U.S. patent application number 14/526667 was filed with the patent office on 2015-06-04 for fusion proteins, uses thereof and processes for producing same.
The applicant listed for this patent is Technion Research & Development foundation Limited. Invention is credited to Roy Noy, Kfir Oved, Yoram REITER.
Application Number | 20150152161 14/526667 |
Document ID | / |
Family ID | 38723866 |
Filed Date | 2015-06-04 |
United States Patent
Application |
20150152161 |
Kind Code |
A1 |
REITER; Yoram ; et
al. |
June 4, 2015 |
FUSION PROTEINS, USES THEREOF AND PROCESSES FOR PRODUCING SAME
Abstract
This invention provides fusion proteins comprising consecutive
amino acids which beginning at the amino terminus of the protein
correspond to consecutive amino acids present in (i) a
cytomegalovirus human MHC-restricted peptide, (ii) a first peptide
linker, (iii) a human .beta.-2 microglobulin, (iv) a second peptide
linker, (v) a HLA-A2 chain of a human MHC class I molecule, (vi) a
third peptide linker, (vii) a variable region from a heavy chain of
a scFv fragment of an antibody, and (viii) a variable region from a
light chain of such scFv fragment, wherein the consecutive amino
acids which correspond to (vii) and (viii) are bound together
directly by a peptide bond or by consecutive amino acids which
correspond to a fourth peptide linker, wherein the antibody from
which the scFv fragment is derived specifically binds to
mesothelin.
Inventors: |
REITER; Yoram; (Haifa,
IL) ; Noy; Roy; (Savyon, IL) ; Oved; Kfir;
(Hof HaCarmel, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Technion Research & Development foundation Limited |
Haifa |
|
IL |
|
|
Family ID: |
38723866 |
Appl. No.: |
14/526667 |
Filed: |
October 29, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12972560 |
Dec 20, 2010 |
|
|
|
14526667 |
|
|
|
|
11804541 |
May 17, 2007 |
7977457 |
|
|
12972560 |
|
|
|
|
60801798 |
May 19, 2006 |
|
|
|
Current U.S.
Class: |
424/134.1 ;
435/252.3; 435/254.2; 435/320.1; 435/328; 435/419; 435/69.6;
530/387.3; 536/23.4 |
Current CPC
Class: |
C07K 16/30 20130101;
A61P 37/04 20180101; C07K 2319/33 20130101; C12N 15/62 20130101;
A61P 35/00 20180101; C07K 2319/00 20130101; C07K 14/70539 20130101;
C07K 2317/622 20130101; A61K 2039/505 20130101; C07K 2317/56
20130101 |
International
Class: |
C07K 14/74 20060101
C07K014/74; C07K 16/30 20060101 C07K016/30 |
Claims
1. A fusion protein comprising consecutive amino acids which,
beginning at the amino terminus of the protein, correspond to
consecutive amino acids present in (i) a cytomegalovirus human
MHC-restricted peptide, (ii) a first peptide linker, (iii) a human
.beta.-2 microglobulin, (iv) a second peptide linker, (v) a HLA-A2
chain of a human MHC class I molecule, (vi) a third peptide linker,
(vii) a variable region from a heavy chain of a scFv fragment of an
antibody, and (viii) a variable region from a light chain of such
scFv fragment, wherein the consecutive amino acids which correspond
to (vii) and (viii) are bound together directly by a peptide bond
or by consecutive amino acids which correspond to a fourth peptide
linker and the scFv fragment is derived from an antibody which
specifically binds to mesothelin.
2. The fusion protein of claim 1, wherein the first peptide linker
has the amino acid sequence GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:6).
3. The fusion protein of claim 1, wherein the second peptide linker
has the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO:8).
4. The fusion protein of claim 1, wherein the third peptide linker
has the amino acid sequence ASGG (SEQ ID NO:10).
5. The fusion protein of claim 1, wherein the fourth peptide linker
has the amino acid sequence GVGGSGGGGSGGGGS (SEQ ID NO:19).
6. The fusion protein of claim 1, wherein the cytomegalovirus human
MHC-restricted peptide has the amino acid sequence NLVPMVATV (SEQ
ID NO:4).
7. The fusion protein of claim 1, wherein the sequence of the
consecutive amino acids corresponding to (vii), followed by the
fourth peptide linker, followed by (viii) is set forth in SEQ ID
NO:12.
8. The fusion protein of claim 1, wherein the consecutive amino
acids have the amino acid sequence set forth in SEQ ID NO:2.
9. A composition comprising the fusion protein of claim 1 and a
carrier.
10. The composition of claim 9 wherein the fusion protein is
present in the composition in a therapeutically effective amount
and the carrier is a pharmaceutically acceptable carrier.
11. A nucleic acid construct comprising a nucleic acid sequence
encoding the fusion protein of claim 1.
12. The nucleic acid construct of claim 11, wherein said nucleic
acid sequence is as set forth in SEQ ID NO:1.
13. A vector comprising the nucleic acid construct of claim 11.
14. An expression vector comprising the nucleic acid construct of
claim 11 and a promoter operatively linked thereto.
15. A transformed cell comprising the vector of claim 14.
16. An isolated preparation of bacterially-expressed inclusion
bodies comprising over 30 percent by weight of the fusion protein
of claim 1.
17. A process for producing a fusion protein comprising culturing
the transformed cell of claim 15, so that the fusion protein is
expressed, and recovering the fusion protein so expressed.
18. A method of killing a tumor cell which expresses mesothelin on
its surface, the method comprising contacting the tumor cell with
the fusion protein of claim 1 in an amount effective to initiate a
CTL-mediated immune response against the tumor cell so as to
thereby kill the tumor cell.
Description
RELATED APPLICATIONS
[0001] This application is a Continuation of U.S. patent
application Ser. No. 12/972,560 filed on Dec. 20, 2010, which is a
Continuation of U.S. patent application Ser. No. 11/804,541 filed
on May 17, 2007, now U.S. Pat. No. 7,977,457, which claims the
benefit of priority of U.S. Provisional Patent Application No.
60/801,798 filed on May 19, 2006. The contents of the above
Applications are all incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] Throughout this application, certain publications are
referenced. Full citations for these publications may be found
immediately preceding the claims. The disclosures of these
publications are hereby incorporated by reference into this
application in order to more fully describe the state of the art to
which this invention relates.
[0003] According to current immune surveillance theory, the immune
system continuously locates and destroys transformed cells.
However, some cells escape from an apparently effective immune
response and consequently become tumors (1-4). Tumor evasion from
immune response is a well established phenomenon demonstrated in
numerous studies and is caused by a wide variety of suggested
mechanisms (1-4). Among these mechanisms are: the production of
suppressive cytokines, the loss of immunodominant peptides, the
resistance to killing mechanisms (apoptosis), and the loss of MHC
class I (1-4).
[0004] One of the evasion mechanisms shown to be strongly
correlated with tumor progression is the loss or down regulation of
MHC class I molecules. This evasion mechanism is abundant in many
tumors and can result from a number of different mutations. Several
studies revealed weak spots in the MHC class I loading and
presentation route including loss of beta-2-microglobulin,
TAP1/TAP2 mutations, LMP mutations, loss of heterozygocity in the
MHC genes, and down regulation of specific MHC alleles.
[0005] Current cancer immunotherapy strategies typically employ the
two arms of the immune system: the humoral and the cellular
systems. In the first, systemic injection of high affinity
monoclonal antibodies (mAbs) directed against cell surface tumor
associated antigens has demonstrated statistically significant
anti-tumor activity in clinical trials (5,6). Furthermore,
anti-tumor mAbs that carry effectors such as cytokines or toxins
are currently being evaluated in clinical trials (7). The second
major approach for specific cancer immunotherapy employs the
cellular arm of the immune system, mainly the CD8+ cytotoxic
T-lymphocytes. Two major strategies are currently being used to
increase the anti-tumor effectiveness of the cellular arm of the
immune system: (i) active immunization of patients with peptides
known to be recognized by T-lymphocytes, and (ii) adoptive transfer
therapies that enable the selection, activation, and expansion of
highly reactive T-cell subpopulations with improved anti-tumor
potency. In the first approach, MHC-restricted peptides derived
from recently identified tumor associated antigens (such as gp100,
the MAGE group, NY-ESO-1) are used to vaccinate patients. These
tumor specific antigen-derived peptides are highly specific due to
their exclusive expression in specific tissues (8-11). The second
strategy, adoptive cell transfer, has recently shown impressive
results in metastatic melanoma patients in which highly selected,
tumor-reactive T-cells against different over-expressed
self-derived differentiation antigens were isolated, expended
ex-vivo and reintroduced to the patients. In this approach, a
persistent clonal repopulation of T-cells, proliferation in vivo,
functional activity, and trafficking to tumor sites were
demonstrated (12-14).
[0006] A new immunotherapeutic approach recently presented takes
advantage of two well-established areas: (i) the known
effectiveness of CD8+ cytotoxic T-lymphocytes in the elimination of
cells presenting highly immunogenic MHC/peptide complexes, and (ii)
the tumor-specific cell surface antigens targeting via recombinant
fragments of antibodies, mainly single chain Fv fragments (scFvs).
This approach utilizes a recombinant fusion protein composed of two
functionally distinct entities: (i) a single-chain MHC class I
molecule that carries a highly immunogenic tumor or viral-derived
peptide, and (ii) a tumor-specific, high-affinity scFv fragment
(15). Several groups have previously shown that a biotinylated MHC
peptide multimerized on streptavidin or monomeric HLA-A2/influenza
(Flu) matrix peptide complexes coupled via chemical conjugation to
tumor-specific antibodies could induce in vitro
T-lymphocyte-mediated lysis of coated tumor cells (16-20). However,
these approaches utilize chemical conjugation and use whole
antibodies or larger fragments, e.g. Fab fragments. However,
production and homogeneity owing to the coupling strategy as well
as tumor penetration capability are limited due to the large size
of such molecules. Lev et al. describe a genetic fusion created
between a single-chain recombinant HLA-A2 and tumor specific scFvs.
These fusions were shown to be functional in vitro and in vivo,
being able to specifically induce T-lymphocyte mediated in vitro
and in vivo lysis of target-coated tumor cells (15). The stability
of the new chimeric molecule is highly dependent on the presence of
the peptide in the MHC groove. Therefore, dissociation of the
peptide from the scHLA-A2 domain of the chimeric molecule can
impair its stability. Oved et al. addressed this problem by
constructing new chimeric molecules in which the peptide is
connected to the scHLA-A2/scFv construct via a short linker. This
new fusion protein was tested for its in vitro biochemical and
biological activity (21).
[0007] There is a widely recognized need for a new fusion protein
that can maintain its dual activity: bind tumor target cells
through the scFv moiety as well as mediate potent, effective and
specific cytotoxicity through the recruitment of CD8+T-cells whose
specificity is governed by the covalently linked HLA-A2-restricted
peptide.
[0008] The MHC class I-restricted CD8+ cytotoxic T-cell (CTL)
effector arm of the adaptive immune response is best equipped to
recognize tumor cells as foreign and initiate the cascade of events
resulting in tumor destruction. However, tumors have developed
sophisticated strategies to escape immune effector mechanisms, of
which the best-studied is the downregulation of MHC class I
molecules which present the antigens recognized by CTLs.
[0009] To overcome the limitation of previous approaches and
develop new approaches for immunotherapy, a recombinant molecule
was constructed in which a single-chain MHC is specifically
targeted to tumor cells through its fusion to cancer
specific-recombinant antibody fragments or a ligand that binds to
receptors expressed by tumor cells.
SUMMARY OF THE INVENTION
[0010] This invention provides a fusion protein comprising
consecutive amino acids which, beginning at the amino terminus of
the protein, correspond to consecutive amino acids present in (i) a
cytomegalovirus human MHC-restricted peptide, (ii) a first peptide
linker, (iii) a human .beta.-2 microglobulin, (iv) a second peptide
linker, (v) a HLA-A2 chain of a human MHC class I molecule, (vi) a
third peptide linker, (vii) a variable region from a heavy chain of
a scFv fragment of an antibody, and (viii) a variable region from a
light chain of such scFv fragment, wherein the consecutive amino
acids which correspond to (vii) and (viii) are bound together
directly by a peptide bond or by consecutive amino acids which
correspond to a fourth peptide linker and the scFv fragment is
derived from an antibody which specifically binds to
mesothelin.
[0011] This invention also provides compositions comprising the
fusion protein and a carrier.
[0012] This invention further provides a nucleic acid construct
encoding a fusion protein comprising consecutive amino acids which,
beginning at the amino terminus of the protein, correspond to
consecutive amino acids present in (i) a cytomegalovirus human
MHC-restricted peptide, (ii) a first peptide linker, (iii) a human
.beta.-2 microglobulin, (iv) a second peptide linker, (v) a HLA-A2
chain of a human MHC class I molecule, (vi) a third peptide linker,
(vii) a variable region from a heavy chain of a scFv fragment of an
antibody, and (viii) a variable region from a light chain of such
scFv fragment, wherein the consecutive amino acids which correspond
to (vii) and (viii) are bound together directly by a peptide bond
or by consecutive amino acids which correspond to a fourth peptide
linker and the scFv fragment is derived from an antibody which
specifically binds to mesothelin.
[0013] This invention still further provides an isolated
preparation of bacterially-expressed inclusion bodies comprising
over 30 percent by weight of a fusion protein in accordance with
the invention.
[0014] This invention also provides a process for producing a
fusion protein comprising culturing a transformed cell comprising
the fusion protein, so that the fusion protein is expressed, and
recovering the fusion protein so expressed.
[0015] This invention further provides a method of selectively
killing a tumor cell which comprises contacting the cell with the
fusion protein of the invention in an amount effective to initiate
a CTL-mediated immune response against the tumor cell so as to
thereby kill the tumor cell.
[0016] Finally, this invention further provides a method of
treating a tumor cell which expresses mesothelin on its surface,
which comprises contacting the tumor cell with the fusion protein
according to the invention in an amount effective to initiate a
CTL-mediated immune response against the tumor cell so as to
thereby treat the tumor cell.
[0017] As an exemplary molecule of the present invention, a
single-chain MHC molecule composed of 02 microglobulin fused to the
.alpha.1, .alpha.2 and .alpha.3 domains of HLA-A2 via a short
peptide linker (15 amino acids) was fused to the scFv SS1 which
targets mesothelin. To construct a fusion protein with covalently
linked peptide a 9 amino acids peptide derived from the CMV pp65
protein NLVPMVATV (SEQ ID NO:4) was fused to the N-terminus of the
scHLA-A2/SS1(scFv) fusion protein via a 20 amino acid linker
GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:6). The fusion protein was
expressed in E. coli and functional molecules were produced by in
vitro refolding in the presence of CMV/scHLA-A2/SS1(scFv). Flow
cytometry studies revealed the ability to decorate
antigen-positive, HLA-A2-negative human tumor cells with
HLA-A2-peptide complexes in a manner that was entirely dependent
upon the specificity of the targeting antibody fragment. Most
importantly, CMV/scHLA-A2/SS1 (scFv)-mediated coating of target
tumor cells made them susceptible for efficient and specific
HLA-A2-restricted, CMV peptide-specific CTL-mediated lysis. These
results demonstrate that antibody-guided tumor antigen-specific
targeting of MHC-peptide complexes on tumor cells can render them
susceptible to, and potentiate, CTL killing. This novel approach
now opens the way for the development of new immunotherapeutic
strategies based on antibody targeting of natural cognate MHC
ligands and CTL-based cytotoxic mechanisms.
[0018] In connection with the present invention, a novel strategy
was developed to re-target class I MHC-peptide complexes on the
surface of tumor cells in a way that is independent of the extent
of class I MHC expression by the target tumor cells. To this end,
in one embodiment of the present invention, a molecule with two
arms was employed. One arm, the targeting moiety, comprises
tumor-specific recombinant fragments of antibodies directed to
tumor or differentiation antigens which have been used for many
years to target radioisotopes, toxins or drugs to cancer cells. The
second effector arm is a single-chain MHC molecule (scMHC) composed
of human .beta.2-microglobulin linked to the three extracellular
domains of the HLA-A2 heavy chain (24, 25, WO 01/72768). By
connecting genes encoding the two arms in a single recombinant gene
and expressing the gene, the new molecule is expressed efficiently
in E. coli and produced, for example, by in vitro refolding in the
presence of HLA-A2-CMV peptides. This approach, as described
herein, renders the target tumor cells susceptible to lysis by
cytotoxic T-cells regardless of their MHC expression level and thus
may be employed as a new approach to potentiate CTL-mediated
anti-tumor immunity. This novel approach will lead to the
development of a new class of recombinant therapeutic agents
capable of selective killing and elimination of tumor cells
utilizing natural cognate MHC ligands and CTL-based cytotoxic
mechanisms.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIGS. 1A-B
[0020] Schematic representation of scHLA-A2/SS1 (scFv) and a
pep(CMV)/scHLA-A2/SS1 (scFv) (Compound A).
[0021] FIG. 1A illustrates the C-Terminus of the scHLA-A2 fused to
the N-terminus of SS1 (scFv) via a 4 amino acid linker. FIG. 1B
illustrates that the CMV pp65 peptide, i.e. NLVPMVATV (SEQ ID NO:4)
was fused to the N-terminus of the scHLA-A2/SS1 (scFv) via a 20
amino acid linker GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:6).
[0022] FIG. 2
[0023] Nucleic acid sequence encoding Compound A (SEQ ID NO:1).
[0024] FIGS. 3A-B
[0025] Expression and purification of Compound A.
[0026] FIG. 3A shows the SDS/PAGE analysis of isolated inclusion
bodies. FIG. 3B shows the SDS/PAGE analysis of Compound A after
purification on ion-exchange chromatography.
[0027] FIG. 4
[0028] Binding of Compound A to recombinant mesothelin.
[0029] Mesothelin was immobilized on immuno-plates and
dose-dependent binding of Compound A was monitored by conformation
sensitive mAb W6 (33,34).
[0030] FIGS. 5A-D
[0031] Binding of Compound A to mesothelin-expressing cells.
[0032] FIG. 5A-B demonstrates the flow cytometry analysis of the
binding of Compound A to mesothelin-positive HLA-A2-negative A431K5
cells and mesothelin-negative HLA-A2-negative A431 cells. FIG. 5A
shows the binding of the K1 mAb (31,32) to A431K5 cells, and FIG.
5B shows the absence of binding of of the K1 mAb to A431 cells.
FIG. 5C shows the binding of Compound A to A431K5 cells, and FIG.
5D shows the absence of binding of Compound A to A431 cells. The
binding was monitored using anti-HLA-A2 specific antibody BB7.2
(35) and a FITC-labeled secondary antibody.
[0033] FIGS. 6A-B
[0034] Potentiation of CTL-mediated lysis of HLA-A2 negative tumor
cells by Compound A. In FIG. 6A, the mesothelin-transfected A431K5
cells and the parental mesothelin-negative A431 cells were
incubated with Compound A (10 .mu.g) and CMV specific CTLs in a
[S.sup.35]methionine release assay. FIG. 6B demonstrates
dose-dependent activity of Compound A when mesothelin-transfected
A431K5 cells and the parental mesothelin-negative A431 cells were
incubated with different concentrations of Compound A and
CMV-specific CTLs in a [S.sup.35]methionine release assay.
[0035] FIG. 7
[0036] Schematic representation of the pep/scHLA-A2/SS1(scFv)
(Compound B). In Compound B, the peptide NLVPMVATV (SEQ ID NO:4)
was fused to the N-terminus of scHLA-A2/SS1 (scFv) via a 15 amino
acid linker GGGGSGGGGSGGGGS (SEQ ID NO:8).
[0037] FIG. 8
[0038] Nucleic acid sequence encoding Compound B (SEQ ID
NO:22).
[0039] FIGS. 9A-B
[0040] Expression and purification of Compound B.
[0041] FIG. 9A shows SDS/PAGE analysis of isolated inclusion
bodies. FIG. 9B shows SDS/PAGE analysis of Compound B after
purification on ion-exchange chromatography.
[0042] FIGS. 10A-F
[0043] Binding of Compound B to mesothelin-expressing cells.
[0044] FIGS. 10A-F demonstrate the flow cytometry analysis of the
binding of Compound B to mesothelin-positive HLA-A2-negative A431K5
cells and mesothelin-negative HLA-A2-negative A431 cells. FIG. 10A
shows the binding of K1 mAb to A431K5 cells, and FIG. 10B shows the
lack of binding of K1 mAb to A431 cells (B). FIG. 10C shows the
binding of Compound B to A431K5 cells, and FIG. 10D shows the lack
of binding of Compound B to A431 cells. FIG. 10E shows the
comparison between the binding of Compound A and Compound B to
A431K5 cells, and FIG. 10F shows the lack of binding of Compound A
and Compound B to A431 cells. The binding was monitored using
anti-HLA-A2 specific antibody BB7.2 and a FITC-labeled secondary
antibody.
[0045] FIGS. 11A-B
[0046] Potentiation of CTL-mediated lysis of HLA-A2-negative tumor
cells by Compound B.
[0047] In FIG. 11A, mesothelin-transfected A431K5 cells and the
parental mesothelin-negative A431 cells were incubated with
Compound B (10 .mu.g) and CMV-specific CTLs in a
[S.sup.35]methionine release assay. FIG. 11B demonstrates
dose-dependent activity of Compound B, when mesothelin-transfected
A431K5 cells and the parental mesothelin-negative A431 cells were
incubated with different concentrations of Compound A and
CMV-specific CTLs in a [S.sup.35]methionine release assay.
[0048] FIG. 12
[0049] Potentiation of CTL-mediated lysis of HLA-A2 negative tumor
cells by Compound B and Compound A. Mesothelin-transfected A431K5
cells and the parental mesothelin-negative A431 cells were
incubated with different concentrations of Compound B or Compound A
and with CMV-specific CTLs in a [S.sup.35]methionine release assay.
The figure shows results of incubation of Compound A with A431K5
cells, incubation of Compound B with A431K5 cells, incubation of
Compound A with A431 cells, and incubation of Compound B with A431
cells.
[0050] FIGS. 13A-B
[0051] Schematic representation of scHLA-A2/SS1 (scFv) and
M1cov/scHLA-A2/SS1 (scFv).
[0052] FIG. 13A shows the C-terminus of the scHLA-A2 fused to the
N-terminus of scFv via 4 amino acid linker. FIG. 13B shows the
M158-66 peptide fused to the N-terminus of the scHLA-A2/SS1(scFv)
via a 15 amino acid linker GGGGSGGGGSGGGGS (SEQ ID NO:8).
[0053] FIG. 14
[0054] Nucleic acid sequence encoding the M1cov/scHLA-A2/SS1 (scFv)
fusion protein (SEQ ID NO:23).
[0055] FIGS. 15A-B
[0056] Expression and purification of the M1-cov/scHLA-A2/SS1
(scFv) fusion protein.
[0057] FIG. 15A shows the SDS/PAGE analysis of isolated inclusion
bodies. FIG. 15B shows the SDS/PAGE analysis of M1-cov/scHLA-A2/SS1
(scFv) fusion protein after purification on ion-exchange
chromatography.
[0058] FIG. 16
[0059] Binding of the M1-cov/scHLA-A2/SS1 (scFv) fusion protein to
recombinant Mesothelin. Mesothelin was immobilized onto
immuno-plates and dose-dependent binding of M1-cov/scHLA-A2/SS1
(scFv) was monitored by conformation sensitive mAb (W6).
[0060] FIGS. 17A-D
[0061] Binding of M1-cov/scHLA-A2/SS1 (scFv) fusion protein to
Mesothelin expressing cells. FIGS. 17A-D show flow cytometry
analysis of the binding of M1-cov/scHLA-A2/SS1 (scFv) to
mesothelin-positive HLA-A2-negative A431K5 cells and
mesothelin-negative HLA-A2-negative A431 cells. FIG. 17A shows the
binding of K1 mAb to A431K5 cells, and FIG. 17B shows the absence
of binding of K1 mAb to A431 cells. FIG. 17C shows the binding of
M1-cov/scHLA-A2/SS1 (scFv) fusion protein to A431K5 cells, and FIG.
17D shows the absence of binding of M1-cov/scHLA-A2/SS1 (scFv)
fusion protein to A431 cells. The binding was monitored using
anti-HLA-A2 specific antibody BB7.2 and a FITC-labeled secondary
antibody.
[0062] FIG. 18
[0063] Potentiation of CTL-mediated lysis of HLA-A2-negative tumor
cells by M1-cov/scHLA-A2/SS1 (scFv) fusion protein.
Mesothelin-transfected A431K5 cells and the parental
mesothelin-negative A431 cells were incubated with different
concentration of M1-cov/scHLA-A2/SS1 (scFv) and with M1 specific
HLA-A2-restricted CTLs in a [S.sup.35]methionine release assay.
DETAILED DESCRIPTION OF THE INVENTION
[0064] This invention provides a fusion protein comprising
consecutive amino acids which, beginning at the amino terminus of
the protein, correspond to consecutive amino acids present in (i) a
cytomegalovirus human MHC-restricted peptide, (ii) a first peptide
linker, (iii) a human .beta.-2 microglobulin, (iv) a second peptide
linker, (v) a HLA-A2 chain of a human MHC class I molecule, (vi) a
third peptide linker, (vii) a variable region from a heavy chain of
a scFv fragment of an antibody, and (viii) a variable region from a
light chain of such scFv fragment, wherein the consecutive amino
acids which correspond to (vii) and (viii) are bound together
directly by a peptide bond or by consecutive amino acids which
correspond to a fourth peptide linker and the scFv fragment is
derived from an antibody which specifically binds to mesothelin. In
one embodiment, the first peptide linker has the amino acid
sequence GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:6). In another embodiment,
the second peptide linker has the amino acid sequence
GGGGSGGGGSGGGGS (SEQ ID NO:8). In another embodiment, the third
peptide linker has the amino acid sequence ASGG (SEQ ID NO:10). In
another embodiment, the fourth peptide linker has the amino acid
sequence GVGGSGGGGSGGGGS (SEQ ID NO:19). In another embodiment, the
cytomegalovirus human MHC-restricted peptide has the amino acid
sequence NLVPMVATV (SEQ ID NO:4).
[0065] As used herein, "first peptide linker", "second peptide
linker" and "fourth peptide linker" refer to peptides composed of a
monomeric peptide whose amino acid sequence is GXGGS (SEQ ID NO:20)
or a multimer thereof, wherein X may be any amino acid. These
peptide linkers may be a multimer of 2-10 of such monomeric
peptide. In any such multimer, each monomeric peptide may be the
same as or different from other monomeric peptide in the multimer
depending on the identity of amino acid X. In one embodiment, X in
the monomeric peptide is the amino acid valine (V). In another
embodiment, X in the monomeric peptide is the amino acid glycine
(G). In presently preferred embodiments, the peptide linker
comprises a multimer of three or four monomeric peptides,
particularly a multimer of three monomeric peptides in which the
most N-terminal X is the amino acid V, and the second and third X
are the amino acid G.
[0066] In one embodiment, the sequence of the consecutive amino
acids corresponding to (vii), followed by the fourth peptide
linker, followed by (viii) is set forth in SEQ ID NO:12.
[0067] In another embodiment, the consecutive amino acids of the
fusion protein, Compound A, have the amino acid sequence set forth
in SEQ ID NO:2.
[0068] This invention also provides a composition comprising a
fusion protein in accordance with the invention and a carrier. In
one embodiment, the fusion protein is present in the composition in
a therapeutically effective amount and the carrier is a
pharmaceutically acceptable carrier.
[0069] This invention also provides a nucleic acid construct
encoding a fusion protein comprising consecutive amino acids which,
beginning at the amino terminus of the protein, correspond to
consecutive amino acids present in (i) a cytomegalovirus human
MHC-restricted peptide, (ii) a first peptide linker, (iii) a human
.beta.-2 microglobulin, (iv) a second peptide linker, (v) a HLA-A2
chain of a human MHC class I molecule, (vi) a third peptide linker,
(vii) a variable region from a heavy chain of a scFv fragment of an
antibody, and (viii) a variable region from a light chain of such
scFv fragment, wherein the consecutive amino acids which correspond
to (vii) and (viii) are bound together directly by a peptide bond
or by consecutive amino acids which correspond to a fourth peptide
linker and the scFv fragment is derived from an antibody which
specifically binds to mesothelin. In one embodiment, the nucleic
acid construct has the nucleic acid sequence set forth in SEQ ID
NO:1.
[0070] This invention also provides a vector comprising the nucleic
acid construct of the invention. Examples of such vectors are
plasmids, viruses, phages, and the like.
[0071] This invention further provides an expression vector
comprising the nucleic acid construct of the invention and a
promoter operatively linked thereto.
[0072] This invention also provides a transformed cell comprising a
vector according to the invention. The transformed cell may be a
eukaryotic cell, e.g. one selected from the group consisting of a
mammalian cell, an insect cell, a plant cell, a yeast cell and a
protozoa cell. Alternatively, the transformed cell may be a
bacterial cell.
[0073] This invention provides an isolated preparation of
bacterially-expressed inclusion bodies comprising over 30 percent
by weight of a fusion protein according to the invention.
[0074] This invention also provides a process for producing a
fusion protein comprising culturing the transformed cell of the
invention so that the fusion protein is expressed, and recovering
the fusion protein so expressed. In one embodiment, the recovery of
the fusion protein comprises subjecting the expressed fusion
protein to size exclusion chromatography. In another embodiment,
the fusion protein is expressed in inclusion bodies. In one
embodiment, the process further comprises treating the inclusion
bodies so as to separate and refold the fusion protein and thereby
produce the fusion protein in active form. In another embodiment,
treating of the inclusion bodies to separate the fusion protein
therefrom comprises contacting the inclusion bodies with a
denaturing agent.
[0075] As used herein, an "active form" of the fusion protein means
a three dimensional conformation of the fusion protein which
permits the fusion protein to specifically bind to mesothelin when
mesothelin is present on the surface of a tumor cell.
[0076] This invention also provides a method of selectively killing
a tumor cell, which comprises contacting the cell with the fusion
protein of the invention in an amount effective to initiate a
CTL-mediated immune response against the tumor cell so as to
thereby kill the tumor cell. In one embodiment, the tumor cell is
in a patient and the contacting is effected by administering the
fusion protein to the patient.
[0077] This invention further provides a method of treating a tumor
cell which expresses mesothelin on its surface, which comprises
contacting the tumor cell with the fusion protein according to the
invention in an amount effective to initiate a CTL-mediated immune
response against the tumor cell so as to thereby treat the tumor
cell. In one embodiment, the tumor cell is present in a solid
tumor. In another embodiment, the solid tumor is a tumor associated
with ovarian, lung, pancreatic or head/neck cancer, or
mesothelioma.
[0078] The present invention provides (i) novel fusion proteins;
(ii) processes of preparing same; (iii) nucleic acid constructs
encoding same; and (iv) methods of using same for selective killing
of cells, cancer cells in particular.
[0079] The principles and operation of the present invention may be
better understood with reference to the figures and description set
forth herein.
[0080] It is to be understood that the invention is not limited in
its application to the details set forth in the description or as
exemplified. The invention encompasses other embodiments and is
capable of being practiced or carried out in various ways. Also, it
is to be understood that the phraseology and terminology employed
herein is for the purpose of description and should not be regarded
as limiting.
[0081] Tumor progression is often associated with the secretion of
immune-suppressive factors and/or the down-regulation of MHC class
I antigen-presentation functions (2). Even when a specific CTL
response is demonstrated in patients, this response is low because
the anti-tumor CTL population is rare, very infrequent, and in some
cases the CLTs are not functional or anergic (26). Moreover, it is
well-established that the number of MHC-peptide complexes on the
surface of tumor cells that present a particular tumor-associated
peptide is low (27). Significant progress toward developing
vaccines that can stimulate an immune response against tumors has
involved the identification of the protein antigens associated with
a given tumor type and epitope mapping of tumor antigens for MHC
class I and class II restricted binding motifs were identified and
are currently being used in various vaccination programs (14,
11,8). MHC class I molecules presenting the appropriate peptides
are necessary to provide the specific signals for recognition and
killing by CTLs. However, the principal mechanism of tumor escape
is the loss, downregulation or alteration of HLA profiles that may
render the target cell unresponsive to CTL lysis, even if the cell
expresses the appropriate tumor antigen.
[0082] The present invention provides a new approach to circumvent
this problem. While reducing the present invention to practice,
tumor-specific targeting of class I MHC-peptide complexes on tumor
cells was shown to be an effective and efficient strategy to render
HLA-A2-negative cells susceptible to lysis by relevant
HLA-A2-restricted CTLs. This new strategy of redirecting CTLs
against tumor cells takes advantage of the use of recombinant
anti-mesothelin antibody fragment and CMV ligand that can localize
on malignant cells that express a tumor with a relatively high
degree of specificity.
[0083] The anti-mesothelin antibody targeting fragment and CMV
ligand are fused to a single-chain HLA-A2 molecule that can be
folded efficiently and functionally.
[0084] The results presented herein provide a clear demonstration
of the usefulness of the approach of the present invention to
recruit active CTLs for tumor cell killing via cancer-specific
antibody or ligand guided targeting of scMHC-peptide complexes.
These results pave the way for the development of a new
immunotherapeutic approach based on naturally occurring cellular
immune responses which are redirected against the tumor cells.
[0085] It will be appreciated that the fusion protein of the
present invention or portions thereof can be prepared by several
ways, including solid phase protein synthesis. However, in the
preferred embodiment of the invention, at least major portions of
the molecules, e.g., the scHLA-A2 domain (with or without the CMV
peptide) and the scFV domain are generated by translation of a
respective nucleic acid construct or constructs encoding the
molecule.
[0086] Accordingly, one to three open reading frames are required
to synthesize the molecules of FIG. 1B via translation. These open
reading frames can reside on a single, two or three nucleic acid
molecules. Thus, for example, a single nucleic acid construct can
carry one, two or all three open reading frames. One to three
cis-acting regulatory sequences can be used to control the
expression of the one to three open reading frames. For example, a
single cis-acting regulatory sequence can control the expression of
one, two or three open reading frames, in a cistrone-like manner.
In the alternative, three independent cis-acting regulatory
sequences can be used to control the expression of the three open
reading frames. Other combinations are also envisaged.
[0087] The open reading frames and the cis-acting regulatory
sequences can be carried by one to three nucleic acid molecules.
For example, each open reading frame and its cis-acting regulatory
sequence are carried by a different nucleic acid molecule, or all
of the open reading frames and their associated cis-acting
regulatory sequences are carried by a single nucleic acid molecule.
Other combinations are also envisaged.
[0088] Expression of the fusion protein can be effected by
transformation/transfection and/or
co-transformation/co-transfection of a single cell or a plurality
of cells with any of the nucleic acid molecules, serving as
transformation/transfection vectors (e.g., as plasmids, phages,
phagemids or viruses).
[0089] It will be appreciated that the fusion protein whose amino
acid sequence is set forth in SEQ ID NO:2 and includes the
N-terminal amino acid methionine, likely represents the fusion
protein as expressed in a bacterial cell. Depending on the specific
bacterial cell employed to express the fusion protein, the
N-terminal methionine may be cleaved and removed. Accordingly, it
is contemplated that fusion proteins in accordance with this
invention encompass both those with, and those without, a
N-terminal methionine. In general, when a fusion protein in
accordance with the invention is expressed in a eukaryotic cell, it
would lack the N-terminal methionine. Therefore, it is to be
appreciated that the amino acid sequence of expressed fusion
proteins according to the invention may include or not include such
N-terminal methionine depending on the type of cells in which the
proteins are expressed.
[0090] Whenever and wherever used, the linker peptide is selected
of an amino acid sequence which is inherently flexible, such that
the polypeptides connected thereby independently and natively fold
following expression thereof, thus facilitating the formation of a
functional or active single chain (sc) human .beta..sub.2M/HLA
complex, antibody targeting or human .beta..sub.2M/HLA-CMV
restricted antigen complex.
[0091] Any of the nucleic acid constructs described herein comprise
at least one cis-acting regulatory sequence operably linked to the
coding polynucleotides therein. Preferably, the cis-acting
regulatory sequence is functional in bacteria. Alternatively, the
cis-acting regulatory sequence is functional in yeast. Still
alternatively, the cis-acting regulatory sequence is functional in
animal cells. Yet alternatively, the cis acting regulatory sequence
is functional in plant cells.
[0092] The cis-acting regulatory sequence can include a promoter
sequence and additional transcriptional or a translational enhancer
sequences all of which serve for facilitating the expression of the
polynucleotides when introduced into a host cell. Specific examples
of promoters are described hereinbelow in context of various
eukaryotic and prokaryotic expression systems and in the examples
section which follows.
[0093] It will be appreciated that a single cis-acting regulatory
sequence can be utilized in a nucleic acid construct to direct
transcription of a single transcript which includes one or more
open reading frames. In the later case, an internal ribosome entry
site (IRES) can be utilized so as to allow translation of the
internally positioned nucleic acid sequence.
[0094] Whenever co-expression of independent polypeptides in a
single cell is of choice, the construct or constructs employed must
be configured such that the levels of expression of the independent
polypeptides are optimized, so as to obtain highest proportions of
the final product.
[0095] Preferably a promoter (being an example of a cis-acting
regulatory sequence) utilized by the nucleic acid construct(s) of
the present invention is a strong constitutive promoter such that
high levels of expression are attained for the polynucleotides
following host cell transformation.
[0096] It will be appreciated that high levels of expression can
also be effected by transforming the host cell with a high copy
number of the nucleic acid construct(s), or by utilizing cis acting
sequences which stabilize the resultant transcript and as such
decrease the degradation or "turn-over" of such a transcript.
[0097] As used herein, the phrase "transformed cell" describes a
cell into which an exogenous nucleic acid sequence is introduced to
thereby stably or transiently genetically alter the host cell. It
may occur under natural or artificial conditions using various
methods well known in the art some of which are described in detail
hereinbelow in context with specific examples of host cells.
[0098] The transformed host cell can be a eukaryotic cell, such as,
for example, a mammalian cell, an insect cell, a plant cell, a
yeast cell and a protozoa cell, or alternatively, the cell can be a
bacterial cell.
[0099] When utilized for eukaryotic host cell expression, the
nucleic acid construct(s) according to the present invention can be
a shuttle vector, which can propagate both in E. coli (wherein the
construct comprises an appropriate selectable marker and origin of
replication) and be compatible for expression in eukaryotic host
cells. The nucleic acid construct(s) according to the present
invention can be, for example, a plasmid, a bacmid, a phagemid, a
cosmid, a phage, a virus or an artificial chromosome.
[0100] Suitable mammalian expression systems include, but are not
limited to, pcDNA3, pcDNA3.1(+/-), pZeoSV2(+/-), pSecTag2,
pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, which are available
from Invitrogen.TM. Corporation (Carlsbad, Calif. USA), pCI which
is available from Promega.TM. Corporation (Madison Wis. USA),
pBK-RSV and pBK-CMV which are available from Stratagene.RTM. (La
Jolla, Calif. USA), pTRES which is available from Clontech.RTM.
Laboratories, Inc. (Mountain View, Calif. USA), and their
derivatives.
[0101] Insect cell cultures can also be utilized to express the
nucleic acid sequences of the present invention. Suitable insect
expression systems include, but are not limited to the baculovirus
expression system and its derivatives which are commercially
available from numerous suppliers such as maxBac.TM.
(Invitrogen.TM. Corporation, Carlsbad, Calif. USA) BacPak.TM.
(Clontech.RTM. Laboratories, Inc. Mountain View, Calif. USA), or
Bac-to-Bac.TM. (Invitrogen.TM./Gibco.RTM., Carlsbad, Calif.
USA).
[0102] Expression of the nucleic acid sequences of the present
invention can also be effected in plants cells. As used herein, the
phrase "plant cell" can refer to plant protoplasts, cells of a
plant tissue culture, cells of plant derived tissues or cells of
whole plants.
[0103] There are various methods of introducing nucleic acid
constructs into plant cells. Such methods rely on either stable
integration of the nucleic acid construct or a portion thereof into
the genome of the plant cell, or on transient expression of the
nucleic acid construct in which case these sequences are not stably
integrated into the genome of the plant cell.
[0104] There are two principle methods of effecting stable genomic
integration of exogenous nucleic acid sequences such as those
included within the nucleic acid construct of the present invention
into plant cell genomes: [0105] (i) Agrobacterium-mediated gene
transfer: Klee et al. (1987) Annu. Rev. Plant Physiol. 38:467-486;
Klee and Rogers in Cell Culture and Somatic Cell Genetics of
Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, eds.
Schell, J., and Vasil, L. K., Academic Publishers, San Diego,
Calif. (1989) p. 2-25; Gatenby, in Plant Biotechnology, eds. Kung,
S. and Arntzen, C. J., Butterworth Publishers, Boston, Mass. (1989)
p. 93-112. [0106] (ii) direct DNA uptake: Paszkowski et al., in
Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular
Biology of Plant Nuclear Genes eds. Schell, J., and Vasil, L. K.,
Academic Publishers, San Diego, Calif. (1989) p. 52-68; including
methods for direct uptake of DNA into protoplasts, Toriyama, K. et
al. (1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief
electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988)
7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection
into plant cells or tissues by particle bombardment, Klein et al.
Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology
(1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; by
the use of micropipette systems: Neuhaus et al., Theor. Appl.
Genet. (1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant.
(1990) 79:213-217; or by the direct incubation of DNA with
germinating pollen, DeWet et al. in Experimental Manipulation of
Ovule Tissue, eds. Chapman, G. P. and Mantell, S. H. and Daniels,
W. Longman, London, (1985) p. 197-209; and Ohta, Proc. Natl. Acad.
Sci. USA (1986) 83:715-719.
[0107] The Agrobacterium system includes the use of plasmid vectors
that contain defined DNA segments that integrate into the plant
genomic DNA. Methods of inoculation of the plant tissue vary
depending upon the plant species and the Agrobacterium delivery
system. A widely used approach is the leaf disc procedure, see for
example, Horsch et al. in Plant Molecular Biology Manual A5, Kluwer
Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary
approach employs the Agrobacterium delivery system in combination
with vacuum infiltration. The Agrobacterium system is especially
viable in the creation of stably transformed dicotyledenous
plants.
[0108] There are various methods of direct DNA transfer into plant
cells. In electroporation, protoplasts are briefly exposed to a
strong electric field. In microinjection, the DNA is mechanically
injected directly into the cells using very small micropipettes. In
microparticle bombardment, the DNA is adsorbed on microprojectiles
such as magnesium sulfate crystals, tungsten particles or gold
particles, and the microprojectiles are physically accelerated into
cells or plant tissues. Direct DNA transfer can also be utilized to
transiently transform plant cells.
[0109] In any case suitable plant promoters which can be utilized
for plant cell expression of the first and second nucleic acid
sequences, include, but are not limited to CaMV 35S promoter,
ubiquitin promoter, and other strong promoters which can express
the nucleic acid sequences in a constitutive or tissue specific
manner.
[0110] Plant viruses can also be used as transformation vectors.
Viruses that have been shown to be useful for the transformation of
plant cell hosts include CaV, TMV and BV. Transformation of plants
using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV),
EP-A 67,553 (TMV), Japanese Published Application No. 63-14693
(TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al.,
Communications in Molecular Biology: Viral Vectors, Cold Spring
Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus
particles for use in expressing foreign DNA in many hosts,
including plants, is described in WO 87/06261.
[0111] Construction of plant RNA viruses for the introduction and
expression of non-viral exogenous nucleic acid sequences in plants
is demonstrated by the above references as well as by Dawson, W. O.
et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J.
(1987) 6:307-311; French et al. Science (1986) 231:1294-1297; and
Takamatsu et al. FEBS Letters (1990) 269:73-76.
[0112] When the virus is a DNA virus, the constructions can be made
to the virus itself. Alternatively, the virus can first be cloned
into a bacterial plasmid for ease of constructing the desired viral
vector with the nucleic acid sequences described above. The virus
can then be excised from the plasmid. If the virus is a DNA virus,
a bacterial origin of replication can be attached to the viral DNA,
which is then replicated by the bacteria. Transcription and
translation of this DNA will produce the coat protein which will
encapsidate the viral DNA. If the virus is an RNA virus, the virus
is generally cloned as a cDNA and inserted into a plasmid. The
plasmid is then used to make all of the constructions. The RNA
virus is then produced by transcribing the viral sequence of the
plasmid and translation of the viral genes to produce the coat
protein(s) which encapsidate the viral RNA.
[0113] Construction of plant RNA viruses for the introduction and
expression in plants of non-viral exogenous nucleic acid sequences
such as those included in the construct of the present invention is
demonstrated by the above references as well as in U.S. Pat. No.
5,316,931.
[0114] Yeast cells can also be utilized as host cells by the
present invention. Numerous examples of yeast expression vectors
suitable for expression of the nucleic acid sequences of the
present invention in yeast are known in the art and are
commercially available. Such vectors are usually introduced in a
yeast host cell via chemical or electroporation transformation
methods well known in the art. Commercially available systems
include, for example, the pYES.TM. (Invitrogen.TM. Corporation,
Carlsbad Calif., USA) or the YEX.TM. (Clontech.RTM. Laboratories,
Mountain View, Calif. USA) expression systems.
[0115] It will be appreciated that when expressed in eukaryotic
expression systems such as those described above, the nucleic acid
construct preferably includes a signal peptide encoding sequence
such that the polypeptides produced from the first and second
nucleic acid sequences are directed via the attached signal peptide
into secretion pathways. For example, in mammalian, insect and
yeast host cells, the expressed polypeptides can be secreted to the
growth medium, while in plant expression systems the polypeptides
can be secreted into the apoplast, or directed into a subcellular
organelle.
[0116] A bacterial host can be transformed with the nucleic acid
sequence via transformation methods well known in the art,
including for example, chemical transformation (e.g., CaCl.sub.2)
or electroporation.
[0117] Numerous examples of bacterial expression systems which can
be utilized to express the nucleic acid sequences of the present
invention are known in the art. Commercially available bacterial
expression systems include, but are not limited to, the pET.TM.
expression system (Novagen.RTM., EMB Biosciences, San Diego, Calif.
USA), pSE.TM. expression system (Invitrogen.TM. Corporation,
Carlsbad Calif., USA) or the pGEX.TM. expression system (Amersham
Biosciences, Piscataway, N.J. USA).
[0118] As is further described in the Experimental Details section
which follows, bacterial expression is particularly advantageous
since the expressed polypeptides form substantially pure inclusion
bodies readily amenable to recovery and purification of the
expressed polypeptide.
[0119] Thus, this invention provides a preparation of
bacterial-expressed inclusion bodies which are composed of over
30%, preferably over 50%, more preferably over 75%, most preferably
over 90% by weight of the fusion protein or a mixture of fusion
proteins of the present invention. The isolation of such inclusion
bodies and the purification of the fusion protein(s) therefrom are
described in detail in the Experimental Details section which
follows. Bacterial expression of the fusion protein(s) can provide
high quantities of pure and active forms of fusion proteins.
[0120] As is further described in the Experimental Details section
which follows, the expressed fusion proteins form substantially
pure inclusion bodies which are readily isolated via fractionation
techniques well known in the art and purified via for example
denaturing-renaturing steps.
[0121] The fusion proteins of the invention may be renatured and
refolded in the presence of a MHC-restricted peptide, which is
either linked to, co-expressed with or mixed with other
polypeptides of the invention and being capable of binding the
single chain MHC class I polypeptide. As is further described in
the examples section, this enables to generate a substantially pure
MHC class I-antigenic peptide complex which can further be purified
via size exclusion chromatography.
[0122] It will be appreciated that the CMV peptide used for
refolding can be co-expressed along with (as an independent
peptide) or be fused to the scHLA-A2 chain of the MHC Class I
molecule in the bacteria. In such a case the expressed fusion
protein and peptide co-form inclusion bodies which can be isolated
and utilized for MHC class I-antigenic peptide complex
formation.
[0123] The following section provides specific examples for each of
the various aspects of the invention described herein. These
examples should not be regarded as limiting in any way, as the
invention can be practiced in similar, yet somewhat different ways.
These examples, however, teach one of ordinary skills in the art
how to practice various alternatives and embodiments of the
invention.
[0124] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological and recombinant DNA techniques. Such
techniques are thoroughly explained in the literature. See, for
example, "Molecular Cloning: A laboratory Manual" Sambrook et al.,
(1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in
Molecular Biology", John Wiley and Sons, Baltimore, Md. (1989);
Perbal, "A Practical Guide to Molecular Cloning", John Wiley &
Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A
Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory
Press, New York (1998); methodologies as set forth in U.S. Pat.
Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057;
"Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E.,
ed. (1994); "Culture of Animal Cells--A Manual of Basic Technique"
by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current
Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994);
Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition),
Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi
(eds), "Selected Methods in Cellular Immunology", W. H. Freeman and
Co., New York (1980); available immunoassays are extensively
described in the patent and scientific literature, see, for
example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578;
3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533;
3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and
5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984);
"Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds.
(1985); "Transcription and Translation" Hames, B. D., and Higgins
S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed.
(1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A
Practical Guide to Molecular Cloning" Perbal, B., (1984) and
"Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols:
A Guide To Methods And Applications", Academic Press, San Diego,
Calif. (1990); Marshak et al., "Strategies for Protein Purification
and Characterization--A Laboratory Course Manual" CSHL Press
(1996); all of which are incorporated by reference as if fully set
forth herein. Other general references are provided throughout this
document. The procedures therein are believed to be well known in
the art and are provided for the convenience of the reader. All the
information contained therein is incorporated herein by
reference.
EXPERIMENTAL DETAILS
Materials and Methods
[0125] Cloning of Compound A
[0126] The scHLA-A2/SS1 (scFv) was constructed as previously
described by linking the C-terminus of scHLA-A2 to the N-terminus
of the SS1 scFv via a short linker ASGG (SEQ ID NO:4) (15). To
construct the scHLA-A2/SS1 (scFv) with covalently bound
MHC-restricted peptide, the MHC-restricted peptide was fused with
the peptide linker GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:6) to the
N-terminus of the scHLA-A2/SS1 (scFv) molecule by a PCR overlap
extension reaction with the primers:
5'M1-5'GGAAGCGTTGGCGCATATGGGCATTCTGGGCTTCGTGTTTACC
CTGGGCGGAGGAGGATCCGGTGGCGGAGGTTCAGGAGGCGGTGGATCGA
TCCAGCGTACTCCAAAG3'(SEQ ID NO: 13) and
3'VLscSS1-5'GCAGTAAGGAATTCTCATTATTTTATTTCCAACTTTGT3'(SEQ ID NO:
14). In the 5'M1 primer a silence mutation was inserted at the
linker sequence, this change in sequence creates a BamH1
restriction site.
[0127] The PCR products were sub-cloned to TA cloning vector
(pGEM-T Easy Vector, Promega.TM. Corporation, Madison, Wis. USA)
and subsequently to a T7 promoter-based expression vector (PRB)
using the NdeI and EcoRI restriction sites.
[0128] To generate Compound A, M1/scHLA-A2/SS1 (scFv) was used as a
template for ligation with dsDNA primer. The M1/scHLA-A2/SS1 (scFv)
(in PRB plasmid) was digested with NdeI and BamHI, and the plasmid
fraction was ligated to dsDNA primer containing the CMV peptide
sequence and the extension of the linker sequence 5'CMVcovLL
(cassette):5'TATGAACCTGGTGCCGATGGTCGCGACCGT
TGGAGGTGGCGGTTCTGGCGGAGGAG-3' (SEQ ID NO: 15) and 3'CMVcovLL
(cassette):5'GATC
CTCCTCCGCCAGAACCGCCACCTCCAACGGTCGCGACCATCGGCACCAGGTTCA3'(SEQ ID
NO:16). The annealing of the primers (5'CMVcovLL (cassette) and
3'CMVcovLL (cassette)) was performed by incubating the primers at
95.degree. C. for 2 min followed by 1 h incubation at room
temperature. The ligation product was transformed to E-coli
DH5.alpha. for plasmid amplification. Plasmid was purified by
QIAGEN.RTM. Miniprep.TM., DNA isolation kit (Qiagen.RTM., Inc.,
Valencia, Calif. USA) and samples were set for sequence
analysis.
[0129] Expression refolding and purification of Compound A Compound
A was expressed in E-coli LB21 (ADE3) cells (Novagen.RTM., Madison,
Wis. USA) as inclusion bodies. Compound A construct was transformed
to E-coli cells by heat shock, cells were plated on LBAMP plates
and incubated over night at 37.degree. C. Colonies were transferred
to rich medium (super broth) supplemented with glucose, MgSO.sub.4,
AMP and salts. The cells were grown to DO=2 (600 nm) at 37.degree.
C., induced with IPTG (final concentration 1 mM) and incubated for
an additional 3 h at 37.degree. C.
[0130] Inclusion bodies were purified from cell pellet by cell
disruption with 0.2 mg/ml of lysozyme followed by the addition of
2.5% Triton.RTM. X-100 (Octylphenolpoly[ethyleneglycolether].sub.x,
Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany)
and 0.5M NaCl. The pellets of the inclusion bodies were collected
by centrifugation (13,000 rpm, 60 min at 4.degree. C.) and washed
three times with 50 mM Tris buffer pH 7.4 containing 20 mM EDTA.
The isolated and purified inclusion bodies were solubilized in 6M
Guanidine HCl pH 7.4, followed by reduction with 65-mM DTE.
Solubilized and reduced inclusion bodies were refolded by a 1:100
dilution into a redox-shuffling buffer system containing 0.1-M
Tris, 0.001M EDTA, 0.5-M Arginine, and 0.09-mM Oxidized
Glutathione, pH 9, and incubation at 10.degree. C. for 24 h. After
having been refolded, the protein was dialyzed against 150-mM Urea,
20-mM Tris, pH 8, followed by purification of the soluble Compound
A by ionexchange chromatography on a Q-Sepharose.RTM. column (7.5
mm I.D 60 cm) (Sigma-Aldrich, Inc., St. Louis, Mo. USA), applying a
salt (NaCl) gradient. Peak fractions containing Compound A were
then subjected to buffer exchange with PBS.
[0131] Cloning of Compound B
[0132] The scHLA-A2/SS1 (scFv) was constructed as previously
described by linking the C-terminus of scHLA-A2 to the N-terminus
of the SS1 scFv via a short linker ASGG (SEQ ID NO:15). To
construct the scHLA-A2/SS1 (scFv) with covalently bound
MHC-restricted peptide, the MHC-restricted peptide and the peptide
linker GGGGSGGGGSGGGGS (SEQ ID NO:8) were fused to the N-terminus
of the scHLA-A2/SS1(scFv) molecule by a PCR overlap extension
reaction with the primers
5'-Nde-209B2M:5'GGAAGCGTTGGCGCATATGATCATGGACCAGGTT
CCGTTCTCTGTTGGCGAGGAGGGTCCGGTGGCGGAGGTTCAGGAGGCGGTG
GATCGATCCAGCGTACTCCAAAG3'(SEQ ID NO: 17) And the
3'VLscSS1-5'GCAGTAAGG AATTCTCAT TATTTTATTTCCAACTTTGT3'(SEQ ID
NO:18). 209cov/scHLA-A2/SS1 (scFv) molecule was used as a template
for the construction of Compound B. In this molecule the CMV
peptide NLVPMVATV (SEQ ID NO: 4) was introduced into the
209cov/scHLA-A2/SS1 (scFv) sequence (exchanging the 209 peptide) by
PCR reaction using the primers 5'GGAAGCGTTGGCGCATATGG
GCATTCTGGGCTTCGTGTTTACCCTGGGCGAGGAGGATCCGGTGGCGGAGGTTCAGGAGGCGGTGGA
TCGATCCAGCGTACTCCAAAG3'(SEQ ID NO: 17) and the
3'VLscSS15'GCAGTAAGGAATTCTCATTATTTTAT TTCCAACTTTGT3'(SEQ ID NO:
18).
[0133] The expression and purification protocols of Compound B were
identical to the expression and purification protocols of Compound
A.
[0134] All the methods used to analyze the biochemical and
biological properties of Compound B were identical to the methods
used to analyze the activity of Compound A.
[0135] Construction of M1-COV/scHLA-A2/SS1 (scFv)
[0136] To construct the M1-cov/scHLA-A2/SS1 (scFv) fusion protein
the M1 58-66 peptide was fused to the N-terminus of scHLA-A2/SS1
(scFv) fusion protein through a short 15 amino acid linker by
overlapping PCR reaction with the 5'M1-linker primer:
5'GGAAGCGTTGGCGCATATGGGCATTCTGGGCTTCGTGTTTACCCTGGGCGG
AGGAGGATCCGGTGGCGGAGGTTCAGGAGGCGGTGGATCGATCCAGCGTACTCCAAAG3'(SEQ ID
NO: 13) and the 3'VLscSS1-5'GCAGTAAGGAATTCTCAT
TATTTTATTTCCAACTTTGT3'(SEQ ID NO: 14). PRB plasmid was used as a
template containing the scHLA-A2/SS1 (scFv) sequence. The
expression and purification protocols of the M1-cov/scHLA-A2/SS1
(scFv) fusion protein were identical to the expression and
purification protocols of Compound A. All the methods used to
analyse the biochemical and biological properties of the
M1-cov/scHLA-A2/SS1 (scFv) fusion protein were identical to the
methods used to analyse the activity of Compound A.
[0137] Flow Cytometry
[0138] Cells were incubated with Compound A (60 min at 4.degree. C.
in 100 .mu.l, 10 .mu.g/ml), washed and incubated with the
anti-HLA-A2 MAb BB7.2 (60 min at 4.degree. C., 10 .mu.l/ml). The
cells were washed and incubated with anti-mouse FITC (60 min at
4.degree. C., 10 .mu.l/ml) that served as a secondary antibody. The
cells were subsequently washed and analyzed by a FACS caliber flow
cytometer (Becton-Dickinson, San Jose, Calif. USA).
[0139] Enzyme Linked Immunosorbent Assay
[0140] Immunoplates (Falcon.RTM., Becton-Dickinson Labware,
Franklin Lakes, N.J. USA) were coated with 10 .mu.g/ml of purified
bacterially produced recombinant mesothelin (O/N at 4.degree. C.).
The plates were blocked with PBS containing 2% skim milk and then
incubated with various concentrations of Compound A (60 min at RT)
and washed three times with PBS. Binding was detected using the
anti-HLA-conformational-dependent antibody W6/32 (60 min, RT, 1
.mu.g/ml), plates were washed three times with PBS and incubated
with anti-mouse IgG-peroxidase (60 min, RT, 1 .mu.g/ml). The
reaction was developed using TMB (DAKO) and terminated by the
addition of 50 .mu.l H.sub.2SO.sub.4 2 N. Anti-mesothelin antibody
(K1) was used as a positive control. The immunoplates were analyzed
by ELISA reader using 450 nm filter (Anthos 2001.TM., Anthos
Labtech, Salzburg, Austria).
[0141] Cytotoxicity Assays
[0142] Cytotoxicity was determined by S.sup.35-methionine release
assays. Target cells were cultured in culture plates in RPMI 10%
FCS Methionine free for 2 h, followed by incubation overnight with
15 .mu.Ci/ml of S.sup.35methionine (NEN). The target cells were
harvested by trypsinization and washed twice with 40 ml RPMI 10%
FCS. The target cells were plated in 96-well plates (5.10.sup.3
cells per well) in RMPI+10% FCS and incubated overnight at
37.degree. C., 5% CO.sub.2. Target cells were incubated with
different concentrations of Compound A fusion proteins for 2 h,
effector CTL cells were added at different target: effector ratios
and the plates were incubated for 8-12 h at 37.degree. C., 5%
CO.sub.2. Following incubation, S.sup.35-methionine release from
target cells was measured in a 25 .mu.l sample of the culture
supernatant. All assays were performed in triplicate, lysis was
calculated directly: ([experimental release-spontaneous
release]/[maximum release-spontaneous release])-100. Spontaneous
release was measured as S.sup.35 methionine released from target
cells in the absence of effector cells, and maximum release was
measured as S.sup.35-methionine released from target cells lyzed by
0.05M NaOH.
[0143] Cell Lines
[0144] A431 and A431K5 cells (epidermoid carcinoma) were maintained
in RPMI medium containing 10% FCS, L-glutamine and
penicillin/streptomycin. The A431K5 cell line is a human epidermoid
carcinoma A431 cell line stably transfected with Mesothelin, the
transfected cells were maintained with 700 .mu.g/ml G418
(Gibco-BRL.RTM., Invitrogen.TM. Inc., Carlsbad, Calif. USA).
[0145] CTL's with specificity for CMV pp65 epitope (NLVPMVATV (SEQ
ID NO:4)) were kindly provided by Dr Ditmar Zehn (Charitee,
Berlin). The CTL's were expanded by incubation with peptide pulsed,
radiated (4000rad) PBMC's from a healthy HLA-A2 positive donor and
were maintained in AIMV medium+8.9% FCS+50 .mu.M-2-mercaptoethanol+
penicillin/streptomycin 1.10.sup.5 U/L.
[0146] Results:
[0147] Construction of Compound A
[0148] A construct encoding a single-chain MHC molecule composed of
the .beta.2 microglobulin gene fused to the .alpha.1, .alpha.2 and
.alpha.3 of the HLA-A2 gene via a short peptide linker (15 amino
acids) was fused to the scFv SS1 which targets mesothelin (FIG.
1A). This construct was analyzed in detail for its biochemical and
biological activity and was found to be functional in-vitro and
in-vivo (15). To construct a fusion protein with covalently linked
peptide a 9 amino acids peptide derived from the CMV pp65 protein
(NLVPMVATV) (SEQ ID NO:4) was fused to the N-terminus of the
scHLA-A2/SS1(scFv) fusion protein via 20 amino acids linker
GGGGSGGGGSGGGGSGGGGS (SEQ ID NO:6) (FIG. 1B). Compound A was
constructed in two steps: First a covalent fusion protein termed
M1/scHLA-A2/SS1(scFv) was constructed by overlap extension PCR. In
this construct the influenza M158-66 peptide GILGFVFTL (SEQ ID
NO:21) and a 15 amino acid linker were fused to the N-terminus of
the scHLA-A2/SS1 (scFv) fusion protein. In this construct, a new,
unique restriction site (BamHI) was inserted to the linker sequence
by a silent mutation. In the second step PRB plasmid containing the
M1/scHLA-A2/SS1 (scFv) full sequence was digested with NdeI and
BamHI restriction enzymes. This digestion produced two fragments.
One fragment contains the peptide and part of the linker sequence,
and the second fragment contains the plasmid, part of the linker
and the scHLA-A2/SS1 (scFv) sequence. The fragment which contains
the plasmid, part of the linker and the scHLA-A2/SS1 (scFv)
sequence was then ligated to dsDNA primer that codes the CMV pp65
peptide sequence and an extension of the linker sequence (FIG. 1B).
The new plasmid was transformed to E-coli DH5.alpha. cells and
positive colonies were sent to DNA sequencing (FIG. 2).
[0149] Expression and Purification of Compound A
[0150] Compound A was expressed in E. coli BL21 cells and, upon
induction with isopropyl .beta.-D-thiogalactoside, large amounts of
recombinant protein accumulated in intracellular inclusion bodies.
SDS/PAGE analysis of isolated and purified inclusion bodies
revealed that Compound A with the correct size constituted 80-90%
of the total inclusion bodies mass (FIG. 3A). The isolated
solubilized inclusion bodies were reduced and refolded in-vitro in
a redox-shuffling buffer. Monomeric soluble fusion proteins
(Compound A) were purified by ion-exchange chromatography on
Q-Sepharose.RTM.. SDS/PAGE analysis of Compound A revealed a highly
purified monomeric molecule with the expected size of 72 KDa (FIG.
3B).
[0151] Biological Activity of the Compound A
[0152] ELISA
[0153] To test the binding ability of purified Compound A to its
target antigen, the recombinant mesothelin was immobilized to
immunoplates. The binding of Compound A was monitored by using
conformation sensitive mAb W6/32, this antibody recognizes MHC
molecules that are folded correctly with a peptide in its groove.
As shown in FIG. 4, the binding of Compound A to recombinant
mesothelin was dose-dependent. This suggests that the two
functional domains of Compound A, the scFv (SS1) domain and the
peptide/scHLA-A2 domain are folded correctly. Moreover, the scFv
(SS1) domain of the fusion protein is in active form and can
specifically bind mesothelin.
[0154] Flow Cytometry Analysis (FACS)
[0155] To test the binding ability of Compound A to
mesothelin-expressing cell lines, FACS analysis was made. As a
model, target cells that are HLA-A2 negative were used, thus the
reactivity of an anti-HLA-A2 mAb can be used to measure the binding
of Compound A to cells that express mesothelin on their surface.
This model of mesothelin-positive, HLA-A2-negative cells represents
the extreme case in which the tumor cells lose its HLA expression.
Therefore for the FACS analysis, HLA-A2 negative A431K5 cells were
used, which are human epidermoid carcinoma A431 cells that were
stably transfected with mesothelin. The parental A431 human
epidermoid carcinoma cells which are mesothelin-negative and
HLA-A2-negative are used as negative control. The binding of
Compound A to the target cells was monitored with anti-HLA-A2 mAb
BB7.2 as primary antibody followed by a FITC labeled secondary
antibody. A mesothelin anti-mAb K1 was used to test the expression
levels of mesothelin. As shown in FIG. 5A, A431K5 cells express
high levels of mesothelin, whereas the parental A431 cells do not
express the target antigen. The cell lines A431 and A431K5 were
also tested for the expression of HLA-A2 using HLA-A2 specific
antibody (BB7.2), both cell lines were HLA-A2 negative. However,
when A431K5 cells were pre-incubated with Compound A, they were
positively stained with the HLA-A2 specific antibody BB7.2 (FIG.
5B). Antigen-negative A413 cells were not affected. The specific
binding of Compound A to A431K5 but not to A431 cells further
indicates that the binding is exclusively depended on the
interaction of the targeting scFv domain of the fusion with
mesothelin and that the fusion protein can bind its target antigen
as natively expressed on the surface of cells.
[0156] Cytotoxicity Assay
[0157] To test the ability of Compound A to mediate the killing of
HLA-A2-negative mesothelin-positive cells by HLA-A2-restricted CMV
pp65 NLVPMVATV (SEQ ID NO:4) specific CTLs, S.sup.35-Methionine
release assay was performed using HLA-A2-negative
mesothelin-transfected A431K5 cells, and the HLA-A2-negative
mesothelin-negative A431 parental cells. To determine the killing
potential of the CMV specific CTLs, cytotoxicity assay was
performed using HLA-A2-positive JY cells that were radiolabeled
with MetS.sup.35 and laded with the CMV peptide NLVPMVATV (SEQ ID
NO:4). The average specific killing of the JY cells by the CMV
specific CTLs was 47% with an E:T ratio of 10:1 (data not shown).
As shown in FIG. 6a, Compound A effectively mediated the killing of
the A431K5 cells (mesothelin-positive HLA-A2-negative). Specific
killing could reach 66% in comparison to peptide-loaded JY cells.
Thus, killing with the fusion protein was even more efficient
compared to peptide-pulsed antigen presenting cells which represent
optimal targets. However, when the target A431K5 cells were
incubated with the CMV specific CTLs alone without preincubation
with Compound A or when the target cells were A431
mesothelin-negative cells with or without preincubation with
Compound A, no cytotoxic activity was observed. Next, a titration
experiment was performed to determine the potency of Compound A, as
shown in FIG. 6b, the killing of mesothelin-positive A431K5 cells
was dose-dependent with an IC50 of 0.5-1 .mu.g/ml.
[0158] These results indicate that the killing of
mesothelin-positive HLA-A2-negative A431K5 cell was specific and
controlled by the recognition of mesothelin by the targeting domain
of Compound A (scFv/SS1) and the specificity of the CMV CTLs to the
peptide/scHLA-A2 domain.
[0159] Biological Activity of Compound B
[0160] Flow Cytometry Analysis (FACS)
[0161] To test the binding ability of Compound B to
mesothelin-expressing cell lines a flow cytometry analysis was
used. As a model, target cells that are HLA-A2 negative were used,
thus, the reactivity of the anti-HLA-A2 mAb will indicate the
binding of Compound B to the cell surface antigen. A431K5 cells
which are human epidermoid carcinoma A431 cells that were stably
transfected with mesothelin and are HLA-A2 negative. As controls
the parental A431 human epidermoid carcinoma cells were used which
are mesothelin-negative and HLA-A2 negative. The binding of
Compound B to the target cells was monitored by anti-HLA-A2 mAb
BB7.2 as primary antibody followed by a FITC labeled secondary
antibody. To test the expression levels of mesothelin and as
positive control a commercial anti-mesothelin mAb K1 was used. As
shown in FIG. 10A-B A431K5 cells express high levels of mesothelin,
whereas the parental A431 cells do not express mesothelin. The cell
lines A431 and A431K5 were also tested for their expression of
HLA-A2 using HLA-A2 specific anti body (BB7.2), both cell lines
were HLA-A2 negative. However, when A431K5 cells were pre-incubated
with Compound B, they were positively stained with the HLA-A2
specific antibody BB7.2 whereas control A431 cells were not stained
(FIG. 10 C-D). The specific binding of Compound B to A431K5 cells
but not to A431 cells indicate that binding is exclusively depended
on the interaction of the targeting scFv domain with
mesothelin.
[0162] To analyze the binding of Compound B in comparison to the
Compound A fusion, a FACS analysis was performed using both
molecules in similar conditions and concentrations. As shown in
FIGS. 10E-F only the mesothelin-positive cells A431K5 were
positively stained with HLA-A2-specific Ab when pre-incubated with
both fusion proteins, however, Compound A exhibited better
binding.
[0163] Cytotoxicity Assay
[0164] To test the ability of Compound B to mediate the killing of
HLA-A2-negative mesothelin-positive cells by HLA-A2-restricted CMV
NLVPMVATV (SEQ ID NO:4) specific CTLs, performed
S.sup.35-Methionine release assay using HLA-A2-negative
mesothelin-transfected A431K5 cells was performed, and the
HLA-A2-negative mesothelin-negative A431 parental cells. To
determine the killing potential of the CMV-specific CTLs
cytotoxicity assay was performed, using HLA-A2-positive JY cells
that were radiolabeled with MetS.sup.35 and laded with the CMV
peptide NLVPMVATV (SEQ ID NO: 4). The average specific killing of
the JY cells by the CMV-specific CTLs was around 45-50% using an
E:T ratio of 10:1 (data not shown). As shown in FIG. 11A, Compound
B effectively mediated the killing of the A431K5 cells
(mesothelin-positive HLA-A2-negative), this specific killing was
66% in comparison with peptide-loaded JY cells (.about.150%
compared to JY cells). However, when the target A431K5 cells were
incubated with the CMV-specific CTLs alone without preincubation
with Compound B or when the target cells were mesothelin-negative
(A431 cells), with or without preincubation with Compound B, no
cytotoxic activity was observed. Titration experiments which
determined the potency of the fusion protein, shown in FIG. 11B
indicate that the killing of mesothelin-positive A431K5 cells was
dose-dependent. To compare the cytotoxic activity of Compound B and
Compound A fusion proteins, which differ in the length of peptide
used to covalently attach the antigenic peptide to the .beta.-2
microglobulin, a S.sup.35-Methionine release assay was performed
using similar conditions for both fusion proteins. As shown in FIG.
12, both molecules efficiently and specifically mediated the
killing of A431K5 cells, but not A431 cells. When relatively high
concentrations of fusion proteins (Compound B and Compound A) were
used, the killing activity of both molecules was similar. However,
when low concentrations of fusion proteins were used the cytotoxic
activity of Compound A was superior probably due to better
stability and positioning of the CMV peptide in the MHC
peptide-binding groove due to the longer linker.
[0165] M1-COV/scHLA-A2/SS1
[0166] The M1-cov/scHLA-A2/SS1 (scFv) fusion protein was
constructed by overlap extension PCR reaction in which the
Influenza M1 58-66 peptide and a 15 amino acid linker
GGGGSGGGGSGGGGS were fused to the N-terminus of the
scHLA-A2/SS1(scFv) fusion protein (FIG. 13). The PCR product was
ligated to TA-cloning vector (p-GEM, Promega), transformed to
E-coli DH5.alpha. cells. Positive colonies were selected and the
insert was isolated using EcoRI and NdeI. The insert was ligated to
PRB expression vector and transformed to E-coli DH5.alpha. cells.
Positive colonies were sent to DNA sequencing (FIG. 14).
[0167] Expression and Purification of Compound B
[0168] The M1-cov/scHLA-A2/SS1 (scFv) fusion protein was expressed
in E. coli BL21 cells and, upon induction with isopropyl
.beta.-D-thiogalactoside, large amounts of recombinant protein
accumulated in intracellular inclusion bodies. SDS/PAGE analysis of
isolated and purified inclusion bodies revealed that the
M1-cov/scHLA-A2/SS1 (scFv) fusion protein with the correct size
constituted 80-90% of the total inclusion bodies mass (FIG. 15A).
The isolated solubilized inclusion bodies were reduced and refolded
in vitro in a redox-shuffling buffer. Monomeric soluble fusion
proteins (M1-cov/scHLA-A2/SS1 (scFv)) were purified by ion-exchange
chromatography on Q-sheparose.RTM.. SDS/PAGE analysis of the
M1-cov/scHLA-A2/SS1 (scFv) fusion proteins revealed a highly
purified monomeric molecule with the expected size of 72 KDa (FIG.
15B).
[0169] ELISA
[0170] To test the binding ability of the purified
M1-cov/scHLA-A2/SS1 (scFv) fusion protein to it target antigen,
recombinant mesothelin was immobilized to immunoplates. The binding
of M1-cov/scHLA-A2/SS1 (scFv) fusion protein was monitored by using
conformation sensitive mAb W6/32, this anti body recognizes MHC
molecules that are folded correctly with a peptide in its groove.
As shown in FIG. 16 the binding of the M1-cov/scHLA-A2/SS1 (scFv)
fusion protein to recombinant mesothelin was dose-dependent. This
suggests that the two functional domains of M1-cov/scHLA-A2/SS1
(scFv) fusion protein, the scFv (SS1) domain and the
M1-cov/scHLA-A2 domain are folded correctly. Moreover, the scFv
(SS1) domain of the fusion protein is in active form and can
specifically bind mesothelin.
[0171] Flow Cytometry Analysis (FACS)
[0172] To test the binding ability of the M1-cov/scHLA-A2/SS1
(scFv) fusion protein to mesothelin-expressing cell lines, FACS
analysis was used. As a model, target cells that are
HLA-A2-negative were used, and the anti-HLA-A2 mAb can be used to
monitor the binding of the M1-cov/scHLA-A2/SS1 (scFv) fusion
protein to the cell surface antigen. For the FACS analysis, the
mesothelin-transfected A431K5 cells were used. The binding of the
M1-cov/scHLA-A2/SS1 (scFv) fusion protein to the target cells was
monitored by anti-HLA-A2 mAb BB7.2 as primary antibody followed by
a FITC-labeled secondary antibody. To test the expression levels of
mesothelin and as positive control, a commercial anti mesothelin
mAb K1 was used. As shown in FIG. 17A-B, A431K5 cells express high
levels of mesothelin, whereas the parental A431 cells do not
express mesothelin. The cell lines A431 and A431K5 were also tested
for their expression of HLA-A2 using HLA-A2 specific antibody
(BB7.2), both cell lines were HLA-A2-negative. However, when A431K5
cells but not A431 cells were pre-incubated with the
M1-cov/scHLA-A2/SS1(scFv) fusion proteins, they were positively
stained with the HLA-A2-specific antibody BB7.2 (FIG. 17C-D). This
specific binding of the M1-cov/scHLA-A2/SS1(scFv) fusion protein to
A431K5 cells and not to A431 cells indicates that the binding is
exclusively dependent on the interaction of the targeting domain
(scFv(SS1)) with mesothelin.
[0173] Cytotoxicity Assay
[0174] To test the ability of the M1-cov/scHLA-A2/SS1 (scFv) fusion
protein to mediate the killing of HLA-A2-negative
mesothelin-positive cells by HLA-A2-restrictive M158-66 specific
CTLs, S.sup.35-Methionine release assay using HLA-A2-negative
mesothelin-transfected A431K5 cells was performed. As shown in FIG.
18, M1-cov/scHLA-A2/SS1 (scFv) fusion protein did not mediate the
lysis of A431K5 cells (mesothelin-positive HLA-A2-negative).
However, the scHLA-A2/SS1(scFv) bearing the M158-66 peptide in its
groove mediated the killing of mesothelin-positive target cells by
the HLA-A2-restricted M158-66 specific CTLs.
Discussion:
[0175] This study demonstrates the ability to target covalently
linked peptide/scMHC/scFv fusion protein to tumor cells can render
HLA-A2-negative cells susceptible to lysis by the relevant
HLA-A2-restricted CTLs. As previously shown by Lev et al., and Oved
et al. (15,21), this strategy has two major advantages. First, it
takes advantage of the use of recombinant Ab fragments that can
localize on those malignant cells that express a tumor marker,
usually associated with the transformed phenotype (such as growth
factor receptors and/or differentiation antigens), with a
relatively high degree of specificity. Second, this strategy has
the ability to recruit a particular population of highly reactive
cytotoxic T-cells specific to a preselected, highly antigenic
peptide epitope present in the targeted MHC-peptide complex, such
as viral-specific T-cell epitopes. This platform approach generates
multiple molecules with many tumor-specific scFv fragments that
target various tumor specific antigens, combined with the ability
to target many types of MHC-peptide complexes carrying single,
preselected, and highly antigenic peptides derived from tumor,
viral, or bacterial T-cell epitopes. These examples present a
strategy one step farther by fusing the 9 amino acid peptide linked
by a short linker (20AA) to the previously reported scHLA-A2/scFv
fusion protein (15AA), and by doing so, stabilizing the peptide in
the MHC groove prolonging the general stability of the fusion
proteins. As a model for this new generation of fusion proteins,
the present invention relates to construction of a fusion protein
in which the CMV pp65 derived (NLVPMVATV) fused to the N-terminus
of the scHLA-A2/SS1 (scFv) molecule and its biochemical and
biological characteristics. It is shown that the two domains of the
new fusion protein can refold in vitro to form correctly folded
molecules with the peptide within the HLA-A2 groove and an active
targeting domain (scFv) that can specifically bind its target
antigen. Moreover, this fusion protein had successfully mediated
the lysis of HLA-A2-negative mesothelin-positive tumor cells by
HLA-A2-restricted CTLs.
[0176] Tumor progression is often associated with the secretion of
immune-suppressive factors and/or the down-regulation of MHC class
I antigen-presentation functions (2). Even when a specific CTL
response is demonstrated in patients, this response is low because
the anti-tumor CTL population is rare, very infrequent, and in some
cases the CLTs are not functional or anergic (26). Moreover, it is
well-established that the number of MHC-peptide complexes on the
surface of tumor cells that present a particular tumor-associated
peptide is low (27). As shown herein, the new strategy overcame
these problems. First, the tumor cells are coated with MHC-peptide
complexes independent of their endogenous MHC expression. Second,
the use of tumor specific antigens that are usually part of the
tumor phenotype (such as growth factor receptors and
differentiation antigens) prevent the down regulation of those
antigens and prolong the efficiency of the treatment. Third and
most important, the effector domain of the fusion protein the
MHC-peptide complex can recruit specific populations of CTLs
depending on the peptide harboring the MHC groove.
[0177] It is appreciated that certain features of the invention,
which are, for clarity, described in the context of separate
embodiments, may also be provided in combination in a single
embodiment. Conversely, various features of the invention, which
are, for brevity, described in the context of a single embodiment,
may also be provided separately or in any suitable subcombination.
Although the invention has been described in conjunction with
specific embodiments thereof, it is evident that many alternatives,
modifications and variations will be apparent to those skilled in
the art. Accordingly, it is intended to embrace all such
alternatives, modifications and variations that fall within the
spirit and broad scope of the claims. All publications, patents and
patent applications mentioned in this specification are herein
incorporated in their entirety by reference into the specification,
to the same extent as if each individual publication, patent or
patent application was specifically and individually indicated to
be incorporated herein by reference. In addition, citation or
identification of any reference in this application shall not be
construed as an admission that such reference is available as prior
art to the present invention.
REFERENCES CITED
[0178] 1. Gilboa, E. How tumors escape immune destruction and what
we can do about it. Cancer Immunol. Immunother. 48, 382-385 (1999).
[0179] 2. Seliger, B., Maeurer, M. J., & Ferrone, S.
Antigen-processing machinery breakdown and tumor growth. Immunol.
Today 21, 455-464 (2000). [0180] 3. Garcia-Lora, A., Algarra, I.,
& Garrido, F. MHC class I antigens, immune surveillance, and
tumor immune escape. J. Cell Physiol 195, 346-355 (2003). [0181] 4.
Garrido, F. & Algarra, I. MHC antigens and tumor escape from
immune surveillance. Adv. Cancer Res. 83, 117-158 (2001). [0182] 5.
McLaughlin, P. et al. Rituximab chimeric anti-CD20 monoclonal
antibody therapy for relapsed indolent lymphoma: half of patients
respond to a four-dose treatment program. J. Clin. Oncol. 16,
2825-2833 (1998). [0183] 6. Cobleigh, M. A. et al. Multinational
study of the efficacy and safety of humanized anti-HER2 monoclonal
antibody in women who have HER2-overexpressing metastatic breast
cancer that has progressed after chemotherapy for metastatic
disease. J. Clin. Oncol. 17, 2639-2648 (1999). [0184] 7. Pastan, I.
& Kreitman, R. J. Immunotoxins in cancer therapy. Curr. Opin.
Investig. Drugs 3, 1089-1091 (2002). [0185] 8. Boon, T. & van
der, B. P. Human tumor antigens recognized by T-lymphocytes. J.
Exp. Med. 183, 725-729 (1996). [0186] 9. Esche, C., Shurin, M. R.,
& Lotze, M. T. The use of dendritic cells for cancer
vaccination. Curr. Opin. Mol. Ther. 1, 72-81 (1999). [0187] 10.
Offringa, R., van der Burg, S. H., Ossendorp, F., Toes, R. E.,
& Melief, C. J. Design and evaluation of antigen-specific
vaccination strategies against cancer. Curr. Opin. Immunol. 12,
576-582 (2000). [0188] 11. Wang, E., Phan, G. Q., & Marincola,
F. M. T-cell-directed cancer vaccines: the melanoma model. Expert.
Opin. Biol. Ther. 1, 277-290 (2001). [0189] 12. Dudley, M. E. et
al. Cancer regression and autoimmunity in patients after clonal
repopulation with antitumor lymphocytes. Science 298, 850-854
(2002). [0190] 13. Dudley, M. E. & Rosenberg, S. A.
Adoptive-cell-transfer therapy for the treatment of patients with
cancer. Nat. Rev. Cancer 3, 666-675 (2003). [0191] 14. Rosenberg,
S. A. Progress in human tumour immunology and immunotherapy. Nature
411, 380-384 (2001). [0192] 15. Lev, A. et al. Tumor-specific
Ab-mediated targeting of MHC-peptide complexes induces regression
of human tumor xenografts in vivo. Proc. Natl. Acad. Sci. U.S.A
101, 9051-9056 (2004). [0193] 16. Donda, A. et al. In vivo
targeting of an anti-tumor antibody coupled to antigenic MHC class
I complexes induces specific growth inhibition and regression of
established syngeneic tumor grafts. Cancer Immun. 3, 11 (2003).
[0194] 17. Ogg, G. S. et al. Sensitization of tumour cells to lysis
by virus-specific CTL using antibody-targeted MHC class I/peptide
complexes. Br. J. Cancer 82, 1058-1062 (2000). [0195] 18. Robert,
B., Guillaume, P., Luescher, I., Romero, P., & Mach, J. P.
Antibody-conjugated MHC class I tetramers can target tumor cells
for specific lysis by T-lymphocytes. Eur. J. Immunol. 30, 3165-3170
(2000). [0196] 19. Robert, B. et al. Redirecting anti-viral CTL
against cancer cells by surface targeting of monomeric MHC class
I-viral peptide conjugated to antibody fragments. Cancer Immun. 1,
2 (2001). [0197] 20. Savage, P. et al. Anti-viral cytotoxic T-cells
inhibit the growth of cancer cells with antibody targeted HLA class
I/peptide complexes in SCID mice. Int. J. Cancer 98, 561-566
(2002). [0198] 21. Oved, K., Lev, A., Noy, R., Segal, D., &
Reiter, Y. Antibody-mediated targeting of human single-chain class
I MHC with covalently linked peptides induces efficient killing of
tumor cells by tumor or viral-specific cytotoxic T-lymphocytes.
Cancer Immunol. Immunother. 54, 867-879 (2005). [0199] 22. Chang,
K. & Pastan, I. Molecular cloning and expression of a cDNA
encoding a protein detected by the K1 antibody from an ovarian
carcinoma (OVCAR-3) cell line. Int. J. Cancer 57, 90-97 (1994).
[0200] 23. Chang, K. & Pastan, I. Molecular cloning of
mesothelin, a differentiation antigen present on mesothelium,
mesotheliomas, and ovarian cancers. Proc. Natl. Acad. Sci. U.S.A
93, 136-140 (1996). [0201] 24. Chang, K. & Pastan, I. Molecular
cloning of mesothelin, a differentiation antigen present on
mesothelium, mesotheliomas, and ovarian cancers. Proc. Natl. Acad.
Sci. U.S.A 93, 136-140 (1996). [0202] 25. Hassan, R., Bera, T.,
& Pastan, I. Mesothelin: a new target for immunotherapy. Clin.
Cancer Res. 10, 3937-3942 (2004). [0203] 26. Lee, P. P. et al.
Characterization of circulating T-cells specific for
tumor-associated antigens in melanoma patients. Nat. Med. 5,
677-685 (1999). [0204] 27. Christinck, E. R., Luscher, M. A.,
Barber, B. H., & Williams, D. B. Peptide binding to class I MHC
on living cells and quantitation of complexes required for CTL
lysis. Nature 352, 67-70 (1991). [0205] 28. Jain, R. K. Transport
of molecules, particles, and cells in solid tumors. Annu. Rev.
Biomed. Eng 1, 241-263 (1999). [0206] 29. Bromley, S. K. et al. The
immunological synapse. Annu. Rev. Immunol. 19, 375-396 (2001).
[0207] 30. Lanzavecchia, A., Lezzi, G., & Viola, A. From TCR
engagement to T-cell activation: a kinetic view of T-cell behavior.
Cell 96, 1-4 (1999). [0208] 31. Chang, K., Pastan, I. &
Willingham, M. C. Isolation and characterization of a monoclonal
antibody, K1, reactive with ovarian cancers and normal mesothelium.
Int. J. Cancer 50, 373-381 (1992). [0209] 32. Chang, K., Pai, L.
H., Batra, J. K., Pastan, I. & Willingham, M. C.
Characterization of the antigen (CAK1) recognized by monoclonal
antibody K1 present on ovarian cancers and normal mesothelium.
Cancer Res. 52, 181-186 (1992). [0210] 33. Parham, P., Barnstable,
C. J. & Bodmer, W. F. Use of a monoclonal antibody (W6/32) in
structural studies of HLA-A, B, C, antigens. J. Immunol. 123,
342-349 (1979). [0211] 34. Shields, M. J. & Ribaudo, R. K.
Mapping of the monoclonal antibody W6/32: sensitivity to the amino
terminus of beta2-microglobulin. Tissue Antigens 51, 567-570
(1998). [0212] 35. Parham, P. & Brodsky, F. M. Partial
purification and some properties of BB7.2. A cytotoxic monoclonal
antibody with specificity for HLA-A2 and a variant of HLA-A28. Hum.
Immunol. 3, 277-299 (1981).
Sequence CWU 1
1
2311995DNAArtificial sequenceCompound A fusion protein coding
sequence 1atgaacctgg tgccgatggt cgcgaccgtt ggaggtggcg gttctggcgg
aggaggatcc 60ggtggcggag gttcaggagg cggtggatcg atccagcgta ctccaaagat
tcaggtttac 120tcacgtcatc cagcagagaa tggaaagtca aatttcctga
attgctatgt gtctgggttt 180catccatccg acattgaagt tgacttactg
aagaatggag agagaattga aaaagtggag 240cattcagact tgtctttttc
gaaggactgg tctttctatc tcttgtacta cactgaattc 300acccccactg
aaaaagatga gtatgcctgc cgtgtgaacc atgtgacttt gtcacagccc
360aagatagtta agtgggatcg cgacatgggt ggcggtggaa gcggcggtgg
aggctctggt 420ggaggtggca gcggctctca ctccatgagg tatttcttca
catccgtgtc ccggcccggc 480cgcggggagc cccgcttcat cgcagtgggc
tacgtggacg acacgcagtt cgtgcggttc 540gacagcgacg ccgcgagcca
gaggatggag ccgcgggcgc cgtggataga gcaggagggt 600ccggagtatt
gggacgggga gacacggaaa gtgaaggccc actcacagac tcaccgagtg
660gacctgggga ccctgcgcgg ctactacaac cagagcgagg ccggttctca
caccgtccag 720aggatgtatg gctgcgacgt ggggtcggac tggcgcttcc
tccgcgggta ccaccagtac 780gcgtacgacg gcaaggatta catcgccctg
aaagaggacc tgcgctcttg gaccgcggcg 840gacatggcag ctcagaccac
caagcacaag tgggaggcgg cccatgtagc ggagcagttg 900agagcctacc
tggagggcac gtgcgtggag tggctccgca gatacctgga gaacgggaag
960gagacgctgc agcgcacgga cgcccccaaa acgcacatga ctcaccacgc
tgtctctgac 1020catgaagcca ccctgaggtg ctgggccctg agcttctacc
ctgcggagat cacactgacc 1080tggcagcggg atggggagga ccagacccag
gacacggagc tcgtggagac aaggcctgca 1140ggggatggaa ccttccagaa
gtgggcggct gtggtggtgc cttctggaca ggagcagaga 1200tacacctgcc
atgtgcagca tgagggtttg cccaagcccc tcaccctgag atgggaggct
1260tccggaggtc aggtacaact gcagcagtct gggcctgagc tggagaagcc
tggcgcttca 1320gtgaagatat cctgcaaggc ttctggttac tcattcactg
gctacaccat gaactgggtg 1380aagcagagcc atggaaagag ccttgagtgg
attggactta ttactcctta caatggtgct 1440tctagctaca accagaagtt
caggggcaag gccacattaa ctgtagacaa gtcatccagc 1500acagcctaca
tggacctcct cagtctgaca tctgaagact ctgcagtcta tttctgtgca
1560agggggggtt acgacgggag gggttttgac tactggggcc aagggaccac
ggtcaccgtc 1620tcctcaggtg taggcggttc aggcggcggt ggctctggcg
gtggcggatc ggacatcgag 1680ctcactcagt ctccagcaat catgtctgca
tctccagggg agaaggtcac catgacctgc 1740agtgccagct caagtgtaag
ttacatgcac tggtaccagc agaagtcagg cacctccccc 1800aaaagatgga
tttatgacac atccaaactg gcttctggag tcccaggtcg cttcagtggc
1860agtgggtctg gaaactctta ctctctcaca atcagcagcg tggaggctga
agatgatgca 1920acttattact gccagcagtg gagtaagcac cctctcacgt
tcggtgctgg gacaaagttg 1980gaaataaaat aatga 19952663PRTArtificial
sequenceCompound A fusion protein 2Met Asn Leu Val Pro Met Val Ala
Thr Val Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser Ile Gln 20 25 30 Arg Thr Pro Lys
Ile Gln Val Tyr Ser Arg His Pro Ala Glu Asn Gly 35 40 45 Lys Ser
Asn Phe Leu Asn Cys Tyr Val Ser Gly Phe His Pro Ser Asp 50 55 60
Ile Glu Val Asp Leu Leu Lys Asn Gly Glu Arg Ile Glu Lys Val Glu 65
70 75 80 His Ser Asp Leu Ser Phe Ser Lys Asp Trp Ser Phe Tyr Leu
Leu Tyr 85 90 95 Tyr Thr Glu Phe Thr Pro Thr Glu Lys Asp Glu Tyr
Ala Cys Arg Val 100 105 110 Asn His Val Thr Leu Ser Gln Pro Lys Ile
Val Lys Trp Asp Arg Asp 115 120 125 Met Gly Gly Gly Gly Ser Gly Gly
Gly Gly Ser Gly Gly Gly Gly Ser 130 135 140 Gly Ser His Ser Met Arg
Tyr Phe Phe Thr Ser Val Ser Arg Pro Gly 145 150 155 160 Arg Gly Glu
Pro Arg Phe Ile Ala Val Gly Tyr Val Asp Asp Thr Gln 165 170 175 Phe
Val Arg Phe Asp Ser Asp Ala Ala Ser Gln Arg Met Glu Pro Arg 180 185
190 Ala Pro Trp Ile Glu Gln Glu Gly Pro Glu Tyr Trp Asp Gly Glu Thr
195 200 205 Arg Lys Val Lys Ala His Ser Gln Thr His Arg Val Asp Leu
Gly Thr 210 215 220 Leu Arg Gly Tyr Tyr Asn Gln Ser Glu Ala Gly Ser
His Thr Val Gln 225 230 235 240 Arg Met Tyr Gly Cys Asp Val Gly Ser
Asp Trp Arg Phe Leu Arg Gly 245 250 255 Tyr His Gln Tyr Ala Tyr Asp
Gly Lys Asp Tyr Ile Ala Leu Lys Glu 260 265 270 Asp Leu Arg Ser Trp
Thr Ala Ala Asp Met Ala Ala Gln Thr Thr Lys 275 280 285 His Lys Trp
Glu Ala Ala His Val Ala Glu Gln Leu Arg Ala Tyr Leu 290 295 300 Glu
Gly Thr Cys Val Glu Trp Leu Arg Arg Tyr Leu Glu Asn Gly Lys 305 310
315 320 Glu Thr Leu Gln Arg Thr Asp Ala Pro Lys Thr His Met Thr His
His 325 330 335 Ala Val Ser Asp His Glu Ala Thr Leu Arg Cys Trp Ala
Leu Ser Phe 340 345 350 Tyr Pro Ala Glu Ile Thr Leu Thr Trp Gln Arg
Asp Gly Glu Asp Gln 355 360 365 Thr Gln Asp Thr Glu Leu Val Glu Thr
Arg Pro Ala Gly Asp Gly Thr 370 375 380 Phe Gln Lys Trp Ala Ala Val
Val Val Pro Ser Gly Gln Glu Gln Arg 385 390 395 400 Tyr Thr Cys His
Val Gln His Glu Gly Leu Pro Lys Pro Leu Thr Leu 405 410 415 Arg Trp
Glu Ala Ser Gly Gly Gln Val Gln Leu Gln Gln Ser Gly Pro 420 425 430
Glu Leu Glu Lys Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser 435
440 445 Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp Val Lys Gln Ser
His 450 455 460 Gly Lys Ser Leu Glu Trp Ile Gly Leu Ile Thr Pro Tyr
Asn Gly Ala 465 470 475 480 Ser Ser Tyr Asn Gln Lys Phe Arg Gly Lys
Ala Thr Leu Thr Val Asp 485 490 495 Lys Ser Ser Ser Thr Ala Tyr Met
Asp Leu Leu Ser Leu Thr Ser Glu 500 505 510 Asp Ser Ala Val Tyr Phe
Cys Ala Arg Gly Gly Tyr Asp Gly Arg Gly 515 520 525 Phe Asp Tyr Trp
Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Val 530 535 540 Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Glu 545 550 555
560 Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val
565 570 575 Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met His
Trp Tyr 580 585 590 Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile
Tyr Asp Thr Ser 595 600 605 Lys Leu Ala Ser Gly Val Pro Gly Arg Phe
Ser Gly Ser Gly Ser Gly 610 615 620 Asn Ser Tyr Ser Leu Thr Ile Ser
Ser Val Glu Ala Glu Asp Asp Ala 625 630 635 640 Thr Tyr Tyr Cys Gln
Gln Trp Ser Lys His Pro Leu Thr Phe Gly Ala 645 650 655 Gly Thr Lys
Leu Glu Ile Lys 660 327DNAArtificial sequenceCMV peptide coding
sequence 3aacctggtgc cgatggtcgc gaccgtt 2749PRTArtificial
sequenceCMV peptide 4Asn Leu Val Pro Met Val Ala Thr Val 1 5
560DNAArtificial sequence20-aa peptide linker coding sequence
5ggaggtggcg gttctggcgg aggaggatcc ggtggcggag gttcaggagg cggtggatcg
60620PRTArtificial sequence20-aa peptide linker 6Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly
Gly Ser 20 745DNAArtificial sequence15-aa peptide linker coding
sequence 7ggtggcggtg gaagcggcgg tggaggctct ggtggaggtg gcagc
45815PRTArtificial sequence15-aa peptide linker 8Gly Gly Gly Gly
Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15
912DNAArtificial sequence4-aa peptide linker coding sequence
9gcttccggag gt 12104PRTArtificial sequence4-aa peptide linker 10Ala
Ser Gly Gly 1 11726DNAArtificial sequenceSS1 11caggtacaac
tgcagcagtc tgggcctgag ctggagaagc ctggcgcttc agtgaagata 60tcctgcaagg
cttctggtta ctcattcact ggctacacca tgaactgggt gaagcagagc
120catggaaaga gccttgagtg gattggactt attactcctt acaatggtgc
ttctagctac 180aaccagaagt tcaggggcaa ggccacatta actgtagaca
agtcatccag cacagcctac 240atggacctcc tcagtctgac atctgaagac
tctgcagtct atttctgtgc aagggggggt 300tacgacggga ggggttttga
ctactggggc caagggacca cggtcaccgt ctcctcaggt 360gtaggcggtt
caggcggcgg tggctctggc ggtggcggat cggacatcga gctcactcag
420tctccagcaa tcatgtctgc atctccaggg gagaaggtca ccatgacctg
cagtgccagc 480tcaagtgtaa gttacatgca ctggtaccag cagaagtcag
gcacctcccc caaaagatgg 540atttatgaca catccaaact ggcttctgga
gtcccaggtc gcttcagtgg cagtgggtct 600ggaaactctt actctctcac
aatcagcagc gtggaggctg aagatgatgc aacttattac 660tgccagcagt
ggagtaagca ccctctcacg ttcggtgctg ggacaaagtt ggaaataaaa 720taatga
72612240PRTArtificial sequenceSS1 single chain Fv (scFv)
polypeptide 12Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Glu Lys
Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr
Ser Phe Thr Gly Tyr 20 25 30 Thr Met Asn Trp Val Lys Gln Ser His
Gly Lys Ser Leu Glu Trp Ile 35 40 45 Gly Leu Ile Thr Pro Tyr Asn
Gly Ala Ser Ser Tyr Asn Gln Lys Phe 50 55 60 Arg Gly Lys Ala Thr
Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Asp Leu
Leu Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ala
Arg Gly Gly Tyr Asp Gly Arg Gly Phe Asp Tyr Trp Gly Gln Gly 100 105
110 Thr Thr Val Thr Val Ser Ser Gly Val Gly Gly Ser Gly Gly Gly Gly
115 120 125 Ser Gly Gly Gly Gly Ser Asp Ile Glu Leu Thr Gln Ser Pro
Ala Ile 130 135 140 Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr
Cys Ser Ala Ser 145 150 155 160 Ser Ser Val Ser Tyr Met His Trp Tyr
Gln Gln Lys Ser Gly Thr Ser 165 170 175 Pro Lys Arg Trp Ile Tyr Asp
Thr Ser Lys Leu Ala Ser Gly Val Pro 180 185 190 Gly Arg Phe Ser Gly
Ser Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile 195 200 205 Ser Ser Val
Glu Ala Glu Asp Asp Ala Thr Tyr Tyr Cys Gln Gln Trp 210 215 220 Ser
Lys His Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Ile Lys 225 230
235 240 13109DNAArtificial sequencePCR Primer 13ggaagcgttg
gcgcatatgg gcattctggg cttcgtgttt accctgggcg gaggaggatc 60cggtggcgga
ggttcaggag gcggtggatc gatccagcgt actccaaag 1091438DNAArtificial
sequencePCR primer 14gcagtaagga attctcatta ttttatttcc aactttgt
381556DNAArtificial sequencePCR primer 15tatgaacctg gtgccgatgg
tcgcgaccgt tggaggtggc ggttctggcg gaggag 561658DNAArtificial
sequencePCR primer 16gatcctcctc cgccagaacc gccacctcca acggtcgcga
ccatcggcac caggttca 5817108DNAArtificial sequencePCR primer
17ggaagcgttg gcgcatatga tcatggacca ggttccgttc tctgttggcg aggagggtcc
60ggtggcggag gttcaggagg cggtggatcg atccagcgta ctccaaag
1081838DNAArtificial sequencePCR primer 18gcagtaagga attctcatta
ttttatttcc aactttgt 381915PRTArtificial sequencepeptide linker
19Gly Val Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5
10 15 205PRTArtificial sequencepeptide linker monomer 20Gly Xaa Gly
Gly Ser 1 5 219PRTArtificial sequencepeptide linker 21Gly Ile Leu
Gly Phe Val Phe Thr Leu 1 5 221980DNAArtificial sequencecompound B
fusion protein coding sequence 22atgaacctgg tgccgatggt cgcgaccgtt
ggcggaggag gatccggtgg cggaggttca 60ggaggcggtg gatcgatcca gcgtactcca
aagattcagg tttactcacg tcatccagca 120gagaatggaa agtcaaattt
cctgaattgc tatgtgtctg ggtttcatcc atccgacatt 180gaagttgact
tactgaagaa tggagagaga attgaaaaag tggagcattc agacttgtct
240ttttcgaagg actggtcttt ctatctcttg tactacactg aattcacccc
cactgaaaaa 300gatgagtatg cctgccgtgt gaaccatgtg actttgtcac
agcccaagat agttaagtgg 360gatcgcgaca tgggtggcgg tggaagcggc
ggtggaggct ctggtggagg tggcagcggc 420tctcactcca tgaggtattt
cttcacatcc gtgtcccggc ccggccgcgg ggagccccgc 480ttcatcgcag
tgggctacgt ggacgacacg cagttcgtgc ggttcgacag cgacgccgcg
540agccagagga tggagccgcg ggcgccgtgg atagagcagg agggtccgga
gtattgggac 600ggggagacac ggaaagtgaa ggcccactca cagactcacc
gagtggacct ggggaccctg 660cgcggctact acaaccagag cgaggccggt
tctcacaccg tccagaggat gtatggctgc 720gacgtggggt cggactggcg
cttcctccgc gggtaccacc agtacgcgta cgacggcaag 780gattacatcg
ccctgaaaga ggacctgcgc tcttggaccg cggcggacat ggcagctcag
840accaccaagc acaagtggga ggcggcccat gtagcggagc agttgagagc
ctacctggag 900ggcacgtgcg tggagtggct ccgcagatac ctggagaacg
ggaaggagac gctgcagcgc 960acggacgccc ccaaaacgca catgactcac
cacgctgtct ctgaccatga agccaccctg 1020aggtgctggg ccctgagctt
ctaccctgcg gagatcacac tgacctggca gcgggatggg 1080gaggaccaga
cccaggacac ggagctcgtg gagaccaggc ctgcagggga tggaaccttc
1140cagaagtggg cggctgtggt ggtgccttct ggacaggagc agagatacac
ctgccatgtg 1200cagcatgagg gtttgcccaa gcccctcacc ctgagatggg
aggcttccgg aggtcaggta 1260caactgcagc agtctgggcc tgagctggag
aagcctggcg cttcagtgaa gatatcctgc 1320aaggcttctg gttactcatt
cactggctac accatgaact gggtgaagca gagccatgga 1380aagagccttg
agtggattgg acttattact ccttacaatg gtgcttctag ctacaaccag
1440aagttcaggg gcaaggccac attaactgta gacaagtcat ccagcacagc
ctacatggac 1500ctcctcagtc tgacatctga agactctgca gtctatttct
gtgcaagggg gggttacgac 1560gggaggggtt ttgactactg gggccaaggg
accacggtca ccgtctcctc aggtgtaggc 1620ggttcaggcg gcggtggctc
tggcggtggc ggatcggaca tcgagctcac tcagtctcca 1680gcaatcatgt
ctgcatctcc aggggagaag gtcaccatga cctgcagtgc cagctcaagt
1740gtaagttaca tgcactggta ccagcagaag tcaggcacct cccccaaaag
atggatttat 1800gacacatcca aactggcttc tggagtccca ggtcgcttca
gtggcagtgg gtctggaaac 1860tcttactctc tcacaatcag cagcgtggag
gctgaagatg atgcaactta ttactgccag 1920cagtggagta agcaccctct
cacgttcggt gctgggacaa agttggaaat aaaataatga 1980231980DNAArtificial
sequenceM1cov/scHLA-A2/SS1 (scFv) fusion protein coding sequence
23atgggcattc tgggcttcgt gtttaccctg ggcggaggag gatccggtgg cggaggttca
60ggaggcggtg gatcgatcca gcgtactcca aagattcagg tttactcacg tcatccagca
120gagaatggaa agtcaaattt cctgaattgc tatgtgtctg ggtttcatcc
atccgacatt 180gaagttgact tactgaagaa tggagagaga attgaaaaag
tggagcattc agacttgtct 240ttttcgaagg actggtcttt ctatctcttg
tactacactg aattcacccc cactgaaaaa 300gatgagtatg cctgccgtgt
gaaccatgtg actttgtcac agcccaagat agttaagtgg 360gatcgcgaca
tgggtggcgg tggaagcggc ggtggaggct ctggtggagg tggcagcggc
420tctcactcca tgaggtattt cttcacatcc gtgtcccggc ccggccgcgg
ggagccccgc 480ttcatcgcag tgggctacgt ggacgacacg cagttcgtgc
ggttcgacag cgacgccgcg 540agccagagga tggagccgcg ggcgccgtgg
atagagcagg agggtccgga gtattgggac 600ggggagacac ggaaagtgaa
ggcccactca cagactcacc gagtggacct ggggaccctg 660cgcggctact
acaaccagag cgaggccggt tctcacaccg tccagaggat gtatggctgc
720gacgtggggt cggactggcg cttcctccgc gggtaccacc agtacgcgta
cgacggcaag 780gattacatcg ccctgaaaga ggacctgcgc tcttggaccg
cggcggacat ggcagctcag 840accaccaagc acaagtggga ggcggcccat
gtagcggagc agttgagagc ctacctggag 900ggcacgtgcg tggagtggct
ccgcagatac ctggagaacg ggaaggagac gctgcagcgc 960acggacgccc
ccaaaacgca catgactcac cacgctgtct ctgaccatga agccaccctg
1020aggtgctggg ccctgagctt ctaccctgcg gaaatcacac tgacctggca
gcgggatggg 1080gaggaccaga cccaggacac ggagctcgtg gagaccaggc
ctgcagggga tggaaccttc 1140cagaagtggg cggctgtggt ggtgccttct
ggacaggagc agagatacac ctgccatgtg 1200cagcatgagg gtttgcccaa
gcccctcacc ctgagatggg aggcttccgg aggtcaggta 1260caactgcagc
agtctgggcc tgagctggag aagcctggcg cttcagtgaa gatatcctgc
1320aaggcttctg gttactcatt cactggctac accatgaact gggtgaagca
gagccatgga 1380aagagccttg agtggattgg acttattact ccttacaatg
gtgcttctag ctacaaccag 1440aagttcaggg gcaaggccac attaactgta
gacaagtcat ccagcacagc ctacatggac 1500ctcctcagtc tgacatctga
agactctgca gtctatttct gtgcaagggg gggttacgac 1560gggaggggtt
ttgactactg gggccaaggg accacggtca ccgtctcctc aggtgtaggc
1620ggttcaggcg gcggtggctc tggcggtggc ggatcggaca tcgagctcac
tcagtctcca 1680gcaatcatgt ctgcatctcc aggggagaag gtcaccatga
cctgcagtgc cagctcaagt 1740gtaagttaca tgcactggta ccagcagaag
tcaggcacct cccccaaaag atggatttat 1800gacacatcca aactggcttc
tggagtccca ggtcgcttca gtggcagtgg gtctggaaac 1860tcttactctc
tcacaatcag cagcgtggag gctgaagatg atgcaactta ttactgccag
1920cagtggagta agcaccctct cacgttcggt gctgggacaa agttggaaat
aaaataatga 1980
* * * * *