U.S. patent application number 14/628892 was filed with the patent office on 2015-06-25 for method for providing dna fragments derived from an archived sample.
The applicant listed for this patent is Epigenomics AG. Invention is credited to Matthias Ballhause, Kurt Berlin, Dimo Dietrich, Antje Kluth Lukas, Matthias Schuster, Ute Wagner, Reinhold Wasserkort, Heike Ziebarth.
Application Number | 20150176062 14/628892 |
Document ID | / |
Family ID | 36143114 |
Filed Date | 2015-06-25 |
United States Patent
Application |
20150176062 |
Kind Code |
A1 |
Ballhause; Matthias ; et
al. |
June 25, 2015 |
METHOD FOR PROVIDING DNA FRAGMENTS DERIVED FROM AN ARCHIVED
SAMPLE
Abstract
Aspects of the present invention relate to compositions and
methods for providing DNA fragments from an archived sample (e.g.,
paraffin-embedded and/or fixed-tissue biopsies, etc.). Particular
aspects provide methods whereby high yields of DNA are isolated as
well as a substantial portion of the DNA consists of long DNA
fragments, and where the isolated genomic DNA is free of associated
or cross-linked contaminants like proteins, peptides, amino acids
or RNA. The methods are facile, cost-effective, and are
characterized by high reproducibility and reliability. Particular
aspects provide methods for providing DNA fragments derived from an
archived sample, wherein the yield of DNA before, for example, an
amplification step is at least 20%, and amplicons up to a length of
about 1,000 base pairs are amplifiable.
Inventors: |
Ballhause; Matthias;
(Berlin, DE) ; Berlin; Kurt; (Stahnsdorf, DE)
; Dietrich; Dimo; (Berlin, DE) ; Lukas; Antje
Kluth; (Wentorf, DE) ; Schuster; Matthias;
(Berlin, DE) ; Wagner; Ute; (Berlin, DE) ;
Wasserkort; Reinhold; (Berlin, DE) ; Ziebarth;
Heike; (Berlin, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Epigenomics AG |
Berlin |
|
DE |
|
|
Family ID: |
36143114 |
Appl. No.: |
14/628892 |
Filed: |
February 23, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14094667 |
Dec 2, 2013 |
8962246 |
|
|
14628892 |
|
|
|
|
11664367 |
Jan 11, 2008 |
8679745 |
|
|
PCT/US05/35317 |
Sep 30, 2005 |
|
|
|
14094667 |
|
|
|
|
60614697 |
Sep 30, 2004 |
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
C12N 15/1003 20130101;
C12Q 1/686 20130101; C12Q 1/6806 20130101; C12Q 1/6858 20130101;
C12Q 1/686 20130101; C12Q 2521/101 20130101; C12Q 2523/125
20130101; C12Q 2527/137 20130101; C12Q 2527/149 20130101 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for amplifying DNA derived from an archived sample,
comprising amplifying DNA in a DNA amplification step comprising
use of at least one DNA amplification parameter selected from the
group consisting of: a polymerase concentration in the range of
about 0.05 to about 0.3 U/.mu.l; a concentration of each nucleotide
in the range of about 200 to about 800 .mu.mol/l; and a time of an
elongation step in the range of about 0.1 to about 1.0 s/bp.
2. The method of claim 1, wherein the DNA amplification step
comprises at least one DNA amplification parameter selected from
the group consisting of: a polymerase concentration of about 0.15
U/.mu.l; a concentration of each nucleotide of about 400 .mu.mol/l;
and a time of an elongation step of about 0.5 s/bp.
3. A test kit for carrying out the method according to claim 1,
comprising: a container; organic solvents for removal of paraffin;
proteinase K, buffer for lysis, or both; solutions for DNA
extraction, devices for DNA extraction, or both; solutions for
bisulfite treatment, devices for bisulfite treatment, or both;
solutions for DNA purification, devices for DNA purification, or
both; solutions for DNA amplification, substances for DNA
amplification, or both; and a manual for carrying out the method, a
description for carrying out the method, or both.
4. A test kit for carrying out the method according to claim 2,
comprising: a container; organic solvents for removal of paraffin;
proteinase K, buffer for lysis, or both; solutions for DNA
extraction, devices for DNA extraction, or both; solutions for
bisulfite treatment, devices for bisulfite treatment, or both;
solutions for DNA purification, devices for DNA purification, or
both; solutions for DNA amplification, substances for DNA
amplification, or both; and a manual for carrying out the method, a
description for carrying out the method, or both.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 14/094,667 filed Dec. 2, 2013, now issued as
U.S. Pat. No. 8,962,246; which is a continuation application of
U.S. application Ser. No. 11/664,367 filed Jan. 11, 2008, now
issued as U.S. Pat. No. 8,679,745; which is a 35 USC .sctn.371
National Stage application of International Application No.
PCT/US05/35317 filed Sep. 30, 2005; which claims the benefit under
35 USC .sctn.119(e) to U.S. Application Ser. No. 60/614,697 filed
Sep. 30, 2004, now expired. The disclosure of each of the prior
applications is considered part of and is incorporated by reference
in the disclosure of this application.
SEQUENCE LISTING
[0002] A sequence listing in .txt format (EPIGEN1510-2_ST25.txt, 11
KB) comprising SEQ ID NOS:1-72 is filed as part of this
application.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The invention relates generally to novel and substantially
improved compositions and methods for providing DNA fragments
derived from an archived sample (e.g., paraffin-embedded and/or
fixed-tissue biopsies etc.), and for analyses of same.
[0005] 2. Background Information
[0006] Samples or biopsies are archived many times by default in
diagnostic routines. This is done in order to conserve the tissue
and to prepare it for subsequent histological examinations. Such
conservation is necessary to ensure that the biopsy has not changed
after the removal, the observed findings correspond to the
situation of the patient, and to prevent degradation of cell
structures. Accordingly, the tissue sample is immediately put into
a fixative for example formalin after removal. After fixation, the
sample is embedded into paraffin, which allows a sectioning of the
tissue and a subsequent further histological examination.
[0007] Using these procedures, biopsies are routinely taken from
patients for diagnosing diseases and/or for studying the pattern of
markers associated with diseases. Over the last decades, millions
of biopsies were collected, archived and stored in this way. These
samples represent a major resource for the detection or analysis of
disorders or disease associated alterations. Therefore, these
samples are invaluable because they allow the evaluation of
diagnostic and/or prognostic indicators in retrospective
collections.
[0008] But unfortunately, this resource is only minimally
accessible by molecular biological means, in particular by the most
promising and modern methods such as those for the analysis of the
methylation pattern. This is because of difficulties in obtaining
sufficiently large amounts of high quality genomic DNA at low costs
and with minimal handling effort.
[0009] These difficulties are based on the degradation of DNA and
RNA due to fixation and storage conditions of the sample or biopsy,
and on the insufficient methods for the preparation of DNA. To
preserve morphological structures in the sample as well as
possible, biopsies are usually fixed very well. This has the
disadvantage that a lot of proteins are covalently linked to the
genomic DNA and also the genomic DNA becomes cross-linked.
Consequently, genomic DNA tends to be of small fragment size, has a
low integrity, and is contaminated by proteins, peptides and/or
amino acids which are cross linked with the DNA and which also
interfere with further analysis.
[0010] Most prior art methods for the isolation of DNA from
paraffin embedded formalin-fixed tissues are based on methods for
the isolation of DNA from fresh tissue. They are carried out as one
skilled in the art would treat fresh samples maybe with an
additional paraffin removal step. As it is well known, such a
procedure leads only to comparably low yields of genomic DNA, the
DNA having only a small fragment length. Furthermore, the DNA is
also not suitable for more sophisticated analysis methods, because
still a lot of interfering proteins, peptides and/or amino acids
are linked to the DNA.
[0011] Particular `improved` methods are known in the art. For
example U.S. Pat. No. 6,248,535 teaches a method for the isolation
of nucleic acids from paraffin embedded formalin-fixed tissue.
According to this method, the sample gets deparaffinized,
homogenized before it is heated in a chaotropic solution. After
mixing with chloroform, following centrifugation, the solution has
three phases. The interphase contains the genomic DNA.
[0012] A different method is described by GB 2369822. According to
this, sections of a paraffin-embedded formalin-fixed sample are put
into a tube. A detergent, a wax and a tissue-digesting enzyme are
added, before the tube is heated to about 60.degree. C. for about
30 min. After this the enzyme is inactivated by a temperature
increase to 96.degree. C. A subsequent centrifugation step leads to
a layering inside the tube, the middle layer containing the genomic
DNA as well the RNA.
[0013] Such methods usually lead to larger amounts of genomic DNA
with a lot of contaminating RNA and protein. In addition, the
contaminants cannot be easily removed because they are cross-linked
to the genomic DNA by the fixative. Moreover, in principle, it may
be possible to also isolate longer nucleic acid fragments with
these kinds of methods, but the portion of long fragments is very
small.
[0014] Several proposals have been made to get longer fragments:
Bonin et al. teach a filling in of single-stranded breaks after
isolation of the DNA and a denaturing step before PCR amplification
(Bonin S., Petrera, F., Niccolini, B., Stanta, G. (2003) J. Clin.
Pathol: Mol. Pathol. 56, 184-186). According to this method
fragments up to 300 bp are amplifiable.
[0015] Inadome et al. suggest the isolation of the portion of
longer DNA fragments by HPLC (Inadome, Y., Noguchi, M. (2003)
Diagn. Mol. Pathol. 12, 231-236). This procedure leads only to very
low yields of DNA.
[0016] To enlarge the amount of long DNA fragments isolated from
paraffin-embedded, formalin-fixed tissues, a whole genome
amplification was suggested by Tie et al. and Siwoski et al. (Tie,
J., Serizawa, Y., Oshida, S., Usami, R., Yoshida Y. (2005) Pathol.
Int. 55, 343-347; Siwoski, A., Ishkanian, A., Garnis, C., Zhang,
L., Rosin, M., Lam, W. L. (2002) Mod. Pathol. 15, 889-892). This
solution has the disadvantage of a low reproducibility and is not
applicable when DNA is going to be analyzed for methylation as
amplification erases methylation signals.
[0017] Consequently, genomic DNA isolated according to prior art
methods is not suitable for analysis of the methylation pattern as
explained in detail below.
[0018] The importance of DNA methylation pattern analyses has been
revealed in recent years. Many diseases, in particular cancer
diseases, are accompanied by modified gene expression. This may be
a mutation of the genes themselves, which leads to an expression of
modified proteins or to an inhibition or over-expression of the
proteins or enzymes. A modulation of the expression may however
also occur by epigenetic modifications, in particular by changes in
the DNA methylation pattern. Such epigenetic modifications do not
affect the actual DNA coding sequence. It has been found that DNA
methylation processes have substantial implications for health, and
it seems to be clear that knowledge about methylation processes and
modifications of the methyl metabolism and DNA methylation are
essential for understanding diseases, for the prophylaxis,
diagnosis and therapy of diseases.
[0019] The precise control of genes, which represents a small part
only of the complete genome of mammals, involves regulation in
consideration of the fact that the main part of the DNA in the
genome is not coding. The presence of such `trunk` DNA containing
introns, repetitive elements and potentially actively transposable
elements, requires effective mechanisms for their durable
suppression (silencing). Apparently, the methylation of cytosine by
S-adenosylmethionine (SAM) dependent DNA methyl transferases, which
form 5-methylcytosine, represents such a mechanism for the
modification of DNA-protein interactions. Genes can be transcribed
by methylation-free promoters, even when adjacent transcribed or
not-transcribed regions are widely methylated. This permits the use
and regulation of promoters of functional genes, whereas the trunk
DNA including the transposable elements is suppressed. Methylation
also takes place for the long-term suppression of X-linked genes
and may lead to either a reduction or an increase of the degree of
transcription, depending on where the methylation in the
transcription units occurs.
[0020] Nearly the complete natural DNA methylation in mammals is
restricted to cytosine-guanosine (CpG) dinucleotide palindrome
sequences, which are controlled by DNA methyl transferases. CpG
dinucleotides are about 1 to 2% of all dinucleotides and are
concentrated in CpG islands. According to an art-recognized
definition, a region is considered as a CpG island when the C+G
content over 200 bp is at least 50% and the percentage of the
observed CG dinucleotides in comparison to the expected CG
dinucleotides is larger than 0.6 (Gardiner-Garden, M., Frommer, M.
(1987) J. Mol. Biol. 196, 261-282). Typically, CpG islands have at
least 4 CpG dinucleotides in a sequence of a length of 100 bp.
[0021] CpG islands located in promotor regions frequently have a
regulatory function for the expression of the corresponding gene.
For example, in case the CpG island is hypomethylated, the gene can
be expressed. On the other hand, hypermethylation frequently leads
to a suppression of the expression. Normally tumor suppressor genes
are hypomethylated, but if they become hypermethylated, their
expression becomes suppressed. This is observed many times in tumor
tissues. By contrast, oncogenes are hypermethylated in healthy
tissue, whereas they are hypomethylated in many times in tumor
tissues.
[0022] The methylation of cytosine has the effect that the binding
of proteins is normally prohibited which regulate the transcription
of genes. This leads to an alteration of the expression of the
gene. Relating to cancer, the expression of genes regulating cell
division are thereby altered, for example, the expression of an
apoptotic gene is down regulated, while the expression of an
oncogene is up regulated. Additionally, hypermethylation may have a
long-term influence on regulation. Proteins which deacetylate
histones are able to bind via their 5-methyIcytosine binding domain
to the DNA when the cytosines get methylated. This results in a
deacetylation of the histones, which itself leads to a tighter
package of the DNA. Because of that, regulatory proteins are not
precluded from binding to the DNA.
Pronounced Need in the Art
[0023] The efficient detection of DNA methylation patterns
consequently is an important tool for developing new approaches to
understand diseases, for the prevention, diagnosis and treatment of
diseases and for the screening for disease associated targets. But
on the other hand, methods for an efficient detection of DNA
methylation require high quality standards in regard to the
starting material the genomic DNA. Preferably, the standards are:
i) DNA fragment range is between 150 to 1200 bp; and ii) the DNA is
free of associated or cross-linked proteins, peptides, amino acids,
RNA as well as of nucleotides or bases, which are not part of the
DNA backbone.
[0024] Furthermore, there are also requirements with regard to the
methods according to which the DNA is isolated. The reason for
these is that a lot of samples are typically analyzed for
developing new approaches for the prevention, diagnosis and
treatment of a disease and for the screening for disease associated
targets. Preferably, the requirements are: i) isolation of high
quality DNA (as specified above); ii) high reproducibility; iii)
high reliability, iv) ease of handling; v) low handling effort; and
vi) low costs.
[0025] Additionally, because in general the amount of the tissue
sample or biopsy is very small, it is necessary that the methods
for DNA preparation result in high yields of DNA.
[0026] Because of all these requirements, and given the prior art
methods, archived samples, despite being a major resource in
medical science, can only be minimally used for the efficient
analysis of the DNA methylation. Thus, a major technical need
exists to efficiently make archived samples (e.g.,
paraffin-embedded formalin-fixed tissues) available for the
analysis of, for example, the DNA methylation patterns.
[0027] Thus far, applicants are aware of only one attempt to solve
this problem. WO03/083107 teaches a method for isolation of genomic
DNA from paraffin-embedded suitable for subsequent DNA methylation
analysis by methylation specific PCR (MSP). In principle, the
deparaffinated formalin-fixed sample is boiled in a citrate buffer
pH 6.0, which recovers parts of the cytosines making them better
accessible for subsequent treatment and analysis. However, this
method is conflicting with regard to the aim to provide as long as
possible DNA fragments. According to this method, DNA is brought
into contact with a buffer of acidic pH. As is well known in the
relevant art, such treatment reduces the integrity of DNA resulting
in a random breakage of the DNA strand and therefore the length of
the DNA fragments.
SUMMARY OF THE INVENTION
[0028] Aspects of the present invention relate to compositions and
methods for providing DNA fragments from an archived sample.
Particular aspects provide compositions and methods for providing
DNA fragments derived from an archived sample, wherein the yield of
DNA before, for example, an amplification step is at least 20%, and
amplicons up to a length of about 1,000 base pairs are
amplifiable.
[0029] Additional aspects provide a method for the preparation of
genomic DNA from archived paraffin-embedded formalin-fixed tissue
samples, whereby high yields of DNA are isolated as well as a
substantial portion of the DNA consists of long DNA fragments. In
particular aspects, the isolated genomic DNA is free of associated
or cross-linked contaminants like proteins, peptides, amino acids
or RNA. In particular aspects, the methods are characterized by
high reproducibility and high reliability. In particular aspects,
the methods are easy to handle, have a low handling effort, and are
cost-effective.
[0030] Particularly preferred embodiments providing compositions
and methods are further characterized in that
[0031] i) DNA extracted from an archived sample is subject to a
bisulfite treatment;
[0032] ii) the yield of DNA after a bisulfite treatment step and a
subsequent purification step and before an amplification step is
30-50%;
[0033] iii) amplicons up to a length of 600 base pairs are
amplifiable after bisulfite treatment and subsequent purification;
and
[0034] iv) in the average at least 10% of the DNA fragments are
amplifiable after bisulfite treatment and subsequent purification
in a PCR reaction resulting in fragments of at least 110 bp
length.
[0035] Additional aspects provide a test kit for carrying out the
method of the invention or an embodiment of the method of the
invention. In particular aspects, the test kits comprise one or
more of the following: a container, organic solvents for the
removal of paraffin, proteinase K, buffer for the lysis of tissue,
solutions and/or devices for DNA extraction, solutions and/or
devices for bisulfite treatment, solutions and/or devices for DNA
purification, solutions and/or substances for DNA amplification, a
manual and/or description for carrying out the method according to
the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0036] FIG. 1 shows, according to particular aspects, positions of
the DNA samples and PCR plates on a TECAN.RTM. workstation.
[0037] FIG. 2 shows, according to particular aspects, results of
real time PCR quantification of pooled bisulfite DNA derived from
different paraffin-embedded formalin-fixed specimens--Influence of
dNTP concentration on PCR performance (Example 11).
[0038] FIG. 3 shows, according to particular aspects, results of
real time PCR quantification of pooled bisulfite DNA derived from
different paraffin-embedded formalin-fixed specimens--Influence of
extension time on PCR performance (Example 11).
[0039] FIG. 4 shows, according to particular aspects, results of
real time PCR quantification of pooled bisulfite DNA derived from
different paraffin-embedded formalin-fixed specimens--Influence of
polymerase amount on PCR performance (Example 11).
[0040] FIG. 5 shows, according to particular aspects, yield of
bisulfite treated DNA after purification derived from
paraffin-embedded formalin-fixed prostate biopsies (Example
12).
[0041] FIG. 6 shows, according to particular aspects, content of
amplifiable DNA after bisulfite treatment and subsequent
purification (the content is defined by the ratio of amplifiable
DNA determined according to Example 10c and UV value determined
according to Example 10a which reflects the total amount of DNA
present in the sample; Example 12).
[0042] FIG. 7 shows, according to particular aspects, PCR
amplification of bisulfite specific amplicons ranging from 185 bp
to 711 bp. A: HMW template DNA (positive control). B: bisulfite
treated and subsequently purified template DNA derived from
paraffin-embedded formalin-fixed tissue. 30 ng template DNA and 1 U
Taq polymerase in a total volume of 25 .mu.l were used. C:
bisulfite treated and subsequently purified template DNA derived
from paraffin-embedded formalin-fixed tissue. 30 ng template DNA
and 3 U Taq polymerase in a total volume of 25 .mu.l were used
(Example 13).
[0043] FIG. 8 shows, according to particular aspects, total DNA in
lysates quantified according to Example 10d (CFF1 assay; data
scaled logarithmically). All data are means of four independently
processed samples per specimen including standard deviation
(Example 14).
[0044] FIG. 9 shows, according to particular aspects, total DNA in
extracts quantified according to Example 10d (CFF1 assay; data
scaled logarithmically). All data are means of four independently
processed samples per specimen including standard deviation
(Example 14).
[0045] FIG. 10 shows, according to particular aspects, DNA yield
after extraction (ratio of DNA in extract and DNA in lysate). All
data are means of four independently processed samples per specimen
including standard deviation (Example 14).
[0046] FIG. 11 shows, according to particular aspects, total amount
of DNA physically present as determined by UV spectrophotometry
(this DNA contains amplifiable as well as non-amplifiable DNA). All
data are means of four independently processed samples per specimen
including standard deviation (Example 14).
[0047] FIG. 12 shows, according to particular aspects, content of
amplifiable DNA in extracts. The content is determined by the ratio
of quantified DNA according to Example 10d (CFF1 assay) and of
quantified DNA according to Example 10a (UV value from which the
total amount of physically present DNA is calculated). All data are
means of four independently processed samples per specimen
including standard deviation (Example 14).
[0048] FIG. 13 shows, according to particular aspects, total DNA in
lysates quantified according to Example 10d (CFF1 assay; data
scaled logarithmically) (Example 15).
[0049] FIG. 14 shows, according to particular aspects, total DNA in
extract quantified according to Example 10d (CFF1 assay; data
scaled logarithmically) (Example 15).
[0050] FIG. 15 shows, according to particular aspects, yield of DNA
after extraction (ratio of DNA in extract and DNA in lysate)
(Example 15).
[0051] FIG. 16 shows, according to particular aspects, total amount
of DNA physically present as determined by UV spectrophotometry
(This DNA contains amplifiable as well as non-amplifiable DNA)
(Example 15).
[0052] FIG. 17 shows, according to particular aspects, content of
amplifiable DNA in extracts. The content is determined by the ratio
of quantified DNA according to Example 10d (CFF1 assay) and of
quantified DNA according to Example 10a (UV value from which the
total amount of physically present DNA is calculated) (Example
15).
[0053] FIG. 18 shows, according to particular aspects, total yield
of DNA after bisulfite treatment and subsequent purification. The
quantification was carried out according to Example 10d (CFF1
assay; data scaled logarithmically). All data are means of two
independently processed samples per specimen.
[0054] FIG. 19 shows, according to particular aspects, total yield
of DNA after bisulfite treatment and subsequent purification. The
quantification was carried out according to Example 10c (C3 assay;
data scaled logarithmically). All data are means of two
independently processed samples per specimen (Example 16).
[0055] FIG. 20 shows, according to particular aspects, total yield
of DNA after bisulfite treatment and subsequent purification. The
quantification was carried out according to Example 10d (CFF1
assay; data scaled logarithmically). All data are means of four
independently processed samples per specimen (Example 17).
[0056] FIG. 21 shows, according to particular aspects, total yield
of DNA after bisulfite treatment and subsequent purification. The
quantification was carried out according to Example 10c (C3 assay;
data scaled logarithmically). All data are means of four
independently processed samples per specimen (Example 17).
[0057] FIG. 22 schematically depicts the preparation of binding
conditions in the DNA purification procedure using a combination of
QIAAMP.RTM. Viral RNA Mini Kit and QIAAMP.RTM. 96 DNA Blood
Kit.
DETAILED DESCRIPTION OF THE INVENTION
[0058] For achieving various technical objects, aspects the
invention teach compositions and methods for providing DNA
fragments derived from an archived sample, characterized in that
the yield of DNA before an amplification step is at least 20%, and
amplicons up to a length of 1,000 base pairs are amplifiable.
Particular aspects provide methods to find amongst an enormous
plurality of known methods for paraffin removal, tissue lysis, DNA
extraction, bisulfite treatment, DNA purification and DNA
amplification those methods, which in principle can be used to
solve the technical object of the invention. Particular aspects
provide suitable combinations and adjustments of these methods with
each other in a manner that actually meets the technical
object(s).
ADVANTAGES OF ASPECTS OF THE INVENTION
[0059] In particular aspects, the exemplary inventive method has
the following advantages: It has a low handling effort because it
includes only a very limited amount of steps which has to be
carried out. Additionally, it is possible to carry out the method
of the invention in a plate scale. Moreover, the different steps
can also be automated and therefore robotics can also be used. The
execution in plate scale and the suitability of the method for
automatization also led to a reduction in costs. In addition, the
costs are further reduced by the use of devices and solutions which
are available at low expenses.
[0060] Another advantage of the method of the invention is that
every step can easily be performed because only standard laboratory
equipment is necessary for its execution.
[0061] Because of its simpleness, its suitability for
automatization, its low handling effort as well as its easy
handling, the method of the invention has a high reliability and
reproducibility. In addition, DNA provided by this method is
characterized by its high quality, even where an archived
paraffin-embedded formalin-fixed sample was used as a starting
material. Furthermore, DNA provided according to this method
comprises a notable fraction of long fragments (in the average 10%
of the fragments have at least a length of 110 bp) and surprisingly
long fragments are amplifiable (up to 600 bp). The DNA is further
characterized that only minor contaminant proteins or peptides are
linked to it. These contaminations are only so slightly that the
bisulfate treatment is only faintly impaired if at all.
[0062] On the other hand, relatively high yields of DNA can be
obtained reliably from the archived sample with an additional high
reproducibility. Therefore it is possible to obtain from only very
small samples sufficient DNA for methylation analysis.
METHOD OF ASPECTS OF THE INVENTION
[0063] The method of the invention is a method for providing DNA
fragments derived from an archived sample. According to the method
of the invention, the yield of DNA before any amplification is at
least 20%. For determination of the yield of DNA, the yield of DNA
of every step of the method according to the invention is
determined. The overall yield is then calculated by multiplication
of the yields of the individual steps as known by those skilled in
the art. The yield of DNA for each individual step can be carried
out (determined) as described in detail in the instant EXAMPLES 10,
12, and 14-18, or by any other suitable method known to those
skilled in the art, for example UV 260/280 nm or gel
electrophoresis especially in combination with a detection system
like a phosphor imager.
[0064] Furthermore, particular aspects of the exemplary inventive
are characterized in that amplicons up to a length of 1,000 bp are
amplifiable, whether or not a bisulfite treatment is carried out. A
bisulfite treatment step carried out according to the state of the
art reduces the ability of amplification of amplicons if the
bisulfite treated DNA is used as a template. However, the single
steps of the exemplary inventive methods are harmonized in such a
way and the bisulfite treatment step is carried out in such a way
that the application of a bisulfite treatment has nearly no
influence on the ability/efficiency of amplification.
[0065] In brief, the method of the invention is a method for
providing DNA fragments derived from an archived sample, which is
characterized in that [0066] the yield of DNA before an
amplification step is at least 20%, and [0067] amplicons up to a
length of 1,000 base pairs are amplifiable.
[0068] At this, amplifiable means that any amplicon of a desired
length can be amplified by the corresponding primers during a PCR
amplification. The PCR amplification can be standard PCR or real
time PCR or any known PCR amplification known to those skilled in
the art. Of course, also methods which lead to similar results like
ligase mediated chain reaction (LCR) or the NASBA/TMA technique can
be used. The amplicon is then detected by means of fluorescence by
standard techniques, for example by means of intercalating dyes
like ethidium bromide or SYBR green or labels attached to the used
primers or nucleotides. Suitable methods for detection are known to
those skilled in the art.
[0069] In a further embodiment, the method of the invention is
characterized in that [0070] the yield of DNA before an
amplification step is 20-60%, and [0071] amplicons up to a length
of 600 base pairs are amplifiable.
[0072] In a particular preferred embodiment, the method of the
invention comprises a bisulfite treatment step. After the then
necessary DNA purification step, the overall yield of DNA is at
least 20%, preferable in the range of 30-50%. Furthermore, the DNA
after bisulfite treatment and the purification step is further
characterized in that at least 5 of the DNA fragments are
amplifiable in a PCR reaction resulting in fragments of at least
110 bp in length. In a particularly preferred embodiment, this DNA
is characterized in that 5-60% of the DNA fragments are amplifiable
in a PCR reaction resulting in fragments of at least 110 bp in
length. In an especially preferred embodiment, an average of 10% of
the purified DNA is amplifiable in a PCR reaction resulting in
fragments of at least 110 bp length. These values can be determined
as exemplified in Examples 10 and 14.
[0073] Therefore, in an embodiment, the method of the invention is
a method for providing DNA fragments derived from an archived
sample, characterized in that
[0074] a) the DNA is extracted,
[0075] b) the extracted DNA is treated with bisulfite,
[0076] c) the bisulfite treated DNA is purified, whereby [0077] (i)
the yield of purified DNA is at least 20% of the DNA contained in
the archived sample, and [0078] (ii) at least 5% of the purified
DNA is amplifiable in a PCR reaction generating fragments of at
least 110 bp length.
[0079] In a preferred embodiment, the method of the invention is
characterized in that the yield of the DNA in step c(i) is between
30-50%.
[0080] In a preferred embodiment, the method of the invention is
characterized in that in step c(ii) 5-60% of the purified DNA is
amplifiable in a PCR reaction generating fragments of at least 110
bp length.
[0081] In a preferred embodiment, the method of the invention is
characterized in that in step c(ii) an average of 10% of the
purified DNA is amplifiable in a PCR reaction generating fragments
of at least 110 bp length.
[0082] In an especially preferred embodiment, the method of the
invention is further characterized in that in the average at least
10% of the DNA fragments are amplifiable after bisulfite treatment
and subsequent purification in a PCR reaction resulting in
fragments of at least 110 bp length.
[0083] In another especially preferred embodiment, the method of
the invention is further characterized in that between 7-60% of the
DNA fragments are amplifiable after bisulfite treatment and
subsequent purification in a PCR reaction resulting in fragments of
at least 70 bp in length. More preferably, in the average, 15% are
amplifiable after bisulfite treatment and subsequent purification
in a PCR reaction resulting in fragments of at least 70 bp in
length.
Archived Sample
[0084] According to the invention, the archived sample is a
paraffin-embedded and/or fixed tissue biopsy or a paraffin embedded
and/or fixed tissue section or parts thereof for example
microdissected samples. Thereby, the term "biopsy" refers to any
kind of needle biopsy or any kind of tissue sample collected during
a surgery. Moreover, the term "tissue section" refers to any part
of a biopsy for example derived by microtom sectioning of the
biopsy.
[0085] As it is well known by those skilled in the art, it is
difficult to determine the actual weight of a tissue section. These
difficulties are caused therein that the section is usually
brittle, teeny and sticky. Furthermore, it is also important to
have in mind the percentage of paraffin which surrounds the tissue.
According to the invention, samples are preferred which have a
paraffin percentage of 50% or less. Typically 1-6, in particularly
three sections of 10 .mu.m thickness with a tissue area in the
range of 0.7 cm.times.0.7 cm to 2.5 cm.times.3.5 cm are used as a
starting material. A person with ordinary skill in the art will
know how to adjust the method according to invention to use samples
which have a paraffin percentage of more than 50% or in case
sections are used with a smaller or larger tissue area. For samples
obtained by biopsies, different amounts are chosen as a starting
material. Typically 1-6, in particularly three sections of 10 .mu.m
thickness of a biopsy sample are used. The biopsy sample comprises
1-6, preferable 3 biopsies embedded into paraffin. Typical biopsies
are cylindrical having a diameter of about 1 cm, the length cannot
be standardized. A person with ordinary skill in the art will know
to choose a sufficient amount of starting material from a biopsy
sample if the sample contains more biopsies. In addition, he would
also know how to choose an equivalent amount of non-sectioned
biopsy, which can be used according to the invention. Again, a
person with ordinary skill in the art will know how to choose an
appropriate amount of starting material. Of course, the method of
the invention is also applicable for samples fixed with other
fixatives like glutaraldehyd, Bouin' fixative, isopentane, or
alcohol based fixatives like methanol or ethanol.
[0086] In an embodiment of the invention, the archived sample is a
formalin-fixed sample, typically embedded into paraffin. But also
formalin treated samples which are not embedded into paraffin can
be used as a starting material. Of course, fresh or fresh frozen
samples can also be subject of the method according to the
invention which will than start directly with the lysis step.
[0087] In an embodiment of the invention, the archived sample is a
paraffin-embedded and/or fixed tissue biopsy or a paraffin-embedded
and/or fixed tissue section.
STEPS OF THE METHOD ACCORDING TO THE INVENTION
[0088] An embodiment of the invention comprises an optional
paraffin removal step, a lysis step, an optional DNA extraction
step, an optional bisulfite treatment step, an optional
purification step and an amplification step. The method can be
carried out in plate scale or tube scale. It can be conducted
manually or by a roboter. So, it is possible to carry out the
method of the invention manually in tube scale as well as in plate
scale manually or by a roboter. This latter possibility has the
advantage of a low handling effort and a reduction in costs.
[0089] An embodiment of the invention comprises a paraffin removal
step, a lysis step, a DNA extraction step, a bisulfite treatment
step, a purification step and an amplification step.
[0090] In another embodiment, the archived sample is directly
subjected to a lysis step, wherein the paraffin is liquefied by
heating. This lysis step typically leads to DNA free from
cross-links, making it possible to also leave out the DNA
extraction step and continuing with the bisulfite treatment step if
desired, followed by the amplification step.
[0091] For the two above mentioned embodiments, it is preferred
that the bisulfite step can be left out as well as the subsequent
purification step for suitable applications that may follow.
Therefore, in a particular embodiment, it is preferred that the DNA
extraction step is carried out by means of MINELUTE.TM. columns
which are part of the QIAAMP.RTM. DNA Micro Kit. Very surprisingly,
such a proceeding leads to the advantage that the portion of
amplifiable DNA is comparably large if the eluate of the first step
of elution from the MINELUTE.TM. columns is used (see below).
[0092] To leave out the bisulfite treatment step and the subsequent
DNA purification step is also particularly preferred if a bisulfite
treatment is not necessary for the analysis of the DNA methylation
for example by use of restriction enzymes. An example for such a
method is the DMH method as it is described below or the
restriction assay also known as Mest evaluation method as described
in DE102004029700.2 or in PCT/DE205/001109 (both references
incorporated by its entirety).
[0093] In principle, for the above named embodiments, it is also
possible to leave out the amplification step if it is not necessary
for subsequent analysis like methylation sensitive restriction and
subsequent southern blot analysis. On the other hand, an
amplification step might be advantageous even it is not necessary
for the real detection of the DNA methylation status. This is, for
example, the case if only low amounts of large DNA fragments are
provided. An amplification will in this case cause a lowering of
the sensitivity of the subsequent methods for the DNA methylation
analysis.
[0094] The method according to invention comprises the following
steps:
[0095] a) optional, a paraffin removal step,
[0096] b) a lysis step,
[0097] c) optional, a DNA extraction step
[0098] d) optional, a bisulfite treatment step
[0099] e) optional, a purification step
[0100] f) an amplification step
Paraffin Removal Step
[0101] According to the invention, the paraffin removal step
comprises the dissolving of paraffin by an organic solvent. In a
preferred embodiment, the sample is additional washed with another
organic solvent which enables afterwards a better rehydratisation.
Therefore, in an embodiment, the paraffin removal step comprises
the dissolving of paraffin by an organic solvent or the dissolving
of paraffin by an organic solvent and washing by another organic
solvent.
[0102] In a preferred embodiment, the organic solvent which
dissolves paraffin is a solvent of the group "limonene, xylene or
any mixture of these solvents". In particular, it is preferred that
the organic solvent is limonene. This is especially favorable
because limonene is less hazardous and less harmful to health and
environment than other suitable solvents. Additionally, it is also
possible to use organic solvents like benzene, ethylbenzene,
toluene, isoparaffin (also known as x-tra-solve (medite
medizintechnik)) or any solvent with similar chemical properties or
any mixture of said solvents.
[0103] An organic solvent which is suitable for washing the sample
and preparing it for a better rehydratisation after dissolving
paraffin is a solvent of the group of "ethanol, methanol,
isopropanol or any mixture of these solvents with each other or
with water". It is particularly preferred to use ethanol as a
washing solvent after dissolving paraffin. Of course, additional
solvents with comparable chemical properties can also be used.
[0104] In an embodiment of the invention, the organic solvent for
dissolving paraffin is a solvent of the group "limonene, xylene or
any mixture of these solvents", and wherein the washing solvent is
a solvent of the group of "ethanol, methanol, isopropanol or any
mixture of these solvents with each other or with water."
[0105] In a preferred embodiment of the invention, the paraffin
removal step comprises the addition of a suitable volume of
limonene to the archived sample. The volume of limonene is thereby
dependent on the amount of sample. For 1-6 10 .mu.m sections, which
are typically used as a starting material (see above), 0.1-3 ml of
limonene are used. A person with ordinary skill in the art will
know how to adjust the volume of limonene to smaller or larger
samples. After incubation, preferably for at least 5 min at
10-70.degree. C. and centrifugation, the limonene with the
dissolved paraffin is removed.
[0106] In an embodiment of the invention, the paraffin removal step
comprises [0107] addition of 0.1-3 ml of limonene to the archived
sample, [0108] incubation for at least 5 min at 10-70.degree. C.,
[0109] centrifugation, and [0110] removal of the limonene.
[0111] In a particularly preferred embodiment, 0.5-1.5 ml,
preferably 1 ml of limonene is added to the archived sample in
order to remove the paraffin. Subsequently, the sample is incubated
with agitation for 5-120 min at 15-30.degree. C., preferably for
10-60 min at room temperature. The agitation can be continuous or
is briefly repeated several times. After centrifugation for at
least 5,000.times.g for 1-20 min, preferably for 5 min, the tissue
is located at the bottom of the tube and the mixture of limonene
and paraffin is removed.
[0112] In an embodiment of the invention, the paraffin removal step
comprises [0113] addition of 1 ml of limonene to the archived
sample, [0114] incubation for 10 min-1 h at room temperature mixing
the sample, and [0115] centrifugation for at least 5,000.times.g
for 5 min, and removal of the limonene.
[0116] In a preferred embodiment of the invention, the tissue
sample after the removal of paraffin is washed with ethanol. If the
typical amount of sample (1-6 10 .mu.m thick sections) is used, a
suitable volume of ethanol for this washing step is 0.1-3 ml. A
person with ordinary skill in the art will know how to adjust this
volume if smaller or larger samples are used. After the addition of
ethanol, the sample is incubated at 15-30.degree. C. for up to 10
min. But even longer incubations are possible because they are not
unfavorable. After centrifugation, the ethanol is removed and the
tissue sample is dried at 15-65.degree. C.
[0117] In an embodiment of the invention, the washing solvent is
ethanol and the embodiment comprises addition of 0.1-3 ml of
ethanol, [0118] optional, incubation for up to 10 min at
15-30.degree. C., [0119] centrifugation, [0120] removal of the
ethanol, and [0121] drying.
[0122] In a particularly preferred embodiment, 0.5-1.5 ml
preferably 1.0 ml of ethanol is added as a washing solution. The
incubation takes place for 1-10 min, preferably for 10 min at room
temperature with agitation. The agitation can be continuous or is
briefly repeated several times. After centrifugation for at least
5,000.times.g for 1-20 min, preferably for 5 min, the tissue is
located at the bottom of the tube and the ethanol is removed. The
tissue sample is dried at 45-65.degree. C. for 5-60 min, preferably
at 50.degree. C. for 10-30 min.
[0123] A preferred embodiment of the invention comprises the
following steps: [0124] addition of 1 ml ethanol, [0125] incubation
for 10 min at room temperature mixing the sample, [0126]
centrifugation at least 5,000.times.g for 5 min, [0127] removal of
the ethanol, and [0128] incubation for 10-30 min at 50.degree.
C.
Lysis Step
[0129] In an embodiment of the invention, the lysis step is carried
out by the use of protease. This protease can be a serin protease,
a thiol protease, a carboxy protease, a metalloprotease, proteinase
K or any mixture of these proteases.
[0130] Depending on the protease, the time for digestion may vary.
The reason for this are the different activities of the proteases.
According to the invention, it is preferred to choose a protease
with a high enzymatic activity, but according to the invention, it
is also preferred to choose a protease which is available at low
cost. Therefore, it is particularly preferred to choose a protease
with a high enzymatic activity/cost ratio. Because of that, it is
particularly preferred to choose proteinase K for lysis.
[0131] In addition, the time for digestion varies also dependent on
the texture and nature of the tissue sample. For example, tissues
like breast tissue are digested rather quickly, because of the
loose cohesion of the cells. On the hand, tissues like colon or
liver tissue might need longer digestions because of the
compactness of the tissue.
[0132] Another important factor which has a significant influence
on the time of digestion is the geometrical shape of the sample. In
general, samples with a large surficial area are easier digestable
than samples with a smaller surficial area if they have the same
texture and nature and if the same protease is used for digestion.
Therefore, it is preferred to use tissue sections or to cut larger
tissue samples into pieces. But, according to the invention, it is
also preferred to adjust the time for digestion on the geometrical
shape of the tissue samples. In doing so, it is not necessary any
more to cut larger tissue sections into pieces. Because this also
lowers the handling effort, it is particularly preferred to use
long times for digestion.
[0133] Longer digestion times are also particularly more preferred
because it is supposed that they enable a better removal of
cross-linked proteins or peptides from the DNA. The importance of a
complete removal of contaminated protein or peptides is already
explained in detail above. According to the invention, it is
preferred to lyse the tissue samples with proteinase K not longer
than 60 h, in particular not longer than 48 h because of efficiency
reasons. This is usually sufficient for a complete digestion
removing all contaminated proteins and peptides.
[0134] Taken the above said into account, the minimum time of
digestion is 2.5 h, preferably 3 h. This is especially the case for
easy to digest tissues which have a large surface area and the use
of proteinase K.
[0135] Furthermore, for a better removal of contaminant proteins or
peptides, it is particularly preferred to add an additional amount
of protease after the first 24 h of digestion. This is recommended
because the enzymatic activity decreases over time because of
self-digestion. For some tissues it might be advantageous to add
additional amounts of protease for several times. For example, for
colon or prostate tissue, it is particularly preferred to add three
times proteinase K.
[0136] In an embodiment of the invention, the lysis step is carried
out by the use of a protease selected from the group "a serine
protease, a thiol protease, a carboxy protease, a metalloprotease,
proteinase K or any mixture of these proteases".
[0137] In a preferred embodiment, the lysis step comprises the
addition of 0.05-1 ml of a lysis buffer to 1-10 deparaffinated
formalin-fixed tissue sections of 10 .mu.m thickness or an equal
amount of a deparaffinated formalin-fixed tissue biopsy. The lysis
buffer comprises 50 mmol/l Tris(tris-hydroxymethyl-amino-methan) pH
8.0, 1 mmol/l EDTA, 0.5% Tween 20 v/v. Of course, the use of any
other lysis buffer as it is known by those skilled in the art is
possible. Subsequently, 0.1-3 mg of proteinase K is added.
Proteinase K may be dissolved in a suitable buffer, preferentially
the used lysis buffer. This can be done by addition of 10-100 .mu.l
of a proteinase K solution comprising 10-30 g/l proteinase K. After
the addition of the protease, the mixture is agitated. The mixture
is incubated for at least 2.5 h at 40-70.degree. C. Thereafter, if
desired, the proteinase K can be inactivated by heating or by the
use of inhibitors. A person with ordinary skill in the art knows
how to adjust the volume of said solutions if the thickness of the
section varies or if a smaller or larger amount of sample is
used.
[0138] In a preferred embodiment, the lysis step comprises [0139]
addition of 0.05-1 ml of lysis buffer comprising 50 mmol/l
tris-hydroxymethyl-amino-methan pH 8.0, 1 mmol/l EDTA, 0.5% Tween
v/v to 1-10 deparaffinated formalin-fixed tissue sections or an
equal amount of a deparaffinated formalin-fixed tissue biopsy,
[0140] addition of 10-100 .mu.l of proteinase K comprising 10-30
g/l proteinase K, subsequently agitating the sample, [0141]
incubation for at least 2.5 h at 40-70.degree. C., and [0142]
optional, inactivation of the proteinase K by heating or by use of
an inhibitor.
[0143] In a particularly preferred embodiment, the lysis step
comprises the addition of 100-300 .mu.l, preferably 190 .mu.l of
lysis buffer to 1-10 deparaffinated formalin-fixed tissue sections
of 10 .mu.m thickness or an equal amount of a deparaffinated
formalin-fixed tissue biopsy. Furthermore, 0.45-1.5 mg, preferably
0.6 mg, of proteinase K are added. In particular, the proteinase K
is added as 15-50 .mu.l, preferably as 20 .mu.l, of a proteinase K
solution comprising 30 .mu.g/.mu.l proteinase K. The subsequent
agitation is carried out by rigorous vortexing. After this, the
mixture is incubated for 2.5-60 h at 45-65.degree. C., preferably
for 3-48 h at 50-60.degree. C., wherein the mixture is agitated
continuously or briefly repeated many times. The inactivation of
the proteinase K can be achieved by incubation of the mixture for
5-20 min at least at 90.degree. C., preferably for 10 min at least
at 95.degree. C. In a special variant, it is preferred that at
least 0.6 mg of proteinase K, for example 20 .mu.l of a 30
.mu.g/.mu.l proteinase K solution after the first 24 h of the
incubation are added. A person with ordinary skill in the art knows
how to adjust the volume of said solutions if the thickness of the
section varies or if smaller or larger amount of sample is
used.
[0144] In a preferred embodiment, the lysis step comprises [0145]
addition of 190 .mu.l of lysis buffer to 1-6 deparaffinated
formalin-fixed tissue sections or an equal amount of a
deparaffinated formalin-fixed tissue biopsy, [0146] addition of 20
.mu.l of proteinase K solution comprising 30 g/l proteinase K,
subsequent rigorously vortexing, [0147] incubation for 3-48 h at
50.degree. C.-60.degree. C. mixing the sample, and optional,
addition of at least 20 .mu.l proteinase K solution after the first
24 h incubation at 50.degree. C.-60.degree. C., and [0148]
incubation for 10 min at least at 95.degree. C.
[0149] In another preferred embodiment, the archived sample is
directly subjected to the lysis step which comprises the addition
of 0.05-1 ml of a lysis buffer to 1-10 deparaffinated
formalin-fixed tissue sections of 10 .mu.m thickness or an equal
amount of a deparaffinated formalin-fixed tissue biopsy. The lysis
buffer comprises 50 mmol/l Tis (tris-hydroxymethyl-amino-methan) pH
8.0, 1 mmol/l EDTA, 0.5% Tween 20 v/v. Preferably, it also
comprises 5 ng/.mu.l poly-dA DNA. Of course, other suitable lysis
buffers as they are known to those skilled in the art can also be
used. Subsequently, the mixture is incubated for 5-20 min at
40-75.degree. C. After this, 0.15-1.2 mg of proteinase K, for
example, 5-40 .mu.l of a 30 .mu.g/.mu.l proteinase K solution is
added. The mixture is then incubated for at least 2.5 h at
40-70.degree. C. with agitation. Thereafter, if desired, the
proteinase K can be inactivated by heating or by the use of
inhibitors. A person with ordinary skill in the art knows how to
adjust the volume of said solutions if the thickness of the section
varies or if smaller or larger amount of sample is used.
[0150] In a preferred embodiment, the archived sample is directly
subjected to the lysis step which comprises [0151] addition of
50-1,000 .mu.l lysis buffer to 1-10 deparaffinated formalin-fixed
tissue sections or an equal amount of a deparaffinated
formalin-fixed tissue biopsy, the lysis buffer pH 8.0 comprising 50
mmol/l tris-hydroxymethyl-amino-methan, 1 mmol/l EDTA, 0.5% Tween
v/v, and optional 5 ng/.mu.l poly-dA DNA, [0152] incubation for
5-20 min at 40-75.degree. C., [0153] addition of 5-40 .mu.l
proteinase K solution, the proteinase K solution comprising 30
mg/ml proteinase K, [0154] incubation for at least 2.5 h at
40-70.degree. C., and [0155] optional, inactivation of the
proteinase K by heating or by use of an inhibitor.
[0156] In a particularly preferred variant, 75-200 .mu.l,
preferably 100 .mu.l, of lysis buffer are added to 1-6
deparaffinated formalin-fixed tissue sections of 10 .mu.m thickness
or an equal amount of a deparaffinated formalin-fixed tissue
biopsy. After the addition, the mixture is incubated for 7-15 min
at 50-70.degree. C. in a thermomixer at 500-2,000 rpm, preferably
for 10 min at 65.degree. C. in a thermomixer at 1,000 rpm.
Subsequently, 0.21-0.6 mg, preferably 0.3 mg of proteinase K, for
example 7-20 .mu.l, preferably 10 .mu.l of a 30 .mu.g/.mu.l
proteinase K solution is added. The mixture is then incubated for
2.5-60 h at 50-65.degree. C. in a thermomixer at 1,000-2,000 rpm,
preferably for 3-48 h at 60.degree. C. in a thermomixer at 1,400
rpm. The proteinase K can be inactivated by incubation of the
mixture for 5-20 min at least at 90.degree. C., preferably for 10
min at least at 95.degree. C. The inactivation of proteinase K can
also be achieved by the addition of proteinase K inhibitors. A
person with ordinary skill in the art knows how to adjust the
volume of said solutions if the thickness of the section varies or
if smaller or larger amount of sample is used.
[0157] In a particularly preferred embodiment, the lysis step
comprises [0158] addition of 100 .mu.l lysis buffer to 1-6
deparaffinated formalin-fixed tissue sections or an equal amount of
a deparaffinated formalin-fixed tissue biopsy, [0159] incubation
for 10 min at 65.degree. C. in a thermomixer at 1,000 rpm, [0160]
incubation at 50.degree. C. in a thermomixer at 1,400 rpm, [0161]
addition of 10 .mu.l proteinase K solution, [0162] incubation for
3-48 h at 60.degree. C. in thermomixer at 1,000 rpm, and [0163]
incubation for 10 min at >95.degree. C.
[0164] In case the archived sample is directly subjected to the
lysis step, it is preferred that the DNA may be directly subjected
to the bisulfite treatment leaving out the DNA extraction step.
This is in particular preferred if the amount of archived sample is
small or if a person with ordinary skill in the art would expect
only small yields of DNA.
DNA Extraction Step
[0165] A lot of methods are known to those skilled in the art for
DNA extraction from tissue samples (Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor
Laboratory Press).
[0166] To reduce the handling effort and also to ensure a high
reproducibility as well as reliability, it is preferred to use a
kit for DNA extraction. For one with ordinary skill in the art, a
huge amount of kits is known which might be suitable for DNA
extraction.
[0167] Therefore, in a first step, the most promising kits were
chosen for subsequent tests. These kits are: QIAAMP.RTM. DNA Mini
Kit, ZR GENOMIC.TM. DNA II kit, MAGNASIL.RTM. Genomic, Fixed Tissue
System, MAGNA-PURE.TM. LC DNA Isolation Kit II (Tissue), Nexttec
tissue kit, CHARGE SWITCH.RTM. Forensic DNA Purification Kit, and
CHARGE SWITCH.RTM. genomic DNA Purification kit.
[0168] In a second step, these kits were tested in view of a DNA
extraction, wherein the following criteria were used: i) a minimal
handling effort; ii) a minimal length of time; iii) yield of DNA;
iv) the ability of amplification after the extraction step; and v)
purity of the DNA by means of UV light (260 nm/280 nm ratio
preferably in the range of 1.7-1.9). The QIAAMP.RTM. DNA Mini Kit
was used as a reference. Best results were just obtained by the
QIAAMP.RTM. DNA Mini Kit.
[0169] Therefore, according to the invention and for best results,
the QIAAMP.RTM. DNA Mini Kit is preferably used. In addition, also
kits are preferably used which contain the same solutions and/or
equivalent materials such as columns or buffers. Such kinds of kits
are, for example, the DNEASY.RTM. 96 Tissue Kit, the QIAAMP.RTM. 96
DNA Blood Kit, the QIAAMP.RTM. DSP 96 Virus MDX Kit, the
DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Micro Kit, QIAAMP.RTM.
Viral RNA Mini kit or the QIAAMP.RTM. DSP Virus Kit (all
QIAGEN.RTM.).
[0170] In an embodiment of the invention, the DNA extraction step
is characterized in that the DNA to be extracted binds to silica
surfaces, in particular to silica membranes.
[0171] In an embodiment, the DNA extraction step is characterized
by a binding of DNA to silica surfaces, in particular to silica
membranes.
[0172] It is particularly preferred that the DNA extraction step is
carried out by means of the DNEASY.RTM. 96 Tissue Kit, the
QIAAMP.RTM. 96 DNA Blood Kit, the QIAAMP.RTM. DSP 96 Virus MDX Kit,
the DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini Kit, or the
QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini or the
QIAAMP.RTM. DSP Virus Kit (all QIAGEN.RTM.).
[0173] In principle, other kits are also useable according to the
invention as long as they lead to similar results. Those kits are,
for example, kits which are based on the "charge-switch"-technology
(Invitrogen) or the "nexttec"-technology (nexttec GmbH). These can
be the Nexttec tissue kit, the ChargeSwitch.RTM. Forensic DNA
Purification Kit, and the CHARGE SWITCH.RTM. genomic DNA
Purification kit.
[0174] In an embodiment, one or more of the following kits are used
in the DNA extraction step: DNEASY.RTM. 96 Tissue Kit, QIAAMP.RTM.
96 DNA Blood Kit, QIAAMP.RTM. DSP 96 Virus MDX Kit, DNEASY.RTM.
Tissue Kit, QIAAMP.RTM. DNA Mini Kit, QIAAMP.RTM. DNA Micro Kit,
QIAAMP.RTM. Viral RNA Mini or the QIAAMP.RTM. DSP Virus Kit.
[0175] In embodiments of the invention, the binding buffer AL is
replaced by the binding buffers ATL or AVL. A person with ordinary
skill in the art knows how to adjust the method of the invention
accordingly. The buffers ATL and AVL can also be premixed like the
buffer AL with ethanol as known to those skilled in the art.
Therefore, in embodiments of the invention, the binding buffer AL/E
is replaced by the binding buffers ATL/E or AVL/E. A person with
ordinary skill in the art knows how to adjust the method of the
invention accordingly.
[0176] In an especially preferred embodiment, the DNA extraction
step is carried out according to the DNEASY.RTM. 96 Tissue Kit or
the QIAAMP.RTM. 96 DNA Blood Kit. Also, the QIAAMP.RTM. DSP 96
Virus MDx Kit can be used if only small amounts of DNA are
expected. According to this embodiment, 100-600 .mu.l of the
binding buffer AL/E, ATL/E or AVL/E (QIAGEN.RTM.) are added to the
mixture derived from the lysis step. The lysate is derived from
1-10 deparaffinated formalin-fixed tissue sections of 10 .mu.m
thickness or an equal amount of a deparaffinated formalin-fixed
tissue biopsy. After agitation, the mixture is applied onto a
column of a plate of the DNEASY.RTM. 96 Tissue Kit, the QIAAMP.RTM.
96 DNA Blood Kit or the QIAAMP.RTM. DSP 96 Virus MDX Kit (all
QIAGEN.RTM.). The column is washed with the buffers AW1
(QIAGEN.RTM.) and AW2 (QIAGEN.RTM.) before the DNA is eluted by
20-200 .mu.l of elution buffer. The elution buffer can be AE, AVE
or EB (all QIAGEN.RTM.) or water. Typically, the elution buffer is
adjusted to 15-80.degree. C. After the addition of the preheated
elution buffer, the column is incubated for at least 30 s at
15-40.degree. C. before it is centrifuged. The flow-through of the
column contains the DNA to be extracted. A person with ordinary
skill in the art knows how to adjust the volume of the solutions if
the thickness of the section varies or if smaller or larger amount
of sample is used.
[0177] In an embodiment, the DNA extraction step is carried out
according to the DNEASY.RTM. 96 Tissue Kit, the QIAAMP.RTM. 96 DNA
Blood Kit or the QIAAMP.RTM. DSP 96 Virus MDx Kit comprising [0178]
addition of 100-600 .mu.l of binding buffer AL/E, ATL/E or [0179]
AVL/E to a lysate derived from 1-10 deparaffinated formalin-fixed
tissue sections or an equal amount of a deparaffinated
formalin-fixed tissue biopsy, [0180] application of the mixture
onto a plate, [0181] washing with washing buffer AW1 and AW2, and
[0182] elution by addition of 20-200 .mu.l elution buffer AE, AVE,
EB or water adjusted to 15-80.degree. C., incubation for at least
30 s at 15-40.degree. C., and centrifugation.
[0183] According to this embodiment, it is particularly more
preferred that 300-500 .mu.l of binding buffer AL/E, ATL/E or AVL/E
are added to 100-300 .mu.l of lysate derived from to 1-6
deparaffinated formalin-fixed tissue sections of 10 .mu.m thickness
or an equal amount of a deparaffinated formalin-fixed tissue
biopsy, preferably 400 .mu.l of binding buffer AL/E are added to
200 .mu.l of lysate. The shaking is performed by shaking with both
hands for 10-30 s, preferably for 15 s. After application of the
mixture onto a column of a plate, the plate is centrifuged for 5-20
min at 4,000-6500.times.g, preferably for 10 min at 5,790.times.g.
The washing with the buffers AW1 and AW2, respectively, is carried
out by application of 300-700 .mu.l, preferably of 500 .mu.l of
washing buffer followed by a centrifugation for 5-20 min at
4,000-6500.times.g, preferably for 10 min at 5,790.times.g. After
the washing steps, the columns of a plate are dried by
centrifugation for 10-30 min at 4,000-6,500.times.g, preferably for
15 min at 5,790.times.g. The DNA is eluted by addition of 90-150
.mu.l, preferably of 120 .mu.l of elution buffer preheated to
50-75.degree. C., preferably to 70.degree. C., followed by an
incubation for 1-20 min at 17-30.degree. C., preferably for 5 min
at room temperature, and a subsequent centrifugation for 1-10 min
at 4,000-6,500.times.g, preferably for 2 min at 5,790.times.g. The
flow-through of the column containing the DNA can be stored
+4.degree. C. to -80.degree. C. A person with ordinary skill in the
art knows how to adjust the volume of the solutions if the
thickness of the section varies or if smaller or larger amount of
sample is used.
[0184] In an embodiment, the DNA extraction step comprises [0185]
addition of 400 .mu.l of binding buffer AL/E, ATL/E or AVL/E to 200
.mu.l lysate derived from 1-6 deparaffinated formalin-fixed tissue
sections or an equal amount of a deparaffinated formalin-fixed
tissue biopsy, [0186] shaking for 15 s with both hands, [0187]
application of the mixture onto a plate, [0188] centrifugation for
10 min at 5790.times.g, [0189] application of 500 .mu.l washing
buffer AW1 and subsequent centrifugation at 5,790.times.g for 5
min, [0190] application of 500 .mu.l washing buffer AW2 and
subsequent centrifugation at 5,790.times.g for 5 min, [0191] drying
of the column by centrifugation at 5,790.times.g for 15 min, and
[0192] elution by addition of 120 .mu.l elution buffer AE, AVE or
EB or water preheated to 70.degree. C., incubation for 5 min at
room temperature and centrifugation for 2 min at 5,790.times.g.
[0193] In a further especially preferred embodiment, the DNA
extraction step is carried out according to the DNEASY.RTM. Tissue
Kit, the QIAAMP.RTM. DNA Mini Kit or the QIAAMP.RTM. DNA Micro Kit.
Also, the QIAAMP.RTM. Viral RNA Mini or the QIAAMP.RTM. DSP Virus
Kit can be used if only small amounts of DNA are expected.
According to this embodiment, 150-300 .mu.l of the binding buffer
AL, ATL or AVL (QIAGEN.RTM.) are added to the lysate derived from
to 1-6 deparaffinated formalin-fixed tissue sections of 10 .mu.m
thickness or an equal amount of a deparaffinated formalin-fixed
tissue biopsy. The mixture is incubated for at least 5 min at
45.degree. C.-80.degree. C. with agitation. Subsequently, 150-300
.mu.l of ethanol are added, after which the sample is agitated,
centrifuged and applied onto a column of the DNEASY.RTM. Tissue
Kit, the QIAAMP.RTM. DNA Mini Kit, the QIAAMP.RTM. DNA Micro Kit,
the QIAAMP.RTM. Viral RNA Mini, or the QIAAMP.RTM. DSP Virus Kit.
After centrifugation, the column is washed with the washing buffers
AW1 and AW2. To dry the column, it is favorable to centrifuge the
column, but this is not necessary. The DNA is eluted from the
column by applying in one or two elution steps up to 180 .mu.l of
elution buffer onto the column. The elution buffer can be AE, AVE
or EB (all QIAGEN.RTM.) or water adjusted to room temperature. Of
course, other similar buffers are also suitable as long as do not
interfere with the subsequent steps. After addition of the elution
buffer, the column is incubated at room temperature, before it is
centrifuged. The flow-through of the column contains the DNA to be
extracted. A person with ordinary skill in the art knows how to
adjust the volume of the solutions if the thickness of the section
varies or if smaller or larger amount of sample is used.
[0194] In a particular embodiment, the DNA extraction step is
carried out by means of a MINELUTE.TM. column. These columns are,
for example, part of the QIAAMP.RTM. DNA Micro Kit. Very
surprisingly, DNA eluted in the first step of the elution of
extracted DNA from these columns results in better ability of
amplification. As already mentioned above, the use of a
MINELUTE.TM. column improves the ability of amplification if a
bisulfite treatment step and subsequent DNA purification step is
carried out or not.
[0195] In an embodiment, the DNA extraction step is carried out
according to the DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini
Kit, the QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini,
or the QIAAMP.RTM. DSP Virus Kit comprising [0196] addition of
150-300 .mu.l of binding buffer AL, ATL or AVL to the lysate
derived from 1-6 deparaffinated formalin-fixed tissue sections or
an equal amount of a deparaffinated formalin-fixed tissue biopsy,
[0197] incubation for at least 5 min at 45.degree. C.-80.degree. C.
agitating the sample, [0198] addition of 150-300 .mu.l of ethanol,
subsequently agitating the sample and centrifugation, [0199]
application of the mixture onto a column, [0200] centrifugation,
[0201] washing with washing buffer AW1 and AW2, [0202] optional,
centrifugation, and [0203] elution in one or two steps by addition
of up to 180 .mu.l elution buffer AE, AVE or EB or water adjusted
to room temperature, incubation at room temperature and
centrifugation.
[0204] According to this embodiment, it is particularly more
preferred that 175-250 .mu.l of binding buffer AL are added to
175-250 .mu.l of lysate, preferable 200-210 .mu.l of binding buffer
AL, ATL or AVL are added to 210 .mu.l of lysate derived from 1-6
deparaffinated formalin-fixed tissue sections of 10 .mu.m thickness
or an equal amount of a deparaffinated formalin-fixed tissue
biopsy. The mixture is incubated for 5-25 min at 50.degree.
C.-75.degree. C. with agitation, preferably for 10 min at
56.degree. C.-70.degree. C. with agitation. Subsequently, 175-250
.mu.l, preferably 200-210 ml of ethanol are added, after which the
sample is agitated by pulse-vortexing for 15 s, and centrifuged for
1-20 s at 1,000-14,000.times.g, preferably for 5 s at
5,000.times.g. The mixture is then added on a column of the
DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini Kit, the
QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini, or the
QIAAMP.RTM. DSP Virus Kit. Subsequently, the columns are
centrifuged for 0.5-10 min at 4,000-8,000.times.g, preferably for 1
min at 6,000.times.g. The washing with the buffers AW1 is carried
out by application of 300-700 .mu.l, preferably of 500 .mu.l of AW1
followed by a centrifugation for 0.5-10 min at 4,000-8,000.times.g,
preferably for 1 min at 6,000.times.g. Subsequently, the washing
with the buffers AW2 is carried out by application of 300-700
.mu.l, preferably of 500 .mu.l of AW2 followed by a centrifugation
for 1-10 min at 15,000-25,000.times.g, preferably for 3 min at
20,000.times.g. To dry the column, it is favorable to centrifuge
the column for 0.5-5 min at 15,000-25,000.times.g, preferably for 1
min at 20,000.times.g, but this is not necessary. The DNA is eluted
from the column by applying 20-150 .mu.l, preferably 35-120 .mu.l
of elution buffer onto the column. The elution buffer can be AE,
AVE or EB (all QIAGEN.RTM.) or water adjusted to room temperature.
After addition of the elution buffer, the column is incubated at
room temperature for 0.5-15 min, preferably for 1-5 min. The column
is then centrifuged for 0.5-10 min at 4,000-8,000.times.g,
preferably for 1 min at 6,000.times.g. The flow-through of the
column contains the DNA to be extracted. Although it is not
necessary, it is favorable to carry out a second elution step,
wherein 20-80 .mu.l, preferably 35-60 .mu.l of elution buffer are
added onto the column. The elution buffer can be AE, AVE or EB (all
QIAGEN.RTM.) or water adjusted to room temperature. After addition
of the elution buffer, the column is incubated at room temperature
for 0.5-15 min, preferably for 1-5 min. The column is then
centrifuged for 0.5-10 min at 4,000-8,000.times.g, preferably for 1
min at 6,000.times.g. The flow-through of the column is combined
with the flow-through of the first elution step and can be stored
at 0.degree. C.-10.degree. C., preferably at 4.degree. C. for no
more than 2 days. If a longer storage is intended, the flow-through
is stored at -20.degree. C. to -80.degree. C. A person with
ordinary skill in the art knows how to adjust the volume of the
solutions if the thickness of the section varies or if smaller or
larger amount of sample is used.
[0205] In an embodiment, the DNA extraction step comprises [0206]
a) addition of 200-210 .mu.l of binding buffer AL, ATL or AVL to
210 .mu.l lysate derived from 1-6 deparaffinated formalin-fixed
tissue sections or an equal amount of a deparaffinated
formalin-fixed tissue biopsy, [0207] b) incubation for 10 min at
56.degree. C.-70.degree. C. mixing the sample, [0208] c) addition
of 200-210 .mu.l of ethanol, pulse-vortexing for 15 s and
centrifugation for 5 s at 5,000.times.g, [0209] d) application of
the mixture onto a column, [0210] e) centrifugation for 1 min at
6,000.times.g, [0211] f) application of 500 .mu.l washing buffer
AW1 and subsequent centrifugation at 6,000.times.g for 1 min,
[0212] g) application of 500 .mu.l washing buffer AW2 and
subsequent centrifugation at 20,000.times.g for 3 min, [0213] h)
optional, centrifugation at 20,000.times.g for 1 min using new
tubes, and [0214] i) elution by a first addition of 35-120 .mu.l
elution buffer AE, AVE or EB or water adjusted to room temperature,
incubation for 1-5 min at room temperature and centrifugation for 1
min at 6,000.times.g, and an optional second addition of 35-60
.mu.l elution buffer AE, AVE or EB or water adjusted to room
temperature, incubation for 1-5 min at room temperature and
centrifugation for 1 min at 6,000.times.g.
[0215] An alternative to the last embodiment is a variant, wherein
it is favorable to dry the column after the washing step with
buffer AW2 by beating the column on a Kleenex tissue on the bench
with a subsequent centrifugation for 0.5-10 min at
4,000-8,000.times.g, preferably for 1 min at 6,000.times.g. After
this, the elution is carried out by applying 25-200 .mu.l,
preferably of 50-150 .mu.l of elution buffer onto the column. The
elution buffer can be AE, AVE or EB (all QIAGEN.RTM.) or water
preheated to 30-50.degree. C., preferably to 40.degree. C. After
addition of the elution buffer, the column is incubated at room
temperature for 0.5-15 min, preferably for 1-5 min. The column is
then centrifuged for 0.5-10 min at 4,000-8,000.times.g, preferably
for 1 min at 6,000.times.g. The flow-through containing DNA is
again applied onto the same column. After the addition, the column
is incubated at room temperature for 0.5-5 min, preferably for 1
min. The column is then centrifuged for 0.5-10 min at
4,000-8,000.times.g, preferably for 1 min at 6,000.times.g. This
proceeding has the advantage that a higher recovery of DNA can be
eluted from the column not extending the elution buffer. A person
with ordinary skill in the art knows how to adjust the volume of
the solutions if the thickness of the section varies or if smaller
or larger amount of sample is used.
[0216] In a particular embodiment, steps h) and i) of the DNA
extraction step are replaced by the following steps k) and l),
respectively: [0217] k) optional, beating the column on a Kleenex
tissue on the bench with a subsequent centrifugation at
6,000.times.g for 1 min, and [0218] l) elution by addition of
50-150 .mu.l of buffer AE or water preheated to 40.degree. C.,
incubation for 1-5 min at room temperature, centrifugation at
6,000.times.g for 1 min, repeated application of this first eluate
onto the column, incubation for 1 min at room temperature and
centrifugation at 6,000.times.g for 1 min.
Bisulfite Treatment Step
[0219] In an embodiment, the bisulfite treatment step is
essentially carried out as described in WO05/038051 (this reference
is incorporated by its entirety). According to this, in one
embodiment DNA is reacted with a bisulfite reagent, characterized
in that said reaction is carried out in the presence of a compound
out of the group of dioxane, one of its derivatives and a similar
aliphatic cyclic ether.
[0220] In another embodiment, DNA is reacted with a bisulfite
reagent, characterized in that said reaction is carried out in the
presence of a compound of the following formula:
##STR00001##
n=1-35000 m=1-3
R1=H, Me, Et, Pr, Bu
R2=H, Me, Et, Pr, Bu
[0221] Preferred are thus n-alkylene glycol compounds, particularly
their dialkyl ethers, and especially diethylene glycol dimethyl
ether (DME).
[0222] The bisulfite conversion may take place both in solution as
well as also on DNA bound to a solid phase. Preferably sodium
disulfite (=sodium bisulfite/sodium metabisulfite) is used since it
is more soluble in water than sodium sulfite. The disulfite salt
disproportionates in aqueous solution to the hydrogen sulfite
anions necessary for the cytosine conversion. When bisulfite
concentration is discussed below, this refers to the concentration
of hydrogen sulfite and sulfite anions in the reaction solution.
For the method according to the invention, concentration ranges of
0.1 to 6 mol/l are possible. Particularly preferred is a
concentration range of 1 to 6 mol/l, and most particularly
preferred, 2-4 mol/l. However, when dioxane is used, the maximal
concentration of bisulfite that can be used is smaller (see below).
In selecting the bisulfite concentration, one must consider that a
high concentration of bisulfite leads to a high conversion, but
also leads to a high decomposition rate due to the lower pH.
[0223] Dioxane can be utilized in different concentrations.
Preferably, the dioxane concentration amounts to 10 to 35%
(vol/vol), particularly preferred is 20 to 30%, and most
particularly preferred is 22 to 28%, especially 25%. A dioxane
concentration higher than 35% is problematic, since this results in
a formation of two phases within the reaction solution. In the
particularly preferred embodiments with a dioxane concentration of
22-28%, the final preferred bisulfite concentration amounts to 3.3
to 3.6 mol/l, and in the most particularly preferred embodiment
with a dioxane concentration of 25%, it amounts to 3.5 mol/l (see
Examples).
[0224] The n-alkylene glycol compounds according to the invention
can be utilized in a different concentration range. DME is
preferably used in concentrations between 1-35% (vol/vol). There is
preferably between 5 and 25%, and most preferably 10% DME.
[0225] The preferred scavengers utilized according to the invention
are chromane derivatives, e.g.,
6-hydroxy-2,5,7,8,-tetramethylchromane 2-carboxylic acid (also
known as: Trolox-C.TM.). Further scavengers are listed in the
patent application WO 01/98528 (=DE 100 29 915; =U.S. application
Ser. No. 10/311,661; incorporated herein in its entirety).
[0226] The bisulfite conversion can be conducted in a wide
temperature range from 0 to 95.degree. C. However, as at higher
temperatures the rates of both the conversion and decomposition of
the DNA increase, in a preferred embodiment the reaction
temperature lies between 0-80.degree. C., preferably between
30-80.degree. C. Particularly preferred is a range between
50-70.degree. C.; most particularly preferred between 57-65.degree.
C. The optimal reaction time of the bisulfite treatment depends on
the reaction temperature. The reaction time normally amounts to
between 1 and 18 hours (see: Grunau et al. 2001, Nucleic Acids Res.
2001, 29 (13):E65-5; incorporated by reference herein in its
entirety). The reaction time is ordinarily 4-6 hours for a reaction
temperature of 60.degree. C.
[0227] In a particularly preferred embodiment of the method
according to the invention, the bisulfite conversion is conducted
at mild reaction temperatures, wherein the reaction temperature is
then clearly increased for a short time at least once during the
course of the conversion. In this way, the effectiveness of the
bisulfite conversion can surprisingly clearly be increased. The
temperature increases of short duration are named "thermospikes"
below. The "standard" reaction temperature outside the thermospikes
is denoted as the basic reaction temperature. The basic reaction
temperature amounts to between 0 and 80.degree. C., preferably
between 30-80.degree. C., more preferably between 50-70.degree. C.,
most preferably between 57-65.degree. C., as described above.
[0228] The reaction temperature during a thermospike is increased
to over 85.degree. C. by at least one thermospike. The optimal
number of thermospikes is a function of the basic reaction
temperature. The higher the optimal number of thermospikes is, the
lower is the basic reaction temperature. At least one thermospike
is necessary in each case. And, on the other hand, in principle,
any number of thermospikes is conceivable. Of course, it must be
considered that with a large number of temperature increases, the
decomposition rate of the DNA also increases, and an optimal
conversion is no longer assured. The preferred number of
thermospikes is thus between 1 and 10 thermospikes each time,
depending on the basic reaction temperature. A number of two to 5
thermospikes is thus particularly preferred. The thermospikes
increase the reaction temperature preferably to 85 to 100.degree.
C., particularly preferably to 90-100.degree. C., and most
preferably to 94.degree. C.-100.degree. C.
[0229] The duration in time of the thermospikes also depends on the
volume of the reaction batch. It must be assured that the
temperature is increased uniformly throughout the total reaction
solution. For a 20 .mu.l reaction batch when using a thermocycler,
a duration between 15 seconds and 1.5 minutes, especially a
duration between 20 and 50 seconds, is preferred. In a particular
preferred embodiment, the duration is 30 seconds. Operating on a
volume of 100 .mu.l, the preferred range lies between 30 seconds
and 5 minutes, especially between 1 and 3 minutes. Particularly
preferred are 1.5-3 minutes. For a volume of 600 .mu.l, a duration
of 1 to 6 minutes is preferred, especially between 2 and 4 minutes.
Particularly preferred is a duration of 3 minutes. A person skilled
in the art will easily be able to determine suitable durations of
thermospikes in relation to a variety of reaction volumes. The
above-described use of thermospikes leads to a significantly better
conversion rate in the bisulfite conversion reaction, even when the
above-described denaturing solvents are not utilized.
[0230] In a preferred variant, 10-60 .mu.l of the solution
containing the extracted genomic DNA is mixed with 50-120.mu. of
bisulfite solution. The bisulfite solution has a pH in the range of
4.7 to 6.5, preferably in the range of 5.0 to 6.0, and particularly
preferred in the range of 5.45 to 5.50. The bisulfite solution
comprises hydogensulfite in a concentration of 3.5-6.0, preferably
in a concentration of 4.4-5.3, and particularly preferred in a
concentration of 4.83-4.93 mol/l. For example, such kind of
bisulfite solution can be obtained by adding 4.708 of sodium
disulfite and 1.128 g of sodium sulfite to 10 ml of water. After
dissolving of the salts, the final volume is about 12 ml. To the
mixture of genomic DNA solution and the bisulfite solution 8-45
.mu.l of an organic radical scavenger solution is added. The
organic radical scavenger solution comprises an organic solvent and
50-1,000 mmol/l, preferably 100-750 mmol/l, and particularly
preferred 158-500 mmol/l of the radical scavenger
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid or any
other suitable radical scavenger. After the addition of the radical
scavenger solution, a temperature protocol is applied for 3-8 h.
The protocol is characterized in that the reaction is conducted in
a temperature range of 0-80.degree. C. with additional 2-5
temperature increases (thermospikes) for 1-10 min to 85-100.degree.
C. including an initial temperature increase (thermospike) to
85-100.degree. C.
[0231] In an embodiment, the bisulfite treatment step comprises
[0232] mixing of 10-60 .mu.l of the solution containing the genomic
DNA with 50-120 .mu.l of bisulfite solution, the bisulfite solution
having a pH in the range of 5.45 to 5.50 comprising 4.83-4.93 mol/l
hydrogensulfite, [0233] addition of 8-45 .mu.l of an organic
radical scavenger solution, the organic radical scavenger solution
comprising an organic solvent and 158-500 mmol/l
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid, and
applying a temperature protocol for 3-8 h, characterized in that
the reaction is conducted in a temperature range of 0-80.degree. C.
with additional 2-5 temperature increases for 1-10 min to 85 to
100.degree. C. including an initial temperature increase to
85-100.degree. C.
[0234] In a particularly preferred embodiment, the bisulfite step
is carried out as described in the following: 44-50 .mu.l of a
solution containing the extracted genomic DNA are mixed with 83-95
.mu.l of a bisulfite solution. The bisulfite solution has a pH in
the range of 5.45 to 5.50 and comprises hydogensulfite in a
concentration of 4.83-4.93 mol/l. For example, such kind of
bisulfite solution can be obtained by adding 4.708 g of sodium
disulfite and 1.128 g of sodium sulfite to 10 ml of water. After
dissolving of the salts, the final volume is about 12 ml. After the
addition of the bisulfite solution 13-15 .mu.l of a DME solution
are added, the DME solution comprising 250-1,000 mmol/l, preferably
350-750 mmol/l, and particularly preferred 500 mmol/l
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid dissolved
in diethyleneglycoldimethylether (DME). Thereafter, a temperature
protocol is applied for 4-7 h. The protocol is characterized in
that the reaction is conducted in a temperature range of
57-65.degree. C. with additional 2-5 temperature increases
(thermospikes) for 3-5 min to 94-100.degree. C. including an
initial temperature increase (thermospike) to 94-100.degree. C.
[0235] In an preferred embodiment, the bisulfite treatment step
comprises [0236] mixing of 44-50 .mu.l of solution containing the
genomic DNA with 83-95 .mu.l of the bisulfite solution, [0237]
addition of 13-15 .mu.l of DME solution, the DME solution
comprising 500 mmol/l
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid dissolved
in diethyleneglycoldimethylether, and [0238] applying a temperature
protocol for 4-7 h, characterized in that the reaction is conducted
in a temperature range of 57-65.degree. C. with additional 2-5
temperature increases for 3-5 min to 94-100.degree. C. including an
initial temperature increase to 94-100.degree. C.
[0239] In another particularly preferred embodiment, 15-20 .mu.l of
solution containing the isolated genomic DNA is mixed with 60-85
.mu.l of a bisulfite solution. The bisulfite solution has a pH in
the range of 5.45 to 5.50 and comprises hydogensulfite in a
concentration of 4.83-4.93 mol/l. After the addition of the
bisulfite solution, 25-35 .mu.l of dioxane solution is added. The
dioxane solution comprises 50-500 mmol/l, preferably 75-300 mmol/l,
and particularly preferred 158 mmol/l
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid dissolved
in 1,4-dioxane. Thereafter, a temperature protocol is applied for
4-7 h. The protocol is characterized in that the reaction is
conducted in a temperature range of 57-65.degree. C. with
additional 2-5 temperature increases (thermospikes) for 3-5 min to
94-100.degree. C. including an initial temperature increase
(thermospike) to 94-100.degree. C.
[0240] In a preferred embodiment, the bisulfite treatment step
comprises [0241] mixing of 15-20 .mu.l of solution containing the
genomic DNA with 60-85 .mu.l of the bisulfite solution, [0242]
addition of 25-35 .mu.l of dioxane solution, the dioxane solution
comprising 158 mmol/l
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid dissolved
in 1,4-dioxane, and [0243] applying a temperature protocol for 4-7
h, characterized in that the reaction is conducted in a temperature
range of 57-65.degree. C. with additional 2-5 temperature increases
for 3-5 min to 94-100.degree. C. including an initial temperature
increase to 94-100.degree. C.
DNA Purification Step
[0244] After the bisulfite conversion is completed, the DNA is
desulfonated and purified. Different methods are known for this
purpose (e.g., see: DE 101 54 317 A1=U.S. Ser. No. 10/416,624;
Grunau et al. 2001, loc. cit.). Normally, the reaction solution is
first treated with sodium hydroxide. Subsequently, a neutralization
and alcohol precipitation of the DNA are carried out.
[0245] In a preferred embodiment of the above-described embodiments
according to the invention, the purification is performed by means
of a gel filtration, e.g., with Sephadex-G25 columns or with
Sephadex-G50 columns. The bisulfite salt can be removed very
effectively in this way, without the need for further washing
steps. In a second preferred embodiment, the purification is
conducted via DNA-binding surfaces, e.g., via the WIZARD.RTM. DNA
purification resin of Promega (see: Kawakami et al., Journal of the
National Cancer Institute, Vol. 92, No. 22, 2000, pp. 1805-11). A
third preferred embodiment utilizes magnetic particles for
purification, e.g., with the help of the MAGNA-PURE.TM. process.
These purification methods lead to particularly good results in
combination with the n-alkylene glycol compounds according to the
invention, particularly with DME. The purification is conducted
according to the manufacturer's instructions. It is known to the
person skilled in the art that an even further increased yield may
be attainable by variation of the manufacturer's instructions by
using standard experiments. Correspondingly, optimized protocols
are also part of this invention. Further technical instructions for
purifying nucleic acids via gel filtration, DNA-binding surfaces
and magnetic particles are known to the person skilled in the art
and are provided, e.g., from the manufacturer's instructions.
[0246] In a most particularly preferred embodiment, purification is
conducted by means of an ultrafiltration. Such a procedure has
several technical advantages and results in a surprisingly
successful purification of the converted DNA. The recovery rate of
the converted DNA which was initially derived from an archived
sample is very high (>25%). Ultrafiltration also has other
advantages. For instance, purification is very flexible with
respect to the volume of the samples to be used. In addition, the
bisulfite salts can be removed almost completely. Furthermore, a
desulfonation can be performed on the filter membrane, which
additionally results in a savings in time.
[0247] Different commercially available ultrafiltration systems are
known to the person skilled in the art, which may be used for the
method according to the invention. In a preferred embodiment,
Microcon.TM. columns of MILLIPORE.RTM. are used.
[0248] It is known to the person skilled in the art that other
procedures may be indicated with other ultrafiltration systems, and
that a good yield can also be obtained by varying the
above-indicated conditions. The corresponding embodiments are also
part of this invention.
[0249] In addition, bisulfite treated DNA can also be purified
according to the invention by means of the ability of DNA to bind
to silica surfaces, in particular to silica membranes. Because of
their high reliability and reproducability and also to reduce the
handling effort, silica based kits are preferred. For one with
ordinary skill in the art, a huge amount of kits is known which
might be suitable for bisulfite treated DNA purification.
[0250] Therefore, in a first step, the most promising kits were
chosen. These kits are: QIAAMP.RTM. Viral RNA Mini, ZYMO-SPIN.TM.
IC columns in combination with buffer supplied with the QIAAMP.RTM.
Viral RNA Mini kit, STRATAPREP.RTM. PCR purification, AUTOSEQ.RTM.
G50, MICROSPIN.TM. G25, ChargeSwitch.RTM. Forensic DNA Purification
Kit, and CHARGE SWITCH.RTM. genomic DNA Purification kit. In a
second step, these kits were tested according to the following
criteria: i) a minimal handling effort; ii) a minimal length of
time; iii) yield of DNA; and iv) concentration of sulfite in the
DNA solution after purification. As a reference, the purification
by means of a Microcon.TM. device (example 2d) was used. Comparably
good results as by means of a Microcon.TM. device were just
obtained with the QIAAMP.RTM. Viral RNA Mini kit.
[0251] In addition, also kits are preferably used which contain the
same solutions and/or equivalent materials such as columns or
buffers. These kits are the DNEASY.RTM. 96 Tissue Kit, the
QIAAMP.RTM. 96 DNA Blood Kit, the QIAAMP.RTM. DSP 96 Virus MDX Kit,
the DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini Kit, the
QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini or the
QIAAMP.RTM. DSP Virus Kit (all QIAGEN.RTM.). These kits are all
based on binding of DNA to silica surfaces.
[0252] For purification after the bisulfite treatment, the
manufacturer's instructions are each amended in preferred
embodiments by addition of an alkaline hydrolytic step. This
alkaline hydrolytic step is carried out by incubation with an
alkaline solution comprising a high content of an alcohol.
According to the invention, the alkaline solution comprises sodium
hydroxide or any other hydroxides with similar chemical properties
like potassium hydroxide or any mixture of these as well as ethanol
or any other alcohol with similar chemical properties like
isopropanol or any mixture of these. In particular, it is preferred
that the alkaline solution comprises sodium hydroxide and ethanol.
It is especially preferred that the concentration of sodium
hydroxide is in the range of 0.1-0.3 mol/l, preferably 0.15-0.25
mol/l, and particularly preferred 0.2 mol/l, while the content of
ethanol is in the range of 60-95%, preferably 75-93%, and
particularly preferred 90%. According to the invention, the
recovery rate of converted DNA is as good as the recovery rate
obtained with Microcon.TM. devices (>25%).
[0253] According to the invention, other kits may also be used, for
example, other kits which are based on DNA binding to silica
surfaces, in particular to silica membranes. In principle, other
kits are also useable as long as they lead to similar results.
Those kits are, for example, kits which are based on the
"charge-switch"-technology (Invitrogen). These can be the
ChargeSwitch.RTM. Forensic DNA Purification Kit and CHARGE
SWITCH.RTM. Genomic DNA Purification Kit.
[0254] According to the invention, the DNA purification step
follows the bisulfite treatment step. In case the bisulfite
treatment step is not carried out, this purification step might be
dispensable and therefore it is not necessary according to the
invention to carry out this step.
[0255] In a preferred embodiment of the invention, the purification
step is carried out by means of the DNEASY.RTM. 96 Tissue Kit, the
QIAAMP.RTM. 96 DNA Blood Kit, the DNEASY.RTM. Tissue Kit, the
QIAAMP.RTM. DNA Mini Kit, and the QIAAMP.RTM. DNA Micro Kit. Also
the QIAAMP.RTM. DSP 96 Virus MDx Kit, QIAAMP.RTM. Viral RNA Mini or
the QIAAMP.RTM. DSP Virus Kit can be used. These kits are favorable
in case only small amounts of DNA are expected. According to the
invention, devices and solutions of other kits can also be used if
they lead to similar results regarding the quality and quantity of
purificated DNA. For example, this can be devices and solutions of
kits which are based on the "charge-switch" technology
(Invitrogen). According to this embodiment, the bisulfite treated
sample is mixed with 500-620 .mu.l binding buffer, the binding
buffer comprising 1-50 ng/.mu.l, preferably 5-25 ng/.mu.l,
particularly preferred 10 ng/.mu.l RNA or a comparable amount of
any nucleic acid dissolved in the buffer AVL. After this, 500-620
.mu.l of ethanol are added. The mixture is then incubated at
0-37.degree. C. for 5-20 min, before it is applied onto a column of
a plate of the DNEASY.RTM. 96 Tissue Kit, the QIAAMP.RTM. 96 DNA
Blood Kit, or the QIAAMP.RTM. DSP 96 Virus MDx Kit or onto a column
of the DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini Kit, the
QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini or the
QIAAMP.RTM. DSP Virus Kit. In any case, the DNA binds to a column.
Thereafter, the column is washed with 300-1,000 .mu.l washing
buffer AW1. This is followed by an alkaline hydrolysis, wherein
450-550 .mu.l of a solution containing 0.2 mol/l sodium hydroxide
and 90% ethanol is applied for 10-25 min at 15-26.degree. C. to the
column and therewith to the DNA. Afterward, the column is washed
with 300-1,000 .mu.l of washing buffer AW2 before the DNA is eluted
form the column by addition of 50-150 .mu.l of one of the elution
buffers AE, AVE, EB or water.
[0256] It is also possible to carry out the purification step with
a binding buffer comprising not any RNA or any comparable amount of
any nucleic acid. Corresponding embodiments are also part of the
invention.
[0257] In an embodiment of the invention, the purification step is
carried by means of the DNEASY.RTM. 96 Tissue Kit, the QIAAMP.RTM.
96 DNA Blood Kit, the QIAAMP.RTM. DSP 96 Virus MDx Kit, the
DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini Kit, the
QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini, the
QIAAMP.RTM. DSP Virus Kit, comprising [0258] mixing of the
bisulfite treated sample with 500-620 .mu.l binding buffer,
optionally the binding buffer containing 10 ng/.mu.l RNA dissolved
in the buffer AVL, [0259] addition of 500-620 .mu.l ethanol, [0260]
incubation at 0-37.degree. C. for 5-20 min, [0261] binding of the
DNA onto a plate of the DNEASY.RTM. 96 Tissue Kit, the QIAAMP.RTM.
96 DNA Blood Kit, or the QIAAMP.RTM. DSP 96 Virus MDx Kit or onto a
column of the DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini Kit,
the QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini, the
QIAAMP.RTM. DSP Virus Kit, [0262] washing with 300-1,000 .mu.l
washing buffer AW1, [0263] treatment with 450-550 .mu.l of a
solution containing 0.2 mol/l sodium hydroxide and 90% ethanol for
10-25 min at 15-26.degree. C., [0264] washing with 300-1,000 .mu.l
washing buffer AW2, and [0265] elution with 50-150 .mu.l of one of
the elution buffers AE, AVE, EB oder water.
[0266] In a particularly preferred embodiment, 100-200 .mu.l of
bisulfite treated sample is mixed with 520-600 .mu.l binding buffer
AVL optionally comprising 10 ng/.mu.l RNA, preferably 140 .mu.l of
bisulfite treated sample is mixed with 560 .mu.l of binding buffer.
After this, 520-600 .mu.l, preferably 560 .mu.l of ethanol are
added. The mixture is then centrifuged at 750-2000.times.g at least
for 1 s, preferably at 1.450.times.g for 1 s. After this, it is
incubated at 15-25.degree. C. for 7-15 min, preferably at room
temperature for 10 min. Subsequently, it is added onto a column of
a plate of the DNEASY.RTM. 96 Tissue Kit, the QIAAMP.RTM. 96 DNA
Blood Kit, or the QIAAMP.RTM. DSP 96 Virus MDx Kit or onto a column
of the DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini Kit, the
QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini, or the
QIAAMP.RTM. DSP Virus Kit. After centrifugation of the plate at
4,000-6,000.times.g for 1-10 min, preferably at 5,790.times.g for 4
min, or of the column at >15,000.times.g for 0.5-10 min,
preferably for 20,000.times.g for 1 min, the DNA is bound to a
column. Thereafter, the column is washed with 300-750 .mu.l,
preferably with 500 .mu.l of washing buffer AW1. Subsequently, the
plate is centrifuged at 4,000-6,500.times.g for 1-5 min, preferably
at 5.790.times.g for 2 min and the column is centrifuged at
>15,000.times.g for 0.5-5 min, preferably for >20,000.times.g
for 1 min, respectively. This is followed by an alkaline
hydrolysis, wherein 470-530 .mu.l, preferably 500 .mu.l of a
solution comprising 0.2 mol/l sodium hydroxide and 90% ethanol is
added for 11-20 min at 17-24.degree. C., preferably for 15 min at
room temperature to the column and therewith to the DNA. This
solution is withdrawn by centrifugation of the plate at
4,000-6,500.times.g for 1-5 min, preferably at 5.790.times.g for 2
min and of the column at >15,000.times.g for 0.5-5 min,
preferably for >20,000.times.g for 1 min, respectively. Although
it is not necessary, it can be favorable to repeat the washing
step, including the subsequent centrifugation step with the washing
buffer AW1 as it is described above. However, the column is washed
by addition of 300-750 .mu.l, preferably 500 .mu.l of washing
buffer AW2. This is followed by a centrifugation of the plate at
4,000-6,500.times.g for 5-30 min, preferably at 5.790.times.g for
15 min and of the column at >15,000.times.g for 0.5-10 min,
preferably for 20,000.times.g for 3 min, respectively. In addition,
after removal of the flow-through, the column is centrifuged at
>15,000.times.g for 0.5-5 min, preferably for 20,000.times.g for
1 min. The elution of the DNA from a column of a plate is carried
out by addition of 75-170 .mu.l, preferably 120 .mu.l of elution
buffer which can be AE, AVE or EB (all QIAGEN.RTM.) or water each
preheated to 60-80.degree. C., preferably to 70.degree. C. The
plate is incubated for 1-20 min at 15-30.degree. C., preferably for
5 min at room temperature, before it is centrifuged at
4,000-6,500.times.g for 0.5-20 min, preferably at 5,790.times.g for
2 min. The elution of the DNA from a column of the DNEASY.RTM.
Tissue Kit, the QIAAMP.RTM. DNA Mini Kit, the QIAAMP.RTM. DNA Micro
Kit, the QIAAMP.RTM. Viral RNA Mini, or the QIAAMP.RTM. DSP Virus
Kit is carried out as in the following: In a first application
25-150 .mu.l, preferably 35-120 .mu.l of elution buffer is added.
The elution buffer can be AE, AVE or EB (all QIAGEN.RTM.) or water
each adjusted to 15-30.degree. C., preferably to room temperature.
After incubation for 0.5-20 min at 15-30.degree. C., preferably for
1-5 min at room temperature, the column is centrifuged for 0.5-5
min at 4,000-8,000.times.g, preferably for 1 min at 6,000.times.g.
Although it is not necessary, it might be favorable to carry out a
second elution step. In doing so, 25-75 .mu.l, preferably 35-60
.mu.l of the above specified elution buffer is added. Again, the
column is incubated for 0.5-20 min at 15-30.degree. C., preferably
for 1-5 min at room temperature, before it is centrifuged for 0.5-5
min at 4,000-8,000.times.g, preferably for 1 min at 6,000.times.g.
The flow-through of the first and second elution step containing
the DNA are combined.
[0267] In a preferred embodiment, the DNA purification step
comprises [0268] mixing of 140 .mu.l of bisulfite treated sample
with 560 .mu.l binding buffer, [0269] addition of 560 .mu.l
ethanol, [0270] centrifugation at 1.450.times.g for 1 s, [0271]
incubation at room temperature for 10 min, [0272] application of
the reaction mixture in one or two steps onto a plate of the
DNEASY.RTM. 96 Tissue Kit, the QIAAMP.RTM. 96 DNA Blood Kit, or the
QIAAMP.RTM. DSP 96 Virus MDx Kit or onto a column of the
DNEASY.RTM. Tissue Kit, the QIAAMP.RTM. DNA Mini Kit, the
QIAAMP.RTM. DNA Micro Kit, the QIAAMP.RTM. Viral RNA Mini, the
QIAAMP.RTM. DSP Virus Kit, [0273] centrifugation of the plate at
5.790.times.g for 4 min or of the column at >20,000.times.g for
1 min, [0274] application of 500 .mu.l buffer AW1 and subsequent
centrifugation of the plate at 5.790.times.g for 2 min or of the
column at >20,000.times.g for 1 min, application of 500 .mu.l of
a solution containing 0.2 mol/l sodium hydroxide and 90% ethanol,
incubation for 15 min at room temperature and subsequent
centrifugation of the plate at 5.790.times.g for 2 min or of the
column at >20,000.times.g for 1 min, [0275] optional,
application of 500 .mu.l buffer AW1 and subsequent centrifugation
of the plate at 5.790.times.g for 2 min or of the column at
>20,000.times.g for 1 min, [0276] application of 500 .mu.l of
buffer AW2 and subsequent centrifugation of the plate at
5.790.times.g for 15 min or of the column at 20,000.times.g for 3
min, [0277] centrifugation of the column at 20,000.times.g for 1
min, [0278] elution of the DNA from the plate by application of 120
.mu.l elution buffer AE, AVE or EB or water preheated to 70.degree.
C., incubation for 5 min at room temperature and centrifugation for
2 min at 5,790.times.g or elution of the DNA from a column by a
first application of 35-120 .mu.l elution buffer AE, AVE or EB or
water adjusted to room temperature, incubation for 1-5 min at room
temperature and centrifugation for 1 min at 6,000.times.g, and an
optional second application of 35-60 .mu.l elution buffer AE, AVE
or EB or water adjusted to room temperature, incubation for 1-5 min
at room temperature and centrifugation for 1 min at
6,000.times.g.
[0279] In a preferred embodiment, the purification step is carried
out by means of a MICROCON.TM. filter device (MILLIPORE.RTM.). This
is done essentially as described in the manufacturer's instruction
with an additional alkaline hydrolysis step and some modifications.
The sample after the bisulfite treatment is adjusted with water to
a volume of 350-500 .mu.l, before it is applied to a MICROCON.TM.
filter device which detains the DNA. Thereafter 25-1,000 .mu.l of a
solution comprising 0.1-0.3 mol/l, preferably 0.15-0.25 mol/l, and
particularly preferred 0.2 mol/l sodium hydroxide are applied,
wherein it is favorable but not necessary to incubate the alkaline
solution for 3-25 min at 15-26.degree. C. The device is then washed
with 200-1,000.mu. TE buffer. The TE buffer has a pH of 8.0 and
comprises 10 mmol/l Tris(tris-hydroxymethyl-amino-methan) and 0.1
mmol/l EDTA. The DNA is removed from the device by means of 30-100
.mu.l of TE buffer preheated to 40-65.degree. C. The buffer on the
device is incubated for 5-25 min at 10-60.degree. C. and will then
contain the DNA.
[0280] In an embodiment, the purification step is carried out by
means of a MICROCON.TM. filter device, comprising [0281] adjustment
of the sample after the bisulfite reaction with water to a volume
of 350-500 .mu.l, [0282] application of the DNA onto a MICROCON.TM.
filter device, [0283] treatment with 25-1,000 .mu.l of 0.2 mol/l
sodium hydroxide, optional incubation for 3-25 min at 15-26.degree.
C., [0284] washing with 200-1,000 .mu.l TE buffer, the TE buffer pH
8.0 containing 10 mmol/l tris-hydroxymethyl-amino-methan and 0.1
mmol/l EDTA, and [0285] removal of the DNA by means of 30-100 .mu.l
TE buffer preheated to 40-65.degree. C. incubated for 5-25 min at
10-60.degree. C.
[0286] In a particularly preferred embodiment, the sample after
bisulfite reaction is adjusted with water to a volume of 370-450
.mu.l, preferably of 400 .mu.l for purification. The mixture is
then added to a MICROCON.TM. filter device. Subsequently, the
device is centrifuged at 10,000-18,000.times.g for 5-30 min,
preferably at 14,000.times.g for 15 min. Although it is not
necessary, it is favorable to follow with 1-2 repetitions of a
washing step. For each washing step, 400 .mu.l TE buffer as
described above are added and subsequently the device is
centrifuged at 10,000-18,000.times.g for 5-30 min, preferably at
14,000.times.g for 12 min. Afterwards, 50-700 .mu.l, preferably
100-400 .mu.l of 0.2 mol/l sodium hydroxide, are added to the
device. Although not necessary, it is favorable to incubate the
solution of the device for 5-20 min at 15-30.degree. C., preferably
for 10 min at room temperature. Subsequently, the device is
centrifuged at 10,000-18,000.times.g for 5-30 min, preferably at
14,000.times.g for 10-12 min. After this, the device is washed for
1-4 times as described before. The DNA is recovered by elution in
one or two steps. Thereby, 30-85 .mu.l, preferably by 37.5-75 .mu.l
of the TE buffer preheated to 45-60.degree. C., preferably to
50.degree. C. are added. The buffer on the device is then incubated
for 7-15 min at 12-55.degree. C., preferably for 10 min at
15-50.degree. C., before the device is inverted and centrifuged at
500-5,000.times.g at 0.5-20 min, preferably at 1,000.times.g for 5
min. This embodiment is essentially carried out as it is described
in WO05/038051 (this reference is incorporated by its
entirety).
[0287] In a preferred embodiment, the purification step comprises
[0288] adjustment of the sample after the bisulfite reaction with
water to a volume of 400 .mu.l, [0289] application of the mixture
onto a MICROCON.TM. filter device and subsequent centrifugation at
14,000.times.g for 15 min, [0290] optional, 1-2 repetitions of the
following washing step: application of 400 .mu.l TE buffer, the TE
buffer pH 8 containing 10 mmol/l tris-hydroxymethyl-amino-methan
and 0.1 mmol/l EDTA, subsequent centrifugation at 14,000.times.g
for 12 min, [0291] application of 100-400 .mu.l of 0.2 mol/l sodium
hydroxide, optional incubation for 10 min at room temperature, and
subsequent centrifugation at 14,000.times.g for 10-12 min, [0292]
1-4 repetitions of the following: application of 400 .mu.l water or
TE buffer and subsequent centrifugation at 14,000.times.g for 12
min, and [0293] elution in one or two steps by application of
37.5-75 .mu.l TE buffer preheated to 50.degree. C., incubation for
10 min at 15-50.degree. C., and subsequent inversion of the
MICROCON.TM. filter device and centrifugation at 1,000.times.g for
5 min.
Amplification Step
[0294] In an embodiment of the invention, the amplification step
comprises a detection of positions which are methylated in the
genomic DNA of the archived sample. Alternatively, it also
comprises a detection of positions which are unmethylated in the
genomic DNA of the archived sample. Of course, it is also possible
to detect simultaneously positions which are methylated and to
detect positions which are unmethylated in the genomic DNA of the
archived sample by the amplification step.
[0295] It is especially preferred that the methylation pattern is
analyzed by means of bisulfite sequencing, the COBRA method, the
Ms-SNuPE (Methylation-sensitive Single Nucleotide Primer Extension)
method, the MSP (Methylation Specific PCR) method, including the
nested MSP method, the HEAVYMETHYL.TM. method, the METHYLIGHT.TM.
method, or the QM assay. Of course, if desired, it is also possible
to combine two or more of these methods.
[0296] In an embodiment of the invention, the amplification step is
carried out by one or more of the following methods and/or by a
combination of one or more of the following methods with each
other: PCR, the bisulfite sequencing method, the COBRA method, the
Ms-SNuPE (Methylation-sensitive Single Nucleotide Primer Extension)
method, the MSP (Methylation Specific PCR) method, the nested MSP
method, the HEAVYMETHYL.TM. method, the METHYLIGHT.TM. method, or
the QM assay.
[0297] According to the invention, a better ability of
amplification is given if one or more of the following amendments
are made in comparison to normal conditions as a person with
ordinary skill in the art would probably choose them with respect
to the methods specified above: i) increase in the concentration of
the polymerase activity; ii) increase in the concentration of each
nucleotide, whereby simultaneously the concentration of magnesium
chloride has also be adjusted as explained below; and iii)
elongation of the time for the elongation and annealing step as
explained below. This is the case for bisulfite treated DNA derived
from archived samples as well as for non-bisulfite treated genomic
DNA derived from archived samples.
[0298] In a preferred embodiment of the invention, the
amplification step is carried out with use of a DNA polymerase and
comprises one or more of the following: A) The DNA polymerase
concentration is in the range of 0.05-0.3 U/.mu.l of the reaction
mixture. B) The concentration of each nucleotide is in the range of
200-800 .mu.mol/l. Thereby the concentration of magnesium chloride
(MgCl2) in the reaction mixture is adjusted to the concentration of
nucleotides as it is well known for those skilled in the art. C)
The time for elongating the template DNA is in the range of 0.1-1.0
s/bp of the template DNA. This time usually comprises for a PCR the
elongation step as well as the annealing step if the case may be.
If the annealing is performed at temperatures below 53.degree. C.,
this time corresponds only to the elongation step.
[0299] In an embodiment, the method of the invention includes a
method for amplifying DNA derived from an archived sample,
comprising one or more of the following: [0300] the polymerase
concentration is in the range of 0.05-0.3 U/.mu.l, [0301] the
concentration of each nucleotide is in the range of 200-800
.mu.mol/l, and [0302] the time of the elongation step is in the
range of 0.1-1.0 s/bp.
[0303] In a particularly preferred embodiment, the amplification
step comprises one or more of the following: A) A polymerase
concentration in the range of 0.08-0.25 U/.mu.l, preferably the
concentration is 0.15 U/.mu.l in the reaction mixture. B) The
concentration of each nucleotide is in the range of 350-650
.mu.mol/l, preferably the concentration of each nucleotide is 400
.mu.mol/l in the reaction mixture. As already explained before the
concentration of magnesium chloride (MgCl.sub.2) in the reaction
mixture is thereby adjusted to the concentration of the nucleotides
as it is well known for those skilled in the art. C) The time for
elongating the template DNA is in the range of 0.25-0.75 s/bp of
the template DNA, preferably it is 0.5 s/bp of the template DNA. As
already described, this time usually comprises for a PCR the
elongation step as well as the annealling step if the case may be.
If the annealing is performed at temperatures below 53.degree. C.,
this time corresponds only to the elongation step.
[0304] In a preferred embodiment, the amplification step comprises
one or more of the following: [0305] the polymerase concentration
is 0.15 U/.mu.l, [0306] the concentration of each nucleotide is 400
.mu.mol/l, and [0307] the time of the elongation step is 0.5
s/bp.
[0308] In a preferred embodiment of the invention, the
amplification step is carried out in order to amplify a defined
fragment, a subtraction of fragments or to amplify the whole
genome. For this, one or more of the methods as they are known to
those skilled in the art can be used. For this, the amplification
step can be carried out by amplification reactions which are
non-PCR based methods for example by the NASBA/TMA technique. But
more preferably, ligase mediated chain reaction (LCR), and in
particular polymerase chain reaction (PCR) methods are used.
[0309] Preferably, such an amplification is used for an enrichment
of the DNA of interest carrying the epigenomic information of the
archived sample. Thereafter any method for methylation analysis can
be performed, in particular the bisulfite sequencing method, the
COBRA method, the Ms-SNuPE (Methylation-sensitive Single Nucleotide
Primer Extension) method, the MSP (Methylation Specific PCR)
method, the nested MSP method, the HEAVYMETHYL.TM. method, the
METHYLIGHT.TM. method, or the QM assay.
[0310] Furthermore, it is also preferred that after an
amplification of a defined fragment, a subtraction of fragments or
the whole genome the amplified DNA is subject to additional
analyses, for example for the analysis of point mutations or
SNPs.
[0311] In principle, according to the invention, it is possible
that the amplification reaction mixtures comprise more than two
primers. Therefore, the amplification will result in more than one
amplicon. In case the amplification is carried out by PCR, such a
procedure is known as multiplex PCR by those skilled in the art.
Such a procedure is in particular advantageous if only small
amounts of DNA are available. Additionally, it has also the
advantage of a reduction of costs, lowering the handling effort,
and shortening of the experiment, e.g., results earlier
obtained.
Embodiments for Small Amounts of an Archived Sample as Starting
Material
[0312] In an embodiment of the invention, small amounts of an
archived sample are used as starting material. Such small amounts
can be any part of a tissue of an archived sample. This tissue part
is in the following size range: The area is between 0.025-50
mm.sup.2, preferably between 0.05-10 mm.sup.2, and most preferably
between 0.1-3 mm.sup.2. Thereby, the thickness of the tissue part
is in the range of 5-20 .mu.m, preferably in the range of 7-13
.mu.m, and most preferably the tissue part has a thickness of 10
.mu.m. Of course, tissue parts with other dimensions are also
applicable. If the tissue part is of a different volume, a person
with ordinary skill in the art will know how to adjust the
following embodiments for small amounts of an archived sample as
starting material.
Microdissection
[0313] In an preferred embodiment, cells of an archived sample are
microdissected. Therefore, a section of an archived sample in the
range of 5-20 .mu.m, preferably in the range of 7-13 .mu.m, and
most preferably of 10 .mu.m thickness is mounted on a slide as
specified below. The microdissection can be done, for example, by
means of a laser capture processing, but any other method known to
those skilled in the art is as well suitable.
[0314] Various methods for microdissection by means of a laser
capture processing are known to those skilled in the art (for
example, Eltoum I A, Siegal G P and Frost A R. 2002.
Microdissection of histologic sections: past, present, and future.
Adv Anat Pathol. September; 9(5):316-22). In a preferred
embodiment, the laser capture method is the AutoPix.TM. LCM System
(Arcturus, USA). In brief, a film is thermally fused to the
respective tissue area by means of a laser, whereby the tissue area
is dissected.
[0315] In another preferred embodiment, the laser mediated
microdissection is carried out by mounting the tissue section onto
a membrane coated slide, for example, onto MembraneSlides
(P.A.L.M..RTM. Microlaser Technologies AG, Germany).
[0316] In further preferred embodiment, the tissue section is
mounted onto a conventional microscopic slide. After this, the
tissue section is subjected to a staining before the desired areas
are microdissected. Of course, also similar procedures are also
applicable as long as they enable the identification of desired
parts of the sample, in particular as long as they enable the
identification of desired cell or group of cells in the sample.
Such a staining can be, for example, also a hematoxylin-eosin
staining, a methylene blue staining, a hemalum-eosin staining, an
azan staining, a periodic acid-schiff staining, a prussian blue
staining, a Masson-Goldner staining, a Ladewig staining, a
elastica-van Gieson staining, a Gomori staining, a methyl green
staining, a nuclear fast red staining, a Evans blue staining, a
light-green SF yellowish staining, a Wright's staining, a
May-Grunwald staining, a toluidine blue 0 staining, an azure B
staining, a Giemsa staining or any other histological or
histopathological staining But any immunohistological staining can
also be used, for example any kind of staining which is based on
antibodies or on DNA or RNA hybridization. These staining methods
are well described and are well known to those skilled in the art.
The corresponding embodiments are herewith enclosed in the method
according to the invention. Of course, any staining can be
completely omitted if it is not desired or suitable for
microdissection.
[0317] Microdissection is carried out by means of a Microbeam
instrument (P.A.L.M..RTM. Microlaser Technologies AG, Bernried,
Germany), but similar instruments that enable a dissection of
single cells, of group of cells or of tissue parts can also be used
according to the invention. These techniques are well known to
those skilled in the art and are therefore herewith included as
preferred embodiments.
[0318] The dissected material is collected in tubes preferably with
adhesive caps for further processing. The adhesive caps can be any
kind of adhesive caps, for example, Adhesive Caps 200
(P.A.L.M..RTM. Microlaser Technologies AG, Bernried, Germany).
Because of the microdissection, no removal of paraffin is
necessary.
[0319] In another preferred embodiment, the dissected material is
collected in the cap of a normal tube which contains the below
specified volume of lysis buffer.
Lysis Step
[0320] In an embodiment, the microdissected sample material is
subjected to a lysis step. Therefore, 20 .mu.l lysis buffer (50
mmol/l Tris-HCl, pH 8.0, 1 mmol/l EDTA, 0.5 v/v % Tween, 10
ng/.mu.l poly-dA, 3 mg/ml proteinase K) were carefully added to the
cap. As already described above, other lysis buffers as they are
known to those skilled in the art are also applicable. The tubes
were closed carefully avoiding a loosening of the drop from the
cap. Subsequently, the tubes were incubated for 1-48 h, preferably
for 5-24 h, and most preferably for 12 h at 40-80.degree. C.,
preferably at 50-70.degree. C., and most preferably at 60.degree.
C. This can be done, for example, in a waterbath, thermomixer or
PCR cycler. If a PCR cycler is used, preferably also the lid of the
cycler is set to same temperature as the cycler, because the sample
material is located at the caps.
[0321] After incubation the sample is centrifuged to transfer the
lysed sample to the bottom of the tube.
[0322] In an preferred embodiment, the amount of lysis buffer is
adjusted to the sizes of the dissected material. This is
characterized in that at least the dissected material is completely
covered by the lysis buffer. After lysis of the material, the lysis
buffer is concentrated to 20 .mu.l by vacuum centrifugation,
lyophilisation or any other suitable methods as they are known to
those skilled in the art.
Bisulfite Treatment
[0323] In an embodiment, the lysed sample is then directly
subjected to bisulfite treatment because of the small amount of
starting material and hence DNA. For bisulfite treatment, 9-70
.mu.l, preferably 12-52 .mu.l, and most preferably 38 .mu.l
bisulfite solution are added to the cap. A bisulfite solution is
used as it is already described above. Subsequently, the bisulfite
solution at the cap is incubated for 0.5-15 min, preferably for
2-10 min, and most preferably for 5 min at 0-80.degree. C.,
preferably at 10-40.degree. C., in particular preferably at
15-30.degree. C., and most preferably at room temperature. The
addition and incubation of the bisulfite solution at the cap
dissolves any remaining DNA in the cap. After the incubation, the
sample is centrifuged.
[0324] In an preferred embodiment, the addition of bisulfite
solution is carried by two steps which resemble themselves. This
has the advantage that all DNA attached to the cap is subject for
further processing. In the first step, 9-35 .mu.l, preferably 12-26
.mu.l, and most preferably 19 .mu.l bisulfite solution are added to
the cap. A bisulfite solution is used as it is already described
above. Subsequently, the bisulfite solution at the cap is incubated
for 0.5-15 min, preferably for 2-10 min, and most preferably for 5
min at 0-80.degree. C., preferably at 10-40.degree. C., in
particular preferably at 15-30.degree. C., and most preferably at
room temperature. The addition and incubation of the bisulfite
solution at the cap dissolves any remaining DNA in the cap. After
the incubation, the sample is centrifuged, before again bisulfite
solution is added in a second step which is a repetition of the
first step.
[0325] Thereafter, in an embodiment, 2-12 .mu.l, preferably 4-8
.mu.l, and most preferably 6 .mu.l of DME solution as it is
described above are added. The bisulfite conversion is in the
following conducted as described already above. The corresponding
embodiments for small amounts of starting material are herewith
enclosed. In a particular embodiment, the following temperature
protocol is applied: 5 min 99.degree. C., 22 min 60.degree. C., 3
min 99.degree. C., 97 min 60.degree. C., 3 min 99.degree. C. and
177 min 60.degree. C. Therefore, one or more waterbath, thermomixer
or PCR cycler are used.
DNA Purification
[0326] In an embodiment, the DNA after bisulfite treatment is
purified. Therefore, methods for purification of small amounts of
DNA as they are known to those skilled in the art can be used. In a
preferred embodiment, the purification is carried out by means of
ZYMO-SPIN.TM. IC columns (Zymo Research, USA). Therefore, 75-250
.mu.l, preferably 125-210 .mu.l, and most preferably 166 .mu.l of
buffer AVL, AL or ATL (all QIAGEN.RTM., Germany) were added to the
ZYMO-SPIN.TM. IC columns. Thereafter, the bisulfite reaction mix is
added to the column. The used pipette tip can be placed in the
respective bisulfite reaction tube for further use in order to
avoid DNA loss due to drops sticking at the tip, but this is not
strictly necessary according to the invention. According to the
invention, a new pipette tip may also be used. In addition, 20-170
.mu.l, preferably 60-120 .mu.l and most preferably 90 .mu.l of
buffer AVL, AL or ATL are added to the empty bisulfite reaction
tube and subsequently transferred to the corresponding
ZYMO-SPIN.TM. IC column. The bisulfite reaction mix and the
transferred buffer AVL, AL or ATL are mixed in the columns by
pipetting up and down several times. Subsequently, the mixture is
incubated in the column for 1-30 min, preferably for 3-15 min, and
most preferably for 10 min at 0-60.degree. C., preferably at
10-40.degree. C., in particular preferably at 15-30.degree. C. and
most preferably at room temperature. After this incubation, 175-400
.mu.l, preferably 225-275 .mu.l, most preferably 250 .mu.l of
ethanol are added to the columns and mixed. Subsequently, the
column is centrifuged for 0.5-10 min, preferably for 1-5 min, most
preferably for 1 min at 10,000-20,000.times.g, preferably for
14,000-18,000.times.g, and most preferably for 16,000.times.g. The
column is then transferred to a new 2 ml collection tube. After
this, 250-750 .mu.l, preferably 350-650 .mu.l, and most preferably
500 .mu.l of a buffer or solution comprising 0.2 mol/l NaOH and/or
90% v/v ethanol are added to the column. Also instead, suitable
buffers or solutions as they are already described above can be
used. In the following, the column is centrifuged for 0.5-10 min,
preferably for 1-5 min, most preferably for 1 min at
10,000-20,000.times.g, preferably for 14,000-18,000.times.g, and
most preferably for 16,000.times.g. The column is then transferred
to a new 2 ml collection tube. After this, 250-750 .mu.l,
preferably 350-650 .mu.l, and most preferably 500 .mu.l of buffer
AW1 (QIAGEN.RTM., Germay) are added to each column. Again, the
column is centrifuged for 0.5-10 min, preferably for 1-5 min, most
preferably for 1 min at 10,000-20,000.times.g, preferably for
14,000-18,000.times.g, and most preferably for 16,000.times.g and
transferred to a new 2 ml collection tube. Thereafter, 250-750
.mu.l, preferably 350-650 .mu.l, and most preferably 500 .mu.l of
buffer AW2 (QIAGEN.RTM., Germany) are added to each column. Again,
the column is centrifuged for 0.5-15 min, preferably for 1-8 min,
most preferably for 3 min at 10,000-20,000.times.g, preferably for
14,000-18,000.times.g, and most preferably for 16,000.times.g.
Afterwards, the column is placed in a collection tube for DNA
elution which is suitable for further analysis. The elution is
carried out by one step. Therefore, the DNA is eluted by the
addition of 15-50 .mu.l, preferably of 20-30 .mu.l, and most
preferably of 25 .mu.l of water or of buffer AE, AVE or EB (all
QIAGEN.RTM.) prewarmed to 30-70.degree. C., preferably
40-60.degree. C., and most preferably to 50.degree. C. Thereafter,
the column is incubated for 0-10 min, preferably for 1-5 min, most
preferably for 1 min, before it is centrifuged for 0.5-10 min,
preferably for 1-5 min, most preferably for 1 min at
1,000-10,000.times.g, preferably for 4,000-8,000.times.g, and most
preferably for 6,000.times.g.
[0327] In a preferred embodiment, the elution is carried out in two
steps. In a first step, the DNA is eluted by the addition of 7.5-25
.mu.l, preferably of 10-15 .mu.l, and most preferably of 12.5 .mu.l
of water or of buffer AE, AVE or EB (all QIAGEN.RTM.) prewarmed to
30-70.degree. C., preferably 40-60.degree. C., and most preferably
to 50.degree. C. Thereafter, the column is incubated for 0-10 min,
preferably for 1-5 min, most preferably for 1 min, before it is
centrifuged for 0.5-10 min, preferably for 1-5 min, most preferably
for 1 min at 1,000-10,000.times.g, preferably for
4,000-8,000.times.g, and most preferably for 6,000.times.g.
Afterward, the second elution step is carried out as a repetition
of the first elution step.
Subsequent Analysis
[0328] In an embodiment, DNA is quantified directly after lysis or
after bisulfite treatment and subsequent purification by means of a
real time assay (see Example 10).
[0329] In an embodiment of the invention, the lysed sample is
directly subject to subsequent analysis without any bisulfite
treatment or any DNA purification. This is in particular preferred
if a bisulfite treatment is not necessary for subsequent analysis.
For example, for the analysis of the methylation pattern by means
of restriction enzymes. Examples for such methods are as already
mentioned the DMH method or the restriction assay also known as
MestVal method (see above).
[0330] In an preferred embodiment, the DNA after bisulfite
treatment and subsequent purification is subject to subsequent
analysis or amplification. In a particular embodiment, it is
preferred that the subsequent analysis is an analysis of the
methylation pattern of the original DNA derived from the archived
sample.
[0331] For the analysis or amplification of bisulfite treated and
purified DNA derived from small amounts of an archived sample,
refer to the said above according to the amplification step.
Corresponding embodiments are included herewith.
Test Kits
[0332] The subject of the present invention is also a kit,
comprising one or more of the following: [0333] A container. [0334]
One or more organic solvents for removal of paraffin. This can be a
solvent which dissolves paraffin and is a solvent of the group
"limonene, xylene or any mixture of these solvents". Of course, the
kit may comprise organic solvents like benzene, ethylbenzene,
toluene or solvents with similar chemical properties or any mixture
of these solvents. Furthermore, the kit may comprise one or more
organic solvents which are suitable for washing the sample after
dissolving paraffin and which enable a better rehydratisation of
the sample. Such kind of solvent or solvents is a solvent of the
group of "ethanol, methanol, isopropanol or any mixture of these
solvents with each other or with water". Of course, the kit may
also comprise solvents with comparable chemical properties. [0335]
Protease in solution or as a powder. This protease can be a serin
protease, a thiol protease, a carboxy protease, a metalloprotease,
proteinase K or any mixture of these proteases. In a preferred
variant of the kit, the protease is proteinase K in from of a
powder or dissolved in an appropriate solution. [0336] One or more
lysis buffer, the lysis buffer comprising 50 mmol/l
Tris(tris-hydroxymethyl-amino-methan) pH 8.0, 1 mmol/l EDTA, 0.5%
Tween 20 v/v. Of course, the kit may also comprise any other lysis
buffer with similar properties. Such a buffer may include
detergents and/or chaotropic salts. [0337] One or more solutions
for DNA extraction. According to the invention, the kit may
comprise one or more of the following buffers: a) binding buffer
AL/E (QIAGEN.RTM.); b) binding buffer AL (QIAGEN.RTM.); c) binding
buffer ATL (QIAGEN.RTM.); d) binding buffer AVL (QIAGEN.RTM.); e)
ethanol, preferentially at least 96% pure ethanol; f) washing
buffers AW1 (QIAGEN.RTM.); g) washing buffer AW2 (QIAGEN.RTM.); h)
elution buffer AE(QIAGEN.RTM.); i) elution buffer AVE
(QIAGEN.RTM.); j) elution buffer EB (QIAGEN.RTM.); or k) water.
[0338] One or more devices for DNA extraction. According to the
invention, the kit may comprise one or more of the following plates
or columns as they are part of the following kits: DNEASY.RTM. 96
Tissue Kit, QIAAMP.RTM. 96 DNA Blood Kit, QIAAMP.RTM. DSP 96 Virus
MDx Kit, DNEASY.RTM. Tissue Kit, QIAAMP.RTM. DNA Mini Kit,
QIAAMP.RTM. DNA Micro Kit, QIAAMP.RTM. Viral RNA Mini or
QIAAMP.RTM. DSP Virus Kit (all QIAGEN.RTM.). According to the
invention, devices of other kits may also comprise to a kit of the
invention. For example, this can be devices which are based on the
"nexttec"-technology (nexttec) or the "charge-switch"-technology
(Invitrogen). If the case may be, the kit comprises also additional
solutions suitable for extracting DNA. [0339] One or more solutions
for bisulfite treatment. This can be any solution as described in
WO05/038051. Preferably the kit may comprise: [0340] A) A bisulfite
solution with a pH in the range of 4.7 to 6.5, preferably in the
range of 5.0 to 6.0, and particularly preferred in the range of
5.45 to 5.50. The bisulfite solution comprises hydogensulfite in a
concentration of 3.5-6.0, preferably in a concentration of 4.4-5.3,
and particularly preferred in a concentration of 4.83-4.93 mol/l.
For example, such kind of bisulfite solution can be obtained by
adding 4.708 g of sodium disulfite and 1.128 g of sodium sulfite to
10 ml of water. Of course, as known to those skilled in the art, a
kit may also comprise solutions with other concentrations. As the
case may be, appropriate volumes have then to be taken. After
dissolving of the salts, the final volume of the solution is about
12 ml. Therefore the kit may comprise sodium disulfite and/or
sodium sulfite each alone or combined in form of salts or dissolved
in solution. [0341] B) Additionally a kit may comprise water.
[0342] C) An organic radical scavenger solution comprising an
organic solvent and 50-1,000 mmol/l, preferably 100-750 mmol/l, and
particularly preferred 158-500 mmol/l of the radical scavenger
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid or any
other suitable radical scavenger as described in WO01/98528 or
WO05/038051. For preferred variants of the kit, a kit may comprise
a DME solution comprising 250-1,000 mmol/l, preferably 350-750
mmol/l, and particularly preferred 500 mmol/l
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid dissolved
in diethyleneglycoldimethylether (DME) or a dioxane solution
comprising 50-500 mmol/l, preferably 75-300 mmol/l, and
particularly preferred 158 mmol/l
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid dissolved
in 1,4-dioxane. [0343] One or more devices for bisulfite treatment.
This can be any device as described in WO01/98528 or WO05/038051.
[0344] One or more solutions for DNA purification. This can be in
part the same solutions as described above as for the DNA
extraction. According to the invention, the kit may comprise one or
more of the following buffers: [0345] A) Binding buffer AVL
(QIAGEN.RTM.), the binding buffer AVL may comprise 1-50 ng/.mu.l,
preferably 5-25 ng/.mu.l, particularly preferred 10 ng/.mu.l RNA or
a comparable amount of any nucleic acid. [0346] B) Ethanol,
preferentially at least 96% pure ethanol. [0347] C) Washing buffer
AW1 (QIAGEN.RTM.). [0348] D) Washing buffer AW2 (QIAGEN.RTM.).
[0349] E) One or more solutions suitable for an alkaline
hydrolysis. Preferably such kind of solution comprises 0.1-0.3
mol/l, preferably 0.15-0.25 mol/l, and particularly preferred 0.2
mol/l sodium hydroxide and 60-90%, preferably 75-90%, and
particularly preferred 90% ethanol. It is further preferably that
such kind of solutions comprise 0.1-0.3 mol/l, preferably 0.15-0.25
mol/l, and particularly preferred 0.2 mol/l sodium hydroxide.
[0350] F) Elution buffer AE (QIAGEN.RTM.). [0351] G) Elution buffer
AVE (QIAGEN.RTM.). [0352] H) Elution buffer EB (QIAGEN.RTM.).
[0353] I) Water. [0354] One or more devices for DNA purification.
According to the invention, this can be the same device as already
described for the extraction of DNA. It is preferable that the kit
may comprise one or more of the following plates or columns as they
are part of the following kits: DNEASY.RTM. 96 Tissue Kit,
QIAAMP.RTM. 96 DNA Blood Kit, QIAAMP.RTM. DSP 96 Virus MDx Kit,
DNEASY.RTM. Tissue Kit, QIAAMP.RTM. DNA Mini Kit, QIAAMP.RTM. DNA
Micro Kit, QIAAMP.RTM. Viral RNA Mini or QIAAMP.RTM. DSP Virus Kit
(all QIAGEN.RTM.). Also ZYMO-SPIN.TM. columns I, II and/or III may
be comprised. According to the invention, devices of other kits may
also comprise to a kit of the invention. For example, these can be
devices which are based on the "charge-switch"-technology
(Invitrogen). If the case may be, the kit comprises also additional
solutions suitable for extracting DNA. According to the invention,
the kit may also comprise columns or devices with are based on the
MICROCON.TM. technology. [0355] Solutions and/or substances for DNA
amplification. According to the invention, this may be one or more
of the following: [0356] A) One or more primers, which are suitable
for the amplification of one or more DNA amplificates, amongst
others the primer or primers can be modified, for example, with a
label for detection as well known by a person skilled in the art
like the dye FAM, Cy 3, Cy 5, biotin, digoxigenin, [0357] B) One or
more probes, which can be used to specifically record the
amplification of one or more amplificates, for example, in a
real-time-assay, amongst others the probe or probes can be
modified, for example, with a quencher and/or a label for detection
as well known by a person skilled in the art like the dye FAM or
the quencher BHQ black hole or dabcyl, [0358] C) One or more
blockers, which are nucleic acids and can be used to block the
binding of a specific primer or the replication by DNA polymerase,
amongst others the blocker or blockers can be modified, for
example, with 3'phosphate as well known by a person skilled in the
art, [0359] D) One or more reaction buffers, which are suitable for
a PCR reaction, [0360] E) Nucleotides, which can be dATP, dCTP,
dTTP, dUTP and dGTP or any derivative of these nucleotides, [0361]
F) MgCl.sub.2 as a substance or in solution and/or any other
magnesium salt, which can be used to carry out a DNA polymerase
replication, [0362] G) DNA polymerase, for example Taq DNA
polymerase or any other polymerase with or without proof-reading
activity, or [0363] H) Dye or quencher, which can be used for the
detection of the amplificates as known in the art, for example, an
intercalating dye like SYBR Green or a dye for linkage to a primer
or probe or blocker like the dye FAM or the quencher BHQ black hole
or dabcyl. [0364] A manual and/or description to carry out the
method of the invention or only to carry an embodiment of the
method according to the invention, and/or [0365] Any reagent,
solution, device and/or instruction which is useful for realization
of an assay according to the invention.
[0366] Subject of the invention is a test kit for carrying out a
method according to one or more of the embodiments of the
inventions, comprising [0367] a container, [0368] organic solvents
for removal of paraffin, [0369] proteinase K and/or buffer for
lysis, [0370] solutions and/or devices for DNA extraction, [0371]
solutions and/or devices for bisulfite treatment, [0372] solutions
and/or devices for DNA purification, [0373] solutions and/or
substances for DNA amplification, and [0374] a manual and/or
description for carrying out the method of the invention.
Use of the Methods and Test Kits
[0375] The methods and test kits disclosed herein are preferably
used for the detection of the DNA methylation status of a sample
taken from a tissue of a diseased or healthy person or of a person
whose status of health is not determined so far regarding a defined
disease. In a particularly preferred manner, the so determined DNA
methylation statuses are then compared with each other and/or with
a reference DNA methylation status.
[0376] Therefore, the invention also comprises the use of the
method according to one or more of the embodiments or of a test kit
according to the invention for the detection of the DNA methylation
status.
[0377] In case the status of health of a person from whom the
sample is derived is not or only insufficiently determined so far,
the results of the DNA methylation status analysis can be used to
determine the status of health of said person regarding a specific
disease or any predispositions for a specific disease. Therefore,
it is particularly preferred that the DNA methylation status is
used for diagnosing a disease or for diagnosing a predisposition
for a disease. Furthermore, it is also particularly preferred that
the DNA methylation status is used for diagnosing a progression of
a disease, if the status of health of a person regarding said
specific disease has been already been determined.
[0378] According to the invention, the use of the methods and kits
described herein are especially preferred if the disease is a
cancer disease.
[0379] The use of methods and kits described herein is in
particular preferred if the use is characterized in that the DNA
methylation status is used for diagnosing a disease, for diagnosing
a predisposition for a disease and/or for diagnosing a progression
of a disease, wherein in particular the disease is a cancer
disease.
[0380] The use of methods and kits described herein is in
particular preferred if it is characterized in that it is predicted
if the health status of a person will be positively or negatively
influenced by a drug or chemical substance or not. This is
particularly preferred if the use of the methods and kits described
herein is characterized in that the DNA methylation status is used
for predicting if the health status of a person will be positively
or negatively influenced by a drug or chemical substance or not.
The use is especially preferred if the health status is
characterized by a disease, a predisposition for a disease and/or
by a progression of a disease. This is most especially preferred if
the disease is a cancer disease.
[0381] The use of the methods and kits described herein is
especially preferred if the DNA methylation status is characterized
in that positions are methylated or non-methylated compared to
normal conditions and if a single defined disease or a
predisposition for a single defined disease exists. Of course, the
use of the methods and kits described herein is also preferred if
the DNA methylation status may also be characterized in that
positions are methylated or non-methylated compared to various
levels of diseased conditions and if a gradually progressive
disease exists.
[0382] The use of methods and kits described herein is especially
preferred if the DNA methylation status is characterized in that
positions are methylated or non-methylated compared to normal
conditions if a single defined disease exists.
[0383] If status of health of a person from whom the sample is
derived is independently determined from the DNA methylation
status, the results of the DNA methylation status analysis can be
used to identify a disease specific DNA methylation status. Such
disease specific DNA methylation status may include one or more
sites of a potential DNA methylation and/or the knowledge of the
presence or absence of a methylation at CG dinucleotides in case of
the presence or absence of a particular disease. Therefore, it is
particularly preferred to use any method or kit described herein
for the identification of an indication-specific target. According
to this, a) DNA of an archived sample originating from a diseased
tissue is prepared and the DNA methylation status is determined; b)
DNA of a sample originating from a healthy tissue is prepared and
the DNA methylation status is determined; c) an indication-specific
target is defined as differences in the DNA methylation status of a
DNA derived from a diseased tissue in comparison to a DNA derived
from a healthy tissue. Thereby, the sample of the diseased tissue
and the sample of the healthy tissue can originate from different
persons. Preferably these persons are relatives. It is particularly
preferred that the sample of the diseased tissue and the sample of
the healthy tissue originate from the same person, and it is
especially preferred that the samples originate from adjacent
tissues.
[0384] Of course, in the same manner also indication-specific
targets can be identified which are specific for a predisposition
for a disease or which are specific for a progression of a
disease.
[0385] The use according to one or more of the embodiments or of a
test kit according to the invention is preferred for identifying an
indication-specific target, wherein [0386] a) DNA of an archived
sample originating from a diseased tissue is prepared and the DNA
methylation status is determined, [0387] b) DNA of sample
originating from a healthy tissue is prepared and the DNA
methylation status is determined, and [0388] c) an
indication-specific target is defined as differences in the DNA
methylation status of a DNA derived from a diseased tissue in
comparison to a DNA derived from a healthy tissue.
[0389] The use of the methods or kits described herein is preferred
if the indication-specific target is a protein, peptide or RNA or
any other endogenous bioactive substance as for example
hormones.
[0390] In particular, the use is preferred if the
indication-specific target is a protein, peptide or RNA.
[0391] The said use is preferred if a per se known modulator of the
protein, peptide, RNA or other endogenous bioactive substance is
assigned to the specific indication of the diseased tissue.
[0392] In particular, a use is preferred wherein a per se known
modulator of the protein, peptide or RNA is assigned to the
specific indication of the diseased tissue.
[0393] Furthermore, the use of such a modulator is particularly
preferred for preparing a pharmaceutical composition in case of a
specific indication. This is especially preferred if the specific
indication is a specific cancer indication.
[0394] In particular, the use of the modulator assigned to the
specific indication of the diseased tissue is preferred for
preparing a pharmaceutical composition with a specific indication,
in particular a specific cancer indication.
[0395] The methods and test kits disclosed herein are preferably
used for the diagnosis and/or prognosis of adverse events for
patients or individuals, whereby diagnosis means to diagnose an
adverse event, a predisposition for an adverse event and/or a
progression of an adverse event. These adverse events belong to at
least one of the following categories: undesired drug interactions;
cancer diseases; CNS malfunctions, damage or disease; symptoms of
aggression or behavioral disturbances; clinical, psychological and
social consequences of brain damage; psychotic disturbances and
personality disorders; dementia and/or associated syndromes;
cardiovascular disease, malfunction or damage; malfunction, damage
or disease of the gastrointestinal tract; malfunction, damage or
disease of the respiratory system; lesion, inflammation, infection,
immunity and/or convalescence; malfunction, damage or disease of
the body as an abnormality in the development process; malfunction,
damage or disease of the skin, of the muscles, of the connective
tissue or of the bones; endocrine and metabolic malfunction, damage
or disease; headaches or sexual malfunction.
[0396] The methods and test kits disclosed herein are also
preferable used for distinguishing cell types, tissues or for
investigating cell differentiation. These serve in a particularly
preferred manner for analyzing the response of a patient to a drug
treatment.
Methods for DNA Methylation Analysis
[0397] The following methods for the detection of the DNA
methylation are all preferred embodiments of the invention. These
methods allow for determination of the methylation state of one or
a plurality of CpG dinucleotides (e.g., CpG islands) within a DNA
sequence. Such methods involve, among other techniques, the DMH
method, DNA sequencing of bisulfite-treated DNA, a number of PCR
based methylation assays, some of them--known as COBRA, MS-SNuPE,
MSP, nested MSP, HEAVYMETHYL.TM., METHYLIGHT.TM. and QM assay--are
described in more detail now:
[0398] DMH METHOD. The DMH method is carried out according to the
invention as it is described in principle in Huang et al. (Huang et
al., Hum Mol Genet, 8:459-470, 1999), in U.S. Ser. No. 09/497,855,
in DE 102005007185.6, in DE102005025 240.0, in DE102005036500.0, or
in U.S. 60/710,556 (all incorporated by its entirety). According to
these, genomic DNA is fragmented by restriction endonucleases
before it is subject to a DNA microarray of cloned CpG islands.
[0399] But the DMH method may also include several improvements:
After isolation of the DNA, an enrichment of methylated or
unmethylated DNA takes place by different means. This means can be
one or more of the following: for example restriction endonucleases
or proteins, peptides or oligmers which specially bind to CpG
dinucleotide either specific on methylated or on non-methylated CpG
dinucleotides. Four variants of enrichment by means of restriction
endonucleases are especially preferred.
[0400] The enrichment by use of only methylation specific
restriction enzymes without a previous addition of non-methylation
specific restriction enzymes but with a subsequent selective
amplification of fragments in the range of 50-5.000 bp via linker
(also known as adapters by those skilled in the art). Preferred
restriction enzymes are of the group "BisI, BstUI, BshI2361, AccII,
BstFNI, McrBC, MvnI, HpaII (HapII), HhaI, AciI, SmaI, HinPII,
HpyCH4IV and mixtures of two or more of the aforesaid enzymes."
[0401] Another enrichment is performed at first by the restriction
of DNA by one or more non-methylation specific restriction enzymes;
secondly, fragments smaller than 50 bp are discarded and
subsequently linker are ligated on each end of every fragment;
thirdly, the fragments provided with linker are subject to a
restriction by one or more methylation specific restriction
enzymes; and fourthly, the resulted fragments are subjected to an
amplification, wherein only fragments are amplified which are not
restricted in step three. According to this procedure fragments of
50-5.000 bp are enriched. It is thereby preferable that three
different methylation specific restriction enzymes are used, one or
more of the methylation specific restriction enzymes have a
restriction site in the length of 4 bp, in particular, which do not
contain any CG. The non-methylation specific restriction enzymes
are selected from the group "MseI, BfaI, Csp6I, Tru1I, Tvu1I,
Tru9I, Tvu9I, MaeI, XspI and mixtures of two or more of the
aforesaid enzymes". Preferably, a mixture of MseI, BfaI and Csp6I
is used. The methylation specific restriction enzymes can be any
enzyme which either cuts methylation specifically unmethylated or
methylated DNA. Preferably, the methylation specific enzyme is
selected from the group of "BisI, BstUI, BshI2361, AccII, BstFNI,
McrBC, MvnI, HpaII (HapII), HhaI, AciI, SmaI, HinP1I, HpyCH4IV,
EagI and mixtures of two or more of the aforesaid enzymes". In
particular, the use of BstUI, HpaII, HpyCH4IV and HinP1I is
preferred.
[0402] Besides that, an enrichment is also possible according to
the method of "Nod representation" as exemplified in WO02/086163.
According to this, DNA is restricted by suitable enzymes like BamHI
of BglII. After inactivation of the enzymes, the fragments are
circularized by self ligation before they are subject to another
restriction by NotI which only cut its unmethylated recognition
side. Through this, fragments with only unmethylated NotI
recognition sites are linearised onto which specific linker are
ligated. Therefore, it is possible to amplify those fragments. In
principle, this method can also be adjusted to other methylation
specific restriction enzymes as listed above.
[0403] As the fourth procedure of enrichment by the means of
restriction endonucleases, the MS AP-PCR (Methylation Sensitive
Arbitrarily-Primed Polymerase Chain Reaction) is preferred. This
technique is well known in the art and was described the first time
by Gonzalgo et al., Cancer Res., 57:594-599, 1997. In principle,
genomic DNA is subject to an restriction digestion, for example
HpaII. The resulting fragments are then subject to an amplification
wherein random primers are used which are rich in CG dinucleotides.
According to this, DNA regions are amplified which are rich in CG
dinucleotides.
[0404] An enrichment of methylated or non-methylated DNA can also
occur by means of proteins, peptides or oligmers which specifically
bind to methylated or non-methylated DNA. The binding can be
sequence specific or unspecific. However, unbound DNA is separated
by bound DNA through the binding. Depending on which kind of DNA is
of interest, methylated or non-methylated DNA, or which kind of DNA
is bound, the bound or unbound DNA fraction is further analyzed.
These means proteins may be used which specifically bind
unmethylated DNA, as well as proteins which specifically bind
methylated DNA. Furthermore, it is possible to bind that DNA, which
is later analyzed. Therefore, the unbound DNA is removed before the
bound DNA is released from the protein. On the other hand, it is
also possible to let bind the background DNA to the proteins and
thereby it is removed from the reaction mixture. Of course, it is
also possible to carry out such an enrichment in two subsequent
steps whereby the order is not relevant. In one step, proteins
which specifically bind unmethylated DNA and in the other step,
proteins which specifically bind methylated DNA are used. Such a
proceeding has the advantage that simultaneously unmethylated DNA
and methylated DNA are enriched while DNA with no or only a view
CpG positions is removed.
[0405] An enrichment can be achieved by proteins which methylation
specifically bind to DNA and also by the use of their domains or
peptides. Such proteins can be for example MeCP2, MBD1, MBD2, MBD4
and Kaiso. The later binds sequence specifically namely on
symmetrical methylated CpGpCpG positions. Exemplary the
Methyl-CpG-binding domain of MeCP2 protein or the CXXC-3 domain of
the MBD1 protein is mentioned as suitable domains for enrichment
(for an overview: Shiraishi et al., Anal Biochem. 2004 Jun. 1; 329
(1):1-10; Hendrich and Tweedie, Trends Genet. 2003 May, 19 (5):
269-77; Jorgensen et al., Molecular and Cellular Biology, 2004,
3387-3395; all incorporated by its entirety).
[0406] Typically, the proteins, domains or peptides are bound to a
solid surface, for example, on beads which enable a separation of
by means of a batch procedure or by a column chromatography (Cross
et al., Nature Genetics, 1994 (6) 236-244; Shiraishi et al., Anal
Biochem. 2004 Jun. 1; 329 (1):1-10). Biochemical Methods which have
to be applied are known to those skilled in the art. This may, for
example, include the use of biotin or histidine tags (for example,
Gretch et al., Anal Biochem., 1987, (163) 270-7; Janknecht et al.,
Pre Nat. Acad Sci, 1991, (88) 8972-6).
[0407] Moreover, an enrichment can also be achieved by methylation
specific antibodies, for example, by means of the anti
5-methyIcytosine antibody available from Abeam Inc. Again the
enrichment can be performed in a batch procedure or by column
chromatography. Details are known to persons skilled in the art
(for example: Fisher et al., Nucleic Acids Res. 2004, 32(1),
287-97). On the hand, an enrichment can also be achieved by
immunoprecipitation with methylation specific antibodies and
suitable secondary antibodies, followed by a proteinase K
treatment.
[0408] Another variant of enrichment is the chromatin
immunoprecipitation (ChIP). Details are known to those skilled in
the art (for example: Matarazzo et al., Biotechniques, 2004, 37(4),
666-8, 670, 672-3). According to this, a immunoprecipitation is
carried out with antibodies which are specific for 5-methylcytosine
binding proteins like MeCP2, MBD1, MBD2, MBD4 or Kaiso. Thereby,
the proteins are fixed onto the DNA before the antibodies are
added. In particular, it is preferred to purify the DNA first and
then add the DNA binding proteins. It is also particularly
preferred to apply a suitable physical method like
ultracentrifugation before the second precipitation step. A
suitable kit is available from Panomics, Inc.
[0409] Furthermore, an enrichment can be achieved by triplex
binding oligomers, which can be PNA- or DNA-Oligomers. This method
is described in detail in WO04/113564. In principle, a
triplex-binding oligomer is brought in contact with DNA.
Thereafter, it preferentially forms a triple helix with
unmethylated DNA in comparison to methylated DNA. This advantage is
taken for enrichment.
[0410] In principle, a DNA may be fragmented randomly or
non-randomly before it is subject to enrichment by any method using
proteins, peptides or oligmers. This is done as it is known by
those skilled in the art. Fragmentation can be performed randomly
for example with sonification or shearing. But is also can be
performed non-randomly, preferentially by the use of methylation
specific restriction endonucleases, in particular of the group of
"BisI, BstUI, BshI236I, AccII, BstFNI, McrBC, MvnI, HpaII (HapII),
HhaI, AciI, SmaI, HinP1I, J7pyCH4IV and any mixture of two or more
of the aforesaid enzymes".
[0411] A further reduction of complexity can be achieved by
physical methods which are applied before or after an
amplification. Such physical methods can, for example, be gel
electrophoresis, size-exclusion chromatography or filtration.
[0412] After enrichment of the DNA, the fragments are labeled
preferentially with a suitable fluorescent dye. Such a dye enables
selective one or two dimensional scanning Typically Cy3 and/or Cy5
are used as dyes, but other suitable dyes are also known to those
skilled in the art. Furthermore, it is preferred that the fragments
are labeled with biotin, which interacts with another substance in
the actually detection process. Thereby, it is necessary to carry
out two arrays which are compared with each other.
[0413] The labeling is carried out preferentially by means of an
amplification, in particular whole genome amplifications. Several
suitable methods are known by those skilled in the art.
[0414] The labeled fragments are then subject to a DNA microarray
which can be either an array of cloned CpG islands or array of
oligonucleotides. The oligonucleotides of the oligonucleotide
microarray can be any oligonucleotide suitable for the detection of
methylation or non-methylation of CpG dinucleotides. Preferably,
the oligonucleotides are designed after fragments derived according
to the following two strategies:
[0415] According to the first strategy, A) the genome of an
organism of desire is analyzed for first fragments, which are
flanked by recognition sites of non-methylation specific
restriction enzymes of interest and which are in the range of
100-1.200 bp. B) Second fragments are then selected under those
first fragments which have no more than 50%, preferably no more
than 20% of repeats. These two steps A) and B) can be performed in
arbitrary order. Additionally, C) the second selected fragments are
analyzed for the presence of recognition sites of methylation
specific restriction endonucleases of interest. Those second
fragments which include such a recognition site are then selected
as third fragments. Again, the steps A), B) and C) can be performed
in arbitrary order.
[0416] According to the second strategy, A) the genome of an
organism of desire is analyzed for first fragments, which are
flanked by recognition sites of methylation specific restriction
enzymes of interest and which are in the range of 100-1.200 bp. B)
Second fragments are then selected under those first fragments
which have no more than 50%, preferably no more than 20% of
repeats. C) The second selected fragments are analyzed for the
presence of recognition sites of methylation specific restriction
endonucleases of interest. Those second fragments which include
such a recognition site are then selected as third fragments.
Again, the steps A), B) and C) can be performed in arbitrary
order.
[0417] Fragments selected according to these strategies can match
fragments obtained by the enrichment procedures. The sequence of
the oligonucleotides of the array is chosen from the selected
fragments, so that they would hybridize to the selected fragments
or so that they are identical to them and therefore would hybridize
to the counter strand. These oligonucleotides are then synthesized
on the array or are linked to it after the synthesis. Typically
3-30 oligonucleotides are derived from one fragment, whereby it is
possible that the oligonucleotide sequences are overlapping.
Preferably, the oligonucleotides have a defined distance between
each other so that a so called "tiling array" results, similar as
described by Kapranov et al., Science, 2002, 296 (5569):916-9.
[0418] According to the DMH method, fragments hybridized on the
immobilized oligonucleotides contain preferably nucleic acid
sequences, which methylation positions are non-methylated or
methylated in case of a definite disease in comparison to the
normal condition. The oligonucleotides do not have to necessarily
encode for the methylation positions by themselves, although it is
possible. Moreover, it is possible that a oligonucleotide array
carries different sets of oligonucleotides, suitable for the
detection of different diseases or of predispositions for a disease
or of the susceptibility for side effects for a definitive medical
treatment. Additionally, it is also possible to predict the type,
the aggressiveness or the progression of a disease or for the
effectiveness of a medical treatment, in case it is based on
methylation differences. Further conclusions can be made by
comparison of the results obtained by means of an oligonucleotide
array according to the DMH method with a results obtained with
arrays with different oligonucleotide set, for example,
oligonucleotide sets suitable for SNP analysis.
[0419] BISULFITE SEQUENCING. DNA methylation patterns and
5-methylcytosine distribution can be analyzed by sequencing
analysis of a previously amplified fragment of the bisulfite
treated genomic DNA, as described by Frommer et al. (Frommer et al.
Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992). As the bisulfite
treated DNA is amplified before sequencing, the amplification
procedure according to the invention may be used in combination
with this detection method.
[0420] COBRA. COBRA analysis is a quantitative methylation assay
useful for determining DNA methylation levels at specific gene loci
in small amounts of genomic DNA (Xiong & Laird, Nucleic Acids
Res. 25:2532-2534, 1997). Briefly, restriction enzyme digestion is
used to reveal methylation-dependent sequence differences in PCR
products of sodium bisulfite-treated DNA. Methylation-dependent
sequence differences are first introduced into the genomic DNA by
standard bisulfite treatment according to the procedure described
by Frommer et al. (Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992)
or as described by Olek et al (Olek A, Oswald J, Walter J. (1996)
Nucleic Acids Res. 24: 5064-6). PCR amplification of the bisulfite
converted DNA is then performed using methylation unspecific
primers followed by restriction endonuclease digestion, gel
electrophoresis, and detection using specific, labeled
hybridization probes. Methylation levels in the original DNA sample
are represented by the relative amounts of digested and undigested
PCR product in a linearly quantitative fashion across a wide
spectrum of DNA methylation levels. In addition, this technique can
be reliably applied to DNA obtained from microdissected
paraffin-embedded tissue samples. Typical reagents (e.g., as might
be found in a typical COBRA-based kit) for COBRA analysis may
include, but are not limited to: PCR primers for specific gene (or
methylation-altered DNA sequence or CpG island); restriction enzyme
and appropriate buffer; gene-hybridization oligo; control
hybridization oligo; kinase labeling kit for oligo probe; and
radioactive nucleotides. Additionally, bisulfite conversion
reagents may include: DNA denaturation buffer; sulfonation buffer;
DNA recovery reagents or kits (e.g., precipitation,
ultrafiltration, affinity column); desulfonation buffer; and DNA
recovery components.
[0421] Additionally, restriction enzyme digestion of PCR products
amplified from bisulfite-converted DNA is also used, in the method
described by Sadri & Hornsby (Nucl. Acids Res. 24:5058-5059,
1996).
[0422] The bisulfite conversion and amplification procedure
according to the invention may be used in combination with this
detection method.
[0423] Ms-SNuPE (Methylation-sensitive Single Nucleotide Primer
Extension). The Ms-SNuPE technique is a quantitative method for
assessing methylation differences at specific CpG sites based on
bisulfite treatment of DNA, followed by single-nucleotide primer
extension (Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531,
1997). Briefly, genomic DNA is reacted with sodium bisulfite to
convert unmethylated cytosine to uracil while leaving
5-methylcytosine unchanged. Amplification of the desired target
sequence is then performed using PCR primers specific for
bisulfite-converted DNA, and the resulting product is isolated and
used as a template for methylation analysis at the CpG site(s) of
interest. Small amounts of DNA can be analyzed (e.g.,
microdissected pathology sections), and it avoids utilization of
restriction enzymes for determining the methylation status at CpG
sites.
[0424] Typical reagents (e.g., as might be found in a typical
Ms-SNuPE-based kit) for Ms-SNuPE analysis may include, but are not
limited to: PCR primers for specific gene (or methylation-altered
DNA sequence or CpG island); optimized PCR buffers and
deoxynucleotides; gel extraction kit; positive control primers;
Ms-SNuPE primers for specific gene; reaction buffer (for the
Ms-SNuPE reaction); and radioactive nucleotides. Additionally,
bisulfite conversion reagents may include: DNA denaturation buffer;
sulfonation buffer; DNA recovery regents or kit (e.g.,
precipitation, ultrafiltration, affinity column); desulfonation
buffer; and DNA recovery components.
[0425] The bisulfite conversion and amplification procedure
according to the invention may be used in combination with this
detection method.
[0426] MSP. MSP (methylation-specific PCR) allows for assessing the
methylation status of virtually any group of CpG sites within a CpG
island, independent of the use of methylation-sensitive restriction
enzymes (Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826,
1996; U.S. Pat. No. 5,786,146). Briefly, DNA is modified by sodium
bisulfite converting all unmethylated, but not methylated cytosines
to uracil, and subsequently amplified with primers specific for
methylated versus unmethylated DNA.
[0427] MSP primer pairs contain at least one primer, which
hybridizes to a bisulfite treated CpG dinucleotide. Therefore, the
sequence of said primers comprises at least one CpG dinucleotide.
MSP primers specific for non-methylated DNA contain a "T" at the 3'
position of the C position in the CpG. Preferably, therefore, the
base sequence of said primers is required to comprise a sequence
having a length of at least 9 nucleotides which hybridizes to the
bisulfite converted nucleic acid sequence, wherein the base
sequence of said oligomers comprises at least one CpG dinucleotide.
MSP requires only small quantities of DNA, is sensitive to 0.1%
methylated alleles of a given CpG island locus, and can be
performed on DNA extracted from paraffin-embedded samples. Typical
reagents (e.g., as might be found in a typical MSP-based kit) for
MSP analysis may include, but are not limited to: methylated and
unmethylated PCR primers for specific gene (or methylation-altered
DNA sequence or CpG island), optimized PCR buffers and
deoxynucleotides, and specific probes. The bisulfite conversion and
amplification procedure according to the invention may be used in
combination with this detection method.
[0428] NESTED MSP (Belinsky and Palmisano in US application
20040038245). Considering the apparent conflict of requiring high
specificity of the MSP primer to sufficiently differentiate between
CG and TG positions but allowing for a mismatch in order to create
a unique restriction site, it is preferred to use an amended
version of MSP, known as nested MSP, as described in WO02/18649 and
US patent application 20040038245 by Belinsky and Palmisano. This
method to detect the presence of gene-specific promoter
methylation, comprises the steps of: expanding the number of copies
of the genetic region of interest by using a polymerase chain
reaction to amplify a portion of said region where the promoter
methylation resides, thereby generating an amplification product;
and using an aliquot of the amplification product generated by the
first polymerase chain reaction in a second, methylation-specific,
polymerase chain reaction to detect the presence of methylation. In
other words, a non-methylation specific PCR is performed prior to
the methylation specific PCR. The bisulfite conversion and
amplification procedure according to the invention may be used in
combination with this detection method.
[0429] HEAVYMETHYL.TM.. (WO02/072880; Cottrell S E et al. Nucleic
Acids Res. 2004 Jan. 13; 32 (1):e10) A further preferred embodiment
of the method comprises the use of blocker oligonucleotides. In the
HEAVYMETHYL.TM. assay blocking probe, oligonucleotides are
hybridized to the bisulfite treated nucleic acid concurrently with
the PCR primers. PCR amplification of the nucleic acid is
terminated at the 5' position of the blocking probe, such that
amplification of a nucleic acid is suppressed where the
complementary sequence to the blocking probe is present. The probes
may be designed to hybridize to the bisulfite treated nucleic acid
in a methylation status specific manner. For example, for detection
of methylated nucleic acids within a population of unmethylated
nucleic acids, suppression of the amplification of nucleic acids
which are unmethylated at the position in question would be carried
out by the use of blocking probes comprising a `CpA` or `TpA` at
the position in question, as opposed to a `CpG` if the suppression
of amplification of methylated nucleic acids is desired. For PCR
methods using blocker oligonucleotides, efficient disruption of
polymerase-mediated amplification requires that blocker
oligonucleotides not be elongated by the polymerase. Preferably,
this is achieved through the use of blockers that are
3'-deoxyoligonucleotides, or oligonucleotides derivatized at the 3'
position with other than a "free" hydroxyl group. For example,
3'-0-acetyl oligonucleotides are representative of a preferred
class of blocker molecule.
[0430] Additionally, polymerase-mediated decomposition of the
blocker oligonucleotides should be precluded. Preferably, such
preclusion comprises either use of a polymerase lacking 5'-3'
exonuclease activity, or use of modified blocker oligonucleotides
having, for example, thioate bridges at the 5'-terminii thereof
that render the blocker molecule nuclease-resistant. Particular
applications may not require such 5' modifications of the blocker.
For example, if the blocker- and primer-binding sites overlap,
thereby precluding binding of the primer (e.g., with excess
blocker), degradation of the blocker oligonucleotide will be
substantially precluded. This is because the polymerase will not
extend the primer toward, and through (in the 5 `-3` direction) the
blocker-a process that normally results in degradation of the
hybridized blocker oligonucleotide.
[0431] A particularly preferred blocker/PCR embodiment, for
purposes of the present invention and as implemented herein,
comprises the use of peptide nucleic acid (PNA) oligomers as
blocking oligonucleotides. Such PNA blocker oligomers are ideally
suited, because they are neither decomposed nor extended by the
polymerase.
[0432] Preferably, therefore, the base sequence of said blocking
oligonucleotide is required to comprise a sequence having a length
of at least 9 nucleotides which hybridizes to the chemically
treated nucleic acid sequence, wherein the base sequence of said
oligonucleotides comprises at least one CpG, TpG or CpA
dinucleotide.
[0433] The bisulfite conversion and amplification procedure
according to the invention may be used in combination with this
detection method.
[0434] Preferably, real-time PCR assays are performed specified by
the use of such primers according to the invention. Real-time PCR
assays can be performed with methylation specific primers (MSP-real
time) as methylation-specific PCR ("MSP"; as described above), or
with non-methylation specific primers in presence of methylation
specific blockers (HM real-time) ("HEAVYMETHYL.TM.", as described
above). Real-time PCR may be performed with any suitable detectably
labeled probes. For details, see below. Both of these methods (MSP
or HM) can be combined with the detection method known as
METHYLIGHT.TM. (a fluorescence-based real-time PCR technique) (Eads
et al., Cancer Res. 59:2302-2306, 1999), which generally increases
the specificity of the signal generated in such an assay. Whenever
the real-time probe used is methylation specific in itself, the
technology shall be referred to as METHYLIGHT.TM., a widely used
method.
[0435] Another assay makes use of the methylation specific probe,
the so called "QM" (quantitative methylation) assay. A methylation
unspecific, therefore unbiased, real-time PCR amplification is
performed, which is accompanied by the use of two methylation
specific probes (METHYLIGHT.TM.), one for the methylated and a
second for the unmethylated amplificate. That way two signals are
generated which can be used to a) determine the ratio of methylated
(CG) to unmethylated (TG) nucleic acids, and at the same time b)
the absolute amount of methylated nucleic acids can be determined,
when calibrating the assay with a known amount of control DNA.
[0436] METHYLIGHT.TM.. The METHYLIGHT.TM. assay is a
high-throughput quantitative methylation assay that utilizes
fluorescence-based real-time PCR (TAQMAN.RTM.) technology that
requires no further manipulations after the PCR step (Eads et al.,
Cancer Res. 59:2302-2306, 1999). Briefly, the METHYLIGHT.TM.
process begins with a mixed sample of genomic DNA that is
converted, in a sodium bisulfite reaction, to a mixed pool of
methylation-dependent sequence differences according to standard
procedures (the bisulfite process converts unmethylated cytosine
residues to uracil). Fluorescence-based PCR is then performed
either in an "unbiased" (with primers that do not overlap known CpG
methylation sites) PCR reaction, or in a "biased" (with PCR primers
that overlap known CpG dinucleotides) reaction. Sequence
discrimination can occur either at the level of the amplification
process or at the level of the fluorescence detection process, or
both.
[0437] The METHYLIGHT.TM. assay may be used as a quantitative test
for methylation patterns in the genomic DNA sample, wherein
sequence discrimination occurs at the level of probe hybridization.
In this quantitative version, the PCR reaction provides for
unbiased amplification in the presence of a fluorescent probe that
overlaps a particular putative methylation site. An unbiased
control for the amount of input DNA is provided by a reaction in
which neither the primers, nor the probe overlie any CpG
dinucleotides. Alternatively, a qualitative test for genomic
methylation is achieved by probing of the biased PCR pool with
either control oligonucleotides that do not "cover" known
methylation sites (a fluorescence-based version of the "MSP"
technique), or with oligonucleotides covering potential methylation
sites.
[0438] The METHYLIGHT.TM. process can be used with a "TAQMAN.RTM."
probe in the amplification process. For example, double-stranded
genomic DNA is treated with sodium bisulfite and subjected to one
of two sets of PCR reactions using TAQMAN.RTM. probes; e.g., with
either biased primers and TAQMAN.RTM. probe, or unbiased primers
and TAQMAN.RTM. probe. The TAQMAN.RTM. probe is dual-labeled with
fluorescent "reporter" and "quencher" molecules, and is designed to
be specific for a relatively high GC content region so that it
melts out at about 10.degree. C. higher temperature in the PCR
cycle than the forward or reverse primers. This allows the
TAQMAN.RTM. probe to remain fully hybridized during the PCR
annealing/extension step. As the Taq polymerase enzymatically
synthesizes a new strand during PCR, it will eventually reach the
annealed TAQMAN.RTM. probe. The Taq polymerase 5' to 3'
endonuclease activity will then displace the TAQMAN.RTM. probe by
digesting it to release the fluorescent reporter molecule for
quantitative detection of its now unquenched signal using a
real-time fluorescent detection system.
[0439] Variations on the TAQMAN.TM. detection methodology that are
also suitable for use with the described invention include the use
of dual-probe technology (LIGHTCYCLER.TM.) or fluorescent
amplification primers (SUNRISE.TM. technology). Both these
techniques may be adapted in a manner suitable for use with
bisulfite treated DNA, and moreover for methylation analysis within
CpG dinucleotides. Typical reagents (e.g., as might be found in a
typical METHYLIGHT.TM.-based kit) for METHYLIGHT.TM. analysis may
include, but are not limited to: PCR primers for specific bisulfite
sequences, i.e., bisulfite converted genetic regions (or bisulfite
converted DNA or bisulfite converted CpG islands); probes (e.g.,
TAQMAN.RTM. or LIGHTCYCLER.TM.) specific for said amplified
bisulfite converted sequences; optimized PCR buffers and
deoxynucleotides; and a polymerase, such as Taq polymerase.
[0440] The bisulfite conversion and amplification procedure
according to the invention may be used in combination with this
detection method.
[0441] The fragments obtained by means of the amplification can
carry a directly or indirectly detectable label. Preferred are
labels in the form of fluorescence labels, radionuclides, or
detachable molecule fragments having a typical mass, which can be
detected in a mass spectrometer. Where said labels are mass labels,
it is preferred that the labeled amplificates have a single
positive or negative net charge, allowing for better detectability
in the mass spectrometer. The detection may be carried out and
visualized by means of, e.g., matrix assisted laser
desorption/ionization mass spectrometry (MALDI) or using electron
spray mass spectrometry (ESI).
[0442] Matrix Assisted Laser Desorption/Ionization Mass
Spectrometry (MALDI-TOF) is a very efficient development for the
analysis of biomolecules (Karas & Hillenkamp, Anal Chem.,
60:2299-301, 1988). An analyte is embedded in a light-absorbing
matrix. The matrix is evaporated by a short laser pulse thus
transporting the analyte molecule into the vapor phase in an
unfragmented manner. The analyte is ionized by collisions with
matrix molecules. An applied voltage accelerates the ions into a
field-free flight tube. Due to their different masses, the ions are
accelerated at different rates. Smaller ions reach the detector
sooner than bigger ones. MALDI-TOF spectrometry is well suited to
the analysis of peptides and proteins. The analysis of nucleic
acids is somewhat more difficult (Gut & Beck, Current
Innovations and Future Trends, 1:147-57, 1995). The sensitivity
with respect to nucleic acid analysis is approximately 100-times
less than for peptides, and decreases disproportionally with
increasing fragment size. Moreover, for nucleic acids having a
multiply negatively charged backbone, the ionization process via
the matrix is considerably less efficient. In MALDI-TOF
spectrometry, the selection of the matrix plays an eminently
important role. For desorption of peptides, several very efficient
matrixes have been found which produce a very fine crystallization.
There are now several responsive matrixes for DNA, however, the
difference in sensitivity between peptides and nucleic acids has
not been reduced. This difference in sensitivity can be reduced,
however, by chemically modifying the DNA in such a manner that it
becomes more similar to a peptide. For example, phosphorothioate
nucleic acids, in which the usual phosphates of the backbone are
substituted with thiophosphates, can be converted into a
charge-neutral DNA using simple alkylation chemistry (Gut &
Beck, Nucleic Acids Res. 23:1367-73, 1995). The coupling of a
charge tag to this modified DNA results in an increase in MALDI-TOF
sensitivity to the same level as that found for peptides.
[0443] The amplificates may also be further detected and/or
analyzed by means of oligonucleotides constituting all or part of
an "array" or "DNA chip" (i.e., an arrangement of different
oligonucleotides and/or PNA-oligomers bound to a solid phase). Such
an array of different oligonucleotide- and/or PNA-oligomer
sequences can be characterized, for example, in that it is arranged
on the solid phase in the form of a rectangular or hexagonal
lattice. The solid-phase surface may be composed of silicon, glass,
polystyrene, aluminum, steel, iron, copper, nickel, silver, or
gold. Nitrocellulose as well as plastics such as nylon, which can
exist in the form of pellets or also as resin matrices, may also be
used. An overview of the Prior Art in oligomer array manufacturing
can be gathered from a special edition of Nature Genetics (Nature
Genetics Supplement, Volume 21, January 1999, and from the
literature cited therein). Fluorescently labeled probes are often
used for the scanning of immobilized DNA arrays. The simple
attachment of Cy3 and Cy5 dyes to the 5'-OH of the specific probe
are particularly suitable for fluorescence labels. The detection of
the fluorescence of the hybridized probes may be carried out, for
example, via a confocal microscope. Cy3 and Cy5 dyes, besides many
others, are commercially available. The bisulfite conversion and
amplification procedure according to the invention may be used in
combination with this detection method.
[0444] Furthermore, additional methods for methylation analysis are
known by persons skilled in the art. Such methods are for example
methods in which bisulfite treated DNA is subject to DNA array
based analysis methods as described in WO 99/28498, WO 01/38565, or
in WO 02/18632.
[0445] All references cited herein are incorporated in their
entirety.
Example 1
Paraffin Removal Step
[0446] Chemical needed: Limonene145, Fluka Chemika, Art Nr.
89188
[0447] Procedure: [0448] 1. Spin safe look or screw cap reaction
tubes (containing 1-5 sections of a paraffin-embedded
formalin-fixed tissue) for 1 min at 5,000.times.g. [0449] 2. Add 1
ml limonene to each tube. Push all pieces into the liquid. In some
cases sample material is already very brittle with small pieces of
paraffin/tissue in tube--make sure that material sticking to the
tube cap goes back into the tube. [0450] 3. 1 h incubation at room
temperature at 1,000 rpm in thermomixer, vortex vigorously at least
3 times during incubation. [0451] 4. Place tubes into centrifuge
and spin at 16,000 rcf (=16,000.times.g) for 5 min, the tissue will
pellet at the tube bottom. [0452] 5. Use a 1 ml pipette to suck up
the limonene from each sample. Great care should be taken not to
disturb the pellet! Place pipette tip opposite the pellet onto the
tube and gently allow limonene to enter the pipette tip; for
removal of last droplets a yellow tip should be used. [0453] 6. If
the tissue settles only weakly at the bottom (i.e., not forming a
nice pellet) do the following: [0454] repeat centrifugation again
for 5 min on EPPENDORF.RTM. 5417 centrifuge at max speed
(>20,000 rcf), and [0455] then repeat the removal of limonene:
make sure the pipette tip is pressed against the bottom of the tube
and limonene is removed very slowly such as not to suck in the
tissue. Remove as much limonene as possible.
Lysis Step
[0456] Prepare a larger volume of the lysis buffer (0.5 or 1 l),
depending on the number of samples to be processed for a project.
This buffer can be stored at room temperature for 3 months. Check
for contamination and carry out filter sterilization of an aliquot
before each use.
[0457] Chemicals: TRIS (tris-hydroxymethyl-amino-methan), Merck,
Art. Nr. 1.01549.0500, MW=121.14 g/mol. Prepare a 1 mol/l stock
solution: dissolve 121.14 g in 800 ml H.sub.2O and adjust to pH 8.0
with HCl and fill up to 1 l.
[0458] EDTA (ethylendiaminetetraacetic acid), Sodium EDTA
(Titriplex III) from Merck, Art. Nr. 159294 MW=3 7 2.24 g/mol.
Prepare a 0.5 mol/l stock solution: Dissolve 186.1 g in 800 ml
H.sub.2O and adjust to pH 8.0 with NaOH, fill up to 1 l.
[0459] Tween (Tween 20), Fluka, Chemika Art Nr. 93773. This
detergent is added to the buffer in volume percent. To add Tween to
the buffer, take 1 ml of Tween (in 2 ml tube), warm it at
50.degree. C. and add desired volume to buffer with a widened
pipette tip.
[0460] Lysis buffer composition: 50 mmol/l TrisHCl, pH 8.0, 1
mmol/l EDTA, 0.5% Tween (volume %).
[0461] Proteinase K, Roth. Always prepare a fresh 30 mg/ml stock
solution in H.sub.2O. The size of the stock solution should be
adjusted to the number of samples to be processed. For example, 300
mg proteinase K dissolved in 10 ml H.sub.2O will be sufficient for
.about.400 samples.
[0462] Procedure: [0463] 1. Add 190 .mu.l of the prepared lysis
buffer to each sample. It is important to ensure that all sample
material is covered by lysis buffer. [0464] 2. Add 20 .mu.l of the
prepared proteinase K solution. [0465] 3. Vortex the tube
rigorously to ensure proper mixing of sample with lysis buffer and
proteinase K. Make sure the tube caps are tightly closed--otherwise
loss of liquid will happen! [0466] 4. Incubate at 60.degree. C.,
shaking 1,000 rpm (thermoshaker). [0467] 5. Incubate for 40 to 48
hours, no further additions of proteinase K necessary. [0468] 6.
Spin in the morning and the evening of each day to remove droplets
from the cap, vortex vigorously. [0469] 7. Incubate samples at
>95.degree. C. for 10 min in to order to inactive proteinase K.
For this, set the thermomixer at a temperature of 99.degree. C.,
since the real temperature at the highest setting is some degrees
below the indicated temperature. [0470] Active proteinase K in the
lysate will reduce PCR performance, especially if lysate is used
directly for quantitation of genomic DNA by real time PCR.
Quality Check of Lysis (During Lysis)
[0471] After lysis step 5, there should be a homogeneous, maybe
turbid solution in the tube with no visible pieces of tissue left.
However, should there be visible pieces of tissues in MANY of the
samples left after the first ON-incubation additional proteinase K
step and increase of lysis volume should be considered. If only
individual samples have some undigested material left this may be
neglected. Have a careful look!
Storage
[0472] Lysed samples may be stored at either -20.degree. C. or
-80.degree. C. (depending on storage time) or be used immediately
for downstream processing.
DNA Extraction Step
[0473] Equipment needed:
[0474] Plate centrifuge (Sigma or QIAGEN.RTM., capable of up to
5,758.times.g (6,000 rpm))
[0475] Pipettors for volumes of from 10 .mu.l to 1,000 .mu.l
(multichannel for large volumes)
[0476] Waste container for DNA flowthrough (e.g., bowl with
DNA-off)
[0477] Material needed:
[0478] DNEASY.RTM. 96 Tissue Kit (QIAGEN.RTM. #69581 or 69582)
[0479] pipette tips (100 .mu.l, 1,000 .mu.l)
[0480] 15 ml and 50 ml Falcon tubes
[0481] Chemicals needed:
[0482] ethanol, molecular biology grade
[0483] Procedure
Make sure by respective labeling, that are turned in the same
direction (well all plates in an ass A1 over well A1 etc.). [0484]
1. Distribute 400 .mu.l AL/E in collection microtubes and transfer
lysate (200 .mu.l) to the tubes; seal tubes with caps for
collection tubes; use plate lid to fix tubes in rack [0485] 2. Mix
by shaking 15 s with BOTH hands; spin shortly (let centrifuge reach
1,450.times.g and stop); [0486] 3. Place the DNEASY.RTM. 96 plate
on an S-block (seal unused wells of DNEASY.RTM. plate with
AIRPORE.TM. Tape sheet). Carefully apply the mixture from step 2
onto columns. Seal with AIRPORE.TM. Tape. Centrifuge at
5,790.times.g for 10 min. If there's still fluid visible on
membranes, add centrifugation step. [0487] 4. Remove the tape. Add
500 .mu.l AW1. Seal with new AIRPORE.TM. Tape sheet. Empty S-block.
Spin for 5 min at 5,790.times.g. [0488] 5. Remove the tape. Add 500
.mu.l AW2. Seal with new AIRPORE.TM. Tape sheet. Empty S-block.
Spin for 15 min at 5,790.times.g, this should leave the membrane
dried. [0489] 6. Place DNEASY.RTM. plate on elution microtube
plate. To elute DNA add 120 .mu.l buffer AE or ddH.sub.2O preheated
to 70.degree. C. to each well. Seal the plate with a new
AIRPORE.TM. Tape sheet. Incubate for 5 min at room temperature.
Spin for 2 min at 5,790.times.g. [0490] 7. Seal elution microtubes
with caps provided. Store at -20.degree. C. or -80.degree. C.
(depending on storage time)
Bisulfite Treatment Step and DNA Purification Step
[0491] Equipment needed: [0492] Thermocycler (e.g., EPPENDORF.RTM.,
Tetrad) [0493] Plate centrifuge (Sigma or QIAGEN.RTM., capable of
up to 5,700.times.g) [0494] Pipettors for volumes of from 10 .mu.l
to 1,000 .mu.l (multichannel EPPENDORF.RTM.+Matrix pipettors)
[0495] Material needed: [0496] PCR-plates+cap strips [0497]
QIAAMP.RTM. 96 DNA Blood Kit (QIAGEN.RTM. #51161 for 4 plates or
51162 for 12) [0498] Additional round well blocks and caps (1
needed additional for each purification of 96 samples; #19576 for
24 plates) [0499] QIA Buffer AVL (#19073 for 155 ml, 560 .mu.l per
sample needed) [0500] Pipette tips (100 .mu.l, 1,000 .mu.l,
EPPENDORF.RTM.+Matrix) [0501] 15 ml and 50 ml Falcon tubes [0502]
Waste container for DNA-flowthroughs (e.g., bowl with DNA-off)
[0503] Chemicals needed: [0504] Sodium bisulfite (Na2S205, 190.1
g/mol), Merck 1.06528.0500 [0505] Sodium sulfite, anhydrous
(Na2S03, 126.04 g/mol), Fluka 71988 [0506] ddH.sub.2O molecular
biology grade (0.2 pm filtered, DEPC-treated, autoclaved, free of
DNases- and RNases) [0507] Diethyleneglycoldimethylether (DME),
Merck 8.02934.0250 [0508]
6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (250.29
g/mol), Aldrich 23,881-3 [0509] Ethanol, molecular biology grade
[0510] Sodium hydroxide pellets (NaOH, 40.0 g/mol), Merck
1.06482.1000
[0511] Preparation of Solutions (Sufficient for 80 Reactions,
Always to be Prepared Fresh):
[0512] Bisulfite solution: Sodium disulfite (4.708 g) and sodium
sulfite (1.128 g) are dissolved by adding 10 ml ddH.sub.2O (the
solution is 4.9 M). The final volume is around 12 ml. Check pH of
the solution--if it is not between 5.45 and 5.5, discard solution
and repeat preparation. Shake rigorously and if needed, heat the
solution to 50.degree. C. in a waterbath than vortex at maximum
speed for 30 sec. Repeat this procedure as often until the salt is
completely dissolved.
[0513] DME-radical scavenger solution: Dissolve 125.3 mg of
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid by adding
1.0 ml DME. Vortex rigorously in order to ensure that no
undissolved particles remain. DME is hazardous and potentially
carcinogenic. Therefore take appropriate precautions when handling
this chemical. If only few samples are to be bisulfite treated,
prepare smaller volumes.
[0514] Desulfonation buffer: Dissolve 0.8 g sodium hydroxide in 10
ml ddH.sub.2O to prepare a 2 mol/l stock-solution. For the
desulfonation buffer mix 1.0 ml 2 mol/l sodium hydroxide and 9.0 ml
ethanol. The solution has to prepared freshly before each
purification!
[0515] Procedure Bisulfite Reaction (Final Volume of 140
.mu.l):
Pipette the following solutions into PCR-plates in the order shown.
[0516] 1. 44 .mu.l buffer/water containing the DNA to be bisulfite
treated [0517] 2. 83 .mu.l bisulfite solution (pipetting of
bisulfite and sample can be interchanged) [0518] 3. 13 .mu.l DME
solution, containing the radical scavenger [0519] 4. Mix thoroughly
[0520] 5. Place in 0.2 ml wells of thermocycler. Use cap-strips to
close wells.
[0521] Temperature Program in a Thermocycler [0522] 5:00 min
denaturation of DNA at 99.degree. C. [0523] 22:00 min incubation at
60.degree. C. [0524] 3:00 min denaturation of DNA at 99.degree. C.
[0525] 1:27:00 hours incubation at 60.degree. C. [0526] 3:00 min
denaturation of DNA at 99.degree. C. [0527] 2:57:00 hours
incubation at 60.degree. C. [0528] cooling at 20.degree. C.
[0529] 1. Preparation of Binding Buffer AVL [0530] Add 1 ml of
buffer AVL to 310 .mu.g of lyophilized carrier RNA. Dissolve
thoroughly. [0531] Transfer to the buffer AVL bottle (30 ml), and
mix thoroughly before using buffer AVL for the first time. [0532]
This buffer can be stored at 2-8.degree. C. for future use up to 6
months. However, if a precipitate develops, then redissolve by
heating at 80.degree. C. no longer than 5 min. This should be done
no more than a total of 6 times. Cool to room temperature before
use. An aliquot of prepared buffer AVL can also be stored at room
temperature for up to 2 weeks.
[0533] 2. Preparation of Binding Conditions [0534] For each sample
two wells have to be used; these should be on 2 round well blocks
in order to keep the original layout (e.g., well Al of bisulfite
plate will be split into 70 .mu.l in well Al block 1 and 70 .mu.l
in well Al block 2, see FIG. 22). [0535] Into each well of blocks
pipette 280 .mu.l of prepared buffer AVL/carrier RNA. [0536] Add 70
.mu.l DNA/bisulfite solution from PCR-plate, place DNA directly
into buffer and pipette up and down 3 times to ensure complete
transfer of DNA and mixing. [0537] Add 280 .mu.l Ethanol. Seal the
wells by using caps for blocks. Mix vigorously for at least 15 sec.
(Ethanol tends to refuse to mix with fluids based on water.) [0538]
Alternatively, if DNA amounts are very critical: Pipette only 200
.mu.l into blocks, use remaining 80 .mu.l to wash wells of
bisulfitation-plate after transfer of DNA. [0539] Spin briefly at
1,450.times.g (reach 1,450.times.g and stop) to get the drops down.
Incubate at room temperature for 10 minutes.
[0540] 3. Binding [0541] Both wells are loaded subsequently onto
ONE column (see illustration above) [0542] Place QIAAMP.RTM. 96
plate on top of an S-block [0543] apply 630 .mu.l of the first well
per sample QIAAMP.RTM. 96 plate [0544] Seal plate with a
AIRPORE.TM. Tape sheet, spin at 5,790.times.g for 4 min [0545]
Empty the S-block [0546] Repeat binding with second well of each
sample onto the same column like first well (load, seal, spin,
empty S-block).
[0547] 4. Washing and 5. Desulfonation [0548] Place QIAAMP.RTM. 96
plate of S-block [0549] Add 500 .mu.l buffer AW1 [0550] Seal the
plate with new AIRPORE.TM. Tape sheet [0551] Spin at 5,790.times.g
for 2 min [0552] Empty S-block, place plate on S-block [0553] Add
500 .mu.l 0.2 mol/l NaOH to the QIAAMP.RTM. 96 plate [0554] Seal
with a fresh AIRPORE.TM. Tape sheet, incubation for 15 min at room
temperature. [0555] Centrifuge at 5,790.times.g for 1 min. [0556]
Empty S-block [0557] add 500 .mu.l AW2 [0558] Seal the plate with
new AIRPORE.TM. Tape sheet [0559] Spin at 5,790.times.g for 15
min.
[0560] 6. Elution [0561] Place QIAqmp 96 plate on rack of elution
microtubes. [0562] Add 100 .mu.l AE or ddH.sub.2O preheated to
70.degree. C. [0563] Seal plate with a new AIRPORE.TM. sheet and
incubate at room temperature for 5 min [0564] Spin at 5,790.times.g
for 4 min [0565] Seal tubes with caps.
[0566] The DNA can then be further amplified and analyzed by means
of the sensitive methods for DNA methylation analysis.
Example 2
[0567] All steps will be done in the tubes that the samples are
provided in, i.e., the tubes provided by the supplier of the
samples, these can be both 1.5 and 2.0 ml (preferred) tubes. Please
double check that tube formats fit into the centrifuge.
[0568] The solvents and buffers can be delivered with either single
channel pipettes or multipipettes
Removal of Paraffin
[0569] Chemical needed: Limonene145, Fluka Chemika, Art Nr.
89188
[0570] Procedure: [0571] 1. Add 1 ml limonene to each tube
(containing 1 to 5 slides of paraffin-embedded formalin-fixed
surgery sample). Push all pieces into the liquid. In some cases
sample material is already very brittle with small pieces of
paraffin/tissue in tube--make sure that material sticking to the
tube cap goes back into the tube. [0572] 2. 1 h incubation at room
temperature at 1,000 rpm, vortex vigorously at least 3 times during
incubation. [0573] 3. Place tubes into centrifuge and spin at
16,000 rcf (=16,000.times.g) for 5 min, the tissue will pellet at
the tube bottom. [0574] 4. Use a 1 ml pipette to suck up the
limonene from each sample. Great care should be taken not to
disturb the pellet! Place pipette tip opposite the pellet onto the
tube and gently allow limonene to enter the pipette tip, in some
cases it can be easier to remove the entire volume in two rather
than one pipetting steps. It is o.k. if small amounts (up to 50
.mu.l) of limonene remain in tube. [0575] 5. If the tissue settles
only weakly at the bottom (i.e., not forming a nice pellet) do the
following: [0576] repeat centrifugation again for 5 min on
EPPENDORF.RTM. 5417 centrifuge at max speed (>20,000 rcf) [0577]
then repeat the removal of limonene: make sure the pipette tip is
pressed against the bottom of the tube and limonene is removed very
slowly such as not to suck in the tissue. Remove as much limonene
as possible.
[0578] Leave out ethanol step, if it was possible to remove nearly
all limonene (if there are 50 .mu.l left, this will be ok) [0579]
6. Add 1 ml of ethanol (purity>99%). [0580] 7. Vortex, 10 min
incubation at room temperature at 1,000 rpm. [0581] 8. Place tubes
into centrifuge and spin at 16,000 rcf for 5 min, the tissue will
pellet again at the tube bottom. [0582] 9. Use pipette to suck up
the ethanol, great care should be taken not to disturb the pellet!
Place pipette tip opposite the pellet onto the tube wall and gently
allow ethanol to enter the pipette tip. [0583] 10. Remove as much
of ethanol as possible with the pipette. [0584] 11. Residual
ethanol not removed by pipetting must be evaporated by incubation
in a thermomixer at 50.degree. C. This may take between 10 to 30
min, but take care not to over dry the samples.
[0585] No drying needed, if ethanol step was left out.
Lysis Step
[0586] Prepare a larger volume of the lysis buffer (0.5 or 1 l),
depending on the number of samples to be processed for a project.
This buffer can be stored at room temperature for 3 months. After
this time it is prudent to prepare a fresh buffer.
[0587] Chemicals [0588] TRIS (tris-hydroxymethyl-amino-methan),
Merck, Art. Nr. 1.01549.0500, MW=121.14 g/ml
[0589] Prepare a 1 mol/l stock solution:
[0590] Dissolve 121.14 g in 800 ml H.sub.2O and adjust to pH 8.0
with HCl and fill up to 1 l. [0591] EDTA (ethylendiaminetetraacetic
acid)
[0592] Sodium EDTA (Titriplex III) from Merck, Art. Nr. 159294 MW=3
7 2.24 g/mol
[0593] Prepare a 0.5 mol/l stock solution:
[0594] Dissolve 186.1 g in 800 ml H.sub.2O and adjust to pH 8.0
with NaOH, fill up to 1 l.
[0595] Tween (Tween 20), Fluka, Chemika Art Nr. 93773
This detergent is added to the buffer in volume percent. To add
Tween to the buffer take 1 ml of Tween (in 2 ml tube), warm it at
50.degree. C. and add desired volume to buffer with a widened
pipette tip.
[0596] Lysis Buffer Composition
[0597] 50 mmol/l TrisHCl, pH 8.0, 1 mmol/l EDTA, 0.5% Tween (volume
%)
[0598] Proteinase K, Roth
Prepare a 30 mg/ml stock solution in H.sub.2O. The size of the
stock solution should be adjusted to the number of samples to be
processed. For example: 300 mg proteinase K dissolved in 10 ml
H.sub.2O will be sufficient for .about.400 samples.
[0599] Proteinase K can be stored at 4.degree. C. for up to one
week safely. If more samples will be processed it is recommended to
prepare fresh solutions repeatedly.
[0600] Procedure [0601] 1. Add 190 .mu.l of the prepared lysis
buffer to each sample. It is important to ensure that all sample
material is covered by lysis buffer. [0602] 2. Add 20 .mu.l of the
prepared proteinase K solution. [0603] 3. Vortex the tube
rigorously to ensure proper mixing of sample with lysis buffer and
proteinase K. Make sure the tube caps are tightly closed--otherwise
loss of liquid will happen! [0604] 4. Incubate at 50.degree. C.,
shaking 1,000 rpm (thermoshaker). [0605] 5. Incubate for 40 to 48
h, no further additions of Proteinase K necessary. [0606] 6. Spin
in the morning and the evening of each day to remove droplets from
the cap, vortex vigorously.
[0607] Quality Check of Lysis (During Lysis)
After these lysis steps, there should be a homogeneous, maybe
turbid solution in the tube with no visible pieces of tissue left.
However, should there be visible pieces of tissues in MANY of the
samples left after the first ON-incubation additional proteinase K
step and increase of lysis volume should be considered. If only
individual samples have some undigested material left, this may be
neglected. Have a careful look! [0608] 7. Incubate samples at
>95.degree. C. for 10 min in to order to inactive proteinase K.
For this set the temperature of the thermomixer at 99.degree. C.,
since the real temperature at the highest setting is some degrees
below the indicated temperature. (Active proteinase K in the lysate
will reduce PCR performance, especially if lysate is used directly
for quantitation of genomic DNA by RT-PCR). [0609] 8. Lysed samples
may be stored at either -20.degree. C. or -80.degree. C. (depending
on storage time) or be used immediately for downstream
processing.
DNA Extraction with QIAGEN.RTM. DNEASY.RTM. Tissue Kit
[0610] Approximate duration for 30 samples.
[0611] Preparation of devices and materials: 15 min; Preparation:
30 min; Procedure: 1.5 h
[0612] The following devices are needed:
Centrifuge, e.g., model EPPENDORF.RTM. 5417R; EPPENDORF.RTM.
pipettes and/or Multipipettes; 1.5 ml and 2 ml reaction-tubes;
thermomixer.
[0613] The following reagents are needed:
Paraffin sample lysates (.about.210 .mu.l or more, if lysis
buffer+proteinase K were added, the actual volumes may differ
slightly, lower volumes may occur because aliquots were taken for
quantitation, evaporation loss. Also larger volume may occur
because lysed tissue amount was more than average).
[0614] Ethanol for molecular biology (96-100%)
[0615] DNEASY.RTM. kit (QIAGEN.RTM. cat nr. 69504 [50 columns] or
69506 [250 columns])
[0616] Preparation (before starting the actual extraction) [0617]
1. Mix buffer AL thoroughly by shaking before use. Buffer AL is
stable for 1 year when stored at room temperature. If a precipitate
has formed in buffer AL, dissolve by incubating at 70.degree. C.
[0618] 2. Buffer AW 1 is supplied as a concentrate. Add the
appropriate amount of ethanol (96-100%) before first use (these
amounts differ for the 69504 and 69506 kits, respectively). Buffer
AW 1 is stable for 1 year when stored closed at room temperature.
[0619] 3. Buffer AW 2 is supplied as a concentrate, the appropriate
amount of ethanol (96-100%) before first use (these amounts differ
for the 69504 and 69506 kits, respectively). Buffer AW 2 is stable
for 1 year when stored closed at room temperature. [0620] 4. If
samples were frozen after tissue lysis make sure the samples are
equilibrated to room temperature. [0621] 5. Heat a thermomixer to
70.degree. C. [0622] 6. All centrifugation steps should be carried
out at room temperature. [0623] 7. Be careful not to cause spills
when using the Multipipette instead of single pipettors.
[0624] Extraction Procedure [0625] 1. Add 210 .mu.l (if lysate had
a larger volume: 1 volume of lysis buffer+proteinase K volume used)
of buffer AL to the tube (1.5 or 2.0 ml) containing the lysate, mix
thoroughly by vortexing. Place tube into a thermomixer and incubate
at 70.degree. C., shaking at 1,000 rpm for 10 min. [0626] 2. Add
210 .mu.l (if lysate had a larger volume: again 1 volume of lysis
buffer+proteinase K volume used) ethanol (96-100%) to the sample,
and mix by pulse-vortexing for 15 sec. After mixing, briefly
centrifuge the tube to remove drops from the inside of the lid.
[0627] 3. Carefully apply the mixture from step 2 (up to 700 .mu.l
will fit into the column, include precipitates!) onto a DNEASY.RTM.
spin column which is already placed into a 2 ml collection tube
(QIAGEN.RTM. provided) without wetting the rim. Close the cap, and
centrifuge at 6,000.times.g (=rcf, or 8,000 rpm) for 1 min. Place
the DNEASY.RTM. spin column in a clean 2 ml collection tube
(QIAGEN.RTM. provided), and discard the tube containing the
filtrate. [0628] 4. If lysates were larger than 210 .mu.l the
column has be loaded a 2nd time: place into a fresh 2 ml tube, add
remaining volume of the mixture from step 2, spin like in step 3
[0629] 5. Carefully open the spin column and add 500 .mu.l buffer
AW 1 (this stays the same for large lysates, too) without wetting
the rim. Close the cap and centrifuge at 6,000.times.g for 1 min.
Place the spin column in a clean 2 ml collection tube (provided),
and discard the collection tube containing the filtrate. [0630] 6.
Carefully open the spin column and add 500 .mu.l Buffer AW 2
without wetting the rim. Close the cap and centrifuge at full speed
20,000.times.g (14,000 rpm) for 3 min. [0631] 7. Optional: Discard
the filtrate. In order to avoid carryover of ethanol, new tubes
(not provided by QIAGEN.RTM.) should be used. Centrifuge again for
1 min at 20,000.times.g (14,000 rpm). [0632] 8. Place the
DNEASY.RTM. spin column in a clean and already labeled 1.5 ml
reaction-tube (not provided by QIAGEN.RTM.), and discard the
collection tube containing the filtrate. Carefully open the
DNEASY.RTM. spin column and add 60 .mu.l of elution buffer AE (at
room temperature) to the center of the column. Incubate at room
temperature for 1 min, then centrifuge at 6,000.times.g (8,000 rpm)
for 1 min. Add again 60 .mu.l of new elution buffer to the column
center, incubate for 1 min and centrifuge at 6,000.times.g for 1
min using the same tube. Final volume is 120 .mu.l (sufficient for
2 bis-reactions with new protocol), though some loss may occur due
to liquid retention on column. [0633] If final DNA concentration is
not critical, also larger elution volumes can be chosen (volumes to
be defined project-specifically!) [0634] 9. If samples are used for
bisulfite treatment within the next 2 days keep them at +4.degree.
C. in a fridge. For long-term storage, -20.degree. C. is
recommended.
[0635] Analysis
An aliquot of the eluate (3 .mu.l) is used to quantiate the DNA
concentration using a genomic real time PCR assay. UV quantitation
is optional.
Bisulfite Treatment and DNA Purification with MICROCON.TM.
Device
[0636] Equipment needed: [0637] thermo cycler (e.g.,
EPPENDORF.RTM., Tetrad) [0638] centrifuge (capable of up to
14,000.times.g) [0639] pipettors for volumes of 100 .mu.l and 1,000
.mu.l
[0640] Material needed: [0641] MICROCON.TM. Centrifugal Filter
devices, MICROCON.TM. YM-30 (MILLIPORE.RTM./AMICON.RTM. 42410)
[0642] pipette tips (100 .mu.l, 1,000 .mu.l) [0643] 200 .mu.l
PCR-tubes (e.g., EPPENDORF.RTM. 0030 124.359) [0644] 1.5 ml tubes
(e.g., EPPENDORF.RTM. 0030 120.086) [0645] 15 ml and 50 ml Falcon
tubes
[0646] Chemicals needed: [0647] sodium bisulfite (Na2S205, 190.1
g/mol), Merck 1.06528.0500 [0648] sodium sulfite, anhydrous
(Na2S03, 126.04 g/mol), Fluka 71988 [0649] ddH.sub.2O molecular
biology grade (0.2 pm filtered, DEPC-treated, autoclaved, free of
DNases- and RNases) [0650] diethyleneglycoldimethylether (DME),
Merck 8.02934.0250 [0651]
6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (250.29
g/mol), Aldrich 23,881-3 [0652] Tris-hydroxymethyl-aminomethan
(C.sub.4H.sub.8O.sub.2, M=121.14 g/mol), Merck 1.01549.0500 [0653]
sodium hydroxide pellets (NaOH, 40.0 g/mol), Merck 1.06482.1000
[0654] EDTA (Titriplex.RTM. III,
C.sub.10H.sub.4N.sub.2O.sub.8Na.sub.2*2H.sub.2O, 372.24 g/mol),
Merck 1.08418.0250
Preparation of Solutions (Sufficient for 80 Reactions)
[0655] Bisulfite Solution: Sodium disulfite (4.708 g) and sodium
sulfite (1.128 g) are dissolved by adding 10 ml ddH.sub.2O (the
solution is 4.9 M). The final volume is around 12 ml. Check pH of
the solution--if it is not between 5.45 and 5.5, discard solution
and repeat preparation. Shake rigorously and if needed, heat the
solution to 50.degree. C. in a waterbath than vortex at maximum
speed for 30 sec. Repeat this procedure as often until the salt is
completely dissolved.
[0656] DME-Radical Scavenger Solution: dissolve 125.3 mg of
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid by adding
1.0 ml DME. Vortex rigorously in order to ensure that no
undissolved particles remain. DME is hazardous and potentially
carcinogenic. Therefore take appropriate precautions when handling
this chemical. If only few samples are to be bisulfite treated,
prepare smaller volumes.
[0657] NaOH 0.2 mol/l: Dissolve 0.32 g sodium hydroxide in 40 ml
ddH.sub.2O. TE buffer: 10 mmol/l Tris/0.1 mmol/l EDTA, pH 8
[0658] General: [0659] This procedure is designed to be applied in
200 .mu.l PCR-tubes. The total number of samples is limited by the
number of tubes that can be handled in the thermocyclers,
centrifuges, etc. [0660] The working solutions should not be stored
over prolonged periods of time. It is best to prepare them fresh
and scale the solutions according to the number of samples to be
processed. [0661] All solutions collected as waste in this
procedure should be collected e.g., in a glass bottle and finally
discarded as halogen-free organic solvents
[0662] Procedure Bisulfite Treatment:
Pipette the following solutions into PCR-tubes in the order
shown.
[0663] 1. 50 .mu.l buffer/water containing the DNA to be bisulfite
treated.
[0664] 2. 95 .mu.l bisulfite solution.
[0665] 3. 15 .mu.l DME solution, containing the radical
scavenger.
The total volume of the reaction mixture is 160 .mu.l! Tightly
close the caps of PCR-tubes!
[0666] Temperature Program: [0667] 5:00 min denaturation of DNA at
99.degree. C. [0668] 22:00 min incubation at 50.degree. C. [0669]
3:00 min denaturation of DNA at 99.degree. C. [0670] 1:27:00 hours
incubation at 50.degree. C. [0671] 3:00 min denaturation of DNA at
99.degree. C. [0672] 2:57:00 hours incubation at 50.degree. C.
[0673] Cooling at 20.degree. C. [0674] Due to the high molarity of
the bisulfite salts some of the salt may precipitate. These
precipitates will not affect the bisulfite reaction.
[0675] Procedure DNA Purification: [0676] After incubation is over,
transfer reaction solution (160 .mu.l) into 1.5 ml collection tube.
[0677] Add 120 .mu.l ddH.sub.2O to the reaction tube. Mix by
pipetting up and down and transfer solution into the same
collection tube. [0678] Repeat this step with additional 120 .mu.l
ddH.sub.2O! [0679] Close caps, vortex intensively and spin shortly
to remove drops from lid. [0680] Take all of this solution (400
.mu.l) and pipette it into the sample reservoir of an assembled
Microcon filter device--do not touch the membrane with the pipette
tip! [0681] Seal with the attached cap. [0682] Place the assembly
into the centrifuge, align the cap strap towards the center of the
rotor and spin 15 min at 14,000.times.g. [0683] After the spin,
take out assembly and discard flowthrough. [0684] PLEASE NOTE: The
centrifugation efficacies may vary depending on the particular
centrifuge model and instrument used. Therefore, for all
centrifugation steps always check whether the sample volume passed
through the membrane! If needed, increase the spin times in 2 min
steps. [0685] For desulfonation add 400 .mu.l 0.2 mol/l NaOH to the
membrane [0686] place assembly back to centrifuge and spin 12 min
at 14,000.times.g. Take out assembly and discard flowthrough.
[0687] For washing add 400 .mu.l ddH.sub.2O [0688] place assembly
back to centrifuge and spin 12 min at 14,000 g. Take out assembly
and discard flowthrough. [0689] repeat this step two additional
times! [0690] PLEASE NOTE: After this the membrane should look
moist, but should not be covered by a visible volume of liquid.
[0691] For elution take filter assembly out of centrifuge. [0692]
Add 75 .mu.l of prewarmed TE buffer (50.degree. C.) into the sample
reservoir. (Note: If the total amount of is critical, elution
should be performed by 2 subsequent elution steps, e.g.,
2.times.37.5 .mu.l--should be defined prior to each study). [0693]
Incubate for 10 min at room temperature while shaking in a
thermomixer at 1,000 rpm. [0694] Invert the filter device and place
it into a new Microcon 1.5 ml tube. [0695] Elute DNA from membrane
by spinning 5 min at 1,000 g. [0696] Optional: If desired transfer
DNA to a new tube--the lid of Microcon tubes tends to open quickly.
[0697] Store DNA at -80.degree. C. for long-term storage or at
+4.degree. C. for immediate use.
Example 3
[0698] All steps will be done in the tubes that the samples are
provided in. The tubes can be both 1.5 and 2.0 ml tubes. Please
double check that tube formats fit into the centrifuge. The
solvents and buffers can be delivered with either single channel
pipettes or multipipettes.
Removal of Paraffin
[0699] Chemical needed:
Limonenel 45, Fluka Chemika, Art Nr. 89188
[0700] Procedure: [0701] 1. Add 1 ml limonene to each tube
(containing 1 to 5 sect of a paraffin-embedded formalin-fixed
tissue). Push all pieces into the liquid. In some cases sample
material already very brittle with small pieces of paraffin/tissue
in tube. Make sure that material sticking to the tube cap goes back
into the tube. [0702] 2. 1 h incubation at RT at 1,000 rpm, vortex
vigorously at least 3 times during incubation. [0703] 3. Place
tubes into centrifuge and spin at 16,000 rcf (=16,000.times.g) for
5 min, the tissue will pellet at the tube bottom. [0704] 4. Use a 1
ml pipette to suck up the limonene from each sample. Great care
should be taken not to disturb the pellet! Place pipette tip
opposite the pellet onto the tube and gently allow limonene to
enter the pipette tip. In some cases it can be easier to remove the
entire volume in two rather than one pipetting steps.
[0705] It is o.k. if small amounts (up to 50 .mu.l) of limonene
remain in tube. [0706] 5. If the tissue settles only weakly at the
bottom (i.e., not forming a nice pellet) do the following: [0707]
Repeat centrifugation again for 5 min on EPPENDORF.RTM. 5417
centrifuge at max speed (>20,000 rcf) [0708] Then repeat the
removal of limonene: Make sure the pipette tip is pressed against
the bottom of the tube and limonene is removed very slowly such as
not to suck in the tissue. Remove as much limonene as possible.
[0709] Leave out Ethanol step, if it was possible to remove nearly
all limonene (if there are 50 .mu.l left, this will be ok). [0710]
6. Add 1 ml of Ethanol (purity>99%). [0711] 7. Vortex, 10 min
incubation at RT at 1,000 rpm. [0712] 8. Place tubes into
centrifuge and spin at 16,000 rcf for 5 min. The tissue will pellet
again at the tube bottom. [0713] 9. Use pipette to suck up the
ethanol, great care should be taken not to disturb the pellet!
Place pipette tip opposite the pellet onto the tube wall and gently
allow ethanol to enter the pipette tip. [0714] 10. Remove as much
of Ethanol as possible with the pipette. [0715] 11. Residual
ethanol not removed by pipetting must be evaporated by incubation
in a thermomixer at 50.degree. C. This may take between 10 to 30
min, but take care not to over dry the samples.
[0716] No drying needed, if ethanol step was left out.
Lysis Step
[0717] Prepare a larger volume of the lysis buffer (0.5 or 1 l),
depending on the number of samples to be processed for a project.
This buffer can be stored at room temperature for 3 months. After
this time it is prudent to prepare a fresh buffer.
[0718] Chemicals:
TRIS (tris-hydroxymethyl-amino-methan), Merck, Art. Nr. 1.01549
0.0500, MW=121.14 g/ml Prepare a 1 mol/l stock solution: dissolve
121.14 g in 800 ml H.sub.2O and adjust to pH 8.0 with HC1 and fill
up to 1 l.
[0719] EDTA (ethylendiaminetetraacetic acid)
Sodium EDTA (Titriplex III) from Merck, Art. Nr. 159294 MW=3 7 2.24
g/mol Prepare a 0.5 mol/l stock solution: Dissolve 186.1 g in 800
ml H.sub.2O and adjust to pH 8.0 with NaOH, fill up to 1 l.
[0720] Tween (Tween 20), Fluka, Chemika Art Nr. 93773
This detergent is added to the buffer in volume percent. To add
Tween to the buffer take 1 ml of Tween (in 2 ml tube), warm it at
50.degree. C. and add desired volume to buffer with a widened
pipette tip.
[0721] Lysis Buffer Composition:
50 mmol/l TrisHCl, pH 8.0 f 1 mmol/l EDTA, 0.5% Tween (volume
%)
[0722] Proteinase K, Roth
Prepare a 30 mg/ml stock solution in H.sub.2O. The size of the
stock solution should be adjusted to the number of samples to be
processed. For example, 300 mg proteinase K dissolved in 10 ml
H.sub.2O will be sufficient for .about.400 samples. Proteinase K
can be stored at 4.degree. C. for up to one week safely. If more
samples will be processed it is recommended to prepare fresh
solutions repeatedly.
[0723] Procedure: [0724] 1. Add 190 .mu.l of the prepared lysis
buffer to each sample. It is important to ensure that all sample
material is covered by lysis buffer. [0725] 2. Add 20 .mu.l of the
prepared proteinase K solution. [0726] 3. Vortex the tube
rigorously to ensure proper mixing of sample with lysis buffer and
proteinase K. Make sure the tube caps are tightly closed--otherwise
loss of liquid will happen! [0727] 4. Incubate at 50.degree. C.,
shaking 1,000 rpm (thermoshaker). [0728] 5. Incubate for 40 to 48
h, no further additions of proteinase K necessary. [0729] 6. Spin
in the morning and the evening of each day to remove droplets from
the cap, vortex vigorously.
[0730] Quality Check of Lysis (During Lysis):
After these lysis steps, there should be a homogeneous, maybe
turbid solution in the tube with no visible pieces of tissue left.
However, should there be visible pieces of tissues in MANY of the
samples left after the first overnight incubation additional
proteinase K step and increase of lysis volume should be
considered. If only individual samples have some undigested
material left this may be neglected. Have a careful look! [0731] 7.
Incubate samples at >95.degree. C. for 10 min in to order to
inactive proteinase K. For this set the temperature of the
thermomixer at 99.degree. C., since the real temperature at the
highest setting is some degrees below the indicated temperature.
(Active proteinase K in the lysate will reduce PCR performance,
especially if lysate is used directly for quantitation of genomic
DNA by RT-PCR.) [0732] 8. Lysed samples may be stored at either
-20.degree. C. or -80.degree. C. (depending on storage time) or be
used immediately for downstream processing
Example 4
[0733] All steps will be done in the tubes in which the samples are
provided. The tubes can be both 1.5 and 2.0 ml tubes. Please double
check that tube formats fit into the centrifuge.
[0734] The solvents and buffers can be delivered with either single
channel pipettes or multipettes.
Removal of Paraffin
[0735] Chemical needed:
Limonenel 45, Fluka Chemika, Art Nr. 89188
[0736] Procedure: [0737] 1. Add 1 ml limonene to each tube
(containing 1-6 sections of a paraffin-embedded formalin-fixed
surgery sample or an equal amount of a biopsy). In some cases
sample material is already very brittle with small pieces of
paraffin/tissue in tube--make sure that material sticking to the
tube cap goes back into the tube. [0738] 2. 10 min incubation at
room temperature, during incubation vortex rigorously several times
(2-4.times.5 sec) such that the sample disintegrates as much as
possible. This may vary from sample to sample. [0739] 3. Place
tubes into centrifuge and spin at 16,000 rcf (=16,000.times.g) for
5 min. The tissue will pellet at the tube bottom. [0740] 4. Use a 1
ml pipette to suck up the limonene from each sample. Great care
should be taken not to disturb the pellet! Place pipette tip
opposite the pellet onto the tube and gently allow limonene to
enter the pipette tip. In some cases it can be easier to remove the
entire volume in two rather than one pipetting steps. It is o.k. if
small amounts (few .mu.l) of limonene remain in tube. [0741] 5. If
the tissue settles only weakly at the bottom (i.e., not forming a
nice pellet) do the following: [0742] repeat centrifugation again
for 5 min on EPPENDORF.RTM. 5417 centrifuge at max speed
(>20,000 rcf) [0743] then repeat the removal of limonene: make
sure the pipette tip is pressed against the bottom of the tube and
limonene is removed very slowly such as not to suck in the tissue.
Remove as much limonene as possible. [0744] 6. Add 1 ml of Ethanol
(purity>99%). [0745] 7. 10 min incubation at room temperature.
During incubation vortex tubes 2-3 times such that the pellet
loosens and all tissue is soaked in ethanol. [0746] 8. Place tubes
into centrifuge and spin at 16,000 rcf for 5 min, the tissue will
pellet again at the tube bottom. [0747] 9. Use pipette to suck up
the ethanol, great care should be taken not to disturb the pellet!
Place pipette tip opposite the pellet onto the tube wall and gently
allow ethanol to enter the pipette tip. Remove as much of ethanol
as possible with the pipette. [0748] 10. Residual ethanol not
removed by pipetting must be evaporated by incubation in a
thermomixer at 50.degree. C. This may take between 10 to 30 min,
but take care not to over dry the samples.
Lysis Step
[0749] Prepare a larger volume of the lysis buffer (0.5 or 1 l),
depending on the number of samples to be processed for a project.
This buffer can be stored at room temperature for 3 months. After
this time it is prudent to prepare a fresh buffer.
[0750] Chemicals: TRIS (tris-hydroxymethyl-amino-methan), Merck,
Art. Nr. 1.01549.0500; MW=121.14 g/ml; Prepare a 1 mol/l stock
solution: Dissolve 121.14 g in 800 ml H.sub.2O and adjust to pH 8.0
with HCl and fill up to 1 l. A 50 mmol/l Tris solution should be
prepared from this stock by dilution.
[0751] EDTA (ethylendiaminetetraacetic acid); sodium EDTA
(Titriplex III) from Merck, Art. Nr. 159294; MW=372.24 g/mol;
prepare a 0.5 mol/l stock solution: Dissolve 186.1 g in 800 ml
H.sub.2O and adjust to pH 8.0 with NaOH, fill up to 1 l.
[0752] Tween (Tween 20), Fluka, Chemika Art Nr. 93773; this
detergent is added to the buffer in volume percent. To add Tween to
the buffer take 1 ml of Tween (in 2 ml tube), warm it at 50.degree.
C. and add desired volume to buffer with a widened pipette tip.
[0753] Lysis Buffer Composition: 50 mmol/l TrisHCl, pH 8.0, 1
mmol/l EDTA, 0.5% Tween (volume %).
[0754] Proteinase K, Roth
Prepare a 10 mg/ml stock solution in H.sub.2O. The size of the
stock solution should be adjusted to the number of samples to be
processed. For example, 100 mg proteinase K dissolved in 10 ml
H.sub.2O will be sufficient for .about.160 samples. Proteinase K
can be stored at 4.degree. C. for up to two weeks safely. If more
samples will be processed it is recommended to prepare fresh
solutions repeatedly.
[0755] Procedure: [0756] 1. Add 150 .mu.l of the prepared lysis
buffer to each sample. It is important to ensure that all sample
material is covered by lysis buffer. [0757] 2. Add 20 .mu.l of the
prepared proteinase K solution. Vortex the tube rigorously to
ensure proper mixing of sample with lysis buffer and proteinase K.
Very briefly spin to bring down droplets. Make sure the tube caps
are tightly closed--otherwise loss of liquid will happen! [0758] 3.
Incubate at 50.degree. C., shaking 1,000 rpm (thermoshaker). [0759]
4. Incubate for 40 h, with a total of 3.times. proteinase K
injections (always 20 .mu.l). [0760] 5. After each incubation
period the tubes should be briefly spun to remove any liquid from
the cap to prevent contamination risk (via gloves). After the
proteinase K injection, samples should be vortexed to ensure proper
mixing. Spin down and continue with incubation.
[0761] Incubation scheme: 1 overnight, 1 day, 1 overnight.
[0762] Suggested Work Schedule:
[0763] a. Per person not more than 24 samples should be processed
in parallei.
[0764] b. Sample deparaffination of 24 samples will take
approximately 2 h.
[0765] c. First proteinase K step at 16:00.
[0766] d. Second proteinase K step next day 8:00.
[0767] e. Third proteinase K step this day at 16:00.
[0768] f. Lysis complete over next day at 8:00.
[0769] Quality Check of Lysis (after end of lysis):
After these lysis steps, there should be a clear solution in the
tube with no visible pieces of tissue left. However, should there
be visible pieces of tissues in MANY of the samples left additional
proteinase K steps should be considered. If only individual samples
have some undigested material left this may be neglected. [0770] 6.
Incubate samples at >95.degree. C. for 10 min in to order to
inactive proteinase K. For this the temperature of the thermomixer
is set to 99.degree. C., since the real temperature at the highest
setting is some degrees below the indicated temperature. (Active
proteinase K in the lysate will reduce PCR performance, especially
if lysate is used directly for quantitation of genomic DNA by
RT-PCR). [0771] 7. Lysed samples may be stored at either
-20.degree. C. or -80.degree. C. (depending on storage time) or be
used immediately for downstream processing.
DNA Extraction with Qiagen.RTM. DNA-Mini-Mt
[0772] Time Exposure for 30 samples:
Provision of devices and materials (15 min); Preparation (0.5 h);
Implementation (1.5 h).
[0773] Provision of Devices and Materials:
The following devices/means of labor are needed: [0774] centrifuge
EPPENDORF.RTM. 5417R, EPPENDORF.RTM. pipettes, 1.5 ml
reaction-tubes, 2 ml reaction-tubes, thermomixer or waterbath.
[0775] The following reagents are needed: [0776] Sample units
(liquid or tissue) [0777] Phosphate buffered saline (PBS) [0778]
Ethanol (96-100%) [0779] Water for molecular biology (0.2
pm-filtered, DEPC-treated, autoclaved, and free of DNases, RNases,
proteases, and phosphatases) [0780] QIAAMP.RTM. DNA-Mini-Kit
[0781] Preparation of Solutions: [0782] 1. Mix buffer AL thoroughly
by shaking before use. Buffer AL is stable for 1 year when stored
at room temperature. If a precipitate has formed in buffer AL,
dissolve by incubating at 70.degree. C. [0783] 2. Buffer AW 1 is
supplied as a concentrate. Add 125 ml ethanol (96-100%) before
first use. Buffer AW 1 is stable for 1 year when stored closed at
room temperature. [0784] 3. Buffer AW 2 is supplied as a
concentrate. Add 160 ml ethanol (96-100%) before first use. Buffer
AW 2 is stable for 1 year when stored closed at room temperature.
[0785] 4. Equilibrate samples to room temperature. [0786] 5. Heat a
waterbath or thermomixer to 56.degree. C. [0787] 6. Equilibrate the
desired elution buffer (buffer AE or water) to room temperature.
[0788] 7. All centrifugation steps should be carried out at room
temperature.
[0789] Procedure: [0790] 1. Add 200 .mu.l Buffer AL to the sample.
Mix by pulse-vortexing for 15 sec. [0791] 2. Incubate at 56.degree.
C. for 10 min. A longer incubation may lead to DNA degradation!
[0792] 3. Add 200 .mu.l ethanol (96-100%) to the sample, and mix by
pulse-vortexing for 15 sec. After mixing, briefly centrifuge the
1.5 ml reaction tube to remove drops from the inside of the lid.
[0793] 4. Carefully apply the mixture from step 3 on a QIAAMP.RTM.
spin column previously placed in a 2 ml collection tube without
wetting the rim. Close the cap and centrifuge at 6,000.times.g
(8,000 rpm) for 1 min. Place the QIAAMP.RTM. spin column in a clean
2 ml collection tube (provided), and discard the tube containing
the filtrate. [0794] 5. Carefully open the QIAAMP.RTM. spin column
and add 500 .mu.l buffer AW 1 without wetting the rim. Close the
cap and centrifuge at 6,000.times.g (8,000 rpm) for 1 min. Place
the QIAAMP.RTM. spin column in a clean 2 ml collection tube
(provided), and discard the collection tube containing the
filtrate. [0795] 6. Carefully open the QIAAMP.RTM. spin column and
add 500 .mu.l buffer AW 2 without wetting the rim. Close the cap
and centrifuge at full speed 20,000.times.g (14,000 rpm) for 3 min.
[0796] 7. Discard the filtrate, dry the collection tubes by beating
them on a Kleenex tissue on the bench, insert the column and spin
again for 1 min at 8,000 rpm to remove residual ethanol present in
AW2. [0797] 8. Place the QIAAMP.RTM. spin column in a clean 1.5 ml
reaction-tube, and discard the collection tube containing the
filtrate. Carefully open the QIAAMP.RTM. spin column and add an
adequate volume (50-150 .mu.l) of warm 40.degree. C.) buffer AE or
water. [0798] 9. Incubate at room temperature for 1 min, and then
centrifuge at 6,000.times.g (8,000 rpm) for 1 min. [0799] 9. Take
the eluate and pipette it a second time on the QIAAMP.RTM. spin
column. Incubate at room temperature for 1 min, and then centrifuge
at 6,000.times.g (8,000 rpm) for 1 min. Incubation of the
QIAAMP.RTM. spin column loaded with buffer for 5 min at room
temperature before centrifugation generally increases DNA yield.
[0800] 10. For immediate use, a storage at +4.degree. C. in the
fridge is acceptable, while for long-term, storage at -20.degree.
C. is recommended. [0801] 11. Optional, the quality and the
quantity should be checked by measurement with the photometer. A
sample of 200 .mu.l whole human blood typically yields 6 pg of DNA
in 200 .mu.l water (30 ng/.mu.l) with an A260/A280 ratio of
1.7-1.9. A further quality control of the DNA status would be to
load around 5 .mu.l (1 .mu.l sample+4 .mu.l water) on an 0.8%
agarose gel. By this check, the level of DNA degradation and the
average fragment size as well as the rough concentration can be
determined.
Example 5
Bisulfite Treatment and DNA Purification with MICROCON.TM. Device
and Using Dioxane
[0802] Equipment needed: [0803] thermo cycler (e.g.,
EPPENDORF.RTM., Tetrad) [0804] centrifuge (capable of up to
14,000.times.g) [0805] pipettors for volumes of 100 .mu.l and 1,000
.mu.l
[0806] Material needed: [0807] MICROCON.TM. Centrifugal Filter
devices, MICROCON.TM. YM-30, MILLIPORE.RTM./AMICON.RTM. [0808]
Pipette tips (100 .mu.l, 1,000 .mu.l) [0809] 200 .mu.l PCR tubes,
thin wall [0810] 1.5 ml reaction-tubes [0811] 15 ml and 50 ml
Falcon tubes
[0812] Chemicals needed: [0813] sodium bisulfite (Na2S205, MW=190.1
g/mol), Merck 1.06528.0500 [0814] sodium sulfite, anhydrous
(Na2S03, MW=126.04 g/mol), Fluka 71988 [0815] ddH.sub.2O molecular
biology grade (0.2 pm filtered, DEPC-treated, autoclaved, free of
DNases and RNases) [0816] 1,4-dioxane, stabilized (MW=88.11 g/mol),
Riedel de Haen 33147 [0817]
6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (MW=250.29
g/mol), Aldrich 23,881-3 [0818] Tris-hydroxymethyl-aminomethan
(M=121.14 g/mol), Merck 1.01549.0500 [0819] sodium hydroxide
pellets (MW=40 g/mol), Merck 1.06482.1000 [0820] EDTA
(Titriplex.RTM. III, MW=372.24 g/mol), Merck 1.08418.0250
[0821] Preparation of Solutions:
Bisulfite solution: Sodium disulfite (4.708 g) and sodium sulfite
(1.128 g) are dissolved by adding 10 ml ddH.sub.2O (the solution is
4.9 M). Check pH of the solution--if it is not between 5.45 and
5.5, discard solution and repeat preparation. Shake rigorously and
if needed, heat the solution to 50.degree. C. in a waterbath than
vortex at max speed for 30 sec. Repeat this procedure as often
until the salt is completely dissolved.
[0822] Dioxane-radical scavenger solution: Dissolve 197.2 mg of
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid by adding 5
ml 1,4-dioxane. Vortex rigorously in order to ensure that no
undissolved particles remain. Dioxane is hazardous. Therefore take
appropriate precautions when handling this chemical. If only few
samples are to be bisulfite treated, prepare smaller volumes.
[0823] NaOH 0.2 M: Dissolve 0.32 g sodium hydroxide in 40 ml
ddH.sub.2O.
[0824] TE buffer: 10 mmol/l Tris, 0.1 mmol/l EDTA, pH 8.
[0825] General: [0826] This procedure can be applied to a single
sample or many samples in parallel. [0827] The working solutions
should not be stored over prolonged periods of time. It is best to
prepare them fresh and scale the solutions according to the number
of samples to be processed. [0828] All solutions collected as waste
in this procedure should be collected e.g., in a glass bottle and
finally discarded as halogen-free organic solvents.
[0829] Procedure:
Pipette the following solutions into a 200 .mu.l PCR tube in the
order shown: [0830] 1. 20 .mu.l buffer/water containing the DNA to
be bisulfite treated. [0831] 2. 85 .mu.l bisulfite solution. [0832]
3. 35 .mu.l dioxane solution, containing the radical scavenger
(total volume of the reaction mixture is 140 .mu.l)
[0833] Temperature Program: [0834] 5:00 min denaturation of DNA at
99.degree. C. [0835] 25 min incubation at 60.degree. C. [0836] 5:00
min denaturation of DNA at 95.degree. C. [0837] 1:25 hours
incubation at 60.degree. C. [0838] 5:00 min denaturation of DNA at
95.degree. C. [0839] 2:55 hours incubation at 60.degree. C. [0840]
cooling at 20.degree. C. forever Due to the high molarity of the
bisulfite salts some of the salt may precipitate. These
precipitates will not affect the bisulfite reaction.
[0841] DNA Purification: [0842] 1. After incubation is over,
transfer reaction solution (140 .mu.l) into 1.5 ml collection tube,
add 260 .mu.l ddH.sub.2O into the collection tube. [0843] 2. Mix by
vortexing. [0844] 3. Take all of this solution (400 .mu.l) and
pipette it into the sample reservoir of an assembled Microcon
filter device. (Do not touch the membrane with the pipette tip!)
[0845] 4. Seal with the attached cap. [0846] 5. Place the assembly
into the centrifuge, align the cap strap towards the center of the
rotor and spin 15 min at 14,000.times.g (=rcf). [0847] 6. After the
spin take out assembly and discard flowthrough. [0848] PLEASE NOTE:
the centrifugation efficacies may vary depending on the particular
centrifuge model and instrument used. Therefore for all
centrifugation steps always check whether the sample volume passed
through the membrane! If needed, increase the spin times in 2 min
steps. [0849] 7. Take filter assembly out of centrifuge. [0850] 8.
Add 400 .mu.l 0.2 mol/l NaOH to the membrane. [0851] 9. Place
assembly back to centrifuge and spin 12 min at 14,000.times.g,
discard flowthrough. [0852] 10. Wash the membrane with by adding
400 .mu.l water and spin for 12 min, discard flowthrough. [0853]
11. Repeat washing-step two more times. [0854] 12. The membrane
should look moist, but should not be covered b a visible volume of
liquid. [0855] 13. For elution, take filter assembly out of
centrifuge. [0856] 14. Add 75 .mu.l of prewarmed (50.degree. C.) TE
buffer (Tris/HCl 10 mmol/l EDTA 0.1 mmol/l) into the sample
reservoir. [0857] 15. Incubate for 10 min while shaking on a
thermomixer with 1,000 rpm (50.degree. C.). [0858] 16. Invert the
filter device and place it into a new Microcon 1.5 ml tube. [0859]
17. Spin 5 min at 1,000.times.g. [0860] 18. Store DNA at
-20.degree. C. for long-term storage or at +4.degree. C. for
immediate use.
Example 6
DNA Purification by Means of a QIAAMP.RTM. Viral RNA Mini Kit
[0861] Equipment needed: [0862] Tube centrifuge [0863] Pipettors
for volumes of from 10 .mu.l to 1,000 pi
[0864] Material needed: [0865] QIAAMP.RTM. Viral RNA Mini Kit (50)
(QIAGEN.RTM. cat#52904) [0866] Pipette tips (100 .mu.l, 1,000
.mu.l)
[0867] Chemicals needed: [0868] Ethanol, molecular biology grade
[0869] Sodium hydroxide pellets (NaOH, MW=40.0 g/mol), Merck
1.06482.1000
[0870] Preparation of Solutions:
Desulfonation buffer: Dissolve 0.8 g sodium hydroxide in 10 ml
ddH.sub.2O to prepare a 2 mol/l stock solution. For the
desulfonation buffer mix 1.0 ml 2 mol/l sodium hydroxide and 9.0 ml
ethanol. The solution has to prepared freshly before each
purification!
[0871] AVL-buffer: Add 1 ml of buffer AVL to one tube of
lyophilized carrier RNA. Dissolve thoroughly. Transfer to the
buffer AVL bottle, and mix thoroughly before using buffer AVL for
the first time. This buffer can be stored at 2-8.degree. C. for
future use. However, if a precipitate develops, then redissolve by
heating at 80.degree. C. This should be done no more than a total
of 6 times. Cool to room temperature before use. A small aliquot
can be kept at room temperature for up to 2 weeks.
[0872] Procedure: [0873] 1. For binding of bisulfite treated DNA,
pipette 560 .mu.l of prepared buffer AVL/carrier RNA into the tubes
containing 140 .mu.l bisulfite treated DNA solution. Add 560 .mu.l
ethanol to the samples. Pulse-vortex for 15 sec. Centrifuge
briefly. [0874] 2. Incubate at room temperature for 10 min. [0875]
3. Load 630 .mu.l of the mixture from step 2 to the QIAAMP.RTM.
spin column, which is placed in a collection tube (pre-labeled).
Close the cap and centrifuge at full speed for 1 min. [0876] 4.
Place the spin column in a clean 2 ml collection tube and load the
rest of the mixture from step 2. Close the cap and centrifuge at
full speed for 1 minute. [0877] 5. For washing, add 500 .mu.l
buffer AW1 to the spin column in a clean 2 ml collection tube.
Centrifuge at full speed for 1 min. Discard the filtrate. [0878] 6.
For desulfonation, add 500 .mu.l 0.2 mol/l NaOH/ethanol to the spin
column in a clean 2 ml collection tube. Incubation for 15 min at
room temperature. Centrifuge at full speed for 1 min. [0879] 7. Add
500 .mu.l buffer AW2 spin column in a clean 2 ml collection tube.
Centrifuge at 14,000 rpm for 3 min. Discard the filtrate. [0880] 8.
Place the QIAAMP.RTM. spin column in a new 2 ml collection tube.
Centrifuge at 14,000 rpm for 1 min to eliminate possible buffer AW2
carryover. Discard the filtrate. [0881] 9. Place the QIAAMP.RTM.
spin column in a 1.5 ml pre-labeled micro-centrifuge tube. Add 75
.mu.l buffer AVE to the QIAAMP.RTM. spin columns. Incubate for 5
min at room temperature. Centrifuge at 9.000 rpm for 1 min.
Example 7
Lysis Step by Means of Heating
[0881] [0882] 1. Centrifuge 1-6 paraffin-embedded formalin-fixed
tissue sections in a 1.5 ml reaction tube for 5 min at
16,000.times.g. [0883] 2. Add 100 .mu.l lysis buffer (50 mmol/l
TrisHCl, pH 8.0, 1 mmol/l EDTA, 0.5 v/v % Tween 20, 5 ng/.mu.l
polydA) [0884] 3. Incubate 10 min at 65.degree. C. with agitation
at 1,000 rpm in a thermomixer. [0885] 4. Set thermomixer to
50.degree. C. and 1,400 rpm, leave samples in thermomixer and allow
them to cool down. [0886] 5. Add 10 .mu.l proteinase K (30 mg/ml).
[0887] 6. Spin down to remove all droplets from the tube wall. Make
sure the tube caps are tightly closed--otherwise loss of liquid
will happen. [0888] 7. Incubate 40-48 h at 60.degree. C. in a
thermomixer with agitation at 1,000 rpm. [0889] 8. Incubate samples
at >95.degree. C. for 10 min in to order to inactive proteinase
K. For this, set the thermomixer temperature to 99.degree. C.
Transfer tubes IMMEDIATELY to another thermomixer temperated to
50.degree. C., agitate at 1,400 rpm and incubate for 5 min. This
avoids the formation of a paraffin film. [0890] 9. Apply 44 .mu.l
of this lysate directly (without further extraction) to example
8.
Example 8
Bisulfite Treatment and DNA Purification by Means of MICROCON.TM.
Device and Using DME
[0891] Equipment needed: [0892] thermo cycler (e.g.,
EPPENDORF.RTM., Tetrad) [0893] centrifuge (capable of up to
14,000.times.g) [0894] pipettors for volumes of 100 .mu.l and 1,000
.mu.l
[0895] Material needed: [0896] MICROCON.TM. Centrifugal Filter
devices, MICROCON.TM. YM-30 (MILLIPORE.RTM./AMICON.RTM. 42410)
[0897] pipette tips (100 .mu.l, 1,000 .mu.l) [0898] 200 .mu.l
PCR-tubes (e.g., EPPENDORF.RTM. 0030 124.359) [0899] 1.5 ml tubes
(e.g., EPPENDORF.RTM. 0030 120.086) [0900] 15 ml and 50 ml Falcon
tubes
[0901] Chemicals needed: [0902] sodium bisulfite (Na2S205, MW=190.1
g/mol), Merck 1.06528.0500 [0903] sodium sulfite, anhydrous
(Na2S03, MW=126.04 g/mol), Fluka 71988 [0904] ddH.sub.2O molecular
biology grade (0.2 pm filtered, DEPC-treated, autoclaved, free of
DNases- and RNases) [0905] diethyleneglycoldimethylether (DME),
Merck 8.02934.0250 [0906]
6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (MW=250.29
g/mol), Aldrich 23,881-3 [0907] Tris-hydroxymethyl-aminomethan
(C4H802, MW=121.14 g/mol), Merck 1.01549.0500 [0908] sodium
hydroxide pellets (NaOH, MW--40.0 g/mol), Merck 1.06482.1000 [0909]
EDTA (Titriplex.RTM. III, Ci0Hi4N2O8Na2*2H.sub.2O, MW=372.24
g/mol), Merck 1.08418.0250
[0910] Preparation of Solutions (Sufficient for 80 Reactions):
Bisulfite solution: Sodium disulfite (4.708 g) and sodium sulfite
(1.128 g) are dissolved by adding 10 ml ddH.sub.2O (the solution is
4.9 M). The final volume is around 12 ml. Check pH of the
solution--if it is not between 5.45 and 5.5, discard solution and
repeat preparation. Shake rigorously and if needed, heat the
solution to 50.degree. C. in a waterbath than vortex at maximum
speed for 30 sec. Repeat this procedure as often until the salt is
completely dissolved.
[0911] DME-radical scavenger solution: Dissolve 125.3 mg of
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid by adding
1.0 ml DME. Vortex rigorously in order to ensure that no
undissolved particles remain. If only few samples are to be
bisulfite treated, prepare smaller volumes.
[0912] NaOH 0.2 M: dissolve 0.32 g sodium hydroxide in 40 ml
ddH.sub.2O.
[0913] TE buffer: 10 mmol/l Tris, 0.1 mmol/l EDTA, pH 8.
[0914] General: [0915] This procedure is designed to be applied in
200 .mu.l PCR-tubes. The total number of samples is limited by the
number of tubes that can be handled in the thermocyclers,
centrifuges, etc. [0916] The working solutions should not be stored
over prolonged periods of time. It is best to prepare them fresh
and scale the solutions according to the number of samples to be
processed. [0917] All solutions collected as waste in this
procedure should be collected e.g., in a glass bottle and finally
discarded as halogen-free organic solvents
[0918] Procedure Bisulfite Treatment:
Pipette the following solutions into PCR-tubes in the order shown.
[0919] 1. 45 .mu.l buffer/water containing the DNA to be bisulfite
treated. [0920] 2. 83 .mu.l bisulfite solution. [0921] 3. 13 .mu.l
DME solution, containing the radical scavenger. [0922] 4. Mix
thoroughly. [0923] 5. Place in 0.2 ml wells of thermocycler. The
total volume of the reaction mixture is 141 pi! Tightly close the
caps of PCR-tubes!
[0924] Temperature Protocol: [0925] 5:00 min denaturation of DNA at
99.degree. C. [0926] 22:00 min incubation at 60.degree. C. [0927]
3:00 min denaturation of DNA at 99.degree. C. [0928] 1:27:00 hours
incubation at 60.degree. C. [0929] 3:00 min denaturation of DNA at
99.degree. C. [0930] 2:57:00 hours incubation at 60.degree. C.
[0931] Cooling at 20.degree. C. Due to the high molarity of the
bisulfite salts some of the salt may precipitate. These
precipitates will not affect the bisulfite reaction.
[0932] Procedure DNA Purification: [0933] After incubation is over,
transfer reaction solution (141 .mu.l) into 1.5 ml collection tube.
[0934] Add 260 .mu.l ddH.sub.2O to the collection tube. [0935]
Close caps, vortex intensively and spin shortly to remove drops
from lid. [0936] Take all of this solution (400 .mu.l) and pipette
it into the sample reservoir of an assembled Microcon filter
device--do not touch the membrane with the pipette tip! [0937] Seal
with the attached cap. [0938] Place the assembly into the
centrifuge, align the cap strap towards the center of the rotor and
spin 15 min at 14,000.times.g (=rcf). [0939] After the spin take
out assembly and discard flowthrough. [0940] PLEASE NOTE: the
centrifugation efficacies may vary depending on the particular
centrifuge model and instrument used. Therefore for all
centrifugation steps always check whether the sample volume passed
through the membrane! If needed, increase the spin times in 2 min
steps. [0941] For desulfonation, add 400 .mu.l 0.2 mol/l NaOH to
the membrane. [0942] Place assembly back to centrifuge and spin 12
min at 14,000.times.g. Take out assembly and discard flowthrough.
[0943] Add 400 n1 ddH.sub.2O. [0944] Place assembly back to
centrifuge and spin 12 min at 14,000.times.g. Take out assembly and
discard flowthrough. [0945] Repeat this step two additional times!
[0946] PLEASE NOTE: after this the membrane should look moist, but
should not be covered by a visible volume of liquid. [0947] For
elution of the DNA, take filter assembly out of centrifuge. [0948]
Add 75 .mu.l of prewarmed TE buffer (50.degree. C.) into the sample
reservoir. (Note: If the total amount of is critical, elution
should be performed by 2 subsequent elution steps, e.g.,
2.times.37.5 .mu.l--should be defined prior to each study) [0949]
Incubate for 10 min at 50.degree. C. while shaking in a thermomixer
at 1,000 rpm. [0950] Invert the filter device and place it into a
new MICROCON.TM. 1.5 ml tube. [0951] Elute DNA from membrane by
spinning 5 min at 1,000 g. [0952] (if desired transfer DNA to a new
tube--the lid of MICROCON.TM. tubes tends to open quickly) [0953]
store DNA at -80.degree. C. for long-term storage or at +4.degree.
C. for immediate use.
Example 9
Sample Sets
Estrogen Receptor Positive (ER+) Nodal Status Negative (NO)
Untreated Population
[0954] ER+NO tumor samples from patients not treated with any
adjuvant therapy were analyzed. Markers that are able to show a
significant survival difference in this population are considered
to be prognostic. Since adjuvant therapy has become the routine
regiment for breast cancer patients for many years, the collected
sample set is a historical one from the Eighties of the last
century.
[0955] All 508 samples of this set were obtained from the Erasmus
Medical Center in Rotterdam as cell nuclei pellets (fresh frozen
samples).
[0956] ER+NO Tamoxifen (TAM) Treated Population
The target population of the final test is supposed to be patients
with ER+NO tumors that are treated with hormone therapy. To check
the performance of the marker candidates in this population, 589
samples from ER+NO tumors from patients treated with Tamoxifen were
analyzed. All samples were received as paraffin-embedded
formalin-fixed tissues (PET). Three to ten 10 pm sections were
provided. [0957] In addition, for 89 PET patient samples matching
fresh frozen samples from the same tumor were included into the
study as controls.
DNA Extraction
[0958] DNA Extraction from Fresh Frozen Samples
From a total of 508 fresh frozen samples available as cell nuclei
pellets, genomic DNA was isolated using the DNEASY.RTM. Tissue Kit
(QIAGEN.RTM., Hilden, Germany). The extraction was done according
to the Cell Culture protocol using Proteinase K with few
modifications.
[0959] 20 .mu.l of Proteinase K (QIAGEN.RTM., Hilden, Germany) were
pipetted into a 2 ml reaction tube (EPPENDORF.RTM., Hamburg,
Germany) containing the pellets. 200 .mu.l PBS buffer was added and
pulse-vortexed overnight at 37.degree. C. Another 200 .mu.l of AL
buffer were added and subsequently pulse-vortexed again at
56.degree. C. for 10 minutes. After incubation at 70.degree. C. for
10 minutes, 200 .mu.l ethanol (96%) was added and incubated for 15
seconds. The mixture was applied to a column and centrifuged at
6,000.times.g for 1 min. The column was placed into a provided 2 ml
collection tube and 500 .mu.l buffer AW 1 was added. After
centrifugation at 6,000.times.g for 1 minute, 500 .mu.l AW 2 buffer
was added to the column placed in another provided 2 ml collection
tube followed by centrifugation at 20,000.times.g for 3 min. The
collection tube was kept open to dry the DNA pellet for several
minutes and spin again at 6,000.times.g to remove residual ethanol
present in buffer AW 2. The column was placed into an clean 1.5 ml
reaction tube (EPPENDORF.RTM., Hamburg, Germany) and 60 .mu.l of
prewarmed 40.degree. C.) buffer AE was added. After incubation at
room temperature for 1 min, samples were centrifuged at
6,000.times.g for 1 min. The eluate was pipetted a second time on
the column incubated again at room temperature for 1 min with the
following step of centrifugation under same conditions. The quality
and quantity of the extracted genomic DNA was checked by
photometrical measurement (A260 and A280). Extracted DNA was stored
at -20.degree. C. until further processing.
[0960] Deparaffination, Lysis, and DNA Extraction from
Paraffin-Embedded Formalin-Fixed (PET) Samples
[0961] For deparaffination, 589 provided paraffin-embedded
formalin-fixed (PET) samples were processed directly in the tube in
which they were delivered by the providers. 1 ml of limonene was
added to each tube which contained 3 to 10 sections, each about 10
pm thick and incubated at room temperature for 10 minutes. During
incubation they were vortexed rigorously several times (2-4.times.5
seconds). The paraffin samples were centrifuged at 16,000.times.g
for 5 minutes. The limonene supernatant was removed very carefully
by placing a pipette onto the opposite side of the pellet. If no
pellet was received, centrifugation was repeated at higher speed
(20,000.times.g) for the same time and the remaining limonene was
removed. Afterwards 1 ml of EtOH (purity>99%) was added and
incubated at room temperature for 10 minutes while vortexing 2-3
times. Then the tubes were centrifuged at 16,000.times.g for 5 min.
As much ethanol as possible without disturbing the pellet was
removed by pipetting. Residual ethanol not removed by pipetting was
evaporated by incubation in a thermomixer at 50.degree. C. for 10
up to 30 minutes.
[0962] For lysis of the tissue, 150 .mu.l lysis buffer (50 mmol/l
TrisHCl, pH 8.0, 1 mmol/l EDTA, 0.5% Tween (volume %), TRIS
(tris-hydroxymethyl-amino-methan), Merck, no 1.01549.0500, Sodium
EDTA (Titriplex III) from Merck, no. 159294, Tween (Tween20),
Fluka, no. 93773) as well as 20 .mu.l proteinase K (10 mg/ml stock
solution in H.sub.2O, Roth, Karlsruhe) was added to each
deparaffinated sample. After vortexing rigorously, samples were
shortly centrifuged and incubated on a thermoshaker at 50.degree.
C. During the incubation period of about 40 hours, proteinase K was
added every 8-12 hours (altogether three times). The tubes were
always briefly centrifugated before opening to avoid contamination.
After the lysis step, samples were checked to be clear, containing
no debris anymore. Subsequently the inactivation of proteinase K
was done by incubation the lysed samples at 95.degree. C. for 10
minutes. If lysed samples were not directly used for DNA
extraction, they were stored at -20.degree. C.
[0963] The DNA-Isolation from lysates of paraffin-embedded
formalin-fixed tissue (PET) samples was done with the DNEASY.RTM.
Tissue kit (QIAGEN.RTM. cat no. 69504 [50 columns] or 69506 [250
columns]) with few modifications. 200 .mu.l buffer AL was added to
210 .mu.l room temperature equilibrated lysate and mixed thoroughly
by vortexing. This mixture was placed into a thermomixer and
incubated at 70.degree. C. while shaking for 10 minutes. Then 200
.mu.l 96% ethanol was added and mixed by pulse-vortexing for 15
sec. After a brief centrifugation, the whole mixture was applied
onto a column which was placed into a 2 ml collection tube
(QIAGEN.RTM. provided). This was followed by centrifugation at
6,000.times.g for 1 minute. Afterwards the column was placed into a
2 ml collection tube (QIAGEN.RTM. provided) and 500 .mu.l of AW 1
buffer was added. Recentrifugation under same conditions was
applied. The column was placed into an additional provided
collection tube and AW 2 buffer was added followed by
centrifugation at 20,000.times.g for 3 min. After some minutes of
drying, the centrifugation step was repeated at 20,000.times.g for
1 minute. To eluate the DNA, the column was placed into a 1.5 ml
reaction-tube (EPPENDORF.RTM., Hamburg, Germany) and 35 .mu.l of
elution buffer AE (adjusted to room temperature) was pipetted onto
the center of the column. After incubation at room temperature for
1 minute, the column was centrifuged at 6,000.times.g for 1 minute.
Another 35 .mu.l elution buffer was added to the column and the
centrifugation repeated. Therefore, the final volume of extracted
DNA was appr. 70 .mu.l. DNA was stored -20.degree. C.
Bisulfite Treatment
[0964] Bisulfite Treatment of Fresh Frozen Samples
Extracted genomic DNA was modified by bisulfite treatment. During
the bisulfite reaction, unmethylated cytosines are first
sulfonated, during a next step deaminated, and finally desulfonated
converting them to uracil while 5'-methylcytosin remains
unaffected.
[0965] In order to avoid potential process biases, all samples were
randomized in batches of about 30 samples regarding their clinical
follow-up. This randomization was transferred to the 384 well plate
layout of the assay plates resulting in a satisfactorily
randomization for these plates as well. The bisulfite treatment of
genomic DNA derived from fresh frozen material was carried out as
described in the following. 15 .mu.l of lysed genomic DNAs was
pipetted into a 96 well plate for each bisulfite batch according
the randomization. Afterwards 60 .mu.l bisulfite solution (4.9 M,
pH 5.5; sodium bisulfite, Merck 1.06528.0500, sodium sulfite,
anhydrous, Fluka 71988, ddH.sub.2O molecular biology grade) and 25
.mu.l dioxane solution containing the radical scavenger
(dioxane-radical scavenger solution: 98.6 mg of
6-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid, Aldrich
23,881-3 with 2.5 ml 1,4-dioxane, Riedel de Haen 33147) were added
to each well. The total volume of 100 .mu.l per well were sealed by
cap-strips.
[0966] The reaction mixture was thermocycled by the following
protocol:
[0967] 5:00 min denaturation of DNA at 99.degree. C.
[0968] 1:30 min cooling down to 4.degree. C.
[0969] 23:30 min incubation at 50.degree. C.
[0970] 3:00 min denaturation of DNA at 99.degree. C.
[0971] 1:30 min cooling at 4.degree. C.
[0972] 1:25:30 hours incubation at 50.degree. C.
[0973] 3:00 min denaturation of DNA at 99.degree. C.
[0974] 1:30 min cooling at 4.degree. C.
[0975] 2:55:30 hours incubation at 50.degree. C.
[0976] cooling down to 4.degree. C.
[0977] After incubation, the reaction was transferred into a 500
.mu.l collection tube (EPPENDORF.RTM. no. 124.502, Hamburg,
Germany) and 300 .mu.l ddH.sub.2O was added to increase the
solubility of the bisulfite salts.
[0978] The whole mixture of 400 .mu.l was pipetted into a sample
reservoir of an assembled MICROCON.TM. filter device (MICROCON.TM.
YM-30, 42410, MILLIPORE.RTM., USA) and sealed with the attached
cap. The assembly was centrifuged at 14,000.times.g for 15 minutes.
After discarding the flowthrough, 400 .mu.l TE buffer was added and
centrifuged again at same speed for 12 minutes. The washing step
was repeated once. For the desulfonation, 100 .mu.l NaOH 0.2 mol/l
(Merck no. 1.06482.1000) was added to the filter assembly without
touching the membrane and incubated at room temperature for 10
minutes. The assembly was centrifuged again at same speed for 10
minutes. The residual sodium hydroxide solution was removed by
washing the membrane with 400 .mu.l TE buffer and centrifugation at
same speed for 12 minutes. For elution of the bisulfite converted
DNA (bisDNA), 50 .mu.l of prewarmed TE buffer (50.degree. C.) (10
mmol/l Tris, Merck no. 1.01549.0500; 0.1 mmol/l EDTA, pH 8, Merck
no. 1.08418.0250) were pipetted into each sample reservoir and
incubated at room temperature for 10 minutes. Subsequently the
filter device was inverted and placed into a new MICROCON.TM. 1.5
ml tube and centrifuged at 1,000.times.g for 5 minutes. The
bisulfite treated DNA samples were transferred into a new 96 well
plate according to their specified sample order. The bisulfite
treated DNA samples were stored at -20.degree. C.
[0979] Bisulfite Treatment of Paraffin-Embedded Formalin-Fixed
Tissue (PET) Samples
The bisulfite treatment of genomic DNA derived from
paraffin-embedded formalin-fixed tissue was done according to
example 5. For this process, the samples were randomized not only
regarding to their clinical follow-up but also regarding to their
providers. For paraffin-embedded formalin-fixed (PET) samples, half
of the volume obtained from DNA extraction was used for subsequent
bisulfite reaction.
[0980] The procedure was especially designed for
bisulfite-treatment of paraffin-embedded formalin-fixed tissue
samples (PET-samples) to increase the resulting bisDNA amount.
Therefore, two bisulfite reactions of the same DNA sample were
performed and purified on one Microcon.TM. spin-column. The
following modifications compared to the fresh frozen protocol (see
above) were conducted. The first step of pipetting 15 .mu.l of
lysed genomic DNAs into a 96 well plate with 60 .mu.l bisulfite
solution (for ingredients see above) and 25 .mu.l dioxane solution
(for ingredients see above) containing the radical scavenger was
done twice for each DNA sample. The incubation step was performed
with the same thermocycler program as for the fresh frozen samples.
After incubation, both reactions (200 .mu.l in total) originating
from the same sample DNA were transferred into one 500 .mu.l
collection tube (EPPENDORF.RTM. no. 124.502, Hamburg, Germany)
while each well was washed with 100 .mu.l ddH.sub.2O and also
transferred to the collection tube containing finally 400 .mu.l
reaction solution. After mixing briefly, the solution was pipetted
into the sample reservoir of an assembled Microcon.TM. filter
device and purified, desulfonated and eluted as the fresh frozen
sample DNA. The bisulfite treated DNA samples were stored at
-20.degree. C.
Preparation of DNA Standards for QM Assays
[0981] Preparation of Quantification Standards
2,000 ng batches of human genomic DNA (Promega) were treated with
bisulfite. For this 100 .mu.l DNA (2,000 ng) are mixed with 354
.mu.l bisulfite solution and 146 .mu.l dioxane solution. Therefore
the following temperature program was applied for bisulfite
reaction: 1. Water bath at 95.degree. C. for 3 min; 2. Thermomixer
at 50.degree. C. for 30 min, shaking at 1,000 rpm; 3. Water bath at
95.degree. C. for 3 min.; 4. Thermomixer 50.degree. C., 1.5 hours,
shaking at 1,000 rpm; 5. Waterbath 95.degree. C., 3 min; 6.
Thermomixer 50.degree. C. for 3 hours, shaking 1,000 rpm). The
desalting, washing and desulfonation was done via MICROCON.TM.
YM-30 columns (MILLIPOREO/AMICON.RTM.) following the working
instructions. Quantification of the standard DNA was done with UV
spectrometer.
[0982] Preparation of Calibration Standards
Molecular-Displacement (MDA) DNA
[0983] Molecular-displacement (MDA) DNA is generated according to
the GenomiPhi.TM. DNA amplification kit (Amersham Bioscience). In
brief, genomic DNA is applied to Phi-DNA-polymerase in the presence
of random primers. This leads to a whole genome amplification of
DNA fragments which are unmethylated.
Sssl Treatment
[0984] To generate methylated MDA DNA, 13 tubes of 4.5 pg MDA-DNA
(700 ng/.mu.l) was treated with Sssl in the following reaction with
a total volume of 75 .mu.l (keep reaction-solutions on ice):
[0985] 4.5 .mu.g MDA-DNA (6, 3 .mu.l)
[0986] 57.3 .mu.l H.sub.2O
[0987] 0.375 .mu.l 200.times.SAM
[0988] 3 .mu.l (12U) Sssl
[0989] 7.5 .mu.l NE-buffer2
[0990] Incubation was performed at 37.degree. C. in a water bath.
After appr. 3 h, 0.375 .mu.l SAM was added and after another 5 h, 3
pl Sssl were added (2 times). Incubate overnight and subsequently
inactivate at 65.degree. C. for 10 min. Pool all 13 tubes (975
.mu.l) take 967 .mu.l and place DNA in a new 10 ml Falcon tube. Add
2 times 967 .mu.l water (20 ng/.mu.1) and aliquotate the DNA in
25.times.1.5 ml EPPENDORF.RTM. tubes containing 100 .mu.l each (2
pg).
Bisulfite Treatment of MDA-DNA Sssl Treated
[0991] 24 tubes each 2 pg were bisulfite treated. This was done by
mixing 100 .mu.l DNA with 354 .mu.l bisulfite solution and 146
.mu.l dioxane solution. Thereafter the following temperature
program was applied for bisulfite reaction: 1. Waterbath at
95.degree. C., 3 min.; 2. Thermomixer at 50.degree. C., 30 min,
shaking at 1,000 rpm; 3. Waterbath at 95.degree. C. 3 min.; 4.
Thermomixer 50.degree. C., 1.5 hours, shaking at 1,000 rpm; 5.
Waterbath 95.degree. C. for 3 min.; 6. Thermomixer 50.degree. C.,
shaking 1,000 rpm, 3 hours. The desalting, washing and
desulfonation was done via MICROCON.TM. YM-30 columns
(MILLIPORE.RTM./AMICON.RTM.).
Bisulfite Treatment of MDA-DNA not Sssl Treated
[0992] For bisulfite treatment of MDA-DNA, take 82.9 .mu.l MDA-DNA
(700 ng/.mu.l) and place in a new 10 ml Falcon tube. Add 3 times
939 .mu.l water (20 ng/.mu.l), aliquotate the DNA in 25 1.5 ml
EPPENDORF.RTM. tubes containing 100 .mu.l each (2 pg), perform 24
times the following: Mix 100 .mu.l DNA with 354 .mu.l bisulfite
solution and 146 .mu.l dioxane solution and apply thereafter the
following temperature program for bisulfite reaction: 1. Waterbath
at 95.degree. C., 3 min.; 2. Thermomixer at 50.degree. C., 30 min,
shaking at 1,000 rpm; 3. Waterbath at 95.degree. C. 3 min.; 4.
Thermomixer 50.degree. C., 1.5 hours, shaking at 1,000 rpm; 5.
Waterbath 95.degree. C. for 3 min.; 6. Thermomixer 50.degree. C.,
shaking 1,000 rpm, 3 hours. The desalting, washing and
desulfonation was done via MICROCON.TM. YM-30 columns
(MILLIPORE.RTM./AMICON.RTM.).
Quantification of Bisulfite Converted MDA-DNA Sssl Treated and
MDA-DNA not Sssl Treated
[0993] MDA-DNA Sssl treated and MDA-DNA not Sssl treated was
diluted 1 to 2 and 1 to 10 each sample, and DNA concentration was
determined in duplicates using the C3 assay and the quantification
standard prepared according to [0409]. Both standards were diluted
1 to 10 and 1 to 100. Afterwards, 10 .mu.l were used for UV
quantification.
[0994] Determination of Sulfite Concentration in MDA-DNA Sssl
Treated- and MDA-DNA not Sssl Treated
[0995] Determination of residual sulfite was performed using the
Merck Sulfit-Kuvettentest 1.1 (Merck, Darmstadt) according to the
procedure described for sample measurement. The sulfite
concentrations were below 100 mg/l resulting in values further
below the critical value of 50 mg/l sulfite in the PCR via dilution
of the stock solution.
Preparation of Calibration Standard Mixtures
[0996] Calibration standards were prepared using the stock
solutions of MDA-DNA Sssl treated--and of MDA-DNA not Sssl treated
separately for the samples sets of the ER+NO untreated population
and ER+NO TAM treated population according to Table 1a. For that,
we prepared DNA solutions of 14 different methylation level
(logarithmical series) with the concentration of 1 ng/.mu.l and
distributed 40 .mu.l of each level to several 96 well plates (plate
05) for automatic pipetting into 384 well assay plates.
TABLE-US-00001 TABLE 1a Preparation of calibration standards.
MDA-DNA Sssl treated - and MDA-DNA not Sssl treated were mixed in
the indicated ratios. STARNDARD Sss1 DNAs treatedMDA- .mu.g/.mu.l %
MDA DNA 22.0 ng/.mu.l DNA 28 +.mu.l H2O -> methylation up down
ng needed ng up ng down .mu.l up .mu.l down 10 ng/.mu.l 0 0 1.00
1500 0 1500 0 75 90 4 0.04 0.98 1500 60 1440 2.36 72 90.64 10 0.1
0.90 1500 150 1350 5.89 67.5 91.61 17 0.17 0.83 1500 255 1245 10.02
62.25 92.73 25 0.25 0.75 1500 375 1125 14.73 56.25 94.02 34 0.34
0.66 1500 510 990 20.04 49.5 95.46 44 0.44 0.56 1500 660 840 25.93
42 97.07 50 0.5 0.50 1500 750 750 29.46 37.5 98.04 56 0.56 0.44
1500 840 660 33 33 99 66 0.66 0.34 1500 990 510 38.89 25.5 100.61
75 0.75 0.25 1500 1125 375 44.2 18.75 102.05 83 0.83 0.17 1500 1245
255 48.91 12.75 103.34 90 0.9 0.10 1500 1350 160 53.04 7.5 104.46
96 0.96 0.04 1500 1440 60 56.57 3 105.43 100 1 0.00 1500 1500 0
58.93 0 106.07 441.96 562.5
Verification of Methylation Status of Bisulfite Treated DNA
[0997] To check the methylation status of the MDA-DNA Sssl
treated--and MDA-DNA not Sssl treated, a bisulfite sequencing was
performed. Both types of DNA were amplified using the following
primer pairs producing fragments covering the regions that were
amplified by the QM assays. The length of the PCT products for
sequencing is between 200 and 500 bp.
TABLE-US-00002 Primer 2064:300P22 Primer 2064:514022 Seq ID NO 1:
Seq ID NO 2: GGAGGGGGTAGAGTTATTAGTT TATACTTCCTCAAACAACCCTC Primer
4063:1431P22 Primer 4063:1868020 Seq ID NO 3: Seq ID NO 4:
GTGATATTTGGGGATTGTTATT ACTCCCTCCCCTATCTTACA Primer 15665:699P21
Primer 15665:1124022 Seq ID NO 5: Seq ID NO 6:
TTTGTTGGGATTTGTTAGGAT AAACATTTTACCCCTCTAAACC Primer 15947:907P24
Primer 15947:1360023 Seq ID NO 7: Seq ID NO 8:
TGATTGTGTAGATTATTTTTGGTT CAAACTCTCTAAACCTCAATCTC Primer 2265:176P22
Primer 2265:582022 Seq ID NO 9: Seq ID NO 10:
TTGGTGATGTTGATTAGAGTTT TAAAACACCTTACATTTTCCCT Primer 15908:782P22
Primer 15908:1228023 Seq ID NO 11: Seq ID NO 12:
GGTAGAGGAAGTAGTTGGTTTG CTTTTATATTTCTCCCAATCTCC Primer
0003522:2102Q21 Primer 0003522:1738R23 Seq ID NO 13: Seq ID NO 14:
GTAGGGGAGGGAAGTAGATGT TCCTCAACTCTACAAACCTAAAA
[0998] Bisulfite sequencing was done according to standard
protocols and was performed on a ABI 3770 sequencer (96 well
plate). The expected sequences and methylation ratios could be
confirmed for the used fragments (data not shown).
Quantification and Adjustment of Bisulfite DNA Concentration
Determination of Sulfite Concentration in Bisulfite DNA
[0999] Increased concentrations of residual sulfite influence the
QM-assay. Therefore, we decided to determine the sulfite
concentration for each of the bisulfite treated samples of both
sample sets. Increased sulfite (higher 50 mg/l in the PCR reaction)
affects the PCR amplification of the bisulfite DNA resulting in
higher CT-values compared to sulfite concentrations below this
range. CT-values represent the threshold cycle or the crossing
point of a real time PCR.
[1000] Sodium sulfite was used to prepare a sulfite standard stock
solution with 1 g/l S032.about. in 1.times.TE buffer. We produced
standard solutions from 100 mg/l to 1.56 mg/l sulfite via stepwise
dilution and intensive vortexing between 2 dilution steps to
produce the standard curve.
TABLE-US-00003 TABLE 2 Sulfite-Standards for Sulfite Test.
Sulfite-standards for sulfite test in 384 MTP addition of standard
solution addition TE conzentration number in .mu.l number .mu.l
SO.sub.3.sup.2- [mg/l] 1 100 Stock 900 100 2 500 1 500 50 3 500 2
500 25 4 500 3 500 12.5 5 500 4 500 6.25 6 500 5 500 3.13 7 500 6
500 1.56
[1001] Sample stock and 27 .mu.l of ddH.sub.2O were mixed. 10 .mu.l
of the pre-diluted sample and 10 .mu.l sulfite reagent
(Sulfit-Kuvettentest--Merck, 1.14394.0001) was placed in a 384 well
plate and vortexed. After 2 minutes of waiting time the absorbance
of the solution was measured with a Photometer-Plate reader at 412
nm. The sulfite concentration was determined according to the
calibration curve in mg/l sulfite.
Results
[1002] The amount of sulfite determined for the stock solution of
all samples of the ER+NO untreated population were between 0-390
mg/l. The sulfite amount was reduced up to 0-30 mg/l for the entire
sample set after adjustment of the sample concentration to 1
ng/.mu.l, except for 1 sample. Here we measured exactly the limit
value of 100 mg/l.
[1003] The sulfite concentration of the sample set ER+NO TAM
treated Population was determined with 0-1195 mg/l sulfite. The
sulfite concentration for 7 samples was in a critical, but still
acceptable range (between 50 and 100 mg/1) and for 2 samples over
100 mg/l (12 0 mg/1).
[1004] In conclusion, residual sulfite in bisulfite treated DNA was
no major issue.
Real-Time PCR Based Quantification of Bisulfite DNA
[1005] The GSTP1-C3 assay design makes it suitable for quantitating
DNAs from different sources, including fresh/frozen samples, remote
samples such as plasma or serum, and DNA obtained from archival
specimen such as paraffin-embedded formalin-fixed material. Table 3
provides an overview of fragment and oligonucleotide sequences.
TABLE-US-00004 TABLE 3 Sequence Information of C3 Fragment and
Oligos GSTP1 gene-Genbank number for genomic sequence: AY324387
GSTP1-C3 130 bp bis-sequence Seq ID No 15:
GGAGTGGAGGAAAtTGAGAtttAtTGAGGTTACGTAGTTTGtttAA
GGTtAAGttTGGGTGttTGtAATttTTGtttTGTGttAGGtTGttT
tttAGGTGTtAGGTGAGtTtTGAGtAttTGtTGTGT GG Primer Seq ID NO 16:
2111.C3F GGAGTGGAGGAAAtTGAGAt Primer Seq ID NO 17: 2111.C3R
CCACACAaCAaaTaCTCAaAaC TAQMAN .TM. probe C3-TAQ2 Seq ID NO 18:
FAM-TGGGTGTTTGTAA TTTTTGTTTTGTGTTAGGTT-TAMRA
[1006] The preparation of the quantification standard DNA was
described in 9.4.1. The DNA concentration was adjusted between
4-0.0312 ng/.mu.l and placed into a 96 well format for automatic
pipetting into a 384 well PCR assay plate. Each calibration
standard DNA was amplified up to 3.times. (light green on the 96
well plate and 384 PCR plate).
TABLE-US-00005 TABLE 4 DNA Amounts and Serial Dilution Steps for
Quantification of Bisulfite-Treated DNA Samples. ng DNA per PCR
Step_and Dilution of Stock 40.000 ng 1_1 20.000 ng 2_1:2 10.000 ng
3_1:4 5.000 ng 4_1:8 2.500 ng 5_1:16 1.250 ng 6_1:32 0.625 ng
7_1:64
TABLE-US-00006 TABLE 5 96 Well Plate with Calibration Standard DNA,
Plate 05. 96 well plate with quantification standard, plate 05 1 2
3 4 5 6 7 8 9 10 11 12 A 40 ng Ntc B 20 ng Ntc C 10 ng Ntc D 5 ng
Ntc E 2.5 ng F 1.25 ng.sup. G 0.625 ng H 0.312 ng (Ntc. = No
template control)
[1007] The Mastermix for the entire 384 PCR plate was pipetted
according to Table 6, mixed in a 15 ml falcon tube and distributed
to 8.times.500 .mu.l screw cap vials for automatic pipetting with
TECAN.RTM. workstation.
TABLE-US-00007 TABLE 6 PCR Mastermix Preparation for C3 Assay
Quantification Final Solution Concentration Volume Concentration
Provider PCR buffer 10x 2 .mu.l lx Eurogentec dNTP mix 25 mmol/l
0.2 .mu.l 250 .mu.mol/l Fermentas (each) (each) MgCl.sub.2 25
mmol/l 2.4 .mu.l 3 mmol/l Eurogentec DNA 5 U/.mu.l 0.2 .mu.l 1 unit
Eurogentec polymerase Primer mixture 5 .mu.mol/l 1.25 .mu.l 0.313
.mu.mol/l MWG (each) TAQMAN .TM. 10 .mu.mol/l 0.6 .mu.l 0.3
.mu.mol/l TibMolBiol probe water -- 3.35 .mu.l -- Fluka diluted DNA
-- 10 .mu.l -- -- Total react. 20 .mu.l volume
TABLE-US-00008 TABLE 7 PCR Cycling Conditions for C3 Assay at ABI
7700 or 7900 Instrument 1 Initial denaturation 95.degree. C. 10 min
2 Denaturation 95.degree. C. 15 sec 3 Annealing/ex-tension
58.degree. C. 60 sec 4 Cycling Repeat steps (2 + 3) 45x
[1008] The bisulfate treated DNA samples of the ER+NO untreated
population were stored in 7.times.96 well plates (plate 01-07) and
of the ER+NO untreated population in 8.times.96 well plates (plate
01-08). To quantify all samples, 3 .mu.l of the sample was taken
and 27 .mu.l water were added. This results in a 1:10 dilution of
the DNA stock concentration. Furthermore additional 3 .mu.l of the
first dilution (1:10) were diluted again with 27 .mu.l of water to
obtain a 1:100 dilution of the stock DNA. This process results in 2
dilution plates (1:10 and 1:100) for each sample DNA in separate 96
well plates. The 384 PCR plates for quantification were pipetted
with the TECAN.RTM. workstation using always 4 (2.times.1:10
dilution and 2.times.1:100 dilution).times.96 well plates. So each
quantification PCR run quantified 2 of the DNA stock plates in 2
replicates next to each other for each DNA sample. The pipetting
program of the TECAN.RTM. workstation transferred first 10 n1 of
the Mastermix and afterwards 10 .mu.l of the respective DNA into
the designed well. So DNAs from plate 01 and 02 (one DNA stock
plate) result in orange colors and from plate 03 and 04 in blue
colors on the 384 well PCR plate. Standard DNA wells are marked in
light green and negative control PCR reactions in dark green on the
final plate.
TABLE-US-00009 TABLE 8 96 Well Plate with Bisulfite-Treated Samples
(1:10 and 1:100 Dilution) ##STR00002##
TABLE-US-00010 TABLE 9 384 well PCR plate for quantification.
Layout ##STR00003##
Results of Quantification
TABLE-US-00011 [1009] TABLE 10 Results of C3 Quantification on
Fresh Frozen Samples (ER+ NO Untreated Population) ER+ NO untreated
population Amount of DNA Concentration Number quantified of DNA, of
with C3, ng ng/.mu.l samples 1807-9992 40-222 57 900-1732 20-40 112
454-898 10-20 181 225-442 5-10 90 87.3-221 2-5 36 41.5-81.5 1-2 10
11.7-41.0 0.25-1 10 0 0.0 12
TABLE-US-00012 TABLE 11 Results of C3 Quantification on
Paraffin-Embedded Formalin-Fixed (PET) Samples (ER+ NO TAM Treated
Population) ER+ NO TAM treated Population Amount of DNA quantified
Concentration Number with C3 of DNA, of assay, ng ng/.mu.l samples
1813-24500 40-545 75 905-1795 20-40 52 452-886 10-20 74 225-447
5.0-10.0 72 90.4-225 2.0-5.0 98 45.4-88.4 1.0-2.0 69 4.7-45.2 0.1-1
96 0.24-4.5 0.01-0.1 33 0.0 0.0 20
Adjustment of DNA Concentration
[1010] According to the resulting concentration determined via
quantification, we adjusted each sample to a concentration of 1
ng/.mu.l if possible. This concentration results in up to 10 ng DNA
in the QM assay reaction. For the adjustment, the DNA samples of
one 96 well DNA stock plate were pipetted into a deep well plate
using maximal 390 ng, producing a concentration adjusted copy plate
(96 wells). The adjustment step was also done with the TECAN.RTM.
workstation pipetting between 4 .mu.l and 32 .mu.l of DNA and
adding the respective amount of water (up to 900 .mu.l) to achieve
1 ng/.mu.1. The adjusted DNA solution was afterwards transferred
from deep well plates into several identical 96 well plates for
final QM assay pipetting.
[1011] Note that not all samples could be adjusted to the desired
concentration of 1 ng/.mu.l due to limited material. Table 12 and
Table 13 shows the distribution of actual amounts of DNA that was
used in the QM assays.
TABLE-US-00013 TABLE 12 Final Amount of DNA in QM Assay for Fresh
Frozen Samples (ER+ NO untreated population) after Adjustment. ER+
NO untreated Population Amount of DNA (adjusted) in QM assay Number
of samples 10 ng 357 5-10 ng 85 2-5 ng 34 1-2 ng 10 0-1 ng 10 0 ng
12
TABLE-US-00014 TABLE 13 Final Amount of DNA in QM Assay for
Paraffin-Embedded Formalin-Fixed (PET) Samples (ER+ NO TAM treated
population) after Adjustment. ER+ NO TAM treated Population Amount
of DNA (adjusted) in QM assay Number of samples 10-24 ng 9 10 ng
263 5-10 ng 72 2-5 ng 96 1-2 ng 41 0-1 ng 88 0 ng 20
QM Assay Runs
[1012] The bisulfate treated DNA and concentration adjusted samples
of the ER+NO untreated population were stored in 7.times.96 well
plates (plate 01-07) and of the ER+NO untreated population in
8.times.96 well plates (plate 01-08). To measure the entire sample
set of both populations we run 2.times.384 PCR reaction plates for
each QM assay and population. Each QM assay plate contains the
samples of 3 or 4.times.96 well plates (88 wells actually used per
plate) and 1.times.96 well plate with standard DNA (14 mixtures of
the calibration DNA and water for the no template control PCR
reaction, see Table 15 below). Repetitions of sample measurements
were done by repeating the QM assay run 3 times.
[1013] The 384 PCR plates were also pipetted with the TECAN.RTM.
workstation. The pipetting program transferred at first 10 .mu.l of
the mastermix and afterwards 10 .mu.l of the respective DNA into
the designed well. As described for the quantification step, DNAs
from plate 01 and 02 result in orange colors and from plate 03 and
04 in blue colors on the 384 well PCR plate (see 9.5.2). Standard
DNA wells are signed in light green and negative control PCR
reactions in dark green on the final plate. The components of the
mastermix for each QM assay were adapted according the table 14.
The mixture was pipetted in a falcon tube and distributed to
8.times.500 .mu.l screw cap vials for automatic pipetting with
TECAN.RTM. workstation.
TABLE-US-00015 TABLE 14 PCR Components for 384 Well PCR Plate
(e.g., for QM assay 3522-II). number of reactions: 384 384 Factor:
1.1 component stock conc. .mu.l/reaction .mu.l in MM final conc.
Ampli reaction 10x 2 844.8 1x buffer Ampli MgCl2 25 mmol/l 2 844.8
2.5 mmol/l dNTPs 25 mmol/l each 0.2 84.48 250 .mu.mol/l primer mix
6.25 .mu.mol/l 2 844.8 625 nmol/l cg-probe 4 .mu.mol/l 1 422.4 200
nmol/l Tg-probe 4 .mu.mol/l 1 422.4 200 nmol/l AmpliTaqGold 5
U/.mu.l 0.2 84.48 1U water 1.6 675.84 Ad 10 10 4224
TABLE-US-00016 TABLE 15 Calibration Standard DNA Mixtures and No
Template Control (Plate 05). 96 well plate 1 2 3 4 5 6 7 8 9 10 11
12 A 0% 66% Ntc B 4% 75% Ntc C 10% 83% Ntc D 17% 90% Ntc E 25% 96%
F 34% 100% G 44% H 56% (Ntc = No template control)
[1014] All QM assays were run on a ABI TAQMAN.TM. 7900HT real-time
device (SDS 2.2. software) with a reaction volume of 20 .mu.l and
9600 emulation (emulation of ABI TAQMAN.TM. 7700). An automatic
sample setup was used to transfer the correct sample names and
detector/reporter dyes to the TAQMAN.TM. software. The cycling
conditions were manually adjusted (Table 16) and ROX was used as
passive reference dye.
TABLE-US-00017 TABLE 16 Optimized MgCl2 Concentrations and
Annealing Temperatures of QM Assays Annealing Assay Gene MgCl.sub.2
conc. Temp. 3522 I PITX2 3 mM 62.degree. C. 3522 II PITX2 2.5 mM
60.degree. C. 2395 PLAU 2.5 mM 60.degree. C. 2064 ERBB2 2.5 mM
62.degree. C. 15908 II TBC1D3 4.5 mM 60.degree. C. 15665 ONECUT2 3
mM 60.degree. C. 15947 ABCA8/9 3 mM 62.degree. C. 2265 TFF1 2.5 mM
60.degree. C.
[1015] All 384 well PCR plates we re-analyzed by the SDS2.2
software using the manual analysis settings (baseline setting with
start and stop values and manual threshold) to produce results
files for each run individually.
Example 10
DNA Quantification Methods
UV Determination of Physical DNA Concentration
[1016] UV quantification was performed to determine the total
amount of DNA present including DNA which cannot be amplified using
a real time PCR based approach. UV quantification was done by using
a standard spectrophotometer for example the UV mini 1240 UV-VIS
spectrophotometer (Shimadzu).
Real Time PCR Determination of Bisulfite Converted DNA (HB14 Assay)
by Means of a LIGHTCYCLER.TM. Instrument (Roche).
[1017] Real time PCR quantification specifically detects bisulfite
converted DNA. Only DNA which is not affected by degradation due to
formalin fixation, paraffin-embedding and storage is quantified
using a real time PCR approach. The quantification was performed in
a total volume of 20 .mu.l containing 10 .mu.l template DNA or a
dilution thereof, 1 U or 3 U FastStart Taq DNA polymerase (Roche),
respectively, 4 mmol/l MgCl2, 500 nmol/l (each) forward and reverse
primers (forward primer Seq ID NO 19: TGGTGATGGAGGAGGTTTAGTAAGT,
reverse primer Seq ID No 20: AACCAATAAAACCTACTCCTCCCTTAA),
1.times.PCR buffer (Roche), 0.25 mmol/l or 0.5 mmol/l of each dNTP
(Fermentas), respectively, 0.25 mg/ml BSA (Sigma Aldrich) and 250
nmol/l of each detection probe (Seq ID NO 21:
TTGTGAATTTGTGTTTGTTATTGTGTGTTG-Fluo and Seq ID NO 22: Red6
40-TGGTGGTTATTTTTTTTATTAGGTTGTGGT-Phosphate). Cycling was done
using a LIGHTCYCLER.TM. detection System (Roche) with the following
conditions: 10 min at 95.degree. C. and 40 cycles at 95.degree. C.
for 10 s, 58.degree. C. for 20 s, 72.degree. C. for 10 s or
72.degree. C. for 70 s, detection at 58.degree. C., and ramping
rates 20.degree. C./s. The amplification results in 133 bp
fragments.
Real Time PCR Determination of Bisulfite Converted DNA (C3 Assay)
by Means of a 7900HT Fast Real-Time PCR System (Applied
Biosystems).
[1018] The C3 assay specifically detects bisulfite converted DNA.
Real time PCR quantification (C3 assay) was performed in a total
volume of 20 .mu.l containing 10 .mu.l template DNA or a dilution
thereof, 1 U HotGoldStar polymerase (Eurogentec), 3 mmol/l
MgCl.sub.2, 625 nmol/l (each) forward and reverse primers (forward
primer Seq ID NO 23: GGAGTGGAGGAAATTGAGAT, reverse primer Seq ID NO
24: CCACACAACAAATACTCAAAAC), 1.times. reaction buffer containing
ROX passive reference (Eurogentec), 0.25 mmol/l of each dNTP
(Fermentas) and 200 nmol/l detection probe (Seq ID NO 25:
FAM-TGGGTGTTTGTAATTTTTGTTTTGTGTTAGGTT-EclipseDQ or BNQ1). Cycling
was done using a Applied Biosystems 7900HT Fast Real-Time PCR
System with the following conditions: 10 min at 95.degree. C. and
40 cycles at 95.degree. C. for 15 s, 58.degree. C. for 60 s,
detection at 72.degree. C., and ramping rates 3.degree. C./s.
Real Time PCR Based Simultaneous Determination of Bisulfite
Converted and Unconverted DNA (CFF1 Assay) by Means of a 7 900HT
Fast Real-Time PCR System (Applied Biosystems)
[1019] The CFF1 assay is located in a region without any cytosines
and therefore this region is not affected by the bisulfite
conversion. Accordingly, this assay enables the determination of
both, genomic and bisulfite converted DNA simultaneously. Real time
PCR quantification (CFF1 assay) was performed in a total volume of
20 .mu.l containing 10 .mu.l template DNA, 1 U HotGoldStar
polymerase (Eurogentec), 2.5 mmol/l MgCl2, 625 nmol/l (each) of
forward and reverse primers (forward primer Seq ID NO 26:
TAAGAGTAATAATGGATGGATGATG, reverse primer Seq ID NO 27:
CCTCCCATCTCCCTTCC), 1.times. reaction buffer containing ROX passive
reference (Eurogentec), 0.25 mmol/l of each dNTP (Fermentas) and
200 nmol/l detection probe (Seq ID NO 28:
FAM-ATGGATGAAGAAAGAAAGGATGAGT-EclipseDQ or BHQ1). Cycling was done
using a Applied Biosystems 7900HT Fast Real-Time PCR System with
the following conditions: 10 min at 95.degree. C. and 40 cycles at
95.degree. C. for 15 s, 58.degree. C. for 60 s, detection at
72.degree. C., and ramping rates 3.degree. C./s.
Example 11
Bisulfite Treated DNA Derived from Paraffin-Embedded Formalin-Fixed
Tissues (Pet) in Real Time PCR
[1020] Several different paraffin-embedded formalin-fixed tissue
(PET) specimens (4 breast, 12 gallbladder, 12 tonsil samples) were
processed according to example 2. Bisulfite treated and purified
DNA of these specimens was pooled and subsequently subjected to the
quantitative real time PCR of Example 10b (HB14 assay). FIG. 2
shows that the effective DNA input in the real time PCR
quantification assay (HB14 assay) is in strong concordance to the
quantified DNA amount over a wide range of DNA input amounts. The
use of dNTPs each 250 .mu.mol/l in the quantification assay leads
to a reliable amplification and therefore quantification of up to
25 ng input DNA. Higher DNA inputs results in a relative decrease
of amplified DNA in comparison to the effective input indicating an
inhibition of the PCR. Increasing the dNTP concentration to 500
.mu.mol/l for each nucleotide enables a proper amplification and
therefore quantification of up to 100 ng of input DNA.
[1021] An increase in the extension time within each PCR cycle also
leads to a higher amplifiablity of bisulfite treated DNA derived
from archived samples in case high DNA amounts are used. FIG. 3
shows the amplification and quantification of up to 130 ng input
DNA using a prolonged extension time of 90 s compared to a
extension time of 30 s. For this experiment, it is taken into
account that the polymerase activity already starts during the
annealing step at 58.degree. C. which is therefore also regarded as
extension time.
[1022] In case of the use of higher levels of DNA input amounts,
the real time PCR performance at is also affected by the amount of
polymerase. FIG. 4 shows the positive influence of the three fold
increase of the polymerase activity. This increase enables the
proper amplification and quantification of up to 200 ng of
bisulfite DNA in a single PCR reaction.
Example 12
Processing of Tissue Sections Derived from Paraffin-Embedded
Formalin-Fixed Prostate Biopsies (Processing of 2.times.24
Samples)
[1023] Sections from 24 different paraffin-embedded formalin-fixed
prostate biopsy specimens (1-3 biopsy cores per paraffin block)
were analyzed. Two samples (a and b) of each specimen each
consisting of 5 sections (10 pm) were processed resulting in 48
samples in total. Samples were processed according to example 7
followed by a bisulfite treatment and DNA purification by means of
Microcon.TM. device as described in example 8. The DNA yield after
bisulfite treatment and subsequent purification was determined
according to Example 10c. FIG. 5 shows that the yield of bisulfite
treated and purified DNA is more than 100 ng for at least one of
the two samples per specimen except specimen 5 and 6. Samples of 6
specimen resulted in more than 500 ng bisulfite DNA. DNA yields
from both samples of each specimens show a strong concordance. This
illustrates the high reproducibility and reliability of the method
according to the invention. Most samples comprise 20%-50%
amplifiable DNA (FIG. 6) which is characterized by the ratio of DNA
amounts resulted from the quantification by means of Example 10c
and of the UV value (see Example 10a).
Example 13
Amplification of PCR Amplicons of Different Lengths from
Paraffin-Embedded Formalin-Fixed Tissues (PET)
[1024] Several different paraffin-embedded formalin-fixed tissue
(PET) specimens (4 breast, 12 gallbladder, 12 tonsil samples) were
processed according to Example 2. The purified DNA after bisulfite
treatment was pooled and subsequently subjected to PCR in which
amplicons of different lengths (185 bp-711 bp) should be amplified.
PCR was performed in a total volume of 25 .mu.l containing 1 U and
3 U Hotstar Taq polymerase (QIAGEN.RTM.), respectively, 12.5
.mu.mol of forward and reverse primers (primer sequences are shown
in table 17a), 1.times. PCR buffer (QIAGEN.RTM.), 0.2 mmol/l of
each dNTP (Fermentas). Cycling was done using a MASTERCYCLER.RTM.
(EPPENDORF.RTM.) with the following conditions: 15 min at
95.degree. C. and 40 cycles at 95.degree. C. for 30 s, 55.degree.
C. for 45 s and 72.degree. C. for 1:30 min. Each PCR contained 30
ng template DNA. This amount is based on a prior real time PCR
quantification as exemplified by Example 10b (HB14 assay) and
therefore reflecting the amplifiable partition of the physically
present total DNA amount.
TABLE-US-00018 TABLE 17a Amplicon Sizes and the Respective Primer
Sequences Ampli- con Size Forward Primer Reverse Primer [bp]
(5'->3') (5'->3') 185 Seq ID No 29: Seq ID No 30:
TTTTTGTAGTTTA ACACAATAAAT GAAGGAGGTTAG TCAACCACCAA 210 Seq ID No
31: Seq ID No 32: GGGAGATTT CACCCTCTAA AATTTGGGG TAACCAACCA 235 Seq
ID No 33: Seq ID No 34: TTAGGTATAAG CCCATAAACA TTGGTGGTGG
ACCCCTAAAA 260 Seq ID No 35: Seq ID No 36: AGGTATAGGAT AACCCAAACCC
GGGGAATTAGT TTATACAAAC 285 Seq ID No 37: Seq ID No 38: GTTTTTGGAGT
CACCCCCATC TAATTGGGAG ATTACTATTC 310 Seq ID No 39: Seq ID No 40:
AGGGTAGAG CCAAAACTATA GGTGTTGGT AACCTTCCCA 335 Seq ID No 41: Seq ID
No 42: TTTAGTATGGG CCTCTTTCCTAA TTGAGAGGAGT AACTACACATTC 360 Seq ID
No 43: Seq ID No 44: GGATTATTGTT ACACTTCCCTA GGGTATTTGTT
AAATCTTCAAA 385 Seq ID No 45: Seq ID No 46: GTTGGATTTGT
ACATTTAACTCT TTAGAGAGAGG TTATCCCAAAA 410 Seq ID No 47: Seq ID No
48: TTATTTGATGG ACAAACAACAC GGATAGAGATT ACCCTCATAC 435 Seq ID No
49: Seq ID No 50: TGTAATGAAAG TTAACTAAACC AAGGTGTTGAG ATCCATAACCC
460 Seq ID No 51: Seq ID No 52: GGATTATAGGAA TCTTTCCAACTC
TTAGAATGGGT AACATCTTACT 485 Seq ID No 53: Seq ID No 54: TGGTGGTATG
TCCCCCAAATA GATTGGATAA ACACAATATAC 511 Seq ID No 55: Seq ID No 56:
AGAGGAAAGAGT CTTATCCCC AAGGAATTTTT CACAAAACC 535 Seq ID No 57: Seq
ID No 58: GGTGGAGGGA CCAACAAAAC GAGTTAAGG GCCCTCTCC 561 Seq ID No
59: Seq ID No 60: GATTGAGATTA ACTTAAACCTT TTTTGGGTTTT CCCTCTCCAC
586 Seq ID No 61: Seq ID No 62: TTAAGTATTGG ACCTACCCTCTA
ATTTGGGGTTA ACTCTACAAAAA 606 Seq ID No 63: Seq ID No 64:
AGTAAATAGTGG AAAAACCTCTAA GTGAGTTATGAA AAACTACTCTCC 636 Seq ID No
65: Seq ID No 66: AAGGTTTTAGG ACCTTTTCCTAT GAAGAGTGTTT CACAAAAATAA
660 Seq ID No 67: Seq ID No 68: AGGGGGAATTA CAATAAAACCA AATAGAAAGAG
TCCCAAATACT 678 Seq ID No 69: Seq ID No 70: TATGGGAGGAG CCCCAAATCCT
GTTAGTAAGTG ACATATAAAAA 711 Seq ID No 71: Seq ID No 72: GTATTATGTGG
ACTCCAAACAA TTTAAGGAGGG ATTCAACAACT
[1025] Bisulfite treated high molecular weight (HMW) DNA (human
genomic DNA, Promega, USA) was used as positive control for each
PCR amplicon.
[1026] FIG. 7 shows the results of the PCR amplifications. The use
of 1 U of Taq polymerase per reaction resulted in the successful
amplification of amplicons up to 335 bp. To the contrary, it was
possible to successfully amplify amplicons of up to 511 bp by means
of 3 U Taq polymerase per reaction.
Example 14
Paraffin Removal, Lysis and DNA Extraction Plate Scale
[1027] Samples from 18 different paraffin-embedded formalin-fixed
prostate specimens (P1, P2, P4, P5, P6, P7, P8, P9, P10, ST-268,
ST-269, ST-270, ST-271, ST-272, ST-273, ST-274, ST-275, ST-276)
were processed according to example 1 a) (paraffin removal step),
example 1 b) (lysis step) and example 1 c) (DNA extraction step).
Four samples per specimen were processed independently. Each sample
consisted of 3 sections (10 pm). The concentration of amplifiable
DNA after lysis and DNA extraction was determined according to
Example 10d (CFF1 assay), respectively. The ratio of the quantified
amplifiable DNA concentration after the DNA extraction step and of
the quantified amplifiable DNA concentration after the lysis step
reflects the yield of the extraction procedure. The total amount of
DNA physically present in the extract was determined by UV
spectrophotometry (Example 10a). The content of amplifiable DNA in
the extracts is reflected by the ratio of quantified DNA according
to Example 10d and of the total amount of DNA determined by means
of UV spectrophotometry (Example 10a). Results are shown in Table
17b and FIGS. 8-12.
TABLE-US-00019 TABLE 17b Processing of 18 paraffin-embedded
formalin-fixed tissue specimens. Results of real time PCR based
(Example 10d) and UV spectrophotometry based (Example 10a)
quantification. All data are means of four independently processed
samples per specimen including standard deviation. Total Total
Total DNA in DNA in DNA in lysate - extract - extract - CFF1 CFF1
UV quanti- Amplifi- assay Standard assay Standard Yield Standard
fication Standard ablility Standard sample [ng] deviation [ng]
deviation [%] deviation [ng] deviation [%] deviation P1 769.37
212.86 463.42 62.10 67.30 34.96 8490 1056.98 5.49 0.68 P2 4108.87
3810.73 2697.79 406.28 185.17 184.96 23580 8277.25 12.02 2.59 P4
1735.07 878.86 1181.97 23.15 98.68 84.95 18660 6092.29 6.76 1.75 P5
1235.85 361.47 916.91 134.47 81.92 35.32 19560 3191.49 4.83 1.30 P6
1389.80 438.28 951.95 71.40 73.78 22.61 18240 4313.88 5.46 1.45 P7
3245.58 2235.31 2126.81 53.40 87.89 46.38 21090 1992.69 10.14 0.79
P8 2620.08 1791.35 1687.70 144.38 99.66 69.38 21765 367.83 7.76
0.75 P9 1808.96 549.44 1032.30 686.75 69.39 55.39 21240 10360.27
5.34 4.39 P10 1031.69 326.70 696.47 62.02 71.48 17.29 14865 1818.16
4.76 0.90 ST-268 18906.18 1697.40 4354.72 299.62 23.10 1.54 45195
4658.51 9.67 0.62 ST-269 22888.11 201.42 3736.64 415.22 16.32 1.69
55545 4707.71 6.73 0.46 ST-270 41912.14 14525.27 10316.21 828.41
27.36 10.65 45495 6065.72 22.82 1.56 ST-271 39288.96 21812.73
7842.60 975.43 25.91 14.93 37185 4089.22 21.28 3.53 ST-272 30026.72
6636.77 6578.06 1035.90 23.29 8.43 49725 9499.14 13.31 0.86 ST-273
69900.08 36062.28 15876.32 2394.68 26.92 11.00 70470 6251.05 22.60
3.40 ST-274 19929.85 1098.59 2758.56 754.86 13.78 3.27 50085
8262.94 5.52 1.11 ST-275 46583.92 25018.63 14482.29 1766.26 38.00
17.48 62640 22706.76 25.80 10.11 ST-276 21562.06 701.41 4785.23
430.75 22.25 2.65 40200 4213.41 11.98 1.40
Example 15
Paraffin Removal. Lysis and DNA Extraction Tube Scale
[1028] Sections from 17 different paraffin-embedded formalin-fixed
prostate specimens (P1, P2, P4, P5, P6, P7, P8, P9, P10, ST-268,
ST-269, ST-270, ST-271, ST-272, ST-274, ST-275, ST-276) were
processed according to Example 1a) (paraffin removal step), Example
1b) (lysis step) and Example 2c) (DNA extraction with QIAGEN.RTM.
DNEASY.RTM. tissue kit). Each sample consisted of 3 sections (10
pm). The concentration of amplifiable DNA after lysis and DNA
extraction was determined according to Example 10d (CFF1 assay),
respectively. The ratio of the quantified amplifiable DNA
concentration after the DNA extraction step and of the quantified
amplifiable DNA concentration after the lysis step reflects the
yield of the extraction procedure. The total amount of DNA
physically present in the extract was determined by UV
spectrophotometry (Example 10a). The content of amplifiable DNA in
the extracts is reflected by the ratio of quantified DNA according
to Example 10d and of the total amount of DNA determined by means
of UV spectrophotometry (Example 10a). Results are shown in Table
18 and FIGS. 13-17.
TABLE-US-00020 TABLE 18 Processing of 17 paraffin-embedded
formalin-fixed tissue specimens. Results of real time PCR based
(Example 10d) and UV spectrophotometry based (Example 10a)
quantification. Total Total DNA in DNA in lysate - extract - Total
DNA in CFF1 CFF1 extract - UV Content of assay assay Yield
quantification amplifiable sample [ng] [ng] [%] [ng] DNA [%] P1
179.73 77.29 43.00 4704 1.64 P2 4884.12 1961.33 40.16 9240 21.23 P4
2036.82 732.73 35.97 11460 6.39 P5 903.14 400.61 44.36 5520 7.26 P6
1750.69 491.23 28.06 6480 7.58 P7 3863.33 1176.92 30.46 12240 9.62
P8 957.18 542.60 56.69 9900 5.48 P9 715.74 561.57 78.46 6540 8.59
P10 946.06 417.50 44.13 9240 4.52 ST-268 4383.18 1639.30 37.40
24720 6.63 ST-269 7497.87 1593.21 21.25 36180 4.40 ST-270 9151.79
1081.93 11.82 13260 8.16 ST-271 5954.34 641.61 10.78 5148 12.46
ST-272 9897.51 3335.76 33.70 36960 9.03 ST-274 8230.91 1894.26
23.01 39180 4.83 ST-275 41461.29 11122.82 26.83 77400 14.37 ST-276
7272.27 2139.90 29.43 33600 6.37
Example 16
Processing According to Example 2 of 24 Paraffin-Embedded
Formalin-Fixed Samples Derived from Prostate or Breast Tissue, Tube
Scale
[1029] 24 paraffin-embedded formalin-fixed tissue specimens
(prostate: PET PI-P10 and ST-268-ST-276 and breast: PET B2-BIO)
were processed according to example 2. Two samples per specimen
were processed resulting in 48 samples in total. Each sample
consisted of 3 sections (each 10 pm) provided in 1.5 ml tubes. The
DNA after bisulfate treatment and subsequent purification was
characterized according to Example 10d (CFF1 assay; determination
of the amount of DNA converted by bisulfite treatment and of the
amount of DNA not converted by the bisulfite treatment and
therefore represents genomic DNA) and according to Example 10c (C3
assay; determination of only DNA converted by bisulfite treatment).
Results of these quantifications are shown in Table 19, in FIG. 18
and in FIG. 19, respectively.
TABLE-US-00021 TABLE 19 Processing of 24 paraffin-embedded
formalin-fixed tissue specimens. Results of C3 and CFF1 assay
quantification (Example 10c and 10d, respectively) and the ratio
thereof. All data are means of two independently processed samples
per specimen (Example 16). Yield of Yield of DNA - CFF1 Standard
DNA - C3 Standard Sample assay deviation assay deviation PET P1
31.51 5.35 26.85 3.73 PET P2 307.22 42.33 143.93 9.34 PET P4 167.69
23.03 103.21 2.18 PET P5 176.06 33.61 86.27 17.43 PET P6 598.59
37.35 358.71 28.01 PET P7 137.10 1.56 74.49 1.40 PET P8 511.88
79.05 219.63 25.52 PET P9 189.48 42.02 121.15 36.88 PET P10 158.89
4.36 83.30 8.25 PET B2 3.57 0.76 1.86 0.58 PET B5 1.88 0.03 0.83
0.67 PET B6 34.20 1.56 10.17 2.18 PET B7 48.11 15.50 21.81 5.51 PET
B9 9.34 0.05 2.51 0.40 PET B10 2.57 2.18 0.56 0.61 ST-268 301.94
83.41 171.65 26.14 ST-269 304.14 151.26 173.86 93.37 ST-270 106.51
25.52 0.29 0.21 ST-271 125.88 16.18 1.23 0.03 ST-272 1422.66
1959.30 597.51 841.84 ST-273 205.11 6.22 3.83 0.75 ST-274 521.57
3.11 271.13 13.07 ST-275 264.96 1.24 169.23 16.50 ST-276 547.98
59.13 289.39 38.90
Example 17
Processing of 24 Paraffin-Embedded Formalin-Fixed Samples Derived
from Prostate or Breast Tissue, Plate Scale
[1030] 24 paraffin-embedded formalin-fixed tissue specimens
(prostate: PET PI-P10 and ST-268-ST-276] and breast: PET B2-BIO)
were processed according to example 1. Four samples per specimen
were processed resulting in 96 samples in total. Each sample
consisted of 3 sections (10 pm each) provided in 1.5 ml tubes. The
resulting bisulfite treated and purified DNA was characterized
according to Example 10d (CFF1 assay; determination of the amount
of DNA converted by bisulfite treatment and of the amount of DNA
not converted by the bisulfite treatment and therefore represents
genomic DNA) and according to Example 10c (C3 assay; determination
of only DNA converted by bisulfite treatment). Results of these
quantifications are shown in Table 20, Figure and FIG. 21,
respectively.
TABLE-US-00022 TABLE 20 Processing of 24 paraffin-embedded
formalin-fixed tissue specimens. Results of C3 and CFF1 assay
quantification (Example 10c and 10d, respectively) and the ratio
thereof. All data are means of four independently processed samples
per specimen. Yield of Yield of DNA - CFF1 Standard DNA - C3
Standard Sample assay deviation assay deviation PET P1 71.03 3.65
85.42 7.50 PET P2 920.67 203.57 556.83 129.87 PET P4 311.33 41.97
173.67 36.73 PET P5 273.67 46.65 194.33 30.60 PET P6 263.33 31.26
181.50 17.29 PET P7 736.67 116.22 398.50 60.04 PET P8 411.00 29.14
225.83 23.96 PET P9 319.83 98.97 256.75 70.86 PET P10 230.00 44.73
139.50 15.17 PET B2 75.53 40.85 61.69 39.48 PET B5 2.72 1.99 2.19
1.87 PET B6 7.79 5.25 9.07 12.10 PET B7 10.27 6.96 9.40 5.90 PET B9
6.47 2.25 3.02 3.07 PET B10 42.92 24.85 15.53 9.48 ST-268 948.00
206.25 585.83 175.80 ST-269 969.00 135.27 515.83 92.15 ST-270
2973.33 363.52 1075.83 134.40 ST-271 2983.33 441.33 1054.17 207.50
ST-272 1641.67 307.50 980.83 227.73 ST-273 5263.33 848.62 2598.33
357.87 ST-274 479.67 47.60 259.58 70.33 ST-275 3856.67 896.37
1794.17 470.42 ST-276 871.67 220.93 320.08 94.72
Example 18
Processing of Samples Derived from 150 Paraffin-Embedded
Formalin-Fixed Breast Cancer Specimens
[1031] Samples of 150 paraffin-embedded formalin-fixed breast
cancer specimens (E001-E150) were processed according to Example 9.
Each sample consisted of 3 sections (10 pm each) which were
provided in 1.5 ml tubes. Yield of genomic DNA after extraction was
determined using UV spectrophotometry (Example 10a) and the CFF1
assay (Example 10d). The yield of bisulfite converted DNA after
bisulfite treatment and subsequent purification was determined
using the C3 assay (Example 10c).
TABLE-US-00023 TABLE 21 Yields of bisulfite converted and
non-bisulfite converted DNA derived from paraffin-embedded
formalin-fixed breast cancer specimens. DNA was quantified
according to Example 10d (CFF1 assay), according to Example 10c (C3
assay) and according to Example 10a (UV spectrophotometry). Total
Yield [ng] of Bisulfite Genomic Converted Genomic DNA DNA [ng] DNA
in 50 .mu.l [ng] Total in Total in Eluate after 70 .mu.l extract 70
.mu.l Extract Purification (based on UV (based (based on the
determination; CFF1 assay; C3 assay; Sample Example 10a) Example
10d) Example 10c) E001 13545.0 1812.0 1760.6 E002 6125.0 688.6
215.8 E003 5760.0 348.9 140.0 E004 20160.0 338.6 174.5 E005 6852.6
1017.9 514.2 E006 26460.0 11173.0 1541.6 E007 16905.0 8213.1 2410.4
E008 16012.5 9725.2 4452.0 E009 15866.7 8657.4 1749.4 E010 27195.0
14169.6 200.6 E011 7680.0 4115.0 1009.2 E012 16380.0 2102.2 1032.4
E013 1866.7 1962.8 1374.3 E014 15225.0 2430.8 1028.0 E015 13835.3
1779.8 857.2 E016 17684.2 1866.5 894.2 E017 10350.0 1240.1 240.1
E018 8085.0 1326.0 873.7 E019 16357.9 3256.2 1341.4 E020 21123.5
3401.2 1785.1 E021 10278.9 1395.2 1201.2 E022 20432.4 4540.2 2970.8
E023 22976.5 2506.7 1651.6 E024 5250.0 1691.7 1027.4 E025 24465.0
4408.7 2358.7 E026 17170.6 8749.5 3195.7 E027 17616.7 2819.4 1327.1
E028 4817.6 11498.9 4516.8 E029 30333.3 4922.3 2185.2 E030 16305.9
16442.2 6160.9 E031 7455.0 3703.1 1278.7 E032 10005.9 4757.4 2073.8
E033 9173.7 4922.1 1628.7 E034 8715.0 4010.9 1686.4 E035 10994.1
6841.9 1496.6 E036 10500.0 4358.7 2828.2 E037 20650.0 5711.1 4439.0
E038 30333.3 3311.1 2801.3 E039 9240.0 2956.5 2325.2 E040 6930.0
2261.9 981.5 E041 8505.0 446.5 387.1 E042 4550.0 789.6 669.6 E043
3315.8 779.7 425.8 E044 4095.0 845.1 489.5 E045 4089.5 795.8 531.4
E046 6052.9 107.2 164.8 E047 11200.0 200.1 113.4 E048 5682.4 149.7
248.8 E049 3990.0 76.3 35.9 E050 4531.6 235.4 85.7 E051 13042.1
6107.0 2887.2 E052 8295.0 3162.3 1063.5 E053 11235.0 4412.9 3815.7
E054 8866.7 3196.3 2329.3 E055 7245.0 2458.7 1452.5 E056 14595.0
3257.7 5484.6 E057 11970.0 3005.9 2533.5 E058 17047.1 3892.1 2368.3
E059 13094.1 6094.4 4047.3 E060 35870.3 2849.6 3108.8 E061 22750.0
715.8 440.5 E062 13920.0 840.0 340.1 E063 14452.9 3292.1 3313.1
E064 4095.0 761.4 510.1 E065 3705.9 2855.2 3153.8 E066 2625.0 244.7
11.2 E067 3383.3 417.2 362.6 E068 3088.2 718.6 321.9 E069 2216.7
118.0 17.3 E070 11520.0 214.8 71.5 E071 10623.5 1463.9 1361.2 E072
26950.0 2064.7 2121.6 E073 12723.5 2277.5 2169.1 E074 2333.3 3841.5
3249.4 E075 11488.2 1545.8 1235.2 E076 31360.0 14426.1 5108.5 E077
18060.0 8039.9 3387.0 E078 23415.0 14134.2 6859.3 E079 14000.0
10264.3 5371.6 E080 21735.0 9167.2 2812.9 E081 6883.3 31543.5
25884.0 E082 23730.0 12237.9 7183.1 E083 17541.2 7782.0 4135.6 E084
30836.8 19137.9 12754.5 E085 21466.7 13501.5 5589.2 E086 16026.3
3724.7 2177.5 E087 9173.7 1701.5 1091.9 E088 27176.5 3309.1 1072.5
E089 19950.0 3831.9 1739.0 E090 23566.7 3985.7 3139.2 E091 2594.1
5222.6 5906.1 E092 19600.0 2055.6 1131.1 E093 10500.0 2585.4 1223.6
E094 15093.8 4220.0 300.6 E095 9555.0 1630.1 840.0 E096 14700.0
2675.9 1076.2 E097 21525.0 4163.3 1840.9 E098 13416.7 4691.0 883.6
E099 13230.0 2024.5 1765.6 E100 12250.0 1903.4 852.3 E101 4725.0
4695.8 1007.1 E102 14910.0 6633.8 2066.2 E103 19841.4 10410.8
3738.5 E104 22283.3 10963.4 4059.1 E105 31994.1 15319.9 3397.5 E106
6930.0 968.2 511.4 E107 5526.3 616.5 261.6 E108 5968.4 875.8 175.0
E109 5906.3 753.1 234.5 E110 4830.0 782.8 594.2 E111 2625.0 4344.9
2081.4 E112 14880.0 4266.1 2366.6 E113 6090.0 2727.2 1636.4 E114
10710.0 4280.6 2824.6 E115 7665.0 3166.8 3354.9 E116 6176.5 342.0
64.5 E117 2216.7 385.3 146.0 E118 50770.6 486.5 104.3 E119 4935.0
439.2 406.8 E120 10266.7 929.9 516.2 E121 8925.0 2893.5 259.9 E122
13533.3 7499.9 3242.3 E123 49411.8 16014.1 8003.4 E124 19010.5
6660.4 4336.0 E125 10383.3 2631.8 1100.9 E126 23231.3 8386.5 3450.2
E127 8820.0 2078.4 2172.0 E128 2730.0 676.6 166.4 E129 32160.0
1465.8 606.5 E130 4083.3 Undetermined 1068.5 E131 3045.0 396.5
181.0 E132 3780.0 507.3 515.9 E133 7669.6 526.0 570.5 E134 6650.0
896.0 561.3 E135 6052.9 903.1 314.5 E136 22260.0 6770.9 2886.7 E137
19600.0 4402.2 1359.9 E138 8400.0 10852.0 4979.4 E139 19635.0
6613.7 4495.2 E140 27650.0 9160.8 6587.8 E141 26194.7 8656.0 4678.9
E142 4550.0 10660.7 3116.2 E143 26600.0 9404.2 2983.5 E144 33705.0
12358.5 4073.3 E145 10252.9 5114.6 2774.1 E146 31850.0 19365.9
5729.1 E147 24780.0 11532.6 6048.3 E148 21000.0 11540.2 4106.7 E149
2400.0 13681.8 6231.2 E150 29750.0 18923.4 3814.9
Example 19
Processing of Laser Capture Microdissected Cells
[1032] Laser capture microdissected cells from a paraffin-embedded
formalin-fixed breast cancer specimen was bisulfite treated.
Microdissection
[1033] The 10 .mu.m section which was mounted on a microscopic
slide was subjected to a methylene blue staining procedure and
subsequently laser capture microdissected. Microdissection was
carried out using a Microbeam instrument (P.A.L.M..RTM. Microlaser
Technologies AG, Bernried, Germany). Two areas of the section (each
comprising approximately 0.25 mm2) were microdissected and
collected in two 200 .mu.l tubes with adhesive caps (Adhesive Caps
200, P.A.L.M..RTM. Microlaser Technologies AG, Bernried, Germany).
Because of the microdissection no removal of paraffin is
necessary.
Lysis Step
[1034] Sample material stuck to the adhesive caps after
microdissection and was subjected to a lysis step. Therefore 20
.mu.l lysis buffer (50 mmol/l Tris-HCl, pH 8.0, 1 mmol/l EDTA, 0.5
v/v % Tween, 10 ng/.mu.l poly-dA, 3 mg/ml proteinase K) were
carefully added to the caps. Four control reactions were performed:
two negative controls with tubes containing no sample but lysis
buffer and two positive controls with tubes containing lysis buffer
and 500 pg human genomic DNA (Promega, USA) Tubes were closed
carefully avoiding a loosening of the drop from the cap. The tubes
were incubated 12 h at 60.degree. C. in a MASTERCYCLER.RTM. PCR
machine (EPPENDORF.RTM., Germany). Since the sample material was
located at the caps the lid of the MASTERCYCLER.RTM. was also set
to 60.degree. C. After incubation samples were centrifuged in a
table centrifuge for 30 s to transfer the lysed sample to the
bottom of the tube.
Bisulfite Treatment
[1035] After this, samples were subjected to bisulfite treatment as
follows. To dissolve any DNA which might remain at the cap, 19
.mu.l bisulfite solution (470.8 g/l sodium disulfite [Merck] and
112.8 g/l sodium sulfite [Fluka]) were added to the cap, tubes were
carefully closed and incubated for 5 min at room temperature.
Samples were now centrifuged for 30 s using a table centrifuge. The
last step (adding bisulfite solution to the cap, incubating and
centrifuging) was repeated once. 6 .mu.l DME solution were added to
each sample, the DME solution comprising a radical scavenger (125.3
g/16-hydroxy-2,5,7,8-tetramethyl-chroman-2-carboxylic acid) in DME
(diethylene-glycoldimethylether Merck]). The samples were incubated
under the following conditions: 5 min 99.degree. C., 22 min
60.degree. C., 3 min 99.degree. C., 97 min 60.degree. C., 3 min
99.degree. C. and 177 min 60.degree. C. Incubation was carried out
using a MASTERCYCLER.RTM. (EPPENDORF.RTM.).
DNA Purification
[1036] DNA purification after bisulfite treatment was carried out
by means of ZYMO-SPIN.TM. IC columns (Zymo Research, USA). 166
.mu.l AVL buffer (QIAGEN.RTM., Germany) were added to the
ZYMO-SPIN.TM. IC columns. Bisulfite reaction mix (64 .mu.l total
per sample) was added to the columns. The used pipette tips were
placed in the respective bisulfite reaction tubes for further usage
in order to avoid DNA loss due to drops sticking at the tips. 90
.mu.l of AVL buffer were added to the empty bisulfite reaction
tubes and afterward transferred to the ZYMO-SPIN.TM. IC columns
using the respective pipette tips which were previously placed in
the respective tubes. Bisulfite reaction mix and buffer AVL were
mixed in the columns by pipetting up and down several times and
incubated 10 min at room temperature. 250 .mu.l ethanol were added
to the columns and mixed with the pipette. Again, the same pipette
was used for mixing in order to avoid DNA loss due to drops
sticking at the tips as already explained above. Columns were
centrifuged 1 min at 16,000.times.g. Columns were transferred to a
new 2 ml collection tube and 500 .mu.l desulfonation buffer (0.2
mol/l NaOH, 90% v/v ethanol) was added to each column. Columns were
centrifuged 1 min at 16,000.times.g. Columns were transferred to a
new 2 ml collection tube and 500 .mu.l buffer AW1 (QIAGEN.RTM.,
Germany) was added to each column. Columns were centrifuged 1 min
at 16,000.times.g. Columns were transferred to a new 2 ml
collection tube and 500 .mu.l buffer AW2 (QIAGEN.RTM., Germany) was
added to each column. Columns were centrifuged 3 min at
16,000.times.g. Columns were placed in a 1.5 ml collection tube for
DNA elution. DNA was eluted by adding 12.5 .mu.l water (prewarmed
to 50.degree. C.) to the columns, incubating 1 min and centrifuging
1 min at 6,000.times.g. The elution step was repeated resulting in
approximately 20 .mu.l eluate total (5 .mu.l loss due to columns
geometry and evaporation).
Subsequent Analysis
[1037] Thereafter, DNA was ready for subsequent PCR applications,
for example real time PCR quantification, PCR and sequencing, etc.
The six processed reactions (two samples, two negative controls and
two positive controls) were subjected to HB14 real time PCR
quantification using the LIGHTCYCLER.TM. system (Roche, Germany)
according to Example 10b. Each quantification was performed in
duplicates (10 .mu.l input in PCR reaction each). Table 22 shows
the results of this quantification. The yield of DNA is in the
range of 66% to 80% (based on positive controls with known DNA
inputs). Samples resulted in 175 pg and 73 pg DNA, respectively
(Table 22).
TABLE-US-00024 TABLE 22 Yield of Bisulfite Converted DNA Derived
from Laser Capture Microdissected Cells and Controls. DNA in 1. PCR
DNA in 2. (10 .mu.l input) PCR (10 .mu.l DNA total in Sample [pg]
input) [pg] both PCR [pg] yield [%] positive 192 206 398 79.6
control 1 (500 pg DNA) positive 234 96.5 330.5 66.1 control 2 (500
pg DNA) negative 0 0 0 x control 1 (no DNA) negative 0 0 0 x
control 0 (no DNA) sample 1 96.1 78.6 174.7 x sample 2 7.5 65.1
72.6 x
Sequence CWU 1
1
72122DNAHomo Sapiens 1ggagggggta gagttattag tt 22222DNAHomo Sapiens
2tatacttcct caaacaaccc tc 22322DNAHomo Sapiens 3gtgatatttg
gggattgtta tt 22420DNAHomo Sapiens 4actccctccc ctatcttaca
20521DNAHomo Sapiens 5tttgttggga tttgttagga t 21622DNAHomo Sapiens
6aaacatttta cccctctaaa cc 22724DNAHomo Sapiens 7tgattgtgta
gattattttt ggtt 24823DNAHomo Sapiens 8caaactctct aaacctcaat ctc
23922DNAHomo Sapiens 9ttggtgatgt tgattagagt tt 221022DNAHomo
Sapiens 10taaaacacct tacattttcc ct 221122DNAHomo Sapiens
11ggtagaggaa gtagttggtt tg 221223DNAHomo Sapiens 12cttttatatt
tctcccaatc tcc 231321DNAHomo Sapiens 13gtaggggagg gaagtagatg t
211423DNAHomo Sapiens 14tcctcaactc tacaaaccta aaa
2315130DNAArtificial SequenceGSTP1-C3_bis-sequence_example_9.5.1.
15ggagtggagg aaattgagat ttattgaggt tacgtagttt gtttaaggtt aagtttgggt
60gtttgtaatt tttgttttgt gttaggttgt tttttaggtg ttaggtgagt tttgagtatt
120tgttgtgtgg 1301620DNAHomo Sapiens 16ggagtggagg aaattgagat
201722DNAHomo Sapiens 17ccacacaaca aatactcaaa ac 221833DNAHomo
Sapiens 18tgggtgtttg taatttttgt tttgtgttag gtt 331925DNAHomo
Sapiens 19tggtgatgga ggaggtttag taagt 252027DNAHomo Sapiens
20aaccaataaa acctactcct cccttaa 272130DNAHomo Sapiens 21ttgtgaattt
gtgtttgtta ttgtgtgttg 302230DNAHomo Sapiens 22tggtggttat tttttttatt
aggttgtggt 302320DNAHomo Sapiens 23ggagtggagg aaattgagat
202422DNAHomo Sapiens 24ccacacaaca aatactcaaa ac 222533DNAHomo
Sapiens 25tgggtgtttg taatttttgt tttgtgttag gtt 332625DNAHomo
Sapiens 26taagagtaat aatggatgga tgatg 252717DNAHomo Sapiens
27cctcccatct cccttcc 172825DNAHomo Sapiens 28atggatgaag aaagaaagga
tgagt 252925DNAHomo Sapiens 29tttttgtagt ttagaaggag gttag
253022DNAHomo Sapiens 30acacaataaa ttcaaccacc aa 223118DNAHomo
Sapiens 31gggagattta atttgggg 183220DNAHomo Sapiens 32caccctctaa
taaccaacca 203321DNAHomo Sapiens 33ttaggtataa gttggtggtg g
213420DNAHomo Sapiens 34cccataaaca acccctaaaa 203522DNAHomo Sapiens
35aggtatagga tggggaatta gt 223621DNAHomo Sapiens 36aacccaaacc
cttatacaaa c 213721DNAHomo Sapiens 37gtttttggag ttaattggga g
213820DNAHomo Sapiens 38cacccccatc attactattc 203918DNAHomo Sapiens
39agggtagagg gtgttggt 184021DNAHomo Sapiens 40ccaaaactat aaaccttccc
a 214122DNAHomo Sapiens 41tttagtatgg gttgagagga gt 224224DNAHomo
Sapiens 42cctctttcct aaaactacac attc 244322DNAHomo Sapiens
43ggattattgt tgggtatttg tt 224422DNAHomo Sapiens 44acacttccct
aaaatcttca aa 224522DNAHomo Sapiens 45gttggatttg tttagagaga gg
224623DNAHomo Sapiens 46acatttaact ctttatccca aaa 234722DNAHomo
Sapiens 47ttatttgatg gggatagaga tt 224821DNAHomo Sapiens
48acaaacaaca caccctcata c 214922DNAHomo Sapiens 49tgtaatgaaa
gaaggtgttg ag 225022DNAHomo Sapiens 50ttaactaaac catccataac cc
225123DNAHomo Sapiens 51ggattatagg aattagaatg ggt 235223DNAHomo
Sapiens 52tctttccaac tcaacatctt act 235320DNAHomo Sapiens
53tggtggtatg gattggataa 205422DNAHomo Sapiens 54tcccccaaat
aacacaatat ac 225523DNAHomo Sapiens 55agaggaaaga gtaaggaatt ttt
235618DNAHomo Sapiens 56cttatccccc acaaaacc 185719DNAHomo Sapiens
57ggtggaggga gagttaagg 195819DNAHomo Sapiens 58ccaacaaaac gccctctcc
195922DNAHomo Sapiens 59gattgagatt attttgggtt tt 226021DNAHomo
Sapiens 60acttaaacct tccctctcca c 216122DNAHomo Sapiens
61ttaagtattg gatttggggt ta 226224DNAHomo Sapiens 62acctaccctc
taactctaca aaaa 246324DNAHomo Sapiens 63agtaaatagt gggtgagtta tgaa
246424DNAHomo Sapiens 64aaaaacctct aaaaactact ctcc 246522DNAHomo
Sapiens 65aaggttttag ggaagagtgt tt 226623DNAHomo Sapiens
66accttttcct atcacaaaaa taa 236722DNAHomo Sapiens 67agggggaatt
aaatagaaag ag 226822DNAHomo Sapiens 68caataaaacc atcccaaata ct
226922DNAHomo Sapiens 69tatgggagga ggttagtaag tg 227022DNAHomo
Sapiens 70ccccaaatcc tacatataaa aa 227122DNAHomo Sapiens
71gtattatgtg gtttaaggag gg 227222DNAHomo Sapiens 72actccaaaca
aattcaacaa ct 22
* * * * *