U.S. patent application number 14/418984 was filed with the patent office on 2015-06-18 for use of attenuated strains of parasites for the prevention or treatment of pathologies associated with an apicomplexan.
The applicant listed for this patent is INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE, UNIVERSITE FRANCOIS RABELAIS DE TOURS, VITAMFERO. Invention is credited to Audrey Gnahoui-David, Fabrice Laurent, Marie-Noelle Mevelec, Edouard Seche.
Application Number | 20150165008 14/418984 |
Document ID | / |
Family ID | 47501366 |
Filed Date | 2015-06-18 |
United States Patent
Application |
20150165008 |
Kind Code |
A1 |
Gnahoui-David; Audrey ; et
al. |
June 18, 2015 |
USE OF ATTENUATED STRAINS OF PARASITES FOR THE PREVENTION OR
TREATMENT OF PATHOLOGIES ASSOCIATED WITH AN APICOMPLEXAN
Abstract
Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof in the prevention or
the treatment, in a mammal, of a pathology associated with an
apicomplexan of the family Cryptosporidiidae.
Inventors: |
Gnahoui-David; Audrey;
(Tours, FR) ; Laurent; Fabrice; (Tours, FR)
; Mevelec; Marie-Noelle; (Tours, FR) ; Seche;
Edouard; (Tours, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
VITAMFERO
INSTITUT NATIONAL DE LA RECHERCHE AGRONOMIQUE
UNIVERSITE FRANCOIS RABELAIS DE TOURS |
Tours
Paris Cedex 07
Tours Cedex 01 |
|
FR
FR
FR |
|
|
Family ID: |
47501366 |
Appl. No.: |
14/418984 |
Filed: |
August 2, 2013 |
PCT Filed: |
August 2, 2013 |
PCT NO: |
PCT/FR2013/051876 |
371 Date: |
February 2, 2015 |
Current U.S.
Class: |
424/273.1 ;
424/269.1; 435/258.1 |
Current CPC
Class: |
A61P 33/02 20180101;
A61K 39/012 20130101; A61K 2039/522 20130101; A61K 2039/552
20130101; A61K 39/39 20130101; A61K 2039/55 20130101; Y02A 50/30
20180101; A61K 2039/57 20130101; A61K 2039/572 20130101; A61K
2039/575 20130101; Y02A 50/489 20180101; A61K 2039/58 20130101;
A61K 39/002 20130101 |
International
Class: |
A61K 39/012 20060101
A61K039/012; A61K 39/002 20060101 A61K039/002 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 2, 2012 |
FR |
12/57547 |
Claims
1. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof in the prevention or
the treatment, in a neonate mammal, of a pathology associated with
an apicomplexan of the family Cryptosporidiidae.
2. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 1,
in which said mammal is a human being or an animal.
3. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 2,
in which said animal belongs to the group comprising or constituted
by ovines, caprins, porcines, bovines, equines, camelids, canids or
felids.
4. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 1,
in which said strains of Toxoplasma spp or of Neospora spp have at
least an adhesin MIC-1 and/or an adhesin MIC-3 inactivated by a
genetic modification relating to at least one of the mic-1 and/or
mic-3 genes.
5. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 1,
in which said strains of Toxoplasma spp or of Neospora spp have the
two adhesins MIC-1 and MIC-3 inactivated by a genetic modification
relating to the two mic-1 and mic-3 genes.
6. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 4,
in which the strains of Toxoplasma spp or of Neospora spp are
respectively Toxoplasma gondii or Neospora caninum.
7. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 1,
in which the immunostimulant effect of said strains leads to the
secretion of interleukin-12 (IL-12) and then of interferon-.gamma.
(IFN-.gamma.).
8. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 7,
in which the secretion of interleukin-12 (IL-12) and of
interferon-.gamma. (IFN-.gamma.) begins between 3 and 9 days after
using said strains of Toxoplasma spp or of Neospora spp as
immunostimulant.
9. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 1,
in which said pathology associated with an apicomplexan of the
family Cryptosporidiidae is cryptosporidiosis.
10. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 9,
in which the apicomplexan of the family Cryptosporidiidae
responsible for the cryptosporidiosis is at least one apicomplexan
selected from the group constituted by Cryptosporidium parvum,
Cryptosporidium bovis, Cryptosporidium andersoni, Cryptosporidium
ryanae, Cryptosporidium muris, Cryptosporidium ubiquitum,
Cryptosporidium hominis, Cryptosporidium canis, Cryptosporidium
felis, Cryptosporidium baileyi, Cryptosporidium meleagridis or
Cryptosporidium xiaoi.
11. Strains of Toxoplasma gondii or of Neospora caninum isolated
from their natural environment and having an immunostimulant
effect, said strains of Toxoplasma gondii or of Neospora caninum
having the two adhesins MIC-1 and MIC-3 inactivated by a genetic
modification relating to the two mic-1 and mic-3 genes, for the use
thereof according to claim 6, in which said pathology associated
with an apicomplexan of the family Cryptosporidiidae is
cryptosporidiosis.
12. Strains of Toxoplasma gondii or of Neospora caninum isolated
from their natural environment and having an immunostimulant
effect, for the use thereof in the prevention or the treatment, in
a mammal, of a pathology associated with an apicomplexan of the
family Cryptosporidiidae, said strains of Toxoplasma gondii or of
Neospora caninum having the two adhesins MIC-1 and MIC-3
inactivated by a genetic modification relating to the two mic-1 and
mic-3 genes, and said pathology associated with an apicomplexan of
the family Cryptosporidiidae is cryptosporidiosis.
13. Strains of Toxoplasma gondii or of Neospora caninum isolated
from their natural environment and having an immunostimulant
effect, said strains of Toxoplasma gondii or of Neospora caninum
having the two adhesins MIC-1 and MIC-3 inactivated by a genetic
modification relating to the two mic-1 and mic-3 genes, for the use
thereof according to claim 6, in which said strains of Toxoplasma
gondii or of Neospora caninum are administered to the mammal at a
rate from 20 to 10.sup.9 tachyzoites.
14. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 1,
in which said strains are in a galenic form selected from the group
comprising or constituted by liquid suspensions, solid or liquid
dispersions, powders, pastes or lyophilizates.
15. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 1,
in which said strains are associated with at least one other
antigen, or at least one adjuvant, or at least one stabilizer, or
at least one preservative or a mixture of at least two of said
products for increasing the immune response of said mammal.
16. Strains of Sarcocystidae selected from Toxoplasma spp or
Neospora spp isolated from their natural environment and having an
immunostimulant effect, for the use thereof according to claim 5,
in which the strains of Toxoplasma spp or of Neospora spp are
respectively Toxoplasma gondii or Neospora caninum.
Description
[0001] The present invention relates to the use of attenuated
strains of parasites for preventing or treating pathologies
associated with an apicomplexan.
[0002] The Apicomplexa are predominantly obligate intracellular
parasites that have a life cycle that may involve several hosts.
The phylum of these parasites is subdivided into several
families.
[0003] Toxoplasma gondii (T. gondii) belongs to the Sarcocystidae
family. This protozoon exists in three infectious forms which vary
depending on the host and the infectious stage: [0004] tachyzoite:
the infectious proliferative form which multiplies asexually in the
cells of the intermediate hosts (i.e. all homeotherms) and
definitive hosts (i.e. felids and the cat in particular), [0005]
bradyzoite: slowly dividing form with low level of metabolism of
the parasite contained in cysts, [0006] sporozoite: the form
contained in the oocysts, which results from the sexual
multiplication of the parasite in the intestine of the definitive
hosts (i.e. cat and other felids). The cat, the definitive host of
the parasite, becomes infected by ingesting parasitized prey
containing cysts (or tachyzoites if the animal is in the acute
phase of toxoplasmosis), or by ingestion of oocysts. After sexual
multiplication in the intestine of the felids, via gametocytes, the
oocysts are disseminated in the environment. These oocysts
sporulate in the external environment and they remain pathogenic
for at least a year. After ingestion of oocysts, the released
sporozoites infect the enterocytes of the definitive or
intermediate host and undergo transformation to tachyzoites, which
are disseminated in the organism. Under the pressure of the immune
system, the tachyzoites become encysted with preferential tropism
for the central nervous system, the retina or the muscles.
Ingestion of encysted tissues is the second commonest cause of
contamination of the definitive and intermediate hosts. After
ingestion of cysts, the bradyzoites are released and infect the
intestinal epithelial cells and are transformed into tachyzoites,
which are disseminated in the host.
[0007] The strains of T. gondii are classified according to their
degree of virulence in vivo: the type I strains (i.e. the strain
RH) are highly virulent whereas the type II strains (i.e. the
strains ME49, 76K or Pru) and type III strains (i.e. the strains
CEP or M7741) are less virulent and generally establish chronic
infections. Moreover, numerous atypical strains not assignable to
the first three types have been identified, in particular in Africa
and in South America (Howe D K et al., 1995, J. Infect. Dis., 171,
1561-1566; Rajendran C et al., 2011, Infect. Genet. Evol., 12,
359-368; Mercier A et al., 2010, PLoS Negl. Trop. Dis., 4,
e876).
[0008] Recently, an attenuated live strain of Toxoplasma gondii,
the parasite responsible for toxoplasmosis, was developed by
silencing two genes coding for the proteins TgMIC1 and TgMIC3 (EP 1
703 914 B1 and U.S. Pat. No. 7,964,185 B2/Cerede et al., 2005, J.
Exp. Med., 201: 453-63). This strain, designated Toxo mic1-3 KO,
generated a strong and specific immune response against Toxoplasma
gondii and makes it possible to prevent the effects of subsequent
infection in the mouse (Ismael et al., 2005, J. Infect. Dis., 194:
1176-1183) and in the ewe (Mevelec et al., 2010, Vet. Res., 41:
49). It has also been demonstrated that virulence in vivo is only
very slightly affected by isolated inactivation of TgMIC1 or of
TgMIC3; in contrast, it is greatly reduced by simultaneous
inactivation of both proteins, demonstrating the synergistic role
of the two proteins (Cerede et al., 2005 J. Exp. Med., 201:
453-63).
[0009] Neospora caninum is an intracellular parasite, responsible
for neosporosis. It also belongs to the Sarcocystidae family. The
life cycle of Neospora caninum is very similar to that of T. gondii
with two distinct phases: a sexual phase in the final host (i.e.
the canids and the dog in particular) which leads to the production
of oocysts, containing sporozoites, which are eliminated in the
faeces, and an asexual phase in an intermediate host (i.e. ovines,
caprins, bovines, equines, etc.), which leads to the production of
tachyzoites and then cysts containing the bradyzoites.
[0010] More recently, an attenuated live strain of Neospora caninum
was obtained, the strain Neo ncmic1-3 KO, in which the ncmic1 and
ncmic3 genes were knocked out by homologous recombination. In this
strain, the ncmic3 gene is replaced by a DHFR cassette, which
confers resistance to pyrimethamine, and the ncmic1 gene is
replaced by a CAT-GFP cassette, which endows the parasite with
resistance to chloramphenicol and makes the parasite fluorescent.
The parasite no longer expresses the NcMIC1 and NcMIC3 proteins. It
has been shown that this mutant strain has infectious and
immunogenic properties, endowing mammals with vaccine protection
against the harmful effects of neosporosis.
[0011] Toxoplasma gondii and Neospora caninum have in common a
specific process of invasion of the host cells in several steps
leading to the formation of a parasitophorous vacuole in which the
parasite multiplies and develops.
[0012] The Cryptosporidiidae constitute another family belonging to
the phylum of the apicomplexans and are responsible for
cryptosporidiosis, an extremely common disease which in particular
affects humans and many animal species including farm animals
(ovin, caprin, bovine, etc.) by the ingestion of parasites present
in their food. The parasite then multiplies in the intestines,
firstly asexually and then, secondly, sexually. The contaminated
individuals excrete and disseminate new parasites, thus
contaminating their environment (i.e. pastureland, water,
etc.).
[0013] Several species of Cryptosporidiidae have been identified,
among which Cryptosporidium parvum is one of the commonest and most
virulent.
[0014] In humans, cryptosporidiosis is generally a benign disease.
However, the consequences of this disease, the incidence of which
is increasing every year, in particular in the United States, may
be extremely serious in young children and immunodepressed persons,
especially patients infected with the HIV virus. Thus, within these
populations, cryptosporidiosis is responsible for severe diarrhoea
that may cause significant dehydration or, without suitable
treatment, even death of the individual.
[0015] In immunocompetent adult animals, cryptosporidiosis is also
benign. Conversely, cryptosporidiosis generally has grave
consequences in very young animals, a few days to a few weeks old,
and whose immune system is immature. Thus, Cryptosporidium spp, and
in particular C. parvum, has proved to be one of the commonest
etiological agents of neonatal diarrhoea, which causes severe
growth retardation and without suitable treatment may be fatal to
the animal.
[0016] Neonatal diarrhoea constitutes a constant threat for
breeders of bovines, ovines and caprins, and represents a
considerable economic loss due to the loss of income resulting from
retardation of growth, mortality of neonates, intervention of
veterinarians and the costs of therapeutic treatment and
rehydration. The etiology of neonatal diarrhoea is often multiple,
several infectious agents in fact being responsible for these
symptoms, in particular rotaviruses, coronaviruses, BVDV (Bovine
Viral Diarrhoea Virus), Escherichia coli and, of course, C. parvum.
The role of these various infectious agents in neonatal diarrhoea
of ruminants is difficult to estimate as diagnostics is rarely
carried out and there are regularly multiple infections. However,
C. parvum is currently considered to be the main factor in neonatal
diarrhoea (de Graaf et al., 1999, Int. J. Parasitol., 29:
1269-1287). Thus, a study carried out on calves with neonatal
diarrhoea demonstrated that 40% of them were infected with C.
parvum and three-quarters of them did not have any other infectious
agent (data from "Veterinary and Agrochemical Research Centre" in
Brussels).
[0017] In order to reduce the intensity and duration of the
symptoms, numerous molecules have been evaluated in various models,
but none has given satisfactory results. Thus, in domestic
ruminants, only halofuginone lactate (HaloCur.RTM.) and paromycin
have produced useful results, but do not allow complete control of
the parasite (Chartier, 2002, Le Point veterinaire Pathologic ovine
et caprine [The veterinary perspective. Pathologies of sheep and
goats], 112-117). In humans, and especially for treating AIDS
patients, the usual treatment is based on the use of paromomycin
(Humatin) or nitazoxanide. The two molecules have similar efficacy
but nitazoxanide is judged less toxic. Moreover, specific
inhibitors of calcium-dependent protein kinases of T. gondii and of
C. parvum have recently been developed (WO 2011/094628 A1). These
are in particular compounds belonging to the classes of the
pyrazolopyrimidines and the imidazo[1,5-.alpha.]pyrazines. These
inhibitors affect the capacity of the parasites for invasion and
proliferation, without disturbing the biological activities of the
host cell.
[0018] In conclusion, whether in humans or animals, at present
there is no specific treatment making it possible to effectively
combat cryptosporidiosis, and only prevention, based on strict
rules of hygiene, allow a reduction in the ingestion of water or
foodstuffs contaminated with C. parvum.
[0019] There is consequently a real need for agents for the
prevention and treatment of cryptosporidiosis in mammals, in
particular mammals that have an immature or deficient immune
system. In fact, as infection may occur during the first few days,
the neonates have an immune system that is still developing, making
a conventional vaccination scheme impossible in young mammals.
Thus, prophylactic trials conducted with killed parasites on
neonate calves in a region where the disease is highly endemic did
not show any significant protection (Harp et al., 1996,
Am.J.Vet.Res., 57: 1586-1588; Harp et al., 1998, J.Dairy.Sci. 81:
289-294).
[0020] It has, however, been demonstrated that the immune response
to C. parvum leads to the development of a protective response of
type Th1 with considerable production of the cytokines IL-12 and
IFN-.gamma.. It has also been demonstrated that these cytokines are
able to lessen the impact of infection (Lacroix et al., 2001,
Infect. Immun., 69: 1635-42).
[0021] One of the aims of the invention is to provide an
immunostimulant capable of inducing a non-specific immune response
in the neonate, with the production of IL-12 and IFN.gamma..
[0022] Another aim of the invention is to provide an
immunostimulant capable of limiting the effects of infection of
mammals, human or animal, by Cryptosporidium parvum.
[0023] Yet another aim of the invention is to provide a
prophylactic treatment, and in particular a vaccine, against
cryptosporidiosis.
[0024] The present invention relates to strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp, isolated from their
natural environment and having an immunostimulant effect, for the
use thereof in the prevention or the treatment, in a mammal, of a
disorder associated with an apicomplexan of the family
Cryptosporidiidae.
[0025] The present invention relates to attenuated strains of
Sarcocystidae selected from attenuated Toxoplasma spp or attenuated
Neospora spp, isolated from their natural environment and having an
immunostimulant effect, for the use thereof in the prevention or
the treatment, in a mammal, of a pathology associated with an
apicomplexan of the family Cryptosporidiidae.
[0026] The present invention relates to strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp isolated from their
natural environment and having an immunostimulant effect, for the
use thereof in the prevention or the treatment, in a mammal, of a
pathology associated with an apicomplexan of the family
Cryptosporidiidae, said strains having attenuated virulence
relative to the wild strains that induce a pathology associated
with Toxoplasma spp or Neospora spp.
[0027] By way of example, without limiting the scope of the present
invention, such wild strains of apicomplexans may be illustrated by
a virulent strain of T. gondii of type RH for toxoplasmosis, or a
virulent strain of N. caninum of type NC1 for neosporosis.
[0028] The present invention relates to strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp isolated from their
natural environment and having an immunostimulant effect, for the
use thereof in the prevention or the treatment, in a mammal, of a
pathology associated with an apicomplexan of the family
Cryptosporidiidae, said strains having attenuated virulence
relative to a virulent strain, i.e. a strain having virulence
substantially identical to the virulence of the strain from which
the strain with attenuated virulence was obtained.
[0029] By "immunostimulant" is meant the ability of a strain of
Toxoplasma spp or Neospora spp to induce early activation of the
immune system of the host. This activation involves components of
the immune system such as interferons, cytokines, phagocytic cells,
NK (Natural Killer) cells, dendritic cells and the complement
system, which will act in a non-specific fashion on the targeted
pathogen. This immunostimulation is not based on the establishment
of adaptive immunity.
[0030] By "prevention" is meant prophylaxis with the aim of
preventing the appearance or spreading of a disease. It is in
particular a question of protecting an individual with
predisposition to contracting and developing a disorder associated
with an apicomplexan of the family Cryptosporidiidae. Such
individuals are in particular neonates that have an immature immune
system or individuals with an immune system dysfunction. It is also
a question of protecting a mammal exposed to a risk of
contamination from its environment.
[0031] By "treatment" is meant not only inhibition of the
progression of the pathology but also attenuation of the symptoms
associated with this pathology. The treatment has the aim of
reducing the extent of the symptoms until they disappear
completely, allowing the individual to recover a normal
physiological state.
[0032] By "mammal" is meant human beings, certain commercial or
farm animals and certain pet animals.
[0033] By "attenuated strains of Toxoplasma spp or Neospora spp" is
meant strains of Toxoplasma spp or Neospora spp having an
attenuated virulence, less than the virulence of the wild strains
of T. gondii or of N. caninum capable of inducing a pathology, but
which nevertheless conserve immunogenicity so as to be able to be
used in the prevention or the treatment of a disorder associated
with an apicomplexan of the family Cryptosporidiidae. The
attenuation of virulence may result either from a natural process
of evolution of the species or may be induced in particular by
techniques of molecular biology familiar to a person skilled in the
art. Whether it is of natural origin or the result of human
activity, the attenuation of virulence is due to the absence of
expression of virulence factors or to the expression of one or more
virulence factors that are non-functional or have an altered
function. The in vitro modification of the genetic heritage of
Toxoplasma spp or Neospora spp confers a mutant character on the
strain, relative to the wild-type strain from which it is derived.
The wild strains of parasites not only have an immunogenic
potential but are also virulent, i.e. they are capable of inducing
a pathology associated with Toxoplasma spp or Neospora spp (i.e.
toxoplasmosis and neosporosis respectively), making their use
unsuitable in the context of the present invention. The virulence
of the strains of Toxoplasma spp or of Neospora spp may in
particular be evaluated by in vitro cellular infectivity tests or
by infectivity tests in animals.
[0034] The cellular infectivity tests are carried out by depositing
tachyzoites on confluent cells, for example HFF (Human Foreskin
Fibroblast) cells or Vero cells, cell lines frequently used for the
production of tachyzoites of T. gondii or of N. caninum. The number
of vacuoles formed and the number of parasites in each vacuole is
determined by microscopic observation. For the infectivity tests in
animals, the various strains are injected into the animals and the
survival of these animals is monitored over time (Cerede et al.,
2005).
[0035] By "pathologies associated with an apicomplexan of the
family Cryptosporidiidae" is meant the diseases resulting from an
infection by a protozoon belonging to the phylum of the
apicomplexans, and in particular parasites belonging to the family
Cryptosporidiidae, which comprises the genus Cryptosporidium.
Several tens of species of Cryptosporidium are referenced (Fayer R,
2010, Exp. Parasitol., 124, 90-7). These parasites are capable of
invading the mucosal epithelia.
[0036] According to a particular embodiment, in the use according
to the present invention of the strains of Sarcocystidae selected
from Toxoplasma spp or Neospora spp isolated from their natural
environment and having an immunostimulant effect, said mammal is a
neonate.
[0037] The present invention relates to strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp, isolated from their
natural environment and having an immunostimulant effect, for use
in the prevention or the treatment, in a neonate mammal, of a
pathology associated with an apicomplexan of the family
Cryptosporidiidae.
[0038] By "neonate" is meant a mammal from the time of its birth
until it is weaned, i.e. until the moment when the mammal becomes
capable of feeding itself and is no longer dependent on its
mother's milk. The main advantage of using the mutant strain of
Toxoplasma spp or Neospora spp for the prevention and/or the
treatment of pathologies associated with an apicomplexan of the
family Cryptosporidiidae in the neonate is stimulation of its
immature immune system in order to induce a non-specific immune
response by synthesizing molecules that inhibit the growth of the
Apicomplexa.
[0039] According to a particular embodiment, in the use according
to the present invention of the strains of Sarcocystidae selected
from Toxoplasma spp or Neospora spp isolated from their natural
environment and having an immunostimulant effect, said mammal is a
human being or an animal.
[0040] The animals to which the present invention relates are
mainly commercial or farm animals, which are of interest to the
agricultural and food industries, but also certain pet animals.
[0041] According to a more particular embodiment, in the use
according to the present invention of the strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp isolated from their
natural environment and having an immunostimulant effect, said
animal belongs to the group comprising or constituted by of ovines,
caprids, porcines, bovines, equines, camelids, canids or felids
(Fayer, 2004, Vet. Parasitol., 126, 37-59).
[0042] According to another embodiment, in the use according to the
present invention of the strains of Sarcocystidae selected from
Toxoplasma spp or Neospora spp isolated from their natural
environment and having an immunostimulant effect, said strains of
Toxoplasma spp or of Neospora spp have at least an adhesin MIC1
and/or an adhesin MIC3 inactivated by a genetic modification
relating to at least one of the genes mid and/or mic3.
[0043] By "an adhesin MIC1 and/or an adhesin MIC3" is meant the
proteins of the micronemes, also called adhesins, MIC1 and/or MIC3
which play a role in the mobility, the migration or the invasion of
parasites of the phylum Apicomplexa in its host. These proteins
have linkage modules that allow them to bind to the target cells of
the host.
[0044] By "an inactivated adhesin" is meant an adhesin the function
of which can no longer be ensured within the cell. An adhesin is
inactivated when it is not produced or when it is produced but does
not have functional activity or has reduced functional activity.
The inactivation also relates to an adhesin that can no longer bind
to other proteins in order to form a complex.
[0045] By "genetic modification" is meant any mutation made in the
nucleic acid sequence of a gene leading to the absence of
expression of the protein encoded by that gene or leading to
expression of a non-functional or less functional form of the
protein encoded by that gene. This operation requires human
intervention when it is carried out in vitro. This mutation may
consist of the deletion of all or part of the gene, or of its
coding region, or of its promoter region, and of the insertion or
the substitution of nucleotides in the nucleotide sequence of the
gene.
[0046] By "mic1 gene" is meant the gene coding for the protein of
the micronemes MIC1, also called adhesin MIC1. This protein
contains several modules, including binding domains that bind
lactose specifically. The protein MIC1 is also capable of binding
to the surface of the host cells.
[0047] The detailed construction of the Toxo mid KO strain is
described in documents U.S. Pat. No. 7,946,185 B2 and EP 1 703 914
B1. The detailed construction of the Neo ncmic1 KO strain is
described in the present application.
[0048] By "mic3 gene" is meant the gene coding for the protein of
the micronemes MIC-3, also called adhesin MIC3. This protein
homodimerizes in order to form a complex of 90 kDa. MIC3 comprises
domains of the EGF type and a domain of the lectin type. The
protein MIC3 is also capable of binding to the surface of the host
cells.
[0049] The detailed construction of the Toxo mic3 KO strain is
described in documents U.S. Pat. No. 7,946,185 B2 and EP 1 703 914
B1. The detailed construction of the Neo ncmic3 KO strain is
described in the present application.
[0050] According to another particular embodiment, in the use
according to the present invention of the strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp isolated from their
natural environment and having an immunostimulant effect, said
strains of Toxoplasma spp or of Neospora spp have the two adhesins
MIC1 and MIC3 inactivated by a genetic modification relating to the
two genes mid and mic3.
[0051] By "genetic modification relating to the two genes mid and
mic3" is meant the mutation made in the nucleic acid sequence of
the mid gene and in that of the mic3 gene. This double mutation
leads to the absence of expression of the proteins MIC1 and MIC3 or
leads to the expression of a non-functional or less functional form
of the proteins MIC1 and MIC3. These mutant strains of Toxoplasma
spp or of Neospora spp are called Toxo mic1-3 KO or Neo ncmic1-3 KO
respectively and have a very attenuated virulence in comparison
with the wild strains of T. gondii of type RH or of N. caninum of
type NC1 from which they are derived. However, the Toxo mic1-3 KO
or Neo ncmic1-3 KO strains retain a strong immunogenicity. The
detailed construction of the Toxo mic1-3 KO strain is described in
documents U.S. Pat. No. 7,946,185 B2 and EP 1 703 914 B1. The
detailed construction of the Neo ncmic1-3 KO strain is described in
the present application.
[0052] The Toxo mic1-3 KO and Neo ncmic1-3 KO strains retained
their capacity for colonizing the target tissues without the
development of a pathogenic effect following administration of said
strains to a mammal. The knock out of the genes mid and mic3 has
little or no effect on the immunogenic potential of these strains,
but reduces their virulence considerably relative to a virulent
strain, i.e. a strain having a virulence substantially identical to
the virulence of the strain from which the strain with attenuated
virulence was obtained.
[0053] The inoculation of the Toxo mic1-3 KO strain in neonate mice
leads to the production of cytokines IL-12 and IFN-.gamma. and
effectively protects the mouse pups from subsequent infection with
Cryptosporidium parvum.
[0054] The mutant Toxo mic1-3 KO strain effectively stimulates the
production of IL-12 and IFN-.gamma. from cells of the mesenteric
lymph nodes and splenocytes of lambs, confirming the possibility of
using this mutant strain as an immunostimulant in this target
animal species.
[0055] According to a particular embodiment, in the use according
to the present invention of the strains of Sarcocystidae selected
from Toxoplasma spp or Neospora spp isolated from their natural
environment and having an immunostimulant effect, said strains of
Toxoplasma spp or of Neospora spp are respectively Toxoplasma
gondii or Neospora caninum.
[0056] According to another embodiment, in the use according to the
present invention of the strains of Sarcocystidae selected from
Toxoplasma spp or Neospora spp isolated from their natural
environment and having an immunostimulant effect, said
immunostimulant effect of said strains leads to the secretion of
interleukin-12 (IL-12) and then of interferon-.gamma.
(IFN-.gamma.).
[0057] By "interleukin-12 (IL-12)" is meant the cytokine
synthesized by immune system cells such as the monocytes, the
dendritic cells and the macrophages. The cytokine is secreted early
and will thus activate the target cells (T cells and Natural Killer
cells) so that the latter secrete IFN-.gamma. in their turn.
[0058] By "interferon-.gamma. (IFN-.gamma.)" is meant the cytokine
synthesized by the T lymphocytes CD4+, CD8+ and the Natural Killer
(NK) cells activated by IL-12. The secretion of IFN-.gamma. by the
cells of the organism will allow production of an innate response
protective against C. parvum. This cytokine will have a pleiotropic
activity owing to the diversity of the targeted cell lines.
[0059] By "cytokines" is meant all the molecules involved in the
development and the regulation of the immune system. The cytokines
are glycosylated or non-glycosylated proteins, which may be
classified according to their biological activity: [0060]
pro-inflammatory: this includes the interleukins (IL) and the
tumour necrosis factors (TNF), [0061] immunoregulatory: this
includes the interleukins (IL), [0062] effector: this includes the
interferons (IFN), the tumour necrosis factors (TNF) and the
chemokines.
[0063] According to another more particular embodiment, in the use
according to the present invention of the strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp isolated from their
natural environment and having an immunostimulant effect, said
secretion of interleukin-12 (IL-12) and of interferon-.gamma.
(IFN-.gamma.) begins between 3 and 9 days after using said strains
of Toxoplasma spp or of Neospora spp as immunostimulant.
[0064] According to a more particular embodiment, in the use
according to the present invention of the strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp isolated from their
natural environment and having an immunostimulant effect, said
pathology associated with an apicomplexan of the family
Cryptosporidiidae is cryptosporidiosis.
[0065] By "cryptosporidiosis" is meant the pathology characterized
by symptoms such as cramps, fever, fatigue, nausea and especially
diarrhoea, which may lead to the dehydration of the mammal infected
by Cryptosporidium parvum or by another Cryptosporidium species.
Cryptosporidiosis mainly affects the intestines of mammals but may
also infect the biliary and pancreatic tracts and the respiratory
tract in an immunodepressed individual. The infestation occurs by
ingestion of oocysts present in the excrement of parasitized
animals with which the environment is contaminated (water, earth or
raw food). The symptoms appear two to ten days after the infection
occurred and persist for more than two weeks. The severity of this
pathology varies depending on the age of the infected host but more
particularly on the state of its immune system. In a host having a
mature and functional immune system, cryptosporidiosis has no
effect on the health of the host. Conversely, a host that is very
young, very old or has an immature or deficient immune system may
develop very severe forms of cryptosporidiosis.
[0066] By "immature or deficient immune system" is meant the immune
system for which one or more cell lines are either absent, or
deficient. The immaturity of the immune system is a common trait in
neonate mammals, which makes them particularly vulnerable to
parasitic infections. The absorption of antibodies from the mother
via the colostrum endows the neonate with a certain degree of
protection while its immune system is being established. The
immaturity or the deficiency of the immune system may also result
from pathologies of a genetic origin, in particular in humans, such
as Wiskott-Aldrich syndrome, an X-linked lymphoproliferative
syndrome. This deficiency may also arise after an infection by the
human immunodeficiency virus (HIV) or following a therapeutic
treatment associated with an organ graft or the medical management
of certain cancers by chemo- or radiotherapy. The mammals that have
an immature or deficient immune system are particularly vulnerable
to infections with apicomplexans.
[0067] According to an even more particular embodiment, in the use
according to the present invention of the strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp isolated from their
natural environment and having an immunostimulant effect, said
apicomplexan of the family Cryptosporidiidae responsible for
cryptosporidiosis is at least one apicomplexan selected from the
group constituted by Cryptosporidium parvum, Cryptosporidium bovis,
Cryptosporidium andersoni, Cryptosporidium ryanae, Cryptosporidium
muris, Cryptosporidium ubiquitum, Cryptosporidium hominis,
Cryptosporidium canis, Cryptosporidium felis, Cryptosporidium
baileyi, Cryptosporidium meleagridis or Cryptosporidium xiaoi.
[0068] By "Cryptosporidium parvum, Cryptosporidium bovis,
Cryptosporidium andersoni, Cryptosporidium ryanae, Cryptosporidium
muris, Cryptosporidium ubiquitum, Cryptosporidium hominis,
Cryptosporidium canis, Cryptosporidium felis, Cryptosporidium
baileyi, Cryptosporidium meleagridis or Cryptosporidium xiaoi" is
meant the protozoa of the phylum Apicomplexa capable of causing
intestinal pathologies of a hydric nature in the majority of
mammals. These parasites are in particular capable of causing
cryptosporidiosis in ovines, caprins, porcines, bovines, equines,
camels, camelids, canids, felids or humans (Payer, 2004, Vet.
Parasitol., 126, 37-59) that have an immature or deficient immune
system.
[0069] The present invention also relates to the strains of
Toxoplasma gondii or of Neospora caninum that have the two adhesins
MIC1 and MIC3 inactivated by a genetic modification relating to the
two mid and mica genes for the use thereof in the prevention or the
treatment, in a mammal, of a pathology associated with an
apicomplexan of the family Cryptosporidiidae, said pathology
associated with an apicomplexan of the family Cryptosporidiidae
being cryptosporidiosis.
[0070] The present invention also relates to the strains of
Toxoplasma gondii or of Neospora caninum isolated from their
natural environment and having an immunostimulant effect, for use
in the prevention or the treatment, in a mammal, of a pathology
associated with an apicomplexan of the family Cryptosporidiidae,
said strains of Toxoplasma gondii or of Neospora caninum having the
two adhesins MIC-1 and MIC-3 inactivated by a genetic modification
relating to the two mic-1 and mic-3 genes, and said pathology
associated with an apicomplexan of the family Cryptosporidiidae is
cryptosporidiosis.
[0071] The invention also relates to the strains of Toxoplasma
gondii or of Neospora caninum isolated from their natural
environment and having an immunostimulant effect, said strains of
Toxoplasma gondii or of Neospora caninum having the two adhesins
MIC1 and MIC3 inactivated by a genetic modification relating to the
two mic1 and mic3 genes for the use thereof in the prevention or
the treatment, in a mammal, of a pathology associated with an
apicomplexan of the family Cryptosporidiidae, said strains of
Toxoplasma gondii or of Neospora caninum being administered to said
mammal at a rate from 20 to 10.sup.9 tachyzoites.
[0072] By "tachyzoite" is meant the rapidly multiplying form of
Toxoplasma gondii or of Neospora caninum. The tachyzoite has a
crescent shape and a variable size of 5-8.times.2-3 .mu.m. The
apical part of the parasite comprises conoids which participate in
the penetration of the parasite into the host cell. The micronemes,
the rhoptries and the dense granules constitute the three major
organelles of the tachyzoite, which also comprises a nucleus, an
apicoplast, a Golgi apparatus, an endoplasmic reticulum and an
organite similar to the mitochondrion.
[0073] The determination of an effective dose of tachyzoites for
the prophylactic treatment of mammals makes it possible to limit
the infection or the transmission of the pathogenic agent
responsible for cryptosporidiosis. Such a treatment may be adapted
and/or repeated as many times as necessary by a person skilled in
the art, depending on the age and immunological status of the
mammal.
[0074] The tachyzoites may be brought into contact with the mammal
not only on a mammal presenting the symptoms characteristic of
cryptosporidiosis but also on a mammal without any of the symptoms
of cryptosporidiosis but which is in contact with other mammals
infected by Cryptosporidium parvum or by another species of
Cryptosporidium able to induce cryptosporidiosis.
[0075] According to a particular embodiment, the strains of
Sarcocystidae selected from Toxoplasma spp or Neospora spp isolated
from their natural environment and having an immunostimulant effect
for the use thereof according to the present invention are in a
galenic form selected from the group comprising or constituted by
liquid suspensions, solid or liquid dispersions, powders, pastes or
lyophilizates.
[0076] The galenic form is adapted by a person skilled in the art
depending on the method of administration selected. All the
conventional methods of administration may be envisaged: by
parenteral route (intravenous, subcutaneous, intradermal,
intramuscular, intraperitoneal, and intranasal) or by enteral
route.
[0077] According to a more particular embodiment, the strains of
Sarcocystidae selected from Toxoplasma spp or Neospora spp isolated
from their natural environment and having an immunostimulant effect
for the use thereof according to the present invention are
associated with at least one other antigen, or at least one
adjuvant, or at least one stabilizer, or at least one preservative
or a mixture of at least two of said products for increasing the
immune response of said mammal.
[0078] By "antigen" is meant any natural or recombinant protein, in
its native or mutated form, originating from a parasite or from a
pathogen other than Toxoplasma spp or Neospora spp capable of
inducing a cellular or humoral immune response in a mammal. The aim
of combining the mutant strain of Toxoplasma spp or Neospora spp
with such an antigen is to amplify the mammal's immune response and
thus endow it with better protection against an apicomplexan
infection.
[0079] By "adjuvant" is meant any substance capable of reinforcing
and prolonging the immune response directed against the targeted
antigen. The mechanism involved in order to make the immune
response more effective is dependent on the adjuvant used. The
adjuvants are substances which are well known to a person skilled
in the art and in particular include aluminium salts, squalene,
saponins, the bacterial constituents or toxins, or also certain
proteins (peptone, albumin, casein).
[0080] By "stabilizers or preservatives" is meant the compounds
allowing perfect preservation of the strains of Toxoplasma spp or
Neospora spp in their packaging.
[0081] Stabilizers or preservatives are substances which are well
known to a person skilled in the art and in particular include the
carbohydrates (sorbitol, mannitol, lactose, sucrose, glucose,
dextran, trehalose), the polar organic solvents, such as DMSO
(dimethylsulphoxide), and the polysorbates.
[0082] By "to increase the immune response" is meant the activation
of various pathways of the immune system. In a mammal that has an
immature or deficient immune system, it is a question of activating
the non-specific response by increasing the synthesis of different
categories of cytokines, such as the interferons or the
interleukins. Among these cytokines interleukin-12 (IL-12) may be
mentioned, which will activate the CD4+ or CD8+LT cells as well as
the NK cells. These activated cells will in their turn secrete
interferon .gamma. (IFN-.gamma.), which plays a role in the
immunological mechanisms that control the multiplication of many
intracellular parasites, thus preventing their propagation in the
organism. In an adult mammal having a mature immune system, the
increase in the immune response passes via an adaptive immunity
(specific proliferation in response to the foreign antigens) in
addition to the non-specific response.
[0083] The present invention also relates to a method of inducing
an immune response in a mammal comprising a step of administration,
to said mammal, of tachyzoites of strains of Sarcocystidae selected
from Toxoplasma spp or Neospora spp, isolated from their natural
environment and having an immunostimulant effect, allowing an
immune response to be induced.
[0084] The present invention also relates to a method of inducing
an immune response in a neonate mammal comprising a step of
administration, to said neonate mammal, of tachyzoites of strains
of Sarcocystidae selected from Toxoplasma spp or Neospora spp,
isolated from their natural environment and having an
immunostimulant effect, allowing an immune response to be
induced.
[0085] By "immune response" is meant the two essential phases
constituted by the recognition of the antigen and the reaction
intended to eliminate said antigen. When an antigen enters the body
for the first time, it is the non-specific immune response that is
activated. It uses non-clonal mechanisms, since it does not require
specific cellular clones. The inflammatory reaction created by this
non-specific response will lead to adaptive immunity. This response
involves cells specifically recognizing the antigen and will then
lead to clonal expansion. This clonal expansion will result in a
very effective immune response and a memory response (specific
immune response following the second entry of the antigen into the
organism).
[0086] According to a particular embodiment, in the method
according to the present invention, said mammal is a neonate.
[0087] According to a more particular embodiment, in the method
according to the present invention, said mammal is a human being or
an animal.
[0088] According to an even more particular embodiment, in the
method according to the present invention, the animal belongs to
the group comprising or constituted by ovines, caprins, porcines,
bovines, equines, camelids, canids or felids.
[0089] According to another embodiment, in the method according to
the present invention, said strains of Sarcocystidae selected from
Toxoplasma spp or Neospora spp have at least one adhesin MIC1
and/or one adhesin MIC3 inactivated by a genetic modification which
relates to at least one of the mic1 and/or mic3 genes.
[0090] According to another particular embodiment, in the method
according to the present invention, said strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp have the two adhesins
MIC1 and MIC3 inactivated by a genetic modification which relates
to the two mid and mic3 genes.
[0091] According to another more particular embodiment, in the
method according to the present invention, said strains of
Sarcocystidae selected from Toxoplasma spp or Neospora spp are
respectively Toxoplasma gondii or Neospora caninum.
[0092] According to yet another particular embodiment, in the
method according to the present invention, the strains of
Sarcocystidae selected from Toxoplasma spp or Neospora spp induce a
non-specific immune response in particular characterized by the
secretion of IL-12 and/or IFN-.gamma..
[0093] The present invention also relates to a method for
protecting a mammal against a parasitosis associated with an
apicomplexan of the family Cryptosporidiidae comprising a step of
administration, to said mammal, tachyzoites of strains of
Sarcocystidae selected from Toxoplasma spp or Neospora spp,
isolated from their natural environment and having an
immunostimulant effect, for inducing protection against said
parasitosis.
[0094] According to a more particular embodiment, in the method
according to the present invention, the mammal is a neonate.
[0095] According to an even more particular embodiment, in the
method according to the present invention, the mammal is a human
being or an animal.
[0096] According to a particular embodiment, in the method
according to the present invention, the animal belongs to the group
comprising or constituted by ovines, caprins, porcines, bovines,
equines, camelids, canids or felids.
[0097] According to a particular embodiment, in the method
according to the present invention, said strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp have at least one
adhesin MIC1 and/or one adhesin MIC3 inactivated by a genetic
modification which relates to at least one of the mic1 and/or mic3
genes.
[0098] According to a more particular embodiment, in the method
according to the present invention, said strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp have the two adhesins
MIC1 and MIC3 inactivated by a genetic modification which relates
to the two mid and mic3 genes.
[0099] According to a more particular embodiment, in the method
according to the present invention, said parasitosis associated
with an apicomplexan of the family Cryptosporidiidae is
cryptosporidiosis.
[0100] According to another more particular embodiment, in the
method according to the present invention, the apicomplexan of the
family Cryptosporidiidae responsible for the cryptosporidiosis is
at least one apicomplexan selected from the group constituted by
Cryptosporidium parvum, Cryptosporidium bovis, Cryptosporidium
andersoni, Cryptosporidium ryanae, Cryptosporidium muris,
Cryptosporidium ubiquitum, Cryptosporidium hominis, Cryptosporidium
canis, Cryptosporidium felis, Cryptosporidium baileyi,
Cryptosporidium meleagridis or Cryptosporidium xiaoi.
[0101] According to an even more particular embodiment, in the
method according to the present invention, the administration, to
said mammal, of said tachyzoites of said strains of Sarcocystidae
selected from Toxoplasma spp or Neospora spp is carried out by
enteral route or by parenteral route.
[0102] According to yet another embodiment, in the method according
to the present invention, the administration, to said mammal, of
said tachyzoites of said strains of Sarcocystidae selected from
Toxoplasma spp or Neospora spp is carried out before exposure of
said mammal to the apicomplexan of the family Cryptosporidiidae
responsible for cryptosporidiosis.
[0103] According to yet another embodiment, in the method according
to the present invention, the administration, to said mammal, of
said tachyzoites of said strains of Sarcocystidae selected from
Toxoplasma spp or Neospora spp is carried out during exposure of
said mammal to the apicomplexan of the family Cryptosporidiidae
responsible for cryptosporidiosis.
[0104] According to yet another embodiment, in the method according
to the present invention, the administration, to said mammal, of
said tachyzoites of said strains of Sarcocystidae selected from
Toxoplasma spp or Neospora spp is carried out after exposure of
said mammal to the apicomplexan of the family Cryptosporidiidae
responsible for cryptosporidiosis.
[0105] In the aforementioned three embodiments, said mammal may be
a neonate.
[0106] The following figures and examples are given purely by way
of illustration of the subject of the present invention and do not
in any way constitute a limitation thereof.
DESCRIPTION OF THE FIGURES
[0107] FIG. 1: this figure illustrates the 2 steps of homologous
recombination in order to obtain the strain Neo ncmic1-3 KO. The
first step of homologous recombination allows integration of the
gene coding for the enzyme dihydrofolate reductase (DHFR) at the
locus of the ncmic3 gene. Selection with pyrimethamine makes it
possible to amplify the mutant single strain Neo ncmic3 KO. The Neo
ncmic3 KO strain thus obtained serves for the second step of
homologous recombination, which allows the integration of the gene
coding for the chimeric protein
chloramphenicol-acetyl-transferase/green fluorescent protein
(CAT-GFP) at the locus of the ncmic1 gene. Selection with
chloramphenicol then makes it possible to amplify the double mutant
strain Neo ncmic1-3 KO.
[0108] FIG. 2-A: this figure is a schematic representation of the
pNcMic3KO-DHFR plasmid. This plasmid with 11,312 base pairs
comprises the DHFR selection gene flanked by the homologous regions
(5HR-NcMic3 and 3HR-NcMic3) of the sequences flanking the ncmic3
gene, the ampicillin resistance gene (Amp) as well as the Not I
restriction site which permits its linearization.
[0109] FIG. 2-B: this figure is a schematic representation of the
pNcMic1KO-CAT-GFP plasmid. This plasmid with 10,069 base pairs
comprises the CAT-GFP selection gene flanked by the homologous
regions (3HR-NcMic1 and 5HR-NcMic1) of the sequences flanking the
ncmic1 gene, the ampicillin resistance gene (Amp) as well as the
Kpn I restriction site which permits its linearization.
[0110] FIG. 3-A: this figure shows the electrophoretic profiles of
the PCR products obtained respectively in the wild-type strain NC1
of N. caninum and in the mutant strain Neo ncmic3 KO, using the
sets of PCR primers No. 1, No. 2 or No. 3 in Table II which
correspond to SEQ ID NO: 5 to SEQ ID NO: 10.
[0111] FIG. 3-B: this figure shows the electrophoretic profiles of
the PCR products obtained respectively in the wild-type strain NC1
of N. caninum and in the mutant strain Neo ncmic3 KO, using the
sets of PCR primers No. 4, No. 5, No. 6 or No. 7 in Table II which
correspond to SEQ ID NO: 11 to SEQ ID NO: 16.
[0112] FIG. 4-A: this figure illustrates the analysis for detecting
the NcMIC3 protein in the wild-type strain NC1 of N. caninum by
immunofluorescence, using an antibody specifically recognizing the
NcMIC3 protein. One and the same microscopic field is visualized in
direct light (image A) or in fluorescence (image B).
[0113] FIG. 4-B: this figure illustrates the analysis for detecting
the NcMIC3 protein in the mutant strain of N. caninum Neo ncmic3 KO
by immunofluorescence, using an antibody specifically directed
against the NcMIC3 protein. One and the same microscopic field is
visualized in direct light (image A) or in fluorescence (image
B).
[0114] FIG. 5: this figure shows the electrophoretic profiles of
the PCR products obtained respectively in the wild-type strain NC1
of N. caninum, in the mutant strain Neo ncmic3 KO and in the mutant
strain Neo ncmic1-3 KO using the sets of PCR primers No. 1 to No.
12 in Table VII which correspond to SEQ ID NO: 7 to 16 and to SEQ
ID NO: 21 to 30.
[0115] FIG. 6: this figure illustrates the analysis for detecting
the GFP protein in the mutant strains Neo ncmic3 KO (images A and
B) and Neo ncmic1-3 KO (image C and D) by immunofluorescence, using
the fluorescent properties of the CAT-GFP protein. One and the same
microscopic field is visualized in direct light (top images A and
C) or in fluorescence (bottom images B and D).
[0116] FIG. 7: FIG. 7 illustrates the assay of antibodies of type
IgM anti-Toxoplasma gondii in mouse pup serum. The assay of
antibodies of type IgM anti-Toxoplasma gondii in the serum was
carried out 3 days (empty grey squares) or 9 days (filled black
squares) after the mouse pups had received 20 tachyzoites of the
strain Toxo mic1-3 KO by intraperitoneal route. The mouse pups that
had not received any tachyzoite of the strain Toxo mic1-3 KO served
as controls. [0117] on the x-axis: batches of C57BL/6 mouse pups
controls (A) and inoculated with the strain Toxo mic1-3 KO (B)
[0118] on the y-axis: absorbance values measured at 405 nm. The
three mouse pups that received 20 tachyzoites of the strain Toxo
mic1-3 KO and were sacrificed at 9 days are shown by their number
(4, 5, 6) in FIG. 7.
[0119] FIG. 8-A: FIG. 8-A illustrates the measurement of the
expression of interferon-gamma (IFN-.gamma.) in the ileum of the
mouse pup. The expression level of the gene coding for IFN-.gamma.
was measured by quantitative PCR on the total RNAs extracted from a
fragment of ileum using specific primers (SEQ ID NO: 33 to 34), 9
days after the mouse pups had received 20 tachyzoites of the strain
Toxo mic1-3 KO by intraperitoneal route (filled black squares). The
mouse pups that had not received any tachyzoites of the strain Toxo
mic1-3 KO served as controls (empty grey squares). [0120] on the
x-axis: batches of C57BL/6 mouse pups controls (A) and inoculated
with the strain Toxo mic1-3 KO (B) [0121] on the y-axis:
IFN-.gamma./HPRT ratio. The three mouse pups that received 20
tachyzoites of the Toxo mic1-3 KO strain and were sacrificed at 9
days are shown by their number (4, 5, 6) in FIG. 8-A.
[0122] FIG. 8-B: FIG. 8-B illustrates the measurement of the
expression of interleukin-12 (p40 subunit) (IL-12p40) in the mouse
pup ileum. The expression level of the gene coding for IL-12p40 was
measured by quantitative PCR on the total RNAs extracted from a
fragment of ileum using specific primers (SEQ ID NO: 31 to 32), 9
days after the mouse pups received 20 tachyzoites of the strain
Toxo mic1-3 KO by intraperitoneal route (filled black squares). The
mouse pups that had not received any tachyzoites of the strain Toxo
mic1-3 KO served as controls (empty grey squares): [0123] on the
x-axis: batches of C57BL/6 mouse pups controls (A) and
immunostimulated by the strain Toxo mic1-3 KO (B) [0124] on the
y-axis: IL-12p40/HPRT ratio. The three mouse pups that received 20
tachyzoites of the strain Toxo mic1-3 KO and were sacrificed at 9
days are shown by their number (4, 5, 6) in FIG. 8-B.
[0125] FIG. 9: FIG. 9 illustrates the detection of the presence of
tachyzoites of Toxo mic1-3 KO in the intestine of the mouse pup.
The detection of the presence of tachyzoites of Toxo mic1-3 KO was
carried out by immunohistology on sections of the intestine 9 days
after the mouse pups received 20 tachyzoites of the strain Toxo
mic1-3 KO by intraperitoneal route Immunolabelling is carried out
using a rabbit anti-SAG-1 polyclonal antibody and an anti-rabbit
secondary antibody coupled to fluorescein isothiocyanate.
[0126] The detection of tachyzoites of Toxoplasma gondii mic1-3 KO
is shown for the intestines of the mouse pups No. 4 (B) and No. 6
(D). The tachyzoites appear in the form of white dots in the
intestinal muscles of the mouse pup No. 4 (B).
[0127] The nuclei of the cells of the intestinal villi and
intestinal muscles of the mouse pups No. 4 (C) and No. 6 (E) are
labelled with Hoechst and appear in the form of white dots.
[0128] FIG. 10: FIG. 10 illustrates the presence of Toxoplasma
gondii via the expression of the surface antigen SAG-1 in the ileum
of the mouse pup.
[0129] The cDNAs obtained from the total RNAs extracted from a
fragment of ileum served as a matrix for the amplification of SAG-1
by PCR using specific primers (SEQ ID NO: 37 to 38). The mouse pups
were sacrificed three days (T1) or 9 days (T2) after receiving 20
tachyzoites of the strain Toxo mic1-3 KO by intraperitoneal route
(V). The mouse pups that had not received any tachyzoite of the
strain Toxo mic1-3 KO served as controls (NV). The PCR products
were deposited on agarose gel.
[0130] SAG-1 was also amplified from the genomic DNA of the
wild-type strain of Toxoplasma gondii (RH) and from the genomic DNA
of the mutated strain of Toxo mic1-3 KO (KO). The amplification
products serve as controls of the size of the amplification product
of SAG-1.
[0131] The mouse pups are shown by their number (1, 2, 3, 4, 5, 6)
in FIG. 10.
[0132] FIG. 11: FIG. 11 illustrates the count of the oocysts of
Cryptosporidium parvum in the intestine of the mouse pup. The
number of oocysts of Cryptosporidium parvum was counted in a Thoma
cell from an extract of ground material of the intestine placed in
a sugar solution. The intestines originate from: [0133] the mouse
pups challenged with 500 000 parasites of Cryptosporidium parvum,
which had received 20 tachyzoites of the strain Toxo mic1-3 KO by
intraperitoneal route 3 days prior the challenge with
Cryptosporidium parvum (filled black squares), or [0134] the mouse
pups challenged with 500 000 parasites of Cryptosporidium parvum,
which had not received any tachyzoite of the strain Toxo mic1-3 KO
(empty grey squares).
[0135] The mouse pups are sacrificed 6 days after the infection by
Cryptosporidium parvum. [0136] on the x-axis: the batches of
C57BL/6 mouse pups infected by Cryptosporidium parvum alone (C.p)
or by Toxo mic1-3 KO and then Cryptosporidium parvum (T.g+C.p)
[0137] on the y-axis: the total number of oocysts of
Cryptosporidium parvum in the intestine.
[0138] FIG. 12: FIG. 12 illustrates the detection of the presence
of oocysts of Cryptosporidium parvum in the intestine of the mouse
pup. The number of oocysts of Cryptosporidium parvum was counted in
a Thoma cell from an extract of ground material of the intestine
placed in a sugar solution. The intestines originate from: [0139]
the mouse pups challenged with 1 000 000 parasites of
Cryptosporidium parvum, which had received 20 000 tachyzoites of
the strain Toxo mic1-3 KO by oral route 3 days prior the challenge
with Cryptosporidium parvum (filled black squares), or [0140] the
mouse pups challenged with 1 000 000 parasites of Cryptosporidium
parvum, which had not received any tachyzoite of the strain Toxo
mic1-3 KO (empty grey squares).
[0141] The mouse pups are sacrificed 7 days after the infection by
Cryptosporidium parvum. [0142] on the x-axis: the batches of
C57BL/6 mouse pups infected by Cryptosporidium parvum alone (C.p)
or by Toxo mic1-3 KO and then Cryptosporidium parvum (T.g+C.p)
[0143] on the y-axis: the total number of oocysts of
Cryptosporidium parvum in the intestine.
[0144] FIG. 13-A: FIG. 13-A illustrates the assay of interleukin-12
(IL-12) in the mononuclear cells from the spleen of lambs and of
adult sheep. Samples of mononuclear cells from the spleen of lambs
(grey triangles) and of adult sheep (black squares) were infected
in vitro by three different strains of Toxoplasma gondii: type I
wild-type strain (RH), type I mutant strain Toxo mic1-3 KO (KO) and
type II wild-type strain (Pru). Mononuclear cells from the spleen
of lambs and of adult sheep not infected in vitro serve as controls
(M). [0145] on the x-axis: the "RH": type I wild-type strain of
Toxoplasma gondii, "KO": strain Toxo mic 1-3 KO, "Pru" type II
wild-type strain, "M": spleen cells cultured in vitro without
stimulant (negative control) [0146] on the y-axis: the
concentration of IL-12 (IU/ml).
[0147] FIG. 13-B: FIG. 13-B illustrates the assay of interleukin-12
(IL-12) in the mononuclear cells originating from the mesenteric
lymph nodes of lambs and of adult sheep. Samples of mononuclear
cells originating from the mesenteric lymph nodes of lambs (grey
triangles) and of adult sheep (black squares) were infected in
vitro by three different strains of Toxoplasma gondii: type I
wild-type strain (RH), type I mutant strain Toxo mic1-3 KO (KO) and
type II wild-type strain (Pru). Mononuclear cells from the
mesenteric lymph nodes of lambs and of adult sheep not infected in
vitro serve as controls (M). [0148] on the x-axis: the "RH": type I
wild-type strain of Toxoplasma gondii, "KO": strain Toxo mic 1-3
KO, "Pru" type II wild-type strain, "M": spleen cells cultured in
vitro without stimulant (negative control) [0149] on the y-axis:
the concentration of IL-12 (IU/ml).
[0150] FIG. 13-C: FIG. 13-C illustrates the assay of interferon
gamma (IFN.gamma.) in the mononuclear cells from the spleen of
lambs and of adult sheep. Samples of mononuclear cells from the
spleen of lambs (grey triangles) and of adult sheep (black squares)
were infected in vitro by three different strains of Toxoplasma
gondii: type I wild-type strain (RH), type I mutant strain Toxo
mic1-3 KO (KO) and type II wild-type strain (Pru). Mononuclear
cells from the spleen of lambs and of adult sheep not infected in
vitro serve as controls (M). [0151] on the x-axis: the "RH": type I
wild-type strain of Toxoplasma gondii, "KO": strain Toxo mic 1-3
KO, "Pru" type II wild-type strain, "M": spleen cells cultured in
vitro without stimulant (negative control) [0152] on the y-axis:
the concentration of IFN.gamma. (ng/ml).
[0153] FIG. 14: FIG. 14 illustrates the change in body weight of
the lambs immunostimulated with 10.sup.6 tachyzoites Toxo mic1-3
KO, one day after their birth (batch A-black square) in comparison
with control lambs not immunostimulated (batch B-grey circle).
[0154] on the x-axis: the time elapsed after stimulation of the
lambs by Toxo mic1-3 KO (in days) [0155] on the y-axis: the body
weight of the lambs (in kilograms).
[0156] FIG. 15: FIG. 15 illustrates the production of IFN-.gamma.
after restimulation with the total extract of the strain Toxo
mic1-3 KO of mononuclear cells of the spleen of lambs
immunostimulated with 10.sup.6 tachyzoites Toxo mic1-3 KO, one day
after their birth (lambs No. 1416-1418-1421 and 1424) or of control
lambs (lambs 1428 and 1423), sacrificed 15 days after the immuno
stimulation, [0157] on the x-axis: the "medium": spleen cells
cultured in vitro without stimulant (control-), "Mic1-3 KO ET:
spleen cells restimulated with the total parasite extract of the
strain Toxo mic1-3 KO and "ConA": spleen cells stimulated by
concanavalin A (control+)] [0158] on the y-axis: the concentration
of IFN-.gamma. (in ng/ml).
[0159] FIG. 16: FIG. 16 illustrates the production of IFN-.gamma.
produced from the ex vivo culture of cells of subiliac and
popliteal lymph nodes of lambs immunostimulated with 10.sup.6
tachyzoites Toxo mic1-3 KO, one day after their birth (lambs No.
1416-1418-1421 and 1424) or of control lambs (lambs 1428 and 1423),
sacrificed 15 days after the immunostimulation. [0160] on the
x-axis: the cells of popliteal lymph nodes (A) and cells of
subiliac lymph nodes (B) [0161] on the y-axis: the concentration of
IFN-.gamma. (in pg/ml).
[0162] FIG. 17: FIG. 17 illustrates the survival of lambs
immunostimulated with 10.sup.6 tachyzoites Toxo mic1-3 KO, one day
after their birth and challenged with 5.10.sup.6 oocysts of C.
parvum (black square) and the control lambs only challenged (grey
circle).
[0163] The survival curves are of the Kaplan-Meier type. [0164] on
the x-axis: the time elapsed after infection of the lambs by C.
parvum (in days) [0165] on the y-axis: the survival of the lambs
(in %).
[0166] FIG. 18: FIG. 18 illustrates the daily weight gain of lambs
immunostimulated with 10.sup.6 tachyzoites Toxo mic1-3 KO, one day
after their birth and challenged with 5.10.sup.6 oocysts of C.
parvum (black square) and the control lambs only challenged (grey
diamond). [0167] on the x-axis: the time elapsed after stimulation
of the lambs by Toxo mic1-3 KO (in days) [0168] on the y-axis: the
weight change of the lambs (in kg).
[0169] The average weight gain (DAG, daily average gain) reflects
the rate of increase as a function of time according to the
formula: DAG weight=d Weight/d' Age.
[0170] FIG. 19: FIG. 19 illustrates the mean excretion of oocysts
C. parvum per gram of excrement of lambs immuno stimulated with
10.sup.6 tachyzoites Toxo mic1-3 KO, one day after their birth and
challenged with 5.10.sup.6 oocysts of C. parvum (black square) and
the control lambs only challenged (grey diamond). [0171] on the
x-axis: the time elapsed after infection of the lambs by C. parvum
(in days) [0172] on the y-axis: number of oocysts of C. parvum per
gram of excrement.
EXPERIMENTAL SECTION
[0173] In order to prepare the strain of N. caninum with the ncmic1
and ncmic3 genes knocked out, two steps of homologous recombination
were carried out. The first step of homologous recombination makes
it possible to obtain a simple mutant KO (strain Neo ncmic3 KO).
The second step of homologous recombination is carried out in the
strain Neo ncmic3 KO in order to obtain a doubly deleted strain
(Neo ncmic1-3 KO) (FIG. 1).
Example 1
Construction of the Mutant Strain Neo Ncmic3 KO
[0174] The haploidy of the genome of Neospora caninum during the
proliferative phase allows inactivation of a gene in a single
homologous recombination.
[0175] All the tachyzoites of the strain NC1 of Neospora caninum
used were produced in human fibroblasts (HFF) cultured in
Dulbecco's minimum medium (DMEM) supplemented with 10% of foetal
calf serum (FCS), 2 mM of glutamine, 50 U/mL of penicillin and 50
.mu.g/mL of streptomycin. They were harvested after mechanical
lysis of the host cells and 3 passes through a 25 G syringe.
[0176] a) Construction of the Plasmid pNcMic3KO-DHFR
[0177] The plasmid pNcMic3KO-DHFR (FIG. 2-A) contains the DHFR
(dihydrofolate reductase) selection gene, which confers resistance
to pyrimethamine. The DHFR selection gene is placed under the
control of the .alpha.-tubulin promoter of Toxoplasma gondii (aTUB5
promoter) to allow expression of the gene in the parasite. The
efficacy of this heterologous promoter had been demonstrated
beforehand in N. caninum. This cassette is framed by the homologous
regions (5HR-NcMic3 and 3HR-NcMic3) of the sequences flanking the
ncmic3 gene. The DHFR selection cassette makes it possible to carry
out selection for pyrimethamine.
[0178] The 5'UTR region of the ncmic3 gene was amplified by PCR
from the genomic DNA of the strain NC1 of Neospora caninum. For the
amplification, the primers 5 HR NCmic3 F KpnI and 5 HR NCmic3 R
ClaI (SEQ ID NO: 1 and SEQ ID NO: 2) allow amplification of the
5'UTR region of the ncmic3 gene and creation of two restriction
sites, which were used for cloning the 5HR fragment upstream of the
DHFR selection cassette into the plasmid pT230 DHFR (KpnI at 5' and
ClaI at 3' of the PCR fragment).
[0179] The 3'UTR region of the ncmic3 gene was amplified by PCR
from the genomic DNA of the strain NC1 of Neospora caninum. For the
amplification, the primers 3 HR NCmic3 F XbaI and 3 HR NCmic3 R
NotI (SEQ ID NO: 3 and SEQ ID NO: 4) allow amplification of the
3'UTR region of the ncmic3 gene and creation of two restriction
sites, which were used for cloning the 3HR fragment downstream of
the DHFR selection cassette in the plasmid pT230 5HR-NcMic3-DHFR
(XbaI at 5' and NotI at 3' of the PCR fragment). The sequences of
the primers are shown in Table I below.
TABLE-US-00001 TABLE I List of the primers used for integration of
the 5'UTR and 3'UTR sequences of the ncmic3 gene. Name of No. of
the primer 5' .fwdarw. 3' Sequence sequence 5 HR NCmic3
CGCGGTACCCATGTGAATATGCTTTA SEQ ID F KpnI ACCGTGAC NO: 1 5 HR NCmic3
CGCATCGATGAGCTATAACCCTTGGA SEQ ID R ClaI AATGACTC NO: 2 3 HR NCmic3
CGCTCTAGACATGCTGATGAAGAAGG SEQ ID F XbaI GAAGT NO: 3 3 HR NCmic3
CGCGCGGCCGCTCTCTCCTGAAGTCT SEQ ID R NotI TCGAGACC NO: 4 The
sequences of the restriction sites are underlined.
[0180] b) Conditions for Electroporation and Selection
[0181] 50 .mu.g of the plasmid pNcMic3KO-DHFR, purified and then
linearized by NotI, was added to 5.times.10.sup.7 NC1 tachyzoites
of Neospora caninum suspended in the CYTOMIX electroporation medium
containing ATP (3 mM) and glutathione (3 mM) (Van den Hoff et al.,
Nucleic Acid Research, June 11; 20(11): 2902), and electroporation
was carried out in a cuvette with a 4 mm gap, in a volume of 800
.mu.L on a BioRad apparatus (parameters: 2000 V, 50 ohms, 25 .mu.F,
with two electric shocks).
[0182] After electroporation, the tachyzoites were deposited on a
monolayer of HFF cells in culture. For selection of the mutants,
the culture medium is replaced and supplemented with the selection
agent (2 .mu.M pyrimethamine), 24 h after electroporation. Three
culture passages are carried out in this medium.
[0183] After 16 days of selection, the resistant parasites are
cloned by limit dilution in the wells of 96-well plates of HFF
cells. After amplification, the lysis plaques caused by the
parasite are investigated. The parasites are subcultured and their
genomic DNA is extracted for PCR analyses. These PCR analyses
should confirm integration of the transgene but should also allow
differentiation of the parasites that have randomly integrated the
transgene from the parasites of interest the ncmic3 gene of which
has been effectively suppressed by homologous recombination.
[0184] c) PCR Analysis
[0185] Starting from the genomic DNA, PCRs were carried out for:
[0186] investigating the size of the DNA fragment amplified with a
set of PCR primers No. 1: HR NCmic3 F (SEQ ID NO: 5) and HR NCmic3
R (SEQ ID NO: 6), present on the homologous sequences. With random
integration of the transgene, two DNA fragments of 2163 bp and of
3824 bp are amplified, whereas with homologous recombination, only
a fragment of 3824 bp is amplified. With the wild-type strains,
only a fragment of 2163 bp is amplified. [0187] verifying the
presence/absence of the ncmic3 gene with the set of PCR primers No.
2: ORF NCmic3 F (SEQ ID NO: 7) and ORF NCmic3 R (SEQ ID NO: 8).
[0188] and/or verifying the presence/absence of the DHFR cassette
with the set of PCR primers No. 3: ORF DHFR F (SEQ ID NO: 9) and
ORF DHFR R (SEQ ID NO: 10).
[0189] The sequences of the primers and the size of the amplicons
resulting from the different PCRs are shown in Table II and Table
III below, respectively.
TABLE-US-00002 TABLE II List of the primers used for the different
PCRs for validation of the construction of the mutant strain Neo
ncmic3 KO. No. Name of the No. of of primer 5' .fwdarw. 3' Sequence
sequence PCR HR NCmic3 F GTCATCGACCGCCGGAACTA SEQ ID 1 GTAGT NO: 5
HR NCmic3 R GCAGAGGTTCTGCGTATCTA SEQ ID 1 ACACGG NO: 6 ORF NCmic3 F
TTTCCCTTCTAAACACAGTCG SEQ ID 2 NO: 7 ORF NCmic3 R
CCTTCAGTGGTTCTCCATGA SEQ ID 2 GT NO: 8 ORF DHFR F
CCTTCTCAGACAACGGGGTA SEQ ID 3 NO: 9 ORF DHFR R AGATCTTCACGCCCTTCTCA
SEQ ID 3 NO: 10 Integ NCmic3 F GAAAGTGTCAGTGGTAGAGAC SEQ ID 4 TGC
NO: 11 and 6 ORF NCmic3 R2 CCTTCACTCGAGATCGCGCAA SEQ ID 4 ATGAGC
NO: 12 ORF DHFR R2 GGACCTCTGTACGAGACATGC SEQ ID 6 CG NO: 13 Integ
NCmic3 R TGTTTACAGGTGATCCAGAAA SEQ ID 5 AGG NO: 14 and 7 ORF NCmic3
F2 GAATTTTGGGACAGGGGAAT SEQ ID 5 NO: 15 ORF DHFR F2
GTCTCTCGTTTTCCTCTCTTT SEQ ID 7 TCGG NO: 16
TABLE-US-00003 TABLE III Size of the amplicons (in base pairs) of
the different PCRs for validation of the construction of the mutant
strain Neo ncmic3 KO. No. of Neospora PCR Neo ncmic3 KO caninum
(NC1) 1 3824 2163 2 -- 850 3 504 -- 4 -- 3127 5 -- 3374 6 2890 -- 7
3258 --
[0190] The electrophoretic profiles of the PCR products are
presented in FIG. 3-A. Among the clones studied, certain clones
display a specific band of DHFR (PCR 3) but no specific band of
ncmic3 (PCR 2). PCR No. 1, which was carried out on these clones,
revealed a band of 3824 bp specific for a Neo ncmic3 KO clone.
[0191] New PCR analyses were carried out on these clones of
interest with new sets of primers. These PCRs, called integration
PCRs, allow validation of the genetic KO using a primer present on
the genome upstream or downstream of the sequences flanking the
ncmic3 gene and a second primer present in the selection cassette
(dhfr gene) or in the gene of interest (ncmic3) (FIG. 3-B).
[0192] In FIG. 3-B, PCRs No. 4 and No. 5 make it possible to show
the presence of ncmic3 at the locus of ncmic3. PCR No. 4 is carried
out with the primer set Integ NCmic3 F (SEQ ID NO: 11) and ORF
NCmic3 R2 (SEQ ID NO: 12). PCR No. 5 is carried out with the primer
set Integ NCmic3 R (SEQ ID NO: 14) and ORF NCmic3 F2 (SEQ ID NO:
15). The presence of bands for the wild-type strain NC1 of Neospora
caninum and the absence of these bands for the mutant strain Neo
ncmic3 KO are observed. In FIG. 3-B, PCRs No. 6 and No. 7 make it
possible to show the presence of DHFR at the locus of ncmic3. PCR
No. 6 is carried out with the primer set Integ NCmic3 F (SEQ ID NO:
11) and ORF DHFR R2 (SEQ ID NO: 13). PCR No. 7 is carried out with
the primer set Integ NCmic3 R (SEQ ID NO: 14) and ORF DHFR F2 (SEQ
ID NO: 16). The absence of bands for the wild-type strain NC1 of
Neospora caninum and the presence of bands for the strain Neo
ncmic3 KO are noted. The presence of a non-specific band for PCR
No. 6 at approximately 1000 bp should be noted.
[0193] All of the PCR results demonstrate that homologous
recombination has indeed taken place and that ncmic3 gene has
indeed been deleted from the mutant strain Neo ncmic3 KO.
[0194] d) Analysis by Immunofluorescence
[0195] Analysis was carried out by immunofluorescence. 24 h before
immunofluorescence analysis, 5.times.10.sup.5 parasites were
deposited in a p24 well containing a coverslip covered with a HFF
cell lawn.
[0196] The cells infected by the parasites are washed twice with
1.times.PBS and then fixed with paraformaldehyde (3.7% in
1.times.PBS) for 30 min After 3 washings with 1.times.PBS, the
cells are permeabilized with Triton solution (0.1% in 1.times.PBS)
for 5 minutes. After 3 washings with 1.times.PBS, a saturation step
is carried out with a solution of 1.times.PBS/10% FCS (foetal calf
serum) for 30 min. The cells are then incubated with the primary
antibody diluted in a solution of PBS/2% FCS (foetal calf serum)
for 1 hour, washed 3 times and then incubated with the secondary
antibody diluted in a solution of PBS/2% FCS (foetal calf serum)
for 1 hour. After 2 washings with 1.times.PBS, the coverslips are
mounted on a slide with Immu-Mount and are observed with a
fluorescence microscope.
[0197] The primary antibody used is an antibody that allows
detection of expression of the protein NcMIC3 in the parasite
(primary antibody: rabbit anti-mic3 antibody and commercial
secondary antibody: Alexa fluor.RTM. 594 goat anti-rabbit, Life
Technologies ref. A-11012).
[0198] For the wild-type strain NC1 of Neospora caninum, red
fluorescence is observed at the apical pole of the parasite,
revealing the presence of the protein NcMIC3 (FIG. 4A), whereas for
the mutant strain Neo ncmic3 KO, no fluorescence is observed at the
apical pole of the parasite, demonstrating absence of the protein
NcMIC3 (FIG. 4B).
Example 2
Construction of the Mutant Strain Neo Ncmic1 KO
[0199] a) Construction of the Plasmid pNc mic1KO-CAT-GFP
[0200] The plasmid pNcMic1KO-CAT-GFP (FIG. 2-B) contains a CAT-GFP
selection cassette coding for a fusion protein giving both
resistance to chloramphenicol (CAT) and green fluorescence (GFP:
Green Fluorescent Protein). The latter is placed under the control
of the .alpha.-tubulin promoter of Toxoplasma gondii to allow
expression of the gene in the parasite. Either side of the
cassette, the homologous regions of the sequences flanking the
ncmic1 gene have been cloned.
[0201] The 3' UTR region of the ncmic1 gene was amplified by PCR
from the genomic DNA of the strain NC1 of Neospora caninum. For the
amplification, the primers 3 HR NCmic1 F KpnI and 3 HR NCmic1 R
HindIII (SEQ ID NO: 17 and SEQ ID NO: 18) allow amplification of
the 3'UTR region of the ncmic1 gene and creation of two restriction
sites, which were used for cloning the 3HR fragment upstream of the
CAT-GFP selection cassette into the plasmid pT230 CAT-GFP (KpnI at
5' and HindIII at 3' of the PCR fragment).
[0202] The 5' UTR region of the ncmic1 gene was amplified by PCR
from the genomic DNA of the strain NC1 of Neospora caninum. For the
amplification, the primers 5 HR NCmic1 F BamHI and 5 HR NCmic1 R
NotI (SEQ ID NO: 19 and SEQ ID NO: 20) allow amplification of the
5' UTR region of the ncmic1 gene and creation of two restriction
sites, which were used for cloning the 5HR fragment downstream of
the CAT-GFP selection cassette into the plasmid pT230
3HRNcMic1CAT-GFP (BamHI at 5' and NotI at 3' of the PCR fragment).
The sequences of the primers are shown in Table IV below.
TABLE-US-00004 TABLE IV List of the primers used for integration of
the 5'UTR and 3'UTR sequences of the ncmic 1 gene. Name of No. of
the primer 5' .fwdarw. 3' Sequence sequence 3 HR NCmic1
CGCGGTACCAGGCAGAAGTAAAGA SEQ ID F KpnI AGGTTCCTC NO: 17 3 HR NCmic1
CGCAAGCTTTGATCACGCAAGAAA SEQ ID R HindIII AGAAGC NO: 18 5 HR NCmic1
CGCGGATCCCATTTGTAGATACGGT SEQ ID F BamHI TGCACAC NO: 19 5 HR NCmic1
CGCGCGGCCGCACATTCAGACGGC SEQ ID R NotI AGAACTCTG NO: 20 The
sequences of the restriction sites are underlined.
[0203] b) Conditions for Electroporation and Selection
[0204] 50 .mu.g of the plasmid pNcMic1KO-CAT-GFP, purified and then
linearized by KpnI, must be added to 5.times.10.sup.7 NC1
tachyzoites suspended in CYTOMIX electroporation medium containing
ATP (3 mM) and glutathione (3 mM) (Van den Hoff et al., Nucleic
Acid Research, June 11; 20(11): 2902), and electroporation must be
carried out in a cuvette with a 4 mm gap, in a volume of 800 .mu.L
on a BioRad apparatus (parameters: 2000 V, 50 ohms, 25 .mu.F, with
two electric shocks).
[0205] After electroporation, the tachyzoites will be deposited on
a monolayer of HFF cells in culture. For selection of the mutants,
the culture medium will be replaced and supplemented with the
selection agent (50 .mu.M chloramphenicol), 24 h after
electroporation. Three culture passages must be carried out in this
medium.
[0206] After 15 days of selection, the resistant parasites will be
cloned by limiting dilution in the wells of 96-well plates of HFF
cells. After amplification, the lysis plaques caused by the
parasite will be investigated. The parasites will be subcultured
and their genomic DNA will be extracted for PCR analyses.
[0207] c) PCR Analysis
[0208] The sequences of the primers and the expected size of the
amplicons resulting from the different PCRs are shown in Table V
and Table VI below, respectively.
TABLE-US-00005 TABLE V List of the primers used for the different
PCRs for validation of the construction of the mutant strains Neo
ncmic1 KO. Name of the No. of No. of primer 5' .fwdarw. 3' Sequence
sequence PCR Integ NCmic1 F CCGAGCAAGTTAGCAAGTCC SEQ ID 1 and 3 NO:
21 ORF CATGFP R CCGTTTGGTGGATGTCTTCT SEQ ID 1 NO: 22 ORF CATGFP F
GCATCGACTTCAAGGAGGAC SEQ ID 2 NO: 23 Integ NCmic1 R
CTTGTCCGTCACATCGTTTG SEQ ID 2 and 4 NO: 24 ORF NCmic1 R
TTCTCCAGGCACTCACCTCT SEQ ID 3 NO: 25 ORF NCmic1 F
AGCTTCCAACAACGAGAGGA SEQ ID 4 NO: 26 ORF NCmic1 F2
CCCAGGATATCGTTTGTTGC SEQ ID 5 NO: 27 ORF NCmic1 R2
CTTCTGATGCACGGAACTGA SEQ ID 5 NO: 28 ORF CATGFP F2
CCTGAAGTTCATCTGCACCA SEQ ID 6 NO: 29 ORFCATGFP R2
GTAGTGGTTGTCGGGCAGCA SEQ ID 6 NO: 30
TABLE-US-00006 TABLE VI Size of the amplicons (in base pairs) of
the different PCRs for validation of the construction of the mutant
strain Neo ncmic1 KO. No. of Neospora PCR Neo ncmic1 KO caninum
(NC1) 1 3359 -- 2 3421 -- 3 -- 3746 4 -- 3046 5 -- 449 6 472 --
Example 3
Construction of the Mutant Strain Neo Ncmic1-3 KO
[0209] a) Construction of the Plasmid pNc mic1KO-CAT-GFP
Construction of the plasmid pNcMic1KO-CAT-GFP is described in
Example 2 (2a).
[0210] b) Conditions for Electroporation and Selection
[0211] 50 .mu.g of the plasmid pNcMic1KO-CAT-GFP, purified and then
linearized by KpnI, was added to 5.times.10.sup.7 Neo ncmic3 KO
tachyzoites suspended in the CYTOMIX electroporation medium
containing ATP (3 mM) and glutathione (3 mM) (Van den Hoff et al.,
Nucleic Acid Research, June 11; 20(11): 2902), and electroporation
was carried out in a cuvette with a 4 mm gap, in a volume of 800
.mu.L on a BioRad apparatus (parameters: 2000 V, 50 ohms, 25 .mu.F,
with two electric shocks).
[0212] After electroporation, the tachyzoites were deposited on a
monolayer of HFF cells in culture. For selection of the mutants,
the culture medium is replaced and supplemented with the selection
agent (chloramphenicol 50 .mu.M), 24 h after electroporation. Three
culture passages are carried out in this medium.
[0213] After 15 days of selection, the resistant parasites are
cloned by limiting dilution in the wells of 96-well plates of HFF
cells. After amplification, the lysis plaques caused by the
parasite are investigated. The parasites are subcultured and their
genomic DNA is extracted for PCR analyses.
[0214] c) PCR Analysis
[0215] The sequences of the primers and the size of the amplicons
resulting from the different PCRs are shown in Table VII and Table
VIII below, respectively.
TABLE-US-00007 TABLE VII List of the primers used for the different
PCRs for validation of the construction of the mutant strains Neo
ncmic3 KO and Neo ncmic1-3 KO. No. Name of the No. of of primer 5'
.fwdarw. 3' Sequence sequence PCR Integ NCmic1 F
CCGAGCAAGTTAGCAAGTCC SEQ ID 1 NO: 21 and 3 ORF CATGFP R
CCGTTTGGTGGATGTCTTCT SEQ ID 1 NO: 22 ORF CATGFP F
GCATCGACTTCAAGGAGGAC SEQ ID 2 NO: 23 Integ NCmic1 R
CTTGTCCGTCACATCGTTTG SEQ ID 2 NO: 24 and 4 ORF NCmic1 R
TTCTCCAGGCACTCACCTCT SEQ ID 3 NO: 25 ORF NCmic1 F
AGCTTCCAACAACGAGAGGA SEQ ID 4 NO: 26 Integ NCmic3 F
GAAAGTGTCAGTGGTAGAGAC SEQ ID 5 TGC NO: 11 and 7 ORF NCmic3 R2
CCTTCACTCGAGATCGCGCAA SEQ ID 5 ATGAGC NO: 12 ORF DHFR R2
GGACCTCTGTACGAGACATGC SEQ ID 7 CG NO: 13 Integ NCmic3 R
TGTTTACAGGTGATCCAGAAA SEQ ID 6 AGG NO: 14 and 8 ORF NCmic3 F2
GAATTTTGGGACAGGGGAAT SEQ ID 6 NO: 15 ORF DHFR F2
GTCTCTCGTTTTCCTCTCTTT SEQ ID 8 TCGG NO: 16 ORF NCmic1 F2
CCCAGGATATCGTTTGTTGC SEQ ID 9 NO: 27 ORF NCmic1 R2
CTTCTGATGCACGGAACTGA SEQ ID 9 NO: 28 ORF CATGFP F2
CCTGAAGTTCATCTGCACCA SEQ ID NO: 29 10 ORFCATGFP R2
GTAGTGGTTGTCGGGCAGCA SEQ ID 10 NO: 30 ORF NCmic3 F
TTTCCCTTCTAAACACAGTCG SEQ ID 11 NO: 7 ORF NCmic3 R
CCTTCAGTGGTTCTCCATGA SEQ ID 11 GT NO: 8 ORF DHFR F
CCTTCTCAGACAACGGGGTA SEQ ID 12 NO: 9 ORF DHFR R
AGATCTTCACGCCCTTCTCA SEQ ID 12 NO: 10
TABLE-US-00008 TABLE VIII Size of the amplicons (in base pairs) of
the different PCRs for validation of the construction of the mutant
strains Neo ncmic3 KO and Neo ncmic1-3 KO. No. of Neospora PCR Neo
ncmic1-3 KO caninum (NC1) Neo ncmic3 KO 1 3359 -- -- 2 3421 -- -- 3
-- 3746 3746 4 -- 3046 3046 5 -- 3127 -- 6 -- 3374 -- 7 2890 --
2890 8 3258 -- 3258 9 -- 449 449 10 472 -- -- 11 -- 850 -- 12 504
-- 504
[0216] In FIG. 5, PCR No. 1 is carried out with the set of primers
Integ NCmic1 F (SEQ ID NO: 21) and ORF CATGFP R (SEQ ID NO: 22).
PCR 2 is carried out with the set of primers ORF CATGFP F (SEQ ID
NO: 23) and Integ NCmic1 R (SEQ ID NO: 24). PCR No. 3 is carried
out with the set of primers Integ NCmic1 F (SEQ ID NO: 21) and ORF
NCmic1 R (SEQ ID NO: 25). PCR No. 4 is carried out with the set of
primers Integ NCmic1 R (SEQ ID NO: 24) and ORF NCmic1 F (SEQ ID NO:
26). PCR No. 5 is carried out with the set of primers Integ NCmic3
F (SEQ ID NO: 11) and ORF NCmic3 R2 (SEQ ID NO: 12). PCR No. 6 is
carried out with the set of primers Integ NCmic3 R (SEQ ID NO: 14)
and ORF NCmic3 F2 (SEQ ID NO: 15). PCR No. 7 is carried out with
the set of primers Integ NCmic3 F (SEQ ID NO: 11) and ORF DHFR R2
(SEQ ID NO: 13). PCR No. 8 is carried out with the set of primers
Integ NCmic3 R (SEQ ID NO: 14) and ORF DHFR F2 (SEQ ID NO: 16). PCR
No. 9 is carried out with the set of primers ORF NCmic1 F2 (SEQ ID
NO: 27) and ORF NCmic1 R2 (SEQ ID NO: 28). PCR No. 10 is carried
out with the set of primers ORF CATGFP F2 (SEQ ID NO: 29) and ORF
CATGFP R2 (SEQ ID NO: 30). PCR No. 11 is carried out with the set
of primers ORF NCmic3 F (SEQ ID NO: 7) and ORF NCmic3 R (SEQ ID NO:
8). PCR No. 12 is carried out with the set of primers ORF DHFR F
(SEQ ID NO: 9) and ORF DHFR R (SEQ ID NO: 10).
[0217] The electrophoretic analyses of the PCR products show that
the strain Neo ncmic1-3 KO no longer has the ncmic1 and ncmic3
genes (wells 3, 4, 5, 6, 9 and 11, FIG. 5) and does have the dhfr
and cat-gfp genes (wells 1, 2, 7, 8, 10 and 12, FIG. 5), thus
validating production of the strain Neo ncmic1-3 KO. All of the PCR
results demonstrate that homologous recombination has indeed taken
place and the strain Neo ncmic1-3 KO has indeed been deleted from
the ncmic1 and ncmic3 genes.
[0218] d) Immunofluorescence Analysis
[0219] Immunofluorescence analysis was carried out solely by direct
observation of the fluorescence of the parasite (FIG. 6).
[0220] The parasites of the two mutant strains are visualized in
direct light (images A and C). One and the same microscopic field
is visualized in fluorescence. Green fluorescence, due to
expression of the recombinant chimeric protein CAT-GFP, is only
detected in the mutant strain Neo ncmic1-3 KO (image D) following
insertion of the CAT-GFP cassette. Conversely, the strain Neo
ncmic3 KO, which does not have a CAT-GFP cassette, does not express
the CAT-GFP protein and consequently does not display fluorescence
(image B).
Example 4
Immunostimulation of the Mouse Pups with the Mutant Toxo Mic1-3
KO
1-Experimental Protocol
[0221] 1.1-Animals
[0222] Immunostimulation is carried out on the C57BL/6 mouse pups
aged 3 days. These mouse pups were obtained and bred in the INRA
Centre in Nouzilly (Indre et Loire, France). The mouse pups are
kept throughout the experiments in an animal house of containment
level 2 in order to minimize the risk of external
contamination.
[0223] 1.2-Strain T. gondii
[0224] 1.2.1-Strain Toxo mic1-3 KO
[0225] The mutant strain of Toxoplasma gondii, in which the genes
coding for the proteins MIC1 and MIC3 were knocked out (called
strain Toxo mic1-3 KO) is maintained by successive passages on a
human foreskin fibroblast (HFF) line cultured in DMEM medium
supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of
streptomycin.
[0226] 1.2.2-Strain RH
[0227] The wild-type strain RH of Toxoplasma gondii, from which the
strain Toxo mic1-3 KO is derived, is also maintained by successive
passages on a human foreskin fibroblast (HFF) line cultured in DMEM
medium supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of
streptomycin.
[0228] For preparation of the total parasite extract, the
tachyzoites of the strain RH are washed, sonicated at 60 W/s, three
times for 10 min and centrifuged at 2000 g for 30 min at 4.degree.
C. The supernatant is concentrated and divided into aliquots. The
concentration is determined by BCA assay, using BSA (Bovine Serum
Albumin) as standard. The aliquots are stored at -20.degree. C.
[0229] 1.3-Immunostimulation
[0230] Batches of 3-day-old C57BL/6 mouse pups were treated as
follows:
[0231] 6 mouse pups (batch A) served as unvaccinated control
batch,
[0232] 6 mouse pups (batch B) received the mutant Toxo mic1-3
KO
[0233] On D0, the mouse pups in batch A received 20 tachyzoites of
the strain Toxo mic1-3 KO by intraperitoneal route.
[0234] On D3 post-immunostimulation, 3 mouse pups from each batch
were sacrificed for investigating the humoral immune response, the
inflammatory response and parasitaemia.
[0235] On D9 post-immunostimulation, the 3 remaining mouse pups of
each batch were sacrificed for investigating the humoral immune
response, the inflammatory response and parasitaemia.
[0236] 1.4-Humoral Immune Response
[0237] The humoral immune response was studied by evaluating, by
ELISA, the kinetics of appearance of the IgM specific
anti-Toxoplasma gondii antibodies in the serum. The sera are taken
at the moment of sacrifice of the mouse pups on D3 and on D9
post-infection. The sample is left for 10 mM at room temperature to
allow clotting. The serum is recovered by centrifuging the samples
at 2000 rpm for 10 min at +20.degree. C. The supernatant is divided
into aliquots in a clean tube and stored at -20.degree. C.
[0238] The total extract of the RH strain of Toxoplasma gondii,
obtained as described above, is used for sensitizing the
flat-bottomed wells of microtitre plates (Nunc). 100 .mu.L of
extract (at a concentration of 10 .mu.g/mL in carbonate buffer at
50 mM and pH=9.6) is deposited in each well. After one night at
+4.degree. C., three washings are carried out in PBS buffer with
the addition of 0.05% Tween-20 (PBS-T).
[0239] The non-specific sites are saturated by incubation of the
plates for 1.5 h at 37.degree. C. under humid atmosphere with PBS
with 4% BSA.
[0240] 100 .mu.L of each sample of serum diluted in PBS-T (1/50
dilution) is deposited and incubated for 1 h at 37.degree. C. under
humid atmosphere.
[0241] After two series of three washings, 100 .mu.L of anti-mouse
IgM coupled to alkaline phosphatase (ALP; Sigma), diluted to 1/5000
in PBS-T, is deposited and incubated for 1.5 h at 37.degree. C.
under humid atmosphere. Two new series of three washings are
carried out. Development is carried out using 100 .mu.L of
paranitrophenylphosphate (PNPP) at 1 mg/mL in DEA-HCL.
[0242] Reading is carried out after incubation for 10 to 20
minutes, on a plate reader (Wallac 1420 Multilabel counter) at a
wavelength .lamda.=405 nm.
[0243] The assumed positivity threshold was determined as a
function of the values of absorbance (OD) of the mouse pups in the
control batch: it is fixed at 0.23 of OD for a 1/50 serum
dilution.
[0244] 1.5-Investigation of the Inflammatory Response
[0245] Analysis of the inflammatory response of the mouse pups at
intestinal level was quantified by quantitative PCR (qPCR) by
amplification of the genes coding for IL-12 and IFN-.gamma.. IL-12
is a cytokine produced in response to intrusion of a pathogen that
stimulates secretion of IFN-.gamma., a cytokine produced by the
immune system cells in response to inflammation on the site of
infection by the pathogen.
[0246] After sacrifice of the mouse pups on D3 and D9, the
intestine is removed and the ileum (1 cm above the caecum) is used
for analysis by qPCR. The tissue is incubated in 1 mL of
Trizol.RTM. (Invitrogen) and then is ground in a Thurax, incubated
at room temperature for 5 min and centrifuged for 10 minutes at
12,000 g. The supernatant is then recovered and mixed by pipetting
up and down approximately ten times.
[0247] Once the nuclear protein complexes have been dissociated
with Trizol.RTM., the RNA is isolated from the DNA and from the
proteins with chloroform. One millilitre of chloroform is added to
the supernatant and the Trizol.RTM./chloroform mixture is stirred
vigorously for 15 seconds, then incubated at room temperature and
finally centrifuged at 12,000 g for 15 minutes at 4.degree. C.
After centrifugation, the mixture is separated into an organic
phase (phenol/chloroform, pink, lower phase), an interphase (white
film, DNA and cell debris) and an aqueous phase (upper phase)
containing the total RNAs.
[0248] The aqueous phase containing the total RNAs is recovered and
500 .mu.L of isopropanol is added to precipitate the RNA. The
solution is stirred, incubated at room temperature for 10 min and
centrifuged at 12,000 g for 10 min at 4.degree. C. The pellet
obtained is isolated and then washed with 1 mL of 75% ethanol
(absolute ethanol diluted in 0.1% DEPC water and stored at
-20.degree. C.), stirred and centrifuged at 7500 g at 4.degree. C.
for 10 min. The pellet is dried for 10 min under a fume hood in
ice. Finally the RNA is taken up in approximately 20 .mu.L of 0.1%
DEPC water.
[0249] The quality of extraction of the RNA is verified by
electrophoresis on 1% agarose gel and by calculating the direct
ratio of the absorbance at a wavelength of 260 nm to that at a
wavelength of 280 nm. This ratio must be close to 2. Finally, the
RNA extraction yield is quantified using a spectrophotometer.
[0250] Two micrograms of RNA are incubated with 1 .mu.L of Oligo dT
(Eurogentec 133 pmol/.mu.l) in a final volume of 11 .mu.L at
65.degree. C. for 10 min, and then 2 min in ice. Once the
oligonucleotides dT are fixed on the polyA tail, the RNA solution
is incubated with 2 .mu.L of dNTP (dATP, dTTP, dGTP, dCTP each at
20 mM), 4 .mu.L of reverse transcriptase buffer (5.times.
Eurogentec; 250 mM Tris-HCl (pH 8.3); 375 mM KCl; 50 mM DTT; 15 mM
MgCl.sub.2) and 0.4 .mu.L of MuMLV (25 U/.mu. L; 50 mM Tric-HCL (pH
8.3); 1 mM EDTA, 0.1% Triton X-100, 0.1 M NaCl; 5 mM DTT; 50% (v/v)
glycerol) in a final volume of 20 .mu.L for 1.5 h at 37.degree. C.
The reverse transcriptase is then inhibited at 85.degree. C. for 10
min.
[0251] In the present case, expression of the genes coding for the
proteins IL-12 and IFN-.gamma., expressed during the inflammatory
response, was quantified.
[0252] For amplification, the primer pair SEQ ID NO: 31
(5'-CTCACATCTGCTGCTCCACAA-3') and SEQ ID NO: 32
(5'-GACGCCATTCCACATGTCACT-3') was used for IL-12, the primer pair
SEQ ID NO: (5'-TCTTCTTGGATATCTGGAGGAA-3') and SEQ ID NO: 34
(5'-AGCTCATTGAATGCTTGGCGCTG-3') was used for assaying IFN.gamma.
and the primer pair SEQ ID NO: 35 (5'-GGATACAGGCCAGACTTTGTTG-3')
and SEQ ID NO: 36 (5'-GAGGGTAGGCTGGCCTATAG-3') was used for
assaying the murine HPRT reference gene.
[0253] Two microlitres of cDNA diluted to 1/10 from the reverse
transcription reaction is incubated with 0.3 .mu.L of the 5' primer
(25 .mu.M); 0.3 .mu.L of the 3' primer (25 .mu.M); 7.5 .mu.L of Mix
PCR (BioRad) in a final volume of 15 .mu.L. The conditions selected
for the PCR reaction are as follows: 1) denaturation at 95.degree.
C. for 5 minutes, 2) denaturation at 95.degree. C. for 10 seconds,
3) pairing and elongation at 62.degree. C. for IL-12, IFN' and HPRT
for 15 seconds, 4) repeating the cycle starting from step 2: 39
times, 5) melting curve from 55.degree. C. to 95.degree. C. to
verify the presence or absence of the dimers.
[0254] 1.6-Investigation of the State of Infection of the Mouse
Pups
[0255] The level of infection of the mouse pups was analysed by
three different techniques: 1) tissue dissemination of the
tachyzoites on HFF cells, 2) immunohistology on sections of
intestine from the infected mouse pups and 3) PCR from the ileum of
the mouse pups in batches A and B.
[0256] 1.6.1-Tissue Dissemination of the Tachyzoites on HFF
Cells
[0257] The HFF cells are deposited in a 24-well plate one week
before depositing the organs at a rate of 1.times.10.sup.4
cells/well. The cells are cultured in 1 mL of DMEM cell culture
medium supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of
streptomycin.
[0258] After sacrifice, the spleen of the mouse pups of batches 1
and 2 is removed and ground in 2 mL of 1.times.PBS. Ten microlitres
of ground material is deposited per well containing the HFF cells.
Twenty-four hours after depositing the ground materials from the
spleen, the cells are washed with DMEM and then 1 mL of clean
medium is deposited in each well. The cells are incubated at
37.degree. C., 5% CO.sub.2 until the lysis plaques revealing the
presence of Toxo mic1-3 KO tachyzoites are detected.
[0259] 1.6.2-Immunohistology on Sections of Intestine from the
Infected Mouse Pups
[0260] The intestine of the sacrificed mouse pups is rolled up like
a Swiss roll and then kept in this form using paper wrapped around
the Swiss roll and stapled. The samples are fixed in 4%
paraformaldhehyde solution, diluted in 1.times.PBS (pH=7) and
incubated for 8 hours at 4.degree. C. The tissues are then washed
in 1.times.PBS and then incubated at 4.degree. C. for 8 h in clean
1.times.PBS. This last step is repeated a second time. The tissues
are incubated for 8 hours at 4.degree. C., in 30% sucrose solution
diluted in 1.times.PBS and filtered. Finally the tissues are
transferred to moulds of a suitable size filled with OCT embedding
medium. After 5 minutes of incubation in the OCT, the samples are
frozen using dry ice and stored at -80.degree. C.
[0261] The samples of intestine are then cut into sections using a
cryostat which maintains the sample at -20.degree. C. Histological
sections with a thickness of 7 .mu.m are prepared and then
deposited on a slide by electrostatic force. The slides are stored
at -80.degree. C.
[0262] The slides of histological sections are thawed and then left
to dry at room temperature for 1 h. The zone of the sample on the
slide is delimited with a pen with hydrophobic ink (Dakocitamation
pen). The histological sections of intestine are permeabilized with
50 .mu.L of a solution of 1.times.PBS, Mg.sup.2+, Ca.sup.2+ free,
Triton X-100 and 1% BSA at room temperature and in a humid chamber
for 10 min. The permeabilizing solution is removed by aspiration
and the samples are saturated in 50 .mu.L of a solution of
1.times.PBS, Mg.sup.2+, Ca.sup.2+ free, Triton X-100 and 10% BSA at
room temperature and in a humid chamber for 1 h. After aspiration
of the saturation solution, 50 .mu.L of rabbit anti-SAG1 polyclonal
serum of Toxoplasma gondii diluted to 1/100 in a solution of
1.times.PBS, Mg.sup.2+, Ca.sup.2+ free, Triton X-100 and BSA 1%, is
deposited per sample. The samples are incubated at 4.degree. C., in
a humid chamber for 8 h. Two washings for 5-minutes in 1.times.PBS,
Mg.sup.2+, Ca.sup.2+ free, Triton X-100 and 1% BSA are carried out.
50 .mu.L of swine anti-rabbit antibodies coupled to fluorescein
isothiocyanate diluted to 1/20 in a solution of 1.times.,
Mg.sup.2+, Ca.sup.2+ free, Triton X-100 and 1% BSA is deposited per
sample. The samples are incubated in the presence of the coupled
secondary antibody, at room temperature, in a humid chamber for 1 h
20 min Two washings for 5-minute in 1.times.PBS, Mg.sup.2+,
Ca.sup.2+ free, Triton X-100 and 1% BSA are carried out and then a
final washing of the samples is carried out in sterile distilled
water. The slides are dried and then a drop of fluoromount G is
deposited on each sample. Finally, the samples are mounted between
the slide and the cover slip.
[0263] 1.6.3-Detection of SAG-1
[0264] A PCR was carried out from cDNAs obtained by reverse
transcription reaction (cf. paragraph 1.5). The SAG-1 gene specific
to the parasite Toxoplasma gondii was amplified by PCR with the
primers SEQ ID NO: 37 (5'-CTGCACCACTTCATTATTTCTTCTG-3') and SEQ ID
NO: 38 (5'-ACTCACGCGACACAAGCTG-3').
[0265] 2 .mu.L of cDNA is incubated with 1 .mu.L of 5' primer (10
.mu.M); 1 .mu.L of 3' primer (10 .mu.M); 25 .mu.L of GoTaq.RTM.
Green Master Mix (2.times., Promega) in a final volume of 50 .mu.L.
The conditions selected for the PCR are as follows: 1) denaturation
at 94.degree. C. for 5 min, 2) denaturation at 94.degree. C. for 30
s, 3) pairing at 60.degree. C. for 30 s, 4) elongation at
72.degree. C. for 1 min, 5) repeating the cycle starting from step
2: 34 times, 6) elongation at 72.degree. C. for 5 min. The presence
of the parasite Toxoplasma gondii in the intestine is verified by
an amplified fragment of 1001 base pairs.
2-Results
[0266] 2.1-Investigation of the Humoral Response
Post-Immunostimulation
[0267] The results of the ELISA assays on D3 and D9 post-infection
for the sera of the batches of mouse pups, controls and
immunostimulated with the strain Toxo mic1-3 KO, are shown in FIG.
7. The mouse pups in the control batch (A) have not developed a
humoral response on D3 and on D9 post-infection in contrast to 2
mouse pups out of 3 of the batch immunostimulated with the strain
Toxo mic1-3 KO (B), which produced anti-toxoplasmic IgM antibodies
at 9 days post-infection; these are the mouse pups No. 4 and No.
6.
[0268] 2.2-Investigation of the Inflammatory Response
Post-Immunostimulation
[0269] The results of the quantitative PCR tests for expression of
the gene coding for IFN-.gamma. and the gene coding for IL-12
carried out on D9 post-immunostimulation are shown in FIGS. 8-A and
8-B respectively. The mouse pups in the control batch (A) have not
developed an inflammatory response (secretion of IL-12 and
IFN-.gamma.) on D9 post-infection. In contrast, 9 days after
immunostimulation, the mouse pups No. 4, 5 and 6 display
significantly greater expression of IL-12 than that of the mouse
pups in the control batches (FIG. 8-B). Similarly, two mouse pups
out of 3 in the batch immunostimulated with the strain Toxo mic1-3
KO display expression of IFN-.gamma. significantly greater than
that of the mouse pups in the control batches (FIG. 8-A); these are
the mouse pups No. 4 and No. 6.
[0270] 2.3-Investigation of the state of infection of the mouse
pups
[0271] 2.3.1-Dissemination of the Spleens on HFF Cells
[0272] The dissemination of the spleens on HFF cells is illustrated
in Table IX. No lysis plaque is detected in the HFF cells infected
with the spleens from the mouse pups of the control batch. In
contrast, the HFF cells infected with the ground material from the
spleen originating from the mouse pups immunostimulated with the
strain Toxo mic1-3 KO have lysis plaques, demonstrating that
tachyzoites are present in the spleen.
[0273] Moreover, the technique of tissue dissemination of the
tachyzoites on HFF cells is a semiquantitative technique which
shows that the mouse pups in the batch immunostimulated with the
strain Toxo mic1-3 KO have different states of infection. The mouse
pups No. 4 and No. 6 seem be the most infected as they have the
largest number of parasites in the spleen, followed by mouse pup
No. 5, which has far fewer parasites in the spleen (Table IX).
TABLE-US-00009 TABLE IX Result of optical microscopy analysis, of
the dissemination of the organs on human fibroblast cells (HFF).
The tachyzoites observed originate from the spleens of the mouse
pups immunostimulated with the strain Toxo mic1-3 KO and form lysis
plaques when they colonize the HFF cells. Presence of Lysis plaques
parasites observed Control mouse pup 4 NO 0 Control mouse pup 5 NO
0 Control mouse pup 6 NO 0 Immunostimulated YES >70% of the
lysed mouse pup 4 cells Immunostimulated YES 2 mouse pup 5
Immunostimulated YES >70% of the lysed mouse pup 6 cells
[0274] 2.3.2-Immunohistology
[0275] The immunohistology sections of the intestines from the
mouse pups are illustrated in FIG. 9.
[0276] For the mouse pups in the control batch, no tachyzoite was
observed on the immunohistology sections.
[0277] The sections of intestine from the mouse pups No. 4 (B) and
No. 6 (D) and No. 5 respectively (data not shown), immunolabelled
with a rabbit anti-T. gondii polyclonal antibody, allow
visualization of the presence of tachyzoites of the strain Toxo
mic1-3 KO (white dots) for the mouse pup No. 4 only.
[0278] 2.3.3-PCR
[0279] The PCR results are presented in FIG. 10. Amplification of
the SAG1 gene of Toxoplasma gondii from a DNA sample originating
from ground material from the ileum is representative of the
presence of Toxo mic1-3 KO tachyzoites (amplified fragment at 1001
bp). This semiquantitative technique shows absence of a band for
the mouse pups in the control batch (NV) sacrificed on D3 (T1) or
on D9 (T2).
[0280] For the mouse pups immunostimulated with the strain Toxo
mic1-3 KO (V), no band corresponding to the SAG1 gene is detected 3
days after infection. On D9, two mouse pups out of 3 display a band
of DNA of 1001 base pairs, providing evidence of the presence of
Toxo mic1-3 KO tachyzoites. The intensity of the bands observed
between the mouse pups No. 4 and No. 6 is clearly different. As the
intensity of the bands is proportional to the number of parasites
present in the intestine, the mouse pup No. 4 has more parasites in
the intestine than the mouse pup No. 6, 9 days post-infection.
These results confirm the observation made by immunohistology.
Example 5
Protection Against Cryptosporidiosis of the Mouse Pups
Immunostimulated with the Mutant Toxo Mic1-3 KO by Intraperitoneal
Route
1-Experimental Protocol
[0281] 1.1-Animals
[0282] Immunostimulation is carried out on C57BL/6 mouse pups aged
3 days. These mouse pups were obtained and bred in the INRA Centre
in Nouzilly (Indre et Loire). The mouse pups are kept throughout
the experiments in an animal house of containment level 2 in order
to limit the risk of external contamination as far as possible.
[0283] 1.2-Cryptosporidium parvum
[0284] The oocysts of Cryptosporidium parvum are obtained from
excrement of calves infected with 10.sup.7 C. parvum oocysts. The
stool undergoes various treatments until a suspension of purified,
sterile parasites is obtained, suitable for use in cell culture.
Throughout the treatment, the oocysts are manipulated at 4.degree.
C., to prevent excystation of the oocysts.
[0285] Briefly, after recovery of the stool, the latter is diluted
in fresh water and then passed through a 100-.mu.m filter and
centrifuged at 1900 g for 10 minutes at 4.degree. C. The pellets
obtained, containing the oocysts, are taken up in 2% potassium
dichromate solution (Prolabo, ref. 26 776 290, CAS 7778-50-9), then
washed twice with cold water by centrifugation at 1900 g for 10
minutes at 4.degree. C. to remove the potassium dichromate. After
washing, the pellet of coccidia is taken up in a mixture of water
and ether (Ethyl Ether, Carlo Erba, CAS No. 60-29-7) diluted to
1/5, and then is centrifuged again at 1900 g for 10 minutes at
4.degree. C. The upper phases containing the fats and the ether are
removed and the pellet is recovered and taken up in cold water
after passing through a 20-.mu.m filter. Two to three millilitres
of the suspension of parasites obtained is deposited on a glucose
gradient prepared from Sheather solution (sucrose 500 g, water 320
ml, 0.2 g of sodium azide (Prolabo, CAS 26628-22-8)). Two rings of
oocysts are formed after centrifugation of the glucose gradient at
2000 g for 20 minutes at 4.degree. C. The two rings are recovered
and washed several times in cold water. The purified oocysts are
then sterilized. After centrifugation at 1900 g for 10 minutes at
4.degree. C., the pellet of oocysts is incubated for 15 minutes in
a solution of bleach (sodium hypochlorite (Sigma 239305-500ML
Titre: 4.5% of active chlorine) diluted to 10% in demineralized
water, then washed 3 times in sterile 1.times.PBS (diluted from a
solution of 10.times.PBS: sodium chloride, NaCl 80 g/litre water;
potassium chloride, KCl 2 g/litre; potassium dihydrogen phosphate,
KH.sub.2PO.sub.4: 2 g/litre; disodium hydrogen phosphate,
Na.sub.2HPO.sub.4, 12 H.sub.2O: 29 g/litre). The purified and
sterilized oocysts are counted on a slide (5 .mu.L of solution of
oocysts and 495 .mu.L of malachite green), adjusted to a
concentration of 2.times.10.sup.8 oocysts/mL, divided into aliquots
in 1.5-mL tubes and stored at 4.degree. C.
[0286] 1.3-Strain Toxo Mic1-3 KO
[0287] The mutant strain of Toxoplasma gondii, in which the genes
coding for the proteins MIC1 and MIC3 have been knocked out (called
strain Toxo mic1-3 KO) is maintained by successive passages on a
human foreskin fibroblast (HFF) line cultured in DMEM medium
supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of
streptomycin.
[0288] 1.4-Immunostimulation
[0289] Batches of C57BL/6 mouse pups aged 3 days were treated as
follows:
[0290] 7 mouse pups (batch 1) received the mutant Toxo mic1-3
KO
[0291] 7 mouse pups (batch 2) served as unvaccinated control
batch.
[0292] On D0, the mouse pups in batch 1 received 20 tachyzoites of
the strain Toxo mic1-3 KO by intraperitoneal route.
[0293] On D3 post-immunostimulation, the mouse pups in batch 1 and
batch 2 were challenged with 500,000 parasites of Cryptosporidium
parvum.
[0294] On D9 post-infection, the mouse pups in batch 1 and 2 were
sacrificed in order to evaluate protection against Cryptosporidium
parvum.
[0295] 1.5-Investigation of the State of Infection of the Mouse
Pups
[0296] The state of infection of the mouse pups was analysed by the
technique of tissue dissemination of the tachyzoites on HFF cells
described above. The HFF cells are deposited in a 24-well plate,
one week before depositing the organs at a rate of 10.sup.4 cells
per well. The cells are cultured in 1 mL of DMEM cell culture
medium supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of streptomycin.
After sacrifice of the mouse pups, the spleen of each of the mouse
pups is taken and ground in 2 mL of 1.times.PBS. Ten microlitres of
ground material is deposited per well containing the HFF cells
cultured in 1 mL of medium. Twenty-four hours after depositing the
ground material from the spleen, the cells are washed in DMEM and
then 1 mL of clean medium is deposited per well. The cells are
cultured until the lysis plaques revealing the presence of Toxo
mic1-3 KO tachyzoites are detected.
[0297] 1.6-Investigation of Protection
[0298] The protection of the mouse pups against Cryptosporidium
parvum is analysed by counting the oocysts in the intestine. After
the mouse pups are sacrificed, the intestines are recovered,
weighed, placed in 1 mL of water (4.degree. C.) and ground for 20
seconds. 100 microlitres of ground material is added to 400 .mu.L
of sugar solution at 4.degree. C. (500 g of powdered sugar, 320 mL
of distilled water, Na azide at 0.02%). After homogenizing the
solution by pipetting, 20 .mu.L is deposited on a Thoma cell.
Before counting the oocysts, the slides are kept in a cool place
for 15 minutes to allow the oocysts in the sugar solution to rise
to the surface. The total number of oocysts in the intestine is
calculated by means of the following formula: Total number of
oocysts of C. parvum in the intestine=Number of oocysts counted on
Thoma slide.times.dilution factor.times.10 000.times.(1+weight of
the mouse pup intestine).
2-Results
[0299] 2.1-Investigation of the State of Infection of the Mouse
Pups
[0300] The state of infection of the mouse pups is evaluated from
parasitaemia in the case of Cryptosporidium parvum (C. parvum) and
Toxoplasma gondii (T. gondii). Parasitaemia in the case of C.
parvum is determined by the total number of oocysts of C. parvum
counted in the mouse pup intestine. Parasitaemia in the case of T.
gondii is evaluated by dissemination of the spleens of the mouse
pups on HFF cells. The parasitaemias for C. parvum and T. gondii
are presented in Table X.
TABLE-US-00010 TABLE X Summary table of parasitaemia observed in
the case of C. parvum and in the case of T. gondii of the batch of
the mouse pups infected with C. parvum (infected C. parvum) and of
the batch of the mouse pups inoculated with T. gondii and infected
with C. parvum (inoculated T. gondii + C. parvum): t, tachyzoites;
NR, data not reported. The number associated with parasitaemia in
the case of T. gondii corresponds to the number of tachyzoites
counted in 20 .mu.L of supernatant of the HFF cells infected after
dissemination of the spleen. Infected C. parvum Inoculated T.
gondii + C. parvum Total Total number of Parasit- number of
Parasit- mouse oocysts of aemia mouse oocysts of aemia pups C.
parvum T. gondii pups C. parvum T. gondii 1 862500 NO 1 935000
SLIGHT (6.6 10.sup.5 t.) 2 966500 NO 2 53000 YES (NR) 3 1083000 NO
3 55000 YES (2 10.sup.6 t.) 4 565000 NO 4 1568000 VERY SLIGHT (2
10.sup.5 t.) 5 684000 NO 5 832500 VERY SLIGHT (1.2 10.sup.5 t.) 6
847500 NO 6 754000 VERY SLIGHT (1.6 10.sup.5 t.) 7 994500 NO 7
330000 YES (1.24 10.sup.6 t.)
[0301] The mouse pups infected with C. parvum only, have a total
number of oocysts of C. parvum in the intestine in the range from
5.times.10.sup.5 to 1.times.10.sup.6 oocysts.
[0302] The mouse pups immunostimulated with the strain Toxo mic1-3
KO and then infected with C. parvum display T. gondii parasitaemia
varying from one mouse pup to another. For mouse pups No. 2, 3 and
7, which have the highest T. gondii parasitaemia, the total number
of oocysts of C. parvum in the intestine varies from
5.times.10.sup.4 to 3.3.times.10.sup.5 oocysts. These results
demonstrate the correlation that exists between parasitaemia with
Toxo mic1-3 KO and the reduction in C. parvum infection.
[0303] 2.2-Investigation of Protection
[0304] The state of protection of the mouse pups is shown in FIG.
11.
[0305] In the batch of the mouse pups vaccinated by intraperitoneal
route with the mutant Toxo mic1-3 KO, 3 mouse pups out of 7 have a
total number of oocysts of C. parvum in the intestine that is
significantly reduced, by approximately 62% to 94%. These three
mouse pups are the mouse pups No. 2, No. 3 and No. 7, which
displayed the highest parasitaemia with T. gondii of all the mouse
pups in this group.
Example 6
Protection Against Cryptosporidiosis, of the Mouse Pups
Immunostimulated with the Mutant Toxo Mic1-3 KO by Oral Route
1-Experimental Protocol
[0306] 1.1-Animals
[0307] Immunostimulation is carried out on C57BL/6 mouse pups aged
3 days. These mouse pups were obtained and bred in the INRA Centre
in Nouzilly (Indre et Loire). The mouse pups are kept throughout
the experiments in an animal house of containment level 2 in order
to limit the risk of external contamination as far as possible.
[0308] 1.2-Cryptosporidium parvum
[0309] Oocysts of Cryptosporidium parvum are obtained from
excrement of calves infected with 10.sup.7 C. parvum oocysts. The
stool undergoes various treatments until a suspension of sterile,
purified parasites is obtained, suitable for use in cell culture.
Throughout the treatment, the oocysts are manipulated at 4.degree.
C. to prevent excystation of the oocysts.
[0310] Briefly, after recovery of the stool, the latter is diluted
in fresh water and then passed through a 100-.mu.m filter and
centrifuged at 1900 g for 10 minutes at 4.degree. C. The pellets
obtained, containing the oocysts, are taken up in 2% potassium
dichromate solution (Prolabo ref. 26 776 290, CAS 7778-50-9), then
washed twice with cold water by centrifugation at 1900 g for 10
minutes at 4.degree. C. to remove the potassium dichromate. After
washing, the pellet of coccidia is taken up in a mixture of water
and ether (ethyl ether, Carlo Erba CAS No. 60-29-7) diluted to 1/5,
then centrifuged again at 1900 g for 10 minutes at 4.degree. C. The
upper phases containing the fats and the ether are removed and the
pellet is recovered and taken up in cold water after passing
through a 20-.mu.m filter. Two to three millilitres of the
suspension of parasites obtained is deposited on a glucose gradient
prepared from Sheather solution (sucrose 500 g, water 320 ml, 0.2 g
of sodium azide (Prolabo, CAS 26628-22-8)). Two rings of oocysts
are formed after centrifugation of the glucose gradient at 2000 g
for 20 minutes at 4.degree. C. The two rings are recovered and
washed several times in cold water. The purified oocysts are then
sterilized. After centrifugation at 1900 g for 10 minutes at
4.degree. C., the pellet of oocysts is incubated for 15 minutes in
a solution of bleach (sodium hypochlorite, Sigma 239305-500ML
Titre: 4.5% of active chlorine) diluted to 10% in demineralized
water and then washed 3 times in sterile 1.times.PBS (diluted from
a solution of 10.times.PBS: sodium chloride, NaCl 80 g/litre water;
potassium chloride, KCl 2 g/litre; potassium dihydrogen phosphate,
KH.sub.2PO.sub.4: 2 g/litre; disodium hydrogen phosphate,
Na.sub.2HPO.sub.4, 12 H.sub.2O: 29 g/litre). The purified and
sterilized oocysts are counted on a slide (5 .mu.L of solution of
oocysts and 495 .mu.L of malachite green), adjusted to a
concentration of 2.times.10.sup.8 oocysts/mL, divided into aliquots
in 1.5-mL tubes and stored at 4.degree. C.
[0311] 1.3-Strain Toxo mic1-3 KO
[0312] The mutant strain of Toxoplasma gondii, in which the genes
coding for the proteins MIC1 and MIC3 have been suppressed (called
strain Toxo mic1-3 KO) is maintained by successive passages on a
human foreskin fibroblast (HFF) line cultured in DMEM medium
supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of
streptomycin.
[0313] 1.4-Immunostimulation
[0314] Batches of C57BL6 mouse pups aged 3 days were treated as
follows:
[0315] 4 mouse pups (batch 1) received the mutant Toxo mic1-3
KO
[0316] 4 mouse pups (batch 2) served as untreated control
batch.
[0317] On D0, the mouse pups in batch 1 received 20,000 tachyzoites
of the strain Toxo mic1-3 KO by oral route.
[0318] On D3 post-immunostimulation, the mouse pups in batch 1 and
batch 2 were challenged with 1,000,000 parasites of Cryptosporidium
parvum,
[0319] On D10 post-immunostimulation, the mouse pups in batch 1 and
2 were sacrificed to evaluate protection against Cryptosporidium
parvum.
[0320] 1.5-Investigation of the State of Infection of the Mouse
Pups
[0321] The state of infection of the mouse pups was analysed by the
technique of tissue dissemination of the tachyzoites on HFF cells
described above. The HFF cells are deposited in a 24-well plate,
one week before depositing the organs at a rate of 10.sup.4 cells
per well. The cells are cultured in 1 mL of DMEM cell culture
medium supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of streptomycin.
After sacrifice of the mouse pups, the spleen of each of the mouse
pups is taken and ground in 2 mL of 1.times.PBS. Ten microlitres of
ground material is deposited per well containing the HFF cells
cultured in 1 mL of medium. Twenty-four hours after depositing the
ground material from the spleen, the cells are washed in DMEM and
then 1 mL of clean medium is deposited per well. The cells are
cultured until the lysis plaques revealing the presence of Toxo
mic1-3 KO tachyzoites are detected.
[0322] 1.6-Investigation of Protection
[0323] The protection of the mouse pups against Cryptosporidium
parvum is analysed by counting the oocysts in the intestine. Once
the mouse pups have been sacrificed, the intestines are recovered,
weighed, placed in 1 mL of water (4.degree. C.) and ground for 20
seconds. 100 microlitres of ground material is added to 400 .mu.l
of sugar solution at 4.degree. C. (500 g of sucrose, 320 mL of
distilled water, Na azide at 0.02%). After homogenizing the
solution by pipetting, 20 .mu.L is deposited on a Thoma slide.
Before counting the oocysts, the slides are kept in a cool place
for 15 minutes to allow the oocysts in the sugar solution to rise
to the surface. The total number of oocysts in the intestine is
calculated from the following formula: Total number of oocysts of
C. parvum in the intestine=Number of oocysts counted on Thoma
slide.times.dilution factor.times.10,000.times.(1+weight of the
intestine of the mouse pup).
2-Results
[0324] 2.1-Investigation of the State of Infection of the Mouse
Pups
Dissemination of the Spleens on HFF Cells
[0325] Dissemination of the spleens on MT' cells is illustrated in
Table XI.
TABLE-US-00011 TABLE XI Summary table of parasitaemia observed in
the case of C. parvum and in the case of T. gondii of the batch of
the mouse pups infected with C. parvum (infected C. parvum) and of
the batch of the mouse pups inoculated with Toxo mic1-3 KO and
infected with C. parvum (inoculated T. gondii + C. parvum).
Inoculated C. parvum Inoculated T. gondii + C parvum Total Total
number of Parasit- number of Parasit- mouse oocysts of aemia mouse
oocysts of aemia pups C. parvum T. gondii pups C. parvum T. gondii
1 2240000 NO 1 260000 YES 2 1794000 NO 2 476000 YES 3 1370000 NO 3
2046000 SLIGHT 4 2448000 NO 4 1687500 SLIGHT
[0326] The mouse pups infected only with C. parvum have a total
number of oocysts of C. parvum in the intestine in the range from
1.4.times.10.sup.6 to 2.4.times.10.sup.6 oocysts.
[0327] The mouse pups immunostimulated with Toxo mic1-3 KO and then
infected with C. parvum display T. gondii parasitaemia determined
semiquantitatively. For the mouse pups No. 1 and 2, which have
severe T. gondii parasitaemia, the total number of oocysts of C.
parvum in the intestine varies from 2.6.times.10.sup.5 to
4.8.times.10.sup.5 oocysts. These results demonstrate the
correlation that exists between parasitaemia with T. gondii mic1-3
KO and the reduction in infection with C. parvum.
[0328] 2.2-Investigation of Protection
[0329] The state of protection of the mouse pups is shown in FIG.
12.
[0330] In the batch of the mouse pups vaccinated with the mutant
Toxo mic1-3 KO by oral route, two mouse pups out of 4 have a total
number of oocysts of C. parvum in the intestine that is
significantly reduced by approximately 75% and 87%. These are the
mouse pups No. 1 and No. 2.
Example 7
Induction of Secretion of IL-12 and of IFN-.gamma. of Splenocytes
and Induction of Secretion of IL-12 of MLN Cells Originating from
Adult or Neonate Sheep after Stimulation with the Mutant Toxo
Mic1-3 KO
1-Experimental Protocol
[0331] 1.1-Animals
[0332] The mesenteric lymph nodes and the spleens of neonates used
in this experiment originate from lambs of the Ile de France breed
aged 6-12 days. Until sacrifice, the lambs were kept with their
mothers in a sealed sheep house (INRA-Nouzilly) in order to limit
the risks of natural contamination. They were anaesthetized by
electronarcosis and then euthanased to collect the different
organs. Only the animal keepers and the experimenters, equipped
with clothing for use inside the sheep house, may enter the
buildings, in order to avoid contamination of the environment, and
they only leave the sealed zone after showering. The utensils used
and the biological material are only taken out after passing
through a disinfectant bath, and the waste is incinerated.
[0333] The mesenteric lymph nodes and the spleens of adult subjects
used in this experiment originate from adult sheep of the Ile de
France breed aged from 1 to 3 years.
[0334] 1.2-Strains of Toxoplasma gondii
[0335] The wild-type RH and Pru strains and the mutant strain Toxo
mic1-3 KO are maintained by successive passages on a human foreskin
fibroblast (HFF) line cultured in DMEM medium supplemented with 10%
of foetal calf serum (FCS), 2 mM of glutamine, 50 U/mL of
penicillin and 50 .mu.g/mL of streptomycin.
[0336] 1.3-Isolation of the Cells of Interest
[0337] 1.3.1-Cells of the Mesenteric Lymph Nodes
[0338] The mesenteric lymph nodes are removed as quickly as
possible after the animals are euthanased, and transferred to a
sterile sample tube containing culture medium (HBSS supplemented
with 2% foetal calf serum (FCS) and 1% penicillin/streptomycin
(P/S)). The sample tube containing the sample is stored in ice
until it reaches the research laboratory.
[0339] Each lymph node is defatted using previously sterilized
forceps, scissors or scalpel. The lymph node is then deposited on a
sterile (autoclaved) nylon mesh measuring 3 cm.times.3 cm placed at
the bottom of a sterile Petri dish containing 10 mL of medium
(HBSS; 2% FCS; 1% P/S). The lymph node is crushed and comminuted
using a piston of a 5-mL syringe to release the cells contained in
the lymph node. The medium thus enriched with cells is filtered
using a 60-.mu.m sterile nylon cloth positioned above a 50-mL tube
for recovering the medium enriched with filtered cells. These last
steps are repeated twice as follows: 10 mL of medium is added to
the remaining fragments of lymph nodes. The fragments of lymph
nodes are crushed, comminuted and filtered as described above. The
50-mL tube for recovering the filtered cell-enriched medium is
centrifuged at 1600 g for 15 min at 4.degree. C. Washing is carried
out with 50 mL of medium (HBSS; 2% FCS; 1% P/S) by centrifugation
for 10 min at 400 g at 4.degree. C. The pellet thus obtained is
resuspended in a final volume of 90 mL of medium (HBSS; 2% FCS; 1%
P/S) at ambient temperature in two 50-mL tubes.
[0340] The 90 mL of cell suspension is divided into 3 to be
purified in a Ficoll-Hypaque gradient. 30 mL is carefully deposited
per tube (3 tubes in total) containing 15 mL of Ficoll-Hypaque. The
3 tubes of Ficoll-Hypaque enriched with cell suspension are
centrifuged at 1500 g without braking (deceleration 2, acceleration
5), for 30 minutes at room temperature. For each tube of
Ficoll-Hypaque, an upper phase is obtained composed of cell debris,
a ring composed of mononuclear cells, positioned as an interphase
between the cell debris and the Ficoll phase, and finally a lower
phase composed of red blood cells. The 3 rings (20 mL/tubes) are
recovered and divided into two 50-mL tubes and washed with a final
volume of 50 mL of medium (HBSS; 2% FCS; 1% P/S) at 700 g for 10
min. The pellets of mononuclear cells obtained are pooled. The
final pellet is washed with 50 mL of medium (HBSS; 2% FCS; 1% P/S)
by centrifugation at 400 g for 10 min. The pellet is taken up in 5
mL of RPMI, 10% FCS, 1% P/S, 5.10.sup.-5M of beta-mercaptoethanol.
The mononuclear cells are stored in ice; a proportion of the cells
is used for counting and observation of viability with Trypan blue
(sample diluted to 1/100). Once counted, the cells are distributed
in a 96-well plate at a rate of 3.10.sup.5 cells/well.
[0341] 1.3.2-Isolation of the Splenocytes
[0342] The spleen is removed as quickly as possible after
euthanasia and transferred to a sterile sample tube containing
culture medium (HBSS; 2% FCS; 1% P/S). The sample tube containing
the sample is stored in ice until it reaches the research
laboratory.
[0343] Each spleen is defatted using previously sterilized forceps,
scissors or scalpel. The spleen is then deposited on a metal grid
(autoclaved) placed at the bottom of a sterile Petri dish
containing 10 mL of medium (HBSS; 2% FCS; 1% P/S). The spleen is
crushed and comminuted using a piston of a 5-mL syringe to release
the cells contained in the spleen. The medium thus enriched with
cells is deposited in a 50-mL tube. These last steps are repeated
twice as follows: 5 mL of medium is added to the fragments of
spleen. The fragments of spleen are crushed and comminuted as
described above. The 50-mL tube for recovery of the medium enriched
with cells is left to settle for 5 min at 4.degree. C. The
supernatant is filtered on a 60 .mu.m nylon mesh above a 50-mL
tube. Ten millilitres of medium is added to the remaining sediments
and the second supernatant is recovered in the same way. The 50-mL
tube for recovery of the two supernatants is centrifuged for 30 s
at 400 g at 4.degree. C. The supernatant is recovered and filtered
on a 60-.mu.m sterile nylon mesh above a 50-mL tube. This last tube
is centrifuged for 10 min at 400 g at 4.degree. C. The cell pellet
thus obtained is resuspended in a final volume of 50 mL of medium
(HBSS; 2% FCS; 1% P/S). Washing is carried out by centrifugation
for 10 min at 400 g at 4.degree. C. The pellet is then taken up in
a final volume of 120 mL in three 50-mL tubes of medium (HBSS; 2%
FCS; 1% P/S) at room temperature.
[0344] The 120 mL of cell suspension is divided into 3 to be
purified in a Ficoll-Hypaque gradient. 30 mL is carefully deposited
per tube (4 tubes in total) containing 15 mL of Ficoll-Hypaque. The
4 tubes of Ficoll-Hypaque enriched with cell suspension are
centrifuged at 1500 g without braking (deceleration 2, acceleration
5), for 30 minutes at room temperature. For each tube of
Ficoll-Hypaque, an upper phase is obtained composed of cell debris,
a ring composed of mononuclear cells positioned as an interphase
between the cell debris and the Ficoll phase, and finally a lower
phase composed of red blood cells. The 4 rings (20 mL/tubes) are
recovered and divided into three 50-mL tubes and washed with a
final volume of 50 mL of medium (HBSS; 2% FCS; 1% P/S) at 700 g for
10 min. The pellets of mononuclear cells obtained are pooled. The
final pellet is washed with 50 mL of medium (HBSS; 2% FCS; 1% P/S)
by centrifugation at 400 g for 10 min. The pellet is taken up in 5
mL of RPMI, 10% FCS, 1% P/S, 5.10.sup.-5M of beta-mercaptoethanol.
The mononuclear cells are stored in ice; a proportion of the cells
is used for counting and observation of viability with trypan blue
(sample diluted to 1/100). Once counted, the cells are distributed
in a 96-well plate at a rate of 3.10.sup.5 cells/well.
[0345] 1.4-Stimulation of the Mononuclear Cells of the Lamb
Mesenteric Lymph Nodes and Splenocytes
[0346] Once counted, the cells are distributed in a 96-well plate
at a rate of 3.10.sup.5 cells/well. The tachyzoites are also
counted on a Malassey slide; pellets are obtained and are taken up
in RPMI medium, 10% FCS, 1% P/S. The solutions of the tachyzoites
(RH or KO) are adjusted to obtain a concentration of 3.10.sup.6
tachyzoites/mL. The conditions for stimulation are as follows: 3
mononuclear cells are stimulated per tachyzoite. Parasites, lymph
node mononuclear cells and spleen mononuclear cells are cultured at
37.degree. C. in a stove at 5% CO.sub.2 and 95% humidity.
[0347] 24 h post-stimulation, the supernatants of the lymph node
mononuclear cells and the supernatants of the spleen mononuclear
cells are used for assay of interleukin-12 and IFN-.gamma. by the
ELISA technique.
[0348] 1.5-Assay of Interleukin-12 by the ELISA Technique
[0349] The technique used for assay of interleukin-12 is an ELISA
of the sandwich type on a 96-well plate. The antibody (anti-IL-12)
immobilized on a plate reacts specifically with the IL-12 present
in the test sample. The quantity of antigen-antibody is measured
for a second time after it has reacted with an antibody of
identical specificity coupled to an enzyme.
[0350] All the dilutions of the different reagents are carried out
with 1.times.PBS, 0.05% Tween 20 and 1% BSA except for the capture
antibody, which is diluted in 1.times.PBS.
[0351] 50 .mu.L per well of capture antibodies diluted to 1/500
(Mouse anti-bovine interleukin-12 clone CC 301, Serotec MCA1782EL,
Initial concentration: 1000 .mu.g/mL) is deposited in an ELISA
plate (ELISA plate Nunc maxisorp 442404) and then incubated
overnight at 4.degree. C. Three washings are carried out in
1.times.PBS buffer with the addition of 0.05% Tween 20 (PBS-T). The
non-specific sites are saturated by incubating the plates for 1
hour at room temperature with 200 .mu.L of a 1.times.PBS solution;
0.05% Tween 20, 1% BSA. Three washings are carried out in
1.times.PBS buffer with the addition of 0.05% Tween 20 (PBS-T).
[0352] The range is prepared as follows: 50 .mu.L of the standard
range of rov IL-12 is deposited at different concentrations: 16
U/mL, 8 U/mL, 4 U/mL, 2 U/mL, 1 U/mL, 0.5 U/mL, 0.25 U/mL, 0.125
U/mL, 0.0625 U/mL, 0.03125 U/mL. In parallel, the samples
(supernatant of stimulated mononuclear cells, diluted 1/2) are
deposited at a rate of 50 .mu.L per well. The samples and the
standard range are incubated for 1 h at room temperature. 4
washings are carried out in 1.times.PBS buffer with the addition of
0.05% Tween 20 (PBS-T).
[0353] 50 .mu.L of biotinylated detection antibodies (Mouse
anti-bovine interleukin-12: biotin clone CC 326 (Serotec MCA2173B)
Initial concentration: 500 .mu.g/ml) diluted to 1/500 is deposited
per well, for an incubation time of one hour at room temperature. A
series of 4 washings is carried out in 1.times.PBS buffer with the
addition of 0.05% Tween 20 (PBS-T).
[0354] IL-12 is detected by a biotin-ExtrAvidine.RTM. affinity
reaction followed by a colorimetric reaction between peroxidase and
its substrate: 50 .mu.L of modified avidin coupled to a peroxidase
(ExtrAvidine-Peroxidase conjugate.RTM. (Sigma E2886)) diluted to
1/2000th is deposited per well and incubated for 20 minutes at room
temperature. A series of 4 washings is carried out in 1.times.PBS
buffer with the addition of 0.05% Tween 20 (PBS-T). Detection is
carried out using 50 .mu.L/well of peroxidase substrate originating
from a solution A and B mixed volume for volume (TMB Peroxidase
substrate Eurobio KPL solution A 50-76-01 and solution B 50-65-00).
The substrate solution is incubated for 15 minutes at room
temperature. 50 .mu.L of stopping solution (phosphoric acid 1M
Sigma 43,080-1, CAS 7664-38-2) is added per well under a fume
hood.
[0355] The plates are read at wavelength 2=450 nm. The standard
curve is determined by the following function: OD value as a
function of the concentration of recombinant IL-12. The OD values
of the samples tested are converted to concentration using the
standard curve. To be taken into account, the samples must give ODs
located on the linear portion of the standard curve.
[0356] 1.6-Assay of Interferon Gamma by the ELISA Technique
[0357] The technique used for assay of interferon is an ELISA,
comparable to the assay of interleukin-12 described in the
preceding paragraph, of the sandwich type on a 96-well plate. The
antibody (anti-IFN.gamma.) immobilized on a plate reacts
specifically with the IFN.gamma. present in the test sample. The
quantity of antigen-antibody is measured for a second time after it
has reacted with an antibody of identical specificity to an
enzyme.
[0358] All the dilutions of the different reagents are prepared in
1.times.PBS, 0.05% Tween 20 and 1% BSA except for the capture
antibody, which is diluted in 1.times.PBS.
[0359] 50 .mu.l per well of capture antibodies diluted to 1/500
(Mouse anti-bovine interferon gamma clone CC 330, Serotec MCA2112,
Initial concentration: 1000 .mu.g/mL) is deposited in an ELISA
plate (ELISA plate Nunc maxisorp 442404) and then incubated
overnight at 4.degree. C. Three washings are carried out in
1.times.PBS buffer with the addition of 0.05% Tween 20 (PBS-T). The
non-specific sites are saturated by incubating the plates for 1
hour at room temperature with 200 .mu.L of a solution 1.times.PBS;
0.05% Tween 20, 1% BSA. Three washings are carried out in
1.times.PBS buffer with the addition of 0.05% Tween 20 (PBS-T).
[0360] The range is prepared as follows: 50 .mu.L of the standard
range of Recombinant bovine IFN.gamma. (Perbio Endogen
robIFNG.gamma., initial concentration: 30 .mu.g/ml) is deposited at
different concentrations: 4 ng/mL, 2 ng/mL, 1 ng/mL, 0.5 ng/mL,
0.25 ng/mL, 0.125 ng/mL, 0.0625 ng/mL, 0.03125 ng/mL, 0.015 ng/ml).
In parallel, the samples (supernatant of stimulated mononuclear
cells, diluted 1/2) are deposited at a rate of 50 .mu.L per well.
The samples and the standard range are incubated for 1 h at room
temperature. 4 washings are carried out in 1.times.PBS buffer with
the addition of 0.05% Tween 20 (PBS-T).
[0361] 50 .mu.L of biotinylated detection antibodies (Mouse
anti-bovine interferon gamma: biotin clone CC 302 (Serotec
MCA1783B) Initial concentration: 500 .mu.g/ml) diluted to 1/500 is
deposited per well, for an incubation time of one hour at room
temperature. A series of 4 washings is carried out in 1.times.PBS
buffer with the addition of 0.05% Tween 20 (PBS-T).
[0362] IFN.gamma. is detected by a biotin-ExtrAvidine.RTM. affinity
reaction followed by a colorimetric reaction between peroxidase and
its substrate: 50 .mu.L of modified avidin coupled to a peroxidase
(ExtrAvidine-Peroxidase conjugate.RTM. (Sigma E2886)) diluted to
1/2000th is deposited per well and incubated for 20 minutes at room
temperature. A series of 4 washings is carried out in 1.times.PBS
buffer with the addition of 0.05% Tween 20 (PBS-T). Detection is
carried out using 50 .mu.L per well of peroxidase substrate
originating from a solution A and B mixed volume for volume (TMB
Peroxidase substrate Eurobio KPL solution A 50-76-01 and solution B
50-65-00). The substrate solution is incubated for 15 minutes at
room temperature. 50 .mu.L of stopping solution (phosphoric acid 1M
Sigma 43,080-1, CAS 7664-38-2) is added per well under a fume
hood.
[0363] The plates are read at wavelength 2=450 nm. The standard
curve is determined by the following function: OD value as a
function of the concentration of recombinant IFN.gamma.. The OD
values of the samples tested are converted to concentration using
the standard curve. To be taken into account, the samples must give
ODs located on the linear portion of the standard curve.
2-Results
[0364] The level of IL-12 and of IFN-.gamma. secreted by the
mononuclear cells of spleens and the level of IL-12 secreted by the
mononuclear cells of mesenteric lymph nodes (MLN) isolated from
lambs aged from 6 to 12 days and from adult sheep aged from 1 to 3
years and stimulated with different strains of the parasite
Toxoplasma gondii are shown in FIGS. 13-A, 13-B and 13-C.
[0365] In the sheep aged from 1 to 3 years, production of IL-12 by
the mononuclear cells originating from the spleen or from the
mesenteric lymph nodes is greater when the latter have been
stimulated in vitro by the mutant strain Toxo mic1-3 KO or by the
wild-type Pru and RH strains of T. gondii. This observation is more
pronounced in the case of cells from the mesenteric lymph nodes of
adult sheep.
[0366] In the lambs aged from 6 to 12 days, production of IL-12 by
the mononuclear cells originating from the spleen or from the
mesenteric lymph nodes is greater when the latter have been
stimulated in vitro by the parasite T. gondii. Production of IL-12
is even greater when the mononuclear cells have been stimulated in
vitro by the mutant strain Toxo mic1-3 KO.
[0367] In the sheep aged from 1 to 3 years, production of
IFN.gamma. by the mononuclear cells originating from the spleen
does not differ significantly when the latter have been stimulated
in vitro by the mutant strain mic1-3 KO or by the wild-type strains
Pru and RH of T. gondii.
[0368] In the lambs aged from 6 to 12 days, production of
IFN.gamma. by the mononuclear cells originating from the spleen
does not differ significantly when the latter have been stimulated
in vitro by the mutant strain mic1-3 KO or by the wild-type strains
Pru and RH of T. gondii.
[0369] Production of IL-12 and IFN-.gamma. by the mononuclear cells
originating from lambs is much greater than that observed for the
mononuclear cells from the adult sheep.
Example 8
Immunostimulation of Neonate Lambs by the Mutant Toxoplasma gondii
Toxo Mic1-3 KO
1-Experimental Protocol
[0370] 1.1-Animals
[0371] Immunostimulation is carried out on 1-day-old neonate lambs.
After ingestion of colostrum, the lambs were isolated from their
mothers in a sealed sheep house (INRA-Nouzilly) in order to limit
the risks of natural contamination. They were anaesthetized by
electronarcosis and then euthanased to collect the various organs.
Only the animal keepers and the experimenters, equipped with
clothing for use inside the animal house, may enter the buildings,
to prevent contamination of the environment, and they only leave
the sealed zone after showering.
[0372] 1.2-Strain Toxo mic1-3 KO
[0373] The mutant strain of Toxoplasma gondii, in which the genes
coding for the proteins MIC1 and MIC3 have been suppressed (called
strain Toxo mic1-3 KO) is maintained by successive passages on a
human foreskin fibroblast (HFF) line cultured in DMEM medium
supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of
streptomycin.
[0374] 1.3-Immunostimulation
[0375] Six one-day-old lambs were treated as follows:
[0376] 4 lambs (batch A) received the mutant Toxo mic1-3 KO
[0377] 2 lambs (batch B) served as unvaccinated control batch.
[0378] On D1, the lambs in batch A received 10.sup.6 tachyzoites of
the strain Toxo mic1-3 KO subcutaneously. After immunostimulation,
the temperatures and the weights of the lambs are recorded
daily.
[0379] On D15 post-immunostimulation, the lambs are euthanased for
investigating the immune response and parasitaemia.
[0380] 1.4-Isolation of the Cells of Interest
[0381] 1.4.1-Isolation of the Splenocytes
[0382] The spleen is removed as quickly as possible after
euthanasia and transferred to a sterile sample tube containing
culture medium (HBSS; 2% FCS; 1% P/S). The sample tube containing
the sample is stored in ice until it reaches the research
laboratory.
[0383] Each spleen is defatted using previously sterilized forceps,
scissors or scalpel. The spleen is then deposited on a metal grid
(autoclaved) placed at the bottom of a sterile Petri dish
containing 10 mL of medium (HBSS; 2% FCS; 1% P/S). The spleen is
crushed and comminuted using a piston of a 5-mL syringe to release
the cells contained in the spleen. The medium thus enriched with
cells is deposited in a 50-mL tube. These last steps are repeated
twice as follows: 5 mL of medium is added to the fragments of
spleen. The fragments of spleen are crushed and comminuted as
described above. The 50-mL tube for recovery of the cell-enriched
medium is left to settle for 5 min at 4.degree. C. The supernatant
is filtered on a 60 .mu.m nylon mesh above a 50-mL tube. Ten
millilitres of medium is added to the remaining sediments and the
second supernatant is recovered in the same way. The 50-mL tube for
recovery of the two supernatants is centrifuged for 30 s at 400 g
at 4.degree. C. The supernatant is recovered and filtered on a
60-.mu.m sterile nylon mesh above a 50-mL tube. This last tube is
centrifuged for 10 min at 400 g at 4.degree. C. The cell pellet
thus obtained is resuspended in a final volume of 50 mL of medium
(HBSS; 2% FCS; 1% P/S). Washing is carried out by centrifugation
for 10 min at 400 g at 4.degree. C. The pellet is then taken up in
a final volume of 120 mL in three 50-mL tubes of medium (HBSS; 2%
FCS; 1% P/S) at room temperature.
[0384] The 120 mL of cell suspension is divided into 3 to be
purified in a Ficoll-Hypaque gradient. 30 mL is carefully deposited
per tube (4 tubes in total) containing 15 mL of Ficoll-Hypaque. The
4 tubes of Ficoll-Hypaque enriched with cell suspension are
centrifuged at 1500 g without braking (deceleration 2, acceleration
5), for 30 minutes at room temperature. For each tube of
Ficoll-Hypaque, an upper phase is obtained composed of cell debris,
a ring composed of mononuclear cells positioned as an interphase
between the cell debris and the Ficoll phase, and finally a lower
phase composed of red blood cells. The 4 rings (20 mL/tubes) are
recovered and divided into three 50-mL tubes and washed with a
final volume of 50 mL of medium (HBSS; 2% FCS; 1% P/S) at 700 g for
10 min. The pellets of mononuclear cells obtained are pooled. The
final pellet is washed with 50 mL of medium (HBSS; 2% FCS; 1% P/S)
by centrifugation at 400 g for 10 min. The pellet is taken up in 5
mL of RPMI, 10% FCS, 1% P/S, 5.10.sup.-5M of beta-mercaptoethanol.
The mononuclear cells are stored in ice; a proportion of the cells
is used for counting and observation of viability with trypan blue
(sample diluted to 1/100). Once counted, the cells are distributed
in a 96-well plate at a rate of 3.10.sup.5 cells/well.
[0385] 1.4.2-Isolation of the Lymph Node Cells
[0386] The popliteal and subiliac lymph nodes, situated near the
injection site, are removed as quickly as possible after euthanasia
of the animals and are transferred to a sterile sample tube
containing culture medium (HBSS supplemented with 2% foetal calf
serum (FCS) and 1% penicillin/streptomycin (P/S)). The sample tube
containing the sample is stored in ice until it reaches the
research laboratory.
[0387] Each lymph node is defatted using previously sterilized
forceps, scissors or scalpel. The lymph node is then deposited on a
sterile (autoclaved) nylon mesh measuring 3 cm.times.3 cm placed at
the bottom of a sterile Petri dish containing 10 ml of medium
(HBSS; 2% FCS; 1% P/S). The lymph node is crushed and comminuted
using a piston of a 5-mL syringe to release the cells contained in
the lymph node. The medium thus enriched with cells is filtered
using a 60-.mu.m sterile nylon mesh positioned above a 50-mL tube
for recovering the medium enriched with filtered cells. These last
steps are repeated twice as follows: 10 mL of medium is added to
the remaining fragments of lymph nodes. The fragments of lymph
nodes are crushed, comminuted and filtered as described above. The
50-mL tube for recovering the filtered cell-enriched medium is
centrifuged at 1600 g for 15 min at 4.degree. C. Washing is carried
out with 50 mL of medium (HBSS; 2% FCS; 1% P/S) by centrifugation
for 10 min at 400 g at 4.degree. C. The pellet is taken up in 5 mL
of RPMI, 10% FCS, 1% P/S, 5.10.sup.-5M of beta-mercaptoethanol. The
pellet is stored in ice; a proportion of the cells is used for
counting and observation of viability with trypan blue (sample
diluted to 1/100). Once counted, the cells are distributed in a
96-well plate at a rate of 3.10.sup.5 cells/well.
[0388] 1.5-Investigation of the Inflammatory Response
Post-Immunostimulation
[0389] 1.5.1-from the Spleen Cells
[0390] Once the mononuclear cells of the spleen have been isolated
by Ficoll Histopaque gradient and distributed in a 96-well plate,
at a rate of 3.10.sup.5 cells per well, the latter are stimulated
in vitro with 30 .mu.g/ml of total parasite extract of the strain
Toxo mic1-3 KO. To establish a positive control for the
experiments, the cells are stimulated with concanavalin A.
Conversely, to establish a negative control for the experiments,
the cells are cultured in a medium without stimulant. The
supernatants are taken after 24 hours post-stimulation in
vitro.
[0391] The technique used for assay of IFN.gamma. is an ELISA of
the sandwich type on a 96-well plate. The antibody
(anti-IFN.gamma.) immobilized on a plate reacts specifically with
the IFN.gamma. present in the test sample. The quantity of
antigen-antibody is measured in a second phase after it has reacted
with an antibody of identical specificity coupled to an enzyme.
[0392] All the dilutions of the various reagents are prepared in
1.times.PBS, 0.05% Tween 20 and 1% BSA, except for the capture
antibody, which is diluted in 1.times.PBS.
[0393] 50 .mu.L per well of capture antibody diluted to 1/500
(Mouse anti-bovine IFNg clone CC 330, Serotec MCA2112, Initial
concentration: 1000 .mu.g/mL) is deposited in an ELISA plate (ELISA
plate Nunc maxisorp 442404) and then incubated overnight at
4.degree. C. Three washings are carried out in 1.times.PBS buffer
with the addition of 0.05% Tween 20 (PBS-T). The non-specific sites
are saturated by incubating the plates for 1 hour at room
temperature with 200 .mu.L of a 1.times.PBS solution; 0.05% Tween
20, 1% BSA. Three washings are carried out in 1.times.PBS buffer
with the addition of 0.05% Tween 20 (PBS-T).
[0394] The range is prepared as follows: 50 .mu.L of the standard
range of rBoIFN.gamma. is deposited at different concentrations: 4
ng/mL, 2 ng/mL, 1 ng/mL, 0.5 ng/mL, 0.25 ng/mL, 0.125 ng/mL, 0.0625
ng/mL, 0.03125 ng/mL, 0.015 ng/mL. In parallel, the samples
(supernatant of stimulated mononuclear cells) are deposited at a
rate of 50 .mu.L per well. The samples and the standard range are
incubated for 1 h at room temperature. 4 washings are carried out
in 1.times.PBS buffer with the addition of 0.05% Tween 20
(PBS-T).
[0395] 50 .mu.L of biotinylated detection antibodies (Mouse
anti-bovine IFNg: biotin clone CC 302 (Serotec MCA1783B) Initial
concentration: 500 .mu.g/ml) diluted to 1/500 is deposited per
well, for an incubation time of one hour at room temperature. A
series of 4 washings is carried out in 1.times.PBS buffer with the
addition of 0.05% Tween 20 (PBS-T).
[0396] IFN.gamma. is detected by a biotin-ExtrAvidine.RTM. affinity
reaction followed by a colorimetric reaction between peroxidase and
its substrate: 50 .mu.L of a solution of modified avidin coupled to
a peroxidase (ExtrAvidine-Peroxidase conjugate.RTM. (Sigma E2886))
diluted to 1/2000th is deposited per well and incubated for 20
minutes at room temperature. A series of 4 washings is carried out
in 1.times.PBS buffer with the addition of 0.05% Tween 20 (PBS-T).
Detection is carried out using 50 .mu.L/well of peroxidase
substrate originating from a solution A and B mixed volume for
volume (TMB Peroxidase substrate Eurobio KPL solution A 50-76-01
and solution B 50-65-00). The substrate solution is incubated for
15 minutes at room temperature. 50 .mu.L of stopping solution
(phosphoric acid 1M Sigma 43,080-1, CAS 7664-38-2) is added per
well under a fume hood.
[0397] The plates are read at wavelength .lamda.=450 nm. The
standard curve is determined by the following function: OD value as
a function of the concentration of the recombinant IFN.gamma.. The
OD values of the samples tested are converted to concentration
using the standard curve. To be taken into account, the samples
must give ODs located on the linear portion of the standard
curve.
[0398] 1.5.2-from the Lymph Node Cells
[0399] The lymph node cells distributed in a 96-well plate at a
rate of 3.10.sup.5 cells per well are cultured without any
stimulant in order to detect expression of the cytokines ex-vivo.
The supernatants of the lymph node cells are taken after 24 hours.
IFN.gamma. is assayed by the ELISA technique as described
above.
2-Results
[0400] 2.1-Experimental Procedure
[0401] After ingestion of colostrum, the lambs are separated from
their mothers and are fed with a lamb feeder bucket. The 4 lambs in
batch A were immunostimulated with 10.sup.6 tachyzoites of the
strain Toxo mic1-3 KO, freshly produced. After inoculation with the
strain Toxo mic1-3 KO, no severe clinical sign was found and the
lambs immunostimulated with the strain Toxo mic1-3 KO have a weight
curve similar to the weight gain of the control lambs (FIG.
14).
[0402] The lambs from batch A and from batch B were euthanased 15
days after immunostimulation.
[0403] 2.2-Investigation of the Inflammatory Response
Post-Immunostimulation
[0404] The results of the assays of the IFN-.gamma. produced from
splenocytes restimulated with total extract of T. gondii and from
the cells of the subiliac and popliteal lymph nodes are presented
in FIGS. 15 and 16.
[0405] The lambs of the control batch (1423 and 1428) did not
develop an inflammatory response (IFN-.gamma. secretion), either in
the spleen, or in the subiliac and popliteal lymph nodes.
[0406] In contrast, 15 days after immunostimulation, the cells of
the subiliac lymph nodes of 3 lambs out of 4 produce IFN-.gamma..
These lymph nodes are situated downstream of the injection site, in
contrast to the popliteal lymph nodes, situated upstream and in
which no production of IFN-.gamma. is detected.
[0407] The inflammatory response of the lambs immunostimulated with
the strain Toxo mic1-3 KO is confirmed after restimulation of the
splenocytes with total parasite extract of the strain Toxo mic1-3
KO, since production of IFN-.gamma. is induced for the 4 lambs. The
splenocytes are also stimulated with concanavalin A, a protein of
the lectin family, known to be a polyclonal activator of the T
lymphocytes, which serves as positive control of stimulation of the
immune system cells.
Example 9
Protection Against Cryptosporidiosis of Lambs Immunostimulated
Subcutaneously with the Mutant Toxo Mic1-3 KO
1-Experimental Protocol
[0408] 1.1-Animals
[0409] Immunostimulation is carried out on 1-day-old neonate lambs.
After ingestion of colostrum, the lambs were isolated from their
mothers in a sealed sheep house (INRA-Nouzilly) in order to limit
the risks of natural contamination.
[0410] At the end of the experiments, the lambs were anaesthetized
by electronarcosis and then euthanased to collect the various
organs. Only the animal keepers and the experimenters, equipped
with clothing for use inside the animal house, may enter the
buildings, in order to prevent contamination of the environment,
and they only leave the sealed zone after showering.
[0411] 1.2-Cryptosporidium parvum
[0412] Oocysts of Cryptosporidium parvum are obtained from
excrement of calves infected with 10.sup.7 C. parvum oocysts. The
stool undergoes various treatments until a suspension of sterile,
purified parasites is obtained, suitable for use in cell culture.
Throughout the treatment, the oocysts are manipulated at 4.degree.
C. to prevent excystation of the oocysts.
[0413] Briefly, after recovery of the stool, the latter is diluted
in fresh water and then passed through a 100-.mu.m filter and
centrifuged at 1900 g for 10 minutes at 4.degree. C. The pellets
obtained, containing the oocysts, are taken up in 2% potassium
dichromate solution (Prolabo, ref. 26 776 290, CAS 7778-50-9), and
are then washed twice with cold water by centrifugation at 1900 g
for 10 minutes at 4.degree. C. to remove the potassium dichromate.
After washing, the pellet of coccidia is taken up in a mixture of
water and ether (ethyl ether, Carlo Erba, CAS No. 60-29-7) diluted
to 1/5, then centrifuged again at 1900 g for 10 minutes at
4.degree. C. The upper phases containing the fats and the ether are
removed and the pellet is recovered and taken up in cold water
after passing through a 20-.mu.m filter. Two to three millilitres
of the suspension of parasites obtained is deposited on a glucose
gradient prepared from Sheather solution (sucrose 500 g, water 320
ml, 0.2 g of sodium azide (Prolabo, CAS 26628-22-8)). Two rings of
oocysts are formed after centrifugation of the glucose gradient at
2000 g for 20 minutes at 4.degree. C. The two rings are recovered
and washed several times in cold water. The purified oocysts are
then sterilized. After centrifugation at 1900 g for 10 minutes at
4.degree. C., the pellet of oocysts is incubated for 15 minutes in
a solution of bleach (sodium hypochlorite (Sigma 239305-500ML
Titre: 4.5% of active chlorine)) diluted to 10% in demineralized
water, then washed 3 times in sterile 1.times.PBS (diluted from a
solution of PBS 10.times.: sodium chloride, NaCl 80 g/litre water;
potassium chloride, KCl 2 g/litre; potassium dihydrogen phosphate,
KH.sub.2PO.sub.4: 2 g/litre; disodium hydrogen phosphate,
Na.sub.2HPO.sub.4, 12 H.sub.2O: 29 g/litre). The purified and
sterilized oocysts are counted on a slide (5 .mu.L of solution of
oocysts and 495 .mu.L of malachite green), adjusted to a
concentration of 2.times.10.sup.8 oocysts/mL, divided into aliquots
in 1.5-mL tubes and stored at 4.degree. C.
[0414] 1.3-Strain Toxo Mic1-3 KO
[0415] The mutant strain of Toxoplasma gondii, in which the genes
coding for the proteins TgMIC1 and TgMIC3 have been knocked out
(called strain Toxo mic1-3 KO) is maintained by successive passages
on a human foreskin fibroblast (HFF) line cultured in DMEM medium
supplemented with 10% of foetal calf serum (FCS), 2 mM of
glutamine, 50 U/mL of penicillin and 50 .mu.g/mL of
streptomycin.
[0416] 1.4-Immunostimulation
[0417] Two batches of 1-day-old male lambs were treated as
follows:
[0418] 8 lambs (batch A) served as unvaccinated control batch,
[0419] 8 lambs (batch B) received the mutant Toxo mic1-3 KO.
[0420] On D1, the lambs in batch B received 10.sup.6 tachyzoites of
the strain Toxo mic1-3 KO by intraperitoneal route.
[0421] On D7 post-infection, the lambs in batch A and in batch B
were challenged with 5.10.sup.6 oocysts of Cryptosporidium parvum
and the lambs were sacrificed on D31.
[0422] 1.5-Investigation of Protection
[0423] To analyse the protection generated by immunostimulation
with the strain Toxo mic1-3 KO, 3 parameters were studied:
[0424] Survival-Mortality
After challenge with Cryptosporidium parvum, the lambs were
monitored daily for 25 days (until D31).
[0425] Weight Gain:
The lambs in batch A and in batch B were weighed every 2-3 days to
evaluate their weight gain.
[0426] Excretion of Oocysts:
The faeces of the lambs were recovered daily from D9 to D22 and
were stored at +4.degree. C. After weighing, 26 mg of faecal matter
is diluted in 750 .mu.L of water. 4 mL of sucrose solution is
added. After homogenization, 20 .mu.L is deposited on a Thoma slide
and the oocysts are counted. The number of oocysts excreted is then
calculated with the following formula: N=n.times.10 000.times.20
(N: number of oocysts per g or per ml, n=number of oocysts counted
on the cell, 20=dilution 1/4.times.1/5).
2-Results
[0427] 2.1-Experimental procedure
[0428] After ingestion of colostrum, the lambs are separated from
their mother and are fed with a lamb feeder bucket. 3 lambs from
batch B and 1 lamb from batch A were unable to feed properly and
were euthanased. Since euthanasia took place before the infectious
challenge, these animals were statistically removed from the
protocol.
[0429] 2.1 Investigation of Protection
[0430] Survival-Mortality
Following infection with C. parvum, four lambs essentially of the
control batch (batch A) were euthanased, in contrast to the
immunostimulated batch (batch B), in which no lamb died following
infection with C. parvum (FIG. 17).
[0431] Weight Gain
The daily weight gain (DAG, daily average gain) of the lambs in
batch A and in batch B is presented in FIG. 18. A significantly
lower DAG is found for batch A challenged only with C. parvum than
for batch B immunostimulated with the strain Toxo mic1-3 KO and
then challenged with C. parvum.
[0432] Excretion of Oocysts
Analysis of the parasitic load in the excrement of the lambs shows
a shift of the excretion peak of one day for the batch
immunostimulated with the strain Toxo mic1-3 KO, with a 70% drop of
the mean excretion peak observed at 5 days post-infection with C.
parvum compared to the mean excretion peak for the control batch
challenged only with C. parvum observed at 4 days post-infection
with C. parvum (FIG. 19).
Sequence CWU 1
1
38134DNAArtificial Sequence5 HR NCmic3 F KpnI 1cgcggtaccc
atgtgaatat gctttaaccg tgac 34234DNAArtificial Sequence5 HR NCmic3 R
ClaI 2cgcatcgatg agctataacc cttggaaatg actc 34331DNAArtificial
Sequence3 HR NCmic3 F XbaI 3cgctctagac atgctgatga agaagggaag t
31434DNAArtificial Sequence3 HR NCmic3 R NotI 4cgcgcggccg
ctctctcctg aagtcttcga gacc 34525DNAArtificial SequenceHR NCmic3 F
5gtcatcgacc gccggaacta gtagt 25626DNAArtificial SequenceHR NCmic3 R
6gcagaggttc tgcgtatcta acacgg 26721DNAArtificial SequenceORF NCmic3
F 7tttcccttct aaacacagtc g 21822DNAArtificial SequenceORF NCmic3 R
8ccttcagtgg ttctccatga gt 22920DNAArtificial SequenceORF DHFR F
9ccttctcaga caacggggta 201020DNAArtificial SequenceORF DHFR R
10agatcttcac gcccttctca 201124DNAArtificial SequenceInteg NCmic3 F
11gaaagtgtca gtggtagaga ctgc 241227DNAArtificial SequenceORF NCmic3
R2 12ccttcactcg agatcgcgca aatgagc 271323DNAArtificial SequenceORF
DHFR R2 13ggacctctgt acgagacatg ccg 231424DNAArtificial
SequenceInteg NCmic3 R 14tgtttacagg tgatccagaa aagg
241520DNAArtificial SequenceORF NCmic3 F2 15gaattttggg acaggggaat
201625DNAArtificial SequenceORF DHFR F2 16gtctctcgtt ttcctctctt
ttcgg 251733DNAArtificial Sequence3 HR NCmic1 F KpnI 17cgcggtacca
ggcagaagta aagaaggttc ctc 331830DNAArtificial Sequence3 HR NCmic1 R
HindIII 18cgcaagcttt gatcacgcaa gaaaagaagc 301932DNAArtificial
Sequence5 HR NCmic1 F BamHI 19cgcggatccc atttgtagat acggttgcac ac
322033DNAArtificial Sequence5 HR NCmic1 R NotI 20cgcgcggccg
cacattcaga cggcagaact ctg 332120DNAArtificial SequenceInteg NCmic1
F 21ccgagcaagt tagcaagtcc 202220DNAArtificial SequenceORF CATGFP R
22ccgtttggtg gatgtcttct 202320DNAArtificial SequenceORF CATGFP F
23gcatcgactt caaggaggac 202420DNAArtificial SequenceInteg NCmic1 R
24cttgtccgtc acatcgtttg 202520DNAArtificial SequenceORF NCmic1 R
25ttctccaggc actcacctct 202620DNAArtificial SequenceORF NCmic1 F
26agcttccaac aacgagagga 202720DNAArtificial SequenceORF NCmic1 F2
27cccaggatat cgtttgttgc 202820DNAArtificial SequenceORF NCmic1 R2
28cttctgatgc acggaactga 202920DNAArtificial SequenceORF CATGFP F2
29cctgaagttc atctgcacca 203020DNAArtificial SequenceORFCATGFP R2
30gtagtggttg tcgggcagca 203121DNAArtificial SequenceIL12 F
31ctcacatctg ctgctccaca a 213221DNAArtificial SequenceIL12 R
32gacgccattc cacatgtcac t 213322DNAArtificial SequenceIFN gamma F
33tcttcttgga tatctggagg aa 223423DNAArtificial SequenceIFN gamma R
34agctcattga atgcttggcg ctg 233522DNAArtificial SequenceHPRT F
35ggatacaggc cagactttgt tg 223620DNAArtificial SequenceHPRT R
36gagggtaggc tggcctatag 203725DNAArtificial SequenceSAG-1 F
37ctgcaccact tcattatttc ttctg 253819DNAArtificial SequenceSAG-1 R
38actcacgcga cacaagctg 19
* * * * *