U.S. patent application number 14/403516 was filed with the patent office on 2015-06-11 for methods of regulating cannabinoid receptor activity-related disorders and diseases.
The applicant listed for this patent is The United States of America, as represented by the Secretary, Dept. of Health and Human Services, The United States of America, as represented by the Secretary, Dept. of Health and Human Services. Invention is credited to Michel Bernier, Rajib Kumar Paul, Irving William Wainer.
Application Number | 20150157580 14/403516 |
Document ID | / |
Family ID | 48577922 |
Filed Date | 2015-06-11 |
United States Patent
Application |
20150157580 |
Kind Code |
A1 |
Wainer; Irving William ; et
al. |
June 11, 2015 |
METHODS OF REGULATING CANNABINOID RECEPTOR ACTIVITY-RELATED
DISORDERS AND DISEASES
Abstract
This disclosure concerns the discovery of the use of fenoterol
analogues for regulating cannabinoid (CB) receptor activity-related
disorders and disease, such as dysregulated CB receptors, including
treating a disorder or disease, such as a glioblastoma,
hepatocellular carcinoma, liver cancer, colon cancer, and/or lung
cancer, which is associated with altered cannabinoid receptor
activity. In one example, the method includes administering to a
subject having or at risk of developing a disorder or disease
regulated by CB receptor activity an effective amount of a
fenoterol analogue to reduce one or more symptoms associated with
the disorder or disease regulated by CB receptor activity.
Inventors: |
Wainer; Irving William;
(Washington, DC) ; Bernier; Michel; (Pikesville,
MD) ; Paul; Rajib Kumar; (Baltimore, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The United States of America, as represented by the Secretary,
Dept. of Health and Human Services |
Bethesda |
MD |
US |
|
|
Family ID: |
48577922 |
Appl. No.: |
14/403516 |
Filed: |
May 23, 2013 |
PCT Filed: |
May 23, 2013 |
PCT NO: |
PCT/US2013/042457 |
371 Date: |
November 24, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61651961 |
May 25, 2012 |
|
|
|
61789629 |
Mar 15, 2013 |
|
|
|
Current U.S.
Class: |
514/653 |
Current CPC
Class: |
A61K 45/06 20130101;
A61P 43/00 20180101; A61K 31/137 20130101; A61P 35/00 20180101;
A61K 31/05 20130101 |
International
Class: |
A61K 31/137 20060101
A61K031/137; A61K 45/06 20060101 A61K045/06 |
Claims
1. A method of treating a disorder or disease regulated by
cannabinoid (CB) receptor activity, comprising: administering to a
subject having or at risk of developing a disorder or disease
regulated by CB receptor activity an effective amount of a compound
to reduce one or more symptoms associated with the disorder or
disease regulated by CB receptor activity, wherein the compound has
the formula ##STR00034## wherein R.sub.1-R.sub.3 independently are
hydrogen, acyl, alkoxy carbonyl, amino carbonyl (carbamoyl) or a
combination thereof; R.sub.4 is H or alkyl having from 1 to 10
carbon atoms; R.sub.5 is ##STR00035## wherein Y.sup.1, Y.sup.2 and
Y.sup.3 independently are hydrogen, --OR.sub.6 and
+NR.sub.7R.sub.8; R.sub.6 is H or alkyl having from 1 to 10 carbon
atoms; R.sub.7 and R.sub.8 independently are hydrogen, alkyl having
from 1 to 10 carbon atoms, alkoxy carbonyl, acyl or amino carbonyl
and wherein the compound is optically active, thereby reducing the
one or more symptoms associated with the disorder or disease in the
subject regulated by CB receptor activity.
2. The method of claim 1, wherein administering comprises
administering a therapeutically effective amount of a compound,
wherein R.sub.4 within the compound is a methyl, ethyl, n-propyl,
or isopropyl group.
3. The method of claim 2, wherein administering comprises
administering a therapeutically effective amount of a compound,
wherein R.sub.4 within the compound is a methyl group.
4. The method of claim 1, wherein administering comprises
administering a therapeutically effective amount of a compound,
wherein R.sub.6 within the compound is a methyl group.
5. The method of claim 1, wherein administering comprises
administering a therapeutically effective amount of a compound,
wherein R.sub.5 within the compound is one of the following
structures: ##STR00036##
6. The method of claim 1, wherein administering comprises
administering a therapeutically effective amount of a compound,
wherein R.sub.1,R.sub.2, and R.sub.3 within the compound are
hydrogen.
7. The method of claim 1, wherein administering comprises
administering a therapeutically effective amount of
(R,R')-4'-methoxy-1-napthylfenoterol (MNF), (R,S')-MNF,
(R,R')-ethylMNF, (R,R')-napthylfenoterol (NF), (R,R')-ethylNF,
(R,S')--NF and (R,R')-4'-amino-1-napthylfenoterol (aminoNF),
(R,R')-4'-hydroxy-1-napthylfenoterol (hydroxyNF), or a combination
thereof.
8. The method of claim 7, wherein administering comprises
administering a therapeutically effective amount of MNF, NF, or a
combination thereof.
9. The method of claim 7, wherein administering comprises
administering a therapeutically effective amount of MNF.
10. The method of claim 1, further comprising selecting a subject
having or at risk of developing a disorder or disease regulated by
CB receptor activity prior to administering a therapeutically
effective amount of a compound.
11. The method of claim 10, wherein selecting the subject having or
at risk of developing a disorder or disease regulated by CB
receptor activity comprises measuring CB receptor activity or
expression (or both) in a sample obtained from the subject, wherein
the presence of CB receptor activity or expression (or both)
indicates that the subject has or is at risk of developing a
disorder or disease regulated by CB receptor activity.
12. The method of claim 10, wherein selecting the subject having or
at risk of developing a disorder or disease regulated by CB
activity comprises selecting a subject having a disorder or disease
which, prior to administering a therapeutically effective amount of
a compound, does not respond to a treatment targeting .beta.2-AR
activity.
13. The method of claim 1, wherein the method is for use in
treating a tumor expressing a CB-receptor.
14. The method of claim 1, wherein the disorder or disease is
selected from the group consisting of a primary brain tumor
expressing a CB-receptor, an astrocytoma expressing a CB-receptor,
a glioblastoma expressing a CB-receptor, a hepatocellular carcinoma
expressing a CB-receptor, colon cancer, liver cancer, and lung
cancer.
15. The method claim 1, wherein inhibiting one or more signs or
symptoms associated with the disease or disorder comprises
inhibiting cellular growth, such as tumor or cancer cell growth (or
both), tumor volume, or a combination thereof.
16. The method of claim 1, wherein the CB receptor is GPR55.
17. The method of claim 17, further comprising administering an
additional therapeutic agent, such as prior to, concurrent with, or
subsequent to administering a compound.
18. The method of claim 17, wherein the additional therapeutic
agent is a chemotherapeutic agent.
19. The method of claim 1, wherein administering a therapeutically
effective amount of a compound comprises administering a
therapeutically effective amount of the compound with a
pharmaceutically acceptable carrier.
20. The method of claim 1, wherein the subject is a human.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Patent Application Nos. 61/651,961, filed on May 25, 2012, and
61/789,629, filed on Mar. 15, 2013, each of which is hereby
incorporated by reference in its entirety.
FIELD
[0002] The present disclosure relates to the field of cannabinoid
receptors and, in particular, to methods of regulating cannabinoid
(CB) receptor activity-related disorders and diseases, such as
activating CB receptors, including treating a disorder or disease,
such as a glioblastoma, hepatocellular carcinoma, liver cancer,
colon cancer, and/or lung cancer, which is associated with altered
cannabinoid receptor activity by administration of specific
fenoterol analogues.
BACKGROUND
[0003] Cancer is the second leading cause of human death next to
coronary disease in the United States. Worldwide, millions of
people die from cancer every year. In the United States alone, as
reported by the American Cancer Society, cancer causes the death of
well over a half-million people annually, with over 1.2 million new
cases diagnosed per year. While deaths from heart disease have been
declining significantly, those resulting from cancer generally are
on the rise. Cancer is soon predicted to become the leading cause
of death. Many types of cancers, including brain and liver cancers,
have no effective clinical treatments.
SUMMARY
[0004] This disclosure concerns the discovery that specific
fenoterol analogues are cannabinoid (CB) receptor modulators and
can be used to treat a disorder or disease such as a tumor,
including, but not limited to, a glioblastoma or hepatocellular
carcinoma that is associated with altered CB receptor activity or
expression (or both), such as altered expression or activity (or
both) of the GPR55 cannabinoid receptor. The inventors have
discovered that administration of specific fenoterol analogues
inhibits one or more signs or symptoms (such as tumor growth)
associated with a tumor that expresses a CB receptor. Using this
discovery, the inventors developed the disclosed methods of
treating a CB receptor-modulated disorder or disease, including
treatment of a tumor expressing a CB receptor; for example, a
glioblastoma or hepatocellular carcinoma expressing a CB
receptor.
[0005] In some embodiments, the method includes administering to a
subject having or at risk of developing a disorder or disease
regulated by CB receptor activity an effective amount of a compound
to reduce one or more symptoms associated with the disorder or
disease regulated by CB receptor activity, wherein the compound has
the formula
##STR00001## [0006] wherein R.sub.1-R.sub.3 independently are
hydrogen, acyl, alkoxy carbonyl, amino carbonyl (carbamoyl) or a
combination thereof; R.sub.4 is H or lower alkyl; R.sub.5 is
##STR00002##
[0006] wherein Y.sup.1, Y.sup.2 and Y.sup.3 independently are
hydrogen, halogen, sulphur-containing moiety including SH,
sulfoxides, sulphones, sulphanamides and related alkyl and aromatic
substituted moieties, lower --OR.sub.6 and --NR.sub.7R.sub.8;
R.sub.6 is H or lower alkyl; R.sub.7 and R.sub.8 independently are
hydrogen, lower alkyl, alkoxy carbonyl, acyl or amino carbonyl and
wherein the compound is optically active, thereby reducing the one
or more symptoms associated with the disorder or disease in the
subject regulated by CB receptor activity.
[0007] In some embodiments, administering comprises administering a
therapeutically effective amount of a compound, wherein R.sub.4
within the compound is selected from methyl, ethyl, n-propyl, and
isopropyl.
[0008] In some embodiments, administering comprises administering a
therapeutically effective amount of a compound, wherein R.sub.4
within the compound is methyl.
[0009] In some embodiments, administering comprises administering a
therapeutically effective amount of a compound, wherein R.sub.6
within the compound is methyl.
[0010] In some embodiments, administering comprises administering a
therapeutically effective amount of a compound, wherein R.sub.5
within the compound is one of
##STR00003##
[0011] In some embodiments, administering comprises administering a
therapeutically effective amount of a compound, wherein
R.sub.1-R.sub.3 within the compound are hydrogen.
[0012] In some embodiments, administering comprises administering a
therapeutically effective amount of
(R,R')-4'-methoxy-1-napthylfenoterol (MNF), (R,S')-MNF,
(R,R')-ethylMNF, (R,R')-napthylfenoterol (NF), (R,R')-ethylNF,
(R,S')--NF and (R,R')-4'-amino-1-napthylfenoterol (aminoNF),
(R,R')-4'-hydroxy-1-napthylfenoterol (hydroxyNF), or a combination
thereof.
[0013] In some embodiments, administering comprises administering a
therapeutically effective amount of MNF, NF or a combination
thereof.
[0014] In some embodiments, administering comprises administering a
therapeutically effective amount of MNF.
[0015] In some embodiments, the method includes administering a
therapeutically effective amount of a pharmaceutical composition
containing any of the disclosed fenoterol analogues capable of
regulating a CB receptor-associated disorder or disease and a
pharmaceutically acceptable carrier to treat the disorder or
disease regulated by a CB receptor, such as a glioblastoma or
hepatocellular carcinoma expressing GPR55. For example, the
disclosed (R,R')-MNF, (R,S')-MNF, (R,R')-ethylMNF, (R,R')--NF,
(R,R')-ethylNF, (R,S')--NF and (R,R')-aminoNF, (R,R')-hydroxyNF, or
a combination thereof are effective at treating a glioblastoma or
hepatocellular carcinoma expressing a CB receptor, such as a GPR55
expressing glioblastoma or hepatocellular carcinoma. In some
embodiments, the method further includes selecting a subject having
or at risk of developing a disorder or disease regulated by a CB
receptor. For example, a subject is selected for treatment by
determining that the disorder or tumor is associated with CB
receptor expression, such as GPR55 expression. In one particular
example, the method further includes selecting a subject with a
disorder and/or disease, which is not associated with altered
.beta.2-AR function. For example, the disorder or disease does not
respond to a treatment targeting .beta.2-AR activity. In further
examples, the method includes administering one or more therapeutic
agents in addition to the fenoterol analogue or combination
thereof. The methods can include administration of the one or more
therapeutic agents separately, sequentially or concurrently, for
example in a combined composition with a fenoterol analogue or
combinations thereof.
[0016] In some embodiments, the method is for use in treating a
tumor expressing a CB-receptor. For example, the disorder or
disease is selected from the group consisting of a primary brain
tumor expressing a CB-receptor, a glioblastoma expressing a
CB-receptor, a hepatocellular carcinoma expressing a CB-receptor,
colon cancer, liver cancer, and lung cancer.
[0017] In some embodiments, inhibiting one or more signs or
symptoms associated with the disease or disorder comprises
inhibiting cellular growth, such as tumor and/or cancer cell
growth, tumor volume or a combination thereof.
[0018] In some embodiments, the method is used to treat a disorder
or disease regulated by a CB receptor, which is GPR55, such as
diabetes.
[0019] The foregoing and other features and advantages of the
disclosure will become more apparent from the following detailed
description, which proceeds with reference to the accompanying
figures.
BRIEF DESCRIPTION OF THE DRAWINGS
[0020] FIGS. 1A-1C illustrate responses of HepG2 cells exposed to
.beta.-agonist stimulation. FIG. 1A is a digital image of soluble
extracts which were prepared from HepG2 (lane 1) and 1321N1 (lane
2) cells maintained in complete medium, and subjected to Western
blot analysis. Cellular content in .beta.2-adrenergic receptor
(.beta.2-AR) and .beta.-actin was measured using specific primary
antibodies. FIG. 1B is a bar graph illustrating increases in cAMP
accumulation in HepG2 cells with forskolin, but not with
(R)-isoproterenol (Iso) or (R,R')-fenoterol (Fen). Data shown are
from a single study conducted in quadruplicate. Error bars indicate
mean.+-.S.D. from a single study. FIG. 1C is a digital image of an
immunoblot. Serum-starved HepG2 cells were incubated in the
presence of (R)-isoproterenol (Iso; 1 .mu.M) or (R,R')-Fen (1
.mu.M) for 5, 10 and 30 minutes. Cell lysates were immunoblotted
with antibodies against phosphorylated (Ser473) and total Akt, as
well as phosphorylated ERK1/2 and total ERK2. The studies shown in
FIGS. 1B and 1C were repeated twice with comparable results. The
migration of molecular mass markers (values in kilodaltons) is
shown on the left of immunoblots.
[0021] FIGS. 2A-D illustrate the effects of (R)-isoproterenol,
(R,R')-Fen and derivatives on cell growth are cell-type specific.
Serum-starved HepG2 cells were incubated with vehicle or the
indicated concentrations of (R)-isoproterenol (Iso), (R,R')-Fen,
(R,R')-aminoFen (NH.sub.2-fen) or (R,R')-MNF for 24 hours, and
levels of [.sup.3H]-thymidine incorporation was measured.
Representative dose-response curves are shown in FIGS. 2A and 2B.
HepG2 cells in serum-depleted medium and 1321N1 cells in complete
medium were treated with compounds at 1 .mu.M for 24 hours and
those results are shown in FIG. 2C. FIG. 2D illustrates the
findings when HepG2 and 1321N1 cells were incubated without (SFM)
or with serum (CM) in the presence of the indicated concentrations
of Iso or (R,R')-Fen (fen). Quantification of percent change in
[.sup.3H]-thymidine incorporation versus control are expressed as
means.+-.SE and represent results from two to six independent
studies, each performed in triplicate dishes. In most instances,
error bars are smaller than the symbols.
[0022] FIGS. 3A-3D demonstrate that a .beta.2-AR antagonist does
not inhibit the anti-proliferative action of (R,R')-MNF in HepG2
cells. Serum-depleted HepG2 cells were incubated with the indicated
concentrations of the .beta.2-AR antagonist, ICI-118,551 (ICI), for
1 hour followed by the addition of vehicle (FIG. 3A), (R,R')-Fen
(FIG. 3B, left panel), or (R,R')-MNF (FIG. 3B, right panel) for 24
hours, and levels of [.sup.3H]-thymidine incorporation were
measured. Representative dose-response curves for (R,R')-Fen and
(R,R')-MNF are shown FIG. 3B. FIGS. 3C and 3D are bar graphs
illustrating quantification of percent change in
[.sup.3H]-thymidine incorporation versus control expressed as
means.+-.SE and represent results from three independent studies,
each performed in triplicate.
[0023] FIG. 4 illustrates (R,R')-MNF increases the number of sub-G1
events in HepG2 cells. Serum-depleted HepG2 cells were harvested
after 6-hour, 12-hour or 24-hour treatment with vehicle, (R,R')-Fen
(1 .mu.M) or (R,R')-MNF (1 .mu.M). Cells were fixed, stained, and
analyzed for DNA content using flow cytometry, Representative DNA
content analysis in various phases of the cell cycle after 24-hour
treatment with vehicle, (R,R')-Fen, or (R,R')-MNF are shown. The
number of sub-G1 events, which represents dead cells or cells in
late-stage apoptosis, was quantified as a function of treatment
duration using results from two independent studies, each performed
in duplicate (lower right panel). Data are expressed as means.+-.SE
(n=4).
[0024] FIG. 5 illustrates the results of flow cytometry studies in
which (R,R')-MNF induced apoptosis in HepG2 cells. Serum-depleted
HepG2 cells were treated with vehicle, (R,R')-Fen (1 .mu.M), or
(R,R')-MNF (1 .mu.M) for 24 hours; stained with Annexin V and
propidium iodide (PI); and then analyzed by flow cytometry.
Representative profiles are shown. The fraction of annexin
V-positive HepG2 cells that were apoptotic was quantitated using
results from two independent studies, each performed in duplicate
(lower right panel). Data are expressed as means.+-.SE (n=4).
[0025] FIGS. 6A-6C illustrate the role of cannabinoid receptor
activation in the anti-proliferative action of (R,R')-MNF in HepG2
cells. FIG. 6A, Total RNA was extracted from HepG2, 1321N1 and
U87MG cells, and then analyzed semi-quantitatively by PCR. A
non-template control (NTC) has been included (lane 1). FIGS. 6B and
6C, Serum-depleted HepG2 cells were incubated with the cannabinoid
receptor agonist, WIN 55,212-2 (Win; 1 .mu.M), (FIG. 6B) or the
cannabinoid receptor antagonists, AM251
(1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-N-1-piperidinyl-1H-pyra-
zole-3-carboxamide; 1 .mu.M) or AM630
(6-iodo-2-methyl-1-[2-(4-morpholinyl)ethyl]-1H-indol-3-yl](4-methoxypheny-
l)methanone, 0.5 .mu.M), (FIG. 6C) for 1 hour followed by the
addition of vehicle, (R,R')-Fen (0.5 .mu.M), or (R,R')-MNF (0.25
.mu.M) for 24 hours. Quantification of percent change in
[.sup.3H]-thymidine incorporation versus control are expressed as
means.+-.SD and represent results from three independent studies,
each performed in triplicate dishes.
[0026] FIG. 7 is a series of graphs illustrating selective
inhibition of (R,R')-Fen-mediated cell proliferation control by the
.beta.2-AR antagonist, ICI-118,551. HepG2, 1321N1 and U87MG cells
were incubated with the .beta.2-AR antagonist, ICI-118,551 (ICI, 1
.mu.M), for 1 hour followed by the addition of vehicle, (R,R')-Fen
(0.5 .mu.M), or (R,R')-MNF (0.25 .mu.M) for 24 hours, and levels of
[.sup.3H]-thymidine incorporation was measured. Quantification of
percent change in [.sup.3H]-thymidine incorporation versus control
are expressed as means.+-.SD and represent the results from three
independent studies, each performed in triplicate dishes.
[0027] FIGS. 8A-8D are bar graphs illustrating cannabinoid
receptors play no role in cell proliferation control by (R,R')-Fen.
1321N1 (FIG. 8A) and U87MG (FIG. 8C) cells were incubated with the
cannabinoid receptor agonist, WIN 55,212-2 (Win; 0.5-1 .mu.M) or
the cannabinoid receptor antagonists, AM251 (0.5-1 .mu.M) or AM630
(0.25-0.5 .mu.M) (FIGS. 8B, 8D) for 1 hour followed by the addition
of vehicle, (R,R')-Fen (0.5 .mu.M), or (R,R')-MNF (0.25 .mu.M) for
24 hours. Quantification of percent change in [.sup.3H]-thymidine
incorporation versus control is expressed as means.+-.SD and
represents the results from three independent studies, each
performed in triplicate.
[0028] FIG. 9 illustrates cellular uptake of TocriFluor 1117
(T1117), a fluorescent AM251 analog, in HepG2 cells. Cells were
treated with (R,R')-Fen (1 .mu.M), (R,R')-MNF (1 .mu.M), or AM251
(10 .mu.M) for 1 hour followed by addition of T1117 (0.1 .mu.M).
Cells were mounted on confocal microscope and maintained at
37.degree. C. with CO.sub.2. Images were captured every 30 seconds
for up to one hour.
[0029] FIG. 10 is a graph illustrating metabolic stability of
(R,R')-MNF on human and rat liver microsomes.
[0030] FIG. 11 is a bar graph illustrating cytochrome p450 (CYP)
inhibition by (R,R')-MNF. Human liver microsomes were incubated
with 8 different CYP substrates and 1 or 10 .mu.M MNF. MNF at 10
.mu.M was determined to inhibit CYP2D6 and CYP3A4. The primary
metabolite was determined to be O-demethylated-MNF.
[0031] FIGS. 12 and 13 are tracings illustrating plasma and brain
tissue concentrations of (R,R')-MNF. FIG. 12 illustrates the
analysis of a plasma sample obtained 30 minutes post IV
administration of 10 mg/kg MNF. MNF and Gluc-MNF, in the insert of
FIG. 12, are shown with no interfering peaks being present in the
control plasma matrix. FIG. 13 illustrates the analysis of brain
tissue obtained 30 minutes post IV administration of 10 mg/kg MNF.
The peak at 6.39 minutes is an unidentified compound present in
control brain matrix (see insert of FIG. 13).
[0032] FIG. 14 is a MNF concentration-time course in plasma and
brain of male Sprague-Dawley rats after IV administration of 10
mg/kg MNF IV where n=3 rats per time point (10 minutes to 24 hours
in plasma and 10 to 60 minutes in the brain). The MNF concentration
in brain tissue was 200 ng/mg tissue at 10 minutes after
administration and peaked at 30 minutes at 800 ng/mg tissue. The
relative distribution between the concentration of MNF in blood
(measured as ng/ml) and brain tissue (measured as ng/mg tissue) was
0.2 at 10 minutes and 1.0 at 30 minutes and 60 minutes reflecting
an equivalent distribution between both the central and peripheral
body compartments.
[0033] FIG. 15 is a series of bar graphs illustrating that MNF does
not produce significant negative effects on the central nervous
system relative to the effects produced by tetrahydrocannabinol
(presented in FIG. 16).
[0034] FIG. 16 is a series of bar graphs illustrating the effects
of tetrahydrocannabinol on central nervous system function.
[0035] FIG. 17 is a series of graphs illustrating [3H]-Thymidine
incorporation in 96-well culture plates including Hep3B cells, PC3
cells or LN229 cells.
[0036] FIGS. 18A, 18B and 18C illustrate MNF reduces proliferation
of rat C6 glioma cell line. FIG. 18A, Cell proliferation assay was
performed in rat C6 glioma cells treated with increasing
concentrations of MNF for 24 hours followed by the addition of
[.sup.3H]-thymidine for 16 hours. FIG. 18B, Cells were preincubated
without or with the selective .beta.2-AR blocker, ICI-118,551 (3
nM) for 30 minutes followed by the addition of vehicle or 20 nM of
MNF, (R,R')-Fen or isoproterenol (ISO) for 24 hours. FIG. 18C, C6
glioma cells were pretreated in the presence or absence of
cannabinoid receptor inverse agonists, AM251 (0.5 and 1 .mu.M) and
AM630 (0.5 .mu.M), for 30 minutes followed by the addition of
vehicle or 20 nM MNF for 24 hours. FIGS. 18B and 18C,
[.sup.3H]-thymidine was determined after a 16 hour-incubation. Bars
represent the average.+-.SD of a single experiment performed in
triplicate wells. Similar results were obtained in 2-3 independent
experiments. FIG. 18D, Changes in cell morphology were observed for
C6 cells incubated with 20 nM MNF for 48 hours.
[0037] FIGS. 19A and 19B each include a graph illustrating MNF
reduces tumor growth in vivo in a rat C6 glioma xenograft model. C6
tumor-bearing female nude mice were assigned randomly to either the
vehicle or the MNF group. Treatment was given by injecting either 2
mg/kg MNF or citrate in PBS five days a week for 19 days. Tumor
volume was monitored daily and mice were sacrificed on the day
after the last treatment. FIG. 19A, Tumor volume over time is shown
for MNF-treated animals compared with vehicle-treated,
tumor-bearing mice (means.+-.SEM; n=9-10). FIG. 19B, The individual
results from two cohorts of animals are depicted as area under the
plasma drug concentration-time curve (AUCs). The average AUC.+-.SEM
for the vehicle group was 5450.+-.518 (n=17) and MNF: 3217.+-.265
(n=19). The P value presented is for a two-tailed test.
[0038] FIGS. 20A-20D illustrate gene expression profiling in
MNF-treated C6 tumor-bearing mice. FIG. 20A, Gene clustering in the
rat C6 xenografts: Principal component analysis (PCA) of rat C6
glioma xenograft treated with MNF vs. vehicle control. PCA was
applied to the six independent samples (3 MNF, 3 controls), and
numbers refer to individual sample labels. Analysis reveals
clustering of samples into treatment groups. FIG. 20B, Cluster
analysis of 100 gene sets altered by MNF treatment, as compared to
the control group, in cohort #1, cohort #2, and combined cohorts
(1+2). FIG. 20C, Zratios of selected genes of interest is depicted,
showing either up- or down-regulated expression after pairwise
comparison between MNF and the vehicle-treated group. FIG. 20D,
Total RNA from C6 xenograft tumors from MNF- and vehicle-treated
mice was extracted and analyzed for Sox4, Olig1, Galnt3, Cdkn3,
Ccna2 and Bub1b mRNA levels by quantitative real-time PCR
(mean.+-.SD; n=5-6). Values were normalized to GAPDH.
[0039] FIG. 20E demonstrates the negative impact of MNF on cyclin
expression in C6 tumor xenografts. Lysates from tumor samples were
separated by SDS-PAGE and Western blotting was carried out primary
antibodies raised against cyclin A and cyclin D. Membranes were
reprobed for Hsp90, which served as a loading control. Upper panel,
representative immunoblots; lower panels, scatter plot of data
showing significant differences in cyclin A and cyclin D1
expression between xenograft tumors from vehicle and MNF-treated
mice. *, p<0.05; **, p<0.01 using two-tailed Student's
t-test. FIG. 20F, C6 glioma cells were incubated with 20 nM MNF for
6 and 24 hours after which lysates were prepared and immunoblotted
for cyclin A and cyclin D1. Membranes were reprobed for
.beta.-actin, which served as a loading control. Upper panel,
representative blots; lower panel, Bars represent densitometric
quantification of each blot with the values in vehicle-treated
cells set at 1.0. Bars represent means.+-.SEM from three
independent studies. a, b: significant difference between groups at
P<0.01.
[0040] FIGS. 21A-21D illustrate rapid and saturable incorporation
of T1117 in HepG2 cells. Cellular entry of T1117 was measured on a
Zeiss 710 confocal microscope with thermoregulated chamber system
for live cell imaging. FIG. 21A, Serum-depleted HepG2 cells were
incubated in the presence of increasing concentrations of T1117
(2.5-100 nM). Plots of signal intensity versus time were generated
from defined regions of interest (ROIs). Results are from 2-3
independent studies. FIG. 21B, Relative AUC data versus T1117
concentrations is shown, and the T1117-100 nM values were set at 1.
FIG. 21C, The cellular incorporation of T1117 (100 nM) was carried
out in the presence of a 100.times. molar excess of unlabeled
AM251. Error bars indicate mean.+-.S.D. (n=3 ROIs) from a single
study, which was repeated twice with comparable results. FIG. 21D,
Representative images at t=15 minutes are shown. Bar, 30 .mu.m.
[0041] FIGS. 22A-22D illustrate a role for GPR55 in cellular
incorporation of T1117. FIG. 22A, HepG2 cells were transfected with
siRNA oligos either against CB.sub.1R, CB.sub.2R or GPR55 or the
non-silencing siRNA control for 48 hours. Cells were maintained in
serum-free medium for 3 hours, followed by the addition of T1117.
Plots of signal intensity vs. time were generated from defined
ROIs. Error bars indicate mean.+-.S.D. of two independent studies,
each performed with 3-4 ROIs. FIG. 22B, Relative AUC data, and the
control siRNA values were set at 1. FIG. 22C, Serum-depleted HepG2
cells were treated with vehicle (0.01% DMSO), AM630 (1 .mu.M), or
WIN 55,212-2 (1 .mu.M) for 1 hour followed by the addition of
T1117. Error bars indicate mean.+-.S.D. (n=3 ROIs) from a single
study, which was repeated twice with comparable results. FIG. 22D,
Serum-depleted HepG2 cells were treated with vehicle (0.01% DMSO),
CP 55,940 (0.25 .mu.M), or O-1602
([5-methyl-4-[(1R,6R)-3-methyl-6-(1-methylethenyl)-2-cyclohexen-1-yl]-1,3-
-benzenediol; 0.25 .mu.M) for 30 minutes followed by the addition
of 10 nM T1117. Error bars indicate mean.+-.S.D. (n=3 ROIs) from a
single study, which was repeated twice with comparable results.
[0042] FIGS. 23A-25D illustrate the effect of MNF on cellular
uptake of T1117. Serum-depleted HepG2 (FIG. 23A, FIG. 23B) and
PANC-1 (FIG. 18C, FIG. 23D) cells were pretreated or not with MNF
(1 .mu.M) or AM251 (10 .mu.M) for 30 minutes followed by the
addition of vehicle (0.1% DMSO), AM251 or MNF for an additional 30
minutes. Cells were then incubated with 10 nM T1117. FIGS. 23A, C:
Plots of signal intensity vs. time were generated from defined
ROIs. Error bars indicate mean.+-.S.D. of two independent studies,
each performed with 3-4 ROIs. FIGS. 23B, D: Relative AUC data, and
the DMSO values were set at 1.
[0043] FIGS. 24A and 24B show MNF impairs ligand-induced
internalization of GPR55. HEK293 cells stably transfected with
3xHA-tagged hGPR55 vector were serum-starved, and then incubated
with anti-HA antibody in the absence or presence of MNF (1 .mu.M)
for 45 minutes at 37.degree. C. After extensive washing, O-1602 (5
.mu.M) was added to the cells for 20 minutes at 37.degree. C. to
promote GPR55 internalization. Intact cells were fixed and then
incubated with anti-rabbit Alexa Fluor 488 antibody to label cell
surface GPR55. After a permeabilization step, anti-rabbit Alexa
Fluor 568 antibody was added to detect intracellular GPR55. Nuclei
were counterstained with DAPI. Scale bar=20 .mu.m.
[0044] FIGS. 25A-25D illustrates impairment in GPR55 downstream
signaling by MNF. Serum-depleted HepG2 (FIG. 25A, FIG. 25B) and
PANC-1 (FIG. 25C, FIG. 25D) cells were pretreated or not in the
presence of MNF (1 .mu.M) for 10 minutes followed by the addition
of vehicle, O-1602 (2.5 and 10 .mu.M), or 10% FBS for an additional
10 minutes. Cell lysates were prepared, separated by reducing
SDS-PAGE gel electrophoresis and immunoblotted for total and
phosphoactive forms of ERK. FIGS. 25A, C: Representative
immunoblots; FIGS. 25B, D: phospho-ERK1/2 bands were normalized to
total ERK2, and the O-1602-10.mu.M values were set at 1. Data are
means of two independent dishes.+-.range. The migration of
molecular-mass markers (values in kilodaltons) is shown on the left
of immunoblots.
[0045] FIGS. 26A-26C show MNF interferes with inducible changes in
cell morphology and expression of EGFR. Serum-starved HepG2 (FIG.
26A) and PANC-1 (FIG. 26B) cells were pre-incubated in the presence
of DMSO (0.1%) or MNF (1 .mu.M) for 30 minutes followed by the
addition of AM251 (5 .mu.M) or O-1602 (5 .mu.M) for 16 hours.
Unstimulated PANC-1 cells displayed cuboidal morphology with and
without MNF. White arrows show individual cells with filopodia.
FIG. 26C, Cell lysates were prepared from similar studies and
immunoblotted for EGFR. The membranes were reprobed for Hsp90,
which served as a loading control.
[0046] FIGS. 27A-27D show MNF inhibits ligand-induced motility of
HepG2 and PANC-1 cells in a wound-healing assay. Confluent HepG2
(FIG. 27A, FIG. 27B) and PANC-1 (FIG. 27C, FIG. 27D) cells were
subjected to scratch wound. Cells were incubated in the presence of
DMSO (0.1%) or the GPR55 agonist AM251 (1 .mu.M) for 30 minutes,
followed by the addition of MNF (1 .mu.M) where indicated. Images
were captured at various time-points. FIGS. 27A, C: The relative
wound surface area was measured over time and plotted, and values
at time 0 were set at 1. FIGS. 27B, D: The relative wound surface
area of four independent observations at the 24-hour time point is
plotted. *, ***P<0.05 and 0.001.
[0047] FIG. 28A provides the structure of
5'-TAMRA-3-phenylpropan-1-amine (TAMRA-PPA) and T1117.
[0048] FIG. 28B provides the mass spectrum of TAMPRA-PPA ion, m/z
equals 548.0.
[0049] FIG. 28C provides a comparison of the cellular accumulation
of T1117 (10 nM) vs. TAMRA-PPA (20 nM) in serum-depleted HepG2
cells. Note the absence of TAMRA-PPA incorporation in cells.
[0050] FIGS. 29A-29C are captured images of a representative
wound-healing assay. Confluent HepG2 (FIG. 29A) and PANC-1 (FIG.
29B) cells were subjected to scratch wound and treated as described
above for FIGS. 27A-27D. Similar profiles were obtained in four
independent assays. FIG. 29C, Confluent HepG2 and PANC-1 cells were
subjected to scratch wound. Cells were incubated in the presence of
the atypical cannabinoid O-1602 (1 .mu.M) for 30 minutes, followed
by the addition of vehicle (DMSO, 0.1%) or MNF (1 .mu.M). Images
were captured at various time-points. The relative wound surface
area at the 24-hour time point is plotted. **P<0.01.
DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS
I. Introduction
[0051] Disclosed herein is the finding that specific fenoterol
analogues, such as MNF, inhibit the growth of various types of
tumor cells, including glioblastoma tumor cells, hepatocellular
carcinoma cells, colon cancer cells, lung cancer cells, and liver
cancer cells. In particular, the inventors performed a series of
studies to characterize fenoterol analogues and determine their
possible therapeutic activities. MNF was observed to inhibit the
growth of human-derived hepatocellular carcinoma cells (HepG2) and
human- (U87MG) and rat- (C6) derived glioblastoma cells using in
vitro incubation and in vivo in flank implanted C6 xenograft in
nude mice. The results were unexpected as MNF is a .beta.2-AR
agonist and this class of compounds had been shown to increase
cellular growth in HepG2 cells. Binding and functional studies were
performed which revealed that MNF acts as an inhibitor of the GPR55
cannabinoid receptor and, as such, represents one of the first
potential drugs directed at this target. Initial pK studies
demonstrated that the compound crosses the blood brain barrier and
initial toxicity studies indicated that the drug had little
off-target effects. The .beta.2-AR agonist properties were a
positive indication and suggest that MNF may have cardio-protective
effects. MNF was also found to be capable of significantly
inhibiting additional types of tumor cell growth, including, but
not limited to, colon cancer cells, lung cancer cells and liver
cancer cells. Further, additional fenoterol compounds, such as
(R,R')-1-naphthylfenoterol (NF), were found to inhibit
hepatocellular carcinoma cell growth. Thus, the essence of the
discovery is the identification of a new class of compounds that
can be used to treat CB receptor related disorders and diseases,
and in particular GRP55-related disorders and diseases, including
brain and liver cancers for which there are no current effective
treatments. Based upon these findings, disclosed are methods of
regulating CB receptor activity and treating disorders and diseases
modulated by CB receptor activity or expression (or both), such as
GRP55 activity or expression (or both).
II. Abbreviations and Terms
Abbreviations
[0052] AKAP: A-kinase anchoring protein
[0053] AM251:
1-(2,4-dichlorophenyl)-5-(4-iodophenyl)-4-methyl-N-(1-piperidyl)pyrazole--
3-carboxamide
[0054] AM630:
1-[2-(morpholin-4-yl)ethyl]-2-methyl-3-(4-methoxybenzoyl)-6-iodoindole
[0055] AR: adrenergic receptor
[0056] BBB: blood brain barrier
[0057] .beta.2-AR: .beta.2-adrenergic receptor
[0058] CB: cannabinoid
[0059] ERK: extracellular regulated kinase
[0060] Fen: fenoterol
[0061] GPR55: G protein-coupled receptor 55
[0062] GPCR: G protein-coupled receptor
[0063] HPLC: high performance liquid chromatography
[0064] IAM-PC: immobilized artificial membrane chromatographic
support
[0065] ICI 118,551:
3-(isopropylamino)-1-[(7-methyl-4-indanyl)oxy]butan-2-ol
[0066] ICYP: [.sup.125I]cyanopindolol
[0067] IP: intraperitoneal
[0068] IV: intravenous
[0069] MNF: 4-methoxy-1-naphthylfenoterol
[0070] NF: naphthylfenoterol
[0071] OGTT: oral glucose tolerance test
[0072] UV: ultraviolet
[0073] Terms
[0074] Unless otherwise explained, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which the disclosed subject
matter belongs. Definitions of common terms in chemistry may be
found in The McGraw-Hill Dictionary of Chemical Terms, 1985, and
The Condensed Chemical Dictionary, 1981.
[0075] Except as otherwise noted, any quantitative values are
approximate whether the word "about" or "approximately" or the like
are stated or not. The materials, methods, and examples described
herein are illustrative only and not intended to be limiting. Any
molecular weight or molecular mass values are approximate and are
provided only for description. Except as otherwise noted, the
methods and techniques of the present invention are generally
performed according to conventional methods well known in the art
and as described in various general and more specific references
that are cited and discussed throughout the present specification.
See, e.g., Loudon, Organic Chemistry, Fourth Edition, New York:
Oxford University Press, 2002, pp. 360-361, 1084-1085; Smith and
March, March's Advanced Organic Chemistry: Reactions, Mechanisms,
and Structure, Fifth Edition, Wiley-Interscience, 2001; or Vogel, A
Textbook of Practical Organic Chemistry, Including Qualitative
Organic Analysis, Fourth Edition, New York: Longman, 1978.
[0076] In order to facilitate review of the various embodiments
disclosed herein, the following explanations of specific terms are
provided:
[0077] Acyl: A group of the formula RC(O)-- wherein R is an organic
group.
[0078] Acyloxy: A group having the structure --OC(O)R, where R may
be an optionally substituted alkyl or optionally substituted aryl.
"Lower acyloxy" groups are those where R contains from 1 to 10
(such as from 1 to 6) carbon atoms.
[0079] Administration: To provide or give a subject a composition,
such as a pharmaceutical composition including one or more
fenoterol analogues by any effective route. Exemplary routes of
administration include, but are not limited to, injection (such as
subcutaneous, intramuscular, intradermal, intraperitoneal (IP), and
intravenous (IV)), oral, sublingual, rectal, transdermal,
intranasal, vaginal and inhalation routes.
[0080] Alkoxy: A radical (or substituent) having the structure
--O--R, where R is a substituted or unsubstituted alkyl. Methoxy
(--OCH.sub.3) is an exemplary alkoxy group. In a substituted
alkoxy, R is alkyl substituted with a non-interfering substituent.
"Thioalkoxy" refers to --S--R, where R is substituted or
unsubstituted alkyl. "Haloalkyloxy" means a radical --OR where R is
a haloalkyl.
[0081] Alkoxy carbonyl: A group of the formula --C(O)OR, where R
may be an optionally substituted alkyl or optionally substituted
aryl. "Lower alkoxy carbonyl" groups are those where R contains
from 1 to 10 (such as from 1 to 6) carbon atoms.
[0082] Alkyl: An acyclic, saturated, branched- or straight-chain
hydrocarbon radical, which, unless expressly stated otherwise,
contains from one to fifteen carbon atoms; for example, from one to
ten, from one to six, or from one to four carbon atoms. This term
includes, for example, groups such as methyl, ethyl, n-propyl,
isopropyl, isobutyl, t-butyl, pentyl, heptyl, octyl, nonyl, decyl,
or dodecyl. The term "lower alkyl" refers to an alkyl group
containing from one to ten carbon atoms. Unless expressly referred
to as an "unsubstituted alkyl," alkyl groups can either be
unsubstituted or substituted. An alkyl group can be substituted
with one or more substituents (for example, up to two substituents
for each methylene carbon in an alkyl chain). Exemplary alkyl
substituents include, for instance, amino groups, amide,
sulfonamide, halogen, cyano, carboxy, hydroxy, mercapto,
trifluoromethyl, alkyl, alkoxy (such as methoxy), alkylthio,
thioalkoxy, arylalkyl, heteroaryl, alkylamino, dialkylamino,
alkylsulfano, keto, or other functionality.
[0083] Amino carbonyl (carbamoyl): A group of the formula
C(O)N(R)R', wherein R and R' are independently of each other
hydrogen or a lower alkyl group.
[0084] Anti-diabetic agent: A chemical or pharmaceutical
anti-hyperglycemic agent or drug capable of treating diabetes,
including, but not limited to agents for alleviating the symptoms
associated with type 2 diabetes or slowing the progression or onset
of type 2 diabetes. Anti-diabetic agents are generally categorized
into six classes: biguanides; thiazolidinediones; sulfonylureas;
inhibitors of carbohydrate absorption; fatty acid oxidase
inhibitors and anti-lipolytic drugs; and weight-loss agents. The
anti-diabetic agents include those agents disclosed in Diabetes
Care, 22(4):623-634 (1999), herein incorporated by reference. One
common class of anti-diabetic agents is the sulfonylureas, which
are believed to increase secretion of insulin, decrease hepatic
gluconeogenesis, and increase insulin receptor sensitivity. Another
class of anti-diabetic agents is the biguanide antihyperglycemics,
which decrease hepatic glucose production and intestinal
absorption, and increase peripheral glucose uptake and utilization,
without inducing hyperinsulinemia. In some examples, an
anti-diabetic agent is a disclosed fenoterol analogue capable of
modulating a CB receptor activity, such as GPR55 activity.
[0085] Astrocytoma: A tumor of the brain that originates in
astrocytes. An astrocytoma is an example of a primary tumor.
Astrocytomas are the most common glioma, and can occur in most
parts of the brain and occasionally in the spinal cord. However,
astrocytomas are most commonly found in the cerebrum. In one
example, an astrocytoma is inhibited by administering to a subject
a therapeutic effective amount of fenoterol, a fenoterol analogue
or a combination thereof, thereby inhibiting astrocytoma
growth.
[0086] .beta.2-adrenergic receptor (.beta.2-AR): A subtype of
adrenergic receptors that are members of the G-protein coupled
receptor family. .beta.2-AR subtype is involved in respiratory
diseases, cardiovascular diseases, premature labor and, as
disclosed herein, tumor development. Increased expression of
.beta.2-ARs can serve as therapeutic targets. Currently, a number
of drugs e.g., albuterol, formoterol, isoproterenol, or salmeterol
have .beta.2-AR agonist activities. As disclosed herein, fenoterol
and fenoterol analogues are .beta.2-AR agonists.
[0087] Blood-brain barrier (BBB): The barrier formed by epithelial
cells in the capillaries that supply the brain and central nervous
system. This barrier selectively allows entry of substances such as
water, oxygen, carbon dioxide, and nonionic solutes such as
glucose, alcohol, and general anesthetics, while blocking entry of
other substances. Some small molecules, such as amino acids, are
taken across the barrier by specific transport mechanisms. In one
example, fenoterol or disclosed fenoterol analogues are capable of
passing through the barrier.
[0088] Body Mass Index (BMI): A mathematical formula for measuring
body mass in humans, also sometimes called Quetelet's Index. BMI is
calculated by dividing weight (in kg) by height.sup.2 (in
meters.sup.2). The current standards for both men and women
accepted as "normal" are a BMI of 20-24.9 kg/m.sup.2. In one
embodiment, a BMI of greater than 25 kg/m.sup.2 can be used to
identify an obese subject. Grade I obesity corresponds to a BMI of
25-29.9 kg/m.sup.2. Grade II obesity corresponds to a BMI of 30-40
kg/m.sup.2; and Grade III obesity corresponds to a BMI greater than
40 kg/m.sup.2 (Jequier, Am. J Clin. Nutr., 45:1035-47, 1987). Ideal
body weight will vary among individuals based on height, body
build, bone structure, and sex.
[0089] Cannabinoid Receptors: A class of cell membrane receptors
under the G protein-coupled receptor superfamily. The cannabinoid
receptors contain seven transmembrane spanning domains. Cannabinoid
receptors are activated by three major groups of ligands,
endocannabinoids (produced by the mammalian body), plant
cannabinoids (such as THC, produced by the cannabis plant) and
synthetic cannabinoids (such as HU-210). All of the
endocannabinoids and plant cannabinoids are lipophilic, i.e. fat
soluble, compounds. Two subtypes of cannabinoid receptors are
CB.sub.1 (see GenBank Accession No. NM.sub.--033181 mRNA and
UniProt P21554, each of which is hereby incorporated by reference
as of May 23, 2012) and CB.sub.2 (see GenBank Accession No.
NM.sub.--001841 mRNA and UniProt P34972, each of which is hereby
incorporated by reference as of May 23, 2012). The CB.sub.1
receptor is expressed mainly in the brain (central nervous system,
CNS), but also in the lungs, liver and kidneys. The CB.sub.2
receptor is expressed mainly in the immune system and in
hematopoietic cells. Additional non-CB.sub.1 and non-CB.sub.2
include GPR55 (GenBank Accession No. NM.sub.--005683.3 or
NP.sub.--005674.2 protein, each of which is hereby incorporated by
reference as of May 23, 2012), GPR119 (GenBank Accession No.
NM.sub.--178471.2 or NP.sub.--848566.1 protein, each of which is
hereby incorporated by reference as of May 23, 2012) and GPR18
(also known as N-arachidonyl glycine receptor and involved in
microglial migration, GenBank Accession No. NM.sub.--001098200
mRNA, NP.sub.--001091670.1, each of which is hereby incorporated by
reference as of May 23, 2012).
[0090] The protein sequences of CB.sub.1 and CB.sub.2 receptors are
about 44% similar. When only the transmembrane regions of the
receptors are considered, amino acid similarity between the two
receptor subtypes is approximately 68%. In addition, minor
variations in each receptor have been identified. Cannabinoids bind
reversibly and stereo-selectively to the cannabinoid receptors. The
affinity of an individual cannabinoid to each receptor determines
the effect of that cannabinoid. Cannabinoids that bind more
selectively to certain receptors are more desirable for medical
usage. GPR55 is coupled to the G-protein G.sub.13 and/or G.sub.11
and activation of the receptor leads to stimulation of rhoA, cdc42
and rac1. GPR55 is activated by the plant cannabinoids
.DELTA..sup.9-THC and cannabidiol, and the endocannabinoids
anandamide, 2-AG, noladin ether in the low nanomolar range. In
contrast, CB.sub.1 and CB.sub.2 receptors are coupled to inhibitory
G proteins. This indicates that both types of receptors will have
different readouts. For example, activation of CB1 causes apoptosis
whereas increase in GPR55 activity is oncogenic. The CB1 receptor
antagonist (also termed `inverse agonist`) compound, AM251, is, in
fact, an agonist for GPR55. It binds GPR55 and is readily
internalized. This illustrates the opposite behavior of these two
GPCRs. In turn, MNF is shown herein to be a CB1 receptor agonist
(similar to WIN55,212-2) but acts as an inhibitor of GPR55, hence
the pro-apoptotic behavior of MNF in select cancer cells.
[0091] As disclosed herein, specific fenoterol analogues, such as
MNF and NF, are cannabinoid receptor regulators, such as regulators
of GPR55. In an example, a fenoterol analogue either alone or in
combination with other agents is administered to a subject to
reduce or inhibit one or more symptoms or signs associated with a
disorder (such as a metabolic, inflammatory, pain or the like
disorder) or disease (such as hepatocellular carcinoma,
glioblastoma, liver cancer, lung cancer, colon cancer, brain
cancer, diabetes, or an inflammatory disease) modulated by
cannabinoid receptors (such as GPR55).
[0092] Carbamate: A group of the formula --OC(O)N(R)--, wherein R
is H, or an aliphatic group, such as a lower alkyl group or an
aralkyl group.
[0093] Chemotherapy; chemotherapeutic agents: As used herein, any
chemical agent with therapeutic usefulness in the treatment of
diseases characterized by abnormal cell growth. Such diseases
include tumors, neoplasms, and cancer as well as diseases
characterized by hyperplastic growth. In one embodiment, a
chemotherapeutic agent is an agent of use in treating neoplasms
such as solid tumors, including a tumor associated with CB receptor
activity and/or expression. In one embodiment, a chemotherapeutic
agent is radioactive molecule. In some embodiments, a CB receptor
regulator, such as one or more fenoterol analogues or a combination
thereof is a chemotherapeutic agent. In one example, a
chemotherapeutic agent is carmustine, lomustine, procarbazine,
streptozocin, or a combination thereof. One of skill in the art can
readily identify a chemotherapeutic agent of use (e.g., see Slapak
and Kufe, Principles of Cancer Therapy, Chapter 86 in Harrison's
Principles of Internal Medicine, 14th edition; Perry et al.,
Chemotherapy, Ch. 17 in Abeloff, Clinical Oncology 2.sup.nd ed.,
.COPYRGT. 2000 Churchill Livingstone, Inc; Baltzer L., Berkery R.
(eds): Oncology Pocket Guide to Chemotherapy, 2nd ed. St. Louis,
Mosby-Year Book, 1995; Fischer D S, Knobf M F, Durivage H J (eds):
The Cancer Chemotherapy Handbook, 4th ed. St. Louis, Mosby-Year
Book, 1993).
[0094] Control or Reference Value: A "control" refers to a sample
or standard used for comparison with a test sample. In some
embodiments, the control is a sample obtained from a healthy
subject or a tissue sample obtained from a patient diagnosed with a
disorder or disease, such as a tumor, that did not respond to
treatment with a .beta.2-agonist. In some embodiments, the control
is a historical control or standard reference value or range of
values (such as a previously tested control sample, such as a group
of subjects which do not have a tumor expressing CB receptors or
group of samples that represent baseline or normal values, such as
the level of CB receptors in tumor tissue that does not respond to
treatment with fenoterol, a fenoterol analogue or a combination
thereof).
[0095] Diabetes mellitus: A disease caused by a relative or
absolute lack of insulin leading to uncontrolled carbohydrate
metabolism, commonly simplified to "diabetes," though diabetes
mellitus should not be confused with diabetes insipidus. As used
herein, "diabetes" refers to diabetes mellitus, unless otherwise
indicated. A "diabetic condition" includes pre-diabetes and
diabetes. Type 1 diabetes (sometimes referred to as
"insulin-dependent diabetes" or "juvenile-onset diabetes") is an
autoimmune disease characterized by destruction of the pancreatic 0
cells that leads to a total or near total lack of insulin. In
diabetes type 2 (sometimes referred to as "non-insulin-dependent
diabetes" or "adult-onset diabetes"), the body does not respond to
insulin, though it is present.
[0096] Symptoms of diabetes include: excessive thirst (polydipsia);
frequent urination (polyuria); extreme hunger or constant eating
(polyphagia); unexplained weight loss; presence of glucose in the
urine (glycosuria); tiredness or fatigue; changes in vision;
numbness or tingling in the extremities (hands, feet); slow-healing
wounds or sores; and abnormally high frequency of infection.
Diabetes may be clinically diagnosed by a fasting plasma glucose
(FPG) concentration of greater than or equal to 7.0 mmol/L (126
mg/dL), or a plasma glucose concentration of greater than or equal
to 11.1 mmol/L (200 mg/dL) at about two hours after an oral glucose
tolerance test (OGTT) with a 75 g load. A more detailed description
of diabetes may be found in Cecil Textbook of Medicine, J. B.
Wyngaarden, et al., eds. (W.B. Saunders Co., Philadelphia, 1992,
19.sup.th ed.).
[0097] A subject exhibiting one or more of the following risk
factors is considered to have a heightened or substantial risk of
developing diabetes type 2:
1. Obesity, such as a BMI greater than or equal to about 30
kg/m.sup.2; 2. Elevated fasting blood glucose (FPG) levels; 3.
Impaired glucose tolerance (IGT); 4. Non-Caucasian ethnicity;
5. Hyperinsulinemia;
6. Hypertriglyceridemia;
[0098] 7. Family history of diabetes; 8. History of gestational
diabetes; 9. Sedentary lifestyle; and 10. In humans, middle age or
elderly status (i.e., 40 years old and older).
[0099] A "non-diabetic" or "normal" subject does not have any form
of diabetes, such as type 1 diabetes, type 2 diabetes, or
pre-diabetes.
[0100] Derivative: A chemical substance that differs from another
chemical substance by one or more functional groups. Preferably, a
derivative (such as a fenoterol analogue) retains a biological
activity (CB receptor activation) of a molecule from which it was
derived (such as a fenoterol analogue capable of regulating a CB
receptor, such as GPR55).
[0101] Effective amount: An amount of agent that is sufficient to
generate a desired response, such as reducing or inhibiting one or
more signs or symptoms associated with a condition or disease. When
administered to a subject, a dosage will generally be used that
will achieve target tissue concentrations. In some examples, an
"effective amount" is one that treats one or more symptoms and/or
underlying causes of any of a disorder or disease. In some
examples, an "effective amount" is a "therapeutically effective
amount" in which the agent alone with an additional therapeutic
agent(s) (for example a chemotherapeutic agent) induces the desired
response such as treatment of a tumor. In one example, a desired
response is to decrease tumor size or metastasis in a subject to
whom the therapy is administered. Tumor metastasis does not need to
be completely eliminated for the composition to be effective. For
example, a composition can decrease metastasis by a desired amount,
for example by at least 20%, at least 50%, at least 60%, at least
70%, at least 80%, at least 90%, at least 95%, at least 98%, or
even at least 100% (elimination of the tumor), as compared to
metastasis in the absence of the composition.
[0102] In particular examples, it is an amount of an agent
effective to decrease a number of carcinoma cells, such as in a
subject to whom it is administered, for example a subject having
one or more carcinomas. The cancer cells do not need to be
completely eliminated for the composition to be effective. For
example, a composition can decrease the number of cancer cells by a
desired amount, for example by at least 20%, at least 50%, at least
60%, at least 70%, at least 80%, at least 90%, at least 95%, at
least 98%, or even at least 100% (elimination of detectable cancer
cells), as compared to the number of cancer cells in the absence of
the composition.
[0103] In some examples, an effective amount is the amount of
(R,R')- or (R,S')-fenoterol analogue(s) useful in reducing,
inhibiting, and/or treating a disorder or disease associated with
CB receptor, such as GPR55, expression and/or activity. Ideally, a
therapeutically effective amount of an agent is an amount
sufficient to reduce, inhibit, and/or treat the disorder in a
subject without causing a substantial cytotoxic effect in the
subject.
[0104] The effective amount of a composition useful for reducing,
inhibiting, and/or treating a disorder in a subject will be
dependent on the subject being treated, the severity of the
disorder, and the manner of administration of the therapeutic
composition. Effective amounts a therapeutic agent can be
determined in many different ways, such as assaying for a reduction
in tumor size or improvement of physiological condition of a
subject having a tumor, such as a brain tumor. Effective amounts
also can be determined through various in vitro, in vivo or in situ
assays.
[0105] Glioblastoma: A common and malignant form of a primary brain
tumor. A glioblastoma is a grade IV astrocytoma and usually spreads
rapidly in the brain. In one example, a glioblastoma is inhibited
by administering a therapeutic effective amount of a fenoterol
analogue with other agents capable of regulating a CB receptor,
such as GPR55, to a subject, thereby inhibiting one or more
symptoms associated with the glioblastoma.
[0106] Inflammation: When damage to tissue occurs, the body's
response to the damage is usually inflammation. The damage may be
due to trauma, lack of blood supply, hemorrhage, autoimmune attack,
transplanted exogenous tissue or infection. This generalized
response by the body includes the release of many components of the
immune system (for instance, IL-1 and TNF), attraction of cells to
the site of the damage, swelling of tissue due to the release of
fluid and other processes. In some examples, a disclosed fenoterol
analogue capable of regulating CB receptor activity is used to
treat, such as reduce or inhibit, one or more signs or symptoms
associated with inflammation.
[0107] Isomers: Compounds that have the same molecular formula but
differ in the nature or sequence of bonding of their atoms or the
arrangement of their atoms in space are termed "isomers". Isomers
that differ in the arrangement of their atoms in space are termed
"stereoisomers". Stereoisomers that contain two or more chiral
centers and are not mirror images of one another are termed
"diastereomers." Steroisomers that are non-superimposable mirror
images of each other are termed "enantiomers." When a compound has
an asymmetric center, for example, if a carbon atom is bonded to
four different groups, a pair of enantiomers is possible. An
enantiomer can be characterized by the absolute configuration of
its asymmetric center and is described by the R- and S-sequencing
rules of Cahn and Prelog, or by the manner in which the molecule
rotates the plane of polarized light and designated as
dextrorotatory or levorotatory (i.e., as (+) or (-) isomers,
respectively). A chiral compound can exist as either an individual
enantiomer or as a mixture thereof. A mixture containing equal
proportions of the enantiomers is called a "racemic mixture."
[0108] The compounds described herein may possess one or more
asymmetric centers; such compounds can therefore be produced as
individual (R), (S), (R,R'), (R,S')-stereoisomers or as mixtures
thereof. Unless indicated otherwise, the description or naming of a
particular compound in the specification and claims is intended to
include both individual enantiomers and mixtures, racemic or
otherwise, thereof. The methods for the determination of
stereochemistry and the separation of stereoisomers are well known
in the art (see, e.g., March, Advanced Organic Chemistry, 4th
edition, New York: John Wiley and Sons, 1992, Chapter 4).
[0109] Obesity: A condition in which excess body fat may put a
person at health risk (see Barlow and Dietz, Pediatrics 102: E29,
1998; National Institutes of Health, National Heart, Lung, and
Blood Institute (NHLBI), Obes. Res. 6 (suppl. 2):51S-209S, 1998).
Excess body fat is a result of an imbalance of energy intake and
energy expenditure. In one embodiment in humans, the Body Mass
Index (BMI) is used to assess obesity. In one embodiment, a BMI of
25.0 kg/m.sup.2 to 29.9 kg/m.sup.2 is overweight, while a BMI of 30
kg/m.sup.2 is obese.
[0110] In another embodiment in humans, waist circumference is used
to assess obesity. In this embodiment, in men a waist circumference
of 102 cm or more is considered obese, while in women a waist
circumference of 89 cm or more is considered obese. Strong evidence
shows that obesity affects both the morbidity and mortality of
individuals. For example, an obese individual is at increased risk
for heart disease, non-insulin-dependent (type 2) diabetes,
hypertension, stroke, cancer (e.g., endometrial, breast, prostate,
and colon cancer), dyslipidemia, gall bladder disease, sleep apnea,
reduced fertility, and osteoarthritis, amongst others (see Lyznicki
et al., Am. Fam. Phys. 63:2185, 2001).
[0111] Optional: "Optional" or "optionally" means that the
subsequently described event or circumstance can but need not
occur, and that the description includes instances where said event
or circumstance occurs and instances where it does not.
[0112] Oral glucose tolerance test (OGTT): A diagnostic test for
diabetes. After fasting overnight, a subject is provided a
concentrated sugar solution to drink, usually containing 50 to 100
grams of glucose. The subject's blood is sampled periodically over
the next few to several hours to test blood glucose levels over
time. In a non-diabetic subject, blood glucose concentration shows
a slight upward shift and returns to normal within 2-3 hours. In a
diabetic subject, blood glucose concentration is generally higher
than normal after fasting, rises more after the subject drinks the
glucose solution, and may take several hours to return to normal.
An OGTT of greater than or equal to 140 mg/dl and less than 200
mg/dl indicates that a subject has pre-diabetes. An OGTT of greater
than or equal to 200 mg/dl indicates that a subject has frank
diabetes, and an OGTT of less than 140 mg/dl indicates that a
subject is normal (healthy) and does not have pre-diabetes or
diabetes.
[0113] Overweight: An individual who weighs more than their ideal
body weight. An overweight individual can be obese, but is not
necessarily obese. In one embodiment, an overweight human
individual is any individual who desires to decrease their weight.
In another embodiment, an overweight human individual is an
individual with a BMI of 25.0 kg/m.sup.2 to 29.9 kg/m.sup.2.
[0114] Pharmaceutically Acceptable Carriers: The pharmaceutically
acceptable carriers (vehicles) useful in this disclosure are
conventional. Remington's Pharmaceutical Sciences, by E. W. Martin,
Mack Publishing Co., Easton, Pa., 19th Edition (1995), describes
compositions and formulations suitable for pharmaceutical delivery
of one or more therapeutic compounds or molecules, such as one or
more nucleic acid molecules, proteins or antibodies that bind these
proteins, and additional pharmaceutical agents.
[0115] In general, the nature of the carrier will depend on the
particular mode of administration being employed. For instance,
parenteral formulations usually comprise injectable fluids that
include pharmaceutically and physiologically acceptable fluids such
as water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
(for example, powder, pill, tablet, or capsule forms), conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically-neutral carriers, pharmaceutical
compositions to be administered can contain minor amounts of
non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for
example sodium acetate or sorbitan monolaurate.
[0116] Phenyl: Phenyl groups may be unsubstituted or substituted
with one, two or three substituents, with substituent(s)
independently selected from alkyl, heteroalkyl, aliphatic,
heteroaliphatic, thioalkoxy, halo, haloalkyl (such as --CF.sub.3),
nitro, cyano, --OR (where R is hydrogen or alkyl), --N(R)R' (where
R and R' are independently of each other hydrogen or alkyl), --COOR
(where R is hydrogen or alkyl) or --C(O)N(R')R'' (where R' and R''
are independently selected from hydrogen or alkyl).
[0117] Purified: The term "purified" does not require absolute
purity; rather, it is intended as a relative term. Thus, for
example, a purified preparation is one in which a desired component
such as an (R,R')-enantiomer of fenoterol is more enriched than it
was in a preceding environment such as in a (.+-.)-fenoterol
mixture. A desired component such as (R,R')-enantiomer of fenoterol
is considered to be purified, for example, when at least about 70%,
80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% of a sample by weight is
composed of the desired component. Purity of a compound may be
determined, for example, by high performance liquid chromatography
(HPLC) or other conventional methods. In an example, the specific
fenoterol analogue enantiomers are purified to represent greater
than 90%, often greater than 95% of the other enantiomers present
in a purified preparation. In other cases, the purified preparation
may be essentially homogeneous, wherein other stereoisomers are
less than 1%.
[0118] Compounds described herein may be obtained in a purified
form or purified by any of the means known in the art, including
silica gel and/or alumina chromatography. See, e.g., Introduction
to Modern Liquid Chromatography, 2nd Edition, ed. by Snyder and
Kirkland, New York: John Wiley and Sons, 1979; and Thin Layer
Chromatography, ed. by Stahl, New York: Springer Verlag, 1969. In
an example, a compound includes purified fenoterol or fenoterol
analogue with a purity of at least about 70%, 80%, 85%, 90%, 92%,
95%, 97%, 98%, or 99% of a sample by weight relative to other
contaminants. In a further example, a compound includes at least
two purified stereoisomers each with a purity of at least about
70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% of a sample by
weight relative to other contaminants. For instance, a compound can
include a substantially purified (R,R')-fenoterol analogue and a
substantially purified (R,S')-fenoterol analogue.
[0119] Subject: The term "subject" includes both human and
veterinary subjects, for example, humans, non-human primates, dogs,
cats, horses, rats, mice, and cows. Similarly, the term mammal
includes both human and non-human mammals.
[0120] Tissue: A plurality of functionally related cells. A tissue
can be a suspension, a semi-solid, or solid. Tissue includes cells
collected from a subject such as the brain or a portion
thereof.
[0121] Tumor: All neoplastic cell growth and proliferation, whether
malignant or benign, and all pre-cancerous and cancerous cells and
tissues. A primary tumor is tumor growing at the anatomical site
where tumor progression began and proceeded to yield this mass. A
primary brain tumor (also referred to as a glioma) is a tumor that
originates in the brain. Exemplary primary brain tumors include
astrocytomas, glioblastomas, ependymoma, oligodendroglomas, and
mixed gliomas. In some examples, a primary brain tumor expresses CB
receptors, such as a glioblastoma associated with CB receptor
expression.
[0122] Under conditions sufficient for: A phrase that is used to
describe any environment that permits the desired activity. In one
example, under conditions sufficient for includes administering one
or more fenoterol analogues, fenoterol or a combination thereof to
a subject to at a concentration sufficient to allow the desired
activity. In some examples, the desired activity is reducing or
inhibiting a sign or symptom associated with a disorder or disease,
such as a primary brain tumor, hepatocellular carcinoma, liver
cancer, colon cancer, or lung cancer, can be evidenced, for
example, by a delayed onset of clinical symptoms of the tumor in a
susceptible subject, a reduction in severity of some or all
clinical symptoms of the tumor, a slower progression of the tumor
(for example by prolonging the life of a subject having the tumor),
a reduction in the number of tumor reoccurrence, an improvement in
the overall health or well-being of the subject, or by other
parameters well known in the art that are specific to the
particular disease. In one particulate example, the desired
activity is preventing or inhibiting tumor growth, such as
astrocytoma, glioblastoma, or hepatocellular carcinoma growth.
Tumor growth does not need to be completely inhibited for the
treatment to be considered effective. For example, a partial
reduction or slowing of growth such as at least about a 10%
reduction, such as at least 20%, at least about 30%, at least about
40%, at least about 50% or greater is considered to be
effective.
III. (R,R')-Fenoterol and Fenoterol Analogues
A. Chemical Structure
[0123] Some exemplary fenoterol analogues disclosed herein have the
formula:
##STR00004##
[0124] wherein R.sub.1-R.sub.3 independently are hydrogen, acyl,
alkoxy carbonyl, amino carbonyl or a combination thereof;
[0125] R.sub.4 is H or lower alkyl;
[0126] R.sub.5 is lower alkyl,
##STR00005##
[0127] wherein X and Y independently are selected from hydrogen,
lower --OR.sub.6 and --NR.sub.7R.sub.8;
[0128] R.sub.6 is lower alkyl or acyl; and
[0129] R.sub.7 and R.sub.8 independently are hydrogen, lower alkyl,
alkoxy carbonyl, acyl or amino carbonyl.
[0130] With continued reference to the general formula for
fenoterol analogues above, Y may be --OH.
[0131] In one embodiment, R.sub.5 is a 1- or 2-napthyl derivative
optionally having 1, 2 or 3 substituents. Examples of such R.sub.5
groups are represented by the formula
##STR00006##
wherein Y.sup.1, Y.sup.2 and Y.sup.3 independently are hydrogen,
halogen, sulphur-containing moiety including SH, sulfoxides,
sulphones, sulphanamides and related alkyl and aromatic substituted
moieties, lower --OR.sub.6 and --NR.sub.7R.sub.8; R.sub.6 is
independently for each occurrence selected from lower alkyl and
acyl; and R.sub.7 and R.sub.8 independently are hydrogen, lower
alkyl, alkoxy carbonyl, acyl or amino carbonyl (carbamoyl). In
particular compounds at least one of Y.sup.1, Y.sup.2 and Y.sup.3
is --OCH.sub.3.
[0132] Particular R.sub.5 groups include those represented by the
formulas
##STR00007##
[0133] wherein R.sub.6 is lower alkyl, such as methyl, ethyl,
propyl or isopropyl or acyl, such as acetyl.
[0134] Exemplary R.sub.5 groups include
##STR00008##
[0135] In one example, R.sub.4 is lower alkyl and R.sub.5 is
##STR00009##
wherein X and Y independently are selected from H, lower alkyl
--OR.sub.6 and --NR.sub.7R.sub.8; R.sub.6 is lower alkyl; and
R.sub.7 and R.sub.8 independently are hydrogen or lower alkyl.
[0136] In a further example, R.sub.4 is selected from ethyl,
n-propyl, and isopropyl and R.sub.5 has the formula
##STR00010##
wherein X is H, --OR.sub.6 or --NR.sub.7R.sub.8. For example,
R.sub.6 may be methyl or R.sub.7 and R.sub.8 are hydrogen.
[0137] In an additional example, R.sub.5 has the formula
##STR00011##
[0138] In further embodiments, R.sub.4 is selected from methyl,
ethyl, n-propyl and isopropyl and R.sub.5 represents
##STR00012##
[0139] In some embodiments, R.sub.1-R.sub.3 independently are
hydrogen; R.sub.4 is a lower alkyl (such as, CH.sub.3 or
CH.sub.2CH.sub.3); R.sub.5 is lower alkyl,
##STR00013##
wherein X, Y.sup.1, Y.sup.2 and Y.sup.3 independently are hydrogen,
--OR.sub.6 and --NR.sub.7R.sub.8; R.sub.6 is independently
hydrogen, lower alkyl, acyl, alkoxy carbonyl or amino carbonyl;
R.sub.7 and R.sub.8 independently are hydrogen, lower alkyl, alkoxy
carbonyl, acyl or amino carbonyl and wherein the compound is
optically active.
[0140] In some embodiments, R.sub.1-R.sub.3 independently are
hydrogen; R.sub.4 is a methyl or an ethyl; R.sub.5 is
##STR00014##
wherein X is --OH or --OCH.sub.3.
[0141] In some embodiments, R.sub.1-R.sub.3 independently are
hydrogen; R.sub.4 is a methyl or an ethyl; R.sub.5 is
##STR00015##
[0142] Exemplary compounds include, but are not limited to,
(R,R')-4'-methoxy-1-napthylfenoterol (MNF), (R,S')-MNF,
(R,R')-ethylMNF, (R,R')-napthylfenoterol (NF), (R,R')-ethylNF,
(R,S')--NF and (R,R')-4'-amino-1-napthylfenoterol (aminoNF), or
(R,R')-4'-hydroxy-1-napthylfenoterol (hydroxyNF).
[0143] Examples of suitable groups for R.sub.1-R.sub.3 that can be
cleaved in vivo to provide a hydroxy group include, without
limitation, acyl, acyloxy and alkoxy carbonyl groups. Compounds
having such cleavable groups are referred to as "prodrugs." The
term "prodrug," as used herein, means a compound that includes a
substituent that is convertible in vivo (e.g., by hydrolysis) to a
hydroxyl group. Various forms of prodrugs are known in the art, for
example, as discussed in Bundgaard, (ed.), Design of Prodrugs,
Elsevier (1985); Widder, et al. (ed.), Methods in Enzymology, Vol.
4, Academic Press (1985); Krogsgaard-Larsen, et al., (ed), Design
and Application of Prodrugs, Textbook of Drug Design and
Development, Chapter 5, 113 191 (1991); Bundgaard, et al., Journal
of Drug Delivery Reviews, 8:1 38(1992); Bundgaard, Pharmaceutical
Sciences, 77:285 et seq. (1988); and Higuchi and Stella (eds.)
Prodrugs as Novel Drug Delivery Systems, American Chemical Society
(1975).
[0144] In some embodiments, administering comprises administering a
therapeutically effective amount of MNF, NF or a combination
thereof. In some embodiments, administering comprises administering
a therapeutically effective amount of MNF.
[0145] In some embodiments, the method includes administering a
therapeutically effective amount of a pharmaceutical composition
containing any of the disclosed fenoterol analogues capable of
regulating a CB receptor disorder or disease and a pharmaceutically
acceptable carrier to treat the disorder or disease regulated by a
CB receptor, such as a glioblastoma or hepatocellular carcinoma
expressing GPR55. For example, the disclosed (R,R')-MNF,
(R,S')-MNF, (R,R')-ethylMNF, (R,R')-NF, (R,R')-ethylNF, (R,S')--NF
and (R,R')-aminoNF, (R,R')-hydroxyNF, or a combination thereof
[0146] An exemplary (R,R')-compound has the chemical structure
of:
##STR00016##
X and R.sub.1-R.sub.3 are as described above.
[0147] An additional exemplary (R,R')-compound has the chemical
structure:
##STR00017##
[0148] An exemplary (R,S')-compound has the chemical structure:
##STR00018##
wherein X and R.sub.1-R.sub.3 are as described above.
[0149] An additional exemplary (R,S')-compound has the chemical
structure:
##STR00019##
[0150] An exemplary (S,R')-compound has the chemical structure:
##STR00020##
wherein X and R.sub.1-R.sub.3 are as described above.
[0151] An exemplary (S,S')-compound has the chemical structure:
##STR00021##
wherein X and R.sub.1-R.sub.3 are as described above.
[0152] Examples of chemical structures illustrating the various
stereoisomers of fenoterol are provided below.
##STR00022##
[0153] Particular method embodiments contemplate the use of
solvates (such as hydrates), pharmaceutically acceptable salts
and/or different physical forms of (R,R')-fenoterol or any of the
fenoterol analogues herein described.
[0154] 1. Solvates, Salts and Physical Forms
[0155] "Solvate" means a physical association of a compound with
one or more solvent molecules. This physical association involves
varying degrees of ionic and covalent bonding, including by way of
example covalent adducts and hydrogen bonded solvates. In certain
instances the solvate will be capable of isolation, for example
when one or more solvent molecules are incorporated in the crystal
lattice of the crystalline solid. "Solvate" encompasses both
solution-phase and isolable solvates. Representative solvates
include ethanol-associated compound, methanol-associated compounds,
and the like. "Hydrate" is a solvate wherein the solvent
molecule(s) is/are H.sub.2O.
[0156] The disclosed compounds also encompass salts including, if
several salt-forming groups are present, mixed salts and/or
internal salts. The salts are generally pharmaceutically acceptable
salts that are non-toxic. Salts may be of any type (both organic
and inorganic), such as fumarates, hydrobromides, hydrochlorides,
sulfates and phosphates. In an example, salts include non-metals
(e.g., halogens) that form group VII in the periodic table of
elements. For example, compounds may be provided as a hydrobromide
salt.
[0157] Additional examples of salt-forming groups include, but are
not limited to, a carboxyl group, a phosphonic acid group or a
boronic acid group, that can form salts with suitable bases. These
salts can include, for example, nontoxic metal cations, which are
derived from metals of groups IA, IB, IIA and IIB of the periodic
table of the elements. In one embodiment, alkali metal cations such
as lithium, sodium or potassium ions, or alkaline earth metal
cations such as magnesium or calcium ions can be used. The salt can
also be a zinc or an ammonium cation. The salt can also be formed
with suitable organic amines, such as unsubstituted or
hydroxyl-substituted mono-, di- or tri-alkylamines, in particular
mono-, di- or tri-alkylamines, or with quaternary ammonium
compounds, for example with N-methyl-N-ethylamine, diethylamine,
triethylamine, mono-, bis- or tris-(2-hydroxy-lower alkyl)amines,
such as mono-, bis- or tris-(2-hydroxyethyl)amine,
2-hydroxy-tert-butylamine or tris(hydroxymethyl)methylamine,
N,N-di-lower alkyl-N-(hydroxy-lower alkyl)amines, such as
N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine,
or N-methyl-D-glucamine, or quaternary ammonium compounds such as
tetrabutylammonium salts.
[0158] Exemplary compounds disclosed herein possess at least one
basic group that can form acid-base salts with inorganic acids.
Examples of basic groups include, but are not limited to, an amino
group or imino group. Examples of inorganic acids that can form
salts with such basic groups include, but are not limited to,
mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric
acid or phosphoric acid. Basic groups also can form salts with
organic carboxylic acids, sulfonic acids, sulfo acids or phospho
acids or N-substituted sulfamic acid, for example acetic acid,
propionic acid, glycolic acid, succinic acid, maleic acid,
hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid,
tartaric acid, gluconic acid, glucaric acid, glucuronic acid,
citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic
acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid,
2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic
acid, and, in addition, with amino acids, for example with
.alpha.-amino acids, and also with methanesulfonic acid,
ethanesulfonic acid, 2-hydroxymethanesulfonic acid,
ethane-1,2-disulfonic acid, benzenedisulfonic acid,
4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid, 2- or
3-phosphoglycerate, glucose-6-phosphate or N-cyclohexylsulfamic
acid (with formation of the cyclamates) or with other acidic
organic compounds, such as ascorbic acid. In a currently preferred
embodiment, fenoterol is provided as a hydrobromide salt and
exemplary fenoterol analogues are provided as their fumarate
salts.
[0159] Additional counterions for forming pharmaceutically
acceptable salts are found in Remington's Pharmaceutical Sciences,
19th Edition, Mack Publishing Company, Easton, Pa., 1995. In one
aspect, employing a pharmaceutically acceptable salt may also serve
to adjust the osmotic pressure of a composition.
[0160] In certain embodiments the compounds used in the method are
provided are polymorphous. As such, the compounds can be provided
in two or more physical forms, such as different crystal forms,
crystalline, liquid crystalline or non-crystalline (amorphous)
forms.
[0161] 2. Use for the Manufacture of a Medicament
[0162] Any of the above described compounds (e.g., (R,R') and/or
(R,S') fenoterol analogues or a hydrate or pharmaceutically
acceptable salt thereof) or combinations thereof are intended for
use in the manufacture of a medicament for regulation of a CB
receptor, such as GPR55, in a subject either at risk of developing
or having a CB receptor-regulated disorder (such as a metabolic,
inflammatory, pain or the like disorder) or disease (such as
hepatocellular carcinoma, glioblastoma, liver cancer, lung cancer,
colon cancer, brain cancer, diabetes, or an inflammatory disease)
modulated by cannabinoid receptors (such as GPR55).
[0163] Formulations suitable for such medicaments, subjects who may
benefit from same and other related features are described
elsewhere herein.
B. Methods of Synthesis
[0164] The disclosed fenoterol analogues can be synthesized by any
method known in the art including those described in U.S. patent
application Ser. No. 12/376,945 filed Feb. 9, 2009, U.S. patent
application Ser. No. 13/333,866 filed Dec. 21, 2011 and WO
2011/112867 filed Mar. 10, 2011, each of which is hereby
incorporated by reference in its entirety. Many general references
providing commonly known chemical synthetic schemes and conditions
useful for synthesizing the disclosed compounds are available (see,
e.g., Smith and March, March's Advanced Organic Chemistry:
Reactions, Mechanisms, and Structure, Fifth Edition,
Wiley-Interscience, 2001; or Vogel, A Textbook of Practical Organic
Chemistry, Including Qualitative Organic Analysis, Fourth Edition,
New York: Longman, 1978).
[0165] Compounds as described herein may be purified by any of the
means known in the art, including chromatographic means, such as
HPLC, preparative thin layer chromatography, flash column
chromatography and ion exchange chromatography. Any suitable
stationary phase can be used, including normal and reversed phases
as well as ionic resins. Most typically the disclosed compounds are
purified via open column chromatography or prep chromatography.
[0166] Suitable exemplary syntheses of fenoterol analogues are
provided below:
[0167] Scheme I: An exemplary synthesis of 4 stereoisomers of 1-6
including the coupling of the epoxide formed from either (R)- or
(S)-3',5'-dibenzyloxyphenylbromohydrin with the (R)- or
(S)-enantiomer of the appropriate benzyl-protected
2-amino-3-benzylpropane (1-5) or the (R) or (S)-enantiomer of
N-benzyl-2-aminoheptane (6).
##STR00023## ##STR00024##
[0168] Scheme II: Exemplary synthesis of (R)-7 and (S)-7 using
2-phenethylamine. The resulting compounds may be deprotected by
hydrogenation over Pd/C and purified as the fumarate salts.
##STR00025##
[0169] Scheme III describes an exemplary synthesis for the chiral
building blocks used in Scheme II. The (R)- and
(S)-3',5'-dibenzyloxyphenyl-bromohydrin enantiomers were obtained
by the enantiospecific reduction of
3,5-dibenzyloxy-.alpha.-bromoacetophenone using boron-methyl
sulfide complex (BH.sub.3SCH.sub.3) and either (1R,2S)- or
(1S,2R)-cis-1-amino-2-indanol. The required (R)- and
(S)-2-benzylaminopropanes were prepared by enantioselective
crystallization of the rac-2-benzylaminopropanes using either (R)-
or (S)-mandelic acid as the counter ion.
##STR00026## ##STR00027##
IV. Pharmaceutical Compositions
[0170] The disclosed fenoterol analogues can be useful, at least,
for reducing or inhibiting one or more symptoms or signs associated
with a disorder (such as a metabolic, inflammatory, pain or the
like disorder) or disease (such as hepatocellular carcinoma,
glioblastoma, liver cancer, lung cancer, colon cancer, brain
cancer, diabetes, or an inflammatory disease) modulated by
cannabinoid receptors (such as GPR55). Accordingly, pharmaceutical
compositions comprising at least one disclosed fenoterol analogue
are also described herein.
[0171] Formulations for pharmaceutical compositions are well known
in the art. For example, Remington's Pharmaceutical Sciences, by E.
W. Martin, Mack Publishing Co., Easton, Pa., 19th Edition, 1995,
describes exemplary formulations (and components thereof) suitable
for pharmaceutical delivery of (R,R')-fenoterol and disclosed
fenoterol analogues. Pharmaceutical compositions comprising at
least one of these compounds can be formulated for use in human or
veterinary medicine. Particular formulations of a disclosed
pharmaceutical composition may depend, for example, on the mode of
administration (e.g., oral or parenteral) and/or on the disorder to
be treated (e.g., a tumor associated with CB receptor, such as
GPR55 receptor, activity or expression). In some embodiments,
formulations include a pharmaceutically acceptable carrier in
addition to at least one active ingredient, such as a fenoterol
compound.
[0172] Pharmaceutically acceptable carriers useful for the
disclosed methods and compositions are conventional in the art. The
nature of a pharmaceutical carrier will depend on the particular
mode of administration being employed. For example, parenteral
formulations usually comprise injectable fluids that include
pharmaceutically and physiologically acceptable fluids such as
water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
such as powder, pill, tablet, or capsule forms conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically neutral carriers, pharmaceutical
compositions to be administered can optionally contain minor
amounts of non-toxic auxiliary substances or excipients, such as
wetting or emulsifying agents, preservatives, and pH buffering
agents and the like; for example, sodium acetate or sorbitan
monolaurate. Other non-limiting excipients include, nonionic
solubilizers, such as cremophor, or proteins, such as human serum
albumin or plasma preparations.
[0173] The disclosed pharmaceutical compositions may be formulated
as a pharmaceutically acceptable salt. Pharmaceutically acceptable
salts are non-toxic salts of a free base form of a compound that
possesses the desired pharmacological activity of the free base.
These salts may be derived from inorganic or organic acids.
Non-limiting examples of suitable inorganic acids are hydrochloric
acid, nitric acid, hydrobromic acid, sulfuric acid, hydriodic acid,
and phosphoric acid. Non-limiting examples of suitable organic
acids are acetic acid, propionic acid, glycolic acid, lactic acid,
pyruvic acid, malonic acid, succinic acid, malic acid, maleic acid,
fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic
acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid,
p-toluenesulfonic acid, methyl sulfonic acid, salicylic acid,
formic acid, trichloroacetic acid, trifluoroacetic acid, gluconic
acid, asparagic acid, aspartic acid, benzenesulfonic acid,
p-toluenesulfonic acid, naphthalenesulfonic acid, and the like.
Lists of other suitable pharmaceutically acceptable salts are found
in Remington's Pharmaceutical Sciences, 19th Edition, Mack
Publishing Company, Easton, Pa., 1995. A pharmaceutically
acceptable salt may also serve to adjust the osmotic pressure of
the composition.
[0174] The dosage form of a disclosed pharmaceutical composition
will be determined by the mode of administration chosen. For
example, in addition to injectable fluids, oral dosage forms may be
employed. Oral formulations may be liquid such as syrups, solutions
or suspensions or solid such as powders, pills, tablets, or
capsules. Methods of preparing such dosage forms are known, or will
be apparent, to those skilled in the art.
[0175] Certain embodiments of the pharmaceutical compositions
comprising a disclosed compound may be formulated in unit dosage
form suitable for individual administration of precise dosages. The
amount of active ingredient such as (R,R')-MNF or NF administered
will depend on the subject being treated, the severity of the
disorder, and the manner of administration, and is known to those
skilled in the art. Within these bounds, the formulation to be
administered will contain a quantity of the extracts or compounds
disclosed herein in an amount effective to achieve the desired
effect in the subject being treated.
[0176] In particular examples, for oral administration the
compositions are provided in the form of a tablet containing from
about 1.0 to about 50 mg of the active ingredient, particularly
about 2.0 mg, about 2.5 mg, 5 mg, about 10 mg, or about 50 mg of
the active ingredient for the symptomatic adjustment of the dosage
to the subject being treated. In one exemplary oral dosage regimen,
a tablet containing from about 1 mg to about 50 mg (such as about 2
mg to about 10 mg) active ingredient is administered two to four
times a day, such as two times, three times or four times.
[0177] In other examples, a suitable dose for parental
administration is about 1 milligram per kilogram (mg/kg) to about
100 mg/kg, such as a dose of about 10 mg/kg to about 80 mg/kg, such
including about 1 mg/kg, about 2 mg/kg, about 5 mg/kg, about 20
mg/kg, about 30 mg/kg, about 40 mg/kg, about 50 mg/kg, about 80
mg/kg or about 100 mg/kg administered parenterally. However, other
higher or lower dosages also could be used, such as from about
0.001 mg/kg to about 1 g/kg, such as about 0.1 to about 500 mg/kg,
including about 0.5 mg/kg to about 200 mg/kg.
[0178] Single or multiple administrations of the composition
comprising one or more of the disclosed compositions can be carried
out with dose levels and pattern being selected by the treating
physician. Generally, multiple doses are administered. In a
particular example, the composition is administered parenterally
once per day. However, the composition can be administered twice
per day, three times per day, four times per day, six times per
day, every other day, twice a week, weekly, or monthly. Treatment
will typically continue for at least a month, more often for two or
three months, sometimes for six months or a year, and may even
continue indefinitely, i.e., chronically. Repeat courses of
treatment are also possible.
[0179] In one embodiment, the pharmaceutical composition is
administered without concurrent administration of a second agent
for the treatment of a tumor that expresses a CB receptor, such as
GPR55. In one specific, non-limiting example, one or more of the
disclosed compositions is administered without concurrent
administration of other agents, such as without concurrent
administration of an additional agent also known to target the
tumor. In other specific non-limiting examples, a therapeutically
effective amount of a disclosed pharmaceutical composition is
administered concurrently with an additional agent, including an
additional therapy (such as, but not limited to, a chemotherapeutic
agent, an additional CB receptor regulator (such as regulator of
GPR55), an anti-inflammatory agent, an anti-oxidant, or other
agents known to those of skill in the art). For example, the
disclosed compounds are administered in combination with a
chemotherapeutic agent, anti-oxidants, anti-inflammatory drugs or
combinations thereof.
[0180] In other examples, a disclosed pharmaceutical composition is
administered an adjuvant therapy. For example, a pharmaceutical
composition containing one or more of the disclosed compounds is
administered orally daily to a subject in order to prevent or
retard tumor growth. In one particular example, a composition
containing equal portions of two or more disclosed compounds is
provided to a subject. In one example, a composition containing
unequal portions of two or more disclosed compounds is provided to
the subject. For example, a composition contains unequal portions
of a (R,R')-fenoterol derivative and a (S,R')-fenoterol derivative
and/or a (R,S')-derivative. In one particular example, the
composition includes a greater amount of the (S,R')- or
(R,S')-fenoterol derivative. Such therapy can be given to a subject
for an indefinite period of time to inhibit, prevent, or reduce
tumor reoccurrence.
V. Methods of Use
[0181] The present disclosure includes methods of treating
disorders including reducing or inhibiting one or more signs or
symptoms associated with a disorder (such as a metabolic,
inflammatory, pain or the like disorder) or disease (such as
hepatocellular carcinoma, glioblastoma, liver cancer, lung cancer,
colon cancer, brain cancer, diabetes, or an inflammatory disease)
modulated by cannabinoid receptors (such as GPR55). In some
examples, methods include reducing or inhibiting one or more signs
or symptoms associated with a tumor (such as hepatocellular
carcinoma, glioblastoma, liver cancer, lung cancer, colon cancer,
brain cancer, diabetes, or an inflammatory disease) modulated by
cannabinoid receptors (such as GPR55).
[0182] In some examples, the tumor is a primary tumor, such as a
primary brain tumor expressing or regulated by CB receptors, such
as GPR55. In some examples, the tumor is a glioblastoma or
hepatocellular carcinoma expressing CB receptors, such as GPR55. In
some examples, the tumor is a glioblastoma or hepatocellular
carcinoma expressing CB receptors, such as GPR55, but not
expressing .beta.2-AR. In some examples, the tumor is a
glioblastoma or hepatocellular carcinoma expressing both CB
receptors, such as GPR55, and .beta.2-AR. The fenoterol analogue
and/or fenoterol, such as (R,R') fenoterol, itself is administered
depending upon the tumor receptor population. For example, a tumor
expressing or regulated by a CB receptors, such as GPR55, is
treated by administering one or more disclosed fenoterol analogues
possessing CB receptor modulatory activity, such as
(R,R')-4'-methoxy-1-napthylfenoterol (MNF), (R,S')-MNF,
(R,R')-ethylMNF, (R,R')-napthylfenoterol (NF), (R,R')-ethylNF,
(R,S')--NF and (R,R')-4'-amino-1-napthylfenoterol (aminoNF),
(R,R')-4'-hydroxy-1-napthylfenoterol (hydroxyNF), or a combination
thereof. In some examples, a tumor expressing or regulated by a CB
receptor, such as GPR55, and .beta.2-AR is treated by administering
one or more disclosed fenoterol analogues possessing CB receptor
regulatory activity, such as (R,R')-4'-methoxy-1-napthylfenoterol
(MNF), (R,S')-MNF, (R,R')-ethylMNF, (R,R')-napthylfenoterol (NF),
(R,R')-ethylNF, (R,S')--NF and (R,R')-4'-amino-1-napthylfenoterol
(aminoNF), (R,R')-4'-hydroxy-1-napthylfenoterol (hydroxyNF), and
one or more fenoterol analogues or fenoterol itself having
.beta.2-AR stimulatory activity in combination.
[0183] Disclosed methods include administering fenoterol, such as
(R,R')-fenoterol, a disclosed fenoterol analogue or a combination
thereof (and, optionally, one or more other pharmaceutical agents)
depending upon the receptor population of the tumor, to a subject
in a pharmaceutically acceptable carrier and in an amount effective
to treat the tumor expressing a .beta.2-AR, a CB receptor or
combination thereof, such as a primary tumor. Treatment of a tumor
includes preventing or reducing signs or symptoms associated with
the presence of such tumor (for example, by reducing the size or
volume of the tumor or a metastasis thereof). Such reduced growth
can in some examples decrease or slow metastasis of the tumor, or
reduce the size or volume of the tumor by at least 10%, at least
20%, at least 50%, or at least 75%, such as between 10%-90%,
20%-80%, 30%-70%, 40%-60%, including a 10%, 15%, 20%, 25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, or 95%
reduction. In another example, treatment includes reducing the
invasive activity of the tumor in the subject, for example by
reducing the ability of the tumor to metastasize. In some examples,
treatment using the methods disclosed herein prolongs the time of
survival of the subject.
[0184] Routes of administration useful in the disclosed methods
include but are not limited to oral and parenteral routes, such as
intravenous (IV), intraperitoneal (IP), rectal, topical,
ophthalmic, nasal, and transdermal as described in detail
above.
[0185] An effective amount of fenoterol, such as (R,R')-fenoterol,
or a disclosed fenoterol analogue or combination thereof will
depend, at least, on the particular method of use, the subject
being treated, the severity of the tumor, and the manner of
administration of the therapeutic composition. A "therapeutically
effective amount" of a composition is a quantity of a specified
compound sufficient to achieve a desired effect in a subject being
treated. For example, this may be the amount of (R,R')-fenoterol, a
disclosed fenoterol analogue or a combination thereof necessary to
prevent or inhibit tumor growth and/or one or more symptoms
associated with the tumor in a subject. Ideally, a therapeutically
effective amount of (R, 'R)-fenoterol or a disclosed fenoterol
analogue is an amount sufficient to prevent or inhibit a tumor,
such as a brain or liver tumor growth and/or one or more symptoms
associated with the tumor in a subject without causing a
substantial cytotoxic effect on host cells.
[0186] Therapeutically effective doses of a disclosed fenoterol
compound or pharmaceutical composition can be determined by one of
skill in the art, with a goal of achieving concentrations that are
at least as high as the IC.sub.50 of the applicable compound
disclosed in the examples herein. An example of a dosage range is
from about 0.001 to about 10 mg/kg body weight orally in single or
divided doses. In particular examples, a dosage range is from about
0.005 to about 5 mg/kg body weight orally in single or divided
doses (assuming an average body weight of approximately 70 kg;
values adjusted accordingly for persons weighing more or less than
average). For oral administration, the compositions are, for
example, provided in the form of a tablet containing from about 1.0
to about 50 mg of the active ingredient, particularly about 2.5 mg,
about 5 mg, about 10 mg, or about 50 mg of the active ingredient
for the symptomatic adjustment of the dosage to the subject being
treated. In one exemplary oral dosage regimen, a tablet containing
from about 1 mg to about 50 mg active ingredient is administered
two to four times a day, such as two times, three times or four
times.
[0187] In other examples, a suitable dose for parental
administration is about 1 milligram per kilogram (mg/kg) to about
100 mg/kg, such as a dose of about 10 mg/kg to about 80 mg/kg, such
including about 1 mg/kg, about 2 mg/kg, about 5 mg/kg, about 20
mg/kg, about 30 mg/kg, about 40 mg/kg, about 50 mg/kg, about 80
mg/kg or about 100 mg/kg administered parenterally. However, other
higher or lower dosages also could be used, such as from about
0.001 mg/kg to about 1 g/kg, such as about 0.1 to about 500 mg/kg,
including about 0.5 mg/kg to about 200 mg/kg.
[0188] Single or multiple administrations of the composition
comprising one or more of the disclosed compositions can be carried
out with dose levels and pattern being selected by the treating
physician. Generally, multiple doses are administered. In a
particular example, the composition is administered parenterally
once per day. However, the composition can be administered twice
per day, three times per day, four times per day, six times per
day, every other day, twice a week, weekly, or monthly. Treatment
will typically continue for at least a month, more often for two or
three months, sometimes for six months or a year, and may even
continue indefinitely, i.e., chronically. Repeat courses of
treatment are also possible.
[0189] The specific dose level and frequency of dosage for any
particular subject may be varied and will depend upon a variety of
factors, including the activity of the specific compound, the
metabolic stability and length of action of that compound, the age,
body weight, general health, sex and diet of the subject, mode and
time of administration, rate of excretion, drug combination, and
severity of the condition of the subject undergoing therapy.
[0190] Selecting a Subject
[0191] Subjects can be screened prior to initiating the disclosed
therapies, for example to select a subject in need of or at risk of
developing a disorder or disease regulated by CB receptor activity
or expression. Briefly, the method can include screening subjects
to determine if they have or are at risk of developing a
GPR55-regulated disorder or disease, such as if the subject is in
need of tumor inhibition. Subjects having a tumor that expresses a
CB receptor, such as GPR55, or is regulated by CB receptor
activity, such as a primary tumor, including a primary brain tumor,
such as a glioblastoma, hepatocellular carcinoma, liver cancer,
lung cancer, or colon cancer or at risk of developing such a tumor
are selected. In one example, subjects are diagnosed with the tumor
by clinical signs, laboratory tests, or both. For example, a tumor,
such as a primary brain tumor, can be diagnosed by characteristic
clinical signs, such as headaches, vomiting, seizures, dizziness,
weight loss and various associated complaints. Diagnosis is
generally by imaging analysis such as by magnetic resonance imaging
(MRI) and confirmed by histology. In some examples, a subject is
selected that does not have a bleeding disorder, such as an
intracerebral hemorrhage.
[0192] In an example, a subject in need of the disclosed therapies
is selected by detecting a tumor expressing a CB receptor (e.g.,
GPR55) or regulated by its activity, such as by detecting CB
receptor activity or expression in a sample obtained from a subject
identified as having, suspected of having or at risk of acquiring
such a tumor. For example, detection of altered, such as at least a
10% alteration, including a 10%-90%, 20%-80%, 30%-70%, 40%-60%,
such as a 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 90%, 95% alteration or more in CB expression or
activity as compared to CB expression or activity in the absence of
a primary tumor, indicates that the tumor can be treated using the
fenoterol compositions and methods provided herein which are CB
receptor regulators. In other examples, a subject is selected by
detecting a primary brain tumor such as an astrocytoma or
glioblastoma by MRI or positron emission tomography (PET) in a
subject.
[0193] In some examples, a subject is selected by determining the
subject has or is at risk of developing a disorder or disease, such
as a tumor and/or cancer, which does not respond to .beta.2-AR
stimulation.
[0194] Pre-screening is not required prior to administration of the
therapeutic agents disclosed herein (such as those including
fenoterol, a fenoterol analogue or a combination thereof).
[0195] Exemplary Tumors
[0196] Exemplary tumors include tumors that express a CB receptor,
such as GPR55, or regulated by such, including primary tumors, such
as a primary brain tumor. A primary brain tumor includes
astrocytomas, glioblastomas, ependymoma, oligodendroglomas, and
mixed gliomas. Additional possible types of tumors associated with
CB receptor activity or expression include hematological tumors,
such as leukemias, including acute leukemias (such as
11q23-positive acute leukemia, acute lymphocytic leukemia, acute
myelocytic leukemia, acute myelogenous leukemia and myeloblastic,
promyelocytic, myelomonocytic, monocytic and erythroleukemia),
chronic leukemias (such as chronic myelocytic (granulocytic)
leukemia, chronic myelogenous leukemia, and chronic lymphocytic
leukemia), polycythemia vera, lymphoma, Hodgkin's disease,
non-Hodgkin's lymphoma (indolent and high grade forms), multiple
myeloma, Waldenstrom's macroglobulinemia, heavy chain disease,
myelodysplastic syndrome, hairy cell leukemia and
myelodysplasia.
[0197] Examples of possible solid tumors which may express a CB
receptor or be regulated by CB receptor activity, include sarcomas
and carcinomas, such as fibrosarcoma, myxosarcoma, liposarcoma,
chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovioma,
mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma,
colon carcinoma, lymphoid malignancy, pancreatic cancer, breast
cancer (including basal breast carcinoma, ductal carcinoma and
lobular breast carcinoma), lung cancers, liver cancers, ovarian
cancer, prostate cancer, hepatocellular carcinoma, squamous cell
carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland
carcinoma, medullary thyroid carcinoma, papillary thyroid
carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary
carcinoma, papillary adenocarcinomas, medullary carcinoma,
bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct
carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer,
testicular tumor, seminoma, bladder carcinoma, and CNS tumors (such
as a glioma, astrocytoma, medulloblastoma, craniopharyrgioma,
ependymoma, pinealoma, hemangioblastoma, acoustic neuroma,
oligodendroglioma, meningioma, melanoma, neuroblastoma and
retinoblastoma). In several examples, a tumor is a brain cancer,
liver cancer, or lung cancer that expresses a CB receptor, such as
GPR55. Tumors expressing a CB receptor, such as GPR55, can be
identified by routine methods known to those of skill in the art
including Western blot and histological studies with antibodies
capable of detecting a CB receptor, such as GPR55
[0198] Assessment
[0199] Following the administration of one or more therapies,
subjects having a disorder or disease regulated by CB receptor
activity, such as a tumor-expressing GPR55 (for example, a primary
tumor) can be monitored for decreases in tumor growth, tumor volume
or in one or more clinical symptoms associated with the tumor. In
particular examples, subjects are analyzed one or more times,
starting 7 days following treatment. Subjects can be monitored
using any method known in the art including those described herein
including imaging analysis.
[0200] Additional Treatments and Additional Therapeutic Agents
[0201] In particular examples, if subjects are stable or have a
minor, mixed or partial response to treatment, they can be
re-treated after re-evaluation with the same schedule and
preparation of agents that they previously received for the desired
amount of time, including the duration of a subject's lifetime. A
partial response is a reduction, such as at least a 10%, at least a
20%, at least a 30%, at least a 40%, at least a 50%, or at least a
70% reduction in one or more signs or symptoms associated with the
disorder or disease, such as a tumor regulated by CB receptor
activity, including tumor size or volume.
[0202] In some examples, the method further includes administering
a therapeutic effective amount of fenoterol, a fenoterol analogue
or a combination thereof with additional therapeutic treatments. In
particular examples, prior to, during, or following administration
of a therapeutic amount of an agent that prevents or inhibits a
tumor regulated by CB receptor activity, the subject can receive
one or more other therapies. In one example, the subject receives
one or more treatments to remove or reduce the tumor prior to
administration of a therapeutic amount of a composition including
fenoterol, a fenoterol analogue or combination thereof.
[0203] Examples of such therapies include, but are not limited to,
surgical treatment for removal or reduction of the tumor (such as
surgical resection, cryotherapy, or chemoembolization), as well as
anti-tumor pharmaceutical treatments which can include
radiotherapeutic agents, anti-neoplastic chemotherapeutic agents,
antibiotics, alkylating agents and antioxidants, kinase inhibitors,
and other agents. Particular examples of additional therapeutic
agents that can be used include microtubule-binding agents, DNA
intercalators or cross-linkers, DNA synthesis inhibitors, DNA
and/or RNA transcription inhibitors, antibodies, enzymes, enzyme
inhibitors, and gene regulators. These agents (which are
administered at a therapeutically effective amount) and treatments
can be used alone or in combination. Methods and therapeutic
dosages of such agents are known to those skilled in the art, and
can be determined by a skilled clinician.
[0204] "Microtubule-binding agent" refers to an agent that
interacts with tubulin to stabilize or destabilize microtubule
formation thereby inhibiting cell division. Examples of
microtubule-binding agents that can be used in conjunction with the
disclosed therapy include, without limitation, paclitaxel,
docetaxel, vinblastine, vindesine, vinorelbine (navelbine), the
epothilones, colchicine, dolastatin 15, nocodazole, podophyllotoxin
and rhizoxin. Analogs and derivatives of such compounds also can be
used and are known to those of ordinary skill in the art. For
example, suitable epothilones and epothilone analogs are described
in International Publication No. WO 2004/018478. Taxoids, such as
paclitaxel and docetaxel, as well as the analogs of paclitaxel
taught by U.S. Pat. Nos. 6,610,860; 5,530,020; and 5,912,264 can be
used.
[0205] The following classes of compounds are of use in the methods
disclosed herein: Suitable DNA and/or RNA transcription regulators,
including, without limitation, actinomycin D, daunorubicin,
doxorubicin and derivatives and analogs thereof also are suitable
for use in combination with the disclosed therapies. DNA
intercalators and cross-linking agents that can be administered to
a subject include, without limitation, cisplatin, carboplatin,
oxaliplatin, mitomycins, such as mitomycin C, bleomycin,
chlorambucil, cyclophosphamide and derivatives and analogs thereof.
DNA synthesis inhibitors suitable for use as therapeutic agents
include, without limitation, methotrexate,
5-fluoro-5'-deoxyuridine, 5-fluorouracil and analogs thereof.
Examples of suitable enzyme inhibitors include, without limitation,
camptothecin, etoposide, formestane, trichostatin and derivatives
and analogs thereof. Examples of alkylating agents include
carmustine or lomustine. Suitable compounds that affect gene
regulation include agents that result in increased or decreased
expression of one or more genes, such as raloxifene, 5-azacytidine,
5-aza-2'-deoxycytidine, tamoxifen, 4-hydroxytamoxifen, mifepristone
and derivatives and analogs thereof. Kinase inhibitors include
Gleevac, Iressa, and Tarceva that prevent phosphorylation and
activation of growth factors.
[0206] Other therapeutic agents, for example anti-tumor agents,
that may or may not fall under one or more of the classifications
above, also are suitable for administration in combination with the
disclosed therapies. By way of example, such agents include
adriamycin, apigenin, rapamycin, zebularine, cimetidine, and
derivatives and analogues thereof.
[0207] In one example, at least a portion of the tumor (such as the
primary brain tumor) is surgically removed (for example via
cryotherapy), irradiated, chemically treated (for example via
chemoembolization) or combinations thereof, prior to administration
of the disclosed therapies (such as administration of fenoterol, a
fenoterol analogue or a combination thereof). For example, a
subject having a primary brain tumor associated with CB receptor
activity can have at least a portion of the tumor surgically
excised prior to administration of the disclosed therapies. In an
example, one or more chemotherapeutic agents are administered
following treatment with a composition including fenoterol, a
fenoterol analogue or a combination thereof. In another particular
example, the subject has a primary brain tumor and is administered
radiation therapy, chemoembolization therapy, or both concurrently
with the administration of the disclosed therapies.
[0208] Additional Disorders and Diseases
[0209] As discussed above, in addition to methods of treating CB
receptor-regulated tumors, it is contemplated that the disclosed
fenoterol analogues possessing CB receptor modulatory activity,
such as modulator of GPR55 activity, can be used to treat other
conditions associated with CB receptor regulation, such as
metabolic disorders and disease (e.g., obesity and diabetes), or
inflammatory and neuropathic pain disorders, diseases associated
with aging such as Alzheimer's, bone loss, muscle wasting
(sarcopenia), osteoarthritis and loss of appetite, central nervous
system conditions such as depression and anxiety and other diseases
and disorders associated with CB receptor regulation.
[0210] Based on these observations, methods of treating metabolic
disorders/diseases, (such as obesity, loss of appetite, and/or
diabetes), bone and/or muscle disorders or diseases (such as bone
loss, muscle wasting, osteoarthritis), central nervous system
conditions (such as depression and anxiety) and inflammatory
disorders/diseases, such as inflammation, neuropathic pain
disorders and diseases associated with inflammation and/or aging
(such as Alzheimer's disease, osteoarthritis), are disclosed. For
example, disclosed herein are methods of preventing and treating
obesity, diabetes, and related disorders.
[0211] In one example, a method of treating obesity or a condition
associated with obesity, such as diabetes, in a subject is
disclosed comprising administering to a subject an effective amount
of at least one fenoterol analogue with CB receptor modulatory
activity, such as GPR55 activity (e.g., a disclosed
naphthylfenoterol analogue, such as
(R,R')-4'-methoxy-1-napthylfenoterol (MNF), (R,S')-MNF,
(R,R')-ethylMNF, (R,R')-napthylfenoterol (NF), (R,R')-ethylNF,
(R,S')--NF and (R,R')-4'-amino-1-napthylfenoterol (aminoNF),
(R,R')-4'-hydroxy-1-napthylfenoterol (hydroxyNF), or a combination
thereof), to reduce or inhibit one or more signs or symptoms
associated with obesity or a condition associated with obesity. In
some examples, methods of treating one or more signs or symptoms
associated with an inflammatory disorder and/or disease are
disclosed comprising administering to a subject an effective amount
of at least one fenoterol analogue with CB receptor modulatory
activity, such as GPR55 activity (e.g., a disclosed
naphthylfenoterol analogue, such as
(R,R')-4'-methoxy-1-napthylfenoterol (MNF), (R,S')-MNF,
(R,R')-ethylMNF, (R,R')-napthylfenoterol (NF), (R,R')-ethylNF,
(R,S')--NF and (R,R')-4'-amino-1-napthylfenoterol (aminoNF),
(R,R')-4'-hydroxy-1-napthylfenoterol (hydroxyNF), or a combination
thereof), to reduce or inhibit one or more signs or symptoms
associated with the inflammatory disorder/disease or a condition
associated with the inflammatory disorder/disease.
[0212] Disclosed methods include administering a disclosed
fenoterol analogue with CB receptor modulatory activity (and,
optionally, one or more other pharmaceutical agents) to a subject
in a pharmaceutically acceptable carrier and in an amount effective
to treat the disorder or disease regulated by CB receptor activity,
such as GPR55 activity. Treatment of the disorder or disease
includes preventing or reducing signs or symptoms associated with
the particular disorder or disease. The signs and symptoms
associated with the particular disorder or disease are known to one
of ordinary skill in the art and can be measured by assays
disclosed herein as well as those known to those skilled in the
art. In some examples, treatment using the methods disclosed herein
prolongs the time of survival of the subject.
[0213] Routes of administration useful in the disclosed methods
include but are not limited to oral and parenteral routes, such as
intravenous (IV), intraperitoneal (IP), rectal, topical,
ophthalmic, nasal, and transdermal as described in detail
above.
[0214] An effective amount of a disclosed fenoterol analogue or
combination thereof will depend, at least, on the particular method
of use, the subject being treated, the severity of the
disorder/disease, and the manner of administration of the
therapeutic composition. A "therapeutically effective amount" of a
composition is a quantity of a specified compound sufficient to
achieve a desired effect in a subject being treated. Ideally, a
therapeutically effective amount of a disclosed fenoterol analogue
is an amount sufficient to prevent or inhibit one or more symptoms
associated with the particular disorder/disease in a subject
without causing a substantial cytotoxic effect on host cells.
[0215] Therapeutically effective doses of a disclosed fenoterol
compound or pharmaceutical composition can be determined by one of
skill in the art, with a goal of achieving concentrations that are
at least as high as the IC.sub.50 of the applicable compound
disclosed in the examples herein. An example of a dosage range is
from about 0.001 to about 10 mg/kg body weight orally in single or
divided doses. In particular examples, a dosage range is from about
0.005 to about 5 mg/kg body weight orally in single or divided
doses (assuming an average body weight of approximately 70 kg;
values adjusted accordingly for persons weighing more or less than
average). For oral administration, the compositions are, for
example, provided in the form of a tablet containing from about 1.0
to about 50 mg of the active ingredient, particularly about 2.5 mg,
about 5 mg, about 10 mg, or about 50 mg of the active ingredient
for the symptomatic adjustment of the dosage to the subject being
treated. In one exemplary oral dosage regimen, a tablet containing
from about 1 mg to about 50 mg active ingredient is administered
once to four times a day, such as one time, two times, three times
or four times.
[0216] In other examples, a suitable dose for parental
administration is about 1 milligram per kilogram (mg/kg) to about
100 mg/kg, such as a dose of about 10 mg/kg to about 80 mg/kg, such
including about 1 mg/kg, about 2 mg/kg, about 5 mg/kg, about 20
mg/kg, about 30 mg/kg, about 40 mg/kg, about 50 mg/kg, about 80
mg/kg or about 100 mg/kg administered parenterally. However, other
higher or lower dosages also could be used, such as from about
0.001 mg/kg to about 1 g/kg, such as about 0.1 to about 500 mg/kg,
including about 0.5 mg/kg to about 200 mg/kg.
[0217] Single or multiple administrations of the composition
comprising one or more of the disclosed compositions can be carried
out with dose levels and pattern being selected by the treating
physician. Generally, multiple doses are administered. In a
particular example, the composition is parenterally administered
once per day. However, the composition can be administered twice
per day, three times per day, four times per day, six times per
day, every other day, twice a week, weekly, or monthly. Treatment
will typically continue for at least one month, more often for two
or three months, sometimes for six months or a year, and may even
continue indefinitely, that is, chronically. Repeat courses of
treatment are also possible.
[0218] The specific dose level and frequency of dosage for any
particular subject may be varied and will depend upon a variety of
factors, including the activity of the specific compound, the
metabolic stability and length of action of that compound, the age,
body weight, general health, sex and diet of the subject, mode and
time of administration, rate of excretion, drug combination, and
severity of the condition of the subject undergoing therapy. In
some examples, one or more disclosed fenoterol analogues with CB
receptor activity is orally administered to a subject daily to
treat one or more symptoms associated with an aging disorder or
disease (such as Alzheimer's, sarcopenia, bone loss, or
combinations thereof) or a central nervous system disorder or
disease (such as anxiety or depression).
[0219] Subjects can be screened prior to initiating the disclosed
therapies, for example to select a subject in need of or at risk of
developing a disorder or disease regulated by CB receptor activity
or expression. Briefly, the method can include screening subjects
to determine if they have or are at risk of developing a
GPR55-regulated disorder or disease. Subjects having a disorder or
disease that expresses a CB receptor, such as GPR55, or is
regulated by CB receptor activity are selected. In one example,
subjects are diagnosed by clinical signs, laboratory tests, or both
known to those of ordinary skill in the art or disclosed herein (or
both).
[0220] Pre-screening is not required prior to administration of the
therapeutic agents disclosed herein (such as those including
fenoterol, a fenoterol analogue or a combination thereof).
[0221] In particular examples, if subjects are stable or have a
minor, mixed or partial response to treatment, they can be
re-treated after re-evaluation with the same schedule and
preparation of agents that they previously received for the desired
amount of time, including the duration of a subject's lifetime. A
partial response is a reduction, such as at least a 10%, at least a
20%, at least a 30%, at least a 40%, at least a 50%, or at least a
70% reduction in one or more signs or symptoms associated with the
disorder or disease.
[0222] In some examples, the method further includes administering
a therapeutic effective amount of one or more fenoterol analogues
with additional therapeutic treatments. In particular examples,
prior to, during, or following administration of a therapeutic
amount of an agent that prevents or inhibits a tumor regulated by
CB receptor activity, the subject can receive one or more other
therapies. In one example, the subject receives one or more
treatments to remove or reduce one or more signs or symptoms
associated with the CB receptor regulated disorder/disease prior to
administration of a therapeutic amount of a composition including
one or more fenoterol analogues.
[0223] In particular examples, prior to, during, or following
administration of a therapeutic amount of a disclosed fenoterol
analogue composition that reduces or inhibits one or more signs or
symptoms of obesity or a condition associated with obesity, the
subject can receive one or more other therapies. In one example,
the subject receives one or more treatments to remove or reduce one
or more conditions associated with obesity, such as diabetes.
[0224] Examples of such therapies include, but are not limited to,
anti-diabetic agents, insulin sensitizers, insulin secretagogues,
agents that preserve and/or increase .beta.-cell mass, agents that
enhance glucose-stimulated insulin secretion and glucose uptake in
peripheral organs of insulin action (skeletal muscle, liver,
adipose tissue), agents that suppress endogenous glucose
production, and anti-obesity agents. For example, the disclosed
therapies can be administered with anti-diabetic agents such as
biguanides. In particular embodiments, the biguanide antidiabetic
agent is metformin. Metformin is manufactured by Lyonnaise
Industrielle Pharmaceutique SA (Lyons, France), also known by its
acronym LIPHA SA, and commercially distributed in the United States
as a hydrochloride salt by the Bristol-Myers Squibb Company
(Princeton, N.J.) as GLUCOPHAGE.RTM. XR. Additionally,
Bristol-Myers Squibb distributes a pharmaceutical having a
combination of metformin and glyburide as GLUCOVANCE.RTM..
[0225] Anti-diabetic agents other than biguanides can also be
administered to the identified subject. For example, in alternative
embodiments, the anti-diabetic agent is a thiazolidinedione, such
as troglitazone. In some examples, the anti-diabetic agent is an
incretin or dipeptidyl peptidase-4 inhibitor, but the anti-diabetic
agent can be any agent of interest.
[0226] A therapeutically effective amount of an anti-diabetic agent
may be administered in a single dose, or in several doses, for
example daily, during a course of treatment. The course of
treatment may last for any length of time, such as a day or several
days, a week or several weeks, a month or several months, or a year
or several years, so long as the therapeutic effect is observed,
such as inhibiting the onset of type II diabetes in a subject
diagnosed with pre-diabetes, or inducing a subject diagnosed with
type 2 diabetes or pre-diabetes to a normal glucose tolerance. The
subject can be monitored while undergoing treatment using the
methods described herein in order to assess the efficacy of the
treatment protocol. In this manner, the length of time or the
amount given to the subject can be modified based on the results
obtained using the methods disclosed herein.
[0227] The therapeutically effective amount will depend on the
anti-diabetic agent being used, the characteristics of the subject
being treated (such as age, BMI, physiological condition, etc.),
the severity and type of the affliction, and the manner of
administration of the agent. The therapeutically effective dose can
be determined by various methods, including generating an empirical
dose-response curve, predicting potency and efficacy by using
quantitative structure-activity relationships (QSAR) methods or
molecular modeling, and other methods used in the pharmaceutical
sciences. In certain, non-limiting examples, the therapeutically
effective amount of metformin (or a related biguanide analog or
homolog) is at least about 1000 mg per day, such as at least about
1500 mg per day, or even at least about 1700 mg per day. In certain
other, non-limiting examples, the total amount of metformin is
divided into smaller doses, such as two or three doses per day, for
example 850 mg twice a day (b.i.d.) or 500 mg three times a day
(t.i.d.). In alternative, non-limiting examples, the total amount
of metformin is about 500 mg or less per day. The subject can be
monitored at different doses of an agent using the assays described
herein, in order to determine a therapeutically effective amount
for the subject of interest.
[0228] For administration to animals, purified therapeutically
active agents are generally combined with a pharmaceutically
acceptable carrier. Pharmaceutical preparations may contain only
one type of anti-diabetic agent or may be composed of a combination
of several types of anti-diabetic agents, such as a combination of
two or more anti-diabetic agents.
[0229] In general, the nature of the carrier will depend on the
particular mode of administration being employed. For instance,
parenteral formulations usually comprise injectable fluids that
include pharmaceutically and physiologically acceptable fluids such
as water, physiological saline, balanced salt solutions, aqueous
dextrose, glycerol or the like as a vehicle. For solid compositions
(e.g., powder, pill, tablet, or capsule forms), conventional
non-toxic solid carriers can include, for example, pharmaceutical
grades of mannitol, lactose, starch, or magnesium stearate. In
addition to biologically-neutral carriers, pharmaceutical
compositions to be administered can contain minor amounts of
non-toxic auxiliary substances, such as wetting or emulsifying
agents, preservatives, and pH buffering agents and the like, for
example sodium acetate or sorbitan monolaurate.
[0230] Anti-diabetic agents may be administered by any means that
achieve their intended purpose. For example, the anti-diabetic
agents may be administered to a subject through systemic
administration, such as intravenous, intraperitoneal,
intralesional, suppository, or oral administration.
[0231] The anti-diabetic agent can be administered alone or in
combination with another anti-diabetic agent. In certain
embodiments, the anti-diabetic agent is administered in the absence
of administering any other anti-diabetic agent.
[0232] Other measures may be taken to inhibit or delay the onset of
type II diabetes in subjects at a heightened risk of developing the
disease. For example, in some embodiments, a subject may be
instructed, trained, or induced to adopt anti-diabetic lifestyle
modifications. For example, the subject can be counseled to reduce
caloric intake or to exercise. The methods disclosed herein can be
used to monitor the effectiveness of these alternative measures to
determine if pharmaceutical intervention is warranted for a subject
of interest.
[0233] The subject matter of the present disclosure is further
illustrated by the following non-limiting Examples.
EXAMPLES
Example 1
Material and Methods
[0234] This example describes the Material and Methods used for
Examples 2-4.
[0235] Materials.
[0236] (R,R')-, (R,S')-, (S,R')- and (S,S')-fenoterol and the
fenoterol analogs, (R,R')-ethylfenoterol, (R,R')-4'-aminofenoterol,
(R,R')-1-naphthylfenoterol and (R,R')- and
(R,S')-4-methoxy-1-naphthylfenoterol, were synthesized as
previously described (Jozwiak et al., J Med Chem 50:2903-2915,
2007; Jozwiak et al., Bioorg Med Chem 18:728-736, 2010; each of
which is incorporated by reference in its entirety).
[.sup.3H]-Thymidine (70-90 Ci/mmol) was purchased from PerkinElmer
Life and Analytical Sciences (Waltham, Mass.). Eagle's Minimum
Essential Medium (E-MEM), trypsin solution, phosphate-buffered
saline (PBS), fetal bovine serum (FBS), 100.times. solutions of
sodium pyruvate (100 mM), L-glutamine (200 mM), and
penicillin/streptomycin (a mixture of 10,000 units/ml penicillin
and 10,000 .mu.g/ml streptomycin) were obtained from Quality
Biological (Gaithersburg, Md.). WIN 55,212-2, AM251, and AM630 were
purchased from Cayman Chemical (Ann Arbor, Mich.). ICI 118,551
hydrochloride and (R)-isoproterenol were obtained from
Sigma-Aldrich (St. Louis, Mo.).
[0237] Maintenance and Treatment of Cell Lines.
[0238] Human HepG2 hepatocarcinoma cells and human U87MG glioma
cells (ATCC, Manassas, Va.) were maintained in EMEM medium
supplemented with 1% L-glutamine, 1% sodium pyruvate, 1%
penicillin/streptomycin, and 10% FBS (Hyclone, Logan, Utah). The
human 1321N1 astrocytoma cells (European Collection of Cell
Cultures, Sigma-Aldrich) were cultured in Dulbecco's modified
Eagle's medium supplemented with 10% FBS and
penicillin/streptomycin. All cell lines were cultured at 37.degree.
C. in 5% CO.sub.2, and the medium was replaced every 2-3 days.
[0239] Unless otherwise indicated, cells at 70-80% confluence were
depleted of serum for 3 hours, followed by the addition of ICI
118551, AM251, AM630 or WIN 55-212.2 for 1 hour before treatment
with vehicle, fenoterol or fenoterol derivatives at the indicated
concentrations.
[0240] [.sup.3H]-Thymidine Incorporation Assay.
[0241] Cells were seeded in 12-well plates at approximately 50,000
cells/well and incubated at 37.degree. C. After 24 hours, the wells
were rinsed with PBS and replaced with serum-free medium containing
the appropriate concentration of the test compounds. After another
24-hour incubation at 37.degree. C., 1 .mu.Ci of
[.sup.3H]-thymidine was added to each well and incubated at
37.degree. C. for 16 hours. [.sup.3H]-Thymidine incorporation into
DNA was monitored after the cells were washed twice with PBS and
then lysed in 600 .mu.L of 0.1 N NaOH for 30 minutes with shaking.
The lysate was then mixed with 3 mL of liquid scintillation
cocktail (Beckman Coulter, Inc., Brea, Calif.), and radioactivity
was measured by liquid scintillation counting using Beckman Coulter
LS6000IC Scintillation Counter. Data are shown as CPM incorporated
compared to the control cells.
[0242] cAMP Accumulation.
[0243] HepG2 cells were seeded in 96-well plates and grown to
confluency. Cells were rinsed in Krebs-HEPES buffer, pH 7.4,
pre-incubated for 10 minutes with the buffer, and then 10 .mu.M
(R)-isoproterenol or (R,R')-fenoterol was added followed by
incubation for an additional 10 minutes. The levels of cAMP
accumulated in cells were determined and normalized to the amount
of protein per well.
[0244] RNA Extraction, cDNA Synthesis, and RT-PCR Analysis.
[0245] Total RNA was isolated from HepG2, 1321N1 and U87MG cells
using the RNeasy Mini kit (Qiagen, Valencia, Calif.). The RNA
preparation included a DNAse digestion step. RNA concentration and
quality was measured using the NanoDrop spectrophotometer (NanoDrop
Technologies, Wilmington, Del.). To obtain cDNA, 1 .mu.g total RNA
was reverse-transcribed using the Promega reverse transcription kit
(Promega Corp., Madison, Wis.). PCR reactions were performed to
determine the expression of CB1R, CB2R, and .beta.2-AR mRNAs using
GAPDH as internal control. The PCR primers and conditions are found
in Supplemental Table 1.
[0246] Cell Cycle Analysis.
[0247] Cell cycle distributions were performed by flow cytometry on
propidium iodide-stained nuclei prepared by the NIM technique. DNA
histograms of at least 10,000 cells acquired on a Becton-Dickinson
FACScanto II (BD Biosciences, San Jose, Calif.) were deconvoluted
using the Multicycle program (Phoenix Flow Systems) for estimates
of the percentage of cells in the G0/1, S, and G2+M phases of the
cell cycle. Debris and doublets were removed from the analysis by
software algorithms.
[0248] Apoptosis Assay.
[0249] The degree of apoptosis induced by drug treatment was
assayed by flow cytometry using the Alexa Fluor.RTM. 488 annexin
V/Dead Cell Apoptosis Kit (Invitrogen) following the standard
manufacturer's protocol. Briefly, HepG2 cells (5.times.10.sup.5)
were grown on 100-mm dishes for 24 hours followed by treatment with
vehicle, (R,R')-fenoterol, or (R,R')-MNF, all in serum-free medium.
Cells were subsequently harvested after a 24-hour incubation,
washed in cold PBS, and resuspended in 100 .mu.L of 1.times.
annexin-binding buffer to maintain a density
.about.1.times.10.sup.6 cells/mL, after which 5 .mu.L Alexa
Fluor.RTM. 488 annexin V and 1 .mu.L 100 .mu.g/mL propidium iodide
were added to the cell suspensions. Cells were then incubated at
room temperature for 15 minutes and 400 .mu.L 1.times.
annexin-binding buffer was added followed by gentle mixing. Stained
cells were analyzed on a BDFACSCanto II flow cytometer.
[0250] Western Blotting.
[0251] Cells were lysed with RIPA buffer containing EGTA and EDTA
(Boston BioProducts, Ashland, Mass.). The lysis buffer was mixed
with a protease inhibitor cocktail (Sigma-Aldrich). Protein
concentrations were measured using the bicinchoninic acid reagent
(Thermo-Pierce Biotechnology, Inc., Rockford, Ill.). Proteins (20
.mu.g/well) were separated on 4-12% precast gels (Invitrogen,
Carlsbad, Calif.) using SDS-polyacrylamide gel electrophoresis
under reducing conditions and were electrophoretically transferred
onto polyvinylidene fluoride membrane (Invitrogen). Western blots
were performed according to standard methods. The visualization of
immunoreactive bands was performed using the ECL Plus Western
Blotting Detection System (GE Healthcare, NJ) and their
quantification was done by volume densitometry using Image J
software and normalization to .beta.-actin. The primary antibody
for .beta.2-AR was obtained from Enzo Life Sciences, Inc. (Cat. #
ADI-905-742-100, Farmingdale, N.Y.); rabbit anti-phospho-Akt
(Ser-473), phospho-ERK1/2, total Akt and total ERK2 were from Cell
Signaling Technology (Beverly, Mass.), and anti-.beta.-actin was
from Abcam (Cambridge, Mass.). The antibodies were used at a
dilution recommended by the manufacturer.
[0252] Statistical Analysis.
[0253] Results were expressed as relative to the control value.
Studies were performed in at least two to three different culture
preparations, and two to three dishes for each test condition were
plated in each preparation. Results are expressed as means.+-.S.E.
Student's t-test was used to make statistical comparisons between
groups. Analyses were performed using the SigmaPlot Software
(Systat Software, Inc. San Jose, Calif.), Graphpad Prism 4
(GraphPad Software, Inc., La Jolla, Calif.) and Microsoft.RTM.
Office Excel, 2003 (Microsoft Corp., Redmond, Wash.), with p
values.ltoreq.0.05 considered significant.
Example 2
Characterization of Fenoterol and Fenoterol Analogs on Cannabinoid
Receptor Activity
[0254] This example describes a series of studies performed to
characterize the ability of fenoterol and disclosed fenoterol
analogs to modulate cannabinoid receptor activity.
[0255] (R,R')-Fenoterol, (R,R')-Fen, is a potent and selective
agonist of the .beta..sub.2-adrenergic receptor (.beta..sub.2-AR),
which has a 43-fold higher affinity for the .beta..sub.2-AR
relative to the .beta..sub.1-AR and an EC.sub.50cAMP value of 0.3
nM for the stimulation of cAMP accumulation in HEK cells expressing
human .beta..sub.2-AR. The inventors have disclosed the synthesis
and characterization of a number of (R,R')-Fen analogs and
stereoisomers with a range of .beta..sub.2-AR selectivity and
potency (see, for example International Patent Publication No. WO
2008/022038 and WO 2011/112867, each of which is incorporated by
reference in its entirety herein). One of these analogs,
(R,R')-4-methoxy-1-naphthylfenoterol (MNF) has a .beta..sub.2-AR
selectivity of 573 with an EC.sub.50cAMP of 3.90 nM.
[0256] .beta..sub.2-ARs associate with heterotrimeric G proteins
(e.g., G.sub.S, G.sub.i), ion channels and cytosolic scaffold
proteins, including .beta.-arrestin, to initiate various signaling
pathways and modulate the activity of intracellular effectors such
as adenyl cyclase and mitogen-activated protein kinase (MAPK). The
difference in the G protein and .beta.-arrestin signaling by
.beta..sub.2-AR agonists has been attributed to interaction with
ligand-specific GPCR conformations and functional selectivity,
which is based upon the assumption that the .beta..sub.2-AR exists
in an inactive (R) state and one or more ligand-specific active
conformations (R*.sup.n). The basis for the ligand-specific
differences in pharmacological outcome lies in the interplay
between the molecular structure of the agonist and the cellular
environment of the receptor. In the first instance, the inventors
have shown that the G.sub.S/G.sub.i selectivity of Fen is a
function of molecular structure and stereochemistry as (R,R')-Fen
preferentially activated G.sub.S signaling in a cardiomyocyte
contractility model while (S,R')-Fen and (R,R')-MNF activated both
G.sub.S and G.sub.i proteins. In the latter case, the inventors
have demonstrated that .beta..sub.2-AR agonists such as (R,R')-Fen
and isoproterenol exert anti-proliferative effects in the
human-derived 1321N1 astrocytoma cell line specifically through the
cAMP-dependent pathway while Yuan and colleagues (Oncol Rep
23:151-157, 2010) reported that isoproterenol dose-dependently
induced the growth of the human-derived HepG2 hepatocellular
carcinoma cell line.
[0257] The current example describes the effect of the molecular
structure and stereochemistry of .beta..sub.2-AR agonists on
[.sup.3H]-thymidine incorporation in HepG2 cells and to compare
these results to similar studies conducted using the 1321N1 and
human-derived U87MG glioblastoma cells lines. The initial data
demonstrated that (R,R')-Fen and isoproterenol induced
[.sup.3H]-thymidine incorporation in HepG2 cells, reduced
proliferation in 1321N1 cells and had no effect on U87MG cells and
that the effects in the HepG2 and 1321N1 cells could be attenuated
by the .beta..sub.2-AR antagonist ICI 118551. When (R,R')-MNF was
utilized in the studies, opposite results were obtained as the
compound inhibited [.sup.3H]-thymidine incorporation in HepG2 cells
and had no significant effect on 1321N1 cells. The inhibitory
effect of (R,R')-MNF in HepG2 cells was not affected by the
addition of ICI 118551 and (R,R')-MNF also attenuated
[.sup.3H]-thymidine incorporation in the .beta..sub.2-AR-deficient
U87MG cell line. These results indicate that while (R,R')-MNF is a
full .beta..sub.2-AR agonist, the anti-proliferative effects of
this compound are not due to this activity. Further studies
indicated that AM251 and AM630, inverse agonists of the CB1 and CB2
cannabinoid receptors, respectively, blocked (R,R')-MNF mitogenic
responses in HepG2 and U87MG cell lines and that WIN 55,212-2, a
synthetic CB1 and CB2 receptor agonist, produced growth inhibition
in these cell lines. These results suggest that cannabinoid
receptor activation is associated with the cell type-dependent
antiproliferative and pro-apoptotic effects of (R,R')-MNF.
[0258] Expression of .beta..sub.2-AR in select human cancer cell
lines.
[0259] The protein levels of the .beta..sub.2-AR were determined by
Western blot analysis in total extracts of HepG2 hepatocarcinoma
cells, 1321N1 astrocytoma cells, and U87MG glioma cells (FIG. 1A).
.beta..sub.2-AR protein level was the highest in 1321N1 cells when
compared to HepG2 cells. U87MG cells were previously found by the
inventors to be devoid of .beta..sub.2-AR at the cell surface.
[0260] Effect of 3-AR Agonists on cAMP Accumulation and
Phosphorylation of Akt and ERK1/2 in HepG2 Cells.
[0261] Neither (R)-isoproterenol nor (R,R')-Fen, at 10 elicited an
increase in cAMP production in HepG2 cells, whereas cell treatment
with the adenylate cyclase activator, forskolin, induced
significant accumulation of cAMP (FIG. 1B). Studies have
demonstrated that .beta..sub.2-AR can signal to the
mitogen-activated protein kinases ERK1 and ERK2 independent of a
functional adenylate cyclase coupling. The effect of isoproterenol
and (R,R')-Fen on Akt and ERK1/2 activation was assessed by
imunoblotting using selective antibodies to phosphorylated peptides
that correspond to the active forms of Akt and ERK1/2. Treatment of
HepG2 cells with these .beta.-agonists induced a time-dependent
increase in Akt and ERK activation (FIG. 1C). These results
indicate that due to low receptor number,
.beta..sub.2-AR-stimulated adenylyl cyclase activity might be below
detectable levels in this cell line.
[0262] The Effects of (R)-Isoproterenol and Fen Analogs on the
Proliferation of HepG2 Cells.
[0263] The effect of (R)-isoproterenol, (R,R')-Fen and selected Fen
analogs on cell proliferation was determined in HepG2 cells. Both
(R)-isoproterenol and (R,R')-Fen produced a significant increase in
cell proliferation, as assessed by [.sup.3H]-thymidine
incorporation, with ED.sub.50 of 0.40.+-.0.08 .mu.M and
1.17.+-.0.37 .mu.M, respectively (Table 1; FIG. 2A). Fen has two
chiral centers and has 4 possible steroisomeric forms, (R,R'),
(R,S'), (S,R') and (S,S'). The effect of the stereochemistry on the
proliferative effect of Fen was determined using a concentration of
1 .mu.M of each isomer. The data indicate that all of the isomers
induced an increase in [.sup.3H]-thymidine incorporation and that
stereochemistry had only a quantitative effect on this process with
(R,R')-Fen producing the greatest increase (51.3%) and (S,S')-Fen
the lowest (9.7%) (Table 1). This result was consistent with the
previously reported inhibitory effect of Fen stereoisomers on
mitogenesis in 1321N1 cells in which the inhibitory potency was
(R,R')>(R,S').apprxeq.(S,R')>>(S,S') (see Table 1 below).
The effect of the change of the N-alkyl methyl group to an ethyl
moiety {(R,R')-ethylFen} and the substitution of an 4'-amino group
for the 4'-hydroxyl group {(R,R')-aminoFen} were also investigated.
Neither alteration changed the direction of the effect on
[.sup.3H]-thymidine incorporation and (R,R')-aminoFen appeared to
be 3-fold more active than (R,R')-Fen with an
EC.sub.50=0.47.+-.0.09 .mu.M (Table 1; FIG. 2A).
[0264] The inventors determined that the incorporation of a
naphthyl moiety into the Fen molecule reduced the potency of the
resulting compound, but not the inhibitory effect on mitogenesis in
1321N1 cells. Further, the opposite effect was observed as
(R,R')-MNF and 1-naphthylFen inhibited [.sup.3H]-thymidine
incorporation with IC.sub.50 values of 0.39.+-.0.09 .mu.M and
0.21.+-.0.07 .mu.M, respectively (Table 1; FIG. 2B). The change in
the stereochemistry of the chiral center on the N-alkyl portion of
the MNF molecule had no effect on the anti-proliferative response
as 1 .mu.M concentrations of (R,R')-MNF and (R,S')-MNF produced
equivalent decreases in [.sup.3H]-thymidine incorporation of -59.4%
and -68.1%, respectively (Table 1).
TABLE-US-00001 TABLE 1 Structures, percent change in thymidine
incorporation and IC.sub.50/EC.sub.50 of fenoterol (Fen) and
analogs that were used for this study. ##STR00028## Mitogenesis
Inhibition in IC.sub.50/EC.sub.50 % Change in 1321N1 cells
Compounds R1 R2 (.mu.M) HepG2 cells (IC.sub.50 nM)* Fen CH.sub.3
##STR00029## 1.17 .+-. 0.37 (n = 6) (R,R'): 51.3 (R,S'): 19.1
(S,R'): 28.7 (S,S'): 9.7 0.14 .+-. 0.07 6.09 .+-. 1.93 6.74 .+-.
2.18 184.2 .+-. 26.1 ethylFen CH.sub.3--CH.sub.2 ##STR00030## n.d.
(R,R'): 50.90 at 10 .mu.M 1.44 .+-. 0.27 aminoFen CH.sub.3
##STR00031## 0.47 .+-. 0.09 (n = 3) (R,R'): 54.37 1-naphthylFen
CH.sub.3 ##STR00032## 0.21 .+-. 0.07 (n = 2) (R,R): -67.52 1.57
.+-. 0.34 4'-methoxy-1- naphthylFen CH.sub.3 ##STR00033## 0.39 .+-.
0.09 (n = 6) (R,R'): -59.4 (R,S'): -68.1 3.98 .+-. 0.28 4.37 .+-.
0.70
[0265] (R,R')-MNF is a full and potent .beta..sub.2-AR agonist in
respect to the stimulation of cAMP expression in HEK cells stably
transfected with .beta.2-AR and in 1321N1 cells, with EC.sub.50 of
3.9 nM and 68.9 nM, respectively. Since HepG2 cells displayed
substantial sensitivity to (R,R')-aminoFen (EC.sub.50=0.47.+-.0.09
.mu.M) and (R,R')-MNF (IC.sub.50=0.39.+-.0.09 .mu.M) with regard to
[.sup.3H]-thymidine incorporation, the responsiveness of 1321N1
cells to the two compounds was determined and found to be markedly
lower (FIG. 2C). The specificity of the observed .beta..sub.2-AR
response to (R,R')-Fen and (R,R')-MNF in the HepG2 and 1321N1 cells
was tested using the U87MG cells, which had been previously shown
to lack the expression of active .beta..sub.2-AR. In this cell
line, (R,R')-MNF produced a potent inhibition of cellular
proliferation while (R,R')-Fen had no effect (FIG. 7).
[0266] In the previous study of the effect of (R)-isoproterenol and
(R,R')-Fen on mitogenesis in 1321N1 cells, the studies were
conducted using complete medium. In order to determine if the
presence of serum or its absence significantly influenced the
extent of mitogenesis in response to (R)-isoproterenol and
(R,R')-Fen, the studies were repeated using both protocols. The
results indicated that HepG2 cells exhibited a better sensitivity
in serum-depleted medium, whereas the sensitivity was greater in
1321N1 cells maintained in complete medium (FIG. 2D). These data
suggest that there are contrasting mitogenic responses to
.beta..sub.2-AR agonists in HepG2 and 1321N1 cells.
[0267] .beta..sub.2-AR Antagonism does not Inhibit the
Anti-Proliferative Action of (R,R')-MNF while Preventing
(R,R')-Fen's Growth Promoting Effects in HepG2 Cells.
[0268] The divergent actions mediated by (R,R')-Fen and (R,R')-MNF
are consistent with activation of distinct signaling pathways with
opposite effects on cell proliferation. To evaluate this, HepG2
cells were pretreated with the .beta..sub.2 receptor antagonist,
ICI 118,551, followed by incubation in the presence of (R,R')-Fen
or (R,R')-MNF for 24 h. While ICI 118,551 alone showed no effect on
cell proliferation (FIG. 3A), its addition significantly blocked
(R,R')-Fen-stimulated mitogenesis (FIGS. 3B and 3C). However, the
anti-proliferative effect of (R,R')-MNF was refractory to ICI
118,551 pretreatment (FIGS. 3B and 3D).
[0269] The ability to hamper the action of (R,R')-Fen by the
co-addition of MNF was determined. The results showed clearly a
mitogenic response in HepG2 cells that was intermediate between
(R,R')-Fen and (R,R')-MNF alone, and the pretreatment with ICI
118,551 partially restored the anti-proliferative effects of
(R,R')-MNF (FIG. 7, upper panel). However, characteristics of the
cell proliferation profile elicited by (R,R')-Fen in 1321N1 cells
and (R,R')-MNF in U87MG cells were maintained by the co-treatment
with (R,R')-Fen and (R,R')-MNF (FIG. 7, middle and lower panels).
Pretreatment with ICI 118,551 blocked (R,R')-Fen signaling in
1321N1 cells while being inactive against the anti-proliferative
action of (R,R')-MNF in U87MG cells (FIG. 7). These results
indicate that the effects of (R,R')-Fen and (R,R')-MNF on cell
proliferation are cell type-specific and may require activation of
distinct receptors.
[0270] (R,R')-MNF Induces Apoptosis in HepG2 Cells.
[0271] The proliferation of HepG2 cells was assessed by flow
cytometry analysis using propidium iodide staining to examine the
cell cycle. (R,R')-Fen produced no significant alterations of the
cell cycle, but (R,R')-MNF caused a temporal decrease in the
G.sub.2/M- and S-phase cell populations (G2/M: 118.+-.1.1% in
control versus 10.2.+-.0.9% after 6 h, 14.6.+-.1.8% after 12 h and
8.9.+-.1.6% after 24 h; S: 34.7.+-.0.3% in control versus
34.1.+-.0.9% after 6 h, 13.7.+-.1.2% after 12 h and 24.6.+-.4.2%
after 24 h) in HepG2 cells treated with 1 .mu.M (R,R')-MNF (FIG.
4). The treatment with (R,R')-MNF also yielded a time-dependent
increase in the number of sub-G.sub.1 events, reaching a maximum of
21.5.+-.0.7% by 12 hours (FIG. 4, bottom, right panel). No
significant increase in sub-G.sub.1 events was observed when cells
were treated with (R,R')-Fen (1 .mu.M) for up to 24 hours.
[0272] Sub-G.sub.1 events occur when cells have proceeded to the
late stage of apoptosis or are already dead. To directly measure
apoptosis, flow cytometry analysis with Annexin V/PI staining was
carried out in HepG2 cells. The percentage of apoptotic cells
induced by a 24-hour treatment with (R,R')-MNF (1 .mu.M) increased
5.7-fold compared to the control (P<0.01). However, (R,R')-Fen
treatment markedly reduced apoptosis when compared to control
untreated cells (FIG. 5).
[0273] Role of Cannabinoid Receptors in the Control of Cell
Proliferation of (R,R')-MNF and (R,R')-Fen.
[0274] Whether the regulation of mitogenesis in response to
(R,R')-Fen and (R,R')-MNF occurs through cannabinoid receptor
signaling mechanisms was examined. The mRNA levels of CB1R and CB2R
were determined by RT-PCR in HepG2, 1321N1 and U87MG cells (FIG.
6A, primers provided below in Table 2). The results indicated that
HepG2 and U87MG cells expressed CB1R and CB2R, whereas 1321N1 cells
had no detectable levels of CBR mRNAs. Potent regulatory effects of
synthetic cannabinoid compounds were observed in cells treated with
(R,R')-Fen and (R,R')-MNF as compared with controls. Similar to
(R,R')-MNF, treatment of HepG2 cells with the cannabinoid receptor
agonist, WIN55,211-1 (1 .mu.M), reduced cell proliferation and
canceled out the growth-promoting action of fenoterol (FIG. 6B).
AM251 and AM630 are synthetic inverse agonists for CB1R and CB2R,
respectively. Cell pretreatment with AM251 or AM630 had no impact
on the mitogenic responses of (R,R')-Fen (FIG. 6C), indicating that
basal-level activity of these two cannabinoid receptors does not
play a major role in the proliferative action of (R,R')-Fen.
However, preincubation with AM251 or AM630 completely inhibited the
anti-proliferative effects of (R,R')-MNF in HepG2 cells (FIG. 6C),
which is consistent with the involvement of cannabinoid receptors
in (R,R')-MNF signaling. In support of this hypothesis, 1321N1
cells, which are (R,R')-MNF unresponsive, were refractory to
cannabinoid receptor ligands when added alone or combined with
(R,R')-Fen (FIGS. 8A and 8B). However, the anti-proliferative
effects of MNF were partially blocked by AM251 and AM630 in the
.beta..sub.2-AR-deficient, MNF responsive U87MG cells (FIGS. 8C and
8D).
TABLE-US-00002 TABLE 2 List of PCR primers and assay conditions.
Each of the references listed in the below Table is hereby
incorporated by reference in its entirety. Initial Final Human Gene
Primers Denaturation Denaturation Annealing Extension extension CB1
F: 95.degree. C./5 min 94.degree. C./30 sec 57.degree. C./30 sec
72.degree. C./1 min 72.degree. C./5 min (SEQ ID NOs:
5'-CGTGGGCAGCCTGTTCCTCA 1 and 2, R: resp.) 5'-CATGCGGGCTTGGTCTGG
CB2 F: 95.degree. C./5 min 94.degree. C./30 sec 57.degree. C./30
sec 72.degree. C./1 min 72.degree. C./5 min (SEQ ID NOs:
5'-CGCCGGAAGCCCTCATACC 3 and 4) R: CCTCATTCGGGCCATTCCTG GAPDH F:
94.degree. C./4 min 94.degree. C./1 min 53.degree. C./1 min
72.degree. C./1 min 72.degree. C./10 min (SEQ ID NOs:
5'-ACCACAGTCCATGCCATC 5 and 6, R: resp.) 5'-TCCACCACCCTGTTGCTG
.beta.2AR F: 94.degree. C./6 min 94.degree. C./1 min 58.degree.
C./30 sec 72.degree. C./1 min 72.degree. C./5 min (SEQ ID NOs:
5'-CATGTCTCTCATCGTCCTGG 7 and 8, CCA resp.) R:
5'-CACGATGGAAGAGGCAATGG CA
[0275] The present Example demonstrates that treatment of HepG2
cells with (R,R')-Fen led to increased cellular proliferation. ICI
118,551 blocked this effect indicating the involvement of
.beta..sub.2-ARs. However, neither (R,R')-Fen- or isoproterenol
induced formation of cAMP in HepG2 cells, although treatment with
forskolin demonstrated that the cells expressed functional
adenylate cyclase (FIG. 1). These results support two possibilities
to explain the lack of effect of .beta..sub.2-AR agonists on cAMP
accumulation: either the .beta..sub.2-ARs are at a low enough level
that they do not significantly increase cAMP, or the
.beta..sub.2-ARs in the HepG2 cell line are poorly coupled to the
stimulatory G.alpha. protein and suggest potential interactions
with other signaling intermediates that promote cell growth. The
present results demonstrate that treatment of HepG2 cells with
(R,R')-Fen or isoproterenol activated the PI3-kinase/Akt and ERK
pathways.
[0276] Previous studies on the effect of the stereochemistry of Fen
on .beta..sub.2-AR-associated stimulation of cAMP accumulation and
inhibition of mitogenesis in 1321N1 cells have demonstrated that
changes in the spatial configurations at the molecule's two chiral
centers produces only quantitative changes in these properties. A
similar effect of stereochemistry was observed in the HepG2 cells
as all of the Fen stereoisomers produced an increase in
[.sup.3H]-thymidine incorporation (reported as % change) with
(R,R')>>(S,R').apprxeq.(R,S')>>(S,S') (Table 1). The
effect of structural changes in the (R,R')-Fen molecule was
investigated by increasing the steric bulk at the chiral center on
the N-alkyl portion of the molecule, (R,R')-ethylFen, and by
changing the hydrogen bonding properties of the 4'-substituent,
(R,R')-aminoFen. Both analogs increased [.sup.3H]-thymidine
incorporation in HepG2 cells to the same extent as (R,R')-Fen
(Table 1 and FIG. 2A), suggesting that when the Fen molecule
contains a 4'-substituted phenyl ring, the compound stimulates
[.sup.3H]-thymidine incorporation in HepG2 cells and that the
stereochemistry of the molecule influences this effect, but does
not qualitatively change it. A full structure-activity relationship
study has been initiated and the results will be reported
elsewhere.
[0277] The inventors demonstrated that naphthylfenoterol (NF)
analogs of Fen produced by the substitution of a naphthyl moiety
for the phenyl ring on the N-alkyl portion are full and potent
.beta..sub.2-AR agonists with respect to the stimulation of cAMP
expression in HEK cells stably transfected with .beta..sub.2-AR
(HEK-.beta..sub.2-AR); for example, EC.sub.50cAMP of (R,R')-1-NF
and (R,R')-MNF were 12.5 and 3.9 nM, respectively. As was observed
with (R,R')-Fen, (R,R')-1-NF and (R,R')-MNF also inhibited
mitogenesis in 1321N1 cells although the IC.sub.50 values were
.gtoreq.10-fold higher than (R,R')-Fen (Toll et al., J Pharmacol
Exp Ther 336:524-32, 2011). A similar quantitative effect was
expected when HepG2 cells were incubated with (R,R')-1-NF and
(R,R')-MNF, that is, a weaker stimulation of [.sup.3H]-thymidine
incorporation. However, a qualitative different effect was observed
as (R,R')-MNF and (R,R')-1-NF inhibited [.sup.3H]-thymidine
incorporation with IC.sub.50 values of 0.39.+-.0.09 .mu.M and
0.21.+-.0.07 .mu.M, respectively (Table 1 and FIG. 2B). In
addition, unlike Fen, a change in the stereochemistry of the chiral
center on the N-alkyl portion of the MNF molecule had no effect on
the anti-proliferative response (Table 1).
[0278] Since the Fen and NF analogs used in this study are
.beta..sub.2-AR agonists, a potential explanation for the effect
produced by the substitution of a naphthyl ring for a phenyl ring
is "ligand-directed signaling" or "biased agonism." It has been
demonstrated that the .beta..sub.2-AR binds ligands in multiple
conformations and that binding to different receptor conformations
can lead to differences in signal transduction. In respect to the
Fen and NF molecules, initial Comparative Molecular Field Analysis
(CoMFA) studies of the interaction of the Fen analogs with the
.beta..sub.2-AR have indicated that the naphthyl substituent of the
NFs molecules can interact with the .beta..sub.2-AR through a
series of .pi.-.pi. and .pi.-hydrogen bond interactions unavailable
to the phenyl moiety on the Fen molecule. However, the direct
association of the binding of the NF analogs and the decrease in
[.sup.3H]-thymidine incorporation appears doubtful as the selective
pharmacological .beta..sub.2-AR antagonist, ICI 118,551, failed to
block the anti-proliferative action of (R,R')-MNF (FIG. 3) and
treatment of the .beta..sub.2-AR-negative U87MG cells with
(R,R')-MNF causes a marked reduction in cell growth while
(R,R')-Fen had no effect (FIG. 7). This data does not eliminate the
possibility that NFs bind to and stabilize a conformation of the
.beta..sub.2-ARs expressed in HepG2 cells that is distinct from the
conformation stabilized by (R,R')-Fen, but it suggests that if this
occurs it does not result in the initiation of a downstream
signaling cascade that effects cellular growth.
[0279] Pharmacological evidence disclosed herein indicates that
(R,R')-MNF mediates its anti-proliferative effects through
activation of the CB receptors. On one hand, this action of
(R,R')-MNF was reproduced by WIN 55,212-2 in HepG2 and U87MG cells,
and the combination (R,R')-MNF plus WIN 55,212-2 showed a lack of
additive effect. On the other hand, selective inhibition of the CB1
and CB2 receptors showed suppression of (R,R')-MNF signaling. The
finding of a lack of effect of the WIN 55,212-2-mediated actions on
cell growth in 1321N1 cells may be explained by there being
substantially more CBR expression in HepG2 and U87MG cell lines
than in 1321N1 cells. Moreover, the present results demonstrate
that the (R,R')-Fen-mediated increase in HepG2 cell proliferation
was neutralized by WIN 55,212-2, possibly indicating that
stimulation of G.sub.i-linked CBRs in response to WIN 55,212-2
inhibits cell growth primarily by negatively targeting the
PI3-kinase/Akt and/or ERK pathways. Taken together, these findings
indicate a complex cell type-specific involvement of CB receptors
in the anti-mitogenic and proapoptotic activities of (R,R')-MNF
through a mechanism that does not require .beta..sub.2-AR
activation.
Example 3
Characterization of Cannabinoid Receptor Modulation
[0280] This example describes a series of studies performed to
further characterize the ability of fenoterol and disclosed
fenoterol analogs to modulate cannabinoid receptor activity.
[0281] To identify the type of CB receptor mediating the
(R,R')-MNF-induced response, the effect of MNF on TocriFluor 1117
(T1117, Tocris Bioscience) uptake in HepG2 cells was evaluated.
T1117 is a fluorescent form of the cannabinoid CB1 receptor inverse
agonist AM251, which binds GPR55 with high affinity, but has modest
binding with CB1 receptors and no interaction with CB2 receptors.
HepG2 cells were incubated with fenoterol (1 .mu.M), MNF (1 .mu.M)
or AM251 (10 .mu.M) for 1 hour followed by addition of T1117 (0.1
.mu.M). As illustrated in FIG. 9, T1117 uptake was dramatically
reduced in cells treated with MNF or AM251 prior to T1117 as
compared to either vehicle or fenoterol. These studies indicate
that the MNF is capable of modulating GPR55.
Example 4
In Vitro Metabolic Stability of MNF
[0282] This example describes the metabolic stability of MNF on
human and rat liver microsomes.
[0283] FIG. 10 presents the data from the in vitro metabolic
stability study in which MNF was incubated (in duplicate) with
active and heat-inactivated human (HLM) and rat (RLM) liver
microsomes and cofactors at 37.degree. C. Aliquots were removed at
0, 15, 30 and 60 minutes and the amount of test compound (MNF)
remaining at each time point was determined by LC-MS/MS. Although
the results indicated that MNF is somewhat unstable under the
incubation conditions, based on the decrease in concentration in
the heat-inactivated microsome controls, the results show a greater
decrease in MNF levels when incubated with rat and human liver
microsomes.
[0284] FIG. 11 demonstrates the results from the co-incubation of
MNF, 1 or 10 .mu.M, with a cocktail of model CYP substrates, human
liver microsomes and CYP cofactors for 20 minutes at 37.degree. C.
Incubations containing known CYP inhibitors were also included as
positive controls. Formation of the model substrate metabolites was
measured by LC-MS/MS and compared to control incubations
(incubation of substrates with microsomes and cofactors, no test
articles or inhibitors). CYP activity in presence of test compound
(MNF) that was less than 70% of control was considered significant.
MNF (10 .mu.M) inhibited CYP2D6 and CYP3A4 to less than 70% of the
control. Further, the primary metabolite was determined to be
O-demethylated-MNF. These studies indicate that MNF alters the
metabolism of other drugs or endogenous compounds that are
substrates for CYP2D6 and/or CYP3A4 isoforms, when present in the
plasma or liver at 10 .mu.M or higher.
Example 5
In Vivo Distribution and Clearance after IV Administration
[0285] To determine plasma and brain tissue concentrations of MNF,
the concentrations of MNF and its metabolites in plasma and brain
tissue samples obtained from male Sprague-Dawley rats were
determined after administration of a single IV dose of 10 mg/kg of
MNF. The assays were conducted using an Eclipse XDB-C.sub.18 guard
column (4.6 mm.times.12.5 mm) and an Atlantis HILIC column
(150.times.2.1 mm ID, 5 mm). The mobile phase consisted of water
containing 0.1% formic acid as Component A and acetonitrile as
component B. A linear gradient was run as follows: 0 minutes 95% B;
5 minutes 60% B; 6 minutes 80% B; 10 minutes 95% B at a flow rate
of 1.0 ml/minutes. The total run time was 15 minutes per sample.
Identification and quantification of the analytes was accomplished
using an API-4000 LC-MS/MS in positive electrospray ionization mode
and data was acquired employing multiple reaction monitoring (MRM)
and the following MRM transitions: MNF(369-200); MNF-Gluc
(545-200).
[0286] FIG. 12 illustrates the analysis of a plasma sample obtained
30 minutes post-IV administration of 10 mg/kg MNF. In the insert of
FIG. 12, MNF and Gluc-MNF are shown with no interfering peaks being
present in the control plasma matrix. FIG. 13 illustrates the
analysis of brain tissue obtained 30 minutes post-IV administration
of 10 mg/kg MNF. The peak at 6.39 minutes is an unidentified
compound present in control brain matrix (see insert of FIG. 13).
FIG. 14 is a MNF time-course in plasma and brain of Sprague-Dawley
male rats and the calculated pharmacokinetic parameters are
presented in Table 3 below.
TABLE-US-00003 TABLE 3 Calculated pharmacokinetic parameters for
MNF time-course in plasma and brain. AUC.sub.last AUC.sub.inf Cl
Rat t.sub.1/2 (hr) C.sub.max (ng/ml) C.sup.0 (ng/ml) (hr ng/ml) (hr
ng/ml) V (l/kg) (ml/hr/kg) 1 9.8 1780.7 3033.4 3582.2 4103.6 34.3
2436.9 2 18.6 2304.9 4131.4 4070.7 5335.2 50.4 1874.4 3 13.0 1383.4
2340.7 2905.1 3695.2 50.6 2706.2 Mean 13.8 1823.0 3168.5 3519.3
4378.0 45.1 2339.1 SD 4.5 462.2 903.0 585.3 853.7 9.4 424.5
Abbreviations Elimination phase half life = t.sub.1/2; maximum
plasma concentration observed = C.sub.max; plasma concentration
extrapolated to time 0 = C.sup.0; area under the plasma versus time
curve to last time point and extrapolated to infinity =
AUC.sub.last, AUC.sub.inf; apparent volume of distribution = V;
whole body clearance = Cl.
[0287] Ten mg/kg MNF was administered IV to male Sprague-Dawley
rats and the plasma concentrations of MNF were determined between
10 minutes and 24 hours post administration with the levels
measured in 3 animals per time point. In the same study, the
concentration of MNF in brain tissue was measured between 10 and 60
minutes after administration with 3 animals per time point. The MNF
concentration in brain tissue was 200 ng/mg tissue at 10 minutes
after administration and peaked at 30 minutes at 800 ng/mg tissue.
The relative distribution between the concentration of MNF in blood
(measured as ng/ml) and brain tissue (measured as ng/mg tissue) was
0.2 at 10 minutes and 1.0 at 30 minutes and 60 minutes reflecting
an equivalent distribution between both the central and peripheral
body compartments. This analysis indicates that significant levels
of the drug can be quantified in the brain tissue 10 minutes after
administration and that the concentration peaks at 30 minutes after
dosing, at which time it parallels the plasma concentration and
that at 60 minutes, the brain tissue concentration continues to
parallel the plasma concentration. Further, the apparent volume of
distribution (V) is high indicating extensive tissue
distribution.
[0288] These studies demonstrate that MNF is capable of passing
through the blood brain barrier and that administration of such
compound as well as likely other related fenoterol analogues and/or
fenoterol by IV is an effective means of delivering these compounds
to the brain, such as to treat a brain tumor regulated by CB
receptor activity.
Example 6
MNF has No Significant Negative Effects on Central Nervous System
Function
[0289] This example demonstrates that MNF has no significant
negative effects on central nervous system function.
[0290] A single dose escalation study was performed to select dose
levels for 7-day repeat dose study with IV administration in
Sprague-Dawley rats. Dose levels were 0, 5, 10 and 25 mg/kg. Toxic
effects were minimal in this study (see Tables 4 and 5 below).
TABLE-US-00004 TABLE 4 7-Day Repeat Dose Range Finding Study of MNF
in Sprague-Dawley rats. Endpoints: body weight change; clinical
observations; clinical pathology; gross necropsy; and
histopathology. Number of Dose Dose Dose Number of Animals Test
Level Volume Concentration.sup.b Animals Main Recovery Article
Vehicle (mg/kg) (ml/kg) (mg/ml) Groups.sup.a Groups.sup.a MNF 0.9%
Sodium Chloride 0 5 0 3 M/3 F 3 M/3 F for Injection, USP SRI-12838
0.9% Sodium Chloride 2.5 5 0.5 3 M/3 F 3 M/3 F for Injection, USP
SRI-12838 0.9% Sodium Chloride 10 5 2 3 M/3 F 3 M/3 F for
Injection, USP SRI-12838 0.9% Sodium Chloride 25 5 5 3 M/3 F 3 M/3
F for Injection, USP
TABLE-US-00005 TABLE 5 Evaluation of MNF study shown in Table 4.
Species/ Clinical Gross Necropsy Strain Study Design.sup.a Body
Weight.sup.b Observation.sup.c Clinical Pathology.sup.d
Observation.sup.e Histopathology Rat/ Escalation: Body weight for
Slight Increases: ~2-fold Discolored red: Evaluation Sprague 0,
2.5, 5, 10, or treated rats was hypoactivity: WBC, % Neut, thymus,
in progress Dawley 25 mg/kg comparable all treated rats % RET/REA,
and mandibular lymph 7-Day: with control post dose PLC node 0.5,
10, or animals Necrosis: Discolored black 25 mg/kg/day high-dose or
necrosis: tail .sup.aDosing regimen (5 ml/kg in 0.9% saline):
single intravenous (iv) injection via the lateral tail vein
(escalation study); single daily iv dose with a 7 day recovery
period (7-day study) .sup.bBody weight collected: Day 1 for
escalation dose calculation; Day 1, Day 3, and Day 8 (Main and
Recovery) and Day 14 (Recovery) for 7-day repeat study.
.sup.cObservations seen during 7-Day repeat study: performed daily;
hypoactivity observed ~5 minutes post-dose and subsided ~1 hour
post-dose; necrosis observed at injection site for males and
females. .sup.dHematology and clinical chemistry evaluations
performed Day 8 and Day 14; increases seen in high-dose males and
females at interim and terminal sacrifice appear to be associated
with necrosis at dose site. .sup.eObservations seen at interim (Day
8) and terminal (Day 14) time points.
[0291] Additional studies were performed which further evaluated
the effect of MNF on central nervous system functions. In these
studies, MNF was found to not have any significant negative effects
on the central nervous system (FIG. 15) as compared to
tetrahydrocannabinol (FIG. 16).
Example 7
(R,R')-MNF and (R,R')-4-Methoxyfenoterol (MF) are Potent Inhibitors
of Liver, Colon and Lung Cancer Cell Growth
[0292] This example demonstrates that (R,R')-MNF and
(R,R')-4-methoxyfenoterol (MF) are potent inhibitors of liver,
colon, and lung cancer cell growth.
[0293] The effect of (R,R')-MF and (R,R')-MNF on the growth of a
variety of tumor cells was evaluated. An IC.sub.50 value of less
than 30 .mu.M was considered to be an effective inhibitor of tumor
cell growth whereas an IC.sub.50 value of less than 50 .mu.M
indicates potential activity. As illustrated in Tables 6 and 7
below, MNF was a potent inhibitor of liver cancer cell growth, lung
cancer cell growth, colon cancer cell growth, prostate cancer cell
growth, CNS cancer cell growth, and non-small cell lung cancer
(NSCLC)
[0294] These studies indicate that MNF and MF are capable of
inhibiting additional types of cancer growth, including liver, lung
and colon cancer. One of skill in the art will appreciate that they
also provide support for using other fenoterol analogues (such as
other naphthylfenoterol analogues), to reduce tumor growth,
including treating cancer, such as liver, lung and colon cancer, in
additional subjects, including humans.
TABLE-US-00006 TABLE 6 Effect of MNF and MF on various tumor cells.
IC50 (uM) seeding In vivo RR- T3 # Type Name n/well imaging RR-MF
MNF Doxorubicin % CV T3/T0 None CNS 1 Pancreatic CAPAN 750 N.E Not
0.23 5.16 1.71 added C Regress. 2 Pancreatic PANC-1 1125 N.E. 33.38
2.97 12.69 1.73 C 3 Liver C HEPG2 750 Caliperls N.E. 28.82 0.28
7.68 3.11 4 Liver C HEP3B 750 >50 uM 14.71 0.43 4.55 2.42 NCI60
5 Prostate C Du-145 750 >50 uM 34.76 0.38 3.34 4.39 Subpanel 6
Prostate C PC3 1125 >50 uM 28.06 0.91 2.18 4.08 7 Breast C MCF7
2250 N.E. 37.19 0.30 3.23 2.51 8 Breast C MDAMB231 1500 SRI stock
N.E. 33.23 0.68 3.28 3.94 9 NSCLC H460 750 >50 uM 11.59 0.02
2.90 12.78 10 NSCLC A549 750 >50 uM 23.14 0.11 3.27 7.96 11
Colon C HT29 375 >50 uM 10.71 0.26 5.85 12.46 12 Colon C HCT116
375 >50 uM 12.91 0.06 5.75 10.87 13 CNS U251 375 N.E. 26.67 0.17
2.48 4.47 CNS 14 CNS U87 1125 Caliperls N.E. 25.72 0.21 10.16 3.71
Panel 15 CNS GL261 375 Caliperls N.E.? 21.32 0.17 7.54 4.61 16 CNS
LN-18 1125 N.E.? 29.74 0.53 2.76 6.25 17 CNS A172 750 ? N.E.? 30.48
0.46 5.08 2.77 18 CNS LN-229 750 ? >50 uM 26.77 0.61 2.23 3.90
19 CNS U118 1125 ? >50 uM 37.04 0.81 2.66 2.43 20 CNS 1321N 1125
? TBD TBD TBD TBD TBD
TABLE-US-00007 TABLE 7 Effect of MNF and MF on various tumor cells.
IC50 (uM) Name seeding n/well RR-MF RR-MNF Doxorubicin VcCV
Tr/Tz.sup.a Note HEP3B 750 >50 uM 14.71 0.43 4.55 2.42 384 well
CTG 3 days treatment + 1 (Liver Cancer) >50 uM 12.14 0.35 8.65
2.22 384 well CTG 3 days treatment + 2 4275 >50 uM 13.53 0.52
6.56 1.74 96 well CTG 2 days treatment 2.35 10.03 0.02 13.38
NA.sup.b 96 well Thy 2 days treatment >50 uM 28.30 NF.sup.c 4.40
1.19 96 well CTG 1 day treatment 2.40 10.69 0.04 14.66 NA.sup.b 96
well Tye 1 day treatment PC3 1125 >50 uM 28.06 0.91 2.18 4.08
384 well CTG 3 days treatment + 1 (Prostate 6412.5 >50 uM 20.36
0.93 3.10 5.89 96 well CTG 2 days treatment Cancer) >50 uM 10.84
0.28 13.74 NA.sup.b 96 well Thy 2 days treatment >50 uM 34.51
3.02 4.52 2.66 96 well CTG 1 day treatment >50 uM 10.95 0.04
9.16 NA.sup.b 96 well Tye 1 day treatment NCIH460 750 >50 uM
11.59 0.02 2.90 12.78 384 well CTG 3 days treatment + 1 (NSCLC)
>50 uM 17.68 0.11 3.10 9.71 384 well CTG 3 days treatment + 2
4275 >50 uM 15.40 0.12 7.82 5.26 96 well CTG 2 days treatment
>50 uM 21.03 0.03 17.96 NA.sup.b 96 well Thy 2 days treatment
>50 uM 38.92 0.31 3.10 1.30 96 well CTG 1 day treatment >50
uM 25.08 0.09 16.10 NA.sup.b 96 well Tye 1 day treatment HCT116 375
>50 uM 12.91 0.05 5.75 10.87 384 well CTG 3 days treatment + 1
(Colon Cancer) >50 uM 12.20 0.21 5.39 13.13 384 well CTG 3 days
treatment + 2 2137.5 >50 uM 10.54 0.23 6.01 8.30 96 well CTG 2
days treatment >50 uM 10.97 0.14 6.79 NA.sup.b 96 well Thy 2
days treatment >50 uM 18.96 0.21 5.34 2.15 96 well CTG 1 day
treatment >50 uM 23.75 0.12 9.90 NA.sup.b 96 well Tye 1 day
treatment HT29 375 >50 uM 10.71 0.26 5.85 12.46 384 well CTG 3
days treatment + 1 (Colon Cancer) 2137.5 >50 uM 11.65 0.52 8.63
6.11 96 well CTG 2 days treatment >50 uM 19.57 0.12 44.53
NA.sup.b 96 well Thy 2 days treatment >50 uM 30.40 NF.sup.c 3.84
1.56 96 well CTG 1 day treatment >50 uM 12.98 0.11 17.05
NA.sup.b 96 well Tye 1 day treatment LN229 750 >50 uM 26.77 0.61
2.23 3.90 384 well CTG 3 days treatment + 1 (CNS Cancer) 4275
>50 uM 15.69 1.70 1.80 2.20 96 well CTG 2 days treatment >50
uM 10.37 0.07 12.20 NA.sup.b 96 well Thy 2 days treatment >50 uM
29.32 NF.sup.c 2.70 1.37 96 well CTG 1 day treatment >50 uM 9.64
0.10 12.09 NA.sup.b 96 well Tye 1 day treatment VcCV Percent
Variance of control wells on day of reading Tr/Tz.sup.a cell growth
measured by comparing control wells before and after compound
treatment; NA.sup.b not applicable NF.sup.c no optimum fitting
Example 8
Antitumor Activity of (R,R')-4-Methoxy-1-Naphthylfenoterol in a Rat
C6 Glioma Xenograft Model in the Mouse
[0295] This example demonstrates antitumor activity of MNF in a rat
C6 glioma xenograft model in the mouse.
[0296] (R,R')-4-methoxy-1-naphthylfenoterol (MNF) inhibits in vitro
proliferation of several types of cancer cell lines. In this
example, the in vivo antitumor effects of MNF were evaluated using
rat C6 glioma cells implanted subcutaneously into the lower flank
of 5 week-old NMRI/Nude female Swiss mice. Three days after the
inoculation, the mice were subjected to intraperitoneal injections
of saline or MNF (2 mg/kg) for five days per week for two weeks.
Tumor volumes were measured everyday using slide calipers. At the
end of the study, animals were sacrificed and tumors were collected
for cDNA microarray, quantitative RT-PCR and immunoblot analyses.
Significant reduction in mean tumor volumes was observed in mice
receiving MNF when compared with the saline-treated group
(p<0.001, n=17-19). Clusters in expression of genes involved in
cellular proliferation were identified, as well as molecular
markers for glioblastoma that were significantly downregulated in
tumors of MNF-treated mice as compared to saline-injected controls.
The efficacy of MNF against C6 glioma cell proliferation in vivo
and in vitro was accompanied by marked reduction in the expression
of cell cycle regulator proteins. This study is the first
demonstration of MNF-dependent chemoprevention in a glioblastoma
xenograft model and provides a mechanism for its anticancer action
in vivo.
[0297] Materials and Methods
[0298] Materials.
[0299] (R,R')-4-methoxy-1-naphthylfenoterol (MNF) was synthesized
as described herein and previously (Jozwiak et al., J Med Chem
50:2903-2915, 2007; Jozwiak et al., Bioorg Med Chem 18:728-736,
2010; each of which is incorporated by reference in its entirety).
Dulbecco's modified Eagle Medium (DMEM), trypsin solution,
phosphate-buffered saline (PBS), fetal bovine serum (FBS),
100.times. solution of L-glutamine (200 mM), and
penicillin/streptomycin (a mixture of 10,000 units/ml penicillin
and 10,000 .mu.g/ml streptomycin) were obtained from Quality
Biological (Gaithersburg, Md., USA).
[0300] Cell culture.
[0301] The rat-derived C6 glioma cell line was obtained from the
American Type Culture Collection (Manassas, Va.). The cells were
routinely maintained in DMEM supplemented with L-glutamine, 1%
penicillin/streptomycin solution, and 10% FBS in a humidified CO2
incubator at 37.degree. C.
[0302] 3H-Thymidine incorporation.
[0303] C6 glioma cells were seeded in 12-well plates at
.about.5.times.104 cells/well and incubated for 24 hours followed
by a second 24-hour incubation with various concentrations of MNF.
Radiolabeled thymidine (10 Ci/mmol; PerkinElmer Life and Analytical
Sciences, Waltham, Mass.) was added at 1 .mu.Ci per well for 16
hours and its incorporation into DNA was then measured. Each
treatment group was performed in triplicate and three independent
studies were carried out.
[0304] C6 tumor xenograft in mice.
[0305] In order to assess the ability of MNF to induce regression
of tumor growth in vivo, rat C6 glioma cells were trypsin-collected
at confluency and were used to generate tumor xenografts. Athymic
female nude mice (SWISS nu+/nu+) were obtained from Charles Rivers
(L'Arbresle, France) and maintained under pathogen-free conditions
with a 12 hours light/12 hours dark cycle. Animals were fed ad
libitum with normal chow (supplier). Athymic nude mice were
inoculated subcutaneously with 100 .mu.l of culture medium
containing 0.5.times.106 C6 glioma cells in the left flank and then
were randomly divided into two groups of 10 animals each. Starting
3 days after cell inoculation, mice received daily intraperitoneal
injection (10 .mu.lg-1 body weight) of vehicle or MNF (2 mgkg-1) in
100 .mu.M ascorbic acid in saline (vehicle) five days a week for 19
days. Animal survival was monitored daily, and tumor size was
determined with the use of a caliper to measure the length (a) and
width (b) and estimated as 4/3.pi..times.r12.times.r2, where r1 is
the smaller and r 2 the larger radius. The mice were monitored up
to 19 days after MNF injection or euthanized earlier if the tumor
size was superior to 2 cm3 or the mouse was lethargic, sick and
unable to feed, which caused the body weight to drop below 20% of
initial weight. The mice were euthanized by cervical extension, and
tumor masses were removed, weighed and washed with cold PBS before
being snap-frozen in liquid nitrogen. A second set of studies with
8-9 animals in both groups was repeated.
[0306] Evaluation of MNF accumulation in vivo in C6 glioma
tumors.
[0307] The accumulation of MNF in vivo in C6 tumor xenografts in
athymic mice was assessed in comparison with vehicle-treated
tumor-bearing animals. The frozen tumor samples were thawed, and
then homogenized. The concentration of MNF and its metabolites was
determined by HPLC followed by LC-MS/MS. In brief, the assays were
conducted using an Eclipse XDB-C18 guard column (4.6 mm.times.12.5
mm) and an Atlantis HILIC column (150.times.2.1 mm ID, 5 mm). The
mobile phase consisted of water containing 0.1% formic acid as
component A and acetonitrile as component B. A linear gradient was
run as follows: 0 minutes 95% B; 5 minutes 60% B; 6 minutes 80% B;
10 minutes 95% B at a flow rate of 1.0 ml/minute. The total run
time was 15 minutes per sample. Identification and quantification
of the analytes was accomplished using an API-4000 LC-MS/MS in
positive electrospray ionization mode and data was acquired
employing multiple reaction monitoring (MRM) and the following MRM
transitions: MNF (369-200); MNF-Gluc (545-200). Tumor tissues from
vehicle-injected mice were used as controls.
[0308] Analysis of Gene Expression in Rat C6 Glioma Xenografts.
[0309] Total RNA was isolated from rat C6 glioma xenografts
harvested from vehicle and MNF-treated mice (n=3 per group, cohort
1). This analysis was repeated in a second cohort of animals (n=3
per group, cohort 2). Total cellular RNA was extracted using an
RNeasy plus mini kit (QIAGEN, Valencia, Calif.), and its quality
was assessed using an Agilent BioAnalyzer using RNA 6000 Nano Chips
(Agilent Technologies, Santa Clara, Calif.). Transcriptional
profiling was determined using Illumina Sentrix BeadChips
(Illumina, San Diego, Calif.). Total RNA was used to generate
biotin-labeled cRNA with the Illumina TotalPrep RNA Amplification
Kit. In short, 0.5 ug of total RNA was first converted into
single-stranded cDNA with reverse transcriptase using an oligo-dT
primer containing the T7 RNA polymerase promoter site and then
copied to produce double-stranded cDNA molecules. The
double-stranded cDNA was cleaned and concentrated with the supplied
columns and used in an overnight in-vitro transcription reaction
where single-stranded RNA (cRNA) was generated incorporating
biotin-16-UTP. A total of 0.75 .mu.g of biotin-labeled cRNA was
hybridized at 58.degree. C. for 16 hours to Illumina's Sentrix Rat
Ref-12 Expression BeadChips. Each BeadChip has .about.22,000
well-annotated RefSeq transcripts with approximately 30-fold
redundancy. The arrays were washed, blocked and the labeled cRNA
was detected by staining with streptavidin-Cy3. Hybridized arrays
were scanned using an Illumina BeadStation 500X Genetic Analysis
Systems scanner and the image data extracted using IIlumina's
GenomeStudio software, version 1.6.1. For statistical analysis, the
expression data were filtered to include only probes with a
consistent signal on each chip and an Illumina detecton p
value<0.02.
[0310] Correlation analysis, sample clustering analysis and
principal component analysis was performed to identify/exclude any
possible outliers. The resulting dataset was next analyzed with
DIANE 6.0, a spreadsheet-based microarray analysis program using
value statistics for Z-Score reliability below 0.05; and mean
background-corrected signal intensity greater than zero.
[0311] Gene set enrichment analysis use gene expression values or
gene expression change values for all of the genes in the
microarray. Parametric analysis of gene set enrichment (PAGE) was
used using the WEB-PAGE GSA tool for gene set analysis. Gene Sets
include the MSIG database, Gene Ontology Database, GAD human
disease and mouse phenotype gene sets were used to explore
functional level changes. Gene-gene interaction was also analyzed
using the INGENUITY.RTM. Pathway Analysis (IPA) system
(INGENUITY.RTM. Systems).
[0312] Total RNA Extraction, cDNA Synthesis and qRT-PCR
Analysis.
[0313] Total RNA (including the DNase treatment step) was isolated
from frozen tumor tissues using the RNeasy mini kit (Qiagen,
Valencia, Calif.). RNA concentration and quality was measured using
the NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington,
Del.). Subsequently, 2 .mu.g total RNA was reverse-transcribed to
cDNA using the qSCRIPT.TM. cDNA SuperMix (Quanta Biosciences,
Gaithersburg, Md.). Quantitative real-time PCR (qRT-PCR) reactions
were performed to validate the expression of 6 genes that were
selected from the microarray analysis. The reactions were carried
out with SYBR.RTM. Green PCR master mix on an ABI Prism 7300
sequence detection system (Applied Biosystems) using commercially
available target probes for Sox4, Olig1, Galnt3, Cdkn3, Ccna2, and
Bub1b (PrimeTime qPCR Assays and Primers, IDT DNA Technologies,
Coralville, Iowa). The data was analyzed using the
2-.DELTA..DELTA.Ct method with Gapdh and vehicle-treated tumors as
internal controls. Controls consisting of reaction mixture without
cDNA were negative in all runs.
[0314] Western Blot Analysis.
[0315] Frozen tumor tissues were lysed with radioimmune
precipitation buffer containing EGTA and EDTA (Boston BioProducts,
Ashland, Mass.) supplemented with a phosphatase inhibitor cocktail
(EMB-Calbiochem), and protease inhibitor cocktail (Sigma-Aldrich),
according to standard protocols. Equal amounts of protein from the
clarified lysates were separated by SDS-polyacrylamide gel
electrophoresis under reducing conditions (Invitrogen, Carlsbad,
Calif.), and electrotransferred onto polyvinylidene difluoride
membranes using the iBlot system (Invitrogen). Western blots were
performed according to standard methods, which involved blocking
the membrane in 5% non-fat milk, followed by sequential incubation
method with the primary antibody of interest and secondary antibody
conjugated with the enzyme horseradish peroxidase. The detection of
immunoreactive bands was performed by chemiluminescence using the
ECL Plus Western Blotting Detection System (GE Healthcare,
Piscataway, N.J.). Quantitation of the protein bands was done by
volume densitometry using ImageJ software (National Institutes of
Health, Bethesda, Md.). Primary antibodies used in this study were
raised against cyclin A (sc-751, 1:500 dilution; Santa Cruz
Biotechnology, Inc., Santa Cruz, Calif., USA), cyclin D1 (sc-8396;
1:500 dilution; Santa Cruz), and .beta.-actin (mouse; 1:10000
dilution; Abcam, Cambridge, Mass., USA). Detection of Hsp90 with a
monoclonal antibody (1:1000; Santa Cruz Biotechnology, Inc., Santa
Cruz, Calif.) was carried out to control for equal protein
loading.
[0316] Statistical Analysis.
[0317] Western blot data form both sets of tumor tissues were
analyzed together. The Shapiro-Wilk test was used to assess if the
values (protein expression levels) followed a Gaussian
distribution. Outliers were removed from further analysis as they
were preventing the population to pass the normality test. The
results from rat C6 cells in culture were analyzed using the
Student t-test. Repeated two-way analysis of variance (ANOVA) was
used to compare induction of changes as a function of time. Data
were expressed as means.+-.standard error of the mean (SEM) and
were considered significant when the p value was less than
0.05.
[0318] Results
[0319] MNF Reduces Tumor Cell Proliferation.
[0320] When cell proliferation assay was performed using the rat C6
glioma cell line, a potent growth inhibition was observed in
response to MNF with a IC.sub.50 of .about.1.0 nM (FIG. 18A). The
effect of the .beta.-AR agonists isoproterenol and Fen on cell
proliferation was compared to that of MNF in the absence and
presence of the selective .beta.2-AR blocker, ICI-118,551 (FIG.
18B). Both isoproterenol and Fen elicited weak 10-15% inhibition of
C6 cell growth when used at 20 nM, and the same concentration of
MNF caused a significant 54.3.+-.1.2% reduction in mitogenesis
(n=4, P<0.001). The addition of ICI-118,551 did not block the
antiproliferative effect of MNF while impeding isoproterenol and
Fen signaling (FIG. 18B). C6 glioma cells express both .beta.2-AR
and CB receptors, and the cellular actions of MNF have been
reported earlier to implicate CB receptor activity. Preincubation
with the CB1 receptor inverse agonist AM251 rendered C6 cells
refractory to the growth-inhibitory effect of MNF, while inhibition
of CB2 receptor with AM630 had minimal effect against MNF signaling
(FIG. 18C). These results indicate that the anti-proliferative
action of MNF occurs through CB1 receptor signaling. A coincident
change in cell morphology and nuclear condensation was observed in
MNF-treated C6 glioma cells, consistent with apoptosis (FIG.
18D).
[0321] MNF Reduces Tumor Growth In Vivo in a Rat C6 Glioma
Xenograft Model.
[0322] To determine whether MNF might have a therapeutic effect in
vivo, a rat C6 glioma xenograft model was developed in
immune-deficient mice. Tumor-bearing female nude mice were treated
intraperitoneally with MNF daily for 19 days. Significant reduction
in tumor volume was observed in MNF-treated animals compared with
the vehicle-treated group (P<0.008; FIG. 19A). These studies
were performed in a second independent cohort of mice, and showed
similar results (see FIG. 19B for combined results). Tumors were
excised after the last day of treatment and snap frozen in liquid
nitrogen for subsequent analyses.
[0323] Determination of MNF levels in vivo. At the completion of
the study, the tumors from the MNF-treated animals were assayed for
the tissue concentrations of MNF. The results indicated that
significant concentrations of MNF accumulated in the tumor tissues,
141.0.+-.52.5 ng/ml/g tissue (cohort 1, n=9) and 214.4.+-.65.5
ng/ml/g tissue (cohort 2, n=7), demonstrating that systemically
administered MNF reaches the proposed therapeutic target.
[0324] MNF Alters Gene Expression Profiling in C6 Glioma
Xenografts.
[0325] Global gene expression profiling by microarray analysis was
performed to identify groups of genes in C6 glioma xenografts whose
expression was altered upon MNF treatment as compared to
tumor-bearing vehicle-treated mice. Six independent biological
samples from two cohorts of animals were used in each group. After
normalization and processing of the microarray data, genes were
considered as differentially expressed if they showed an absolute
zratio of 1.5 or more between MNF and vehicle and had been assigned
an adjusted P value<0.05 and false discovery rate<0.3.
Principal component analysis (PCA) revealed a discriminating
pattern of significantly altered gene expression between MNF and
vehicle groups (FIG. 20A). Computational analysis of the datasets
derived from this study led to the identification of a number of
cell cycle-associated GO terms, such as "DNA replication", "Cell
cycle", "Mitosis" and "Cell division" that are likely involved in
the control of tumor growth during MNF treatment (Table 8). The
analysis of the overrepresented GO terms upon MNF treatment in the
xenograft transcriptome revealed significant negative regulation of
cell division-related genes together with those involved in control
of metabolism of nucleic acids. Using parameterized analysis of
gene set enrichment (PAGE), additional insight was provided into
regulated signaling pathways and biological processes affected by
MNF. From the collection of more than 308 gene sets, there were 55
gene sets whose expression levels were significantly altered by
MNF, with the majority of the gene sets (48/55) being
down-regulated (Table 10).
TABLE-US-00008 TABLE 10 MNF_Control, MNF_Control, MNF_Control,
cohort 1 cohort 2 combined cohorts PathwayName (Zscore) (P_value)
(fdr) (Zscore) (P_value) (fdr) (Zscore) (P_value) (fdr)
HIPPOCAMPUS_DEVELOPMENTAL.sub.-- 3.6731 0.0211 0.1456 10.3512
0.0020 0.0344 11.4209 0.0017 0.0282 POSTNATAL TARTE_MATURE_PC
3.6636 0.0129 0.1088 5.3293 0.0097 0.1023 6.8026 0.0004 0.0085
HDACI_COLON_BUT12HRS_UP 5.3212 0.0002 0.0053 3.6676 0.0035 0.0527
5.8481 0.0008 0.0962 HYPOPHYSECTOMY_RAT_DN 3.6187 0.0459 0.2249
3.9294 0.0170 0.1483 5.3951 0.0006 0.0144 HDACI_COLON_TSABUT_UP
4.1465 0.0080 0.0751 3.4480 0.0042 0.0608 5.2313 0.0010 0.0109
HDACI_COLON_BUT16HRS_UP 3.6723 0.0199 0.1426 3.4287 0.0072 0.0877
4.8024 0.0010 0.0176 HDACI_COLON_BUT24HRS_UP 3.0864 0.1878 0.1878
3.3154 0.0119 0.1209 4.4492 0.0010 0.0169 ATRBRCAPATHWAY -1.8815
0.0406 0.2138 -2.9977 0.0000 0.0000 -3.4407 0.0000 0.0002
GOLDRATH_HP -2.4433 0.0229 0.1518 -2.2875 0.0441 0.2766 -3.4750
0.0007 0.0141 BRENIANI_REPAIR -3.8568 0.0002 0.0052 -2.9453 0.0101
0.1094 -4.2370 0.0002 0.0048 REN_E2P1_TARGETS -2.9150 0.0121 0.1044
-3.5319 0.0026 0.0414 -4.4393 0.0008 0.0145
MOREAUX_TACI_HI_IN_PPC_UP -2.9881 0.0064 0.0635 -3.8456 0.0807
0.0154 -4.9180 0.0000 0.0009 LAMB_CYCLIN_D3_GLOCUS -2.8637 0.0360
0.2028 -4.3054 0.0000 0.0000 -5.0503 0.0000 0.0001 PODI_KO_OP
-3.9363 0.0052 0.0553 -4.3565 0.0064 0.0812 -5.1416 0.0007 0.0129
MOREAUX_TACI_HI_VS_LOW_DN -4.3725 0.0000 0.0011 -3.2936 0.0020
0.0034 -5.1872 0.0000 0.0000 F2F1_DNA_UP -3.6781 0.0008 0.0142
-4.4885 0.0804 0.0099 -5.4288 0.0000 0.0014
SHEPARD_CRASH_AND_BURN.sub.-- -3.9994 0.0035 0.0413 -4.0540 0.0139
0.1315 -5.5788 0.0009 0.0160 MUT_VS_WT_DN IRITANI_ADPROX_LYMPH
-5.1408 0.0007 0.0132 -3.3728 0.0787 0.2504 -5.7142 0.0004 0.0075
SHEPARD_GENES_COMMON_BW_CB_MO -4.0300 0.0067 0.0656 -4.3867 0.0259
0.1927 -5.7440 0.0019 0.0308 PFART_HISTONE_DN -3.5055 0.0408 0.2142
-5.2170 0.0902 0.0063 -5.7817 0.0001 0.0017
SHEPARD_BMBY_MORPHILINO_DN -4.3350 0.0022 0.0300 -4.7947 0.0100
0.1089 -6.0639 0.0002 0.0054 DAC_FIBRO_DN -4.4476 0.0007 0.0127
-4.9523 0.0007 0.0142 -6.4794 0.0000 0.0002 BBCA_PROGNOSIS_NEG
-3.2974 0.0377 0.2052 -5.4682 0.0000 0.0003 -6.5976 0.0000 0.0002
MANALO_HYPOXIA_DN -3.2723 0.0019 0.0268 -6.1956 0.0000 0.0000
-6.7155 0.0000 0.0000 LEE_TCELLS2_UP -4.1051 0.0020 0.0282 -5.6671
0.0000 0.0006 -6.9464 0.0000 0.0000 KENNY_WNT_UP -4.0135 0.0093
0.0858 -5.5586 0.0000 0.0000 -6.9481 0.0000 0.0000
STEMCELL_NEURAL_UP -6.0983 0.0000 0.0001 -5.0064 0.0000 0.0010
-7.2833 0.0000 0.0000 SASAKI_ATL_UP -5.0963 0.0000 0.0019 -5.5299
0.0000 0.0005 -7.2897 0.0000 0.0000 SASAKI_TCELL_LYMPHOMA_VS_CD4_UP
-5.0963 0.0000 0.0010 -5.5299 0.0000 0.0005 -7.2897 0.0000 0.0000
DNA_REPLICATION_REACTOME -3.8683 0.0039 0.0450 -6.5700 0.0000
0.0000 -7.3185 0.0000 0.0000 VERNELL_PRB_CLSTRI -3.4691 0.0269
0.1692 -6.5636 0.0000 0.0000 -7.4144 0.0000 0.0000 GAY_YY1_DN
-7.637 0.0000 0.0000 -4.7456 0.0016 0.0295 -7.4972 0.0000 0.0001
CANCER_UNDIFFERENTIATED_META_UP -4.8288 0.0001 0.0034 -6.2847
0.0000 0.0013 -7.7981 0.0000 0.0002 CELL_CYCLE_KEGG -4.1925 0.0008
0.0139 -7.0955 0.0000 0.0000 -7.8764 0.0000 0.0000
ADIP_DIFF_CLUSTERS -4.6054 0.0050 0.0547 -6.8850 0.0000 0.0006
-7.9684 0.0000 0.0003 OLDAGE_DN -4.5391 0.0006 0.0115 -7.1043
0.0000 0.0001 -8.1220 0.0000 0.0000 MIDDLEAGE_DN -3.6696 0.0102
0.0919 -7.7600 0.0000 0.0000 -8.2457 0.0000 0.0000
TARTE_PLASMA_BLASTIC -4.8905 0.0002 0.0054 -6.7905 0.0000 0.0000
-8.3308 0.0000 0.0000 YU_CMYC_UP -4.4689 0.0049 0.0539 -7.3723
0.0000 0.0000 -8.4501 0.0000 0.0000 CMV_IE86_UP -6.1497 0.0000
0.0000 -6.5954 0.0000 0.0000 -8.5032 0.0000 0.0000
HOFFMAN_BIVSBB_BI_TABLE2 -5.1273 0.0001 0.0030 -7.7114 0.0000
0.0005 -8.5773 0.0000 0.0002 CELL_CYCLE -5.0187 0.0000 0.0013
-7.4222 0.0000 0.0000 -8.6730 0.0000 0.0000 KAMMINGA_EZH2_TARGETS
-5.3211 0.0000 0.0004 -7.2448 0.0000 0.0000 -8.8163 0.0000 0.0000
P21_P53_ANY_DN -5.0275 0.0012 0.0186 -7.4300 0.0000 0.0000 -8.8530
0.0000 0.0000 PRMTS_KD_UP -9.3903 0.0000 0.0000 -5.4620 0.0000
0.0010 -8.9362 0.0000 0.0000 CROONQUIST_IL6_RAS_DN -6.7147 0.0000
0.0000 -7.7040 0.0000 0.0000 -9.7453 0.0000 0.0000
DOX_RESIST_GASTRIC_UP -5.8557 0.0000 0.0001 -8.6145 0.0000 0.0000
-10.1840 0.0000 0.0000 LEE_TCELLS3_UP -7.2409 0.0000 0.0000 -8.0339
0.0000 0.0000 -10.3427 0.0000 0.0000 LI_FETAL_VS_WT_KIDNEY_DN
-5.4447 0.0091 0.0024 -9.1715 0.0000 0.0000 -10.4609 0.0000 0.0000
ZHAN_MM_CD138_PR_VS_REST -6.1404 0.0000 0.0000 -9.0080 0.0000
0.0000 -10.7002 0.0000 0.0000 CROONQUIST_IL6_STARVE_UP -6.5055
0.0000 0.0000 -9.0059 0.0000 0.0000 -10.7172 0.0000 0.0000
LE_MYELIN_UP -6.5477 0.0000 0.0009 -8.8777 0.0000 0.0000 -10.8010
0.0000 0.0000 IDX_TSA_UP_CLUSTER3 -6.1057 0.0000 0.0008 -10.1593
0.0000 0.0000 -11.3388 0.0000 0.0000 SERUM_FIBROBLAST_CELLCYCLE
-7.2985 0.0000 0.0000 -10.6997 0.0000 0.0000 -12.2668 0.0000
0.0000
[0326] The intensity of this signature from the two cohorts of
animals is represented in FIG. 20B and a partial list of 10 gene
sets influenced most by MNF treatment is depicted in Table 9. Among
the genes of interest many were downregulated in the MNF group
compared to the vehicle control, including matrix metalloproteinase
(MMP)-11 and 14 (FIG. 20C). Treatment with MNF also sensitized C6
glioma tumor xenograft to growth arrest via the down-regulation of
Galnt3 and other cell cycle regulators, such as Ccna2, Cdkn3 and
Bub1b (FIG. 20C). In addition, there was significant reduction in
expression of molecular markers for glial brain tumors upon MNF
treatment. On the other hand, apoptosis-associated transcripts such
as Casp1, Casp11 and Casp12 were upregulated by MNF (FIG. 20C).
Quantitative RT-PCR analysis confirmed that MNF decreased the
expression of Bub1b, Cdkn3 Ccna2, Olig1, Sox4, and Galnt3 as
compared to control (FIG. 20D), thus validating the microarray
data. Overall, these results indicate routes by which MNF might
negatively affect glioma growth and progression. Also, these
results indicate biomarkers, which can be used to determine the
efficiency of MNF treatment as well as glioma growth and
progression in general. Thus, these studies disclose methods of
diagnosing, prognosing and determining the efficiency of MNF as
well as other treatments of tumor growth and progression in general
by using the disclosed biomarkers as indicators.
[0327] Oligodendrocyte transcription factor 1 (Olig1) has been
identified as a novel glioblastoma marker with diagnostic and
prognostic value. Moreover, SRY-box 4 (Sox4) is a transcription
factor that has been implicated in the determination of the cell
fate and in tumorigenesis. The fact that Olig1 and Sox4 mRNA levels
were reduced in MNF-treated C6 glioma tumors compared with the
control group is consistent with decreased activation of molecular
pathways leading to gliomagenesis. The involvement of Cdkn3, Bub1b
and Olig-1 in gliomagenesis is established. Here, evidence is
provided of a down-regulation in the expression levels of these
genes in rat C6 glioma tumour xenografts in response to MNF,
indicating that MNF and related analogs represent a therapeutic
strategy in the treatment of high-grade gliomas. MNF is readily
transported across the blood-brain barrier and can accumulate in
the rat brain.
TABLE-US-00009 TABLE 8 List of GOTerms influenced by MNF treatment
of a C6 glioma xenograft model Z scores for `MNF_Crtl` are shown.
These studies were performed on two independent cohorts of mice,
with both cohorts showing equivalent results. Annotation GO Term
Set 1 Set 2 Combined GO0006270 DNA replication initiation -4.0283
-3.7775 -5.0248 GO0048015 Phosphoinositide mediated -4.2781 -3.5441
-5.2545 signaling GO0004527 Exonuclease activity -2.5829 -5.4622
-5.8765 GO0000775 Chromosome pericentric -6.7644 -3.5296 -6.3081
region GO0007051 Spindle organization and -4.6166 -5.2288 -6.7039
biogenesis GO0006260 DNA replication -4.7695 -6.0446 -7.3157
GO0007049 Cell cycle -5.1361 -8.0162 -9.3510 GO0005634 Nucleus
-2.1680 -9.9454 -9.4291 GO0007067 Mitosis -7.5266 -7.6563 -10.1574
GO0051301 Cell division -6.9059 -8.0673 -10.1585
TABLE-US-00010 TABLE 9 List of gene sets influenced by MNF
treatment of C6 glioma xenograft model Size indicates the number of
genes found in each gene set. These studies were performed on two
independent cohorts of mice, with both cohorts showing equivalent
results. Size Name Z score P value Fdr 40
HIPPOCAMPUS_DEVELOPMENT_POSTNATAL 10.3511 0.0020 0.0344 280
TARTE_MATURE_PC 5.3293 0.0097 0.1073 41 HYPOPHYSECTOMY_RAT_DN
3.9294 0.0170 0.1483 30 HDACI_COLON_BUT12HRS_UP 3.6676 0.0035
0.0527 60 CELL_CYCLE -7.4222 1.5E-10 1.73E-08 37 P21_P53_ANY_DN
-7.4300 5.12E-09 4.31E-07 74 LE_MYELIN_UP -8.8777 6.34E-08 4.64E-06
24 CROONQUIST_IL6_STARVE_UP -9.0059 1.87E-18 6.31E-16 65
IDX_TSA_UP_CLUSTER3 -10.1593 3.15E-20 1.76E-17 79
SERUM_FIBROBLAST_CELLCYCLE -10.6997 2.98E-20 2.51E-17
[0328] This example demonstrates MNF-dependent chemoprevention in a
glioblastoma xenograft model in the mouse and provides a mechanism
for its anticancer action in vivo. Also, diagnostic markers and
method of determining the efficiency of tumor treatment were
revealed.
Example 9
MNF Targets GPR55-Mediated Ligand Internalization and Impairs
Cancer Cell Motility
[0329] This example demonstrates that MNF targets GPR55-mediated
ligand internalization and impairs cancer cell motility.
[0330] (R,R')-4'-Methoxy-1-naphthylfenoterol (MNF) promotes growth
inhibition and apoptosis of human HepG2 hepatocarcinoma cells via
cannabinoid receptor (CBR) activation. The synthetic CB1R inverse
agonist, AM251, has been shown to block the anti-mitogenic effect
of MNF in these cells; however, AM251 is also an agonist of the
recently deorphanized, lipid-sensing receptor, GPR55, whose
upregulation contributes to carcinogenesis. Here, the role of GPR55
in MNF signaling in human HepG2 and PANC-1 cancer cell lines in
culture was investigated, with a focus on internalization of the
fluorescent ligand Tocrifluor 1117 (T1117), reorganization of actin
cytoskeleton, and cell motility as measured by scratch assay.
Results indicated that GPR55 knockdown by RNA interference markedly
reduced cellular uptake of T1117, a process that was sensitive to
MNF inhibition. GPR55 internalization mediated by the atypical
cannabinoid O-1602 was blocked by MNF in GPR55-expressing HEK293
cells. Pretreatment of HepG2 and PANC-1 cells with MNF
significantly abrogated the induction of ERK1/2 phosphorylation in
response to AM251, O-1602 and fetal bovine serum, known to contain
bioactive lipids. Moreover, MNF exerted a coordinated negative
regulation of AM251 and O-1602 inducible processes, including
change in cell morphology and migration using scratch wound healing
assay. This study shows that MNF impairs GPR55-mediated signaling
and has therapeutic potential in the management of cancer by
facilitating future research on GPR55.
[0331] Accumulation of cAMP by beta2-adrenoreceptor (.beta.2-AR)
agonists has been associated both with a decrease and increase in
the mitogenic response of cancer cell lines in culture. The
mechanisms that determine cell type-specificity of
.beta.2-AR-mediated antitumor activity are poorly understood and
raise questions about possible biased agonism of the .beta.2-AR,
whereby the molecular structure and stereochemistry of the agonist
and the cellular environment of the receptor stabilizes one or more
ligand-specific active conformations of .beta.2-AR. The main
consequence of biased agonism at the .beta.2-AR [and other G
protein-coupled receptors] is the activation of multiple G-protein
isoforms and modulation of various downstream signal transduction
pathways that can lead to dramatic differences in biological
outcomes.
[0332] (R,R')-4'-methoxy-1-naphthylfenoterol (MNF) is an analog of
fenoterol with a 573-fold greater selectivity for the
.beta.2-adrenergic receptor (.beta.2-AR) than .beta.1-AR. It
enhances cAMP accumulation with EC50 value of 3.90 nM in human
.beta.2-AR-overexpressing cells and attenuates proliferation of
1321N1 astrocytoma cells with IC.sub.50 value of 3.98 nM. In
contrast to (R,R')-fenoterol, MNF activates both G.alpha.s and
G.alpha.i proteins and potently stimulates cardiomyocyte
contractility, consistent with its role as a .beta.2-AR agonist.
However, it is disclosed herein that MNF treatment of the
human-derived HepG2 hepatocarcinoma cell line causes growth arrest
and apoptosis via a .beta.2-AR-independent route. The MNF response
was found to be insensitive to the .beta.2-AR antagonist ICI
118,551, and U87MG cells, which lack .beta.2-AR binding activity,
were responsive to the antimitogenic effects of MNF. The presence
of the naphthyl moiety in MNF led us to speculate that it may share
structural similarities with other ligands and, therefore, behave
as a dually acting compound with unique affinity and selectivity
profile.
[0333] Cannabinoid receptors (CBRs) are often co-expressed with
.beta.2-AR in many tissues and various cell types, and their
propensity to heterodimerize demonstrates the potential for
crosstalk between the two receptors. In fact, CBRs can modulate
.beta.2-AR activity. The engagement of CBRs by endogenous and
synthetic cannabinoid ligands results in the regulation of
proliferation and apoptosis of cancer cells, including HepG2 cells.
It is interesting that treatment with selective pharmacological
inverse agonists of CBRs blocks the antiproliferative actions of
MNF in HepG2 cells, consistent with the potential role of CBRs in
MNF signaling. Even though AM251 and its clinical analog,
rimonabant (SR141716A;
N-(piperidin-1-yl)-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H--
pyrazole-3-carboxamide hydrochloride), interact with CB1R as
inverse agonists, there is growing body of evidence to suggest that
they also act as agonists for the recently deorphanized GPR55.
GPR55 is a G protein-coupled receptor with lipid-sensing properties
whose upregulation contributes to the aggressive behavior of
various cancer types. A role for ERK/MAP kinase signaling during
microglial activation and the promotion of cancer cell
proliferation by GPR55 has been proposed. AM251 also promotes
neutrophil chemotaxis by acting as a GPR55 agonist. Thus, the
actions of AM251 and rimonabant, which have been widely interpreted
as being mediated by CB1R, may, in fact, include off-target effects
of GPR55 by this class of compounds.
[0334] The current example was designed to investigate the
contribution of GPR55 in MNF actions in two human cancer cell lines
in culture, HepG2 and PANC-1 cells. Using Tocrifluor 1117 (T1117),
a fluorescent ligand that binds to endogenous GPR55, with low
affinity for CB1R, pharmacodynamic studies were performed and the
data indicate that MNF significantly delays T1117 incorporation via
impairment in the internalization/recycling of GPR55. Treatment
with MNF also resulted in impaired ligand-mediated activation of
downstream GPR55 signaling pathways in both tumor cell lines and
their cell migration using the wound-healing assay. The present
data show that cell exposure to MNF leads to impairment in GPR55
signaling.
[0335] Materials and Methods
[0336] Materials.
[0337] (R,R')-4'-methoxy-1-naphthylfenoterol (MNF) was synthesized
as described previously (Jozwiak et al., Bioorg. Med. Chem. 18:
728, 736, 2007 which is hereby incorporated by reference in its
entirety). Eagle's minimum essential medium, trypsin solution,
phosphate-buffered saline (PBS), fetal bovine serum (FBS),
100.times. solutions of sodium pyruvate (100 mM), L-glutamine (200
mM), and penicillin/streptomycin (a mixture of 10,000 units/ml
penicillin and 10,000 .mu.g/ml streptomycin) were obtained from
Quality Biological (Gaithersburg, Md., USA). WIN 55,212-2, AM251,
and AM630 were purchased from Cayman Chemical (Ann Arbor, Mich.),
whereas CP 55,940, O-1602 and Tocrifluor T1117 were from Tocris
Bioscience (Ellisville, Mo., USA).
[0338] Maintenance and Treatment of Cell Lines.
[0339] Human HepG2 hepatocarcinoma cells and human PANC-1 cells
were purchased from ATCC (Manassas, Va., USA). HepG2 cells were
maintained in Eagle's minimum essential medium supplemented with 1%
L-glutamine, 1% sodium pyruvate, 1% penicillin/streptomycin, and
10% FBS (Hyclone, Logan, Utah, USA). PANC-1 cells were cultured in
phenol red-free Dulbecco's modified Eagle's medium (DMEM)
supplemented with 4.5 g/L glucose and 1.5 g/L sodium bicarbonate
together with glutamine, pyruvate, penicillin/streptomycin and 10%
FBS. HEK293 cells stably expressing the HA-tagged human GPR55
(hGPR55-HEK293) were a gift of Maria Waldhoer (Medical University
of Graz, Graz, Austria) (Henstridge et al., Br. J. Pharmacol. 160:
604-614, 2010). The cells were maintained in DMEM with 4.5 g/L
glucose supplemented with 10% FBS, 0.2 mg/ml G418, and
penicillin/streptomycin. All cell lines were maintained in culture
at 37.degree. C. in 5% CO2, and the medium was replaced every 2-3
days.
[0340] Cellular Uptake of TocriFluor T1117, a Fluorescently Labeled
GPR55 Agonist
[0341] Cells were grown in 35-mm glass bottom culture dishes
(MatTek Corp., Ashland, Mass., USA) for 48 hours until reaching
.about.70% confluence. Serum-depleted cells were incubated either
with DMSO (vehicle, 0.1%), MNF (1 .mu.M), or synthetic cannabinoid
compounds (AM630, AM251, O-1602, CP 55,940) for 30 minutes prior to
the addition of the novel fluorescent diarylpyrazole cannabinoid
ligand, Tocrifluor T1117 (10-100 nM). Cells were imaged with a
Zeiss LSM 710 confocal microscope equipped with a
temperature-controlled and humidified CO2 chamber and a definite
focus system. A 561 nm DPSS laser was used for the excitation of
the 5-TAMRA conjugate. The time-series function of the Zeiss Zen
software was used to collect images with a 40.times.1.3 NA
objective every 30 s for up to one hour, with all confocal settings
remaining the same throughout the studies. Still images, movies and
fluorescent intensity quantitation were obtained from these series
using the Zeiss Zen software. Studies were repeated at least two to
three times.
[0342] Gene silencing.
[0343] HepG2 cells were transfected with siRNA oligos (1.25 .mu.g)
against CB1R, CB2R, or GPR55 or a non-silencing siRNA control
(Santa Cruz Biotechnology, Santa Cruz, Calif.) for 48 hours using
10 .mu.l of siRNA Transfection Reagent (Santa Cruz Biotechnology)
following the manufacturer's protocol. siRNAs have been validated
to perform efficient knockdown with minimal off-target effects.
Following 48 hours of siRNA treatment, cells were washed with PBS,
and maintained in serum-free medium before the addition of
T1117.
[0344] GPR55 Internalization Assay.
[0345] Endocytosis of GPR55 was observed following a previously
described protocol with minor modifications (Henstridge et al., Br.
J. Pharmacol. 160: 604-614, 2010). Briefly, hGPR55-HEK293 cells
were grown on Lab-Tek II CC2 chamber slides (Thermo Scientific
Nunc, Rochester, N.Y.) for 48 hours in regular media and then were
serum starved for 1 hour. A pre-incubation with 1:1000 rabbit HA
antibody (Covance, Md.) was performed in the presence of vehicle
(0.1% DMSO) or 1 .mu.M MNF in serum-free media for 45 minutes at
37.degree. C. in the CO.sub.2 incubator. Cells were then washed
extensively with PBS and treated with 5 .mu.M 01602 in serum-free
media for 20 minutes at 37.degree. C. in the CO.sub.2 incubator.
Subsequently, cells were washed three times, fixed in fresh 3.7%
paraformaldehyde in PBS (10 min), and incubated with anti-rabbit
Alexa Fluor 488 antibody (Molecular Probes, Eugene, Oreg.; 1:1000,
30 minutes). Cells were washed and fixed for a second time prior to
permeabilization with 0.2% Triton X-100 (5 minutes). Incubation
with anti-rabbit Alexa Fluor 568 antibody (Molecular Probes;
1:1000, 30 minutes) was carried out to determine the extent of
internalized GPR55-HA antibody complex. The cells were washed in
PBS, nuclear counterstaining was performed with DAPI
(4',6-diamidino-2-phenylindole) added to the Prolong Gold antifade
mounting medium (Invitrogen) and cured for 24 hours at room
temperature in the dark. Images were acquired with a Zeiss LSM 710
confocal microscope (Thornwood, N.Y.) using Carl Zeiss LSM
software.
[0346] Scratch Assays.
[0347] These assays were carried out essentially as described
previously (Fiori et al., Endocrinology 150: 2551-2560, 2009). In
brief, cells were seeded in 12-well nontreated polystyrene cell
culture plates with flat bottom (Greiner Bio-One, Monroe, N.C.).
Once the cells became confluent, a scratch wound was made with a
pipette tip and pictured immediately (time 0). Cells were
pretreated either with vehicle (DMSO, 0.1%) or the synthetic GPR55
ligands AM251 (1 .mu.M) or O-1602 (1 .mu.M) for 30 minutes followed
by the addition of MNF (1 .mu.M) where indicated. Cell migration
was examined at 12, 24, 36, 48 hours and 12, 18, 24, 48 hours after
scratch for the HepG2 and PANC-1 cells, respectively. Images of the
same field were taken every 3 hours to determine the rate of cell
migration. Images were captured on an Axiovert 200 inverted
microscope (Carl Zeiss, Thornwood, N.Y.) mounted with an AxioCam
HRc digital camera (Carl Zeiss) and the measurement of scratch area
was performed with ImageJ 1.46s software (National Institutes of
Health, Bethesda, Md.). Each study was performed in duplicate
dishes and repeated at least twice.
Synthesis of 5'-TAMRA-3-phenylpropan-1-amine
[0348] Ten nmoles of the NHS ester of 5'-TAMRA (Sigma-Aldrich,
St-Louis, Mo.) was incubated with 20 nmoles of
3-phenylpropan-1-amine (Sigma-Aldrich) in 1 ml of 0.1M PBS, pH 8.0
for 4 hours. The solution was stream dried under nitrogen and
reconstituted in 500 .mu.l of a 1:1 solution of 10 mM Tris-HCl, pH
8.0 in ethanol. The formation of 5'-TAMRA-3-phenylpropan-1-amine
(TAMRA-PPA, structure shown in FIG. 28A) and absence of the NHS
ester of 5'-TAMRA was confirmed by mass spectrometry (FIGS. 28B,
28C). A stock solution of 10 mM of TAMRA-PPA was prepared,
aliquoted and stored at -20.degree. C.
[0349] Western Blot Analysis.
[0350] For detection of intracellular signaling proteins, cells
were lysed in radioimmunoprecipitation buffer containing EGTA and
EDTA (Boston BioProducts, Ashland, Mass.). The lysis buffer
contained a protease inhibitor cocktail (Sigma-Aldrich) and
phosphatase inhibitor cocktail (Calbiochem, San Diego, Calif.).
Equivalent amount of proteins (14 and 54 .mu.g/well for PANC-1 and
HepG2 cells, respectively) were separated on 4 to 12% precast gels
(Invitrogen, Carlsbad, Calif.) using SDS-polyacrylamide gel
electrophoresis under reducing conditions and then
electrophoretically transferred onto polyvinylidene fluoride
membrane (Invitrogen). Western blots were performed according to
standard methods, which involved blocking in 5% non-fat milk and
incubated with the antibody of interest, followed by incubation
with a secondary antibody conjugated with the enzyme horseradish
perodixase. The detection of immunoreactive bands was performed by
chemiluminescence using the ECL Plus Western Blotting Detection
System (GE Healthcare, Piscataway, N.J.). The quantification of
bands was done by volume densitometry by using ImageJ software. The
rabbit polyclonal antibodies against EGFR were obtained from Cell
Signaling Technology, Inc. (Beverly, Mass.) and the monoclonal
anti-Hsp90 was purchased from Santa Cruz Biotechnology, Inc. (Santa
Cruz, Calif.).
[0351] Effect of MNF on O-1602-Mediated Increase in Cell
Signaling.
[0352] Serum-starved cells were pretreated in the absence or
presence of 1 .mu.M MNF for 10 minutes followed by a 10 minute
incubation with 0, 2.5 and 10 .mu.M O-1602 or 10% FBS, after which
the levels of total ERK2 and phosphorylated forms of ERK1/2
(pErk1/2, Thr202/Tyr204), were determined by Western blotting
technique. All primary antibodies were purchased from Cell
Signaling Technology and used at a dilution recommended by the
manufacturer.
[0353] Statistical Analysis.
[0354] Prism 4 (GraphPad Software, Inc., La Jolla, Calif.) running
on a personal computer was used to perform all the statistical data
analysis.
[0355] Results
[0356] A Role for the Deorphanized GPR55 in the Cellular
Incorporation of T1117.
[0357] The fluorescently labeled AM251 analog, T1117, acts as a
ligand for GPR55 with low affinity for CB1R. To address the issue
of sensitivity and specificity of T1117 incorporation,
serum-depleted cells were maintained on a confocal microscope stage
equipped with a temperature-controlled and humidified CO.sub.2
chamber. Studied herein were the characteristics of T1117
incorporation in human HepG2 and PANC-1 cells at 37.degree. C. The
amount of cellular T1117 levels increased in a dose-dependent
manner, with a maximal incorporation at 100 nM and a half-maximal
effect at approximately 8 nM (FIGS. 21A, 21B). Simultaneous
addition of a 100.times. molar excess of unlabeled AM251 caused a
significant 18-minutes delay in the cellular accumulation of T1117
(FIGS. 21C, 21D). Similarly, dropping the temperature to 10.degree.
C. reduced the rate of T1117 uptake. To establish whether the
cellular incorporation of T1117 required the presence of the AM251
moiety, HepG2 cells were incubated for up to 1 hour with equimolar
amounts either of T1117 (5'-TAMRA-(3-phenylpropan-1-amine)-labeled
AM251) or 5'-TAMRA-3-phenylpropan-1-amine (TAMRA-PPA). Under these
conditions, there was no significant incorporation of fluorescence
upon cell incubation with TAMRA-PPA (FIG. 29C). These results
demonstrate that cellular accumulation of T1117 is rapid and
saturable, and initiated through competitive binding to cell
surface receptors.
[0358] To confirm the role of GPR55 in the cellular uptake of
T1117, HepG2 cells were incubated with siRNA oligos against CB1R,
CB2R or GPR55 and the non-silencing siRNA control for 48 hours,
after which T1117 incorporation was monitored (FIGS. 24A, 24B).
Studies showed selective reduction in gene expression when using
siRNA duplexes against the indicated targets. In HepG2 cells
transfected with control siRNA, entry of T1117 was observed with
half-maximum incorporation at .about.15 minutes (FIG. 22A).
Silencing of GPR55 blocked T1117 uptake by more than 6-fold whereas
a significant 10-12 minutes delay occurred upon CB1R silencing,
ultimately resulting in a 40% reduction in cellular T1117 levels
(FIG. 22B). However, in cells transfected with CB2R siRNA, the
profile of T1117 incorporation was comparable to that of
non-silencing siRNA-transfected cells. These results indicate that
GPR55 plays a major role in the cellular entry of T1117 and that
constitutive CB1R activity may participate in this GPR55
function.
[0359] To independently confirm these observations, HepG2 cells
were pretreated with selective inverse agonists/antagonists of CB1R
and CB2R prior to the addition of T1117. The CB2R inverse agonist,
AM630, was largely inactive while pretreatment with the CBR
agonist, WIN 55,212-2, markedly increased the rate of T1117
accumulation (FIG. 22C). The potent synthetic cannabinoid agonist
CP 55,940 has been reported to block GPR55 internalization in a
heterologous expression system. Here, a 30-minutes pretreatment
with CP 55,940 (0.25 .mu.M) clearly reduced T1117 uptake by
2.5-fold in HepG2 cells (FIG. 24D). Similarly, cell treatment with
the atypical cannabinoid O-1602 (0.25 .mu.M) caused a 12.5-minutes
delay in cellular accumulation of T1117, resulting in a 47%
reduction in the amount of T1117 incorporated (FIG. 22D).
[0360] MNF Inhibits Cellular Incorporation of T1117.
[0361] The effects of MNF on GPR55 signaling were initially
investigated using the incorporation of T1117 as an in vitro model
of GPR55-dependent activity. Pretreatment of HepG2 cells with 1
.mu.M AM251 for 30 minutes neither inhibited nor enhanced
constitutive T1117 incorporation, suggesting the absence of
negative or positive allosteric modulation (FIGS. 23A, 23B). This
is in contrast to the effect of concomitant addition of a
100.times.-excess of AM251 with T1117, which significantly reduced
cellular T1117 accumulation under the same assay conditions (FIG.
23C), possibly because of the lower specific activity of the
fluorescent marker. When this study was performed in the presence
of MNF alone, a .about.70% reduction was observed (FIGS. 23A, 23B).
Moreover, the addition of AM251 either before or after the
30-minutes treatment with MNF caused a further lowering in T1117
incorporation, with a .about.6.8-fold reduction as compared to
vehicle-treated cells.
[0362] To investigate whether the effects of the compounds were
unique to HepG2 cells, similar studies were conducted in PANC-1
cells in culture. Semi-quantitative PCR analysis indicated the
presence of CB1R, CB2R and GPR55 in these cells. The results
indicated that MNF was a potent inhibitor of T1117 incorporation in
PANC-1 cells (FIGS. 23C and 23D). Thus, it would appear that MNF
blocked endocytosis of a GPR55 ligand.
[0363] Effect of MNF on GPR55 Internalization and Downstream
Signaling.
[0364] The effect of MNF on ligand-induced GPR55 internalization
was performed in HEK293 cells stably expressing HA-tagged GPR55.
Using confocal laser scanning microscopy, GPR55 was found to be
located largely at the plasma membrane of unstimulated cells (FIG.
24A). Addition of O-1602 for 20 minutes led to marked endocytosis
of HA-tagged GPR55, which was blocked by pretreatment with MNF
(FIG. 24B).
[0365] Additional events downstream of GPR55 internalization may be
impaired by cell treatment with MNF, as the redistribution of
ligand-bound receptors from the cell surface to endosomal
compartment differentially regulates various signaling pathways and
their associated biological outcomes. Indeed, spatio-temporal
activation of extracellular signal-regulated kinase (ERK)-MAP
kinase plays a role in the dynamic control of complex cellular
functions. Here, exposure of HepG2 cells to O-1602 dose-dependently
increased ERK phosphorylation and MNF pretreatment abrogated O-1602
responsiveness (FIGS. 25A and 25B). PANC-1 cells exhibited the same
behavior as HepG2 cells, and displayed exquisite sensitivity to MNF
with regard to O-1602-mediated ERK phosphorylation (FIGS. 25C and
25D). Similar findings were observed following cell stimulation
with AM251 with and without MNF pretreatment.
[0366] Bioactive concentrations of endocannabinoids are present in
fetal bovine serum (250-700 nM of 2-arachidonoylglycerol), which
strongly influence monocytes/macrophage responses. As shown in
FIGS. 26A-26D, pretreatment with MNF potently inhibited
serum-induced ERK phosphorylation in both cell lines.
[0367] A Role of MNF in the Morphology and Motility of Tumor
Cells.
[0368] To further study the role of MNF and GPR55 activation in
HepG2 and PANC-1 cell biology, possible alteration in morphology
was investigated. Cells with irregular appearance and long
filipodia and lamellipodia were observed in response to AM251 and
O-1602 stimulation (FIGS. 26A and 26B, white arrows). Pretreatment
with MNF rendered the cells refractory to the change in morphology
induced by AM251 and O-1602 in both tumor cell lines. As shown in
FIG. 26C, treatment of HepG2 and PANC-1 cells with O-1602 led to
higher EGFR levels when compared to vehicle-treated cells, and MNF
blocked this effect (FIG. 26C, lane 4 vs. 3) and that of AM251.
These findings are consistent with the idea that MNF conferred
refractoriness to GPR55 signaling.
[0369] A Wound-Healing Assay In Vitro was then Performed to
Investigate the Effects of MNF on Cell Motility.
[0370] As shown in FIGS. 27A and 29A, MNF alone had no effect on
the motility of HepG2 cells at the concentration used throughout
the study (1 .mu.M). This is in contrast, however, to its
significant inhibitory effect toward AM251-mediated increase in
cell motility (FIGS. 27A, 29A). The relative wound surface area
after 24-hour treatment of HepG2 cells with each condition depicted
in FIG. 27B. Similar to its effects in HepG2 cells, MNF also
produced significant decrease in AM251-induced motility of PANC-1
cells, but did not alter the constitutive rate of gap filling
(FIGS. 27C, 27D and 29B). When tested against O-1602, a cell
type-selective effect was observed in the presence of MNF. In
particular, the ability of MNF to inhibit the wound closure evoked
by O-1602 in PANC-1 cells was absent in HepG2 cells (FIG. 29C),
indicative of a complex mode of antagonism.
[0371] Engagement of the `cannabinoid-like receptor` GPR55 triggers
a number of signaling cascades that promote cell proliferation,
migration, survival and oncogenesis. MNF displays a number of
characteristics associated with selective attenuation in GPR55
signaling, including 1) delayed cellular entry of a fluorescent
GPR55 ligand, 2) inhibition of the internalization of the
ligand-occupied GPR55, and 3) a significant reduction in GPR55
agonist efficacy with regard to a number of biological
readouts.
[0372] In cellular assays, the low level of non-specific uptake of
the fluorophore alone (5'-TAMRA-PPA) makes T1117
(5'-TAMRA-PPA-conjugated AM251) suitable for in vivo imaging
approaches aimed at assessing occupancy and internalization of
GPR55. The compound T1117 has been shown previously to measure the
distribution of GPR55 in small mouse arteries. Here, employing the
siRNA-based gene silencing method, it was determined that GPR55 was
a main molecule responsible for T1117 entry in intact cells. In
human HepG2 cells, the presence of GPR55 and the classical CB1R was
evidenced by PCR and functional assays. Both receptors trigger
distinct signaling pathways in endothelial cells, and it was thus
not surprising to observe in our study that the silencing of CB1R
by siRNA limited the response mediated by GPR55 while cell
stimulation with an agonist of CB1R (WIN 55,212-2) resulted in an
increase in GPR55 constitutive activity. Although GPR55 interacts
cooperatively with CB2R to influence inflammatory responses of
neutrophils, pharmacological inhibition and silencing of CB2R by
siRNA failed to impact on T1117 incorporation in HepG2 cells. Thus,
CB1R-triggered mechanism appears to contribute is some extent to
the constitutive GPR55-mediated T1117 uptake. The propensity of
CB1R to form functional heterodimers with various GPCRs explains
some of the cell type-specific physiological responses of
GPR55.
[0373] Analysis of the data revealed that MNF significantly delayed
the cellular accumulation of T1117 in serum-depleted cells
expressing endogenous levels of GPR55, indicative of a decrease in
the binding affinity of T1117 to GPR55 and/or impairment in
constitutive cell surface GPR55 internalization and recycling
pathways. Pretreatment with AM251 for 30 minutes potentiated the
effect of MNF, consistent with a negative cumulative event. In this
model, AM251-bound GPR55 complexes were internalized and any
residual cell surface GPR55 receptors were targeted by MNF, making
this GPCR inaccessible for efficient T1117 binding and/or
internalization. Alternatively, inhibition of CB1R by AM251 may
have also contributed to the observed potency in MNF signaling. The
ability of CP 55,940 to block cellular entry of T1117 was
consistent with its role as a GPR55 antagonist.
[0374] The stimulation of GPR55-expressing HEK-293 cells with the
atypical cannabinoid O-1602 triggered rapid internalization of
GPR55 through a MNF-inhibitable mechanism, indicating that under
the current assay conditions, the potency of MNF was not
appreciably influenced by the conditions of overexpression. GPCR
desensitization and internalization requires the participation of
.beta.-arrestin translocation to the activated receptor. Using a
.beta.-arrestin translocation assay in a transient transfection
format, AM251 and its clinical analog rimonabant exhibit potent
activity as GPR55 agonists, whereas CP 55,940 blocks the formation
of .beta.-arrestin/GPR55 complexes. The possibility exists that MNF
prevents the recruitment of .beta.-arrestin to the GPR55, thereby
providing a negative impact on internalization and recycling of
this GPCR after agonist exposure. In addition to its role in the
promotion of GPCR internalization, .beta.-arrestin is required for
activation of downstream signaling (e.g., ERK activation). GPR55 is
thought to bind predominantly G-protein G13, where it promotes
Rho-dependent signaling in endothelial cells. Additional events
downstream of GPR55 include activation of ERK and Ca2+ release from
internal stores. Here, in vitro exposure of HepG2 and PANC-1 cells
to AM251 or O-1602 resulted in rapid increase in ERK
phosphorylation, a process that was inhibited by cell pretreatment
with MNF. An explanation for the significant reduction in
agonist-stimulated increase in ERK phosphorylation in response to
MNF is that ligand-bound GPR55 stimulates ERK activity once the
receptor is internalized, in contrast to an earlier study by Li and
colleagues showing that opioid-mediated ERK activation is not
dependent on .kappa.-opioid receptor internalization (J. Biol.
Chem. 274: 12087-12094, 1999). Alternatively, MNF may interact with
a putative allosteric binding site on GPR55 and elicit negative
allosteric modulation of GPR55 agonists. It is noteworthy that an
allosteric binding site has been reported at the CB1R. MNF may
inhibit signaling downstream of GPR55 to disrupt the binding of
T1117, receptor internalization and induction of the signaling
cascade leading to ERK activation.
[0375] Another striking observation from the disclosed study was
the similarity between the effect of MNF on basal and
agonist-induced ERK phosphorylation and on biological readouts,
including GPR55-dependent cellular morphology and cell motility.
ERK has been found to coordinate and regulate cell migration by
promoting lamellipodial leading edge movement via phosphorylation
of the WAVE2 regulatory complex. Here, treatment of HepG2 and
PANC-1 cells with AM251 or O-1602 led to fillipodia extension,
which was blocked by MNF pretreatment. Moreover, MNF elicited a
significant reduction in the rate of wound closure for GPR55
agonists in HepG2 and PANC-1 cells using a scratch wound-healing
assay.
[0376] This example indicates MNF reduced proliferation and
increased apoptosis in human HepG2 hepatocellular carcinoma cells
and PANC-1 pancreatic cancer cell line in culture. The role of
GPR55 in MNF signaling in HepG2 and PANC-1 cells was investigated
with a focus on internalization of the fluorescent ligand
Tocrifluor 1117 (T1117), reorganization of actin cytoskeleton, and
cell motility as measured by scratch assay. Results indicated that
GPR55 knockdown by RNA interference markedly reduced cellular
uptake of T1117, a process that was sensitive to MNF inhibition.
GPR55 internalization mediated by the atypical cannabinoid O-1602
was blocked by MNF in GPR55-expressing HEK293 cells. Pretreatment
of HepG2 and PANC-1 cells with MNF significantly abrogated the
induction of ERK1/2 phosphorylation in response to AM251, O-1602
and fetal bovine serum, known to contain bioactive lipids.
Moreover, MNF exerted a coordinated negative regulation of AM251
and O-1602 inducible processes, including change in cell morphology
and migration, using scratch-wound healing assay. Thus, these
studies show for the first time that MNF impairs GPR55-mediated
signaling and has therapeutic use in the management of cancer.
Example 10
Treatment of a CB Receptor Activity-Regulated Tumor
[0377] This example describes a method that can be used to treat a
tumor in a human subject by administration of a composition
comprising fenoterol, a fenoterol analogue or a combination thereof
at a therapeutically effective amount to reduce or inhibit on or
more signs or symptoms associated with the tumor, such as a
glioblastoma or hepatocellular carcinoma. Although particular
methods, dosages, and modes of administrations are provided, one
skilled in the art will appreciate that variations can be made
without substantially affecting the treatment.
[0378] A subject with a glioblastoma or hepatocellular carcinoma is
selected based upon clinical symptoms. A biological sample is
isolated from the subject and CB receptor expression, including
GPR55, and .beta.2-AR expression are determined by microarray,
Western blotting or histological studies. A positive result
indicates that the tumor may be treated by administration of
fenoterol, a disclosed fenoterol analogue or a combination thereof.
In one particular example, a tissue biopsy is obtained from a
subject with a primary brain tumor. Expression of .beta.2-AR and
GPR55 is determined in the sample. The absence of .beta.2-ARs and
the presence of GPR55 in the sample indicates that the primary
brain tumor can be treated by administration of a composition
including (R,R')-MNF. The presence of .beta.2-ARs and the presence
of GPR55 indicates the tumor can be treated by (R,R')-MNF or
fenoterol (or both) or other fenoterol analogue(s) known to
stimulate .beta.2-ARs activity. The composition including the
desired compounds is intraperitoneally administered to the subject
at a concentration of 30 mg/kg/day for the first 10 days and 50
mg/kg/day for the remaining 32 days. Tumor growth is then assessed
7 days, 14 days, 21 days, 30 days, and 42 days following treatment.
In one example, the effectiveness of the treatment is determined by
imaging methods, including non-invasive, high-resolution
modalities, such as computed tomography (CT) and especially
magnetic resonance imaging (MRI). For example, contrast agent
uptake is monitored to determine the effectiveness of the
treatment. A decrease in permeability to the blood-brain barrier
marked by an at least twenty percent (20%) decrease in uptake of a
contrast agent as compared to reference value or that measured
prior to treatment indicates the treatment is effective. Also, a
twenty-percent (20%) reduction in tumor size as compared to tumor
size prior to treatment is considered to be an effective treatment.
In one example, the therapeutic effectiveness is determined by
measuring expression or activity of one or more molecules
demonstrated herein to be regulated by MNF (see for example, Table
10). In some examples, a subject is administered an intravenous
formulation of MNF used with a cGMP-produced
(R,R')-4-methoxynaphthylfenoterol (such as a cGMP-produced
(R,R')-4-methoxynaphthylfenoterol 2 Kg formulation). In some
examples, a subject is administered an intravenous formulation of
MNF at a concentration ranging from 0.1 to 10 mg/kg for 4 days as a
single agent or in combination with other fenoterol analogs or
standard agents used in cancer chemotherapy over a two week period
as a continuous or pulsed therapy. In some examples, a subject is
administered orally a 25 mg/kg dose of MNF formulated as a single
agent or as a combination of (R,R')-MNF and other MNF stereoisomers
or fenoterol stereoisomers on a daily basis for a certain period of
time, such as 1 month, 2 months, 3 months, 4 months, 5 months, 6
months followed by additional periods if desired, based upon
regression of or inhibition of tumor growth.
Example 11
Use of Disclosed Compositions Including (R,R')-MNF or (R,R')--NF
(or Both) as an Adjuvant Therapy
[0379] This example describes a method that can be used to reduce,
prevent, or retard tumor growth in a human subject that has been
treated for a malignant astrocytoma.
[0380] A subject with an astrocytoma is selected based upon
clinical symptoms and determined to have an astrocytoma expressing
CB-receptors. The primary form of treatment of the malignant
astrocytoma is open surgery. For subjects that are not surgical
candidates, either radiation or chemotherapy is used as the initial
treatment. Following the initial treatment, a subject is
administered a pharmaceutical composition containing (R,R')-MNF
and/or (R,R')--NF orally daily for an indefinite period of time.
The reoccurrence of tumor growth is monitored by imaging methods,
including non-invasive, high-resolution modalities, such as CT and
MRI.
[0381] In view of the many possible embodiments to which the
principles of the disclosed invention may be applied, it should be
recognized that the illustrated embodiments are only preferred
examples of the invention and should not be taken as limiting the
scope of the invention. Rather, the scope of the invention is
defined by the following claims. We therefore claim as our
invention all that comes within the scope and spirit of these
claims.
Sequence CWU 1
1
8120DNAArtificial Sequencesynthetic oligonucleotide primer
1cgtgggcagc ctgttcctca 20218DNAArtificial Sequencesynthetic
oligonucleotide primer 2catgcgggct tggtctgg 18319DNAArtificial
Sequencesynthetic oligonucleotide primer sequence 3cgccggaagc
cctcatacc 19420DNAArtificial Sequencesynthetic oligonucleotide
primer sequence 4cctcattcgg gccattcctg 20518DNAArtificial
SequenceSynthetic oligonucleotide primer 5accacagtcc atgccatc
18618DNAArtificial Sequencesynthetic oligonucleotide primer
sequence 6tccaccaccc tgttgctg 18723DNAArtificial Sequencesythetic
oligonucleotide primer sequence 7catgtctctc atcgtcctgg cca
23822DNAArtificial Sequencesynthetic oligonucleotide primer
sequence 8cacgatggaa gaggcaatgg ca 22
* * * * *