Compositions And Methods For The Treatment Of Hemoglobinopathies

Abstract

Provided are compositions and methods for the treatment of hemoglobinopathies such as thalassemias and sickle cell disease. Compositions and methods include one or more endonuclease(s) or endonuclease fusion protein(s), including one or more homing endonuclease(s) and/or homing endonuclease fusion protein(s) and/or CRISPR endonuclease(s) ad/or CRISPR endonuclease fusion protein(s): (a) to disrupt a Bcl11a coding region; (b) to disrupt a Bcl11a gene regulatory region; (c) to modify an adult human .beta.-globin locus; (d) to disrupt a HbP silencing DNA regulatory element or pathway, such as a Bcl11a-regulated HbP silencing region; (e) to mutate one or more .gamma.-globin gene promoter(s) to achieve increased expression of a .gamma.-globin gene; (f) to mutate one or more .delta.-globin gene promoter(s) to achieve increased expression of a .delta.-globin gene; and/or (g) to correct one or more .beta.-globin gene mutation(s).

Description

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is being filed on 22 Feb. 2013, as a PCT International patent application, and claims priority to U.S. Provisional Patent Application No. 61/603,231, filed Feb. 24, 2012, the disclosure of which is hereby incorporated by reference herein in its entirety.

SEQUENCE LISTING

[0002] The present application includes a Sequence Listing in electronic format as a txt file entitled "sequence listing 54428.0006WOUI_ST25" and crested on Feb. 22, 2013 and which has a size of 174 kilobytes (KB). The contents of the txt file "sequence listing 54428.0006WOUI_ST25" are incorporated by reference herein.

BACKGROUND OF THE DISCLOSURE

[0003] 1. Technical Field of the Disclosure

[0004] The present disclosure relates, generally, to the treatment of genetic diseases. More specifically, the present disclosure provides endonuclease-based compositions and methods, including homing endonuclease- and Cas9 endonuclease-based compositions and methods, for altering the expression of globin genes, which compositions and methods are useful for the treatment of thalassemias, sickle cell disease, and other hemoglobinopathies.

[0005] 2. Description of the Related Art

[0006] Hemoglobinopathies, such as thalassemias and sickle cell disease, are highly prevalent genetic red blood sell disorders that cause a significant health burden worldwide. Over 1,300,000 people with severe hemoglobin disorders are born each year. While 5% of people worldwide are carriers, the birth rates are 0.44 and 1.96 per thousand for clinically significant forms of thalassemia and sickle cell disease (SCD), respectively.

[0007] In the normal state, hemoglobins found in mammalian erythroid cells predominantly consist of heterotetramers of two .alpha.-like chains (polypeptides) and two .beta.-like chains. The five genes of the .beta.-globin locus reside in a cluster on chromosome 11. The genes are expressed in an erythroid, and developmentally stage specific manor; the .epsilon., A.sub.65 and .delta. and .beta. genes being expressed primarily during the embryonic, fetal and post-natal periods respectively. At birth 95% of .beta.-like chains are .gamma., with the rest being .beta.. This ratio gradually inverts during the first year of life, explaining why phenotypes limited to the .beta.-globin gene such, as sickle cell and most .beta.-thalassemias do not manifest until several months of ago. Expression of the chromosome 16 based .alpha.-like genes differs; the embryonic .zeta.-gene parallels the expression of .epsilon., but the twin .alpha.-genes are expressed from the fetal period onward. Thus .alpha. abnormalities manifest in utero, potentially with devastating consequences (e.g. hydrops fetalis). The resultant .alpha.-, .beta.-heterotetramers are developmentally expressed; embryonic Hb Gower1 (.zeta..sub.2, .epsilon..sub.2), Hb Gower2 (.alpha..sub.2, .epsilon..sub.2) and Hb Portland (.zeta..sub.2, .gamma..sub.2); fetal: HbF (Fetal) (.alpha..sub.2, .gamma..sub.2) and Adult: HbA2 (.alpha..sub.2, .delta..sub.2) and HbA (Adult) (.alpha..sub.2, .beta..sub.2).

[0008] .beta.-thalassemia is caused by an abnormality in the adult .beta.-globin locus, which results in an abnormal stoichiometry of .beta.-like globin chains to .alpha.-like chains, resulting in the precipitation of the unpaired .alpha.-like chains. The severity of thalassemia is directly related to the degree of this globin chain imbalance. The ensuing damage meditated through several pathways including oxidation of cellular and membrane proteins culminates in ineffective erythropoiesis, apoptosis, and decreased red cell survival. Over 200 mutations have been described that are responsible for .beta.-thalassemia.

[0009] Sickle cell disease is caused by a single nucleotide substitution within the .beta.-globin gene, which results in glutamic acid being substituted by valine at amino acid position 6 of the peptide resulting in .beta..sup.S. Hemoglobin S (.alpha..sub.2, .beta..sup.S.sub.2), which carries this mutation, is referred to as HbS, as opposed to the normal adult hemoglobin (HbA). Under conditions of low oxygen concentration Hb-S undergoes an allosteric change at which point it can polymerize. The deoxy-form of hemoglobin exposes a hydrophobic patch on the protein between the E and F helices. The hydrophobic valine at position 6 of the hemoglobin .beta.-chain forms a hydrophobic patch which can associate with the hydrophobic patch of other hemoglobin S molecules causing hemoglobin S molecules to aggregate and form fibrous precipitates which, in turn, cause the red blood cells to adopt a sickle-shape and leads to alterations in numerous pathways that result in tissue damage via vaso-occlusion and hemolyis.

[0010] Although .beta.-thalassemia and sickle cell disease (SCD) are quantitative and qualitative disorders, respectively, of the .beta.-globin locus, the expression of normal .beta.-like globin genes can ameliorate both diseases. In thalassemia, any improvement in the globin chain imbalance provides a selective advantage for each cell and results in clinical benefit. In sickle cell disease the presence of normal or certain mutant .beta.-like chains can ameliorate the clinical phenotype by competing for .alpha.-like chains more effectively than the mutant sickle cell chains thus reducing the amount of HbS, by forming hemoglobins that block the polymerization of Hbs (e.g. HbF) and increasing the amount of non-sickling hemoglobin per cell. For example, in sickle cell disease, fetal hemoglobin (HbF) levels of only 8% inhibit polymerization of HbS, which results in increased survival, while HbF levels of 20% provide nearly complete phenotypic correction. Critically, the progeny of donor erythroid cells containing normal HbA have a strong selective advantage following hematopoietic stem cell transplantation (HSCT) over endogenous derived cells containing HbS. A patient with 11% donor cells in the marrow had 35% donor BFUe and 73% donor erythrocytes, which resulted in transfusion independence. Thus, correction in a relatively small fraction of transplanted HSCs provides clinical benefit.

[0011] Severe forms of thalassemia require chronic transfusions, resulting in iron overload. Survival directly correlates with the efficacy of chelation, though cost, side effects, and compliance severely limit efficacy. The only FDA approved drug for SCD is hydroxyurea, which can attenuate morbidity and mortality. This treatment, however, is under-prescribed, compliance is poor, and it does not adequately protect health.

[0012] Hematopoietic cell transplantation (HCT) is an important therapeutic option for thousands of patients each year with hematologic malignancies and related disorders. According to the Center for International Blood and Marrow Transplant Research (CIBMTR), approximately 60,000 transplants were performed in 2009, an increase of over 15,000 transplants per year compared to a decade earlier. The effectiveness of transplantation is also increasing, with more recent outcomes demonstrating a significant reduction in the risk of relapse, non-relapse mortality, and overall mortality, Gooley et al., N. Engl. J. Med. 363:2091-101 (2011).

[0013] Allogeneic hematopoietic cell transplantation (HCT) from HLA-matched sibling or unrelated donors offers a cure for patients with hemoglobinopathies, but is limited by the need for a suitably matched related or unrelated donor and is complicated by graft versus host disease (GVHD) and infections. In addition, a major barrier is a high rate of graft failures, which is higher than observed for HCT for malignancies. Alternative approaches include performing HCT with donor cord blood cells, as cord blood donors can be identified for nearly all patients. Additional experimental approaches are focused on using a patient's own hematopoietic stem cells (HSCs) and inducing expression of the endogenous globin genes, or adding an exogenous .beta.-like globin gene.

[0014] For many patients who are unable to find a donor, particularly those of ethnic minority or mixed race background, umbilical cord blood (CB) transplantation, may offer the best hope for cure. A source of donor stem cells (easily collected at the time of birth without risk to the mother or infant), CB also has the advantage of being readily available and safely used in an HLA-mismatched setting without increasing the risk of GVHD.

[0015] Unfortunately, several factors, including the low cell dose available in many cord blood units lead to slow engraftment and an increase in transplant related mortality in adults and larger children. Significantly delayed hematopoietic recovery of both neutrophils and platelets is a known risk factor for cord blood transplant (CBT) recipients and is associated with the low total nucleated cell (TNC) and CD34.sup.+ cell doses provided in a single or double CB transplant. Similarly, these low cell numbers correlate with higher rates of graft failure, thus a particular concern in hemoglobinopathies where there is already high risk of graft failure. In fact, a recent analysis of adult single CBT recipients demonstrated that infused CD34.sup.+ cell dose is the most important predictor of myeloid engraftment.

[0016] Non-relapse mortality (NRM) is highest in double CBT (dCBT) recipients when compared to matched and mismatched unrelated donor recipients, Brunstein et al., Blood 116:4693-9 (2010). The majority of the NRM occurs within the first 100 days post transplant with infection being the most common cause of death. Importantly, an analysis of the risk factors for NRM among dCBT recipients revealed a higher risk in patients with delayed myeloid recovery (time to absolute neutrophil count (ANC)>500/ml) if the recovery was .gtoreq.26 days, the median time to engraftment in dCBT recipients. When, however, the analysis of risk factors for NRM was restricted to include only those dCBT recipients engrafting before day 26, no difference was found between the donor sources, emphasizing the important contribution of delayed engraftment to increased risk of NRM.

[0017] Moreover, an ANC of >100 on any given day post stem cell transplant has been previously shown to be a critical threshold for a decreased risk of mortality before day 100 post transplant (Offner et al., Blood 88:4058-62 (1996)). Thus, the significant delay in myeloid recovery that is observed in CBT recipients remains a critical barrier to successful outcomes in the CBT setting. The ability to increase not only the absolute number of CB progenitor cells available for transplantation, but also cells that can reliably result in more rapid myeloid recovery post-transplant, should improve overall survival for patients undergoing CBT. Strategies utilizing ex vivo expansion of cord blood stem/progenitor cells are being developed to overcome the low cell dose available in a cord blood graft with the goal of enhancing hematopoietic recovery and overall survival in CBT.

[0018] With the goal of overcoming the significant delay in neutrophil recovery that occurs following transplantation with umbilical cord blood (CB), the role of the Notch signaling pathway in regulating ex vivo expansion of hematopoietic stem/progenitor cells has been investigated to generate increased numbers of progenitor cells capable of rapid depopulation in vivo. A clinically feasible methodology utilizing an engineered Notch ligand (Delta1) has been developed, which results in a multi-log increase in the absolute numbers of CD34.sup.+ cells and a cellular therapy capable of rapid repopulation in vivo.

[0019] Infusion of expanded, partially HLA-matched cells results in a significant reduction in the median time to achieve an initial absolute neutrophil count (ANC) of 500/ml to just 11 days as compared to a median time of 25 days (p<0.0001) in a concurrent cohort of 29 patients undergoing identical treatment but with two non-manipulated CB units. Although the number of patients treated was small (i.e. n=14), a significant effect on time to myeloid recovery was demonstrated, as was the safety and clinical feasibility of this approach.

[0020] Despite tremendous investment of resources by many laboratories for over 30 years, there has been little progress in the development of therapeutic regimens for hemoglobinopathies, in large part due to the lack of identified drugable targets and the requirement for gene therapy vectors to persistently express at extremely high levels, while not leading to insertional mutagenesis. While increased expression of fetal hemoglobin (HbF) ameliorates both hemoglobinopathies, extensive research has not yielded viable new agents based on that observation. Hematopoietic stem cell (HSC) gene therapy with integrating lentiviral vectors is being pursued by several investigators. HSC gene therapy, however, requires high-level persistent expression and carries a substantial/risk of insertional mutagenesis and leukemia.

[0021] What is critically needed in the art are compositions and methods, which exhibit improved efficacy for the treatment of hemoglobinopathies, including thalassemias and sickle cell disease while overcoming the safety concerns of existing therapeutic modalities.

SUMMARY OF THE DISCLOSURE

[0022] The present disclosure addresses these and other related needs in the art by providing, inter alia, compositions and methods for the treatment of hemoglobinopathies. Compositions and methods disclosed herein employ one or more polynucleotide that encodes one or more endonuclease(s) or endonuclease fusion protein(s), including one or more homing endonuclease(s) and/or homing endonuclease fusion protein(s) and/or one or more CRISPR endonucleases (i.e. Cas9 endonucleases in combination with one or more RNA guide strands) and/or CRISPR endonuclease fusion protein(s) (i.e. Cas9 endonuclease fusion protein(s) in combination with one or more RNA guide strands): (a) to disrupt a Bcl11a coding region or a Bcl11a gene regulatory region; (b) to disrupt a HbP silencing DNA regulatory element or pathway, such as a Bcl11a-regulated HbF silencing region; (c) to mutate one or more .gamma.-globin gene promoters) to achieve increased expression of a .gamma.-globin gene; (d) to mutate one or more .delta.-globin gene promoter(s) to achieve increased expression of a .delta.-globin gene; and/or (e) to correct one or more .beta.-globin gene mutation(s).

[0023] Within a first embodiment, the present disclosure provides compositions and methods that comprise a polynucleotide that encodes one or more endonuclease(s), such as a homing endonuclease (HE) and/or a CRISPR endonucleases (i.e. Cas9 endonucleases in combination with one or more RNA guide strands) to achieve the targeted disruption of a sequence within a Bcl11a coding region, or a Bcl11a gene regulatory region, thereby increasing to therapeutic levels the expression of an endogenous gene such as a .gamma.- or a .epsilon.-globin gene. Within related aspects, the compositions of these embodiments comprise a polynucleotide that encodes one or more TALEN, one or more TALE-HE fusion protein, and/or one or more TREX2 protein.

[0024] Within a second embodiment, the present disclosure provides compositions and methods that comprise a polynucleotide that encodes one or more endonuclease(s), such as a homing endonuclease (HE) or a CRISPR endonucleases (i.e. Cas9 endonucleases in combination with one or more RNA guide strands) to achieve the targeted disruption of a key regulatory sequence within a .beta.-globin gene locus, thereby increasing to therapeutic levels the expression of an endogenous gene such, as a .gamma.- or .delta.-globin gene. Within related aspects, the compositions of these embodiments comprise a polynucleotide that encodes one or more TALEN, one or more TALE-HE fusion protein, and/or one or more TREX2 protein.

[0025] Within certain aspects of this embodiment are provided HEs and CRISPR endonucleases that target a 3.6 kb region (SEQ ID NO: 1) within a .beta.-globin gene locus (chr11:5212342-5213944 in HG18) that contains a binding site for the regulatory protein Bcl11a.

[0026] The homing endonucleases and CRISPR endonucleases described herein exhibit unique advantages over conventional gene targeting nucleases. Because they are broadly efficacious regardless of genotype, the homing and Cas9 endonucleases in combination with one or more RNA guide strands described herein are not patient specific, they provide clinical benefit in the heterozygotic state, and avoid the insertion of vector sequences.

[0027] Within a third embodiment, the present disclosure provides compositions and methods for recapitulating, via genome editing, one or more naturally-occurring mutatian(s) within a patient's genome thereby providing clinical benefits including, for example, deletional or non-deletional forms of hereditary persistence of fetal hemoglobin (HPFH). More specifically, the present disclosure provides compositions and methods for achieving the direct correction of a thalassemia and/or a sickle cell disease (SCD) mutation through genome editing.

[0028] Within certain aspects of this embodiment, one or more homing endonuclease(s) is/are employed in combination with a normal or wild-type polynucleotide sequence (correction template) to permit the editing and/or repair of one or more genetic sequence, such as a .beta.-like globin gene(s). These homing endonucleases permit the modification of key regulatory and/or coding sequences within a gene locus, exemplified herein by the human .beta.-globin gene locus, through the transient expression of a polynucleotide that includes one or more naturally occurring mutation(s). Within related aspects, the compositions of these embodiments comprise a polynucleotide that encodes one or more TALEN, one or more TALE-HE fusion protein, and/or one or more TREX2 protein.

[0029] More specifically, the present disclosure provides compositions and methods for genome editing, comprising one or more polynucleotides, each encoding a HE and a correction template, which may be employed to generate naturally-occurring mutations within stem cells, including, for example, hematopoietic stem cells (HSCs), embryonic stem (ES) cells, and induced pluripotent stem cells (iPSCs). Genome edited HSCs, ESs, and IPSCs, including autologous HSCs and iPSCs, may be transplanted into a patient to treat one or more hemoglobinopathies, such as a thalassemia and/or sickle cell disease.

[0030] The compositions and methods disclosed herein permit the efficient modification of HSCs, ESs, and iPSCs, through the transient expression of a polynucleotide encoding a HE with or without a targeting template, a Cas9 endonuclease, and/or an RNA guide strand, without the need for the persistent expression or insertion of an exogenous gene to achieve the amelioration of hemoglobinopathies in mature erythroid cells and in patient cells in vivo. Because these therapeutic methods do not require the integration and/or persistent expression of a transgene, the safety concerns associated with currently available gene therapy technologies are obviated.

[0031] Within a fourth embodiment, the present disclosure provides compositions and methods for the delivery of one or more homing endonuclease(s) and/or one or more Cas9 endonuclease(s) in combination with one or more RNA guide strands, each of which may be transiently expressed in targeted regions shown to have clinical benefit in humans. The endonuclease coding sequences described herein may be expressed in combination with, or fused to, a TAL effector nuclease (TALBN) coding sequence. Exemplified herein are TAL effector-HE (TALE-HE) fusion proteins and polynucleotides that encode those TALE-HE fusion proteins, which target critical genomic regions that influence fetal hemoglobin production.

[0032] Within certain aspects of these embodiments, a polynucleotide encoding one or more HE with or without a targeting template, one or more Cas9 endonuclease, one or more RNA guide strands, one or more TALEN, one or more TALE-HE fusion, protein, and/or one or more TREX2 protein are operably linked to a promoter sequence within a viral vector to achieve the delivery and transient expression of a HE, a Cas9, an RNA guide strand, a TALEN, a TALE-HE fusion protein, and/or a TREX2 protein. Suitable viral vectors that may be satisfactorily employed for the delivery of HE, TALEN, TALE-HE fusion protein, and/or TREX2 protein may be selected from the group consisting of a cocal pseudotyped lentiviral vector, a foamy virus vector, an adenoviral vector, and an adeno-associated viral (AAV) vector.

[0033] Within a fifth embodiment, the present disclosure provides compositions and methods comprising ex-vivo expanded modified hematopoietic stem cells (HSCs), which allow for efficient engraftment of corrected cells and the use of induced pluripotent stem cells (iPSCs) for screening and clinical application. Within certain aspects of these embodiments are provided compositions and methods for the efficient expansion of autologous HSCs, autologous gene-modified HSCs, iPSC-derived HSCs, and ES cells. Cord blood expansion methodology may be employed, which methodology utilizes Delta1 in serum free media supplemented with hematopoietic growth factors using mobilized peripheral blood CD34+ cells obtained from normal donors. These compositions and methods may be used in combination with one or more additional reagent to enhance the survival and proliferation of hematopoietic stem/progenitor cells. Within other aspects, these compositions and methods may employ endothelial cell co-cultures for the enhanced expansion of long-term repopulating cells, including corrected iPSC-derived HSCs.

[0034] Within a sixth embodiment, the present disclosure provides compositions and methods for providing supportive care, which compositions and methods comprise off-the-shelf cellular therapies that abrogate post-transplant neutropenia and improve outcome following transplantation of gene-corrected autologous HSCs. Ex vivo expanded, cryopreserved cord blood (CB) stem/progenitor cells may, for example, be administered as a means of supportive care to patients with thalassemia and/or sickle cell disease who are undergoing myeloablative HCT with autologous CD34+ gene corrected cells.

BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Certain aspects of the present disclosure will be better understood in view of the following figures:

[0036] FIG. 1 shows targets to increase expression of .beta.-globin-like genes in adult erythroid tissues. Factors that are implicated in regulating the switch from a fetal expression pattern (two .gamma. genes) to an adult program (.delta. and .beta.) are displayed. (Adapted from Wilber et al., Blood 117(15):3945-3953 (2011)).

[0037] FIG. 2 depicts three exemplary rare cleaving nuclease technologies.

[0038] FIG. 3 is a graph showing that the risk of non-relapse mortality is highest among double CBT recipients. Non-relapse mortality after double CBT (DUCB), matched unrelated donor (MUD), mismatched unrelated donor (MMUD), and matched related donor (SIB) transplant.

[0039] FIG. 4 shows that a culture of CB progenitors with Delta1.sup.ext-IgG results in more rapid neutrophil recovery in a myeloablative double CBT setting. The individual and median times (solid line) to ANC of .gtoreq.500/.mu.l for patients receiving double unit CBT with two non-manipulated units ("conventional") versus with one ex vivo expanded unit and one non-manipulated unit ("expanded") is presented.

[0040] FIG. 5 is a bar graph depicting the number of cord blood transplantations performed annually by disease indication.

[0041] FIG. 6 (SEQ ID NO: 1) is the sequence of the 3.6 kb region for which the HbF silencing region falls, which spans chr11:5212342-5215944in HG18.

[0042] FIG. 7 (SEQ ID NO: 2) is the 350 base pair region spanning from a repeat element (chr11:5,213,912-5,214,261 in HG18), through the upstream French HPFH breakpoint known to disrupt the Bcl11a occupancy region within the HbF silencing region and that includes a GATA-1 binding motif, and from which exemplary homing endonucleases (HEs) of the present disclosure were designed.

[0043] FIG. 8 (SEQ ID NO: 13) is the human beta-globin gene from 1 kb upstream of the cap through the polyA site, which spans from chr11:5203272-5205877 in HG18 (reverse strand).

[0044] FIG. 9 (SEQ ID NO: 14) is a 606 bp region of the human beta-globin spanning from the promoter into Intron 2 (chr11:5204380-5204985 in HG18). This relatively small region contains the majority of mutations leading to severe thalassemia as well as the mutation causing sickle cell disease. This small region is readily amenable to homologous recombination resulting in gene correction.

[0045] FIG. 10 (SEQ ID NO: 24) is the cDNA sequence for human Bcl11a cDKA (CCDS1862.1).

[0046] FIG. 11 is a restriction map for the plasmid pET-21a(+).

[0047] FIG. 12 is a restriction map for the plasmid pEndo (Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006).

[0048] FIG. 13 is a schematic diagram of directed evolution for creating the BCL11A gene-targeting endonuclease. A constructed library was subjected to selection in IVC against a target site, a portion of which was replaced with the BCL11A gene target.

[0049] FIG. 14 (SEQ ID NO: 28) is the nucleotide sequence of I-HjeMI (the parental enzyme for the BCL11A gene targeting nuclease), which is codon optimized for expression in E. coli.

[0050] FIG. 15 (SEQ ID NO: 29) is the nucleotide sequence of I-HjeMI (the parental enzyme for the BCL11A gene targeting nuclease), which is codon optimized for mammalian expression.

[0051] FIG. 16 (SEQ ID NO: 30) is the amino acid sequence of the homing endonuclease I-HjeMI.

[0052] FIG. 17 (SEQ ID NO: 31) is the nucleotide sequence of a BCL11A gene targeting nuclease (Bcl11Ahje), which is based on the homing endonuclease I-HjeMI (detained through directed evolution in IVC and in bacteria), which is codon optimized for expression in E coli.

[0053] FIG. 18 (SEQ ID NO: 32) is the nucleotide sequence of a BCL11A gene targeting nuclease based on the homing endonuclease I-HjeMI (obtained through directed evolution in IVC and in bacteria), which is codon optimized for mammalian expression.

[0054] FIG. 19 (SEQ ID NO: 33) is the amino acid sequence of a BCL11A gene targeting nuclease based on the homing endonuclease I-HjeMI (obtained through directed evolution in IVC and in bacteria).

[0055] FIG. 20 is a protein model showing the distribution of amino-acid residues different between the BCL11A gene-targeting endonuclease and its parental LHE I-HjeMI. Substituted residues of the BCL11A gene-targeting endonuclease are mapped on the crystal structure of I-HjeMI bound to its target site (PDB ID: 3UVF). D161 is deleted in the variant endonuclease.

[0056] FIG. 21 is a bar graph showing the activity of a BCL11A gene-targeting endonuclease in a two-plasmid cleavage assay.

[0057] FIG. 22A (SEQ ID NO: 34) nucleotide sequence of I-OnuI homing endonuclease (the parental enzyme for homing endonucleases targeting the HbP silencing region), codon optimized for expression in E. coli.

[0058] FIG. 22B (SEQ ID NO: 15) is an amino acid sequence of I-OnuI homing endonuclease.

[0059] FIG. 23 is an agarose gel showing the activity of an I-OnuI homing endonuclease targeting the HbF silencing region.

[0060] FIG. 24 (SEQ ID NO: 35) is the nucleotide sequence of MegaTAL:5.5 RVD+Y2 I-AniI.

[0061] FIG. 25 (SEQ ID NO: 36) is an amino acid sequence of MegaTAL:5.5 RVD+ Y2 I-AniI.

[0062] FIG. 26 (SEQ ID NO: 37) nucleotide sequence of Cas9 endonuclease (from Mali et al., Science (2013)).

[0063] FIG. 27 (SEQ ID NO: 38) is the nucleotide sequence of an RNA Guide Strand for use with Cas9 endonuclease (from Mali et al., Science (2013)).

[0064] FIG. 28 (SEQ ID NO: 62) is a nucleotide sequence of I-CpaMI homing endonuclease (ORF, codon optimized for mammalian expression).

[0065] FIG. 29 (SEQ ID NO: 63) is an amino acid sequence of I-CpaMI homing endonuclease.

[0066] FIG. 30 is an agarose gel showing the detection of targeted mutagenesis at the endogenous human BCL11A gene as described in Example 4.

[0067] FIG. 31 is a restriction map for the plasmid pCedB wt6 (Doyon et al., J. Am. Chem. Soc. 128(7):247-2484 (2006).

[0068] FIG. 32 (SEQ ID NO: 64) is a nucleotide sequence of a BCL11A gene targeting nuclease-encoding plasmid (pExodusBCL11Ahje).

[0069] FIG. 33 (SEQ ID NO: 65) is a nucleotide sequence of TREX2-encoding plasmid (pExodus CMV.Trex2).

[0070] FIG. 34 is a restriction map for the plasmid pExodusBCL11Ahje.

[0071] FIG. 35 is a restriction map for the plasmid pExodus CMV.Trex2.

DETAILED DESCRIPTION OF THE DISCLOSURE

[0072] The present disclosure is directed, generally, to compositions and methods for the treatment of a genetic disease, such as a hemoglobinopathy, by the transient or persistent expression of a polynucleotide that encodes one or more endonuclease(s) or endonuclease fusion protein(s), including one or more homing endonuclease(s) and/or homing endonuclease fusion protein(s) and/or one or more Cas9 endonuclease(s) and/or Cas9 endonuclease fusion protein(s) in combination with one or more RNA guide strands: (a) to disrupt a Bcl11a coding region; (b) to disrupt a HbF silencing DNA regulatory element or pathway, such as a Bcl11a-regulated HbF silencing region; (c) to mutate one or more .gamma.-globin gene promoter(s) to achieve increased expression of a .gamma.-globin gene; (d) to mutate one or more .delta.-globin gene promoter(s) to achieve increased expression of a .delta.-globin gene; and/or (e) to correct one or more .beta.-globin gene mutation(s). The compositions and methods disclosed herein find utility in the treatment of hemoglobinopathies, including .beta.-thalassemia and sickle cell disease. The compositions and methods described herein may, optionally, comprise a polynucleotide that encodes one or more TALEN, one or more TALE-HE fusion protein, and/or one or more TREX2 protein.

[0073] The present disclosure will be better understood in view of the following definitions:

Definitions

[0074] As used herein, the term "hemoglobinopathy" refers to a class of genetic defects that result in an abnormal structure, abnormal function or altered expression of one or more of the globin chains of the hemoglobin molecule. Hemoglobinopathies are inherited single-gene disorders. Common hemoglobinopathies include thalassemias and sickle-cell disease.

[0075] As used herein, the term "thalassemia" refers to a hemoglobinopathy that results from an altered ratio of .alpha.-like to .beta.-like globin polypeptide chains resulting in the underproduction of normal hemoglobin tetrameric proteins and the accrual of tree or unpaired .alpha.- or .beta.-chains.

[0076] As used herein, the term "sickle-cell disease" refers to a group of autosomal recessive genetic blood disorders, which results from mutations in a globin gene and which is characterized by red blood cells that assume an abnormal, rigid, sickle shape. They are defined by the presence of .beta..sup.S-gene coding for a .beta.-globin chain variant in which glutamic acid is substituted by valine at amino acid position 6 of the peptide, and second .beta.-gene that has a mutation that allows for the crystallization of HbS leading to a clinical phenotype. The term "sickle-cell anaemia" refers to a specific form of sickle-cell disease in patients who are homozygous for the mutation that causes HbS. Other common forms of sickle cell disease include HbS/.beta.-thalassemia, HbS/HbC and HbS/HbD. Table 1 discloses the nucleotide sequences encoding the initial amino acids of a wild-type and sickle cell .beta.-globin chains

TABLE-US-00001 TABLE 1 .beta.-globin Sequence chain Sequence Identifier Wild-type GTGCACCTCACTCCAGAGGAG SEQ ID NO: 3 Sickle GTGCACCTCACTCCAGTGGAG SEQ ID NO: 4

[0077] As used herein, the term "hereditary persistence of fetal hemoglobin" or "HPFH" refers to, a benign condition in which significant fetal hemoglobin (hemoglobin F) production, continues well into adulthood, disregarding the normal shutoff point.

[0078] As used herein, the term "globin" refers to a family of heme-containing proteins that are involved in the binding and transport of oxygen.

[0079] As used herein, the term "homing endonuclease" or "HE" refers to a class of restriction endonucleases that are characterized by recognition sequences that are long enough to occur only once in a genome and randomly with a very low probability (e.g., once every 7.times.10.sup.10 bp).

[0080] As used herein, the term "Transcription Activator-Like Effector Nuclease" or "TAL effector nuclease" or "TALEN" refers to a class of artificial restriction endonucleases that are generated by fusing a TAL effector DNA binding domain to a DNA cleavage domain.

[0081] As used herein, the term "three prime repair exonuclease 2" or "TREX2" refers to a nuclease having 3' exonuclease activity, which is typically involved in DNA replication, repair, and recombination.

[0082] As used herein, the term "Cas9 endonuclease" refers to an endonuclease that uses an RNA guide strand to target the site of endonuclease cleavage. The term "CRISPR endonuclease" refers to a Cas9 endonuclease in combination with an RNA guide strand. See, Jinek et al., Science 337:816-821 (2013); Cong et al., Science (Jan. 3, 2013) (Epub ahead of print); and Mali et al., Science (Jan. 3, 2013) (Epub ahead of print).

[0083] It will be understood that unless indicated to the contrary, terms intended to be "open" (e.g., the term "including" should be interpreted as "including but not limited to," the term "having" should be interpreted as "having at least," the term "includes" should be interpreted as "includes but is not limited to," etc.). Phrases such as "at least one," and "one or more," and terms such as "a" or "an" include both the singular and the plural.

[0084] It will be further understood that where features or aspects of the disclosure are described in terms of Markush groups, the disclosure is also intended to be described in terms of any individual member or subgroup of members of the Markush group. Similarly, all ranges disclosed herein also encompass all possible sub-ranges and combinations of sub-ranges and that language such as "between," "up to," "at least," "greater than," "less than," and the like include the number recited in the range and includes each individual member.

[0085] All references cited herein, whether supra or infra, including, but not limited to, patents, patent applications, and patent publications, whether U.S., PCT, or non-U.S. foreign, and all technical and/or scientific publications are hereby incorporated by reference in their entirety.

[0086] While various embodiments have been disclosed herein, other embodiments will be apparent to those skilled in the art. The various embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the claims.

Homing Endonucleases for Achieving High-Efficiency, Multiplex Gene Disruption and Gene Editing Functions

[0087] As discussed above and exemplified below, the present disclosure provides compositions and methods comprising a polynucleotide that encodes one or more endonuclease(s), including one or more homing endonuclease(s) (HE(s)), such as one or more I-HjeMI homing endonuclease(s), I-CpaMI homing endonuclease(s), and/or I-OnuI homing endonuclease(s), and/or one or more Cas9 endonuclease in combination with one or more RNA guide strand, which may be transiently or persistently expressed in targeted cells shown to have clinical benefit in humans. Exemplary endonucleases target critical genomic regions that influence fetal hemoglobin production by: (a) disrupting a Bcl11a coding region or a Bcl11a gene regulatory region; (b) disrupting a HbF silencing DNA regulatory element or pathway, such as a Bcl11a-regulated HbF silencing region; (c) mutating one or more .gamma.-globin gene promoter(s) to achieve increased expression of a .gamma.-globin gene; (d) mutating one or more .delta.-globin gene promoter(s) to achieve increased expression of a .delta.-globin gene; and/or (c) correcting one or more .beta.-globin gene mutation(s). The compositions and methods disclosed herein find utility in the treatment of hemoglobinopathies, including .beta.-thalassemia and sickle cell disease.

[0088] The endonuclease coding sequences described herein may be expressed in combination with, or fused to, a DNA binding domain coding sequence, such as a TAL effector (TALE) coding sequence or a nuclease coding sequence such as a three prime repair exonuclease 2 (TREX2) coding sequence. Exemplified herein are TALE-HE fusion proteins and polynucleotides that encode one or more TALE-HE fusion protein(s).

[0089] Four protein scaffolds are known in the art for achieving targeted gene modification and disruption in eukaryotes: zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), homing endonucleases (HEs), and Cas9 endonucleases in combination with a RNA guide strand. The present disclosure employs TAL effector nucleases, homing endonucleases, and/or Cas9 endonucleases either alone or in combination. TAL nucleases offer more straightforward modular design and higher DNA recognition specificity than zinc finger nucleases while homing endonucleases, such as LAGLIDADG homing endonucleases (LHEs), offer highly specific cleavage profiles, compact structures, and, because they are compact monomeric proteins that do not require dimerization as do ZFNs and TALENs, the ability to be used in multiplex combinations. Accordingly, HEs and CRISPR endonucleases (i.e. Cas9 endonucleases in combination with one or more RNA guide strands) are extremely efficient in mediating gene disruption, Stoddard, supra and Mali et al., Science (2013), supra.

[0090] As part of the present disclosure, a critical region within the .beta.-globin locus that suppresses HbF function has been identified. This region provides multiple targets for HE- and Cas9-mediated cleavage. Specifically-designed nucleases may be tested for activity against a cognate target site and for off-target activity against any closely related genomic targets. These HEs and Cas9 endonucleases in combination with one or more RNA guide strands may be engineered to avoid off-target genomic cleavage using the methods described in Stoddard, Structure 19:7-15 (2011) and Mali et al., Science (2013). HEs and Cas9 endonucleases in combination with one or more RNA guide strands that are disclosed herein are capable of directly targeting the .gamma.- and .delta.-promoters and replacing a 606 bp region (SEQ ID NO: 14) that spans the majority of thalassemia mutations as well as the HbS mutation.

[0091] To facilitate the generation of large deletions spanning the HbF silencing region or subsets thereof one or more HEs and/or one or more Cas9 endonucleases in combination with one or more RNA guide strands may be co-transduced with a bridging oligonucleotide, which spans from the endonuclease cleavage site to the end of the target region, Chen et al., Nat. Methods 8(9):753-5 (2011). Higher frequency genome editing may be achieved by employing one or more HEs that bind to and cleave a sequence that flanks each side of the target region. Similarly, a HE and a mutagenizing oligonucleotide may be used to introduce promoter region mutations, which leads to elevated expression of a gamma or delta gene.

[0092] The presently disclosed HEs may be first evaluated in an erythroid cell line and in human CD34+ cells that are induced to differentiate to erythroid cells, thereby confirming the ability to alter globin gene expression. Depending upon the precise application contemplated, one, two, three, or more HEs may be delivered to facilitate the generation of larger deletions. The suitability of individual HEs can be assessed in additional culture and animal model assays to confirm their ability to target HSCs without compromising pluripotency and expansion potential, and to assess clinical benefit in hemoglobinopathy models. One or more HEs and one or more exonuclease, such as a TREX2 exonuclease or a TAL effector exonuclease, may be delivered to CD34+ HSC for the induction of targeted genetic deletions in critical regions for HbF.

[0093] Individual nucleases may be tested against a series of targets in a 350 bp region (SEQ ID NO: 2) defined by a region initiating at the edge of a repeat element and spanning through the upstream French HPFH breakpoint known to disrupt the Bcl11a occupancy region within the HbF silencing region and that includes a GATA-1 binding motif. Initial analyses have identified seven targets, evenly distributed throughout the region, which comprise DNA sequence modules for which pools of highly active endonuclease variants have been isolated and sequenced. Notably, one target overlaps with a potential Bcl11a binding motif and is adjacent to the GATA-1 motif. Successively larger deletions of a target region may be achieved by transducing two, three, or more HEs. Alternatively, multiple targets for disrupting the Bcl11a gene have been identified on the 5'-end of the gene to ensure the elimination of gene function. Similarly, multiple optimal targets for Cas9/RNA guide mediated disruption have been identified through the area that can be used singly, or in combination leading to larger deletions.

[0094] Individual HEs may be tested in transfected human cell lines using integrated genomic reporters, and may further employ additional selection steps to further optimize cleavage and gene conversion activities using protocols as described in Stoddard, supra. The validation and delivery of individual targeted HEs that are active against targets in the globin locus may be followed by vectorization of the nucleases in expression systems. For example, an expression system may be employed that links each HE to the compression of a nuclease, such as a TALEN and/or a TREX exonoclease, to achieve greatly enhanced gene disruption efficiency in transduced cells.

[0095] The present disclosure also provides TALE-HE fusion proteins, and polynucleotides that encode TALE-HE fusion proteins, which exhibit the desired feature of restricting the recruitment and activity of engineered HEs to the desired target site, such as within a globin locus, through the synergistic recognition of adjacent DNA targets by the TALE and HE scaffolds. Such TALE-HE fusions combine the most favorable properties of each scaffold (i.e., modular assembly of TALEs and nuclease specificity of HEs) while reducing nonspecific nuclease activity that is associated with traditional TALENs or zinc finger nucleases (ZFNs).

[0096] The high-resolution crystal structures have been determined for ten separate LAGLIDADG homing endonucleases (LHEs) in complex with their cognate DNA target sites. Stoddard, Structure 19:7-15 (2011) and Takeuchi et al., Proc. Natl. Acad. Sci. U.S.A. 108:13077-13082 (2011). Chimeric `hybrids` of those LHEs have been constructed that, collectively, provide a broad range of LHE targeting proteins for gene-specific applications. Baxter et al., Nucl. Acids Res. 40(16):7985-8000 (2012).

[0097] HEs having suitable target sequence specificity may be identified by a yeast surface display strategy, combined with high-throughput cell sorting for desirable DNA cleavage specificity. A series of protein-DNA `modules`, which correspond to sequential pockets of contacts that extend across the entire target site, may be systematically randomized in separate libraries. Each library may then be systematically sorted for populations of enzymes that can specifically cleave each possible DNA variant within each module, and each sorted population deep-sequenced and archived for subsequent enzyme assembly and design. HEs that may be suitably employed in the compositions and methods of the present disclosure are commercially available (Pregenen, Seattle, Wash.).

[0098] Within certain aspects, the compositions and methods described herein may employ the co-expression of one or more HE, including, for example, one or more LHE, with a TREX2 3' exonuclease. In contrast to the 5' overhangs left by current versions of ZFNs and TALENs, HEs generate 3' overhangs at the site of targeted double-strand breaks, which results in an enhanced rate of end processing following HE cleavage. Near complete modification of a double strand break site in primary cells can be achieved through HE/TREX2 co-expression. Because of the way HE/TREX2 co-expression influences break processing, this combination achieves multiple targeted deletions in one region and increases the safety of nuclease-induced targeted gene disruption by diminishing break persistence and reducing the potential for large scale translocations mediated through alternative end joining pathways.

[0099] The crystal structure of a TAL effector (PthXo1) bound to its DNA target site has recently been determined. Mak et al., Science 335(6069):716-9 2012; e-pub 5 Jan. 2012 PubMed PMID: 22223736. These crystal structure data permit the precise definition of the boundaries of DNA recognition region and facilitates strategies for the creation of well-behaved TALEN-HE, or other TALEN-nuclease fusion construct, which may be applied to achieve a variety of complex genomic manipulations.

Genome Disruption to Bcl11a Gene Expression

[0100] Knockout of Bcl11a in a sickle cell mouse model ameliorates disease, supporting the clinical relevance of this pathway. Xu et al., Science 334:993-6 (2011). In addition, mice containing a YAC transgene spanning the human .beta.-globin locus are used to model perturbations in Bcl11a mediated silencing of HbF. Heterozygous and homozygous knockout of the endogenous Bcl11a gene in these mice results in .delta.-globin mRNA comprising 20 and 76% of total .beta.-like mRNA respectively, compared to 0.24% in controls. Sankaran et al., Nature 460:1093-7 (2009). This suggests Bcl11a acts as rheostat, modulating the degree of HbF suppression. Consistent with this, decrease of function mutations in Bcl11a result in elevated levels of HbF and a lessening of the clinical thalassemia and/or sickle cell disease phenotype, Galanello et al., Blood 114:3935-7 (2009).

[0101] Within certain embodiments, the present disclosure provides compositions and methods that comprise one or more endonuclease(s), including one or more homing endonuclease(s) (HE(s)) such as one or more I-HjeMI homing endonuclease(s), I-CpaMI homing endonuclease(s), and/or I-OnuI homing endonuclease(s)s and/or one or more Cas9 endonuclease(s) to achieve the disruption of a sequence that encodes Bcl11a or its key regulatory sequences. As described in greater detail and exemplified herein, compositions and methods comprising one or more Cas9 endonucleases further comprise one or more Bcl11a gene-specific RNA guide strands to mediate the targeting of the Cas9 endonuclease to a Bcl11a gene sequence.

[0102] The Bcl11a gene has multiple exons spanning over 100 kb and results in several splice variants that lead to proteins associated with different activities. As part of the present disclosure, several DNA targets have been identified that are transcribed into multiple Bcl11a splice variants. All disrupt the long (L) and extra-long (XL) forms, which are associated with the greatest HbF silencing activity, while one disrupts all forms of Bcl11a. These targets comprise DNA sequence modules for which pools of highly active endonuclease variants have been isolated and sequenced. The human Bcl11a cDNA sequence (CCDS1862.1) is presented herein as SEQ ID NO: 24 (FIG. 10).

[0103] Thus, within certain aspects, the present disclosure provides compositions for achieving therapeutic levels of HbF, which compositions comprise a polynucleotide encoding one or more homing endonuclease (HE), which is capable of mediating the disruption of the nucleotide sequence within this 1.3 kb region, thereby preventing the binding of Bcl11a, and the formation of the corresponding repressive complex, and de-repressing .gamma.-globin expression.

Genome Disruption to Block Bcl11a-Mediated Silencing of HbF

[0104] As summarized above, within certain embodiments, the present disclosure provides compositions and methods for treating and/or ameliorating a genetic disease, such as a hemoglobinopathy, including a thalassemia and/or sickle cell disease. Certain aspects of these embodiments include the transient expression of a polynucleotide encoding one or more homing endonuclease(s) to disrupt a HbF silencing element or pathway within a .beta.-globin gene locus or a .delta.-globin gene locus thereby increasing to therapeutic levels the expression of an endogenous gene such as a .gamma.-or .delta.-globin gene.

[0105] The compositions disclosed herein comprise a polynucleotide encoding one or more homing endonuclease(s) (HE(s)) and or one or more Cas9 endonuclease in combination with one or more RNA guide strands and, optionally, one or more transcription activator-like (TAL) effector(s), to achieve the targeted disruption of key regulatory sequences within the .beta.-globin gene locus. More specifically, the compositions and methods disclosed herein achieve an increase in .gamma.-globin gene expression, and consequent HbF protein production, by removing essential elements for Bcl11a binding to the HbF silencing region(s) within the .beta.-globin gene locus.

[0106] During normal development, expression of an embryonic .beta.-like gene (.epsilon.-globin) is sequentially replaced by a pair of -.gamma.-globin genes in the fetus and the .delta.- and .beta.-globin genes in the adult. In adult erythroid tissues, the zinc finger protein Bcl11a binds to a region between the .gamma.-globin and .delta.-globin genes within the .beta.-globin gene locus thereby silencing the production of HbF. The importance of Bcl11a-mediated silencing of HbF is supported by knockdown of Bcl11a mRNA in human CD34 cells, which increases HbF levels to 24-36% of total .beta.-like proteins. Sankaran et al., Science 322:1839-42 (2008). Removal of this region in the deletion form of HPFH, as well as the knockdown of Bcl11a, blocks Bcl11a-mediated HbF silencing and results in an elevated level of .gamma.-globin gene expression and HbF protein production in adult erythroid tissues (Sankaran et al., N. Engl. J. Med 365:507-14 (2011)).

[0107] While multiple mechanisms contribute to an elevation in HbF protein levels, it has been shown that a 3.6 kb region is key for HbF silencing (SEQ ID NO: 1), Sankaran et al., N. Engl. J. Med. 365:807-14 (2011). While there are several peaks of Bcl11a enrichment in the .beta.-globin locus, the single peak in the 3.6 kb HbF silencing region stands out as proteins known to form a repressive complex with Bcl11a are bound in this region (GATA-1 and HDAC-1) and the chromatin is enriched for the repressive histone mark trimethylation of histone H3 on lysine27.

[0108] Notably this 3.6 kb region contains a single peak of Bcl11a binding downstream of the .gamma.-gene. Multiple point mutations have been identified in the .gamma.-globin promoters that result in HbF levels of 20-30% as a heterozygote, ameliorating thalassemia and SCD. These point mutations cluster to three regions all within 200 bp of the .gamma.-cap sites: (1) -200, a GC-rich region bound by SP1 and a stage specific protein complex; (2) -175, bound by GATA-1; and (3) Oct1 and a CCAAT motif at -117 bound by several addition factors. Forget, Ann. NY Acad Sci. 850:38--44 (1998).

[0109] Mutations within these three regions block the binding of a repressive complex in adult erythroid cells. Consequently, these regions are suitable targets for HE-mediated disruption and targeted mutation by the compositions and methods disclosed herein. The disruption of these regions leads to a decrease in repressive complexes, which results in an elevated level of .gamma.-globin gene expression, and a corresponding increase in HbP protein production to levels that are sufficient to achieve therapeutic efficacy in methods for the treatment of hemoglobinopathies, including .beta.-thalassemia and sickle cell disease.

[0110] A single peak of Bcl11a occupancy is present within the 3.6 kb HbF silencing region (Sankaran et al., N. Engl. J. Med. 365:807-14 (2011)) ((SEQ ID NO: 1). This region of Bcl11a occupancy is disrupted by the upstream breakpoint of French HPFH Sankaran et al., N. Engl. J. Med 365:807-14 (2011). Described herein is a 350 bp region initiating at the edge of a repeat element and spanning through the upstream French HPFH breakpoint known to disrupt the Bcl11a occupancy region within the HbF silencing region and that includes a GATA-1 binding motif (SEQ ID NO: 2). The base before the upstream French HPFH deletion is HG18 chr11:5,214,023. The GATA-1 motif spans chr11:5,214,200-5,214,206. Without being limited by theory, it is believed that GATA-1 and HDAC-1 form a repressive complex with Bcl11a when Bcl11a is bound within this 350 bp region and this leads to the formation of a repressive complex that inhibits the expression of the .gamma.-globin genes and, thereby, reduces cellular levels of HbF protein.

[0111] The HE-mediated disruption, which is achieved by the compositions and methods disclosed herein, occurs at high efficiency. Unlike shRNA knockdown approaches that are known in the art, the highly sequence specific disruption of the HbF silencing region, which is mediated by the homing endonucleases disclosed herein, avoids off target effects at other Bcl11a binding sites in the genome, and in other cell types, especially within B-cells where Bcl11a binding is required for normal development.

[0112] Thus, the homing endonucleases described herein exhibit unique advantages over conventional gene targeting nucleases. Because they are broadly efficacious regardless of genotype, the homing endonucleases described herein are not patient specific and provide clinical benefit in the heteroxygotic state.

Recapitulation of Genetic Modifications for Correcting a Thalassemia or Sickle Cell Disease Mutation

[0113] Within other embodiments, the present disclosure provides compositions and methods for recapitulating, via genome editing, one or more naturally-occurring mutation(s) within a patient's genome to provide clinical benefits. More specifically, the present disclosure provides compositions and methods for achieving the direct correction of a thalassemia and/or sickle cell disease (SCD) mutation through genome editing.

[0114] The compositions and methods disclosed herein employ a correction template to achieve gene editing and correction to ameliorate hemoglobinopathies, including thalassemias and sickle cell disease, by enhancing the rate of homologous recombination (HR) between the correction template and the corresponding mutated sequence within a patient's genome. Exemplified herein are compositions and methods for correcting an underlying .beta.-globin mutation, which provide clinical benefit in the heterozygotic state while avoiding the insertion of vector sequences. These compositions and methods may be used independently from or in combination with the compositions and methods described above for the disruption of Bcl11a-mediated gene silencing.

[0115] The present disclosure provides a robust set of technologies for genome editing that exploits the advantages of HEs, as compared to alternative platforms that are available in the art. These HEs can be combined with a TAL effector modular DNA binding platform to achieve additional therapeutic advantages.

[0116] While homologous recombination (HR) to edit genomes is powerful, it is inefficient. Introduction of a double stranded break at the region to be modified results in a tremendous increase in HR efficiency. Simultaneous introduction of a polynucleotide encoding a HE and a correction template, wherein the correction template comprises as little as 100 bp of flanking homology, allows an increased frequency of HR, thereby permitting genome editing as the corrective template is introduced.

[0117] The transduction of cells with a short synthesized correction template may also be employed for the efficient introduction of defined single base-pair mutations. Such approaches typically exploit a single HE. Alternatively HEs may be transduced that flank the region targeted for modification. Correction templates may be transduced by optimized methods as described herein. The design, transduction, and evaluation of HEs may be performed, as discussed in detail below, according to the methodology described Certo. et al., Nat Methods 8:671-6 (2011) and Jarjour et al., Nucleic Acids Res 37:6871-80 (2009).

[0118] Within certain aspects of these embodiments, one or more homing endonuclease(s) is/are employed in combination with a normal or wild-type polynucleotide sequence to permit the editing and/or repair of one or more .beta.-like globin gene(s). For example, the present disclosure provides compositions and methods for the treatment of hemoglobinopathies, which compositions and methods permit the modification of key regulatory and/or coding sequences within a gene locus, exemplified herein by the human .beta.-globin gene locus, through the transient expression of a polynucleotide that includes one or more naturally occurring mutation(s).

[0119] More specifically, the present disclosure provides compositions and methods for genome editing, which may be employed to generate mutations that recapitulate naturally-occurring mutations within stem cells, including, for example, hematopoietic stem cells (HSCs), embryonic stem (ES) cells, and induced pluripotent stem cells (iPSCs). Genome edited HSCs, ESs, and iPSCs, including autologous HSC's and iPSCs, may be transplanted into a patient to treat one or more hemoglobinopathies, such as a thalassemia and/or sickle cell disease. The compositions and methods disclosed herein permit the efficient modification of HSCs, ESs, and iPSCs, without the need for the persistent expression or insertion of an exogenous gene to achieve the amelioration of hemoglobinopathies in mature erythroid cells and in patient cells in vivo.

[0120] Because these therapeutic methods do not require the integration and/or persistent expression of a transgene, the safety concerns associated with currently available gene therapy technologies are obviated. Within certain aspects of these embodiments, the compositions and methods employ one or more polynucleotide for the targeted disruption of Bcl11a-mediated silencing of HbF.

[0121] Exemplified herein are compositions and methods that permit the recapitulation of genetic modifications within one or more HbF silencing region(s) that is/are responsible for hereditary persistence of HbF (HPFH). Because such genetic modifications lead to increased expression of a therapeutically effective gene, the recapitulated genetic modifications need only be present as a heterozygote to achieve therapeutic efficacy.

[0122] The compositions and methods for ameliorating thalassemia and sickle cell disease that are disclosed herein achieve therapeutic efficacy by introducing one or more mutation that result in increased HbF and/or HbA.sub.2 and/or HbA protein production. Exemplified herein are compositions and methods for recapitulating one or more naturally-occurring deletion(s) of the .beta.- globin gene and/or regions, which activate .gamma.-globin gene expression thereby increasing levels of fetal hemoglobin. Because a modest increase in HbF and/or HbA.sub.2 protein production is sufficient to ameliorate these disease phenotypes, heterozygotic mutations are sufficient to achieve substantial therapeutic benefit.

[0123] Within certain aspects, the delivery of a correction template may be done in conjunction with the delivery of a selectable marker gene thereby permitting the selection of corrected cells ex vivo and in vivo, although such an approach requires long-term expression via integration of the selectable marker gene. Beard et al., J. Clin. Invest. 120:2345-54 (2010) and Munoz et al., Nucleic Acids Res. 39(2):729-743 (2011).

[0124] Activation of .beta.-globin expression in adult tissues depends upon binding of KLF-1 at a CACCC box in its promoter. The .delta.-globin promoter lacks an intact CACCC box, KLF-1 is not bound and expression is limited to 2% of .beta.-globin. Mutations of the .delta.-promoter that recapitulate the .beta.-globin promoter by, for example, introducing an intact CACCC box, allow KLF-1 bindings and result in a therapeutically efficacious increase in .delta.-globin expression.

[0125] Within certain aspects of these embodiments, a non-deletion HPFH .gamma.-globin promoter mutation may be generated. Only a single base pair must be modified to achieve efficacy. For example, a -175 T.fwdarw.C mutation (SEQ ID NO: 21) may be recapitulated to maximize the levels of HbF. Mutation of any of the four .gamma.-globin genes will provide benefit, thus increasing potential targets.

Delivery of Homing Endonucleases, Cas9 Endonuclease, TAL Effector Nucleases, and TREX2 Endonucleases

[0126] Within further embodiments, the present disclosure provides systems, in particular non-integrating vector systems, for the delivery of one or more HE, Cas9, TALEN, and/or TREX2 nuclease described herein. There are three major challenges to the therapeutic gene editing of hematopoietic stem cells (HSCs): (1) nuclease reagents must be transiently delivered to HSCs; (2) gene editing efficiency in cells receiving a nuclease must be high; and (3) gene-edited HSCs must engraft to a level sufficient for therapeutic effect. These challenges may be overcome by employing various vectorization approaches.

[0127] Exemplified herein are cocal pseudotyped lentiviral vectors and foamy virus vectors for the efficient gene transfer to HSCs. Trobridge et al., Mol Ther 18:725-33 (2008). Alternatively, adenoviral vectors may be modified as previously described for use in gene transfer to HSCs. Wang et al., Exp. Hematol. 36:823-31 (2008) and Wang et al., Nat. Med. 17:96-104 (2011). Within other aspects of these embodiments, AAV-based vector systems may also be employed for the delivery of HEs, Cas9 (and/or RNA guide strands), TALE-HE, TALENs, and/or TREX2 nucleases.

[0128] AAV6-serotype recombinant AAV vectors provide a 4.5 kb payload, sufficient to deliver a promoter-HE-exonuclease or a promoter-TAL-HE fusion-exonuclease cassette in addition to a small recombination template. Alternatively, it can carry the small Cas9 polypeptide and guide RNAs. AAV6 provides efficient transduction of human CD34+ umbilical cord blood cells of all known AAV capsids and is able to mediate significant levels of transient gene expression in HSC. Self-complementary and single stranded AAV6 vectors may be employed for both gene knockout and recombination-based gene editing in HSC in cell lines and in primary CD34+ cells.

[0129] Adenoviral vectors with hybrid capsids are capable of efficiently transducing many types of hematopoietic cells including CD34+ cells. Improved transduction may be achieved with a chimeric adenoviral vector using the serotype 35 fiber (Ad5-F35) and the serotype 11 fiber (Ad5-F11) for efficient transduction of hematopoietic cells. Helper-dependent adenoviral vectors offer up to a 30 kb payload, along with transient gene expression in HSC, and can be used to deliver multiple HE/exonuclease cassettes, HE-TAL fusions, as well as very large recombination templates. Alternatively it can carry the small Cas9 polypeptide and guide RNAs. These modified chimeric adenovirus vectors may, therefore, be employed for both gene knockout and recombination-based gene editing in HSC.

[0130] Integration-deficient lentiviral and foamyviral vectors (IDLV and IDFV) provide 6 kb (IDLV) to 9 kb (IDFV) payloads, and have well documented capabilities to transduce human HSCs. Within certain aspects, both IDLV and IDFV vectors may be employed for gene knockout and recombination-based gene editing in HSC. IDLV with alternative promoter GFP cassettes provide efficient and high level expression in CD34+ HSC. High titer stocks may be achieved using a TFF purification step. Vectors with a set of promoter/GFP cassettes may be used to provide efficient and high level HE expression in CD34+ HSC and may be generated to express individual HEs, HB/Trex2, multiplex-HE (i.e., two, three, or four HEs that are co-expressed), and multiplex-HE/TREX2 combinations. Multiplex HE expression permits multiple cleavage events in a critical region, which depending upon the precise application, may be desired to create increased HbF de-repression. Such multiplex strategies are feasible with LHEs, because they function autonomously, and may be satisfactorily employed in combination with TREX2 co-expression to permit highly efficient and synchronous processing of closely-targeted double strand breaks. Alternatively it can carry the small Cas9 polypeptide and guide RNAs.

[0131] The efficiency of gene targeting, levels of globin gene expression in individual targeted cells as well as populations of cells and of their progeny, the effect of targeting on erythropoiesis and on stem cell function, and on hematologic parameters and organ function may be continued in model organisms.

[0132] Transductions may be followed by single-cell and bulk population assessments of modification efficiency and expression of .beta.-like genes at the RNA and protein levels. Alterations in factor binding and chromatin structure may be assessed, as well as morphology, the extent of ineffective erythropoiesis and apoptosis. Candidates that score well in initial screens may be further assessed for effects on HSC pluripotency as well as the ability to ameliorate disease specific phenotypes in vitro and in vivo.

[0133] Initial screening of HE candidates and delivery systems may be performed in a mouse erythroleukemia cell line containing a single intact human chromosome 11 (N-MEL) and clinical grade CD34+ normal human HSCs with endpoints of assessing targeted mutation efficiency and globin gene expression. Both cell types can be induced to differentiate along an erythroid path during which expression of .beta.-like genes is highly induced with high .beta.- to .quadrature.- and .delta.- ratios allowing a quantitative assessment of effects globin gene regulation at a single-cell and population level. Second level assessments may include an analysis of the pluripotency of transduced CD34+ cells and erythropoiesis. Suitable assay systems may include culturing to assess long-term proliferative potential, analysis of myeloid and erythroid colonies for clonal analysis and transplant into NOD SCID gamma (NSG) mice followed by assessment of multilineage engraftment of primary and secondary recipients. Clinical effectiveness may be assessed simultaneously in vitro and in vivo.

[0134] Knockout of murine Bcl11a leads to a dramatic dose-dependent increase in .gamma.-globin in mice containing a human .beta.-globin locus and ameliorates the sickle phenotype in humanized mouse models. While both systems allow the analysis of globin gene expression, the sickle mice allow for the assessment of the improvement of phenotype in these mice with special attention to the hematologic parameters, liver and lung pathology, renal function and spleen size. Phenotypic improvement may be correlated to the number of HbF containing cells, the HbF/HbS ratio and expression patterns in single cell assays.

[0135] In addition, erythrocyte lifespan and morphology may be assessed by transducing human CD34+ HSCs from hemoglobinopathy patients. Cultured thalassemic cells show minimal expansion, a lack of hemoglobinization, evidence of ineffective erythropoiesis and increased apoptosis compared to normals. These features permit the quantitative assessment of expression levels and degree of erythropoiesis post-targeting. The degree of sickling of erythroid progeny of CD34+ cells under hypoxic conditions may also be assessed. CD34+ cells from patients may be transplanted into NSG mice, after which several features of abnormal erythropoiesis are be recapitulated, allowing assessment of the effect of targeted mutagenesis.

Expansion of Autologous HSCs, ESs, and iPSC-Derived HSCs

[0136] Within further embodiments, the present disclosure provides compositions and methods for the ex-vivo expansion of modified hematopoietic stem cells (HSCs) to allow for efficient engraftment of corrected cells and the use of induced pluripotent stem cells (iPSCs) for screening and clinical application. Within certain aspects of these embodiments are provided compositions and methods for the efficient expansion of autologous HSCs, autologous gene-modified HSCs, ESs, and iPSC-derived HSCs. Cord blood expansion methodology may be employed, which methodology utilizes Delta1 in serum free media supplemented with hematopoietic growth factors using mobilized peripheral blood CD34+ obtained from normal donors. These compositions and methods may be used in combination with one or more additional reagent to enhance the survival and proliferation of hematopoietic stem/progenitor cells. Within other aspects, these compositions and methods may employ endothelial cell co-cultures for the enhanced expansion of long-term repopulating cells, including corrected iPSC-derived HSCs.

[0137] For effective clinical translation of the presently disclosed gene correction strategics, the present disclosure provides methods for the ex vivo expansion of the absolute number of corrected autologous HSCs. Gene correction procedures are generally more efficient if done in a smaller scale and often only limited numbers of HSCs are available for correction. Thus, it is contemplated by the present disclosure that expansion methods may be employed to permit clinically feasible ex vivo expansion of corrected HSCs, ESs, and/or HSCs derived from induced pluripotent stem cells (iPSCs). Within certain aspects, the present disclosure provides methods for expanding hematopoietic stem/progenitor cells for therapeutic application by exploiting the role of Notch signaling in determining stem cell fate. Dahlherg et al., Blood 117:6083-90 (2010); Delaney et al., Nat Med 16:232-6 (2010); and Varnum-Finney et al., Nat Med 6:1278-81 (2000).

[0138] These methods permit the clinically relevant ex vivo expansion of cord blood stem/progenitor cells, and an expanded cellular therapy for treatment of myelosuppression in patients undergoing cord blood transplantation, by first using a partially HLA-matched fresh product (harvested post-culture and infused directly) and/or by using a previously expanded and cryopreserved product as an off-the-shelf non-HLA matched cellular therapy.

[0139] Ex vivo expansion of gene-corrected autologous HSCs enhances the safety and effectiveness of HSC-based gene therapy by permitting the transplantation of greater numbers of appropriately corrected repopulating cells to allow for rapid repopulation and ensures predominance of gene-corrected cells in vivo. Accordingly, the present disclosure provides compositions and methods for the supportive care via a third-party, non HLA-matched, donor ex vivo expanded stem/progenitor cell, which is capable of providing rapid but transient myeloid recovery, essential to reduce the risk of early transplant related mortality secondary to infections that is observed after myeloablative T cell depleted autologous transplants. Delaney et al., Nat Med 16:232-6 (2010).

[0140] Agents that inhibit differentiation (e.g., the Notch ligand) may be combined with compositions and methods that enhance the proliferation and survival of early stem/progenitor cells thereby achieving improved Notch-mediated ex vivo expansion. Enhanced proliferation of cord blood stem/progenitor cells may be achieved by combining the Notch ligand, Delta1, with the aryl hydrocarbon receptor inhibitor (SRI) (Boitano et al., Science 329:1345-8 (2011) or HoxB4 (Watts et al., Blood 116:5859-66 (2010) and Zhang et al., PLoS Med 3:e173 (2006)) to enhance proliferation and self-renewal of hematopoietic precursors, and with angiopoietin-like 5 to enhance their survival. Essential to the clinical application of gene therapy is the ability to expand long-term repopulating cells, assuring longevity of the corrected cell graft.

[0141] Akt-activated endothelial cells may be employed in co-culture systems to confirm expansion of gene-corrected cells. Butler et al., Cell Stem Cell 6:251-64 (2011). Expansion of gene-corrected cells depends upon endothelial cell-induced activation of Notch signaling in the hematopoietic precursors. A second critical aspect for clinical application is the genetic and epigenetic fidelity of the derived cells as compared to their normal counterparts to ensure appropriate behavior and lack of oncogenic potential in vivo. Importantly, genome-wide assessment of expanded cord blood stem/progenitor cells exhibit fidelity of the transcriptome, chromatin structure, and the DNA methylome in comparison with primary isolated CD34+ cells.

[0142] Expansion strategies in normal CD34+ cells may be employed in conjunction with defined methods that utilize CD34+ cells from patients with hemoglobinopathies. Cord blood expansion methodology may utilize Delta1 in serum free media supplemented with hematopoietic growth factors using mobilized peripheral blood CD34+ obtained from normal donors. Optimized ex vivo expansion conditions using established in vitro assays (immunophenotyping, growth, etc) and in vivo repopulating ability may be assessed using the NSG mouse model. Optimized conditions may be used in combination with compositions that include SRI (aryl hydrocarbon receptor inhibitor), Hox proteins, or angiopoietins to enhance the proliferation and survival of early stem/progenitor cells. Promising combinations may be evaluated in progenitor cell in vitro assays and in the immunodeficient mouse model (NSG mice) and then extended from expansion of CD34+ from normal individuals to evaluate these methods for expansion of CD34+ cells from patients with thalassemia (and other hemoglobinopathies).

[0143] The transcriptional, genetic, and epigenetic fidelity of expanded cells with their normal counterpart HSCs may be assessed using genome wide approaches to assess the oncogenic potential of the generated cells. Following growth in vivo (after infusion), cells may be used to determine whether there are functionally significant aberrations that enhance in vivo growth of any affected clone(s), thereby allowing selective expansion and detection of rare cells.

Cellular Therapies to Abrogate Post-Transplant Neutropenia and to Improve Outcome Following Transplantation of Gene-Corrected Autologous HSCs

[0144] Within another embodiment, the present disclosure provides compositions and methods for providing supportive care, which compositions and methods comprise off-the-shelf cellular therapies that abrogate post-transplant neutropenia and improve outcome following transplantation of gene-corrected autologous HSCs. Ex-vivo expanded, cryopreserved cord blood (CB) stem/progenitor cells may, for example, be administered as a means of supportive care to patients with thalassemia and/or sickle cell disease who are undergoing myeloablative HCT with autologous CD34+ gene corrected cells.

[0145] In studies aimed at developing an economically feasible "off-the-shelf" source of progenitor cells capable of providing rapid neutrophil recovery, a bank of pre-expanded, cryopreserved hematopoietic stem/progenitor cell products was generated--each being derived from a single CB unit that can be held for future clinical use.

[0146] The safety of administering this "off-the-shelf" non-HLA matched product to adults was demonstrated immediately following first salvage chemotherapy for relapsed/refractory AML, as well as in the myeloablative CBT setting in pediatric and adult patients with hematologic malignancy.

[0147] It has been hypothesized that this expanded cell product which is devoid of T cells, can be infused as an off-the-shelf cellular therapy to provide rapid but temporary myeloid engraftment and to potentially facilitate autologous hematopoietic recovery in patients undergoing myeloablative HCT with autologous gene-corrected stem cell grafts, thereby reducing the infectious complications and risk of mortality.

[0148] Critical is the question of whether HLA-matching is required for safe infusion of an "off-the-shelf" non-HLA matched product, which is devoid of T cells. Without the need for HLA-matching, fresh CB units can be collected for immediate ex vivo expansion and the final product cryopreserved for future on demand use. Patient access to an off-the-shelf expanded CB product is dramatically enhanced as all of the expanded products banked would be potentially available for any given patient, regardless of HLA typing, race/ethnicity or location of the patient.

[0149] Moreover, the ability to create an off-the-shelf universal donor expanded cell therapy is not only promising to shorten the duration of severe neutropenia post HCT, it is also likely to enhance more broad areas of investigation outside of stem cell transplantation, e.g., as a way of providing temporary myeloid engraftment for treatment of chemotherapy induced severe neutropenia, any acquired severe neutropenia or accidental radiation exposure.

[0150] Ex vivo expansion abrogates the risks of CBT by overcoming delayed hematopoietic recovery and a significant improvement in overall survival will result. A reduced risk of relapse has been observed in patients undergoing double CBT, and chronic GVHD is lower despite highly mismatched grafts. If the risk of early transplant related mortality can be reduced by infusion of ex vivo expanded cord blood progenitors to enhance hematopoietic recovery, overall survival is likely to exceed that seen with conventional unrelated donors.

[0151] Within further embodiments, the present disclosure provides cellular therapies to abrogate post-transplant neutropenia and to improve outcome following transplantation of gene-corrected autologous HSCs. Patients with thalassemia who undergo myeloablative HCT with autologous gene corrected cells are at increased risk of infections and mortality secondary to limiting numbers of CD34+ cells in the infused graft (until ex vivo expansion of these gene corrected cells to clinically feasible numbers are achieved). Infusion of a previously expanded and cryopreserved cord blood progenitor cell product as an off-the-shelf supportive care measure can be employed to reduce the risk of mortality by contributing to early, but transient, myeloid recovery until the long term graft contributes to hematopoietic recovery.

[0152] Patients who undergo myeloablative HCT experience severe pancytopenia as a direct consequence of the conditioning regimen, and all patients are at increased risk of infection and bleeding during this time. The time to hematopoietic recovery (of neutrophil and platelets) is directly influenced by the CD34+ cell dose, and thus, for those patients undergoing myeloablative HCT with umbilical cord blood where the stem cell dose is 1/10.sup.th of a conventional donor graft or with autologous CD34 enriched low cell dose grafts, the risk of transplant related mortality due to delayed hematopoietic recovery is even greater.

[0153] To overcome these risks and to increase the safety of these HCT approaches, there is a great need for novel therapies that can abrogate prolonged pancytopenia and facilitate more rapid hematopoietic recovers. As discussed above, such a strategy has been developed wherein the absolute number of marrow repopulating cord blood (CB) hematopoietic stem/progenitor cells (HSPC) can be increased by culture with the Notch ligand Delta1. Infusion of these partially HLA-matched ex vivo expanded CB cells into children or adults undergoing cord blood transplantation (CBT) has been demonstrated to be safe and can significantly shorten the time to reach an initial absolute neutrophil count of 500 from 26 to 11 days, as a result of rapid myeloid engraftment contributed by the expanded cells.

[0154] In more recent studies aimed at developing an economically feasible "off-the-shelf" source of progenitor cells capable of providing rapid neutrophil recovery, we have generated a bank of pre-expanded cryopreserved hematopoietic stem/progenitor cell products, each derived from a single CB unit that can be held for future clinical use. We have now also demonstrated the safety of administering this "off-the-shelf" non-HLA matched product to adults immediately following first salvage chemotherapy for relapsed/refractory AML, as well as in the myeloablative CBT setting in pediatric and adult patients with hematologic malignancy. We hypothesize that this expanded cell product which is devoid of T cells can be infused as an off-the-shelf cellular therapy to provide rapid but temporary myeloid engraftment and to potentially facilitate autologous hematopoietic recovery in patients undergoing myeloablative HCT with autologous gene-corrected stem cell grafts, thereby reducing the infectious complications and risk of mortality,

[0155] Using the defined optimal methods for generation of ex vivo expanded cord, blood stem/progenitor cells, a bank of off-the-shelf expanded cell products may be employed to determine the safety of infusing these cells as supportive care in an autologous gene-corrected HCT.

[0156] The present disclosure will be best understood in view of the following non-limiting Examples.

EXAMPLES

Example 1

Selection of Bcl11a Gene Targeting Homing Endonucleases Based on I-HjeMI, I-CpaMI, and I-OnuI Using In Vitro Compartmentalization (IVC)

[0157] The open reading frame (ORF) of a parental LAGLIDADG homing endonuclease (LHE), I-HjeMI (FIG. 14; SEQ ID NO: 28; Jacoby et al., Nucl. Acids Res. 40(11):4954-4964 (2012), Taylor et al., Nucl. Acids Res. 40(Web Server issue): W110-6 (2012)), codon optimized for expression in E. coli, was cloned between the NcoI and NotI restriction sites of pET21-a(+) (FIG. 11; EMD Millipore (Novagen) division of Merck KGaA. To introduce site-directed saturation mutagenesis into the ORF of I-HjeMI, DNA fragments containing its partial ORF with approximately 20 base pairs of a region overlapped with flanking fragments on both sides were PCR-amplified using primers that contained degenerate codon 5'-NNK-3' (coding all 20 amino acids). Amino-acid residues mutated using such PCR primers are shown in Table 2. PCR products were purified by extraction from an agarose gel, and assembled in a subsequent round of PCR with a sequence containing 2 copies of target sites for variant endonucleases to be selected. Successfully assembled DNA fragment was again purified by gel extraction, and used as a library in in vitro compartmentalization (IVC).

[0158] Three rounds of IVC were conducted after each round of site-directed saturation mutagenesis in order to enrich variant nuclease genes with altered specificity. The oil-surfactant mixture (2% ABIL EM 90 (Evonik Industries AG Personal Care, Essen, North Rhine-Westphalia, Germany), 0.05% Triton X-100 in light mineral oil) was thoroughly mixed with the saturation buffer (100 mM potassium glutamate (pH 7.5), 1.0 mM magnesium acetate (pH 7.5), 1 mM dithiothreitol and 5 mg/ml bovine serum albumin), incubated at 37.degree. C. for 20 minutes, and centrifuged at 16,000.times.g for 15 minutes at 4.degree. C. Five hundred microliters of the upper phase was used to emulsify 30 .mu.l of the in vitro protein synthesis mixture (25 .mu.l of PURExpress (New England Biolabs, Ipswich, Mass.), 20 units of RNase inhibitor, 1 mg/ml bovine serum albumin, and 8 ng of a DNA library) by constant stirring at 1,400 r.p.m. for three and a half minutes on ice. The emulsion was incubated at 30.degree. C. for 4 hours, and then heated at 75.degree. C. for 15 minutes. Emulsified droplets were collected by centrifugation at 16,000.times.g for 15 min at 4.degree. C., and broken by an addition of phenol/chloroform/isoamyl alcohol. Nucleic acids were recovered by ethanol precipitation, and treated with RNase cocktail (Life Technologies Corporation (Invitrogen), Grand Island, N.Y.). After purification using QIAquick PCR purification kit (Qiagen, Hilden, Germany), a DNA library was ligated with a DNA adaptor with a 4-base 3' overhang sequence complementary to the cohesive end of a target site generated by endonuclease variants expressed in emulsified droplets, and added to PCR mixture containing a pair of primers, one of which was specific for the ligated DNA adaptor in order to enrich genes of variant endonucleases linked to a cleaved target site. A PCR amplicon was gel-purified and the ORF of variant genes was further PCR-amplified to prepare a DNA library to be used in the subsequent round of IVC.

[0159] In the second round of IVC, an emulsion was made with 1 ng of a reconstructed library, and incubated at 42.degree. C. for 75 minutes before quenching in vitro transcription/translation reaction by heating at 75.degree. C. The DNA library was recovered and active endonuclease genes were specifically enriched by PCR following ligation with a DNA adaptor as described above.

[0160] In the third round of IVC, an in vitro protein synthesis mixture containing 0.5 ng of a library fragment was emulsified in 4.5% Span 80/0.5 % Triton X-100/light mineral oil. The reaction ran at 42.degree. C. for 45 minutes and was heat-inactivated at 75.degree. C. After extraction from emulsion, cleaved target site-associated endonuclease genes were PCR-amplified and subjected to the subsequent round of site-directed mutagenesis.

[0161] To redesign I-HjeMI variants that recognized the (-) and (+) half sites of the BCL11A gene target, 4 and 2 rounds of site-directed saturation mutagenesis were earned out, respectively (FIG. 13). A pool of variant nucleases targeting the former half-site was subjected to an additional (fifth) round of mutagenesis on the surface opposite to the protein-DNA interface, followed by 3 rounds of IVC (Table 2).

TABLE-US-00002 TABLE 2 Amino-acid Positions Subjected to Saturation Mutagenesis in IVC Target Sequence Round Site* Identifier Amino Acid Residues 1 TTGAGGAGATG SEQ ID R61, R63, N64, E65, TCTCTGTTAAT NO: 55 I66, M68, S70 2 TTGAGGTGATG SEQ ID Y20, S22, E33, G35, TCTCTGTTAAT NO: 56 E37, S59, R61, R70, R72 3 TTGAAGTGATG SEQ ID Y20, S22, T24, T31, TCTCTGTTAAT NO: 57 E33, G35, R72, R74 4 TCCAAGTGATG SEQ ID Y20, S22, T24, K26, TCTCTGTTAAT NO: 58 G27, K28, T31, E33 5 TCCAAGTGATG SEQ ID S109, N110, A121, TCTCTGTTAAT NO: 59 S123, N124, N135, S137 1 TTGAGGAGGTT SEQ ID S154, S168, D170, TCTGTGTTAAT NO: 60 I193, L195, R202, K204 2 TTGAGGAGGTT SEQ ID S154, L158, N159, TCTCGGTGGTG NO: 61 D162, D163, I166, I168, K204, T206 *Underlined nucleotides differ from those in the target site for the parental LHE I-HjeMI.

DNA fragments that encoded the N-terminal and the C-terminal half-domains of I-HjeMI variant endonucleases responsible for the (-) and (+) half sites of the BCL11A gene target were assembled, and a pool of nucleases that cleaved the full BCL11A gene target site were selected through 3 rounds of IVC (FIG. 13).

[0162] Table 3 presents exemplary BCL11a target sequences, which comprise DMA sequence modules for which pools of highly active endonuclease variants (based upon homing endonucleases I-CpaMI and I-OnuI) have been isolated and their sequences determined.

TABLE-US-00003 TABLE 3 Base Homing Endonuclease I-CpaMI f 683/2508 ATGGGATTCAT SEQ ID chr2: 60, 542, 847-60, 542, 868 ATTGCAGACAA NO: 25 Disrupts Bcl11a-X and XL forms Base Homing Endonuclease I-OnuI r 1588/2508 AGCCATTGGAT SEQ ID chr2: 60, 542, 630-60, 542, 651 TCAACCGCAGC NO: 26 Disrupts Bcl11a-X and XL forms f 525/2508 caaCAgccATT SEQ ID chr2: 60, 543, 005-60, 543, 026 CAcCagTgcA NO: 27 Disrupts all Bcl11a forms

Example 2

Optimization of Activity of BCL11A Gene-Targeting I-HjeMI Variants Using Two-Plasmid Gene Elimination Cleavage Assay in Bacteria

[0163] The activity of I-HjeMI variants obtained in selection using IVC display selections (disclosed in Example 1, above) was optimized using a two-plasmid selection system in bacterial cells according to the methodology of Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006). The ORF of the endonuclease genes was inserted between NcoI and NotI sites of the pENDO (FIG. 12, Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006) expression plasmid. NovaXGF (EMD Millipore (Novagen)) competent cells harboring the pCcdB reporter plasmid (FIG. 31, Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006); Takeuchi et al., Nucl. Acids Res. 37(3)877-8890 (2009); and Takeuchi et al., Proc. Natl. Acad Sci. U.S.A. 10.1073/pnas.1107719108 (2011)) containing 4 copies of the BCL11A gene target were transformed with a pool of the pEndo plasmid encoding I-HjeMI variants. The transformants were grown in 2.times.YT medium (16 g/L tryptone, 10 g/L yeast extract, and 5 g/L NaCl) at 37.degree. C. for 30 min and then diluted 10-fold with 2.times.YT medium supplemented with 100 .mu.g/mL carbenicillin and 0.02 % L-arabinose (in order to preinduce expression of I-HjeMI variants). After the culture was grown at 30.degree. C. for 15 hours, the cells were harvested, resuspended in sterile water and spread on both nonselective (1.times.M9 salt, 1 % glycerol, 0.8 % tryptone, 1 mM MgSO.sub.4, 1 mM CaCl.sub.2, 2 .mu.g/mL thiamine, and 100 .mu.g/mL carbenicillin) and selective plates (i.e. nonselective plates supplemented with 0.02% L-arabinose and 0.4 mM IPTG to induce expression of the toxic CedB protein). After incubation at 30.degree. C. for 30-40 hours, the pEndo plasmid was extracted from the surviving colonies on the selective plates.

[0164] The ORFs encoding active I-HjeMI variants were amplified via error-prone PCR using the Gene Morph II Random Mutagenesis Kit (Agilent Technologies, Santa Clara, Calif.). After digestion with NcoI, NotI, and DpnI, the resulting fragments were re-cloned into the pEndo vector. The plasmid was subjected to 2 rounds of selection under the conditions where variant endonucleases were expressed at 30.degree. C. for 4 hours before plating. The N-terminal half and C-terminal half domains of the selected genes were shuffled using overlapping PCR, and again cloned into the pEndo vector. Transformed cells carrying both the pEndo plasmid and the pCcdB reporter were grown in 2.times.YT medium containing 0.02 % L-arabonise at 37.degree. C. for an hour and then spread on selective plates at 37.degree. C. for 16-20 hours. After 2 rounds of selection at the same level of stringency, the pEndo plasmid was extracted from surviving colonies on the selective plates, and ORFs of the variant genes carried on the plasmid were sequenced.

Example 3

Activity of BCL11A Gene-Targeting Endonucleases Tested in a Two-Plasmid Cleavage Assay

[0165] Activity of an exemplary BCL11A gene-targeting endonuclease (BCL11Ahje; FIG. 17, SEQ ID NO: 31), its catalytically inactive variant (BCL11Ahje D18N), and its parental LHE I-HjeMI (FIG. 14, SEQ ID NO: 28) was measured in bacterial cells that harbor the pCcdB reporter plasmid (Doyon et al., J. Am. Chem. Soc. 128(7):2477-2484 (2006)) containing 4 copies of either the target site for I-HjeMI (I-HjeMI target) or the BCL11A gene target (TCCAAGTGATGTCTCGGTGGTG (SEQ ID NO: 39; underlined nucleotides differ from those in the target site for the parental LHE I-HjeMI). The pCcdB reporter plasmid encodes "control of cell death B" ("ccdB", a toxic protein in bacteria, which is inducible by an addition of IPTG). Cleavage of the target sites in the reporter plasmid leads to RecBCD-mediated degradation of the reporter plasmid and corresponding cell survival on the selective medium containing IPTG. The survival rate was determined by dividing the number of colonies on the selective plates by that on the nonselective plates. Error bars refer .+-.S.D. of 3 independent experiments.

Example 4

Detection of Targeted Mutagenesis at the Endogenous Human BCL11A Gene

[0166] HEK 293T cells (1.6.times.10.sup.5) were seeded 24 hours prior to transaction in 12-well plates, and transfected with 0.5 ug each of expression plasmids for the BCL11A gene targeting nuclease and TREX2. At 48 hours post transfection, transfected cells were lysed and genomic DNA was extracted using Quick-gDNA MiniPrep kit (Zymo Research). Approximately 500-bp fragment spanning the BCL11A gene target was PCR-amplified from 50 ng of the extracted genomes using a pair of the following primers: Bcl11A_up1,5'-GCT GGA ATG GTT GCA GTA AC-3' (SEQ ID NO: 66); Bcl11A_down1,5'-CAA ACA GCC ATT CAC CAG TG-3' (SEQ ID NO: 67). The PCR amplicon was incubated in 1.times.NEB buffer 4 plus 1.times.BSA (New England Biolabs) with or without 0.5 uM of the BCL11A gene targeting nuclease that was purified from E. coli overexpressing the recombinant protein at 37.degree. C. for 2 hours. The reaction was terminated by adding 5.times.Stop solution (50 mM Tris-HCl (pH7.5), 5 mM EDTA, 0.5 % SDS, 25% glycerol 0.1 orange G and 0.5 mg/mL proteinase K). After incubation at room temperature for 15 minutes, a half of each sample was separated on a 1.6% agarose gel containing ethidium bromide in TAE (upper panels). The rest of each sample was purified using DNA Clean & Concentrator-5 kit (Zymo Research), and used as a template in the second round of PCR with a pair of the following primers: Bcl11A_up2, 5'-CTG CCA GCT CTC TAA GTC TCC-3' (SEQ ID NO: 68); Bcl11A_down2, 5'-TCC AAC ACG CAC AGA ACA CTC -3' (SEQ ID NO: 69). The PCR product was again digested with the BCL11A gene targeting nuclease under the conditions described above, and analyzed on a 1.6 % agarose gel (lower panels) (See FIG. 30).

Example 5

Selection of Fetal Hemoglobin Silencing Region Targeting Endonucleases Based on I-OnuI Using In Vitro Compartmentalization

[0167] Exemplary homing endonuclease (HE) target sequences, which are evenly distributed throughout the 350 bp region (SEQ ID NO: 2) that includes the region of Bcl11a occupancy within the HbF silencing region in adult erythroid cells that is disrupted in the French HPFH deletion, are presented in Table 4. These target sequences comprise DNA sequence modules for which pools of highly active endonuclease variants have been isolated and sequenced.

TABLE-US-00004 TABLE 4 Chromosomal Sequence Position Location Sequence Identifier Wild N/A TTTCCACTTAT SEQ ID Type TCAACCTTTTA NO: 5 f 13/303 chr11: 5, 214, TGTGGCCCTAT SEQ ID 235-5, 214, 256 TCTTGTGTTCA NO: 6 f 79/303 chr11: 5, 214, CATTGTCACTT SEQ ID 169-5, 214, 190 TCTTCCCTACT NO: 7 f 143/303 chr11: 5, 214, TAAAATACATT SEQ ID 105-5, 214, 126 TCTTCACTAAG NO: 8 f 124/303 chr11: 5, 214, ACTAAGTGAGA SEQ ID 089-5, 214, 110 ATAATCTTTTA NO: 9 f 200/303 chr11: 5, 214, GCCACCACCTT SEQ ID 048-5, 214, 069 TCTTGAATTAT NO: 10 f 211/303 chr11: 5, 214, TCTTGAATTAT SEQ ID 037-5, 214, 058 TCAATATCTTT NO: 11 f 274/303 chr11: 5, 213, TTAAAGGTCAT SEQ ID 974-5, 213, 995 TCATGGCTCCT NO: 12

[0168] Table 5 presents a region from -100 bp to 210 bp upstream of globin genes, which is identical for both A.gamma.-and G.gamma.-globin genes and which contains many of the non-deletion HPFH mutations. Gene editing resulting in these mutations leads to decreased repression, thus activation, of a gamma gene and results in increased HbF.

TABLE-US-00005 TABLE 5 Sequence Sequence Identifier Wild-type TGGGGGCCCCTTCCCCACACTATCTCAATGCAAATATCTG SEQ ID NO: 16 TCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGC CAGCCTTGCCTTGACCAATAGCCTTGACAA G-gamma - TGGGGGCGCCTTCCCCACACTATCTCAATGCAAATATCTG SEQ ID NO: 17 202 C G TCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGC CAGCCTTGCCTTGACCAATAGCCTTGACAA G-gamma - TGGGGGCCCCTTCCCCACACTATCTCAATGCAAACATCTG SEQ ID NO: 18 175 T C TCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGC CAGCCTTGCCTTGACCAATAGCCTTGACAA G-gamma - TGGGGGCCCCTTCCCCACACTATCTCAATGCAAATATCTG SEQ ID NO: 19 114 C T TCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGC CAGCCTTGCCTTGACTAATAGCCTTGACAA A-gamma - TGGGGGCCCCTTCTCCACACTATCTCAATGCAAATATCTG SEQ ID NO: 20 196 C T TCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGC CAGCCTTGCCTTGACCAATAGCCTTGACAA A-gamma - TGGGGGCCCCTTCCCCACACTATCTCAATGCAAACATCTG SEQ ID NO: 21 175 T C TCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGC CAGCCTTGCCTTGACCAATAGCCTTGACAA A-gamma - TGGGGGCCCCTTCCCCACACTATCTCAATGCAAATATCTG SEQ ID NO: 22 117 G A TCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGC CAGCCTTGCCTTAACCAATAGCCTTGACAA A-gamma - TGGGGGCCCCTTCCCCACACTATCTCAATGCAAATATCTG SEQ ID NO: 23 114 102 TCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGC deleted CAGCCTTGCCTTGACCAATAGCCTTGACAA (deleted bases in bold)

[0169] Table 6 presents amino acid positions within a parental LHE I-OnuI homing endonuclease (FIG. 22A, SEQ ID NO: 34) that were subjected to saturation mutagenesis in IVC (as described in Example 1, above) to create homing endonucleases that are targeted against a human fetal globin silencing region.

TABLE-US-00006 TABLE 6 Amino-acid Positions Subjected to Saturation Mutagenesis in IVC to Create Targeted Homing Endonucleases against a Human Fetal Globin Silencing Region Sequence Round Target site* Identifier Amino-acid residues 1 TTTCCAATTATTCAACCTTTTA SEQ ID NO: L26, G44, Q46, A70, 40 S72, S78, K80 2 TCTTGAATTATTCAACCTTTTA SEQ ID NO: L26, R28, R30, N32, 41 S40, E42, G44, K80, T82 1 TTTCCATTTATTCAATATTTTA SEQ ID NO: F182, N184, V199, S201, 42 K225, K227, D236, V238 2 TTTCCATTTATTCAATATCTTT SEQ ID NO: F182, N184, I186, S190, 43 K191, Q197, V199, V238, T240

[0170] FIG. 23 presents the results of a of a cleavage assay with `half-targets` from a human fetal globin silencing region. The amplified bands contain both the cleaved half-sites (captured by ligation with complementary duplex oligonucleotides and corresponding overhanging ssDNA) and the sequences of the enzyme variants that are responsible for generation of cleaved DNA products. The final step upon completion of enrichment of the `half-site` endonuclease libraries includes the assembly of DNA fragments that encode the N-terminal and C-terminal half domains of I-OnuI homing endonuclease, which are responsible for the left (L) and right (R) half sites of the gGlobin silencing region target. Active I-OnuI endonucleases are selected from a pool that cleaves the full-length human fetal globin silencing region target.

Example 6

MegaTALs Homing Endonucleases with N-Terminal Fusions of TAL Anchors to Increase Specificity and Activity of a Gene-Targeted Endonuclease

[0171] N-terminal fusions of TAL anchors can be employed to increase the specificity and activity of a gene-targeted endonuclease, including one or more homing endonucleases such as one or more of the I-HjeMI, I-CpaMI, and I-OnuI homing endonucleases. MegaTALs are constructed using the Golden Gate assembly strategy described by Cermak et al., Nucl. Acids Res. 39:e82-e82 (2011), using an RVD plasmid library and destination vector (see, FIG. 24, SEQ ID NO: 35 and FIG. 25, SEQ ID NO: 36 for the nucleotide and amino acid sequences of MegaTAL:5.5 RVD+Y2 I-AniI).

[0172] Plasmids are modified to allow the assembly of TAL effector containing 1.5 to 10.5 TAL repeats and their corresponding RVDs (`Repeat Variable Diresidues,` which contact consecutive DNA bases in the 5' region of the target site and thereby define the cognate DNA sequence in that region). The pthXO1 destination vector was modified to include a hemagglutinin (HA) tag immediately downstream of the NLS and to yield a TALEN scaffold that begins at residue 154 (relative to wild-type PthXo1 TAL effector) and ends 63 residues beyond the final `halfTAL repeat` sequence.

[0173] TAL effectors are built using the following RVDs to target each specific nucleotide: A--NI, C--HD, G--NN and T--NG. Following cloning of the TAL effector repeats into the destination vector, an individual protein linker (`Zn4`; VGGS) and the engineered homing endonuclease variants are cloned in place of the FokI nuclease catalytic domain, between engineered Xba-I and Sal-I restriction sites.

[0174] This is a `model test case` MegaTAL (a fusion of a TAL effector at the N-terminal end of a single protein chain, fused via a flexible linker to the wild-type Y2 I-AniI homing endonuclease, which was originally described in Takeuchi et al., Nucl. Acids Res. 37(3): 877-890 (2009).

Example 7

A Cas9-Based Endonuclease System for Disrupting a Bcl11a-Regulated Fetal Hemoglobin (HbF) Silencing Region

[0175] The recent mechanistic understanding of the clustered regularly interspaced short palindromic repeat (CRISPR) system that bacteria use for adaptive immunity has led to the development of a powerful tool that allows for genome editing of mammalian cells, which can be employed in the compositions and methods for the treatment of hemoglobinopathies that are disclosed herein: (a) to disrupt a Bcl11a coding region; (b) to disrupt a HbF silencing DNA regulatory element or pathway, such as a Bcl11a-regulated Hbf silencing region; (c) to mutate one or more .gamma.-globin gene promoter(s) to achieve increased expression of a .gamma.-globin gene; (d) to mutate one or more .delta.-globin gene promoters) to achieve increased expression of a .delta.-globin gene; and/or (e) to correct one or more .beta.-globin gene mutation(s). The bacterial CRISPR system is described in Jinek et al., Science 337:816-821 (2013); Cong et al., Science (Jan. 3, 2013) (Epub ahead of print); and Mali et al., Science (Jan. 3, 2013) (Epub ahead of print).

[0176] The Cas9 protein generates a double stranded break at a specific site the location of which is determined by an RNA-guide sequence. All guide RNAs contain the same scaffold sequence that binds Cas9, as well as a variable targeting sequence having the structure G-N.sub.20 -GG, which provides Cas9-RNA complex cleavage specificity. Co-expression of the Cas9 protein and a guide RNA results in the efficient cleavage and disruption at a sequence-specific location within the human genome, which sequence-specific cleavage is defined by the guide RNA sequence. Co-expression of Cas9 and guide RNAs that are specific to multiple targets leads to efficient deletion of the intervening region between target sites.

[0177] Thus, within certain aspects of the present disclosure, Cas9-mediated genome editing is employed: (1) to disrupt the Bcl11a binding site within the HbF silencing region, (2) to disrupt Bcl11a gene function, and (3) to delete the entire HbF silencing region. Target regions are identified and guide RNAs are designed and generated based on consideration of the optimal guide RNA target sequences. Exemplified herein are guide RNAs that target the Bcl11a binding region within the HbF silencing region as well as the single GATA-1 binding motif. These guide RNAs are used singly or in combination to achieve the targeted disruption of the HbF silencing region. Cas9 with guide RNAs to additional regions within the HbF silencing regions that correspond to Bcl11a peaks of occupancy are also used singly and in combination. Several pairs of guide RNAs flanking the Bcl11a binding site and GATA-1 motif, as well as the entire footprint, can also be co-expressed with Cas9 in order to generate deletions within the HbF silencing region.

[0178] The sequence of a human codon optimized Cas9 from Mali et al., Science (Jan. 3, 2013) is presented in FIG. 26, SEQ ID NO: 37. The generic sequence of a guide RNA (Mali et al.) is presented in FIG. 27, SEQ ID NO: 38, the key sequence elements of which are presented in Table 7. Exemplary Cas9 Guide RNAs sequences of target-specific binding to and cleavage of the human fetal hemoglobin (HbF) silencing region (FIG. 6, SEQ ID NO: 1 and FIG. 7, SEQ ID NO: 2) are presented in Table 8.

TABLE-US-00007 TABLE 7 Sequence Elements of a Generic Cas9 Guide RNA Sequence Nucleotide Description Identifer Sequence U6 Promoter SEQ ID NO: 44 GGACGAAACACC Sequence Generic Target- SEQ ID NO: 45 GNNNNNNNNNNNNNNNNNNN specific Sequence Guide RNA SEQ ID NO: 46 GTTTTAGAGCTAGAAATAGC Scaffold AAGTTAAAATAAGGCTAGTC Sequence CGTTATCAACTTGAAAAAGT GGCACCGAGTCGGTGCT Poly T Tail SEQ ID NO: 47 NNNNTTTTTT

TABLE-US-00008 TABLE 8 Target-specific Sequences for Exemplary Cas9 Guide RNAs Sequence Nucleotide Designation Description Use Identifer Sequence GGN20GG-B Targets the Used singly, SEQ ID NO: 48 GCCATTTCTATTA GATA-1 with #C to TCAGACTTGG recognition delete the motif putative Bcl11a and GATA-1motifs jointly, or with #E, #F or #G to delte the entire Bcl11a ChIP peak and surrounding sequences GGN20GG-C Targets the Used singly, SEQ ID NO: 49 GCTGGGCTTCTGT putative Bcl11a with #B to TGCAGTAGGG recognition delete the motif putative Bcl11a and GATA-1motifs jointly GGN20GG-D Tagets Used singly, SEQ ID NO: 50 GAAAATGGGAGAC immediately with #B to AAATAGCTGG adjacent to the delete the putative Bcl11a putative recognition Bcl11a and motif GATA-1motifs jointly GGN20GG-E Tagrets Used with #B SEQ ID NO: 51 GAATAATTCAAGA downstream of and/or #H to AAGGTGGTGG the Bcl11a delete the binding peak entire Bcl11a ChIP peak and surrouning sequences GGN20GG-F Targets Used with #B SEQ ID NO: 52 GATATTGAATAAT downstream of and/or #H to TCAAGAAAGG the Bcl11a delete the binding peak entire Bcl11a ChIP peak and surrouning sequences GGN20GG-G Targets Used with #B SEQ ID NO: 53 GCCTGAGATTCTG downstream of and/or #H to ATCACAAGGG the Bcl11a delete the binding peak entire Bcl11a ChIP peak and surrouning sequences GGN20GG-H Targets Used with #E, SEQ ID NO: 54 GGTAAATTCTTAA upstream of the #F or #G to GGCCATGAGG Bcl11a binding delete the peak entire Bcl11a ChIP peak and surrounding sequences

Example 8

Vector Systems for Expressing Endonucleases

[0179] For NSG, sickle cell and thalassemia mouse models, human CD34 cells or mouse bone marrow nucleated cells are transduced along with a fluorescent marker allowing flow cytometry-based enrichment of cells prior to transplantation. Suitable transduction methods include the following:

[0180] AAV6 vectors. AAV6-serotype recombinant AAV vectors provide a 4.5 kb payload, sufficient to deliver a promoter-HE-exonuclease or promoter-TAL-HE fusion-exonuclease cassettes in addition to a small recombination template. Alternatively they can carry Cas9 and a guide RNA. in addition, we have preliminary data that show AAV6 provides the most efficient transduction of human CD34+ umbilical cord blood cells of all known AAV capsids, and is able to mediate significant levels of transient gene expression in HSC.

[0181] Modified Adenovirus vectors. Adenoviral vectors with hybrid capsids are capable of efficiently transducing many types of hematopoietic cells including CD34+ cells. Improved transduction with the chimeric vector using the serotype 35 fiber (Ad5-F35) was demonstrated by Dr. Rowlings (SCH) and more recent data suggest that the serotype 11 fiber (Ad5-F11) may be even more efficient in hematopoietic cells. Helper-dependent adenoviral vectors offer up to a 30 kb payload, along with transient gene expression in HSC, and can be used to deliver multiple HE/exonuclease cassettes, HE-TAL fusions, as well as very large recombination templates or a Cas9 expression cassette and multiple guide RNAs.

[0182] Integration-deficient Lentiviral and Foamyviral Vectors (IDLV and IDFV). These vectors provide 6 kb (IDLV) to 9 kb (IDFV) payloads, and have well documented capabilities to transduce human HSCs. Both. IDLV and IDFV vectors can be used for gene knockout and recombination-based gene editing in HSC. Drs. Rawlings (SCH) and Kiem (FHCRC) have generated and evaluated a series of IDLV with alternative promoter GFP cassettes and have determined constructs that provide efficient and high level expression in CD34+ HSC.

[0183] Direct nucleofection of plasmid and mRNA. Conditions for efficient transduction of N-MEL and CD34 cells have been defined using the Amaxa nucleofection system. Benefits include the lack of integration, and the ability to transduce multiple expression plasmids or RNA species simultaneously.

[0184] In parallel, sorted and un-sorted cells will be transplanted into separate mice. While the later transplants may contain low numbers of modified cells, human studies of post-transplant chimeras suggest that these cells will have a selective survival advantage and be enriched in the periphery. Regardless, single reticulocyte RNA and F-Cell analysis will allow assessment of gene disruption in cells even if present in low abundance.

[0185] Second level assessments will focus on the pluripotency of transduced CD34+ cells and erythropoiesis. Assays will include culturing to assess long-term proliferative potential, analysis of myeloid and erythroid colonies for clonal analysis and transplant into NOD scid gamma (NSC) mice followed by assessment of multi-lineage engraftment of primary and secondary recipients.

[0186] Typically stem cells are infused via tail vein injection after total body irradiation (275 rads for NSG mice or 1000 rads for C57 mice). Though efficient, this is effective, for most studies we will inject stem cells directly into the mouse femur as 50 fold fewer cells are required, ideal or assaying a potentially limited number of flow cytometry sorted and/or modified cells. After anesthesia and local analgesia are provided and anatomic landmarks defined, 0.5-1 million cells are directly injected into the femurs marrow space.

Example 9

Characterization of Homing and Cas9 Endonucleases for Efficient Gene Targeting

[0187] For clinical impact efficient gene targeting is demonstrated by assessing levels of globin gene expression in individual targeted cells and in populations of cells, the effect of targeting on erythropoiesis and on stem cell function, and impact hematologic parameters and organ function in model organisms.

[0188] Transductions are followed by single cell and bulk population assessments of gene targeting efficiency and expression of all .beta.-like genes at the RNA and protein levels. Alterations in factor binding and chromatin structure are assessed, as cell morphology and the extent of ineffective erythropoiesis and apoptosis. Candidate endonucleases that score well in initial screens are further assessed for effects on HSC pluripotency as well as the ability to ameliorate disease specific phenotypes in vitro and in vivo.

[0189] Initial screening of endonuclease candidates and delivery systems is performed in a mouse erythroleukemia cell line containing a single intact human chromosome 11 (N-MEL) and clinical grade CD34+ normal human HSCs with endpoints of assessing targeted mutation efficiency and globin gene expression. Both cell types can be induced to differentiate along an erythroid path during which expression of .beta.-like genes is highly induced with a low .quadrature.-globin/.quadrature.-+.beta.-globin RNA ratio. Using a HbF specific antibody, the percent of "F-cells" can be quantified. These low ratios are ideal as the systems are sensitive for detecting and quantifying even small increases in .quadrature.-globin mRNA as well as HbF expression at the single cell and population level.

[0190] N-MEL cells are a derivative of murine erythroleukemia cells that contain a single intact human chromosome 11 that contains the .beta.-globin locus. This erythroid cell line normally expresses low levels of mouse and human .beta.-like globin genes, but can be induced to differentiate at which time globin expression is greatly increased.

[0191] N-MEL cells are efficiently transduced using the Amaxa nucleofection system. Using 2 .mu.g of plasmid DNA, Kit "L" and program A20 25% of cells are transduced. Infection at multiplicity of infection (MOI) of 20 with a RSCS-MCS-PG-WZ based lentiviral vector containing a homing endonuclease designed to disrupt the Bcl11a gene yields approximately 40% of N-MEL cells being transduced.

[0192] The efficiency of targeted disruption is assayed using the Cel-I assay. The target region is amplified by PCR, heat-denatured, re-annealed and exposed to the enzyme Cel-I that efficiently cleaves bubbles from mismatched regions as small as one base pair. If the targeted region has been mutated in any way, heteroduplexes of wild type and mutant strands are cleaved and detected by gel electrophoresis. This assay can be used on bulk populations of cells to estimate the efficiency of mutation, or on flow cytometry sorted individual cells in which case analysis of multiple cells provides an accurate assessment of mutation frequency.

[0193] Using routine quantitative Taqman RT-PCR (qRT-PCR) assays for RNA from a bulk population of cells, .beta.-globin expression is induced 11-fold with differentiation and with a .quadrature.-globin/.quadrature.-+.beta.-globin ratio of 0.1%. After infection with a Bcl11a knockdown vector a 30-fold increase in this ratio can be obtained, thus demonstrating that this cell culture system provides an accurate readout of disruption of the BCl11a mediated HbF silencing pathway.

[0194] Due to concerns that altering Bcl11a pathways may lead to a relative increase in .quadrature.-globin RNA but a decrease in globin gene expression, flow cytometry cap be used to sort 1000 cell pools of cells that are lysed and the above qRT-PCR assays can be performed. Because RNA is directly compared from the same number of cells, any diminution in the amount of globin RNA is reflected by an increase in the Ct, providing a direct measure of both the level of .beta.- and .quadrature.-expression, as well as the ratio of .quadrature.-globin/.quadrature.-+.beta.-globin.

[0195] To determine the percent of cells that show an altered .quadrature.-globin/.quadrature.-+.beta.-globin ratio after manipulation and to determine the range of change in expression observed, single cell assays are performed. Flow cytometry sorted individual cells are subjected to routine RT-PCR of .quadrature.- and .beta.-globin RNA simultaneously for several cycles and once adequate material is present to allow for accurate splitting of the sample, .quadrature.- and .beta.-globin are assessed by qRT-PCR as above.

[0196] Ultimately it is levels of HbF protein, not RNA that are therapeutic, thus single cell and bulk cell HbF assays are performed. Bulk populations of cells are assayed using HPLC after cell lysis and elution on a hemoglobin-dedicated column and the ratios of HbF to HbA and HbA2 are determined. The number of cells expressing HbF are compared pre- and post-transduction using gluteraldehyde fixing cells, permeabilizing with detergent and adding an HbF specific antibody followed by quantitation by flow cytometry.

[0197] Effects of mutations are assessed in modified cloned cells after isolation of single cells by flow cytometry. The above assays are performed. In addition, to show that targeted mutations disrupt binding of the Bcl11a repressive complex, cells are fixed in formaldehyde, chromatin isolated and sheared by sonication. Chromatin immune-precipitation (ChIP) is performed using commercially available antibodies to Bcl11a, GATA-1 and HDAC-1. Binding of these proteins to a target region in N-MEL cells, as well as erythroid-differentiated CD34 cells is described below. A lack of binding is assessed after targeted disruption.

Example 10

Clinical grade CD34+ Hematopoietic Stem Cells

[0198] CD34+ cells from normal human donors are adhered to culture dishes with fibronectin peptide CH-296 and infected at an MOI of 20 twice, 8 hours apart, in media containing G-CSF, SCF, IL-3, IL-6, FLT-3, and TPO, with RSCS-MCS-PG-WZ based lentiviral vectors described above. This results in .about.80% of cells being infected. Transduced cells are differentiated to erythroid cells using the protocol of Douy. Giarratana et al., Nat. Biotechnol. 23(1):69-74 (2005). The qRT-PCR assays above reveal a .quadrature.-globin/.quadrature.-+.beta.-globin ratio of 4%. This low ratio allows for the sensitive detection of increases that are secondary to genome editing.

[0199] To assess alterations in differentiation state, flow cytometry using multiple cell surface markers including CD34, CD71, and glycophorin are performed, as well as assessment of cell growth and morphology of cytospins after Wright-Giemsa staining. Disruption efficiency is assessed by Cel-1 assays on bulk populations and single cells as above. Additional assessment of globin gene expression and HbF is performed as above using qRT-PCR on 1000 cell pools and individual cells as well as HPLC and F-cell assays. ChIP is employed to assess binding of Bcl11a, GATA-1, and HDAC-1 to the target region.

[0200] To assess clinical effectiveness in human cells CD34+ human, HSCs from hemoglobinopathy patients are transduced and cultured using the same methods. In addition to the routine analysis for normal cells, additional disease-specific assessments are performed. Cultured thalassemic cells show minimal expansion, a lack of hemoglobinization, evidence of ineffective erythropoiesis, and increased apoptosis compared to normal cells. This allows for quantitative assessments of improvements in expression and erythropoiesis post-targeting. Similarly, the degree of sickling of erythroid progeny of CD34 cells under hypoxic conditions is assessed. These transduced CD34+ cells from hemogobinopathy patients are transplanted into NSG mice, after which several features of abnormal erythropoiesis are recapitulated, allowing assessment of the effect of targeted mutagenesis.

[0201] Clinical effectiveness is assessed in vivo in mouse models of hemoglobinopathies. Knockout of murine Bcl11a leads to a dramatic dose-dependent increase in .quadrature.-globin in mice containing a human .beta.-globin locus on a transgene and ameliorates the sickle phenotype in humanized mouse models. While both systems allow the analysis of globin gene expression, the sickle mice allow for the assessment of the improvement of phenotype in these mice with special attention to the hematologic parameters especially the hematocrit, liver and lung pathology, renal function and spleen size. This can be correlated to the number of HbF containing cells, the HbF/S ratio and expression patterns in single cell assays similar to the above.

[0202] For RNA analysis total blood is used as it contains sufficient RNA-containing reticulocytes for analysis. For single cell analyses blood is stained with thiazole orange and RNA containing cells with the forward and side scatter profiles of red cells are collected. The erythrocyte lifespan is significantly reduced in the sickle cell mice and improvement in lifespan is assessed after intra-peritoneal injection of NHS-biotin with labels 100% of RBC. At time points, a microliter of blood is stained with strep-avidin FITC and the remaining percent of labeled RBC is assessed by flow cytometry. This is done with the mice from our BERK sickle cell mice. Paszty et al., Science 278(5339):876-878 (1997). In addition, the .quadrature.-globin/.quadrature.-+.beta.-globin ratio is assessed in mice containing the A25 and A85 human .beta.-globin YACs. Porcu et al., Blood 90(11):4602-4609 (1997).

[0203] Two thalassemic models are assessed, the Th-3 mouse heterozygotes (Yang et al., Proc. Natl. Acad. Sci. U.S.A. 92(25): 11608-11612 (1995)) and mice heterozygous for a deletion of the LCR (Bender et al., Mol. Cell. 5(2):387-393 (2000)). In each case, the focus of analysis for thalassemic mice will be hematocrit, assessment of ineffective erythropoiesis, spleen size, iron overload and organ morphology.

Sequence CWU 1

1

6913603DNAHomo sapiens 1ccagtgagca ggttggttta agataagcag ggtttcatta gtttgtgaga atgaaaaatg 60aaccttcatt ccactattcc cttaacttgc cctgagattg gctgttctgt catgtgtgtc 120ttgactcaga aaccctgttc tcctctacat atctccccac cgcatctctt tcagcagttg 180tttctaaaaa tatcctccta gtttcatttt tgcagaagtg ttttaggcta atatagtgga 240atgtatctta gagtttaact tatttgtttc tgtcacttta tactaagaaa acttatctaa 300aagcagatgt tttaacaagt tgactcaata taaagttctt ctttgcctct agagattttt 360gtctccaagg gaattttgag aggttggaat ggacaaatct attgctgcag tttaaacttg 420cttgcttcct ccttcttttg gtaaattctt cctataataa aactctaatt ttttattata 480ttgaaataaa tatccattaa aagaatattt aaaaaatgaa tagtgtttat ttaccagtta 540ttgaaatagg ttctggaaac atgaatttta aggttaacat tttaatgaca gataaaatca 600aatattatat acaaatattt tgaatgttta aaattatggt atgactaaag aaagaatgca 660aagtgaaaag tagatttacc atattcagcc agattaaatt taacgaagtt cctgggaata 720tgctagtaca gaacattttt acagatgtgt tcttaaaaaa aaatgtggaa ttagacccag 780gaatgaagat cccagtagtt tttcactctt ttctgaattc aaataatgcc acaatggcag 840acaaatacac acccatgagc atatccaaaa ggaaggattg aaggaaagag gaggaagaaa 900tggagaaagg aaggaaggaa gaggggaaga gagaggatgg aagggatgga ggagaagaag 960gaaaaataaa taatggagag gagaggagaa aaaaggaggg gagaggagag gagaagggat 1020agggaagaga aagagaaagg gaagggaaga gaggaaagaa gagaagagga gagaaaagaa 1080acgaagagag gggaagggaa ggaaaaaaaa gaggaaaaaa gagacaagag aagagataag 1140actgacagtt caaattttgg tggtgatatg gatcaataga aactcaaact ctgttggtga 1200cactgtacaa tagtataacc cctttggaaa acctttaata gtatccacaa atgctggatg 1260cttgataagt ctattaccta gcaattacat ttttagatat tcagaaacac atgcatgtgt 1320gtatccaaag acatgtatag aaatgcttat gacagcaata atcataaaaa cctcaaaccg 1380gtagccactt aaatgcttac caacagtaga attgataaat tacggtatag tcaaagaata 1440gaatattaca cagaaatgaa aagaatcaac tactgcttaa cacgtagcga tacaaatgca 1500ttttacagca tttggttgat taaaagtaac cagaggtgag ttcaaactat atgactttat 1560ttgtatatag aaagatggat gatgtgcctg agattctgat cacaagggga aatgttataa 1620aatagggtag agaggagcca tgaatgacct ttaaactttg ttacaagtta tttttctgta 1680acctggaagc caacgaaaga tattgaataa ttcaagaaag gtggtggcat ggtttgattt 1740gtgtctttaa aagattattc tcacttagtg aagaaatgta ttttagaagt agagaaaatg 1800ggagacaaat agctgggctt ctgttgcagt agggaagaaa gtgacaatgc catttctatt 1860atcagacttg gaccatgacg gtgatgtcag tcgtgaacac aagaataggg ccacatttgt 1920gagtttagtg gtacgataaa atcagaaata cagtcttgga tacattgtat tgtatgcact 1980cttgtaaaat gcaaaaagat gtacttagat atgtggatct ggagctcaga aagaatacaa 2040ccaggtcaag aatacagaat ggaacagaac atacaagaac agatcataat gtgctgtgtg 2100aatcactacc actacctgtt aaaaatgaca gatgatgtac ttcatcaata tctccttaaa 2160atcttagaat gtgtttgtga gggaggaatt atgtttccaa ttcatatata agaaaattga 2220ttctaaaaaa aatgttaggt aaattcttaa ggccatgagg actgttattt gatctttgtc 2280tgttaattcc aaagacttgg cttttcactt taattctgtt ctacctgaaa tgattttaca 2340cattgggaga tctggttaca tgtttattct atatggattg cattgagagg atttgtataa 2400cagaataagg tctttttttc ttttctcttc tgagatggag tttcatccct attgcccaag 2460ctagagtgca atggtgcaat ctaggctcac cgcaacctct gcctcctggg ttcaagcaat 2520tctcctgcct cagccacctg aatagctggg actgcaggca tgcaccacac gcccggctga 2580ttttgtattt ttagtagaga tggggtttca ccatgttggt caggctggtc ttgaactcct 2640gacctcaagt gatctgcctg ccttggcctc ccaaagtgct gggtttacaa gcctgagcca 2700ccgcatccag ccaggataag gtctaaaagt ggaaagaata gcatctactc ttgttcagga 2760aacaatgagg acctgactgg gcagtaagag tggtgattaa tagataggga caaattgaag 2820cagaatcgaa ctgttgatta gaggtaggga aatgatttta atctgtgacc ttggtgaatg 2880ggcaagtagc tatctaatga ctaaaatgga aaacactgga agagaaacag ttttagtata 2940acaagtgaaa tacccatgct gagtctgagg tgcctatagg acatctatat aaataagccc 3000agtacattgt ttgatatatg ggtttggcac tgaggttgga ggtcagaggt tagaaatcag 3060agttgggaat tgggattata caggctgtat ttaagagttt agatataact gtgaatccaa 3120gagtgtgatg aatacaaagt taaatgaagg acctttaatg aacaccaaca tttaatgtga 3180aatctcaagg aagtatgaag taagacatag tccccaaaat ccccgatgat tttagaactc 3240agtatcgatt ttaattagtg taatgccaat gtgggttaga atggaagtca acttgctgtt 3300ggtttcagag caggtaggag ataaggttct agattttgac acagtgaaaa gctgaaacaa 3360aaaggaaaag gtagggtgaa agatgggaaa tgtatgtaag gaggatgagc cacatggtat 3420gggaggtata ctaaggactc tagggtcaga gaaatatggg ttatatcctt ctacaaaatt 3480cacattcttg gctgggtgtg gtggctcacg cctgtgatcc cagcactttc agaggccgag 3540gagggtggat cacctgatgt taggagttcg agatcagcct gaccaacatg gtgaaacccc 3600cta 36032350DNAHomo sapiens 2aaagatggat gatgtgcctg agattctgat cacaagggga aatgttataa aatagggtag 60agaggagcca tgaatgacct ttaaactttg ttacaagtta tttttctgta acctggaagc 120caacgaaaga tattgaataa ttcaagaaag gtggtggcat ggtttgattt gtgtctttaa 180aagattattc tcacttagtg aagaaatgta ttttagaagt agagaaaatg ggagacaaat 240agctgggctt ctgttgcagt agggaagaaa gtgacaatgc catttctatt atcagacttg 300gaccatgacg gtgatgtcag tcgtgaacac aagaataggg ccacatttgt 350321DNAHomo sapiens 3gtgcacctca ctccagagga g 21421DNAHomo sapiens 4gtgcacctca ctccagtgga g 21522DNAHomo sapiens 5tttccactta ttcaaccttt ta 22622DNAHomo sapiens 6tgtggcccta ttcttgtgtt ca 22722DNAHomo sapiens 7cattgtcact ttcttcccta ct 22822DNAHomo sapiens 8taaaatacat ttcttcacta ag 22922DNAHomo sapiens 9actaagtgag aataatcttt ta 221022DNAHomo sapiens 10gccaccacct ttcttgaatt at 221122DNAHomo sapiens 11tcttgaatta ttcaatatct tt 221222DNAHomo sapiens 12ttaaaggtca ttcatggctc ct 22132606DNAHomo sapiens 13gcaatgaaaa taaatgtttt ttattaggca gaatccagat gctcaaggcc cttcataata 60tcccccagtt tagtagttgg acttagggaa caaaggaacc tttaatagaa attggacagc 120aagaaagcga gcttagtgat acttgtgggc cagggcatta gccacaccag ccaccacttt 180ctgataggca gcctgcactg gtggggtgaa ttctttgcca aagtgatggg ccagcacaca 240gaccagcacg ttgcccagga gctgtgggag gaagataaga ggtatgaaca tgattagcaa 300aagggcctag cttggactca gaataatcca gccttatccc aaccataaaa taaaagcaga 360atggtagctg gattgtagct gctattagca atatgaaacc tcttacatca gttacaattt 420atatgcagaa atatttatat gcagagatat tgctattgcc ttaacccaga aattatcact 480gttattcttt agaatggtgc aaagaggcat gatacattgt atcattattg ccctgaaaga 540aagagattag ggaaagtatt agaaataaga taaacaaaaa agtatattaa aagaagaaag 600cattttttaa aattacaaat gcaaaattac cctgatttgg tcaatatgtg tacacatatt 660aaaacattac actttaaccc ataaatatgt ataatgatta tgtatcaatt aaaaataaaa 720gaaaataaag tagggagatt atgaatatgc aaataagcac acatatattc caaatagtaa 780tgtactaggc agactgtgta aagttttttt ttaagttact taatgtatct cagagatatt 840tccttttgtt atacacaatg ttaaggcatt aagtataata gtaaaaattg cggagaagaa 900aaaaaaagaa agcaagaatt aaacaaaaga aaacaattgt tatgaacagc aaataaaaga 960aactaaaacg atcctgagac ttccacactg atgcaatcat tcgtctgttt cccattctaa 1020actgtaccct gttacttatc cccttcctat gacatgaact taaccataga aaagaagggg 1080aaagaaaaca tcaagcgtcc catagactca ccctgaagtt ctcaggatcc acgtgcagct 1140tgtcacagtg cagctcactc agtgtggcaa aggtgccctt gaggttgtcc aggtgagcca 1200ggccatcact aaaggcaccg agcactttct tgccatgagc cttcacctta gggttgccca 1260taacagcatc aggagtggac agatccccaa aggactcaaa gaacctctgg gtccaagggt 1320agaccaccag cagcctaagg gtgggaaaat agaccaatag gcagagagag tcagtgccta 1380tcagaaaccc aagagtcttc tctgtctcca catgcccagt ttctattggt ctccttaaac 1440ctgtcttgta accttgatac caacctgccc agggcctcac caccaacttc atccacgttc 1500accttgcccc acagggcagt aacggcagac ttctcctcag gagtcagatg caccatggtg 1560tctgtttgag gttgctagtg aacacagttg tgtcagaagc aaatgtaagc aatagatggc 1620tctgccctga cttttatgcc cagccctggc tcctgccctc cctgctcctg ggagtagatt 1680ggccaaccct agggtgtggc tccacagggt gaggtctaag tgatgacagc cgtacctgtc 1740cttggctctt ctggcactgg cttaggagtt ggacttcaaa ccctcagccc tccctctaag 1800atatatctct tggccccata ccatcagtac aaattgctac taaaaacatc ctcctttgca 1860agtgtattta cgtaatattt ggaatcacag cttggtaagc atattgaaga tcgttttccc 1920aattttctta ttacacaaat aagaagttga tgcactaaaa gtggaagagt tttgtctacc 1980ataattcagc tttgggatat gtagatggat ctcttcctgc gtctccagaa tatgcaaaat 2040acttacagga cagaatggat gaaaactcta cctcggttct aagcatatct tctccttatt 2100tggattaaaa ccttctggta agaaaagaaa aaatatatat atatatgtgt gtatatatac 2160acacatacat atacatatat atgcattcat ttgttgttgt ttttcttaat ttgctcatgc 2220atgctaataa attatgtcta aaaatagaat aaatacaaat caatgtgctc tgtgcattag 2280ttacttatta ggttttggga aacaagagat aaaaaactag agacctctta atgcagtcaa 2340aaatacaaat aaataaaaag tcacttacaa cccaaagtgt gactatcaat ggggtaatca 2400gtggtgtcaa ataggaggtt aactggggac atctaactgt ttctgcctgg actaatctgc 2460aagagtgtct gggggaacaa aaagcctctg tgacttagaa agtaggggta ggaggggaaa 2520aggtcttcta cttggctcag attatttttt tcctctagtc cactaagaat actgcgtttt 2580aaaatcattt ccttgattca agttcc 260614606DNAHomo sapiens 14caccctgaag ttctcaggat ccacgtgcag cttgtcacag tgcagctcac tcagtgtggc 60aaaggtgccc ttgaggttgt ccaggtgagc caggccatca ctaaaggcac cgagcacttt 120cttgccatga gccttcacct tagggttgcc cataacagca tcaggagtgg acagatcccc 180aaaggactca aagaacctct gggtccaagg gtagaccacc agcagcctaa gggtgggaaa 240atagaccaat aggcagagag agtcagtgcc tatcagaaac ccaagagtct tctctgtctc 300cacatgccca gtttctattg gtctccttaa acctgtcttg taaccttgat accaacctgc 360ccagggcctc accaccaact tcatccacgt tcaccttgcc ccacagggca gtaacggcag 420acttctcctc aggagtcaga tgcaccatgg tgtctgtttg aggttgctag tgaacacagt 480tgtgtcagaa gcaaatgtaa gcaatagatg gctctgccct gacttttatg cccagccctg 540gctcctgccc tccctgctcc tgggagtaga ttggccaacc ctagggtgtg gctccacagg 600gtgagg 60615303PRTOphiostoma novo-ulmi 15Ser Ala Tyr Met Ser Arg Arg Glu Ser Ile Asn Pro Trp Ile Leu Thr 1 5 10 15 Gly Phe Ala Asp Ala Glu Gly Ser Phe Leu Leu Arg Ile Arg Asn Asn 20 25 30 Asn Lys Ser Ser Val Gly Tyr Ser Thr Glu Leu Gly Phe Gln Ile Thr 35 40 45 Leu His Asn Lys Asp Lys Ser Ile Leu Glu Asn Ile Gln Ser Thr Trp 50 55 60 Lys Val Gly Val Ile Ala Asn Ser Gly Asp Asn Ala Val Ser Leu Lys 65 70 75 80 Val Thr Arg Phe Glu Asp Leu Lys Val Ile Ile Asp His Phe Glu Lys 85 90 95 Tyr Pro Leu Ile Thr Gln Lys Leu Gly Asp Tyr Met Leu Phe Lys Gln 100 105 110 Ala Phe Cys Val Met Glu Asn Lys Glu His Leu Lys Ile Asn Gly Ile 115 120 125 Lys Glu Leu Val Arg Ile Lys Ala Lys Leu Asn Trp Gly Leu Thr Asp 130 135 140 Glu Leu Lys Lys Ala Phe Pro Glu Ile Ile Ser Lys Glu Arg Ser Leu 145 150 155 160 Ile Asn Lys Asn Ile Pro Asn Phe Lys Trp Leu Ala Gly Phe Thr Ser 165 170 175 Gly Glu Gly Cys Phe Phe Val Asn Leu Ile Lys Ser Lys Ser Lys Leu 180 185 190 Gly Val Gln Val Gln Leu Val Phe Ser Ile Thr Gln His Ile Lys Asp 195 200 205 Lys Asn Leu Met Asn Ser Leu Ile Thr Tyr Leu Gly Cys Gly Tyr Ile 210 215 220 Lys Glu Lys Asn Lys Ser Glu Phe Ser Trp Leu Asp Phe Val Val Thr 225 230 235 240 Lys Phe Ser Asp Ile Asn Asp Lys Ile Ile Pro Val Phe Gln Glu Asn 245 250 255 Thr Leu Ile Gly Val Lys Leu Glu Asp Phe Glu Asp Trp Cys Lys Val 260 265 270 Ala Lys Leu Ile Glu Glu Lys Lys His Leu Thr Glu Ser Gly Leu Asp 275 280 285 Glu Ile Lys Lys Ile Lys Leu Asn Met Asn Lys Gly Arg Val Phe 290 295 300 16110DNAHomo sapiens 16tgggggcccc ttccccacac tatctcaatg caaatatctg tctgaaacgg tccctggcta 60aactccaccc atgggttggc cagccttgcc ttgaccaata gccttgacaa 11017110DNAHomo sapiens 17tgggggcgcc ttccccacac tatctcaatg caaatatctg tctgaaacgg tccctggcta 60aactccaccc atgggttggc cagccttgcc ttgaccaata gccttgacaa 11018110DNAHomo sapiens 18tgggggcccc ttccccacac tatctcaatg caaacatctg tctgaaacgg tccctggcta 60aactccaccc atgggttggc cagccttgcc ttgaccaata gccttgacaa 11019110DNAHomo sapiens 19tgggggcccc ttccccacac tatctcaatg caaatatctg tctgaaacgg tccctggcta 60aactccaccc atgggttggc cagccttgcc ttgactaata gccttgacaa 11020110DNAHomo sapiens 20tgggggcccc ttctccacac tatctcaatg caaatatctg tctgaaacgg tccctggcta 60aactccaccc atgggttggc cagccttgcc ttgaccaata gccttgacaa 11021110DNAHomo sapiens 21tgggggcccc ttccccacac tatctcaatg caaacatctg tctgaaacgg tccctggcta 60aactccaccc atgggttggc cagccttgcc ttgaccaata gccttgacaa 11022110DNAHomo sapiens 22tgggggcccc ttccccacac tatctcaatg caaatatctg tctgaaacgg tccctggcta 60aactccaccc atgggttggc cagccttgcc ttaaccaata gccttgacaa 11023110DNAHomo sapiens 23tgggggcccc ttccccacac tatctcaatg caaatatctg tctgaaacgg tccctggcta 60aactccaccc atgggttggc cagccttgcc ttgaccaata gccttgacaa 110242508DNAHomo sapiens 24atgtctcgcc gcaagcaagg caaaccccag cacttaagca aacgggaatt ctcgcccgag 60cctcttgaag ccattcttac agatgatgaa ccagaccacg gcccgttggg agctccagaa 120ggggatcatg acctcctcac ctgtgggcag tgccagatga acttcccatt gggggacatt 180cttattttta tcgagcacaa acggaaacaa tgcaatggca gcctctgctt agaaaaagct 240gtggataagc caccttcccc ttcaccaatc gagatgaaaa aagcatccaa tcccgtggag 300gttggcatcc aggtcacgcc agaggatgac gattgtttat caacgtcatc tagaggaatt 360tgccccaaac aggaacacat agcagataaa cttctgcact ggaggggcct ctcctcccct 420cgttctgcac atggagctct aatccccacg cctgggatga gtgcagaata tgccccgcag 480ggtatttgta aagatgagcc cagcagctac acatgtacaa cttgcaaaca gccattcacc 540agtgcatggt ttctcttgca acacgcacag aacactcatg gattaagaat ctacttagaa 600agcgaacacg gaagtcccct gaccccgcgg gttggtatcc cttcaggact aggtgcagaa 660tgtccttccc agccacctct ccatgggatt catattgcag acaataaccc ctttaacctg 720ctaagaatac caggatcagt atcgagagag gcttccggcc tggcagaagg gcgctttcca 780cccactcccc ccctgtttag tccaccaccg agacatcact tggaccccca ccgcatagag 840cgcctggggg cggaagagat ggccctggcc acccatcacc cgagtgcctt tgacagggtg 900ctgcggttga atccaatggc tatggagcct cccgccatgg atttctctag gagacttaga 960gagctggcag ggaacacgtc tagcccaccg ctgtccccag gccggcccag ccctatgcaa 1020aggttactgc aaccattcca gccaggtagc aagccgccct tcctggcgac gccccccctc 1080cctcctctgc aatccgcccc tcctccctcc cagcccccgg tcaagtccaa gtcatgcgag 1140ttctgcggca agacgttcaa atttcagagc aacctggtgg tgcaccggcg cagccacacg 1200ggcgagaagc cctacaagtg caacctgtgc gaccacgcgt gcacccaggc cagcaagctg 1260aagcgccaca tgaagacgca catgcacaaa tcgtccccca tgacggtcaa gtccgacgac 1320ggtctctcca ccgccagctc cccggaaccc ggcaccagcg acttggtggg cagcgccagc 1380agcgcgctca agtccgtggt ggccaagttc aagagcgaga acgaccccaa cctgatcccg 1440gagaacgggg acgaggagga agaggaggac gacgaggaag aggaagaaga ggaggaagag 1500gaggaggagg agctgacgga gagcgagagg gtggactacg gcttcgggct gagcctggag 1560gcggcgcgcc accacgagaa cagctcgcgg ggcgcggtcg tgggcgtggg cgacgagagc 1620cgcgccctgc ccgacgtcat gcagggcatg gtgctcagct ccatgcagca cttcagcgag 1680gccttccacc aggtcctggg cgagaagcat aagcgcggcc acctggccga ggccgagggc 1740cacagggaca cttgcgacga agactcggtg gccggcgagt cggaccgcat agacgatggc 1800actgttaatg gccgcggctg ctccccgggc gagtcggcct cggggggcct gtccaaaaag 1860ctgctgctgg gcagccccag ctcgctgagc cccttctcta agcgcatcaa gctcgagaag 1920gagttcgacc tgcccccggc cgcgatgccc aacacggaga acgtgtactc gcagtggctc 1980gccggctacg cggcctccag gcagctcaaa gatcccttcc ttagcttcgg agactccaga 2040caatcgcctt ttgcctcctc gtcggagcac tcctcggaga acgggagttt gcgcttctcc 2100acaccgcccg gggagctgga cggagggatc tcggggcgca gcggcacggg aagtggaggg 2160agcacgcccc atattagtgg tccgggcccg ggcaggccca gctcaaaaga gggcagacgc 2220agcgacactt gtgagtactg tgggaaagtc ttcaagaact gtagcaatct cactgtccac 2280aggagaagcc acacgggcga aaggccttat aaatgcgagc tgtgcaacta tgcctgtgcc 2340cagagtagca agctcaccag gcacatgaaa acgcatggcc aggtggggaa ggacgtttac 2400aaatgtgaaa tttgtaagat gccttttagc gtgtacagta ccctggagaa acacatgaaa 2460aaatggcaca gtgatcgagt gttgaataat gatataaaaa ctgaatag 25082522DNAHomo sapiens 25atgggattca tattgcagac aa 222622DNAHomo sapiens 26agccattgga ttcaaccgca gc 222722DNAHomo sapiens 27caaacagcca ttcaccagtg ca 2228771DNAArtificial SequenceNucleotide Sequence of I-HjeMI, Codon Optimized for Expression in E. coli 28atgggatccc acatggacct gacctacgct tacctggttg gtctgttcga aggtgacggt 60tacttctcta tcaccaaaaa gggtaaatac ctgacctacg aactgggtat cgaactgtct 120atcaaagacg ttcagctgat ctacaaaatc aaagacatcc tgggtgttgg taaagtttct 180ttccgtaaac gtaacgaaat cgaaatggtt tctctgcgta tccgtgacaa gaatcacctg 240aaaaacttca tcctgccgat cttcgacaaa tacccgatgc tgtctaacaa gcagtacgac 300tacctgcgtt tcaaagacgc tctcctgtct aacattatct actctgacga tctgccggaa 360tacgctcgtt ctaacgaatc tatcaactct gttgactcta ttatcaacac ctcttacttc 420tctgcttggc tggttggttt catcgaagct gaaggttgct tctctaccta caaactgaac 480aaagatgacg attacctgat cgcttctttc gacatcgctc agaaagacgg tgacatcctg 540atctctgcta tccacaaata cctgtctttc accacgaaaa tctacctgga caaaaccaac 600tgctctcgtc tgaaagtgac cggtgtacgt tctgttaaaa acgtggttaa attcatccag 660ggtgctccgg ttaaactgct cggtaacaag aaactgcagt acaaactgtg gatcaaacag 720ctgcgtaaaa tctctcgtta ctctgaaaaa atccagctgc cgtctaacta c 77129771DNAArtificial SequenceNucleotide Sequence of I-HjeMI, Codon Optimized for Expression in Mammals

29atgggcagcc acatggacct gacctacgcc tatctggtcg gcctgttcga gggcgacggc 60tattttagca taaccaagaa gggcaagtat ctgacgtatg aactgggcat cgagctctcc 120atcaaggacg tgcagctcat ctacaagatc aaggacatcc tcggcgtggg caaagtgtct 180tttaggaaga ggaacgagat cgagatggtc agcctgcgaa tcagggacaa aaaccacctg 240aagaacttca tcctgcccat cttcgacaag taccccatgc tgagcaacaa gcagtacgac 300tatctccgat tcaaggatgc cctcctgtcc aacatcatct atagcgacga cctgcccgag 360tacgccagga gcaacgagtc aatcaatagc gtggacagca tcatcaacac ctcatacttc 420agcgcctggc tggttggctt catcgaggcc gagggctgct tcagcaccta caagctcaac 480aaggacgacg attatttgat cgcgagcttc gatatagccc agaaggacgg cgacattctc 540atctccgcga tccacaaata cctgagcttc acgaccaaaa tctacctgga caagaccaac 600tgtagcaggc tcaaggtcac cggcgtgagg agcgtcaaga acgtggttaa gttcatccag 660ggtgcgccgg tcaagttgct gggtaacaag aagctgcagt acaaactttg gataaagcag 720ctgcgcaaga tctcccgata cagcgagaaa atccagctgc ccagtaacta c 77130254PRTTrichoderma reesei 30Met Gly Asp Leu Thr Tyr Ala Tyr Leu Val Gly Leu Phe Glu Gly Asp 1 5 10 15 Gly Tyr Phe Ser Ile Thr Lys Lys Gly Lys Tyr Leu Thr Tyr Glu Leu 20 25 30 Gly Ile Glu Leu Ser Ile Lys Asp Val Gln Leu Ile Tyr Lys Ile Lys 35 40 45 Asp Ile Leu Gly Val Gly Lys Val Ser Phe Arg Lys Arg Asn Glu Ile 50 55 60 Glu Met Val Ser Leu Arg Ile Arg Asp Lys Asn His Leu Lys Asn Phe 65 70 75 80 Ile Leu Pro Ile Phe Asp Lys Tyr Pro Met Leu Ser Asn Lys Gln Tyr 85 90 95 Asp Tyr Leu Arg Phe Lys Asp Ala Leu Leu Ser Asn Ile Ile Tyr Ser 100 105 110 Asp Asp Leu Pro Glu Tyr Ala Arg Ser Asn Glu Ser Ile Asn Ser Val 115 120 125 Asp Ser Ile Ile Asn Thr Ser Tyr Phe Ser Ala Trp Leu Val Gly Phe 130 135 140 Ile Glu Ala Glu Gly Cys Phe Ser Thr Tyr Lys Leu Asn Lys Asp Asp 145 150 155 160 Asp Tyr Leu Ile Ala Ser Phe Asp Ile Ala Gln Lys Asp Gly Asp Ile 165 170 175 Leu Ile Ser Ala Ile His Lys Tyr Leu Ser Phe Thr Thr Lys Ile Tyr 180 185 190 Leu Asp Lys Thr Asn Cys Ser Arg Leu Lys Val Thr Gly Val Arg Ser 195 200 205 Val Lys Asn Val Val Lys Phe Ile Gln Gly Ala Pro Val Lys Leu Leu 210 215 220 Gly Asn Lys Lys Leu Gln Tyr Lys Leu Trp Ile Lys Gln Leu Arg Lys 225 230 235 240 Ile Ser Arg Tyr Ser Glu Lys Ile Gln Leu Pro Ser Asn Tyr 245 250 31768DNAArtificial SequenceNucleotide Sequence for a BCL11A Gene Targeting Nuclease Based on the Homing Endonuclease I-HjeMI; Codon Optimized for Expression in E. coli and Obtained through Directed Evolution in IVC and in Bacteria 31atgggatccc acatggacct gacctacgct tacctggttg gtctgttcga aggtgacggt 60tacttcacta tcgctaaagc gggtaagtac ctgaattacg agctgggtat cacgctgtct 120atcaaagacg ctcagctgat ctacaaaatc aaagacatcc tgggtgttgg taatgtttat 180ttccggaaat ataggcagca tgaaatggtt tctctgcgga tccaggacaa gaatcacctg 240aaaaacttca tcctgccgat cttcgacaaa tacccgatgc tgtctaacaa gcagtacgac 300tacctgcgtt tcaaagacgc tctcctgtct aacattatct actctgacga tctgccggaa 360tacgctcgtt ctaacgaatc tatcaactct gttgactcta ttatcaacac ctcttacttc 420tctgcttggc tggttggttt catcgaagct gaaggttgct tcacgaccta caaagcgagt 480aaagataagt acctgacggc tgggttcagt atcgctcaga aagacggtga catcctgatc 540tctgctatcc acaaatacct gtctttcacc acgaaaccgt acaaggacaa aaccaactgc 600tctcatctga aggtgaccgg tgtacgttct gttaacaacg tggttaaatt catccagggt 660gctccggtta aactgctcgg taacaagaaa ctgcagtaca aactgtggat caaacagctg 720cgtaaaatct ctcgttactc tgaaaaaatc cagctgccgt ctaactac 76832768DNAArtificial SequenceNucleotide Sequence of a BCL11A Gene Targeting Nuclease Based on the Homing Endonuclease I-HjeMI; Codon Optimized for Expression in Mammals and Obtained through Directed Evolution in IVC and in Bacteria 32atgggcagcc acatggacct gacctacgcc tatctggtcg gcctgttcga gggcgacggc 60tattttacaa tagctaaggc cggcaagtat ctgaactacg agctgggcat cacactctcc 120atcaaggacg ctcagctcat ctacaagatc aaggacatcc tcggcgtggg caacgtgtac 180tttaggaagt acaggcaaca tgagatggtc agcctgcgaa tccaggacaa aaaccacctg 240aagaacttca tcctgcccat cttcgacaag taccccatgc tgagcaacaa gcagtacgac 300tacctgcgat tcaaggatgc cctcctgtcc aacatcatct atagcgacga cctgcccgag 360tacgccagga gcaacgagtc aatcaatagc gtggacagca tcatcaacac ctcatacttc 420agcgcctggc tggttggctt catcgaggcc gagggctgct tcaccaccta caaggcatcc 480aaggacaagt acctgacagc gggcttctcc atagcccaga aggacggcga cattctcatc 540tccgcgatcc acaaatacct gagcttcacg accaaaccct acaaagacaa gaccaactgt 600agccacctca aggtcaccgg cgtgaggagc gtcaataacg tggttaagtt catccagggt 660gcgccggtca agctgctggg taacaagaag ctgcagtaca aactttggat aaagcagctg 720cgcaagatct cccgatacag cgagaaaatc cagctgccca gtaactac 76833256PRTArtificial SequenceAmino Acid Sequence of a BCL11A Gene Targeting Nuclease Based on the Homing Endonuclease I-HjeMI 33Met Gly Ser His Met Asp Leu Thr Tyr Ala Tyr Leu Val Gly Leu Phe 1 5 10 15 Glu Gly Asp Gly Tyr Phe Thr Ile Ala Lys Ala Gly Lys Tyr Leu Asn 20 25 30 Tyr Glu Leu Gly Ile Thr Leu Ser Ile Lys Asp Ala Gln Leu Ile Tyr 35 40 45 Lys Ile Lys Asp Ile Leu Gly Val Gly Asn Val Tyr Phe Arg Lys Tyr 50 55 60 Arg Gln His Glu Met Val Ser Leu Arg Ile Gln Asp Lys Asn His Leu 65 70 75 80 Lys Asn Phe Ile Leu Pro Ile Phe Asp Lys Tyr Pro Met Leu Ser Asn 85 90 95 Lys Gln Tyr Asp Tyr Leu Arg Phe Lys Asp Ala Leu Leu Ser Asn Ile 100 105 110 Ile Tyr Ser Asp Asp Leu Pro Glu Tyr Ala Arg Ser Asn Glu Ser Ile 115 120 125 Asn Ser Val Asp Ser Ile Ile Asn Thr Ser Tyr Phe Ser Ala Trp Leu 130 135 140 Val Gly Phe Ile Glu Ala Glu Gly Cys Phe Thr Thr Tyr Lys Ala Ser 145 150 155 160 Lys Asp Lys Tyr Leu Thr Ala Gly Phe Ser Ile Ala Gln Lys Asp Gly 165 170 175 Asp Ile Leu Ile Ser Ala Ile His Lys Tyr Leu Ser Phe Thr Thr Lys 180 185 190 Pro Tyr Lys Asp Lys Thr Asn Cys Ser His Leu Lys Val Thr Gly Val 195 200 205 Arg Ser Val Asn Asn Val Val Lys Phe Ile Gln Gly Ala Pro Val Lys 210 215 220 Leu Leu Gly Asn Lys Lys Leu Gln Tyr Lys Leu Trp Ile Lys Gln Leu 225 230 235 240 Arg Lys Ile Ser Arg Tyr Ser Glu Lys Ile Gln Leu Pro Ser Asn Tyr 245 250 255 34912DNAArtificial SequenceNucleotide Sequence of I-OnuI, Codon Optimized for Expression in E. coli 34atgtccgcct acatgtcccg tcgcgagtcc attaacccgt ggattctcac cggtttcgcc 60gacgcggaag gctccttttt gctgcgcatc cgcaacaaca acaagtccag cgtcggctac 120tccactgagc tcggcttcca aattacactt cataacaagg acaagagcat tcttgagaac 180atccagtcaa catggaaggt gggcgtgatc gccaacagcg gtgacaacgc cgtgtcgctg 240aaggtcacgc gttttgagga cctgaaggtc attatcgacc attttgaaaa atacccactg 300attacgcaga agctcggtga ctacatgctg tttaagcagg cgttttgcgt catggagaac 360aaggagcatt tgaagattaa tggtatcaag gagctggtgc gcattaaggc aaagctcaat 420tggggtctga cggatgagct gaagaaggcc tttccggaga tcatctcgaa ggagcgctcc 480ctcatcaaca agaacatccc taatttcaag tggctggcgg gttttacctc gggcgagggt 540tgcttctttg ttaacctgat caagtcaaag tcgaagctag gtgtccaggt gcagctggtg 600ttcagcatta cccaacacat caaggataag aacctcatga actctctgat tacctacttg 660ggctgcggct acattaagga gaaaaacaag agtgagttct cctggcttga cttcgtcgtc 720acgaaattct ccgacatcaa cgacaagatc attccggtct ttcaggaaaa cacgctcatc 780ggcgtgaagc tcgaggactt cgaggattgg tgtaaggtcg ctaagctgat cgaggagaaa 840aagcacctga cagaaagtgg cctggacgag atcaagaaga ttaagctgaa catgaacaag 900ggcagagtat tc 912351998DNAArtificial SequenceNucleotide Sequence of MegaTAL5.5 RVD + Y2 I-AniI 35gtggatctac gcacgctcgg ctacagtcag cagcagcaag agaagatcaa accgaaggtg 60cgttcgacag tggcgcagca ccacgaggca ctggtgggcc atgggtttac acacgcgcac 120atcgttgcgc tcagccaaca cccggcagcg ttagggaccg tcgctgtcac gtatcagcac 180ataatcacgg cgttgccaga ggcgacacac gaagacatcg ttggcgtcgg caaacagtgg 240tccggcgcac gcgccctgga ggccttgctc acggatgcgg gggagttgag aggtccgccg 300ttacagttgg acacaggcca acttgtgaag attgcaaaac gtggcggcgt gaccgcaatg 360gaggcagtgc atgcatcgcg caatgcactg acgggtgccc ccctgaacct gaccccggac 420caagtggtgg ctatcgccag caacaatggc ggcaagcaag cgctcgaaac ggtgcagcgg 480ctgttgccgg tgctgtgcca ggaccatggc ctgactccgg accaagtggt ggctatcgcc 540agccacgatg gcggcaagca agcgctcgaa acggtgcagc ggctgttgcc ggtgctgtgc 600caggaccatg gcctgacccc ggaccaagtg gtggctatcg ccagcaacat tggcggcaag 660caagcgctcg aaacggtgca gcggctgttg ccggtgctgt gccaggacca tggcctgacc 720ccggaccaag tggtggctat cgccagcaac aatggcggca agcaagcgct cgaaacggtg 780cagcggctgt tgccggtgct gtgccaggac catggcctga ctccggacca agtggtggct 840atcgccagcc acgatggcgg caagcaagcg ctcgaaacgg tgcagcggct gttgccggtg 900ctgtgccagg accatggcct gaccccggac caagtggtgg ctatcgccag caacggtggc 960ggcaagcaag cgctcgaaag cattgtggcc cagctgagcc ggcctgatcc ggcgttggcc 1020gcgttgacca acgaccacct cgtcgccttg gcctgcctcg gcggacgtcc tgccatggat 1080gcagtgaaaa agggattgcc gcacgcgccg gaattgatca gaagagtcaa tcgccgtatt 1140ggcgaacgca cgtcccatcg cgttgcgata tctagagtgg gaggaagcga tcttacgtac 1200gcgtatttag ttggtctcta cgaaggggat ggatacttta gtatcaccaa gaaaggcaag 1260tacttgactt atgaattagg tattgagctg agcatcaaag acgtccaatt gatttacaag 1320atcaagaaaa tcctaggtat tggcatcgta agcttcagga agagaaacga gattgaaatg 1380gttgcattga ggatccgtga taagaatcat ctaaaatcta agatattgcc tatatttgag 1440aagtatccaa tgttttccaa caaacagtac gactatttaa gattcaggaa tgcattgtta 1500tctggcatta tatacctaga agacttgcct gattacacta gaagtgacga accattgaat 1560tctatagaat ccattatcaa cacatcatac ttctccgcct ggctagttgg atttatagaa 1620gctgagggct gtttcagtgt gtacaagctg aacaaagacg atgactactt gattgcttca 1680ttcgacattg cccaaagaga tggtgatatc ttgatttcag caattaggaa gtacttaagt 1740ttcactacta aggtttacct agacaagact aattgtagca aattgaaggt cactagtgtt 1800agatccgtcg agaacatcat taagtttctg cagaatgctc ctgtcaaatt gttaggcaac 1860aagaaactgc aatacaagtt gtggttgaaa caactaagga agatttctag gtattccgag 1920aagatcaaga ttccatcaaa ctacgtcgac cgagcatctt accgccattt atacccatat 1980ttgttctgtt tttcttga 199836665PRTArtificial SequenceAmino Acid Sequence of MegaTAL5.5 RVD + Y2 I-AniI 36Val Asp Leu Arg Thr Leu Gly Tyr Ser Gln Gln Gln Gln Glu Lys Ile 1 5 10 15 Lys Pro Lys Val Arg Ser Thr Val Ala Gln His His Glu Ala Leu Val 20 25 30 Gly His Gly Phe Thr His Ala His Ile Val Ala Leu Ser Gln His Pro 35 40 45 Ala Ala Leu Gly Thr Val Ala Val Thr Tyr Gln His Ile Ile Thr Ala 50 55 60 Leu Pro Glu Ala Thr His Glu Asp Ile Val Gly Val Gly Lys Gln Trp 65 70 75 80 Ser Gly Ala Arg Ala Leu Glu Ala Leu Leu Thr Asp Ala Gly Glu Leu 85 90 95 Arg Gly Pro Pro Leu Gln Leu Asp Thr Gly Gln Leu Val Lys Ile Ala 100 105 110 Lys Arg Gly Gly Val Thr Ala Met Glu Ala Val His Ala Ser Arg Asn 115 120 125 Ala Leu Thr Gly Ala Pro Leu Asn Leu Thr Pro Asp Gln Val Val Ala 130 135 140 Ile Ala Ser Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg 145 150 155 160 Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Asp Gln Val 165 170 175 Val Ala Ile Ala Ser His Asp Gly Gly Lys Gln Ala Leu Glu Thr Val 180 185 190 Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Asp 195 200 205 Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu 210 215 220 Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr 225 230 235 240 Pro Asp Gln Val Val Ala Ile Ala Ser Asn Asn Gly Gly Lys Gln Ala 245 250 255 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly 260 265 270 Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser His Asp Gly Gly Lys 275 280 285 Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp 290 295 300 His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn Gly Gly 305 310 315 320 Gly Lys Gln Ala Leu Glu Ser Ile Val Ala Gln Leu Ser Arg Pro Asp 325 330 335 Pro Ala Leu Ala Ala Leu Thr Asn Asp His Leu Val Ala Leu Ala Cys 340 345 350 Leu Gly Gly Arg Pro Ala Met Asp Ala Val Lys Lys Gly Leu Pro His 355 360 365 Ala Pro Glu Leu Ile Arg Arg Val Asn Arg Arg Ile Gly Glu Arg Thr 370 375 380 Ser His Arg Val Ala Ile Ser Arg Val Gly Gly Ser Asp Leu Thr Tyr 385 390 395 400 Ala Tyr Leu Val Gly Leu Tyr Glu Gly Asp Gly Tyr Phe Ser Ile Thr 405 410 415 Lys Lys Gly Lys Tyr Leu Thr Tyr Glu Leu Gly Ile Glu Leu Ser Ile 420 425 430 Lys Asp Val Gln Leu Ile Tyr Lys Ile Lys Lys Ile Leu Gly Ile Gly 435 440 445 Ile Val Ser Phe Arg Lys Arg Asn Glu Ile Glu Met Val Ala Leu Arg 450 455 460 Ile Arg Asp Lys Asn His Leu Lys Ser Lys Ile Leu Pro Ile Phe Glu 465 470 475 480 Lys Tyr Pro Met Phe Ser Asn Lys Gln Tyr Asp Tyr Leu Arg Phe Arg 485 490 495 Asn Ala Leu Leu Ser Gly Ile Ile Tyr Leu Glu Asp Leu Pro Asp Tyr 500 505 510 Thr Arg Ser Asp Glu Pro Leu Asn Ser Ile Glu Ser Ile Ile Asn Thr 515 520 525 Ser Tyr Phe Ser Ala Trp Leu Val Gly Phe Ile Glu Ala Glu Gly Cys 530 535 540 Phe Ser Val Tyr Lys Leu Asn Lys Asp Asp Asp Tyr Leu Ile Ala Ser 545 550 555 560 Phe Asp Ile Ala Gln Arg Asp Gly Asp Ile Leu Ile Ser Ala Ile Arg 565 570 575 Lys Tyr Leu Ser Phe Thr Thr Lys Val Tyr Leu Asp Lys Thr Asn Cys 580 585 590 Ser Lys Leu Lys Val Thr Ser Val Arg Ser Val Glu Asn Ile Ile Lys 595 600 605 Phe Leu Gln Asn Ala Pro Val Lys Leu Leu Gly Asn Lys Lys Leu Gln 610 615 620 Tyr Lys Leu Trp Leu Lys Gln Leu Arg Lys Ile Ser Arg Tyr Ser Glu 625 630 635 640 Lys Ile Lys Ile Pro Ser Asn Tyr Val Asp Arg Ala Ser Tyr Arg His 645 650 655 Leu Tyr Pro Tyr Leu Phe Cys Phe Ser 660 665 374146DNAArtificial SequenceEngineered type II CRISPR system for human cells; expression format and full sequence of cas9 gene insert of Mali et al. 37gccaccatgg acaagaagta ctccattggg ctcgatatcg gcacaaacag cgtcggctgg 60gccgtcatta cggacgagta caaggtgccg agcaaaaaat tcaaagttct gggcaatacc 120gatcgccaca gcataaagaa gaacctcatt ggcgccctcc tgttcgactc cggggagacg 180gccgaagcca cgcggctcaa aagaacagca cggcgcagat atacccgcag aaagaatcgg 240atctgctacc tgcaggagat ctttagtaat gagatggcta aggtggatga ctctttcttc 300cataggctgg aggagtcctt tttggtggag gaggataaaa agcacgagcg ccacccaatc 360tttggcaata tcgtggacga ggtggcgtac catgaaaagt acccaaccat atatcatctg 420aggaagaagc ttgtagacag tactgataag gctgacttgc ggttgatcta tctcgcgctg 480gcgcatatga tcaaatttcg gggacacttc ctcatcgagg gggacctgaa cccagacaac 540agcgatgtcg acaaactctt tatccaactg gttcagactt acaatcagct tttcgaagag 600aacccgatca acgcatccgg agttgacgcc aaagcaatcc tgagcgctag gctgtccaaa 660tcccggcggc tcgaaaacct catcgcacag ctccctgggg agaagaagaa cggcctgttt 720ggtaatctta tcgccctgtc actcgggctg acccccaact ttaaatctaa cttcgacctg 780gccgaagatg ccaagcttca actgagcaaa gacacctacg atgatgatct cgacaatctg 840ctggcccaga tcggcgacca gtacgcagac ctttttttgg cggcaaagaa cctgtcagac 900gccattctgc tgagtgatat tctgcgagtg aacacggaga tcaccaaagc tccgctgagc 960gctagtatga tcaagcgcta tgatgagcac caccaagact tgactttgct gaaggccctt 1020gtcagacagc aactgcctga gaagtacaag gaaattttct tcgatcagtc taaaaatggc

1080tacgccggat acattgacgg cggagcaagc caggaggaat tttacaaatt tattaagccc 1140atcttggaaa aaatggacgg caccgaggag ctgctggtaa agcttaacag agaagatctg 1200ttgcgcaaac agcgcacttt cgacaatgga agcatccccc accagattca cctgggcgaa 1260ctgcacgcta tcctcaggcg gcaagaggat ttctacccct ttttgaaaga taacagggaa 1320aagattgaga aaatcctcac atttcggata ccctactatg taggccccct cgcccgggga 1380aattccagat tcgcgtggat gactcgcaaa tcagaagaga ccatcactcc ctggaacttc 1440gaggaagtcg tggataaggg ggcctctgcc cagtccttca tcgaaaggat gactaacttt 1500gataaaaatc tgcctaacga aaaggtgctt cctaaacact ctctgctgta cgagtacttc 1560acagtttata acgagctcac caaggtcaaa tacgtcacag aagggatgag aaagccagca 1620ttcctgtctg gagagcagaa gaaagctatc gtggacctcc tcttcaagac gaaccggaaa 1680gttaccgtga aacagctcaa agaagactat ttcaaaaaga ttgaatgttt cgactctgtt 1740gaaatcagcg gagtggagga tcgcttcaac gcatccctgg gaacgtatca cgatctcctg 1800aaaatcatta aagacaagga cttcctggac aatgaggaga acgaggacat tcttgaggac 1860attgtcctca cccttacgtt gtttgaagat agggagatga ttgaagaacg cttgaaaact 1920tacgctcatc tcttcgacga caaagtcatg aaacagctca agaggcgccg atatacagga 1980tgggggcggc tgtcaagaaa actgatcaat gggatccgag acaagcagag tggaaagaca 2040atcctggatt ttcttaagtc cgatggattt gccaaccgga acttcatgca gttgatccat 2100gatgactctc tcacctttaa ggaggacatc cagaaagcac aagtttctgg ccagggggac 2160agtcttcacg agcacatcgc taatcttgca ggtagcccag ctatcaaaaa gggaatactg 2220cagaccgtta aggtcgtgga tgaactcgtc aaagtaatgg gaaggcataa gcccgagaat 2280atcgttatcg agatggcccg agagaaccaa actacccaga agggacagaa gaacagtagg 2340gaaaggatga agaggattga agagggtata aaagaactgg ggtcccaaat ccttaaggaa 2400cacccagttg aaaacaccca gcttcagaat gagaagctct acctgtacta cctgcagaac 2460ggcagggaca tgtacgtgga tcaggaactg gacatcaatc ggctctccga ctacgacgtg 2520gatcatatcg tgccccagtc ttttctcaaa gatgattcta ttgataataa agtgttgaca 2580agatccgata aaaatagagg gaagagtgat aacgtcccct cagaagaagt tgtcaagaaa 2640atgaaaaatt attggcggca gctgctgaac gccaaactga tcacacaacg gaagttcgat 2700aatctgacta aggctgaacg aggtggcctg tctgagttgg ataaagccgg cttcatcaaa 2760aggcagcttg ttgagacacg ccagatcacc aagcacgtgg cccaaattct cgattcacgc 2820atgaacacca agtacgatga aaatgacaaa ctgattcgag aggtgaaagt tattactctg 2880aagtctaagc tggtctcaga tttcagaaag gactttcagt tttataaggt gagagagatc 2940aacaattacc accatgcgca tgatgcctac ctgaatgcag tggtaggcac tgcacttatc 3000aaaaaatatc ccaagcttga atctgaattt gtttacggag actataaagt gtacgatgtt 3060aggaaaatga tcgcaaagtc tgagcaggaa ataggcaagg ccaccgctaa gtacttcttt 3120tacagcaata ttatgaattt tttcaagacc gagattacac tggccaatgg agagattcgg 3180aagcgaccac ttatcgaaac aaacggagaa acaggagaaa tcgtgtggga caagggtagg 3240gatttcgcga cagtccggaa ggtcctgtcc atgccgcagg tgaacatcgt taaaaagacc 3300gaagtacaga ccggaggctt ctccaaggaa agtatcctcc cgaaaaggaa cagcgacaag 3360ctgatcgcac gcaaaaaaga ttgggacccc aagaaatacg gcggattcga ttctcctaca 3420gtcgcttaca gtgtactggt tgtggccaaa gtggagaaag ggaagtctaa aaaactcaaa 3480agcgtcaagg aactgctggg catcacaatc atggagcgat caagcttcga aaaaaacccc 3540atcgactttc tcgaggcgaa aggatataaa gaggtcaaaa aagacctcat cattaagctt 3600cccaagtact ctctctttga gcttgaaaac ggccggaaac gaatgctcgc tagtgcgggc 3660gagctgcaga aaggtaacga gctggcactg ccctctaaat acgttaattt cttgtatctg 3720gccagccact atgaaaagct caaagggtct cccgaagata atgagcagaa gcagctgttc 3780gtggaacaac acaaacacta ccttgatgag atcatcgagc aaataagcga attctccaaa 3840agagtgatcc tcgccgacgc taacctcgat aaggtgcttt ctgcttacaa taagcacagg 3900gataagccca tcagggagca ggcagaaaac attatccact tgtttactct gaccaacttg 3960ggcgcgcctg cagccttcaa gtacttcgac accaccatag acagaaagcg gtacacctct 4020acaaaggagg tcctggacgc cacactgatt catcagtcaa ttacggggct ctatgaaaca 4080agaatcgacc tctctcagct cggtggagac agcagggctg accccaagaa gaagaggaag 4140gtgtga 414638455DNAArtificial SequenceNucleotide Sequence of RNA Guide Strand for use with Cas9 Endonuclease 38tgtacaaaaa agcaggcttt aaaggaacca attcagtcga ctggatccgg taccaaggtc 60gggcaggaag agggcctatt tcccatgatt ccttcatatt tgcatatacg atacaaggct 120gttagagaga taattagaat taatttgact gtaaacacaa agatattagt acaaaatacg 180tgacgtagaa agtaataatt tcttgggtag tttgcagttt taaaattatg ttttaaaatg 240gactatcata tgcttaccgt aacttgaaag tatttcgatt tcttggcttt atatatcttg 300tggaaaggac gaaacaccgn nnnnnnnnnn nnnnnnnngt tttagagcta gaaatagcaa 360gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 420tctagaccca gctttcttgt acaaagttgg catta 4553922DNAArtificial SequenceBCL11A gene target site 39tccaagtgat gtctcggtgg tg 224022DNAArtificial SequenceTargeted Homing Endonuclease Target Site 40tttccaatta ttcaaccttt ta 224122DNAArtificial SequenceTargeted Homing Endonuclease Target Site 41tcttgaatta ttcaaccttt ta 224222DNAArtificial SequenceTargeted Homing Endonuclease Target Site 42tttccattta ttcaatattt ta 224322DNAArtificial SequenceTargeted Homing Endonuclease Target Site 43tttccattta ttcaatatct tt 224412DNAArtificial SequenceU6 Promoter Sequence of a Generic Cas9 Guide RNA 44ggacgaaaca cc 124520DNAArtificial SequenceGeneric Target-specific Sequence of a Generic Cas9 Guide RNA 45gnnnnnnnnn nnnnnnnnnn 204677DNAArtificial SequenceGuide RNA Scaffold Sequence of a Generic Cas9 Guide RNA 46gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60ggcaccgagt cggtgct 774710DNAArtificial SequencePoly T Tail of a Generic Cas9 Guide RNA 47nnnntttttt 104823DNAArtificial SequenceTarget-specific Sequence for Cas9 Guide RNA GGN20GG-B 48gccatttcta ttatcagact tgg 234923DNAArtificial SequenceTarget-specific Sequence for Cas9 Guide RNA GGN20GG-C 49gctgggcttc tgttgcagta ggg 235023DNAArtificial SequenceTarget-specific Sequence for Cas9 Guide RNA GGN20GG-D 50gaaaatggga gacaaatagc tgg 235123DNAArtificial SequenceTarget-specific Sequence for Cas9 Guide RNA GGN20GG-E 51gaataattca agaaaggtgg tgg 235223DNAArtificial SequenceTarget-specific Sequence for Cas9 Guide RNA GGN20GG-F 52gatattgaat aattcaagaa agg 235323DNAArtificial SequenceTarget-specific Sequence for Cas9 Guide RNA GGN20GG-G 53gcctgagatt ctgatcacaa ggg 235423DNAArtificial SequenceTarget-specific Sequence for Cas9 Guide RNA GGN20GG-H 54ggtaaattct taaggccatg agg 235522DNAArtificial SequenceEngineered target site 55ttgaggagat gtctctgtta at 225622DNAArtificial SequenceEngineered target site 56ttgaggtgat gtctctgtta at 225722DNAArtificial SequenceEngineered target site 57ttgaagtgat gtctctgtta at 225822DNAArtificial SequenceEngineered target site 58tccaagtgat gtctctgtta at 225922DNAArtificial SequenceEngineered target site 59tccaagtgat gtctctgtta at 226022DNAArtificial SequenceEngineered target site 60ttgaggaggt ttctgtgtta at 226122DNAArtificial SequenceEngineered target site 61ttgaggaggt ttctcggtgg tg 2262900DNAArtificial SequenceNucleotide Sequence of a I-CpaMI homing endonuclease; ORF, codon optimized for mammalian expression 62atgaacacca gctctagctt caatccctgg ttcctgaccg gctttagcga tgcagagtgc 60tctttcagca tcctgataca ggccaacagc aagtactcca ccggttggag gatcaagccc 120gtgttcgcca tcggcttgca caagaaggac ctggagcttc tgaagagaat ccagagctat 180ctgggcgtgg gcaagataca cattcacggc aaagacagca ttcagttcag gattgacagc 240cccaaggagc tggaggtgat catcaaccac tttgagaact accccctggt aaccgccaag 300tgggccgact acaccctctt taagaaggcc ctggacgtaa ttctgttgaa ggagcacctg 360agccagaagg gcctgcttaa actggtaggc attaaggcga gcctgaatct cgggttgaac 420ggcagcctca aggaggcgtt cccgaactgg gaagaactgc agatcgacag gccgagctac 480gtgttcaagg gcatccccga ccccaactgg atcagcggct tcgcgtcagg cgatagcagc 540tttaatgtga aaatcagcaa ctcccccacg tcactgctca ataaaagggt gcagctgagg 600ttcggcatcg gactgaacat cagagagaaa gcccttatcc aatacctggt ggcctacttt 660gacctgtcag acaacctgaa gaacatctac ttcgacctga acagcgcacg gttcgaggtg 720gtgaagttca gcgacatcac cgacaagatc atccccttct tcgacaagta cagcatacaa 780ggcaagaaga gcctggacta catcaacttc aaggaagtgg ccgacattat caagagcaag 840aaccatctta ctagcgaggg cttccaggaa atcttggaca tcaaagccag tatgaacaag 90063300PRTCryphonectria parasitica 63Met Asn Thr Ser Ser Ser Phe Asn Pro Trp Phe Leu Thr Gly Phe Ser 1 5 10 15 Asp Ala Glu Cys Ser Phe Ser Ile Leu Ile Gln Ala Asn Ser Lys Tyr 20 25 30 Ser Thr Gly Trp Arg Ile Lys Pro Val Phe Ala Ile Gly Leu His Lys 35 40 45 Lys Asp Leu Glu Leu Leu Lys Arg Ile Gln Ser Tyr Leu Gly Val Gly 50 55 60 Lys Ile His Ile His Gly Lys Asp Ser Ile Gln Phe Arg Ile Asp Ser 65 70 75 80 Pro Lys Glu Leu Glu Val Ile Ile Asn His Phe Glu Asn Tyr Pro Leu 85 90 95 Val Thr Ala Lys Trp Ala Asp Tyr Thr Leu Phe Lys Lys Ala Leu Asp 100 105 110 Val Ile Leu Leu Lys Glu His Leu Ser Gln Lys Gly Leu Leu Lys Leu 115 120 125 Val Gly Ile Lys Ala Ser Leu Asn Leu Gly Leu Asn Gly Ser Leu Lys 130 135 140 Glu Ala Phe Pro Asn Trp Glu Glu Leu Gln Ile Asp Arg Pro Ser Tyr 145 150 155 160 Val Phe Lys Gly Ile Pro Asp Pro Asn Trp Ile Ser Gly Phe Ala Ser 165 170 175 Gly Asp Ser Ser Phe Asn Val Lys Ile Ser Asn Ser Pro Thr Ser Leu 180 185 190 Leu Asn Lys Arg Val Gln Leu Arg Phe Gly Ile Gly Leu Asn Ile Arg 195 200 205 Glu Lys Ala Leu Ile Gln Tyr Leu Val Ala Tyr Phe Asp Leu Ser Asp 210 215 220 Asn Leu Lys Asn Ile Tyr Phe Asp Leu Asn Ser Ala Arg Phe Glu Val 225 230 235 240 Val Lys Phe Ser Asp Ile Thr Asp Lys Ile Ile Pro Phe Phe Asp Lys 245 250 255 Tyr Ser Ile Gln Gly Lys Lys Ser Leu Asp Tyr Ile Asn Phe Lys Glu 260 265 270 Val Ala Asp Ile Ile Lys Ser Lys Asn His Leu Thr Ser Glu Gly Phe 275 280 285 Gln Glu Ile Leu Asp Ile Lys Ala Ser Met Asn Lys 290 295 300 645264DNAArtificial SequenceNucleotide sequence of BCL11A gene targeting nuclease-encoding plasmid pExodusBCL11Ahje 64gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900gtttaaactt aagcttggta ccgagctcgg atccactagt ccagtgtggt ggaattctgc 960aggtacgttg acgccgccac catgggatat ccatacgatg tcccagatta tgcgccacct 1020aagaagaaac gcaaagtccc cgggggcagc cacatggacc tgacctacgc ctatctggtc 1080ggcctgttcg agggcgacgg ctattttaca atagctaagg ccggcaagta tctgaactac 1140gagctgggca tcacactctc catcaaggac gctcagctca tctacaagat caaggacatc 1200ctcggcgtgg gcaacgtgta ctttaggaag tacaggcaac atgagatggt cagcctgcga 1260atccaggaca aaaaccacct gaagaacttc atcctgccca tcttcgacaa gtaccccatg 1320ctgagcaaca agcagtacga ctacctgcga ttcaaggatg ccctcctgtc caacatcatc 1380tatagcgacg acctgcccga gtacgccagg agcaacgagt caatcaatag cgtggacagc 1440atcatcaaca cctcatactt cagcgcctgg ctggttggct tcatcgaggc cgagggctgc 1500ttcaccacct acaaggcatc caaggacaag tacctgacag cgggcttctc catagcccag 1560aaggacggcg acattctcat ctccgcgatc cacaaatacc tgagcttcac gaccaaaccc 1620tacaaagaca agaccaactg tagccacctc aaggtcaccg gcgtgaggag cgtcaataac 1680gtggttaagt tcatccaggg tgcgccggtc aagctgctgg gtaacaagaa gctgcagtac 1740aaactttgga taaagcagct gcgcaagatc tcccgataca gcgagaaaat ccagctgccc 1800agtaactact aatctagagg gcccgtttaa acccgctgat cagcctcgac tgtgccttct 1860agttgccagc catctgttgt ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc 1920actcccactg tcctttccta ataaaatgag gaaattgcat cgcattgtct gagtaggtgt 1980cattctattc tggggggtgg ggtggggcag gacagcaagg gggaggattg ggaagacaat 2040agcaggcatg ctggggatgc ggtgggctct atggcttctg aggcggaaag aaccagctgg 2100ggctctaggg ggtatcccca cgcgccctgt agcggcgcat taagcgcggc gggtgtggtg 2160gttacgcgca gcgtgaccgc tacacttgcc agcgccctag cgcccgctcc tttcgctttc 2220ttcccttcct ttctcgccac gttcgccggc tttccccgtc aagctctaaa tcgggggctc 2280cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgattagggt 2340gatggttcac gtagtgggcc atcgccctga tagacggttt ttcgcccttt gacgttggag 2400tccacgttct ttaatagtgg actcttgttc caaactggaa caacactcaa ccctatctcg 2460gtctattctt ttgatttata agggattttg ccgatttcgg cctattggtt aaaaaatgag 2520ctgatttaac aaaaatttaa cgcgaattaa ttctgtggaa tgtgtgtcag ttagggtgtg 2580gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag cctatcagga catagcgttg 2640gctacccgtg atattgctga agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt 2700tacggtatcg ccgctcccga ttcgcagcgc atcgccttct atcgccttct tgacgagttc 2760ttctgagcgg gactctgggg ttcgaaatga ccgaccaagc gacgcccaac ctgccatcac 2820gagatttcga ttccaccgcc gccttctatg aaaggttggg cttcggaatc gttttccggg 2880acgccggctg gatgatcctc cagcgcgggg atctcatgct ggagttcttc gcccacccca 2940acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa 3000ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt 3060atcatgtctg tataccgtcg acctctagct agagcttggc gtaatcatgg tcatagctgt 3120ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 3180agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac 3240tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 3300cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 3360gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 3420ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 3480ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 3540atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 3600aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 3660gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 3720ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 3780ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 3840acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 3900gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtat 3960ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 4020ccggcaaaca aaccaccgct ggtagcggtt tttttgtttg caagcagcag attacgcgca 4080gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga 4140acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga 4200tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt 4260ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt 4320catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat 4380ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag 4440caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct 4500ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt 4560tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg 4620cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca 4680aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt 4740tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat 4800gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac 4860cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa 4920aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt 4980tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt 5040tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa 5100gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt 5160atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa 5220taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtc 5264655100DNAArtificial SequenceNucleotide sequence of TREX2-encoding

plasmid pExodus CMV.Trex2 65gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900atgtctgagc cacctcgggc tgagaccttt gtattcctgg acctagaagc cactgggctc 960ccaaacatgg accctgagat tgcagagata tccctttttg ctgttcaccg ctcttccctg 1020gagaacccag aacgggatga ttctggttcc ttggtgctgc cccgtgttct ggacaagctc 1080acactgtgca tgtgcccgga gcgccccttt actgccaagg ccagtgagat tactggtttg 1140agcagcgaaa gcctgatgca ctgcgggaag gctggtttca atggcgctgt ggtaaggaca 1200ctgcagggct tcctaagccg ccaggagggc cccatctgcc ttgtggccca caatggcttc 1260gattatgact tcccactgct gtgcacggag ctacaacgtc tgggtgccca tctgccccaa 1320gacactgtct gcctggacac actgcctgca ttgcggggcc tggaccgtgc tcacagccac 1380ggcaccaggg ctcaaggccg caaaagctac agcctggcca gtctcttcca ccgctacttc 1440caggctgaac ccagtgctgc ccattcagca gaaggtgatg tgcacaccct gcttctgatc 1500ttcctgcatc gtgctcctga gctgctcgcc tgggcagatg agcaggcccg cagctgggct 1560catattgagc ccatgtacgt gccacctgat ggtccaagcc tcgaagcctg aattctgcag 1620atatccagca cagtggcggc cgctcgagtc tagagggccc gtttaaaccc gctgatcagc 1680ctcgactgtg ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt 1740gaccctggaa ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca 1800ttgtctgagt aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga 1860ggattgggaa gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc 1920ggaaagaacc agctggggct ctagggggta tccccacgcg ccctgtagcg gcgcattaag 1980cgcggcgggt gtggtggtta cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc 2040cgctcctttc gctttcttcc cttcctttct cgccacgttc gccggctttc cccgtcaagc 2100tctaaatcgg gggctccctt tagggttccg atttagtgct ttacggcacc tcgaccccaa 2160aaaacttgat tagggtgatg gttcacgtag tgggccatcg ccctgataga cggtttttcg 2220ccctttgacg ttggagtcca cgttctttaa tagtggactc ttgttccaaa ctggaacaac 2280actcaaccct atctcggtct attcttttga tttataaggg attttgccga tttcggccta 2340ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattaattct gtggaatgtg 2400tgtcagttag ggtgtggaaa gtccccaggc tccccagcag gcagaagtat gcaaagccta 2460tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg aatgggctga 2520ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg ccttctatcg 2580ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga ccaagcgacg 2640cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag gttgggcttc 2700ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct catgctggag 2760ttcttcgccc accccaactt gtttattgca gcttataatg gttacaaata aagcaatagc 2820atcacaaatt tcacaaataa agcatttttt tcactgcatt ctagttgtgg tttgtccaaa 2880ctcatcaatg tatcttatca tgtctgtata ccgtcgacct ctagctagag cttggcgtaa 2940tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata 3000cgagccggaa gcataaagtg taaagcctgg ggtgcctaat gagtgagcta actcacatta 3060attgcgttgc gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa 3120tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg 3180ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag 3240gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa 3300ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc 3360cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca 3420ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg 3480accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct 3540catagctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt 3600gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag 3660tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc 3720agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac 3780actagaagaa cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga 3840gttggtagct cttgatccgg caaacaaacc accgctggta gcggtttttt tgtttgcaag 3900cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 3960tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 4020aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 4080tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 4140atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata 4200cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 4260gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 4320gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 4380tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 4440tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 4500tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 4560aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 4620atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 4680tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 4740catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 4800aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 4860tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 4920gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 4980tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 5040tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc 51006620DNAArtificial SequencePCR Primer 66gctggaatgg ttgcagtaac 206720DNAArtificial SequencePCR Primer 67caaacagcca ttcaccagtg 206821DNAArtificial SequencePCR Primer 68ctgccagctc tctaagtctc c 216921DNAArtificial SequencePCR Primer 69tgcaacacgc acagaacact c 21

Claims

1-96. (canceled)

97. A polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation.

98. The polynucleotide of claim 97, wherein the endonuclease is: a) a HE that binds to said Bcl11a coding region or said Bcl11a gene regulatory region; b) a HE selected from the group consisting of an I-OnuI homing endonuclease, an I-HjeMI homing endonuclease, and an I-CpaMI homing endonuclease; c) a HE that can specifically bind to a fetal hemoglobin (HbF) silencing region; d) an I-OnuI homing endonuclease; e) an I-OnuI homing endonuclease comprising the amino acid sequence encoded by a variant of the nucleotide sequence of SEQ ID NO: 34 that encodes an I-OnuI homing endonuclease that can specifically bind to the fetal hemoglobin (HbF) silencing region; f) an I-OnuI homing endonuclease comprising one or more amino acid substitutions within the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 34, wherein each of the amino acid substitutions is selected from the group consisting of L26, R28, R30, N32, S40, E42, G44, Q46, A70, S72, S78, K80, and T82; or g) an I-OnuI homing endonuclease comprising one or more amino acid substitutions within the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 34, wherein said amino acid substitution is selected from the group consisting of F182, N184, 1186, S190, K191, Q197, V199, S201, K225, K227, D236, V238, and T240.

99. The polynucleotide of claim 97 or claim 98, further comprising a polynucleotide encoding a TAL effector nuclease (TALEN), a TALE-HE fusion protein, and/or a TREX2 nuclease.

100. A vector system comprising a vector and: a) a polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation; or b) a polynucleotide encoding a Cas9 endonuclease, optionally wherein the Cas9 endonuclease comprises the nucleotide sequence of SEQ ID NO: 37 or a variant thereof which encodes a functional Cas9 endonuclease, and an RNA guide strand that mediates the binding of the Cas9 endonuclease to a fetal hemoglobin (HbF) silencing region, optionally wherein the RNA guide strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54.

101. The vector system of claim 100, wherein said endonuclease is: a) a HE that binds to said Bcl11a coding region or said Bcl11a gene regulatory region; b) a HE selected from the group consisting of an I-OnuI homing endonuclease, an I-HjeMI homing endonuclease, and an I-CpaMI homing endonuclease; c) a HE that can specifically bind to a fetal hemoglobin (HbF) silencing region; d) an I-OnuI homing endonuclease; e) an I-OnuI homing endonuclease comprising the amino acid sequence encoded by a variant of the nucleotide sequence of SEQ ID NO: 34 that encodes an I-OnuI homing endonuclease that can specifically bind to the fetal hemoglobin (HbF) silencing region; f) an I-OnuI homing endonuclease comprising one or more amino acid substitutions within the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 34, wherein each of the amino acid substitutions is selected from the group consisting of L26, R28, R30, N32, S40, E42, G44, Q46, A70, S72, S78, K80, and T82; or g) an I-OnuI homing endonuclease comprising one or more amino acid substitutions within the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 34, wherein said amino acid substitution is selected from the group consisting of F182, N184, 1186, S190, K191, Q197, V199, S201, K225, K227, D236, V238, and T240.

102. The vector system of claim 100, further comprising a polynucleotide encoding a TAL effector nuclease (TALEN), a TALE-HE fusion protein, and/or a TREX2 nuclease.

103. The vector system of claim 100, claim 101, or claim 102, wherein said vector is selected from the group consisting of an AAV6, a modified adenovirus vector, an integration-deficient lentiviral vector (IDLV), and an integration-deficient foamyviral vector (IDFV).

104. A polypeptide encoded by a polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation.

105. The polypeptide of claim 104, wherein said endonuclease is: a) a HE that binds to said Bcl11a coding region or said Bcl11a gene regulatory region; b) a HE selected from the group consisting of an I-OnuI homing endonuclease, an I-HjeMI homing endonuclease, and an I-CpaMI homing endonuclease; c) a HE that can specifically bind to a fetal hemoglobin (HbF) silencing region; d) an I-OnuI homing endonuclease; e) an I-OnuI homing endonuclease comprising the amino acid sequence encoded by a variant of the nucleotide sequence of SEQ ID NO: 34 that encodes an I-OnuI homing endonuclease that can specifically bind to the fetal hemoglobin (HbF) silencing region; f) an I-OnuI homing endonuclease comprising one or more amino acid substitutions within the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 34, wherein each of the amino acid substitutions is selected from the group consisting of L26, R28, R30, N32, S40, E42, G44, Q46, A70, S72, S78, K80, and T82; or g) an I-OnuI homing endonuclease comprising one or more amino acid substitutions within the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 34, wherein said amino acid substitution is selected from the group consisting of F182, N184, 1186, S190, K191, Q197, V199, S201, K225, K227, D236, V238, and T240.

106. A composition for the treatment of a hemoglobinopathy, said composition comprising: a) a polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation; b) a vector system, comprising a vector and: i) a polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation; or ii) a polynucleotide encoding a Cas9 endonuclease, optionally wherein the Cas9 endonuclease comprises the nucleotide sequence of SEQ ID NO: 37 or a variant thereof which encodes a functional Cas9 endonuclease, and an RNA guide strand that mediates the binding of the Cas9 endonuclease to a fetal hemoglobin (HbF) silencing region, optionally wherein the RNA guide strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54; or c) a polypeptide encoded by a polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation.

107. The composition of claim 106 wherein said endonuclease is: a) a HE that binds to said Bcl11a coding region or said Bcl11a gene regulatory region; b) a HE selected from the group consisting of an I-OnuI homing endonuclease, an I-HjeMI homing endonuclease, and an I-CpaMI homing endonuclease; c) a HE that can specifically bind to a fetal hemoglobin (HbF) silencing region; d) an I-OnuI homing endonuclease; e) an I-OnuI homing endonuclease comprising the amino acid sequence encoded by a variant of the nucleotide sequence of SEQ ID NO: 34 that encodes an I-OnuI homing endonuclease that can specifically bind to the fetal hemoglobin (HbF) silencing region;

108. The composition of claim 106 wherein said polynucleotide further comprises a polynucleotide encoding a TAL effector nuclease (TALEN), a TALE-HE fusion protein, and/or a TREX2 nuclease.

109. The composition of claim 106 wherein said vector is selected from the group consisting of an AAV6, a modified adenovirus vector, an integration-deficient lentiviral vector (IDLV), and an integration-deficient foamyviral vector (IDFV).

110. A cell comprising: a) a polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation; b) a vector system comprising a vector and: i) a polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation; or ii) a polynucleotide encoding a Cas9 endonuclease, optionally wherein the Cas9 endonuclease comprises the nucleotide sequence of SEQ ID NO: 37 or a variant thereof which encodes a functional Cas9 endonuclease, and an RNA guide strand that mediates the binding of the Cas9 endonuclease to a fetal hemoglobin (HbF) silencing region, optionally wherein the RNA guide strand comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, and SEQ ID NO: 54; or c) a polypeptide encoded by a polynucleotide encoding an endonuclease selected from the group consisting of a homing endonuclease (HE) and a CRISPR endonuclease, wherein said endonuclease binds to a nucleotide sequence selected from the group consisting of a Bcl11a coding region, a Bcl11a gene regulatory region, an adult human .beta.-globin locus, a fetal hemoglobin (HbF) silencing region, a Bcl11a-regulated HbF silencing region, a .gamma.-globin gene promoter, a .delta.-globin gene promoter, and a site of a .beta.-globin gene mutation.

111. The cell of claim 110 wherein said endonuclease is: a) a HE that binds to said Bcl11a coding region or said Bcl11a gene regulatory region; b) a HE selected from the group consisting of an I-OnuI homing endonuclease, an I-HjeMI homing endonuclease, and an I-CpaMI homing endonuclease; c) a HE that can specifically bind to a fetal hemoglobin (HbF) silencing region; d) an I-OnuI homing endonuclease; e) an I-OnuI homing endonuclease comprising the amino acid sequence encoded by a variant of the nucleotide sequence of SEQ ID NO: 34 that encodes an I-OnuI homing endonuclease that can specifically bind to the fetal hemoglobin (HbF) silencing region.

112. The cell of claim 110, further comprising a polynucleotide encoding a TAL effector nuclease (TALEN), a TALE-HE fusion protein, and/or a TREX2 nuclease.

113. The cell of claim 110 wherein said vector is selected from the group consisting of an AAV6, a modified adenovirus vector, an integration-deficient lentiviral vector (IDLV), and an integration-deficient foamyviral vector (IDFV).

114. The cell of claim 110 wherein said cell is: a) a stem cell; b) a stem cell selected from the group consisting of a hematopoietic stem cell (HSC), an induced pluripotent stem cell (iPSC), an embryonic stem (ES) cell, and an erythroid progenitor cell; or c) a stem cell selected from the group consisting of a hematopoietic stem cell (HSC), an induced pluripotent stem cell (iPSC), and an erythroid progenitor cell.

115. A genome edited stem cell wherein said genome edited stem cell is generated by the introduction of a homing endonuclease and a correction template.

116. The genome edited stem cell of claim 115 wherein said homing endonuclease is: a) a HE that binds to said Bcl11a coding region or said Bcl11a gene regulatory region; b) a HE selected from the group consisting of an I-OnuI homing endonuclease, an I-HjeMI homing endonuclease, and an I-CpaMI homing endonuclease; c) a HE that can specifically bind to a fetal hemoglobin (HbF) silencing region; d) an I-OnuI homing endonuclease; e) an I-OnuI homing endonuclease comprising the amino acid sequence encoded by a variant of the nucleotide sequence of SEQ ID NO: 34 that encodes an I-OnuI homing endonuclease that can specifically bind to the fetal hemoglobin (HbF) silencing region; f) an I-OnuI homing endonuclease comprising one or more amino acid substitutions within the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 34, wherein each of the amino acid substitutions is selected from the group consisting of L26, R28, R30, N32, S40, E42, G44, Q46, A70, S72, S78, K80, and T82; or g) an I-OnuI homing endonuclease comprising one or more amino acid substitutions within the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 34, wherein said amino acid substitution is selected from the group consisting of F182, N184, 1186, S190, K191, Q197, V199, S201, K225, K227, D236, V238, and T240.

117. The genome edited stem cell of claim 115 wherein the homing endonuclease is fused to a TAL effector (TALE) DNA binding domain and/or a TREX2 nuclease domain.

118. The genome edited stem cell of any one of claims 115 to 117 wherein: a) the correction template comprises a nucleotide sequence that permits the modification of key regulatory or coding sequences within a globin gene locus; b) the cell stem cell is selected from the group consisting of a hematopoietic stem cell (HSC), an induced pluripotent stem cell (iPSC), an embryonic stem (ES) cell, and an erythroid progenitor cell; or c) stem cell is selected from the group consisting of a hematopoietic stem cell (HSC), an induced pluripotent stem cell (iPSC), and an erythroid progenitor cell.