U.S. patent application number 14/632455 was filed with the patent office on 2015-06-18 for polypeptides having cellulase activity and polynucleotides encoding same.
The applicant listed for this patent is Novozymes A/S. Invention is credited to Lars Anderson, Maria Lenor Quintais Cancela Da Fonseca, Ricardo Leite, Kirk Matthew Schnorr.
Application Number | 20150166971 14/632455 |
Document ID | / |
Family ID | 46640049 |
Filed Date | 2015-06-18 |
United States Patent
Application |
20150166971 |
Kind Code |
A1 |
Schnorr; Kirk Matthew ; et
al. |
June 18, 2015 |
Polypeptides Having Cellulase Activity and Polynucleotides Encoding
Same
Abstract
The present invention relates to isolated polypeptides having
cellulase activity. The invention also relates to nucleic acid
constructs, vectors, and host cells comprising the polynucleotides
as well as methods of producing and using the polypeptides.
Inventors: |
Schnorr; Kirk Matthew;
(Holte, DK) ; Anderson; Lars; (Malmoe, SE)
; Da Fonseca; Maria Lenor Quintais Cancela; (Faro,
PT) ; Leite; Ricardo; (Faro, PT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Novozymes A/S |
Bagsvaerd |
|
DK |
|
|
Family ID: |
46640049 |
Appl. No.: |
14/632455 |
Filed: |
February 26, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14236471 |
Jan 31, 2014 |
9000138 |
|
|
PCT/EP2012/065671 |
Aug 10, 2012 |
|
|
|
14632455 |
|
|
|
|
61524841 |
Aug 18, 2011 |
|
|
|
Current U.S.
Class: |
435/209 ;
435/252.31; 435/252.33; 435/252.34; 435/252.35; 435/254.11;
435/254.2; 435/254.21; 435/254.22; 435/254.23; 435/254.3;
435/254.4; 435/254.5; 435/254.6; 435/254.7; 435/254.8; 435/263;
435/320.1; 435/325; 435/348; 435/419; 536/23.2 |
Current CPC
Class: |
C12N 9/2437 20130101;
C11D 3/38645 20130101 |
International
Class: |
C12N 9/42 20060101
C12N009/42; C11D 3/386 20060101 C11D003/386 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 15, 2011 |
EP |
11177564.9 |
Claims
1-15. (canceled)
16. An isolated polypeptide having cellulase activity, selected
from the group consisting of: (a) a polypeptide having at least 60%
sequence identity to the mature polypeptide of SEQ ID NO:2; (b) a
polypeptide encoded by a polynucleotide that hybridizes under low
stringency conditions with the mature polypeptide coding sequence
of SEQ ID NO:1, or the full-length complement thereof; (c) a
polypeptide encoded by a polynucleotide having at least 60%
sequence identity to the mature polypeptide coding sequence of SEQ
ID NO:1 or the genomic DNA sequence thereof; or (d) a variant of
the mature polypeptide of SEQ ID NO:2 comprising a substitution,
deletion, and/or insertion at one or more (e.g., several)
positions; and (e) a fragment of the polypeptide of (a), (b) or (c)
that has cellulase activity.
17. A composition comprising the polypeptide of claim 16.
18. The composition of claim 17, which is a detergent
composition.
19. An isolated polynucleotide encoding the polypeptide of claim
16.
20. A nucleic acid construct or expression vector comprising the
polynucleotide of claim 19 operably linked to one or more control
sequences that direct the production of the polypeptide in an
expression host.
21. A recombinant host cell comprising the polynucleotide of claim
19 operably linked to one or more control sequences that direct the
production of the polypeptide.
22. A method of producing a polypeptide having cellulase activity,
comprising: (a) cultivating the host cell of claim 21 under
conditions conducive for production of the polypeptide; and (b)
recovering the polypeptide.
23. A method of cleaning a fabric, comprising treating the fabric
with a polypeptide of claim 16 in a wash liquor.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 14/236,471 filed on Jan. 31, 2014, now pending, which is a 35
U.S.C. 371 national application of PCT/EP2012/065671 filed Aug. 10,
2012, which claims priority or the benefit under 35 U.S.C. 119 of
European application no. 11177564.9 filed Aug. 15, 2011 and U.S.
provisional application No. 61/524,841 filed Aug. 18, 2011. The
content of each application is fully incorporated herein by
reference.
REFERENCE TO A SEQUENCE LISTING
[0002] This application contains a Sequence Listing in computer
readable form, which is incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates to polypeptides having
cellulase activity and polynucleotides encoding the polypeptides.
The invention also relates to nucleic acid constructs, vectors, and
host cells comprising the polynucleotides as well as methods of
producing and using the polypeptides.
[0005] 2. Description of the Related Art
[0006] Terebella lapidaria (Linaeus, 1767) is a polychaete living
only in marine environments. Specimens are typically 3-9 cm in
length and 4-5 mm in diameter.
[0007] T. lapidaria are tube builders that cement sand particles
together into a tube habitat. They scavenge organic material, algae
and or small animals with their numerous grooved palps. Terebella
lapidaria is a marine specie with a wide ecologic distribution,
that can be found in the intertidal and subtidal in up to 30-40 m
depth, both in mobile substrates such as sand, muddy sand and mud
but can also be found on rigid substrates such as rock strata.
[0008] Like many sand and detritus eating polychaetes, Terebella
has a powerful digestive biosurfactant system and enzymes produced
by the digestive system have obviously evolved to work efficiently
in surfactant environments at or around neutral pH.
[0009] The present invention provides polypeptides having cellulase
activity and polynucleotides encoding the polypeptides.
SUMMARY OF THE INVENTION
[0010] The present invention relates to isolated polypeptides
having cellulase activity selected from the group consisting
of:
[0011] (a) a polypeptide having at least 60% sequence identity to
the mature polypeptide of SEQ ID NO:2;
[0012] (b) a polypeptide encoded by a polynucleotide that
hybridizes under medium stringency conditions with (i) the mature
polypeptide coding sequence of SEQ ID NO:1, (ii) the genomic DNA
sequence thereof, or (iii) the full-length complement of (i) or
(ii);
[0013] (c) a polypeptide encoded by a polynucleotide having at
least 60% sequence identity to the mature polypeptide coding
sequence of SEQ ID NO:1 or the genomic DNA sequence thereof;
[0014] (d) a variant of the mature polypeptide of SEQ ID NO:2
comprising a substitution, deletion, and/or insertion at one or
more (e.g., several) positions; and
[0015] (e) a fragment of the polypeptide of (a), (b), (c) or (d)
that has cellulase activity.
[0016] The present invention also relates to isolated polypeptides
comprising a GH9 catalytic domain selected from the group
consisting of:
[0017] (a) a catalytic domain having at least 60% sequence identity
to amino acids 1 to 428 of SEQ ID NO:2;
[0018] (b) a catalytic domain encoded by a polynucleotide that
hybridizes under medium stringency conditions with (i) nucleotides
12 to 1295 of SEQ ID NO:1, (ii) the genomic DNA sequence thereof,
or (iii) the full-length complement of (i) or (ii);
[0019] (c) a catalytic domain encoded by a polynucleotide having at
least 60% sequence identity to nucleotides 12 to 1295 of SEQ ID
NO:1 or the genomic DNA sequence thereof;
[0020] (d) a variant of amino acids 1 to 428 of SEQ ID NO:2
comprising a substitution, deletion, and/or insertion at one or
more (e.g., several) positions; and
[0021] (e) a fragment of the GH9 catalytic domain of (a), (b), (c)
or (d) that has cellulase activity.
[0022] The present invention also relates to isolated
polynucleotides encoding the polypeptides of the present invention;
nucleic acid constructs; recombinant expression vectors;
recombinant host cells comprising the polynucleotides; and methods
of producing the polypeptides.
[0023] The present invention also relates to compositions
comprising the cellulose of the invention, in particular detergent
compositions, and compositions for textile treatment and for pulp
and paper treatment.
BRIEF DESCRIPTION OF THE FIGURES
[0024] FIG. 1 shows the pH optimum for the cellulase, determined
using PASC with a reducing sugar assay. The enzyme displayed a
broad pH optimum and the optimal pH for this enzyme was 6. The
activity was above 80% max activity from pH 6 to 9. Diamonds,
PASC+Enzyme; Triangles, PASC-Enzyme.
[0025] FIG. 2 shows the temperature profile for Terebella lapidaria
determined on 0.2% AZCL-HE-Cellulose in 0.1 M Na-phosphate, pH
7.
[0026] FIG. 3 shows the wash performance of the Terebella
cellulase, column marked U33M5, compared with two commercial
products, Endolase and Whitezyme.
DEFINITIONS
[0027] Cellulase: The term "cellulase" means an endo
.beta.-1,4-glucanase activity (EC 3.2.1.4.) that catalyzes the
hydrolyses of a .beta.-1,4-binding connecting two glucosyl residues
in a .beta.-1,4-glucan. For purposes of the present invention,
cellulase activity is determined according to the procedure
described in the Examples.
[0028] The polypeptides of the present invention have at least 20%,
e.g., at least 40%, at least 50%, at least 60%, at least 70%, at
least 80%, at least 90%, at least 95%, or at least 100% of the
cellulase activity of the mature polypeptide of SEQ ID NO:2.
[0029] Endoglucanase: The term "endoglucanase" means an
endo-1,4-(1,3;1,4)-beta-D-glucan 4-glucanohydrolase (E.C. 3.2.1.4),
which catalyses endohydrolysis of 1,4-beta-D-glycosidic linkages in
cellulose, cellulose derivatives (such as carboxymethyl cellulose
and hydroxyethyl cellulose), lichenin, beta-1,4 bonds in mixed
beta-1,3 glucans such as cereal beta-D-glucans or xyloglucans, and
other plant material containing cellulosic components.
Endoglucanase activity can be determined by measuring reduction in
substrate viscosity or increase in reducing ends determined by a
reducing sugar assay (Zhang et al., 2006, Biotechnology Advances
24: 452-481). For purposes of the present invention, endoglucanase
activity is determined using carboxymethyl cellulose (CMC) as
substrate according to the procedure of Ghose, 1987, Pure and Appl.
Chem. 59: 257-268, at pH 5, 40.degree. C.
[0030] Allelic variant: The term "allelic variant" means any of two
or more alternative forms of a gene occupying the same chromosomal
locus. Allelic variation arises naturally through mutation, and may
result in polymorphism within populations. Gene mutations can be
silent (no change in the encoded polypeptide) or may encode
polypeptides having altered amino acid sequences. An allelic
variant of a polypeptide is a polypeptide encoded by an allelic
variant of a gene.
[0031] Binding domain: The term "cellulose binding domain" means
the region of an enzyme that mediates binding of the enzyme to
amorphous regions of a cellulose substrate. The cellulose binding
domain (CBD) is typically found either at the N-terminal or at the
C-terminal extremity of an endo-glucanase.
[0032] Catalytic domain: The term "catalytic domain" means the
region of an enzyme containing the catalytic machinery of the
enzyme.
[0033] cDNA: The term "cDNA" means a DNA molecule that can be
prepared by reverse transcription from a mature, spliced, mRNA
molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks
intron sequences that may be present in the corresponding genomic
DNA. The initial, primary RNA transcript is a precursor to mRNA
that is processed through a series of steps, including splicing,
before appearing as mature spliced mRNA.
[0034] Coding sequence: The term "coding sequence" means a
polynucleotide, which directly specifies the amino acid sequence of
a polypeptide. The boundaries of the coding sequence are generally
determined by an open reading frame, which begins with a start
codon such as ATG, GTG, or TTG and ends with a stop codon such as
TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA,
synthetic DNA, or a combination thereof.
[0035] Control sequences: The term "control sequences" means
nucleic acid sequences necessary for expression of a polynucleotide
encoding a mature polypeptide of the present invention. Each
control sequence may be native (i.e., from the same gene) or
foreign (i.e., from a different gene) to the polynucleotide
encoding the polypeptide or native or foreign to each other. Such
control sequences include, but are not limited to, a leader,
polyadenylation sequence, propeptide sequence, promoter, signal
peptide sequence, and transcription terminator. At a minimum, the
control sequences include a promoter, and transcriptional and
translational stop signals. The control sequences may be provided
with linkers for the purpose of introducing specific restriction
sites facilitating ligation of the control sequences with the
coding region of the polynucleotide encoding a polypeptide.
[0036] Expression: The term "expression" includes any step involved
in the production of a polypeptide including, but not limited to,
transcription, post-transcriptional modification, translation,
post-translational modification, and secretion.
[0037] Expression vector: The term "expression vector" means a
linear or circular DNA molecule that comprises a polynucleotide
encoding a polypeptide and is operably linked to control sequences
that provide for its expression.
[0038] Fragment: The term "fragment" means a polypeptide or a
catalytic domain having one or more (e.g., several) amino acids
deleted from the amino and/or carboxyl terminus of a mature
polypeptide or domain; wherein the fragment has cellulase activity.
In one aspect, a fragment contains at least 300 amino acid residues
such as the fragment containing amino acids 3-428 of SEQ ID NO:
2.
[0039] High stringency conditions: The term "high stringency
conditions" means for probes of at least 100 nucleotides in length,
prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured
salmon sperm DNA, and 50% formamide, following standard Southern
blotting procedures for 12 to 24 hours. The carrier material is
finally washed three times each for 15 minutes using 2.times.SSC,
0.2% SDS at 65.degree. C.
[0040] Host cell: The term "host cell" means any cell type that is
susceptible to transformation, transfection, transduction, or the
like with a nucleic acid construct or expression vector comprising
a polynucleotide of the present invention. The term "host cell"
encompasses any progeny of a parent cell that is not identical to
the parent cell due to mutations that occur during replication.
[0041] Isolated: The term "isolated" means a substance in a form or
environment that does not occur in nature. Non-limiting examples of
isolated substances include (1) any non-naturally occurring
substance, (2) any substance including, but not limited to, any
enzyme, variant, nucleic acid, protein, peptide or cofactor, that
is at least partially removed from one or more or all of the
naturally occurring constituents with which it is associated in
nature; (3) any substance modified by the hand of man relative to
that substance found in nature; or (4) any substance modified by
increasing the amount of the substance relative to other components
with which it is naturally associated (e.g., multiple copies of a
gene encoding the substance; use of a stronger promoter than the
promoter naturally associated with the gene encoding the
substance). An isolated substance may be present in a fermentation
broth sample.
[0042] Low stringency conditions: The term "low stringency
conditions" means for probes of at least 100 nucleotides in length,
prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured
salmon sperm DNA, and 25% formamide, following standard Southern
blotting procedures for 12 to 24 hours. The carrier material is
finally washed three times each for 15 minutes using 2.times.SSC,
0.2% SDS at 50.degree. C.
[0043] Mature polypeptide: The term "mature polypeptide" means a
polypeptide in its final form following translation and any
post-translational modifications, such as N-terminal processing,
C-terminal truncation, glycosylation, phosphorylation, etc. In one
aspect, the mature polypeptide is amino acids 1 to 428 of SEQ ID
NO:2. It is known in the art that a host cell may produce a mixture
of two of more different mature polypeptides (i.e., with a
different C-terminal and/or N-terminal amino acid) expressed by the
same polynucleotide.
[0044] Mature polypeptide coding sequence: The term "mature
polypeptide coding sequence" means a polynucleotide that encodes a
mature polypeptide having cellulase activity. In one aspect, the
mature polypeptide coding sequence is nucleotides 12 to 1295 of SEQ
ID NO:1 or the genomic DNA sequence thereof.
[0045] Medium stringency conditions: The term "medium stringency
conditions" means for probes of at least 100 nucleotides in length,
prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured
salmon sperm DNA, and 35% formamide, following standard Southern
blotting procedures for 12 to 24 hours. The carrier material is
finally washed three times each for 15 minutes using 2.times.SSC,
0.2% SDS at 55.degree. C.
[0046] Medium-high stringency conditions: The term "medium-high
stringency conditions" means for probes of at least 100 nucleotides
in length, prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured
salmon sperm DNA, and either 35% formamide, following standard
Southern blotting procedures for 12 to 24 hours. The carrier
material is finally washed three times each for 15 minutes using
2.times.SSC, 0.2% SDS at 60.degree. C.
[0047] Nucleic acid construct: The term "nucleic acid construct"
means a nucleic acid molecule, either single- or double-stranded,
which is isolated from a naturally occurring gene or is modified to
contain segments of nucleic acids in a manner that would not
otherwise exist in nature or which is synthetic, which comprises
one or more control sequences.
[0048] Operably linked: The term "operably linked" means a
configuration in which a control sequence is placed at an
appropriate position relative to the coding sequence of a
polynucleotide such that the control sequence directs the
expression of the coding sequence.
[0049] Purified: The term "purified" means a polypeptide or
polynucleotide that is removed from at least one component with
which it is naturally associated. For example, a polypeptide may be
at least 1% pure, e.g., at least 5% pure, at least 10% pure, at
least 20% pure, at least 40% pure, at least 60% pure, at least 80%
pure, at least 90% pure, or at least 95% pure, as determined by
SDS-PAGE, and a polynucleotide may be at least 1% pure, e.g., at
least 5% pure, at least 10% pure, at least 20% pure, at least 40%
pure, at least 60% pure, at least 80% pure, at least 90% pure, or
at least 95% pure, as determined by agarose electrophoresis.
[0050] Sequence identity: The relatedness between two amino acid
sequences or between two nucleotide sequences is described by the
parameter "sequence identity".
[0051] For purposes of the present invention, the sequence identity
between two amino acid sequences is determined using the
Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol.
Biol. 48: 443-453) for example as implemented in the Needle program
of the EMBOSS package (EMBOSS: The European Molecular Biology Open
Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277),
preferably version 5.0.0 or later. The parameters used are gap open
penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62
(EMBOSS version of BLOSUM62) substitution matrix. The output of
Needle labeled "longest identity" (obtained using the -nobrief
option) is used as the percent identity and is calculated as
follows:
(Identical Residues.times.100)/(Length of Alignment-Total Number of
Gaps in Alignment)
[0052] For purposes of the present invention, the sequence identity
between two deoxyribonucleotide sequences is determined using the
Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as
implemented in the Needle program of the EMBOSS package (EMBOSS:
The European Molecular Biology Open Software Suite, Rice et al.,
2000, supra), preferably version 5.0.0 or later. The parameters
used are gap open penalty of 10, gap extension penalty of 0.5, and
the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.
The output of Needle labeled "longest identity" (obtained using the
-nobrief option) is used as the percent identity and is calculated
as follows:
(Identical Deoxyribonucleotides.times.100)/(Length of
Alignment-Total Number of Gaps in Alignment)
[0053] Subsequence: The term "subsequence" means a polynucleotide
having one or more (e.g., several) nucleotides deleted from the 5'
and/or 3' end of a mature polypeptide coding sequence; wherein the
subsequence encodes a fragment having cellulase activity. In one
aspect, a subsequence contains at least 900 nucleotides (e.g.,
nucleotides 9 to 1293 of SEQ ID NO:1.
[0054] Variant: The term "variant" means a polypeptide having
cellulase activity comprising an alteration, i.e., a substitution,
insertion, and/or deletion of one or more (e.g., several) amino
acid residues at one or more positions. A substitution means a
replacement of the amino acid occupying a position with a different
amino acid; a deletion means removal of the amino acid occupying a
position; and an insertion means adding an amino acid adjacent to
the amino acid occupying a position.
[0055] Very high stringency conditions: The term "very high
stringency conditions" means for probes of at least 100 nucleotides
in length, prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured
salmon sperm DNA, and 50% formamide, following standard Southern
blotting procedures for 12 to 24 hours. The carrier material is
finally washed three times each for 15 minutes using 2.times.SSC,
0.2% SDS at 70.degree. C.
[0056] Very low stringency conditions: The term "very low
stringency conditions" means for probes of at least 100 nucleotides
in length, prehybridization and hybridization at 42.degree. C. in
5.times.SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured
salmon sperm DNA, and 25% formamide, following standard Southern
blotting procedures for 12 to 24 hours. The carrier material is
finally washed three times each for 15 minutes using 2.times.SSC,
0.2% SDS at 45.degree. C.
DETAILED DESCRIPTION OF THE INVENTION
Polypeptides Having Cellulase Activity
[0057] In an embodiment, the present invention relates to isolated
polypeptides having a sequence identity to the mature polypeptide
of SEQ ID NO:2 of at least 60%, e.g., at least 65%, at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at
least 96%, at least 97%, at least 98%, at least 99%, or 100%, which
have cellulase activity. In one aspect, the polypeptides differ by
no more than ten amino acids, e.g., nine amino acids, eight amino
acids, seven amino acids, six amino acids, five amino acids, four
amino acids, three amino acids, two amino acids, or one amino acid
from the mature polypeptide of SEQ ID NO:2.
[0058] A polypeptide of the present invention preferably comprises
or consists of the amino acid sequence of SEQ ID NO:2 or an allelic
variant thereof; or is a fragment thereof having cellulase
activity. In another aspect, the polypeptide comprises or consists
of the mature polypeptide of SEQ ID NO:2. In another preferred
aspect, the polypeptide comprises or consists of amino acids 1 to
428 of SEQ ID NO:2.
[0059] In another embodiment, the present invention relates to
isolated polypeptides having cellulase activity that are encoded by
a polynucleotide that hybridizes under very low stringency
conditions, low stringency conditions, medium stringency
conditions, medium-high stringency conditions, high stringency
conditions, or very high stringency conditions with (i) the mature
polypeptide coding sequence of SEQ ID NO:1, (ii) the genomic DNA
sequence thereof, or (iii) the full-length complement of (i) or
(ii) (Sambrook et al., 1989, Molecular Cloning, A Laboratory
Manual, 2d edition, Cold Spring Harbor, N.Y.).
[0060] The polynucleotide of SEQ ID NO:1 or a subsequence thereof,
as well as the polypeptide of SEQ ID NO:2 or a fragment thereof,
may be used to design nucleic acid probes to identify and clone DNA
encoding polypeptides having cellulose activity from strains of
different genera or species according to methods well known in the
art. In particular, such probes can be used for hybridization with
the genomic DNA or cDNA of a cell of interest, following standard
Southern blotting procedures, in order to identify and isolate the
corresponding gene therein. Such probes can be considerably shorter
than the entire sequence, but should be at least 15, e.g., at least
25, at least 35, or at least 70 nucleotides in length. Preferably,
the nucleic acid probe is at least 100 nucleotides in length, e.g.,
at least 200 nucleotides, at least 300 nucleotides, at least 400
nucleotides, at least 500 nucleotides, at least 600 nucleotides, at
least 700 nucleotides, at least 800 nucleotides, or at least 900
nucleotides in length. Both DNA and RNA probes can be used. The
probes are typically labeled for detecting the corresponding gene
(for example, with .sup.32P, .sup.3H, .sup.35S, biotin, or avidin).
Such probes are encompassed by the present invention.
[0061] A genomic DNA or cDNA library prepared from such other
strains may be screened for DNA that hybridizes with the probes
described above and encodes a polypeptide having cellulase
activity. Genomic or other DNA from such other strains may be
separated by agarose or polyacrylamide gel electrophoresis, or
other separation techniques. DNA from the libraries or the
separated DNA may be transferred to and immobilized on
nitrocellulose or other suitable carrier material. In order to
identify a clone or DNA that is homologous with SEQ ID NO:1 or a
subsequence thereof, the carrier material is preferably used in a
Southern blot.
[0062] For purposes of the present invention, hybridization
indicates that the polynucleotide hybridizes to a labeled nucleic
acid probe corresponding to (i) SEQ ID NO:1; (ii) the mature
polypeptide coding sequence of SEQ ID NO:1; (iii) or the genomic
DNA sequence thereof; (iv) the full-length complement thereof; or
(v) a subsequence thereof; under very low to very high stringency
conditions. Molecules to which the nucleic acid probe hybridizes
under these conditions can be detected using, for example, X-ray
film.
[0063] In one aspect, the nucleic acid probe is nucleotides 12 to
1295 of SEQ ID NO:1. In another aspect, the nucleic acid probe is a
polynucleotide that encodes the polypeptide of SEQ ID NO:2; the
mature polypeptide thereof; or a fragment thereof. In another
aspect, the nucleic acid probe is SEQ ID NO:1 or the genomic
sequence thereof.
[0064] For probes of at least 100 nucleotides in length, very low
stringency conditions are defined as prehybridization and
hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200
micrograms/ml sheared and denatured salmon sperm DNA, and 25%
formamide, following standard Southern blotting procedures for 12
to 24 hours optimally. The carrier material is finally washed three
times each for 15 minutes using 2.times.SSC, 0.2% SDS at 45.degree.
C.
[0065] For probes of at least 100 nucleotides in length, low
stringency conditions are defined as prehybridization and
hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200
micrograms/ml sheared and denatured salmon sperm DNA, and 25%
formamide, following standard Southern blotting procedures for 12
to 24 hours optimally. The carrier material is finally washed three
times each for 15 minutes using 2.times.SSC, 0.2% SDS at 50.degree.
C.
[0066] For probes of at least 100 nucleotides in length, medium
stringency conditions are defined as prehybridization and
hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200
micrograms/ml sheared and denatured salmon sperm DNA, and 35%
formamide, following standard Southern blotting procedures for 12
to 24 hours optimally. The carrier material is finally washed three
times each for 15 minutes using 2.times.SSC, 0.2% SDS at 55.degree.
C.
[0067] For probes of at least 100 nucleotides in length,
medium-high stringency conditions are defined as prehybridization
and hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200
micrograms/ml sheared and denatured salmon sperm DNA, and either
35% formamide, following standard Southern blotting procedures for
12 to 24 hours optimally. The carrier material is finally washed
three times each for 15 minutes using 2.times.SSC, 0.2% SDS at
60.degree. C.
[0068] For probes of at least 100 nucleotides in length, high
stringency conditions are defined as prehybridization and
hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200
micrograms/ml sheared and denatured salmon sperm DNA, and 50%
formamide, following standard Southern blotting procedures for 12
to 24 hours optimally. The carrier material is finally washed three
times each for 15 minutes using 2.times.SSC, 0.2% SDS at 65.degree.
C.
[0069] For probes of at least 100 nucleotides in length, very high
stringency conditions are defined as prehybridization and
hybridization at 42.degree. C. in 5.times.SSPE, 0.3% SDS, 200
micrograms/ml sheared and denatured salmon sperm DNA, and 50%
formamide, following standard Southern blotting procedures for 12
to 24 hours optimally. The carrier material is finally washed three
times each for 15 minutes using 2.times.SSC, 0.2% SDS at 70.degree.
C.
[0070] In another embodiment, the present invention relates to
isolated polypeptides having cellulase activity encoded by
polynucleotides having a sequence identity to the mature
polypeptide coding sequence of SEQ ID NO:1 or the genomic DNA
sequence thereof of at least 60%, e.g., at least 65%, at least 70%,
at least 75%, at least 80%, at least 85%, at least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at
least 96%, at least 97%, at least 98%, at least 99%, or 100%.
[0071] In another embodiment, the present invention relates to
variants of the mature polypeptide of SEQ ID NO:2 comprising a
substitution, deletion, and/or insertion at one or more (e.g.,
several) positions. Preferably, amino acid changes are of a minor
nature, that is conservative amino acid substitutions or insertions
that do not significantly affect the folding and/or activity of the
protein; small deletions, typically of one to about 30 amino acids;
small amino- or carboxyl-terminal extensions, such as an
amino-terminal methionine residue; a small linker peptide of up to
about 20-25 residues; or a small extension that facilitates
purification by changing net charge or another function, such as a
poly-histidine tract, an antigenic epitope or a binding domain.
[0072] Examples of conservative substitutions are within the groups
of basic amino acids (arginine, lysine and histidine), acidic amino
acids (glutamic acid and aspartic acid), polar amino acids
(glutamine and asparagine), hydrophobic amino acids (leucine,
isoleucine and valine), aromatic amino acids (phenylalanine,
tryptophan and tyrosine), and small amino acids (glycine, alanine,
serine, threonine and methionine). Amino acid substitutions that do
not generally alter specific activity are known in the art and are
described, for example, by H. Neurath and R. L. Hill, 1979, In, The
Proteins, Academic Press, New York. Common substitutions are
Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn,
Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile,
Leu/Val, Ala/Glu, and Asp/Gly.
[0073] Alternatively, the amino acid changes are of such a nature
that the physico-chemical properties of the polypeptides are
altered. For example, amino acid changes may improve the thermal
stability of the polypeptide, alter the substrate specificity,
change the pH optimum, and the like.
[0074] Essential amino acids in a polypeptide can be identified
according to procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells,
1989, Science 244: 1081-1085). In the latter technique, single
alanine mutations are introduced at every residue in the molecule,
and the resultant mutant molecules are tested for cellulase
activity to identify amino acid residues that are critical to the
activity of the molecule. See also, Hilton et al., 1996, J. Biol.
Chem. 271: 4699-4708. The active site of the enzyme or other
biological interaction can also be determined by physical analysis
of structure, as determined by such techniques as nuclear magnetic
resonance, crystallography, electron diffraction, or photoaffinity
labeling, in conjunction with mutation of putative contact site
amino acids. See, for example, de Vos et al., 1992, Science 255:
306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver
et al., 1992, FEBS Lett. 309: 59-64. The identity of essential
amino acids can also be inferred from an alignment with a related
polypeptide.
[0075] Essential amino acids in the sequence of amino acids 1 to
428 of SEQ ID NO: 2 are located in positions Asp56, Asp69 and
Glu216. Consequently these positions should not be substituted or
deleted.
[0076] Single or multiple amino acid substitutions, deletions,
and/or insertions can be made and tested using known methods of
mutagenesis, recombination, and/or shuffling, followed by a
relevant screening procedure, such as those disclosed by
Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and
Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413;
or WO 95/22625. Other methods that can be used include error-prone
PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30:
10832-10837; U.S. Pat. No. 5,223,409; WO 92/06204), and
region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145;
Ner et al., 1988, DNA 7: 127).
[0077] Mutagenesis/shuffling methods can be combined with
high-throughput, automated screening methods to detect activity of
cloned, mutagenized polypeptides expressed by host cells (Ness et
al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA
molecules that encode active polypeptides can be recovered from the
host cells and rapidly sequenced using standard methods in the art.
These methods allow the rapid determination of the importance of
individual amino acid residues in a polypeptide.
[0078] In an embodiment, the number of amino acid substitutions,
deletions and/or insertions introduced into the mature polypeptide
of SEQ ID NO:2 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8 or
9.
[0079] The polypeptide may be a hybrid polypeptide in which a
region of one polypeptide is fused at the N-terminus or the
C-terminus of a region of another polypeptide.
[0080] The polypeptide may be a fusion polypeptide or cleavable
fusion polypeptide in which another polypeptide is fused at the
N-terminus or the C-terminus of the polypeptide of the present
invention. A fusion polypeptide is produced by fusing a
polynucleotide encoding another polypeptide to a polynucleotide of
the present invention. Techniques for producing fusion polypeptides
are known in the art, and include ligating the coding sequences
encoding the polypeptides so that they are in frame and that
expression of the fusion polypeptide is under control of the same
promoter(s) and terminator. Fusion polypeptides may also be
constructed using intein technology in which fusion polypeptides
are created post-translationally (Cooper et al., 1993, EMBO J. 12:
2575-2583; Dawson et al., 1994, Science 266: 776-779).
[0081] A fusion polypeptide can further comprise a cleavage site
between the two polypeptides. Upon secretion of the fusion protein,
the site is cleaved releasing the two polypeptides. Examples of
cleavage sites include, but are not limited to, the sites disclosed
in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576;
Svetina et al., 2000, J. Biotechnol. 76: 245-251; Rasmussen-Wilson
et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al.,
1995, Biotechnology 13: 498-503; and Contreras et al., 1991,
Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25:
505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987;
Carter et al., 1989, Proteins: Structure, Function, and Genetics 6:
240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.
Sources of Polypeptides Having Cellulase Activity
[0082] A polypeptide having cellulase activity of the present
invention may be obtained from microorganisms of any genus. For
purposes of the present invention, the term "obtained from" as used
herein in connection with a given source shall mean that the
polypeptide encoded by a polynucleotide is produced by the source
or by a strain in which the polynucleotide from the source has been
inserted. In one aspect, the polypeptide obtained from a given
source is secreted extracellularly.
[0083] The polypeptide may be a bacterial polypeptide. For example,
the polypeptide may be a Gram-positive bacterial polypeptide such
as a Bacillus, Clostridium, Enterococcus, Geobacillus,
Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus,
Streptococcus, or Streptomyces polypeptide having cellulase
activity, or a Gram-negative bacterial polypeptide such as a
Campylobacter, E. coli, Flavobacterium, Fusobacterium,
Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella, or
Ureaplasma polypeptide.
[0084] In one aspect, the polypeptide is a Bacillus alkalophilus,
Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans,
Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus
lautus, Bacillus lentus, Bacillus licheniformis, Bacillus
megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus
subtilis, or Bacillus thuringiensis polypeptide.
[0085] In another aspect, the polypeptide is a Streptococcus
equisimilis, Streptococcus pyogenes, Streptococcus uberis, or
Streptococcus equi subsp. Zooepidemicus polypeptide.
[0086] In another aspect, the polypeptide is a Streptomyces
achromogenes, Streptomyces avermitilis, Streptomyces coelicolor,
Streptomyces griseus, or Streptomyces lividans polypeptide.
[0087] The polypeptide may also be a fungal polypeptide. For
example, the polypeptide may be a yeast polypeptide such as a
Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces,
or Yarrowia polypeptide; or a filamentous fungal polypeptide such
as an Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium,
Botryosphaeria, Ceriporiopsis, Chaetomidium, Chrysosporium,
Claviceps, Cochliobolus, Coprinopsis, Coptotermes, Corynascus,
Cryphonectria, Cryptococcus, Diplodia, Exidia, Filibasidium,
Fusarium, Gibberella, Holomastigotoides, Humicola, Irpex,
Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus,
Mucor, Myceliophthora, Neocaffimastix, Neurospora, Paecilomyces,
Penicillium, Phanerochaete, Piromyces, Poitrasia, Pseudoplectania,
Pseudotrichonympha, Rhizomucor, Schizophyllum, Scytalidium,
Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma,
Trichophaea, Verticillium, Volvariella, or Xylaria polypeptide.
[0088] In another aspect, the polypeptide is a Saccharomyces
carlsbergensis, Saccharomyces cerevisiae, Saccharomyces
diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri,
Saccharomyces norbensis, or Saccharomyces oviformis
polypeptide.
[0089] In another aspect, the polypeptide is an Acremonium
cellulolyticus, Aspergillus aculeatus, Aspergillus awamori,
Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus,
Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae,
Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium
lucknowense, Chrysosporium merdarium, Chrysosporium pannicola,
Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium
zonatum, Fusarium bactridioides, Fusarium cerealis, Fusarium
crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium
graminum, Fusarium heterosporum, Fusarium negundi, Fusarium
oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium
sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides,
Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides,
Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola
lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora
thermophila, Neurospora crassa, Penicillium funiculosum,
Penicillium purpurogenum, Phanerochaete chrysosporium, Thielavia
achromatica, Thielavia albomyces, Thielavia albopilosa, Thielavia
australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia
ovispora, Thielavia peruviana, Thielavia setosa, Thielavia
spededonium, Thielavia subthermophila, Thielavia terrestris,
Trichoderma harzianum, Trichoderma koningii, Trichoderma
longibrachiatum, Trichoderma reesei, or Trichoderma viride
polypeptide.
[0090] In other aspects the polypeptide is derived from a marine
organism such as a polychaete, e.g., a Terebella species such as
Terebella lapidaria.
[0091] It will be understood that for the aforementioned species
the invention encompasses both the perfect and imperfect states,
and other taxonomic equivalents, e.g., anamorphs, regardless of the
species name by which they are known. Those skilled in the art will
readily recognize the identity of appropriate equivalents.
[0092] Strains of these species are readily accessible to the
public in a number of culture collections, such as the American
Type Culture Collection (ATCC), Deutsche Sammlung von
Mikroorganismen and Zellkulturen GmbH (DSMZ), Centraalbureau Voor
Schimmelcultures (CBS), and Agricultural Research Service Patent
Culture Collection, Northern Regional Research Center (NRRL). The
polypeptide may be identified and obtained from other sources
including microorganisms isolated from nature (e.g., soil,
composts, water, etc.) using the above-mentioned probes. Techniques
for isolating microorganisms from natural habitats are well known
in the art. A polynucleotide encoding the polypeptide may then be
obtained by similarly screening a genomic DNA or cDNA library of
another microorganism or mixed DNA sample. Once a polynucleotide
encoding a polypeptide has been detected with the probe(s), the
polynucleotide can be isolated or cloned by utilizing techniques
that are well known to those of ordinary skill in the art (see,
e.g., Sambrook et al., 1989, supra).
Polynucleotides
[0093] The present invention also relates to isolated
polynucleotides encoding a polypeptide of the present invention, as
described above.
[0094] The techniques used to isolate or clone a polynucleotide
encoding a polypeptide are known in the art and include isolation
from genomic DNA or cDNA, or a combination thereof. The cloning of
the polynucleotides from genomic DNA can be effected, e.g., by
using the well known polymerase chain reaction (PCR) or antibody
screening of expression libraries to detect cloned DNA fragments
with shared structural features. See, e.g., Innis et al., 1990,
PCR: A Guide to Methods and Application, Academic Press, New York.
Other nucleic acid amplification procedures such as ligase chain
reaction (LCR), ligation activated transcription (LAT) and
polynucleotide-based amplification (NASBA) may be used. The
polynucleotides may be cloned from a strain of Terebella or a
related organism and thus, for example, may be an allelic or
species variant of the polypeptide encoding region of the
polynucleotide.
[0095] Modification of a polynucleotide encoding a polypeptide of
the present invention may be necessary for synthesizing
polypeptides substantially similar to the polypeptide. The term
"substantially similar" to the polypeptide refers to non-naturally
occurring forms of the polypeptide. These polypeptides may differ
in some engineered way from the polypeptide isolated from its
native source, e.g., variants that differ in specific activity,
thermostability, pH optimum, or the like. The variants may be
constructed on the basis of the polynucleotide presented as the
mature polypeptide coding sequence of SEQ ID NO:1 or the genimoc
DNA sequence thereof, e.g., a subsequence thereof, and/or by
introduction of nucleotide substitutions that do not result in a
change in the amino acid sequence of the polypeptide, but which
correspond to the codon usage of the host organism intended for
production of the enzyme, or by introduction of nucleotide
substitutions that may give rise to a different amino acid
sequence. For a general description of nucleotide substitution,
see, e.g., Ford et al., 1991, Protein Expression and Purification
2: 95-107.
Nucleic Acid Constructs
[0096] The present invention also relates to nucleic acid
constructs comprising a polynucleotide of the present invention
operably linked to one or more control sequences that direct the
expression of the coding sequence in a suitable host cell under
conditions compatible with the control sequences.
[0097] A polynucleotide may be manipulated in a variety of ways to
provide for expression of the polypeptide. Manipulation of the
polynucleotide prior to its insertion into a vector may be
desirable or necessary depending on the expression vector. The
techniques for modifying polynucleotides utilizing recombinant DNA
methods are well known in the art.
[0098] The control sequence may be a promoter sequence, a
polynucleotide that is recognized by a host cell for expression of
a polynucleotide encoding a polypeptide of the present
invention.
[0099] The promoter sequence contains transcriptional control
sequences that mediate the expression of the polypeptide. The
promoter may be any polynucleotide that shows transcriptional
activity in the host cell of choice including mutant, truncated,
and hybrid promoters, and may be obtained from genes encoding
extracellular or intracellular polypeptides either homologous or
heterologous to the host cell.
[0100] Examples of suitable promoters for directing transcription
of the nucleic acid constructs of the present invention in a
bacterial host cell are the promoters obtained from the Bacillus
amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis
alpha-amylase gene (amyL), Bacillus licheniformis penicillinase
gene (penP), Bacillus stearothermophilus maltogenic amylase gene
(amyM), Bacillus subtilis levansucrase gene (sacB), Bacillus
subtilis xylA and xylB genes, E. coli lac operon, E. coli trc
promoter (Egon et al., 1988, Gene 69: 301-315), Streptomyces
coelicolor agarase gene (dagA), and prokaryotic beta-lactamase gene
(Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75:
3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proc.
Natl. Acad. Sci. USA 80: 21-25). Further promoters are described in
"Useful proteins from recombinant bacteria" in Gilbert et al.,
1980, Scientific American, 242: 74-94; and in Sambrook et al.,
1989, supra.
[0101] Examples of suitable promoters for directing transcription
of the nucleic acid constructs of the present invention in a
filamentous fungal host cell are promoters obtained from the genes
for Aspergillus nidulans acetamidase, Aspergillus niger neutral
alpha-amylase, Aspergillus niger acid stable alpha-amylase,
Aspergillus niger or Aspergillus awamori glucoamylase (gIaA),
Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline
protease, Aspergillus oryzae triose phosphate isomerase, Fusarium
oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum
amyloglucosidase (WO 00/56900), Fusarium venenatum Dania (WO
00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor
miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma
reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I,
Trichoderma reesei cellobiohydrolase II, Trichoderma reesei
endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma
reesei endoglucanase III, Trichoderma reesei endoglucanase IV,
Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I,
Trichoderma reesei xylanase II, Trichoderma reesei beta-xylosidase,
as well as the NA2-tpi promoter (a modified promoter from an
Aspergillus gene encoding a neutral alpha-amylase in which the
untranslated leader has been replaced by an untranslated leader
from an Aspergillus gene encoding a triose phosphate isomerase;
non-limiting examples include modified promoters from an
Aspergillus niger gene encoding neutral alpha-amylase in which the
untranslated leader has been replaced by an untranslated leader
from an Aspergillus nidulans or Aspergillus oryzae gene encoding a
triose phosphate isomerase); and mutant, truncated, and hybrid
promoters thereof.
[0102] In a yeast host, useful promoters are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1,
ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase
(TPI), Saccharomyces cerevisiae metallothionein (CUP1), and
Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful
promoters for yeast host cells are described by Romanos et al.,
1992, Yeast 8: 423-488.
[0103] The control sequence may also be a suitable transcription
terminator sequence, which is recognized by a host cell to
terminate transcription. The terminator sequence is operably linked
to the 3'-terminus of the polynucleotide encoding the polypeptide.
Any terminator that is functional in the host cell of choice may be
used in the present invention.
[0104] Preferred terminators for filamentous fungal host cells are
obtained from the genes for Aspergillus nidulans anthranilate
synthase, Aspergillus niger glucoamylase, Aspergillus niger
alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium
oxysporum trypsin-like protease.
[0105] Preferred terminators for yeast host cells are obtained from
the genes for Saccharomyces cerevisiae enolase, Saccharomyces
cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae
glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators
for yeast host cells are described by Romanos et al., 1992,
supra.
[0106] The control sequence may also be a suitable leader sequence,
when transcribed is a nontranslated region of an mRNA that is
important for translation by the host cell. The leader sequence is
operably linked to the 5'-terminus of the polynucleotide encoding
the polypeptide. Any leader sequence that is functional in the host
cell of choice may be used.
[0107] Preferred leaders for filamentous fungal host cells are
obtained from the genes for Aspergillus oryzae TAKA amylase and
Aspergillus nidulans triose phosphate isomerase.
[0108] Suitable leaders for yeast host cells are obtained from the
genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces
cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae
alpha-factor, and Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
(ADH2/GAP).
[0109] The control sequence may also be a polyadenylation sequence,
a sequence operably linked to the 3'-terminus of the polynucleotide
and, when transcribed, is recognized by the host cell as a signal
to add polyadenosine residues to transcribed mRNA. Any
polyadenylation sequence that is functional in the host cell of
choice may be used.
[0110] Preferred polyadenylation sequences for filamentous fungal
host cells are obtained from the genes for Aspergillus oryzae TAKA
amylase, Aspergillus niger glucoamylase, Aspergillus nidulans
anthranilate synthase, Fusarium oxysporum trypsin-like protease,
and Aspergillus niger alpha-glucosidase.
[0111] Useful polyadenylation sequences for yeast host cells are
described by Guo and Sherman, 1995, Mol. Cellular Biol. 15:
5983-5990.
[0112] The control sequence may also be a signal peptide coding
region that encodes a signal peptide linked to the N-terminus of a
polypeptide and directs the polypeptide into the cell's secretory
pathway. The 5'-end of the coding sequence of the polynucleotide
may inherently contain a signal peptide coding sequence naturally
linked in translation reading frame with the segment of the coding
sequence that encodes the polypeptide. Alternatively, the 5'-end of
the coding sequence may contain a signal peptide coding sequence
that is foreign to the coding sequence. A foreign signal peptide
coding sequence may be required where the coding sequence does not
naturally contain a signal peptide coding sequence. Alternatively,
a foreign signal peptide coding sequence may simply replace the
natural signal peptide coding sequence in order to enhance
secretion of the polypeptide. However, any signal peptide coding
sequence that directs the expressed polypeptide into the secretory
pathway of a host cell of choice may be used.
[0113] Effective signal peptide coding sequences for bacterial host
cells are the signal peptide coding sequences obtained from the
genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus
licheniformis subtilisin, Bacillus licheniformis beta-lactamase,
Bacillus stearothermophilus alpha-amylase, Bacillus
stearothermophilus neutral proteases (nprT, nprS, nprM), and
Bacillus subtilis prsA. Further signal peptides are described by
Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
[0114] Effective signal peptide coding sequences for filamentous
fungal host cells are the signal peptide coding sequences obtained
from the genes for Aspergillus niger neutral amylase, Aspergillus
niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola
insolens cellulase, Humicola insolens endoglucanase V, Humicola
lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
[0115] Useful signal peptides for yeast host cells are obtained
from the genes for Saccharomyces cerevisiae alpha-factor and
Saccharomyces cerevisiae invertase. Other useful signal peptide
coding sequences are described by Romanos et al., 1992, supra.
[0116] The control sequence may also be a propeptide coding
sequence that encodes a propeptide positioned at the N-terminus of
a polypeptide. The resultant polypeptide is known as a proenzyme or
propolypeptide (or a zymogen in some cases). A propolypeptide is
generally inactive and can be converted to an active polypeptide by
catalytic or autocatalytic cleavage of the propeptide from the
propolypeptide. The propeptide coding sequence may be obtained from
the genes for Bacillus subtilis alkaline protease (aprE), Bacillus
subtilis neutral protease (nprT), Myceliophthora thermophila
laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and
Saccharomyces cerevisiae alpha-factor.
[0117] Where both signal peptide and propeptide sequences are
present at the N-terminus of a polypeptide, the propeptide sequence
is positioned next to the N-terminus of a polypeptide and the
signal peptide sequence is positioned next to the N-terminus of the
propeptide sequence.
[0118] It may also be desirable to add regulatory sequences that
regulate expression of the polypeptide relative to the growth of
the host cell. Examples of regulatory systems are those that cause
expression of the gene to be turned on or off in response to a
chemical or physical stimulus, including the presence of a
regulatory compound. Regulatory systems in prokaryotic systems
include the lac, tac, and trp operator systems. In yeast, the ADH2
system or GAL1 system may be used. In filamentous fungi, the
Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA
alpha-amylase promoter, and Aspergillus oryzae glucoamylase
promoter may be used. Other examples of regulatory sequences are
those that allow for gene amplification. In eukaryotic systems,
these regulatory sequences include the dihydrofolate reductase gene
that is amplified in the presence of methotrexate, and the
metallothionein genes that are amplified with heavy metals. In
these cases, the polynucleotide encoding the polypeptide would be
operably linked with the regulatory sequence.
Expression Vectors
[0119] The present invention also relates to recombinant expression
vectors comprising a polynucleotide of the present invention, a
promoter, and transcriptional and translational stop signals. The
various nucleotide and control sequences may be joined together to
produce a recombinant expression vector that may include one or
more convenient restriction sites to allow for insertion or
substitution of the polynucleotide encoding the polypeptide at such
sites. Alternatively, the polynucleotide may be expressed by
inserting the polynucleotide or a nucleic acid construct comprising
the sequence into an appropriate vector for expression. In creating
the expression vector, the coding sequence is located in the vector
so that the coding sequence is operably linked with the appropriate
control sequences for expression.
[0120] The recombinant expression vector may be any vector (e.g., a
plasmid or virus) that can be conveniently subjected to recombinant
DNA procedures and can bring about expression of the
polynucleotide. The choice of the vector will typically depend on
the compatibility of the vector with the host cell into which the
vector is to be introduced. The vector may be a linear or closed
circular plasmid.
[0121] The vector may be an autonomously replicating vector, i.e.,
a vector that exists as an extrachromosomal entity, the replication
of which is independent of chromosomal replication, e.g., a
plasmid, an extrachromosomal element, a minichromosome, or an
artificial chromosome. The vector may contain any means for
assuring self-replication. Alternatively, the vector may be one
that, when introduced into the host cell, is integrated into the
genome and replicated together with the chromosome(s) into which it
has been integrated. Furthermore, a single vector or plasmid or two
or more vectors or plasmids that together contain the total DNA to
be introduced into the genome of the host cell, or a transposon,
may be used.
[0122] The vector preferably contains one or more selectable
markers that permit easy selection of transformed, transfected,
transduced, or the like cells. A selectable marker is a gene the
product of which provides for biocide or viral resistance,
resistance to heavy metals, prototrophy to auxotrophs, and the
like.
[0123] Examples of bacterial selectable markers are the dal genes
from Bacillus subtilis or Bacillus licheniformis, or markers that
confer antibiotic resistance such as ampicillin, chloramphenicol,
kanamycin, or tetracycline resistance. Suitable markers for yeast
host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3.
Selectable markers for use in a filamentous fungal host cell
include, but are not limited to, amdS (acetamidase), argB
(ornithine carbamoyltransferase), bar (phosphinothricin
acetyltransferase), hph (hygromycin phosphotransferase), niaD
(nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase),
sC (sulfate adenyltransferase), and trpC (anthranilate synthase),
as well as equivalents thereof. Preferred for use in an Aspergillus
cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG
genes and a Streptomyces hygroscopicus bar gene.
[0124] The vector preferably contains an element(s) that permits
integration of the vector into the host cell's genome or autonomous
replication of the vector in the cell independent of the
genome.
[0125] For integration into the host cell genome, the vector may
rely on the polynucleotide's sequence encoding the polypeptide or
any other element of the vector for integration into the genome by
homologous or non-homologous recombination. Alternatively, the
vector may contain additional polynucleotides for directing
integration by homologous recombination into the genome of the host
cell at a precise location(s) in the chromosome(s). To increase the
likelihood of integration at a precise location, the integrational
elements should contain a sufficient number of nucleic acids, such
as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to
10,000 base pairs, which have a high degree of sequence identity to
the corresponding target sequence to enhance the probability of
homologous recombination. The integrational elements may be any
sequence that is homologous with the target sequence in the genome
of the host cell. Furthermore, the integrational elements may be
non-encoding or encoding polynucleotides. On the other hand, the
vector may be integrated into the genome of the host cell by
non-homologous recombination.
[0126] For autonomous replication, the vector may further comprise
an origin of replication enabling the vector to replicate
autonomously in the host cell in question. The origin of
replication may be any plasmid replicator mediating autonomous
replication that functions in a cell. The term "origin of
replication" or "plasmid replicator" means a polynucleotide that
enables a plasmid or vector to replicate in vivo.
[0127] Examples of bacterial origins of replication are the origins
of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184
permitting replication in E. coli, and pUB110, pE194, pTA1060, and
pAMR1 permitting replication in Bacillus.
[0128] Examples of origins of replication for use in a yeast host
cell are the 2 micron origin of replication, ARS1, ARS4, the
combination of ARS1 and CEN3, and the combination of ARS4 and
CEN6.
[0129] Examples of origins of replication useful in a filamentous
fungal cell are AMA1 and ANSI (Gems et al., 1991, Gene 98: 61-67;
Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO
00/24883). Isolation of the AMA1 gene and construction of plasmids
or vectors comprising the gene can be accomplished according to the
methods disclosed in WO 00/24883.
[0130] More than one copy of a polynucleotide of the present
invention may be inserted into a host cell to increase production
of a polypeptide. An increase in the copy number of the
polynucleotide can be obtained by integrating at least one
additional copy of the sequence into the host cell genome or by
including an amplifiable selectable marker gene with the
polynucleotide where cells containing amplified copies of the
selectable marker gene, and thereby additional copies of the
polynucleotide, can be selected for by cultivating the cells in the
presence of the appropriate selectable agent.
[0131] The procedures used to ligate the elements described above
to construct the recombinant expression vectors of the present
invention are well known to one skilled in the art (see, e.g.,
Sambrook et al., 1989, supra).
Host Cells
[0132] The present invention also relates to recombinant host
cells, comprising a polynucleotide of the present invention
operably linked to one or more control sequences that direct the
production of a polypeptide of the present invention. A construct
or vector comprising a polynucleotide is introduced into a host
cell so that the construct or vector is maintained as a chromosomal
integrant or as a self-replicating extra-chromosomal vector as
described earlier. The term "host cell" encompasses any progeny of
a parent cell that is not identical to the parent cell due to
mutations that occur during replication. The choice of a host cell
will to a large extent depend upon the gene encoding the
polypeptide and its source.
[0133] The host cell may be any cell useful in the recombinant
production of a polypeptide of the present invention, e.g., a
prokaryote or a eukaryote.
[0134] The prokaryotic host cell may be any Gram-positive or
Gram-negative bacterium. Gram-positive bacteria include, but not
limited to, Bacillus, Clostridium, Enterococcus, Geobacillus,
Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus,
Streptococcus, and Streptomyces. Gram-negative bacteria include,
but not limited to, Campylobacter, E. coli, Flavobacterium,
Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas,
Salmonella, and Ureaplasma.
[0135] The bacterial host cell may be any Bacillus cell including,
but not limited to, Bacillus alkalophilus, Bacillus
amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus
clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus,
Bacillus lentus, Bacillus licheniformis, Bacillus megaterium,
Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis,
and Bacillus thuringiensis cells.
[0136] The bacterial host cell may also be any Streptococcus cell
including, but not limited to, Streptococcus equisimilis,
Streptococcus pyogenes, Streptococcus uberis, and Streptococcus
equi subsp. Zooepidemicus cells.
[0137] The bacterial host cell may also be any Streptomyces cell
including, but not limited to, Streptomyces achromogenes,
Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces
griseus, and Streptomyces lividans cells.
[0138] The introduction of DNA into a Bacillus cell may be effected
by protoplast transformation (see, e.g., Chang and Cohen, 1979,
Mol. Gen. Genet. 168: 111-115), using competent cells (see, e.g.,
Young and Spizizen, 1961, J. Bacteriol. 81: 823-829, or Dubnau and
Davidoff-Abelson, 1971, J. Mol. Biol. 56: 209-221), electroporation
(see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751),
or conjugation (see, e.g., Koehler and Thorne, 1987, J. Bacteriol.
169: 5271-5278). The introduction of DNA into an E. coli cell may
be effected by protoplast transformation (see, e.g., Hanahan, 1983,
J. Mol. Biol. 166: 557-580) or electroporation (see, e.g., Dower et
al., 1988, Nucleic Acids Res. 16: 6127-6145). The introduction of
DNA into a Streptomyces cell may be effected by protoplast
transformation and electroporation (see, e.g., Gong et al., 2004,
Folia Microbiol. (Praha) 49: 399-405), conjugation (see, e.g.,
Mazodier et al., 1989, J. Bacteriol. 171: 3583-3585), or
transduction (see, e.g., Burke et al., 2001, Proc. Natl. Acad. Sci.
USA 98: 6289-6294). The introduction of DNA into a Pseudomonas cell
may be effected by electroporation (see, e.g., Choi et al., 2006,
J. Microbiol. Methods 64: 391-397) or conjugation (see, e.g.,
Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71: 51-57). The
introduction of DNA into a Streptococcus cell may be effected by
natural competence (see, e.g., Perry and Kuramitsu, 1981, Infect.
Immun. 32: 1295-1297), protoplast transformation (see, e.g., Catt
and Jollick, 1991, Microbios 68: 189-207), electroporation (see,
e.g., Buckley et al., 1999, Appl. Environ. Microbiol. 65:
3800-3804) or conjugation (see, e.g., Clewell, 1981, Microbiol.
Rev. 45: 409-436). However, any method known in the art for
introducing DNA into a host cell can be used.
[0139] The host cell may also be a eukaryote, such as a mammalian,
insect, plant, or fungal cell.
[0140] The host cell may be a fungal cell. "Fungi" as used herein
includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and
Zygomycota (as defined by Hawksworth et al., In, Ainsworth and
Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB
International, University Press, Cambridge, UK) as well as the
Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and
all mitosporic fungi (Hawksworth et al., 1995, supra).
[0141] The fungal host cell may be a yeast cell. "Yeast" as used
herein includes ascosporogenous yeast (Endomycetales),
basidiosporogenous yeast, and yeast belonging to the Fungi
Imperfecti (Blastomycetes). Since the classification of yeast may
change in the future, for the purposes of this invention, yeast
shall be defined as described in Biology and Activities of Yeast
(Skinner, F. A., Passmore, S. M., and Davenport, R. R., eds, Soc.
App. Bacteriol. Symposium Series No. 9, 1980).
[0142] The yeast host cell may be a Candida, Hansenula,
Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or
Yarrowia cell such as a Kluyveromyces lactis, Saccharomyces
carlsbergensis, Saccharomyces cerevisiae, Saccharomyces
diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri,
Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia
lipolytica cell.
[0143] The fungal host cell may be a filamentous fungal cell.
"Filamentous fungi" include all filamentous forms of the
subdivision Eumycota and Oomycota (as defined by Hawksworth et al.,
1995, supra). The filamentous fungi are generally characterized by
a mycelial wall composed of chitin, cellulose, glucan, chitosan,
mannan, and other complex polysaccharides. Vegetative growth is by
hyphal elongation and carbon catabolism is obligately aerobic. In
contrast, vegetative growth by yeasts such as Saccharomyces
cerevisiae is by budding of a unicellular thallus and carbon
catabolism may be fermentative.
[0144] The filamentous fungal host cell may be an Acremonium,
Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis,
Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium,
Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora,
Neocallimastix, Neurospora, Paecilomyces, Penicillium,
Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum,
Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or
Trichoderma cell.
[0145] For example, the filamentous fungal host cell may be an
Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus,
Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger,
Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina,
Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis
pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa,
Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium
keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium,
Chrysosporium pannicola, Chrysosporium queenslandicum,
Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus,
Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis,
Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum,
Fusarium graminum, Fusarium heterosporum, Fusarium negundi,
Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium
sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides,
Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides,
Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor
miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium
purpurogenum, Phanerochaete chrysosporium, Phlebia radiata,
Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes
versicolor, Trichoderma harzianum, Trichoderma koningii,
Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma
viride cell.
[0146] Fungal cells may be transformed by a process involving
protoplast formation, transformation of the protoplasts, and
regeneration of the cell wall in a manner known per se. Suitable
procedures for transformation of Aspergillus and Trichoderma host
cells are described in EP 238023, Yelton et al., 1984, Proc. Natl.
Acad. Sci. USA 81: 1470-1474, and Christensen et al., 1988,
Bio/Technology 6: 1419-1422. Suitable methods for transforming
Fusarium species are described by Malardier et al., 1989, Gene 78:
147-156, and WO 96/00787. Yeast may be transformed using the
procedures described by Becker and Guarente, In Abelson, J. N. and
Simon, M. I., editors, Guide to Yeast Genetics and Molecular
Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic
Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153: 163;
and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75: 1920.
Methods of Production
[0147] Based on the nucleotide sequence identified as SEQ ID NO: 1,
a synthetic gene may be obtained from a number of vendors such as
Gene Art (GENEART AG BioPark, Josef-Engert-Str. 11, 93053,
Regensburg, Germany) or DNA 2.0 (DNA2.0, 1430 O'Brien Drive, Suite
E, Menlo Park, Calif. 94025, USA. The synthetic gene may be
designed to incorporate additional DNA sequences such as
restriction sites or homologous recombination regions to facilitate
direct cloning into an expression vector.
[0148] Alternatively, using synthetic oligonucleotide primers such
as (SEQ ID NO: 3) and (SEQ ID NO: 4), a simple PCR reaction can be
used to amplify the full-length open reading frame from the gene of
SEQ ID NO: 1. The gene can then be cloned into an expression vector
for example as described above and expressed in a host cell, for
example in Aspergillus oryzae.
[0149] The present invention also relates to methods of producing a
polypeptide of the present invention, comprising: (a) cultivating a
cell, which in its wild-type form produces the polypeptide, under
conditions conducive for production of the polypeptide; and (b)
recovering the polypeptide. In a preferred aspect, the cell is a
Terebella cell. In a more preferred aspect, the cell is a Terebella
lapidaria cell.
[0150] The present invention also relates to methods of producing a
polypeptide of the present invention, comprising: (a) cultivating a
recombinant host cell of the present invention under conditions
conducive for production of the polypeptide; and (b) recovering the
polypeptide.
[0151] The host cells are cultivated in a nutrient medium suitable
for production of the polypeptide using methods well known in the
art. For example, the cell may be cultivated by shake flask
cultivation, and small-scale or large-scale fermentation (including
continuous, batch, fed-batch, or solid state fermentations) in
laboratory or industrial fermentors performed in a suitable medium
and under conditions allowing the polypeptide to be expressed
and/or isolated.
[0152] The cultivation takes place in a suitable nutrient medium
comprising carbon and nitrogen sources and inorganic salts, using
procedures known in the art. Suitable media are available from
commercial suppliers or may be prepared according to published
compositions (e.g., in catalogues of the American Type Culture
Collection). If the polypeptide is secreted into the nutrient
medium, the polypeptide can be recovered directly from the medium.
If the polypeptide is not secreted, it can be recovered from cell
lysates.
[0153] The polypeptide may be detected using methods known in the
art that are specific for the polypeptides. These detection methods
may include use of specific antibodies, formation of an enzyme
product, or disappearance of an enzyme substrate. For example, an
enzyme assay may be used to determine the activity of the
polypeptide.
[0154] The polypeptide may be recovered using methods known in the
art. For example, the polypeptide may be recovered from the
nutrient medium by conventional procedures including, but not
limited to, centrifugation, filtration, extraction, spray-drying,
evaporation, or precipitation.
[0155] The polypeptide may be purified by a variety of procedures
known in the art including, but not limited to, chromatography
(e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and
size exclusion), electrophoretic procedures (e.g., preparative
isoelectric focusing), differential solubility (e.g., ammonium
sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein
Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers,
New York, 1989) to obtain substantially pure polypeptides.
[0156] In an alternative aspect, the polypeptide is not recovered,
but rather a host cell of the present invention expressing the
polypeptide is used as a source of the polypeptide.
Plants
[0157] The present invention also relates to isolated plants, e.g.,
a transgenic plant, plant part, or plant cell, comprising a
polynucleotide of the present invention so as to express and
produce a polypeptide or domain in recoverable quantities. The
polypeptide or domain may be recovered from the plant or plant
part. Alternatively, the plant or plant part containing the
polypeptide or domain may be used as such for improving the quality
of a food or feed, e.g., improving nutritional value, palatability,
and rheological properties, or to destroy an antinutritive
factor.
[0158] The transgenic plant can be dicotyledonous (a dicot) or
monocotyledonous (a monocot). Examples of monocot plants are
grasses, such as meadow grass (blue grass, Poa), forage grass such
as Festuca, Lolium, temperate grass, such as Agrostis, and cereals,
e.g., wheat, oats, rye, barley, rice, sorghum, and maize
(corn).
[0159] Examples of dicot plants are tobacco, legumes, such as
lupins, potato, sugar beet, pea, bean and soybean, and cruciferous
plants (family Brassicaceae), such as cauliflower, rape seed, and
the closely related model organism Arabidopsis thaliana.
[0160] Examples of plant parts are stem, callus, leaves, root,
fruits, seeds, and tubers as well as the individual tissues
comprising these parts, e.g., epidermis, mesophyll, parenchyme,
vascular tissues, meristems. Specific plant cell compartments, such
as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and
cytoplasm are also considered to be a plant part. Furthermore, any
plant cell, whatever the tissue origin, is considered to be a plant
part. Likewise, plant parts such as specific tissues and cells
isolated to facilitate the utilization of the invention are also
considered plant parts, e.g., embryos, endosperms, aleurone and
seed coats.
[0161] Also included within the scope of the present invention are
the progeny of such plants, plant parts, and plant cells.
[0162] The transgenic plant or plant cell expressing the
polypeptide or domain may be constructed in accordance with methods
known in the art. In short, the plant or plant cell is constructed
by incorporating one or more expression constructs encoding the
polypeptide or domain into the plant host genome or chloroplast
genome and propagating the resulting modified plant or plant cell
into a transgenic plant or plant cell.
[0163] The expression construct is conveniently a nucleic acid
construct that comprises a polynucleotide encoding a polypeptide or
domain operably linked with appropriate regulatory sequences
required for expression of the polynucleotide in the plant or plant
part of choice. Furthermore, the expression construct may comprise
a selectable marker useful for identifying host cells into which
the expression construct has been integrated and DNA sequences
necessary for introduction of the construct into the plant in
question (the latter depends on the DNA introduction method to be
used).
[0164] The choice of regulatory sequences, such as promoter and
terminator sequences and optionally signal or transit sequences, is
determined, for example, on the basis of when, where, and how the
polypeptide or domain is desired to be expressed. For instance, the
expression of the gene encoding a polypeptide or domain may be
constitutive or inducible, or may be developmental, stage or tissue
specific, and the gene product may be targeted to a specific tissue
or plant part such as seeds or leaves. Regulatory sequences are,
for example, described by Tague et al., 1988, Plant Physiology 86:
506.
[0165] For constitutive expression, the 35S-CaMV, the maize
ubiquitin 1, or the rice actin 1 promoter may be used (Franck et
al., 1980, Cell 21: 285-294; Christensen et al., 1992, Plant Mol.
Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165).
Organ-specific promoters may be, for example, a promoter from
storage sink tissues such as seeds, potato tubers, and fruits
(Edwards and Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from
metabolic sink tissues such as meristems (Ito et al., 1994, Plant
Mol. Biol. 24: 863-878), a seed specific promoter such as the
glutelin, prolamin, globulin, or albumin promoter from rice (Wu et
al., 1998, Plant Cell Physiol. 39: 885-889), a Vicia faba promoter
from the legumin B4 and the unknown seed protein gene from Vicia
faba (Conrad et al., 1998, J. Plant Physiol. 152: 708-711), a
promoter from a seed oil body protein (Chen et al., 1998, Plant
Cell Physiol. 39: 935-941), the storage protein napA promoter from
Brassica napus, or any other seed specific promoter known in the
art, e.g., as described in WO 91/14772. Furthermore, the promoter
may be a leaf specific promoter such as the rbcs promoter from rice
or tomato (Kyozuka et al., 1993, Plant Physiol. 102: 991-1000), the
chlorella virus adenine methyltransferase gene promoter (Mitra and
Higgins, 1994, Plant Mol. Biol. 26: 85-93), the aldP gene promoter
from rice (Kagaya et al., 1995, Mol. Gen. Genet. 248: 668-674), or
a wound inducible promoter such as the potato pin2 promoter (Xu et
al., 1993, Plant Mol. Biol. 22: 573-588). Likewise, the promoter
may be induced by abiotic treatments such as temperature, drought,
or alterations in salinity or induced by exogenously applied
substances that activate the promoter, e.g., ethanol, oestrogens,
plant hormones such as ethylene, abscisic acid, and gibberellic
acid, and heavy metals.
[0166] A promoter enhancer element may also be used to achieve
higher expression of a polypeptide or domain in the plant. For
instance, the promoter enhancer element may be an intron that is
placed between the promoter and the polynucleotide encoding a
polypeptide or domain. For instance, Xu et al., 1993, supra,
disclose the use of the first intron of the rice actin 1 gene to
enhance expression.
[0167] The selectable marker gene and any other parts of the
expression construct may be chosen from those available in the
art.
[0168] The nucleic acid construct is incorporated into the plant
genome according to conventional techniques known in the art,
including Agrobacterium-mediated transformation, virus-mediated
transformation, microinjection, particle bombardment, biolistic
transformation, and electroporation (Gasser et al., 1990, Science
244: 1293; Potrykus, 1990, Bio/Technology 8: 535; Shimamoto et al.,
1989, Nature 338: 274).
[0169] Presently, Agrobacterium tumefaciens-mediated gene transfer
is the method of choice for generating transgenic dicots (for a
review, see Hooykas and Schilperoort, 1992, Plant Mol. Biol. 19:
15-38) and can also be used for transforming monocots, although
other transformation methods are often used for these plants.
Presently, the method of choice for generating transgenic monocots
is particle bombardment (microscopic gold or tungsten particles
coated with the transforming DNA) of embryonic calli or developing
embryos (Christou, 1992, Plant J. 2: 275-281; Shimamoto, 1994,
Curr. Opin. Biotechnol. 5: 158-162; Vasil et al., 1992,
Bio/Technology 10: 667-674). An alternative method for
transformation of monocots is based on protoplast transformation as
described by Omirulleh et al., 1993, Plant Mol. Biol. 21: 415-428.
Additional transformation methods for use in accordance with the
present disclosure include those described in U.S. Pat. Nos.
6,395,966 and 7,151,204 (both of which are herein incorporated by
reference in their entirety).
[0170] Following transformation, the transformants having
incorporated the expression construct are selected and regenerated
into whole plants according to methods well known in the art. Often
the transformation procedure is designed for the selective
elimination of selection genes either during regeneration or in the
following generations by using, for example, co-transformation with
two separate T-DNA constructs or site specific excision of the
selection gene by a specific recombinase.
[0171] In addition to direct transformation of a particular plant
genotype with a construct of the present invention, transgenic
plants may be made by crossing a plant having the construct to a
second plant lacking the construct. For example, a construct
encoding a polypeptide or domain can be introduced into a
particular plant variety by crossing, without the need for ever
directly transforming a plant of that given variety. Therefore, the
present invention encompasses not only a plant directly regenerated
from cells which have been transformed in accordance with the
present invention, but also the progeny of such plants. As used
herein, progeny may refer to the offspring of any generation of a
parent plant prepared in accordance with the present invention.
Such progeny may include a DNA construct prepared in accordance
with the present invention. Crossing results in the introduction of
a transgene into a plant line by cross pollinating a starting line
with a donor plant line. Non-limiting examples of such steps are
described in U.S. Pat. No. 7,151,204.
[0172] Plants may be generated through a process of backcross
conversion. For example, plants include plants referred to as a
backcross converted genotype, line, inbred, or hybrid.
[0173] Genetic markers may be used to assist in the introgression
of one or more transgenes of the invention from one genetic
background into another. Marker assisted selection offers
advantages relative to conventional breeding in that it can be used
to avoid errors caused by phenotypic variations. Further, genetic
markers may provide data regarding the relative degree of elite
germplasm in the individual progeny of a particular cross. For
example, when a plant with a desired trait which otherwise has a
non-agronomically desirable genetic background is crossed to an
elite parent, genetic markers may be used to select progeny which
not only possess the trait of interest, but also have a relatively
large proportion of the desired germplasm. In this way, the number
of generations required to introgress one or more traits into a
particular genetic background is minimized.
[0174] The present invention also relates to methods of producing a
polypeptide or domain of the present invention comprising: (a)
cultivating a transgenic plant or a plant cell comprising a
polynucleotide encoding the polypeptide or domain under conditions
conducive for production of the polypeptide or domain; and (b)
recovering the polypeptide or domain.
Detergent Compositions
[0175] In one embodiment, the invention is directed to detergent
compositions comprising an enzyme of the present invention in
combination with one or more additional cleaning composition
components. The choice of additional components is within the skill
of the artisan and includes conventional ingredients, including the
exemplary non-limiting components set forth below.
[0176] The choice of components may include, for textile care, the
consideration of the type of textile to be cleaned, the type and/or
degree of soiling, the temperature at which cleaning is to take
place, and the formulation of the detergent product. Although
components mentioned below are categorized by general header
according to a particular functionality, this is not to be
construed as a limitation, as a component may comprise additional
functionalities as will be appreciated by the skilled artisan.
Enzyme of the Present Invention
[0177] In one embodiment of the present invention, the a
polypeptide of the present invention may be added to a detergent
composition in an amount corresponding to 0.001-100 mg of protein,
such as 0.01-100 mg of protein, preferably 0.005-50 mg of protein,
more preferably 0.01-25 mg of protein, even more preferably 0.05-10
mg of protein, most preferably 0.05-5 mg of protein, and even most
preferably 0.01-1 mg of protein per liter of wash liquor.
[0178] The enzyme(s) of the detergent composition of the invention
may be stabilized using conventional stabilizing agents, e.g., a
polyol such as propylene glycol or glycerol, a sugar or sugar
alcohol, lactic acid, boric acid, or a boric acid derivative, e.g.,
an aromatic borate ester, or a phenyl boronic acid derivative such
as 4-formylphenyl boronic acid, and the composition may be
formulated as described in, for example, WO 92/19709 and WO
92/19708.
[0179] A polypeptide of the present invention may also be
incorporated in the detergent formulations disclosed in WO
97/07202, which is hereby incorporated by reference.
Surfactants
[0180] The detergent composition may comprise one or more
surfactants, which may be anionic and/or cationic and/or non-ionic
and/or semi-polar and/or zwitterionic, or a mixture thereof. In a
particular embodiment, the detergent composition includes a mixture
of one or more nonionic surfactants and one or more anionic
surfactants. The surfactant(s) is typically present at a level of
from about 0.1% to 60% by weight, such as about 1% to about 40%, or
about 3% to about 20%, or about 3% to about 10%. The surfactant(s)
is chosen based on the desired cleaning application, and includes
any conventional surfactant(s) known in the art. Any surfactant
known in the art for use in detergents may be utilized.
[0181] When included therein the detergent will usually contain
from about 1% to about 40% by weight, such as from about 5% to
about 30%, including from about 5% to about 15%, or from about 20%
to about 25% of an anionic surfactant. Non-limiting examples of
anionic surfactants include sulfates and sulfonates, in particular,
linear alkylbenzenesulfonates (LAS), isomers of LAS, branched
alkylbenzenesulfonates (BABS), phenylalkanesulfonates,
alpha-olefinsulfonates (AOS), olefin sulfonates, alkene sulfonates,
alkane-2,3-diylbis(sulfates), hydroxyalkanesulfonates and
disulfonates, alkyl sulfates (AS) such as sodium dodecyl sulfate
(SDS), fatty alcohol sulfates (FAS), primary alcohol sulfates
(PAS), alcohol ethersulfates (AES or AEOS or FES, also known as
alcohol ethoxysulfates or fatty alcohol ether sulfates), secondary
alkanesulfonates (SAS), paraffin sulfonates (PS), ester sulfonates,
sulfonated fatty acid glycerol esters, alpha-sulfo fatty acid
methyl esters (alpha-SFMe or SES) including methyl ester sulfonate
(MES), alkyl- or alkenylsuccinic acid, dodecenyl/tetradecenyl
succinic acid (DTSA), fatty acid derivatives of amino acids,
diesters and monoesters of sulfo-succinic acid or soap, and
combinations thereof.
[0182] When included therein the detergent will usually contain
from about 1% to about 40% by weight of a cationic surfactant.
Non-limiting examples of cationic surfactants include
alkyldimethylehanolamine quat (ADMEAQ), cetyltrimethylammonium
bromide (CTAB), dimethyldistearylammonium chloride (DSDMAC), and
alkylbenzyldimethylammonium, and combinations thereof, Alkyl
quaternary ammonium compounds, Alkoxylated quaternary ammonium
(AQA),
[0183] When included therein the detergent will usually contain
from about 0.2% to about 40% by weight of a non-ionic surfactant,
for example from about 0.5% to about 30%, in particular from about
1% to about 20%, from about 3% to about 10%, such as from about 3%
to about 5%, or from about 8% to about 12%. Non-limiting examples
of non-ionic surfactants include alcohol ethoxylates (AE or AEO),
alcohol propoxylates, propoxylated fatty alcohols (PFA),
alkoxylated fatty acid alkyl esters, such as ethoxylated and/or
propoxylated fatty acid alkyl esters, alkylphenol ethoxylates
(APE), nonylphenol ethoxylates (NPE), alkylpolyglycosides (APG),
alkoxylated amines, fatty acid monoethanolamides (FAM), fatty acid
diethanolamides (FADA), ethoxylated fatty acid monoethanolamides
(EFAM), propoxylated fatty acid monoethanolamide (PFAM),
polyhydroxy alkyl fatty acid amides, or N-acyl N-alkyl derivatives
of glucosamine (glucamides, GA, or fatty acid glucamide, FAGA), as
well as products available under the trade names SPAN and TWEEN,
and combinations thereof.
[0184] When included therein the detergent will usually contain
from about 1% to about 40% by weight of a semipolar surfactant.
Non-limiting examples of semipolar surfactants include amine oxides
(AO) such as alkyldimethylamineoxide, N-(coco
alkyl)-N,N-dimethylamine oxide and
N-(tallow-alkyl)-N,N-bis(2-hydroxyethyl)amine oxide, fatty acid
alkanolamides and ethoxylated fatty acid alkanolamides, and
combinations thereof.
[0185] When included therein the detergent will usually contain
from about 1% to about 40% by weight of a zwitterionic surfactant.
Non-limiting examples of zwitterionic surfactants include betaine,
alkyldimethylbetaine, and sulfobetaine, and combinations
thereof.
Hydrotropes
[0186] A hydrotrope is a compound that solubilises hydrophobic
compounds in aqueous solutions (or oppositely, polar substances in
a non-polar environment). Typically, hydrotropes have both
hydrophilic and a hydrophobic character (so-called amphiphilic
properties as known from surfactants); however the molecular
structure of hydrotropes generally do not favor spontaneous
self-aggregation, see, e.g., review by Hodgdon and Kaler, 2007,
Current Opinion in Colloid & Interface, Science 12: 121-128.
Hydrotropes do not display a critical concentration above which
self-aggregation occurs as found for surfactants and lipids forming
miceller, lamellar or other well defined meso-phases. Instead, many
hydrotropes show a continuous-type aggregation process where the
sizes of aggregates grow as concentration increases. However, many
hydrotropes alter the phase behavior, stability, and colloidal
properties of systems containing substances of polar and non-polar
character, including mixtures of water, oil, surfactants, and
polymers. Hydrotropes are classically used across industries from
pharma, personal care, food, to technical applications. Use of
hydrotropes in detergent compositions allow for example more
concentrated formulations of surfactants (as in the process of
compacting liquid detergents by removing water) without inducing
undesired phenomena such as phase separation or high viscosity.
[0187] The detergent may contain 0-5% by weight, such as about 0.5
to about 5%, or about 3% to about 5%, of a hydrotrope. Any
hydrotrope known in the art for use in detergents may be utilized.
Non-limiting examples of hydrotropes include sodium benzene
sulfonate, sodium p-toluene sulfonates (STS), sodium xylene
sulfonates (SXS), sodium cumene sulfonates (SCS), sodium cymene
sulfonate, amine oxides, alcohols and polyglycolethers, sodium
hydroxynaphthoate, sodium hydroxynaphthalene sulfonate, sodium
ethylhexyl sulfate, and combinations thereof.
Builders and Co-Builders
[0188] The detergent composition may contain about 0-65% by weight,
such as about 5% to about 50% of a detergent builder or co-builder,
or a mixture thereof. In a dish wash detergent, the level of
builder is typically 40-65%, particularly 50-65%. The builder
and/or co-builder may particularly be a chelating agent that forms
water-soluble complexes with Ca and Mg. Any builder and/or
co-builder known in the art for use in laundry detergents may be
utilized. Non-limiting examples of builders include zeolites,
diphosphates (pyrophosphates), triphosphates such as sodium
triphosphate (STP or STPP), carbonates such as sodium carbonate,
soluble silicates such as sodium metasilicate, layered silicates
(e.g., SKS-6 from Hoechst), ethanolamines such as 2-aminoethan-1-ol
(MEA), iminodiethanol (DEA) and 2,2',2''-nitrilotriethanol (TEA),
and carboxymethylinulin (CMI), and combinations thereof.
[0189] The detergent composition may also contain 0-50% by weight,
such as about 5% to about 40%, of a detergent co-builder, or a
mixture thereof. The detergent composition may include include a
co-builder alone, or in combination with a builder, for example a
zeolite builder. Non-limiting examples of co-builders include
homopolymers of polyacrylates or copolymers thereof, such as
poly(acrylic acid) (PAA) or copoly(acrylic acid/maleic acid)
(PAA/PMA). Further non-limiting examples include citrate, chelators
such as aminocarboxylates, aminopolycarboxylates and phosphonates,
and alkyl- or alkenylsuccinic acid. Additional specific examples
include 2,2',2''-nitrilotriacetic acid (NTA),
etheylenediaminetetraacetic acid (EDTA),
diethylenetriaminepentaacetic acid (DTPA), iminodisuccinic acid
(IDS), ethylenediamine-N,N'-disuccinic acid (EDDS),
methylglycinediacetic acid (MGDA), glutamic acid-N,N-diacetic acid
(GLDA), 1-hydroxyethane-1,1-diylbis(phosphonic acid) (HEDP),
ethylenediaminetetrakis(methylene)tetrakis(phosphonic acid)
(EDTMPA), diethylenetriaminepentakis(methylene)pentakis(phosphonic
acid) (DTPMPA), N-(2-hydroxyethyl)iminodiacetic acid (EDG),
aspartic acid-N-monoacetic acid (ASMA), aspartic acid-N,N-diacetic
acid (ASDA), aspartic acid-N-monopropionic acid (ASMP),
iminodisuccinic acid (IDA), N-(2-sulfomethyl) aspartic acid (SMAS),
N-(2-sulfoethyl) aspartic acid (SEAS), N-(2-sulfomethyl) glutamic
acid (SMGL), N-(2-sulfoethyl) glutamic acid (SEGL),
N-methyliminodiacetic acid (MIDA), .alpha.-alanine-N,N-diacetic
acid (.alpha.-ALDA), serine-N,N-diacetic acid (SEDA),
isoserine-N,N-diacetic acid (ISDA), phenylalanine-N,N-diacetic acid
(PHDA), anthranilic acid-N,N-diacetic acid (ANDA), sulfanilic
acid-N,N-diacetic acid (SLDA), taurine-N,N-diacetic acid (TUDA) and
sulfomethyl-N,N-diacetic acid (SMDA),
N-(hydroxyethyl)-ethylidenediaminetriacetate (HEDTA),
diethanolglycine (DEG), Diethylenetriamine Penta (Methylene
Phosphonic acid) (DTPMP), aminotris(methylenephosphonic acid)
(ATMP), and combinations and salts thereof. Further exemplary
builders and/or co-builders are described in, e.g., WO 2009/102854,
U.S. Pat. No. 5,977,053.
Bleaching Systems
[0190] The detergent may comprise a bleaching system. Any bleaching
system known in the art for use in laundry detergents may be
utilized. Suitable bleaching system components include bleaching
catalysts, photobleaches, bleach activators, sources of hydrogen
peroxide such as sodium percarbonate and sodium perborates,
preformed peracids and mixtures thereof. Suitable preformed
peracids include, but are not limited to, peroxycarboxylic acids
and salts, percarbonic acids and salts, perimidic acids and salts,
peroxymonosulfuric acids and salts, for example, Oxone (R), and
mixtures thereof. Non-limiting examples of bleaching systems
include peroxide-based bleaching systems, which may comprise, for
example, an inorganic salt, including alkali metal salts such as
sodium salts of perborate (usually mono- or tetra-hydrate),
percarbonate, persulfate, perphosphate, persilicate salts, in
combination with a peracid-forming bleach activator. By Bleach
activator is meant herin a compound which reacts with peroxygen
bleach like hydrogen peroxide to form a Peracid. The peracid thus
formed constitutes the activated bleach. Suitable bleach activators
to be used herein include those belonging to the class of esters
amides, imides or anhydrides, Suitable examples are tetracetyl
athylene diamine (TAED), sodium 3,5,5 trimethyl hexanoyloxybenzene
sulphonat, diperoxy dodecanoic acid,
4-(dodecanoyloxy)benzenesulfonate (LOBS),
4-(decanoyloxy)benzenesulfonate, 4-(decanoyloxy)benzoate (DOBS),
4-(3,5,5-trimethylhexanoyloxyl)benzenesulfonate (ISONOBS),
tetraacetylethylenediamine (TAED) and
4-(nonanoyloxy)benzenesulfonate (NOBS), and/or those disclosed in
WO 98/17767. A particular family of bleach activators of interest
was disclosed in EP 624154 and particulary preferred in that family
is acetyl triethyl citrate (ATC). ATC or a short chain triglyceride
like Triacin has the advantage that it is environmental friendly as
it eventually degrades into citric acid and alcohol. Furthermore
acethyl triethyl citrate and triacetin has a good hydrolytical
stability in the product upon storage and it is an efficient bleach
activator. Finally ATC provides a good building capacity to the
laundry additive. Alternatively, the bleaching system may comprise
peroxyacids of, for example, the amide, imide, or sulfone type. The
bleaching system may also comprise peracids such as
6-(phthaloylamino)percapronic acid (PAP). The bleaching system may
also include a bleach catalyst. In some embodiments the bleach
component may be an organic catalyst selected from the group
consisting of organic catalysts having the following formulae:
##STR00001##
(iii) and mixtures thereof; wherein each R.sup.1 is independently a
branched alkyl group containing from 9 to 24 carbons or linear
alkyl group containing from 11 to 24 carbons, preferably each
R.sup.1 is independently a branched alkyl group containing from 9
to 18 carbons or linear alkyl group containing from 11 to 18
carbons, more preferably each R.sup.1 is independently selected
from the group consisting of 2-propylheptyl, 2-butyloctyl,
2-pentylnonyl, 2-hexyldecyl, n-dodecyl, n-tetradecyl, n-hexadecyl,
n-octadecyl, iso-nonyl, iso-decyl, iso-tridecyl and iso-pentadecyl.
Other exemplary bleaching systems are described, e.g., in WO
2007/087258, WO 2007/087244, WO 2007/087259, WO 2007/087242.
Suitable photobleaches may for example be sulfonated zinc
phthalocyanine
Polymers
[0191] The detergent may contain 0-10% by weight, such as 0.5-5%,
2-5%, 0.5-2% or 0.2-1% of a polymer. Any polymer known in the art
for use in detergents may be utilized. The polymer may function as
a co-builder as mentioned above, or may provide antiredeposition,
fiber protection, soil release, dye transfer inhibition, grease
cleaning and/or anti-foaming properties. Some polymers may have
more than one of the above-mentioned properties and/or more than
one of the below-mentioned motifs. Exemplary polymers include
(carboxymethyl)cellulose (CMC), poly(vinyl alcohol) (PVA),
poly(vinylpyrrolidone) (PVP), poly(ethyleneglycol) or poly(ethylene
oxide) (PEG), ethoxylated poly(ethyleneimine), carboxymethyl inulin
(CMI), and polycarboxylates such as PAA, PAA/PMA, poly-aspartic
acid, and lauryl methacrylate/acrylic acid copolymers,
hydrophobically modified CMC (HM-CMC) and silicones, copolymers of
terephthalic acid and oligomeric glycols, copolymers of
polyethylene terephthalate and polyoxyethene terephthalate
(PET-POET), PVP, poly(vinylimidazole) (PVI),
poly(vinylpyridin-N-oxide) (PVPO or PVPNO) and
polyvinylpyrrolidone-vinylimidazole (PVPVI). Further exemplary
polymers include sulfonated polycarboxylates, polyethylene oxide
and polypropylene oxide (PEO-PPO) and diquaternium ethoxy sulfate.
Other exemplary polymers are disclosed in, e.g., WO 2006/130575.
Salts of the above-mentioned polymers are also contemplated.
Fabric Hueing Agents
[0192] The detergent compositions of the present invention may also
include fabric hueing agents such as dyes or pigments which when
formulated in detergent compositions can deposit onto a fabric when
said fabric is contacted with a wash liquor comprising said
detergent compositions thus altering the tint of said fabric
through absorption/reflection of visible light. Fluorescent
whitening agents emit at least some visible light. In contrast,
fabric hueing agents alter the tint of a surface as they absorb at
least a portion of the visible light spectrum. Suitable fabric
hueing agents include dyes and dye-clay conjugates, and may also
include pigments. Suitable dyes include small molecule dyes and
polymeric dyes. Suitable small molecule dyes include small molecule
dyes selected from the group consisting of dyes falling into the
Colour Index (C.I.) classifications of Direct Blue, Direct Red,
Direct Violet, Acid Blue, Acid Red, Acid Violet, Basic Blue, Basic
Violet and Basic Red, or mixtures thereof, for example as described
in WO 2005/003274, WO 2005/003275, WO 2005/003276 and EP 1876226
(hereby incorporated by reference). The detergent composition
preferably comprises from about 0.00003 wt. % to about 0.2 wt. %,
from about 0.00008 wt. % to about 0.05 wt. %, or even from about
0.0001 wt. % to about 0.04 wt. % fabric hueing agent. The
composition may comprise from 0.0001 wt. % to 0.2 wt. % fabric
hueing agent, this may be especially preferred when the composition
is in the form of a unit dose pouch. Suitable hueing agents are
also disclosed in, e.g., WO 2007/087257, WO 2007/087243.
(Additional) Enzymes
[0193] The detergent additive as well as the detergent composition
may comprise one or more additional enzymes such as a protease,
lipase, cutinase, an amylase, carbohydrase, cellulase, pectinase,
mannanase, arabinase, galactanase, xylanase, oxidase, e.g., a
laccase, and/or peroxidase.
[0194] In general the properties of the selected enzyme(s) should
be compatible with the selected detergent, (i.e., pH-optimum,
compatibility with other enzymatic and non-enzymatic ingredients,
etc.), and the enzyme(s) should be present in effective
amounts.
[0195] Cellulases:
[0196] Suitable cellulases include those of bacterial or fungal
origin. Chemically modified or protein engineered mutants are
included. Suitable cellulases include cellulases from the genera
Bacillus, Pseudomonas, Humicola, Fusarium, Thielavia, Acremonium,
e.g., the fungal cellulases produced from Humicola insolens,
Myceliophthora thermophila and Fusarium oxysporum disclosed in U.S.
Pat. No. 4,435,307, U.S. Pat. No. 5,648,263, U.S. Pat. No.
5,691,178, U.S. Pat. No. 5,776,757 and WO 89/09259.
[0197] Especially suitable cellulases are the alkaline or neutral
cellulases having color care benefits. Examples of such cellulases
are cellulases described in EP 495257, EP 531372, WO 96/11262, WO
96/29397, WO 98/08940. Other examples are cellulase variants such
as those described in WO 94/07998, EP 0 531 315, U.S. Pat. No.
5,457,046, U.S. Pat. No. 5,686,593, U.S. Pat. No. 5,763,254, WO
95/24471, WO 98/12307 and PCT/DK98/00299.
[0198] Commercially available cellulases include Celluzyme.TM., and
Carezyme.TM. (Novozymes NS), Clazinase.TM., and Puradax HA.TM.
(Genencor International Inc.), and KAC-500(B).TM. (Kao
Corporation).
[0199] Proteases:
[0200] Suitable proteases include those of animal, vegetable or
microbial origin. Microbial origin is preferred. Chemically
modified or protein engineered mutants are included. The protease
may be a serine protease or a metalloprotease, preferably an
alkaline microbial protease or a trypsin-like protease. Examples of
alkaline proteases are subtilisins, especially those derived from
Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin
309, subtilisin 147 and subtilisin 168 (described in WO 89/06279).
Examples of trypsin-like proteases are trypsin (e.g., of porcine or
bovine origin) and the Fusarium protease described in WO 89/06270
and WO 94/25583.
[0201] Examples of useful proteases are the variants described in
WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially
the variants with substitutions in one or more of the following
positions: 27, 36, 57, 76, 87, 97, 101, 104, 120, 123, 167, 170,
194, 206, 218, 222, 224, 235, and 274.
[0202] Preferred commercially available protease enzymes include
Alcalase.TM., Savinase.TM. Primase.TM., Duralase.TM., Esperase.TM.,
and Kannase.TM. (Novozymes A/S), Maxatase.TM., Maxacal.TM.
Maxapem.TM., Properase.TM., Purafect.TM., Purafect OxP.TM.,
FN2.TM., and FN3.TM. (Genencor International Inc.).
[0203] Lipases and Cutinases:
[0204] Suitable lipases and cutinases include those of bacterial or
fungal origin. Chemically modified or protein engineered mutants
are included. Examples include lipase from Thermomyces, e.g., from
T. lanuginosus (previously named Humicola lanuginosa) as described
in EP 258068 and EP 305216, cutinase from Humicola, e.g., H.
insolens as described in WO 96/13580, a Pseudomonas lipase, e.g.,
from P. alcaligenes or P. pseudoalcaligenes (EP 218272), P. cepacia
(EP 331376), P. stutzeri (GB 1,372,034), P. fluorescens,
Pseudomonas sp. strain SD 705 (WO 95/06720 and WO 96/27002), P.
wisconsinensis (WO 96/12012), a Bacillus lipase, e.g., from B.
subtilis (Dartois et al., 1993, Biochemica et Biophysica Acta,
1131: 253-360), B. stearothermophilus (JP 64/744992) or B. pumilus
(WO 91/16422).
[0205] Other examples are lipase variants such as those described
in WO 92/05249, WO 94/01541, EP 407225, EP 260105, WO 95/35381, WO
96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO
97/04079, WO 97/07202, WO 00/60063, WO 2007/087508 and WO
2009/109500.
[0206] Preferred commercially available lipase enzymes include
Lipolase.TM., Lipolase Ultra.TM.' and Lipex.TM.; Lecitase.TM.,
Lipolex.TM.; Lipoclean.TM., Lipoprime.TM. (Novozymes A/S). Other
commercially available lipases include Lumafast (Genencor Int Inc);
Lipomax (Gist-Brocades/Genencor Int Inc) and Bacillus sp lipase
from Solvay.
[0207] Amylases:
[0208] Suitable amylases (.alpha. and/or .beta.) include those of
bacterial or fungal origin. Chemically modified or protein
engineered mutants are included. Amylases include, for example,
.alpha.-amylases obtained from Bacillus, e.g., a special strain of
Bacillus licheniformis, described in more detail in GB
1,296,839.
[0209] Examples of useful amylases are the variants described in WO
94/02597, WO 94/18314, WO 96/23873, and WO 97/43424, especially the
variants with substitutions in one or more of the following
positions: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181, 188,
190, 197, 202, 208, 209, 243, 264, 304, 305, 391, 408, and 444.
[0210] Commercially available amylases are Stainzyme.TM.,
Natalase.TM., Duramyl.TM., Termamyl.TM., Fungamyl.TM. and BAN.TM.
(Novozymes A/S), Rapidase.TM. and Purastar.TM. (from Genencor
International Inc.).
[0211] Peroxidases/Oxidases:
[0212] Suitable peroxidases/oxidases include those of plant,
bacterial or fungal origin. Chemically modified or protein
engineered mutants are included. Examples of useful peroxidases
include peroxidases from Coprinus, e.g., from C. cinereus, and
variants thereof as those described in WO 93/24618, WO 95/10602,
and WO 98/15257.
[0213] Commercially available peroxidases include Guardzyme.TM.
(Novozymes NS).
[0214] The detergent enzyme(s) may be included in a detergent
composition by adding separate additives containing one or more
enzymes, or by adding a combined additive comprising all of these
enzymes. A detergent additive of the invention, i.e., a separate
additive or a combined additive, can be formulated, for example, as
a granulate, liquid, slurry, etc. Preferred detergent additive
formulations are granulates, in particular non-dusting granulates,
liquids, in particular stabilized liquids, or slurries.
[0215] Non-dusting granulates may be produced, e.g., as disclosed
in U.S. Pat. Nos. 4,106,991 and 4,661,452 and may optionally be
coated by methods known in the art. Examples of waxy coating
materials are poly(ethylene oxide) products (polyethyleneglycol,
PEG) with mean molar weights of 1000 to 20000; ethoxylated
nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated
fatty alcohols in which the alcohol contains from 12 to 20 carbon
atoms and in which there are 15 to 80 ethylene oxide units; fatty
alcohols; fatty acids; and mono- and di- and triglycerides of fatty
acids. Examples of film-forming coating materials suitable for
application by fluid bed techniques are given in GB 1483591. Liquid
enzyme preparations may, for instance, be stabilized by adding a
polyol such as propylene glycol, a sugar or sugar alcohol, lactic
acid or boric acid according to established methods. Protected
enzymes may be prepared according to the method disclosed in EP
238216.
Adjunct Materials
[0216] Any detergent components known in the art for use in laundry
detergents may also be utilized. Other optional detergent
components include anti-corrosion agents, anti-shrink agents,
anti-soil redeposition agents, anti-wrinkling agents, bactericides,
binders, corrosion inhibitors, disintegrants/disintegration agents,
dyes, enzyme stabilizers (including boric acid, borates, CMC,
and/or polyols such as propylene glycol), fabric conditioners
including clays, fillers/processing aids, fluorescent whitening
agents/optical brighteners, foam boosters, foam (suds) regulators,
perfumes, soil-suspending agents, softeners, suds suppressors,
tarnish inhibitors, and wicking agents, either alone or in
combination. Any ingredient known in the art for use in laundry
detergents may be utilized. The choice of such ingredients is well
within the skill of the artisan.
Dispersants--
[0217] The detergent compositions of the present invention can also
contain dispersants.
[0218] In particular powdered detergents may comprise dispersants.
Suitable water-soluble organic materials include the homo- or
co-polymeric acids or their salts, in which the polycarboxylic acid
comprises at least two carboxyl radicals separated from each other
by not more than two carbon atoms. Suitable dispersants are for
example described in Powdered Detergents, Surfactant science series
volume 71, Marcel Dekker, Inc.
Dye Transfer Inhibiting Agents--
[0219] The detergent compositions of the present invention may also
include one or more dye transfer inhibiting agents. Suitable
polymeric dye transfer inhibiting agents include, but are not
limited to, polyvinylpyrrolidone polymers, polyamine N-oxide
polymers, copolymers of N-vinylpyrrolidone and N-vinylimidazole,
polyvinyloxazolidones and polyvinylimidazoles or mixtures thereof.
When present in a subject composition, the dye transfer inhibiting
agents may be present at levels from about 0.0001% to about 10%,
from about 0.01% to about 5% or even from about 0.1% to about 3% by
weight of the composition.
Fluorescent Whitening Agent--
[0220] The detergent compositions of the present invention will
preferably also contain additional components that may tint
articles being cleaned, such as fluorescent whitening agent or
optical brighteners. Where present the brightener is preferably at
a level of about 0.01% to about 0.5%. Any fluorescent whitening
agent suitable for use in a laundry detergent composition may be
used in the composition of the present invention. The most commonly
used fluorescent whitening agents are those belonging to the
classes of diaminostilbene-sulphonic acid derivatives,
diarylpyrazoline derivatives and bisphenyl-distyryl derivatives.
Examples of the diaminostilbene-sulphonic acid derivative type of
fluorescent whitening agents include the sodium salts of:
4,4'-bis-(2-diethanolamino-4-anilino-s-triazin-6-ylamino)
stilbene-2,2'-disulphonate;
4,4'-bis-(2,4-dianilino-s-triazin-6-ylamino)
stilbene-2,2'-disulphonate;
4,4'-bis-(2-anilino-4(N-methyl-N-2-hydroxy-ethylamino)-s-triazin-6-ylamin-
o) stilbene-2,2'-disulphonate,
4,4'-bis-(4-phenyl-2,1,3-triazol-2-yl)stilbene-2,2'-disulphonate;
4,4'-bis-(2-anilino-4(1-methyl-2-hydroxy-ethylamino)-s-triazin-6-ylamino)
stilbene-2,2'-disulphonate and
2-(stilbyl-4''-naptho-1,2':4,5)-1,2,3-trizole-2''-sulphonate.
Preferred fluorescent whitening agents are Tinopal DMS and Tinopal
CBS available from Ciba-Geigy AG, Basel, Switzerland. Tinopal DMS
is the disodium salt of 4,4'-bis-(2-morpholino-4
anilino-s-triazin-6-ylamino) stilbene disulphonate. Tinopal CBS is
the disodium salt of 2,2'-bis-(phenyl-styryl)disulphonate. Also
preferred are fluorescent whitening agents is the commercially
available Parawhite KX, supplied by Paramount Minerals and
Chemicals, Mumbai, India. Other fluorescers suitable for use in the
invention include the 1-3-diaryl pyrazolines and the
7-alkylaminocoumarins.
[0221] Suitable fluorescent brightener levels include lower levels
of from about 0.01, from 0.05, from about 0.1 or even from about
0.2 wt. % to upper levels of 0.5 or even 0.75 wt. %.
Soil Release Polymers--
[0222] The detergent compositions of the present invention may also
include one or more soil release polymers which aid the removal of
soils from fabrics such as cotton and polyester based fabrics, in
particular the removal of hydrophobic soils from polyester based
fabrics. The soil release polymers may for example be nonionic or
anionic terephthalte based polymers, polyvinyl caprolactam and
related copolymers, vinyl graft copolymers, polyester polyamides
see for example Chapter 7 in Powdered Detergents, Surfactant
science series volume 71, Marcel Dekker, Inc. Another type of soil
release polymers are amphiphilic alkoxylated grease cleaning
polymers comprising a core structure and a plurality of alkoxylate
groups attached to that core structure. The core structure may
comprise a polyalkylenimine structure or a polyalkanolamine
structure as described in detail in WO 2009/087523 (hereby
incorporated by reference). Furthermore random graft co-polymers
are suitable soil release polymers Suitable graft co-polymers are
described in more detail in WO 2007/138054, WO 2006/108856 and WO
2006/113314 (hereby incorporated by reference). Other soil release
polymers are substituted polysaccharide structures especially
substituted cellulosic structures such as modified cellulose
deriviatives such as those described in EP 1867808 or WO
2003/040279 (both are hereby incorporated by reference). Suitable
cellulosic polymers include cellulose, cellulose ethers, cellulose
esters, cellulose amides and mixtures thereof. Suitable cellulosic
polymers include anionically modified cellulose, nonionically
modified cellulose, cationically modified cellulose,
zwitterionically modified cellulose, and mixtures thereof. Suitable
cellulosic polymers include methyl cellulose, carboxy methyl
cellulose, ethyl cellulose, hydroxyl ethyl cellulose, hydroxyl
propyl methyl cellulose, ester carboxy methyl cellulose, and
mixtures thereof.
Anti-Redeposition Agents--
[0223] The detergent compositions of the present invention may also
include one or more anti-redeposition agents such as
carboxymethylcellulose (CMC), polyvinyl alcohol (PVA),
polyvinylpyrrolidone (PVP), polyoxyethylene and/or
polyethyleneglycol (PEG), homopolymers of acrylic acid, copolymers
of acrylic acid and maleic acid, and ethoxylated
polyethyleneimines. The cellulose based polymers described under
soil release polymers above may also function as anti-redeposition
agents.
Other suitable adjunct materials include, but are not limited to,
anti-shrink agents, anti-wrinkling agents, bactericides, binders,
carriers, dyes, enzyme stabilizers, fabric softeners, fillers, foam
regulators, hydrotropes, perfumes, pigments, sod suppressors,
solvents, and structurants for liquid detergents and/or structure
elasticizing agents.
Formulation of Detergent Products
[0224] The detergent composition of the invention may be in any
convenient form, e.g., a bar, a homogenous tablet, a tablet having
two or more layers, a pouch having one or more compartments, a
regular or compact powder, a granule, a paste, a gel, or a regular,
compact or concentrated liquid.
[0225] Detergent formulation forms: Layers (same or different
phases), Pouches, versus forms for Machine dosing unit.
[0226] Pouches can be configured as single or multicompartments. It
can be of any form, shape and material which is suitable for hold
the composition, e.g., without allowing the release of the
composition to release of the composition from the pouch prior to
water contact. The pouch is made from water soluble film which
encloses an inner volume. Said inner volume can be divided into
compartments of the pouch. Preferred films are polymeric materials
preferably polymers which are formed into a film or sheet.
Preferred polymers, copolymers or derivates thereof are selected
polyacrylates, and water soluble acrylate copolymers, methyl
cellulose, carboxy methyl cellulose, sodium dextrin, ethyl
cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose,
malto dextrin, poly methacrylates, most preferably polyvinyl
alcohol copolymers and, hydroxypropyl methyl cellulose (HPMC).
Preferably the level of polymer in the film for example PVA is at
least about 60%. Preferred average molecular weight will typically
be about 20,000 to about 150,000. Films can also be of blend
compositions comprising hydrolytically degradable and water soluble
polymer blends such as polyactide and polyvinyl alcohol (known
under the Trade reference M8630 as sold by Chris Craft In. Prod. Of
Gary, Ind., US) plus plasticisers like glycerol, ethylene glycerol,
Propylene glycol, sorbitol and mixtures thereof. The pouches can
comprise a solid laundry cleaning composition or part components
and/or a liquid cleaning composition or part components separated
by the water soluble film. The compartment for liquid components
can be different in composition than compartments containing
solids. Ref: (US 2009/0011970).
[0227] Detergent ingredients can be separated physically from each
other by compartments in water dissolvable pouches or in different
layers of tablets. Thereby negative storage interaction between
components can be avoided. Different dissolution profiles of each
of the compartments can also give rise to delayed dissolution of
selected components in the wash solution.
Definition/Characteristics of the Forms
[0228] A liquid or gel detergent, which is not unit dosed, may be
aqueous, typically containing at least 20% by weight and up to 95%
water, such as up to about 70% water, up to about 65% water, up to
about 55% water, up to about 45% water, up to about 35% water.
Other types of liquids, including without limitation, alkanols,
amines, diols, ethers and polyols may be included in an aqueous
liquid or gel. An aqueous liquid or gel detergent may contain from
0-30% organic solvent.
[0229] A liquid or gel detergent may be non-aqueous.
Granular Detergent Formulations
[0230] A granular detergent may be formulated as described in WO
2009/092699, EP 1705241, EP 1382668, WO 2007/001262, U.S. Pat. No.
6,472,364, WO 2004/074419 or WO 2009/102854. Other useful detergent
formulations are described in WO 2009/124162, WO 2009/124163, WO
2009/117340, WO 2009/117341, WO 2009/117342, WO 2009/072069, WO
2009/063355, WO 2009/132870, WO 2009/121757, WO 2009/112296, WO
2009/112298, WO 2009/103822, WO 2009/087033, WO 2009/050026, WO
2009/047125, WO 2009/047126, WO 2009/047127, WO 2009/047128, WO
2009/021784, WO 2009/010375, WO 2009/000605, WO 2009/122125, WO
2009/095645, WO 2009/040544, WO 2009/040545, WO 2009/024780, WO
2009/004295, WO 2009/004294, WO 2009/121725, WO 2009/115391, WO
2009/115392, WO 2009/074398, WO 2009/074403, WO 2009/068501, WO
2009/065770, WO 2009/021813, WO 2009/030632, WO 2009/015951, WO
2011/025615, WO 2011/016958, WO 2011/005803, WO 2011/005623, WO
2011/005730, WO 2011/005844, WO 2011/005904, WO 2011/005630, WO
2011/005830, WO 2011005912, WO 2011/005905, WO 2011/005910, WO
2011/005813, WO 2010/135238, WO 2010120863, WO 2010/108002, WO
2010/111365, WO 2010/108000, WO 2010/107635, WO 2010090915, WO
2010/033976, WO 2010/033746, WO 2010/033747, WO 2010/033897, WO
2010033979, WO 2010/030540, WO 2010/030541, WO 2010/030539, WO
2010/024467, WO 2010/024469, WO 2010/024470, WO 2010/025161, WO
2010/014395, WO 2010/044905, WO 2010/145887, WO 2010/142503, WO
2010/122051, WO 2010/102861, WO 2010/099997, WO 2010/084039, WO
2010/076292, WO 2010/069742, WO 2010/069718, WO 2010/069957, WO
2010/057784, WO 2010/054986, WO 2010/018043, WO 2010/003783, WO
2010/003792, WO 2011/023716, WO 2010/142539, WO 2010/118959, WO
2010/115813, WO 2010/105942, WO 2010/105961, WO 2010/105962, WO
2010/094356, WO 2010/084203, WO 2010/078979, WO 2010/072456, WO
2010/069905, WO 2010/076165, WO 2010/072603, WO 2010/066486, WO
2010/066631, WO 2010/066632, WO 2010/063689, WO 2010/060821, WO
2010/049187, WO 2010/031607, WO 2010/000636.
Method of Producing the Composition
[0231] The present invention also relates to methods of producing
the composition.
Uses
[0232] The present invention is also directed to methods for using
the compositions thereof.
[0233] Laundry/textile/fabric (House hold laundry washing,
Industrial laundry washing)
[0234] Hard surface cleaning (ADW, car wash, Industrial
surface)
[0235] Use in Detergents.
[0236] The polypeptides of the present invention may be added to
and thus become a component of a detergent composition.
[0237] The detergent composition of the present invention may be
formulated, for example, as a hand or machine laundry detergent
composition including a laundry additive composition suitable for
pre-treatment of stained fabrics and a rinse added fabric softener
composition, or be formulated as a detergent composition for use in
general household hard surface cleaning operations, or be
formulated for hand or machine dishwashing operations.
[0238] In a specific aspect, the present invention provides a
detergent additive comprising a polypeptide of the present
invention as described herein.
[0239] The gene may be obtained from any prokaryotic, eukaryotic,
or other source.
[0240] The present invention is further described by the following
examples that should not be construed as limiting the scope of the
invention.
EXAMPLES
Strains
[0241] Aspergillus oryzae MT3568 strain was used for expression of
the T. lapidaria gene encoding the polypeptides having cellulase
activity. A. oryzae MT3568 is an amdS (acetamidase) disrupted gene
derivative of Aspergillus oryzae JaL355 (WO 02/40694) in which pyrG
auxotrophy was restored by disrupting the A. oryzae acetamidase
(amdS) gene with the pyrG gene.
Media and Solutions
[0242] LB plates were composed of 10 g of Bacto-Tryptone, 5 g of
yeast extract, 10 g of sodium chloride, 15 g of Bacto-agar, and
deionized water to 1 liter.
[0243] LB medium was composed of 10 g of Bacto-Tryptone, 5 g of
yeast extract, and 10 g of sodium chloride, and deionized water to
1 liter.
[0244] YP medium was composed of 10 g of yeast extract, 20 g of
Bactopeptone, and deionized water to 1 liter.
[0245] SOC medium: 20 g Bacto-Tryptone, 5 g yeast extract and 0.5 g
NaCl is dissolved in 1 liter of water. 10 ml 250 mM KCl is added
and pH is adjusted to 7.0. The medium is autoclaved. After cooling
to 60.degree. C. 18 ml of sterile filtered 20% glucose and 5 ml of
a 2 M MgCl.sub.2 solution is added.
TABLE-US-00001 COVE Medium 20 ml salt solution 20 g agar 218 g
sorbitol H.sub.2O ad 1 l Autoclave and then add: 50 ml 20% glucose
10 mM NaNO.sub.3. Salt solution: 26 g KCl 26 g MgSO.sub.47H.sub.2O
76 g KH.sub.2PO.sub.4 50 ml trace element solution H.sub.2O ad 1 l
Sucrose 20 ml salt solution medium: 342 g sucrose H.sub.2O ad 1 l
Autoclave and then add: 10 mM NaNO.sub.3 ST 0.6M sorbitol 100 mM
Tris/HCl pH 7.0 STC 1.2M sorbitol 10 mM CaCl.sub.2 10 mM Tris/HCl
pH 7.5 PEG 60% (W/V) PEG 4000 (BDH) in H.sub.2O 10-20 sec. in
microwave oven until it is dissolved, cool down to RT then add 10
mM CaCl.sub.2 10 mM Tris/HCl pH 7.5 Topagar: 20 ml salt solution
342 g sucrose 6 g Low melting agarose (BioWhittaker Molecular
Applications 1-800-341-1574) It is important to adjust the pH to 6,
with a few drops of 4M NaOH H.sub.2O ad 1 L Autoclave Before use,
boil and cold down to approx. 40.degree. C. Amds selection: add 10
mM Acetamid and 15 mM CsCl amdS 20 g agar selective 20 ml
Saltsolution plates 342 g sucrose pH is adjusted to 6, with a few
drops of 4M NaOH H.sub.2O ad 1 l Autoclave 10 ml 1M acetamide 15 ml
1M CsCl
Methods
Temperature Optimum
[0246] 50 .mu.L sample in appropriate dilution was mixed with 750
.mu.L AZCL-HE-cellulose in 0.1 M Na-phosphate. The samples were
incubated at temperature covering 20 to 80.degree. C. in
thermo-mixers (1400 rpm agitation, 20 min). After the incubation,
unhydrolyzed substrate was removed by centrifugation and 200 .mu.L
supernatant from each sample was transferred to a 96-hole
microtitre plate. Absorbance at 600 nm was determined using a
PowerWave microtitre plate reader. Activity was expressed as
absorbance units.
Specific Activity Analysis
Specific Activity on PASC (Amorphous Cellulose; Phosphoric Acid
Swollen Cellulose)
[0247] 20 g PASC (amorphous cellulose; phosphoric acid swollen
cellulose) (10% w/v) was centrifuged for 10 min, 5000 rpm.
Supernatant was removed and the pellet was resuspended in 40 mL 0.1
M Na-phosphate buffer followed by a similar centrifugation step.
The insolubles were resuspended in 20 mL 0.1 M Na-phosphate buffer.
Substrate solution was preincubated at 40.degree. C. for 5 min and
500 .mu.L enzyme solution was added.
TABLE-US-00002 Enzyme solution/ Substrate (.mu.L) Buffer (.mu.L)
glu standard (.mu.L) 500 1500 500
[0248] The sample was mixed and incubated for 20 min at 40.degree.
C. The reaction was stopped by adding 500 .mu.L 2% NaOH. The
samples were centrifuged for 15 min at 5000 rpm. 1000 .mu.L
supernatant was mixed with 500 .mu.L PHBAH-solution. The samples
were boiled for 10 min and cooled. A410 was measured on all
samples. The standard curve was done by replacing the enzyme
solution with glucose with known concentrations (0-50 mg/L). Enzyme
blanks were also added for each enzyme dilution (enzyme was added
after the addition of 2% NaOH).
PHBAH Solution
[0249] 1 g PHBAH in 100 mL 2% NaOH. 100 .mu.L Bismuth solution was
added.
Bismuth Solution
[0250] 1 mol Bismuth nitrate
1 mol K/Na-tartrat
[0251] 3 mol NaOH (solid)
100 mL H.sub.2O
[0252] Specific activity on carboxymethyl-cellulose was determined
using CMC 7LF. A stock solution of 1% CMC was prepared. 1500 .mu.L
substrate was mixed with 500 .mu.L diluted enzyme. The samples were
incubated for 20 min at 40.degree. C. on temperate water batch.
After 20 min, 1000 .mu.L PHBAH/bismuth (1.5 g PHBAH+5 g K/Na
tartrate+100 mL 2% NaOH) stop reagent was added. Samples were
boiled for 10 min and were immediately cooled on ice. The
absorbance was read at 410 nm. A standard curve was also mixed
using glucose (0 to 50 mg/L).
Wash Performance
[0253] Wash performance is testes as anti-redeposition test in
mini-TOM with dirty detergent (5 ppm carbon black in 1/2 dose
Liquid Persil small & mighty non-Bio) at 24 FH and 25.degree.
C.
[0254] The trials are run in 250 ml beakers. 8 pieces of pre-washed
wfk 80A (pre-wash procedure see below), 5.times.5 cm are loaded in
the beakers together with flotte: 100 ml, 1.25 mL/L detergent, 24
FH (13,45.degree. dH) (Ca.sup.2+/Mg.sup.2+=2:1, no HCO.sub.3), pH
as in the detergent, 5 ppm carbon black and the enzyme sample. The
beakers are shaken, 125-150 rpm at a temperature of 25.degree. C.
for three hours. Swatches are rinsed in running tap water.
[0255] There are 8 swatches. After 1 h and 2 h a swatch is removed
from the load, i.e., 6 swatches are included in 3 h.
[0256] Carbon: A stock solution of carbon black is made by
dispersing 100 mg carbon black in 50 mL flotte providing a
concentration of 2 mg per mL. The flotte is to contain 5 ppm
carbon; i.e., 2.5 ml stock solution per litre flotte is added. The
mixture is stirred for half an hour before addition to the
detergent solution as well as during the flotte during
portioning.
Test/Analysis
[0257] Macbeth Color-Eye measurement of swatches at 500 nm after 1
h, 2 h and 3 h incubation in a dirty detergent. In all cases
measurement is done through 2-6 layers of fabric. Each swatch is
measured 2 times, 1 time on front and 1 time on bag site, with
aperture large and observation D65 daylight.
Pre-Wash wfk 80A
[0258] Desizing: Washed in Miele 60.degree. C. cotton standard wash
program in tap water, with 4 g/L IEC A* without CMC and Enzyme and
1.2 mg ep/L (0.09 g/L or 2.2%) Stainzyme (Novozymes NS, Bagsvaerd
Denmark).
[0259] Prewash: Washed in Miele 95.degree. C. cotton standard wash
program with extra rinse in tap water, with 4 g/L IEC A* without
CMC and Enzyme
[0260] Rinse: Rinsed in Miele standard rinse program in deionized
water.
Example 1
Isolation of the Terebella GH9 Cellulase
[0261] In a DNA sequencing project based on the marine organisms
the marine polychaete Terebella lapidaria was collected from Ria de
Formosa, The Algarve, Southern Portugal. Nucleic acid material was
isolated and two channels of Terebella RNA was sequenced with
RNA-sep technology in an illumine HTS sequences in accordance with
the manufacturers instructions.
[0262] A GH9 hydrolase was identified in the project having the
nucleotide sequence disclosed in SEQ ID NO: 1. The gene encodes a
polypeptide of 428 amino acid having the structure of a GH9
cellulase with the amino acid sequence shown in SEQ ID NO: 2.
Example 2
Expression of the Terebella GH9 Cellulase
Preparation of Expression Construct
[0263] The coding sequence for the Terebella cellulose was PCR
cloned using the primers
TABLE-US-00003 TLGH9F (SEQ ID NO: 3)
GTGAAGCGTACGCGTTACGACTACGCCGATGCGCTGG TLGH9R (SEQ ID NO: 4)
AGATCTCGAGAAGCTTATCACAAGCCCAGACTGAGGAGACC
[0264] The primers contain MluI and HindIII restriction sites for
integration of the isolated fragment into the selected expression
vector. The underlined region of TLGH9F represents the MluI site
used for the in frame fusion between the Candida B lipase
signal-pre pro region and the predicted mature peptide of the
GH9.
[0265] cDNA fragments generated by Marathon cDNA Amplification kit
from Clontech (cat. Nr 634913) according to the manufacturer's
instructions. The resulting cDNA fragments were used as
template.
[0266] The primers above were used in a PCR reaction composed of
100 ng of Terebella lapidaria cDNA. The cDNA was diluted in TE
Buffer (10 mM Tris, 1 mM EDTA) pH 8.0 to 100 ng/.mu.l. A PTC-200
DNA engine (MJ Research Inc., Waltham, Mass., USA) was used to
perform the PCR reaction. Extensor Long PCR Master Mix, Buffer 1,
ReddyMix.TM. version (AB Gene Ltd., Epsom United Kingdom) was used
for the PCR amplification. The master mix contains buffer, dNTPs
and a thermostable polymerase blend.
[0267] The PCR reaction was composed of 20 .mu.l of Extensor Long
PCR Master Mix, Buffer 1, ReddyMix.TM. version, 1 .mu.l of primer
TLGH9F (100 .mu.M), 1 .mu.l of primer TLGH9R (100 .mu.M), 1 .mu.l
of T. lapidaria cDNA (100 ng/.mu.l), and 17 .mu.l of deionized
water in a total volume of 40 .mu.l. The PCR conditions were 1
cycle at 95.degree. C. for 2 minutes. 30 cycles each at 94.degree.
C. for 10 seconds, 55.degree. C. for 30 seconds, and 68.degree. C.
for 1 minute; and 1 cycle at 68.degree. C. for 10 minutes. The
sample was then held at 10.degree. C. until removed from the PCR
machine.
[0268] The reaction product was isolated by 1.0% agarose gel
electrophoresis using 40 mM Tris base, 20 mM sodium acetate, 1 mM
disodium EDTA (TAE) buffer where a 1.3 kb product band was excised
from the gel and purified using an illustra GFX.RTM. PCR DNA and
Gel Band Purification Kit (GE Healthcare Life Sciences, Brondby,
Denmark) according to the manufacturer's instructions. The fragment
was then cloned into MleI and HindIII digested pDau222 using an
IN-FUSION.TM. Cloning Kit resulting in plasmid pGH9-7-2.
[0269] The vector used was pDau222, an Aspergillus expression
plasmid based on pDau109 (WO 2005/042735). To create pDau222 from
pDau109, the following BamHI-HindIII flanked insert was used to
replace the BamHI-HindIII insert of pDau222:
TABLE-US-00004 (SEQ ID NO: 5)
GGATCCACCATGAAGCTACTCTCTCTGACCGGTGTGGCTGGTGTG
CTTGCGACTTGCGTTGCAGCCACTCCTTTGGTGAAGCGTACGCGT
GCGCATCACCATCACCATCACTAAGCTT.
[0270] The underlined portions denote the BamHI, MluI and HindIII
restriction sites respectively. The codons representing the KexB
cleavage site are shown in bold. The insert enables the fusion of a
signal less coding region of interest with the Candida anartica
lipase B (CalB) secretion signal and pre pro region via utilization
of the MluI cloning site. The ATG start codon of the CalB region is
optimally placed for expression from the NA2-tpi promoter.
Placement of the coding region of interest between the MluI site
and the HindIII site can result in a secreted protein that is
further cleaved by the KexB processing protease to a mature
protein. A translation of the insert from the ATG start codon is as
follows:
TABLE-US-00005 (SEQ ID NO: 6)
MKLLSLTGVAGVLATCVAATPLVKRTRAHHHHHH
[0271] The cleavable region of the CalB signal is underlined and
the KexB protease cleavage site is shown in bold. The poly
histidines displayed are available for His-Tag C terminal fusions
or can be omitted from the expression by presence of a stop codon
to the coding region of interest.
[0272] The cloning of the pGH9-7-2 gene into MleI HindIII digested
pDau222 resulted in the transcription of the Terebella lapidaria
open reading frame under the under the control of a NA2-tpi double
promoter. NA2-tpi is a modified promoter from the gene encoding the
Aspergillus niger neutral alpha-amylase in which the untranslated
leader has been replaced by an untranslated leader from the gene
encoding the Aspergillus nidulans triose phosphate isomerase.
[0273] For cloning the isolated PCR fragment and 300 ng pDau222
precut with MluI and HindIII were mixed in a 2:1 molar ratio in 10
.mu.l deionized water. The aluminium seal was removed from a
In-Fusion reaction tube kit and 10 .mu.l of the mixture containing
fragment and vector was added and carefully mixed. The mixture was
incubated at room temperature (appx 25.degree. C.) for 30 minutes
and thereafter the tube was transferred to ice. The In-fusion
reaction mixture was diluted with 40 .mu.l TE buffer (10 mM
Tris-HCl, 1 mM EDTA pH 8.0) and stored at -20.degree. C. until
use.
[0274] The diluted reaction mixture was transformed into competent
Fusion Blue Competent cells (Clontech Inc.) using the instructions
of the manufacturer. 4 .mu.l of the diluted reaction mixtire was
gently mixed with 50 .mu.l of the thawed competent cells and the
mixture incubated 30 minutes on ice. The cells are heat shocked in
a water bath at 42.degree. C. for 45 s and thereafter returned to
ice for 1 minute. After heat showing 250 .mu.l SOC medium was added
to the cells and the mixture was incubated at 37.degree. C. for 90
minutes with shaking at 220 rpm. 20 .mu.l of the cells were spread
on a LB+50 .mu.g/ml ampicillin, the remaining cells were spread on
another plate and the plates were incubated over night at
37.degree. C.
[0275] Next day several colonies appeared on the LB plates. 10
random colonies were picked and grown over night in 3 ml LB+100
.mu.g/ml ampicillin, plasmid DNA was prepared from these colonies
using the "FASTPlasmid mini kit" from SPrime according to the
manufacturer's instructions. The isolated plasmids were sequenced
in order to confirm the sequence (data not shown). One clone with
correct sequence was selected and incubated over night in 50 ml
LB+50 .mu.g/ml ampicillin at 37.degree. C. at 225 rpm. Plasmid DNA
was prepared from the culture using a Qiagen Compact Prep midi kit,
cat. nr: 12743. Protocol according to the manufacturer.
Transformation of Aspergillus Expression Host
[0276] 2.5 .mu.g of the prepared expression construct was
transformed into Aspergillus oryzae MT3568 using the following
protocol: [0277] An agar slant (COVE medium) is inoculated with
spores of the strain in question (MT3568), and the strain is grown
at 37.degree. C. for approx 6 days (until it is completely
sporulated). Slants can be stored in the cold for approx 2 months.
[0278] 5-10 ml YP medium is added to the slant, and the spores are
suspended. The spore suspension is transferred to a 500 ml Nalgene
plastic shakeflask, containing 100 ml sucrose medium. The flask is
incubated at 30.degree. C. for 20 hr (270 rpm). [0279] The mycelium
is collected by filtration through mira cloth (Calbiochem Cat. No
475855), and it is washed using 200 ml 0.6 M MgSO.sub.4. The
remaining liquid is squeezed out of the mycelium using a plastic
pipette. [0280] 1-2 g of the mycelium is transferred to a 125 ml
Nalgene plastic erlenmeyer flask. 15 ml 1.2 M MgSO.sub.4, 10 mM
NaH.sub.2PO.sub.4 pH 5.8 containing 750 mg Glucanex.RTM. 200 G.
(Novozymes Bagsvaerd, Denmark) batch KM629002), is added, and the
mycelium is suspended. Put on ice for 5 minutes. 1 ml of 12 mg/ml
BSA (sterile filtered) is added. [0281] The suspension is incubated
at 37.degree. C. for 1.5-2 hours, and the protoplasting is
monitored frequently by microscopy. [0282] The protoplast
suspension is filtered through mira cloth into a 25 ml NUNC tube
(or similar), and the suspension is overlaid with 5 ml ST (be
careful not to mix up the lower layer), and the protoplasts are
banded by centrifugation (2500 rpm, 15 min, slow acc.). The
interface band of protoplasts is recovered using a P1000 pipette
and transferred to a fresh tube. [0283] The protoplasts are diluted
with 2 volumes of STC followed by centrifugation (2500 rpm, 5 min).
The protoplasts are washed twice with STC (using resuspension and
centrifugation), and are then resuspended in STC to a concentration
of approx 5.times.10.sup.7 protoplasts/ml. In most case
resuspending in 4-5 ml of STC will give the correctly
concentration. [0284] For each transformation, DNA is added at to
bottom in a tube, and 100 .mu.l of protoplasts are added. After 10
minutes of incubation (RT), 250 .mu.l of PEG is added, and the tube
is gently mixed by hand. After 30 minutes of incubation (37.degree.
C.), 4 ml of topagar (temp 40.degree. C.) is added. The protoplasts
are plated onto selective plates. [0285] The plates are incubated
at 37.degree. C. until transformants are clearly visible and start
to sporulate.
[0286] 16 Transformants were picked and grown in dep well
microtiterplates containing 750 ml/well of YP+2% glucose for 4 days
at 26.degree. C. Supernatants from the transformants were tested
for cellulose activity on AZCL-He-cellulose in microtiterplates. 50
.mu.l supernatant was mixed with 200 .mu.l AZCL-He-cellulose
mixture (0.1% AZCL-He-Cellulose in 0.2 M MOPS buffer, pH 7.0) and
incubated at 26.degree. C. over night. The supernatants from all
transformants have activity in this assay demonstrating that the
Terebella GH9 cellulase has activity on AZCL-He-cellulose.
Example 3
Purification and Characterization of the Cellulase
Purification of the Cellulase
[0287] One transformant prepared in example 2, was grown in 1 liter
YP+2% glucose medium 4 days at 26.degree. C. in shake flasks at 225
rpm, and the supernatant collected for purification of the cloned
cellulose.
[0288] Culture broth was sterile filtered through 0.2 .mu.m PES
bottle-top filters. 800 ml broth was concentrated using ultra
filtration (Sartorium 10 kDa PES membrane) resulting in 250 ml
concentrate, which was mixed with an equal volume of a 2 M
(NH.sub.4).sub.2SO.sub.4 solution in 40 mM Tris-HCl, pH 8.0. The
precipitate was removed by centrifugation and the fluid was loaded
on a 16 ml PhenylSepharose HP column. Unbound material was removed
by washing with the binding buffer (1 M (NH.sub.4).sub.2SO.sub.4
solution in 20 mM Tris-HCl, pH 8.0). Elution was done by a linear
decreasing gradient (NH.sub.4).sub.2SO.sub.4 (1.0 M to 0.0 M).
Fractions of 10 ml were collected and analysed for endo-glucanase
activity on AZCL-HE-cellulose.
[0289] Activity analysis was carried out using 0.2%
AZCL-HE-cellulose. Briefly, 750 .mu.L substrate slurry in 50 mM
Na-Phosphate buffer, pH 7.5 was incubated with 50 .mu.L sample. The
samples were incubated for 20 min on a thermo mixer with full
agitation (1400 rpm, 40.degree. C.). Samples developing blue color
were treated as endoglucanase positive. The endoglucanse positive
fractions were analyzed for purity using SDS-PAGE. Fractions
evaluated as pure were pooled.
[0290] Protein concentration was determined by measuring A.sub.280
and .epsilon.=127590 M.sup.-1 cm.sup.-1 and a theoretical molecular
weight of 47601 g/mol. These parameters were calculated using the
software GPMAW (Lighthouse software, DK).
[0291] The estimated purify was >95% pure based on visual
determination from an SDS-PAGE. The apparent molecular weight was
50 kDa, a value in agreement with the expected molecular
weight.
[0292] Protein concentration of the purified preparation was
estimated to 0.77 mg/mL.
pH Optimum
[0293] The pH optimum was determined using amorphous cellulose
(PASC) and reducing sugar quantification. Max activity was observed
at pH 6 but the enzyme also displayed >50% activity from pH 5 to
9 (see FIG. 1).
Specific Activity
TABLE-US-00006 [0294] Substrate Specific activity Conditions CMC
270 IU/mg Reducing ends, pH 7.0, 40.degree. C. PASC 11 IU/mg
Reducing ends, pH 7.0, 40.degree. C.
[0295] Thus, the activity on CMC was done by measuring the
liberation of reducing sugars using PHBAH as reagent. The analysis
revealed a specific activity of 270 IU/mg. Many of the
endoglucanases described in 2008-07497-20 have much lower specific
activity on CMC. However, CMC is an artificial cellulose substrate.
A more "real life" substrate is phosphoric acid swollen cellulose,
which is believed to consist of mainly amorphous cellulose. The
observed specific activity on this substrate was 11 IU/mg. As a
comparison, approximately 80 IU/mg has been reported for Humicola
insolens cellulase (WO 91/17243).
Temperature Profile
[0296] The temperature profile is presented in FIG. 2. This enzyme
did not show any signs of being a low temperature cellulase. On the
contrary, the temperature optimum was 60.degree. C. and at
70.degree. C. it displayed 70% of its maximum activity.
Example 4
Wash Performance
[0297] The wash performance of the Terebella cellulase was tested
using was an anti-redeposition test, where white cotton fabric is
washed in a detergent solution supplemented with carbon black. It
has been shown previously that the addition of an endoglucanase can
reduce the amount of carbon black sticking to the fabric in these
rather stressed wash conditions. The textiles were washed in three
wash cycles to maximize the wash effects.
[0298] The cellulase of the invention was tested and compared with
the commercial endo-glucanase Endolase.COPYRGT. (GH7) and the
xylo-glucanase Whitezyme.COPYRGT.(GH44) both available at Novozymes
NS Denmark.
[0299] The test results indicated that Endolase showed the
strongest ability to prevent carbon black from depositing on the
textile. Whitezyme and T. lapidaria cellulase showed similar
response (see FIG. 3).
[0300] The invention described and claimed herein is not to be
limited in scope by the specific aspects herein disclosed, since
these aspects are intended as illustrations of several aspects of
the invention. Any equivalent aspects are intended to be within the
scope of this invention. Indeed, various modifications of the
invention in addition to those shown and described herein will
become apparent to those skilled in the art from the foregoing
description. Such modifications are also intended to fall within
the scope of the appended claims. In the case of conflict, the
present disclosure including definitions will control.
Sequence CWU 1
1
611303DNATerebella lapidariaCDS(12)..(1295)GH9 cellulase
1tctcagccca a tac gac tac gcc gat gcg ctg ggt aag tct atc ctg ttt
50 Tyr Asp Tyr Ala Asp Ala Leu Gly Lys Ser Ile Leu Phe 1 5 10 tac
gag gtg cag agg tcg gga tac ctg ccg cct gaa aac cgc atc cca 98Tyr
Glu Val Gln Arg Ser Gly Tyr Leu Pro Pro Glu Asn Arg Ile Pro 15 20
25 tgg cgc gga gac tcg gcc act ggt gac ggc agc gat atc ccg atc gac
146Trp Arg Gly Asp Ser Ala Thr Gly Asp Gly Ser Asp Ile Pro Ile Asp
30 35 40 45 ctg gag ggc ggc tgg tat gac gcc ggt gac cac gta aag ttc
aac ttt 194Leu Glu Gly Gly Trp Tyr Asp Ala Gly Asp His Val Lys Phe
Asn Phe 50 55 60 ccc atg gcg tgg tca gtg acg acg ttg gct tgg gga
atc ttg gac ttc 242Pro Met Ala Trp Ser Val Thr Thr Leu Ala Trp Gly
Ile Leu Asp Phe 65 70 75 tat gat gct tat agc gca gct ggt caa ctg
gac tac gcc ctg gac agc 290Tyr Asp Ala Tyr Ser Ala Ala Gly Gln Leu
Asp Tyr Ala Leu Asp Ser 80 85 90 att aga tgg ccg cta gac tac ttc
atc aaa tgt cac ccc tcc gac aac 338Ile Arg Trp Pro Leu Asp Tyr Phe
Ile Lys Cys His Pro Ser Asp Asn 95 100 105 gaa ctc tgg gga cag tgt
ggc gat ggc tat gag gac cac gcc tac tgg 386Glu Leu Trp Gly Gln Cys
Gly Asp Gly Tyr Glu Asp His Ala Tyr Trp 110 115 120 125 gga cgg cct
gag gac atg aca atg tac cgc ccc tca ttc aaa gtg gat 434Gly Arg Pro
Glu Asp Met Thr Met Tyr Arg Pro Ser Phe Lys Val Asp 130 135 140 acc
ggg gta ccc ggc tcc gac ctt gcg ggg gag aca gct gct gcc atg 482Thr
Gly Val Pro Gly Ser Asp Leu Ala Gly Glu Thr Ala Ala Ala Met 145 150
155 gcc gcc ggc tcc atg gca ttc caa cag aca gac cct tct tac gct gcc
530Ala Ala Gly Ser Met Ala Phe Gln Gln Thr Asp Pro Ser Tyr Ala Ala
160 165 170 act ctt ctg gat cat gct cgc cga ttg cac gat ttt gcg tac
aac tac 578Thr Leu Leu Asp His Ala Arg Arg Leu His Asp Phe Ala Tyr
Asn Tyr 175 180 185 aga ggc cta tac acc gcc gcc att ccg gct caa gac
ttc tat ggt tcg 626Arg Gly Leu Tyr Thr Ala Ala Ile Pro Ala Gln Asp
Phe Tyr Gly Ser 190 195 200 205 act ggg tac gat gac gag ttg gcg ttt
tcg gca gcc tgg ttg tat cgg 674Thr Gly Tyr Asp Asp Glu Leu Ala Phe
Ser Ala Ala Trp Leu Tyr Arg 210 215 220 gcc act gga gag cag ctg tac
ctg gac cgg gtg aac gag ttc tac agc 722Ala Thr Gly Glu Gln Leu Tyr
Leu Asp Arg Val Asn Glu Phe Tyr Ser 225 230 235 agc gga gtg cca tgg
gcc tac tcc tgg gac gac aag aat gcc gga gta 770Ser Gly Val Pro Trp
Ala Tyr Ser Trp Asp Asp Lys Asn Ala Gly Val 240 245 250 cag atg ttg
atg tat ata gcg acg gga gat acc cag tat agt ggt cac 818Gln Met Leu
Met Tyr Ile Ala Thr Gly Asp Thr Gln Tyr Ser Gly His 255 260 265 gtg
gaa gcg ttc ctc agg agc tgg ttc ccg ggc ggc tct gtg cag tat 866Val
Glu Ala Phe Leu Arg Ser Trp Phe Pro Gly Gly Ser Val Gln Tyr 270 275
280 285 acg ccc ctg ggt ctg gcc tgg cga gac caa tgg gga tgc ctc aga
tac 914Thr Pro Leu Gly Leu Ala Trp Arg Asp Gln Trp Gly Cys Leu Arg
Tyr 290 295 300 acc gga aac act gcg ttt att gcc acg atg gcg gcg agc
tac gga ata 962Thr Gly Asn Thr Ala Phe Ile Ala Thr Met Ala Ala Ser
Tyr Gly Ile 305 310 315 ata gca cag gag gcg agg gac tgg gcc gcg ggt
cag ttg ggc tac att 1010Ile Ala Gln Glu Ala Arg Asp Trp Ala Ala Gly
Gln Leu Gly Tyr Ile 320 325 330 ctt ggt gac act ggg cgc agc tac gtg
tgc gga ttt ggc aac aat cct 1058Leu Gly Asp Thr Gly Arg Ser Tyr Val
Cys Gly Phe Gly Asn Asn Pro 335 340 345 ccc ctg cga ccc cat cac aga
gct gcg tcg tgc ccg gat gct cca gct 1106Pro Leu Arg Pro His His Arg
Ala Ala Ser Cys Pro Asp Ala Pro Ala 350 355 360 365 aca tgt gac tgg
tcg cat cac gac tcg cct gat ccg aac ccc cat acg 1154Thr Cys Asp Trp
Ser His His Asp Ser Pro Asp Pro Asn Pro His Thr 370 375 380 ctg gac
ggc gct ctc gtg ggc ggc ccc gac gct aac gac tac tat gag 1202Leu Asp
Gly Ala Leu Val Gly Gly Pro Asp Ala Asn Asp Tyr Tyr Glu 385 390 395
gat gac agg acc gac tac atc ttc aac gag gtg gcc tgc gac tac aac
1250Asp Asp Arg Thr Asp Tyr Ile Phe Asn Glu Val Ala Cys Asp Tyr Asn
400 405 410 gcc ggc ttc caa ggc gct ctg gca ggt ctc ctc agt ctg ggc
ttg 1295Ala Gly Phe Gln Gly Ala Leu Ala Gly Leu Leu Ser Leu Gly Leu
415 420 425 tgaagtca 13032428PRTTerebella lapidaria 2Tyr Asp Tyr
Ala Asp Ala Leu Gly Lys Ser Ile Leu Phe Tyr Glu Val 1 5 10 15 Gln
Arg Ser Gly Tyr Leu Pro Pro Glu Asn Arg Ile Pro Trp Arg Gly 20 25
30 Asp Ser Ala Thr Gly Asp Gly Ser Asp Ile Pro Ile Asp Leu Glu Gly
35 40 45 Gly Trp Tyr Asp Ala Gly Asp His Val Lys Phe Asn Phe Pro
Met Ala 50 55 60 Trp Ser Val Thr Thr Leu Ala Trp Gly Ile Leu Asp
Phe Tyr Asp Ala 65 70 75 80 Tyr Ser Ala Ala Gly Gln Leu Asp Tyr Ala
Leu Asp Ser Ile Arg Trp 85 90 95 Pro Leu Asp Tyr Phe Ile Lys Cys
His Pro Ser Asp Asn Glu Leu Trp 100 105 110 Gly Gln Cys Gly Asp Gly
Tyr Glu Asp His Ala Tyr Trp Gly Arg Pro 115 120 125 Glu Asp Met Thr
Met Tyr Arg Pro Ser Phe Lys Val Asp Thr Gly Val 130 135 140 Pro Gly
Ser Asp Leu Ala Gly Glu Thr Ala Ala Ala Met Ala Ala Gly 145 150 155
160 Ser Met Ala Phe Gln Gln Thr Asp Pro Ser Tyr Ala Ala Thr Leu Leu
165 170 175 Asp His Ala Arg Arg Leu His Asp Phe Ala Tyr Asn Tyr Arg
Gly Leu 180 185 190 Tyr Thr Ala Ala Ile Pro Ala Gln Asp Phe Tyr Gly
Ser Thr Gly Tyr 195 200 205 Asp Asp Glu Leu Ala Phe Ser Ala Ala Trp
Leu Tyr Arg Ala Thr Gly 210 215 220 Glu Gln Leu Tyr Leu Asp Arg Val
Asn Glu Phe Tyr Ser Ser Gly Val 225 230 235 240 Pro Trp Ala Tyr Ser
Trp Asp Asp Lys Asn Ala Gly Val Gln Met Leu 245 250 255 Met Tyr Ile
Ala Thr Gly Asp Thr Gln Tyr Ser Gly His Val Glu Ala 260 265 270 Phe
Leu Arg Ser Trp Phe Pro Gly Gly Ser Val Gln Tyr Thr Pro Leu 275 280
285 Gly Leu Ala Trp Arg Asp Gln Trp Gly Cys Leu Arg Tyr Thr Gly Asn
290 295 300 Thr Ala Phe Ile Ala Thr Met Ala Ala Ser Tyr Gly Ile Ile
Ala Gln 305 310 315 320 Glu Ala Arg Asp Trp Ala Ala Gly Gln Leu Gly
Tyr Ile Leu Gly Asp 325 330 335 Thr Gly Arg Ser Tyr Val Cys Gly Phe
Gly Asn Asn Pro Pro Leu Arg 340 345 350 Pro His His Arg Ala Ala Ser
Cys Pro Asp Ala Pro Ala Thr Cys Asp 355 360 365 Trp Ser His His Asp
Ser Pro Asp Pro Asn Pro His Thr Leu Asp Gly 370 375 380 Ala Leu Val
Gly Gly Pro Asp Ala Asn Asp Tyr Tyr Glu Asp Asp Arg 385 390 395 400
Thr Asp Tyr Ile Phe Asn Glu Val Ala Cys Asp Tyr Asn Ala Gly Phe 405
410 415 Gln Gly Ala Leu Ala Gly Leu Leu Ser Leu Gly Leu 420 425
337DNAArtificialPrimer TLGH9F 3gtgaagcgta cgcgttacga ctacgccgat
gcgctgg 37441DNAArtificialPrimer TLGH9R 4agatctcgag aagcttatca
caagcccaga ctgaggagac c 415118DNAArtificialsynthetic vector
fragment 5ggatccacca tgaagctact ctctctgacc ggtgtggctg gtgtgcttgc
gacttgcgtt 60gcagccactc ctttggtgaa gcgtacgcgt gcgcatcacc atcaccatca
ctaagctt 118634PRTArtificialtranslational start 6Met Lys Leu Leu
Ser Leu Thr Gly Val Ala Gly Val Leu Ala Thr Cys 1 5 10 15 Val Ala
Ala Thr Pro Leu Val Lys Arg Thr Arg Ala His His His His 20 25 30
His His
* * * * *