99/25836 and WO 02/101026, which describe the use of a chimeric
fusion protein containing an AcmA(-like) binding domain fused to an
antigen to attach antigens to non-viable spherical peptidoglycan
particles derived from non-recombinant Gram-positive bacteria. The
Gram-positive bacteria receive a non-enzymatic pretreatment (see WO
02/101026) before they are formulated with the antigens. The
peptidoglycan particles, previously referred to as "ghosts," still
contain bacterial components, like peptidoglycan, which have
immunostimulatory properties. Accordingly, these particles are now
referred to as Gram-positive Enhancer Matrix ("GEM") or "GEM
particles."
[0008] Thus, the methods disclosed in WO 99/25836 and WO 02/101026
avoid the use of live bacteria and/or of micro-organisms which in
general are of recombinant or pathogenic nature. However, these
previously disclosed methods are limited to the attachment of
proteinaceous antigens that can be produced (recombinantly) as a
chimeric proteinaceous product. For some protein antigens this may
not be a feasible approach. There may for instance be specific
requirements for the production of the antigen in which the
presence of an AcmA(-like) binding domain, can interfere. In
addition, for non-proteinaceous antigens a genetic fusion can of
course not be made. Also, the method does not allow the attachment
of particulate antigens.
[0009] It can be envisaged to couple an antigen of interest
covalently by chemical means to a peptidoglycan particle, for
instance, using a chemical cross-linker reactive with both the
antigen and the bacterial particle. The peptidoglycan layer of the
cell wall of lactic acid bacteria is covered by a variety of
substances, for example (lipo)teichoic acids, neutral and acidic
polysaccharides, and (surface) proteins. However, this chemical
approach may not be suitable for every type of antigen since
chemical modification can interfere with antigen efficacy to induce
the immune system. Furthermore, most chemical cross-linkers require
a specific reactive group (e.g., SH) to mediate a covalent
interaction, which group may not always be present or which may be
located at an undesirable (e.g., antigen binding) site within the
molecule(s) cross-linked.
BRIEF SUMMARY
[0010] Bifunctional polypeptides have been developed that contain a
functionality to bind (non-covalently) an antigen of interest as
well as a functionality to bind (non-covalently) an immunogenic
carrier, such as a GEM particle. This system allows the
immobilization of any antigen of interest, without prior
modification, on the surface of GEM particles. The antigens can be
(poly)peptides, carbohydrates, lipids, DNA, RNA or any other
bio-organic compound and can even have a particulate nature by
themselves, e.g., viral particles.
[0011] Described is an antigen--loaded immunogenic carrier complex
comprising at least one polypeptide attached to an immunogenic
carrier, the polypeptide comprising a peptidoglycan binding domain
(PBD) through which the polypeptide is attached to the carrier,
fused to an antigen binding domain (ABD) capable of binding an
antigen of interest. In an antigen-loaded complex, at least one
antigen of interest is bound (non-covalently) to the ABD. The PBD
comprises an amino acid sequence capable of binding to
peptidoglycan, which sequence is selected from the group consisting
of (i) a LysM domain, (ii) an amino acid sequence retrieved from a
homology search in an amino acid sequence database with one of the
three LysM domains (repeated regions) in the C-terminus of
Lactococcus lactis cell wall hydrolase AcmA (the domains herein
also referred to as AcmA LysM domains) and (iii) a sequence showing
at least 70% identity to any one of the three AcmA LysM
domains.
[0012] The PBD is capable of attaching to the cell wall of a
Gram-positive microorganism. The term "antigen binding" is meant to
indicate the capacity to bind an antigen of interest. The capacity
is conferred by at least one bifunctional polypeptide.
[0013] The term "bifunctional" indicates that the polypeptide has
at least two different functionalities: a peptidoglycan binding
functionality and an antigen binding functionality. The
functionalities can be multivalent, e.g., a bifunctional
polypeptide may comprise multiple antigen binding sites.
[0014] The term "immunogenic carrier" refers to a moiety which,
upon administration to a subject, has the capacity to enhance or
modify the immune-stimulating properties of an antigen attached to
it. An immunogenic carrier thus has adjuvant properties.
Furthermore, it comprises peptidoglycans to allow attachment of one
or more bifunctional linker polypeptide(s) via its peptidoglycan
binding domain (PBD). Non-recombinant immunogenic carriers are
preferred for reasons given above.
[0015] In a preferred embodiment, the immunogenic carrier complex
is a non-viable spherical peptidoglycan particle obtained from a
Gram-positive bacterium (GEM particle, or "ghost"). Methods for the
preparation of GEM particles have been described before, for
instance in patent applications WO 02/101026 and WO 2004/102199.
The process preserves most of the bacteria's native spherical
structure. Briefly, the method comprises treating Gram-positive
bacteria with a solution capable of removing a cell-wall component,
such as a protein, lipoteichoic acid or carbohydrate, from the
cell-wall material. The resulting GEM particles may be subsequently
stored until it is contacted with a desired bifunctional
polypeptide. GEM particles bind substantially higher amounts of a
PBD fusion than untreated Gram-positive bacteria. Therefore, a high
loading capacity can be achieved for antigens on GEM particles (WO
02/101026). GEM particles are also better able to bind to and/or
are more easily taken up by specific cells or tissues than
mechanically disrupted cell-wall material. The ability of GEM
particles to target macrophages or dendritic cells enhances their
functional efficacy. The non-recombinant, non-living immunogenic
carrier complex of the disclosure is therefore well suited as a
vaccine delivery vehicle. See also WO 02/101026 and
WO2004/102199.
[0016] In one embodiment, provided is a vaccine delivery technology
that is based on GEM particles with one or more antigens attached
to the particles through the use of bifunctional polypeptides,
wherein the GEM particles serve as immunogenic backbone to surface
attach compounds of pathogenic origin, thereby mimicking a
pathogenic particle (FIG. 1). This delivery technology can mimic a
pathogen by delivering subunit vaccines as a particle to the
immunoreactive sites.
[0017] The GEM particles can, in principle, be prepared from any
Gram-positive bacterium. The cell walls of Gram-positive bacteria
include complex networks of peptidoglycan layers, proteins,
lipoteichoic acids and other modified carbohydrates. Chemical
treatment of the bacterial cell-wall material may be used to remove
cell-wall components such as proteins and lipoteichoic acids to
result in GEM particles with improved binding characteristics.
Preferably, such an antigen binding immunogenic carrier complex
comprises GEM particles obtained using an acid solution (see e.g.,
WO 02/101026).
[0018] In a preferred embodiment, the immunogenic carrier complex
is prepared from a non-pathogenic bacterium, preferably a
food-grade bacterium or a bacterium with the G.R.A.S.
("generally-recognized-as-safe") status. In one embodiment, the
cell-wall material is derived from a Lactococcus, a Lactobacillus,
a Bacillus or a Mycobacterium ssp. Use of a Gram-positive,
food-grade bacterium, such as Lactococcus lactis, offers
significant advantages over use of other bacteria, such as
Salmonella or Mycobacterium, as a vaccine delivery vehicle. L.
lactis does not replicate in or invade human tissues and reportedly
possesses low intrinsic immunity (Norton et al., 1994).
[0019] L. lactis expressing tetanus toxin fragment C has been shown
to induce antibodies after mucosal delivery that protect mice
against a lethal challenge with tetanus toxin even if the carrier
bacteria were killed prior to administration (Robinson et al.,
1997). In contrast to the non-recombinant GEM particles in an
immunogenic carrier complex disclosed herein, these bacteria still
contain recombinant DNA that will be spread into the environment,
especially when used in wide-scale oral-immunization programs. This
uncontrollable shedding of recombinant DNA into the environment may
have the risk of uptake of genes by other bacteria or other (micro)
organisms.
[0020] A polypeptide hereof comprises a peptidoglycan binding
domain (PBD) which allows for the attachment of any antigen of
interest to an immunogenic carrier, such as a GEM. In one
embodiment, the PBD comprises an amino acid sequence (peptide)
capable of binding to peptidoglycan, which sequence is a LysM
domain. Preferably, a polypeptide comprises at least two, more
preferably at least three LysM domains. The LysM (lysin motif)
domain is about 45 residues long. It is found in a variety of
enzymes involved in bacterial cell wall degradation (Joris et al.,
FEMS Microbiol. Lett. 1992; 70:257-264). The LysM domain is assumed
to have a general peptidoglycan binding function. The structure of
this domain is known ("The structure of a LysM domain from E. coli
membrane-bound lytic murein transglycosylase D (MltD)." A. Bateman
and M. Bycroft, J. Mol. Biol. 2000; 299:1113-11192). The presence
of the LysM domains is not limited to bacterial proteins. They are
also present in a number of eukaryotic proteins, whereas they are
lacking in archaeal proteins. A cell wall binding function has been
postulated for a number of proteins containing LysM domains.
[0021] Partially purified muramidase-2 of Enterococcus hirae, a
protein similar to AcmA and containing six LysM domains, binds to
peptidoglycan fragments of the same strain. The p60 protein of
Listeria monocytogenes contains two LysM domains and was shown to
be associated with the cell surface. The
.gamma.-D-glutamate-meso-diaminopimelate muropeptidases LytE and
LytF of Bacillus subtilis have three and five repeats,
respectively, in their N-termini and are both cell wall-bound.
[0022] A skilled person will be able to identify a LysM domain
amino acid sequence by conducting a homology-based search in
publicly available protein sequence databases using methods known
in the art. A variety of known algorithms are disclosed publicly
and a variety of publicly and commercially available software can
be used. Examples include, but are not limited to MacPattern
(EMBL), BLASTP (NCBI), BLASTX (NCBI) and FASTA (University of
Virginia). In one embodiment, PFAM accession number PF01476 for the
LysM domain (see
WorldWideWeb.sanger.ac.uk/cgi-bin/Pfam/getacc?PF01476) is used to
search for an amino acid sequence which fulfils the criteria of a
LysM domain. The PFAM website provides two profile hidden Markov
models (profile HMMs) which can be used to do sensitive database
searching using statistical descriptions of a sequence family's
consensus. HMMER is a freely distributable implementation of
profile HMM software for protein sequence analysis.
[0023] The C-terminal region of the major autolysin AcmA of L.
lactis contains three homologous LysM domains, which are separated
by nonhomologous sequences. For the amino acid sequences of the
three AcmA LysM domains see for example FIG. 10 of WO99/25836
wherein the three LysM domains are indicated by R1, R2 and R3. The
C-terminal region of AcmA was shown to mediate peptidoglycan
binding of the autolysin (Buist et al. [1995] J. Bacteriol.
177:1554-1563). In one embodiment, an antigen binding immunogenic
carrier complex comprises a bifunctional polypeptide bound via its
PBD to a peptidoglycan at the surface of the immunogenic carrier,
preferably a GEM particle, wherein the PBD comprises at least one
LysM domain as present in AcmA. Variations within the exact amino
acid sequence of an AcmA LysM domain are also comprised, under the
provision that the peptidoglycan binding functionality is
maintained. Thus, amino acid substitutions, deletions and/or
insertions may be performed without losing the peptidoglycan
binding capacity. Some parts of the AcmA LysM domains are less
suitably varied, for instance the conserved GDTL and GQ motifs
found in all three domains. Others may however be altered without
affecting the efficacy of the PBD to bind the immunogenic carrier.
For example, amino acid residues at positions which are of very
different nature (polar, apolar, hydrophilic, hydrophobic) amongst
the three LysM domains of AcmA can be modified. Preferably, the PBD
comprises a sequence that is at least 70%, preferably 80%, more
preferably 90%, like 92%, 95%, 97% or 99%, identical to one of the
three LysM domains of L. lactis AcmA. The PBD of a polypeptide for
use in the disclosure may contain one or more of such (homologous)
AcmA LysM domains, either distinct or the same. Typically, the LysM
domains are located adjacent to each other, possibly separated by
one or more amino acid residues. The LysM domains can be separated
by a short distance, for example 1-15 amino acids apart, or by a
medium distance of 15-100 amino acids, or by a large distance, like
150 or even 200 amino acids apart.
[0024] In a certain aspect, a PBD comprising an amino acid sequence
having at least about 80% amino acid sequence identity,
alternatively at least about 81% amino acid sequence identity,
alternatively at least about 82% amino acid sequence identity,
alternatively at least about 83% amino acid sequence identity,
alternatively at least about 84% amino acid sequence identity,
alternatively at least about 85% amino acid sequence identity,
alternatively at least about 86% amino acid sequence identity,
alternatively at least about 87% amino acid sequence identity,
alternatively at least about 88% amino acid sequence identity,
alternatively at least about 89% amino acid sequence identity,
alternatively at least about 90% amino acid sequence identity,
alternatively at least about 91% amino acid sequence identity,
alternatively at least about 92% amino acid sequence identity,
alternatively at least about 93% amino acid sequence identity,
alternatively at least about 94% amino acid sequence identity,
alternatively at least about 95% amino acid sequence identity,
alternatively at least about 96% amino acid sequence identity,
alternatively at least about 97% amino acid sequence identity,
alternatively at least about 98% amino acid sequence identity and
alternatively at least about 99% amino acid sequence identity to an
AcmA LysM domain.
[0025] The "percentage of amino acid sequence identity" for a
polypeptide, such as 70, 80, 90, 95, 98, 99 or 100 percent sequence
identity may be determined by comparing two optimally aligned
sequences over a comparison window, wherein the portion of the
polypeptide sequence in the comparison window may include additions
or deletions (i.e., gaps) as compared to the reference sequence
(which does not comprise additions or deletions) for optimal
alignment of the two amino acid sequences. The percentage is
calculated by: (a) determining the number of positions at which the
identical amino acid occurs in both sequences to yield the number
of matched positions; (b) dividing the number of matched positions
by the total number of positions in the window of comparison; and
(c) multiplying the result by 100 to yield the percentage of
sequence identity. Optimal alignment of sequences for comparison
may be conducted by computerized implementations of known
algorithms, or by inspection. Readily available sequence comparison
and multiple sequence alignment algorithms are, respectively, the
Basic Local Alignment Search Tool (BLAST) (S. F. Altschul, et al.
1990, J. Mol. Biol. 215:403; S. F. Altschul, et al. 1997, Nucleic
Acid Res. 25:3389-3402) and ClustalW programs both available on the
internet.
[0026] In another embodiment, a PBD comprises a LysM domain which
is present in an amino acid sequence retrieved from a homology
search in an amino acid sequence database with an AcmA LysM domain,
wherein the LysM domain is capable of attaching the substance to
the cell wall of a Gram-positive microorganism. Preferably, the
amino acid sequence retrieved is an amino acid sequence originating
from a Gram-positive bacterium. It is for instance an amino acid
sequence of a bacterial cell wall hydrolase. Preferably, the
retrieved amino acid sequence shows at least 70%, more preferably
80%, most preferably at least 90% sequence identity with an AcmA
LysM domain. Examples of sequences that may be retrieved can be
found in FIG. 11 of patent application WO99/25836.
[0027] As will be clear from the above, a PBD can be structurally
defined in various manners. However, in all cases a PBD can be
defined as a means for binding to the cell wall of a microorganism,
wherein the means for binding is of peptidic nature. In one
embodiment, the PBD is capable of binding to a Gram-positive
bacterium or cell wall material derived thereof (e.g., a GEM
particle). The binding capacity of a PBD can be readily determined
in a binding assay comprising the steps of labeling the PBD with a
reporter molecule, contacting the labeled PBD with a Gram-positive
micro-organism to allow for binding of the means to the
micro-organism; and determining the binding capacity of the PBD by
detecting the absence or presence of reporter molecule associated
with the micro-organism.
[0028] The reporter molecule, also referred to as detectable
molecule, for use in the binding assay can be of various nature.
Many types of reporter molecules are known in the art. It is for
example a fluorescent molecule (e.g., FITC), an antigen, an
affinity tag (e.g., biotin) an antibody or an enzyme. A reporter
molecule can be conjugated to the PBD by methods known in the
art.
[0029] If the reporter molecule is of peptidic nature, the step of
labeling the PBD with a reporter molecule preferably comprises the
generation of a genetic fusion between the PBD and reporter
molecule. Such fusions have been described in the art. For example,
WO99/25836 describes the generation of fusion constructs between a
polypeptide comprising zero, one, two or three AcmA LysM domains
and a reporter enzyme (in that case either .alpha.-amylase or
.beta.-lactamase). To determine whether a given polypeptide is a
PBD of the disclosure, a person skilled in the art will be able to
apply standard recombinant DNA techniques to provide a fusion with
a reporter polypeptide (enzyme, antigen or the like) which can
subsequently be tested for cell binding activity.
[0030] Preferred enzyme reporter molecules are those that allow for
colorimetric or fluorescent detection of their activity. Many
reporter enzyme systems are described in the art which make use of
colorimetric or fluorimetric substrates, like horseradish
peroxidase (HRP)/2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic
acid) (ABTS); alkaline phosphatase/4-nitro phenylphosphate or
beta-galactosidase/2-nitrophenyl-beta-D-galactopyranoside
(2-NPG).
[0031] In case the PBD is labeled with an antigen, determining the
binding capacity of the PBD by detecting the absence or presence of
reporter molecule associated with the micro-organism typically
comprises the use of an antibody (e.g., a monoclonal murine
antibody) specifically reactive with the antigen. The
antigen-antibody complex can be detected using a secondary antibody
(e.g., rabbit anti-mouse IgG antibody) carrying a detectable label
in a so-called sandwich format. The secondary antibody is, for
instance, provided with a reporter enzyme whose activity can be
measured using a colorimetric substance mentioned above. It is also
possible to label the PBD with a primary antibody as reporter
molecule and detect the absence or presence of reporter molecule
associated with the micro-organism using a secondary antibody
carrying a detectable label (enzyme, fluorochrome).
[0032] A Gram-positive microorganism for use in a binding assay can
be viable or non-viable. Included are Gram-positive bacteria, such
as a Bacillus ssp., Streptococcus ssp., Mycobacterium ssp.,
Listeria ssp. or a Clostridium ssp. The step of contacting the
labeled PBD with a Gram-positive micro-organism to allow for
binding of the means to the micro-organism can involve the
resuspension of a pelleted culture of exponentially growing
Gram-positive bacteria, like L. lactis, in a solution comprising
the labeled PBD or a crude cell extract containing the labeled PBD.
The solution can also be a culture supernatant of a host cell
expressing and secreting the labeled PBD.
[0033] Following a certain period of incubation, for instance 1-120
minutes at 4-40.degree. C., like 1-30 minutes at 10-40.degree. C.,
the Gram-positive bacteria are pelleted and washed to remove any
non-specifically bound reporter molecule. Thereafter, the amount of
reporter molecule associated with the pelleted bacteria is
determined.
[0034] In a specific embodiment, a cell binding assay comprises the
use of .alpha.-amylase from Bacillus licheniformis or E. coli TEM
.beta.-lactamase as reporter molecule as a fusion to PBD. Fusion
proteins are recombinantly produced in a bacterial host cell which
secretes the fusion protein in the culture supernatant. GEM
particles are be used as Gram-positive microorganisms in the
binding assay. They can be prepared as described in WO 02/101026
and herein below. GEM particles loaded with both fusion proteins
were spun down and washed twice with PBS. Enzyme activity of bound
.alpha.-amylase--and .beta.-lactamase PBD fusions are measured
colorimetrically. .alpha.-Amylase activity is determined by
incubating the loaded GEM particles in 1 ml amylose azure (Sigma)
substrate solution (0.6 mg/ml amylose azure in 20 mM
K.sub.2HPO.sub.4/KH.sub.2PO.sub.4-buffer, 50 mM NaCl, pH 7.5), at
37.degree. C. and 200 rpm. After 60 minutes, GEM particles and
insoluble amylose azure were spun down, and the absorbance at 595
nm was measured. .beta.-Lactamase activity was measured by adding
40 .mu.l nitrocefin (CalBiochem) to GEM particles loaded with
.beta.-lactamase PBD fusion in a final volume of 1 ml PBS. After 30
minutes the absorbance at 486 nm was measured.
[0035] A polypeptide comprising a PBD and an ABD wherein the PBD
comprises the three LysM domains of L. lactis cell wall hydrolase
AcmA, also referred to as cA or protein anchor in WO 99/25836 and
WO 02/101026, will herein be termed "Protan linker" As will be
understood by the skilled person, the Protan linker may contain one
or more amino acid substitutions as compared to the naturally
occurring AcmA LysM sequences, provided that the peptidoglycan
binding capacity is maintained.
[0036] The relative positions of the ABD and the PBD within the
polypeptide can vary. However, it will be understood that allowing
attachment of the polypeptide to the immunogenic carrier via the
PBD on the one hand and binding of an antigen via the ABD on the
other hand requires a certain degree of spacing between the domains
to avoid or minimize mutual interference. In a preferred
embodiment, the polypeptide comprises a PBD fused via a linker or
spacer sequence to an ABD. The linker or spacer can be a relatively
short stretch of amino acids, e.g., 1-200, a medium size linker,
e.g., 200-600 amino acids, or a larger linker, of more than 600
residues. For example, in one embodiment the N-terminal part of the
polypeptide comprises a PBD which is fused via a linker to an ABD
located in the C-terminal part. In another embodiment, the PBD
constitutes the C-terminal part of the polypeptide and the ABD the
N-terminal part. The ABD and/or PBD do not have to reside at the
extreme ends of the polypeptides; one or more amino acid residues
can be present at either end of the polypeptide which are neither
part of the ABD nor of the PBD.
[0037] A polypeptide of the disclosure comprises one or more
antigen binding domains (ABDs). A multiplicity of ABDs within a
single polypeptide allows the presentation of an antigen on an
immunogenic carrier complex at a high density. In one embodiment, a
polypeptide comprises two ABDs, capable of binding either the same
or distinct antigens of interest. If multiple ABDs are present, it
may be advantageous to place them adjacent to each other, e.g.,
with one or more amino acids in between to allow for an optimal
binding of the multiple antigens to the polypeptide.
[0038] An ABD present in a polypeptide hereof is a proteinaceous
moiety capable of binding to an antigen of interest. Any type of
antigen can be bound to an antigen binding immunogenic carrier
complex of the disclosure, provided that there is a suitable ABD
available. The antigen of interest can be selected from the group
consisting of polypeptides, carbohydrates, lipids, polynucleotides
and pathogenic antigens, including inactivated viral particles and
purified antigenic determinants. In one embodiment, an antigen of
interest is an antigen which cannot be produced as a fusion to a
PBD, like an antigen comprising at least one non-proteinaceous
moiety.
[0039] In one embodiment, the antigen of interest is a
polynucleotide. Immunization with polynucleotides is a recent
development in vaccine development. This technology has been
referred to as genetic immunization or DNA immunization. The basis
for this approach to immunization is that cells can take-up plasmid
DNA and express the genes within the transfected cells. Thus, the
vaccinated animal itself acts as a bioreactor to produce the
vaccine. This makes the vaccine relatively inexpensive to produce.
Some of the advantages of polynucleotide immunization is that it is
extremely safe, induces a broad range of immune responses (cellular
and humoral responses), long-lived immunity, and, most importantly,
can induce immune responses in the presence of maternal antibodies.
Although this is one of the most attractive developments in vaccine
technology, there is a great need to develop better delivery
systems to improve the transfection efficiency in vivo. In a
specific aspect, an immunogenic carrier complex is used to deliver
dsRNA, for example in an RNA interference (RNAi)-based therapy.
Such therapy is particularly suitable to combat viral
infections.
[0040] It will be understood that the structural characteristics of
an ABD will primarily depend on the antigen of interest. Known
binding partners of an antigen of interest, or a part of such known
binding partner, may be used as ABD. For example, the capacity of
the polypeptide to bind a pathogen, e.g., virus or bacterium, may
be conferred by using a normal host receptor for the pathogen.
Pathogen host receptors are known in the art and their sequences
have been determined and stored in publicly available databases.
For example, ICAM-1 is a host receptor for human rhinovirus (HRV)
and CD4 for HIV.
[0041] In another aspect, the ABD comprises an antibody or
functional fragment thereof, e.g., a Fab fragment, containing the
antigen binding site, or other polypeptide, that binds to an
antigen of interest. Many specific antibody (fragments) known in
the art can be used in the disclosure. For instance, an antibody
(fragment) that binds to a conserved determinant on the viral
surface, such as VP4 on poliovirus, or gp120 on HIV, or HA on
influenza virus. Industrial molecular affinity bodies (IMAB) are
also suitably used as ABD (see e.g., WO2004108749 from CatchMabs
BV, The Netherlands). NANOBODIES.RTM. developed by Ablynx, Gent,
Belgium may also be used.
[0042] WO 02/101026 in the name of the applicant discloses the use
of GEM particles as delivery vehicles for a polypeptide fusion
between an AcmA-type protein anchor and a reactive group, like
proteins, peptides and antibodies. Therein, the antibodies do not
serve as carrier for an antigen but they are therapeutic substances
themselves i.e., through specific interaction with endogenous
antigens. Of course, for that purpose the antibody must not be
"pre-loaded" with antigen, as is the case in the disclosure. WO
02/101026 therefore does not disclose or suggest the loading of an
antibody attached to GEM-particles with antigen of interest.
[0043] Antibody fragments and peptides specific for essentially any
antigen, be it a peptide, sugar, lipid, nucleic acid or whole
organism etc., can be selected by methods known in the art. Peptide
libraries containing large amounts of randomly synthesized peptides
which can be used in selecting a suitable binding partner for an
antigen of interest are commercially available. For instance, New
England Biolabs offers pre-made random peptide libraries, as well
as the cloning vector M13KE for construction of custom libraries.
The pre-made libraries consist of linear heptapeptide and
dodecapeptide libraries, as well as a disulfide-constrained
heptapeptide library. The randomized segment of the
disulfide-constrained heptapeptide is flanked by a pair of cysteine
residues, which are oxidized during phage assembly to a disulfide
linkage, resulting in the displayed peptides being presented to the
target as loops. All of the libraries have complexities in excess
of two billion independent clones. The randomized peptide sequences
in all three libraries are expressed at the N-terminus of the minor
coat protein pIII, resulting in a valency of five copies of the
displayed peptide per virion. All of the libraries contain a short
linker sequence (Gly-Gly-Gly-Ser) between the displayed peptide and
pIII.
[0044] Of particular interest is the use of phage display
technology. Many reviews on phage display are available, see, for
example, Smith and Petrenko (1997) Chem. Rev. 97:391-410. Briefly,
phage display technology is a selection technique in which a
library of variants of a peptide or human single-chain Fv antibody
is expressed on the outside of a phage virion, while the genetic
material encoding each variant resides on the inside. This creates
a physical linkage between each variant protein sequence and the
DNA encoding it, which allows rapid partitioning based on binding
affinity to a given target molecule (antibodies, enzymes,
cell-surface receptors, etc.) by an in vitro selection process
called panning. In its simplest form, panning is carried out by
incubating a library of phage-displayed peptides with a plate (or
bead) coated with the target (i.e., antigen of interest), washing
away the unbound phage, and eluting the specifically bound phage.
The eluted phage is then amplified and taken through additional
binding/amplification cycles to enrich the pool in favor of binding
sequences. After 3-4 rounds, individual clones are typically
characterized by DNA sequencing and ELISA. The DNA contained within
the desired phage encoding the particular peptide sequence can then
be used as nucleic acid encoding an ABD in a nucleic acid construct
encoding a polypeptide of the disclosure.
[0045] There are several examples in the art of successful
applications of phage display technology to identify peptides that
bind selectively to micro-organisms. These teachings can be used to
identify a peptide which can be used as antigen binding domain
according to the disclosure. For example, Knurr et al. (Appl.
Environ Microbiol. 2003 November; 69(11):6841) describe the
screening of phage display peptide libraries for 7- and 12-mer
peptides that bind tightly to spores of B. subtilis and closely
related species.
[0046] Lindquist et al. (Microbiology 2002 February; 148(Pt
2):443-51) used a phage-displayed human single-chain Fv antibody
library to select binding partners specific to components
associated with the surface of Chlamydia trachomatis elementary
bodies (EBs). While phage display has been used in the art
primarily to select specific antibodies for purified components,
these data show that this technology is suitable for selection of
specific probes from complex antigens such as the surface of a
microbial pathogen.
[0047] As another useful example, JP2002284798 discloses peptides,
obtained by phage display technology, that bind specifically to
influenza virus/hemagglutinin (HA).
[0048] Also of particular interest for the disclosure is a recent
study by Kim et al. (J. Biochem Biophys Res Commun. 2005 Apr. 1;
329(1):312) which describes the screening of LPS-specific peptides
from a phage display library using epoxy beads. LPS
(lipopolysaccharide; endotoxin) is the major surface-exposed
structural component of the outer membrane of Gram-negative
bacteria. Its structure can be divided into three regions: (1) a
phospholipids (lipid A) that is responsible for most of its
biological activities, (2) a core oligosaccharide, and (3) an
O-specific chain, which is an antigenic polysaccharide composed of
a chain of highly variable repeating oligosaccharide subunits.
[0049] Kim et al., using biopanning on LPS-conjugated epoxy beads,
repeatedly enriched clones encoding AWLPWAK (SEQ ID NO:1) and
NLQEFLF (SEQ ID N0:2). These peptides were found to interact with
the polysaccharide moiety of LPS, which is highly variable among
Gram-negative bacterial species. In addition, it was found that
phages encoding these peptides preferentially bound to the LPS of
Salmonella family. AWLPWAK (SEQ ID NO:1)-conjugated beads could be
used to absorb Salmonella enteritidis from solution.
[0050] Whereas the disclosure allows the immobilization of
unmodified antigens to an immunogenic carrier, it is not restricted
to unmodified antigens. In one embodiment, the ABD is capable of
binding to an antigen of interest through a (chemical) modified or
tagged version of the antigen of interest. For instance, an antigen
can be provided with an affinity tag, which tag can be bound to the
ABD. Example 2 herein below shows the binding of a biotin-tagged
enzyme to GEM particles by virtue of a bifunctional
Streptavidin-Protan bifunctional linker.
[0051] Also provided herein is a method for providing an antigen
binding immunogenic carrier complex. As is exemplified below, such
a method comprises the steps of providing an immunogenic carrier,
providing a polypeptide comprising a peptidoglycan binding domain
(PBD) fused to an antigen binding domain (ABD), and allowing the
attachment of the polypeptide to the immunogenic carrier to yield
an antigen binding immunogenic carrier complex. As already
indicated above, the use of phage display technology is
particularly useful to obtain an ABD for a particular antigen of
interest. Use can be made of commercial peptide or antibody
fragment libraries.
[0052] The bifunctional polypeptide comprising an ABD and a PBD can
be readily made by constructing a genetic fusion of the respective
domains, typically spaced by a linker sequence, and expressing the
gene in a suitable (bacterial) host cell employing methods well
known in the art. As is exemplified in the Examples below, the
recombinantly obtained polypeptide can be simply contacted with the
immunogenic carrier to allow binding of the bifunctional
polypeptide to peptidoglycans at the surface of the particles
resulting in the antigen binding immunogenic carrier complex. In a
specific aspect, the step of providing an immunogenic carrier
comprises the preparation of non-viable spherical peptidoglycan
particles from a Gram-positive bacterium (GEM particles).
[0053] The resulting carrier complex is contacted with one or more
(modified) antigen(s) of interest to provide an antigen-loaded
immunogenic carrier complex wherein at least one antigen of
interest is bound to an ABD. It is however also possible to reverse
the order of binding, i.e., bind an antigen of interest to a
polypeptide via its ABD prior to attaching the antigen-loaded
polypeptide(s) via the PBD to the immunogenic carrier.
[0054] In one embodiment, provided is a pharmaceutical composition
comprising an antigen-loaded immunogenic carrier complex. For
example, it provides an immunogenic composition comprising an
antigen-loaded immunogenic carrier complex. An immunogenic
composition is capable of inducing an immune response in an
organism. In one embodiment, the immunogenic composition is a
vaccine composition capable of inducing a protective immune
response in an animal. The immunogenic composition, e.g., the
vaccine, may be delivered to mucosal surfaces instead of being
injected since mucosal surface vaccines are easier and safer to
administer. A L. lactis derived immunogenic carrier complex may be
used for mucosal vaccination since this bacterium is of intestinal
origin and no adverse immune reactions are generally expected from
L. lactis. Also provided is the use of an antigen binding
immunogenic carrier complex for the delivery of an (protective)
antigen of interest to the immune system of a subject. The antigen
binding immunogenic carrier complex comprises at least one
bifunctional polypeptide attached to an immunogenic carrier, the
polypeptide comprising a peptidoglycan binding domain (PBD) through
which the polypeptide is attached to the carrier, fused to an
antigen binding domain (ABD) capable of binding the antigen of
interest, wherein the PBD comprises an amino acid sequence selected
from the group consisting of (i) a LysM domain, (ii) an amino acid
sequence retrieved from a homology search in an amino acid sequence
database with a LysM domain in the C-terminus of AcmA LysM domain
and (iii) a sequence showing at least 70% sequence identity to an
AcmA LysM domain, provided that the PBD is capable of attaching the
substance to the cell wall of a Gram-positive microorganism. Also
provided is the use of an antigen-loaded immunogenic carrier
complex for the delivery of an (protective) antigen of interest to
the immune system of a subject, preferably a human subject.
Delivery to the immune system preferably comprises antigen delivery
to a mucosal site, such as intranasal delivery, e.g., by means of a
spray, or oral, vaginal or rectal delivery.
[0055] In a preferred embodiment, provided is a subunit vaccine
based on an immunogenic carrier complex disclosed herein. Subunit
vaccines are vaccines developed against individual viral or
bacterial components, also referred to as "immunogenic
determinants" that play a key role in eliciting protective
immunity. In order to develop subunit vaccines, it is important to
identify those components (often (glyco)proteins) of the pathogen
that are important for inducing protection and eliminate the
others. Some proteins, if included in the vaccine, may be
immunosuppressive, whereas in other cases immune responses to some
proteins may actually enhance disease. Combining genomics with our
understanding of pathogenesis, it is possible to identify specific
proteins from most pathogens that are critical in inducing the
immune responses (see WO2004/102199). In addition to using a whole
protein as a vaccine, it is possible to identify individual
epitopes within these protective proteins and develop peptide
vaccines. The potential advantages of using subunits as vaccines
are the increased safety and less antigenic competition since only
a few components are included in the vaccine, ability to target the
vaccines to the site where immunity is required, and the ability to
differentiate vaccinated animals from infected animals (marker
vaccines). One of the disadvantages of subunit vaccines known in
the art is that they generally require strong adjuvants and these
adjuvants often induce tissue reactions. An immunogenic carrier
complex as disclosed herein has built-in immunostimulatory
properties and can efficiently deliver antigenic determinants as a
particle to immunoreactive sites. Especially GEM particles are
readily bound by and/or taken up by specific cells or tissues. The
ability of GEMs to target macrophages or dendritic cells enhances
their functional efficacy. In fact, it is now possible to mimic a
pathogen with respect to its antigenic components while avoiding
the undesired effects of other components while maintaining the
adjuvant properties. Of course, an immunogenic carrier can be
provided with multiple polypeptides. Some of these polypeptides
being hybrid antigen-Protan fusions (e.g., as described in WO
99/25836 and WO 02/101026) and some being bifunctional Protan
fusions as disclosed herein, each comprising at least one ABD (see
FIG. 1). The use of polypeptides with distinct ABDs allows the
binding of distinct antigens of interest to a single immunogenic
carrier. The use of multiple ABDs, being part of a single
polypeptide or of distinct polypeptides, allows for the preparation
of multiple epitope vaccines.
[0056] In a further aspect, described is a diagnostic method
comprising the use of an immunogenic carrier complex. Also
described is a diagnostic kit comprising the use of an immunogenic
carrier complex. The ABD can be used to capture and immobilize an
antigen of interest in a sample, e.g., a biological sample, onto
the carrier complex. This "loaded" carrier complex is suitably used
to separate the antigen of interest from the remainder of the
sample, for example by centrifugation. Subsequently, the amount of
carrier-associated antigen of interest can be detected or
quantitated. Thus, the immunogenic carrier complex, for instance a
GEM particle, can be used as "biological affinity bead" to isolate
an antigen of interest, optionally followed by analysis of the
antigen of interest.
BRIEF DESCRIPTION OF THE DRAWINGS
[0057] In the drawings, which illustrate what is currently
considered to be the best mode for carrying out the invention:
[0058] FIG. 1. Schematic presentation of the vaccine delivery
technology of the disclosure. Shown on the right is an immunogenic
GEM particle loaded with several different antigens bound to the
particle through the use of antigen-Protan fusion proteins and/or
bifunctional polypeptides comprising an antigen binding domain
(ABD) and a peptidoglycan binding domain (PBD), in this case
Protan.
[0059] FIG. 2. GEM-binding analysis of the ProtA-Protan
bifunctional polypeptide.
[0060] M=Molecular weight marker prestained Precision Plus All Blue
(BioRad); BG=TCA precipitation of ProtA-Protan production medium
before binding to GEM particles (200 .mu.l supernatant); AG=TCA
precipitation of production medium after binding to and removal of
GEM particles (200 .mu.l supernatant); G=GEM particles loaded with
ProtA-Protan (0.4 unit GEM with 800 .mu.l supernatant). The arrow
indicates the expected migration position of the ProtA-Protan
fusion protein (50.7 kilodalton [kDa]).
[0061] FIG. 3. Binding of mouse IgG to GEM particles with attached
ProtA-Protan. Upper part: Colorimetric values obtained due to the
activity of alkaline phosphatase (AP). AP is conjugated to a
secondary antibody that recognizes mouse IgG. Thus, if mouse IgG is
bound, AP activity can be detected. Lower part: description of the
sample composition of the corresponding samples in the upper
part.
[0062] FIG. 4. GEM-binding analysis of Streptavidin-Protan.
M=Molecular weight marker prestained Precision Plus All Blue
(BioRad); BG=TCA precipitation of Streptavidin-Protan containing
medium before binding to GEM particles (200 .mu.l supernatant);
AG=TCA precipitation of medium after binding to and removing of GEM
particles (200 .mu.l supernatant); G=GEM particles loaded with
Streptavidin-Protan (0.4 unit GEM with 800 .mu.l supernatant). The
arrow indicates the expected migration position of the
Streptavidin-Protan fusion protein (35.8 kDa).
[0063] FIG. 5. Binding of Biotin-HRP to GEM particles with attached
Streptavidin-Protan. Upper part: the graphic shows the colorimetric
values that are obtained due to the activity of horse radish
peroxidase (HRP). Biotin is conjugated to HRP. Thus, if biotin is
bound, HRP activity will be measured. Lower part: describes the
sample composition of the corresponding samples in the upper part
of the figure. If no Streptavidin-Protan fusion is present (sample
1 and 3), only Protan is present on the GEM particles (sample 3),
no Biotin-HRP (sample 2) or GEM particles (sample 5) are added: no
activity is measured as expected. Activity is only measured in
sample 4, which means that Streptavidin-Protan on the GEM particles
binds the Biotin-HRP conjugate. In conclusion, the
Streptavidin-Protan bifunctional linker can be attached to GEM
particles and this complex can bind biotinylated compounds.
DETAILED DESCRIPTION
Experimental Section
Example 1
Loading of Antibodies on GEM Particles
[0064] This example describes the preparation of an antigen binding
immunogenic carrier complex using GEM particles as immunogenic
carrier and Protein A as antigen binding domain to attach
antibodies as antigen of interest to the carrier complex.
[0065] Protein A (ProtA) of Staphylococcus aureus is a 42 kDa
protein that binds to the Fc region of IgG antibodies. It can be
used to capture antibodies from a solution and immobilize them on a
surface. Here we made a genetic fusion of ProtA with the
peptidoglycan binding domain (cA) of the L. lactis cell wall
hydrolase AcmA comprising three AcmA LysM domains, also herein
referred to as protein anchor or "Protan linker" The resulting
ProtA-Protan bifunctional linker was expressed and secreted by
recombinant L. lactis. After removal of the recombinant producer
cells, the bifunctional linker was attached to lactococcal GEM
particles by the Protan moiety in the hybrid linker. The ProtA
moiety in the same hybrid linker was still able to bind IgG
antibodies, thereby immobilizing these on the GEM particles.
Bacterial Strains and Growth Conditions
[0066] The bacterial strains used in this study are listed in Table
1. L. lactis strains were grown in 30.degree. C. in M17 broth
(DIFCO) as standing cultures or on M17 plates containing 1.5% agar.
All media were supplemented with 0.5% glucose (w/v) (GM17) and,
when necessary, supplemented with 5 .mu.g/ml chloramphenicol
(SIGMA) for plasmid selection. Induction for P.sub.nisA-driven gene
expression was done with the culture supernatant of the nisin
producing L. lactis strain NZ9700 as described previously (Kuipers
et al. [1997] Trends Biotechnol. 15:135-140).
TABLE-US-00001 TABLE 1 Bacterial strains and plasmids Relevant
phenotype or genotype Reference or origin Strain Lactococcus lactis
subsp. cremoris PA1001 Derivative of the strain NZ9000 Steen et al.
[2003] (MG1363 pepN::nisRK) carrying a J. Biol. Chem. 701-bp
SacI/SpeI deletion in acmA 278:23874-23881. and a complete deletion
of htrA NZ9700 Nisin-producing transconjugant Kuipers et al. [1997]
containing the nisin-sucrose Trends Biotechnol. transposon Tn5276
15:135-140) Plasmids pPA3 cm.sup.R, pNZ8048 derivative contain-
Steen et al. [2003] ing the Protan domain under J. Biol. Chem.
control of P.sub.nisA 278:23874-23881. pPA217 cm.sup.R, pPA3
containing Protein A Example 1 fusion to the Protan domain under
control of P.sub.nisA pPA218 cm.sup.R, pPA3 containing Streptavidin
Example 2 core fusion to the Protan domain under control of
P.sub.nisA cm.sup.R: chloramphenicol resistance gene. P.sub.nisA:
nisA promoter.
General Molecular Biology
[0067] Enzymes and buffers were purchased from New England Biolabs
or Fermentas. Electro-transformation of L. lactis was carried out
as described previously (Holo and Nes [1995] Methods Mol. Biol.
47:195-199) using a Bio-Rad Gene Pulser (Bio-Rad). Nucleotide
sequence analyses were performed by BaseClear (Leiden, The
Netherlands).
Production of the Fusion Construct Containing ProtA-Protan.
[0068] ProtA (NCBI accession number BAB93949.1; U.S. Pat. No.
5,151,350; Uhlen et al. [1984] J. Biol. Chem. 259:1695-1702) from
S. aureus contains five homologous IgG-Fc binding regions
consisting of approximately 58 amino acids each. For the fusion of
ProtA to Protan, only the Fc binding domains were amplified by PCR
using primers SpA.fw and SpA.rev (see Table 2).
TABLE-US-00002 TABLE 2 Primers used in this study Restriction Name
Sequence (5' .fwdarw. 3') site SpA.fw CCGTCTCCCATGGTTGCT Esp3I
GATGCGCAACAAAATAAC (underlined, (SEQ ID NO: 3) resulting in NcoI
sticky end) SpA.rev CCGTCTCGAATTCGTTTT Esp3I GGTGCTTGAGCATCG
(underlined, (SEQ ID NO: 4) resulting in EcoRI sticky end)
[0069] After amplification of the Fc-binding part from the S.
aureus genome, the 710 bp PCR fragment was isolated from gel and
digested with Esp3I, resulting in NcoI and EcoRI sticky ends. The
digested product was ligated into pPA3 which was digested with
EcoRI and NcoI. The ligation mixture was transferred by
electroporation to L. lactis PA1001 and resulted in plasmid pPA217.
Strain L. lactis (pPA217) produces secreted ProtA-Protan
polypeptide.
TCA Precipitation of Produced Fusion Proteins
[0070] For detection of the amount of produced polypeptide in the
cell free culture medium, a TCA precipitation was performed. This
was done by addition of 200 .mu.l 50% trichloroacetic acid (TCA) to
1 ml of cell free culture medium containing the Protan fusion
protein. The mixture was placed on ice for 1 hour after vortexing.
The precipitated protein was spun down in a centrifuge for 20
minutes at 14,000 rpm (4.degree. C.), was washed with acetone,
dried in a vacuum exicator and resuspended in SDS sample
buffer.
GEM Production and Binding Conditions
[0071] Chemical pre-treatment of L. lactis NZ9000 for the
production of GEM, was routinely done with hydrogen chloride (HCl,
pH 1.0) as follows: cells of stationary phase cultures were
collected by centrifugation and washed once with 0.5 volume of
phosphate-buffered saline (PBS: 58 mM Na.sub.2HPO.sub.4, 17 mM
Na.sub.2H.sub.2PO.sub.4, 68 mM NaCl, pH 7.2). Cells were
resuspended in 1/5.sup.th volume of HCl, pH 1.0 solution and boiled
for 30 minutes. Subsequently, the GEM particles formed in this way
were washed three times with PBS, and resuspended in PBS until an
average of 2.5.times.10.sup.10 GEM particles/ml as was determined
with a Burker-Turk hemocytometer. GEM particles were either
immediately used for binding experiments or stored in 1.0 ml
aliquots at -80.degree. C. until use.
[0072] In a typical binding experiment 2.5.times.10.sup.9 GEM
particles (1 unit) were incubated for 30 minutes at room
temperature in an over-end rotator with 2 ml of cell-free culture
medium containing a bifunctional polypeptide (Protan fusion
protein). After binding, GEM particles were collected by
centrifugation, washed twice with PBS and analyzed by SDS-PAGE or
enzymatic activity.
AP Enzyme Assay
[0073] Enzyme activity of bound rabbit anti-mouse IgG Alkaline
Phosphatase (AP) (Sigma) was measured colorimetrically. 0.5 unit
GEM particles loaded with the fusion protein ProtA-Protan, mouse
IgG1 (kappa light chain) (Sigma) (1 ml 1:100 dilution in PBS) and
rabbit anti-mouse IgG AP (Sigma) (1 ml 1:10,000 dilution in PBS)
were spun down and washed twice with PBS. Alkaline phosphatase
activity was determined by incubating the loaded GEM particles in 1
ml 4-nitro phenylphosphate (Sigma) (1 mg/ml in 50 mM sodium
carbonate buffer, pH 9.6, 1 mM MgCl.sub.2) at room temperature.
After 5 minutes, the reaction was stopped by addition of 0.5 ml 2 M
NaOH. GEM particles were spun down, and the absorbance of the
supernatant at 405 nm was measured by a spectrophotometer (BioRad
Smartspec 300).
Attaching of the ProtA-Protan Polypeptide to GEM Particles
[0074] Production of the polypeptide was induced as described
above. After overnight induction, the expression of the protein was
tested by performing a GEM-binding assay with 1 ml supernatant of
the producing strain to 0.5 U of GEM. The results are given in FIG.
2. It is clear that most of the produced ProtA-Protan fusion
peptide (lane BG) is specifically removed from the production
medium (lane AG) and binds efficiently to the GEM particles (lane
G). The smear in lane G is caused by the degraded L. lactis
proteins present in the GEM particles.
Mouse IgG Binding to ProtA-Protan-GEM Particles
[0075] The antibody-binding activity of the ProtA-Protan
polypeptide attached to GEM particles was tested using the reported
enzyme alkaline phosphatase (AP) as described above. For this
experiment different control groups were taken into account, as
described in FIG. 3. The results clearly demonstrate that mouse-IgG
binds to GEM particles that are activated with attached
ProtA-Protan fusion protein (sample 1). No activity was detected
when no ProtA-Protan was added to the GEM particles (sample 2) or
when no secondary antibody with conjugated AP was added (sample 5),
as expected. The anti-mouse secondary antibody that contains the
conjugated AP is also an IgG antibody and binds as well to the
ProtA-Protan-GEM complex even in the absence of mouse IgG (sample
4). In the absence of GEM particles some activity is measured
(sample 3), most likely due to some aggregation of the ProtA-Protan
fusion that is spun down during the procedure or due to some
aspecific binding of the protein to the plastic reaction tube. In
conclusion, the ProtA-Protan bifunctional linker can be attached to
GEM particles and this complex can bind IgG antibodies.
[0076] In conclusion, the ProtA-Protan bifunctional polypeptide can
be attached to GEM particles to yield an immunogenic carrier
complex and this complex can be loaded with IgG antibodies.
Example 2
Immobilization of Biotinylated Compounds on GEM Particles
[0077] Streptavidin of Streptomyces avidinii is a 15 kDa protein
that is functional as a tetramer and binds biotin. It can be used
as antigen binding domain (ABD) to capture biotinylated substances
from a solution and immobilize them on a surface. Here we made a
genetic fusion of Streptavidin with the Protan linker described in
Example 1. The resulting Streptavidin-Protan bifunctional
polypeptide was expressed and secreted by recombinant L. lactis.
After removal of the recombinant producer cells, the bifunctional
linker was attached to lactococcal GEM particles by the
peptidoglycan binding domain (PBD) of the Protan moiety of the
polypeptide. The ABD in the same polypeptide was still functional
and was used to bind to and immobilize biotinylated horse radish
peroxidase as antigen of interest on the GEM particles.
[0078] Bacterial strain, plasmids and procedures for growth
conditions, general molecular biology techniques, GEM production
and binding conditions and TCA precipitation of produced fusion
proteins were the same as in Example 1.
HRP Enzyme Assay
[0079] Enzyme activity of bound Biotin-Horseradish Peroxidase (HRP)
(Molecular Probes) was measured colorimetrically. 0.5 U GEM
particles loaded with the fusion protein Streptavidin-Protan and
Biotin-HRP (1 ml 1:2000 Biotin-HRP (1 mg/ml) in PBS) were spun down
and washed twice with PBS. Horse radish peroxidase activity was
determined by incubating the loaded GEM particles in 1 ml ABTS
(Fluka) (10 mg in 100 ml 0.05 M phosphate-citrate buffer pH 5.0)
and 1 .mu.l H.sub.2O.sub.2 (100%) at room temperature. After 5
minutes, the reaction was stopped by addition of 100 .mu.l 10%
SDS.
[0080] GEM particles were spun down, and the absorbance of the
supernatant at 405 nm was measured by a spectrophotometer (BioRad
Smartspec 300).
Production of the Fusion Construct Containing
Streptavidin-Protan
[0081] Only the core of Streptavidin was used as ABD for the
production of the bifunctional polypeptide (Streptavidin-Protan).
This core is the biotin binding unit of Streptavidin (NCBI
accession number CAA00084), containing amino acids
A.sub.37-S.sub.163. (Argarana et al. [1986] Nucleic Acid Research
14:1871-1882, Pahler et al. [1987] J. Biol. Chem. 262:
13933-13937). For the fusion of Streptavidin core to the Protan
moiety comprising the PBD, 8 primers were designed. These primers
could be amplified to each other, first Strep1.fw until Strep4.rev
and Strep5.fw until Strep8.rev in two different PCR reactions. The
two PCR products were mixed and amplified with the two exterior
primers Strep1.fw and Strep8.rev in which a streptavidin-core
gene-fragment of 397 by was produced that was optimized for L.
lactis codon usage. The primers used for the production of this
gene fragment are described in Table 3.
[0082] To be able to screen the PCR fragment for containing the
correct DNA sequence, the ZERO BLUNT.RTM. TOPO.RTM. Cloning Kit
(Invitrogen) was used. The ZERO BLUNT.RTM. TOPO.RTM. plasmid
containing the correct streptavidin-core gene fragment was digested
with EcoRI and NcoI. This digestion product was ligated into pPA3
which was also digested with EcoRI and NcoI. The ligation mixture
was transferred by electroporation to L. lactis PA1001 and resulted
in plasmid pPA218. Strain L. lactis (pPA218) produced and secreted
Streptavidin-Protan polypeptide in the culture medium.
Attaching the Polypeptide to Immunogenic Carrier
[0083] Production of the fusion protein was induced as described
above. After overnight induction, the expression of the protein was
tested by performing a GEM-binding assay with 1 ml supernatant of
the producing strain to 0.5 unit of GEM particles (FIG. 4). It is
clear that most of the produced Streptavidin-Protan fusion (lane
BG) is specifically removed from the production medium (lane AG)
and binds efficiently to the GEM particles (lane G). The smear in
lane G is caused by the degraded L. lactis proteins present in the
GEM particles.
TABLE-US-00003 TABLE 3 Primers used for production of streptavidin
core gene. The nucleotide stretches which are either in italics,
underlined, double underlined, in lower case letters, in italics
and underlined, in lower case letters and underline or in lower
case letters and in italics and underlined can anneal to each
other. Sequence (5' .fwdarw. 3') Restriction sites Restriction Name
are written in bold site Strep1.fw TATCCATGGTT GCA GAA GCA GGT ATT
NcoI (SEQ ID NO: 5) ACA GGT ACA TGG TAT AAT CAA CTT GGT TCA ACA TTT
ATT GTT ACA GCT GGT G Strep2.rev ACC AAC AGC TGA TTC ATA TGT TCC
NdeI (SEQ ID NO: 6) TGT AAG AGC ACC ATC AGC ACC AGC TGT AAC AAT AAA
TGT TGA ACC Strep3.fw CTT ACA GGA ACA TAT GAA TCA GCT NdeI (SEQ ID
NO: 7) GTT GGT AAT GCT GAA AGT CGT TAT gtt ctc act ggt cgt tat gat
agt gc Strep4.rev KpnI (SEQ ID NO: 8) ACC GTC TGT AGC TGG Agc act
atc ata acg acc agt gag aac Strep5.fw TT KpnI (SEQ ID NO: 9) GCA
TGG AAA AAT AAT TAT CGT aat gct cat tca gct aca act tgg agt
Strep6.rev aag aag cca ttg tgt att aat tct -- (SEQ ID NO: 10) agc
TTC AGC ACC ACC AAC ATA TTG ACC act cca aat tgt aac taa ata aac att
Strep7.fw gct aga att aat aca caa tgg ctt -- (SEQ ID NO: 11) ctt
ACA TCA GGT ACA ACT GAA GCT AAT GCT TGG AAA TCA ACT CTT GTT GGT
Strep8.rev GGAATTCT TGA TGC AGC TGA TGG TTT EcoRI (SEQ ID NO: 12)
AAC TTT AGT AAA TGT ATC ATG ACC AAC AAG AGT TGA TTT CCA AGC ATT
Biotin-HRP Binding to Streptavidin-Protan-GEM Particles
[0084] The biotin binding activity of the fusion protein bound to
GEM was tested as described herein below using HRP as reported
enzyme. For this experiment different control groups were taken
into account, as described in FIG. 5. If no Streptavidin-Protan
fusion is present (sample 1 and 3), only Protan is present on the
GEM particles (sample 3), no Biotin-HRP (sample 2) or GEM particles
(sample 5) are added, no activity is measured as expected. Activity
is only measured in sample 4 which means that Streptavidin-Protan
on the GEM particles binds the Biotin-HRP conjugate.
[0085] In conclusion, the Streptavidin-Protan bifunctional
polypeptide can be attached to immunogenic GEM particles and this
complex can bind a biotin-modified antigen of interest.
Example 3
Immobilization of Inactivated Whole Poliovirus on GEM Particles
Using Bifunctional Protan Linkers
[0086] Phage display (Smith and Petrenko [1997] Chem. Rev.
97:391-410) has emerged as a powerful technique for the selection
of specific binding peptides (Sidhu et al. [2000] Meth. Enzymol.
328:333-344; Cwirla et al. [1990] Proc. Natl. Acad. Sci. USA.
87:63786382). A DNA sequence encoding the peptide is
translationally fused to DNA encoding the gene 3 minor coat
protein, yielding display of the peptide on the surface of the
phage. In this way a physical linkage was established between the
displayed peptide and the DNA encoding this peptide. Phage peptide
libraries can be used to efficiently search for specific binders
out of a pool of variants by selection on a specific target, a
process called panning. Selected phage can subsequently be
amplified in Escherichia coli and subjected to additional rounds of
panning to enrich peptides that specifically bind to the
target.
[0087] Random peptide libraries have been used in various
applications such as binding to proteins (Sidhu et al. [2000] Meth.
Enzymol. 328:333-344), polysaccharides Kim et al. [2005] Biochem.
Biophys. Res. Commun. 329:312-317), bacterial spores Knurr et al.
[2003] Appl. Environ. Microbiol. 69:6841-6847), whole cells (Brown
[2000] Curr. Opinion. Chem. Biol. 4:16-21), and inorganic materials
(Whaley et al. [2000] Nature 405:665-668).
[0088] In the current application, phage display can be used for
the selection of specific binding peptides that are subsequently
used for the construction of bifunctional Protan linkers.
Application of the bifunctional polypeptides like Protan linkers
allows the non-covalent attachment of a compound of interest, i.e.,
proteins, polysaccharides, bacteria, viruses, or fungi to GEM
particles. Peptides are advantageous over binding proteins in that
they are less immunogenic, and easy to produce. In this Example we
describe the construction of a phagemid-based peptide library which
was used for the selection of specific binding peptides targeted to
inactivated whole poliovirus. Selected peptides that specifically
bind to whole poliovirus were genetically fused to Protan and the
bifunctional Protan linkers were attached to lactococcal GEM
particles. This allows the non-covalent coupling of inactivated
whole poliovirus. The resulting antigen--loaded immunogenic carrier
complex of GEM particle with inactivated whole poliovirus is
directly applicable in vaccines.
Construction of Peptide Phage Display Vector
[0089] The phagemid pPEP is constructed from pCANTAB 5EST (Amersham
Pharmacia) for the display of short peptide sequences. The display
of peptides requires the in frame fusion of peptides to the minor
coat protein 3 (g3p) of phage M13. Therefore, superfluous
nucleotide sequences in pCANTAB 5EST between the HindIII and BamHI
recognition sequence are removed and replaced by a PCR-assembled
fragment encoding only the relevant sequence elements. In addition,
KpnI and BpiI recognition sequences are introduced to allow cloning
of peptide sequences at the 5'-end of gene 3. Furthermore, in order
to improve the target accessibility of a displayed peptide a small
spacer sequence of three glycine residues is included between the
cloned peptide and the minor coat protein.
[0090] The construction of the peptide phage display vector
involves a number of polymerase chain reaction (PCR) steps. First a
DNA fragment from the HindIII recognition sequence until the start
of gene 3 is synthesized by two successive overlap PCRs. A
temporary assembly PCR product is produced from oligonucleotides
Cb1F2.fw,
5'-ggagccttttttttggagattttcaacgtgaaaaaattattattcgcaattcctttagtggta
(SEQ ID NO:13); Cb1F.3.fw,
5'-gcaattcctttagtggtacctttctatgcggcccagccggccatggcccagggcgctgggaga
(SEQ ID NO:14); and Cb1F4.rev,
5'-ttcaacagtaccgccaccccgtcttctcccagcgccctgggc (SEQ ID NO:15). This
temporary amplicon is purified and used in a second overlap PCR as
template together with the outside primers Cb1F1.fw,
5'-atgattacgccaagcttt-ggagccttttttttggag (SEQ ID NO:16) and
Cb1F5.rev 5'-aggttttgctaaacaactttcaacagtaccgccacc (SEQ ID NO:17),
yielding the final assembled PCR fragment. A second DNA fragment
containing the first 617 nucleotides of gene 3 is produced by PCR
using the oligonucleotides Cb2.fw, 5'-actgttgaaagttgtttagcaaaacct
(SEQ ID NO:18) and Cb2.rev 5'-agacgattggccttgatattcacaaac (SEQ ID
NO:19). In the final overlap PCR, the latter amplicon is combined
with the first assembly PCR product and the outside primers
Cb1F1.fw and Cb2.rev yielding a 711 bp PCR fragment. This
amplification product is digested with HindIII and BamHI and
ligated into the same sites of pCANTAB 5EST resulting in phagemid
pPEP.
Construction of Random Peptide Libraries
[0091] Phagemid pPEP contains KpnI and BpiI recognition sites at
the 5' end of gene 3 for display of random peptides as N-terminal
g3p fusions. Since pPEP is a phagemid, peptides are displayed in a
monovalent format, i.e., only one or two copies of g3p on the
surface of each phage particle will be fused to the cloned
peptide.
[0092] A library of oligonucleotides encoding 12-amino acid linear
random peptides is constructed according to Noren and Noren[2001]
(Methods 23:169-178). Briefly, a 92 nucleotide library
oligonucleotide, PEP12Lib.rev, is designed with the sequence
5'-accgaagaccccacc(BNN)12ctgggccatggccggctgggccgcatagaaaggtacccggg
(B=C or G or T) (SEQ ID NO:20). The universal extension primer
PEPext.fw 5'catgcccgggtacctttctatgcgg (SEQ ID NO:21) is annealed
and extended in a Klenow reaction. The resulting double stranded
library oligonucleotide is purified, digested with KpnI and BpiI,
and ligated into pPEP that had been digested with the same enzymes
yielding pPEP12. The ligation mixture is transferred to E. coli
XL1-blue or TG1 cells (Stratagene) by electroporation until
.apprxeq.10.sup.9 independent clones are obtained. To produce
phagemid particles E. coli TG1 or XL1 blue cells containing pPEP12
are infected with a 30-fold excess M13K07 helper phage. From the
infected culture, phagemid particles are purified by PEG
precipitation.
Biopanning
[0093] Inactivated whole poliovirus particles are used for affinity
selection of specific binding peptides. Poliovirus is captured on
ELISA plates coated with rabbit anti-poliovirus IgG (0.5-.mu.g/ml).
Alternatively, poliovirus is displayed on GEM particles loaded with
anti-poliovirus IgG bound to ProtA-Protan fusions (Example 1).
Approximately 10.sup.11 phagemid particles in phosphate buffered
saline (PBS)+0.1% Tween 20 (PBS-T) from the dodecapeptide library
are allowed to react in wells, or with .apprxeq.10.sup.9 GEMs with
the inactivated poliovirus for 1 hour at room temperature. After
incubation, unbound phages are removed. The GEMs or wells are
washed ten times with PBS-T and bound phages are eluted with 0.2 M
glycine/HCl (pH 2.2). The eluted phage suspension is neutralized
with 2 M Tris base. The eluted phages are used to infect E. coli
TG1 or XL1 blue cells. A total of 6 cycles of selection are
performed, after which individual phage clones are isolated for
further analysis.
Binding Analysis
[0094] To evaluate binding of peptides to the poliovirus multi-well
plates are coated with anti-poliovirus IgG (0.5-1 .mu.l/ml). After
washing with PBS-T, the wells are blocked with 1% BSA in PBS-T for
1 hour at room temperature. Inactivated whole poliovirus is added
in PBS-T+1% BSA, and incubated for 1 hour at room temperature.
Selected peptide-phages (10.sup.10 cfu/ml) in PBS-T are added to
the wells. After 1 hour room temperature the plates are washed
three times with PBS-T. Peptide-phages bound to poliovirus are
detected with HRP-conjugated anti-M13 antibody (Pharmacia) using
ABTS [2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid)] as a
substrate. The absorbance is measured after a suitable time period
at 410 nm. Two peptide-phages that show the best binding to the
poliovirus are selected for further characterization by sequence
analysis. The two phagemids are designated pPEP-PV1 and
pPEP-PV2.
Construction of PEP-Protan Fusion Proteins
[0095] Based on the nucleotide sequence of the binding peptides in
pPEP-PV1 and pPEP-PV2, two complementary oligonucleotides
corresponding to binding peptides PV1 and PV2 are designed and
produced with BsaI and BpiI overhanging 5'-ends. Equal molar
concentrations of both oligonucleotides are annealed in a total
volume of 100 .mu.l 10 mM Tris-HCl (pH 8.0). The mixture is heated
to 94.degree. C. and slowly cooled to room temperature in a thermal
cycler. The annealed oligonucleotides are ligated into pPA224
digested with BsaI and BpiI. Plasmid pPA224 is a derivative of pPA3
(Steen et al. [2003] J. Biol. Chem. 278:23874-23881), which lacks
the c-myc sequence and has a modified multiple cloning site between
the usp45 signal sequence and the Protan sequence. After ligation
the mixtures are transferred to L. lactis PA1001 by
electroporation. The results are plasmids pPA224-PV1 and pPA224-PV2
in which PV1 and PV2, respectively, are transcriptionally fused to
the 5'-end of the Protan sequence.
[0096] L. lactis PA1001(pPA224-PV1) and L. lactis
PA1001(pPA224-PV2) secrete PV1-Protan and PV2-Protan bifunctional
linkers, respectively, into the growth medium. The producer cells
are removed from the production medium by microfiltration and/or
centrifugation.
Binding of Inactivated Poliovirus to Antigen-Binding GEM
Particles
[0097] The bifunctional polypeptides PV1-Protan and PV2-Protan
attaches efficiently to lactococcal GEM particles, either each
alone or in combination. The antigen-binding immunogenic carrier
complexes PV1-Protan-GEM, PV2-Protan-GEM and PV1+PV2-Protan-GEM
thus obtained are mixed with a suspension containing inactivated
poliovirus particles. In all cases the poliovirus particles
efficiently bind to the GEM-bifunctional Protan complexes.
[0098] This Example illustrates that specific antigen binding
domains can be selected using phage display, even for an entire
viral particle and that this binding domain can be used in a
bifunctional polypeptide to immobilize the entire virus on an
immunogenic carrier.
[0099] Furthermore, the examples demonstrate that either known
antigen binding domains or newly selected binding domains from a
random peptide library can be used in Protan fusions as
bifunctional Protan linkers to immobilize a desired compound (e.g.,
antigen) on GEM particles, without the need to modify the compound
of interest before binding to an immunogenic carrier.
Sequence CWU 1
1
2117PRTArtificial sequencerandom heptamer 1Ala Trp Leu Pro Trp Ala
Lys 1 5 27PRTArtificial sequenceRandom heptamer 2Asn Leu Gln Glu
Phe Leu Phe 1 5 336DNAArtificial sequencepcr primer 3ccgtctccca
tggttgctga tgcgcaacaa aataac 36433DNAArtificial Sequencepcr primer
4ccgtctcgaa ttcgttttgg tgcttgagca tcg 33578DNAartificial
sequencepcr primer Nco I restriction site 5tatccatggt tgcagaagca
ggtattacag gtacatggta taatcaactt ggttcaacat 60ttattgttac agctggtg
78669DNAArtificial sequencePCR primer Nde I site 6accaacagct
gattcatatg ttcctgtaag agcaccatca gcaccagctg taacaataaa 60tgttgaacc
69774DNAArtificial sequencepcr primer Nde I 7cttacaggaa catatgaatc
agctgttggt aatgctgaaa gtcgttatgt tctcactggt 60cgttatgata gtgc
74867DNAArtificial sequencepcr primer Kpn I site 8cagtccaacc
aagagcggta ccactaccgt ctgtagctgg agcactatca taacgaccag 60tgagaac
67975DNAArtificial sequencepcr primer Kpn I 9agtggtaccg ctcttggttg
gactgttgca tggaaaaata attatcgtaa tgctcattca 60gctacaactt ggagt
751078DNAartificial sequenceprimer 10aagaagccat tgtgtattaa
ttctagcttc agcaccacca acatattgac cactccaaat 60tgtaactaaa taaacatt
781175DNAArtificial sequenceprimer 11gctagaatta atacacaatg
gcttcttaca tcaggtacaa ctgaagctaa tgcttggaaa 60tcaactcttg ttggt
751274DNAArtificial sequenceprimer EcoRI 12ggaattcttg atgcagctga
tggtttaact ttagtaaatg tatcatgacc aacaagagtt 60gatttccaag catt
741363DNAartificial sequenceprimer 13ggagcctttt ttttggagat
tttcaacgtg aaaaaattat tattcgcaat tcctttagtg 60gta
631463DNAartificial sequenceprimer 14gcaattcctt tagtggtacc
tttctatgcg gcccagccgg ccatggccca gggcgctggg 60aga
631542DNAartificial sequenceprimer 15ttcaacagta ccgccacccc
gtcttctccc agcgccctgg gc 421636DNAArtificial sequenceprimer
16atgattacgc caagctttgg agcctttttt ttggag 361736DNAartificial
sequenceprimer 17aggttttgct aaacaacttt caacagtacc gccacc
361827DNAartificial sequenceprimer 18actgttgaaa gttgtttagc aaaacct
271927DNAartificial sequenceprimer 19agacgattgg ccttgatatt cacaaac
272092DNAartificial sequenceprimer 20accgaagacc ccaccbnnbn
nbnnbnnbnn bnnbnnbnnb nnbnnbnnbn nctgggccat 60ggccggctgg gccgcataga
aaggtacccg gg 922125DNAartificial sequenceprimer 21catgcccggg
tacctttcta tgcgg 25
* * * * *