U.S. patent application number 14/557653 was filed with the patent office on 2015-06-25 for nogo receptor binding protein.
The applicant listed for this patent is Biogen Idec MA Inc.. Invention is credited to Daniel H.S. Lee, John McCoy, Sha Mi, R. Blake Pepinsky.
Application Number | 20150177240 14/557653 |
Document ID | / |
Family ID | 33102167 |
Filed Date | 2015-06-25 |
United States Patent
Application |
20150177240 |
Kind Code |
A1 |
Mi; Sha ; et al. |
June 25, 2015 |
Nogo Receptor Binding Protein
Abstract
The invention provides Sp35 polypeptides and fusion proteins
thereof, Sp35 antibodies and antigen-binding fragments thereof and
nucleic acids encoding the same. The invention also provides
compositions comprising, and methods for making and using, such
Sp35 antibodies, antigen-binding fragments thereof, Sp35
polypeptides and fusion proteins thereof.
Inventors: |
Mi; Sha; (Belmont, MA)
; McCoy; John; (Reading, MA) ; Pepinsky; R.
Blake; (Arlington, MA) ; Lee; Daniel H.S.;
(Sudbury, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Biogen Idec MA Inc. |
Cambridge |
MA |
US |
|
|
Family ID: |
33102167 |
Appl. No.: |
14/557653 |
Filed: |
December 2, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13827771 |
Mar 14, 2013 |
8932821 |
|
|
14557653 |
|
|
|
|
13414222 |
Mar 7, 2012 |
8765662 |
|
|
13827771 |
|
|
|
|
12698935 |
Feb 2, 2010 |
8153580 |
|
|
13414222 |
|
|
|
|
10553685 |
Nov 1, 2006 |
7785829 |
|
|
PCT/US2004/008323 |
Mar 17, 2004 |
|
|
|
12698935 |
|
|
|
|
60492057 |
Aug 1, 2003 |
|
|
|
60480241 |
Jun 20, 2003 |
|
|
|
60455756 |
Mar 19, 2003 |
|
|
|
Current U.S.
Class: |
435/7.1 ;
435/375 |
Current CPC
Class: |
A61P 25/02 20180101;
C07K 14/70571 20130101; C07K 16/2803 20130101; A61P 9/10 20180101;
A61P 9/00 20180101; A61P 25/00 20180101; A61P 3/10 20180101; A61P
43/00 20180101; C12N 5/0619 20130101; G01N 33/5058 20130101; A61P
25/16 20180101; C07K 16/18 20130101; C12N 2500/46 20130101; C07K
2319/30 20130101; A61P 21/02 20180101; A61P 25/14 20180101; A61K
38/00 20130101; G01N 33/56966 20130101; A61P 25/28 20180101; C07K
14/4702 20130101; G01N 33/6896 20130101 |
International
Class: |
G01N 33/569 20060101
G01N033/569; C12N 5/0793 20060101 C12N005/0793 |
Claims
1-57. (canceled)
58. A method for identifying an oligodendrocyte in a tissue sample,
the method comprising contacting the tissue sample with an
anti-Sp35 antibody or an Sp35-binding fragment thereof and an
anti-O4 oligodendrocyte marker antibody or an O4-binding fragment
thereof, wherein a cell that specifically binds both the anti-Sp35
antibody or Sp35-binding fragment thereof and the anti-O4 antibody
or O4-binding fragment thereof is identified as an
oligodendrocyte.
59. The method of claim 58, wherein the tissue sample is a spinal
cord sample.
60. The method of claim 58, wherein the tissue sample is a primary
granular neuron culture.
61. The method of claim 58, wherein the tissue sample is a frontal
cortex sample.
62. The method of claim 58, wherein the tissue sample is a
posterior cortex sample.
63. The method of claim 58, wherein the tissue sample is an
entorhinal cortex sample.
64. The method of claim 58, wherein the tissue sample is a
hippocampus sample.
65. The method of claim 58, wherein the tissue sample is an
olfactory bulb sample.
66. The method of claim 58, wherein the tissue sample is selected
from the group consisting of a striatum sample, a thalamus sample,
a cerebellum sample, a midbrain sample, a pons sample, and a
medulla sample.
67. A method for identifying a neuron in a tissue sample, the
method comprising contacting the tissue sample with an anti-Sp35
antibody or an Sp35-binding fragment thereof and an anti-.beta.III
tubulin neuronal marker antibody or an .beta.III tubulin-binding
fragment thereof, wherein a cell that specifically binds both the
anti-Sp35 antibody or Sp35-binding fragment thereof and the
anti-.beta.III tubulin antibody or .beta.III tubulin-binding
fragment thereof is identified a neuron.
68. The method of claim 67, wherein the tissue sample is a spinal
cord sample.
69. The method of claim 67, wherein the tissue sample is a primary
granular neuron culture.
70. The method of claim 67, wherein the tissue sample is a frontal
cortex sample.
71. The method of claim 67, wherein the tissue sample is a
posterior cortex sample.
72. The method of claim 67, wherein the tissue sample is an
entorhinal cortex sample.
73. The method of claim 67, wherein the tissue sample is a
hippocampus sample.
74. The method of claim 67, wherein the tissue sample is an
olfactory bulb sample.
75. The method of claim 67, wherein the tissue sample is selected
from the group consisting of a striatum sample, a thalamus sample,
a cerebellum sample, a midbrain sample, a pons sample, and a
medulla sample.
76. A method for inhibiting the homotypic interaction of Sp35 or
modulating Sp35 interaction with NgR1, the method comprising
contacting Sp35 with an oligopeptide of any one of SEQ ID NOs.
10-13.
77. The method of claim 76, wherein the method is for inhibiting
the homotypic interaction of Sp35.
Description
RELATED APPLICATIONS
[0001] Related applications U.S. Ser. No. 13/414,222, filed Mar. 7,
2012, U.S. Ser. No. 12/698,935, filed Feb. 2, 2010, U.S. Ser. No.
10/553,685, .sctn.371 date of Nov. 1, 2006, International
Application PCT/US2004/008323, filed Mar. 17, 2004, U.S.
60/455,756, filed Mar. 19, 2003, U.S. 60/480,241, filed Jun. 20,
2003, and U.S. 60/492,057, filed Aug. 1, 2003, are all incorporated
herein by reference in their entireties.
REFERENCE TO A SEQUENCE LISTING SUBMITTED ELECTRONICALLY VIA
EFS-WEB
[0002] The content of the electronically submitted sequence listing
(Name: sequencelisting_ascii.txt, Size: 17,573 bytes; and Date of
Creation: Feb. 2, 2010) is herein incorporated by reference in its
entirety.
FIELD OF THE INVENTION
[0003] This invention relates to neurology, neurobiology and
molecular biology. More particularly, this invention relates to
molecules and methods for treatment of neurological diseases,
disorders and injuries such as spinal cord injury.
BACKGROUND OF THE INVENTION
[0004] Axons and dendrites extend from neurons. The distal tip of
an extending axon or neurite includes a specialized region, known
as the growth cone. Growth cones sense the local environment and
guide axonal growth toward a neuron's target cell. Growth cones
respond to environmental cues, for example, surface adhesiveness,
growth factors, neurotransmitters and electric fields. The growth
cones generally advance at a rate of one to two millimeters per
day. The growth cone explores the area ahead of it and on either
side, by means of elongations classified as lamellipodia and
filopodia. When an elongation contacts an unfavorable surface, it
withdraws. When an elongation contacts a favorable growth surface,
it continues to extend and guides the growth cone in that
direction. When the growth cone reaches an appropriate target cell
a synaptic connection is created.
[0005] Nerve cell function is influenced by contact between neurons
and other cells in their immediate environment (Rutishauser, et
al., 1988, Physiol. Rev. 68:819). These cells include specialized
glial cells, oligodendrocytes in the central nervous system (CNS),
and Schwann cells in the peripheral nervous system (PNS), which
sheathe the neuronal axon with myelin (Lemke, 1992, in An
Introduction to Molecular Neurobiology, Z. Hall, Ed., p. 281,
Sinauer).
[0006] CNS neurons have the inherent potential to regenerate after
injury, but they are inhibited from doing so by inhibitory proteins
present in myelin (Brittis et al., 2001, Neuron 30:11-14; Jones et
al, 2002, J. Neurosci. 22:2792-2803; Grimpe et al, 2002, J.
Neurosci.:22:3144-3160).
[0007] Several myelin inhibitory proteins found on oligodendrocytes
have been characterized. Known examples of myelin inhibitory
proteins include NogoA (Chen et al., Nature, 2000, 403, 434-439;
Grandpre et al., Nature 2000, 403, 439-444), myelin associated
glycoprotein (MAG) (McKerracher et al., 1994, Neuron 13:805-811;
Mukhopadhyay et al., 1994, Neuron 13:757-767) and oligodendrocyte
glycoprotein (OM-gp), Mikol et al., 1988, J. Cell. Biol.
106:1273-1279). Each of these proteins has been separately shown to
be a ligand for the neuronal NgR1 (Wang et al., Nature 2002, 417,
941-944; Grandpre et al., Nature 2000, 403, 439-444; Chen et al.,
Nature, 2000, 403, 434-439; Domeniconi et al., Neuron 2002,
published online Jun. 28, 2002).
[0008] Nogo receptor-1 (NgR1) is a GPI-anchored membrane protein
that contains 8 leucine rich repeats (Fournier et al., 2001, Nature
409:341-346). Upon interaction with inhibitory proteins (e.g.,
NogoA, MAG and OM-gp), the NgR1 complex transduces signals that
lead to growth cone collapse and inhibition of neurite
outgrowth.
[0009] There is an unmet need for molecules and methods for
inhibiting NgR1-mediated growth cone collapse and the resulting
inhibition of neurite outgrowth.
SUMMARY OF THE INVENTION
[0010] We have made various discoveries regarding a polypeptide
designated "Sp35" (our designation). Alternate designations for
Sp35 include "LINGO" and "LINGO-1." Our discoveries include the
following. Sp35 binds to NgR1. Sp35 binds to itself in a homotypic
interaction. An Sp35-Fc fusion protein induces or promotes
fasciculation in granular neurons. An Sp35-Fc fusion protein
promotes neuronal survival in both the rubro-spinal tract
hemisection injury model and the optic nerve transection model.
Sp35 retrovirus-infected cortical primary cells, when delivered
into spinal cord-injured rats, result in enhanced neuron survival,
increased .beta. III tubulin staining of axons, and increased
myelin content.
[0011] Based in part on these discoveries, the invention features
an isolated nucleic acid containing a nucleotide sequence encoding
a polypeptide wherein: (a) the polypeptide includes (i) an Sp35 LRR
domain, (ii) an Sp35 basic region C-terminal to the LRR domain, and
(iii) an Sp35 immunoglobulin (Ig) domain C-terminal to the basic
region; and (b) the polypeptide lacks a transmembrane domain. The
Sp35 LRR domain can contain a carboxy-terminal LRR (LRRCT), an
amino-terminal LRR (LRRNT), or both. In some embodiments of the
invention, the encoded Sp35 polypeptide lacks the cytoplasmic
domain. In some embodiments, the encoded Sp35 polypeptide includes
amino acid residues 34-532 of SEQ ID NO: 2 and lacks amino acid
residues 533-614.
[0012] The invention also includes a nucleic acid encoding a
polypeptide wherein the polypeptide includes an Sp35 Ig domain and
lacks an Sp35 LRR domain, an Sp35 basic region, a transmembrane
domain, and a cytoplasmic domain.
[0013] The invention also includes a nucleic acid encoding a
polypeptide wherein the polypeptide includes an Sp35 LRR domain and
lacks an Sp35 Ig domain, an Sp35 basic region, a transmembrane
domain, and a cytoplasmic domain.
[0014] The invention also includes a nucleic acid encoding a
polypeptide lacking a functional cytoplasmic domain but including
all the other Sp35 domains. For example, the encoded polypeptide
could include amino acids 1-576 of SEQ ID NO: 2 (prior to
processing of the signal sequence).
[0015] In some embodiments of the invention, the encoded
polypeptide is a fusion polypeptide containing a non-Sp35 moiety.
The non-Sp35 moiety can be, for example, an Ig moiety, a serum
albumin moiety, a targeting moiety, a reporter moiety, or a
purification-facilitating moiety. A preferred non-Sp35 moiety is an
Ig moiety, e.g., an Fc moiety.
[0016] The nucleotide sequence can be operatively linked to an
expression control sequence, for example, in an expression vector.
The invention also includes a host cell transformed with a vector
that expresses an Sp35 polypeptide of the invention.
[0017] The invention also includes an Sp35 polypeptide encoded by
any of the above-described nucleic acids.
[0018] The invention also includes an Sp35 polypeptide conjugated
to a polymer, e.g., a polyalkylene glycol, a sugar polymer, and a
polypeptide. A preferred polymer is a polyalkylene glycol, e.g.,
polyethylene glycol (PEG). The polypeptide can be conjugated to 1,
2, 3 or 4 polymers. Preferably, the total molecular weight of the
conjugated polymers is from 20,000 Da to 40,000 Da per Sp35
polypeptide.
[0019] The invention also includes a method of inhibiting signal
transduction by NgR1. The method includes contacting the NgR1 with
an effective amount of an Sp35 polypeptide. Preferred polypeptides
for use in the method include the following: [0020] (a) an Sp35
polypeptide, wherein: (a) the polypeptide includes (i) an Sp35 LRR
domain, (ii) an Sp35 basic region C-terminal to the LRR domain, and
(iii) an Sp35 immunoglobulin (Ig) domain C-terminal to the basic
region; and (b) the polypeptide lacks a transmembrane domain; and
[0021] (b) an Sp35 polypeptide that includes an Sp35 Ig domain and
lacks an Sp35 LRR domain, an Sp35 basic region, a transmembrane
domain, and a cytoplasmic domain.
[0022] The invention also includes a method of decreasing
inhibition of axonal growth of a central nervous system (CNS)
neuron. The method includes contacting the neuron with an effective
amount of a polypeptide such as an Sp35 polypeptide, an anti-Sp35
antibody, or an antigen-binding fragment of an anti-Sp35
antibody.
[0023] The invention also includes a method of inhibiting growth
cone collapse of a CNS neuron. The method includes contacting the
neuron with an effective amount of a polypeptide such as an Sp35
polypeptide, an anti-Sp35 antibody, or an antigen-binding fragment
of an anti-Sp35 antibody.
[0024] The invention also includes a method of treating a CNS
disease, disorder or injury in a mammal. The method includes
administering to the mammal a therapeutically effective amount of a
polypeptide such as an Sp35 polypeptide, an anti-Sp35 antibody, or
an antigen-binding fragment of an anti-Sp35 antibody. In some
embodiments of the invention, the CNS disease, disorder or injury
is a spinal cord injury. The Sp35 polypeptide can be administered
locally. In some embodiments of the method, the Sp 35 polypeptide
is administered initially within 48 hours of a spinal cord injury.
For local administration, the therapeutically effective amount of
the polypeptide preferably is from 10 .mu.g/kg to 10 mg/kg. For
systemic administration, the therapeutically effective amount of
the polypeptide preferably is from 1 mg/kg to 20 mg/kg.
[0025] The invention also includes an ex vivo gene therapy method
of treating a CNS disease, disorder or injury in a mammal. The
method includes (a) providing a cultured host cell expressing a
recombinant Sp35 polypeptide; and (b) introducing the host cell
into the mammal at the site of the CNS disease, disorder or injury,
e.g., spinal cord injury. The cultured host cell can be derived
from the mammal to be treated. In this ex vivo gene therapy method,
the recombinant Sp35 polypeptide can be a full-length Sp35
polypeptide.
[0026] The invention also includes a method of promoting
myelination at the site of the CNS disease, disorder or injury. The
method includes contacting the site of the CNS disease, disorder or
injury with an effective amount of an Sp35 polypeptide, e.g., a
polypeptide containing an Sp35 LRR domain and lacking an Sp35 Ig
domain, an Sp35 basic region, a transmembrane domain, and a
cytoplasmic domain.
[0027] The invention also includes an in vivo gene therapy method
of treating a CNS disease, disorder or injury by in vivo gene
therapy. The method includes the steps of administering to a
mammal, at or near the site of the disease, disorder or injury, a
viral vector containing a nucleotide sequence that encodes an Sp35
polypeptide so that the Sp35 polypeptide is expressed from the
nucleotide sequence in the mammal in an amount sufficient to reduce
inhibition of axonal extension by neurons at or near the site of
the injury. The viral vector can be, e.g., an adenoviral vector, a
lentiviral vector, a baculoviral vector, an Epstein Barr viral
vector, a papovaviral vector, a vaccinia viral vector, and a herpes
simplex viral vector. The disease, disorder or injury can be, e.g.,
spinal cord injury or optic nerve injury. The viral vector can be
administered by a route such as topical administration, intraocular
administration, parenteral administration, intrathecal
administration, subdural administration and subcutaneous
administration.
[0028] The invention also includes a method of promoting survival
of a neuron at risk of dying. The method includes contacting the
neuron with an effective amount of an Sp35 polypeptide. The Sp35
polypeptide can be a soluble form of Sp35, e.g., an Sp35-Fc fusion
protein. The neuron can be in vitro or in vivo, e.g., in a mammal
with a neurodegenerative disease disorder or injury, e.g., multiple
sclerosis, ALS, Huntington's disease, Alzheimer's disease,
Parkinson's disease, diabetic neuropathy, stroke, traumatic brain
injuries and spinal cord injury. In some embodiments of the
invention, the Sp35 polypeptide is administered indirectly by: (a)
providing a cultured host cell expressing a recombinant Sp35
polypeptide; and (b) introducing the host cell into the mammal at
the site of the neuron. In some embodiments of the invention, the
polypeptide is administered indirectly through in vivo gene
therapy. In such an embodiment, the method includes administering,
at or near the site of the neuron, a viral vector comprising a
nucleotide sequence that encodes an Sp35 polypeptide so that the
Sp35 polypeptide is expressed from the nucleotide sequence in the
mammal in an amount sufficient to promote survival of the
neuron.
[0029] As used herein, "full length human Sp35 polypeptide" means
the polypeptide whose amino acid sequence is amino acids 34-614 of
SEQ ID NO: 2.
[0030] As used herein, "heterologous moiety" means an amino acid
sequence not present in a full-length Sp35 polypeptide.
[0031] As used herein, "nogo receptor-1" means the polypeptide
whose sequence is publicly available under Genbank accession no.
AAG53612.
[0032] As used herein, "Sp35 antagonist polypeptide" means an Sp35
polypeptide that blocks, inhibits, or interferes with the
biological activity of naturally-occurring Sp35.
[0033] As used herein, "Sp35 basic region" means the following
amino acid motif:
TABLE-US-00001 (SEQ ID NO: 4) R R A R I R D R K (SEQ ID NO: 5) K K
V K V K E K R (SEQ ID NO: 6) R R L R L R D R K (SEQ ID NO: 7) R R G
R G R D R K (SEQ ID NO: 8) R R I R A R D R K
The top row of amino acids (in bold; SEQ ID NO: 4) is the preferred
Sp35 basic region sequence, with variants showing optional
substitutions shown below (SEQ ID NOS: 5, 6, 7 and 8).
[0034] As used herein, "Sp35 fusion protein" means a fusion protein
that includes an Sp35 moiety fused to a heterologous moiety.
[0035] As used herein, "Sp35 Ig domain" means amino acids 433-493
of SEQ ID NO: 2, provided that the sequence can contain up to five
individual amino acid insertions, deletions, or conservative amino
acid substitutions. The following substitutions (numbering based on
SEQ ID NO: 2) are expressly included: V to M at position 6; S to G
at position 294; V to A at position 348; and R to H at position
419.
[0036] As used herein, "Sp35 LRR domain" means a domain that
includes 10 to 14 of the leucine rich repeat sequences, including
the LRRNT and LRRCT, listed in Table 1, provided that up to five
amino acid insertions, deletions, or conservative amino acid
substitutions can appear within the aggregate 10-14 leucine rich
repeats.
[0037] As used herein, "Sp35 moiety" means a biologically active
fragment of a full-length Sp35 polypeptide.
[0038] As used herein, "Sp35 polypeptide" means an Sp35 moiety or a
fusion protein that includes an Sp35 moiety.
[0039] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the invention pertains. In case
of conflict, the present specification, including definitions, will
control. All publications, patents and other references mentioned
herein are incorporated by reference.
[0040] Although methods and materials similar or equivalent to
those described herein can be used in the practice or testing of
the invention, the preferred methods and materials are described
below. The materials, methods and examples are illustrative only,
and are not intended to be limiting. Other features and advantages
of the invention will be apparent from the detailed description and
from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0041] FIG. 1 is the nucleotide sequence of a full-length human
Sp35 cDNA (SEQ ID NO:1)
[0042] FIG. 2 is the amino acid sequence of a full-length human
Sp35 polypeptide (SEQ ID NO: 2).
[0043] FIG. 3 is a schematic illustration of the Sp35 domain
structure and deletion mapping to identify Sp35 sequence(s) that
bind to NgR1.
[0044] FIG. 4 is a histogram summarizing data on SP35 binding to
COS7 cells transfected with an expression vector encoding rat p75
or a vector control. After 48 hours, AP-SP35 or AP was incubated
with the cells. Bound AP was detected using chromogenic AP
detection reagent.
[0045] FIG. 5 is a histogram summarizing data on binding of
AP-Omgp, and AP-Nogo-66 to COS7 cells transfected with an
expression vector encoding NgR1; NgR1 and p75; NgR1, p75, and SP35,
or a vector control. After 48 hours, AP-Omgp, AP-Nogo-66 or AP was
incubated with the cells. Bound AP was detected using chromogenic
AP detection reagent.
[0046] FIG. 6 is a histogram summarizing data on the relief of
inhibitory activity of myelin inhibitors on neurite outgrowth in
vitro. Neurite length was measured on postnatal day 7 rat
cerebellar granular neurons expressing DN-Sp35, full-length Sp35,
or controls cultured on immobolized substrate Omgp, Myelin and
Nogo-66. DN-SP35 transfected cells exhibited diminished response to
inhibitory substrates. Neurite length was quantified from 1000
neurons per treatment group from two independent experiments
(p<0.01).
[0047] FIG. 7 is a histogram summarizing data on reversal of
inhibitory activity of myelin inhibitors by SP35-Fc. Neurite length
of postnatal day 7 rat cerebellar granular neurons (1000 neurons)
cultured on immobilized substrate OMgp, Myelin or Nogo-66 in the
presence or absence of SP35-Fc. SP35-Fc reduced the neurite
outgrowth inhibition caused by Omgp, Nogo-66 and MAG. Neurite
length was quantified from 1000 neurons per treatment group from
two independent experiments (p<0.01).
[0048] FIG. 8 is a graph summarizing data from an experiment
showing that intrathecal-administered Sp35-Fc improves functional
recovery after dorsal hemisection in a rat. The locomoter BBB score
measured as a function of time after dorsal hemisection in control
(IgG) or Sp35-Fc-treated rats (8 animals per group). Treatment was
initiated at the time of spinal cord injury.
[0049] FIG. 9 is a graph showing individual animal BBB scores at
week four in the experiment summarized in FIG. 8.
DETAILED DESCRIPTION OF THE INVENTION
[0050] Naturally occurring human Sp35 is a glycosylated
CNS-specific protein containing 614 amino acids (FIG. 2; SEQ ID NO:
2). The human, full-length wild-type SP35 polypeptide contains an
LRR domain consisting of 14 leucine-rich repeats (including N- and
C-terminal caps), an Ig domain, a transmembrane region, and a
cytoplasmic domain (FIG. 3). The cytoplasmic domain contains a
canonical tyrosine phosphorylation site. In addition, the naturally
occurring Sp35 protein contains a signal sequence, a short basic
region between the LRRCT and Ig domain, and a transmembrane region
between the Ig domain and the cytoplasmic domain (FIG. 3). The
human Sp35 gene contains alternative translation start codons, so
that six additional amino acids, i.e., MQVSKR (SEQ ID NO: 9) may or
may not be present at the N-terminus of the Sp35 signal sequence.
Table 1 lists the Sp35 domains and other regions, according to
amino acid residue number, based on the sequence in FIG. 2 (SEQ ID
NO: 2).
TABLE-US-00002 TABLE 1 Domain or Region Beginning Residue Ending
Residue Signal Sequence 1 33 LRRNT 34 64 LRR 66 89 LRR 90 113 LRR
114 137 LRR 138 161 LRR 162 185 LRR 186 209 LRR 210 233 LRR 234 257
LRR 258 281 LRR 282 305 LRR 306 329 LRR 330 353 LRRCT 363 416 Basic
417 424 Ig 433 493 Connecting sequence 494 551 Transmembrane 552
576 Cytoplasmic 577 614
[0051] Tissue distribution and developmental expression of Sp35 has
been studied in humans and rats. Sp35 biology has been studied in
an experimental animal (rat) model. Expression of rat SP35 is
localized to CNS neurons and brain oligodendrocytes, as determined
by northern blot and immuno-histochemical staining. Rat Sp35 mRNA
expression level is regulated developmentally, peaking shortly
after birth, i.e., ca. postnatal day one. In a rat spinal cord
transection injury model, Sp35 is up-regulated at the injury site,
as determined by RT-PCR.
[0052] The inventors have discovered that full-length, wild-type
Sp35 binds to NgR1. Soluble derivatives of Sp35 function as Sp35
antagonist polypeptides by binding to NgR1 and blocking,
inhibiting, or interfering with its function, thereby relieving the
NgR1-mediated inhibition of axonal extension that normally takes
place in CNS neurons. This is beneficial in situations where axonal
extension or neurite sprouting is needed in the brain or spinal
cord. Spinal cord injury, including partial or complete crush or
severance, exemplifies a situation in which axonal extension is
needed, but is normally inhibited through operation of the Nogo
pathway. Examples of diseases or disorders in which axonal
extension and/or neurite sprouting in the brain would be beneficial
include stroke, multiple sclerosis, and other neurodegenerative
diseases or disorders.
[0053] In methods of the present invention, an Sp35 polypeptide or
an Sp35 blocking antibody (or antigen-binding antibody fragment)
can be administered directly as a preformed polypeptide, or
indirectly through a nucleic acid vector, to antagonize NgR1
function and permit beneficial axonal outgrowth.
[0054] In some embodiments of the invention a soluble Sp35
antagonist polypeptide is administered in a treatment method that
includes: (1) transforming or transfecting an implantable host cell
with a nucleic acid, e.g., a vector, that expresses an Sp35
polypeptide; and (2) implanting the transformed host cell into a
mammal, at the site of a disease, disorder or injury. For example,
the transformed host cell can be implanted at the site of a spinal
cord injury. In some embodiments of the invention, the implantable
host cell is removed from a mammal, temporarily cultured,
transformed or transfected with an isolated nucleic acid encoding a
soluble Sp35 polypeptide, and implanted back into the same mammal
from which it was removed. The cell can be, but is not required to
be, removed from the same site at which it is implanted. Such
embodiments, sometimes known as ex vivo gene therapy, can provide a
continuous supply of the Sp35 polypeptide, localized at the site of
site of action, for a limited period of time.
[0055] The invention provides oligopeptides useful as modulators of
the Sp35 interaction with NgR1 and Sp35 homotypic interactions. The
oligopeptides include the following amino acid motif:
TABLE-US-00003 (SEQ ID NO: 10) L S P R K H (SEQ ID NO: 11) I T P K
R R (SEQ ID NO: 12) A C P H H K (SEQ ID NO: 13) V S P R K H
[0056] The top row of amino acids (in bold; SEQ ID NO: 10) is the
preferred sequence, with variants comprising optional substitutions
shown below (SEQ ID NOS: 11, 12 and 13).
[0057] Various exemplary Sp35 polypeptides, anti-Sp35 antibodies
and antibody fragments, and methods and materials for obtaining
these molecules for practicing the present invention are described
below.
Fusion Proteins and Conjugated Polypeptides
[0058] Some embodiments of the invention involve the use of an Sp35
polypeptide, e.g., an Sp35 antagonist polypeptide, wherein an Sp35
moiety is fused to a heterologous polypeptide moiety to form an
Sp35 fusion protein. Sp35 fusion proteins can be used to accomplish
various objectives, e.g., increased serum half-life, improved
bioavailability, in vivo targeting to a specific organ or tissue
type, improved recombinant expression efficiency, improved host
cell secretion, ease of purification, and higher avidity. Depending
on the objective(s) to be achieved, the heterologous moiety can be
inert or biologically active. Also, it can be chosen to be stably
fused to the Sp35 moiety or to be cleavable, in vitro or in vivo.
Heterologous moieties to accomplish different objectives are known
in the art.
[0059] As an alternative to expression of a Sp35 fusion protein, a
chosen heterologous moiety can be preformed and chemically
conjugated to the Sp35 moiety. In most cases, a chosen heterologous
moiety will function similarly, whether fused or conjugated to the
Sp35 moiety. Therefore, in the following discussion of heterologous
amino acid sequences, unless otherwise noted, it is to be
understood that the heterologous sequence can be joined to the Sp35
moiety in the form of a fusion protein or as a chemical
conjugate.
[0060] Pharmacologically active polypeptides such as Sp35 often
exhibit rapid in vivo clearance, necessitating large doses to
achieve therapeutically effective concentrations in the body. In
addition, polypeptides smaller than about 60 kDa potentially
undergo glomerular filtration, which sometimes leads to
nephrotoxicity. Fusion or conjugation of relatively small
polypeptides such as Sp35 fragments can be employed to reduce or
avoid the risk of such nephrotoxicity. Various heterologous amino
acid sequences, i.e., polypeptide moieties or "carriers," for
increasing the in vivo stability, i.e., serum half-life, of
therapeutic polypeptides are known.
[0061] Due to its long half-life, wide in vivo distribution, and
lack of enzymatic or immunological function, essentially
full-length human serum albumin (HSA), or an HSA fragment, is a
preferred heterologous moiety. Through application of methods and
materials such as those taught in Yeh et al., 1992, Proc. Natl.
Acad. Sci. USA, 89:1904-1908 and Syed et al., 1997, Blood
89:3243-3252, HSA can be used to form an Sp35 fusion protein or
conjugate that displays pharmacological activity by virtue of the
Sp35 moiety while displaying significantly increased, e.g., 10-fold
to 100-fold higher, in vivo stability. Preferably, the C-terminus
of the HSA is fused to the N-terminus of the Sp35 moiety. Since HSA
is a naturally secreted protein, the HSA signal sequence can be
exploited to obtain secretion of the Sp35 fusion protein into the
cell culture medium, when the fusion protein is produced in a
eukaryotic, e.g., mammalian, expression system.
[0062] Some embodiments of the invention employ an Sp35 polypeptide
wherein an Sp35 moiety is fused to an Fc region, i.e., the
C-terminal portion of an Ig heavy chain constant region. Potential
advantages of an Sp35-Fc fusion include solubility, in vivo
stability, and multivalency, e.g., dimerization. The Fc region used
can be an IgA, IgD, or IgG Fc region (hinge-CH2-CH3).
Alternatively, it can be an IgE or IgM Fc region
(hinge-CH2-CH3-CH4). An IgG Fc region is preferred, e.g., an IgG1
Fc region or IgG4 Fc region. Materials and methods for constructing
and expressing DNA encoding Fc fusions are known in the art and can
be applied to obtain Sp35 fusions without undue experimentation.
Some embodiments of the invention employ an Sp35 fusion protein
such as those described in Capon et al. U.S. Pat. Nos. 5,428,130
and 5,565,335.
[0063] The signal sequence is a polynucleotide that encodes an
amino acid sequence that initiates transport of a protein across
the membrane of the endoplasmic reticulum. Signal sequences useful
for constructing an immunofusin include antibody light chain signal
sequences, e.g., antibody 14.18 (Gillies et. al., 1989, J. Immunol.
Meth., 125:191-202), antibody heavy chain signal sequences, e.g.,
the MOPC141 antibody heavy chain signal sequence (Sakano et al.,
1980, Nature 286:5774). Alternatively, other signal sequences can
be used. See, for example, Watson, 1984, Nucleic Acids Research
12:5145). The signal peptide is usually cleaved in the lumen of the
endoplasmic reticulum by signal peptidases. This results in the
secretion of a immunofusin protein containing the Fc region and the
Sp35 moiety.
[0064] In some embodiments the DNA sequence encodes a proteolytic
cleavage site between the secretion cassette and the Sp35 moiety. A
cleavage site provides for the proteolytic cleavage of the encoded
fusion protein, thus separating the Fc domain from the target
protein. Useful proteolytic cleavage sites include amino acids
sequences recognized by proteolytic enzymes such as trypsin,
plasmin, thrombin, factor Xa, or enterokinase K.
[0065] The secretion cassette can be incorporated into a replicable
expression vector. Useful vectors include linear nucleic acids,
plasmids, phagemids, cosmids and the like. An exemplary expression
vector is pdC, in which the transcription of the immunofusin DNA is
placed under the control of the enhancer and promoter of the human
cytomegalovirus. See, e.g., Lo et al., 1991, Biochim. Biophys. Acta
1088:712; and Lo et al., 1998, Protein Engineering 11:495-500. An
appropriate host cell can be transformed or transfected with a DNA
that encodes an Sp35 polypeptide, and is used for the expression
and secretion of the Sp35 polypeptide. Preferred host cells include
immortal hybridoma cells, myeloma cells, 293 cells, Chinese hamster
ovary (CHO) cells, Hela cells, and COS cells.
[0066] Fully intact, wild-type Fc regions display effector
functions that normally are unnecessary and undesired in an Fc
fusion protein according to the present invention. Therefore,
certain binding sites preferably are deleted from the Fc region
during the construction of the secretion cassette. For example,
since coexpression with the light chain is unnecessary, the binding
site for the heavy chain binding protein, Bip (Hendershot et al.,
1987, Immunol. Today 8:111-114), is deleted from the CH2 domain of
the Fc region of IgE, such that this site does not interfere with
the efficient secretion of the immunofusin. Likewise, the cysteine
residues present in the Fc regions which are responsible for
binding to the light chain of the immunoglobulin should be deleted
or substituted with another amino acid, such that these cysteine
residues do not interfere with the proper folding of the Fc region
when it is produced as an immunofusin. Transmembrane domain
sequences, such as those present in IgM, should be deleted.
[0067] The IgG1 Fc region is preferred. Alternatively, the Fc
region of the other subclasses of immunoglobulin gamma (gamma-2,
gamma-3 and gamma-4) can be used in the secretion cassette. The
IgG1 Fc region of immunoglobulin gamma-1 is preferably used in the
secretion cassette includes the hinge region (at least part), the
CH2 region, and the CH3 region. In some embodiments, the Fc region
of immunoglobulin gamma-1 is a CH2-deleted-Fc, which includes part
of the hinge region and the CH3 region, but not the CH2 region. A
CH2-deleted-Fc has been described by Gillies et al., 1990, Hum.
Antibod. Hybridomas, 1:47. In some embodiments, the Fc regions of
IgA, IgD, IgE, or IgM, are used.
[0068] Sp35-Fc fusion proteins can be constructed in several
different configurations. In one configuration the C-terminus of
the Sp35 moiety is fused directly to the N-terminus of the Fc
moiety. In a slightly different configuration, a short polypeptide,
e.g., 2-10 amino acids, is incorporated into the fusion between the
N-terminus of the Sp35 moiety and the C-terminus of the Fc moiety.
Such a linker provides conformational flexibility, which may
improve biological activity in some circumstances. If a sufficient
portion of the hinge region is retained in the Fc moiety, the
Sp35-Fc fusion will dimerize, thus forming a divalent molecule. A
homogeneous population of monomeric Fc fusions will yield
monospecific, bivalent dimers. A mixture of two monomeric Fc
fusions each having a different specificity will yield bispecific,
bivalent dimers.
[0069] Any of a number of cross-linkers that contain a
corresponding amino reactive group and thiol reactive group can be
used to link Sp35 to serum albumin. Examples of suitable linkers
include amine reactive cross-linkers that insert a thiol
reactive-maleimide, e.g., SMCC, AMAS, BMPS, MBS, EMCS, SMPB, SMPH,
KMUS, and GMBS. Other suitable linkers insert a thiol
reactive-haloacetate group, e.g., SBAP, SIA, SLAB. Linkers that
provide a protected or non-protected thiol for reaction with
sulfhydryl groups to product a reducible linkage include SPDP,
SMPT, SATA, and SATP. Such reagents are commercially available
(e.g., Pierce Chemicals).
[0070] Conjugation does not have to involve the N-terminus of an
Sp35 polypeptide or the thiol moiety on serum albumin. For example,
Sp35-albumin fusions can be obtained using genetic engineering
techniques, wherein the Sp35 moiety is fused to the serum albumin
gene at its N-terminus, C-terminus, or both.
[0071] Sp35 polypeptides can be fused to heterologous peptides to
facilitate purification or identification of the Sp35 moiety. For
example, a histidine tag can be fused to an Sp35 polypeptide to
facilitate purification using commercially available chromatography
media.
[0072] In some embodiments of the invention, an Sp35 fusion
construct is used to enhance the production of an Sp35 moiety in
bacteria. In such constructs a bacterial protein normally expressed
and/or secreted at a high level is employed as the N-terminal
fusion partner of an Sp35 polypeptide. See, e.g., Smith et al.,
1988 Gene 67:31; Hopp et al., 1988, Biotechnology 6:1204; La Vallie
et al., 1993, Biotechnology 11:187.
[0073] In some embodiments of the invention, a fusion construct
includes an Sp35 moiety and a second human NgR1-binding moiety,
e.g., an oligodendrocyte-myelin glycoprotein (OMgp) moiety, a
myelin associated glycoprotein (MAG) moiety, or Nogo66 moiety.
Advantages of such constructs include increased NgR1 binding
affinity.
[0074] The full-length OMgp amino acid sequence is known in the art
(Genbank accession no. P23515). Specific examples of Sp35-OMgp
fusions include the following:
[0075] Sp35 (an 34-532)+IgG Fc+OMgp (amino acid residues 25-400);
and
[0076] Sp35 (aa 34-532)+HSA+OMgp (amino acid residues 25-400).
[0077] The full-length MAG amino acid sequence is known in the art
(Genbank accession no. A61084). Specific examples of Sp35-MAG
fusions include the following:
[0078] Sp35 (aa 34-532)+IgG1 Fc+MAG (amino acid residues 12-500);
and
[0079] Sp35 (aa 34-532)+HSA+MAG (amino acid residues 12-500).
[0080] The full-length Nogo amino acid sequence is known in the art
(NogoA Genbank accession no. AY102279). Specific examples of
Sp35-Nogo fusions include the following:
[0081] Sp35 (aa 34-532)+IgG1 Fc+Nogo66 (NogoA amino acid residues
1056-1122);
[0082] Sp35 (aa 34-532)+HSA+Nogo66 (NogoA amino acid residues
1056-1122);
[0083] Sp35 (aa 34-532)+IgG1 Fc+amino Nogo (NogoA amino acid
residues 1-949); and
[0084] Sp35 (aa 34-532)+HSA+amino Nogo (NogoA amino acid residues
1-949).
[0085] By fusing an Sp35 moiety at the amino and carboxy termini of
a suitable fusion partner, bivalent or tetravalent forms of an Sp35
polypeptide can be obtained. For example, an Sp35 moiety can be
fused to the amino and carboxy termini of an Ig moiety to produce a
bivalent monomeric polypeptide containing two Sp35 moieties. Upon
dimerization of two of these monomers, by virtue of the Ig moiety,
a tetravalent form of an Sp35 protein is obtained. Such multivalent
forms can be used to achieve increased binding affinity for the
target. Multivalent forms of Sp35 also can be obtained by placing
Sp35 moieties in tandem to form concatamers, which can be employed
alone or fused to a fusion partner such as Ig or HSA.
[0086] Conjugated Polymers (Other than Polypeptides)
[0087] Some embodiments of the invention involve an Sp35
polypeptide wherein one or more polymers are conjugated (covalently
linked) to the Sp35 polypeptide. Examples of polymers suitable for
such conjugation include polypeptides (discussed above), sugar
polymers and polyalkylene glycol chains. Typically, but not
necessarily, a polymer is conjugated to the Sp35 polypeptide for
the purpose of improving one or more of the following: solubility,
stability, or bioavailability.
[0088] A preferred class of polymer for conjugation to an Sp35
polypeptide is a polyalkylene glycol. Polyethylene glycol (PEG) is
particularly preferred. PEG moieties, e.g., 1, 2, 3, 4 or 5 PEG
polymers, can be conjugated to each Sp35 polypeptide to increase
serum half life, as compared to the Sp35 polypeptide alone. PEG
moieties are non-antigenic and essentially biologically inert. PEG
moieties used in the practice of the invention may be branched or
unbranched.
[0089] The number of PEG moieties attached to the Sp35 polypeptide
and the molecular weight of the individual PEG chains can vary. In
general, the higher the molecular weight of the polymer, the fewer
polymer chains attached to the polypeptide. Preferably, the total
polymer mass attached to the Sp35 polypeptide is from 20 kDa to 40
kDa. Thus, if one polymer chain is attached, the preferred
molecular weight of the chain is 20-40 kDa. If two chains are
attached, the preferred molecular weight of each chain is 10-20
kDa. If three chains are attached, the preferred molecular weight
is 7-14 kDa.
[0090] The polymer, e.g., PEG, can be linked to the Sp35
polypeptide through any suitable, exposed reactive group on the
polypeptide. The exposed reactive group(s) can be, for example, an
N-terminal amino group or the epsilon amino group of an internal
lysine residue, or both. An activated polymer can react and
covalently link at any free amino group on the Sp35 polypeptide.
Free carboxylic groups, suitably activated carbonyl groups,
hydroxyl, guanidyl, imidazole, oxidized carbohydrate moieties and
mercapto groups of the Sp35 (if available) also can be used as
reactive groups for polymer attachment.
[0091] Preferably, in a conjugation reaction, from about 1.0 to
about 10 moles of activated polymer per mole of polypeptide,
depending on polypeptide concentration, is employed. Usually, the
ratio chosen represents a balance between maximizing the reaction
while minimizing side reactions (often non-specific) that can
impair the desired pharmacological activity of the Sp35 moiety.
Preferably, at least 50% of the biological activity (as
demonstrated, e.g., in any of the assays described herein or known
in the art) of the Sp35 polypeptide is retained, and most
preferably nearly 100% is retained.
[0092] The polymer can be conjugated to the Sp35 polypeptide using
conventional chemistry. For example, a polyalkylene glycol moiety
can be coupled to a lysine epsilon amino group of the Sp35
polypeptide. Linkage to the lysine side chain can be performed with
an N-hydroxylsuccinimide (NHS) active ester such as PEG
succinimidyl succinate (SS-PEG) and succinimidyl propionate
(SPA-PEG). Suitable polyalkylene glycol moieties include, e.g.,
carboxymethyl-NHS, norleucine-NHS, SC-PEG, tresylate, aldehyde,
epoxide, carbonylimidazole, and PNP carbonate. These reagents are
commercially available. Additional amine reactive PEG linkers can
be substituted for the succinimidyl moiety. These include, e.g.,
isothiocyanates, nitrophenylcarbonates, epoxides, and benzotriazole
carbonates. Conditions preferably are chosen to maximize the
selectivity and extent or reaction. Such optimization of reaction
conditions is within ordinary skill in the art.
[0093] PEGylation can be carried out by any of the PEGylation
reactions known in the art. See, e.g., Focus on Growth Factors, 3:
4-10, 1992; published European patent applications EP 0 154 316 and
EP 0 401 384. PEGylation may be carried out using an acylation
reaction or an alkylation reaction with a reactive polyethylene
glycol molecule (or an analogous reactive water-soluble
polymer).
[0094] PEGylation by acylation generally involves reacting an
active ester derivative of polyethylene glycol. Any reactive PEG
molecule can be employed in the PEGylation. A preferred activated
PEG ester is PEG esterified to N-hydroxysuccinimide (NHS). As used
herein, "acylation" includes without limitation the following types
of linkages between the therapeutic protein and a water soluble
polymer such as PEG: amide, carbamate, urethane, and the like. See,
Bioconjugate Chem. 5: 133-140, 1994. Reaction parameters should be
chosen to avoid temperature, solvent, and pH conditions that would
damage or inactivate the Sp35 polypeptide.
[0095] Preferably, the connecting linkage is an amide. Preferably,
at least 95% of the resulting product is mono, di- or
tri-PEGylated. However, some species with higher degrees of
PEGylation may be formed in amounts depending on the specific
reaction conditions used. Optionally, purified PEGylated species
are separated from the mixture, particularly unreacted species, by
conventional purification methods, including, e.g., dialysis,
salting-out, ultrafiltration, ion-exchange chromatography, gel
filtration chromatography, and electrophoresis.
[0096] PEGylation by alkylation generally involves reacting a
terminal aldehyde derivative of PEG with Sp35 in the presence of a
reducing agent. In addition, one can manipulate the reaction
conditions to favor PEGylation substantially only at the N-terminal
amino group of Sp35 (i.e., a mono-PEGylated protein). In either
case of mono-PEGylation or poly-PEGylation, the PEG groups are
preferably attached to the protein via a --CH2-NH-- group. With
particular reference to the --CH2- group, this type of linkage is
known as an "alkyl" linkage.
[0097] Derivatization via reductive alkylation to produce a
mono-PEGylated product exploits differential reactivity of
different types of primary amino groups (lysine versus the
N-terminal) available for derivatization. The reaction is performed
at a pH that allows one to take advantage of the pKa differences
between the epsilon-amino groups of the lysine residues and that of
the N-terminal amino group of the protein. By such selective
derivatization, attachment of a water soluble polymer that contains
a reactive group such as an aldehyde, to a protein is controlled:
the conjugation with the polymer takes place predominantly at the
N-terminus of the protein and no significant modification of other
reactive groups, such as the lysine side chain amino groups,
occurs.
[0098] The polymer molecules used in both the acylation and
alkylation approaches are selected from among water soluble
polymers. The polymer selected should be modified to have a single
reactive group, such as an active ester for acylation or an
aldehyde for alkylation, preferably, so that the degree of
polymerization may be controlled as provided for in the present
methods. An exemplary reactive PEG aldehyde is polyethylene glycol
propionaldehyde, which is water stable, or mono C1-C10 alkoxy or
aryloxy derivatives thereof (see, U.S. Pat. No. 5,252,714). The
polymer may be branched or unbranched. For the acylation reactions,
the polymer(s) selected should have a single reactive ester group.
For reductive alkylation, the polymer(s) selected should have a
single reactive aldehyde group. Generally, the water soluble
polymer will not be selected from naturally-occurring glycosyl
residues since these are usually made more conveniently by
mammalian recombinant expression systems.
[0099] Methods for preparing a PEGylated Sp35 generally includes
the steps of (a) reacting a Sp35 protein or polypeptide with
polyethylene glycol (such as a reactive ester or aldehyde
derivative of PEG) under conditions whereby the molecule becomes
attached to one or more PEG groups, and (b) obtaining the reaction
product(s). In general, the optimal reaction conditions for the
acylation reactions will be determined case by case based on known
parameters and the desired result. For example, the larger the
ratio of PEG:protein, the greater the percentage of poly-PEGylated
product.
[0100] Reductive alkylation to produce a substantially homogeneous
population of mono-polymer/Sp35 generally includes the steps of:
(a) reacting a Sp35 protein or polypeptide with a reactive PEG
molecule under reductive alkylation conditions, at a pH suitable to
pen-nit selective modification of the N-terminal amino group of
Sp35; and (b) obtaining the reaction product(s).
[0101] For a substantially homogeneous population of
mono-polymer/Sp35, the reductive alkylation reaction conditions are
those that permit the selective attachment of the water soluble
polymer moiety to the N-terminus of Sp35. Such reaction conditions
generally provide for pKa differences between the lysine side chain
amino groups and the N-terminal amino group. For purposes of the
present invention, the preferred pH is in the range of 3-9,
preferably 3-6.
[0102] Sp35 polypeptides can include a tag, e.g., a moiety that can
be subsequently released by proteolysis. Thus, the lysine moiety
can be selectively modified by first reacting a His-tag modified
with a low molecular weight linker such as Traut's reagent (Pierce)
which will react with both the lysine and N-terminus, and then
releasing the his tag. The polypeptide will then contain a free SH
group that can be selectively modified with a PEG containing a
thiol reactive head group such as a maleimide group, a vinylsulfone
group, a haloacetate group, or a free or protected SH.
[0103] Traut's reagent can be replaced with any linker that will
set up a specific site for PEG attachment. For example, Traut's
reagent can be replaced with SPDP, SMPT, SATA, or SATP (Pierce).
Similarly one could react the protein with an amine reactive linker
that inserts a maleimide (for example SMCC, AMAS, BMPS, MBS, EMCS,
SMPB, SMPH, KMUS, or GMBS), a haloacetate group (SBAP, SIA, SIAB),
or a vinylsulfone group and react the resulting product with a PEG
that contains a free SH.
[0104] In some embodiments, the polyalkylene glycol moiety is
coupled to a cysteine group of the Sp35 polypeptide. Coupling can
be effected using, e.g., a maleimide group, a vinylsulfone group, a
haloacetate group, or a thiol group.
[0105] Optionally, the Sp35 polypeptide is conjugated to the
polyethylene glycol moiety through a labile bond. The labile bond
can be cleaved in, e.g., biochemical hydrolysis, proteolysis, or
sulfhydryl cleavage. For example, the bond can be cleaved under in
vivo (physiological) conditions.
[0106] The reactions may take place by any suitable method used for
reacting biologically active materials with inert polymers,
preferably at about pH 5-8, e.g., pH 5, 6, 7, or 8, if the reactive
groups are on the alpha amino group at the N-terminus. Generally
the process involves preparing an activated polymer and thereafter
reacting the protein with the activated polymer to produce the
soluble protein suitable for formulation.
[0107] The invention provides vectors comprising the nucleic acids
encoding Sp35 polypeptides. The choice of vector and expression
control sequences to which the nucleic acids of this invention is
operably linked depends on the functional properties desired, e.g.,
protein expression, and the host cell to be transformed.
[0108] Expression control elements useful for regulating the
expression of an operably linked coding sequence are known in the
art. Examples include, but are not limited to, inducible promoters,
constitutive promoters, secretion signals, and other regulatory
elements. When an inducible promoter is used, it can be controlled,
e.g., by a change in nutrient status, or a change in temperature,
in the host cell medium.
[0109] The vector can include a prokaryotic replicon, i.e., a DNA
sequence having the ability to direct autonomous replication and
maintenance of the recombinant DNA molecule extra-chromosomally in
a bacterial host cell. Such replicons are well known in the art. In
addition, vectors that include a prokaryotic replicon may also
include a gene whose expression confers a detectable marker such as
a drug resistance. Examples of bacterial drug resistance genes are
those that confer resistance to ampicillin or tetracycline.
[0110] Vectors that include a prokaryotic replicon can also include
a prokaryotic or bacteriophage promoter for directing expression of
the coding gene sequences in a bacterial host cell. Promoter
sequences compatible with bacterial hosts are typically provided in
plasmid vectors containing convenient restriction sites for
insertion of a DNA segment to be expressed. Examples of such
plasmid vectors are pUC8, pUC9, pBR322 and pBR329 (BioRad), pPL and
pKK223 (Pharmacia). Any suitable prokaryotic host can be used to
express a recombinant DNA molecule encoding a protein of the
invention.
[0111] Eukaryotic cell expression vectors are known in the art and
are commercially available. Typically, such vectors contain
convenient restriction sites for insertion of the desired DNA
segment. Exemplary vectors include pSVL and pKSV-10 (Pharmacia),
pBPV-1, pML2d (International Biotechnologies), pTDTI (ATCC 31255),
retroviral expression vector pMIG, adenovirus shuttle vector
pDC315, and AAV vectors.
[0112] Eukaryotic cell expression vectors may include a selectable
marker, e.g., a drug resistance gene. The neomycin
phosphotransferase (neo) gene (Southern et al., 1982, J. Mol. Anal.
Genet. 1:327-341) is an example of such a gene.
[0113] To express the antibodies or antibody fragments, DNAs
encoding partial or full-length light and heavy chains are inserted
into expression vectors such as plasmids, retroviruses, cosmids,
YACs, EBV-derived episomes, and the like. The expression vector and
expression control sequences are chosen to be compatible with the
expression host cell used. The antibody light chain gene and the
antibody heavy chain gene can be inserted into separate vector. In
some embodiments, both genes are inserted into the same expression
vector.
[0114] A convenient vector is one that encodes a functionally
complete human C.sub.H or C.sub.L immunoglobulin sequence.
Preferably, restriction sites engineered so that any V.sub.H or
V.sub.L sequence can be easily inserted and expressed. In such
vectors, splicing usually occurs between the splice donor site in
the inserted J region and the splice acceptor site preceding the
human C region, and also at the splice regions that occur within
the human C.sub.H exons. Polyadenylation and transcription
termination occur at native chromosomal sites downstream of the
coding regions. The recombinant expression vector can also encode a
signal peptide that facilitates secretion of the antibody chain
from a host cell.
[0115] Preferred regulatory sequences for mammalian host cell
expression include viral elements that direct high levels of
protein expression in mammalian cells, such as promoters and
enhancers derived from retroviral LTRs, cytomegalovirus (CMV) (such
as the CMV promoter/enhancer), Simian Virus 40 (SV40) (such as the
SV40 promoter/enhancer), adenovirus, (e.g., the adenovirus major
late promoter (AdMLP)), polyoma and strong mammalian promoters such
as native immunoglobulin and actin promoters. For further
description of viral regulatory elements, and sequences thereof,
see e.g., Stinski U.S. Pat. No. 5,168,062; Bell U.S. Pat. No.
4,510,245; and Schaffner U.S. Pat. No. 4,968,615.
[0116] The recombinant expression vectors may carry sequences that
regulate replication of the vector in host cells (e.g., origins of
replication) and selectable marker genes. The selectable marker
gene facilitates selection of host cells into which the vector has
been introduced (see e.g., Axel U.S. Pat. Nos. 4,399,216; 4,634,665
and 5,179,017). For example, typically the selectable marker gene
confers resistance to drugs, such as G418, hygromycin or
methotrexate, on a host cell into which the vector has been
introduced. Preferred selectable marker genes include the
dihydrofolate reductase (DHFR) gene (for use in dhfr.sup.- host
cells with methotrexate selection/amplification) and the neo gene
(for G418 selection).
[0117] Nucleic acid molecules encoding Sp35 polypeptides and
anti-Sp35 antibodies, and vectors comprising these nucleic acid
molecules, can be used for transformation of a suitable host cell.
Transformation can be by any suitable method. Methods for
introduction of exogenous DNA into mammalian cells are well known
in the art and include dextran-mediated transfection, calcium
phosphate precipitation, polybrene-mediated transfection,
protoplast fusion, electroporation, encapsulation of the
polynucleotide(s) in liposomes, and direct microinjection of the
DNA into nuclei. In addition, nucleic acid molecules may be
introduced into mammalian cells by viral vectors.
[0118] Transformation of host cells can be accomplished by
conventional methods suited to the vector and host cell employed.
For transformation of prokaryotic host cells, electroporation and
salt treatment methods can be employed (Cohen et al., 1972, Proc.
Natl. Acad. Sci. USA 69:2110-2114). For transformation of
vertebrate cells, electroporation, cationic lipid or salt treatment
methods can be employed. See, e.g., Graham et al., 1973, Virology
52:456-467; Wigler et al., 1979, Proc. Natl. Acad. Sci. USA
76:1373-1376f.
[0119] Mammalian cell lines available as hosts for expression are
known in the art and include many immortalized cell lines available
from the American Type Culture Collection (ATCC). These include,
inter alia, Chinese hamster ovary (CHO) cells, NSO, SP2 cells, HeLa
cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS),
human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells,
and a number of other cell lines.
[0120] Expression of polypeptides from production cell lines can be
enhanced using known techniques. For example, the glutamine
synthetase (GS) system is commonly used for enhancing expression
under certain conditions. See, e.g., European Patent Nos. 0216846,
0256055, and 0323997 and European Patent Application No.
89303964.4.
Host Cells
[0121] Host cells can be prokaryotic or eukaryotic. Preferred
eukaryotic host cells include, but are not limited to, yeast and
mammalian cells, e.g., Chinese hamster ovary (CHO) cells (ATCC
Accession No. CCL61), NIH Swiss mouse embryo cells NIH-3T3 (ATCC
Accession No. CRL1658), and baby hamster kidney cells (BHK). Other
useful eukaryotic host cells include insect cells and plant cells.
Exemplary prokaryotic host cells are E. coli and Streptomyces.
Formulations
[0122] Compositions containing Sp35 polypeptides, anti-Sp35
antibodies, or antigen binding fragments of anti-Sp35 antibodies
may contain suitable pharmaceutically acceptable carriers. For
example, they may contain excipients and/or auxiliaries that
facilitate processing of the active compounds into preparations
designed for delivery to the site of action. Suitable formulations
for parenteral administration include aqueous solutions of the
active compounds in water-soluble form, for example, water-soluble
salts. In addition, suspensions of the active compounds as
appropriate oily injection suspensions may be administered.
Suitable lipophilic solvents or vehicles include fatty oils, for
example, sesame oil, or synthetic fatty acid esters, for example,
ethyl oleate or triglycerides. Aqueous injection suspensions may
contain substances that increase the viscosity of the suspension
include, for example, sodium carboxymethyl cellulose, sorbitol and
dextran. Optionally, the suspension may also contain stabilizers.
Liposomes also can be used to encapsulate the molecules of the
invention for delivery into cells or interstitial spaces. Exemplary
pharmaceutically acceptable carriers are physiologically compatible
solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic and absorption delaying agents, water, saline,
phosphate buffered saline, dextrose, glycerol, ethanol and the
like. In some embodiments, the composition comprises isotonic
agents, for example, sugars, polyalcohols such as mannitol,
sorbitol, or sodium chloride. In some embodiments, the compositions
comprise pharmaceutically acceptable substances such as wetting or
minor amounts of auxiliary substances such as wetting or
emulsifying agents, preservatives or buffers, which enhance the
shelf life or effectiveness of the active ingredients.
[0123] Compositions of the invention may be in a variety of forms,
including, for example, liquid (e.g., injectable and infusible
solutions), dispersions, suspensions, semi-solid and solid dosage
forms. The preferred form depends on the mode of administration and
therapeutic application.
[0124] The composition can be formulated as a solution, micro
emulsion, dispersion, liposome, or other ordered structure suitable
to high drug concentration. Sterile injectable solutions can be
prepared by incorporating the active ingredient in the required
amount in an appropriate solvent with one or a combination of
ingredients enumerated above, as required, followed by filtered
sterilization. Generally, dispersions are prepared by incorporating
the active ingredient into a sterile vehicle that contains a basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum drying and freeze-drying that yields a
powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution. The proper
fluidity of a solution can be maintained, for example, by the use
of a coating such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants. Prolonged absorption of injectable compositions can be
brought about by including in the composition an agent that delays
absorption, for example, monostearate salts and gelatin.
[0125] The active ingredient can be formulated with a
controlled-release formulation or device. Examples of such
formulations and devices include implants, transdermal patches, and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, for example, ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for the preparation of such formulations
and devices are known in the art. See e.g., Sustained and
Controlled Release Drug Delivery Systems, J. R. Robinson, ed.,
Marcel Dekker, Inc., New York, 1978.
[0126] Injectable depot formulations can be made by forming
microencapsulated matrices of the drug in biodegradable polymers
such as polylactide-polyglycolide. Depending on the ratio of drug
to polymer, and the nature of the polymer employed, the rate of
drug release can be controlled. Other exemplary biodegradable
polymers are polyorthoesters and polyanhydrides. Depot injectable
formulations also can be prepared by entrapping the drug in
liposomes or microemulsions.
[0127] Supplementary active compounds can be incorporated into the
compositions. In some embodiments, an Sp35 polypeptide, anti-Sp35
antibody or fragment thereof is coadministered with an anti-NgR1
antibody, or an antigen-binding fragments thereof, or soluble NgR1
polypeptides or NgR1 fusion protein.
[0128] Dosage regimens may be adjusted to provide the optimum
desired response. For example, a single bolus may be administered,
several divided doses may be administered over time, or the dose
may be proportionally reduced or increased as indicated by the
exigencies of the therapeutic situation. It is advantageous to
formulate parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. See, e.g., Remington's
Pharmaceutical Sciences (Mack Pub. Co., Easton, Pa. 1980).
[0129] In addition to the active compound, the liquid dosage form
may contain inert ingredients such as water, ethyl alcohol, ethyl
carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate,
propylene glycol, 1,3-butylene glycol, dimethylformamide, oils,
glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols, and
fatty acid esters of sorbitan.
Gene Therapy
[0130] An Sp35 polypeptide can be produced in vivo in a mammal,
e.g., a human patient, using a gene therapy approach to treatment
of a CNS disease, disorder or injury in which reducing inhibition
of axonal extension would be therapeutically beneficial. This
involves administration of a suitable Sp35 polypeptide-encoding
nucleic acid operably linked to suitable expression control
sequences. Preferably, these sequences are incorporated into a
viral vector. Suitable viral vectors for such gene therapy include
adenoviral vectors, lentiviral vectors, baculoviral vectors,
Epstein Barr viral vectors, papovaviral vectors, vaccinia viral
vectors, herpes simplex viral vectors, and adeno associated virus
(AAV) vectors. The viral vector can be a replication-defective
viral vector. A preferred adenoviral vector has a deletion in its
E1 gene or E3 gene. When an adenoviral vector is used, preferably
the mammal is not exposed to a nucleic acid encoding a selectable
marker gene.
EXAMPLES
[0131] The invention is further illustrated by the following
experimental examples. The examples are provided for illustrative
purposes only, and are not to be construed as limiting the scope or
content of the invention in any way.
Example 1
Sp35 Expression Pattern
[0132] Expression of Sp35 in human tissues was evaluated by
Northern blot analysis. Multiple tissue blots containing 12 human
major tissues or 14 human CNS tissues were hybridized overnight at
68.degree. C. with P.sup.32 labeled Sp35 probe (nucleotides 150-450
of the Sp35 cDNA sequence). The blots were washed 3 times with
2.times.SSC, 0.5% SDS, then 3 times with 0.5.times.SSC, 0.1% SDS.
The blot was then exposed to X-ray film and the mRNA levels
visualized by autoradiography.
[0133] Sp35 was highly expressed in the human brain but not in
heart, skeletal muscle, colon, thymus, spleen, kidney, liver, small
intestine, placenta, lung and peripheral blood leukocytes. Sp35 was
expressed in all brain tissues tested, including tissues isolated
from frontal cortex, posterior cortex, entorhinal cortex,
hippocampus, olfactory bulb, striatum, thalamus, cerebellum,
midbrains, pons, medulla and spinal cord. A gradient of gene
expression along the rostral/cordal axis was observed for Sp35,
with highest levels in the cortical cortex and lowest levels in the
spinal cord.
[0134] Immunohistochemical (IHC) staining was used to determine if
Sp35 is expressed in specific brain cells. 4% paraformaldehyde
fixed rat brains, spinal cord sections, or primary granular neuron
cultures were incubated with primary antibodies to Sp35, as
indicated, followed by secondary antibodies conjugated to Alexa 480
or 590 (Molecular Probes Inc.). The sections were then mounted in
Vectashield and visualized by fluorescence microscopy. The
anti-Sp35 specific antibodies used for IHC were generated from a
Fab phage display library using MorPhosys technology.
[0135] Sp35 is expressed specifically in neurons and
oligodendrocytes, but not in astrocytes. This was determined in
experiments in which Rat brain tissue sections were stained with
various agents, including anti-astrocyte marker GFAP, an antibody
to an oligodendrocyte marker (O4), and an antibody to the neuronal
marker .beta.III tubulin, all counterstained with an anti-Sp35
antibody. Oligodendrocytes and neurons were intensely stained with
the anti-Sp35 antibody. No staining of astrocytes was observed.
[0136] As an independent confirmation of the expression pattern of
Sp35, we performed semi quantitative RT-PCR using mRNA extracted
(Ambion kit) from rat primary cell cultures of purified astrocytes,
oligodendrocytes, and cerebellum granular neurons. Forward primer
AAGGCCCAGCAGGTGTTTGTGGA (SEQ ID NO: 14) and reverse primer
TACTCGATCTCGATGTTGTGCTTT (SEQ ID NO: 15) were used. Following 26
cycles, a strong band was observed in the mRNA from neurons, a
distinct but weaker signal was detected in oligodendrocyte mRNA,
and no band was observed in astrocytes.
Example 2
Sp35-Fc Fusion Protein
[0137] To study the biological function of Sp35, a construct was
made fusing the extra-cellular portion of human Sp35 (residuse
1-531) to the hinge and Fc region of human IgG1. A partial coding
sequence for human Sp35 was obtained by PCR from clone 227.2
(Incyte) using the forward primer 5'CAGCAGGTCGACGCGGC
CGCATGCTGGCGGGGGGCGT3' (SEQ ID NO: 16) and reverse primer
5'CAGCAGGTCGACCTCGCCCGGCTGGTTGG3' (SEQ ID NO: 17).
[0138] The blunt end PCR product was subcloned into the SrfI site
of the PCR SCRIPT AMP vector (Stratagene) to create PCR SCRIPT
AMP-sp35. A SalI fragment was isolated from PCR SCRIPT AMP-sp35 and
subcloned into the PCRCAMP Ig vector (derivative of Stratagene
vector PCR SCRIPT AMP wherein the Fc gamma sequence is subcloned as
a SalI(5') to NotI(3') fragment), fusing the Sp35 signal sequence
and ectodomain sequence (codons 1-531) in-frame with sequences
encoding the hinge and Fc region of human Ig1. Correct isolates
were identified, and a NotI fragment encompassing the Sp35 Fc
fragment was subcloned into the single Not I cloning site of the
293E expression vector, CH274, a derivative of commercial
expression vector REP4 (Invitrogen). The Sp35-Fc fusion encoded by
the new vector, CH274/sp35-Fc, was confirmed by DNA sequencing as
plasmid GT123.
[0139] Stable cell lines expressing Sp35-Fc fusion protein were
generated by electroporation of CHO host cells DG44 with plasmid
GT123. Transfected CHO cells were cultured in alpha minus MEM in
the presence of 10% dialyzed serum and 4 mM glutamine to select for
nucleoside-independent growth. Fourteen days post-transfection,
cells were fed fresh media. To screen for cells expressing Sp35-Fc,
CHO cells were labeled with Phycoerythrin (PE)-labeled goat
anti-human IgG (Jackson Labs) and subjected to high speed flow
cytometry sorting in a FACS Mo-Flo (Cytomation). The cells that
expressed the highest levels of Sp35-Ig were selected. These cells
were expanded in culture for 7 days, then re-labeled and re-sorted.
Cells expressing the highest levels of Sp35-Ig were isolated as
individual clones in 96-well plates. These clones were grown for
two weeks and then fed fresh media one day prior to FACS analysis
to check for expression levels. Clones that expressed the highest
levels of Sp35-Fc were expanded, and frozen cell banks were
established. The cell lines were adapted to grow in suspension
culture in the serum free media BCM16. The titer of Sp35-Fc
produced by these clones was determined by growing cell lines at
37.degree. C. for 4-5 passages, then growing the cells to 50%
maximal cell density and culturing them for 10-15 days at
28.degree. C. until the viable cell density dropped to 75%. At this
time, the culture media were harvested, cleared of cells and debris
by centrifugation, and the culture supernatants titered for Sp35-Fc
levels by Western blot analysis using an anti-human Ig antibody
(Jackson Lab) as the probe.
[0140] Sp35-Fc fusion protein was purified from the clarified
culture medium as follows: 9 ml of 1M HEPES pH 7.5 was added to 900
ml of conditioned medium. The medium was batch loaded for 3 hr at
4.degree. C. onto 3 ml of Protein A Sepharose (Pharmacia). The
resin was collected in a 1.5 cm (I.D.) column, and washed four
times with 3 ml PBS, two times with 4 ml of PBS containing 800 mM
NaCl, and then again with 3 mL of PBS. The Sp35-Fc was eluted from
the column with 25 mM NaH.sub.2PO.sub.4 pH 2.8, 100 mM NaCl in 1.5
mL fractions and neutralized by adding 75 .mu.L of 0.5 M
NaH.sub.2PO.sub.4 pH 8.6. Peak protein-containing fractions were
identified by absorbence at 280 nm, pooled, and subjected to
further purification on a 1 mL Protein A column. Prior to loading,
NaCl was added to 600 mM and HEPES pH 7.5 to 50 mM. The column was
washed twice with 600 .mu.L of 10 mM HEPES pH 7.5, 1 M NaCl, and
then with 1 mL PBS. Sp35-Fc was eluted from the column with 25 mM
NaH.sub.2PO.sub.4 pH 2.8, 100 mM NaCl, collecting 0.5 mL fractions,
and neutralized by adding 25 .mu.L of 0.5 M NaH.sub.2PO.sub.4 pH
8.6. Peak protein-containing fractions were identified by
absorbance at 280 nm and pooled. By reducing SDS-PAGE, the Sp35-Ig
migrated as a single band (>95% pure) with an apparent mass of
90 kDa. Under non-reducing conditions, the protein ran as a dimer
with an approximate mass of 180 kDa. The purified Sp35-Fc was
aliquoted and stored at -70.degree. C. The NotI fragment of GT123,
which contains Sp35 amino acids 1-531 and human IgG1 Fc, was
subcloned into the PV90 vector Nod site to create DB002.
Example 3
His-AP-Sp35 Fusion Protein
[0141] To study and isolate the receptor for Sp35, the protein was
expressed in COS7 and CHO cells as a His-tagged-alkaline
phosphatase (His-AP) fusion protein. The plasmid was constructed as
follows: The extracellular domain of Sp35 (a.a. 34-532) was PCR
amplified using primers (forward)
5'-AATTAAGAATTCACGGGCTGCCCGCCCCGCTGCGAGT-3' (SEQ ID NO: 18),
containing an Eco RI cleavage site (underlined), and (reverse)
5'-TATATTCTAGATCACTCGCCCGGCTGGTTGGAGATGAAAGCGA-3' (SEQ ID NO: 19),
containing an Xba I cleavage site (underlined). The PCR product was
cleaved with Xba I, the resulting sticky-end filled in with T4 DNA
polymerase, then digested with Eco RI and gel purified. The
digested product was ligated into a Hind III-filled in/EcoR I
His-AP fragment from the His-AP-pcDNA 1.1 vector (Invitrogen). The
His-AP-Sp35 fragment was digested with Hind III and Eco RI, filled
in, then ligated into the Not I-filled site in vector pV90. The DNA
sequence of the insert was confirmed by DNA sequencing.
[0142] COS7 cells were split the day before transfection.
His-AP-Sp35 vector DNA (8 .mu.g) was used to transfect
5.times.10.sup.6 cells using lipofectamine (Invitrogen). The
conditioned medium was harvested 48 hr post transfection.
[0143] We developed a CHO cell line expressing the His-AP-Sp35
fusion protein using the pV90 plasmid. CHO host cells DG44
(2.times.10.sup.6 cells) were transfected with 100 .mu.g of plasmid
by electroporation. Cells were cultured in alpha minus MEM in the
presence of 10% dialyzed serum and 4 mM glutamine to select for
nucleoside-independent growth. Fourteen days post transfection
cells were fed fresh media in anticipation of screening by FACS
Mo-Flo (Cytomation) sorting. Transfected CHO cells were labeled
with the mouse monoclonal antibody 8B6 directed against human
placental alkaline phosphatase (Sigma). A secondary antibody,
PE-labeled goat anti-mouse IgG, was used to produce a signal
specific for transfected cells. After PE-labeling, cells were
subjected to high speed flow cytometry sorting and the top 5%
selected.
[0144] To produce conditioned medium with His-AP-Sp35, the cells
that expressed the highest levels of HIS-ApSp35 were selected. The
cell lines were adapted to grow in suspension culture in serum free
media (BCM16). The titer of His-AP-Sp35 that was produced by these
clones was determined by growing cell lines at 37.degree. C. for
4-5 passages, then growing the cells to 50% of maximal cell density
and culturing them for 10-15 days at 28.degree. C. until the viable
cell density dropped to 75%. The culture media were harvested,
cleared of cells and debris by centrifugation, and the culture
supernatants titered for His-AP-Sp35 levels by western blot
analysis using anti-human AP antibody (Jackson Labs) as the
probe.
[0145] His-AP-Sp35 was purified from the conditioned medium as
follows: 400 mL of conditioned medium from CHO cells expressing
His-AP-Sp35 was diluted with 400 mL of water. Triethanolamine pH
8.5 was added to 25 mM from a 0.5 M stock and the sample was batch
loaded for 2 hours at 4.degree. C. onto 6 ml of Fractogel TMAE (EM
Industries) anion exchange resin. The resin was collected in a 1.5
cm (I.D.) column, and washed two times with 6 mL of 10 mM HEPES
pH7.5, 50 mM NaCl. The AP-Sp35 was eluted from the column with 10
mM HEPES pH 7.5, 200 mM NaCl in 2 mL fractions. Peak fractions were
identified by monitoring AP activity and by SDS-PAGE. The
flow-through fraction from the TMAE column was further diluted with
300 ml of water and loaded in batch overnight at 4.degree. C. onto
6 ml of TMAE resin. The resin was collected and washed as described
above and eluted with 10 mM HEPES pH 7.5, 150 mM NaCl. Peak
fractions again were identified by monitoring AP activity and by
SDS-PAGE. His-AP-Sp35 from the first column was 50% pure and
AP-Sp35 from the second column was 90% pure. Under reducing
conditions, the His-AP-Sp35 migrated on SDS-PAGE gels with an
apparent mass of 130 kDa. While the 90% pure material was
appropriate for most investigations, for some studies the
His-AP-Sp35 was further purified on Ni-NTA agarose resin (Qiagen).
NaCl was added to the elution fractions from the TMAE column to 800
mM and 0.5 M triethanolamine pH. 8.5 and 1M imidazole pH 7.0 was
added to 25 mM and 15 mM, respectively. 4.5 ml of the sample was
loaded onto a 400 .mu.L NiNTA column. The column was washed three
times with 25 mM Triethanolamine pH 8.5, 800 mM NaCl, 15 mM
imidazole, and the His-AP-Sp35 was eluted from the column with 200
mM imidazole pH 7.0, 350 mM NaCl, collecting 200 .mu.L fractions.
Peak AP-containing fractions were pooled and dialyzed overnight
against 250 volumes of 10 mM HEPES pH 7.5, 200 mM NaCl. MgCl.sub.2
and ZnCl.sub.2 were added to the retentive to 2 and 0.25 mM,
respectively. The final product was greater than 95% pure by
SDS-PAGE, and ran as a single band with mass of approximately 140
kDa under reducing conditions.
[0146] The Sp35 constructs were also engineered as Fc fusions. An
Sp-35 LRR-Fc construct was generated by PCR using primers (forward)
5'CTTGACACG GGATCCGCGGCCGCATGCTGGCGGGGGGCGTGAGG3' (SEQ ID NO: 20)
and (reverse) 5'GCAGCGGGGCGGGCAGCCCGTGGCCGAGCCTGACAGC ACTGAGCC3'
(SEQ ID NO: 21). The PCR product was inserted into the NotI site of
PV90 vector. Sp35 IG-Fc construct was generated by PCR using
primers (forward) 5'CTTGACACGGGATCCGCGGCCGCATGCTGGCGGGGGGC GTGAGG3'
(SEQ ID NO: 22) and (reverse) 5'GTCCCGGATGCGGGCGCGGG
CCGAGCCTGACAGCACTGAGCCCAG3' (SEQ ID NO: 23). The PCR product was
inserted into the NotI site of PV90 vector. The proteins were
expressed in CHO cells and purified using a protein A sepharose
column.
Example 4
Sp35 Binding to NgR1-Expressing Cells
[0147] Four different methods were used to show Sp35 binding to
NgR1. First we detected the interaction in a direct binding assay
in which the alkaline phosphatase-Sp35 conjugate (AP-Sp35) was
incubated with NgR1 expressing cells and binding assessed using a
chromogenic AP detection reagent. 90% confluent COS7 cells were
grown on 100 mm tissue culture dishes and transfected with NgR1
expressing plasmids using Fugene 6 reagents (Roche). After 48
hours, the transfected cells were washed once with HBH (Hank's
balanced salt buffer, 1 mg/ml BSA, 20 mM HEPES, pH 7.0), and then
incubated for 1.5 hr at 23.degree. C. with 4 .mu.g/ml of the
AP-Sp35 fusion protein in HBH. The cells were washed with ice-cold
HBH buffer 3 times for 3 min each, then fixed with 3.7%
formaldehyde in 20 mM HEPES, pH 7.0, 150 mM NaCl for 15 min, and
transferred back into HBH buffer. Endogenous heat-labile AP was
heat-inactivated for 2 hours at 67.degree. C. Bound AP-Sp35 was
detected by incubation with nitro blue tetrazolium NBT (Roche).
Ap-Sp35 bound to COS7 cells expressing human NgR1 receptor, but not
to control COS7 cells transfected with the vector alone. A punctate
staining pattern for NgR1 was observed, reflecting that only a
fraction, probably 50% of the cells, were transfected with the
NgR1.
[0148] To better quantify binding, we performed the same experiment
but parallel cell samples were treated with 8, 4, 2, 1, 0.5, 0.125,
0.06 .mu.g/ml of the AP-Sp35. Bound AP was incubated with
4-nitrophenyl phosphate and AP activity assessed in a 96-well plate
reader (Molecular Devices). From these data, we estimated that the
EC50 for binding of Ap-Sp35 to human NgR1 was approximately 6
nM.
[0149] Second, we detected binding of Sp35 to NgR1 in an ELISA
approach. ELISA plates (Costar) were coated with 10 .mu.g/ml
soluble NgR1-Fc receptors (sNgR310-Fc containing rat NgR1 peptide
35-310 fused to the hinge and Fc of rat IgG1 and sNgR344-Fc
containing rat NgR1 peptide 35-344 fused to the rat IgG1) in 0.1M
NaHCO.sub.3, pH 9.0 for 1 hr at 37.degree. C. The plates were
blocked and washed with 25 mM Hepes, pH 7.0, 0.1% BSA, 0.1%
ovalbumin, 0.1% non-fat dried milk and 0.001% NaN.sub.3. AP-Sp35
protein, 4 .mu.g/ml, was added to the plate and incubated overnight
at 4.degree. C. The plates were then washed with 10 mM Tris pH 7.5,
150 mM NaCl and bound AP detected using 10 .mu.g/ml of the
chromogenic substrate 4-nitrophenyl phosphate diluted in 0.1 M
glycine, 1 mM MgCl.sub.2, 1 mM ZnCl.sub.2 pH 10.5. The OD.sub.410
was determined in an ELISA reader (Molecular Devices) equipped with
the Softmax program. AP-Sp35 bound to immobilized sNgR-344-Fc but
not the sNgR-310-Fc protein, indicating that the longer version of
NgR1 was required for Sp35 binding. We were able to compete the
binding of AP-Sp35 to sNgR344-Fc NgR1 by 80% by pre-incubating the
AP Sp35 with 100-fold excess of sNgR344-Fc. No competition of
binding was seen using a hedgehog-rat Ig1 fusion protein as a rat
Ig fusion control protein.
[0150] Third, we detected the binding of Sp35 to NgR1 by
co-immunoprecipitating Sp35 with NgR1. For this study, 80%
confluent COS7 cells, grown on 100 mm tissue culture dishes, were
transfected with plasmids encoding Sp35-hemagglutinin (Sp35-HA) and
NgR-FLAG using Fugene 6 reagents (Roche) 48 hours after
transfection, cells were harvested and lysed in 1 ml lysis buffer
(50 mM HEPES, pH 7.5, 150 mM NaCl, 1.5 mM MgCl.sub.2, 1 mM EGTA, 1%
Triton X-100 and 10% glycerol) at 4.degree. C. for 30 min. The
lysate was then centrifuged at 14,000.times.g for 15 min, and the
supernatants collected and incubated 4.degree. C. overnight with
agitation, using anti-HA affinity matrix (Roche). The samples were
washed 3 times with 1 ml of lysis buffer, then boiled for 3 minutes
in Laemmli sample buffer, subjected to 4-15% SDS-PAGE, and analyzed
by immuno-blotting with Anti-FLAG M2 antibody (Sigma). The anti-HA
tag affinity resin collected a complex containing both Sp35-HA and
FLAG-NgR, as is evident by the presence of FLAG. This complex was
not seen in lysates from control transfections in which cells were
treated with Sp35-HA plasmid or FLAG-NgR1 plasmid alone, or cells
that were co-transfected with the Flag-NgR1 and a HA-tagged control
protein that does not bind NgR1.
[0151] Sp35-HA was made as follows. The Sp35 signal sequence and
extracellular domain (amino acids 1-531) was PCR amplified using
primers 5'ATATTCTAGAATGCTGGCGGGGGGCGTGAG3' (SEQ ID NO: 24) and 5'
ATATACTAGTGTCGTTGCCGCCCGCGTTGG3' (SEQ ID NO: 25) containing XbaI
and SpeI sites (underlined). The PCR product was digested by XbaI
and SpeI and inserted into the vector pCGCHA between the Xba I and
Spe I sites. The sequence of the insert was confirmed by DNA
sequencing. The FLAG NgR1 construct was gift from Dr. Zhigang He
(Nature, Vol 420, Nov. 7, 2002).
[0152] Fourth, we showed that Ap-Sp35 bound to rat cerebellum
granular neurons (CGN) which express NgR1. For this experiment, 90%
confluent postnatal day 8 CGN cells were grown on 100 mm tissue
culture dishes. After 48 hours, the cells were washed once with HBH
buffer, and then incubated with 4 g/ml of AP-Sp35 in HBH buffer for
1.5 hour at 23.degree. C. The cells were then washed with ice-cold
HBH 3 times for 3 minutes each, then fixed with 3.7% formaldehyde
in 20 mM HEPES, pH 7.0, and 150 mM NaCl for 15 min, and transferred
back to HBH. Endogenous heat labile AP was heat-inactivated for 2
hours at 67.degree. C. Bound AP-Sp35 was detected by incubation
with nitro blue tetrazolium NBT (Roche). AP-Sp35 bound to postnatal
day 8 cerebellum granular neurons, which express NgR1. The binding
of AP-Sp35 to the neurons was inhibited by treating the CGN with
PIPLC (5 units/ml) which cleaves most GPI anchored proteins from
membrane surfaces. Since NgR1 is a GPI-linked protein, this result
further supports the notion that Sp35 is binding to NgR1 on CGN
cells.
Example 5
Co-Localization of Sp35 with NgR1
[0153] To determine whether Sp35 and NgR1 are expressed in the same
neurons, we performed a co-localization study. 4%
paraformaldehyde-fixed rat p8 primary granular neuron cultures were
incubated with antibodies against Sp35 and NgR1 (Santa Cruz), and
then with the appropriate Alexa-labeled secondary antibodies
(Molecular Probes Inc.). The cells were visualized by con-focal
fluorescence microscopy. Neurons were intensely stained by the Sp35
and NgR1 antibodies. Both proteins were expressed in the cell
bodies and axons of neurons. To aid in the co-localization
analysis, different colored probes were used for the 2 types of
antibodies. When the stains (red for NgR positive cells and green
for Sp35 positive cells) were merged we saw a yellow color
throughout the cell indicating that the two proteins were
co-localized within the neurons.
Example 6
NgR1 Binding Sites within Sp35
[0154] We used deletion mapping to define the specific domains of
Sp35 involved in NgR1 interactions. The following deletion
constructs were made using the Stratagene Quikchange Mutagenesis
kit. We verified all vector constructs by DNA sequencing of the
modified inserts.
[0155] His-AP-Sp35b which contains the leucine rich repeat domain
of Sp35 plus the basic region (a.a 34-432) was cloned from the
His-AP-Sp35 (a.a. 34-532) vector by PCR. Primers used were
5'CCCAGCAGGTGTTTGTGGACGAGTG ATCTAGGGCCGCGGATCCCTG-3' (SEQ ID NO:
26) and 5'-CAGGGATCCG CGGCCCTAG ATCACTCGTCCACAAACACCTGCTGGG-3' (SEQ
ID NO: 27).
[0156] His-AP-Sp35d, which encodes the Ig domain of Sp35 plus the
basic region (a.a 417-531), was cloned from the His-AP-Sp35a (a.a.
37-531) vector by PCR. Primers used were
5'CGCCGCGCACCCGGGTGAATTCCOCGCCCGC ATCCGGGACCGC-3' (SEQ ID NO: 28)
and 5'-GCGGTCCCGGATGCGGGCGC GGAATTCACCCGGGTGCGCGGCG-3' (SEQ ID NO:
29).
[0157] His-AP-Sp35e, which encodes only the Ig domain (a.a
425-531), was cloned from the His-AP-Sp35(aa 34-532) vector by PCR.
Primers used were 5'-CGCCGCGCACCCGGGTGAATTCGCCCAGCAGGTGTTTGTGGAC-3'
(SEQ ID NO: 30) and 5'-GTCCACAAACACCTGCTGGGCGAATTCACCCG
GGTGCGCGGCG-3' (SEQ ID NO: 31).
[0158] A commercial mutagenesis kit and protocol (Stratagene
Quikchange) were used to mutate amino acid 456 (from arginine to
glutamic acid) and amino acid 458 (from histidine to valine) of
Sp35 in the vector His-AP-Sp35 (34-532). The primers used were
5'-CATCCTCTGGCTCTCACCCGAAAAGGTACTGG TCTCAGCCAAGAGC-3' (SEQ ID NO:
32) and 5'-GCTCTTOGCTGAGACCA GTACCTrITCGGGTGAGAGCCAGA GGATG-3' (SEQ
ID NO: 33).
[0159] His-AP-Sp35 deletion constructs (FIG. 3) were engineered in
pV90 expression vectors and expressed in 293 cells. The conditioned
medium was collected and the AP adducts purified by sequential
chromatography steps on Fractogel TMAE resin and NiNTA agarose. The
purified proteins were tested for binding to NgR1 expressed on COS7
cells. The three constructs all bound weakly to Sp35. These results
indicated that the Sp35 LRR repeat 1-14 (amino acid 34 to 417) and
the Ig domain of Sp35 (amino acid 425-531) both contribute to Sp35
binding to NgR1. The Ig domain showed higher affinity than the LRR
domain.
[0160] A structural model for the Ig domain of Sp35 was generated
using the NCAM crystal structure as a framework (Rasmussen et al.,
2000, Nat. Struct. Biol. 7:389-393). From this model, we observed a
loop (residue numbers 454-458, amino acids: SPRKH; SEQ ID NO: 34)
that might be involved in binding. To test this hypothesis, we
engineered an Sp35 construct in which residues R at 456 and H at
458 were changed into E and V, respectively. When this construct
was tested for NgR1 binding, we observed a >10 fold drop in
signal. As an alternative approach to test the contribution of this
loop region in binding, we synthesized a peptide corresponding to
the sequence LSPRKH (SEQ ID NO: 10) that we cyclized by adding
cysteines at the N and C terminus of the peptide. Upon binding to
NgR1, this peptide blocks, inhibits, or interferes with the
function of NgR1.
Example 7
Sp35 Induces p8 CGN Fasciculation
[0161] To determine the biological function of Sp35 in neurons, we
incubated Sp35-Fc with postnatal day 8 granular neurons to see if
Sp35 can regulate neurite out-growth. Labtek culture slides (8
well) were coated with 0.1 mg/ml poly-D-lysine (Sigma) before
spotting of Sp35-Fc protein (16 .mu.g/well protein). The slides
were dried overnight, then rinsed and coated with 10 .mu.g/ml
laminin (Gibco). Cerebellum granular neurons from postnatal day 8
were dissociated and seeded onto the precoated slides. The slide
cultures were incubated at 37.degree. C. in 5% CO.sub.2 for 24
hours. The slides were then fixed in 4% paraformaldehyde containing
20% sucrose and stained with anti .beta.III tubulin (Covance TUJ1).
After 24 hours, the CGN showed clear fasciculation morphology as
evident by bundling of the neurons. The fasciculation was not seen
in the untreated cells or Fc protein-coated sample controls.
Example 8
Effects of Sp35 on RhoA Activation/Inactivation
[0162] Sp35-Fc induced postnatal cerebellum granular neurons to
undergo fasciculation. Because the signaling molecule RhoA is known
to be involved in fasciculation, we determined if Sp35-Fc can
regulate RhoA functions in neurons. We performed the RhoA
activation experiment as follows: 293 cells or COS7 cells were
transfected with expression vectors containing combinations of
RhoA, Sp35 or NgR1 using Fugene 6 reagents (Roche). 48 hr
post-transfection, cells were serum starved overnight, then lysed
in 50 mM Tris, pH 7.5, 1% Triton X-100, 0.5% sodium deoxycholate,
0.1% SDS, 500 mM NaCl, 10 mM MgCl.sub.2, plus a protease inhibitor
cocktail. Cell lysates were clarified by centrifugation at
13,000.times.g at 4.degree. C. for 5 minutes, and 95% of the
supernatants were incubated with 20 .mu.g of an immobilized GST-Rho
binding domain affinity matrix (Rhotekin beads, Upstate
Biotechnology) at 4.degree. C. for 45 minutes. The beads were
washed 3 times with wash buffer (50 mM Tris, pH 7.5, 1% Triton
X-100, 150 mM NaCl, 10 mM MgCl.sub.2, with protease inhibitors).
GTP-bound Rho was eluted from the beads by heating at 95.degree. C.
for 5 min in SDS-PAGE sample buffer. Bound and total Rho proteins
were detected by western blotting using a monoclonal antibody
against RhoA (Santa Cruz). COS7 and HEK293 cells transfected with
Sp35 induced RhoA activation, as evident by an increase in the
amount of RhoA-GTP detected in the blot following transfection with
the Sp35 gene. A further enhancement in RhoA-GTP was observed
following treatment with Sp35-Fc. In contrast to the increase in
RhoA-GTP following transfection with Sp35 alone, when cells were
transfected with Sp35 and NgR1, RhoA was partially inactivated.
Treatment of these cells with Sp35-Fc resulted in further
inactivation of RhoA.
[0163] We confirmed a signaling response by Sp35 using a FLIPR
assay (Molecular Devices) to determine the affects of Sp35
treatment on Ca.sup.++ flux. We observed a significant Ca.sup.++
flux in cells expressing Sp35 with treatment of Sp35-Fc, but not in
the control cells treated with Sp35-Fc. The Ca.sup.++ flux was
reduced when cells that had been co-transfected with NgR1 and Sp35
were treated with Sp35-Fc fusion protein.
Example 9
Sp35 Protein Interaction with Itself
[0164] Because LRR domains frequently are involved in homotypic
interactions, and we observed that the addition of soluble Sp35 to
Sp35-transfected cells caused an increase in RhoA-GTP over what was
observed with Sp35 transfections alone, we tested for Sp35 binding
to itself. To perform this test, we used co-immunoprecipitation.
COS7 cells 80% confluent, grown on 100 mm tissue culture dishes,
were transfected with plasmids Sp35 HA or Sp35-FLAG, or both, using
Fugene 6 reagents (Roche). Forty-eight hours after transfection,
cells were harvested and lysed in 1 ml lysis buffer (50 mM HEPES,
pH 7.5, 150 mM NaCl, 1.5 mM MgCl.sub.2, 1 mM EGTA, 1% Triton X-100
and 10% glycerol) at 4.degree. C. for 30 min. The lysate was then
centrifuged at 14,000.times.g for 15 min, and the supernatants
collected and incubated, at 4.degree. C. overnight with agitation,
with an anti-HA affinity matrix (Roche). The samples were then
washed 3 times with 1 ml of lysis buffer, boiled in Laemmli sample
buffer, subjected to 4-15% SDS-PAGE, and analyzed by
immuno-blotting with anti-FLAG antibodies. The Anti-HA antibody
resin captured a complex that contained Sp35-FLAG, as determined by
Western blotting. This indicated a direct interaction of Sp35 with
itself. We also treated cells transfected with HA-Sp35 with Sp35-Fc
and used a similar immunoprecipitation approach to show that
HA-Sp35 bound to Sp35-Fc.
[0165] Sp35-FLAG was made as follows. Sp35 gene extracellular
domain (a.a. 1-531) was PCR amplified using primers
5'AATTAAGCGGCCGCATGCTGGCG GGGGGCGT3' (SEQ ID NO: 35) and
5'AATTAAGCGGCCGCTTTGTCATGT'3 (SEQ ID NO: 36) containing NotI sites
(underlined). The PCR product was digested by NotI and inserted
into the NotI site of vector pV90. The DNA sequence of the insert
was confirmed by DNA sequencing.
Example 10
In Vivo Transplantation of Sp35-Transformed Cells
[0166] To determine the biological function of Sp35 in spinal cord
injured rats, we infected cortical primary cultured cells (mixed
cultures) with retrovirus expressing full length Sp35 or a
retrovirus control, for delivery into the injured epicenter of rat
spinal cords. 2.times.10.sup.6 cells were introduced, and the rats
were sacrificed at day 10. The spinal cords were fixed in 4%
paraformaldehyde overnight, then dehydrated in 70%, followed by 95%
ETOH. Tissue samples were imbedded in paraffin. Sections (10
microns thick) were used for immunohistochemical staining. Rats
that received Sp35-expressing cells, in comparison to control, show
less axon retraction and more -.beta.III tubulin staining near the
epicenter. Increased neuronal survival in the injured rats
receiving Sp35 was observed.
[0167] The Sp35 retrovirus construct was made as follows: The Sp35
gene was PCR amplified using primers
5'-GATTACTCGAGATGCTGGCGGGGGGCGT GAGG-3' (SEQ ID NO: 37), containing
an XhoI site (underlined), and
5'CGCGGGAATTCTCAATCATCATCTTCATGTTGAACTTG-3' (SEQ ID NO: 38),
containing an EcoRI site (underlined). The PCR product was digested
with XhoI and EcoRI, then ligated into the Retrovirus vector pMIG
(which contains IRES-GFP), which was previously cleaved with XhoI
and EcoRI. The new vector was named pMMC078. All isolates of
pMMC078 contained inadvertent point mutations, so two isolates of
pMMC078 were ligated together. pMMC078.6 was cut with XhoI and AccI
and pMMC078.7 was cut with XhoI and AccI. These two fragments were
ligated together to make the final correct plasmid, pMMC089. The
DNA sequence of the insert was confirmed by DNA sequencing. Sp35
retrovirus was made as described. 293G cells were split the day
before transfection. 8 .mu.g Sp35-retrovirus DNA was used to
transfect 5.times.10.sup.6 cells by lipofectamine (Invitrogen). The
condition medium was harvested after 92 hours post-transfection.
The conditioned medium was centrifuged at 5000 g for 10 minutes,
and the supernatant used as a Sp35 retrovirus stock. This stock was
stored at 4.degree. C. for 1 week or -80.degree. C. for 6
months.
Example 11
Animal Model of Spinal Cord Injury
[0168] All surgical procedures are performed using aseptic
technique. For 1 week prior to any surgical manipulation animals
are handled. Ampicillin 100 mg/kg SC is administered
prophylactically prior to and after surgery to reduce the incidence
of bladder infection injury.
[0169] Animals are anesthetized using Midazolam at 2.5 mg/kg IP in
conjunction with Isoflurane 2-3% in O.sub.2 to deep anesthesia as
measured by toe pinch. Animals are maintained on a circulating
water heating pad for the duration of surgery and recovery. Ocular
lubricant are used to prevent corneal drying and Atropine 0.05
mg/kg SC are given to reduce excess salivation. A small incision is
made in the skin and the muscle retracted to expose the vertebrae.
A dorsal laminectomy at the spinal level L6 (and L7 if placement of
an intrathecal catheter is necessary, see below) is performed,
L6/L7 and the adjacent spinous processes rigidly fixed in a spinal
frame (David Kopf Instruments). A dorsal hemisection is performed
at L6 with fine iridectomy scissors completely interrupting the
main dorsomedial and the minor dorsolateral coticospinal tract
(CST) components. Following surgery, the laminectomy site is
covered with a protective material such as Durafilm, and the
overlying muscle sutured with 4.0 chromic gut to protect the
exposed spinal column. The skin is sutured and wiped with betadine
solution.
[0170] Functional recovery of animals IS evaluated using the Basso
Beattie and Bresnehan (BBB) scoring method commonly used to
evaluate rats after spinal cord injury. This method quantifies the
hind limb function of rats by detailed analysis of joint movement
and weight bearing ability. Rats are evaluated the day after spinal
cord injury then weekly thereafter.\
[0171] Immediately after CST transection, adenovirus expressing
Sp35 or GFP or control virus (10.sup.10 particles) are injected at
the site of transection and regions immediately caudal and rostral
to the injury site. A total of 10 .mu.l of Adv are injected at 5
different sites (4 ul/site). For the intrathecal administration of
Sp35 protein, a small hole is made into the dura of the spinal cord
at 2 mm caudal to the lesion L7 and an intrathecal catheter is
inserted into the subarachnoid space at L7. The catheter is slowly
and gently slid above the spinal cord about 1 mm caudal to the
lesion. The portion of the catheter lying outside the intrathecal
space is firmly sutured in place to the surrounding tissue. A
primed mini-osmotic pump (Alza corp.) containing the test material
(Sp35 protein or control protein) is connected to the exposed end
of the guide cannula and inserted into the subcutaneous space.
Following surgery, the laminectomy sites are covered with a
protective material such as Durafilm and the overlying muscle
sutured with 4.0 chromic gut to protect the exposed spinal column.
The skin is sutured and wiped with betadine solution.
[0172] Histological Analysis: Tract tracing surgery occurs at the
time of the surgery to induce spinal cord injury. The skin on the
head is shaved and wiped with Betadine and 70% alcohol. The animal
is placed in a stereotaxic frame. The scalp is incised
longitudinally and the periosteum is scraped from the calvaria. A
hole is drilled in the skull approximately 1-2 mm in diameter, and
a glass microliter needle is inserted vertically into 8 locations
in the motor cortex (coordinates are determined according to the
rat brain atlas of Paxinos and Waston, 1997). Approximately 5 .mu.l
of tract tracer material (e.g., Biotin dextran amine, 10,000M.Wt)
is injected and the needle is left in place for an additional five
minutes to allow diffusion of the solution. After needle removal,
the hole in the scull cap is plugged with gel foam and the scalp
stapled closed over the injury site. Animals are allowed to recover
and receive post-operative care (described below). Four to ten
weeks later the animals are deeply anesthetized (Inactin 100-110
mg/kg ip) and perfused for histology as described below. The tract
tracer is carried by anterograde transport mechanisms down the
cortical spinal tract towards the caudal end of the spinal cord and
provides a means to quantify anatomical connectivity within the
corticospinal tract.
[0173] For immunohistochemistry experiments, animals are deeply
anesthetized with Inactin (100-110 mg/kg IP) 2-8 weeks after
surgery to induce injury. The chest cavity is opened and the heart
is exposed, to allow for perfusion. A cannula is inserted into the
left ventricle through which 100 cc ice-cold PBS is pushed slowly
(a hole will be cut in the right ventricle to allow fluid escape).
This is followed by a slow but steady drip of 4% paraformaldehyde
(50-100 ml) until fixation of eyes/ears/toes is obvious. Spinal
cords are removed, with care to minimize alteration of the injury
site, frozen in OCT, sectioned, and processed for
immunohistochemistry. Other tissues optionally are also collected
for later analysis. The animals receiving adenovirus Sp35 showed
increased axon sprouting as determined by .beta.III tubulin
staining for neuron axon.
Example 12
Sp-35 Viral Vector Constructs
[0174] A pMIG-derived Sp-35 viral vector was made as follows. The
full-length Sp35 coding sequence was PCR amplified using primers
5'-GATTACTCGAGA TGCTGGCGGGGGGCGTGAGG-3' (SEQ ID NO: 37), containing
an XhoI site, and 5' CGCGGGAATTCTCATATCATCTTCATGTTGAACTTG-3' (SEQ
ID NO: 38), containing an EcoRI site. The PCR product was cut with
XhoI and EcoRI, then ligated into the Retrovirus vector pMIG (Cheng
et al, 1996, Nat. Biotechnol. 145:576) which was cut with XhoI and
EcoRI. This vector was designated pMMC078. All isolates of pMMC078
contained point mutations, so two isolates of pMMC078 were ligated
together. Vector pMMC078.6 was cut with XhoI and AccI and pMMC078.7
was cut with XhoI and AccI. These two fragments were ligated to
make the plasmid, pMMC089.
[0175] A pMIG-derived Sp35-HA viral vector was made as follows. A
fragment encoding Sp35 amino acids 326-614 in frame with the HA
sequence was obtained by using PCR with primers
5'-GCCTTCCGCGGCCTCAACTACCTGCGCGTG CTC-3' (SEQ ID NO: 39),
containing a SacII site, and 5'-CCGGAATTCTCA
AGCGTAATCAGGAACGTCGTAAGGGTATATA TCATGTTGAACTTGCG GGGCGCGTCGGC-3'
(SEQ ID NO: 40), with pMMC089 serving as a template. The longer
primer includes the HA coding sequence (italics) after Sp35 codon
614 and before the EcoR I site. The PCR product was then cut with
Sac II and EcoR I, and used to replace the Sac II-EcoR I fragment
containing wild-type Sp35 codons 326-614 in the pMIG-derived
retroviral vector.
[0176] An Sp35-baculovirus HA vector was made as follows. The
Sp35-HA coding sequence from Sp35-HA retroviral vector was cut out
with Xho I and EcoR I, blunt-ended, and cloned into Bgl2-fill in
site of baculo viral shuttle vector pBV-CZPG (U.S. Pat. Nos.
6,190,887; and 6,338,953), replacing LacZ gene under CMV
promoter.
[0177] An Sp35-adenoviral vector was made as follows. Sp35-IRES-GFP
coding sequence from the Sp35-retroviral was cut out with Xho
I-fill in and Nhe I, then cloned into the EcoR1-fill in/Nhe I sites
of the Adenovirus shuttle vector pDC315, under minimal CMV
promoter.
Example 13
Animal Model of Remyelination
[0178] Female Long Evans rats are used in all studies. Rats are
anaesthetized using Isoflurane and the T3/4 exposed and a dorsal
hemi-laminectomy performed. The chemical demyelinating agent,
lysolecithin (3 .mu.l of 1% lysolecithin in 0.9% saline), is then
injected into the right side of dorsal columns of the spinal cord
0.5-1 mm below the surface of the cord). Appropriate analgesic
treatment is administered before and after surgery.
[0179] Three days later, the injection site is re-exposed (under
isoflurane anesthesia, with appropriate analgesic treatment) and
the following therapies injected into the injured spinal cord and
an adenovirus vector encoding protein Sp35/control protein is
injected into the injury site. 10.sup.10 particles of adenovirus
encoding Sp35 or GFP control in a volume of 10 .mu.l will be
injected into injured rat spinal cord in up to 5 different sites in
and around the site of lysolecithin-induced demyelination. A volume
of not greater than 2 .mu.l is injected at each of the 5 injection
sites. For histological analysis of spinal cord
demyelination/remyelination 2, 3, 4 or 6 weeks after surgery,
animals are deeply anesthetized with inactin (100-110 mg/kg ip) and
perfused with fixative via the heart. The spinal cord is then
removed and processed for analysis. The animal receiving Sp35
treatment showed increased axon myelination as determined by IHC
using anti-MBP protein antibody or luxol fast blue.
Example 14
Sp35 RNAi
[0180] To address the role of Sp35 in brain function, we introduced
the lentivirus Sp35 RNAi into postnatal 8 CGN cells. Sp35 RNAi
infected cells had shorter neurites and higher rates of
proliferation than control cells. These results indicate a role for
Sp35 in regulating RhoA activation.
[0181] Murine and rat Sp35 DNA sequences were compared to find
homologous regions to use for candidate shRNAs. CH324 was
constructed by annealing oligonucleotides LV1-035 and LV1-036 and
ligating to Hpa1 and Xho1 digested pLL3.7. The oligonucleotides
were purchased from MWG. The sequences are:
TABLE-US-00004 LV1-035 (sense oligo) (SEQ ID NO: 41) 5'
TGATCGTCATCCTGCTAGACTTCAAGAGAGTCT AGCAGGATGACGATCTTTTTTC LV1-036
(antisense oligo) (SEQ ID NO: 42) 5'
TCGAGAAAAAAGATCGTCATCCTGCTAGACTCT CTTGAAGTCTAGCAGGATGACGATCA.
[0182] Prior to producing virus, DNA from pLL3.7 or candidate shRNA
in pLL3.7 were cotransfected with murine SP35-HA tagged plasmid at
a ratio of 5 to 1 into CHO cells in 6 well format. Knockdown was
analysed by western blot detection of SP35-HA tag from transfected
CHO cell lysates as well as by northern blot of total RNA prepared
from duplicate wells. The blot was probed with a 0.7 kb fragment of
mSP35. Assays were performed 48 hours post-transfection (data not
shown). Viruses were produced from the best candidate for use in
rat neuronal cultures. The vector, additional methodology and virus
production were as described in Rubinson et al. "A lentivirus-based
system to functionally silence genes in primary mammalian cells,
stem cells and transgenic mice by RNA interference." Nat. Genet.
33, 401-6 (2003).
Example 15
RhoA Activation
[0183] COS7 cells co-expressing NgR1 and SP35 showed no changes in
RhoA/GTP levels in response to OMgp. This suggested that the
SP35/NgR1 complex is not sufficient for mediating signal
transduction by a myelin inhibitor.
[0184] We explored the possibility that a ternary complex of
SP35/NgR1/p75 mediates signaling. Two approaches were used to
evaluate interactions between SP35, NgR1 and p75. First, binding
was evaluated in a direct binding assay using an AP-SP35 conjugate.
The AP-SP35 conjugate bound weakly to p75-expressing cells. AP-P75
bound to NgR1 expressing cells. The binding of AP-SP35 to NgR1 and
p75 were measured by ELISA (FIG. 4). Second, binding of SP35 to
NgR1 and p75 was evaluated by a co-immunoprecipitation from COS7
cells co-expressing SP35 NgR1 and p75. An anti-NgR1 antibody
immunoprecipitated a complex containing SP35 and p75. An anti SP35
antibody also immunoprecipitated a complex containing p75. The
interaction and co-immunopreicipitation data provided evidence for
a direct interaction between SP35, NgR1 and p75. We used confocal
microscopy and antibodies against SP35, p75 and NgR1 to show that
SP35, NgR1 and p75 co-localize to cell bodies and axons of p7 CG
neurons from rat.
[0185] Next we showed that the combination of SP35, NgR1 and p75 is
sufficient for the activities of the myelin inhibitor. Non-neuronal
COS7 cells were engineered to express all three components. Using
these cells, we showed that RhoA/GTP levels were up-regulated by
OMgp. OMgp-Fc treatment increased RhoA/GTP levels in SP35/p75/NgR1
co-expressing cells, as compared to other combinations of these
three components. We confirmed expression of the proteins by
Western blotting of COS7 cells lysates. The affinity of myelin
inhibitors binding to NgR1 were not affected by the presence of p75
or p75 and SP35. The combined results support a model whereby a
ternary complex of NgR1, SP35 and p75 is required for RhoA
regulation in the presence of NgR1 ligands (FIG. 5).
[0186] SP35 contains a cytoplasmic domain that has potential direct
or indirect involvement in signaling. To determine the role of the
cytoplasmic domain, we produced a cytoplasmic domain truncation of
SP35 (amino acids 34 to 576 of SEQ ID NO: 2), to function in a
dominant negative manner by forming an unproductive, ternary
complex incapable of signaling. We designated this molecule with
the cytoplasmic domain truncation "DN-SP35" (for dominant negative
SP35). We transfected postnatal day 7(p7) CG neurons with
full-length SP35 or DN-SP35, and then assayed for response to the
inhibitory myelin components (Omgp, myelin and Nogo66). As shown in
FIG. 6, DN-SP35 transfected cells failed to respond to the
inhibitory myelin components and showed longer neurites than
controls. In contrast, cells transfected with the full length SP35
construct showed enhanced response to the inhibitory substrates,
and had shorter neurites as compared to controls. This demonstrated
that DN-SP35 acts as a competitor to attenuate neurite outgrowth
inhibition caused by myelin components. We expected that exogenous,
soluble SP35-Fc also would bind NgR1 and block the action of
inhibitory substrates. As shown in FIG. 7, SP35-Fc reduced the
neurite outgrowth inhibition by Omgp, Nogo66 and MAG.
Example 16
Neuroprotective Activity
[0187] Equal numbers of rat p6 cerebellar granule neurons was
plated in each well of a 12-well cell culture plate in the presence
or absence of 50 nM of sp35-Fc protein. These poly-D-lysine plates
have been pre-coated [dried down] with 10 .mu.g of CNS myelin, or
200 ng of Nogo66, MAG and OMgp or control-Fc. The neuronal cultures
were maintained for 1-7 days at 37.degree. C. and 5% CO.sub.2. The
neurons were healthy and grew well in the PBS control wells
independent of sp35-Fc treatment with full neurite extension
[determined by neuronal specific marker,
.quadrature..quadrature.III tubulin] as examined after 3 days. In
the absence of sp35-Fc, the neurons did not grow well in the wells
coated with myelin, Nogo66, MAG and OMgp. There was minimum neurite
sprouting [short and distorted] and the neurons did not appear to
be healthy, with rounded cell body and condensed nuclear materials.
DAPI staining demonstrated that the number of neurons detected in
these wells was less than that in the PBS control wells, suggesting
neuronal loss. In the presence of sp35-Fc, long neurites were
present and the neurons appeared healthy. DAPI staining
demonstrated a higher neuronal number in these wells than those
that did not receive the sp35-Fc. The data are summarized in Table
2 below.
TABLE-US-00005 TABLE 2 In the absence of sp35-Fc Dried down
substrate: OMgp/Nogo/MAG/ Fc control myelin neurite extension short
long distorted extended cell body morphology rounded spread nuclear
materials condensed clear neuron number at the end reduced same as
control Fc of expt In the presence of sp35-Fc Dried down substrate:
OMgp/Nogo/MAG/ Fc control myelin neurite extension long long
extended extended cell body morphology spread spread nuclear
materials clear clear neuron number at the end less reduced that
same as control Fc of expt control FC These data indicated that a
soluble form of Sp35, e.g., Sp35-Fc, possesses neuroprotective
activity.
[0188] In spinal cord hemi-transected (T9, SCT) rats, .beta.-III
tubulin staining of the spinal cord sections showed a substantial
loss of neurons at the lesion site. A recombinant virus expressing
sp35 was used to infect the SCT animals at the lesion site.
Histological staining of these spinal cords showed an increased
number of neurons around the lesion site compared to the control
group that was infected with the vector virus. This is consistent
with the in vitro experimental findings described above, and
further indicates neuroprotective properties associated with
Sp35.
Example 17
Sp35 in Animal Model of Spinal Cord Injury
[0189] Since Sp35-Fc reduced neurite outgrowth inhibition caused by
OMgp, Nogo-66 and MAG in vitro, we expected the molecule to promote
functional recovery of CNS injuries in vivo. To confirm this, we
administered Sp35-Fc to spinal chord hemisected rats, i.e., an
animal model of acute CNS trauma. As shown in FIG. 8 and FIG. 9,
Sp35-Fc treated rats demonstrated significantly improved functional
recovery, compared to control rats treated with IgG.
[0190] Spinal cord injury and behavioral analysis were performed as
follows. All surgical procedures were performed in accordance with
the guidelines of the Biogen Institutional Animal Use and Care
Committee. Female Long Evans rats (190-210 g, Charles River,
Wilmington, Mass.) were anesthetized using 2.5 mg/kg Midazolam,
I.P. and 2-3% Fluothane in O.sub.2. A dorsal laminectomy was
performed at spinal level T6 and T7. A dorsal hemisection was
performed, completely interrupting the main dorsomedial and the
minor dorsolateral corticospinal tract (CST) components.
Immediately after CST transection an intrathecal catheter was
inserted into the subarachnoid space at T7 and connected to a
primed mini-osmotic pump (Alzet model 2004) inserted into the
subcutaneous space. Mini-osmotic pumps delivered Hu IgG isotype
control protein (5 mg/ml, n=5, Pharmingen), PBS (n=3) soluble Hu
Sp35-Ig fusion protein (4.3 mg/ml, n=8) at a rate of 0.25 .mu.l/h.
Following surgery, the laminectomy site was sutured and the skin
wound stapled closed. Postoperative care included analgesia
(Buprenorphine 0.05 mg/kg s.c.) for 3 days and antibiotic treatment
(Ampicillin 100 mg/kg s.c.twice daily) for 7 days after surgery.
Bladders were expressed manually twice a day for the duration of
the study (28 days) or until return of function (the time of which
was noted). All animals were blindly scored using the open-field
BBB scoring system (Basso et al., 1995, J Neurotrauma 12:1-21; Ono
et al., 2003, J. Neurosci. 23:5887-5896). Rats were evaluated the
day after CST transection (day 2) and weekly thereafter for 4 weeks
using the Basso-Beattie-Bresnahan (BBB) locomotor rating scale.
Investigators were blinded to the treatment groups for the duration
of the study.
Example 18
Neuronal Survival and Axon Regeneration in the Rubro-Spinal Tract
(RST) Hemi-Section Injury Model
[0191] We also investigated the effects of Sp35 treatment on the
regeneration of neurons in the rubro-spinal tract which directly
contribute to locomotion.
[0192] Adult 9-week-old Sprague-Dawley rats (200-250 g) were
anesthetized with an intraperitoneal injection of ketamine (80
mg/kg) and xylazine (8 mg/kg). Under an operating microscope, a
dorsal laminectomy was performed and the seventh thoracic spinal
vertebra (C7) identified. After opening the dura mater, a right
hemi-section was performed at spinal cord level C7 using a pair of
spring scissors. Following spinal cord hemi-section, animals
received a piece of gelfoam soaked with either 10 .mu.l of a 2
.mu.g/ml solution of Sp35-Fc, or 101 of a 2 .mu.g/ml solution of
human Ig, or 10 .mu.l PBS, placed on top of the lesion site. After
the operations, animals in each group were subdivided for axonal
tracing and behavioral analysis. The animals for axonal tracing
(n=5 for each group) and behavioral analysis (n=7 for each group)
were allowed to survive for 1 month.
[0193] Fluoro-Gold (FG, 6% w/v, Fluorochrome) was used to label the
RST neurons that had regenerated their axons across the injury scar
and reentered the caudal spinal cord. Two days prior to the end of
the post-injury survival period (1 month), animals were
anesthetized with an intraperitoneal injection of ketamine (80
mg/kg) and xylazine (8 mg/kg). A dorsal laminectomy was carried out
and the T2 spinal segment was identified. FG at a volume of 0.5 ml
was manually injected into the right T2 spinal cord using a
Hamilton syringe. Two days later, the animals were anesthetized and
sacrificed with a lethal dose of ketamine (150 mg/kg) and xylazine
(8 mg/kg) and they were perfused intracardinally with normal
saline, followed by 400 ml of fixative containing 4%
paraformaldehyde in 0.1.times.PBS. The brains and spinal cords were
removed, postfixed with paraformaldehyde overnight, and then placed
in 30% phosphate-buffered sucrose. Brain and spinal cord tissue
were cut into 30 mm sections on a cryostat and mounted onto
gelatin-coated slides. The number of FG-labeled RST neurons on the
lesion side was expressed as a percentage of the total number of
FG-labeled neurons on the contra-lateral intact side. This
percentage among groups was compared statistically using one-way
ANOVA followed by a Tukey-Kramer multiple comparisons test. As
shown in Table 3, Sp35-Fc at 2 .mu.g/ml promoted the survival of
rubro-spinal tract (RST) neurons.
TABLE-US-00006 TABLE 3 Percent Survival of RST Treatment Neurons
(.+-.S.E.M.) PBS 17.1 .+-. 2.sup. Sp35-Fc 31.9 .+-. 1.5 Control-Fc
14.5 .+-. 2.1
[0194] For behavioral analysis, the use of forelimbs during
spontaneous vertical exploration was examined 1 month after
different treatments as described (Liu et al., 1999) with minor
modifications. Rats were placed in a clear Plexiglas cylinder (15
cm in diameter and 30 cm high) that encourages use of the forelimbs
for vertical exploration for 5 min. The following behaviors were
scored: (1) independent use of the left (unimpaired) or right
(impaired) forelimbs for contacting the wall of the cylinder; and
(2) simultaneous use of both forelimbs to contact the wall of the
cylinder. The vertical exploration behavior was expressed in terms
of (1) percentage use of left (unimpaired) forelimb relative to the
total number of impaired, unimpaired, and both limb use; (2)
percentage use of right (impaired) forelimb relative to the total
number of impaired, unimpaired, and both limb use; and (3)
percentage use of both forelimbs relative to the total number of
impaired, unimpaired, and both limb use. The differences between
groups were tested by one-way ANOVA followed by Bonferroni post hoc
analysis. Sp35-Fc treated animals showed significantly improved
front limb movement: 30% usage for both forelimbs in Sp35-1-Fc
treated animals versus 10% usage for both forelimbs in control-Fc
or PBS-treated animals; 55% left (unimpaired) limb usage versus 80%
usage in control-Fc or PBS-treated animals; and 29% right
(impaired) limb usage versus approximately 15% in control-Fc or PBS
treated animals.
Example 19
Sp35-Fc Promotes Retinal Ganglion Cell (RGC) Survival in the Optic
Nerve Transection Model
[0195] We further confirmed the activity of Sp35 using the optic
nerve transection model, which investigates factors that affect
neuronal function. Young adult female Sprague Dawley (SD) rats were
used in this study. The right optic nerve of each animal was
transected intraorbitally 1.5 mm from the optic disc. A piece of
gelfoam soaked with 6% Fluoro-Gold (FG) was applied to the newly
transected site right behind the optic disc to label the surviving
retinal ganglion cells (RGCs). The animals were divided into 6
groups (n=6 in each group) receiving either Sp35-Fc, human IgG 1,
or just PBS, by intravitreal injection. The volume of each
intravitreal injection was 4 ml while the dosage of each injection
was 2 mg. The intravitreal injections were performed immediately
after the optic nerve transection.
[0196] All animals were allowed to survive for 1 week. Two days
before sacrificing the animals, the left optic nerve of each animal
was transected and 6% FG were used to label the surviving RGCs to
serve as the internal control. Animals were sacrificed with an
overdose of Nembutal and the retinas dissected in 4%
paraformaldehyde. Four radial cuts were made to divide the retinas
into four quadrants (superior, inferior, nasal and temporal). The
retinas were then post-fixed in the same fixative for 1 hour before
they were flat-mounted with the mounting medium (Dako). The slides
were examined under a fluorescence microscope using an ultra-violet
filter (excitation wavelength=330-380 nm). Labeled RGCs were
counted along the median line of each quadrants starting from the
optic disc to the peripheral border of the retina at 500 mm
intervals, under an eyepiece grid of 200.times.200 mm. The
percentage of surviving RGCs resulting from each treatment was
expressed by comparing the number of surviving RGCs in the injured
eyes with their contra-lateral eyes. All data were expressed as
mean.+-.SEM. Statistical significance was evaluated by one way
ANOVA, followed by a Tukey-Kramer post hoc test. Differences were
considered significant for p<0.05. Sp35-Fc treated animals
showed significant neuronal survival (83%) when compared to
control-Fc or PBS treated animals, which each only showed
approximately 50% neuronal survival.
OTHER EMBODIMENTS
[0197] Other embodiments are within the following claims.
Sequence CWU 1
1
4112897DNAHomo sapiensmodified_base(2376)n = a, t, c or g
1ggagagacat gcgattggtg accgagccga gcggaccgaa ggcgcgcccg agatgcaggt
60gagcaagagg atgctggcgg ggggcgtgag gagcatgccc agccccctcc tggcctgctg
120gcagcccatc ctcctgctgg tgctgggctc agtgctgtca ggctcggcca
cgggctgccc 180gccccgctgc gagtgctccg cccaggaccg cgctgtgctg
tgccaccgca agcgctttgt 240ggcagtcccc gagggcatcc ccaccgagac
gcgcctgctg gacctaggca agaaccgcat 300caaaacgctc aaccaggacg
agttcgccag cttcccgcac ctggaggagc tggagctcaa 360cgagaacatc
gtgagcgccg tggagcccgg cgccttcaac aacctcttca acctccggac
420gctgggtctc cgcagcaacc gcctgaagct catcccgcta ggcgtcttca
ctggcctcag 480caacctgacc aagctggaca tcagcgagaa caagattgtt
atcctactgg actacatgtt 540tcaggacctg tacaacctca agtcactgga
ggttggcgac aatgacctcg tctacatctc 600tcaccgcgcc ttcagcggcc
tcaacagcct ggagcagctg acgctggaga aatgcaacct 660gacctccatc
cccaccgagg cgctgtccca cctgcacggc ctcatcgtcc tgaggctccg
720gcacctcaac atcaatgcca tccgggacta ctccttcaag aggctctacc
gactcaaggt 780cttggagatc tcccactggc cctacttgga caccatgaca
cccaactgcc tctacggcct 840caacctgacg tccctgtcca tcacacactg
caatctgacc gctgtgccct acctggccgt 900ccgccaccta gtctatctcc
gcttcctcaa cctctcctac aaccccatca gcaccattga 960gggctccatg
ttgcatgagc tgctccggct gcaggagatc cagctggtgg gcgggcagct
1020ggccgtggtg gagccctatg ccttccgcgg cctcaactac ctgcgcgtgc
tcaatgtctc 1080tggcaaccag ctgaccacac tggaggaatc agtcttccac
tcggtgggca acctggagac 1140actcatcctg gactccaacc cgctggcctg
cgactgtcgg ctcctgtggg tgttccggcg 1200ccgctggcgg ctcaacttca
accggcagca gcccacgtgc gccacgcccg agtttgtcca 1260gggcaaggag
ttcaaggact tccctgatgt gctactgccc aactacttca cctgccgccg
1320cgcccgcatc cgggaccgca aggcccagca ggtgtttgtg gacgagggcc
acacggtgca 1380gtttgtgtgc cgggccgatg gcgacccgcc gcccgccatc
ctctggctct caccccgaaa 1440gcacctggtc tcagccaaga gcaatgggcg
gctcacagtc ttccctgatg gcacgctgga 1500ggtgcgctac gcccaggtac
aggacaacgg cacgtacctg tgcatcgcgg ccaacgcggg 1560cggcaacgac
tccatgcccg cccacctgca tgtgcgcagc tactcgcccg actggcccca
1620tcagcccaac aagaccttcg ctttcatctc caaccagccg ggcgagggag
aggccaacag 1680cacccgcgcc actgtgcctt tccccttcga catcaagacc
ctcatcatcg ccaccaccat 1740gggcttcatc tctttcctgg gcgtcgtcct
cttctgcctg gtgctgctgt ttctctggag 1800ccggggcaag ggcaacacaa
agcacaacat cgagatcgag tatgtgcccc gaaagtcgga 1860cgcaggcatc
agctccgccg acgcgccccg caagttcaac atgaagatga tatgaggccg
1920gggcgggggg cagggacccc cgggcggccg ggcaggggaa ggggcctggc
cgccacctgc 1980tcactctcca gtccttccca cctcctccct acccttctac
acacgttctc tttctccctc 2040ccgcctccgt cccctgctgc cccccgccag
ccctcaccac ctgccctcct tctaccagga 2100cctcagaagc ccagacctgg
ggaccccacc tacacagggg cattgacaga ctggagttga 2160aagccgacga
accgacacgc ggcagagtca ataattcaat aaaaaagtta cgaactttct
2220ctgtaacttg ggtttcaata attatggatt tttatgaaaa cttgaaataa
taaaaagaga 2280aaaaaactat ttcctatagc tagtcggaat gcaaactttt
gacgtcctga ttgctccagg 2340gccctcttcc aactcagttt cttgtttttc
tcttcntcct nctcctcttc ttcctccttt 2400ctcttctctt cccccagtgg
ggagggatca ctcaggaaaa caggaaagga ggttccagcc 2460ccacccacct
gcccaccccg ccccaggcac catcaggagc aggctagggg gcaggcctgg
2520gcccagctcc gggctggctt tttgcagggc gcaggtggag gggacaggtc
tgccgatggg 2580ggtgggagcc tgtctgctgg gctgccaggc ggcaccactg
caaggggtgg gagcctggct 2640cgggtgtggc tgagactctg gacagaggct
ggggtcctcc tgggggacag cacagtcagt 2700ggagagagcc aggggctgga
ggtggggccc accccagcct ctggtcccag ctctgctgct 2760cacttgctgt
gtggccctca agcaggtcca ctggcctctc tgggcctcag tctccacatc
2820tgtacaaatg ggaacattac cccctgccct gcctacctna nagggctgtt
ntgaggnatn 2880gatgagatga tgtatgt 28972614PRTHomo sapiens 2Met Leu
Ala Gly Gly Val Arg Ser Met Pro Ser Pro Leu Leu Ala Cys 1 5 10 15
Trp Gln Pro Ile Leu Leu Leu Val Leu Gly Ser Val Leu Ser Gly Ser 20
25 30 Ala Thr Gly Cys Pro Pro Arg Cys Glu Cys Ser Ala Gln Asp Arg
Ala 35 40 45 Val Leu Cys His Arg Lys Arg Phe Val Ala Val Pro Glu
Gly Ile Pro 50 55 60 Thr Glu Thr Arg Leu Leu Asp Leu Gly Lys Asn
Arg Ile Lys Thr Leu 65 70 75 80Asn Gln Asp Glu Phe Ala Ser Phe Pro
His Leu Glu Glu Leu Glu Leu 85 90 95 Asn Glu Asn Ile Val Ser Ala
Val Glu Pro Gly Ala Phe Asn Asn Leu 100 105 110 Phe Asn Leu Arg Thr
Leu Gly Leu Arg Ser Asn Arg Leu Lys Leu Ile 115 120 125 Pro Leu Gly
Val Phe Thr Gly Leu Ser Asn Leu Thr Lys Leu Asp Ile 130 135 140 Ser
Glu Asn Lys Ile Val Ile Leu Leu Asp Tyr Met Phe Gln Asp Leu 145 150
155 160Tyr Asn Leu Lys Ser Leu Glu Val Gly Asp Asn Asp Leu Val Tyr
Ile 165 170 175 Ser His Arg Ala Phe Ser Gly Leu Asn Ser Leu Glu Gln
Leu Thr Leu 180 185 190 Glu Lys Cys Asn Leu Thr Ser Ile Pro Thr Glu
Ala Leu Ser His Leu 195 200 205 His Gly Leu Ile Val Leu Arg Leu Arg
His Leu Asn Ile Asn Ala Ile 210 215 220 Arg Asp Tyr Ser Phe Lys Arg
Leu Tyr Arg Leu Lys Val Leu Glu Ile 225 230 235 240Ser His Trp Pro
Tyr Leu Asp Thr Met Thr Pro Asn Cys Leu Tyr Gly 245 250 255 Leu Asn
Leu Thr Ser Leu Ser Ile Thr His Cys Asn Leu Thr Ala Val 260 265 270
Pro Tyr Leu Ala Val Arg His Leu Val Tyr Leu Arg Phe Leu Asn Leu 275
280 285 Ser Tyr Asn Pro Ile Ser Thr Ile Glu Gly Ser Met Leu His Glu
Leu 290 295 300 Leu Arg Leu Gln Glu Ile Gln Leu Val Gly Gly Gln Leu
Ala Val Val 305 310 315 320Glu Pro Tyr Ala Phe Arg Gly Leu Asn Tyr
Leu Arg Val Leu Asn Val 325 330 335 Ser Gly Asn Gln Leu Thr Thr Leu
Glu Glu Ser Val Phe His Ser Val 340 345 350 Gly Asn Leu Glu Thr Leu
Ile Leu Asp Ser Asn Pro Leu Ala Cys Asp 355 360 365 Cys Arg Leu Leu
Trp Val Phe Arg Arg Arg Trp Arg Leu Asn Phe Asn 370 375 380 Arg Gln
Gln Pro Thr Cys Ala Thr Pro Glu Phe Val Gln Gly Lys Glu 385 390 395
400Phe Lys Asp Phe Pro Asp Val Leu Leu Pro Asn Tyr Phe Thr Cys Arg
405 410 415 Arg Ala Arg Ile Arg Asp Arg Lys Ala Gln Gln Val Phe Val
Asp Glu 420 425 430 Gly His Thr Val Gln Phe Val Cys Arg Ala Asp Gly
Asp Pro Pro Pro 435 440 445 Ala Ile Leu Trp Leu Ser Pro Arg Lys His
Leu Val Ser Ala Lys Ser 450 455 460 Asn Gly Arg Leu Thr Val Phe Pro
Asp Gly Thr Leu Glu Val Arg Tyr 465 470 475 480Ala Gln Val Gln Asp
Asn Gly Thr Tyr Leu Cys Ile Ala Ala Asn Ala 485 490 495 Gly Gly Asn
Asp Ser Met Pro Ala His Leu His Val Arg Ser Tyr Ser 500 505 510 Pro
Asp Trp Pro His Gln Pro Asn Lys Thr Phe Ala Phe Ile Ser Asn 515 520
525 Gln Pro Gly Glu Gly Glu Ala Asn Ser Thr Arg Ala Thr Val Pro Phe
530 535 540 Pro Phe Asp Ile Lys Thr Leu Ile Ile Ala Thr Thr Met Gly
Phe Ile 545 550 555 560Ser Phe Leu Gly Val Val Leu Phe Cys Leu Val
Leu Leu Phe Leu Trp 565 570 575 Ser Arg Gly Lys Gly Asn Thr Lys His
Asn Ile Glu Ile Glu Tyr Val 580 585 590 Pro Arg Lys Ser Asp Ala Gly
Ile Ser Ser Ala Asp Ala Pro Arg Lys 595 600 605 Phe Asn Met Lys Met
Ile 610 359DNAArtificial SequenceDescription of Artificial Sequence
Primer 3tcgagaaaaa agatcgtcat cctgctagac tctcttgaag tctagcagga
tgacgatca 5949PRTHomo sapiens 4Arg Arg Ala Arg Ile Arg Asp Arg Lys
1 5 59PRTHomo sapiens 5Lys Lys Val Lys Val Lys Glu Lys Arg 1 5
69PRTHomo sapiens 6Arg Arg Leu Arg Leu Arg Asp Arg Lys 1 5
79PRTHomo sapiens 7Arg Arg Gly Arg Gly Arg Asp Arg Lys 1 5
89PRTHomo sapiens 8Arg Arg Ile Arg Ala Arg Asp Arg Lys 1 5
96PRTHomo sapiens 9Met Gln Val Ser Lys Arg 1 5 106PRTHomo sapiens
10Leu Ser Pro Arg Lys His 1 5 116PRTHomo sapiens 11Ile Thr Pro Lys
Arg Arg 1 5 126PRTHomo sapiens 12Ala Cys Pro His His Lys 1 5
136PRTHomo sapiens 13Val Ser Pro Arg Lys His 1 5 1423DNAArtificial
SequenceDescription of Artificial Sequence Primer 14aaggcccagc
aggtgtttgt gga 231524DNAArtificial SequenceDescription of
Artificial Sequence Primer 15tactcgatct cgatgttgtg cttt
241637DNAArtificial SequenceDescription of Artificial Sequence
Primer 16cagcaggtcg acgcggccgc atgctggcgg ggggcgt 371729DNAHomo
sapiens 17cagcaggtcg acctcgcccg gctggttgg 291837DNAArtificial
SequenceDescription of Artificial Sequence Primer 18aattaagaat
tcacgggctg cccgccccgc tgcgagt 371944DNAArtificial
SequenceDescription of Artificial Sequence Primer 19tatatttcta
gatcactcgc ccggctggtt ggagatgaaa gcga 442044DNAArtificial
SequenceDescription of Artificial Sequence Primer 20cttgacacgg
gatccgcggc cgcatgctgg cggggggcgt gagg 442145DNAArtificial
SequenceDescription of Artificial Sequence Primer 21gcagcggggc
gggcagcccg tggccgagcc tgacagcact gagcc 452244DNAArtificial
SequenceDescription of Artificial Sequence Primer 22cttgacacgg
gatccgcggc cgcatgctgg cggggggcgt gagg 442345DNAArtificial
SequenceDescription of Artificial Sequence Primer 23gtcccggatg
cgggcgcggg ccgagcctga cagcactgag cccag 452430DNAArtificial
SequenceDescription of Artificial Sequence Primer 24atattctaga
atgctggcgg ggggcgtgag 302530DNAArtificial SequenceDescription of
Artificial Sequence Primer 25atatactagt gtcgttgccg cccgcgttgg
302646DNAArtificial SequenceDescription of Artificial Sequence
Primer 26cccagcaggt gtttgtggac gagtgatcta gggccgcgga tccctg
462746DNAArtificial SequenceDescription of Artificial Sequence
Primer 27cagggatccg cggccctaga tcactcgtcc acaaacacct gctggg
462843DNAArtificial SequenceDescription of Artificial Sequence
Primer 28cgccgcgcac ccgggtgaat tccgcgcccg catccgggac cgc
432943DNAArtificial SequenceDescription of Artificial Sequence
Primer 29gcggtcccgg atgcgggcgc ggaattcacc cgggtgcgcg gcg
433043DNAArtificial SequenceDescription of Artificial Sequence
Primer 30cgccgcgcac ccgggtgaat tcgcccagca ggtgtttgtg gac
433143DNAArtificial SequenceDescription of Artificial Sequence
Primer 31gtccacaaac acctgctggg cgaattcacc cgggtgcgcg gcg
433246DNAArtificial SequenceDescription of Artificial Sequence
Primer 32catcctctgg ctctcacccg aaaaggtact ggtctcagcc aagagc
463346DNAArtificial SequenceDescription of Artificial Sequence
Primer 33gctcttggct gagaccagta ccttttcggg tgagagccag aggatg
46345PRTHomo sapiens 34Ser Pro Arg Lys His 1 53531DNAArtificial
SequenceDescription of Artificial Sequence Primer 35aattaagcgg
ccgcatgctg gcggggggcg t 313624DNAArtificial SequenceDescription of
Artificial Sequence Primer 36aattaagcgg ccgctttgtc atgt
243732DNAArtificial SequenceDescription of Artificial Sequence
Primer 37gattactcga gatgctggcg gggggcgtga gg 323836DNAArtificial
SequenceDescription of Artificial Sequence Primer 38cgcgggaatt
ctcatatcat cttcatgttg aacttg 363933DNAArtificial
SequenceDescription of Artificial Sequence Primer 39gccttccgcg
gcctcaacta cctgcgcgtg ctc 334075DNAArtificial SequenceDescription
of Artificial Sequence Primer 40ccggaattct caagcgtaat caggaacgtc
gtaagggtat atcatcttca tgttgaactt 60gcggggcgcg tcggc
754155DNAArtificial SequenceDescription of Artificial Sequence
Primer 41tgatcgtcat cctgctagac ttcaagagag tctagcagga tgacgatctt
ttttc 55
* * * * *