U.S. patent application number 14/409234 was filed with the patent office on 2015-06-18 for generation of hepatocytes from pluripotent stem cells.
This patent application is currently assigned to ALBERT EINSTEIN COLLEGE OF MEDICINE OF YESHIVA UNIVERSITY. The applicant listed for this patent is ALBERT EINSTEIN COLLEGE OF MEDICINE OF YESHIVA UNIVERSITY. Invention is credited to Sriram Bandi, Sanjeev Gupta.
Application Number | 20150166953 14/409234 |
Document ID | / |
Family ID | 49783851 |
Filed Date | 2015-06-18 |
United States Patent
Application |
20150166953 |
Kind Code |
A1 |
Gupta; Sanjeev ; et
al. |
June 18, 2015 |
GENERATION OF HEPATOCYTES FROM PLURIPOTENT STEM CELLS
Abstract
Methods are provided for producing differentiated cells from
stem cells, including producing hepatocytes. Compositions thereof
are also provided, as are methods of treating a liver disorder.
Inventors: |
Gupta; Sanjeev; (Scarsdale,
NY) ; Bandi; Sriram; (Belleville, NJ) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ALBERT EINSTEIN COLLEGE OF MEDICINE OF YESHIVA UNIVERSITY |
Bronx |
NY |
US |
|
|
Assignee: |
ALBERT EINSTEIN COLLEGE OF MEDICINE
OF YESHIVA UNIVERSITY
Bronx
NY
|
Family ID: |
49783851 |
Appl. No.: |
14/409234 |
Filed: |
June 27, 2013 |
PCT Filed: |
June 27, 2013 |
PCT NO: |
PCT/US13/48113 |
371 Date: |
December 18, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61666219 |
Jun 29, 2012 |
|
|
|
Current U.S.
Class: |
424/93.7 ;
424/553; 435/370; 435/377 |
Current CPC
Class: |
C12N 5/067 20130101;
C12N 5/0672 20130101; C12N 2501/999 20130101; C12N 2502/14
20130101; C12N 2506/02 20130101; C12N 2500/84 20130101; A61K 35/407
20130101 |
International
Class: |
C12N 5/071 20060101
C12N005/071; A61K 35/407 20060101 A61K035/407 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under grant
numbers R01 DK071111, R01 DK088561, P30-DK41296 and P30 CA13330
awarded by the National Institutes of Health. The government has
certain rights in the invention.
Claims
1. A method of producing a differentiated cell from a pluripotent
stem cell, the method comprising maintaining the pluripotent stem
cell in a medium comprising two or more of phenacetin,
phytosphingosine HCl, and pyridoxal HCl, or a medium comprising
conditioned medium from hepatoblasts, for a time sufficient to
produce the differentiated cell.
2. The method of claim 1, wherein the differentiated cell is a
hepatocyte.
3. The method of claim 1, wherein the differentiated cell exhibits
a meso-endodermal phenotype of a fetal human hepatocyte.
4. The method of claim 1, wherein the differentiated cell exhibits
ureagenesis and/or albumin synthesis and/or vimentin
expression.
5. The method of claim 1, wherein the pluripotent stem cell is an
inducible pluripotent stem cell or is an embryonic stem cell.
6. The method of claim 1, wherein the hepatoblasts are immortalized
human hepatoblasts.
7. The method of claim 1, wherein the medium does not comprise
serum.
8. The method of claim 1, wherein the conditioned medium from
hepatoblasts comprises medium conditioned by a culture of
immortalized human hepatoblasts cultured in a medium comprising a
basal medium.
9. The method of claim 1, wherein the immortalized human
hepatoblasts are immortalized human fetal hepatoblasts.
10-18. (canceled)
19. A composition comprising conditioned medium obtained from a
culture of hepatoblasts cultured in a medium comprising a basal
medium, or comprising a basal medium comprising two or more of
phenacetin, phytosphingosine HCl, and pyridoxal HCl.
20. The composition of claim 19, wherein (i) the medium comprising
a basal medium from which the conditioned medium is obtained, or
(ii) the basal medium further comprising two or more of phenacetin,
phytosphingosine HC, and pyridoxal HCl, further comprises
L-glutamine, non essential amino acids, and an antibiotic.
21. The composition of claim 19, wherein basal medium is a
Dulbecco's modified Eagle's medium (DMEM).
22. The composition of claim 20, wherein the antibiotic is
penicillin-streptomycin.
23. The composition of claim 20, wherein the non-essential amino
acids are glycine, L-alanine, L-asparagine, L-aspartic acid,
L-glutamic acid, L-proline and L-serine.
24. The composition of claim 20, wherein (i) the medium comprising
a basal medium from which the conditioned medium is obtained, or
(ii) the basal medium further comprising two or more of phenacetin,
phytosphingosine HCl, and pyridoxal HCl, further comprises an
artificial serum replacement.
25. The composition of claim 19, wherein the hepatoblasts are
immortalized.
26. The composition of claim 19, wherein the hepatoblasts are human
hepatoblasts.
27. The composition of claim 19, wherein the hepatoblasts are fetal
hepatoblasts.
28-35. (canceled)
36. A method of treating a liver disorder in a subject comprising
administering to the subject an amount of the differentiated cells
produced by the method of claim 1, or a conditioned media from a
culture of such cells comprising a basal medium in an amount
effective to treat a liver disorder.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. Provisional
Application No. 61/666,219, filed Jun. 29, 2012 the contents of
which are hereby incorporated by reference.
BACKGROUND OF THE INVENTION
[0003] Throughout this application various publications are
referred to in parentheses by number. Full citations for these
references may be found at the end of the specification. The
disclosures of each of these publications, and of all patents,
patent application publications and books cited herein, are hereby
incorporated by reference in their entirety into the subject
application to more fully describe the art to which the subject
invention pertains.
[0004] The liver occupies a central position in life due to its
crucial metabolic, synthetic, storage, and drug or toxin disposal
functions. Isolated liver cells are extremely useful for developing
disease models, as well as for toxicological testing and drug
development. Moreover, because many proteins are made in liver
cells, cell/gene therapy directed at the liver is of extensive
interest for a long list of genetic or acquired conditions.
However, shortages of donor organs have proved to be an
insurmountable hurdle for therapeutic and other applications of
liver cells. Therefore, alternative means to generate hepatocytes,
e.g., from pluripotent stem cells, is of great interest. This
requires understanding into the processes by which pluripotent stem
cells may transition and differentiate, first into immature and
then into mature hepatocytes. Among candidate pluripotent stem
cells of interest, human embryonic stem cells (hESC) or induced
pluripotent stem cells (iPS), which share properties of the former,
divide indefinitely and may differentiate to produce mature cells
of various tissues and organs. However, available differentiation
protocols to generate hepatocytes from hESC or iPS, etc., are
inefficient and generate cells of indeterminate developmental or
maturational stages. For instance, the convention of generating
hepatocytes from aggregation of hESC or other types of pluripotent
stem cells to form embryoid bodies is not only inefficient, but
yields complex lineage mixtures at various developmental stages or
maturity that pose difficulties in isolating cells of interest,
which may be additionally altered or damaged by cell separation
procedures (1). Directed differentiation of stem cells into
hepatocytes could overcome these problems, (2, 3), but this
accomplishment has generally been elusive.
[0005] The present invention addresses the need for directed
differentiation of stem cells into hepatocytes.
SUMMARY OF THE INVENTION
[0006] A method of producing a differentiated cell from a
pluripotent stem cell is provided, the method comprising
maintaining the pluripotent stem cell in a medium comprising
conditioned medium from immortalized fetal hepatoblasts, for a time
sufficient to produce the differentiated cell.
[0007] A composition is provided for differentiating stem cells
into a differentiated cell of interest, the composition comprising
conditioned medium obtained from a culture of hepatoblasts cultured
in a medium comprising a basal medium.
[0008] A composition is provided for differentiating stem cells
into a differentiated cell of interest, the composition comprising
components identified in conditioned medium obtained from a culture
of human fetal hepatoblasts cultured in a medium comprising a basal
medium without those components.
[0009] A method is provided for treating a liver disorder in a
subject comprising administering to the subject an amount of the
described compositions, or an amount of the described
differentiated cells, in an amount effective to treat a liver
disorder.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1A-1H. Morphology of hESC cultured with FH-CM. (A)
Undifferentiated hESC with clusters of small cells. (B) Primary
embryonic/fetal hepatocyte-like cells (eFHLC) (P0) after 14 d with
fetal hepatocyte-conditioned medium (FH-CM). Note larger cell size
and epithelial morphology. Inset, higher magnification showing
binucleation, common to hepatocytes. (C-F) eFHLC with glycogen,
G6P, glucagon and vimentin. (G-H) eFHLC subpassaged once (P1) or
twice (P2). Orig. Mag., .times.200.
[0011] FIG. 2A-2C. Characterization of differentiating eFHLC. (A)
Light and electron microscopy (LM, EM) in eFHLC and fetal human
hepatocytes showing similarities in epithelial properties (EM,
bottom; magnification bar=1 .mu.m). (B) RT-PCR for gene expression
in hESC, d14 eFHLC and freshly isolated fetal human hepatocytes.
Arrowheads indicate endodermal and mesodermal markers in eFHLC. (C)
Temporal gene expression profile by qRT-PCR in eFHLC over d0, d3
and d14. Pluripotency markers, OCT4, NANOG and SOX2 declined,
endodermal markers, SOX17, FOXA2, and mesodermal marker,
brachyrury, increased transiently, while hepatic transcription
factors, GATA4, HNF4, HNF1A, were increasingly expressed. Hepatic
genes, i.e., AFP, ALB, AAT, TTR, were coordinately expressed, along
with biliary marker, CK19, and mesenchymal markers. Cluster
analysis of global gene expression in hESC, eFHLC, freshly isolated
fetal human hepatocytes (FH-PP) or cultured fetal human hepatocytes
(FH-P3), and adult human hepatocytes (AH), showed convergence of
eFHLC most towards FH-P3.
[0012] FIG. 3A-3C. Microarray analysis of gene expression in eFHLC
versus hESC and freshly isolated fetal human hepatocytes (FH-PP).
Panels A, B show global differences in gene expression. Data were
from total gene sequences called as present, range, 48,942 to
51,031. In eFHLC, 505 or 2123 genes were uniquely upregulated
versus hESC and FH-PP, respectively, and 236 or 1514 genes were
uniquely downregulated versus hESC and FH-PP, respectively. By
contrast, 1504 genes were uniquely upregulated and 1387 genes were
uniquely downregulated in FH-PP cells versus hESC cells. This
indicated that eFHLC were closer to hESC compared with FH-PP. Table
in 3C provides the overall distribution of differentially expressed
genes and fractions representing major gene ontology groups and
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. Changes in
TGF-0 signaling and BMP signaling in eFHLC were observed compared
with FH-PP cells. The data indicated TGF-3 and BMP signaling were
more active in eFHLC. This was in agreement with similar findings
after FH-PP had been cultured.
[0013] FIG. 4A-4F. Secretory, synthetic, metabolic and
hepatoprotective functions in cultured eFHLC. (A-C) Studies with
hESC, d14 eFHLC and HepG2 hepatoma cells for albumin secretion,
urea synthesis and CYP450 activity showing gain of these functions
in eFHLC. (D) Assay of TNF-.alpha. cytotoxicity in primary mouse
hepatocytes showing eFHLC-CM protected cells. Asterisks indicate
p<0.05 versus hESC (A-C), or untreated controls (D). (E-F) Show
regulation of ataxia telangiectasia mutated (ATM) signaling in
cells. After 15 .mu.M cis-P, a known inducer of double-strand DNA
breaks, viability of ATMP-tdT Huh-7 cells, declined (C) and ATM
promoter activity increased (D), confirming DNA damage-induced ATM
signaling. When cells were treated with cis-P plus FGF1, FGF2, GCSF
and IGF1, cell viability improved and ATM promoter activity
decreased. VEGF was ineffective. Asterisks, p<0.05, versus
cis-P-treated cells.
[0014] FIG. 5A-5C. RayBiotech array analysis of 507 proteins in
eFHLC-CM. (A) Basal medium not exposed to cells. (B) eFHLC-CM
harvested after 24 h. Boxes marked by (+) and (-) in A and B
indicate positive and negative controls. Each protein was
represented twice in arrays. (C) Proteins found in eFHLC-CM are
listed.
[0015] FIG. 6A-6C. RayBiotech array analysis of proteins in FH-CM.
(A) Shows basal medium containing various additives but without
exposure to cells. (B) FH-CM harvested after 24 h. Boxes marked by
(+) and (-) in A and B indicate positive and negative array
controls. Each protein was represented twice in arrays. (C) Shows
categorization of proteins in FH-CM according to density of array
spots to indicate higher or lower levels.
[0016] FIG. 7A-7D. RayBiotech array analysis of receptor tyrosine
kinase (RTK) expression in undifferentiated hESC. (A) Untreated
control hESC with basal phosphorylation of several receptor
tyrosine kinases (RTKs). (B and C) hESC stimulated for 1 h (B) or 6
h (C) with FH-CM before analysis of phosphorylated RTKs. Data
showed no differences from untreated controls in (A). Each protein
was spotted twice. Boxes marked by (+) and (-) in A-C indicate
positive and negative array controls. (D) List of phosphorylated
RTKs in hESC irrespective of basal or FH-CM-stimulated
conditions.
[0017] FIG. 8A-8B. Differentiation of hESC over 3 d with FH-CM
altered by protracted heating to degrade proteins or passage
through Amicon membrane of 3 Kd cut-off size. (A) hESC after
culture with heat denatured FH-CM showing switch to epithelial
morphology. (B) hESC cultured with FH-CM passed through Amicon
membrane showing epithelial morphology. Orig. Mag., .times.100.
[0018] FIG. 9A-9F. Hepatic differentiation of hESC with group of 7
CP. Panels on left show undifferentiated hESC, panels in middle
show hESC cultured with FH-CM and panels on right show hESC
cultured with combination of 7 CP, which were most effective for
this purpose. (A) Phase contrast microscopy showing
undifferentiated hESC with small size of cells (left), whereas hESC
cultured with FH-CM (middle) or 10 .mu.m amounts of 7 CP showed
larger size and epithelial morphology (on right). (B-D)
Immunofluorescence staining of hESC under conditions indicated for
OCT4, albumin and vimentin. This showed loss of OCT4 and gain of
albumin and vimentin expression after differentiation (red color).
Nuclei were stained blue with DAPI. (E & F) eFHLC derived from
hESC by either FH-CM or CP showed urea synthesis (E) as well as
cytochrome P450 activity with conversion of ethoxyresorufin to
resorufin (E). Human HepG2 cells were included for comparisons in E
& F.
[0019] FIG. 10A-10D. Hepatic differentiation of iPSC with group of
7 CP. Panels on left show undifferentiated iPSC, panels in middle
show iPSC cultured with FH-CM and panels on right show iPSC
cultured with combination of 7 CP, which were most effective. (A)
Phase contrast microscopy showing undifferentiated iPSC with small
size of cells (left), whereas iPSC cultured with FH-CM (middle) or
10 .mu.m amounts of 7 CP showed larger size and epithelial
morphology (on right). (B-D) Immunofluorescence staining of iPSC
under conditions indicated for OCT4, albumin and vimentin. This
showed loss of OCT4 and gain of albumin and vimentin expression
after differentiation (red color). Nuclei were stained blue with
DAPI. (E & F) eFHLC derived from iPSC by either FH-CM or CP
showed urea synthesis (E) as well as cytochrome P450 activity with
conversion of ethoxyresorufin to resorufin (E). Human HepG2 cells
were included for comparisons in E & F.
DETAILED DESCRIPTION OF THE INVENTION
[0020] A method of producing a differentiated cell from a
pluripotent stem cell is provided, the method comprising
maintaining the pluripotent stem cell in a medium comprising
isolated conditioned medium from hepatoblasts, for a time
sufficient to produce the differentiated cell.
[0021] A method of producing a differentiated cell from a
pluripotent stem cell is provided, the method comprising
maintaining the pluripotent stem cell in a medium comprising
isolated conditioned medium from fetal hepatoblasts, for a time
sufficient to produce the differentiated cell.
[0022] Also provided is a method of producing a differentiated cell
from a pluripotent stem cell, the method comprising maintaining the
pluripotent stem cell in a medium comprising conditioned medium
from hepatoblasts, or a medium comprising two or more of
phenacetin, phytosphingosine HCl, and pyridoxal HCl, for a time
sufficient to produce the differentiated cell. In a preferred
embodiment, the method comprises maintaining the pluripotent stem
cell in a medium comprising two or more of phenacetin,
phytosphingosine HCl, and pyridoxal HCl.
[0023] In an embodiment of the methods, the differentiated cell is
a hepatocyte. In an embodiment, the differentiated cell exhibits a
meso-endodermal phenotype of a fetal human hepatocyte. In an
embodiment, the differentiated cell exhibits ureagenesis and/or
albumin synthesis and/or vimentin expression. In an embodiment, the
pluripotent stem cell is an inducible pluripotent stem cell or is
an embryonic stem cell.
[0024] In an embodiment of the methods, the hepatoblasts are
immortalized. In an embodiment, the hepatoblasts have been
immortalized by contact with a telomerase. In an embodiment, the
hepatoblasts have been immortalized by expression of telomerase, or
maintenance of telomerase expression. In an embodiment,
hepatoblasts are human. In an embodiment, hepatoblasts are fetal.
In an embodiment, hepatoblasts are immortalized human fetal
hepatoblasts. In an embodiment, hepatoblasts are isolated. In an
embodiment, the medium does not comprise serum. In an embodiment,
the conditioned medium from immortalized human fetal hepatoblasts
comprises medium obtained from a culture of immortalized human
fetal hepatoblasts cultured in a medium comprising a basal medium.
In an embodiment, the immortalized fetal hepatoblasts are human
immortalized fetal hepatoblasts. In an embodiment, the hepatoblasts
are mammalian, but are not human. In an embodiment, the
hepatoblasts are human, but are not fetal. In an embodiment, the
medium comprising a basal medium further comprises L-glutamine, one
or more non-essential amino acids, and an antibiotic. In an
embodiment, the basal medium is a Dulbecco's Modified Eagle's
Medium (DMEM). In an embodiment, the antibiotic is
penicillin-streptomycin. In an embodiment, the non-essential amino
acids are glycine, L-alanine, L-asparagine, L-aspartic acid,
L-glutamic acid, L-proline and L-serine. In an embodiment, the
medium comprising a basal medium further comprises an artificial
serum replacement.
[0025] A conditioned medium, with regard a culture, is a medium in
which the cell culture has been maintained. In an embodiment, the
conditioned medium has been exposed to the cells being cultured for
1 or more hours, 2 or more hours, 6 or more hours, 12 or more
hours, 24 or more hours, one week or more or two weeks or more.
[0026] In an embodiment of the methods, the medium further
comprises one or more of L-cysteinglutathione disulfide,
.gamma.-Glu-Cys, DL-kynurenine, D-penicillamine disulfide, and
tetracaine HCl. In an embodiment, the medium does not comprise
tetracaine HCl. In an embodiment, the medium comprises
L-cysteinglutathione disulfide, .gamma.-Glu-Cys, DL-kynurenine,
D-penicillamine disulfide, phenacetin, phytosphingosine HCl, and
pyridoxal HCl.
[0027] In an embodiment of the methods, the medium comprises
retinoic acid and/or dexamethasone. In an embodiment, the medium
comprises L-glutamine. In an embodiment, the medium comprises a
selenium compound. In an embodiment, the medium comprises sodium
selenite. In an embodiment, the medium comprising a selenium
compound also comprises one or more of an albumin, transferrin,
insulin, progesterone, putrescine, biotin, 1-carnitine,
corticosterone, ethanolamine, d(+)-galactose, glutathione
(reduced), linolenic acid, linoleic acid, retinyl acetate,
selenium, T3 (triodo-1-thyronine), dl-.alpha.-tocopherol,
dl-.alpha.-tocopherol acetate, catalase, and superoxide dismutase.
In an embodiment, proteins and enzymes of the medium are isolated
from human or are recombinant with a human sequence.
[0028] A composition is provided for differentiating stem cells
into a differentiated cell of interest, the composition comprising
isolated conditioned medium obtained from a culture of hepatoblasts
cultured in a medium comprising a basal medium. Basal media are
widely-known in the art, and as used herein are understood to
encompass cell-growth media (for example, un-supplemented) used for
culturing mammalian cells.
[0029] A composition is provided comprising isolated conditioned
medium obtained from a culture of hepatoblasts cultured in a medium
comprising a basal medium, or a basal medium further comprising two
or more of phenacetin, phytosphingosine HCl, and pyridoxal HCl.
[0030] A composition is provided for differentiating stem cells
into a differentiated cell of interest, the composition comprising
conditioned medium obtained from a culture of hepatoblasts cultured
in a medium comprising a basal medium, or a basal medium further
comprising two or more of phenacetin, phytosphingosine HCl, and
pyridoxal HCl. In an embodiment, (i) the medium comprising a basal
medium from which the conditioned medium is obtained, or (ii) the
basal medium further comprising two or more of phenacetin,
phytosphingosine HCl, and pyridoxal HCl, also further comprises
L-glutamine, non essential amino acids, and an antibiotic.
[0031] In an embodiment of the compositions, the medium comprising
a basal medium further comprises L-glutamine, non essential amino
acids, and an antibiotic. In an embodiment, the basal medium is a
DMEM. In an embodiment, the antibiotic is penicillin-streptomycin.
In an embodiment, the non-essential amino acids are glycine,
L-alanine, L-asparagine, L-aspartic acid, L-glutamic acid,
L-proline and L-serine. In an embodiment, the medium comprising a
basal medium further comprises an artificial serum replacement.
[0032] In an embodiment of the compositions, the medium further
comprises one or more of L-cysteinglutathione disulfide,
.gamma.-Glu-Cys, DL-kynurenine, D-penicillamine disulfide, and
tetracaine HCl. In an embodiment, the medium does not comprise
tetracaine HCl. In an embodiment, the medium comprises
L-cysteinglutathione disulfide, .gamma.-Glu-Cys, DL-kynurenine,
D-penicillamine disulfide, phenacetin, phytosphingosine HCl, and
pyridoxal HCl. In an embodiment, the aforelisted components are,
independently, present at a concentration of 10 .mu.M or less, of
7.5 .mu.M or less, 5 .mu.M or less, of 2.5 .mu.M or less, or 1
.mu.M or less. In an embodiment, the aforelisted components are,
independently, present at a concentration of greater than 0.01
.mu.M.
[0033] In an embodiment of the compositions, the medium comprises
retinoic acid and/or dexamethasone. In an embodiment, the medium
comprises L-glutamine. In an embodiment, the medium comprises a
selenium compound. In an embodiment, the medium comprises sodium
selenite. In an embodiment, the medium comprising a selenium
compound also comprises one or more of an albumin, transferrin,
insulin, progesterone, putrescine, biotin, 1-carnitine,
corticosterone, ethanolamine, d(+)-galactose, glutathione
(reduced), linolenic acid, linoleic acid, retinyl acetate,
selenium, T3 (triodo-1-thyronine), dl-.alpha.-tocopherol,
dl-.alpha.-tocopherol acetate, catalase, and superoxide dismutase.
In an embodiment, proteins and enzymes of the medium are isolated
from human or are recombinant with a human sequence.
[0034] In an embodiment of the compositions, the hepatoblasts are
immortalized. In an embodiment, the hepatoblasts are human
hepatoblasts. In an embodiment, the hepatoblasts are fetal
hepatoblasts. In an embodiment, the hepatoblasts are immortalized
human fetal hepatoblasts. In an embodiment, the hepatoblasts are
mammalian, but are not human. In an embodiment, the hepatoblasts
are human, but are not fetal.
[0035] In the various media described herein and in the various
compositions comprising media, the specified components are present
in amounts consistent with the health and/or growth of the cells in
the medium.
[0036] A hepatocyte is an epithelial parenchymatous cell of the
liver. In an embodiment, the hepatocyte is capable of secreting
bile. In an embodiment, the hepatocyte is polygonal. Induced
pluripotent stem cells are adult cells, typically somatic cells,
that have been genetically reprogrammed to an embryonic stem
cell-like state by being caused to express genes and factors
important for maintaining the defining properties of embryonic stem
cells. In an embodiment, the induced pluripotent stem cells are
mammalian. In an embodiment, the adult cell from which the induced
pluripotent stem cell is induced is a human adult cell. Embryonic
stem cells are pluripotent stem cells derived from the inner cell
mass of the blastocyst. In an embodiment, the embryonic stem cells
are mammalian. In a further embodiment, the embryonic stem cells
are non-human. In an embodiment, the embryonic stem cells are
human. Basal media are serum-free media widely available in the
art.
[0037] A method is provided for treating a liver disorder in a
subject comprising administering to the subject an amount of the
described compositions, or an amount of the described
differentiated cells obtained by any of the methods described
hereinabove, in an amount effective to treat a liver disorder.
[0038] A liver disorder is a disorder or pathology of the mammalian
liver which impairs the proper functioning of the liver as compared
to a healthy liver. Such disorders are widely known in the art.
[0039] "And/or" as used herein, for example, with option A and/or
option B, encompasses the separate embodiments of (i) option A,
(ii) option B, and (iii) option A plus option B.
[0040] All combinations of the various elements described herein
are within the scope of the invention unless otherwise indicated
herein or otherwise clearly contradicted by context.
[0041] This invention will be better understood from the
Experimental Details, which follow. However, one skilled in the art
will readily appreciate that the specific methods and results
discussed are merely illustrative of the invention as described
more fully in the claims that follow thereafter.
[0042] Here, the principle is established that soluble signals from
fetal liver cells undergoing hepatic development and with stem or
progenitor cell properties can drive differentiation in pluripotent
stem cells to generate hepatocytes in the meso-endodermal stage of
fetal liver development. These pluripotent stem cell-derived
hepatocytes expressed repertoires of hepatobiliary and mesenchymal
genes, distinct microRNA profiles, as well as synthetic and
metabolic hepatic functions, e.g., albumin secretion, urea
production, and xenobiotic disposal, which recapitulated properties
of fetal hepatocytes. Therefore, these hESC-derived cells were
designated "embryonic/fetal hepatocyte-like cells" (eFHLC). It was
found that hepatic functions were expressed at sufficient levels in
eFHLC to sustain mice with fatal drug-induced acute liver failure
(ALF) (11). In this setting, transplanted eFHLC provided liver
support to prolong life. Moreover, eFHLC released paracrine factors
that were capable of protecting hepatocytes in vitro and this
mechanism promoted liver regeneration in vivo to complete rescue of
mice with drug-induced ALF. Therefore, this method to manipulate
pluripotent stem cells to generate hepatocytes in defined
developmental stage and with appropriate hepatic potency offers
opportunities for a variety of cell type-specific basic, clinical
and other applications.
EXPERIMENTAL RESULTS
Example 1
[0043] Differentiation of pluripotent hESC generated hepatocytes:
First, it was determined in what ways would soluble signals from
immature fetal hepatocytes (FH) direct differentiation of hESC. To
avoid donor-to-donor variability, FH immortalized by telomerase
were used, with stem/progenitor cell properties, as well as
meso-endodermal phenotype of primary FH (12-13). Conditioned medium
(CM) was harvested from FH over 24 h and excluded serum. Feeder
cells or animal additives were not included. A multi-step protocol
was developed that included culture of hESC in FH-CM alone for
first 3 d followed over the next 3 d by culture of hESC with FH-CM
plus three known soluble factors and then further culture of hESC
for a total of 14 d with FH-CM plus another known soluble factor.
None of the soluble factors added to FH-CM was essential for
initiating hepatic differentiation in hESC. However, in the
presence of these known soluble factors, hESC adhered better in
plastic culture dishes.
[0044] During differentiation, hESC in primary culture (P0) gained
epithelial morphology within 3 d (FIG. 1A-B). The eFHLC expressed
liver/pancreas foregut endoderm markers, i.e., glycogen,
glucose-6-phosphatase (G6P), glucagon, and others, and the
mesenchymal marker, vimentin (VIM) (FIG. 1C-F). Over 14d,
0.50.+-.0.07.times.10.sup.6 hESC originated
1.94.+-.0.05.times.10.sup.6 eFHLC, which constituted a 4-fold gain
in cell numbers. Moreover, population doublings of eFHLC during P1
and P2 cultures (FIG. 1G-1H), produced >20-fold gains in their
cell numbers, which indicated the ability of differentiating cells
to continue proliferating, and was consistent with highly efficient
generation of differentiated cells from pluripotent stem cells.
[0045] eFHLC were characterized by morphology, gene expression and
functional assays. eFHLC acquired more cytoplasm, larger nuclei,
even binucleated cells, similar to hepatocytes (FIG. 2A).
Cytoplasmic complexity with lysosomes, microperoxisomes and
vacuoles, resembled that in hepatocytes. Reverse
transcription-polymerase chain reactions (RT-PCR) showed hepatic
markers, i.e., .alpha.-fetoprotein (AFP), albumin (ALB), G6P,
.alpha.-1-antitrypsin (AAT), cytokeratin (CK)-18, metabolic
enzymes, e.g., CYP-1B1, -3A4, -2E1, and -1A1, and also mesenchymal
markers, i.e., VIM, .alpha.-smooth muscle actin (aSMA) (FIG. 2B),
confirming conjoint meso-endodermal phenotype of natural fetal
hepatocytes (6,7). Temporal differentiation profile by quantitative
RT-PCR was informative, as within 3d, pluripotency-associated
genes, i.e., OCT4, NANOG and SOX2, were expressed less, and
endoderm-associated genes, i.e., SOX17, FOXA2, and early
mesoderm-associated gene, brachyury, were expressed more (FIG. 2C,
Table 2). By 14 d of epithelial advancement, E-cadherin (ECAD), a
marker of epithelial cells, was well-expressed, which was
paralleled by the appearance after 3 d and increase after 14 d of
hepatic transcription factors, GATA4, HNF1a and HNF4a. Hepatic gene
expression changed correspondingly, since AFP appeared after 3d,
and ALB, AAT or TTR increased between 3 d and 14d. Similarly,
expression of CYP3A4 and CYP7A1, which characterize mature
hepatocytes, increased during this period. Nonetheless, VIM and
CK19 expression after 14 d assigned eFHLC to the fetal hepatic
stage. Global gene expression profiling by Affymetrix microarrays
in hESC, eFHLC, primary or cultured fetal hepatocytes, and adult
hepatocytes, substantiated this possibility, since eFHLC diverged
from undifferentiated hESC and converged more along fetal than
adult hepatocytes (FIG. 2D). In eFHLC, gene expression ontology and
regulation of cytokine signaling trended toward fetal hepatocytes
(FIG. 3). Global microRNA (miRNA) profiling showed several
similarities between eFHLC and fetal hepatocytes when array
analysis of cellular miRNA in eFHLC versus hESC and freshly
isolated fetal human hepatocytes (FH-PP) was performed.
TABLE-US-00001 TABLE 2 qRT-PCR analysis of gene expression - Gene
expression was normalized with .beta.-actin and represents
fold-change versus undifferentiated hESC on d 0 of differentiation
protocol: Undiffer- entiated eFHLC Gene analyzed H1-hESC d 0 3 d 14
d Pluripotency markers OCT4 1.0 0.1 0 NANOG 1.0 0.1 0 SOX2 1.0 0.1
0 Endodermal markers BRACHYURY 1.0 10 0.6 SOX17 1.0 56 1.0 FOXA2
1.0 27 0.2 Epithelial marker CDH1 1.0 1.5 2.6 Mesenchymal marker
VIM 1.0 1 11 Hepatic transcriptional factors GATA4 1.0 155 488
HNF4A 1.0 165 653 HNF1A 1.0 58 136 Hepatic markers AFP 1.0 2 0.4
ALB 1.0 7 21 AAT 1.0 18 82 TAT 1.0 20 25 TTR 1.0 37 273 TDO2 1.0 20
29 ASGPR1 1.0 1 1.6 APOF 1.0 7 9 CYP3A4 1.0 67 66 CYP7A1 1.0 12 14
G6P 1.0 40 68 Biliary marker CK19 1.0 8 17
[0046] Protein studies verified mRNA findings in eFHLC as stem cell
markers declined (OCT4, NANOG, TRA-1-80) and hepatic (FOXA2, ALB,
G6P and glycogen) and biliary (GGT) properties increased. In d14
eFHLC, OCT4 was lost with gain of ECAD, VIM, FOXA2, and ALB
expression. eFHLC contained hepatobiliary markers, glycogen, G6P
and GGT. Similarly, epithelial (ECAD) and mesenchymal (VIM) markers
were coexpressed. High level expression of asialoglycoprotein
receptor (ASGPR1), which is specific to adult hepatocytes,
indicated many eFHLC were maturing along the hepatic lineage. Flow
cytometry showed 27% eFHLC expressed ASGPR1, marking mature
hepatocytes.
[0047] eFHLC expressed hepatic synthetic, metabolic and xenobiotic
disposal functions in vitro: After 14 d of differentiation, eFHLC
secreted albumin, synthesized urea and converted a xenobiotic,
ethoxyresorufin, to resorufin (FIG. 4A-4C). Such functions are
important for hepatic support in liver failure (7, 11). Similarly,
paracrine factors may protect hepatocytes from injury (14). This
was confirmed since CM from eFHLC protected mouse hepatocytes from
tumor necrosis factor (TNF)-.alpha. toxicity (FIG. 4D). Recently,
it was established that drug-induced ALF in mice involved
impairment in ataxia telangiectasia mutated (ATM) signaling (11),
which is regulated by paracrine signals. Therefore, to demonstrate
whether soluble factors could restore ATM signaling,
lentivirally-modified Huh-7 cells were prepared (from human
hepatocellular carcinoma) to express the tdTomato reporter gene
under control of cloned human ATM promoter (15). When these
hATMP-tdT cells were cultured with cis-platinum (Cis-P), DNA strand
breaks were induced, cell viability declined and ATM promoter
activity increased (FIG. 4E, 4F). It was found that culture of
hATMP-tdT cells with Cis-P, plus FGF1, FGF2, G-CSF and IGF1 but not
VEGF, improved cell viability and lowered ATM promoter activity.
These factors had been identified to be present in eFHLC-CM (FIG.
5), which indicated that eFHLC were capable of affecting
intracellular signaling through paracrine mechanisms.
[0048] eFHLC rescued mice with drug-induced ALF: Identification of
hepatic functions and potential for paracrine signaling suggested
eFHLC could support recovery of the damaged liver. This was
facilitated by a NOD/SCID mouse model of ALF (11), where rifampicin
(Rif), phenytoin (Phen) and monocrotaline (MCT) caused
dysregulation of Atm signaling, leading to severe oxidative stress,
DNA damage, hepatic necrosis, liver test abnormalities,
coagulopathy, encephalopathy, and 90-100% mortality.
Intraperitoneal transplantation of mature hepatocytes with
microcarrier scaffolds rescued mice with ALF. Of note, transplanted
hepatocytes remained in peritoneal cavity without migrating to the
liver. Moreover, reseeding of the liver with cells was unnecessary.
ALF was induced with Rif-Phen-MCT in mice (n=20), followed by
4-6.times.10.sup.6 eFHLC (n=10) or vehicle (n=10) i.p. In the FHLC
group, 5 mice survived (50%) versus only 1 mouse in the vehicle
group (10%), p<0.001. In eFHLC-treated mice, encephalopathy was
absent or less severe, whereas sham-treated mice developed severe
encephalopathy (grade 3-4), p<0.05. Liver tests improved in the
eFHLC group versus the vehicle group. After 7d, serum alanine
aminotransferase (ALT) was 77.+-.82 versus 4800.+-.500 u/l and
total bilirubin 0.5.+-.0.2 versus 2.5.+-.0.5 mg/dl, p<0.05.
Normal blood glucose and serum creatinine levels in all mice
excluded hypoglycemia or renal failure as coincidental causes of
death. Human cells were identified in cell-microcarrier
conglomerates recovered from peritoneal cavity. Histological
sections of microcarrier (mc) and cell-conglomerates recovered from
mice 7 d after eFHLC transplantation showed vascular reorganization
(H&E staining), glycogen in transplanted cells, and
confirmation of human transplanted cells by in situ hybridization
for primate-specific centromere sequences. Transplanted eFHLC were
absent from the native liver, as was expected. Livers of
vehicle-treated mice were edematous, hemorrhagic and necrotic with
extensive expression of phosphorylated histone H2AX, confirming
oxidative DNA damage, and only interspersed Ki-67+ cells,
indicating limited liver regeneration. In eFHLC-treated mice, liver
necrosis and H2AX expression decreased, while the prevalence of
Ki-67+ cells increased. Histological grading showed 5.4-fold less
liver injury in eFHLC-treated mice after 7d, 0.7.+-.0.3 versus
3.8.+-.0.4, p<0.05. The prevalence of Ki-67+ cells at that time
was 2.3-fold greater in eFHLC-treated mice, 91.+-.5 versus 39.+-.4
cells/HPF, p<0.05. Analysis of hepatic gene expression indicated
extensive perturbations in animals with ALF (Table 3). In
eFHLC-treated mice, expression of genes in oxidative/metabolic
stress, inflammatory cytokines, chemokines or other mediators, and
of Atm and cell cycle regulators, i.e., Ccnc, Ccnd1 or Egr1,
improved.
[0049] After i.p. or subcutaneous transplantation, eFHLC did not
proliferate, and no tumors were observed in NOD/SCID mice over 3
months. Undifferentiated hESC generated teratomas as expected (not
shown) (5-7).
TABLE-US-00002 TABLE 3 Liver mRNA expression by qRT-PCR (fold
NOD/SCID mice versus mice in ALF with sham-treatment or of eFHLC
transplantation - Data were first normalized against housekeeping
.beta.-actin gene in individual samples. Each condition was
analyzed with samples in triplicate Gene Sham- Sham- eFHLC- eFHLC-
Gene description Symbol 3 d 7 d 3 d 7 d Oxidative or Metabolic
Stress Crystallite, alpha B Cryab -1.2 1.6 1.1 -1.1 Cytochrome
P450, family 1, subfamily a, polypeptide 1 Cyp1a1 -3.7 -4.9 -5.8
-4.7 Cytochrome P450, family 1, subfamily b, polypeptide 1 Cyp1b1
-3.4 1.5 -2.6 -1.3 Cytochrome P450, family 2, subfamily a,
polypeptide 5 Cyp2a5 -6.7 -5.1 -1.1 -1.9 Cytochrome P450, family 2,
subfamily b, polypeptide 10 Cyp2b10 -1.2 1.1 -1.7 -1.8 Cytochrome
P450, family 2, subfamily b, polypeptide 9 Cyp2b9 -7.3 -7.2 -7.3
-2.1 Cytochrome P450, family 2, subfamily c, polypeptide 29 Cyp2c29
-46.3 -106.9 -1.4 -1.4 Cytochrome P450, family 3, subfamily a,
polypeptide 11 Cyp3a11 -13.8 -27.7 -9.1 -4.8 Cytochrome P450,
family 4, subfamily a, polypeptide 10 Cyp4a10 1.6 -5.9 -13.9 -11.0
Cytochrome P450, family 4, subfamily a, polypeptide 14 Cyp4a14 7.8
-2.0 -7.8 -18.8 Cytochrome P450, family 7, subfamily a, polypeptide
1 Cyp7a1 -32.9 -100.2 -64.1 -11.7 Epoxide hydrolase 2, cytoplasmic
Ephx2 -4.1 -10.4 -2.6 -2.0 Flavin containing monooxygenase 1 Fmo1
-15.6 -2.3 -1.9 -1.3 Flavin containing monooxygenase 4 Fmo4 -1.2
-2.0 -2.1 -2.2 Flavin containing monooxygenase 5 Fmo5 1.7 -1.3 1.0
-1.6 Glutathione peroxidase 1 Gpx1 -3.2 -3.1 -3.0 -2.1 Glutathione
peroxidase 2 Gpx2 -1.6 -1.1 -1.7 1.0 Glutathione reductase Gsr -1.4
-1.4 -2.1 -2.0 Glutathione S-transferase, mu 1 Gstm1 -3.8 -10.6
-5.8 -2.5 Glutathione S-transferase, mu 3 Gstm3 -3.9 -5.8 -1.1 1.8
Heme oxygenase (decycling) 1 Hmox1 1.1 3.5 2.2 -1.1 Heme oxygenase
(decycling) 2 Hmox2 -1.2 -1.6 -2.4 -3.0 Metallothionein 2 Mt2 5.7
7.8 17.8 -2.1 Polymerase (RNA) II (DNA directed) polypeptide K
Polr2k -1.5 -1.2 -2.7 -2.3 P450 (cytochrome) oxidoreductase Por
-1.7 -5.9 -2.5 -4.4 Superoxide dismutase 1, soluble Sod1 -2.7 -3.6
-7.5 -6.0 Superoxide dismutase 2, mitochondrial Sod2 -4.4 -5.4 1.3
-1.1 Heat Shock DnaJ (Hsp40) homolog, subfamily A, member 1 Dnaja1
-1.9 -2.8 -3.9 -3.4 Heat shock factor 1 Hsf1 -1.4 -1.7 -1.8 -1.7
Heat shock protein 1B Hspa1b -1.9 -1.1 -1.5 -2.0 Heat shock protein
1-like Hspa1l -2.8 -4.0 -7.4 -3.7 Heat shock protein 4 Hspa4 -1.5
-3.3 -1.7 1.0 Heat shock protein 5 Hspa5 1.9 1.5 -1.1 -1.4 Heat
shock protein 8 Hspa8 -1.0 -1.2 -1.4 -1.4 Heat shock protein 1
Hspb1 -1.2 1.8 -1.7 -2.0 Heat shock protein 1 (chaperonin) Hspd1
-1.6 -2.4 -1.7 -1.7 Heat shock protein 1 (chaperonin 10) Hspe1 -1.7
-1.7 -2.4 -2.3 Proliferation and Carcinogenesis Colony stimulating
factor 2 (granulocyte-macrophage) Csf2 -1.2 2.6 -1.4 1.1 Cyclin C
Ccnc -1.7 -1.7 3.6 4.2 Cyclin D1 Ccnd1 -1.1 1.8 6.7 12.9 Cyclin G1
Ccng1 1.4 2.4 1.2 1.9 E2F transcription factor 1 E2f1 -1.0 2.2 1.4
2.2 Early growth response 1 Egr1 4.2 15.3 30.6 9.7 Proliferating
cell nuclear antigen Pcna -1.3 1.4 -1.0 -1.0 Growth Arrest and
Senescence Cyclin-dependent kinase inhibitor 1A (P21) Cdkn1a 105.0
92.0 141.4 116.5 DNA-damage inducible transcript 3 Ddit3 1.2 3.9
2.1 1.1 Growth arrest and DNA-damage-inducible 45 alpha Gadd45a
-3.1 1.6 -2.1 -5.7 Insulin-like growth factor binding protein 6
Igfbg6 -10.2 -3.5 -101.8 -110.4 Transformed mouse 3T3 cell double
minute 2 Mdm2 -1.0 1.8 5.4 4.7 Transformation related protein 53
Trp53 -1.3 1.3 -1.1 -1.1 Inflammation Chemokine (C-C motif) ligand
21b Ccl21b -5.0 -16.6 -16.1 -16.6 Chemokine (C-C motif) ligand 3
Ccl3 5.4 30.7 6.3 4.4 Chemokine (C-C motif) ligand 4 Ccl4 3.4 21.5
8.1 3.7 Chemokine (C-X-C motif) ligand 10 Cxcl10 2.4 10.8 4.5 1.1
Interleukin 18 Il18 -3.0 -2.1 -3.6 -2.9 Interleukin 1 alpha Il1a
-2.9 1.0 -1.3 -1.2 Interleukin 1 beta Il1b 1.2 3.5 1.6 1.4
Interleukin 6 Il6 1.9 7.3 6.0 1.8 Lymphotoxin A Lta -1.2 1.1 --
-1.8 Macrophage migration inhibitory factor Mif -1.5 -1.3 1.9 1.3
Nuclear factor of kappa light polypeptide gene enhancer Nfkb1 -1.3
1.5 -1.3 -1.5 in B-cells 1, p105 Nitric oxide synthase 2, inducible
Nos2 6.5 24.4 26.5 1.8 Serine (or cysteine) peptidase inhibitor,
clade E, member 1 Serpine1 50.8 57.3 286.0 7.4 DNA Damage and
Repair Ataxia telangiectasia mutated homolog (human) Atm -1.7 -2.4
-1.3 1.1 CHK2 checkpoint homolog (S. pombe) Chek2 -1.1 1.6 -1.2
-1.1 Excision repair cross-complementing rodent repair deficiency,
Ercc1 1.1 2.1 1.2 -1.1 complementation group 1 Excision repair
cross-complementing rodent repair deficiency, Ercc4 -1.5 -2.0 -2.4
-2.1 complementation group 4 RAD23a homolog (S. cerevisiae) Rad23a
-2.0 -2.7 -3.0 -2.8 RAD50 homolog (S. cerevisiae) Rad50 -1.8 -1.5
1.3 1.3 UDP glucuronosyltransferase 1 family, polypeptide A2 Ugt1a2
-2.8 -3.1 -3.2 -2.5 Uracil DNA glycosylase Ung -1.7 -1.4 1.9 -1.4
X-ray repair complementing defective repair in Chinese Xrcc1 -1.3
-1.4 -2.8 -2.4 hamster cells 1 X-ray repair complementing defective
repair in Chinese Xrcc2 1.4 1.1 1.7 1.4 hamster cells 2 X-ray
repair complementing defective repair in Chinese Xrcc4 -1.1 -1.0
-1.4 -1.6 hamster cells 4 Apoptosis Signaling Annexin A5 Anxa5 2.9
5.0 4.4 2.4 Bcl2-associated X protein Bax 1.5 2.3 1.2 1.2 Bcl2-like
1 Bcl2l1 1.7 2.6 3.9 1.9 Caspase 1 Casp1 -2.4 1.7 -1.5 -1.2 Caspase
8 Casp8 -4.3 -1.1 -1.1 1.1 Fas ligand (TNF superfamily, member 6)
Fasl -1.2 1.2 -1.7 -1.8 Nuclear factor of kappa light polypeptide
gene enhancer Nfkbia -1.3 1.7 -1.1 -1.4 in B-cells inhibitor, alpha
Tumor necrosis factor receptor superfamily, member 1a Tnfrsf1a 1.1
1.5 1.7 1.1 Tumor necrosis factor (ligand) superfamily, member 10
Tnfsf10 -4.3 -3.4 -6.3 -4.9 TNFRSF1A-associated via death domain
Tradd -1.6 -1.3 -2.3 -1.9
[0050] Mechanisms in hepatic differentiation of hESC: To understand
how FH-CM caused hepatic differentiation in hESC, cytokines and
growth factors were examined, and 62 of 507 such proteins were
found to be present in FH-CM (FIG. 6), including regulators of cell
differentiation, e.g., activinA, FGFs, or transforming growth
factors (TGF) (12, 13). As signal transduction through these
molecules should have engaged receptors on cell surface followed by
phosphorylation of receptor tyrosine kinases (RTKs), 71 RTKs were
examined in hESC stimulated with FH-CM for 10 min, 1 h or 6 h.
Surprisingly, RTKs were not activated, including receptors of 12
ligands present in FH-CM (FIG. 7). To determine whether proteins in
FH-CM were dispensable for hESC differentiation, FH-CM was degraded
by heating to 100.degree. C., and passed FH-CM through Amicon
membranes to remove >3 kilodalton size proteins.
Protein-depleted FH-CM still induced epithelial differentiation in
hESC, including changes in morphology and gene expression,
including in expression of pluripotency (Nanog, Sox-2), epithelial
(AFP), or mesenchymal (VIM) genes within 3 d (FIG. 8). It was
concluded that nonprotein molecules in FH-CM were involved. These
molecules were stable since FH-CM generated eFHLC despite storage
of FH-CM for 6 weeks at 4.degree. C. To characterize the nature of
nonprotein components in FH-CM, the Purdue University Metabolite
Profiling Facility performed LC-MS metabolomics analysis, which
identified 810 compounds with good separations in blank medium and
FH-CM. Of these 810 compounds, 105 compounds were >3-fold
abundant in FH-CM versus blank medium, p<0.03 (Table 4).
[0051] Genes expressed under differentiation conditions were
analyzed by qRT-PCR with customized array from SA Biosciences.
Expression of individual genes was normalized against housekeeping
gene, .beta.-actin. The data indicated culture of hESC with
protein-depleted FH-CM was effective in initiating differentiation
along meso-endodermal hepatic stage. Most notable were decreases in
expression of Nanog and Sox2 and increases in expression of AFP and
VIM.
TABLE-US-00003 TABLE 1 Changes in gene expression. (C) Genes
expressed under differentiation conditions. Gene expression was
analyzed by qRT-PCR with customized array from SA Biosciences.
Undiffer- FH-CM-treated eFHLC x 3 d entiated Heat- 3 kd Amicon Gene
analyzed H1-hESC denatured cut-off Pluripotency genes OCT4 1.0 1.3
1.3 NANOG 1.0 0.3 0.1 SOX2 1.0 0.7 0.3 Endoderm markers BRACHYURY
1.0 0.5 1.9 SOX17 1.0 0.7 1.0 FOXA2 1.0 0.3 1.2 Epithelial marker
CDH1 1.0 0.7 0.9 Mesenchymal marker VIM 1.0 6.2 4.6 Hepatic
transcription factors GATA4 1.0 0.5 1.5 HNF4A 1.0 1.0 2.0 HNF1A 1.0
0.4 1.4 Hepatic markers AFP 1.0 1.3 2.5 ALB 1.0 0.7 2.0 AAT 1.0 0.5
1.8 TAT 1.0 0.6 1.9 TTR 1.0 0.5 1.7 TDO2 1.0 0.6 1.7 ASGPR1 1.0 0.9
1.5 APOF 1.0 0.5 1.9 CYP3A4 1.0 0.6 1.4 CYP7A1 1.0 0.7 3.3 G6P 1.0
0.5 2.0 Biliary marker CK19 1.0 0.7 0.6
TABLE-US-00004 TABLE 4 Listing of compounds identified by LC-MS
metabolomics analysis in FH-CM Compound, Retention Corrected
Compound Exact Mass Time (min) p-value Identification 281.1072 1.93
1.37E-09 281.1072 448.0098 2.00 1.22E-09 448.0098 426.0855 2.02
2.94E-10 Cysteineglutathione disulfide 197.0828 2.15 3.49E-12
N-benzylideneaniline n-oxide 374.1351 2.17 6.77E-13 374.1351
380.1687 2.25 5.35E-09 Asn Thr Phe 211.0454 2.25 1.13E-09 211.0454
156.0031 2.50 2.26E-11 C6 H7 N P S 128.0112 2.51 1.08E-13 128.0112
268.0192 2.53 3.57E-13 268.0192 161.0683 2.54 1.55E-05
2-Aminoadipic acid 226.9919 2.64 1.92E-10 226.9919 1092.4396 2.65
1.06E-10 1092.4396 339.0923 2.66 1.17E-12 Cys Ser Met 380.1361 2.67
7.25E-04 C15 H29 N2 O3 P S2 408.1783 2.67 2.01E-05 Tryptophan
373.1532 2.71 2.22E-12 C15 H20 N9 O P 135.0547 2.71 1.44E-14
Adenine 301.1136 2.84 7.53E-10 C9 H15 N7 O5 210.9971 2.85 3.14E-09
210.9971 380.1367 2.90 1.01E-10 C15 H29 N2 O3 P S2 + 2.9005 90.0319
2.96 2.24E-16 Lactic acid 323.0060 3.00 4.68E-13 C24 H4 P 167.0584
3.08 7.45E-14 Pyridoxal (Vitamin B6) 250.0623 3.47 3.36E-11
gamma-L-Glutamyl-L- cysteine 122.0487 3.90 1.71E-09 Niacinamide
201.1666 4.04 2.92E-12 C12 H25 S 149.0510 4.05 3.76E-10 Methionine
268.0713 4.72 9.69E-05 Homolanthionine 444.1428 4.75 1.39E-08
444.1428 396.0489 5.00 4.58E-12 C21 H8 N4 O5 329.9910 5.07 3.49E-12
C19 H9 P3 214.0085 5.09 4.95E-12 2,3-Dioxogulonic acid 296.0869
5.35 9.46E-15 Penicillamine disulfide 233.1224 6.30 3.27E-09 C11
H23 O P2 401.1190 9.24 1.77E-07 C17 H25 N2 O5 S2 612.1535 11.45
4.66E-10 Glutathione, oxidized 208.0851 12.83 8.30E-13 Kynurenine
159.0685 15.31 2.39E-15 Indoleacetaldehyde 266.0351 32.20 1.27E-08
C13 H15 P S2 482.1143 34.69 6.19E-13 C16 H26 N4 O9 S2 383.1070
35.60 2.47E-15 Succinoadenosine 135.0558 35.62 1.08E-13 C7 H7 N2 O
297.0898 35.63 4.09E-15 5'-Methylthioadenosine 313.0839 35.63
2.22E-13 C13 H12 N7 O P 369.4807 36.70 2.74E-10 369.4807 315.2040
36.76 4.82E-12 C15 H23 N8 499.1462 37.07 9.72E-11 C23 H28 N5 O2 P3
249.5732 37.30 7.64E-10 249.5732 595.1771 37.42 2.15E-11
8-Hydroxy-perphenazine glucuronide 1482.8310 37.65 1.69E-09
1482.831 556.1732 37.71 3.76E-12 C23 H28 N9 O4 P2 639.1682 38.11
3.28E-13 639.1682 179.0950 38.20 2.24E-16 Phenacetine 264.1823
38.21 3.28E-12 Tetracaine 312.1465 38.38 3.54E-13 Phe Phe 514.1626
38.43 2.11E-10 C21 H26 N9 O3 P2 252.0902 38.49 5.52E-11
Carbamazepine 10,11- epoxide 485.0762 38.74 5.00E-06 C27 H19 N O4
S2 1471.5754 38.79 3.76E-10 1471.5754 450.8249 38.79 6.24E-11
450.8249 1024.2646 38.80 5.22E-10 1024.2646 374.1240 38.81 1.14E-11
C27 H19 P 771.3008 38.83 7.29E-12 771.3008 916.2433 38.89 2.75E-09
FMNH 346.0992 38.95 7.64E-10 C25 H14 O2 582.1468 38.99 3.49E-12 C27
H25 N10 P3 590.1166 38.99 6.94E-12 5-Aminoimidazole ribonucleotide
574.1458 39.10 1.39E-08 C28 H26 N6 O4 S2 450.8238 39.32 1.38E-10
450.8238 578.2068 39.32 3.49E-12 C36 H37 O P3 265.0948 39.45
6.24E-11 265.0948 262.0776 39.54 1.57E-06 C8 H16 N5 O S2 574.1232
39.67 4.57E-13 C24 H34 N O7 P2 S2 558.1804 39.74 6.47E-07 C35 H30
N2 O S2 276.0570 39.83 3.89E-13 C15 H9 N4 P 421.1670 39.83 1.87E-06
C13 H27 N9 O3 S2 208.5870 39.92 4.39E-09 208.587 574.1265 40.06
3.42E-11 C28 H31 O7 P S2 558.1820 40.24 1.31E-06 C23 H34 N4 O8 S2
447.1469 40.38 1.58E-10 C23 H30 N O2 P S2 622.1914 40.39 2.50E-10
622.1914 314.1083 40.70 3.28E-13 C21 H17 N P 558.1816 40.84
1.35E-07 C23 H34 N4 O8 S2 + 40.837997 290.1090 40.97 3.66E-11 C15
H18 N2 O2 S 350.0953 41.14 6.53E-10 N-acetylaspartate 330.1974
41.31 9.31E- 14 C16 H30 N2 O3 S 507.1460 41.32 2.60E-11 C32 H29 P2
S 290.1086 41.42 2.29E-11 C15 H18 N2 O2 S + 41.415 706.1547 41.52
6.64E-11 706.1547 324.1161 41.76 2.29E-10 acetohexamide 1170.3890
41.81 4.73E-12 1170.389 507.1476 42.27 2.81E-10 C30 H24 N2 O4 P
324.1154 42.45 4.93E-12 C19 H19 N O2 P 317.2929 42.65 9.15E-12
Phytosphingosine 507.1482 43.29 2.20E-12
1-deoxy-1-[methyl[3-phenyl- 3-[4-(trifluoro- methyl)phenoxy]pro-
pyl]amino]-b-D- Glucopyranuronic acid 382.1235 43.56 4.58E-12 C20
H22 N3 O P2 366.1256 43.63 6.18E-05 C17 H22 N2 O5 S 906.3010 44.60
3.26E-10 906.301 583.0971 45.71 4.27E-09 583.0971 354.2546 46.00
3.63E-12 5beta-Chola-3,8(14),11-trien- 24-oic Acid 541.1893 46.15
6.05E-08 C29 H33 O8 S 234.1606 46.18 2.09E-10 3-n-decyl acrylic
acid 517.3172 47.16 4.12E-11 Linolenoyl lysolecithin 541.3209 47.22
4.31E-10 541.3209
Discussion
[0052] Direct differentiation of hESC with FH-CM rapidly and
efficiently generated hepatocytes, leading to uniformity of hepatic
development, including expression of hepatic transcription factors,
coordinately-regulated hepatobiliary genes, epithelial markers, as
well as mesenchymal markers. This recapitulated the meso-endodermal
stage of natural fetal hepatocytes (4-7). The extent of synthetic,
metabolic and xenobiotic disposal functions further confirmed this
developmental stage in eFHLC. Despite this immaturity, transplanted
eFHLC rescued mice in ALF by providing critical life-support and
paracrine signals to aid liver repair/regeneration, which was
similar to the capability in this setting of mature hepatocytes (7,
11).
[0053] Previously, lack of knowledge or uncertainties in the
hepatic lineage stage achieved made it difficult to interpret the
efficacy of stem cell differentiation protocols (1-3, 18-21). Use
of FH-CM without animal-derived materials, feeder cells or genetic
manipulation to express multiple transcription factors avoided
previous major restrictions (22). These attributes should be
especially helpful for developing further insights into liver cell
differentiation mechanisms in stem cells, as well as various
applications of stem cell-derived liver cells.
[0054] FH-CM induced hepatic differentiation in hESC by the steps
of endoderm specification followed by maturation to fetal stage.
This reproduced paracrine effects of proteins during
differentiation of mouse stem cells in vitro (17). However, hepatic
differentiation induced by FH-CM lacking proteins was singularly
different from cell differentiation induced by
cytokine/chemokine/growth factor-based protocols. Despite the
presence in FH-CM of proteins affecting cell attachment and perhaps
proliferation, e.g., activinA, FGFs, GCSF, interleukin-6, TNF,
VEGF, etc., (14,18,23,24), deficiency of RTK activation in hESC
substantiated that these proteins did not play seminal roles in
stem cell differentiation with FH-CM. The findings indicated active
role in stem cell differentiation of natural small compounds in
FH-CM. Whether these compounds could additionally have emanated
from eFHLC themselves during cell differentiation was unknown.
Previously, screening of chemical libraries identified synthetic
candidate compounds advancing 3 islet cell differentiation (25).
These results are different from the present findings because small
molecules in FH-CM originated naturally from cells. Among the list
of these small compounds, putative differentiation-inducing
molecules included those affecting differentiation in
stem/progenitor cells, e.g., 2-aminoadipic acid (26). Use of
specific matrices and synthetic surfaces could help in further
expanding eFHLC or other stem cell-derived cell types.
[0055] Protein secretion, urea synthesis and xenobiotic metabolism
in eFHLC indicated suitable hepatic properties. Cells engrafted and
functioned in xenotolerant mice, which was similar to mature human
hepatocytes (27). After transplantation, stem cell-derived
hepatocytes may engraft and express liver functions in animals,
although often largely at mRNA level (5-7, 22, 28) On the other
hand, for cell therapy requiring organ repopulation with healthy
cells, proliferation of transplanted cells is critical (22, 28). In
treating genetic conditions permanently, extensively modified
cells, e.g., those reprogrammed with multiple transcription
factors, will be less desirable than cells differentiated simply by
extracellular soluble signals. It should be noteworthy that in
settings, such as ALF, where short-term liver support by
extrahepatic reservoirs of cells rescued animals without need for
reseeding of the liver with cells, other considerations are
applicable (7, 11). For instance, eFHLC showed capacity for glucose
homeostasis, protein synthesis and ammonia detoxification, besides
releasing hepatoprotective substances, e.g., FGFs, GCSF, IGFs,
VEGF, etc. Previously, only GCSF was known to regulate ATM promoter
activity (29). It was found that FGFs and IGF also regulated
hepatic ATM signaling. As molecular perturbations, including ATM
signaling, improved after eFHLC transplantation, this added
specificity to the effects of cell therapy in ALF.
Materials and Methods
[0056] Studies were approved according to NIH guidelines, by the
Einstein Committee on Clinical Investigations, Embryonic Stem Cell
Research Oversight Committee, and Animal Care and Use
Committee.
[0057] Fetal cells: Fetal livers were from Human Fetal Tissue
Repository at Einstein. Ep-CAM+ liver cells were isolated and
cultured as previously described (5, 6). hTERT-FH-B cells were
cultured in DMEM with 10% FBS (12). To obtain CM, hTERT-FH-B were
cultured for 24 h in DMEM/F12 medium with 2% Knock-out Serum
Replacer (KSR), 2 mM L-glutamine, 0.1 mM MEM Non Essential Amino
Acids (NEAA), 1% penicillin-streptomycin (Invitrogen Corp.,
Carlsbad, Calif.).
[0058] Culture of hESC. WA-01 hESC were passaged weekly on
matrigel-coated dishes in DMEM/F12 medium, 1% B27 supplement, 1% N2
supplement, 2 mM L-glutamine, 0.1 mM NEAA, 1%
penicillin-streptomycin (Invitrogen Corp.) and 50 ng/ml basic FGF
(R&D Systems, Minneapolis, Minn.). For the final hepatic
differentiation protocol, hESC were washed with DMEM/F12, and
cultured in FH-CM.
[0059] Cytotoxicity assays. For effects of CM from hFHLC on
TNF-.alpha.-induced cytotoxicity, 1.5.times.10.sup.5 primary mouse
hepatocytes were isolated by collagenase perfusion (11), and plated
in 24-well dishes in RPMI 1640 medium with 10%/FBS and antibiotics.
After overnight culture, cells were switched to CM plus 10 ng/ml
TNF-.alpha. (Sigma) for 16-18 h, followed by thiazolyl blue
viability assays, as described previously (14). For cisP toxicity
assays, Huh-7 cells were used after transduction by a lentiviral
vector to express human ATM promoter-driven tdTomato gene (15).
Huh-7 cells cultured with 15 .mu.M cis-P (Sigma) or 2 .mu.g/ml
G-CSF (Amgen Inc., Thousand Oaks, Calif.) for 16-18 h were
incubated for 20 min with 6 .mu.g/ml Hoechst33342 (Sigma) for cell
viability and TdTomato/ATM promoter expression.
[0060] Hepatic functions. For albumin, cell culture medium
harvested after 3 h was analyzed by human albumin immunoassay
(Bethyl Laboratories, Montgomery, Tex.). For ureagenesis, cells
were incubated with 2.5-7.5 mM ammonium chloride for 12 h and urea
content was analyzed as previously described (27). For CYP450
activity, cells were induced overnight with phenobarbital,
7-ethoxyresorufin and .mu.M dicumarol were added for 12 h at
37.degree. C., and resorufin was measured, as described previously
(30).
[0061] Human cytokine arrays. Conditioned medium was analyzed by
human antibody array I membrane for 507 human proteins and cell
lysates were analyzed by Human RTK Phosphorylation Antibody Array 1
(RayBiotech, Norcross, Ga.), according to manufacturer.
[0062] NOD/SCID mice with ALF. CB17.NOD/SCID.sup.prkdc mice, 6-7
weeks old, were from Jackson Labs. (Bar Harbor, Me.). Mice were
given 3 daily doses of i.p. Rif (75 mg/kg) and Phen (30 mg/kg)
followed by one i.p. dose on d4 of MCT (160 mg/kg), as described
previously..sup.11 After Id, 4-6.times.10.sup.6 hESC-derived cells
differentiated for 14 d were transplanted i.p. with 1 ml Cytodex
3.TM. microcarriers (Amersham Biosciences Corp., Piscataway. N.J.).
Sham-treated animals received microcarriers. Encephalopathy was
graded from 0 (absent) to 3 (coma). Mice were observed for 2 weeks.
In some studies, hESC-derived cells were injected subcutaneously or
i.p. for tumor formation over 3 months.
[0063] Immunohistochemistry. Cells were fixed in 4%
paraformaldehyde in phosphate buffered saline, pH 7.4 (PBS),
blocked/permeabilized with 5%/o goat serum, 0.2% Triton X-100
(Sigma) in PBS for 1 h, and incubated overnight at 4.degree. C.
with anti-human antibodies for OCT3/4 (1:200), AFP (1:100), ECAD
(1:50) (Santa Cruz Biotechnology Inc., Santa Cruz, Calif.), FOXA2
(1:100) (R&D Systems), ALB (1:200) (Sigma), VIM (1:100) (US
Biologicals, Swampscott, Mass.). After washing in PBS,
TRITC-conjugated goat anti-mouse IgG (1:50, Sigma) or anti-rabbit
IgG (1:100) were added for 1 h with 4'-6-diamidino-2-phenylindole
(DAPI) (Invitrogen) counterstaining. In negative controls, primary
antibodies were omitted. Glycogen, G-6-P, and GGT were stained as
described (4-7).
[0064] Electron microscopy. Cells were fixed in 2.5% glutaraldehyde
in cacodylate butter, postfixed in osmium tetroxide, and stained
with 1% uranyl acetate before embedding in plastic. Ultrathin
sections were examined under JEOL 1200 electron microscope.
[0065] Molecular studies. RNA was extracted by TRIzol reagent
(Invitrogen), cleaned by RNeasy (Qiagen Sciences, Germantown, Md.),
incubated in DNase I (Invitrogen) and reverse-transcribed by
Omniscript RT kit (Qiagen). Platinum PCR SuperMix (Invitrogen) was
used for PCR with annealing at 94.degree. C..times.5 min, and 35
cycles at 94.degree. C..times.30 s, 55.degree. C..times.30 s,
72.degree. C..times.45 s, and 72.degree. C..times.10 min (primers,
Table 4). Mouse Stress and Toxicity RT.sup.2 Profiler PCR Array and
RT.sup.2 Real-Time SyBR Green PCR mix and RT.sup.2 First Strand kit
were from SABiosciences (Frederick, Md.). cDNA synthesis and PCR
was according to the manufacturer. For quantitative (q) RT-PCR
analysis of gene expression, customized arrays were obtained for 24
genes, including pluripotency genes, transcription factors and
hepatobiliary genes (CAPH-0800A; SA Biosciences). Data were
analyzed by 2-.DELTA..DELTA.Ct method. Fold-changes in gene
expression were expressed as log-normalized ratios from
sham-treated/normal and cell transplantation/normal livers. Gene
expression was analyzed with U133 2.0 Plus oligonucleotide arrays
(Affymetrix Corp., Santa Clara, Calif.) as described (10). Changes
in mRNA expression were examined for pathway-specificity by IPA
tools (Ingenuity Systems Inc., Redwood, Calif.).
TABLE-US-00005 TABLE 5 Primer sequences for RT-PCR (SEQ ID NOS.
1-24, top to bottom, respectively). Amplicon size Gene Primer
sequence 5'-3' expected OCT4 F: GACAACAATGAAAATCTTCAGGAGA 218 bp R:
TTCTGGCGCCGGTTACAGAACCA ALB F: TGCTTGAATGTGCTGATGACAGGG 161 bp R:
AAGGCAAGTCAGCAGGCATCTCATC AFP F: TGCAGCCAAAGTGAAGAGGGAAGA 260 bp R:
CATAGCGAGCAGCCCGAAGAA CK-19 F: ATGGCCGAGCAGAACCGGAA 308 bp R:
CCATGAGCCGCTGGTACTCC VIM F: CACCTACAGCCTCTACG 170 bp R:
AGCGGTCATTCAGCTC .alpha.-SMA F: AGTACCCGATAGAACATGG 153 bp R:
TTTTCTCCCGGTTGGC CYP1B1 F: CACCAAGGCTGAGACAGTGA 230 bp R:
GCCAGGTAAACTCCAAGCAC CYP2C9 F: GGACAGAGACGACAAGCACA 200 bp R:
TGGTGGGGAGAAGGTCAAT CYP3A4 F: TGTGCCTGAGAACACCAGAG 201 bp R:
GCAGAGGAGCCAAATCTACC CYP2E1 F: CCGCAAGCATTTTGACTACA 202 bp R:
GCTCCTTCACCCTTTCAGAC CYP1A1 F: AGGCTTTTACATCCCCAAGG 197 bp R:
GCAATGGTCTCACCGATACA .beta.-Actin F: TCACCACCACGGCCGAGCG 350 bp R:
TCTCCTTCTGCATCCTGTCG Abbreviations: F, Forward; R, Reverse; bp,
base pair; ALB, albumin; AFP, .alpha.-fetoprotein; CK-19,
cytokeratin-19; VIM, vimentin; SMA, smooth muscle actin, CYP,
cytochrome P450
[0066] For microRNAs, total RNA isolated by TRIzol reagent
(Invitrogen) was analyzed by LC Sciences (Houston, Tex.) with probe
set based on Sanger miRBase, v 9.0. Later, transcripts with <500
arbitrary signals were excluded as these are not identified by
qRT-PCR. Data were transformed to log 2 followed by clustering of
transcripts (Cluster3, Stanford University) and heatmaps were drawn
(JavaTree1.1.6r2).
[0067] Tissue studies: Tissue samples were frozen to -80.degree. C.
in methylbutane. Cryostat sections were prepared. Tissue morphology
was analyzed by H&E stained sections. Tissue injury was graded
as previously described (38). For hepatic function in transplanted
cells, glycogen and G-6-P were stained (35). For Ki67 and histone
H2AX, tissues were fixed in 4% PAF followed by rabbit anti-Ki67
(1:750, Vector Laboratories, Burlingame, Calif.) or rabbit
anti-phosphoS139 H2AX (1:300, ab2893: Abcam, Cambridge, Mass.),
respectively, and secondary anti-Rabbit Alexa Fluor 546 (1:500,
Molecular Probes), followed by counterstaining with DAPI (7, 11).
Transplanted cells were identified by in situ hybridization for
alphoid satellite sequences in centromeres (27).
[0068] Liquid chromatography-mass spectroscopy (LC-MS)
metabolomics. For non-targeted metabolite screen by LC-MS, 5 uL
media were injected and separated on Agilent 1100 system with
Waters Atlantis T3 column (3 .mu.m, 150.times.2.1 mm i.d.). Binary
mobile phase consisting of solvent systems A (0.1% formic acid in
ddH.sub.2O, v/v) and B (0.1% formic acid in acetonitrile, v/v) were
used in gradient elution with flow of 0.3 mL/min. Initial
conditions were set at 100:0 A:B, 1 min hold was employed followed
by linear gradient to 70:30 at 20 min and linear gradient to 10:90
at 45 min. Gradient conditions were reset to 100:0 A:B from 45.1
min to 55 min. After separation, column effluent was introduced by
positive mode electrospray ionization into Agilent MSD-TOF mass
spectrometer. Mass data from m/z 70-1100 were collected. Biomarkers
were identified with Agilent Mass Profiler Professional software,
as recommended. These studies were performed by Bruce Cooper at
Purdue University Metabolite Profiling Facility.
[0069] Serological studies. Sera were stored at -20.degree. C. and
analyzed for ALT and bilirubin as previously described. Human
albumin was measured by immunoassay (Bethyl Laboratories).
[0070] Statistical analysis. Data were analyzed by t-tests, Pearson
correlation tests, logrank tests, and ANOVA with Holm-Sidak posthoc
test. P values <0.05 were considered significant.
Example 2
[0071] Differentiation of human embryonic stem cells (hESC) by
synthetic counterparts of substances made naturally in fetal
hepatocytes: The list of principal components identified by LC-MS
in conditioned medium from fetal hepatocytes (FH-CM), which was
provided in Table 4 was further reduced to a set of 8 compounds
(CP) (commercially available in chemically synthesized form) (Table
6).
TABLE-US-00006 TABLE 6 CP tested for induction of hepatic
differentiation in hESC and iPSC CP Exemplary Catalog designation
Chemical identity Manufacturer No. 1 L-Cysteinglutathione Santa
Cruz sc- Disulfide 211701 2 .gamma.-Glu-Cys Sigma G0903 3
DL-Kynurenine Sigma 61250 4 D-Penicillamine disulfide Sigma P1101 5
Phenacetin Sigma 77440 6 Phytosphingosine HCl Sigma P2795 7
Pyridoxal HCl Sigma P6155 8 Tetracaine HCl Sigma T7508
[0072] The ability of these CP to substitute for FH-CM in
differentiating hESC (WA-01 line) was examined in various
combinations of CP (see Table 7) in micromolar concentrations of 1,
5, 10, 15, 20, and 25. Amounts of >10 micromolar of the
compounds caused toxicity with cell death and detachment of hESC
(WA-01 line) from surfaces of cell culture dishes. When these 8 CP
were tested in hESC individually in medium (see methods), none of
the CP in 1, 5 or 10 micromolar amounts induced hepatic
differentiation, and OCT4 was still expressed, albumin or vimentin
was not expressed, and cell morphology was unchanged. These 8 CP
were then tested in concentrations of 5 or 10 micromolar each in
combinations to substitute for FH-CM in differentiating hESC.
TABLE-US-00007 TABLE 7 Combinations of CP and their effects on
induction of hepatic differentiation in hESC and iPSC Combination
of compounds in culture (+, present; Hepatic differentiation -,
absent) CP 1 CP 2 CP 3 CP 4 CP 5 CP 6 CP 7 CP 8 induced? 1 + - - -
- - - - No (only undifferentiated hESC) 2 + + - - - - - - No (only
undifferentiated hESC) 3 + + + - - - - - No (only undifferentiated
hESC) 4 + + + + - - - - No (only undifferentiated hESC) 5 + + + + +
- - - Yes but incomplete (undifferentiated hESC present) 6 + + + +
+ + - - Yes but incomplete (undifferentiated hESC present) 7 + + +
+ + + + - Yes (most optimal with no obvious undifferentiated hESC)
8 + + + + + + + + Yes (but less optimal versus 7CP group of row
above) Hepatic differentiation was evaluated by characteristic
morphology of undifferentiated stem cells and of epithelial cells
along with albumin staining.
[0073] The culture medium contained additives, including retinoic
acid, dexamethasone. Amounts of >10 micromolar of the compounds
caused toxicity with cell death and detachment of adherent hESC
from surfaces of cell culture dishes. Further analysis indicated
culture of hESC with CP individually or in groupings of up to 6 CP
at one time in 1, 5 or 10 micromolar amounts, did not alter
morphology of cultured hESC and these continued to display
characteristic small sizes and cluster formation (not shown). By
contrast, culture of hESC with a group of 7 CP in 5 or 10
micromolar concentrations for 2 weeks generated large cells with
uniform morphology of epithelial cells (FIG. 9A). The following
combinations of CP were ineffective in hESC differentiation:
CP1+CP2; CP1+CP2+CP3; CP1+CP2+CP3+CP4. The following combinations
of CP were partially effective because both undifferentiated hESC
and differentiated cells were present in culture dishes: CP5+CP6;
CP6+CP7; and CP5+CP6+CP7. By contrast, when 7 or 8 CP were combined
together, only differentiated cells were present in culture dishes.
Of these two combinations, the following group of CP was most
effective: CP1+CP2+CP3+CP4+CP5+CP6+CP7.
[0074] Further studies were performed of hESC-derived epithelial
cells with this set of 7 CP. In response to the most effective
combination of 7 CP, morphology of undifferentiated hESC changed
and expression of OCT4 was no longer observed in differentiated
hESC (FIG. 9A, 9B). Differentiated cells showed albumin in
cytoplasm indicating hepatic differentiation, whereas
undifferentiated hESC were negative for albumin staining (FIG. 9C).
Moreover, differentiated cells expressed vimentin (FIG. 9D). The
differentiated cells generated by 7 CP synthesized urea (FIG. 9E)
and possessed ability to convert a xenobiotic, ethoxyresorufin,
into resorufin (FIG. 9F). These properties were similar to
hESC-derived cells generated by FH-CM (see Example 1).
[0075] iPSC were utilized that were obtained by reprogramming of
normal human fibroblasts with non-integrating Sendai virus vectors
from the Pluripotent Stem Cell Core at Albert Einstein College of
Medicine. The differentiation protocol with FH-CM and CP was
identical to studies with hESC described above. After 2 weeks, iPSC
cultured with FH-CM became larger with epithelial morphology,
whereas undifferentiated iPSC were smaller and were arranged in
clusters (FIG. 10A). Similarly, iPSC cultured with above-described
combination of 7 CP became larger with epithelial morphology.
Expression of OCT4 was lost in iPSC cultured with either FH-CM or
combination of 7 CP (FIG. 10B). Differentiated cells contained
albumin as shown by immunostaining, whereas undifferentiated iPSC
were negative for albumin staining (FIG. 10C). Moreover, similar to
differentiation of hESC under these conditions, we found
differentiated cells expressed vimentin. These iPSC-derived
hepatocytes synthesized urea and metabolized ethoxyresorufin to
resorufin (FIG. 10E, 10F). This substantiated that this combination
of 7 CP generated hepatocytes from iPSC.
Materials and Methods
[0076] Chemicals and reagents: CP were purchased and stock
solutions were prepared in either water or ethanol as recommended
by the manufacturers (Sigma Chemical Co.: Santa Cruz
Biotechnology).
[0077] Cells and cell culture: WA-01 hESC were passaged on
matrigel-coated dishes in DMEM/F12 medium, 1% B27 supplement, 1%
N.sub.2 supplement, 2 mM L-glutamine, 0.1 mM NEAA (Life
Technologies) and 50 ng/ml basic FGF (R&D Systems). The iPSC
were generated from normal human fibroblasts with CytoTune.RTM.-iPS
Sendai Reprogramming Kit (Life Technologies, Cat #A1378001). The
iPSC were cultured on matrigel-coated dishes in DMEM/F12 medium, 1%
B27 supplement, 1% N.sub.2 supplement, 2 mM L-glutamine, 0.1 mM
NEAA (Life Technologies) and 50 ng/ml basic FGF (R&D Systems).
To obtain FH-CM, hTERT-FH-B cells were cultured for 24 h in
DMEM/F12 medium with 2% Knock-out Serum Replacer (KSR), 2 mM
L-glutamine, 0.1 mM MEM Non Essential Amino Acids (NEAA), 1%
penicillin-streptomycin (Life Technologies).
[0078] Hepatic differentiation: For differentiation, hESC/iPSC were
washed with DMEM/F12 and cultured for 2 weeks in FH-CM and CP in
DMEM/F12 with 2% Knock-out Serum Replacer (KSR), 1% B27 supplement,
2 mM L-glutamine, 0.1 mM MEM Non-Essential Amino Acids (NEAA), 1%
penicillin-streptomycin (Life Technologies). For testing effects of
CP in differentiation of hESC/iPSC, identical culture medium was
used except that one or more CP were added and the step of
incubating hTERT-FH-B cells in this medium was omitted. HepG2 cells
of human origin were included in some studies and were cultured in
usual conditions with serum-containing medium as described in the
parent document.
[0079] Immunostaining: Cells were fixed in 4% paraformaldehyde in
phosphate buffered saline, pH 7.4 (PBS), blocked/permeabilized with
5% goat serum, 0.2% Triton X-100 (Sigma) in PBS for 1 h, and
incubated overnight at 4.degree. C. with mouse anti-human albumin
antibody (HSA-11 clone, 1:200, Sigma), anti-human OCT3/4 (1:200,
Santa Cruz Biotecnology), anti-human vimentin (1:100, US
Biologicals). After washes in PBS, TRITC-conjugated goat anti-mouse
IgG (1:50, Sigma) cells were counterstained for 1 h with
4'-6-diamidino-2-phenylindole (DAPI) (Life Technologies). In
negative controls, primary antibody was omitted.
[0080] Hepatic functions: For ureagenesis, cells were incubated
with 5 mM ammonium chloride for 12 h and analyzed as described (Cho
et al., 2004, (31)). For CYP450 activity, cells were analyzed for
7-ethoxyresorufin conversion, as described (Gupta et al., 1999,
(32)).
REFERENCES
[0081] 1. Chinzei, R., et al. Embryoid-body cells derived from a
mouse embryonic stem cell line show differentiation into functional
hepatocytes. Hepatology 36, 22-29 (2002). [0082] 2. Karp, J. M., et
al. Cultivation of human embryonic stem cells without the embryoid
body step enhances osteogenesis in vitro. Stem Cells 24, 835-843
(2006). [0083] 3. Cai, J., et al. Directed differentiation of human
embryonic stem cells into functional hepatic cells. Hepatology 45,
1229-1239 (2007). [0084] 4. Inada, M., et al. Stage-specific
regulation of adhesion molecule expression segregates epithelial
stem/progenitor cells in fetal and adult human livers. Hepatol Int
2, 50-62 (2008). [0085] 5. Malhi, H., Irani, A. N., Gagandeep, S.
& Gupta, S. Isolation of human progenitor liver epithelial
cells with extensive replication capacity and differentiation into
mature hepatocytes. J Cell Sci 115, 2679-2688 (2002). [0086] 6.
Inada, M., et al. Phenotype reversion in fetal human liver
epithelial cells identifies the role of an intermediate
meso-endodermal stage before hepatic maturation. J Cell Sci 121,
1002-1013 (2008). [0087] 7. Bandi, S., Joseph, B., Cheng, K. &
Gupta, S. Spontaneous origin from human embryonic stem cells of
early developmental stage liver cells displaying conjoint
meso-endodermal phenotype with hepatic functions. J Cell Sci 2012;
in press. [0088] 8. Moore, R. N. & Moghe, P. V. Expedited
growth factor-mediated specification of human embryonic stem cells
toward the hepatic lineage. Stem Cell Res 3, 51-62 (2009). [0089]
9. Johannesson, M., et al. FGF4 and retinoic acid direct
differentiation of hESCs into PDX1-expressing foregut endoderm in a
time- and concentration-dependent manner. PLoS ONE 4, e4794 (2009).
[0090] 10. Ding, B. S., et al. Inductive angiocrine signals from
sinusoidal endothelium are required for liver regeneration. Nature
468, 310-5 (2010). [0091] 11. Bandi, S., et al. Perturbations in
Atm signaling pathways following drug-induced acute liver failure
and their reversal during rescue of animals by cell therapy. Am J
Pathol 178, 161-74 (2011). [0092] 12. Wege, H., et al. Telomerase
reconstitution immortalizes human fetal hepatocytes without
disrupting their differentiation potential. Gastroenterology, 124,
432-444 (2003). [0093] 13. Zalzman, M. et al. Reversal of
hyperglycemia in mice using human expandable insulin-producing
cells differentiated from fetal liver progenitor cells. Proc Natl
Acad Sci USA 100, 7253-8 (2003). [0094] 14. Enami, Y., et al.
Hepatic stellate cells promote hepatocyte engraftment in rat liver
after prostaglandin-endoperoxide synthase inhibition.
Gastroenterology 136, 2356-64 (2009). [0095] 15. Shaner, N. C., et
al. Improved monomeric red, orange and yellow fluorescent proteins
derived from Discosoma sp. red fluorescent protein. Nat Biotechnol
22, 1567-72 (2004). [0096] 16. D'Amour, K. A., et al. Efficient
differentiation of human embryonic stem cells to definitive
endoderm. Nat Biotechnol 23, 1534-1541 (2005). [0097] 17.
Soto-Gutierrez, A., et al. Differentiation of mouse embryonic stem
cells to hepatocyte-like cells by co-culture with human liver
nonparenchymal cell lines. Nat Protoc 2, 347-356 (2007). [0098] 18.
Lavon, N., Yanuka, O. & Benvenisty, N. Differentiation and
isolation of hepatic-like cells from human embryonic stem cells.
Differentiation 72, 230-238 (2004). [0099] 19. Rambhatla, L., Chiu,
C. P., Kundu, P., Peng, Y. & Carpenter, M. K. Generation of
hepatocyte-like cells from human embryonic stem cells. Cell
Transplant 12, 1-11 (2003). [0100] 20. Hay, D. C., et al. Highly
efficient differentiation of hESCs to functional hepatic endoderm
requires ActivinA and Wnt3a signaling. Proc Natl Acad Sci USA 105,
12301-12306 (2008). [0101] 21. Shiraki, N., et al. Differentiation
of mouse and human embryonic stem cells into hepatic lineages.
Genes Cells 13, 731-746 (2008). [0102] 22. Huang, P., et al.
Induction of functional hepatocyte-like cells from mouse
fibroblasts by defined factors. Nature 475, 386-9 (2011). [0103]
23. Jung, J., Zheng, M., Goldfarb, M. & Zaret, K. S. Initiation
of mammalian liver development from endoderm by fibroblast growth
factors. Science 284, 1998-2003 (1999). [0104] 24. Piscaglia, A.
C., Shupe, T. D., Oh, S. H., Gasbarrini, A. & Petersen, B. E.
Granulocyte-colony stimulating factor promotes liver repair and
induces oval cell migration and proliferation in rats.
Gastroenterology 133, 619-31 (2007). [0105] 25. Chen, S., et al. A
small molecule that directs differentiation of human ESCs into the
pancreatic lineage. Nat Chem Biol 5, 258-65 (2009). [0106] 26.
Takeda, M., et al. Alpha-aminoadipate induces progenitor cell
properties of Muller glia in adult mice. Invest Ophthalmol Vis Sci
49, 1142-50 (2008). [0107] 27. Cho, J. J., et al. Analysis of the
functional integrity of cryopreserved human liver cells including
xenografting in immunodeficient mice to address suitability for
clinical applications. Liver Int 24, 361-370 (2004). [0108] 28.
Basma, H., et al. Differentiation and transplantation of human
embryonic stem cell-derived hepatocytes. Gastroenterology 136,
990-999 (2009). [0109] 29. Gueven, N., et al. Site-directed
mutagenesis of the ATM promoter: consequences for response to
proliferation and ionizing radiation. Genes Chromosomes Cancer 38,
157-167 (2003). [0110] 30. Gupta, S., et al. Position-specific gene
expression in the liver lobule is directed by the microenvironment
and not by the previous cell differentiation state. J Biol Chem
274, 2157-2165 (1999). [0111] 31. Cho, J. J., Joseph, B., Sappal,
B. S., Giri, R. K., Wang, R., Ludlow, J. W., Furth, M. E., Susick,
R., and Gupta, S. (2004). Analysis of the functional integrity of
cryopreserved human liver cells including xenografting in
immunodeficient mice to address suitability for clinical
applications. Liver Int 24, 361-370. [0112] 32. Gupta, S.,
Rajvanshi, P., Sokhi, R. P., Vaidya, S., Irani, A. N., and Gorla,
G. R. (1999). Position-specific gene expression in the liver lobule
is directed by the microenvironment and not by the previous cell
differentiation state. J Biol Chem 274, 2157-2165.
Sequence CWU 1
1
24125DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN OCT4 GENE
1gacaacaatg aaaatcttca ggaga 25223DNAARTIFICIAL SEQUENCEPRIMER
DIRECTED TO HUMAN OCT4 GENE 2ttctggcgcc ggttacagaa cca
23324DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN ALB GENE
3tgcttgaatg tgctgatgac aggg 24425DNAARTIFICIAL SEQUENCEPRIMEER
DIRECTED TO HUMAN ALB GENE 4aaggcaagtc agcaggcatc tcatc
25524DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TIO HUMAN AFP GENE
5tgcagccaaa gtgaagaggg aaga 24624DNAARTIFICIAL SEQUENCEPRIMER
DIRECTED TO HUMAN AFT GENE 6catagcgagc agcccaaaga agaa
24720DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN CK-19 GENE
7atggccgagc agaaccggaa 20820DNAARTIFICIAL SEQUENCEPRIMER DIRECTED
TO HUMAN CK-19 GENE 8ccatgagccg ctggtactcc 20917DNAARTIFICIAL
SEQUENCEPRIMER DIRECTED TO HUMAN VIM GENE 9cacctacagc ctctacg
171016DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN VIM GENE
10agcggtcatt cagctc 161119DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO
HUMAN ALPHA-SMA GENE 11agtacccgat agaacatgg 191216DNAARTIFICIAL
SEQUENCEPRIMER DIRECTED TO HUMAN ALPHA-SMA GENE 12ttttctcccg gttggc
161320DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN CYPIB1 GENE
13caccaaggct gagacagtga 201420DNAARTIFICIAL SEQUENCEPRIMER DIRECTED
TO HUMAN CYPIB1 GENE 14gccaggtaaa ctccaagcac 201520DNAARTIFICIAL
SEQUENCEPRIMER DIRECTED TO HUMAN CYP2C9 GENE 15ggacagagac
gacaagcaca 201619DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN
CYP2C9 GENE 16tggtggggag aaggtcaat 191720DNAARTIFICIAL
SEQUENCEPRIMER DIRECTED TO HUMAN CYP3A4 GENE 17tgtgcctgag
aacaccagag 201820DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN
CYP3A4 GENE 18gcagaggagc caaatctacc 201920DNAARTIFICIAL
SEQUENCEPRIMER DIRECTED TO HUMAN CYP2E1 GENE 19ccgcaagcat
tttgactaca 202020DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN
CYP2E1 GENE 20gctccttcac cctttcagac 202120DNAARTIFICIAL
SEQUENCEPRIMER DIRECTED TO HUMAN CYP1A1 GENE 21aggcttttac
atccccaagg 202220DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN
CYP1A1 GENE 22gcaatggtct caccgataca 202319DNAARTIFICIAL
SEQUENCEPRIMER DIRECTED TO HUMAN BETA-ACTIN 23tcaccaccac ggccgagcg
192420DNAARTIFICIAL SEQUENCEPRIMER DIRECTED TO HUMAN BETA-ACTIN
24tctccttctg catcctgtcg 20
* * * * *