U.S. patent application number 14/568444 was filed with the patent office on 2015-06-04 for methods for diagnosing osteoarthritis.
The applicant listed for this patent is CHU SAINTE-JUSTINE. Invention is credited to ALAIN MOREAU.
Application Number | 20150153362 14/568444 |
Document ID | / |
Family ID | 39324072 |
Filed Date | 2015-06-04 |
United States Patent
Application |
20150153362 |
Kind Code |
A1 |
MOREAU; ALAIN |
June 4, 2015 |
METHODS FOR DIAGNOSING OSTEOARTHRITIS
Abstract
A method of predicting the risk of developing osteoarthritis
(OA) comprising: (a) measuring the nuclear cellular level of
prohibitin (PHB-1) in nucleated cells present in a blood sample
from a subject having or suspected of having OA; and (b) comparing
said nuclear cellular level to that corresponding to a control
sample; and (c) identifying the subject as being at risk of
developing OA when the nuclear cellular level of said PHB-1 in said
blood sample is higher than in the control sample.
Inventors: |
MOREAU; ALAIN; (MONTREAL,
CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CHU SAINTE-JUSTINE |
MONTREAL |
|
CA |
|
|
Family ID: |
39324072 |
Appl. No.: |
14/568444 |
Filed: |
December 12, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12447152 |
Apr 24, 2009 |
|
|
|
PCT/CA2007/001901 |
Oct 25, 2007 |
|
|
|
14568444 |
|
|
|
|
60854077 |
Oct 25, 2006 |
|
|
|
Current U.S.
Class: |
506/9 ;
435/7.21 |
Current CPC
Class: |
G01N 2333/4706 20130101;
C12Q 2600/136 20130101; C12Q 2600/158 20130101; C12Q 1/6883
20130101; C12Q 2600/156 20130101; G01N 2333/4704 20130101; C07K
14/4703 20130101; G01N 33/6893 20130101; G01N 2333/47 20130101;
G01N 2800/50 20130101; G01N 2800/105 20130101 |
International
Class: |
G01N 33/68 20060101
G01N033/68 |
Claims
1. A method of predicting the risk of developing osteoarthritis
(OA) comprising: (a) measuring the nuclear cellular level of
prohibitin (PHB-1) in nucleated cells present in a blood sample
from a subject having or suspected of having OA; and (b) comparing
said nuclear cellular level to that corresponding to a control
sample; and (c) identifying the subject as being at risk of
developing OA when the nuclear cellular level of said PHB-1 in said
blood sample is higher than in the control sample.
2. The method of claim 1, further comprising measuring the nuclear
cellular level of prohibitone (PHB-2) in said nucleated cells.
3. The method of claim 1, wherein said sample is from a subject
having OA.
4. The method of claim 2, wherein said sample is from a subject
having OA.
5. The method of claim 1, wherein said measuring in step (a)
comprises i) contacting said sample with an antibody specific for
PHB-1; and ii) detecting the nuclear cellular level of PHB-1 by
immunofluorescence.
6. The method of claim 3, wherein said measuring in step (a)
comprises i) contacting said sample with an antibody specific for
PHB-1; and ii) detecting the nuclear cellular level of PHB-1 by
immunofluorescence.
7. The method of claim 2, wherein said measuring in step (a)
comprises i) contacting said sample with an antibody specific for
PHB-1; and ii) detecting the nuclear cellular level of PHB-1 by
immunofluorescence.
8. A method of predicting the risk of developing osteoarthritis
(OA) comprising: (a) measuring the nuclear cellular level of
prohibitin (PHB-1) in nucleated cells present in a blood sample
from a subject having or suspected of having OA, said measuring
comprising: i) contacting said cells with an antibody specific for
PHB-1; and ii) detecting the nuclear cellular level of PHB-1 by
immunofluorescence; (b) comparing said nuclear cellular level to
that corresponding to a control sample; and (c) identifying the
subject as being at risk of developing OA when the nuclear cellular
level of PHB-1 in said blood sample is higher than in the control
sample.
9. The method of claim 8, wherein said sample is from a subject
having OA.
10. The method of claim 8, further comprising measuring the nuclear
cellular level of prohibitone (PHB-2) in said nucleated cells.
11. The method of claim 9, further comprising measuring the nuclear
cellular level of prohibitone (PHB-2) in said nucleated cells.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 12/447,152, which is a National Entry
Application of PCT Application Serial No. PCT/CA2007/001901 filed
on Oct. 25, 2007 and published in English under PCT Article 21(2),
which itself claims priority on U.S. Provisional Application Ser.
No. 60/854,077 filed on 25 Oct. 2006. All documents above are
incorporated herein in their entirety by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to methods of prognosing
osteoarthritis, methods of selecting compounds and kits
therefore.
REFERENCE TO SEQUENCE LISTING
[0003] Pursuant to 37 C.F.R. 1.821(c), a sequence listing is
submitted herewith as an ASCII compliant text file named
12810.sub.--230_ST25, that was created on Dec. 11, 2014 and having
a size of 34 kilobytes. The content of the aforementioned file is
hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
[0004] The etiology of (OA), the most common form of arthritis,
remains unclear notwithstanding the multiplicity of factors that
have been considered in primary OA (1, 2). At present, it has
become increasingly evident that the majority of OA genetic
susceptibility loci cannot be attributed only to structural genes
or genes regulating bone mass (3-5). These studies have also
highlighted the great heterogeneity and differences in the degree
of OA heritability between different joint sites (e.g. hand versus
knee) and gender. This is also reflected by the multiplicity of
loci identified in OA linkage studies and their discrepancies.
Moreover, the functional importance of these susceptibility loci
has yet to be confirmed and illustrates our incomplete knowledge of
the biology of OA.
[0005] Pitx1 (previously called Ptx1) is a homeodomain
transcription factor detected initially throughout pituitary
development. The Pitx-family contains three related members, Pitx1,
Pitx2 and Pitx3, which are members of the paired class of
homeodomain proteins. The three Pitx factors have similar
transcription properties (6-8). The pitx1 gene is highly expressed
in mouse hind limb long bones during development (5) and
accumulation of high levels of Pitx1 proteins were detected by
immunohistochemistry on hind limb long bone sections mainly in the
periarticular region, along the perichondrium (including at the hip
and knee joints) and also in the nuclei of proliferative
chondrocytes (8). Pitx1 expression was also detected in
craniofacial structures such as the mandible and at the
temporo-mandibular joints. Mice that are homozygous for the pitx1
deletion are born with the expected Mendelian ratio, but they die
soon after birth and phenotypic analysis of pitx1 mutant newborn
mice shows striking craniofacial and hind limb skeletal
abnormalities (9). Interestingly, heterozygous mice harboring only
one mutated allele were phenotypically normal at birth, but a
majority of aging pitx1+/- heterozygous mice exhibited gradual
degenerative changes of knee joints, showing OA-like lesions at
seven months of age. Comparison of histological analysis performed
on seven-month old wild-type (FIG. 1A) and pitx1+/- mouse (FIG. 1B)
femurs further confirmed an abnormal thickening of the subchondral,
trabecular and cortical bone, a feature commonly found in OA. At
higher magnification, histological sections stained with the
Goldner method revealed a fibrillation and a marked calcification
affecting only the articular cartilage of pitx1 heterozygous mice
(FIG. 1D). These abnormalities were reminiscent of clinical changes
usually observed in OA patients.
[0006] The prohibitins, prohibitin (also known as PHB-1 or BAP32)
and prohibitone (also known as PHB-2, B-cell receptor associated
protein or BAP37, REA for Repressor of estrogen receptor) are
highly conserved proteins in eukaryotic cells that are present in
multiple cellular compartments (30-32). PHB-1 is localized to the
mitochondria where it might have a role in the maintenance of
mitochondrial function as well as in the nucleus where it
facilitates cellular senescence by recruiting specific
co-repressors to inhibit E2F target genes (19-21). The role of
PHB-1 in cell-cycle regulation is also demonstrated by its physical
interaction with the retinoblastoma tumor-suppressor protein
families (22, 23) and through a direct interaction with the highly
conserved marked box region of E2Fs (24) preventing E2Fs
interaction with their cognate sequence. Nonetheless, the function
of PHB-1 in the nucleus is still controversial although its nuclear
localization has been found in a variety of cell lines (24).
[0007] To the Applicant's knowledge, there is no molecular test for
assessment of the risk of progression and severity of OA.
[0008] The present description refers to a number of documents, the
content of which is herein incorporated by reference in their
entirety.
SUMMARY OF THE INVENTION
[0009] In accordance with an aspect of the present invention, there
is provided a method of selecting a compound, said method
comprising the steps of (a) contacting a test compound with at
least one cell having a mutation within the E2F-like site of the
pitx1 promoter; and (b) determining pitx1 transcription and/or
expression level; wherein the test compound is selected if pitx1
transcription and/or expression level is increased in the presence
of the test compound as compared to that in the absence thereof. In
a specific embodiment, the mutation is a mutation corresponding to
-3727 C.fwdarw.T within the E2F-like site of the pitx1 promoter. In
another specific embodiment, the selected compound is potentially
useful in the treatment of primary osteoarthritis in a joint where
Pitx1 is normally expressed. In another specific embodiment, the
joint where Pitx1 is normally expressed is selected from the group
consisting of knee joint, hip joint and temporo-mandibular joint.
In another specific embodiment, the joint where Pitx1 is normally
expressed is knee joint. In another specific embodiment, the joint
where Pitx1 is normally expressed is hip joint. In another specific
embodiment, the joint where Pitx1 is normally expressed is
temporo-mandibular joint.
[0010] In accordance with another aspect of the present invention,
there is provided a method comprising: (a) providing a DNA sample
from a subject; and (b) comparing the binding of a pitx1 repressor
protein selected from the group consisting of prohibitin (PHB-1),
prohibitone (PHB-2) and B cell lymphoma-6 transcriptional repressor
interacting co-repressor (BCoR), to an E2F-like site of the pitx1
promoter in the DNA sample from the subject, with that in a control
DNA sample, wherein an increased binding of the pitx1 repressor
protein to the E2F-like site of the pitx1 promoter in the subject
DNA sample as compared to that in the control DNA sample, is
indicative that the subject has or is at risk for developing
osteoarthritis. In a specific embodiment, said repressor protein is
PHB-1. In another specific embodiment, said repressor protein is
PHB-2. In another specific embodiment, said repressor protein is
BCoR. In another specific embodiment, said subject was not
clinically diagnosed with osteoarthritis.
[0011] In accordance with another aspect of the present invention,
there is provided an isolated nucleic acid molecule of no more than
300 nucleotides comprising (a) a sequence of at least 20 contiguous
nucleotides of
AGTTCCATACTCCCATCTGTGCCTCACTGGCGGCAGTCCTGCTCAAATACATCCTGGCTCT (SEQ
ID NO: 1) including nucleotide at position 31 wherein C is replaced
by T; or (b) the complement of the sequence in (a). In a specific
embodiment, the sequence in (a) is of at least 30 contiguous
nucleotides of
AGTTCCATACTCCCATCTGTGCCTCACTGGCGGCAGTCCTGCTCAAATACATCCTGGCTCT (SEQ
ID NO: 1).
[0012] In accordance with another aspect of the present invention,
there is provided an array of nucleic acid molecules attached to a
solid support, the array comprising an oligonucleotide hybridizable
to the nucleic acid molecule of the present invention, under
conditions in which the oligonucleotide will not substantially
hybridize to a nucleic acid molecule consisting of
AGTTCCATACTCCCATCTGTGCCTCACTGGCGGCAGTCCTGCTCAAATACATCCTGGCTCT (SEQ
ID NO: 1) or its complement.
[0013] In accordance with another aspect of the present invention,
there is provided a single-stranded DNA probe of no more than 300
nucleotides hybridizable under high stringency conditions to (a) a
nucleic acid molecule consisting of
AGTTCCATACTCCCATCTGTGCCTCACTGGCGGCAGTCCTGCTCAAATACATCCTGGCTCT (SEQ
ID NO: 1) including nucleotide at position 31 wherein C is replaced
by T; or to (b) the complement of the nucleic acid molecule in (a)
but not to or to a lesser extent to a nucleic acid molecule
consisting of
AGTTCCATACTCCCATCTGTGCCTCACTGGCGGCAGTCCTGCTCAAATACATCCTGGCTCT (SEQ
ID NO: 1) or to its complement. In a specific embodiment, the probe
is detectably labeled.
[0014] In accordance with another aspect of the present invention,
there is provided a kit comprising the probe of the present
invention and instructions to use the probe to diagnose
osteoarthritis in a subject.
[0015] In accordance with another aspect of the present invention,
there is provided a kit comprising the probe of the present
invention and instructions to use the probe to predict whether a
subject is at risk of developing osteoarthritis.
[0016] In a specific embodiment of the kits of the present
invention, the kits further comprise a container for a DNA sample
from the subject. In another specific embodiment, the kits further
comprise an antibody specific to a pitx1 repressor protein.
[0017] In accordance with another aspect of the present invention,
there is provided a method comprising: determining the cellular
localization of a pitx1 repressor protein selected from the group
consisting of prohibitin (PHB-1) and prohibitone (PHB-2) in a
subject cell sample selected from the group consisting of an
articular chondrocytes sample, a growth plate chondrocytes sample,
an osteoblasts sample, a skeletal myoblasts sample and a
synoviocytes sample. In a specific embodiment, said method further
comprises determining whether the repressor protein nuclear
concentration is higher in the subject cell sample as compared to
that in a control cell sample; wherein a higher repressor protein
nuclear concentration in the subject cell sample is indicative that
the subject is at risk of developing osteoarthritis.
[0018] In accordance with another aspect of the present invention,
there is provided a method comprising: (a) identifying a subject
suspected of having osteoarthritis (OA); and (b) detecting the
blood concentration of a pitx1 repressor protein in a blood sample
of the subject.
[0019] In accordance with another aspect of the present invention,
there is provided a method comprising: (a) identifying a subject
suspected of having osteoarthritis (OA); and (b) detecting the
synovial fluid concentration of a pitx1 repressor protein in a
synovial fluid sample of the subject.
[0020] In a specific embodiment of the methods, the osteoarthritis
is selected from the group consisting of knee joint arthritis, hip
joint arthritis and temporo-mandibular joints arthritis. In another
specific embodiment, the osteoarthritis is knee joint arthritis. In
another specific embodiment, the osteoarthritis is hip joint
arthritis.
[0021] In accordance with another aspect of the present invention,
there is provided a method of selecting a compound, said method
comprising (a) contacting a test compound with a cell sample
selected from the group consisting of an articular chondrocytes
sample, a growth plate chondrocytes sample, an osteoblasts sample,
a skeletal myoblasts sample and a synoviocytes sample; and (b)
determining a pitx1 repressor protein nuclear localization in the
cell sample; wherein the test compound is selected if the pitx1
repressor protein nuclear localization in the cell sample is
decreased in the presence of the candidate compound as compared to
in the absence thereof. In a specific embodiment, the selected test
compound is potentially useful in preventing accumulation or
retention of a pitx1 repressor protein in cell nuclei or in
promoting a pitx1 repressor protein nuclear export. In another
specific embodiment, the selected test compound is potentially
useful in the treatment of primary osteoarthritis. In another
specific embodiment, the pitx1 repressor protein is PHB-1. In
another specific embodiment, the pitx1 repressor protein is PHB-2.
In another specific embodiment, the pitx1 repressor protein is
BCoR.
[0022] In accordance with another aspect of the present invention,
there is provided a method of selecting a compound, said method
comprising the steps of (a) contacting a test compound with a cell
sample selected from the group consisting of an articular
chondrocytes sample, a growth plate chondrocytes sample, an
osteoblasts sample, a skeletal myoblasts sample and a synoviocytes
sample; and (b) measuring the binding of a pitx1 repressor protein
or complex on pitx1's E2F-like site in the cell sample, wherein the
test compound is selected if the binding of the pitx1 repressor
protein or complex on pitx1's E2F-like site in the cell sample is
decreased in the presence of the test compound as compared to in
the absence thereof. In a specific embodiment, the selected test
compound is potentially useful in the treatment of primary
osteoarthritis. In another specific embodiment, the pitx1 repressor
protein or complex comprises PHB-1. In another specific embodiment,
the pitx1 repressor protein or complex comprises PHB-2. In another
specific embodiment, the pitx1 repressor protein or complex
comprises BCoR. In another specific embodiment, said cell sample is
from a subject having osteoarthritis. In another specific
embodiment, said cell sample is an articular chondrocytes sample.
In another specific embodiment, said articular chondrocytes sample
is from a subject having osteoarthritis in a knee joint.
[0023] In accordance with another aspect of the present invention,
there is provided a method of identifying a mutation contributing
to osteoarthritis, comprising comparing the nucleotide sequence of
a gene selected from the group consisting of PHB-1 gene and PHB-2
gene, or of any gene encoding a protein causing the nuclear
accumulation or retention of PHB-1 or PHB-2 in articular
chondrocytes of a subject having osteoarthritis with that of the
corresponding gene in a control subject. In a specific embodiment,
said gene is the PHB-1 gene. In another specific embodiment, said
gene is the PHB-2 gene. In another specific embodiment, said
mutation is one affecting PHB-1 or PHB-2 DNA-binding and/or its
cellular localization.
[0024] In accordance with another aspect of the present invention,
there is provided a method for diagnosing osteoarthritis comprising
detecting in a subject the presence of a mutation directly or
indirectly causing the nuclear accumulation or retention of PHB-1
or PHB-2 in cells where PHB-1, PHB-2 or Pitx1 is normally
expressed, wherein the presence of the mutation is an indication
that the subject has or is at risk of developing osteoarthritis. In
a specific embodiment, said method comprises detecting a mutation
in CRM-1.
[0025] In accordance with another aspect of the present invention,
there is provided a method for diagnosing osteoarthritis comprising
detecting in a subject, the presence of at least one
post-translational modification directly or indirectly causing the
nuclear accumulation or retention of PHB-1 or PHB-2 in cells where
PHB-1, PHB-2 or Pitx1 is normally expressed, wherein the presence
of the at least one post-translational modification is an
indication that the subject has osteoarthritis.
[0026] In accordance with another aspect of the present invention,
there is provided a kit comprising an antibody specific to PHB-1 or
to PHB-2 and an antibody specific to BCoR. In a specific
embodiment, the kit further comprises instructions to use the
antibodies to predicting whether a subject is at risk for
developing osteoarthritis.
[0027] In accordance with another aspect of the present invention,
there is provided a purified repressor complex comprising BCoR and
at least one of PHB-1 and PHB-2. In a specific embodiment, the
repressor complex comprises BCoR and PHB-1. In another specific
embodiment, the repressor complex comprises BCoR and PHB-2. In
another specific embodiment, the repressor complex comprises BCoR,
PHB-1 and PHB-2.
[0028] In accordance with another aspect of the present invention,
there is provided a method of using the repressor complex of any
one of claims 32-34, for binding to a E2F-site. In a specific
embodiment, the E2F-site is that of pitx1 promoter.
[0029] In accordance with another aspect of the present invention,
there is provided a method comprising: determining the cellular
localization of a pitx1 repressor protein or complex selected from
the group consisting of prohibitin (PHB-1), prohibitone (PHB-2), B
cell lymphoma-6 transcriptional repressor interacting co-repressor
(BCoR), PHB-1-containing complex, PHB-2-containing complex and
BCoR-containing complex, in a subject cell sample selected from the
group consisting of an articular chondrocytes sample, a growth
plate chondrocytes sample, an osteoblasts sample, a skeletal
myoblasts sample and a synoviocytes sample.
[0030] In a specific embodiment, the method further comprises
determining whether the repressor protein or complex nuclear
concentration is higher in the subject cell sample as compared to
that in a control cell sample; wherein a higher repressor protein
or complex nuclear concentration in the subject cell sample is
indicative that the subject is at risk of developing
osteoarthritis.
[0031] In accordance with another aspect of the present invention,
there is provided a method comprising: (a) identifying a subject
suspected of having osteoarthritis (OA); and (b) detecting the
blood concentration of a pitx1 repressor protein or complex in a
blood sample of the subject.
[0032] In accordance with another aspect of the present invention,
there is provided a method comprising: (a) identifying a subject
suspected of having osteoarthritis (OA); and (b) detecting the
synovial fluid concentration of a pitx1 repressor protein or
complex in a synovial fluid sample of the subject.
[0033] In a specific embodiment, the osteoarthritis is selected
from the group consisting of knee joint arthritis, hip joint
arthritis and temporo-mandibular joints arthritis. In another
specific embodiment, the osteoarthritis is knee joint arthritis. In
another specific embodiment, the osteoarthritis is hip joint
arthritis.
[0034] In accordance with another aspect of the present invention,
there is provided a method of selecting a compound, said method
comprising (a) contacting a test compound with a cell sample
selected from the group consisting of an articular chondrocytes
sample, a growth plate chondrocytes sample, an osteoblasts sample,
a skeletal myoblasts sample and a synoviocytes sample; and (b)
determining a pitx1 repressor protein or complex nuclear
localization in the cell sample; wherein the test compound is
selected if the pitx1 repressor protein or complex nuclear
localization in the cell sample is decreased in the presence of the
candidate compound as compared to in the absence thereof.
[0035] In accordance with another aspect of the present invention,
there is provided a method of selecting a compound, said method
comprising (a) contacting a test compound with a cell sample
selected from the group consisting of an articular chondrocytes
sample, a growth plate chondrocytes sample, an osteoblasts sample,
a skeletal myoblasts sample and a synoviocytes sample; and (b)
assessing the sumoylation of a pitx1 repressor protein or complex
in the cell sample; wherein the test compound is selected if the
sumoylation of the pitx1 repressor protein or complex in the cell
sample is increased in the presence of the candidate compound as
compared to in the absence thereof.
[0036] In a specific embodiment, the selected test compound is
potentially useful in preventing accumulation or retention of the
pitx1 repressor protein or complex in cell nuclei or in promoting
the pitx1 repressor protein or complex nuclear export.
[0037] In accordance with another aspect of the present invention,
there is provided a method of selecting a compound, said method
comprising the steps of (a) contacting a test compound with a cell
sample selected from the group consisting of an articular
chondrocytes sample, a growth plate chondrocytes sample, an
osteoblasts sample, a skeletal myoblasts sample and a synoviocytes
sample; and (b) measuring the binding of a pitx1 repressor protein
or complex on pitx1's E2F-like site in the cell sample, wherein the
test compound is selected if the binding of the pitx1 repressor
protein or complex on pitx1's E2F-like site in the cell sample is
decreased in the presence of the test compound as compared to in
the absence thereof.
[0038] In a specific embodiment, the selected test compound is
potentially useful in the treatment of primary osteoarthritis. In
another specific embodiment, the pitx1 repressor protein or complex
comprises prohibitin (PHB-1). In another specific embodiment, the
pitx1 repressor protein or complex comprises prohibitone (PHB-2).
In another specific embodiment, the pitx1 repressor protein or
complex comprises B cell lymphoma-6 transcriptional repressor
interacting co-repressor (BCoR). In another specific embodiment,
the pitx1 repressor protein is prohibitin (PHB-1). In another
specific embodiment, the pitx1 repressor protein is prohibitone
(PHB-2). In another specific embodiment, the pitx1 repressor
protein is B cell lymphoma-6 transcriptional repressor interacting
co-repressor (BCoR). In another specific embodiment, said cell
sample is from a subject having osteoarthritis. In another specific
embodiment, said cell sample is an articular chondrocytes sample.
In another specific embodiment, said articular chondrocytes sample
is from a subject having osteoarthritis in a knee joint.
[0039] In accordance with another aspect of the present invention,
there is provided a method of identifying a mutation contributing
to osteoarthritis, comprising comparing the nucleotide sequence of
a gene selected from the group consisting of prohibitin (PHB-1)
gene, prohibitone (PHB-2) gene, B cell lymphoma-6 transcriptional
repressor interacting co-repressor (BCoR) gene or of any gene
encoding a protein causing the nuclear accumulation or retention of
PHB-1, PHB-2 or BCoR in articular chondrocytes of a subject having
osteoarthritis with that of the corresponding gene in a control
subject.
[0040] In a specific embodiment, said gene is the PHB-1 gene. In
another specific embodiment, said gene is the PHB-2 gene. In
another specific embodiment, said mutation is one affecting PHB-1
or PHB-2 DNA-binding and/or its cellular localization.
[0041] In accordance with another aspect of the present invention,
there is provided a method for predicting the risk of developing
osteoarthritis comprising detecting in a subject the presence of a
mutation directly or indirectly causing the nuclear accumulation or
retention of prohibitin (PHB-1), prohibitone (PHB-2) or B cell
lymphoma-6 transcriptional repressor interacting co-repressor
(BCoR) in cells where PHB-1, PHB-2, BCoR or Pitx1 is normally
expressed, wherein the presence of the mutation is an indication
that the subject has or is at risk of developing
osteoarthritis.
[0042] In a specific embodiment, said method comprises detecting a
mutation in CRM-1.
[0043] In accordance with another aspect of the present invention,
there is provided a method of identifying a post-translational
modification contributing to osteoarthritis, comprising comparing
the post-translational modification of a protein selected from the
group consisting of prohibitin (PHB-1) and prohibitone (PHB-2), B
cell lymphoma-6 transcriptional repressor interacting co-repressor
(BCoR) or of any protein causing the nuclear accumulation or
retention of PHB-1, PHB-2 or BCoR in articular chondrocytes of a
subject having osteoarthritis with that of the corresponding gene
in a control subject.
[0044] In accordance with another aspect of the present invention,
there is provided a method for predicting the risk of developing
osteoarthritis comprising detecting in a subject, the presence of
at least one post-translational modification directly or indirectly
causing the nuclear accumulation or retention of prohibitin
(PHB-1), prohibitone (PHB-2) or B cell lymphoma-6 transcriptional
repressor interacting co-repressor (BCoR) in cells where PHB-1,
PHB-2 or Pitx1 is normally expressed, wherein the presence of the
at least one post-translational modification is an indication that
the subject has or is at risk of developing osteoarthritis.
[0045] In accordance with another aspect of the present invention,
there is provided a kit comprising an antibody specific to
prohibitin (PHB-1) or to prohibitone (PHB-2) and an antibody
specific to B cell lymphoma-6 transcriptional repressor interacting
co-repressor (BCoR).
[0046] In a specific embodiment, the kit of further comprises
instructions to use the antibodies to predict whether a subject is
at risk for developing osteoarthritis.
[0047] In accordance with another aspect of the present invention,
there is provided a purified repressor complex comprising B cell
lymphoma-6 transcriptional repressor interacting co-repressor
(BCoR) and at least one of prohibitin (PHB-1) and prohibitone
(PHB-2).
[0048] In a specific embodiment, the repressor complex comprises
BCoR and PHB-1. In another specific embodiment, the repressor
complex comprises BCoR and PHB-2. In another specific embodiment,
the repressor complex comprises BCoR, PHB-1 and PHB-2.
[0049] In accordance with another aspect of the present invention,
there is provided a method of using the repressor complex of the
present invention, for binding to a E2F-site. In a specific
embodiment, the E2F-site is that of pitx1 promoter.
[0050] The articles "a," "an" and "the" are used herein to refer to
one or to more than one (i.e., to at least one) of the grammatical
object of the article.
[0051] The term "including" and "comprising" are used herein to
mean, and re used interchangeably with, the phrases "including but
not limited to" and "comprising but not limited to".
[0052] The terms "such as" are used herein to mean, and is used
interchangeably with, the phrase "such as but not limited to".
[0053] As used herein the term "osteoarthritis" refers to a form of
arthritis involving the deterioration of the cartilage that
cushions the ends of bones within joints. It is also called
degenerative arthritis, degenerative joint disease or hypertrophic
arthritis. This term includes early onset of osteoarthritis.
Worldwide, osteoarthritis is the most common joint disorder. In
western countries, radiographic evidence of this disease is present
in the majority of persons by 65 years of age and in about 80
percent of persons more than 75 years of age (33). Approximately 11
percent of persons more than 64 years of age have symptomatic
osteoarthritis of the knee (34).
[0054] As used herein the terms "early onset of osteoarthritis"
refer to a form of osteoarthritis that either is first diagnosed at
40 years of age or earlier or that leads to knee joint replacement
of the subject before he is 55 years old.
[0055] As used herein the terms "risk of developing osteoarthritis"
refers to a predisposition of a subject of presenting primary OA
symptoms and/or more severe primary OA symptoms at a future time.
Similarly, the "risk of developing osteoarthritis in a joint where
Pitx1 is normally expressed" refers to a risk for a subject of
presenting primary OA symptoms, and/or more severe primary OA
symptoms at a future time in a joint where Pitx1 is normally
expressed.
[0056] As used herein the terms "primary OA" when used to qualify
knee/hip joint OA refers to knee/hip joint OA due to a disease or
degeneration for instance as opposed to secondary knee/hip joint OA
resulting from trauma, joint overuse, obesity, etc.
[0057] As used herein the term "subject" is meant to refer to any
mammal including human, mice, rat, dog, cat, pig, monkey, horse,
etc. In a particular embodiment, it refers to a human. In another
particular embodiment, it refers to a horse and more specifically a
racing horse.
[0058] As used herein the terms "control DNA sample" are meant to
refer to a genomic DNA that does not come from a subject known to
suffer from osteoarthritis (OA) (control subject). In reference to
either cartilage sections or articular chondrocytes obtained from
OA versus control subjects, these controls subjects are age-matched
individuals unaffected by OA as tested at the time of autopsy or at
the time of biopsy when knee joints or hip joints are obtained
after a trauma.
[0059] As used herein the terms "predisposition for developing a
disease or condition" refers to a predisposition of a subject of
presenting symptoms of the disease or condition and/or more severe
symptoms of the disease or conditions at a future time.
[0060] As used herein the terms "control sample" are meant to refer
to a sample that does not come from a subject known to suffer from
the disease or disorder or from the subject under scrutiny but
before the subject had the disease or disorder. In methods of
diagnosing a predisposition of a subject to develop a disease or
disorder, the sample may also come from the subject under scrutiny
at an earlier stage of the disease or disorder.
[0061] As used herein the terms "subject DNA sample" are meant to
refer to any biological sample from the subject from whom genomic
DNA can be extracted, namely any subject tissue or cell type
including saliva and blood.
[0062] As used herein the terms "cell sample" are meant to refer to
a sample containing any type of cell wherein, in a subject affected
by OA, PHB-1, PHB-2 and/or BCoR (also known as BCL-6 interacting
corepressor, wherein BCL-6 stands for B cell lymphoma-6
transcriptional repressor) pathologically accumulates in the cell
nuclei. Without being so limited, it includes articular
chondrocytes, growth plate chondrocytes, osteoblasts, skeletal
myoblasts and synoviocytes. As used herein the terms "articular
chondrocyte" are meant to refer to chondrocytes found in
joints.
[0063] As used herein the terms "not clinically diagnosed with
osteoarthritis" are meant to refer to a subject that was never
diagnosed with OA using a clinical method such as an imaging method
like X-ray, and magnetic resonance imaging (MRI). In particular,
for diagnosing hip OA, a current clinical method recommended by the
American College of Rheumatology includes hip pain and at least 2
of the following 3 features: ESR<20 mm/hour; radiographic
femoral or acetabular osteophytes; and radiographic joint space
narrowing (superior, axial, and/or medial). In particular, for
diagnosing knee OA, there are three methods currently recommended
by the American College of Rheumatology 1) Clinical and laboratory
method: knee pain and at least 5 of the following 9 features:
age>50 years, stiffness<30 minutes, crepitus, bony
tenderness, bony enlargement, no palpable warmth, ESR<40
mm/hour, RF<1:40; and SF OA; 2) Clinical and radiographic: knee
pain, and at least 2 of the following 3 features, Age>50 years;
stiffness<30 minutes; crepitus; +osteophytes; and 3) Clinical:
knee pain and at least 3 of the following 6 features: age>50
years, stiffness<30 minutes, crepitus, bony tenderness, bony
enlargement, no palpable warmth.
[0064] As used herein the terminology "purified", "isolated",
"purification" or "isolation" in the expressions "purified
polypeptide", "isolated polypeptide", "isolated protein", "purified
complexes", "isolated complexes" or "tandem affinity purification"
means altered "by the hand of man" from its natural state (i.e. if
it occurs in nature, it has been changed or removed from its
original environment) or it has been synthesized in a non-natural
environment (e.g., artificially synthesized). These terms do not
require absolute purity (such as a homogeneous preparation) but
instead represents an indication that it is relatively more pure
than in the natural environment. For example, a protein/peptide
naturally present in a living organism is not "purified" or
"isolated", but the same protein separated (about 90-95% pure at
least) from the coexisting materials of its natural state is
"purified" or "isolated" as this term is employed herein.
[0065] As used herein, the term "antibody" or refers to an antibody
that specifically binds to (interacts with) a protein of the
present invention and displays no substantial binding to other
naturally occurring proteins other than the ones sharing the same
antigenic determinants. The term antibody or immunoglobulin is used
in the broadest sense, and covers monoclonal antibodies (including
full length monoclonal antibodies), polyclonal antibodies,
multispecific antibodies, and antibody fragments so long as they
exhibit the desired biological activity. Antibody fragments
comprise a portion of a full length antibody, generally an antigen
binding or variable region thereof. Examples of antibody fragments
include Fab, Fab', F(ab')2, and Fv fragments, diabodies, linear
antibodies, single-chain antibody molecules, single domain
antibodies (e.g., from camelids), shark NAR single domain
antibodies, and multispecific antibodies formed from antibody
fragments. Antibody fragments can also refer to binding moieties
comprising CDRs or antigen binding domains including, but not
limited to, VH regions (VH, VH-VH), anticalins, PepBodies.TM.,
antibody-T-cell epitope fusions (Troybodies) or Peptibodies.
Additionally, any secondary antibodies, either monoclonal or
polyclonal, directed to the first antibodies would also be included
within the scope of this invention.
[0066] In general, techniques for preparing antibodies (including
monoclonal antibodies and hybridomas) and for detecting antigens
using antibodies are well known in the art (Campbell, 1984, In
"Monoclonal Antibody Technology: Laboratory Techniques in
Biochemistry and Molecular Biology", Elsevier Science Publisher,
Amsterdam, The Netherlands) and in Harlow et al., 1988 (in:
Antibody A Laboratory Manual, CSH Laboratories). The term antibody
encompasses herein polyclonal, monoclonal antibodies and antibody
variants such as single-chain antibodies, humanized antibodies,
chimeric antibodies and immunologically active fragments of
antibodies (e.g. Fab and Fab' fragments) which inhibit or
neutralize their respective interaction domains in Hyphen and/or
are specific thereto.
Diagnostic or Prognostic Methods
[0067] A method for diagnosing or screening for the presence of a
disease or disorder or a predisposition for developing the disease
or disorder in a subject, which disease or disorder is
characterized by an aberrant amount, activity, protein composition,
intracellular localization and/or formation of a complex,
comprising the steps of: (1) comparing the amount of, activity of,
protein composition of, intracellular localization of, and/or
formation of said complex in a sample from the subject with that in
a control sample, wherein a difference in said amount, activity,
protein composition of, intracellular localization and/or formation
of said complex as compared to that in the control sample is
indicative that the subject has the disease or disorder or a
predisposition for developing the disease or condition.
[0068] In a specific embodiment, the control sample is selected
from a sample from the subject at an earlier stage of the disease
or disorder or before the subject had the disease. In another
embodiment, the control sample is from a different subject that
does not have the disease or disorder or predisposition to develop
the disease or condition.
[0069] As used herein the terms "corresponding to" in the
expression "a mutation corresponding to -3727 C.fwdarw.T" are meant
to reflect the fact that the C.fwdarw.T mutation occurring in the
E2F-like site of the human pitx1 promoter may be found in certain
subjects at a position that is upstream or downstream from the
position -3727. Indeed, because of polymorphism in the pitx1
promoter within the population, the C.fwdarw.T mutation may be at a
position other than 3727 nucleotides upstream of the transcription
point of pitx1. For instance if, as compared to subjects wherein
the C.fwdarw.T mutation occurs at position -3727, a subject has a
deletion of one nucleotide between the transcription point of pitx1
and the position where the mutation in the E2F-like site of the
human pitx1 promoter occurs, then the position of the mutation will
be -3726 in that subject. Similarly as compared to subjects wherein
the C.fwdarw.T mutation occurs at position -3727, a subject that
possesses an additional nucleotide in the region of interest, the
position of the mutation will be -3728 in that subject. The method
of the present invention thus encompasses determining whether there
is a C.fwdarw.T mutation in the E2F-like site of the pitx1 promoter
at a position that corresponds to that found at position -3727
C.fwdarw.T in the subjects tested in the Examples presented herein.
Also as used herein, the terms "corresponding to" in the expression
"a mutation corresponding to -3727 C.fwdarw.T" is meant to
encompass a G.fwdarw.A mutation found in the strand complementary
to that containing the -3727 C-T mutation.
[0070] Other mutations encompass by the present invention include
any other mutation within or adjacent the core binding site of the
E2F-like site found in human pitx1 promoter that could prevent the
binding of E2Fs or enhance the recruitment and/or stabilization of
a repressor complex reducing or abrogating Pitx1 gene
expression.
[0071] As used herein, the terms "joint where Pitx1 is normally
expressed" are meant to refer to, without being so limited, knee
joint and hip joint.
[0072] The present invention encompasses methods for identifying a
mutation corresponding to -3727 C.fwdarw.T within an E2F-like site
in one strand of subject pitx1 promoter. Such methods include,
without being so limited, Wave nucleic acid fragment analysis
(dHPLC) and direct sequencing on PCR fragments amplified from
genomic DNA isolated from subjects.
[0073] The present invention also relates to methods for the
determination of the level of expression of transcripts or
translation product of a single gene such as pitx1. The present
invention therefore encompasses any known method for such
determination including real time PCR and competitive PCR, Northern
blots, nuclease protection, plaque hybridization and slot
blots.
[0074] The present invention also concerns isolated nucleic acid
molecules including probes. In specific embodiments, the isolated
nucleic acid molecules have no more than 300, or no more than 200,
or no more than 100, or no more than 90, or no more than 80, or no
more than 70, or no more than 60, or no more than 50, or no more
than 40 or no more than 30 nucleotides. In specific embodiments,
the isolated nucleic acid molecules have at least 20, or at least
30, or at least 40 nucleotides. In other specific embodiments, the
isolated nucleic acid molecules have at least 20 and no more than
300 nucleotides. In other specific embodiments, the isolated
nucleic acid molecules have at least 20 and no more than 200
nucleotides. In other specific embodiments, the isolated nucleic
acid molecules have at least 20 and no more than 100 nucleotides.
In other specific embodiments, the isolated nucleic acid molecules
have at least 20 and no more than 90 nucleotides. In other specific
embodiments, the isolated nucleic acid molecules have at least 20
and no more than 80 nucleotides. In other specific embodiments, the
isolated nucleic acid molecules have at least 20 and no more than
70 nucleotides. In other specific embodiments, the isolated nucleic
acid molecules have at least 20 and no more than 60 nucleotides. In
other specific embodiments, the isolated nucleic acid molecules
have at least 20 and no more than 50 nucleotides. In other specific
embodiments, the isolated nucleic acid molecules have at least 20
and no more than 40 nucleotides. In other specific embodiments, the
isolated nucleic acid molecules have at least 20 and no more than
30 nucleotides. In other specific embodiments, the isolated nucleic
acid molecules have at least 30 and no more than 300 nucleotides.
In other specific embodiments, the isolated nucleic acid molecules
have at least 30 and no more than 200 nucleotides. In other
specific embodiments, the isolated nucleic acid molecules have at
least 30 and no more than 100 nucleotides. In other specific
embodiments, the isolated nucleic acid molecules have at least 30
and no more than 90 nucleotides. In other specific embodiments, the
isolated nucleic acid molecules have at least 30 and no more than
80 nucleotides. In other specific embodiments, the isolated nucleic
acid molecules have at least 30 and no more than 70 nucleotides. In
other specific embodiments, the isolated nucleic acid molecules
have at least 30 and no more than 60 nucleotides. In other specific
embodiments, the isolated nucleic acid molecules have at least 30
and no more than 50 nucleotides. In other specific embodiments, the
isolated nucleic acid molecules have at least 30 and no more than
40 nucleotides.
[0075] Probes of the invention can be utilized with naturally
occurring sugar-phosphate backbones as well as modified backbones
including phosphorothioates, dithionates, alkyl phosphonates and
.alpha.-nucleotides and the like. Modified sugar-phosphate
backbones are generally known (62,63). Probes of the invention can
be constructed of either ribonucleic acid (RNA) or deoxyribonucleic
acid (DNA), and preferably of DNA.
[0076] The types of detection methods in which probes can be used
include Southern blots (DNA detection), dot or slot blots (DNA,
RNA), and Northern blots (RNA detection). Although less preferred,
labeled proteins could also be used to detect a particular nucleic
acid sequence to which it binds. Other detection methods include
kits containing probes on a dipstick setup and the like.
[0077] As used herein the terms "detectably labeled" refer to a
marking of a probe in accordance with the presence invention that
will allow the detection of the mutation of the present invention.
Although the present invention is not specifically dependent on the
use of a label for the detection of a particular nucleic acid
sequence, such a label might be beneficial, by increasing the
sensitivity of the detection. Furthermore, it enables automation.
Probes can be labeled according to numerous well known methods
(64). Non-limiting examples of labels include 3H, 14C, 32P, and
35S, Non-limiting examples of detectable markers include ligands,
fluorophores, chemiluminescent agents, enzymes, and antibodies.
Other detectable markers for use with probes, which can enable an
increase in sensitivity of the method of the invention, include
biotin and radionucleotides. It will become evident to the person
of ordinary skill that the choice of a particular label dictates
the manner in which it is bound to the probe.
[0078] As commonly known, radioactive nucleotides can be
incorporated into probes of the invention by several methods.
Non-limiting examples thereof include kinasing the 5' ends of the
probes using gamma 32P ATP and polynucleotide kinase, using the
Klenow fragment of Pol I of E. coli in the presence of radioactive
dNTP (e.g. uniformly labeled DNA probe using random oligonucleotide
primers in low-melt gels), using the SP6/T7 system to transcribe a
DNA segment in the presence of one or more radioactive NTP, and the
like.
[0079] The present invention also relates to methods of selecting
compounds. As used herein the term "compound" is meant to encompass
natural, synthetic or semi-synthetic compounds, including without
being so limited chemicals, macromolecules, cell or tissue extracts
(from plants or animals), nucleic acid molecules, peptides,
antibodies and proteins.
[0080] The present invention also relates to arrays. As used
herein, an "array" is an intentionally created collection of
molecules which can be prepared either synthetically or
biosynthetically. The molecules in the array can be identical or
different from each other. The array can assume a variety of
formats, e.g., libraries of soluble molecules; libraries of
compounds tethered to resin beads, silica chips, or other solid
supports.
[0081] As used herein "array of nucleic acid molecules" is an
intentionally created collection of nucleic acids which can be
prepared either synthetically or biosynthetically in a variety of
different formats (e.g., libraries of soluble molecules; and
libraries of oligonucleotides tethered to resin beads, silica
chips, or other solid supports). Additionally, the term "array" is
meant to include those libraries of nucleic acids which can be
prepared by spotting nucleic acids of essentially any length (e.g.,
from 1 to about 1000 nucleotide monomers in length) onto a
substrate. The term "nucleic acid" as used herein refers to a
polymeric form of nucleotides of any length, either
ribonucleotides, deoxyribonucleotides or peptide nucleic acids
(PNAs), that comprise purine and pyrimidine bases, or other
natural, chemically or biochemically modified, non-natural, or
derivatized nucleotide bases. The backbone of the polynucleotide
can comprise sugars and phosphate groups, as may typically be found
in RNA or DNA, or modified or substituted sugar or phosphate
groups. A polynucleotide may comprise modified nucleotides, such as
methylated nucleotides and nucleotide analogs. The sequence of
nucleotides may be interrupted by non-nucleotide components. Thus
the terms nucleoside, nucleotide, deoxynucleoside and
deoxynucleotide generally include analogs such as those described
herein. These analogs are those molecules having some structural
features in common with a naturally occurring nucleoside or
nucleotide such that when incorporated into a nucleic acid or
oligonucleotide sequence, they allow hybridization with a naturally
occurring nucleic acid sequence in solution. Typically, these
analogs are derived from naturally occurring nucleosides and
nucleotides by replacing and/or modifying the base, the ribose or
the phosphodiester moiety. The changes can be tailor made to
stabilize or destabilize hybrid formation or enhance the
specificity of hybridization with a complementary nucleic acid
sequence as desired.
[0082] As used herein "solid support", "support", and "substrate"
are used interchangeably and refer to a material or group of
materials having a rigid or semi-rigid surface or surfaces. In many
embodiments, at least one surface of the solid support will be
substantially flat, although in some embodiments it may be
desirable to physically separate synthesis regions for different
compounds with, for example, wells, raised regions, pins, etched
trenches, or the like. According to other embodiments, the solid
support(s) will take the form of beads, resins, gels, microspheres,
or other geometric configurations.
[0083] Any known nucleic acid arrays can be used in accordance with
the present invention. For instance, such arrays include those
based on short or longer oligonucleotide probes as well as cDNAs or
polymerase chain reaction (PCR) products (52). Other methods
include serial analysis of gene expression (SAGE), differential
display, (53) as well as subtractive hybridization methods (54),
differential screening (DS), RNA arbitrarily primer (RAP)-PCR,
restriction endonucleolytic analysis of differentially expressed
sequences (READS), amplified restriction fragment-length
polymorphisms (AFLP).
[0084] "Stringent hybridization conditions" and "stringent
hybridization wash conditions" in the context of nucleic acid
hybridization experiments such as Southern and Northern
hybridization are sequence dependent, and are different under
different environmental parameters. The T.sub.m is the temperature
(under defined ionic strength and pH) at which 50% of the target
sequence hybridizes to a perfectly matched probe. Specificity is
typically the function of post-hybridization washes, the critical
factors being the ionic strength and temperature of the final wash
solution. For DNA-DNA hybrids, the T.sub.m can be approximated from
the equation of Meinkoth and Wahl, 1984; T.sub.m 81.5.degree.
C.+16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the
molarity of monovalent cations, % GC is the percentage of guanosine
and cytosine nucleotides in the DNA, % form is the percentage of
formamide in the hybridization solution, and L is the length of the
hybrid in base pairs. T.sub.m is reduced by about 1.degree. C. for
each 1% of mismatching; thus, T.sub.m, hybridization, and/or wash
conditions can be adjusted to hybridize to sequences of the desired
identity. For example, if sequences with >90% identity are
sought, the T.sub.m can be decreased 10.degree. C. Generally,
stringent conditions are selected to be about 5.degree. C. lower
than the thermal melting point I for the specific sequence and its
complement at a defined ionic strength and pH. However, severely
stringent conditions can utilize a hybridization and/or wash at 1,
2, 3, or 4.degree. C. lower than the thermal melting point I;
moderately stringent conditions can utilize a hybridization and/or
wash at 6, 7, 8, 9, or 10.degree. C. lower than the thermal melting
point I; low stringency conditions can utilize a hybridization
and/or wash at 11, 12, 13, 14, 15, or 20.degree. C. lower than the
thermal melting point I. Using the equation, hybridization and wash
compositions, and desired T, those of ordinary skill will
understand that variations in the stringency of hybridization
and/or wash solutions are inherently described. If the desired
degree of mismatching results in a T of less than 45.degree. C.
(aqueous solution) or 32.degree. C. (formamide solution), it is
preferred to increase the SSC concentration so that a higher
temperature can be used. An extensive guide to the hybridization of
nucleic acids is found in Tijssen, 1993. Generally, highly
stringent hybridization and wash conditions are selected to be
about 5.degree. C. lower than the thermal melting point T.sub.m for
the specific sequence at a defined ionic strength and pH.
[0085] An example of highly stringent wash conditions is 0.15 M
NaCl at 72.degree. C. for about 15 minutes. An example of stringent
wash conditions is a 0.2.times.SSC wash at 65.degree. C. for 15
minutes (see 64 for a description of SSC buffer). Often, a high
stringency wash is preceded by a low stringency wash to remove
background probe signal. An example medium stringency wash for a
duplex of, e.g., more than 100 nucleotides, is 1.times.SSC at
45.degree. C. for 15 minutes. An example low stringency wash for a
duplex of, e.g., more than 100 nucleotides, is 4-6.times.SSC at
40.degree. C. for 15 minutes. For short probes (e.g., about 10 to
50 nucleotides), stringent conditions typically involve salt
concentrations of less than about 1.5 M, more preferably about 0.01
to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8.3,
and the temperature is typically at least about 30.degree. C. and
at least about 60.degree. C. for long robes (e.g., >50
nucleotides). Stringent conditions may also be achieved with the
addition of destabilizing agents such as formamide. In general, a
signal to noise ratio of 2.times. (or higher) than that observed
for an unrelated probe in the particular hybridization assay
indicates detection of a specific hybridization. Nucleic acids that
do not hybridize to each other under stringent conditions are still
substantially identical if the proteins that they encode are
substantially identical. This occurs, e.g., when a copy of a
nucleic acid is created using the maximum codon degeneracy
permitted by the genetic code.
[0086] Very stringent conditions are selected to be equal to the
T.sub.m for a particular probe. An example of stringent conditions
for hybridization of complementary nucleic acids which have more
than 100 complementary residues on a filter in a Southern or
Northern blot is 50% formamide, e.g., hybridization in 50%
formamide, 1 M NaCl, 1% SDS at 37.degree. C., and a wash in
0.1.times.SSC at 60 to 65.degree. C. Exemplary low stringency
conditions include hybridization with a buffer solution of 30 to
35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at
37.degree. C., and a wash in 1.times. to 2.times.SSC
(20.times.SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to
55.degree. C. Exemplary moderate stringency conditions include
hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at
37.degree. C., and a wash in 0.5.times. to 1.times.SSC at 55 to
60.degree. C.
[0087] Washing with a solution containing tetramethylammonium
chloride (TeMAC) could allow the detection of a single mismatch
using oligonucleotide hybridization since such mismatch could
generate a 10.degree. C. difference in the annealing temperature.
The formulation to determine the washing temperature is Tm
(.degree. C.)=]-682 (L.sup.-1)+97 where L represents the length of
the oligonucleotide that will be used for the hybridization. When
the oligonucleotide of the present invention has a length of 20
nucleotides: 5'-TCACTGGTGGCAGTCCTGCT-3' (SEQ ID NO: 2), underscore
indicating the mutation, the hybridization is performed 5.degree.
C. below the Tm which is calculated using the formula above at
62.9.degree. C. In principle, a single mismatch will generate a
10.degree. C. drop in the annealing so that a temperature of
57.degree. C. should only detect mutants harbouring the T mutation.
Such conditions are high stringency conditions appropriate to
identify a single nucleotide mutation in the 20 nucleotides probes
of the present invention (56).
[0088] As used herein the terms "repressor protein" when used in
relation to the E2F-like site of the pitx1 promoter region refer to
any protein that alone and/or in combination with other proteins
lowers or represses expression of Pitx1. Without being so limited,
they include BCoR, PHB-1, PHB-2, combination thereof and any
interacting partner of PHB-1, PHB-2 and/or BCoR including those
disclosed in Table 1 above. As used herein the term "BCoR
repressing activity on pitx1" or "PHB-1 repressing activity on
pitx1" or "PHB-2 repressing activity on pitx1" is thus meant to
refer to the activity of any of these proteins leading to decreased
expression of Pitx1.
[0089] As used herein the terms "repressor complex" when used in
relation to the E2F-like site of the pitx1 promoter region refers
to a combination of repressor proteins that lowers or represses
expression of Pitx1.
[0090] The present invention also encompasses arrays to detect
and/or quantify the nuclear localization of proteins including
PHB-1, PHB-2 and/or BCoR. Such arrays include protein micro- or
macroarrays, gel technologies including high-resolution 2D-gel
methodologies, possibly coupled with mass spectrometry (55),
imaging system at the cellular level such as microscopy combined
with a fluorescent labeling system.
[0091] The present invention also includes the use of tissue biopsy
to determine the nuclear accumulation of PHB-1, PHB-2 and BCoR
within articular chondrocytes, growth plate chondrocytes,
osteoblasts, skeletal myoblasts and synoviocytes. For instance,
cartilage biopsy could be performed during arthroscopy procedure to
assess OA or its progression by immunofluorescence microscopy to
determine the nuclear localization of PHB-1, PHB-2 and/or BCoR.
This method could be useful for instance when arthroscopy procedure
is required to establish a clinical diagnostic. Alternatively, a
muscle biopsy in lower limbs could be used to test whether or not
PHB-1 and/or PHB-2 are accumulated in the nuclei of myoblasts. This
method would advantageously be less invasive than a regular
arthroscopy. The determination of the cellular localization or
concentration of a pitx1 repressor protein is typically performed
either by a) preparing a nuclear extract of a subject sample and
determining concentration of a pitx1 repressor protein; or by (b)
determining the localization of the pitx1 repressor protein by
immunohistochemistry.
[0092] In accordance with the present invention, an increased pitx1
repressor protein nuclear localization in a subject may be the sign
of an increased binding/affinity of the repressor protein to the
pitx1's E2F-like site, of an increased nuclear entry/import of the
repressor protein or a decreased nuclear export of the repressor
protein. The present invention also relates to methods of selecting
a compound. Hence, a compound tested with specific embodiments of
methods of selecting compounds of the present invention that
results in a decreased pitx1 repressor protein nuclear localization
may be a compound that decreases binding/affinity of the repressor
protein to the pitx1's E2F-like site, that decreases nuclear
entry/import of the repressor protein or that increases nuclear
export of the repressor protein.
[0093] The present invention also encompasses methods for
identifying specific mutation(s) directly or indirectly affecting
the function of PHB-1 and/or PHB-2. Without being so limited,
mutations of interest include any mutation affecting the transport
of these proteins outside the nucleus, or modifying the
interactions between PHB-1 and/or PHB-2.
[0094] As used herein, the terms "mutation directly or indirectly
causing the nuclear accumulation or retention of PHB-1, PHB-2 or
BcoR in cells where PHB-1, PHB-2, BCoR or Pitx1 is normally
expressed" are meant to refer to, without being so limited, a
mutation within the NES (nuclear export sequences) of PHB-1, PHB-2
or BCoR; a mutation modulating the formation of homomeric and
heteromeric complexes between PHB-1, BCoR and/or PHB-2 resulting in
the masking of their respective NES or reducing their accessibility
to exportin-1 (also know as CRM-1); a mutation affecting the
expression and/or function of exportin-1; a mutation affecting the
formation of a ternary complex with CRM-1/exportin 1 and GTP-bound
form of Ran in the nucleus; a mutation affecting TGF-.beta.
signaling including a mutation affecting binding of TGF-.beta. with
asporin, a cartilage extracellular protein elevated in OA
cartilage; a mutation affecting the PHB-1 or PHB-2 recruitment of
Brg-1/Brm to E2F-responsive promoters; a mutation affecting JNK1's
ability to promote PHB-1's association with Brg-1 or Brn on
E2F-responsive promoters; a mutation affecting Akt's binding to
PHB-1-PHB-2 or Akt's ability to enter the nucleus. It also refers
to any mutations in molecules interacting with PHB-1, BCoR and/or
PHB-2, which could prevent the nuclear export of PHB-1 and/or
PHB-2. The list of known interacting partners of PHB-1 and PHB-2 is
indicated in Table 1 but it is not limited to the molecules
indicated in this Table 1.
TABLE-US-00001 TABLE 1 LIST OF PROTEINS INTERACTING WITH PHB-1
AND/OR PHB-2 PHB-1 PHB-2 AR (37) Akt (38) Brg-1 (39) ER (40) Brm
(39) HDAC1 (41) CRM-1 (42) HDAC5 (41) E2F1 (43) NR2F1 (41) ER (44)
NR2F2 (41) HDAC1 (45) PHB-1 (46) HP1 (47) JNK1 (47) MLK2 (48) N-CoR
(45) p53 (49) PHB-2 (46) Raf (50) Rb (51)
[0095] As used herein the terms "post-translational modification
directly or indirectly causing the nuclear accumulation or
retention of PHB-1, PHB-2 or BCoR in cells where PHB-1, PHB-2, BCoR
or Pitx1 is normally expressed" includes, without being so limited,
a post-translational modification including phosphorylation with
kinases such as JNK1, tyrosine kinases such as MTOR, PAK, EGFR
and/or JAK, ubiquitinylation or sumoylation modulating the
formation of homomeric and heteromeric complexes between PHB-1,
PHB-2 and/or BCoR resulting in the masking of their respective NES
or reducing their accessibility to exportin-1.
[0096] The present invention relates to a kit for diagnosing OA
and/or predicting whether a subject is at risk of developing OA
comprising an isolated nucleic acid, a protein or a ligand such as
an antibody in accordance with the present invention. For example,
a compartmentalized kit in accordance with the present invention
includes any kit in which reagents are contained in separate
containers. Such containers include small glass containers, plastic
containers or strips of plastic or paper. Such containers allow the
efficient transfer of reagents from one compartment to another
compartment such that the samples and reagents are not
cross-contaminated and the agents or solutions of each container
can be added in a quantitative fashion from one compartment to
another. Such containers will include a container which will accept
the subject sample (DNA genomic nucleic acid, cell sample or blood
samples), a container which contains in some kits of the present
invention, the probes used in the methods of the present invention,
containers which contain enzymes, containers which contain wash
reagents, and containers which contain the reagents used to detect
the extension products. The present invention also relates to a kit
comprising the antibodies which are specific to pitx1 repressors.
Kits of the present invention may also contain instructions to use
these probes and or antibodies to diagnose OA or predict whether a
subject is at risk of developing OA.
[0097] Other objects, advantages and features of the present
invention will become more apparent upon reading of the following
non-restrictive description of specific embodiments thereof, given
by way of example only with reference to the accompanying
drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0098] In the appended drawings:
[0099] FIGS. 1A-D show a bone histology from a distal end of right
femur of 7-month old normal mouse (wt) and pitx1+/- (ht). Goldner
staining shows in bone and calcified tissues as green and cartilage
and bone marrow cells as red. A representative section of
subchondral, cortical and trabecular bone thickening observed in
pitx1+/- mice (FIG. 1B) as compared to wild-type ones (FIG. 1A) At
higher magnification, a substantial increase in fibrillation and
calcification is observed in the articular cartilage of
heterozygous mice (FIG. 1D) as compared to wild-type ones (FIG.
1D). Note that original magnification of FIG. 1A and FIG. 1B) is
.times.5 and FIG. 1C and FIG. 1D) is .times.20;
[0100] FIGS. 2A-D compare Pitx1 expression in articular
chondrocytes from OA patients and matched control subjects. (FIG.
1A) Reverse transcription-polymerase chain reaction for pitx1 gene
expression in human articular chondrocytes derived from knee
cartilage of control subjects (N, n=4) and patients with
osteoarthritis (OA, n=7). Pitx1 specific mRNA transcripts were
detected in all control tissues (N-1-N4). Loss of the pitx1 gene
expression was observed in all examined OA samples (OA1-OA7) and
.beta.-actin expression was used as internal control.
Immunodetection of Pitx1 proteins in human control (FIG. 1B) and OA
(FIG. 1C) cartilage tissues was performed using a specific antibody
against human Pitx1 protein. In control cartilage sections (n=8),
specific immunoreactivity was demonstrated by intense brown
staining in nucleus of chondrocytes of the superficial and deep
zones (arrow). In OA cartilage (n=8), only a few cells stained
specifically for Pitx1. These were located mainly in the
superficial layer (arrow). The specificity of staining was
evaluated by omission of the primary antibody and by substitution
of the primary antibody with non-immune IgG (Nordic Immunology,
Tilburg, The Netherlands) following the same experimental protocol.
No staining was observed. (Original magnification.times.20). (FIG.
1D) Cell scores for Pitx1-positive chondrocytes, indicating
significant differences between OA and normal (control) cartilage
and between the deep zones for each cartilage type, by Mann-Whitney
U test. Values are the mean+SEM of 8 normal and 8 OA specimens;
[0101] FIG. 3 shows an alignment of the human pitx1 E2F-like
DNA-binding site with known E2F sites found in mammalian cell cycle
regulation promoters. Alignment of different E2F binding sites (E2F
core) and conserved adjacent cyclin homology region (CHR) found in
promoter of genes involved in the regulation of cell cycle. The
presented E2F sites are DNA Pol.alpha. (SEQ ID NO: 3); p107 (SEQ ID
NO: 4); Cdc2 (SEQ ID NO: 5); Adeno E2a (SEQ ID NO: 6); E2F-1 (SEQ
ID NO: 7); H2A (SEQ ID NO: 8); DHFR (SEQ ID NO: 9); HsOrc1 (SEQ ID
NO: 10); c-Myc (SEQ ID NO: 11); CycA (SEQ ID NO: 12); Cdc25 (SEQ ID
NO: 13); TK (SEQ ID NO: 14); B-Myb (SEQ ID NO: 15); Hpitx1 (SEQ ID
NO: 16). Positions are indicated and numbered in function of the
transcriptional start site while Act and Rep indicate an activating
and a repressing site respectively. Note that E2F element found in
human pitx1 promoter is more distal than usual cell cycle
genes;
[0102] FIGS. 4A-D show an electrophoretic mobility shift assay
(EMSA) of nuclear extracts prepared with OA articular chondrocytes.
Representative EMSA using the wild type probe (FIG. 4A) or the
mutant probe (FIG. 4B). Note that attempts to supershift the bound
complexes were performed with different antibodies and addition of
anti-BCoR antibodies disrupted partially the main complex and
generated an additional band suggesting the presence of BCoR in the
bound complex. (FIG. 4C) Representative off-rate autoradiograph
showing the effect of addition of unlabeled double-stranded
oligonucleotide corresponding to E2F-like site found in human pitx1
promoter as a competitor on the E2F complex binding to radiolabeled
wild-type E2F site (wild-type probe) versus mutant E2F site found
in OA patients (mutant probe). Competitor double-stranded
oligonucleotide (70-fold molar excess) was added (t=0), and
aliquots of gel mobility shift reaction mixtures were removed at
the indicated times after the addition. (FIG. 4D) The dissociation
rate of wild-type E2F and the mutant (OA) site were compared by
directly counting the radioactivity of each bound E2F complex by
cutting the corresponding bands on the dried gel. The half-life of
binding for off-rate experiments was computed by plotting the
disappearance of 50% when compared to the initial binding of E2F
complex. The graph depicts the average half-life value for the E2F
complex;
[0103] FIGS. 5A-B show in vitro and in vivo characterization of
PHB-1, PHB-2 and BCoR interactions in primary OA articular
chondrocytes. (FIG. 5A) Co-immunoprecipitation were performed with
anti-PHB-1, anti-PHB-2 (as internal control) and anti-E2F1 in OA
and normal nuclear extracts obtained from primary human articular
chondrocytes cultures. Western blot performed with anti-PHB-2 shows
that PHB-2 interacts physically with PHB-1 and E2F1 only in OA
nuclear extracts. (FIG. 5B) Chromatin immunoprecipitation (ChIP)
assays were performed and showed that PHB-1 and BCoR co-localise in
vivo with the distal E2F site identified in the human pitx1
promoter. Amplification of a 372 bp PCR fragment was obtained with
input (positive control) and after immunoprecipitation with
anti-PHB-1 and anti-BCoR antibodies. Immunoprecipitation with
anti-E2F1 did not generate a positive PCR amplification indicating
that E2F1 does not co-localise on the pitx1 promoter with PHB-1 and
BCoR in spite of the fact that PHB-2 can interact in solution with
E2F1 in OA nuclear extracts. The second lane represents a negative
control generated by omission of the primary antibody during the
immunoprecipitation (-Ab);
[0104] FIGS. 6A-C show immunodetection of PHB-1 proteins in human
articular cartilage. FIGS. 6A and 6B represent cartilage section
obtained from control and OA subjects respectively immunostained
with anti-human PHB-1 protein (cat #RB-292-PO, Lab Vision Corp.,
Fremont Calif., USA). Nuclear signal for PHB-1 was increased
significantly in superficial and deep zones (arrow) only in OA
cartilage (10.times. and 40.times. magnifications). A non specific
immunostaining was detected also with the ECM in both groups
(normal and OA). (FIG. 6C) Cell scores for PHB-1-nuclear
chondrocytes, indicating significant differences between OA and
normal (control) cartilage and between the zones for each cartilage
type, by Mann-Whitney U test. Values are the mean.+-.SEM of normal
(n=3) and OA (n=3) specimens;
[0105] FIG. 7 (Table S2) shows peptides (SEQ ID NOs: 17-27)
sequencing results identifying PHB-1, PHB-2 and BCoR as part of the
repressing complex that binds to the pitx1 E2F-like site;
[0106] FIG. 8 shows EMSA using total nuclear extract (alone or with
PHB-1 antibody (Prohibitin Ab-2 (RB-292-P0) Lab Vision Corp.,
Fremont, Calif.)) and PHB-1-depleted nuclear extract. The use of a
PHB-1 antibody did not allow any supershift but depletion of PHB-1
in OA nuclear extract abrogated all the complexes formation bound
to the wild-type radiolabeled probe;
[0107] FIG. 9 shows an expression analysis by semi-quantitative
RT-PCR of PHB2, PHB-1 and BCoR in human articular chondrocytes
(normal vs. OA);
[0108] FIG. 10 shows the nuclear localization of PHB-1 in an OA
patients by immunohistochemistry using an anti-PHB-1 (Santa Cruz,
sc-18196);
[0109] FIGS. 11A-C FIG. 11A shows a western blot of PHB-1 expressed
in cytoplasm (c) and nucleus (n) of normal and OA human articular
chondrocytes. FIG. 11B shows two putative sumoylation sites at
proximity of a nuclear export sequence (SEQ ID NO: 68) found in
human PHB-1 protein. FIG. 11C shows the two putative sumoylation
sites at positions 202 (SEQ ID NO: 69) and 204 (SEQ ID NO: 70);
[0110] FIG. 12 presents the nuclear (n) and cytoplasmic (c) protein
expression of PHB-1 and Pan-SUMO in articular chondrocytes of OA
patients (C73 and C74) and control patient (C75) analyzed by
western blot. 3 markers are presented: Lamine (nucleus), GAPDH
(cytoplasm) and ATP-Synthase (mitochondria);
[0111] FIG. 13 graphically presents the repression of mir20a
promoter by corepressors BCoR, PHB-1, PHB-2 and combinations
thereof;
[0112] FIG. 14 graphically presents the repression of human PITX1
gene promoter promoter by corepressors BCoR, PHB-1, PHB-2 and
combinations thereof;
[0113] FIG. 15 shows the sequence of a 10 kb pitx1 promoter region
(SEQ ID NO: 28) and polymorphisms in that pitx1 promoter region
between human subjects. The primers used to cover the different
amplicons to cover the 10 kb regions are provided in Table 2
below;
[0114] FIGS. 16A-B shows human PHB-1 mRNA nucleotide (obtained from
gi|6031190|ref|NM.sub.--002634.2) (SEQ ID NO: 29) in FIG. 16A, and
amino acid sequence (obtained from
gi|4505773|ref|NP.sub.--002625.1) (SEQ ID NO: 30) in FIG. 16B;
[0115] FIGS. 17A-B shows human PHB-2 mRNA nucleotide (obtained from
>gi|31543548|ref|NM.sub.--007273.3) (SEQ ID NO: 31) (FIG. 17A)
and amino acid sequence (obtained from
gi|6005854|ref|NP.sub.--009204.1) (SEQ ID NO: 32) (FIG. 17B);
and
[0116] FIGS. 18A-C show a sequence comprising 30 bp upstream and 30
bp downstream of the C to T mutation found in the human pitx1
promoter (SEQ ID NO: 1) (FIG. 18A); a nucleotide fragment showing
restriction sites surrounding wild-type pitx1 E2F-like site (SEQ ID
NO: 16) and (SEQ ID NO: 33) (FIG. 18B); and a nucleotide fragment
showing restriction sites surrounding OA mutated human pitx1
E2F-like site (SEQ ID NO: 2) and (SEQ ID NO: 34) (FIG. 18C).
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0117] The Applicant observed a correlation between accumulation of
PHB-1, PHB-2 and BCoR in the nuclei of articular chondrocytes and
OA.
[0118] The present invention is illustrated in further details by
the following non-limiting examples.
Mice
[0119] Pitx1+/- mice were prepared as previously reported (65).
Human Specimens
[0120] Human tissues were collected with the consent of patients.
The Institutional Ethics Committee Board of Sainte Justine and
Notre Dame Hospitals in Montreal, Canada approved the study
protocol. All OA (n=58), RA (n=39) and control subjects (n=18) were
evaluated by a certified rheumatologist based on the American
College of Rheumatology Diagnostic Subcommittee for OA criteria
(25). Of those, 93 patients (43 OA, 39 RA and 11 healthy controls)
were used for the genetic study. Other patients (OA and controls)
were used either for EMSA analysis, expression analysis or
immunohistochemistry studies using cartilage sections.
Articular Chondrocyte Cultures
[0121] Cartilage was sectioned from the tibial plateaus, rinsed,
finely chopped and cells released by enzymatic digestion performed
as previously described (26).
[0122] The cells were seeded in Falcon culture flasks at high
density (10.sup.8 cells per 175 cm.sup.2 flask) and grown to
confluence in Dulbecco's Modified Eagle's Medium (DMEM; Gibco BRL,
Burlington, Ontario, Canada) containing 10% heated-inactivated
foetal calf serum (FCS; Hyclone, Logan, Utah) and 1%
penicillin/streptomycin (Gibco BRL). Only first passage cultured
cells were used. Expression analysis was performed using RNA
prepared from articular cartilage isolated from OA patients and
age- and gender-matched control subjects.
Total RNA Isolation and RT-PCR
[0123] Total RNA was prepared by phenol/chloroform extraction. For
RT-PCR, 2 .mu.g of total RNA was reversed transcribed using
ThermoScript.TM. reverse transcriptase (Invitrogen), and the
equivalent of 0.1 .mu.g of reverse-transcribed RNA used for PCR
reactions. These were carried out in a final volume of 25 .mu.l
containing 200 micromolar dNTPs, 1.5 mM MgCl2, 10 pM of each
primer, and 1U Pfx DNA-polymerase (Invitrogen). PCR reactions were
performed using the following primers and conditions: human pitx1
(960-bp PCR product), forward primer 5'-CCCACCTCCATGGACGCCTT-3'
(SEQ ID NO: 35); reverse primer 5'-GTCAGCTGTTGTACTGGCACGC-3' (SEQ
ID NO: 36) (35 cycles: 94.degree. C./45 seconds, 65.degree. C./45
seconds, 68.degree. C./1 minute), human .beta.-actin (233-bp PCR
product), forward primer 5'-GGAAATCGTGCGTGACAT-3' (SEQ ID NO: 37),
reverse primer 5'-TCATGATGGAGTTGAATGT AGTT-3' (SEQ ID NO: 38) (32
cycles: 94.degree. C./1 minute, 55.degree. C./1 minute, 72.degree.
C./1 minute), human PHB2 (730-bp PCR product), forward primer
5'-GCCCAGAACTTGAAGGACTT-3' (SEQ ID NO: 39); reverse primer
5'-TCTTGCTCAGTGCTTCTCCA-3' (SEQ ID NO: 40) (30 cycles: 94.degree.
C./45 seconds, 66.degree. C./45 seconds, 72.degree. C./1 minute),
human PHB-1 (546-bp PCR product), forward primer
5'-AGTATGTGTGGTTGGGGAAT-3' (SEQ ID NO: 41); reverse primer
5'-GCTCGCTCTGTAAGGTCGTC-3' (SEQ ID NO: 42) (30 cycles: 94.degree.
C./45 seconds, 65.degree. C./45 seconds, 72.degree. C./1 minute),
and human BCoR (640-bp PCR product), forward primer
5'-*AAAGAGCCGGATCGCAGG-3' (SEQ ID NO: 43); reverse primer
5'-CACCATTGATGTTGAGAGGGC-3' (SEQ ID NO: 44) (35 cycles: 94.degree.
C./45 seconds, 72.degree. C./45 seconds, 72.degree. C./1 minute).
For quantitative and semi-quantitative analysis, all amplifications
were normalized against that of the housekeeping gene .beta.-actin.
PCR amplified product were separated on 1.5% agarose gel (1.0% for
semi-quantitative analysis) and visualized by ethidium bromide
staining.
Pitx1 Promoter Sequencing
[0124] One hundred (100) ng of genomic DNA was mixed in a final
volume of 25 .mu.l containing 200 micromolar dNTPs, 1.5 mM
MgCl.sub.2, 10 pM of each primer (see Table 2 below for full list
of primers used), and 1U Pfx DNA-polymerase (Invitrogen). PCR
reactions were performed using the following conditions (35 cycles:
94.degree. C./30 seconds, 60.degree. C./30 seconds, 68.degree. C./1
minute 20 seconds) and primers:
TABLE-US-00002 TABLE 2 PITX PROMOTER PRIMERS PP1 (962 bp) forward
primer 5'-CTGTTTGCTCAAGACGCTGA-3' (SEQ ID NO: 45) reverse primer
5'-CTCGGCCTCACAAAAGAAAC-3' (SEQ ID NO: 46) PP2 (966 bp) forward
primer 5'-TGTCTGCATTCAGGCTGTTC-3' (SEQ ID NO: 47) reverse primer
5'-GATTCCCTCCTCGAGTCCTT-3' (SEQ ID NO: 48) PP3 (1039 bp) forward
primer 5'-CAAGTGAGCTGGATGCTGAA-3' (SEQ ID NO: 49) reverse primer
5'-AGGGAGTGTCCCTTCACAGA-3' (SEQ ID NO: 50) PP4 (1085 bp) forward
primer 5'-GCTCAGCCATTCTCAGGAAC-3'; (SEQ ID NO: 51) reverse primer
5'-GCCATTGTCCCAGTCAAGAT-3' (SEQ ID NO: 52) PP5 (1011 bp) forward
primer 5'-TCGCGTCAAGAGGGTATTTT-3' (SEQ ID NO: 53) reverse primer
5'-TAGGACCCATGGCTCTACCC-3' (SEQ ID NO: 54) PP6 (1098 bp) forward
primer 5'-CACGAGTCAGGTGGGAAACT-3' (SEQ ID NO: 55) reverse primer
5'-GACGTCTGCTGCTTTTCTGC-3' (SEQ ID NO: 56) PP7 (963 bp) forward
primer 5'-AGGCACGGACTAGCAGGAC-3' (SEQ ID NO: 57) reverse primer
5'-ATGCGGACGAAGCCAGAG-3' (SEQ ID NO: 58) PP8 (986 bp) forward
primer 5'-TTAGCATTCAGCCCCTCTGT-3' (SEQ ID NO: 59) reverse primer
5'-TTCATGAGATGCAGTCAGCAG-3' (SEQ ID NO: 60) PP9 (951 bp) forward
primer 5'-ACAACTGGTAGGGGCAACAG-3' (SEQ ID NO: 61) reverse primer
5'-TGTGTGGCTTTGGCAAATAA-3' (SEQ ID NO: 62) PP10 (990 bp) forward
primer 5'-GCACTGTGCTCCAACTGTGT-3' (SEQ ID NO: 63) reverse primer
5'-GGGGGAGTGTTCTTTTCCTT-3' (SEQ ID NO: 64)
Immunohistochemistry Assays
[0125] IHC assays for Pitx1 were performed using cartilage sections
obtained from 8 OA patients (2 males and 6 females, 59.+-.10 years,
mean.+-.SEM) undergoing total knee replacement, and from 8 donors
without a known history of joint disorders. These tissues were
obtained post-mortem from knee condyles within 24 h of death (2
males and six females aged 67.+-.8 years, mean.+-.SEM). For IHC
assay with PHB-1 antibody, cartilage was obtained from 3 OA
patients (61.+-.8 years, mean.+-.SEM) and 3 control patients
(57.+-.28 years, mean.+-.SEM). Tissue specimens were embedded in
paraffin, sectioned and examined by IHC for Pitx1 or PHB-1 (and
counterstained with hematoxylin for PHB-1 experiments). OA severity
was previously evaluated on adjacent sections using the Mankin's
histological/histochemical scale (27).
Nuclear Protein Extraction and EMSA
[0126] For nuclear protein extraction, cells were rinsed with cold
1.times.PBS and scraped in a buffer containing 10 mM hepes (pH
7.9), 1.5 mM MgCl.sub.2, 10 mM KCl, 1% NP40, 0.5 mM DTT, 1 mM PMSF,
10 g/ml of aprotinin, 10 g/ml of leupeptin and 10 g/ml of
pepstatin. They were left on ice for 10-20 minute while mixed
regularly using a vortex. After a 3 minute centrifugation at 3000
rpm, the pellet was resuspended in a buffer containing 20 mM hepes
(pH 7.9), 25% glycerol, 420 mM NaCl, 1.5 mM MgCl.sub.2, 0.2 mM
EDTA, 0.5 mM DTT, 2 mM PMSF, 10 g/ml of aprotinin, 10 g/ml of
leupeptin and 10 g/ml of pepstatin. After a 20 minute incubation on
ice and a 2 minute centrifugation at 12500 rpm, the supernatant was
collected.
[0127] For the analysis of E2F DNA complexes formed in the presence
of OA articular chondrocytes, gel mobility shift reactions were
performed essentially as previously described (28). Nuclear
extracts (5 .mu.g of proteins) were incubated for 30 min at a
temperature of between about 20-25.degree. C. in 20 .mu.l of a
solution containing 20 mM HEPES (pH 7.5), 40 mM KCl, 5% glycerol, 5
mM spermidine, and 100 ng of poly(dA-dT) and 4 .mu.g of anti-BCoR
antibodies (Abcam, ab5276) were added to specific samples (with a +
sign). The following probes were then added and incubated for
another 30 min at room T.degree.: wild-type
5'-CTGTGCCTCACTGGCGGCAGTCCTGCTCAA-3' (SEQ ID NO: 65); and mutant
5'-CTGTGCCTCACTGGTGGCAGTCCTGCTCAA-3' (SEQ ID NO: 66). Samples were
then separated on 7% native polyacrylamide gels (acrylamide:bis
29:1 in 0.5.times.Tris-borate EDTA). Gels were run at 180 V for 3 h
with a recirculation pump for the buffer and a cooling tank.
[0128] In the presence of radiolabeled probe (14 ng/100,000 cpm) a
cold competitor was added as indicated. For supershift analysis,
the nuclear extracts were pre-incubated 30 min on ice then
incubated in presence of 0.2 .mu.g of E2Fs antibodies (Santa Cruz
Biotechnology, Santa Cruz, Calif., USA; listed in Table 3 below)
and incubated on ice for 1 h.
TABLE-US-00003 TABLE 3 LIST OF ANTIBODIES USED Antibodies used for
results presented in FIGS. 4A-D: E2F1 (KH95, sc-251 X) Santa Cruz
Biotechnology, Santa Cruz, CA, USA E2F3 (C-18, sc-878 X) Santa Cruz
Biotechnology, Santa Cruz, CA, USA E2F4 (A20, sc-1082 X) Santa Cruz
Biotechnology, Santa Cruz, CA, USA E2F5 (C-20, sc-1083) X Santa
Cruz Biotechnology, Santa Cruz, CA, USA E2F6 (K-20, sc-8176 X)
Santa Cruz Biotechnology, Santa Cruz, CA, USA DP1 (K-20, sc-610 X)
Santa Cruz Biotechnology, Santa Cruz, CA, USA Sp1 (1C6, sc-420 X)
Santa Cruz Biotechnology, Santa Cruz, CA, USA Sp3 (D-20, sc-644 X)
Santa Cruz Biotechnology, Santa Cruz, CA, USA BCoR (ab5276) Abcam
Inc., Camridge, MA, USA RXR (D-20, sc-553 X) Santa Cruz
Biotechnology, Santa Cruz, CA, USA Others not shown: E2F1 (H-137,
sc-22820 X) Santa Cruz Biotechnology, Santa Cruz, CA, USA E2F2
(L-20, sc-632 X) Santa Cruz Biotechnology, Santa Cruz, CA, USA E2F3
(N-20, sc-879 X) Santa Cruz Biotechnology, Santa Cruz, CA, USA E2F8
(H00079733-M01) Abnova Corporation, Taipei, Taiwan DP-2 (C-20,
sc-829 X) Santa Cruz Biotechnology, Santa Cruz, CA, USA Sp1 (H-225,
sc-14027 X) Santa Cruz Biotechnology, Santa Cruz, CA, USA
[0129] The sequences of the oligonucleotide probes were: E2F-like
(wild-type) 5'-CTGTGCCTCACTGGCGGCAGTCCTGCTCAA-3' (SEQ ID NO: 65);
and E2F-like mutant (OA) site, 5'-CTGTGCCTCACTGGTGGCAGTCCTGCTCAA-3'
(SEQ ID NO: 66). Samples were then separated on 7% native
polyacrylamide gels (acrylamide:bis 29:1 in 0.5.times.Tris-borate
EDTA). Gels were run at 180 V for 3 h with a recirculation pump for
the buffer and a cooling tank. For analysis of dissociation rate
(off-rate), a 70-fold excess of unlabeled competitor
oligonucleotide corresponding to the wild-type E2F site found in
human pitx1 promoter was added after 30 min of incubation on ice
with either labelled probe. Aliquots from the same binding mixture
were taken at different times and frozen on dry ice to stop the
reaction prior loading on gel.
Nuclear Complexes Precipitation by DNA Pull Down
[0130] Nuclear extracts (300 mg of protein) prepared from cultured
human OA articular chondrocytes from knee joints were initially
incubated in presence of 25 ml of streptavidin-magnetic beads
slurry (BioClone Inc. San Diego, Calif., USA) in order to remove
unspecific protein interactions. Following this, pre-cleared
nuclear extract were incubated with 5 mg of biotinylated ds probe
(5'-CTGTGCCTCACTGGTGGCAGTCCTG CTCAA-3' (SEQ ID NO: 66)) for 2 h at
4.degree. C. with slow agitation in 1.times.EMSA binding buffer. 50
ml of streptavidin-magnetic beads slurry was added and after 1 h of
incubation at 4.degree. C. the bound complexes were recovered using
a magnetic stand and several washes according to the manufacturer's
specifications. The complexes were then detached from the beads in
a boiling mixture of NuPAGE.TM. 4.times.LDS loading buffer
(Invitrogen) and .beta.-mercaptoethanol. After centrifugation, the
supernatant was loaded on a SDS-PAGE gel and visualized by
Coomassie blue staining.
Co-Immunoprecipitation
[0131] Nuclear and cytoplasmic extracts obtained from chondrocytes
of normal or OA patients were incubated overnight with goat
anti-PHB-1 antibodies (Santa Cruz, se-18196). Immunoprecipitated
proteins were collected using protein A-sepharose beads. 50 g of
proteins were loaded and run on SDS-PAGE. Proteins were then
transferred to a nitrocellulose membrane at 100V for 70 minutes.
For blotting, rabbit anti-PHB-1 antibodies (Santa Cruz, sc-28259)
were used in a 15:10000 dilution.
Transfection
[0132] The Lipofectamine.TM. 2000 protocol from Invitrogen
(www.invitrogen.com) was followed: All amounts and volumes are
given on a per well basis. A DNA (.mu.g) to Lipofectamine.TM. 2000
(.mu.l) ratio of 1:2 to 1:3 was used. Cells were transfected at
high cell density for high efficiency, high expression levels, and
to minimize cytotoxicity. One day before transfection,
0.5-2.times.10.sup.5 cells were plated in 500 .mu.l of growth
medium without antibiotics so that cells were 90-95% confluent at
the time of transfection. For each transfection sample, complexes
were prepared as follows: a. DNA was diluted in 50 .mu.l of
Opti-MEM.RTM. I Reduced Serum Medium without serum and mixed
gently. Lipofectamine.TM. 2000 was gently mixed before used, then
the appropriate amount was diluted in 50 .mu.l of Opti-MEM.RTM. I
Medium and incubated for 5 minutes at room temperature. After the 5
minute incubation, the diluted DNA was combined with diluted
Lipofectamine.TM. 2000 (total volume=100 .mu.l), mixed gently and
incubated for 20 minutes at room temperature. The 100 .mu.l of
complexes were added to each well containing cells and medium. The
plate was mixed gently by rocking back and forth. The cells were
incubated at 37.degree. C. in a CO.sub.2 incubator for 18-48 hours
prior to testing for transgene expression.
Peptide Sequencing Analysis
[0133] Bands containing proteins from the DNA pulldown assay and
EMSA were cut, washed, sliced, dried and rehydrated in ammonium
bicarbonate buffer. Proteins were digested with trypsin and
extracted from the gel pieces using 50% acetonitrile and 0.1%
formic acid. Samples were evaporated to dryness and resuspended in
3% acetonitrile-0.1% formic acid in a final volume of 20 .mu.l.
Mass Spectroscopy Analysis
[0134] Samples (10 .mu.l volume) were analyzed using a LC-MS/MS
system consisting of Agilent.TM. 1100 Series nanoflow liquid
chromatography system and 1100 Series LC MSD SL ion trap mass
spectrometer (Agilent Technologies, Palo Alto, Calif., USA).
Peptides were enriched on a Zorbax.TM. 300SB-C18 trap column (5
.mu.m, 5.times.0.3 mm) and separated by reversed phase on a
Zorbax.TM. 300SB-C18 analytical column (3.5 .mu.m, 150.times.0.075
mm, Agilent) with a gradient of 5-90% acetonitrile in 0.1% formic
acid at a flow rate of 300 nl/min. The column eluent was sprayed
directly into the mass spectrometer. Spectra were interpreted using
Spectrum Mill.TM. software (Agilent) and NCBI NR mammalian
database.
Extraction Parameters with Spectrum Mill.TM. Software
[0135] Cysteine modification: carbamidomethylation; sequence tag
length >1; mass range of precursor ions: 600.0 to 4000.0 Da;
scan time range: 0 to 300 minutes; scans were merged for same
precursor m/z: +/-15 seconds; +/-1.4 m/z.
Chromatin Immunoprecipitation Assays
[0136] ChIP experiment was carried out with the ChIP-IT.TM. kit
(Active Motif, Carlsbad, Calif., USA) ChIP-IT.TM. kit. Briefly,
cells were cross-linked with 1% formaldehyde and collected in cell
scraping solution. Nuclear extraction was then performed using
lysis buffer and total DNA was sheared to an approximate length of
0.3-1.5 kb (Branson Sonifier.TM. 450). Chromatin was pre-cleared
with Protein G beads and separated as follows: total input,
negative control without antibody, and ChIP with either anti-PHB-1
(Santa Cruz), anti-BCoR (Abcam) or anti-E2F1 antibodies (Santa
Cruz). After overnight incubation with the appropriate antibody,
Protein G beads were added and several washes were carefully done.
Chromatin was eluted from the beads using ChIP elution buffer.
Cross-linking reversal was done by heating samples at 65.degree. C.
for 4 h, and DNA was purified using columns provided in the kit.
PCR analysis was performed using the following primers and
conditions: human pitx1 promoter harbouring the E2F site (372 bp
PCR product), forward primer 5'-GCTCAGCCATTCTCAGGAAC-3' (SEQ ID NO:
51); reverse primer 5'-CCACCTACCTCTTTCTGCCT-3' (SEQ ID NO: 67) (35
cycles: 94.degree. C./45 seconds, 68.degree. C./45 seconds,
68.degree. C./1 minute).
Statistical Analysis
[0137] The 95% confidence intervals for sensitivity, specificity,
positive predictive value and negative predictive value presented
in Table 4 were calculated according to Deeks and Altman (29). The
association between the presence of mutation and diagnosis was
assessed using the Fisher's Exact Test (two-tailed test). A p value
<0.05 was considered statistically significant.
Example 1
[0138] Comparison of Pitx1 Expression in Articular Chondrocytes of
OA Subjects with that of in Articular Chondrocytes Matched
Controls
[0139] To determine whether pitx1 plays a role in the genetic
control of OA onset, an expression analysis of pitx1 gene using RNA
prepared from articular chondrocyte cultures derived from knee
cartilage of OA patients (n=7) and age- and gender-matched control
subjects (n=4) was performed. Pitx1 expression was detected only in
articular chondrocytes derived from matched controls, while in OA
articular chondrocytes, Pitx1 expression was abrogated or barely
detectable by RT-PCR (FIG. 2A). Analysis of Pitx1 protein levels
and distribution in human knee joint sections showed Pitx1 proteins
only in control cartilages (n=8), while Pitx1 proteins were hardly
detected in OA cartilage sections (n=8) (FIGS. 2B-D).
Example 2
Identification of Pitx1 Promoter Mutation
[0140] To examine the mechanisms turning off pitx1 gene expression
in OA patients, the 5' regulatory region of human pitx1 gene was
examined for specific mutations leading to a progressive loss of
Pitx1 expression during adulthood. Sequencing analysis of genomic
DNA obtained from OA, rheumatoid arthritis (RA) and matched control
subjects revealed, along a 10 kb promoter region of human pitx1
gene, a single homozygous mutation (-3727 C.fwdarw.T) (position
corresponds to distance from transcription point) affecting only OA
patients (11/43) with a high frequency (25%) while none of the RA
patients (0/29) and matched control subjects (0/11) had the
homozygous mutation. The specificity, the positive predictive
values and negative predictive values of the mutation were
calculated for each group as reported in Table 4 below. A
statistically significant association between the mutation and
diagnosis was calculated (two-tailed test) by comparing OA versus
RA patients (p=0.002) or by combining RA and control subjects
(p<0.001). Heterozygous mutation was present in OA patients
(3/43), RA subjects (6/29) and control subjects (3/11) although the
association between the heterozygous mutation and diagnosis was not
statistically significant (p=0.14 for OA versus RA and p=0.09 for
OA versus control).
TABLE-US-00004 TABLE 4 SENSITIVITY, SPECIFICITY, POSITIVE
PREDICTIVE VALUE* (PPV) AND NEGATIVE PREDICTIVE VALUE** (NPV) OF
PITX1 mutation (-3727 C.fwdarw.T) for OA Mutation Sensitivity
Specificity PPV NPV Homozygous OA-Control 25.6 (13.8-39.5) 100.0
(71.5-100.0) 100.0 (71.5-100.0) 25.6 (13.8-39.5) OA-RA 100.0
(88.1-100.0) 100.0 (71.5-100.0) 47.5 (35.2-60.0) OA-(Control &
RA) 100.0 (97.6-100.0) 100.0 (71.5-100.0) 55.6 (44.0-66.8)
Heterozygous OA-Control 7.0 (1.4-16.4) 72.7 (39.0-94.0) OA-RA 79.3
(60.3-92.0) OA-(Control & RA) 77.5 (63.4-88.9)
[0141] Promoter sequence analysis performed with the ALGGEN
PROMO.TM. search program (using TRANSFAC.TM. version 8.3; (35, 36)
revealed that the homozygous mutation was localized within the core
of an E2F-like site (10, 11). The sequence encompassing the
E2F-like site found upstream of the human pitx1 gene is more distal
although it shows an overlap with several functional E2F sites and
also with an adjacent region termed cyclin homology region (CHR)
found in promoter of genes involved in the regulation of cell cycle
12 (FIG. 3). The transcriptional relationship between pitx1 and
E2Fs is further strengthened by the works of Muller et al. showing
that E2F1, E2F2 and E2F3 up regulate Pitx1 expression by several
fold in osteosarcoma cell line U2OS (13). To date, eight different
mammalian E2Fs have been cloned; each of them can heterodimerize
with either DP1 or DP2/3 proteins and bind with similar affinity to
the same collection of target sites (14). These factors could be
broadly divided into two classes: activators (E2F1-3) and
repressors (E2F4-8) of transcription (15), which could explain why
E2F sites on a promoter do not always indicate that it is induced
by E2F but, on the contrary, that it can be repressed through those
sites as well (16-18).
Example 3
Determination of Functional Consequences of Mutation in the
E2F-Like Site on Complex Binding
[0142] To determine the functional consequences of the homozygous
mutation found in OA patients, it was investigated whether E2Fs
were able to bind this E2F-like site using nuclear extracts
prepared with OA articular chondrocytes as described above. EMSA
analysis using both radiolabeled E2F-like sites (wild-type FIG. 4A
versus mutant FIG. 4B) showed no supershift of the bound complex
with any antibodies against E2Fs, or their dimerization partners
DP-1 or DP-2 (E2F2, E2F8 and DP2 data not shown). The Sp1 and Sp3
transcription factors were also analysed since they bind GC-rich
regions such as the E2F-like site found in the human Pitx1
promoter. Unfortunately, there was no supershift with either
anti-Sp1 or anti-Sp3 antibodies. Addition of BCoR antibodies
generated the binding of an additional lower complex bound in
presence of either probes although the binding was increased with
the mutant one as is mostly apparent by comparing lanes 4 to 6.
Functional analysis by EMSA revealed a slower dissociation rate
when the complex was bound to the mutant E2F probe indicating that
C.fwdarw.T mutation increased the stability of the bound
complex.
Example 4
Identification of BCoR as a Member of the Pitx1 Repressor
Complex
[0143] In order to characterize the nature of the complex
identified in Example 3, bands corresponding to the bound complex
were cut and extracted from an EMSA wet gel to perform a peptide
sequencing analysis combined with tandem mass spectrometry.
[0144] This experiment led to the identification of peptides
corresponding to BCoR, a known co-repressor (see FIG. 7). The
presence of BCoR in the bound complex was confirmed also by the
detection of an additional lower band in EMSA when BCoR antibodies
were added (see Example 3 and FIG. 4A, 4B).
Example 5
Identification of PHB-1 and PHB-2 as Members of the Pitx1 Repressor
Complex
[0145] A DNA-pull down method as described above was used with a
biotinylated double-stranded oligonucleotide harboring the mutant
E2F-like site to allow the identification of peptides corresponding
to prohibitin (PHB-1) and prohibitone (PHB-2) (FIG. 7). To confirm
the presence of PHB-1 in the bound complex, an immuno-depletion of
PHB-1 in nuclear extracts prepared from OA articular chondrocytes
was performed and no binding was observed in EMSA with PHB-1
depleted nuclear extracts using either radiolabeled probes (FIG.
8).
Example 6
Identification of the PHB-1 and PHB-2 Nucleus Localization in OA
and Normal Articular Chondrocytes
[0146] The cellular localization of PHB-1 was compared in normal
and OA articular chondrocytes by IHC assays using anti-PHB-1
antibodies. As may be seen in FIGS. 6A-C, an increased nuclear
localization of PHB-1 was observed in OA cartilages when compared
to age-matched control cartilages. See also FIG. 10 for a larger
magnification using different anti-PHB-1 antibodies. The cellular
localization of PHB-2 is also compared in normal and OA articular
chondrocytes by IHC assays using anti-PHB-2 antibodies.
Example 7
Co-Immunoprecipitation Assay of PHB-1, PHB-2 and E2F1
[0147] Co-immunoprecipitation assay of PHB-1, PHB-2 and E2F1 were
performed as described above. Physical interactions between PHB-1,
PHB-2 and E2F1 were detected in nuclear extracts prepared from
human OA articular chondrocytes while controls did not show any
interaction with PHB-2 (FIG. 5A).
Example 8
Chip Assay to Demonstrate the Functionality of the EF2 Site in OA
Chondrocytes and Co-Occupancy of PHB-1 and BCoR
[0148] Chromatin immunoprecipitation (ChIP) assays were performed
as described above with primary OA articular chondrocytes cultures
to examine the co-occupancy of PHB-1, BCoR and E2F1 on the
E2F-responsive element identified in human pitx1 promoter. PHB-1
and BCoR co-localised in vivo only in OA chondrocytes confirming
also the functionality and specificity of this E2F site although
E2F1 was not detected (FIG. 5B). The interaction is however not
dependent on the -3727 C.fwdarw.T mutation since wild-type also
interacts with the repressor complex.
Example 9
Identification of the -3727 C to T Homozygous Mutation in a Subject
Sample
[0149] Genomic DNA is isolated (directly using available commercial
kits or after extraction of lymphocytes) from the subject saliva or
blood. The human pitx1 promoter region harbouring the -3727
C.fwdarw.T homozygous mutation is then amplified by PCR using
specific primers. Amplified products are identified by direct
sequencing using genomic DNA extracted from lymphocytes. They may
also be digested with either restriction enzyme Acil or Fnu4H to
detect the presence of the mutation. Because replacement of C by T
in OA patients abrogates Acil and Fnu4HI restriction sites normally
present in the wild-type sequence, the presence of the mutation are
assessed by absence of relevant restriction fragments.
Example 10
Assay to Identify Blood and Synovial Concentration Levels of PHB-1,
PHB-2 or Native Peptide Agonists to Cell Surface PHB-1 in
Subjects
[0150] PHB-1 and PHB-2 are also found in the bloodstream (Mishra et
al. 2006). Diet-induced obesity was successfully reversed in mice
through subcutaneous injection of a chimeric proapoptotic peptide
that binds to PHB-1 at the cell surface of white fat vasculature
(57). The peptide cut off the blood supply to fat tissue leading to
its reabsorption. Most of the OA patients are obese. Dosage of
PHB-1 in biological fluids like plasma/serum, urine or synovial
fluids are performed using an ELISA method (see for instance
58).
Example 11
Assay to Identify RNA Levels of PHB-1, PHB-2 and BCoR Between
Normal and OA Human Articular Chondrocytes
[0151] Expression analysis was performed as described above by
semi-quantitative RT-PCR of PHB-2, PHB-1 and BCoR in human
articular chondrocytes (normal vs. OA). RNA was extracted from 4
normal patients and 10 OA patients. No significant change was
observed between normal and OA articular chondrocytes as may be
seen in FIG. 9.
Example 12
Detection of PHB-1 Immunoreactive Bands in Nuclear and Cytoplasm of
Human Articular Chondrocyte Fractions from OA Subjects
[0152] Co-immunoprecipitation of PHB-1 was performed as described
above.
[0153] The detection using an anti-PHB-1 antibody revealed (FIG.
11A) a major PHB-1 immunoreactive band of 32 kDa, which corresponds
to the molecular weight of the PHB-1 alone. PHB-1 immunoreactive
bands of higher molecular weight suggest post-translational
modifications of PHB-1 modifying its weight.
[0154] On FIG. 11A, a higher molecular weight bands pattern is
detected mostly in the nuclear fraction of OA patients. This
pattern is not found in the nuclear fraction of the control
subject.
Example 13
Comparison of Sumoylation of PHB-1 Between Normal and OA Human
Articular Chondrocytes
[0155] Sumoylation is the binding of one or more small proteins of
12 kDa, designated SUMO, to another protein. SUMO proteins will
lead to a laddering profile of the protein to which they are
binding in a western blot. The hypothesis that the laddering of
PHB-1 immunoreactive bands observed in FIG. 11A, was caused by
sumoylation was thus tested.
[0156] SUMOsp (SUMOsp: a web server for sumoylation site
prediction. Yu Xue, Fengfeng Zhou, Chuanhai Fu, Ying Xu, and
Xuebiao Yao. Nucl Acids Res 34: W254-W257, 2006.) predicted that
PHB-1 contains two putative sumoylation sites at proximity of a
nuclear export sequence (NES), namely at positions 204 and 240.
FIG. 11B presents the position of these putative sites and the
sequence of the NES (SEQ ID NO: 68). The table FIG. 11C presents
the sequences of these sites, namely 204 (SEQ ID NO: 69) and 240
(SEQ ID NO: 70).
[0157] Total proteins of nuclear and cytoplasmic fractions from
articular chondrocytes of OA patients (C73 and C74) and age-matched
control patient (C75) were then analyzed by western blot against
PHB-1 and Pan-SUMO. They were loaded and run on SDS-PAGE. Proteins
were then transferred to a PVDF membrane at 100V for 70 minutes.
The 3 markers used, namely lamine (nucleus), GAPDH (cytoplasm) and
ATP-Synthase (mitochondria), show that the samples have been
separated efficiently into a nuclear fraction (X-N) and a
cytoplasmic fraction (Cyto). These antibodies were used for
blotting: anti-PHB-1 (Santa Cruz, sc-28259), Pan SUMO antibodies
(ABGENT, AP1299a), anti-Lamin A/C (Cell Signaling, #2032),
anti-GAPDH (Santa Cruz, sc-20357) and anti-F1-ATPase (Santa Cruz,
sc-16689).
[0158] Pan-SUMO immunoreactive bands in FIG. 12 reveal proteins
(different proteins or a single protein) modified by the binding of
one or more SUMO proteins, as reflected by bands with increasing
molecular weights.
[0159] FIG. 12 shows that the two OA subjects have the same
sumoylation pattern in the nuclear fraction, and that this pattern
is absent from the control subject. Arrows (except for the 32 kDa
bands) point to bands that are immunoreactive to both PHB-1 and PAN
SUMO, and are detected in the nuclear fraction of OA subjects but
not in the control nuclear fraction. These results suggest that
sumoylation contributes to PHB-1 nuclear localization in OA
patients.
[0160] Clinically, this suggests that increased sumoylation is the
primary event leading to PHB-1 nuclear accumulation and repression
of Pitx1 in primary OA. The biological consequences of sumoylation
include the increase of protein stability, increase targeting of
proteins (including transcription factors) from the cytoplasm to
the nucleus, regulates transcriptional activities of proteins,
mediates the binding of the protein to other proteins and increases
the repressor activity of certain transcription factors. Recent
studies linked sumoylation of several proteins to important
diseases (neurodegenerative diseases, acute promyelocytic leukemia,
type I diabetes and other disorders). The regulation of these
posttranslational modifications may provide new targets for
therapeutic intervention in several human diseases.
[0161] PHB-1 is a molecule having a molecular weight of less than
50 kDa and can passively penetrate the cell nucleus. In normal
subjects, PHB-1 is quickly exported out of the cell nucleus through
the exportin system by the recognition of a nucleus export signal
(NES). Without being bound by such hypothesis, the proximity of the
2 sumoylation sites to the NES, could contribute to the nuclear
retention of PHB-1 in OA subjects by hiding the NES and thereby
prevent the recognition PHB-1 by exportin.
Example 14
Determination of Repression of mir20a Promoter by Co-Repressors
PHB-1, PHB-2, BCoR and Combinations Thereof
[0162] MG-63 cells were transfected as described above with
Lipofectamine.TM. 2000 during 6 hours. After the transfection,
fresh media was added to cells during 24 hours and 10.sup.-7 M
4-0H-Tamoxifen was added to cells during 24 hours.
[0163] The luciferase assay was then performed. Results are
presented in FIG. 13. Results are expressed by the fold induction
of luciferase signal of reporter construct compared to that of a
control. The control (CTRL) luciferase activity was that measured
in osteoblastic MG-63 cells co-transfected with mir20A reporter
promoter, known to be regulated by E2Fs, from Sylvestre Y et al.
2007, pBAPE-ER and pLPC NEP-Flag vectors. The E2F1 was the
condition where cells were co-transfected with E2F1-ER
over-expressing vector. All luciferase signal was normalized by a
beta-gal reporter vector. The X-axis represents the names of each
repressor co-overexpressed in the conditions tested. This transient
transfection assay shows that BCoR alone or in combinations with
PHB-1 (designated PHB in FIG. 13) and/or PHB-2 is sufficient to
repress the induction of an E2F reporter construct like mir20a even
in the presence of the mir20a agonist E2F1.
Example 15
Determination of Repression of PITX1 Promoter by Corepressors
PHB-1, PHB-2, BCoR and Combinations Thereof
[0164] MG-63 cells were transfected as described above with a
vector containing 3000 or 2000 bp of PITX1 gene promoter upstream
of a firefly luciferase gene. Cells were synchronised 16 h by serum
starvation. Fresh serum was added during 48 h and the luciferase
assay was performed. The luciferase signal was normalised against
beta-gal. Results are expressed by the fold induction of luciferase
signal compared to a luciferase signal from an empty vector.
Results are presented in FIG. 14. These results show the repression
driven when BCoR, PHB-1 and PHB2 are combined together using a
fragment of human pitx1 promoter (fragment -3000 bp). This
demonstrates the repressor activity of this complex. Without being
bound by this hypothesis, it is suggested that more than one
E2F-like sites may be present on the PITX1 gene.
Example 16
Analysis of Prohibitin-CRM-1 Interaction in Normal and OA Articular
Chondrocytes
[0165] PHB-1 physical interaction with CRM-1 is measured by co-IP
assays as described above, while Western blot with anti-CRM-1
antibodies (Santa Cruz) are performed with nuclear extracts
prepared with normal and OA articular chondrocytes to assess
changes in CRM-1 levels in normal versus OA cartilage cells. In
parallel, functionality of CRM-1 is tested by an immunostaining
method. Cells are either untreated or treated with 30 .mu.M
camptothecin (Sigma) for 4 h, a topoisomerase I inhibitor that
stimulates the nuclear export of PHB-1 through a CRM-1-dependent
mechanism. Subcellular localisation of p53 is used as internal
control since p53 normally co-localises with PHB-1 and migrate to
the cytoplasm upon camptothecin treatment. Cells are fixed in 4%
PFA for 5 min and blocked in 5% BSA in PBS buffer at RT for 1 h,
followed by primary antibody incubations overnight at 4.degree. C.
After washing, secondary antibody incubation is performed with goat
anti anti-mouse IgG Alexa.TM. Fluor-488 (green) and goat
anti-rabbit IgG Alexa.TM. Fluor-546 (red) for 30 min at room
temperature. Cells are visualised with a Zeiss.TM. LSM 510 confocal
microscope. Finally, the contribution of TGF-.beta. signalling to
PHB-1 nuclear export is investigated since it was reported that
TGF-.beta.1 mediates the nuclear export of PHB-1 in a prostate
cancer cell line.
Example 17
OA Genetic Association Studies
[0166] Genotyping of the (-3727 C.fwdarw.T) found in the promoter
of human pitx1 gene is performed in a large cohort that currently
comprises 1,400 cases (510 males and 890 females) and 750 controls
(350 females and 400 males) well characterised. The cases have each
undergone elective joint-replacement surgery (hip or knee) due to
severe, end-stage primary OA. The controls have no symptoms of OA
or of any other joint or musculoskeletal disease. The cases and
controls are all aged 45 or over, they are unrelated to each other
and are of UK Caucasian origin. The DNA from the cases and the
controls are arrayed on to 96-well microtitre plates at
concentrations of 100 ng/.mu.l and 10 ng/.mu.l. Results are
analysed in function of differences in genotype or allele
frequencies between OA cases and controls. The cases are stratified
by sex, age, by joint replaced or by sex combined with joint
replaced or age combined with joint replaced.
[0167] Genetic association, and Hardy-Weinberg equilibrium for the
distribution of genotypes, are tested by x.sup.2 analysis with
Yates's correction. Odds ratios are calculated with 95 percent
confidence intervals. The pair wise linkage disequilibrium
coefficient (r2).sup.z is calculated using the GOLD.TM. program
(59). Haplotype frequencies between variants showing evidence of
linkage disequilibrium at r2>0.2 is estimated using the
EH-PLUS.TM. program (60). Haplotype frequency differences are then
compared using x.sup.2.
Example 13
Characterisation of Nuclear Factors Known to Interact with PHB-1
and/or PHB-2
[0168] Additional partners of PHB-1 and PHB-2 are expected to exist
since there are no indications in the literature that either
molecule can bind directly to the DNA to exert their
transcriptional repression. It was shown that prohibitin recruits
Brg-1/Brm to E2F-responsive promoters, and that this recruitment is
required for the repression of E2F-mediated transcription by PHB-1.
Although PHB-1 associates with, and recruits, Brg-1 and Brm
independently of pRb, prohibitin/Brg-1/Brm-mediated transcriptional
repression requires pRb. PHB-1 and PHB-2 mediated transcriptional
repression required also histone-deacetylase activity (HDAC1), but
unlike pRb, additional co-repressors like N-CoR are also involved
(24,41). In addition, PHB-2 also associates with the class II
histone deacetylase HDAC5. Finally, it was reported that PHB-2
specifically interacts with the chicken ovalbumin upstream binding
transcription factors I and II (COUP-TFI and COUP-TF-II). The
nuclear receptor chicken ovalbumin upstream binding transcription
factor I was found to cooperate with PHB-2 and histone deacetylases
in the repression of target genes. PHB-1 and PHB-2 thus appear to
repress E2F-mediated transcription utilising different molecular
mediators and facilitate channeling of specific signalling pathways
to the cell cycle machinery.
[0169] Whether pitx1 repression is mediated by recruitment of
Brg-1/Brm to this E2F site is investigated. The contribution of
specific histone deacetylases (HDACs) is also investigated. To test
whether Brg-1, Brm and prohibitin physically interact in OA nuclear
extracts, co-immunoprecipitation studies are carried out using
nuclear extracts from OA articular chondrocytes, which contain
PHB-1 and PHB-2 endogenously. Immunoprecipitation are then
performed with anti-cmyc (negative control), anti-Brg-1 or anti-Brm
antibodies, and the precipitated proteins are then immunoblotted
for PHB-1 or PHB-2. Normal articular chondrocytes obtained from
control subjects or purchased (PromoCell) are tested in parallel as
negative controls. Positive controls are generated with the use of
anti-E2F1, anti-E2F2 and anti-E2F3 antibodies since E2F1 and E2F3
mRNA were detected in normal and OA articular chondrocytes.
[0170] The same approach is used to determine whether additional
known partners of PHB-1 and PHB-2 are present in the repressor
complex detected in OA patients (the candidate proteins are
indicated in Table 1 above). Notably, the presence of pRb or of one
of its family members (p107 and p130) are investigated since
prohibitin/Brg-1/Brm-mediated transcriptional repression was shown
to require pRb. To assess whether PHB-1 co-localises in vivo with
Brg-1 and Brm to the E2F-responsive element found in the human
pitx1 promoter, chromatin immunoprecipitation (ChIP) assays, using
anti-Brg-1 and anti-Brm antibodies are performed. ChIP assays are
performed with OA articular chondrocytes derived from at least ten
distinct OA patients according to the manufacturer's specifications
(ActiveMotif, Carlsbad Calif., USA). Articular chondrocyte cultures
are obtained from distinct OA patients in order to investigate
whether these factors and repressing mechanism are predominantly
found only in a specific subset of OA patients or they are
conserved among all primary OA patients (excluding secondary knee
joint OA). Presence of the mutation is determined by direct
sequencing of the promoter region harbouring the E2F-like site for
each OA and control subjects to assess whether the mutation seen in
human pitx1 promoter has effects in the recruitment of different
nuclear interacting partners. Whether pRb or one of its family
members (p107 and p-130) is also recruited in vivo with Brg-1 and
Brm is investigated. Control experiments is carried out in parallel
with normal human articular chondrocytes using anti-E2F1, anti
E2F-2 and anti-E2F3 antibodies as positive controls to demonstrate
that this E2F site is also subjected to a positive transcriptional
regulation by E2Fs in normal cartilage cells. Negative controls
will be provided by anti-PHB-1 and anti-PHB-2 antibodies.
Example 18
Determination of Mechanisms Modulating Prohibitins Interactions
with Brg-1/Brm in OA
[0171] Several reports showed that JNK1 promotes the association of
PHB-1 with Brg-1 or Brm on E2F-responsive promoters and represses
the transcriptional activity of E2F. The finding that JNK1
phosphorylates PHB-1 (in vitro) and regulates prohibitin/Brg1/Brm
associations in vivo now adds a testable potential mechanistic link
to this pathway. Furthermore, PHB-1 interacts with MLK2, a binding
partner of, activator of, and substrate for JNK1. To determine
whether JNK1 could affect the physical association between PHB-1
and Brg-1/Brm, co-IP methods are used with normal and OA articular
chondrocyte cultures untreated or treated with 100 .mu.M of
SP600125, a specific inhibitor of JNK1 for two hours (Stressgene
Bioreagents, Ann Arbor, Mich., USA). The effect of JNK1 on the
recruitment of PHB-1, PHB-2, Brg-1 and Brm to the endogenous and
mutant E2F site in the human pitx1 promoter is then tested by ChIP
assays.
[0172] Akt subcellular localisation is compared in normal and OA
chondrocytes by IHC methods as well as by Western blot analysis
with corresponding cytoplasmic and nuclear extracts. Detection of
Akt and phospho-Akt (pAkt) is preformed with specific antibodies
(Santa Cruz). In the event that cytoplasmic Akt is predominantly
detected in OA cells, Akt phosphorylation is stimulated by adding
physiological doses of 17-.beta.-estradiol (10.sup.-10M, Sigma)
since estrogenic stimulation was reported to promote accumulation
of activated Akt in the nucleus (61).
[0173] Additional PHB-1 and PHB-2 interacting partners such as
HDAC1 and HDAC5 are tested while others are determined by DNA-pull
down method. The analysis of the proteins complexed is carried-out
by peptide sequencing coupled to mass spectrometry as described
above. The role of estrogens in Akt activation and nuclear
localisation is of interest in OA pathogenesis because
postmenopausal women are more affected by OA than males after 65
years.
Example 19
Determination of Post-Translational Modifications
Masking/Interfering with NES of PHB-1
[0174] There is evidence that PHB-1 and PHB-2 can undergo
post-translational modification such as phosphorylation and
ubiquitination, but the role of post-translational modifications in
modulating the various functions of the prohibitins has yet to be
determined. In-silico analysis revealed that PHB-1 NES can be
phosphorylated by tyrosine kinases MTOR, PAK, EGFR and JAK. The
effect of individual kinases is tested by adding specific kinase
inhibitors to the cells prior to analysing PHB-1 interaction with
CRM-1 as described above.
[0175] Whether the NES of PHB-1 is a substrate for an unknown
kinase or any other enzymatic action reducing its interaction with
CRM-1 is also tested. A peptide corresponding to the NES of PHB-1
is synthesized and conjugated to a carrier peptide, Penetratin.TM.
(Q-Biogene), for delivery into the cells (cytoplasm and nucleus).
The effect of delivering this peptide on the nuclear export of
PHB-1 is assessed by double immunofluorescence experiments.
Conformation changes in PHB-1-PHB-2 heterodimers or homodimers are
also examined by cross-linkage analyses and Western blot.
[0176] Although the present invention has been described
hereinabove by way of specific embodiments thereof, it can be
modified, without departing from the spirit and nature of the
subject invention as defined in the appended claims.
REFERENCES
[0177] 1. Loughlin, J. Genetic epidemiology of primary
osteoarthritis. Curr. Opin. Rheumatol. 13, 111-116 (2001). [0178]
2. Spector, T. D. & MacGregor, A. J. Risk factors for
osteoarthritis: genetics. Osteoarthritis. Cartilage. 12 Suppl A,
S39-S44 (2004). [0179] 3. Peach, C. A., Carr, A. J., &
Loughlin, J. Recent advances in the genetic investigation of
osteoarthritis. Trends Mol. Med. 11, 186-191 (2005). [0180] 4.
Reginato, A. M. & Olsen, B. R. The role of structural genes in
the pathogenesis of osteoarthritic disorders. Arthritis Res. 4,
337-345 (2002). [0181] 5. Loughlin, J. Polymorphism in signal
transduction is a major route through which osteoarthritis
susceptibility is acting. Curr. Opin. Rheumatol. 17, 629-633
(2005). [0182] 6. Drouin, J., Lanctot, C., & Tremblay, J. J. La
famille Ptx des facteurs de transcription a homeodomaine.
Medecine/Sciences 14, 335-339 (1998). [0183] 7. Drouin, J.,
Lamolet, B., Lamonerie, T., Lanctot, C., & Tremblay, J. J. The
PTX family of homeodomain transcription factors during pituitary
developments. Mol. Cell Endocrinol. 140, 31-36 (1998). [0184] 8.
Lanctot, C., Lamolet, B., & Drouin, J. The bicoid-related
homeoprotein Ptx1 defines the most anterior domain of the embryo
and differentiates posterior from anterior lateral mesoderm.
Development 124, 2807-2817 (1997). [0185] 9. Lanctot, C., Moreau,
A., Chamberland, M., Tremblay, M. L., & Drouin, J. Hindlimb
patterning and mandible development require the Ptx1 gene.
Development 126, 1805-1810 (1999). [0186] 10. Messeguer, X. et al.
PROMO: detection of known transcription regulatory elements using
species-tailored searches. Bioinformatics. 18, 333-334 (2002).
[0187] 11. Farre, D. et al. Identification of patterns in
biological sequences at the ALGGEN server: PROMO and MALGEN.
Nucleic Acids Res. 31, 3651-3653 (2003). [0188] 12. Tommasi, S.
& Pfeifer, G. P. Constitutive protection of E2F recognition
sequences in the human thymidine kinase promoter during cell cycle
progression. J. Biol. Chem. 272, 30483-30490 (1997). [0189] 13.
Muller, H. et al. E2Fs regulate the expression of genes involved in
differentiation, development, proliferation, and apoptosis. Genes
Dev. 15, 267-285 (2001). [0190] 14. Zheng, N., Fraenkel, E., Pabo,
C. O., & Pavletich, N. P. Structural basis of DNA recognition
by the heterodimeric cell cycle transcription factor E2F-DP. Genes
Dev. 13, 666-674 (1999). [0191] 15. Takahashi, Y., Rayman, J. B.,
& Dynlacht, B. D. Analysis of promoter binding by the E2F and
pRB families in vivo: distinct E2F proteins mediate activation and
repression. Genes Dev. 14, 804-816 (2000). [0192] 16. Bremner, R.
et al. Direct transcriptional repression by pRB and its reversal by
specific cyclins. Mol. Cell Biol. 15, 3256-3265 (1995). [0193] 17.
Hamel, P. A., Gill, R. M., Phillips, R. A., & Gallie, B. L.
Transcriptional repression of the E2-containing promoters EIIaE,
c-myc, and RB1 by the product of the RB1 gene. Mol. Cell Biol. 12,
3431-3438 (1992). [0194] 18. Lam, E. W. & Watson, R. J. An
E2F-binding site mediates cell-cycle regulated repression of mouse
B-myb transcription. EMBO J 12, 2705-2713 (1993). [0195] 19.
McClung, J. K., Jupe, E. R., Liu, X. T., & Dell'Orco, R. T.
Prohibitin: potential role in senescence, development, and tumor
suppression. Exp. Gerontol. 30, 99-124 (1995). [0196] 20.
Dell'Orco, R. T., McClung, J. K., Jupe, E. R., & Liu, X. T.
Prohibitin and the senescent phenotype. Exp. Gerontol. 31, 245-252
(1996). [0197] 21. Rastogi, S. et al. Prohibitin facilitates
cellular senescence by recruiting specific corepressors to inhibit
E2F target genes. Mol. Cell Biol. 26, 4161-4171 (2006). [0198] 22.
Campisi, J. Cellular senescence as a tumor-suppressor mechanism.
Trends Cell Biol. 11, S27-S31 (2001). [0199] 23. Martin, J. A.
& Buckwalter, J. A. The role of chondrocyte senescence in the
pathogenesis of osteoarthritis and in limiting cartilage repair. J
Bone Joint Surg Am 85-A Suppl 2, 106-110 (2003). [0200] 24. Wang,
S., Fusaro, G., Padmanabhan, J., & Chellappan, S. P. Prohibitin
co-localizes with Rb in the nucleus and recruits N-CoR and HDAC1
for transcriptional repression. Oncogene 21, 8388-8396 (2002).
[0201] 25. Altman, R. et al. Development of criteria for the
classification and reporting of osteoarthritis. Classification of
osteoarthritis of the knee. Diagnostic and Therapeutic Criteria
Committee of the American Rheumatism Association. Arthritis Rheum.
29, 1039-1049 (1986). [0202] 26. Roy-Beaudry, M. et al. Endothelin
1 promotes osteoarthritic cartilage degradation via matrix
metalloprotease 1 and matrix metalloprotease 13 induction.
Arthritis Rheum. 48, 2855-2864 (2003). [0203] 27. Mankin, H. J.,
Dorfman, H., Lippiello, L., & Zarins, A. Biochemical and
metabolic abnormalities in articular cartilage from osteo-arthritic
human hips. II. Correlation of morphology with biochemical and
metabolic data. J. Bone Joint Surg. Am. 53, 523-537 (1971). [0204]
28. Moreau, A., Yotov, W. V., Glorieux, F. H., & St Arnaud, R.
Bone-specific expression of the alpha chain of the nascent
polypeptide-associated complex, a coactivator potentiating
c-Jun-mediated transcription. Mol. Cell Biol. 18, 1312-1321 (1998).
[0205] 29. Deeks, J. J. & Altman, D. G. Sensitivity and
specificity and their confidence intervals cannot exceed 100%. BMJ
318, 193-194 (1999). [0206] 30. Mishra S., Murphy L. C., The
Prohibitins: emerging roles in diverse functions. J Cell Mol Med.
10(2): 353-63 (2006). [0207] 31. Nijtmans L G, Artal S M, Grivell L
A, Coates P J. The mitochondrial PHB complex: roles in
mitochondrial respiratory complex assembly, ageing and degenerative
disease. Cell Mol Life Sci 2002; 59(1):143-155. [0208] 32. Mishra
S, Murphy L C, Nyomba B L, Murphy L J. Prohibitin: a potential
target for new therapeutics. Trends Mol Med 2005; 11(4):192-197.
[0209] 33. Lawrence R C, Hochberg M C, Kelsey J L, McDuffie F C,
Medsger T A Jr, Felts W R, et al. Estimates of the prevalence of
selected arthritic and musculoskeletal diseases in the United
States. J Rheumatol 1989; 16:427-41. [0210] 34. Felson D T, Zhang
Y. An update on the epidemiology of knee and hip osteoarthritis
with a view to prevention. Arthritis Rheum 1998; 41:1343-55. [0211]
35. Xavier Messeguer, Ruth Escudero, Domenec Farre, Oscar Nunez,
Javier Martinez, M. Mar Alba. PROMO: detection of known
transcription regulatory elements using species-tailored searches.
Bioinformatics, 18, 2, 333-334, 2002; [0212] 36. Domenec Farre,
Roma Roset, Mario Huerta, Jose E. Adsuara, LlorencRoseloo, M. Mar
Alba, Xavier Messeguer. Identification of patterns in biological
sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids
Res, 31, 13, 3651-3653, 2003. [0213] 37. Gamble S C, Odontiadis M,
Waxman J et al. Androgens target prohibitin to regulate
proliferation of prostate cancer cells. Oncogene 2004;
23(17):2996-3004. [0214] 38. Sun L, Liu L, Yang X J, Wu Z. Akt
binds prohibitin 2 and relieves its repression of MyoD and muscle
differentiation. J Cell Sci 2004; 117(Pt 14):3021-3029. [0215] 39.
Wang S, Zhang B, Faller D V. Prohibitin requires Brg-1 and Brm for
the repression of E2F and cell growth. EMBO J 2002;
21(12):3019-3028. [0216] 40. Montano M M, Ekena K, age-Mourroux R,
Chang W, Martini P, Katzenellenbogen B S. An estrogen
receptor-selective coregulator that potentiates the effectiveness
of antiestrogens and represses the activity of estrogens. Proc Natl
Acad Sci USA 1999; 96(12):6947-6952. [0217] 41. Kurtev V, Margueron
R, Kroboth K, Ogris E, Cavailles V, Seiser C. Transcriptional
regulation by the repressor of estrogen receptor activity via
recruitment of histone deacetylases. J Biol Chem 2004;
279(23):24834-24843. [0218] 42. Rastogi S, Joshi B, Fusaro. G,
Chellappan S. Camptothecin induces nuclear export of prohibitin
preferentially in transformed cells through a CRM-1-dependent
mechanism. J Biol Chem 2006; 281(5):2951-2959. [0219] 43. Wang S,
Nath N, Fusaro G, Chellappan S. Rb and prohibitin target distinct
regions of E2F1 for repression and respond to different upstream
signals. Mol Cell Biol 1999; 19(11):7447-7460. [0220] 44. Wang S,
Zhang B, Faller D V. BRG1/BRM and prohibitin are required for
growth suppression by estrogen antagonists. EMBO J 2004;
23(11):2293-2303. [0221] 45. Wang S, Fusaro G, Padmanabhan J,
Chellappan S P. Prohibitin co-localizes with Rb in the nucleus and
recruits N-CoR and HDAC1 for transcriptional repression. Oncogene
2002; 21(55):8388-8396. [0222] 46. Bacher S, Achatz G, Schmitz M L,
Lamers M C. Prohibitin and prohibitone are contained in
high-molecular weight complexes and interact with alpha-actinin and
annexin A2. Biochimie 2002; 84:1205-1218. [0223] 47. Rastogi S,
Joshi B, Dasgupta P, Morris M, Wright K, Chellappan S. Prohibitin
facilitates cellular senescence by recruiting specific corepressors
to inhibit E2F target genes. Mol Cell Biol 2006; 26(11):4161-4171.
[0224] 48. Rasmussen R K, Ji H, Eddes J S et al. Two-dimensional
electrophoretic analysis of mixed lineage kinase 2 N-terminal
domain binding proteins. Electrophoresis 1998; 19(5):809-817.
[0225] 49. Fusaro G, Dasgupta P, Rastogi S, Joshi B, Chellappan S.
Prohibitin induces the transcriptional activity of p53 and is
exported from the nucleus upon apoptotic signaling. J Biol Chem
2003; 278(48):47853-47861. [0226] 50. Rajalingam K, Wunder C,
Brinkmann V et al. Prohibitin is required for Ras-induced
Raf-MEK-ERK activation and epithelial cell migration. Nat Cell Biol
2005; 7(8):837-843. [0227] 51. Wang S, Nath N, Adlam M, Chellappan
S. Prohibitin, a potential tumor suppressor, interacts with RB and
regulates E2F function. Oncogene 1999; 18(23):3501-3510. [0228] 52.
Lyons P., 2003. Advances in spotted microarray ressources for
expression profiling. Briefings in Functionnal Genomics and
Proteomics 2, 21-30. [0229] 53. Ding G. and Cantor C. R., 2004.
Quantitative analysis of nucleic acids--the last few years of
progress. J Biochem Biol 37, 1-10. [0230] 54. Scheel J., Von
Brevern M. C., Horlein A., Fisher A., Schneider A., Bach A. 2002.
Yellow pages to the transcriptome. Pharmacogenomics 3, 791-807.
[0231] 55. Lopez M. F., Pluskal M. G., 2003. Protein micro- and
macroarrays: digitizing the proteome. J Chromatography B 787,
19-27. [0232] 56. Wood, W. I. et al. 1985. Base
composition-independent hybridization in tetramethylammonium
chloride: A method for oligonucleotide screening of highly complex
gene library. Proc. Natl. Acad. Sci. USA 82. 1585-1588. [0233] 57.
Kolonin et al. 2006., Nature Medicine Advance online publication of
June issue. [0234] 58. U.S. Pat. No. 5,401,635. [0235] 59. Abecasis
G R, Cookson W O., 2000. GOLD--graphical overview of linkage
disequilibrium. Bioinformatics 16:182-3. [0236] 60. Ott, J. 2002.
Predicting the range of linkage disequilibrium. Proc. Natl. Acad.
Sci. USA, 97, 2-3. [0237] 61. Camper-Kirby D, Welch S, Walker A et
al. Myocardial Akt activation and gender: increased nuclear
activity in females versus males. Circ Res 2001; 88(10):1020-1027.
[0238] 62. Miller, 1988. Ann. Reports Med. Chem. 23:295. [0239] 63.
Moran et al., 1987. Nucleic Acids Res., 14:5019. [0240] 64.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y. [0241] 65. Lanctot et al., 1999.
Development 126, 1805-1810.
Sequence CWU 1
1
70161DNAHomo sapiens 1agttccatac tcccatctgt gcctcactgg cggcagtcct
gctcaaatac atcctggctc 60t 61220DNAArtificial sequencePrimer
2tcactggtgg cagtcctgct 20318DNAHomo sapiens 3cgtttggcgc cctgtgat
18418DNAHomo sapiens 4attttcgcgc gctttggc 18520DNAHomo sapiens
5tttagcgcgg tgagtttgaa 20621DNAHomo sapiens 6gttttcgcgc ttaaatttga
g 21721DNAHomo sapiens 7gatttggcgc gtaaaagtgg c 21821DNAHomo
sapiens 8tttttcgcgc ccaatagtgt t 21920DNAHomo sapiens 9aatttcgcgc
caaacttggg 201018DNAHomo sapiens 10aacttcgcgc caatcggc
181122DNAHomo sapiens 11tttttcccgc caagcctctg ag 221220DNAHomo
sapiens 12atagtcgcgg gatacttgaa 201320DNAHomo sapiens 13gggctggcgg
aaggtttgaa 201420DNAHomo sapiens 14gacctggcgg gagatttggc
201520DNAHomo sapiens 15cacttggcgg gagataggaa 201620DNAHomo sapiens
16tcactggcgg cagtcctgct 201730PRTHomo sapiens 17Arg Val Pro Ser Ala
Lys Ala Val Thr Ser Gly Leu Pro Gly Asp Thr 1 5 10 15 Ala Leu Leu
Leu Pro Pro Ser Pro Arg Pro Ser Pro Arg Val 20 25 30 1812PRTHomo
sapiens 18Arg Phe Asp Ala Gly Glu Leu Ile Thr Gln Arg Glu 1 5 10
1918PRTHomo sapiens 19Arg Asn Ile Thr Tyr Leu Pro Ala Gly Gln Ser
Val Leu Leu Gln Leu 1 5 10 15 Pro Gln 2012PRTHomo sapiens 20Lys Asp
Leu Gln Asn Val Asn Ile Thr Leu Arg Ile 1 5 10 2120PRTHomo sapiens
21Arg Ser Arg Asn Ile Thr Tyr Leu Pro Ala Gly Gln Ser Val Leu Leu 1
5 10 15 Gln Leu Pro Gln 20 2222PRTHomo sapiens 22Lys Ala Ala Glu
Leu Ile Ala Asn Ser Leu Ala Thr Ala Gly Asp Gly 1 5 10 15 Leu Ile
Glu Leu Arg Lys 20 2317PRTHomo sapiens 23Arg Ala Ala Gln Asn Ile
Ser Lys Thr Ile Ala Thr Ser Gln Asn Arg 1 5 10 15 Ile 2416PRTHomo
sapiens 24Arg Gln Lys Ile Val Gln Ala Glu Gly Glu Ala Glu Ala Ala
Lys Met 1 5 10 15 2510PRTHomo sapiens 25Arg Leu Gly Leu Asp Tyr Glu
Glu Arg Val 1 5 10 2610PRTHomo sapiens 26Arg Ala Gln Val Ser Leu
Leu Ile Arg Arg 1 5 10 2713PRTHomo sapiens 27Arg Val Leu Pro Ser
Ile Val Asn Glu Val Leu Lys Ser 1 5 10 2810006DNAHomo sapiens
28cccaaattgt ctatctgtga tagtggctgt gccccttcgg gccctgagca ccctgtgtcc
60tgtgcagcag tcagatatct ggagggagac tgaggcactg gctgcagagc ttgtgatcat
120gagagagact cactaggact acagatgggt aaactgaggc cttcgagggg
gcagctccag 180aaaggcaggg gccataatgt ctcaccttca tatttcccgt
gccaagctgt ggccttctgc 240attcatggca gatgagtgga caaaggctga
tggactgatg gagaaacaaa gggatagatg 300gagcagctgg gcagctcagc
aaatgatgct gcaatgatct gcttccaact cacctcaaat 360ccatccttct
ctctccaggc agagtgggct tttaagatac acatctggcc aggtctctca
420ctgttcaaac ccttcatctg ctcctttttg ccttcaggat aacatcccac
cctcctatca 480aggactatgg agccctgtgg gatctggttc ccacttgatt
ctccaacttc ctcttcccct 540atgccctgcc ttctcatctg ttccagtgct
attatgaagc cacacgttct tcctttatta 600tcaagcatac cacagtttat
ctcacctcag aggctttgca cagtatattt tcctagggag 660gggtccccag
gtggtagaaa aacggttaca gccaactcct ccatgtgtca ctcaagaccc
720ttcaacagca ggctgcagat ttcctctcca gcactgtgct ccaactgtgt
aatggatttc 780tgtgtctgcc tccttgactc aacccaaatg aacaagagcc
atctatctct gtatctctgc 840aatcacaggc acaaaatagg tgctctctac
attttttcca acctgagagg ccattctaga 900agggtctcag gccacggttc
tgtccagtat tccatgcaga tgctgacagg actgcaatta 960aaaaaatact
tgagatgccc aaatgcccaa atagcttctc attttgcttt gactaccaat
1020aattgcacag tgcaatagaa taatgctcaa atacattaac atcttacttg
atcctagggg 1080gtcctctcta cttttaaagc ctcaaacttc ctccctctca
caggtgaaaa ggggagtaca 1140aatacattcc ctcccttgct ctgcggatcc
attcctacag gtagtcaaga ctctgagctt 1200cccctctgac tttctggcag
tgcttcacct ctccccacag atgagtgcag gaacaattct 1260aacagacttc
agactcttcc aacagagcca atccctcccc atcacgttgg agtggacttg
1320ctacccacac catcaacagg cccctgagaa acttcacagg gcaggggctt
ctttggtaaa 1380accaaccctt tccttccacc agctcagaga agttgttcca
gatagatgcc aggattcttg 1440gaggagcatg gtgattctgg ggtggagcct
ctgaccctgg ccaaccaaag gcctgagcca 1500ctcttccccc acaaagtgat
tggcgcagga gtgggcatgt aagctggacc cagccaatca 1560gcataaccaa
atcccttgcc caccctgggg agggtcctat agttgttgcc aagagaggct
1620cacccctgtt ctcaagaagc ttacaactgg taggggcaac aggttttaat
ctatcattac 1680acaaatattt aatttcaata ctgttgcaat aagagctatg
aaggaaaaga acactccccc 1740tacttttact tggtgttaag atttgaagaa
gaaaaaaaaa aaacactgcc tgaaggattg 1800ttatggcctt ctatataata
gtggctgcag acatttgccc attatgttca gcatgaaccc 1860atgtgacaaa
ttcatcaaag cgttttgcac tagggagaaa aatttgtatt agaggaagca
1920cagcagtttg gactgaaaga caaagaaaat tcagccaatt ctgctgatct
tttttgatgg 1980ggcacctgga agctgaaagc taaagtggta ctcaggaaca
gggactgcta cttctgttcc 2040tggtgaatcc tgccccaaac ctcctctctc
tctgattcct gattccactg tgccagtggg 2100aatatatgct ccccaagatg
tcaaaactaa agggaaattg caaaaaatat atacatatat 2160ttttagagag
aaaataagat tataaaaaat gtgttttgta ccccccaagt ttcactaaga
2220acttcctgac ttccaggccc tggttgtgcc ccacgcacca gcctgcccag
ctttcctgga 2280ccaaacttcc tagcacctaa gcaggggatg agggcagata
aactaaatca gaaaagggat 2340ctgttcctcc tagactcaac caacatgacc
accgtgggga aagaagaaac aaaaacaaga 2400gcaaactctc ttaaagagca
gcctggcagc tatcaccatt agcattcagc ccctctgtcc 2460acaggactca
ggaccaaacc cctcaccttc actatcccat ccgtttccca agaagcagaa
2520atacttattc tcacatttca cagatgggga agctgaggct aggagaggtt
atgttatttg 2580ccaaagccac acaactagta aaagccactg acaagattct
ggctcaggcc atcaggtgcc 2640agaggcagca ttttttggca ccacaggccc
tgcctgggaa caagagcatg cagaaaatct 2700cacaagagat gggaacaaaa
tttggaaaat tgctagcgtg cagggagggg ggaaggtgtg 2760atttcctgct
acagacgcca gagtaaaagc caccccagga gtgcctgtgc agccctccat
2820agtaaggtcc agcggctgca tttatgccca aagatgcccc tggtgcttgg
agtggaagga 2880agattccaga gacaagatta gaaacttctc agcttagcag
ctctagggct ggacccgcca 2940acaagccatt ttacacataa agcagtcaat
gggagggggt agacgtaggg ggctaaactc 3000cccacagcac agggtccaag
ttggtagact gcactttctc caggcgcagg tccgctagtg 3060ccggcatcgg
ggactcgtta tcttaacttg cgaccctggg tgcacagagc cctgcacaca
3120ccactggaga ggggttcctg ctgtcgaggg ttgagaggag ggtatggagt
ccctggaaca 3180gcacgacagg gtgcagaggc cacctggcag ggcctgaaca
ccgaggcctc tgtgagcttg 3240ggtcgggccg gcttcccgct tcggaggttg
gggagggggt cgtgggtctc tgcgttccca 3300ggccaagcgg ccctggaggc
acggactagc aggacgccga ggtggcgcgg gtcgcggcct 3360ctcccgcagc
agctgtcggc gagaaccagg cagggaggcg ccgctgctga ctgcatctca
3420tgaaagattc aggcccggct gccgcgctgc catctcccgg caccttgcgc
cggaaacggt 3480cgctctggag cccgtggccg tcggcgggca ggcttagccg
ctccagtccc tgagaaaggc 3540aggccacagc ccgacctgcc ctgtggtccc
atcccataat cccaacagca agcaggctca 3600ggctgggcac ttcggggtac
caggagtagg ttcggccaac tggtttccac catgaggctt 3660cgcgcacagg
gttatctggc cacgaggcaa cgctggggag ccctgtggcc tgagggtggg
3720caaaggacag gctcccagtt cccttgcgtc cagcccgtct cccagcggca
gccagccagg 3780aacggcctgc ggggccacag gggtggaggc gtcaccgttc
gcaggcccgc agcaggatgg 3840tcgctggggg atgtgcaggc ataggggttg
gacaaggggc cccagaagtg tctgtcctga 3900ggggttggtg tgccctttcc
tcaccagccc agcccctgag gagagggaag aaggcaattc 3960ccccaaccag
ggcaggtcgg gcggttgccc caccctaaca ccccctaccc ccaaacacag
4020aaaacctggg gtctgtcctc aaacctccct ggctgccacg ctctgggcag
cggactctcc 4080ctgccaacac gcaagaccag ctccctcccg caggctgagc
agaaagaaga aaggtccaat 4140ctcaaaaccc caaactcgac caccagcccc
cgtctaaacg gaagtagggc cagcccctca 4200cgagtcaggt gggaaactgg
gcccagggag agaaagtgcc ccagggccag gctgggaccc 4260gctctggctt
cgtccgcatg cggcagggcc cctccacgga ggtcccaggg cgcgctcccc
4320ggcctcgagg cccggccgcc agccgcgcgg accccagcct acgccccgag
ggaggccagg 4380acccctagcc ggcgggactg cgcgccgccc ctctccccgc
aggtcccggc gaacacctag 4440cttcccctcc ccccaccctt cccgcctccc
ggccagtgtc cccgccttcc ccgcgggcga 4500cgggcggcgg cggcgggagg
agcgggccga gccgaggaag ccccggcctc gcgcgctggg 4560atgtagcgaa
ccagcagggg ccgaagaacc gtgcagtgcc agagccagag ctggatccgg
4620ggccccagcc ggagccgaaa cctgagccag agtccgcggc gggcgagccc
ggagcccacg 4680agccgcagac gcagcgctgc ccaggtgggg taagagacgc
tgggctaggg gcgcagggtc 4740tccgcggtgg aggggcgcag ggaggtggcg
gccgagtcct gcgcagtttg ctcctggcgt 4800gtgtgggtcc acccggcggc
gcgggacagc gcaaggcgcg gaaggtcagg agccttcgag 4860gcagcgcgag
gagctcgttc ctgcgcccag ggcacagtca tagccgccgt caccgggtgc
4920tacctcaccc aaccggcggg atcaaccctc tgctttggct ccgggcacct
caagagggta 4980gcagcctcgg gggcacgggc cacggccccg cgaagggcac
aacctgagaa gcccgtggca 5040gcccctcgca gcgtcgggtg acacagggct
cccccacccc caggagaagt gggcaggaga 5100gagggccgcc cgctgctccc
cgctgcgtcc agggatggag ggccccacca cccatggaat 5160tgctggcccc
tctgcgtggc ccgggacttc agccgtggct tcgcgtcaag agggtatttt
5220tcctaaacga aaccgcttcg ttcgttcgtt cgttcgttcg ttcgggcagc
aatgccgcag 5280aaaagcagca gacgtcggtc cgcgccctgg ctctcttcgc
cccggacccc gacgtcccgc 5340cgcagcgctc ggaggtgccc ccagcccaag
gcagcctgct ctcgccggca caggtcgggc 5400tttttcttcc caggagagaa
accccaattc ccttcgtaac gtccaataaa gacattcccg 5460cggcttctcc
caggtttggt tgttgacgca gggtcccgga gcacgcagtc gcttctcaag
5520aaccgggtct cggatttctg aaattgacca gcttcgtaaa ttggagccta
ttctcccgcg 5580gcaaaggcag ggccccaaag ccgggatcgc agtaatggga
accccaggct ggaatccggg 5640tcccaagctt ttccgattta ggaattcccc
gaatctacaa atatttagtc cacttttctg 5700aaaaactaaa ttctgaaaaa
cacaaattct cttgacatcc ctgtgacctc tgaaagccac 5760cagggccaga
gggaggaaat cccaggttgc tgtccactgg gggaggattc aggtctaggg
5820ttcaggtcta cggtagtcag ggcaaaagct acaggcagca ggggcagcac
aggagacttg 5880ctgtccccgt gccctttccc ggggctgctt tcggcctccc
gcatctcttc cagggaaagg 5940aaaagaggtg ggctggggct tggagaccag
gctgtctgga ctctaggatg cagaggcctc 6000cagacaggct cagggtgctc
ttctcccatg aaagcagccg ctgggaggag gaggctatgg 6060tgcatccata
agttgcccct ctgctcccca gttgtgcgac cagctgctac ctccttccta
6120gtcttcttcc ccacagctca gccattctca ggaaccagac agcgtccatg
gacttaggtg 6180agagatgggc cgggtagagc catgggtcct accagccgct
gactgagcgg cccacggcac 6240agagtcctga gttccatact cccatctgtg
cctcactggc ggcagtcctg ctcaaataca 6300tcctggctct ccccgggaca
ggctggggat ccccatttgg caggaagcct cagactgggg 6360tcccaggaag
cctaaaggag ccagtgaggt ctttccagcc cctacctgag caccctcctc
6420cccacttacc cagtaattgc tgtattcaaa gaaacgggag cttttattgg
ggagggggtg 6480ttagatcagg cagaaagagg taggtggtcc aaacctgcac
tcccaaaaca gggttttcaa 6540gtttgaactt ctccacggac taagaggctt
agggctggaa tgtcccagag agtcatggat 6600agccctggtg gcaggccatg
gcacattcct tcctttttcc taaaatacct tgattctggg 6660agcaaggatt
agggcacggt gcccccgtgg gtgggtagaa ggatgccccc ccactgagag
6720ccttccaacc acccttccca aattacatta ctaaaccatt cttgggcaca
gggtgttttt 6780agtgagccag gcttcaggaa gggtcctcat ggtgactact
tcaaccccac aacagcccaa 6840gctcttctgc tcagcccagc caagacccta
aactccaaaa ttcttgaaaa tcagagaatc 6900attgctggct ttgtgtggtc
acggaggggt ggggaacagg gcacatggtt ccagctccac 6960taagccccct
tccctcctct cttcgtgtcc catcagcaag tgagctggat gctgaagcag
7020caggcagagt ccggtgttgg acatgggaac tgaggcacag tgcagatcaa
gccttaacct 7080tgagggaaac acaggtcaca tagcacagct gggggaacac
aaagcctctg cttactcctg 7140aaagagtgct gttttctgtc ctgtatgtgt
gacgtgtctg tgagcgtgca agaagcccct 7200atcttgactg ggacaatggc
cagtgagtgt agctggggaa gaattgagag catgtccagg 7260tcccttcccc
agccaacgcc caagatcagg ccacagcctc ctcacaatca attgcctcct
7320cactccttga tcactcagtg ctgcccaggc ccagcagaac agactctgcc
agcaggcccc 7380actagcccca gctcctcttt gggtctcagg tcccctgagg
atatggggct tcacctgaaa 7440tggtctgagg gcttttcctt ctacacagca
ggcatcaaga tcaccaaata aagggactat 7500tgtgcctgcc tggagccctg
ccagaggttt gggcccagag gggcacacag caggtgctca 7560ataactgcat
taaatgcact aacagtgagg aaacacgccc ctcagactaa gcagtgagtg
7620ctgctcacag aatagtcccc attgggggat ggcccaaaga gtcactttgg
tccctctggg 7680aagtgagaag gcaagtgaga aggctgtgag tcttaacctc
ctctagaggc ccacagacag 7740accattcatt tctaagtctc tacccagaga
cgcactgtgc ttcccacctt ggcctgacat 7800gtggcagggt tagaacacac
ctcctatccc ctgccagccc gcgttcatgc caagtagcac 7860atatatgcct
aaactcagca cttccatagt gcagtgaata catgtgtgtg tacagcatct
7920ccgcatggat gtacaggatg tgtgtgtgtg tgcgtgcccc catgctgtct
gcattcaggc 7980tgttcttttt ggtaagacag ctaaaaaaag aatggtctgt
gaagggacac tccctagcac 8040gctgcaacac ctgaatatct ccttgaaagg
agggatcttc tactgcagga gactcgtggt 8100aaaggtggcc aagaaacatg
gcaacggtgg ggctgagggc aaatgctggg caactgtgct 8160tccccatgtt
cccctccccg tagccaagac tcatttcatg gagggagatc tcagcttgga
8220agaaggcagg agtcactgag cctccccaat ccaaacccct gagaagtgtc
ctccctctgg 8280cctcagaccc tgcatcctgt ggtcacagac ccacagtgag
aaaggaccag gccctaagga 8340gctgtgctgt ctctccacgg cccagagcgg
gggatgggga tggggatggg gatggggatg 8400gggatgggga tgggggtagg
ggtgggggtg ctttggacta acgtggaggg aatggaaggc 8460aggcctggtt
ccaccctgca tgcccgaccc tggccccagc agcccccaca aggagctcag
8520ctgaccctgg gtgtctccct gtgatgggaa ggggtaagac gaggactcaa
aggcagaacc 8580tgcagagtgc cccagacgct gatacctgca cagtcagtgc
cacccaccca ggagttgagg 8640aggcactggg ttttggggtg aggacactgg
acacctccct gcttctttcc caggcagaca 8700atcctggcgc agctcccttg
ggttgctgtg tctggtggag ctgatcacag gtgaggggca 8760gagggcagtc
tggggtccgc ctatggccag aggagcaggt cagggcggcg ccttgccgcc
8820ccagctgtgg cctgtttgct caagacgctg aggtctcggg gccagctaac
aattgttgag 8880caaaatcctt cgacaaactt cacctacgtg caaggactcg
aggagggaat cactcttagg 8940agtgggagag taatgtcttt gcctgtgccc
agtgaaggcc cattggagct gcagctcagc 9000taccactgtg tgggagagaa
gctggaagac tgagggcttc ctgggctgct ggcccagggt 9060tgggagacag
cagtcacctg gcttaccagg cctatgcctg aagccctggg aagccaggac
9120gcaggcccca ggctgggaca aagctaccct gaaggagggc aaaggctgcc
aaggccaacc 9180ccatgcctgc caaggccagg cctggcccat ttggccaagg
cctaaggtgt aaaacaaggg 9240gagaggtaca agaggctgtg gggtctggct
gggatccttg gggtcttcct tctgcattct 9300ccaaacgcct agagccagca
gaaacgtttc gtctgattag aagccatcat ttctatccca 9360atcccggaaa
attgactgcg gtgcagagag ggaggcctga gaagcagccg taggggagaa
9420ggtccaagct aattaggagg cagcatccgg gggcccatta gagcgcaggc
tgctgtcact 9480cagccgggct gagttcccgg gagaagaggc tggagaagga
ggggcaggcg gcccctcgac 9540gaggacaccg ctgggagctg ccggaacggg
ccccgggctc tgcccccgcc ccggcgctgg 9600ctcgaaggcg cccgctcggt
gcgatcctgt tcggcaaaca ttcactcatc ctgggctgtt 9660ctcgccaggg
ctggggactt cgaggcggcc gagacgggag ttgattctag gcgaaacaag
9720tcatttgagg cctgaggtgt gcacgagccg cccgggactc gcaggccaga
tgcgtttctt 9780ttgtgaggcc gagggagaac tcggtgtgtc accggggaag
gagggagagg cgcggcgagg 9840ccgcgggggg cggggaggcg gcgggaaggt
ggctgcggag ggggagggcg cgggcgaggc 9900agggagggag ggagggcggc
agtgagggcg cggcggcgcg ggcggcttgg ggctggattc 9960cgcccgcgct
ccctcgctcg ctcgctccct ccccagcccc ctccca 10006291826DNAHomo sapiens
29agtatgtgtg gttggggaat tcatgtggag gtcagagtgg aagcaggtgt gagagggtcc
60agcagaagga aacatggctg ccaaagtgtt tgagtccatt ggcaagtttg gcctggcctt
120agctgttgca ggaggcgtgg tgaactctgc cttatataat gtggatgctg
ggcacagagc 180tgtcatcttt gaccgattcc gtggagtgca ggacattgtg
gtaggggaag ggactcattt 240tctcatcccg tgggtacaga aaccaattat
ctttgactgc cgttctcgac cacgtaatgt 300gccagtcatc actggtagca
aagatttaca gaatgtcaac atcacactgc gcatcctctt 360ccggcctgtc
gccagccagc ttcctcgcat cttcaccagc atcggagagg actatgatga
420gcgtgtgctg ccgtccatca caactgagat cctcaagtca gtggtggctc
gctttgatgc 480tggagaacta atcacccaga gagagctggt ctccaggcag
gtgagcgacg accttacaga 540gcgagccgcc acctttgggc tcatcctgga
tgacgtgtcc ttgacacatc tgaccttcgg 600gaaggagttc acagaagcgg
tggaagccaa acaggtggct cagcaggaag cagagagggc 660cagatttgtg
gtggaaaagg ctgagcaaca gaaaaaggcg gccatcatct ctgctgaggg
720cgactccaag gcagctgagc tgattgccaa ctcactggcc actgcagggg
atggcctgat 780cgagctgcgc aagctggaag ctgcagagga catcgcgtac
cagctctcac gctctcggaa 840catcacctac ctgccagcgg ggcagtccgt
gctcctccag ctgccccagt gagggcccac 900cctgcctgca cctccgcggg
ctgactgggc cacagccccg atgattctta acacagcctt 960ccttctgctc
ccaccccaga aatcactgtg aaatttcatg attggcttaa agtgaaggaa
1020ataaaggtaa aatcacttca gatctctaat tagtctatca aatgaaactc
tttcattctt 1080ctcacatcca tctacttttt tatccacctc cctaccaaaa
attgccaagt gcctatgcaa 1140accagcttta ggtcccaatt cggggcctgc
tggagttccg gcctgggcac cagcatttgg 1200cagcacgcag gcggggcagt
atgtgatgga ctggggagca caggtgtctg cctagatcca 1260cgtgtggcct
ccgtcctgtc actgatggaa ggtttgcgga tgagggcatg tgcggctgaa
1320ctgagaaggc aggcctccgt cttcccagcg gttcctgtgc agatgctgct
gaagagaggt 1380gccggggagg ggcagagagg aagtggtctg tctgttacca
taagtctgat tctctttaac 1440tgtgtgacca gcggaaacag gtgtgtgtga
actgggcaca gattgaagaa tctgcccctg 1500ttgaggtggg tgggcctgac
tgttgccccc cagggtccta aaacttggat ggacttgtat 1560agtgagagag
gaggcctgga ccgagatgtg agtcctgttg aagacttcct ctctaccccc
1620caccttggtc cctctcagat acccagtgga attccaactt gaaggattgc
atcctgctgg 1680ggctgaacat gcctgccaaa gacgtgtccg acctacgttc
ctggccccct cgttcagaga 1740ctgcccttct cacgggctct atgcctgcac
tgggaaggaa acaaatgtgt ataaactgct 1800gtcaataaat gacacccaga ccttcc
182630272PRTHomo sapiens 30Met Ala Ala Lys Val Phe Glu Ser Ile Gly
Lys Phe Gly Leu Ala Leu 1 5 10 15 Ala Val Ala Gly Gly Val Val Asn
Ser Ala Leu Tyr Asn Val Asp Ala 20 25 30 Gly His Arg Ala Val Ile
Phe Asp Arg Phe Arg Gly Val Gln Asp Ile 35 40 45 Val Val Gly Glu
Gly Thr His Phe Leu Ile Pro Trp Val Gln Lys Pro 50 55 60
Ile Ile Phe Asp Cys Arg Ser Arg Pro Arg Asn Val Pro Val Ile Thr 65
70 75 80 Gly Ser Lys Asp Leu Gln Asn Val Asn Ile Thr Leu Arg Ile
Leu Phe 85 90 95 Arg Pro Val Ala Ser Gln Leu Pro Arg Ile Phe Thr
Ser Ile Gly Glu 100 105 110 Asp Tyr Asp Glu Arg Val Leu Pro Ser Ile
Thr Thr Glu Ile Leu Lys 115 120 125 Ser Val Val Ala Arg Phe Asp Ala
Gly Glu Leu Ile Thr Gln Arg Glu 130 135 140 Leu Val Ser Arg Gln Val
Ser Asp Asp Leu Thr Glu Arg Ala Ala Thr 145 150 155 160 Phe Gly Leu
Ile Leu Asp Asp Val Ser Leu Thr His Leu Thr Phe Gly 165 170 175 Lys
Glu Phe Thr Glu Ala Val Glu Ala Lys Gln Val Ala Gln Gln Glu 180 185
190 Ala Glu Arg Ala Arg Phe Val Val Glu Lys Ala Glu Gln Gln Lys Lys
195 200 205 Ala Ala Ile Ile Ser Ala Glu Gly Asp Ser Lys Ala Ala Glu
Leu Ile 210 215 220 Ala Asn Ser Leu Ala Thr Ala Gly Asp Gly Leu Ile
Glu Leu Arg Lys 225 230 235 240 Leu Glu Ala Ala Glu Asp Ile Ala Tyr
Gln Leu Ser Arg Ser Arg Asn 245 250 255 Ile Thr Tyr Leu Pro Ala Gly
Gln Ser Val Leu Leu Gln Leu Pro Gln 260 265 270 311416DNAHomo
sapiens 31aagttcgggt ccgtagtggg ctaaggggga gggtttcaaa gggagcgcac
ttccgctgcc 60ctttctttcg ccagccttac gggcccgaac cctcgtgtga agggtgcagt
acctaagccg 120gagcggggta gaggcgggcc ggcaccccct tctgacctcc
agtgccgccg gcctcaagat 180cagacatggc ccagaacttg aaggacttgg
cgggacggct gcccgccggg ccccggggca 240tgggcacggc cctgaagctg
ttgctggggg ccggcgccgt ggcctacggt gtgcgcgaat 300ctgtgttcac
cgtggaaggc gggcacagag ccatcttctt caatcggatc ggtggagtgc
360agcaggacac tatcctggcc gagggccttc acttcaggat cccttggttc
cagtacccca 420ttatctatga cattcgggcc agacctcgaa aaatctcctc
ccctacaggc tccaaagacc 480tacagatggt gaatatctcc ctgcgagtgt
tgtctcgacc caatgctcag gagcttccta 540gcatgtacca gcgcctaggg
ctggactacg aggaacgagt gttgccgtcc attgtcaacg 600aggtgctcaa
gagtgtggtg gccaagttca atgcctcaca gctgatcacc cagcgggccc
660aggtatccct gttgatccgc cgggagctga cagagagggc caaggacttc
agcctcatcc 720tggatgatgt ggccatcaca gagctgagct ttagccgaga
gtacacagct gctgtagaag 780ccaaacaagt ggcccagcag gaggcccagc
gggcccaatt cttggtagaa aaagcaaagc 840aggaacagcg gcagaaaatt
gtgcaggccg agggtgaggc cgaggctgcc aagatgcttg 900gagaagcact
gagcaagaac cctggctaca tcaaacttcg caagattcga gcagcccaga
960atatctccaa gacgatcgcc acatcacaga atcgtatcta tctcacagct
gacaaccttg 1020tgctgaacct acaggatgaa agtttcacca ggggaagtga
cagcctcatc aagggtaaga 1080aatgagccta gtcaccaaga actccacccc
cagaggaagt ggatctgctt ctccagtttt 1140tgaggagcca gccaggggtc
cagcacagcc ctaccccgcc ccagtatcat gcgatggtcc 1200cccacaccgg
ttccctgaac ccctcttgga ttaaggaaga ctgaagacta gccccttttc
1260tgggaaatta ctttcctcct ccctgtgtta actggggctg ttggggacag
tgcgtgattt 1320ctcagtgatt tcctacagtg ttgttccctc cctcaaggct
gggaggagat aaacaccaac 1380ccaggaattc tcaataaatt tttattactt aacctg
141632299PRTHomo sapiens 32Met Ala Gln Asn Leu Lys Asp Leu Ala Gly
Arg Leu Pro Ala Gly Pro 1 5 10 15 Arg Gly Met Gly Thr Ala Leu Lys
Leu Leu Leu Gly Ala Gly Ala Val 20 25 30 Ala Tyr Gly Val Arg Glu
Ser Val Phe Thr Val Glu Gly Gly His Arg 35 40 45 Ala Ile Phe Phe
Asn Arg Ile Gly Gly Val Gln Gln Asp Thr Ile Leu 50 55 60 Ala Glu
Gly Leu His Phe Arg Ile Pro Trp Phe Gln Tyr Pro Ile Ile 65 70 75 80
Tyr Asp Ile Arg Ala Arg Pro Arg Lys Ile Ser Ser Pro Thr Gly Ser 85
90 95 Lys Asp Leu Gln Met Val Asn Ile Ser Leu Arg Val Leu Ser Arg
Pro 100 105 110 Asn Ala Gln Glu Leu Pro Ser Met Tyr Gln Arg Leu Gly
Leu Asp Tyr 115 120 125 Glu Glu Arg Val Leu Pro Ser Ile Val Asn Glu
Val Leu Lys Ser Val 130 135 140 Val Ala Lys Phe Asn Ala Ser Gln Leu
Ile Thr Gln Arg Ala Gln Val 145 150 155 160 Ser Leu Leu Ile Arg Arg
Glu Leu Thr Glu Arg Ala Lys Asp Phe Ser 165 170 175 Leu Ile Leu Asp
Asp Val Ala Ile Thr Glu Leu Ser Phe Ser Arg Glu 180 185 190 Tyr Thr
Ala Ala Val Glu Ala Lys Gln Val Ala Gln Gln Glu Ala Gln 195 200 205
Arg Ala Gln Phe Leu Val Glu Lys Ala Lys Gln Glu Gln Arg Gln Lys 210
215 220 Ile Val Gln Ala Glu Gly Glu Ala Glu Ala Ala Lys Met Leu Gly
Glu 225 230 235 240 Ala Leu Ser Lys Asn Pro Gly Tyr Ile Lys Leu Arg
Lys Ile Arg Ala 245 250 255 Ala Gln Asn Ile Ser Lys Thr Ile Ala Thr
Ser Gln Asn Arg Ile Tyr 260 265 270 Leu Thr Ala Asp Asn Leu Val Leu
Asn Leu Gln Asp Glu Ser Phe Thr 275 280 285 Arg Gly Ser Asp Ser Leu
Ile Lys Gly Lys Lys 290 295 3320DNAHomo sapiens 33agtgaccgcc
gtcaggacga 203420DNAHomo sapiens 34agtgaccacc gtcaggacga
203520DNAArtificial sequencePrimer 35cccacctcca tggacgcctt
203622DNAArtificial sequencePrimer 36gtcagctgtt gtactggcac gc
223718DNAArtificial sequencePrimer 37ggaaatcgtg cgtgacat
183823DNAArtificial sequencePrimer 38tcatgatgga gttgaatgta gtt
233920DNAArtificial sequencePrimer 39gcccagaact tgaaggactt
204020DNAArtificial sequencePrimer 40tcttgctcag tgcttctcca
204120DNAArtificial sequencePrimer 41agtatgtgtg gttggggaat
204220DNAArtificial sequencePrimer 42gctcgctctg taaggtcgtc
204318DNAArtificial sequencePrimer 43aaagagccgg atcgcagg
184421DNAArtificial sequencePrimer 44caccattgat gttgagaggg c
214520DNAArtificial sequencePrimer 45ctgtttgctc aagacgctga
204620DNAArtificial sequencePrimer 46ctcggcctca caaaagaaac
204720DNAArtificial sequencePrimer 47tgtctgcatt caggctgttc
204820DNAArtificial sequencePrimer 48gattccctcc tcgagtcctt
204920DNAArtificial sequencePrimer 49caagtgagct ggatgctgaa
205020DNAArtificial sequencePrimer 50agggagtgtc ccttcacaga
205120DNAArtificial sequencePrimer 51gctcagccat tctcaggaac
205220DNAArtificial sequencePrimer 52gccattgtcc cagtcaagat
205320DNAArtificial sequencePrimer 53tcgcgtcaag agggtatttt
205420DNAArtificial sequencePrimer 54taggacccat ggctctaccc
205520DNAArtificial sequencePrimer 55cacgagtcag gtgggaaact
205620DNAArtificial sequencePrimer 56gacgtctgct gcttttctgc
205719DNAArtificial sequencePrimer 57aggcacggac tagcaggac
195818DNAArtificial sequencePrimer 58atgcggacga agccagag
185920DNAArtificial sequencePrimer 59ttagcattca gcccctctgt
206021DNAArtificial sequencePrimer 60ttcatgagat gcagtcagca g
216120DNAArtificial sequencePrimer 61acaactggta ggggcaacag
206220DNAArtificial sequencePrimer 62tgtgtggctt tggcaaataa
206320DNAArtificial sequencePrimer 63gcactgtgct ccaactgtgt
206420DNAArtificial sequencePrimer 64gggggagtgt tcttttcctt
206530DNAArtificial sequenceProbe 65ctgtgcctca ctggcggcag
tcctgctcaa 306630DNAArtificial sequenceProbe 66ctgtgcctca
ctggtggcag tcctgctcaa 306720DNAArtificial sequencePrimer
67ccacctacct ctttctgcct 206814PRTHomo sapiens 68Ile Thr Tyr Leu Pro
Ala Gly Gln Ser Val Leu Leu Gln Leu 1 5 10 6915PRTHomo sapiens
69Arg Ala Arg Phe Val Val Glu Lys Ala Glu Gln Gln Lys Lys Ala 1 5
10 15 7015PRTHomo sapiens 70Asp Gly Leu Ile Glu Leu Arg Lys Leu Glu
Ala Ala Glu Asp Ile 1 5 10 15
* * * * *