U.S. patent application number 14/554965 was filed with the patent office on 2015-06-04 for mirnas as therapeutic targets in cancer.
The applicant listed for this patent is THE RESEARCH FOUNDATION FOR THE STATE UNIVERSITY OF NEW YORK. Invention is credited to Jingfang Ju, Bo Song, Yuan Wang.
Application Number | 20150152422 14/554965 |
Document ID | / |
Family ID | 41398881 |
Filed Date | 2015-06-04 |
United States Patent
Application |
20150152422 |
Kind Code |
A1 |
Ju; Jingfang ; et
al. |
June 4, 2015 |
MIRNAS AS THERAPEUTIC TARGETS IN CANCER
Abstract
MicroRNAs (miRNAs) are a class of non-coding small RNA molecules
that regulate gene expression at the post-transcriptional level by
interacting with 3' untranslated regions (UTRs) of their target
mRNAs. The invention relates to the application of miR-192 and
miR-215. Both of these miRNAs impact cellular proliferation through
the p53-miRNA circuit, and interact with dihydrofolate reductase
(DHFR) and thymidylate synthase (TS). Particularly, upregulation of
these miRNAs reduces cellular proliferation. The invention relates
to this discovery. For example, inhibiting miR-192 and/or miR-215
sensitizes a neoplasm or a subject with a neoplasm to
chemotherapeutic agents. Furthermore, measuring the levels of
miR-192 and/or miR-215 provides one with information regarding
whether the neoplasm or subject will respond to chemotherapeutic
agents. Accordingly, the invention relates to composition and
methods relating to the identification, characterization and
modulation of the expression of miR-192 and miR-215.
Inventors: |
Ju; Jingfang; (East
Setauket, NY) ; Song; Bo; (Port Jefferson, NY)
; Wang; Yuan; (Selden, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE RESEARCH FOUNDATION FOR THE STATE UNIVERSITY OF NEW
YORK |
Stony Brook |
NY |
US |
|
|
Family ID: |
41398881 |
Appl. No.: |
14/554965 |
Filed: |
November 26, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12996249 |
Mar 15, 2011 |
8927207 |
|
|
PCT/US2009/046353 |
Jun 5, 2009 |
|
|
|
14554965 |
|
|
|
|
61122377 |
Dec 13, 2008 |
|
|
|
61059197 |
Jun 5, 2008 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/375; 435/6.12; 536/24.5 |
Current CPC
Class: |
A61K 45/06 20130101;
C12N 2310/14 20130101; C12N 15/113 20130101; C12N 15/1137 20130101;
A61K 31/7088 20130101; C12Q 1/6886 20130101; C12N 2310/113
20130101; C12Q 2600/136 20130101; C12Q 2600/178 20130101; C12N
2320/31 20130101; A61P 35/00 20180101; C12N 15/1135 20130101 |
International
Class: |
C12N 15/113 20060101
C12N015/113; A61K 31/7088 20060101 A61K031/7088; A61K 45/06
20060101 A61K045/06; C12Q 1/68 20060101 C12Q001/68 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH AND
DEVELOPMENT
[0002] The invention was made using U.S. Government funds, and
therefore the U.S. Government has rights in the invention.
Claims
1. A method of modulating expression of a component of a cell,
comprising contacting the cell with a nucleic acid comprising an
inhibitory nucleic acid having a sequence selected from the group
consisting of SEQ ID NOs:1, 2, 3, 9, 10, 25, a complementary
sequence thereof, a variant thereof on a fragment thereof in an
amount sufficient to modulate the cellular component.
2. The method of claim 1, wherein the nucleic acid is an antisense
nucleic acid.
3. The method of claim 1, wherein the nucleic acid is an siRNA or
an shRNA.
4. The method of claim 1, wherein the cellular component is
selected from the group consisting of miR-192 and miR-215.
5. The method of claim 1, wherein the cellular component is p21 or
p53.
6. The method of claim 1, wherein the cellular Component is
regulated by p53.
7. The method of claim 1, wherein the cellular component is DHFR or
TS.
8. A method of increasing proliferation of a cell, comprising
contacting the cell with a nucleic acid complementary to at least a
portion of a sequence selected from the group consisting of SEQ ID
NOs:1, 2, 3, 9, 10, 25 and an antisense sequence of SEQ ID NO:25,
in an amount effective to increase proliferation of the cell.
9. A method of increasing the sensitivity of a cell to a
chemotherapeutic agent, comprising contacting the cell with a
nucleic acid complementary to a sequence selected from the group
consisting of SEQ ID NOs:1, 2, 3, 9, 10, 25 and an antisense
sequence of SEQ ID NO:25, in an amount effective to sensitize the
cell to the chemotherapeutic agent.
10. The method of claim 9, wherein the chemotherapeutic agent is
selected from methotrexate, fluorouracil (5-FU), and
ralitrexed.
11. A method of increasing the sensitivity of a cell to radiation,
comprising contacting the cell with a nucleic acid complementary to
at least a portion of a sequence selected from the group consisting
of SEQ ID NOs:1, 2, 3, 9, 10, 25 and an antisense sequence of SEQ
ID NO:25, in an amount effective to sensitize the cell to
radiation.
12. The method of any one of claims 8 to 11, wherein the nucleic
acid is an antisense nucleic acid.
13. The method of any one of claims 8 to 11, wherein the nucleic
acid is an siRNA or an shRNA.
14. The method of any one of claims 8 to 11, wherein the cell is a
cancer stem cell.
15. The method of any one of claims 8 to 11, wherein the cell is a
neoplastic cell.
16. A method of treating a neoplasm in a subject, comprising
administering to the subject an effective amount of an inhibitory
molecule that inhibits expression of miR-192 or miR-215, and a
second therapy, wherein inhibition of expression of miR-192 or
miR-215 sensitizes the neoplasm to the second therapy.
17. The method of claim 16, wherein the second therapy comprises
administering a chemotherapeutic agent.
18. The method of claim 17, wherein the chemotherapeutic agent is
selected from methotrexate, fluorouracil (5-FU), and
ralitrexed.
19. The method of claim 16, wherein the second therapy comprises
administering radiation to the subject.
20. The method of any one of claims 16 to 19, wherein the neoplasm
is cancer.
21. The method of claim 20, wherein the cancer is selected from the
group consisting of colon cancer, pancreatic cancer, lung cancer,
breast cancer, cervical cancer, gastric cancer, kidney cancer,
leukemia, liver cancer, lymphoma, ovarian cancer, prostate cancer,
rectal cancer, sarcoma, skin cancer, testicular cancer, and uterine
cancer.
22. A method of diagnosing a neoplasm in a subject comprising
determining the level of expression of miR-192 or miR-215.
23. A method of identifying a neoplasm resistant to chemotherapy
comprising determining the level of expression in the neoplasm of a
microRNA (miRNA) selected from the group consisting of miR-192 and
miR-215, and identifying the neoplasm as resistant to therapy if
the level of the miRNA is elevated.
24. A method of determining whether a neoplasm is a candidate for
treatment with a chemotherapeutic agent comprising evaluating the
level of expression of a microRNA (miRNA) selected from the group
consisting of miR-192 and miR-215, and rejecting the candidate if
expression of the miRNA is elevated.
25. A kit for analysis of a pathological sample, the kit comprising
in a suitable container a hybridization reagent for, determining
the level of a miRNA selected from the group consisting of miR-192
or miR-215.
26. The kit of claim 25, wherein the hybridization reagent
comprises a hybridization probe.
27. The kit of claim 25, wherein the hybridization reagent
comprises amplification primers.
28. A method of identifying an agent that inhibits expression of a
microRNA (miRNA) selected-from the group consisting of miR-192 and
miR-215 comprising contacting a cell that expresses the miRNA with
an agent; and comparing an expression level of the miRNA in the
cell contacted by the agent with an expression level of the miRNA
in the absence of the agent, wherein the agent is an inhibitor of
the miRNA if expression of the miRNA is reduced.
29. The method of claim 28, wherein the test cell overexpresses the
miRNA.
30. An isolated inhibitory molecule comprising a nucleic acid,
wherein the nucleic acid consists essentially of a sequence
selected from the group consisting of SEQ ID NO:9, SEQ ID NO:25, a
complementary sequence of SEQ ID NO:9, a complementary sequence of
SEQ ID NO:25, fragments thereof and variants thereof.
31. The isolated inhibitory molecule, whenever the sequence is
selected from the group consisting of the complementary sequence of
SEQ ID NO:9, the complementary sequence of SEQ ID NO:25, fragments
thereof and variants thereof.
32. The isolated inhibitory molecule, wherein the sequence is SEQ
ID NO:25 or a complementary sequence of SEQ ID:25.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 12/996,249 which was filed Mar. 15, 2011,
which is the United States national phase of International
Application No. PCT/US2009/046353 filed Jun. 5, 2009, which claims
the benefit of U.S. Provisional Application No. 61/122,377 which
was filed on Dec. 13, 2008 and U.S. Provisional Application No.
61/059,197 which was filed Jun. 5, 2008. The disclosure of each of
these documents is hereby incorporated in its entirety by
reference.
FIELD OF THE INVENTION
[0003] The present invention relates to compositions and methods
relating to the identification and characterization of genes and
biological pathways related to these genes as represented by the
expression of the identified genes, as well as use of microRNAs
(miRNAs) related to such, for therapeutic, prognostic, and
diagnostic applications, particularly those methods and
compositions related to assessing and/or identifying pathological
conditions directly or indirectly related to miR-192 or
miR-215.
BACKGROUND OF THE INVENTION
[0004] Dihydrofolate reductase (DHFR) and Thymidylate Synthase (TS)
are two key enzymes for DNA synthesis and represent some of the
most important targets for cancer chemotherapy. DHFR catalyzes the
reduction of folate and 7, 8 dihydrofolate to 5, 6, 7, 8
tetrahydrofolate, the latter as the one-carbon donor is essential
for the formation of thymidylate (dTMP) which is the precursor for
DNA synthesis (see Banerjee et al., "Novel aspects of resistance to
drugs targeted to dihydrofolate reductase and thymidylate synthase,
Biochim. Biophys. Acta. (2002) 1587: 164-173). TS catalyzes the
reductive methylation of dUMP by CH2H4folate to produce dTMP and
H2folate (see Carreras et al., "The catalytic mechanism and
structure of thymidylate synthase," Annu. Rev. Biochem. (1995) 64:
721-762). DHFR inhibitors, such as methotrexate (MTX), and TS
inhibitors, such as 5-fluorouracil (5-FU) and Tomudex or Ralitrexed
(TDX, ZD1694), are widely used chemotherapeutic drugs for the
treatment of osteosarcoma and colon cancer (see Widemann et al.,
"Understanding and managing methotrexate nephrotoxicity,"
Oncologist. (2006) 11: 694-703; see also Calvert, "An overview of
folate metabolism: features relevant to the action and toxicities
of antifolate anticancer agents," Semin. Oncol. (1999) 26:
3-10).
[0005] As such, TS and DHFR are the major targets of cancer
chemotherapy in the clinic today. TDX, the third-generation TS
inhibitor, is an active agent in the treatment of human colon and
breast cancer (see Drake et al., "Resistance to tomudex (ZD1694):
multifactorial in human breast and colon carcinoma cell lines,"
Biochem. Pharmacol. (1996) 51: 1349-1355). The inhibitor of DHFR,
such as MTX, is widely used in the treatment of human leukemia,
osteosarcoma and choriocarcinoma. Increased DHFR protein levels are
reported to be associated with drug resistance (see Banerjee et
al., "Novel aspects of resistance to drugs targeted to
dihydrofolate reductase and thymidylate synthase," Biochem.
Biophys. Acta. (2002) 1587: 164-173), and low tumor expression
levels of TS have also been linked with improved outcome for colon
cancer patients treated with 5-FU chemotherapy (see Soong et al.,
"Prognostic significance of thymidylate synthase, dihydropyrimidine
dehydrogenase and thymidine phosphorylase protein expression in
colorectal cancer patients treated with or without
5-fluorouracil-based chemotherapy," Ann. Oncol. (2008) 19:
915-919). However, MTX has the highest activity at the time when
DNA synthesis, DHFR activity, DHFR content, and DHFR mRNA content
increased and the lowest activity at the time when they decreased
(see Yamauchi et al., "Ohdo S. Cell-cycle-dependent pharmacology of
methotrexate in HL-60," J. Pharmacol. Sci. (2005) 99: 335-341).
[0006] Thus, there exists a need for better prognostic and
diagnostic measures, treatment and control of neoplasm through
application of small molecules to target cells to affect various
cellular components, such as TS and DHFR involved in cellular
proliferation of neoplasia.
SUMMARY OF THE INVENTION
[0007] The invention provides an isolated inhibitory nucleic acid
molecule that is complementary to at least a portion of miR-192
(SEQ ID NO:1) or miR-215 (SEQ ID NO:9). The inhibitory nucleic acid
molecule decreases the expression of the at least a portion of
miR-192 or miR-215 in a cell. In an embodiment, the nucleic acid
molecule is an antisense nucleic acid molecule. The antisense
nucleic acid molecule has at least an 85% sequence identity to the
portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9). In another
embodiment, the portion has a sequence selected from the group
consisting of SEQ ID NOs:2, 3 and 10. In this embodiment, the
inhibiting nucleic acid molecule has at least 85% sequence identity
to the sequence. In another embodiment, the nucleic acid molecule
has a sequence consisting essentially of SEQ ID NOs:1-3 or 9-10. In
another embodiment, an expression vector comprises the inhibitory
nucleic acid molecule. The inhibitory nucleic acid molecule may be
operably linked to a promoter suitable for expression in a
mammalian cell. The vector may be a viral vector. In another
embodiment, a cell comprises the vector.
[0008] The invention further provides an isolated inhibitory
nucleic acid molecule that corresponds to at least a portion of
miR-192 (SEQ ID NO:1) or miR-215 (SEQ ID NO:9). The inhibitory
nucleic acid molecule decreases the expression of the miR-192 (SEQ
ID NO:1) or miR-215 (SEQ ID NO:9) in a cell. In one embodiment, the
portion has a sequence selected from the group consisting of SEQ ID
NOs:2, 3 and 10. In another embodiment, the nucleic acid molecule
has a sequence consisting essentially of SEQ ID NOs:1-3 or 9-10. In
another embodiment, the inhibiting nucleic acid molecule has at
least 85% sequence identity to the portion of SEQ ID NOs:1 or 9, or
at least 85% sequence identity to SEQ ID NOs:2, 3 or 10. The
nucleic acid molecule is also an shRNA or an siRNA. In an
embodiment, the nucleic acid molecule comprises at least one
modification. The modification may be a non-natural internucleotide
linkage, a backbone modification, or a substituted sugar moiety. In
another embodiment, an expression vector comprises the inhibitory
nucleic acid molecule. The inhibitory nucleic acid molecule may be
operably linked to a promoter suitable for expression in a
mammalian cell. The vector may be a viral vector. In another
embodiment, a cell comprises the vector.
[0009] The invention further provides an isolated inhibitory
nucleic acid molecule that corresponds to a portion of a miR-192
promoter that binds to a p53 binding sequence (SEQ ID NO: 25). The
inhibitory nucleic acid molecule comprises or consists essentially
of a sequence or a complementary sequence of SEQ ID NO:25, a
fragment thereof, or a variant thereof. In this embodiment, the
inhibitory nucleic acid molecule has at least 85% sequence identity
to SEQ ID NO: 25 or a fragment thereof.
[0010] Methods for delivery of the inhibitory nucleic acid
molecules include, but are not limited to, using a delivery system
such as viral vectors, liposomes, polymers, microspheres, gene
therapy vectors, naked DNA vectors, carbon nanotubes and chemical
linkers. One of ordinary skill in the art would recognize other
methods of delivering the inhibitory nucleic acid molecules into
the cell or subject.
[0011] The invention further provides a method of modulating
expression of a component of a cell, comprising contacting the cell
with a nucleic acid comprising a portion of a sequence or a
complementary sequence selected from an miR-192 sequence (SEQ ID
NO:1), an miR-215 nucleic acid sequence (SEQ ID NO:9), miR-192
promoter binding site for p53 (SEQ ID NO:25), an antisense miR-192
sequence, an antisense miR-215 sequence and an antisense to the
miR-192 promoter binding site for p53 in an amount sufficient to
modulate the cellular component. In an embodiment, the nucleic acid
is an antisense nucleic acid. The nucleic acid may be an siRNA or
an shRNA. In an embodiment, the cellular component is miR-192 or
miR-215. In another embodiment, the portion has a sequence selected
from the group consisting of SEQ ID NOs:2, 3, 10, antisense SEQ ID
NO: 2 and antisense SEQ ID NO: 3 and an antisense SEQ ID NO: 10. In
another embodiment, the nucleic acid molecule has a sequence
consisting essentially of SEQ ID NOs:1-3, 9-10, 25 or antisense
sequences thereof. In another embodiment, the cellular component is
p21 or p53. In another embodiment, the cellular component is
regulated by p53. In another embodiment, the cellular component is
DHFR or TS.
[0012] The invention further provides a method of modulating
proliferation of a cell, comprising contacting the cell with a
nucleic acid having a sequence or a complementary sequence to at
least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), a
p53 region that binds to a miR-192 promoter or the miR-192 promoter
that binds to p53 (SEQ ID NO:25) in an amount effective to modulate
proliferation of the cell. In another embodiment, the nucleic acid
is an antisense nucleic acid. In another embodiment, the portion
has a sequence selected from the group consisting of SEQ ID NOs:2,
3, 10 and 25. In another embodiment, the nucleic acid molecule has
a sequence consisting essentially of SEQ ID NOs:1-3, 9-10 or 25 or
an antisense sequence thereof. In another embodiment, the nucleic
acid is an siRNA or an siRNA. In another embodiment, the cell is a
cancer stem cell. In another embodiment, the cell is a neoplastic
cell. In another embodiment, the method of modulating proliferation
of a cell is a method of increasing the proliferation of a
cell.
[0013] The invention further provides a method of increasing the
sensitivity of a cell to a chemotherapeutic agent, comprising
contacting the cell with a nucleic acid complementary to at least a
portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9) an miR-192
promoter binding site for p53 (SEQ ID NO:25) or a p53 region that
binds to the miRNA-192 promoter, in an amount effective to
sensitize the cell to the chemotherapeutic agent. Examples of
chemotherapeutic agents include, but are not limited to,
methotrexate, fluorouracil (5-FU), nolatrexed, ZD9331, GS7904L and
ralitrexed. In another embodiment, the portion has a sequence
selected from the group consisting of SEQ ID NOs:2, 3, 10 and 25.
In another embodiment, the nucleic acid molecule has a sequence
consisting essentially of SEQ ID NOs:1-3, 9-10, and 25. In
embodiments, the nucleic acid is an antisense nucleic acid. In
another embodiment, the nucleic acid is an siRNA or an shRNA. In
another embodiment, the cell is a cancer stem cell. In another
embodiment, the cell is a neoplastic cell.
[0014] The invention further provides a method of increasing the
sensitivity of a cell to radiation, comprising contacting the cell
with a nucleic acid complementary to at least a portion of miR-192
(SEQ ID NO:1), miR-215 (SEQ ID NO:9) an miR-192 promoter binding
site for p53 (SEQ ID NO:25) or a p53 region that binds to the
miRNA-192 promoter, in an amount effective to sensitize the cell to
radiation. In embodiments, the nucleic acid is an antisense nucleic
acid. In another embodiment, the nucleic acid is an siRNA or an
shRNA. In another embodiment, the portion has a sequence selected
from the group consisting of SEQ ID NOs:2, 3 and 10. In another
embodiment, the nucleic acid molecule has a sequence consisting
essentially of SEQ ID NOs:1-3, 9-10, and 25. In another embodiment,
the cell is a cancer stem cell. In another embodiment, the cell is
a neoplastic cell.
[0015] The invention further provides a method of treating a
neoplasm in a subject, comprising administering to the subject an
effective amount of a nucleic acid molecule that inhibits
expression of miR-192 or miR-215, and a second therapy, wherein
inhibition of expression of miR-192 or miR-215 sensitizes the
neoplasm to the second therapy. In another embodiment, the second
therapy comprises administering a chemotherapeutic agent. In one
embodiment, the chemotherapeutic agent is selected from the group
consisting of a DHFA inhibitor and examples of chemotherapeutic
agents include, but are not limited to, methotrexate, fluorouracil
(5-FU), nolatrexed, ZD9331, GS7904L and ralitrexed. In another
embodiment, the second therapy comprises administering radiation to
the subject. The neoplasm may be cancer. The cancer may be selected
from the group consisting of colon cancer, pancreatic cancer, lung
cancer, breast cancer, cervical cancer, gastric cancer, kidney
cancer, leukemia, liver cancer, lymphoma, ovarian cancer, prostate
cancer, rectal cancer, sarcoma, skin cancer, testicular cancer, and
uterine cancer.
[0016] The invention further provides a method of diagnosing a
neoplasm in a subject comprising determining the level of
expression of miR-192 or miR-215. In one embodiment, the method of
diagnosing the neoplasm in the subject comprises determining the
level of expression of miR-192 and miR-215.
[0017] The invention further provides a method of identifying a
neoplasm resistant to chemotherapy comprising determining the level
of expression in the neoplasm of miR-192 or miR-215, and
identifying the neoplasm as resistant to therapy if the level of
the miR-215 is elevated or the level of miR-192 is reduced as
compared to a control. In one embodiment the method of identifying
the neoplasm resistant to chemotherapy comprises determining the
levels of miR-192 and miR-215, and identifying the neoplasm as
resistant to therapy if the levels of miR-192 and miR-215 are
elevated.
[0018] The invention further provides a method of determining
whether a neoplasm is a candidate for treatment with a
chemotherapeutic agent comprising evaluating the level of
expression of an miRNA, wherein the miRNA is miR-192 or miR-215,
and rejecting the candidate if the expression of the miRNA is
elevated; or accepting the candidate if the expression of the miRNA
is reduced. In one embodiment, the miRNA is miR-192 and miR-215. In
another embodiment, the rejected candidate would be a candidate for
the methods of increasing sensitivity or treating a neoplasm
discussed herein.
[0019] The invention further provides a kit for analysis of a
pathological sample. The kit comprising in a suitable container an
miRNA hybridization reagent for determining the level of miR-192 or
miR-215. In an embodiment, the mRNA hybridization reagent comprises
a hybridization probe. In another embodiment, the mRNA
hybridization reagent comprises amplification primers. In another
embodiment, the hybridization probe or amplification primers
complementary to a sequence selected from the group consisting of
SEQ ID NOs:1, 2, 3, 9, 10 and fragments thereof. The pathological
sample can be any sample commonly taken from a subject, such as,
for example, blood, urine, tissue, or other bodily fluid.
[0020] The invention further provides a method of identifying an
agent that inhibits expression of an miRNA selected from the group
consisting of miR-192 and miR-215, which comprises contacting a
cell that expresses the miRNA with an agent, and comparing the
expression level of the miRNA in the cell contacted by the agent
with the expression level of the miRNA in the absence of the agent,
wherein the agent is an inhibitor of the miRNA if expression of the
miRNA is reduced. In an embodiment, the test cell overexpresses the
miRNA.
BRIEF DESCRIPTION OF THE FIGURES
[0021] FIG. 1 depicts a predicted secondary structure of the
interaction between miR-192 and the 3'-UTR region of DHFR mRNA.
[0022] FIG. 2A is a graph illustrating the expression of miR-192 in
HCT-116 (wt-p53) cells transfected with miR-192.
[0023] FIG. 2B is a graph illustrating the expression of miR-24 in
HCT-116 (wt-p53) cells transfected with miR-24.
[0024] FIG. 2C depicts an image from a Western immunoblot showing
the expression of DHFRT protein in HCT-116 (wt-p53) cells
transfected with DHFR specific siRNA, miR-192 or miR-24.
[0025] FIG. 2D is a graph illustrating the expression of DHFR mRNA
in HCT-116 (wt-p53) cells transfected with DHFR specific siRNA,
miR-192 or miR-24.
[0026] FIG. 3 is a graph illustrating the impact of miR-192 on cell
proliferation with MTX treatment in HCT-116 (wt-p53) cells
transfected with DHFR specific siRNA or miR-192.
[0027] FIGS. 4A-D is a graph illustrating the impact of miR-192 on
cell proliferation in HCT-116 (wt-p53) cells (FIG. 4A), RKO cells
(FIG. 4B), HCT-116 (null-p53) cells (FIG. 4C) and HT-29 (FIG. 4D)
cells transfected with non-specific miR or miR-192.
[0028] FIGS. 5 A-D are graphs illustrating impact of miR-192 on
cell proliferation in HCT-116 (wt-p53) (FIG. 5 A-B) and HCT-116
(null-p53) (FIG. 5 C-D) cells transfected with non-specific miR or
miR-192.
[0029] FIGS. 6A-B are images from a Western immunoblot of p53, p21
and Bax expression in HCT-116 (wt-p53) cells transfected with
non-specific miR, DHFR siRNA or miR-192.
[0030] FIG. 7 is an image from a Western immunoblot for E2F3 and Rb
expression in HCT-116 (wt-p53) cells transfected with non-specific
miR, DHFR siRNA or miR-192.
[0031] FIG. 8A is an image from a Western immunoblot for p53
expression in HCT-116 (wt-p53) cells, RKO (wt-p53) cells, HCT-116
(null-p53) cells and HT-29 cells after treatment with MTX.
[0032] FIG. 8B is a graph depicting the expression of endogenous
mature miR-192 in HCT-116 (wt-p53) cells, RKO (wt-p53) cells,
HCT-116 (null-p53) cells and HT-29 cells after treatment with
MTX.
[0033] FIG. 9A is a diagram of miR-192 p53 binding site relative to
miR-192 on chromosome 11.
[0034] FIG. 9B is a graph illustrating the immunoprecipitation qPCR
analysis using chromosome DNA isolated with non-specific a-tubulin,
p53 monoclonal antibody for the conserved p53 binding site located
on the miR-192 or p21 promoter.
[0035] FIG. 10 shows inhibition of cell proliferation in either
HCT-116 (wt-p53) (Panel A) or U-2 OS (Panel B) cells transfected
with miR-215 precursors, i.e., a longer piece of miRNA (72 bps)
with hairpin stem loop structure that is further processed by DICER
to mature miRNA, compared with a non-specific miRNA control. The
reduction in OD for cultures of HCT-116 (wt-p53) or U-2 OS cells
were approximately 40% or 58% at day 5 respectively.
[0036] FIG. 11 depicts proportions of cultured U-2 OS or MG63
cells, and U-2 OS or MG63 cells transfected with miR-192 or miR-215
at various stages of the cell cycle.
[0037] FIG. 12 depicts the levels of cell cycle control gene
products p53 and p21 determined by Western immunoblot analysis.
[0038] FIG. 13 provides alignments of miR-215 with regions of DHFR
and TS.
[0039] FIG. 14 depicts an analysis of levels of DHFR (Panel A) or
TS (Panel B) protein in cells transfected with miR-215.
[0040] FIG. 15 depicts the levels of DHFR or TS mRNA in U-2 OS
cells transfected with miR-215.
[0041] FIG. 16 depicts the level of luciferase reporter activity
from a construct containing the 3' UTR binding sequence for miR-215
(or a mutated binding sequence) in response to transfection with
miR-215.
[0042] FIG. 17 shows that the effect of miR-192 (Panel A) or
miR-215 (Panel B) on proliferation of HCT-116 (wt-p53) cells
treated with methotrexate.
[0043] FIG. 18 depicts miR-192 and miR-215 expression in
CD133.sup.+ HCT-116 (wt-p53) cells as compared to CD133.sup.-
cells.
[0044] FIG. 19 depicts miR-215 expression in paired human colon
cancer and counterpart normal tissues.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The inventors have discovered that miR-192 and miR-215,
individually, decrease the expression of TS and DHFR protein, and
further found that miR-192 and miR-215, individually, change the
sensitivity of cancerous cells such as, for example, HCT-116
(wt-p53) or U-2 OS cells to TDX or MTX. The inventors have found
that down-regulation of TS or DHFR protein by a siRNA specific
against TS or DHFR increases the sensitivity of TDX or MTX in the
colon cancer or osteosarcoma cell lines, whereas even though
miR-192 and miR-215 also down-regulated the expression levels of TS
or DHFR, they did not increase the chemosensitivity of TDX or MTX
compared to a non-specific miRNA control. TDX or MTX are considered
to be more effective on the cells in the S-phase. As illustrated in
FIGS. 5 and 11, siRNAs specific against TS or DHFR do not decrease
the cells in the S-phase, whereas the cells in the S-phase were
reduced in the miR-192 transfected cells and miR-215 transfected
cells. Thus, down-regulating miR-192 or miR-215 increases the
sensitivity of a cell or a subject to chemotherapy.
[0046] The inventors have found that colon cancer stem cells depend
on, at least in part, elevated miR-192 or miR-215 to have a reduced
cell proliferation phenotype. The advantage of tumor stem cells
using miR-192 or miR-215 to achieve this is that translational
control by miR-192 or miR-215 is an acute response, readily
reversible without permanently degrading its target mRNAs such as
TS and DHFR or trigger apoptosis. This also suggests why half of
the colon cancer cases containing wild type p53 are still resistant
to chemotherapeutic treatment. This mechanism also provides a novel
approach to selectively killing colon cancer stem cells by
inhibiting miR-192 or miR-215 and subsequently eliminating them
with chemotherapeutic agents. Furthermore, this mechanism also
provides a novel approach for identifying a candidate who will
respond to chemotherapeutic treatment by inhibiting miR-192 and/or
miR-215.
[0047] In certain aspects, the invention is directed to methods for
the assessment, analysis, and/or therapy of a cell or subject where
certain genes have a reduced or increased expression (relative to
normal) as a result of an increased or decreased expression of
miR-192 or miR-215. The expression profile and/or response to
miR-192 or miR-215 expression or inhibition may be indicative of a
disease or an individual with a pathological condition such as, for
example, cancer.
[0048] According to a first embodiment, the miR-192 or miR-215
inhibitors may include antisense nucleic acids or molecules.
Antisense nucleic acids are effective in inhibiting human miRNAs.
Antisense nucleic acids include non-enzymatic nucleic acid
compounds that bind to a target nucleic acid by, for example,
RNA-RNA, RNA-DNA or RNA-PNA interactions and effect the target
nucleic acid. Generally, these molecules are complementary to a
target sequence along a single contiguous sequence of the antisense
nucleic acid. In this embodiment, the antisense nucleic acid
reduces expression of miR-192 or miR-215.
[0049] In another embodiment, the inhibitors include fragments of
the nucleic acid molecules that bind to miR-192 (SEQ ID NO:1) or
miR-215 (SEQ ID NO:9), bind to an miR-192 promoter binding sequence
for p53 (SEQ ID NO:25), or bind to the p53 sequence that is
complementary to the miR-192 promoter. A suitable fragment can be
at least 8, at least 10, at least 12, at least 14, at least 16, at
least 18, at least 19, at least 20, at least 21, at least 22, at
least 23, at least 24, or at least 25 nucleotides in length.
Non-limiting examples of suitable fragments include nucleic acids
having sequences complementary to SEQ ID NOs:2, 3, 9 or fragments
thereof. One of ordinary skill in the art recognizes that nucleic
acids complimentary to other portions of SEQ ID NO:1 or SEQ ID NO:9
would be equally effective.
[0050] In another embodiment, antisense nucleic acids may also bind
to a substrate nucleic acid and form a loop. In this embodiment,
the antisense nucleic acids may be complementary to two or more
non-contiguous substrate sequences and/or two or more
non-contiguous sequence portions of an antisense nucleic acid may
be complementary to a target sequence.
[0051] In another embodiment, antisense nucleic acids may be
complementary to a guide strand of an miRNA positioned in the RNA
silencing complex. In another embodiment, antisense nucleic acids
may be used to target a nucleic acid by means of DNA-RNA
interactions. In this embodiment, RNase H is activated to digest
the target nucleic acid as would be understood by one of ordinary
skill in the art. For example, the antisense nucleic acids may
comprise one or more RNase H activating region capable of
activating RNase H to cleave a target nucleic acid. The RNase H
activating region may comprise any suitable backbone. For example,
in this embodiment, the RNase H activating region may comprise a
phosphodiester, phosphorothioate, phosphorodithioate,
5'-thiophosphate, phosphoramidate and/or methylphosphonate.
[0052] In another embodiment, the nucleic acid molecule may
comprise one or more modifications. Antisense nucleic acids
according to the embodiments may comprise natural-type
oligonucleotides and modified oligonucleotides. For example, in
this embodiment, the antisense nucleic acid may comprise
phosphorothioate-type oligodeoxyribonucleotides,
phosphorodithioate-type oligodeoxyribonucleotides,
methylphosphonate-type oligodeoxyribonucleotides,
phosphoramidate-type oligodeoxyribonucleotides, H-phosphonate-type
oligodeoxyribonucleotides, triester-type oligodeoxyribonucleotides,
alpha-anomer-type oligodeoxyribonucleotides, peptide nucleic acids,
locked nucleic acids, and nucleic acid-modified compounds. It will
be readily apparent to one of ordinary skill in the art that other
oligonucleotides are within the scope and spirit of this
invention.
[0053] In another embodiment, the modification may comprise
internucleoside linkages. For example, an inhibitory nucleic acid
may be based on T-modified oligonucleotides containing
oligodeoxynucleotide gaps with internucleotide linkages modified to
phosphorothioates for nuclease resistance. The presence of
methylphosphonate modifications increases the affinity of the
oligonucleotide for its target RNA and thus increases its
effectiveness in inhibiting the target RNA. This modification also
increases the nuclease resistance of the modified
oligonucleotide.
[0054] In another embodiment, the modification may comprise a
backbone modification. For example, oligomers having modified
backbones may include those that retain a phosphorus atom in the
backbone and those that do not have a phosphorus atom in the
backbone. For example, nucleobase oligomers that have modified
oligonucleotide backbones include, but are not limited to,
phosphorothioates, chiral phosphorothioates, phosphorodithioates,
phosphotriesters, aminoalkyl-phosphotriesters, methyl and other
alkyl phosphonates, phosphinates, phosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates. Other forms,
including, but not limited to, salts, mixed salts and free acid
forms, are also contemplated.
[0055] Nucleobase oligomers having modified oligonucleotide
backbones that do not include a phosphorus atom therein have
backbones that are formed by short chain alkyl or cycloalkyl
internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl
internucleoside linkages, or one or more short chain heteroatomic
or heterocyclic internucleoside linkages. These include, but are
not limited to, those having morpholino linkages, siloxane
backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and
thioformacetyl backbones, methylene formacetyl and thioformacetyl
backbones, alkene containing backbones, sulfamate backbones,
methyleneimino and methylenehydrazino backbones, sulfonate and
sulfonamide backbones, and/or amide backbones.
[0056] In another embodiment, the modification may also comprise
one or more substituted sugar moieties. For example, the RNase H
activating region may comprise deoxyribose, arabino and/or
fluoroarabino nucleotide sugar chemistry. Such modifications may
also include 2'-O-methyl and 2'-methoxyethoxy modifications,
2'-dimethylaminooxyethoxy, 2'-aminopropoxy and 2'-fluoro, and
modifications at other positions on the oligonucleotide or other
nucleobase oligomer, particularly the 3' position of the sugar on
the 3' terminal nucleotide. Nucleobase oligomers may also have
sugar mimetics. In another embodiment, both the sugar and the
internucleoside linkage may be replaced with novel groups. The
nucleobase units are maintained for hybridization with at least a
portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192
promoter sequence that binds to p53 (SEQ ID NO:25) or the p53
sequence that binds to the miR-192 promoter (SEQ ID NO:25).
[0057] Those skilled in the art will recognize that the foregoing
are non-limiting examples and that any combination of phosphate,
sugar and base chemistry of a nucleic acid that supports the
activity of RNase H enzyme is within the scope of the present
invention.
[0058] According to another embodiment, the invention relates to
the use of interference RNA (RNAi) to alter the expression of
miR-192 or miR-215. In one embodiment, the expression is altered by
reducing the expression of miR-192 or miR-215. In another
embodiment, the expression of miR-192 and miR-215 is altered. In
another embodiment, the expression is altered by reducing the
expression of miR-192 and miR-215. RNAi comprises double stranded
RNA that can specifically block expression of a target gene.
Double-stranded RNA (dsRNA) blocks gene expression in a specific
and post-transcriptional manner. RNAi provides a useful method of
inhibiting gene expression in vitro or in vivo. RNAi can comprise
either long stretches of dsRNA identical or substantially identical
to the target nucleic acid sequence or short stretches of dsRNA
identical to or substantially identical to only a region of the
target nucleic acid sequence.
[0059] In embodiments RNAi includes, but are not limited to, small
interfering RNAs (siRNAs), small hairpin RNAs (shRNAs), and other
RNA species, such as non-enzymatic nucleic acids, which can be
cleaved in vivo to form siRNAs. In this embodiment, RNAi may also
include RNAi expression vectors capable of giving rise to
transcripts which form dsRNAs or shRNAs in cells, and/or
transcripts which can produce siRNAs in vivo.
[0060] The RNAi may comprise a nucleotide sequence that hybridizes
under physiologic conditions of the cell to the nucleotide sequence
of at least a portion of the RNA transcript for the target gene.
These RNAi have the advantage of being able to tolerate variations
in sequence that may arise from, for example, genetic mutation,
strain polymorphism or evolutionary divergence. The number of
tolerated nucleotide mismatches between the target sequence and the
RNAi sequence is no more than 1 in 5 basepairs, or 1 in 10
basepairs, or 1 in 20 basepairs, or 1 in 50 basepairs. Mismatches
in the center of the siRNA duplex are most critical and may
essentially abolish cleavage of the target RNA. In contrast,
nucleotides at the 3' end of the siRNA strand that is complementary
to the target RNA do not significantly contribute to specificity of
the target recognition. In this embodiment, the antisense nucleic
acid molecule has at least 85% sequence identity to SEQ ID NOs:1-3,
9 or 10.
[0061] Sequence identity may be optimized by sequence comparison
and alignment algorithms known in the art and calculating the
percent difference between the nucleotide sequences. In this
embodiment, the preferred sequence identity between the inhibitory
RNA and the portion of the target gene is greater than 90%, 95%,
96%, 97%, 98%, 99% or 100%. Alternatively, the duplex region of the
RNA may be defined functionally as a nucleotide sequence that is
capable of hybridizing under specified conditions with a portion of
the target gene transcript.
[0062] The double-stranded structure may be formed by a single
self-complementary RNA strand or two complementary RNA strands. RNA
duplex formation may be initiated either inside or outside the
cell. The RNA may be introduced in an amount which allows delivery
of at least one copy per cell. Higher doses of double-stranded
material may yield more effective inhibition, while lower doses may
also be useful for specific applications. Inhibition is
sequence-specific in that nucleotide sequences corresponding to the
duplex region of the RNA are targeted for genetic inhibition.
[0063] In this embodiment, the siRNAs are around 19-30 nucleotides
long, and even more preferably 21-23 nucleotides. The siRNAs
effectively recruit nuclease complexes and guide the complexes to
the target mRNA by pairing to the specific sequences. As a result,
the target mRNA is degraded by the nucleases in the protein
complex. In embodiments, the 21-23 nucleotides siRNA molecules
comprise a 3' hydroxyl group. In certain embodiments, the siRNA can
be generated by the processing of longer double-stranded RNAs, for
example, in the presence of the enzyme dicer. The siRNA molecules
can be purified using a number of techniques known to those of
skill in the art such as, for example, gel electrophoresis,
non-denaturing column chromatography, chromatography, glycerol
gradient centrifugation, and/or affinity purification with an
antibody.
[0064] In this embodiment, the shRNAs can be synthesized
exogenously or can be formed by transcribing from RNA polymerase
III promoters in vivo. Examples of making and using such shRNAs for
gene silencing in mammalian cells are known in the art. Preferably,
such shRNAs are engineered in cells or in an animal to ensure
continuous and stable suppression of a desired gene. It is
recognized in the art that siRNAs can be produced by processing a
shRNA in the cell.
[0065] In another embodiment, the invention relates to the use of
suitable ribozyme molecules, such as, for example, RNA
endoribonucleases and hammerhead ribozymes, designed to
catalytically cleave mRNA transcripts to prevent translation of
mRNA. Hammerhead ribozymes cleave mRNAs at locations dictated by
flanking regions that form complementary base pairs with the target
mRNA, which have a base sequence of 5'-UG-3'.
[0066] According to another embodiment, polynucleotide or
expression vector therapy for treating neoplasia featuring a
polynucleotide encoding an inhibitory nucleic acid molecule or
analog thereof that targets miR-192 or miR-215 is provided. In this
embodiment, the antisense nucleic acid may cause inhibition of
expression by hybridizing with miR-192 or miR-215 and/or genomic
sequences encoding miR-192 or miR-215. Expression vectors encoding
inhibitory nucleic acid molecules can be delivered to cells of a
subject having a neoplasia in a form in which they can be taken up
and expressed so that therapeutically effective levels may be
achieved. The expression vector produces an oligonucleotide which
is complementary to at least a unique portion of miR-192 or
miR-215. Methods for delivery of the polynucleotides to the cell
according to the invention include, but are not limited to, using a
delivery system such as viral vectors, liposomes, polymers,
microspheres, gene therapy vectors, naked DNA vectors, carbon
nanotubes and chemical linkers. One of ordinary skill in the art
would recognize other methods of delivering polynucleotides into
the cell or subject. Nucleic acid probes may also be modified so
that they are resistant to endogenous nucleases such as, for
example, exonucleases and/or endonucleases, and are therefore
stable in vivo.
[0067] Inhibitory nucleic acid molecule expression for use in
polynucleotide therapy methods can be directed from any suitable
promoter and regulated by any appropriate mammalian regulatory
element. Promoters may include, but are not limited to, the human
cytomegalovirus, simian virus 40, and/or metallothionein promoters.
In this embodiment, enhancers known to preferentially direct gene
expression in specific cell types can be used to direct the
expression of a nucleic acid. The enhancers used can include,
without limitation, those that are characterized as tissue- or
cell-specific enhancers.
[0068] Transducing viral vectors such as, for example, retroviral,
adenoviral, lentiviral and adeno-associated viral vectors, can be
used as expression vectors for somatic cell gene therapy. Viral
vectors are especially useful because of their high efficiency of
infection, and stable integration and expression. In this
embodiment, for example, a polynucleotide encoding an inhibitory
nucleic acid molecule can be cloned into a retroviral vector and
expression can be driven from its endogenous promoter, from the
retroviral long terminal repeat, or from a promoter specific for a
target cell type of interest. Other viral vectors that can be used
include, for example, a vaccinia virus, a bovine papilloma virus,
or a herpes virus, such as Epstein-Barr Virus.
[0069] In another embodiment, the invention comprises an inhibitory
nucleic acid molecule that corresponds to a portion of a miR-192
promoter binding sequence for p53 (SEQ ID NO:25). The inhibitory
nucleic acid molecule comprises or consists essentially of a
sequence or a complementary sequence of SEQ ID NO:25, a fragment
thereof or a variation thereof. The inventors have discovered that
SEQ ID NO:25 is a portion of the miR-192 promoter (SEQ ID NO:8)
that binds to p53. Accordingly, the expression of miR-192 can be
altered by administering an inhibitory nucleic acid molecule that
comprises a sequence of SEQ ID NO:25, a fragment thereof, or a
variation thereof. In this embodiment, the inhibitory nucleic acid
molecule would bind to the p53 site at the miR-192 promoter binding
site and thereby block the binding of p53 to the miR-192 promoter.
The expression of miR-192 can also be altered by administering an
inhibitory nucleic acid molecule that comprises a sequence
complementary to SEQ ID NO:25, a fragment thereof, or a variation
thereof. In this embodiment, the inhibitory nucleic acid molecule
would bind to the miR-192 promoter thereby blocking p53 from
binding to the miR-192 promoter region and block transcription of
miR-192.
[0070] The inhibitory nucleic acid molecule can consist essentially
of a sequence or a sequence complementary to SEQ ID NO:25, a
fragment thereof, or a variation. In such embodiments, the
inhibitory nucleic acid molecule may contain other components that
are not involved in binding to the p53 binding sequence or the
miR-192 promoter region. These components may include, but are not
limited to, other nucleic acids, amino acids ligands, linkers, or
other modification that will not effect the primary function of the
inhibitory nucleic acid molecule in these embodiments, blocking the
binding of p53 to the miR-192 promoter region and inhibiting the
transcription of miR-192. For example, the inhibitor nucleic acid
molecule may contain other nucleotides complementary to a position
of the miR-192 promoter (SEQ ID NO:8) that it does not interact
with the p53 binding sequence.
[0071] To effectively block the binding of p53 to the miR-192
promoter and the transcription of miR-192, the full sequence or
complementary sequence of SEQ ID NOs:8 or 25 need not be utilized.
A fragment of the sequence of complementary sequence would be
adequate to block the binding of p53 to the miR-192 promoter and
the transcription of miR-192. A suitable fragment can be at least
8, at least 10, at least 12, at least 14, at least 16, at least 18,
at least 19, at least 20, at least 21, at least 22, at least 23, at
least 24, or at least 25 nucleotides in length.
[0072] In Example 8 (see below), a three base pair gap between SEQ
ID NO:25 and the p53 binding is discussed. Accordingly, 100%
homology is not necessary. Instead, at least 85%, at least 90%, at
least 92%, at least 94%, at least 95%, at least 96%, at least 97%,
at least 98%, at least 99% or 100% homology is sufficient to enable
the inhibitory nucleic acid molecule to bind to the miR-192
promoter or the p53 binding site.
[0073] In another embodiment, a non-viral approach may be employed
for the introduction of an inhibitory nucleic acid molecule
therapeutic to a cell of a patient diagnosed as having a neoplasia.
For example, an inhibitory nucleic acid molecule that targets a
miRNA-215 can be introduced into a cell by administering the
nucleic acid in the presence of lipofection,
asialoorosomucoid-polylysine conjugation, or by micro-injection
under surgical conditions. In this embodiment, the inhibitory
nucleic acid molecules are administered in combination with a
liposome and protamine. Gene transfer can also be achieved using
non-viral means involving transfection in vitro. Such methods
include the use of calcium phosphate, DEAE dextran,
electroporation, and protoplast fusion. Liposomes can also be
potentially beneficial for delivery of DNA into a cell.
[0074] For any particular subject, the specific dosage regimes
should be adjusted over time according to the individual need and
the professional judgment of the person administering or
supervising the administration of the compositions.
[0075] Methods of modulating expression of cellular components in
an amount sufficient to modulate the cellular component are also
provided. In embodiments, the cellular components may comprise
miR-192 or miR-215, p21, p53, DHFR, TS or any cellular component
regulated by these components. One of ordinary skill in the art
would recognize that other cellular components may be modulated and
are within the scope and spirit of this invention.
[0076] p53 and p21, a downstream target of the p53 pathway of
growth control, are reported to block cells at G2 checkpoint mainly
through inhibiting Cdc2 activity, the cyclin-dependent kinase that
normally drives cells into mitosis, which is the ultimate target of
pathways that mediate rapid arrest in G2 in response to DNA damage
as reported in, for example, Taylor et al., "Regulation of the G2/M
transition by p53", Oncogene. (2001); 20: 1803-1815; Stark et al.,
"Control of the G2/M transition," Mol. Biotechnol. (2006); 32:
227-248; and Bunz et al., "Requirement for p53 and p21 to sustain
G2 arrest after DNA damage", Science. (1998); 282: 1497-1501.
[0077] The inventors have discovered that miR-192 or miR-215 can
induce G2-arrest in HCT-116 (wt-p53) and U-2 OS cells. Transfection
of miR-192 or miR-215 precursor into HCT-116 (wt-p53) and U-2 OS
cells to analyze the mechanism of cell proliferation inhibition by
miR-192 or miR-215 indicate that over-expression of miR-192 or
miR-215 led to a significant increase of the p53 and p21 protein in
both HCT-116 (wt-p53) and U-2 OS cells. FIGS. 6 and 12 depicts an
evaluation of the levels of cell cycle control genes p53 and p21 by
Western immunoblot analysis. As illustrated in FIGS. 6 and 12,
miR-192 or miR-215 contributes to the inhibition of cell
proliferation at least partially by the induction of G2-arrest in
HCT-116 (wt-p53) and U-2 OS cells, which was through
over-expression of G2-checkpoint genes p53 and p21.
[0078] The inventors have discovered that miR-192 or miR-215
suppresses cell proliferation. Since most miRNAs have more than one
target range from dozens to hundreds (see Wiemer, "The role of
microRNAs in cancer: No small matter", Eur. J. Cancer. (2007)
43:1529-1544), miR-192 or miR-215 most likely targets the enzymes
for DNA biosynthesis, such as TS and DHFR, and also leads to the
inhibition of cell proliferation in cancer cells. As illustrated in
FIG. 13, the inventors used the Sanger database
(microrna.sanger.ac.uk) to identify TS and DHFR as the putative
targets of miR-192 and miR-215. As illustrated in FIGS. 2 and 14,
at 48 h after transfection, the inventors extracted the proteins
and searched for the changes in TS or DHFR protein levels by
Western immunoblot analysis. Oligofectamine alone and non-specific
miRNA were used as the negative controls. The DHFR expression is
down-regulated by miR-192. Using miR-192 as a positive control of
DHFR down-regulation, the over-expression of miR-215 and miR-192
was confirmed by real time qRT-PCR analysis using U6 RNA to
normalize the expression (see FIG. 11). Introduction of miR-192 or
miR-215 clearly decreases TS or DHFR protein levels (see FIG. 2 and
FIG. 14, lanes 3 and 4). The inventors also analyzed the expression
level of TS or DHFR mRNA using real time qRT-PCR analysis. As
illustrated in FIG. 15, the inventors discovered that there was no
reduction in TS or DHFR mRNA expression by miR-192 or miR-215
(column 3) and miR-192 (column 4). Thus, the suppression of TS or
DHFR expression was regulated at the translational level without
the degradation of TS or DHFR mRNA.
[0079] In another embodiment, a method of increasing proliferation
of a cell is provided using the mechanisms of the various pathways
disclosed herein. In this embodiment, the cell is contacted with a
nucleic acid complementary to at least a portion of miR-192 (SEQ ID
NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that
binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to the
miR-192 promoter. The amount of nucleic acid complementary to
miR-192 (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter
sequence that binds to p53 (SEQ ID NO:25) or the p53 sequence that
binds to the miR-192 promoter (SEQ ID NO:25) effective to increase
proliferation of the cell is not particularly limited. In
embodiments, the amount is in the range of more than about 20% for
cell proliferation and more than about 2-fold of IC.sub.50. In
embodiments, the nucleic acid may comprise an antisense nucleic
acid, siRNA or shRNA. In embodiments, the cell may comprise a
cancer stem cell or a neoplastic cell.
[0080] In another embodiment, a method of increasing the
sensitivity of a cell to a chemotherapeutic agent is provided using
the mechanisms of the various pathways disclosed herein. In this
embodiment, the cell is contacted with a nucleic acid complementary
to at least a portion of miR-192 (SEQ ID NO:1), miR-215 (SEQ ID
NO:9), an miR-192 promoter sequence that binds to p53 (SEQ ID
NO:25) or the p53 sequence that binds to the miR-192 promoter (SEQ
ID NO:25). The amount of nucleic acid complementary to miR-192,
(SEQ ID NO:1), miR-215 (SEQ ID NO:9), an miR-192 promoter sequence
that binds to p53 (SEQ ID NO:25) or the p53 sequence that binds to
the miR-192 promoter effective to sensitize the cell to the
chemotherapeutic agent is not particularly limited. In embodiments,
the amount is in the range of more than about 20% for cell
proliferation and more than about 2-fold of IC.sub.50. In an
embodiment, the chemotherapeutic agent is selected from the group
consisting of a DHFA inhibitor and a TS inhibitor. Examples of
chemotherapeutic agent include, but are not limited to,
methotrexate (MTX), fluorouracil (5-FU), nolatrexed, ZD9331,
GS7904L and ralitrexed (TDX). One of ordinary skill would recognize
other chemotherapeutic agents useful in this embodiment. In
embodiments, the nucleic acid may comprise an antisense nucleic
acid, siRNA or shRNA. In embodiments, the cell may comprise a
cancer stem cell or a neoplastic cell.
[0081] In another embodiment, a method of increasing the
sensitivity of a cell to radiation is provided using the mechanisms
of the various pathways disclosed herein. In this embodiment, the
cell is contacted with a nucleic acid complementary to at least a
portion of miR-192, (SEQ ID NO:1), miR-215 (SEQ ID NO:9), an
miR-192 promoter sequence that binds to p53 (SEQ ID NO:25) or the
p53 sequence that binds to the miR-192 promoter (SEQ ID NO:25). The
amount of nucleic acid complementary to miR-192 (SEQ ID NO:1),
miR-215 (SEQ ID NO:9), an miR-192 promoter sequence that binds to
p53 (SEQ ID NO:25) or the p53 sequence that binds to the miR-192
promoter effective to sensitize the cell to radiation is not
particularly limited. In embodiments, the amount is in the range of
more than about 20% for cell proliferation and more than about
2-fold of IC.sub.50. In embodiments, the nucleic acid may comprise
an antisense nucleic acid, siRNA or shRNA. In embodiments, the cell
may comprise a cancer stem cell or a neoplastic cell.
[0082] In still another embodiment, the compositions and methods of
the present invention involve a first therapy an inhibitor of
miR-192 or miR-215 or an expression construct encoding miR-192 or
miR-215, used in combination with a second therapy to enhance the
effect of the miR-192 or miR-215 therapy, or increase the
therapeutic effect of the second therapy being employed to treat a
neoplasm. These compositions would be provided in a combined amount
effective to achieve the desired effect, such as the killing of a
cancer cell and/or the inhibition of cellular hyperproliferation.
This process may involve contacting the cells with the miR-192 or
miR-215 and the second therapy at the same or different time. This
may be achieved by contacting the cell with one or more
compositions or pharmacological formulation that includes one or
more of the agents, or by contacting the cell with two or more
distinct compositions or formulations, wherein one composition
provides (1) administering to the subject an effective amount of a
nucleic acid molecule that inhibits expression of miR-192 or
miR-215 and/or (2) a second therapy, in which the inhibition of
expression of miR-192 or miR-215 sensitizes the neoplasm to the
second therapy.
[0083] The second therapy may comprise administering chemotherapy,
radiotherapy, surgical therapy, immunotherapy or gene therapy. In
an embodiment, the chemotherapeutic agent is selected from the
group consisting of a DHFR inhibitor and a TS inhibitor. The
chemotherapeutic agents include, but are not limited to, DHFR
inhibitors or TS inhibitors such as, for example, MTX, pemetrexed,
5-FU, raltitrexed (TDX), nolatrexed, ZD9331, and/or GS7904L. One of
ordinary skill would recognize other chemotherapeutic agents useful
in this embodiment. It is contemplated that the combination therapy
may be provided in any suitable manner or under any suitable
conditions readily apparent to one of ordinary skill in the
art.
[0084] For example, administration of any compound or therapy of
the present invention to a patient will follow general protocols
for the administration of such compounds, taking into account the
toxicity, if any, of the vector or any protein or other agent.
Therefore, in some embodiments there is a step of monitoring
toxicity that is attributable to combination therapy. It is
expected that the treatment cycles would be repeated as necessary.
It also is contemplated that various standard therapies, as well as
surgical intervention, may be applied in combination with the
described therapy.
[0085] A wide variety of other chemotherapeutic agents may be used
in accordance with the present invention. A "chemotherapeutic
agent" is used to connote a compound or composition that is
administered in the treatment of cancer. These agents or drugs are
categorized by their mode of activity within a cell, for example,
whether and at what stage they affect the cell cycle.
Alternatively, an agent may be characterized based on its ability
to directly cross-link DNA, to intercalate into DNA, or to induce
chromosomal and mitotic aberrations by affecting nucleic acid
synthesis. Most chemotherapeutic agents fall into the following
categories: alkylating agents, antimetabolites, antitumor
antibiotics, mitotic inhibitors, and nitrosoureas.
[0086] In embodiments, the neoplasm being treated is a form of
cancer. Cancers that may be evaluated by methods and compositions
of the invention include any suitable cancer cells known to one of
ordinary skill in the art. The inventors have found that the
present invention is particularly useful in treating cancer cells
from the colon or the pancreas, including pancreatic ductal
adenocarcinoma. However, other suitable cells include cancer cells
of the bladder, blood, bone, bone marrow, brain, breast, cervix,
esophagus, gastrointestine, gum, head, kidney, liver, lung,
nasopharynx, neck, ovary, prostate, rectum, skin, stomach, testis,
tongue, or uterus. Other conditions treatable by the compositions
and methods of the present invention will be readily apparent to
one of ordinary skill in the art.
[0087] An inhibitory nucleic acid molecule of the invention, or
other negative regulator of miR-192 or miR-215 may be administered
within a pharmaceutically-acceptable diluent, carrier, or
excipient, in unit dosage form. Conventional pharmaceutical
practice may be employed to provide suitable formulations or
compositions to administer the compounds to patients suffering from
a neoplasia. Administration may begin before the patient is
symptomatic. Any appropriate route of administration may be
employed, for example, administration may be parenteral,
intravenous, intraarterial, subcutaneous, intratumoral,
intramuscular, intracranial, intraorbital, ophthalmic,
intraventricular, intrahepatic, intracapsular, intrathecal,
intracisternal, intraperitoneal, intranasal, aerosol, suppository,
or oral administration. Therapeutic formulations and methods for
making such formulations are well known in the art.
[0088] The formulations can be administered to human patients in
therapeutically effective amounts to provide therapy for a
neoplastic disease or condition. The preferred dosage of inhibitory
nucleic acid of the invention is likely to depend on such variables
as the type and extent of the disorder, the overall health status
of the particular patient, the formulation of the compound
excipients, and its route of administration.
[0089] Therapy may be provided at any suitable location and under
any suitable conditions. The duration of the therapy depends on
various factors readily understood by one of ordinary skill in the
art. Drug administration may also be performed at any suitable
interval. For example, therapy may be given in predetermined
on-and-off intervals as appropriate.
[0090] Depending on the type of cancer and its stage of
development, the therapy can be used to slow the spreading of the
cancer, to slow the cancer's growth, to kill or arrest cancer
cells, to relieve symptoms caused by the cancer, or to prevent
cancer. As described herein, if desired, treatment with an
inhibitory nucleic acid molecule of the invention may be combined
with therapies such as, for example, radiotherapy, surgery, or
chemotherapy for the treatment of proliferative disease.
[0091] In another embodiment, a method of diagnosing a neoplasm in
a subject is provided. In this embodiment, the method comprises
determining the level of expression of miR-192 or miR-215.
[0092] As described herein, the present invention has identified
increases in the expression of miR-192 or miR-215, and
corresponding decreases in the expression of TS and DHFR that are
associated with cellular proliferation. Alterations in the
expression level of one or more of the following other markers used
to diagnose a neoplasia are also contemplated. If desired,
alterations in the expression of any combination of these markers
is used to diagnose or characterize a neoplasia as would be readily
apparent to one of ordinary skill in the art.
[0093] In an embodiment, a subject is diagnosed as having or having
a propensity to develop a neoplasia, the method comprising
measuring markers in a biological sample from a patient, and
detecting an alteration in the expression of test marker molecules
relative to the sequence or expression of a reference molecule.
While the following approaches describe diagnostic methods
featuring a miR-192 or miR-215, the skilled artisan will appreciate
that any one or more of the markers set forth above is useful in
such diagnostic methods. Increased expression of a miR-192 or
miR-215 is correlated with neoplasia. Accordingly, the invention
provides compositions and methods for identifying a neoplasia in a
subject. The present invention provides a number of diagnostic
assays that are useful for the identification or characterization
of a neoplasia. Alterations in gene expression are detected using
methods known to the skilled artisan and described herein. Such
information can be used to diagnose a neoplasia.
[0094] In an embodiment, diagnostic methods of the invention are
used to assay the expression of miR-192 or miR-215 in a biological
sample relative to a reference sample. In one embodiment, the level
of miR-192 or miR-215 is detected using a nucleic acid probe that
specifically binds at least a portion of miR-192 (SEQ ID NO:1) or
miR-215 (SEQ ID NO:9). Exemplary nucleic acid probes that
specifically bind miR-192 or miR-215 are described herein. The
biological sample can be any sample commonly used within the art,
such as, for example, blood, urine, tissue or other bodily
fluid.
[0095] In an embodiment, quantitative PCR methods are used to
identify an increase in the expression of miR-192 or miR-215. In
another embodiment, PCR methods are used to identify an alteration
in the sequence of miR-192 or miR-215. The invention provides
probes that are capable of detecting miR-192 or miR-215. Such
probes may be used to hybridize to a nucleic acid sequence derived
from a patient having a neoplasia. The specificity of the probe
determines whether the probe hybridizes to a naturally occurring
sequence, allelic variants, or other related sequences.
Hybridization techniques may be used to identify mutations
indicative of a neoplasia or may be used to monitor expression
levels of these genes.
[0096] In embodiments, a measurement of a nucleic acid molecule in
a subject sample may be compared with a diagnostic amount present
in a reference. Any significant increase or decrease in the level
of test nucleic acid molecule or polypeptide in the subject sample
relative to a reference may be used to diagnose a neoplasia. Test
molecules include any one or more of markers disclosed herein. In
an embodiment, the reference is the level of test polypeptide or
nucleic acid molecule present in a control sample obtained from a
patient that does not have a neoplasia. In another embodiment, the
reference is a baseline level of test molecules present in a
biologic sample derived from a patient prior to, during, or after
treatment for a neoplasia. In yet another embodiment, the reference
can be a standardized curve. The subject sample can be any sample
commonly used within the art, such as, for example, blood, urine,
tissue or other bodily fluid.
[0097] In another embodiment, a method of identifying a neoplasm
resistant to chemotherapy is provided. In this embodiment, the
method comprises determining the level of expression in the
neoplasm of miR-192 or miR-215, and identifying the neoplasm as
resistant to therapy if the level of miR-192 or miR-215 is
elevated, or identifying the neoplasm as not resistant to therapy
if the level of miR-192 or miR-215 is reduced.
[0098] In another embodiment, a method of determining whether a
neoplasm is a candidate for treatment with a chemotherapeutic agent
is provided. In this embodiment, the method comprises evaluating
the level of expression of miR-192 or miR-215 and rejecting the
candidate if expression of the miR-192 or miR-215 is elevated, or
accepting the candidate if the expression of miR-192 or miR-215 is
reduced.
[0099] In another embodiment, a kit for analysis of a pathological
sample is provided. Any of the compositions described herein may be
comprised in the kit. In a non-limiting example, reagents for
isolating miRNA, labeling miRNA, and/or evaluating a miRNA
population using an array, nucleic acid amplification, and/or
hybridization can be included in a kit, as well as reagents for
preparation of samples from blood samples. The kit may further
include reagents for creating or synthesizing miRNA probes. The
kits may comprise, in suitable container means, an enzyme for
labeling the miRNA by incorporating labeled nucleotides or
unlabeled nucleotides that are subsequently labeled. In certain
aspects, the kit can include amplification reagents. In other
aspects, the kit may include various supports, such as glass,
nylon, polymeric beads, and the like, and/or reagents for coupling
any probes and/or target nucleic acids. It may also include one or
more buffers, such as a reaction buffer, labeling buffer, washing
buffer, or a hybridization buffer, compounds for preparing the
miRNA probes, and components for isolating miRNA. Other kits of the
invention may include components for making a nucleic acid array
comprising miRNA, and thus, may include, for example, a solid
support. The pathological sample can be any sample commonly used
within the art, such as, for example, blood, urine, tissue or other
bodily fluid.
[0100] Kits for implementing methods of the invention described
herein are specifically contemplated. In some embodiments, there
are kits for preparing miRNA for multi-labeling and kits for
preparing miRNA probes and/or miRNA arrays. In these embodiments,
the kit may comprise, in suitable container means, any suitable
solvents, buffers, reagents, or additives known to one of ordinary
skill in the art including, but not limited to, those generally
used for manipulating RNA, such as formamide, loading dye,
ribonuclease inhibitors, and DNase.
[0101] In other embodiments, kits may include an array containing
miRNA probes. Such arrays may include, for example, arrays relevant
to a particular diagnostic, therapeutic, or prognostic application.
For example, the array may contain one or more probes that is
indicative of a disease or condition, susceptibility or resistance
to a drug or treatment, susceptibility to toxicity from a drug or
substance, prognosis, and/or genetic predisposition to a disease or
condition.
[0102] For any kit embodiment, including an array, there can be
nucleic acid molecules that contain or can be used to amplify a
sequence that is a variant of, identical to or complementary to all
or part of any SEQ ID described herein. In certain embodiments, a
kit or array of the invention can contain one or more probes for
the miRNAs identified by the SEQ IDs described herein. Any nucleic
acid discussed above may be implemented as part of a kit.
[0103] The components of the kits may be packaged in any suitable
manner known to one of ordinary skill in the art such as, for
example, in aqueous media or in lyophilized form. The kits of the
present invention may also include a means for containing the
nucleic acids, and any other reagent containers in close
confinement for commercial sale. Such containers may include
injection or blow molded plastic containers into which the desired
vials are retained.
[0104] In this embodiment, the kits may also include components
that facilitate isolation of the labeled miRNA. It may also include
components that preserve or maintain the miRNA or that protect
against its degradation. Such components may be RNAse-free or
protect against RNAses. Such kits generally will comprise, in
suitable means, distinct containers for each individual reagent or
solution.
[0105] A kit will also include instructions for employing the kit
components as well as the use of any other reagent not included in
the kit. Instructions may include variations that can be
implemented.
[0106] In another embodiment, a method of identifying an agent that
inhibits the expression or activity of miR-192 or miR-215 is
provided. In embodiments, the method comprises contacting a cell
that expresses the miR-192 or miR-215 with an agent, and comparing
the expression level of the miR-192 or miR-215 in the cell
contacted by the agent with the expression level of the miR-192 or
miR-215 in the absence of the agent. According to this embodiment,
the agent is an inhibitor of the miR-192 or miR-215 if expression
of the miR-192 or miR-215 is reduced. In this embodiment, the test
cell may overexpress the miRNA.
[0107] Compounds that modulate the expression or activity of a
miR-192 or miR-215 are useful in the methods of the invention for
the treatment, prevention, diagnosis and prognostication of a
neoplasm or subject. The method of the invention may measure a
decrease in transcription of miR-192 or miR-215 or an alteration in
the transcription or translation of the target of miR-192 or
miR-215. Any number of methods are available for carrying out
screening assays to identify such compounds. In an embodiment, the
method comprises contacting a cell that expresses miR-192 or
miR-215 with an agent and comparing the level of miR-192 or miR-215
expression in the cell contacted by the agent with the level of
expression in a control cell, wherein an agent that decreases the
expression of miR-192 or miR-215 thereby, in combination with a
secondary therapy, inhibits a neoplasia. In another embodiment,
candidate compounds are identified that specifically bind to and
alter the activity of miR-192 or miR-215 of the invention. Methods
of assaying such biological activities are known in the art. The
efficacy of such a candidate compound is dependent upon its ability
to interact with miR-192 or miR-215. Such an interaction can be
readily assayed using any number of standard binding techniques and
functional assays.
[0108] Potential agonists and antagonists of miR-192 or miR-215
include, but are not limited to, organic molecules, peptides,
peptide mimetics, polypeptides, nucleic acid molecules, and
antibodies that bind to a nucleic acid sequence of the invention
and thereby inhibit or extinguish its activity. Potential
antagonists also include small molecules that bind to miR-192 or
miR-215 thereby preventing binding to cellular molecules with which
the miR-192 or miR-215 normally interacts, such that the normal
biological activity of miR-192 or miR-215 is reduced or inhibited.
Small molecules of the invention preferably have a molecular weight
below 2,000 daltons, more preferably between 300 and 1,000 daltons,
and still more preferably between 400 and 700 daltons. It is
preferred that these small molecules are organic molecules.
[0109] The invention also includes novel compounds identified by
the above-described screening assays. These compounds are
characterized in one or more appropriate animal models to determine
the efficacy of the compound for the treatment of a neoplasia.
Characterization in an animal model can also be used to determine
the toxicity, side effects, or mechanism of action of treatment
with such a compound. Furthermore, novel compounds identified in
any of the above-described screening assays may be used for the
treatment of a neoplasia in a subject. Such compounds are useful
alone or in combination with other conventional therapies known in
the art.
[0110] It is also contemplated that the invention can be used to
evaluate differences between stages of disease, such as between
hyperplasia, neoplasia, precancer and cancer, or between a primary
tumor and a metastasized tumor. Moreover, it is contemplated that
samples that have differences in the activity of certain pathways
may also be compared. It is further contemplated that nucleic acids
molecules of the invention can be employed in diagnostic and
therapeutic methods with respect to any of the above pathways or
factors. Thus, in some embodiments of the invention, a miRNA may be
differentially expressed with respect to one or more of the above
pathways or factors. The samples can be any sample commonly used
within the art, such as, for example, blood, urine, tissue or other
bodily fluid.
[0111] In certain embodiments, miRNA profiles may be generated to
evaluate and correlate those profiles with pharmacokinetics. For
example, miRNA profiles may be created and evaluated for patient
tumor and blood samples prior to the patient's being treated or
during treatment to determine if there are miRNAs whose expression
correlates with the outcome of the patient. Identification of
differential miRNAs can lead to a diagnostic assay involving them
that can be used to evaluate tumor and/or blood samples to
determine what drug regimen the patient should be provided. In
addition, it can be used to identify or select patients suitable
for a particular clinical trial. If a miRNA profile is determined
to be correlated with drug efficacy or drug toxicity, that may be
relevant to whether that patient is an appropriate patient for
receiving the drug or for a particular dosage of the drug. One of
ordinary skill in the art would recognize that other samples, such
as urine, bodily fluid or tissue, can also be used.
[0112] In addition to the above prognostic assay, samples from
patients with a variety of diseases can be evaluated to determine
if different diseases can be identified based on blood miRNA
levels. A diagnostic assay can be created based on the profiles
that doctors can use to identify individuals with a disease or who
are at risk to develop a disease. The samples may be any sample
commonly taken from a patient, such as, for example, blood, urine
or tissue. Alternatively, treatments can be designed based on miRNA
profiling.
[0113] All references mentioned herein are incorporated in their
entirety by reference into this application.
[0114] It is to be understood and expected that variations in the
principles of the invention herein disclosed may be made by one
skilled in the art and it is intended that such modifications are
to be included within the scope of the present invention. The
following examples only illustrate particular ways to use the novel
technique of the invention, and should not be construed to limit
the scope of the invention in any way.
Example 1
miR-192 Regulates the Expression of DHFR
[0115] There are several miRNAs that potentially interact with the
3'-UTR region of DHFR mRNA. Bioinformatic analysis of the secondary
structure of the 3'-UTR of the DHFR mRNA and miRNA binding sites
reduced the candidate miRNAs to a small number. From this analysis,
miR-192 was identified as a candidate that may regulate DHFR.
[0116] FIG. 1 shows the secondary structure of the 3'-UTR of the
DHFR mRNA and the target sequence that interacts with miR-192. To
experimentally confirm the expression of DHFR was regulated by
miR-192, a miR-192 precursor was transfected into HCT-116 (wt-p53)
cells. A non-specific miR was used as a negative control. It has
been reported that the expression of DHFR is regulated by miR-24. A
DHFR siRNA and miR-24 were used as positive controls.
Over-expression of miR-192 (FIG. 2A) and miR-24 (FIG. 2B) was
confirmed by real time qRTPCR analysis using U6 RNA to normalize
the expression.
[0117] The expression of DHFR protein was analyzed using Western
immunoblot analysis and the results are shown in FIG. 2C. In this
experiment, human colon cancer cell lines, HCT-116 (wt-p53), cells
were transfected with miR-192 or miR-24. The cells were maintained
in McCoy's 5A medium (Life Technologies). The media was
supplemented with 10% dialyzed fetal bovine serum (Hyclone
Laboratories). The cell line were grown at 37.degree. C. in a
humidified incubator with 5% CO.sub.2.
[0118] The HCT-116 (wt-p53) cells transfected as follows. The cells
(2.times.10.sup.5) were plated in 6-well plates and transfected
with 100 nmol/L of either miR-192 or miR-24 precursors or
nonspecific control miR (Ambion) after 24 h with Oligofectamine
(Invitrogen) according to the manufacturer's instructions. Small
interfering RNA (siRNA) specific to DHFR (On-Target plus SMARTpool
L-008799-00-0010, human DHFR, NM.sub.--000791) (Dharmacon) and
transfected with Oligofectamine (Invitrogen) according to the
manufacturer's protocols at a final concentration of 100 nmol/L.
siRNA specific to DHFR was used as the positive control. miR-24, a
miRNA that also targets DHFR (Mishra, et al., "A miR-24 microRNA
binding site polymorphism in dihydrofolate reductase gene leads to
methotrexate resistance: Prof. Nat'l. Acad. Sci. (2007)
104:13513-13518) was also used as a positive control.
[0119] At 48 hours after transfection with miR-192 or miR-24
precursors or nonspecific control miRNA, the cells were scraped and
lysed in radioimmunoprecipitation assay buffer (Sigma). Equal
amount of proteins were resolved by SDS-PAGE on 12% gels by the
method of Laemmli, "Cleavage of structured proteins during the
assemble of the head of bacteriophase 74," Nature (1970)
227:680-685, and transferred to polyvinylidene difluoride membranes
(Bio-Rad Laboratories). The membranes were then blocked by 5%
nonfat milk in TBS-0.5% Tween 20 at room temperature for 1 hour.
The primary antibodies used for the analysis included mouse
anti-DHFR monoclonal antibody (mAb; 1:250; BD Biosciences), and
mouse anti-a-tubulin mAb (1:1,000; TU-02) (Santa Cruz
Biotechnology). Horseradish peroxidase-conjugated antibodies
against mouse or rabbit (1:1,000; Santa Cruz Biotechnology) were
used as the secondary antibodies. Protein bands were visualized
with a chemiluminescence detection system using the Super Signal
substrate.
[0120] FIG. 2C is the resulting Western immunoblot that shows
overexpression of miR-192 clearly decreased the expression of DHFR
protein (FIG. 2C, lane 4). In this image, lane 1 is the control,
lane 2 is the cells transfected with non-specific miR control, lane
3 is the cells transfected with siRNA specific to DHFR, lane 4 is
from cells transfected with miR-192 and lane 5 is the cells
transfected with miR-24. The results show that the potency of
miR-192 (FIG. 2C, lane 4) for decreasing DHFR expression was
comparable to miR-24 (FIG. 2C, lane 5).
[0121] The expression level of DHFR mRNA were analyzed using real
time qRT-PCR analysis. The analysis was performed as follows. Total
RNA, including miRNA, was isolated from cell lines by using TRIzol
reagent (Invitrogen) according to the manufacturer's instructions
at 24 h after transfection. cDNA was synthesized with the High
Capacity cDNA synthesis kit (Applied Biosystems) using 2 .mu.g of
total RNA as the template and random primers. Real-time qRT-PCR
analysis was done on the experimental mRNAs. The PCR primers and
probes for DHFR, and the internal control gene GAPDH were purchased
from Applied Biosystems. qRT-PCR was done on an ABI 7500HT
instrument under the following conditions: 50.degree. C., 2 min of
reverse transcription; 95.degree. C., 10 min; 95.degree. C., 15
sec; 60.degree. C., 1 min. The reaction was done for up to 40
cycles (n=3). GAPDH was used as an internal standard for
normalization.
[0122] The results (FIG. 2D) indicated that there was no reduction
in DHFR mRNA expression by miR-192 (lane 4) and miR-24 (lane 5). In
FIG. 2D, each bar corresponds to each lane illustrated in FIG. 2C
(see above). The results demonstrate that the suppression of DHFR
expression was regulated at the translational level without the
degradation of DHFR mRNA. By contrast, the decreased expression of
DHFR by siRNA was clearly caused by mRNA degradation (lane 3, FIG.
2D).
Example 2
Increased Expression of miR-192 Sensitizes Cells to Methotrexate
(MTX) Treatment
[0123] This was confirmed by studying cellular proliferation in
cells transfected with miR-192 and treated with MTX. HCT-116
(wt-p53) cells were plated in 96-well plates at 1.times.10.sup.3
cells/well in triplicate. They were transfected with miR-192
precursor (FIG. 3, lane 4), non-specific control miRNA (FIG. 3,
lane 2), or siRNA against DHFR (FIG. 3, lane 3) in 100 .mu.l of
medium. Twenty-four hours later, MTX in 100 .mu.l medium (final
concentration 25 nM) was added, and incubated for 72 hours. One
sample was only transfected with non-specific miR and was not
treated with MTX (FIG. 3, lane 1). Ten microliters of WST-1 (Roche
Applied Science) was added to each well. After 2 hours of
incubation, absorbance was measured at 450 and 630 nm respectively
(n=3). Non-specific control miRNA alone was used as a negative
control (FIG. 3, lane 1), and siRNA incubation with MTX was used as
a positive control (FIG. 3, lane 3).
[0124] With equal molar concentration of MTX at 25 nM (IC-10), cell
proliferation was reduced by 10% in non specific control miR
treated cells (FIG. 3, lane 2). However, cell proliferation was
reduced by nearly 70% in cells transfected with miR-192,
demonstrating a synergistic effect in combination with MTX (FIG. 3,
lane 4). By contrast, cells treated with siRNA against DHFR were
inhibited by 55% (FIG. 3, lane 3). The more potent effect of
miR-192 plus MTX compared to siRNA targeting specifically to DHFR
suggests that miR-192 may also target additional mRNA targets
through imperfect base pairing.
Example 3
miR-192 Inhibits Cell Proliferation of HCT-116 (wt-p53), RKO
(wt-p53) and HT-29 (mut-p53) Colon Cancer Cell Lines
[0125] To assess the functional significance of miR-192, the impact
of miR-192 on cellular proliferation was evaluated using HCT-116
(wt-p53), HCT-116 (null-p53), RKO (wt-p53) and HT-29 (mut-p53)
colon cancer cell lines. The human colon cancer cell lines HCT-116
(wt-p53) and HCT-116 (null-p53) were provided by Prof. Bert
Vogelstein (The Johns Hopkins University) and were maintained in
McCoy's 5A medium (Life Technologies). The other two human colon
cancer cell lines, RKO (wt-p53) and HT-29 (mut-p53), were obtained
from the American Type Culture Collection. The HT-29 (mut-p53) cell
line has a missense mutation in codon 273 of p53 resulting in an
Argto-His substitution. RKO (wt-p53) and HT-29 (mut-p53) cells were
maintained in Eagle's MEM and Iscove's Modified Dulbecco's Medium
at the American Type Culture Collection, respectively. All media
were supplemented with 10% dialyzed fetal bovine serum (Hyclone
Laboratories). All cell lines were grown at 37.degree. C. in a
humidified incubator with 5% CO.sub.2. The cell lines were
transfected as described above (see Examples 1 and 2).
[0126] The cellular proliferation was evaluated as follows. HCT-116
(wt-p53) (FIG. 4A), HCT-116 (null-p53) (FIG. 4C), RKO (wt-p53)
(FIG. 4B), and HT-29 cells (FIG. 4D) were plated in 96-well plates
in triplicate at 1.times.10.sup.3 cells per well after transfection
with miR-192 precursor (illustrated as --.tangle-solidup.--) or
non-specific control miRNA (illustrated as --.box-solid.--). Cells
were cultured for 24, 48, 72, or 96 hours. The absorbance at 450
and 630 nm was measured after incubation with 10 .mu.l of WST-1 for
2 hours. A non-specific miR was used as a negative control.
[0127] The results (see FIG. 4) show that the overexpression of
miR-192 can suppress cellular proliferation in HCT-116 (wt-p53)
cells by over 55% (n=3) (FIG. 4A) and RKO (wt-p53) cells by 48%
(n=3) (FIG. 4B), with less impact on HCT-116 (null-p53) (15%, n=3)
(FIG. 4C) and HT-29 cell lines (24%, n=3) (FIG. 4D). By contrast,
the non-specific control miR has no effect on cellular
proliferation, indicating that this effect caused by miR-192 is
highly specific. The results clearly showed that the effect of
miR-192 on the inhibition of cellular proliferation is more potent
in colon cancer cells containing wild type p53, further indicating
that miR-192's function depends on the status of p53.
Example 4
[0128] To determine whether the miR-192's impact on cellular
proliferation was related to cell cycle control, the effect on cell
cycle control was analyzed by flow cytometry using HCT-116 (wt-p53)
(FIG. 5A) and HCT-116 (null-p53) (FIG. 5B) cells transfected with
non-specific control miR (left line graph) or miR-192 (right line
graph). This experiment was performed as follows. The HCT-116
(wt-p53) and HCT-116 (null-p53) cells lines as described above (see
Example 3) were transfected with miR-192 precursor and the
non-specific control miRNA described as above (see Examples 1 and
2). At 36 hours after transfection, the cells were harvested and
resuspended at 0.5-1.times.10.sup.5 cells/ml in modified Krishan
buffer containing 0.1% sodium citrate and 0.3% NP-40 and kept at
4.degree. C. Before being analyzed by flow cytometry, cells were
treated with 0.02 mg/ml RNase H and stained with 0.05 mg/ml
propidium iodide (Sigma).
[0129] In the HCT-116 (wt-p53) cells transfected with non-specific
miR had the following cell cycle profile G1: 38.78%, G2: 17.46%, S:
43.76%, G1/S: 0.89%, and G2/S: 0.40%. The HCT-116 (wt-p53) cells
transfected with miR-192 had the follow cell cycle profile G1:
40.84%, G2: 44.71%, S: 14.45%, G1/S: 2.83%, and G2/S: 3.09%. In the
HCT-116 (null) cells transfected with non-specific miR had the
following cell cycle profile G1: 40.15%, G2: 13.33%, S: 46.52%,
G1/S: 0.86%, and G2/S: 0.29%. The HCT-116 (null) cells transfected
with miR-192 had the follow cell cycle profile G1: 35.65%, G2:
19.06%, S: 45.29%, G1/S: 0.79% and G2/S: 0.42%.
[0130] The results (FIG. 5) show that miR-192 induces both G1
(>2-fold) and G2 arrest (>3-fold) in HCT-116 (wt-p53) cells
(FIG. 5A). By contrast, this effect has not been observed in
HCT-116 (null-p53) cells (FIG. 5B). The cell cycle analysis data is
highly consistent with the cell proliferation results that the
function of miR-192 is dependent on the presence of wild type p53
for cell cycle control.
Example 5
miR-192 Expression is Dependent on p53
[0131] To further analyze the cell cycle control genes involved in
miR-192 overexpression, a number of cell cycle control genes were
analyzed (p53, p21, Bax, E2F3, Rb). HCT-116 (wt-p53) cells (FIG.
6A) and RKO (wt-p53) cells (FIG. 6B), as described above (see
Example 3), were transfected with non-specific miR (FIG. 6A, lane
2; and FIG. 6B., lane 1), DHFR siRNA (FIG. 6A, lane 3; and FIG.
6B., lane 2) and miR-192 (FIG. 6A, lane 4; and FIG. 6B., lane 3)
according to the procedure discussed above (see Examples 1 and 2).
Non-transfected HCT-116 (wt-p53) was used as a negative control
(FIG. 6A, lane 1). Alpha-tubulin was used as a protein loading
control. At 48 hours after transfection, the cells were scraped and
lysed in RIPA buffer (Sigma). Equal amount of proteins were
resolved by SDS-PAGE on 12% gels by the method of Laemmli, and
transferred to polyvinylidene fluoride membranes (BIO-RAD
Laboratories). The membranes were then blocked by 5% nonfat milk in
TBS-T (Tris-buffered saline and 0.5% Tween-20) at room temperature
for 1 hour. The primary antibodies used for the analysis included
mouse anti-p53 mAb (1:1000, DO-1) (Santa Cruz Biotechnology), mouse
anti-p21 mAb (1:1000, F-5) (Santa Cruz Biotechnology), and mouse
anti-.alpha.-tubulin mAb (1:1000, TU-02) (Santa Cruz
Biotechnology). Horseradish peroxidase-conjugated antibodies
against mouse or rabbit (1:1000) (Santa Cruz Biotechnology) were
used as the secondary antibodies. Protein bands were visualized
with a chemiluminescence detection system using the Super Signal
substrate.
[0132] FIG. 6 shows the results of Western immunoblot analysis in
HCT-116 (wt-p53) 10 cells (FIG. 6A) and RKO (wt-p53) cells (FIG.
6B). miR-192 increased the expression of the p53 protein (FIG. 6A,
lane 4) over 10-fold and p21 10-fold. By contrast, siRNA against
DHFR (FIG. 6A, lane 3) did not cause an increase in expression of
p53 and p21. The expression of Bax was not altered by miR-192.
Similar results were obtained for RKO (wt-p53) cells (FIG. 6B, lane
3 (miR-192), lane 1 (non-specific miR) and lane 2 (siRNA of
DHFR)).
Example 6
[0133] The expression of miR-192 on the expression of E2F3 and Rb
in HCT-116 (wt-p53) cells was also analyzed. In these experiments,
HVT-116 (wt-p53) cells, as described above (see Example 3) were
transfected with non-specific miR (FIG. 7, lane 2), DHFR siRNA
(FIG. 7, lane 3) or miR-192 (FIG. 7, lane 4) according to the
procedure described above (see Examples 1 and 2). One HCT-116
(wt-p53) sample was not transfected, and used as a negative control
(FIG. 7, lane 1). Western immunoblot analysis was performed
according to the procedure described above (see Example 5), except
that rabbit anti-E2F-3 polyclonal antibody (1:1000, C-18) (Santa
Cruz Biotechnology) was used.
[0134] The results (FIG. 7) indicated that miR-192 caused a
decreased expression of E2F3 and Rb (FIG. 7, lane 4). The results
further confirmed the notion that the function of miR-192 is
clearly dependent on the status of wild type p53. It has been well
characterized that the induction of the p53 dependent cell cycle
check point control gene p21 is the key to trigger cell cycle
arrest at both the G1 and G2 phase. The expression of the
proapoptotic protein Bax was not altered, suggesting that the
reduced proliferation may not be due to increased apoptosis.
miR-192 overexpression also caused a slight decrease in the
expression of E2F3 and Rb (FIG. 7), some of the key regulators of
the G2/M transition. The decreased expression of E2F3 and Rb may be
partially responsible for both the G1/S and G2/M arrest caused by
miR-192 overexpression.
Example 7
[0135] With over-expression of miR-192 by transfection, both
HCT-116 (wt-p53) and RKO (wt-p53) cells undergo cell cycle arrest
at the G1 and G2 phase leading to decreased cellular proliferation.
Bioinformatic analysis also reveals that there is a putative p53
binding site in the miR-192 promoter region.
[0136] To confirm this direct regulatory relationship, the
following experiments were performed. First, the expression of the
p53 protein was induced by treatment with MTX in HCT-116 (wt-p53)
cells, RKO (wt-p53) cells, HCT-116 (null-p53) cells and HT-29
(mut-p53) cells (see Examples 1 and 2 for description of cell
lines). Western immunoblot using mouse anti-p53 mAb (1:1000, DO-1)
(Santa Cruz Biotechnology) according to the procedure discussed in
Example 4 demonstrated that MTX treatment induced p53 protein
expression (FIG. 8A).
[0137] Thereafter, the expression of endogenous mature miR-192 was
analyzed by real time qRT-PCT analysis using an internal control
RNU6B as an internal standard for normalization. The cDNA synthesis
was carried out with the High Capacity cDNA synthesis kit (Applied
Biosystems) using 10 ng of total RNA as template. The miRNA
sequence-specific RT-PCR primers for miR-192 and endogenous control
RNU6B were purchased from Ambion. Real-time quantitative reverse
transcription-PCR (qRT-PCR) analysis was carried out using Applied
Biosystems 7500 Real-Time PCR System. The PCR master mix containing
TaqMan 2.times. Universal PCR Master Mix (No Amperase UNG), 10+
TaqMan assay and RT products in 20 .mu.l volume were processed as
follows: 95.degree. C. for 10 minutes, and then 95.degree. C. for
15 seconds, 60.degree. C. for 60 seconds for up to 40 cycles (n=3).
Signal was collected at the endpoint of every cycle. The gene
expression .DELTA.C.sub.T values of miRNAs from each sample were
calculated by normalizing with internal control RNU6B and relative
quantitation values were plotted.
[0138] The results are illustrated in FIG. 8B where an open bar
indicates an MTX(-) sample, and a dashed bar indicates an MTX(+)
sample. The qRT-PCT (FIG. 8B) shows that induction of p53 by MTX
caused a significant increase of miR-192 expression. By contrast,
MTX treatment in HCT-116 (null-p53) and HT-29 (mut-p53) cells did
not cause any change in the expression of miR-192 (FIG. 8B). These
results suggest that the endogenous expression of miR-192 depends
on the wild type p53.
Example 8
[0139] The promoter site of miR-192 contains a well conserved p53
binding sequence. FIG. 9A is a schematic diagram showing the
position of the miR-192 promoter (over 3 kb) relative to the
location of the miR-192 precursor on chromosome 11. To
experimentally confirm a direct interaction between the p53 protein
and the miR-192 promoter, chromatin immunoprecipitation-qRT-PCT
(ChIP-qPCR) analysis was used to isolate p53-bound chromosome DNA.
p21, a known cell cycle regulator transcriptionally regulated by
p53, was used as a positive control. Mouse monoclonal antibody
(DO-1) against p53 (Santa Cruz Biotechnology) was used for
immunoprecipitation of the p53 binding complex. Non-related
antibody .alpha.-tubulin (TU-02, Santa Cruz Biotechnology) was used
as a negative control. Immunoprecipitation was performed based on
the manufacturer's protocols of Active Motif. The primer sequences
for the miR-192 promoter and the p21 promoter are listed as
follows:
TABLE-US-00001 miR-192 promoter (forward primer): (SEQ ID NO: 4)
5'-AGCACCTCCCATGTCACC-3' miR-192 promoter (reverse primer): (SEQ ID
NO: 5) 5'-CAAGGCAGAGCCAGAGC-3' p21 promoter (forward primer): (SEQ
ID NO: 6) 5'-GCTGGTGGCTATTTTGTCCTTGGGC-3' p21 promoter (reverse
primer): (SEQ ID NO: 7) 5'-AGAATCTGACTCCCAGCACACACTC-3'
[0140] The isolated p53 specific binding DNA was PCR amplified
using primers which span the predicted p53 binding sites of the
miR-192 promoter or the positive control p21 promoter
transcriptionally regulated by p53 protein.
[0141] FIG. 9 shows the immunoprecipitation qPCR analysis of the
predicted miR-192 promoter with conserved p53 binding sequence.
FIG. 9B shows that the p53 protein directly interacts with the
miR-192 promoter based on ChIP-qPCR analysis with a 4-fold enriched
signal of with p53 specific monoclonal antibody compared to the
non-specific antibody control DNA. This data establishes the
existence of a conserved p53 binding site at the promoter region of
miR-192. The binding sequence is 5'-cgccatgcctxxxggccttgccc-3' (SEQ
ID NO:25), with a 3-base-pair gap represented by "x". This suggests
that miR-192, like miR-34, is another miRNA that is involved in the
p53 tumor suppressor network.
[0142] Luciferase reporter assay was used to determine the
transcriptional activation of conserved p53-binding promoter of
miR-192. pGL3-Basic promoterless luciferase reporter plasmid
(Promega) was used in this study. Double-stranded DNA
oligonucleotides of conserved p53-binding sequence of miR-192 was
synthesized and annealed and cloned upstream of firefly luciferase
in the pGL3-Basic plasmid (miR-192-pGL3). The p53-binding site
oligonucleotide (bold) contains MluI at the 5'-end and BglII
sequence at the 3'-end
(5'-ACGCGTCCCATGTCACCACCAGGGGTCGCCATGCCTCCTGGCCTTGCCCAGCAAG
ATCT-3') (SEQ ID NO:8). Control vector and miR-192-pGL3 vector were
transfected into both HCT-116 (wt-p53) and HCT-116 (null-p53)
cells. To further induce p53 expression, transfected HCT-116
(wt-p53) and HCT-116 (null-p53) cells were also treated with 5
.mu.mol/L 5-fluorouracil for 24 hours. The promoter activity of
each construct was quantified by dual luciferase assay (Promega) 24
hours after transfection. Firefly luciferase temperature for 1
hour. The primary antibodies used for the analysis included mouse
anti-DHFR monoclonal antibody (mAb; 1:250) (BD Biosciences), mouse
anti-p53 mAb (1:1,000; DO-1) (Santa Cruz Biotechnology), mouse
antip21mAb (1:1,000; F-5) (Santa Cruz Biotechnology), and mouse
anti-a-tubulin mAb (1:1,000; TU-02) (Santa Cruz Biotechnology).
Horseradish peroxidase-conjugated antibodies against mouse or
rabbit (1:1,000) (Santa Cruz Biotechnology) were used as the
secondary antibodies. Protein bands were visualized with a
chemiluminescence detection system using the Super Signal
substrate.
[0143] The conserved p-53 binding site at the promoter region of
miR-192 can activate luciferase expression only in HCT-116 (wt-p53)
cells. The activation was further enhanced by induced p53
expression in HCT (wt-p53) cells treated with 5-fluorouracil. By
contrast, the induction of luciferase activity was completely
absent from the HCT-116 (null-p53) cells. This evidences that
miR-192, like miR-34, is another miRNA that is involved in the p53
tumor suppressor network.
[0144] p53 is one of the most frequent altered tumor suppressor
gene in colorectal cancer. The potential function of multiple
miRNAs involved in p53 tumor suppressor network is to provide the
p53 with greater flexibility in rapidly responding to different
growth condition changes, by perhaps having unique miRNAs (e.g.
miR-34, miR-192) mediate the regulation of the key mRNA targets.
miR-192 was one of the miRNAs with reduced expression in a large
cohort of colon cancer patient samples, further supporting the
potential impact and clinical relevance of miR-192 in colon cancer.
The decrease or loss of the suppressive function of miR-192 in
colon cancer may be an important factor related to cell cycle
control and chemosensitivity to anti-folate based therapy.
[0145] Example 1-8 establish that miR-192 is directly involved in
the regulation of a key anticancer target DHFR. The expression and
function of the miR-192 is largely dependent on the presence of
functional wild type p53. Thus, miR-192 may be used as a novel
therapeutic option for treating cancer via an effective delivery
system either alone or in combination with anti-folate
compounds.
Example 9
miR-215 Inhibits Cell Proliferation of HCT-116(wt-p53) and U-2 OS
Cells
[0146] HCT-116 (wt-p53), HCT-116 (null-p53), U-2 OS, and MG63 cells
(2.times.10.sup.5) were plated in six-well plates, and transfected
with 100 nM of either miR-215, miR-192 precursors or non-specific
control miRNA (Ambion) after 24 h by Oligofectamine (Invitrogen)
according to the manufacturer's protocols. siRNA specific to TS
(Mishra, et al., "AmiR-24 microRNA binding site polymorphism in
dihydrofolate reductase gene leads to methotrexate resistance,"
Prof. Nat'l. Acad. Sci. (2007) 104:13513-13518) and siRNA specific
to DHFR (ON-TARGET plus SMARTpool L-008799-00-0010, human DHFR,
NM.sub.--000791) were purchased from Dharmacon and transfected with
Oligofectamine (Invitrogen) at a final concentration of 100 nM.
siRNA specific to TS or DHFR were used as the positive controls.
miR-192, an miRNA that targets DHFR, was also used as the positive
control.
[0147] Total RNA, including miRNA, was isolated from cell lines at
24 h after transfection, or from Stem cell lines or snap frozen
tissues by using TRIzol reagent (Invitrogen) according to the
manufacturer's instructions.
[0148] Real-time qRT-PCR confirmed the increased expression of
miR-215 in the transfected cells. cDNA synthesis was carried out
with the High Capacity cDNA synthesis kit (Applied Biosystems)
using 10 ng of total RNA as template. The miRNA sequence-specific
RT-PCR primers for miR-215 and endogenous control RNU6B were
purchased from Ambion. Real-time quantitative reverse
transcription-PCR (qRT-PCR) analysis was carried out using Applied
Biosystems 7500 Real-Time PCR System. The PCR master mix containing
TaqMan 2.times. Universal PCR Master Mix (No Amperase UNG),
10.times. TaqMan assay and RT products in 20 .mu.l volume were
processed as follows: 95.degree. C. for 10 min, and then 95.degree.
C. for 15 sec, 60.degree. C. for 60 sec for up to 40 cycles (n=3).
Signal was collected at the endpoint of every cycle. The gene
expression .DELTA.C.sub.T values of miRNAs from each sample were
calculated by normalizing with internal control RNU6B and relative
quantitation values were plotted.
[0149] Cell proliferation assays were performed on the transduced
cells. HCT-116 (wt-p53), HCT-116 (null-p53), U-2 OS, and MG63 cells
were plated in 96-well plates in triplicate at 1.times.10.sup.3
cells/well after transfection with miR-215 precursor or
non-specific control miRNA. Cells were cultured for 24, 48, 72, 96
h. The absorbance at 450 and 630 nm was measured after incubation
with 10 .mu.l of WST-1 for 2 h. A remarkable inhibition of cell
proliferation was observed in either HCT-116 (wt-p53) or U-2 OS
cells compared with the non-specific miRNA control, and the
reduction in HCT-116 (wt-p53) or U-2 OS cells were approximately
40% or 58% at day 5 respectively (FIG. 10).
[0150] miR-215 Induces G2-Arrest in HCT-116 (Wt-p53) and U-2 OS
Cells.
[0151] To investigate the mechanism by which miR-215 suppressed
cell proliferation in HCT-116 (wt-p53) and U-2 OS cells, the impact
of miR-215 on cell cycle control was analyzed by flow cytometry at
36 h after transfection. HCT-116 (wt-p53), HCT-116 (null-p53), U-2
OS and MG63 cells were transfected with miR-215 precursor and the
non-specific control miRNA described as above. At 36 h after
transfection, cells were harvested and resuspended at
0.5-1.times.10.sup.5 cells/ml in modified Krishan buffer containing
0.1% sodium citrate and 0.3% NP-40 and kept at 4.degree. C. Before
analysis by flow cytometry, cells were treated with 0.02 mg/ml
RNase H and stained with 0.05 mg/ml propidium iodide (Sigma).
[0152] In miR-215 transduced U-2 OS cells, the proportion of cells
in the G2-phase was higher and the proportion of cells in the
S-phase was lower than that in control cells (18.50% vs 29.69%;
52.08% vs 41.24%; FIG. 11). The G2/S ratio was increased in miR-215
transfected cells (0.35 vs 0.72; >2-fold). The results showed
that miR-215 causes increased accumulation of cells at G2-phase,
whereas cells in S-phase decrease. Similar results were observed in
transfected I-WT-116 (wt-p53) cells.
[0153] miR-215 Increases the Expression of Cell Cycle Control Genes
p53 and p21.
[0154] p53 and p21, a downstream target of the p53 pathway of
growth control, are reported to block cells at G2 checkpoint mainly
through inhibiting activity of Cdc2, the cyclin-dependent kinase
that normally drives cells into mitosis, which is the ultimate
target of pathways that mediate rapid arrest in G2 in response to
DNA damage. To further analyze the mechanism of cell proliferation
inhibition by miR-215, we transfected miR-215 precursor into
HCT-116 (wt-p53) and U-2 OS cells, and evaluated the levels of cell
cycle control genes p53 and p21 by western immunoblot analysis.
[0155] At 48 h after transfection with miR-215, miR-192 precursors
or non-specific control miRNA, the cells were scraped and lysed in
RIPA buffer (Sigma). Equal amounts of proteins were resolved by
SDS-PAGE on 12% gels by the method of Laemmli, and transferred to
polyvinylidene fluoride membranes (BIO-RAD Laboratories). The
membranes were then blocked by 5% nonfat milk in TBS-T
(Tris-buffered saline and 0.5% Tween-20) at room temperature for 1
h. The primary antibodies used for the analysis included mouse
anti-TS mAb (1:400, Millipore), mouse anti-DHFR mAb (1:250, BD
Bioscience), mouse anti-p53 mAb (1:1000, DO-1), mouse anti-p21 mAb
(1:1000, F-5), and mouse anti-.alpha.-tubulin mAb (1:1000, TU-02)
purchased from Santa Cruz Biotechnology. Horseradish
peroxidase-conjugated antibodies against mouse (1:1000, Santa Cruz
Biotechnology) were used as the secondary antibodies. Protein bands
were visualized with a chemiluminescence detection system using the
Super Signal substrate (BIO-RAD).
[0156] Over-expression of miR-215 led to a significant increase of
the p53 and p21 protein in both HCT-116 (wt-p53) and U-2 OS cells.
(FIG. 12). The results indicated that miR-215 contributed to the
inhibition of cell proliferation at least partially by the
induction of G2-arrest in HCT-116(wt-p53) and U-2 OS cells through
over-expression of G2-checkpoint genes p53 and p21.
Example 10
DHFR and TS are the Direct Targets of miR-215
[0157] Using the Sanger database (microrna.sanger.ac.uk) TS and
DHFR were identified as putative targets of miR-215 (FIG. 13). At
48 hours after transfection, proteins were extracted from
miR-215-transfected cells and from control cells and changes in TS
or DHFR protein levels were determined by western immunoblot
analysis (FIG. 14). Oligofectamine alone and non-specific miRNA
were used as the negative controls. miR-192, which had been
observed to down-regulate DHFR, was used as a positive control of
DHFR down-regulation. Over-expression of miR-192 and miR-215 was
confirmed by real time qRT-PCR analysis using U6 RNA to normalize
the expression. Introduction of miR-192 or miR-215 clearly
decreased TS or DHFR protein levels (FIG. 14, lane 3 and 4).
Expression levels of TS or DHFR mRNA were analyzed using real time
qRT-PCR analysis (FIG. 15). The results indicated that there was no
reduction in TS or DHFR mRNA expression by miR-215 (column 3) and
miR-192 (column 4). Thus, the suppression of TS or DHFR expression
was regulated at the translational level without the degradation of
TS or DHFR mRNA.
[0158] To confirm whether miR-215 directly targets TS or DHFR,
plasmids were constructed containing the fragments of the 3'UTR of
TS or DHFR in the downstream region of firefly luciferase. The
pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion)
was used to determine the targets of miR-215. Double stranded DNA
oligonucleotides containing the miR-215 binding sequence
(wt-miR-215) or mismatch sequence (mut-miR-215) in 3'UTR of TS or
DHFR mRNA and the HindIII and SpeI restriction site overhangs were
synthesized (IDT, Coralville, Iowa) and annealed and cloned
downstream of firefly luciferase in the pMIR-REPORT plasmid. The
sequences of these synthesized oligonucleotides are provided below.
The 3'UTR of TS includes two miR-215 binding sites: one is located
at 84-104 bp, one is located at 216-236 bp.
TABLE-US-00002 198-247 bp of 3'UTR of TS mRNA Forward-wt-miR-215
(SEQ ID NO: 14) 5'-CTAGTAGTTAACTCCCTGAGGGTATCTGACAATGCTGAGGTTATGA
ACAAAGTGA-3' Reverse-wt-miR-215 (SEQ ID NO: 15)
5'-AGCTTCACTTTGTTCATAACCTCAGCATTGTCAGATACCCTCAGGG AGTTAACTA-3'
Forward-mut-miR-215 (SEQ ID NO: 16)
5'-CTAGTAGTTAACTCCCTGAGGGTATATCACGATGTTGATATCACGA ACAAAGTGA-3'
Reverse-mut-miR-215 (SEQ ID NO: 17)
5'-AGCTTCACTTTGTTCGTGATATCAACATCGTGATATACCCTCAGGG AGTTAACTA-3'
62-115 bp of 3'UTR of TS mRNA Forward-wt-miR-215-2 (SEQ ID NO: 18)
5'-CTAGTAGTTCTTTTTGCTCTAAAAGAAAAAGGAACTAGGTCAAAAA TCTGTCCGA-3'
Reverse-wt-miR-215-2 (SEQ ID NO: 19)
5'-AGCTTCGGACAGATTTTTGACCTAGTTCCTTTTTCTTTTAGAGCAA AAAGAACTA-3'
519-578 bp of 3'UTR of DHFR mRNA Forward-wt-miR-215 (SEQ ID NO: 20)
5'-CTAGTAATTTCAGTGAAAGCAGTGTATTTGCTAGGTCATACCAGAA
ATCATCAATTGAGGTACGGA-3' Reverse-wt-miR-215 (SEQ ID NO: 21)
5'-AGCTTCCGTACCTCAATTGATGATTTCTGGTATGACCTAGCAAATA
CACTGCTTTCACTGAAATTA-3' Forward-mut-miR-215 (SEQ ID NO: 22)
5'-CTAGTAATTTCAGTGAAAGCAGTGTGCTTGCGATATGATACCAGAA
ATCATCAATTGAGGTACGGA-3' Reverse-mut-miR-215 (SEQ ID NO: 23)
5'-AGCTTCCGTACCTCAATTGATGATTTCTGGTATCATATCGCAAGCA
CACTGCTTTCACTGAAATTA-3'
[0159] The constructs were transiently transfected into HCT-116
(wt-p53) cells alone (control) or together with miR-215 precursor.
Twenty-four hours before transfection, HCT116 (wt-p53) and HCT 116
(null-p53) cells were plated in the 96-well plates at
1.5.times.10.sup.4 cells each well in triplicate. pMIR-REPORT
constructs (100 ng) together with ing of Renilla luciferase plasmid
phRL-SV40 (Promega, Madison, Wis.) were transfected by
Lipofectamine 2000 (Invitrogen, Carlsbad, Calif.) according to the
protocols provided by the manufacturer. Thirty hours after
transfection, cells were lysated and luciferase activity was
measured by the dual-luciferase reporter assay system (Promega,
Madison, Wis.) according to the instructions. Firefly luciferase
activity for each condition was normalized by dividing to Renilla
internal control and then compared to pMIR-REPORT.
[0160] As shown in FIG. 16, there was a significant decrease of
luciferase activity compared to the vector alone. These data
demonstrated that TS or DHFR were the direct targets of miR-215,
and suggested that the inhibition of cell proliferation by miR-215
was partially due to the down-regulation of these two enzymes.
Example 11
Reduced Chemosensitivity to TDX and MTX by Overexpression of
miR-215
[0161] TS and DHFR are the major targets of cancer chemotherapy in
the clinic. TDX, the third-generation TS inhibitor, is an active
agent in the treatment of human colon and breast cancer. Inhibitors
of DHFR, such as MTX, are widely used in the treatment of human
leukemia, osteosarcoma and choriocarcinoma. Increased DHFR protein
levels are reported to be associated with drug resistance, and low
tumor expression levels of TS have also been linked with improved
outcome for colon cancer patients treated with 5-FU chemotherapy.
However, Yamauchi et al observed that MTX has the highest activity
at the time when DNA synthesis, DHFR activity, DHFR content, and
DHFR mRNA content increased and the lowest activity at the time
when they decreased.
[0162] In this study, we confirmed miR-215 decreased the expression
of TS and DHFR protein, we then test if miR-215 can change the
sensitivity of TDX or MTX in the HCT-116 (wt-p53) or U-2 OS
cells.
[0163] HCT-116 (wt-p53) cells were plated in 96-well plates at
1.times.10.sup.3 cells/well in triplicate and were transfected with
miR-215 precursor, non-specific control miRNA, or siRNA against TS
or DHFR in 100 .mu.l of medium. Twenty-four hours later, TDX or MTX
in 100 .mu.l medium ranged from 10-200 nM was added, and incubated
for 72 hours. To measure viable cells, 10 .mu.l of WST-1 (Roche
Applied Science) was added to each well. After 2 hours incubation,
absorbance was measured at 450 and 630 nm respectively (n=3).
Non-specific control miRNA alone was used as a negative control,
and siRNAs incubation with TDX or MTX were used as the positive
controls.
[0164] FIG. 17A shows that the IC.sub.50 of TDX in HCT-116(wt-p53)
cells transfected with miR-215 was 98.7 nM, whereas in the negative
control was 18.6 nM, in the positive control was 8.5 nM. FIG. 8B
showed that 83.6% of transduced U-2 OS cells still alive at 200 nM
of MTX. The IC.sub.50 of MTX in the negative control was 49.7 nM,
whereas 37.3 nM in the positive control. These results indicated
that down-regulation of TS or DHFR protein by the siRNA specific
against TS or DHFR indeed increased the sensitivity of TDX or MTX
in the colon cancer or osteosarcoma cell lines, whereas even though
miR-215 also down-regulated the expression levels of TS or DHFR, it
did not increase the chemosensitivity of TDX or MTX compared to the
non-specific miRNA control. TDX or MTX are considered to be more
effective on the cells in the S-phase. The cell cycle data showed
that siRNAs specific against TS or DHFR did not decrease the cells
in the S-phase (FIG. 11), whereas the cells in the S-phase were
reduced in the miR-215 transfected cells.
[0165] Over-Expression of miR-215 in Human Colon Cancer Stem Cells
May Contribute to the Low Sensitivity to TDX and MTX.
[0166] Cancer stem cells also named cancer initiating cells,
exhibit low rate of division and proliferation in their niche that
help them to avoid chemotherapy and radiation. To determine whether
miR-215 expression influences the growth and chemosensitivity in
cancer stem cells, miR-215 levels in colon cancer stem cells were
measured using real-time qRT-PCR. Expression of miR-215 was
determined to be greater than 2-fold higher in the colon cancer
stem cells than in the controls (FIG. 18).
Example 12
Clinical Human Colon Cancers Show Decreased miR-215 Expression
[0167] miR-215 expression in 22 paired human colon cancer and
counterpart normal tissues was analyzed by real-time qRT-PCR (FIG.
19). Eighteen of 22 colon cancer samples (81.8%) showed decreased
miR-215 level (P<0.05).
[0168] From the description and examples provided above, one of
ordinary skill in the art would appreciate the application of
miR-192 and miR-215 in various diagnostic tools and treatments.
Example 13
[0169] It is contemplated that miR-192 and miR-215 would be altered
in a subject simultaneously according to the methods discussed
above, or that the inhibitory molecule would comprise a combination
of miR-192 and miR-215. When both are altered, it is expected that
there would be greater than the effect observed with either miR-192
or miR-215, or would have a synergistic effect. For example, it is
expected that if miR-192 and miR-215 are both inhibited in a
subject, then the sensitivity to a chemotherapeutic agent would be
increased, and that this increase would be greater than the
increase in sensitivity observed with miR-192 or miR-215. It is
further expected that if miR-192 and miR-215 are upregulated
together, then the decrease in cell proliferation would be greater
than observed with miR-192 or miR-215.
Sequence CWU 1
1
251110RNAArtificial Sequenceoligonucleotide 1gccgagaccg agugcacagg
gcucugaccu augaauugac agccagugcu cucgucuccc 60cucuggcugc caauuccaua
ggucacaggu auguucgccu caaugccagc 110219RNAArtificial
Sequenceoligonucleotide 2ugaccuauga auugacagc 19321RNAArtificial
Sequenceoligonucleotide 3cugaccuaug aauugacagc c 21418DNAArtificial
Sequenceoligonucleotide 4agcacctccc atgtcacc 18517DNAArtificial
Sequenceoligonucleotide 5caaggcagag ccagagc 17625DNAArtificial
Sequenceoligonucleotide 6gctggtggct attttgtcct tgggc
25726DNAArtificial Sequenceoligonucleotide 7cagaatctga ctcccagcac
acactc 26859DNAArtificial Sequenceoligonucleotide 8acgcgtccca
tgtcaccacc aggggtcgcc atgcctcctg gccttgccca gcaagatct
599110RNAArtificial Sequenceoligonucleotide 9aucauucaga aaugguauac
aggaaaauga ccuaugaauu gacagacaau auagcugagu 60uugucuguca uuucuuuagg
ccaauauucu guaugacugu gcuacuucaa 1101021RNAArtificial
Sequenceoligonucleotide 10augaccuaug aauugacaga c
211122DNAArtificial Sequenceoligonucleotide 11agcagtgtat ttgctaggtc
at 221220DNAArtificial Sequenceoligonucleotide 12aagaaaaaga
actaggtcaa 201321DNAArtificial Sequenceoligonucleotide 13atctgacaat
gctgaggtta t 211455DNAArtificial Sequenceoligonucleotide
14ctagtagtta actccctgag ggtatctgac aatgctgagg ttatgaacaa agtga
551555DNAArtificial Sequenceoligonucleotide 15agcttcactt tgttcataac
ctcagcattg tcagataccc tcagggagtt aacta 551655DNAArtificial
Sequenceoligonucleotide 16ctagtagtta actccctgag ggtatatcac
gatgttgata tcacgaacaa agtga 551755DNAArtificial
Sequenceoligonucleotide 17agcttcactt tgttcgtgat atcaacatcg
tgatataccc tcagggagtt aacta 551855DNAArtificial
Sequenceoligonucleotide 18ctagtagttc tttttgctct aaaagaaaaa
ggaactaggt caaaaatctg tccga 551955DNAArtificial
Sequenceoligonucleotide 19agcttcggac agatttttga cctagttcct
ttttctttta gagcaaaaag aacta 552066DNAArtificial
Sequenceoligonucleotide 20ctagtaattt cagtgaaagc agtgtatttg
ctaggtcata ccagaaatca tcaattgagg 60tacgga 662166DNAArtificial
Sequenceoligonucleotide 21agcttccgta cctcaattga tgatttctgg
tatgacctag caaatacact gctttcactg 60aaatta 662266DNAArtificial
Sequenceoligonucleotide 22ctagtaattt cagtgaaagc agtgtgcttg
cgatatgata ccagaaatca tcaattgagg 60tacgga 662366DNAArtificial
Sequenceoligonucleotide 23agcttccgta cctcaattga tgatttctgg
tatcatatcg caagcacact gctttcactg 60aaatta 662420RNAArtificial
Sequenceoligonucleotide 24gcaguguauu ugcuagguca 202523DNAArtificial
Sequenceoligonucleotide 25cgccatgcct nnnggccttg ccc 23
* * * * *