U.S. patent application number 14/609743 was filed with the patent office on 2015-05-21 for compositions and methods for treatment.
This patent application is currently assigned to SARCODE BIOSCIENCE INC.. The applicant listed for this patent is SARCODE BIOSCIENCE INC.. Invention is credited to John Burnier, Thomas Gadek.
Application Number | 20150140075 14/609743 |
Document ID | / |
Family ID | 37431594 |
Filed Date | 2015-05-21 |
United States Patent
Application |
20150140075 |
Kind Code |
A1 |
Gadek; Thomas ; et
al. |
May 21, 2015 |
COMPOSITIONS AND METHODS FOR TREATMENT
Abstract
The present invention provides compounds and methods for the
treatment of LFA-1 mediated diseases. In particular, LFA-1
antagonists are described herein and these antagonists are used in
the treatment of LFA-1 mediated diseases. One aspect of the
invention provides for diagnosis of an LFA-1 mediated disease and
administration of a LFA-1 antagonist, after the patient is
diagnosed with a LFA-1 mediated disease. In some embodiments, the
LFA-1 mediated diseases treated are dry eye disorders. Also
provided herein are methods for identifying compounds which are
LFA-1 antagonists.
Inventors: |
Gadek; Thomas; (Oakland,
CA) ; Burnier; John; (Pacifica, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
SARCODE BIOSCIENCE INC. |
BRISBANE |
CA |
US |
|
|
Assignee: |
SARCODE BIOSCIENCE INC.
BRISBANE
CA
|
Family ID: |
37431594 |
Appl. No.: |
14/609743 |
Filed: |
January 30, 2015 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
14045131 |
Oct 3, 2013 |
|
|
|
14609743 |
|
|
|
|
13011760 |
Jan 21, 2011 |
8771715 |
|
|
14045131 |
|
|
|
|
12508367 |
Jul 23, 2009 |
8084047 |
|
|
13011760 |
|
|
|
|
12508311 |
Jul 23, 2009 |
|
|
|
12508367 |
|
|
|
|
11436906 |
May 17, 2006 |
8168655 |
|
|
12508367 |
|
|
|
|
11436906 |
May 17, 2006 |
8168655 |
|
|
12508311 |
|
|
|
|
60681684 |
May 17, 2005 |
|
|
|
60681722 |
May 17, 2005 |
|
|
|
60681772 |
May 17, 2005 |
|
|
|
60681723 |
May 17, 2005 |
|
|
|
Current U.S.
Class: |
424/450 ; 435/29;
435/7.24; 435/7.93; 436/501; 506/10; 506/9; 514/20.8; 514/255.01;
514/419; 514/448; 514/563; 546/146 |
Current CPC
Class: |
A61P 1/00 20180101; G01N
33/6872 20130101; G01N 2800/16 20130101; A61K 31/496 20130101; A61K
31/54 20130101; C07D 405/14 20130101; A61K 31/197 20130101; A61K
31/198 20130101; A61K 31/4745 20130101; A61P 43/00 20180101; A61K
9/0043 20130101; A61P 27/02 20180101; G01N 33/566 20130101; A61K
31/352 20130101; A61K 9/0019 20130101; A61K 9/0048 20130101; G01N
33/5047 20130101; A61K 31/341 20130101; A61P 17/06 20180101; G01N
33/5011 20130101; Y10S 514/914 20130101; G01N 2333/705 20130101;
A61P 29/00 20180101; C07D 207/06 20130101; Y10S 514/912 20130101;
A61K 31/4192 20130101; A61K 38/07 20130101; A61K 38/12 20130101;
C07D 307/52 20130101; A61K 33/00 20130101; G01N 2333/70546
20130101; A61K 9/0051 20130101; C07D 401/06 20130101; C07D 471/04
20130101; C07C 317/50 20130101; G01N 2500/02 20130101; G01N 2500/04
20130101; A61K 31/405 20130101; A61P 11/06 20180101; A61K 31/44
20130101; C07D 217/06 20130101; C07D 405/06 20130101; A61B 3/101
20130101; A61K 9/0053 20130101; A61K 38/1703 20130101; A61K 31/4162
20130101; A61K 31/4184 20130101; C07D 217/02 20130101; G01N 2500/20
20130101; A61K 31/472 20130101; A61K 31/275 20130101; A61K 31/40
20130101; A61K 31/495 20130101; A61K 31/5377 20130101; A61P 17/00
20180101; A61K 9/0014 20130101; A61K 38/08 20130101; A61P 27/00
20180101; G01N 2500/10 20130101; A61K 31/381 20130101; A61K 45/06
20130101; A61B 3/145 20130101; C07C 279/28 20130101; G01N 33/5032
20130101; C07D 217/26 20130101; C07D 409/14 20130101; G01N
2333/70525 20130101; A61K 33/06 20130101; C07D 333/38 20130101;
C07D 413/14 20130101; C07D 217/00 20130101; A61K 31/4709 20130101;
A61K 31/4725 20130101; C07D 217/20 20130101; A61K 31/517 20130101;
A61P 27/04 20180101; A61K 31/404 20130101; A61K 31/541
20130101 |
Class at
Publication: |
424/450 ;
514/563; 546/146; 514/448; 514/255.01; 514/419; 514/20.8; 436/501;
506/9; 435/7.24; 435/29; 506/10; 435/7.93 |
International
Class: |
C07D 405/06 20060101
C07D405/06; A61K 31/381 20060101 A61K031/381; A61K 31/495 20060101
A61K031/495; A61K 31/405 20060101 A61K031/405; G01N 33/50 20060101
G01N033/50; A61K 38/08 20060101 A61K038/08; A61K 38/07 20060101
A61K038/07; A61K 38/12 20060101 A61K038/12; G01N 33/68 20060101
G01N033/68; A61K 31/198 20060101 A61K031/198; A61K 38/17 20060101
A61K038/17 |
Claims
1.-101. (canceled)
102. A method of modulating the ligand/receptor interaction between
an integrin and one or more intercellular adhesion molecules in a
patient in need of such modulation, said method comprising
administering to said patient a modulation effective amount of the
compound ##STR00035## or a pharmaceutically acceptable salt
thereof.
103. A method as defined in claim 102, wherein said integrin
comprises LFA-1 and said intercellular adhesion molecule is
selected from the group consisting of ICAM-1, ICAM-2, ICAM-3,
ICAM-4 or any combination of any of the foregoing.
104. A method as defined in claim 102, wherein the patient does not
have Sjogren's syndrome.
105. A method as defined in claim 102, wherein the patient has
Sjogren's syndrome.
106. A method as defined in claim 102, wherein said administration
comprises topical administration of said compound via a carrier
vehicle selected from a group consisting of liquid drops, liquid
wash, gel, ointment, spray, liposome, and any combination of any of
the foregoing.
107. A method as defined in claim 106, wherein said topical
administration comprises infusion of said compound or salt to an
eye of said patient via a device selected from the group consisting
of a pump-catheter system, a continuous or selective release
device, a contact lens, or any combination of any of the
foregoing.
108. A method as defined in claim 102, wherein said administration
comprises systemically administering a liquid or liquid suspension
of said compound or salt via nose drops, nasal spray, nebulized
liquid, or any combination of any of the foregoing to oral or
nasopharyngeal airways of said patient, such that said modulation
effective amount of said compound or salt contacts one or more of
the lacrimal gland, conjunctival tissue, tears, or ocular surface
of the eye of said patient.
109. A method as defined in claim 102, wherein said administration
comprises administering an oral form of said compound or salt, such
that said modulation effective amount of said compound or salt
contacts one or more of the lacrimal gland, conjunctival tissue,
tears, or ocular surface of the eye of said patient via systemic
absorption and circulation.
110. A method as defined in claim 102, wherein said administration
comprises administering an injectable form of said compound or
salt, such that said modulation effective amount of said compound
or salt contacts one or more of the lacrimal tissues, conjunctival
tissue, tears, or ocular surface of the eye of said patient via
systemic absorption and circulation.
111. A method as defined in claim 102, wherein said administration
comprises administering a suppository dosage form of said compound
or salt, such that said modulation effective amount of said
compound or salt contacts one or more of the lacrimal tissues,
conjunctival tissue, tears, or ocular surface of the eye of said
patient via systemic absorption and circulation.
112. A method as defined in claim 102, wherein said administration
comprises administering an intraocular instillation of a gel,
cream, powder, foam, crystals, liposomes, spray, liquid suspension
form, or any combination of any of the foregoing of said compound
or salt.
113. A method as defined in claim 102, wherein said compound or
salt is administered to the ocular surfaces of said patient in a
modulation effective amount sufficient to achieve concentrations
thereof of from about 1.times.10.sup.-7 to about 1.times.10.sup.-1
moles/liter.
114. A method of modulating the ligand/receptor interaction between
an integrin and one or more intercellular adhesion molecules in a
patient in need of such modulation, said method comprising
administering to an eye of said patient a modulation effective
amount of the compound ##STR00036## or a pharmaceutically
acceptable salt thereof, whereby said administration is effective
in promoting tear secretion or mucin production in said eye in said
patient, and wherein said patient does not have Sjogren's
syndrome.
115. A method of modulating the ligand/receptor interaction between
an integrin and one or more intercellular adhesion molecules in a
patient in need of such modulation, said method comprising
administering to an eye of said patient a modulation effective
amount of the compound ##STR00037## or a pharmaceutically
acceptable salt thereof, whereby said administration is effective
in promoting tear secretion or mucin production in said eye in said
patient, and wherein said patient has Sjogren's syndrome.
116. A method of modulating the ligand/receptor interaction between
an integrin and one or more intercellular adhesion molecules in a
patient in need of such modulation, said method comprising
performing a dry eye diagnostic test on said patient; determining
whether said patient suffers from a dry eye disease based on the
results of said diagnostic step; and upon diagnosis of said dry eye
disease, administering to said patient a modulation effective
amount of the compound ##STR00038## or a pharmaceutically
acceptable salt thereof, and wherein said patient does not have
Sjogren's syndrome.
117. A method of modulating the ligand/receptor interaction between
an integrin and one or more intercellular adhesion molecules in a
patient in need of such modulation, said method comprising
performing a dry eye diagnostic test on said patient; determining
whether said patient suffers from a dry eye disease based on the
results of said diagnostic step; and upon diagnosis of said dry eye
disease, administering to said patient a modulation effective
amount of the compound ##STR00039## or a pharmaceutically
acceptable salt thereof, and wherein said patient has Sjogren's
syndrome.
118. A method as defined in claim 116, wherein said diagnostic step
comprises imaging an eye of said patient, analysis of a biological
sample of an eye of said patient, or a combination of the
foregoing.
119. A method as defined in claim 117, wherein said diagnostic step
comprises imaging an eye of said patient, analysis of a biological
sample of an eye of said patient, or a combination of the
foregoing.
120. A method as defined in claim 102, wherein said administration
is via a sustained release insert or implant, subconjunctival
injection, intraocular injection, periocular injection, retrobulbar
injection, intracameral injection, or any combination of any of the
foregoing.
121. A method as defined in claim 102, wherein said administration
comprises delivery of a liquid or liquid suspension of said
compound or salt via nose drops, nasal spray, nebulized liquid, or
any combination of any of the foregoing to oral or nasopharyngeal
airways of said patient, such that said modulation effective amount
of said compound or salt contacts one or more of the lacrimal
gland, conjunctival tissue, tears, or ocular surface of the eye of
said patient via nasolacrimal ducts.
122. A method as defined in claim 102, wherein said administration
comprises administering an injectable form of said compound or
salt, such that said modulation effective amount of said compound
or salt contacts one or more of the lacrimal tissues, conjunctival
tissue, tears, or ocular surface of the eye of said patient via
local delivery.
123. A method as defined in claim 107, wherein said continuous or
selective release device comprises an ocular insert or implant.
124. A method as defined in claim 107, wherein said modulation
effective amount of said compound or salt is distributed regionally
to one or more of the nose, nasal passages, and nasal cavity.
125. A method as defined in claim 123, wherein said continuous or
selective release device comprises a biocompatible polymer.
126. A method as defined in claim 112, wherein said gel, cream,
powder, foam, crystals, liposomes, spray, or liquid suspension
administers said compound or salt via controlled release of said
compound or salt from a biocompatible polymer.
Description
CROSS-REFERENCE
[0001] This application is a Continuation Application under 35
U.S.C. .sctn.120 of U.S. application Ser. No. 12/508,367, filed
Jul. 23, 2009, and a Continuation Application under 35 U.S.C.
.sctn.120 of U.S. application Ser. No. 12/508,311, filed Jul. 23,
2009, each of which is a Continuation Application under 35 U.S.C.
.sctn.120 of U.S. application Ser. No. 11/436,906, filed May 17,
2006; which claims the benefit under 35 U.S.C. .sctn.119(e) of U.S.
Provisional Patent Application No. 60/681,684, filed May 17, 2005;
U.S. Provisional Application No. 60/681,722, filed May 17, 2005;
U.S. Provisional Application No. 60/681,772, filed May 17, 2005,
and U.S. Provisional Application No. 60/681,723, filed May 17,
2005; each of which is incorporated herein by reference in its
entirety.
BACKGROUND OF THE INVENTION
[0002] An ophthalmological disorder, dry eye, is a common complaint
of ophthalmic patients. Unaddressed conditions of dry eye can lead
to erosion and abrasion of the epithelial cell surface of the
cornea, raising susceptibility to infection. Progression of the
disease can lead to ulceration of the cornea, even loss of
sight.
[0003] A variety of irritants, injuries, and medical conditions
predispose individuals to initiation of decreased lacrimal gland
secretion resulting in deficient levels of aqueous tears protecting
and nourishing the surface of the eye. There are environmental
factors such as high altitudes, arid and windy climates, air
pollution, desiccated air from central heat and central air
conditioning, and exposure to cigarette smoke which can establish
and/or enhance deterioration of the quantity and quality of tear
production. Even extensive computer use can be a contributing
factor as studies have shown significantly decreased blinking rates
for users concentrating their attention on computer screens. Some
advances in eye care, starting with the introduction or contact
lenses, and currently, the popularity of the LASIK procedure for
vision correction, have contributed to the recent growth of subject
numbers with dry eye. Use of contact lenses results in absorption
of tear film by the lens, with resultant physical irritation of the
conjunctiva in the eyelids. LASIK can have a secondary effect of
eye injury as nerves often can be severed or ablated during laser
refractive surgery, which can lead to at least temporary dry eye
syndrome of several months duration.
[0004] Disease and some physical conditions can predispose
individuals to dry eye disorder, including; allergies, diabetes,
lacrimal gland deficiency, lupus, Parkinson's disease, Sjogren's
syndrome, rheumatoid arthritis, rosacea, and others. Medications
for other diseases may cause or exacerbate dry eye disorders,
including diuretics, antidepressants, allergy medications, birth
control pills, decongestants and others.
[0005] Age related changes may induce or exacerbate dry eye as
well. Post menopausal women experience changes in hormonal levels
that can instigate or worsen dry eye, and thyroid imbalances may
cause similar changes. Finally, aging itself can cause a reduction
in lipid production with resultant dry eye.
[0006] Until recently, therapeutic interventions were limited to
palliative measures to increase the moisture level of the eye. This
is most frequently achieved with instillation of fluids which act
as artificial tears. These fluids are often solutions which are
instilled once or several times a day. For more severe cases of dry
eye, artificial tear solutions which incorporate a thickener or
ocular gels can enhance the amount of film retained on the eye.
Alternatively, several night-time ointment therapies are available.
The thickened solutions, gels, and ointments suffer from the
limitation that vision can be impaired significantly upon
application, rendering them less useful to the average subject who
may require numerous applications during their waking, active
hours. Another palliative intervention is the installation of
temporary punctual occlusions, or even surgical closure of the
normal drainage route of tears into the nasal cavity adjacent to
the eye.
[0007] However, none of these interventions are effective in the
treatment of this disorder. Hence, it is desirable to develop
agents which effectively treat dry eye, preferably with minimal
side effects.
SUMMARY OF THE INVENTION
[0008] In one aspect, the present invention provides methods for
treatment of inflammatory disorders mediated by LFA-1 by
administering an effective amount of an antagonist of LFA-1 by
itself or in combination with other therapeutic agents to a
subject. In some embodiments of the invention, diseases in which
the anti-LFA-1 antibody, Raptiva, has shown therapeutic effect or
effect on inflammatory cells in the diseased tissue are disease
that are treated by the LFA-1 compounds of the present invention.
Patients with immune mediated allergic diseases including rhinitis
may be treated with the compounds of the invention to reduce the
inflammation associated with LFA-1 mediated immune and/or allergic
responses. In some embodiments, a local administration of the
compounds of the invention, delivered via the mouth or nose as a
misted solution or dispersed powder is useful in the treatment of
asthma or other LFA-1 mediated pulmonary inflammatory diseases. In
some embodiments, a cream formulation of the compounds of the
invention is useful in the local delivery of a LFA-1 antagonist to
the skin in dermatologic diseases mediated by LFA-1 such as eczema
and psoriasis. In some embodiments, an oral formulation of a LFA-1
antagonist which is known to be poorly absorbed at the systemic
level is administered by the oral route in animal studies is useful
for local topical deliver of LFA-1 antagonists in the treatment of
inflammatory diseases of the gastrointestinal (GI) tract, including
Crohn's disease and irritable bowel syndrome, or other GI disease
mediated by LFA-1 or other leucocyte integrins including VLA4 and
Mac-1.
[0009] In some embodiments, the disorder that is mediated by LFA-1
is an eye disorder. In some embodiments the inflammatory disorder
that is mediated by LFA-1 is dry eye. In particular, the methods of
the present invention are useful for treatment of dry eye syndrome.
This syndrome encompasses symptoms caused by: keratoconjunctivitis
sicca, Sjorgen's syndrome, corneal injury, age-related dry eye,
Stevens-Johnson syndrome, congenital alachrima, pharmacological
side effects, infection, Riley-Day syndrome, conjunctival fibrosis,
eye stress, glandular and tissue destruction, ocular cicatrical
pemphogoid, blepharitis, autoimmune and other immunodeficient
disorders, allergies, diabetes, lacrimal gland deficiency, lupus,
Parkinson's disease, Sjogren's syndrome, rheumatoid arthritis,
rosacea, environmental exposure to excessively dry air, airborne
particulates, smoke, and smog and inability to blink, amongst
others. Many patients suffering from dry eye may also have an
underlying autoimmune disease, Sjogren's syndrome. Currently
recognized diagnostic criteria for patient identification include
clinical signs and symptoms of dry mouth. The compounds of the
present invention may be useful in treating this symptom, in
formulations of mouthwash or lozenges. A skin cream applied to the
outer surface of the eyelids thus delivering a LFA-1 antagonist
across the eyelid to the inner lining of the eyelid and the
intervening conjunctival tissue and accessory lacrimal glands is
desirable in treating LFA-1 mediated inflammation of the eyelid and
eye, particularly in the treatment of dry eye.
[0010] Another aspect of the present invention provides
pharmaceutical compositions which comprise a LFA-1 antagonist for
administration in the methods of treatment of inflammatory
disorders mediated by LFA-1. In some embodiments the inflammatory
disorder mediated by LFA-1 is an eye disorder for which
pharmaceutical compositions which comprise a LFA-1 antagonist are
provided. In some embodiments the inflammatory disorder mediated by
LFA-1 is dry eye, for which pharmaceutical compositions which
comprise a LFA-1 antagonist have been provided. It is further
provided that the compositions may further comprise another
therapeutic agent to be co-administered either in the same
formulation or separately. In some embodiments, the pharmaceutical
compositions are administered orally, via injection, intranasally,
via inhalation, rectally, topically, via instillation to the ocular
surface, or transdermally.
[0011] In another aspect, the present invention provides
formulations for the compositions which are adminstered in the
methods of treatment of inflammatory disorders mediated by LFA-1.
In some embodiments, gastro-retentive formulations of compositions
are provided for administration to treat inflammatory disorders
mediated by LFA-1. In some embodiments, gastro-retentive
formulations of compositions are provided for administration to
treat eye disorders which are inflammatory disorders mediated by
LFA-1. In some embodiments, ocular formulations of compositions are
provided for administration to treat dry eye which is the
inflammatory disorder mediated by LFA-1. In some embodiments,
ocular formulations of compositions are provided for administration
to treat inflammatory disorders mediated by LFA-1. In some
embodiments, formulations of compositions are provided for
administration to treat inflammatory disorders mediated by LFA-1,
which are solutions, creams, powders, suspensions, mists, gels,
solids, and the like. Controlled release formulations are also
provided for in some embodiments of the invention. In some
embodiments of the invention, the compounds of the invention are
formulated as prodrugs.
[0012] In another aspect, compounds are provided for use in the
methods of the invention. Compounds that are useful in the methods
of the invention include antibodies, fragments of antibodies,
polypeptides, peptides, polymers, and organic small molecules. In
another an embodiment of the method of the present invention,
Raptiva is used in an ocular formulation to treat dry eye.
[0013] One aspect of the invention combines a diagnostic with a
method of treatment with an LFA-1 antagonist. In one embodiment, a
diagnostic test for Sjorgren's is performed and after a diagnosis
of the disease is made, the patient is administered an LFA-1
antagonist as described herein. In another embodiment, a diagnostic
test for dry eye is performed and after a diagnosis of dry eye is
made, the patient is administered an LFA-1 antagonist as described
herein.
[0014] The compounds provided herein are administered to increase
tear or mucin production to a subject suffering from an
inflammatory disorder mediated by LFA-1. Preferably, the
inflammatory disorder treated is an eye disorder. Even more
preferably, the inflammatory disorder is dry eye.
[0015] In another aspect, a method for identifying inhibitors of
the LFA-1:ICAM-1 interaction is provided. In some embodiments, the
inhibitors are identified as being directly competitive with ICAM-1
binding to LFA-1 at the .mu.L subunit of LFA-1. In some
embodiments, the method utilizes competitive binding experiments to
identify antagonists of the LFA-1: ICAM-1 interaction. In some
embodiments, labeled probe molecules which are known to bind at
metal ion dependent adhesion site of the LFA-1:ICAM-1 interaction
on the .mu.L subunit of LFA-1 are employed.
[0016] In another aspect a method of identifying useful
pharmaceutical agents for human disease is described using the
pattern of the inhibition of cell growth by siRNA (small
interfering RNA sequences) directed against a cellular target
involved in cell growth and human disease to identify compounds
with a similar pattern of cell growth inhibition in a group of
cultured cell lines. The methods of this invention can also be used
to identify useful inhibitors of LFA-1, the B-cell receptor BR3,
Grb2 (a protein downstream of growth factor receptors in signaling
cascades) and other protein targets inside and outside of cells. In
another embodiment of this invention, the identification of
compounds which fit an activity pattern opposite of the inhibition
of cell growth by siRNA can be stimulants of cell growth useful in
diseases and conditions of slow cell growth. Enhanced cell growth
could be useful in wound healing and other clinical settings. In
another embodiment of this invention, this method uses siRNA
cellular activity data for target or selection of targets by
searching public and/or proprietary databases of compound cellular
activity for a pattern of similar cellular activity in response to
a compound or collection of compounds as a method to identify
compounds useful in the identification of a human
pharmaceutical
INCORPORATION BY REFERENCE
[0017] All publications and patent applications mentioned in this
specification are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings of which:
[0019] FIG. 1 depicts rolling, adhesion of leukocytes and
transendothelial migration resulting from LFA-1:ICAM-1
interaction.
[0020] FIG. 2 depicts antigen activation of the LFA-1:ICAM-1
interaction.
[0021] FIG. 3 depicts co-stimulatory function of the LFA-1:ICAM-1
interaction.
[0022] FIG. 4 depicts small molecule antagonists useful in the
methods of identification.
[0023] FIG. 5 depicts Table 1 showing cation dependence of small
molecule antagonists for LFA-1.
[0024] FIG. 6 depicts SDS-PAGE analysis of compound 5 crosslinked
LFA-1.
[0025] FIG. 7 depicts binding of compound 2B and ICAM-1-Ig to 293
cells expressing wild type LFA-1 or LFA-1 lacking the I domain.
[0026] FIG. 8 depicts antagonist competition by compounds 2A, 3,
A-286982 and sICAM-1 in the LFA-1/ICAM-1 and LFA-1/small molecule
ELISAs.
[0027] FIG. 9 depicts correlation of IC50 values from antagonist
competition in the LFA-1/ICAM-1 and LFA-1/small molecule
ELISAs.
[0028] FIG. 10 depicts effect of antagonists on ligand binding in
the LFA-1/ICAM-1 and LFA-1/small molecule ELISAs.
[0029] FIG. 11 depicts Schild regressions of sICAM-1 and compound 3
antagonism.
[0030] FIG. 12 depicts flow diagram of the discovery of potent
inhibitors of cell growth for the treatment of human cancer and
inflammation.
DETAILED DESCRIPTION OF THE INVENTION
I. Interaction of Leukointegrins and Adhesion Receptors: Biology
and Diseases
[0031] A first aspect of the present invention is methods for the
treatment of the inflammatory component of immune and other
disorders. In particular, the methods described herein are useful
for the treatment of leukocyte mediated inflammation. This
component plays a role in initiating and advancing inflammation in
selected diseases, such as psoriasis, eczema, asthma, dermatitis,
rheumatoid arthritis, systemic lupus erythematosis (SLE), multiple
sclerosis, responses associated with inflammatory bowel disease,
Reynaud's syndrome, Sjorgen's disease, juvenile onset diabetes,
diabetes mellitus, granulomatosis, CNS inflammatory disorder,
multiple organ injury disease, all types of transplantations,
including graft versus host or host versus graft disease, HIV and
rhinovirus infections, and atherosclerosis amongst other
diseases.
[0032] A preferred embodiment of this invention is for the
treatment of eye disorders. In particular, the methods of the
present invention are useful for treatment of dry eye syndrome.
This syndrome encompasses symptoms caused by: keratoconjunctivitis
sicca, Sjorgen's syndrome, corneal injury, age-related dry eye,
Stevens-Johnson syndrome, congenital alachrima, pharmacological
side effects, infection, Riley-Day syndrome, conjunctival fibrosis,
eye stress, glandular and tissue destruction, ocular cicatrical
pemphogoid, blepharitis, autoimmune and other immunodeficient
disorders, allergies, diabetes, lacrimal gland deficiency, lupus,
Parkinson's disease, Sjogren's syndrome, rheumatoid arthritis,
rosacea, environmental exposure to excessively dry air, airborne
particulates, smoke, and smog and inability to blink, amongst
others.
[0033] Not intending to limit the mechanism of action, the methods
of the present invention involve the inhibition of initiation and
progression of inflammation related disease by inhibiting the
interaction between LFA-1 and ICAM-1. LFA-1 and ICAM-1 are
molecules with extracellular receptor domains which are involved in
the process of lymphocyte/leukocyte migration and proliferation,
leading to a cascade of inflammatory responses. In preferred
embodiments, such methods provide anti-inflammatory effects
in-vitro and in-vivo, e.g., as described in more detail below, and
are useful in the treatment of inflammation mediated diseases, and
in particular, dry eye disease.
[0034] Human blood contains white blood cells (leukocytes) which
are further classified as neutrophils, lymphocytes (with B- and
T-subtypes), monocytes, eosinophils, and basophils. Several of
these classes of leukocytes, neutrophils, eosinophils, basophils
and lymphocytes, are involved in inflammatory disorders. LFA-1 is
one of a group of leucointegrins which are expressed on most
leucocytes, and is considered to be the lymphoid integrin which
interacts with a number of ICAMs as ligands. Disrupting these
interactions, and thus the immune/inflammatory response provides
for reduction of inflammation, in particular, inflammation of the
eye.
[0035] For example, ICAM-1 (CD54) is a member of the ICAM family of
adhesion receptors (ICAM-1, ICAM-2, ICAM-3, ICAM-4) in the
immunoglobulin protein super family, and is expressed on activated
leucocytes, dermal fibroblasts, and endothelial cells. See Krensky,
A.M.; Sanchez-Madrid, F.; Robbins, E.; Nagy, J. A.; Springer, T. A.
Burakoff, S. J. "The functional significance, distribution, and
structure of LFA-1, LFA-2, and LFA-3: cell surface antigens
associated with CTL-target interactions." 1983 J. Immunol. 131,
611-616. It is normally expressed on the endothelial cells lining
the vasculature, and is upregulated upon exposure to cytokines such
as IL-1, LPS and TNF during immune/inflammatory initiation.
[0036] Research conducted over the last decade has helped elucidate
the molecular events involved in the movement and activation of
cells in the immune system, focusing on cell-to-cell triggering
interactions within the cascade. See Springer, T. A. "Adhesion
receptors of the immune system." Nature, 1990, 346, 425-434. The
interaction of Intercellular Adhesion Molecules (ICAMs) with
leukointegrins plays a role in the functioning of the immune
system. It is believed that immune processes such as antigen
presentation, T-cell mediated cytotoxicity and leukocyte
transendothelial migration (diapedesis) require cellular adhesion
mediated by ICAMs interacting with leukointegrins. See Kishimoto,
T. K.; Rothlein; R. R."Integrins, ICAMs, and selectins: role and
regulation of adhesion molecules in neutrophil recruitment to
inflammatory sites." Adv. Pharmacol. 1994, 25, 117-138 and Diamond,
M.; Springer, T. A. "The dynamic regulation of integrin
adhesiveness." Current Biology, 1994, 4, 506-532.
[0037] The interaction of ICAM-1 and LFA-1 (also referred to as
.alpha..sub.L.beta..sub.2 and CD11a/CD 18) has been shown to be
involved in the processes of adhesion, leukocyte transendothelial
migration, migration to sites of injury, and proliferation of
lymphocytes at the activated target site, as shown in FIG. 1. For
example, it is presently believed that prior to leukocyte
transendothelial migration, a component of the inflammatory
response, the presence of cytokines/chemokines activate integrins
constitutively expressed on leukocytes. Blood vessel endothelial
cells also upregulate ICAM-1 in response to the presence of the
same cytokines/chemokines. As rolling leukocytes approach activated
endothelial cells, their progress is first slowed by these
upregulated ICAM-1 receptors. This is followed by a ligand/receptor
interaction between LFA-1 and ICAM-1, expressed on blood vessel
endothelial cell surfaces, which arrests the lymphocyte from
rolling further. The lymphocyte then flattens, and transvasation
takes place. This process is of importance both in lymphocyte
transmigration through vascular endothelial as well as lymphocyte
trafficking from peripheral blood to lymph nodes.
[0038] LFA-1 plays a role in creating and maintaining the
immunological synapse, which may be defined as the physical
structure of the interacting surfaces of T cells and Antigen
Presenting Cells (APCs), as shown in FIG. 2. LFA-1 stabilizes
T-cell engagement with the APC, and thus leads to activation of T
cells. The interaction of LFA-1 and ICAM-1 also appears to provide
co-stimulatory signals to resting T cells, as shown in FIG. 3. CD4+
T-cell proliferation and cytokine synthesis are mediated by this
interaction as part of the inflammatory response.
[0039] Given the role that the interaction of ICAM-1 and LFA-1
plays in immune/inflammatory response, it is desirable to modulate
these interactions to achieve a desired therapeutic result (e.g.,
inhibition of the interaction in the event of an overactive
inflammatory response). Also, since LFA-1 has several ligand
partners within the ICAM family (ICAM-1, ICAM-2 and ICAM-3),
involving a number of signaling pathways, in some embodiments of
the invention, it is desirable to modulate these interactions
selectively. It has been demonstrated that the antagonism of the
interaction between ICAMs and leukointegrins can be realized by
agents directed against either component.
[0040] The methods and compositions described herein can modulate
one or more components of the pathways described herein. In
addition to inhibiting interaction between LFA-1 and ICAM-1, the
methods and compositions of the present invention may also
intervene in either earlier or later portions of the inflammatory
process as well. For example, upregulation of ICAM-1 or LFA-1
(activation) on endothelial cells or leukocytes, prior to tethering
and transendothelial migration, may be modulated by the methods and
compositions described herein. The present invention may be useful
in modulating the expression of cytokines or chemokines that
activate ICAM-1 and LFA-1 in the course of leukocyte trafficking,
in modulating the transport of the cytokines or chemokines, in
preventing transvasation of the arrested leukocyte, in modulating
signalling via other mechanisms that are involved in leukocyte
proliferation at the site or injury or inflammation, and the
like.
II. Methods of Treatment
[0041] The term "subject" as used herein includes animals, in
particular humans as well as other mammals. The methods generally
involve the administration of one or more drugs for the treatment
of one or more diseases. Combinations of agents can be used to
treat one disease or multiple diseases or to modulate the
side-effects of one or more agents in the combination. The
compounds described herein can be used in combination with other
dry eye treatment agents. Also, the compounds of the invention can
be used with drugs that cause dry eye as a side effect.
[0042] The term "treating" and its grammatical equivalents as used
herein includes achieving a therapeutic benefit and/or a
prophylactic benefit. By therapeutic benefit is meant eradication
or amelioration of the underlying disorder being treated. Also, a
therapeutic benefit is achieved with the eradication or
amelioration of one or more of the physiological symptoms
associated with the underlying disorder such that an improvement is
observed in the subject, notwithstanding that the subject may still
be afflicted with the underlying disorder. For prophylactic
benefit, the compositions may be administered to a subject at risk
of developing a particular disease, or to a subject reporting one
or more of the physiological symptoms of a disease, even though a
diagnosis of this disease may not have been made. The compositions
may be administered to a subject to prevent progression of
physiological symptoms or of the underlying disorder.
[0043] In some embodiments, the therapeutic agent is present in an
amount sufficient to exert a therapeutic effect by an average of at
least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more
than 90%, or substantially eliminate the disease or at least one of
its underlying symptoms. Preferably the therapeutic effect is an
effect on inflammation.
[0044] In some embodiments, the therapeutic agent is present in an
amount sufficient to exert a therapeutic effect to reduce symptoms
of dry eye by an average of at least about 5, 10, 15, 20, 25, 30,
40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate
symptoms of dry eye.
[0045] In some embodiments, an effective amount of the therapeutic
agent is a daily dose of about 1.times.10.sup.-11,
1.times.10.sup.-10, 1.times.10.sup.-9, 1.times.10.sup.-8,
1.times.10.sup.-7, 1.times.10.sup.-6, 1.times.10.sup.-5,
1.times.10.sup.-4, 1.times.10.sup.-3, 1.times.10.sup.-2,
1.times.10.sup.-1, 1, 1.times.10.sup.1, 1.times.10.sup.2 grams.
[0046] Administration of the therapeutic agent may be by any
suitable means. In some embodiments, the therapeutic agent is
administered by oral administration. In some embodiments, the
therapeutic agent is administered by transdermal administration. In
some embodiments, the therapeutic agent is administered by
injection. In some embodiments, the therapeutic agent is
administered topically. If combinations of agents are administered
as separate compositions, they may be administered by the same
route or by different routes. If combinations of agents are
administered in a single composition, they may be administered by
any suitable route. In some embodiments, combinations of agents are
administered as a single composition by oral administration. In
some embodiments, combinations of agents are administered as a
single composition by transdermal administration. In some
embodiments, the combinations of agent are administered as a single
composition by injection. In some embodiments, the combinations of
agent are administered as a single composition topically.
[0047] The method of the invention described herein is a method of
administering an antagonist of LFA-1 to a subject to treat dry eye.
In particular, the LFA-1 antagonist can modulate inflammation
mediated by leukocytes. A preferred embodiment of the invention
treats a subject by administering an antagonist of LFA-1 to
modulate inflammation associated with ocular inflammation. Another
preferred embodiment of the method is to treat a subject with
inflammation associated with dry eye syndrome by administering an
antagonist of LFA-1. An embodiment of the invention treats a
subject with symptoms of dry eye due to allergies. An embodiment of
the invention treats a subject with symptoms of dry eye disorder
due to diabetes. An embodiment of the invention treats a subject
with symptoms of dry eye disorder due to lacrimal gland deficiency.
An embodiment of the invention treats a subject with symptoms of
dry eye disorder due to lupus. An embodiment of the invention
treats a subject with symptoms of dry eye disorder due to
Parkinson's disease. An embodiment of the invention treats a
subject with symptoms of dry eye disorder due to Sjogren's disease.
An embodiment of the invention treats a subject with symptoms of
dry eye disorder due to rheumatoid arthritis. An embodiment of the
invention treats a subject with symptoms of dry eye disorder due to
rosacea. An embodiment of the invention treats a subject with
symptoms or dry eye disorder due to complications arising from
LASIK therapy for vision correction. An embodiment or the invention
treats a subject with symptoms of dry eye disorder due to use of
contact lenses. An embodiment of the invention treats a subject
with symptoms of dry eye disorder due to exposure to arid climates.
An embodiment of the invention treats a subject with symptoms of
dry eye disorder due to exposure to air pollution. An embodiment of
the invention treats a subject with symptoms of dry eye disorder
due to windy climates. An embodiment of the invention treats a
subject with symptoms of dry eye disorder due to exposure due to
cigarette smoke. An embodiment of the invention treats a subject
with symptoms of dry eye disorder due to keratoconjunctivitis
sicca. An embodiment of the invention treats a subject with
symptoms of dry eye disorder due to cortical injury. An embodiment
of the invention treats a subject with symptoms of dry eye disorder
due to conjunctival fibrosis. An embodiment of the invention treats
a subject with symptoms or dry eye disorder due to age-related dry
eye. An embodiment of the invention treats a subject with symptoms
of dry eye disorder due to Stevens-Johnson syndrome. An embodiment
of the invention treats a subject with symptoms of dry eye disorder
due to congenital alachrima. An embodiment of the invention treats
a subject with symptoms of dry eye disorder due to pharmacological
side effects of other drugs being taken by the patient. An
embodiment of the invention treats a subject with symptoms of dry
eye disorder due to infection. An embodiment of the invention
treats a subject with symptoms of dry eye disorder due to Riley-Day
syndrome. An embodiment of the invention treats a subject with
symptoms of dry eye disorder due to eye stress, including that due
to computer use. An embodiment of the invention treats a subject
with symptoms of dry eye disorder due to glandular and tissue
destruction. An embodiment of the invention treats a subject with
symptoms of dry eye disorder due to ocular cicatrical pemphogoid.
An embodiment of the invention treats a subject with symptoms of
dry eye disorder due to blepharitis. An embodiment of the invention
treats a subject with symptoms of dry eye disorder due to
autoimmune and other immunodeficient disorders. An embodiment of
the invention treats a subject with symptoms of dry eye disorder
due to an inability to blink. An embodiment of the invention treats
a subject with symptoms of psoriasis with a LFA-1 antagonist of the
method. An embodiment of the invention treats a subject with
symptoms of eczema with a LFA-1 antagonist of the method. An
embodiment of the invention treats a subject with symptoms of lupus
with a LFA-1 antagonist of the method. An embodiment of the
invention treats a subject with symptoms of Reynaud's syndrome with
a LFA-1 antagonist of the method. An embodiment of the invention
treats a subject with symptoms of granulomatosis with a LFA-1
antagonist of the method. An embodiment of the invention treats a
subject with symptoms of CNS inflammatory disorder with a LFA-1
antagonist of the method. An embodiment of the invention treats a
subject with symptoms of multiple organ disease with a LFA-1
antagonist of the method. An embodiment of the invention treats a
subject with symptoms or allergic rhinitis with a LFA-1 antagonist
of the method. An embodiment of the invention treats a subject with
symptoms of granulomatosis with a LFA-1 antagonist of the method.
An embodiment of the invention treats a subject with symptoms of
atherosclerosis with a LFA-1 antagonist of the method. An
embodiment of the invention treats a subject with symptoms of graft
versus host disease with a LFA-1 antagonist of the method. An
embodiment of the invention treats a subject with symptoms of host
versus graft disease with a LFA-1 antagonist of the method. An
embodiment of the invention treats a subject with symptoms of
inflammatory response associated with transplantation with a LFA-1
antagonist of the method. An embodiment of the invention treats a
subject with symptoms of inflammatory bowel disease with a LFA-1
antagonist of the method. An embodiment or the invention treats a
subject with symptoms or juvenile onset diabetes with a LFA-1
antagonist or the method. An embodiment of the invention treats a
subject with symptoms of diabetes mellitus with a LFA-1 antagonist
of the method. An embodiment of the invention treats a subject with
symptoms of multiple sclerosis with a LFA-1 antagonist of the
method. An embodiment of the invention treats a subject with
symptoms of asthma with a LFA-1 antagonist of the method. An
embodiment of the invention treats a subject with symptoms of
dermatitis with a LFA-1 antagonist of the method. An embodiment of
the invention treats a subject with symptoms of systemic lupus
erythematosis with a LFA-1 antagonist of the method. An embodiment
of the invention treats a subject with symptoms of HIV and
rhinovirus infections with a LFA-1 antagonist of the method.
[0048] In some embodiments of the invention, diagnostic procedures
will be employed to identify a subject in need of treatment by the
method of the invention. Fluorescein staining of the cornea is used
to diagnose symptoms of dry eye disorder. Rose Bengal staining of
the cornea is used to diagnose symptoms of dry eye disorder.
Corneal sensitivity is used to diagnose symptoms of dry eye
disorder. Tear breakup time (BUT) is used to diagnose symptoms of
dry eye disorder. Schirmer test with anesthesia is used to diagnose
symptoms of dry eye disorder. Schirmer test analysis is used to
diagnose symptoms of dry eye disorder. Impression cytology is used
to diagnose symptoms of dry eye disorder. Subjective dry eye
symptoms are used to diagnose symptoms of dry eye disorder. Tear
flow analysis is used to diagnose symptoms of dry eye disorder.
Immunohistochemical methods, including but not limited to human
leukocyte antigen II (HLA-DR), are used to diagnose symptoms of dry
eye disorder. Antinuclear antibody test (ANA) or fluorescent
antinuclear antibody test (FANA) is used to diagnose symptoms of
dry eye disorder. Ocular evaporation is used to diagnose symptoms
of dry eye disorder. Infrared meibography is used to diagnose
symptoms of dry eye disorder. Tandem scanning confocal microscopy
(TSCM) is used to diagnose symptoms of dry eye disorder. This is an
exemplary list of procedures that may be used to diagnose symptoms
of dry eye and is in no way limiting.
[0049] The antagonist of the method of the invention may be an
antibody, fragment of an antibody, peptide or small molecule. In
preferred embodiments, the LFA-1 antagonist used is a peptide which
is not an antibody. The antagonist of the method is a therapeutic
agent.
[0050] Many therapeutic indications for LFA-1 antagonists require
chronic therapy; therefore, small molecule inhibitors of the
LFA-1/ICAM-1 interaction are one group or preferred embodiments of
this invention as they have the potential for oral administration
as well as a lowered cost of goods.
[0051] A further preferred embodiment is a method of treating dry
eye disease using therapeutic agents which are suitable for
formulation and administration as ocular therapeutics.
[0052] Another aspect of the present invention is described herein
and below, a method of comparison of the binding of ICAM-1 and
antagonists which can be utilized to identify antibodies, antibody
fragments, peptides, and small molecules as antagonists of the
LFA-1:ICAM-1 interaction. See Gadek et al. 2002. The method is
described in terms of identifying small molecule antagonists.
However, it should not be interpreted as limiting the method in any
manner to exclude its use in identifying larger molecule types of
inhibitors of LFA-1, such as antibodies, fragments of antibodies or
peptides.
[0053] This method comprises choosing one or more of the following
steps as part of the process of identifying an antagonist as a
directly competitive inhibitor of LFA-1: (a) competition
experiments utilizing full length wild type LFA-1 comparing the
binding of potential antagonistic agents to that of sICAM-1 (the
extracellular domains of LFA-1's native ligand and a competitive
LFA-1/ICAM-1 inhibitor) and A-286982 (an allosteric LFA-1/ICAM-1
inhibitor known to bind to the I (inserted) domain allosteric site
(IDAS)). See Liu, G.; Huth, J. R.; Olejniczak, E. T.; Mendoza, R.;
DeVries, P.; Leitza, S.; Reilly; E. B., Okasinski; G. F.; Fesik, S.
W.; and von Geldern, T. W. 2001. "Novel p-arylthio cinnamides as
antagonists of leukocyte function-associated
antigen-1/intracellular adhesion molecule-1 interaction. 2.
Mechanism of inhibition and structure-based improvement of
pharmaceutical properties." J. Med. Chem., 44, 1202-1210)), (h)
binding studies of potential antagonistic agents and ICAM-1 with a
LFA-1 mutant, and (c) chemical crosslinking studies. The ICAM-1
binding site targeted herein has previously been localized to
include the metal ion dependent adhesion site (MIDAS) motif within
the I domain of the LFA-1 .alpha. subunit. See Shimaoka, M., Xiao,
T., Liu, J.-H., Yang, Y., Dong, Y., Jun, C-D., McCormack, A. Zhang,
R., Joachimiak, A., Takagi, J., Wang, J.-H., and Springer, T. A.
2003 "Structures of the alpha L I domain and its complex with
ICAM-1 reveal a shape-shifting pathway for integrin regulation"
Cell 2003, 99-111. Antagonists that inhibit ICAM-1 binding to LFA-1
by direct competition for a common high affinity binding site on
LFA-1 can be identified using one or more steps of this method.
[0054] A. Antibodies as Therapeutic Agents
[0055] Several suitable antibodies are known in the art. Blocking
of the CAMs, such as for example ICAM-1, or the leukointegrins,
such as for example, LFA-1, by antibodies directed against either
or both or these molecules can inhibit inflammatory response.
Previous studies have investigated the effects of anti-CD11a MAbs
on many T-cell-dependent immune functions in vitro and a number of
immune responses in vivo. In vitro, anti-CD11a MAbs inhibit T-cell
activation (See Kuypers T. W., Roos D. 1989 "Leukocyte membrane
adhesion proteins LFA-1, CR3 and p150,95: a review of functional
and regulatory aspects" Res. Immunol., 140:461-465; Fischer A,
Durandy A, Sterkers G, Griscelli C. 1986 "Role of the LFA-1
molecule in cellular interactions required for antibody production
in humans" J. Immunol., 136, 3198; target cell lysis by cytotoxic
T-lymphocytes (Krensky et al., supra), formation of immune
conjugates (Sanders V M, Snyder J M, Uhr J W, Vitetta E S.,
"Characterization of the physical interaction between
antigen-specific B and T cells". J. Immunol., 137:2395 (1986);
Mentzer S J, Gromkowski S U, Krensky A M, Burakoff S J, Martz E.
1985 "LFA-1 membrane molecule in the regulation of homotypic
adhesions of human B lymphocytesn" J. Immunol., 135:9), and the
adhesion of T-cells to vascular endothelium (Lo S K, Van Seventer G
A, Levin S M, Wright S D., Two leukocyte receptors (CD11a/CD18 and
CD11b/CD18) mediate transient adhesion to endothelium by binding to
different ligands., J. Immunol., 143:3325 (1989)). Two anti-CD11a
MAbs, HI 111, and G43-25B are available from Pharmingen/BD
Biosciences. Additionally, a study including F8.8, CBR LFA 1/9,
BL5, May.035, TS1/11, TS1/12, TS1/22, TS2/14, 25-3-1, MHM2 and
efalizumab evaluated the range of binding sites on LFA-1 these
antibodies occupied. See Lu, C; Shimaoka, M.; Salas, A.; Springer,
T. A. 2004, "The Binding Sites for Competitive Antagonistic,
Allosteric Antagonistic, and Agonistic Antibodies to the I Domain
of Integrin LFA-1" J. Immure. 173: 3972-3978 and references
therein.
[0056] The observation that LFA-1:ICAM-1 interaction is necessary
to optimize T-cell function in vitro, and that anti-CD11a MAbs
induce tolerance to protein antigens (Benjamin R J, Qin S X, Wise M
P, Cobbold S P, Waldmann H. 1988 "Mechanisms of monoclonal
antibody-facilitated tolerance induction: a possible role for the
CD4 (L3T4) and CD11a (LFA-1) molecules in self-non-self
discrimination" Eur. J. Immunol., 18:1079) and prolongs tumor graft
survival in mice (Heagy W, Walterbangh C, Martz E. 1984 "Potent
ability of anti-LFA-1 monoclonal antibody to prolong allograft
survival" Transplantation, 37: 520-523) was the basis for testing
the MAbs to these molecules for prevention of graft rejection in
humans. Experiments have also been carried out in primates. For
example, based on experiments in monkeys, it has been suggested
that a MAb directed against ICAM-1 can prevent or even reverse
kidney graft rejection (Cosimi et al., "Immunosuppression of
Cynomolgus Recipients of Renal Allografts by R6.5, a Monoclonal
Antibody to Intercellular Adhesion Molecule-1," in Springer et al.
(eds.), Leukocyte Adhesion Molecules New York: Springer, (1988), p.
274; Cosimi et al., J. Immunology, 144:4604-4612 (1990)).
Furthermore, the in vivo administration of MAb to cynomolgus
monkeys prolonged skin allograft survival See Berlin et al.,
Transplantation, 53: 840-849 (1992).
[0057] B. Small Molecules
[0058] Peptides have been investigated for use in reducing the
interaction of LFA-1 with ICAM-1. Polypeptides that do not contain
an Fc region of an IgG are described in U.S. Pat. No. 5,747,035,
which can be used to treat LFA-1 mediated disorders, in particular
dry eye. Use of dual peptides, the first a modulator of ICAM-1 and
the second a blocking peptide with a sequence obtained from LFA-1
is described in U.S. Pat. No. 5,843,885 to reduce the interactions
between LFA-1 and ICAM-1. Cyclic peptides have been described in
U.S. Pat. No. 6,630,447 as inhibitors of the LFA-1:ICAM-1
interaction.
[0059] Small molecule antagonists include statins whichbind to the
CD11a domain of LFA-1. See Kallen, J., Welzenbach, K., Ramage, P.
Geyl, D. Kriwacki, R., Legge, G., Cottens, S., Weitz-Schmidt, G.,
and Hommel, U. 1999. "Structural basis for LFA-1 inhibition upon
lovastatin binding to the CD11a I-domain", J. Mol. Biol., 292: 1-9;
and Weitz-Schmidt, G., Welzenbach, K., Brinkmann, V., Kamata, T.,
Kallen, J., Bruns, C., Cottens, S., Takada, Y., and Hommel, U.
2001. Statins selectively inhibit leukocyte function antigen-1 by
binding to a novel regulatory integrin site, Nature Med., 7:
687-692; and Frenette, P. S. 2001. "Locking a leukocyte integrin
with statins", N. Engl. J. Med., 345: 1419-1421. Molecules derived
from the mevinolin/compactin motif also show activity against
LFA-1. See Welzenbach, K., Hommel, U., and Weitz-Schmidt, G. 2002.
"Small molecule inhibitors induce conformational changes in the I
domain and the I-like domain of Lymphocyte Function-Associated
Antigen-1", J. Biol. Chem., 277: 10590-10598, and U.S. Pat. No.
6,630,492.
[0060] A family or hydantoin-based inhibitors can also be used as
antagonists. See Kelly, T. A., Jeanfavre, D. D., McNeil, D. W.,
Woska, J. R. Jr., Reilly, P. L., Mainolfi, E. A., Kishimoto, K. M.,
Nabozny, G. H., Zinter, R., Bormann, B.-J., and Rothlein, R. 1999.
"Cutting edge: a small molecule antagonist of LFA-1-mediated cell
adhesion", J. Immunol., 163: 5173-5177. These compounds are
believed to be allosteric inhibitors of LFA-1.
[0061] A family of novel p-arylthio cinnamides can act as
antagonists of LFA-1. See Liu, G.; Link, J. T.; Pei, Z.; Reilly, E.
B.; Nguyen, B.; Marsh, K. C.; Okasinski, G. F.; von Geldern, T. W.;
Ormes, M.; Fowler, K.; Gallatin, M. 2000 "Discovery of novel
p-arylthio cinnamides as antagonists of leukocyte
function-associated antigen-1/intracellular adhesion molecule-1
interaction. 1. Identification of an additional binding pocket
based on an anilino diaryl sulfide lead." J. Med. Chem. 43,
4015-4030.
[0062] Other families of small molecule inhibitors are disclosed in
publications (See Gadek, T. R., Burdick, D. J., McDowell, R. S.,
Stanley, M. S., Marsters, J. C. Jr., Paris, K. J., Oare, D. A.,
Reynolds, M. E., Ladner, C., Zioncheck, K. A., Lee, W. P.,
Gribling, P., Dennis, M. S., Skelton, N. J., Tumas, D. B., Clark,
K. R., Keating, S. M., Beresini, M. H., Tilley, J. W., Presta, L.
G., and Bodary, S.C. 2002. "Generation of an LFA-1 antagonist by
the transfer of the ICAM-1 immunoregulatory epitope to a small
molecule" Science, 295: 1086-1089 and online supplementary
material.) and in patents, including U.S. Pat. No. 6,872,735, U.S.
Pat. No. 6,667,318, U.S. Pat. No. 6,803,384, U.S. Pat. No.
6,515,124, U.S. Pat. No. 6,331,640, and patent applications,
including: U.S. 20020119994. U.S. 20040058968, U.S. 20050080119,
WO99/49856, WO00/21920, WO01/58853, WO02/59114, WO05/044817, and
others. The contents of all the cited references are incorporated
in their entirety by reference.
[0063] In some embodiments, the compounds described herein are used
in combination with restasis (Cyclosporine A). The compounds of the
invention can also be used to increase mucin production and/or tear
production. Thus, the compounds of the present invention can offer
additional relief beyond decreasing inflammation and by also
increasing the mucin production that makes up a portion of tear
film.
[0064] The interaction of LFA-1 and ICAMs are known to be involved
in various autoimmune and inflammatory diseases, particularly those
with involvement of lymphocytic (T- or B-cell), dendritic,
monocytic cells expressing LFA-1 on their surface as part of the
inflammatory component of disease. LFA-1 antagonists can be
particularly useful in treatment of these diseases because the
therapeutic target's expression in diseased tissue is limited to
infiltrating cells of the immune system. LFA-1 can block the
adhesion, migration, proliferation, and release of inflammatory
signals to surrounding tissue by immune system cells. The
anti-LFA-1 antibody, Raptiva, which has an effect on inflammatory
cells in diseased tissue may be used to treat dry eye.
[0065] Many patients suffering from dry eye may also have an
underlying autoimmune disease, Sjogren's syndrome. Currently
recognized diagnostic criteria include clinical signs and symptoms
of Dry Mouth. The compounds of the present invention may be useful
in treating this symptom, in formulations of mouthwash or lozenges.
A lozenge incorporating the compounds of the invention in a solid
or waxy material may stimulate salivary secretion while releasing
the compound of the invention under sustained release.
[0066] Patients with immune mediated allergic diseases including
rhinitis may be treated with the compounds of the invention. For
example, a LFA-1 antagonist may be delivered locally to the nose,
nasal passages, and/or nasal cavity to reduce the inflammation
associated immune and/or allergic responses.
[0067] A local administration of the compounds of the invention,
delivered via the mouth or nose as a misted solution or dispersed
powder may be useful in the treatment of Asthma or other LFA-1
mediated pulmonary inflammatory diseases.
[0068] A cream formulation of the compounds of the invention could
be useful in the local delivery of a LFA-1 antagonist to the skin
in dermatologic diseases mediated by LFA-1 such as eczema and
psoriasis. Compounds useful in this regard include LFA-1
antagonists and their pro-drugs which are transformed into the
active drug in inflamed skin. A skin cream applied to the outer
surface of the eyelids thus delivering a LFA-1 antagonist across
the eyelid to the inner lining of the eyelid and the intervening
conjunctival tissue and accessory lacrimal glands may be desirable
in treating LFA-1 mediated inflammation of the eyelid and eye,
particularly in the treatment of dry eye.
[0069] An oral formulation of a LFA-1 antagonist which is known to
be poorly absorbed at the systemic level by the oral route in
animal studies may be useful for local topical deliver of LFA-1
antagonists in the treatment of inflammatory diseases of the
gastrointestinal (GI) tract, including Crohn's disease and
Irritable Bowel Syndrome, or other GI disease mediated by LFA-1 or
other leucocyte integrins including VLA4 and Mac-1.
II. Compounds Useful in the Method
A. Definitions
[0070] The term "aliphatic", as used herein, includes both
saturated and unsaturated, straight chain (unbranched) or branched
aliphatic hydrocarbons, which are optionally substituted with one
or more functional groups. As will be appreciated by one of
ordinary skill in the art, "aliphatic" is intended herein to
include, but is not limited to, alkyl, alkenyl, alkynyl moieties.
Thus, as used herein, the term "alkyl" includes straight and
branched alkyl groups. An analogous convention applies to other
generic terms such as "alkenyl", "alkynyl" and the like.
[0071] Furthermore, as used herein, the terms "alkyl", "alkenyl",
"alkynyl", and the like encompass both substituted and
unsubstituted groups. In certain embodiments, as used herein,
"lower alkyl" is used to indicate those alkyl groups (substituted,
unsubstituted, branched or unbranched) having about 1-6 carbon
atoms.
[0072] In certain embodiments, the alkyl, alkenyl and alkynyl
groups employed in the invention contain about 1-20 aliphatic
carbon atoms. In certain other embodiments, the alkyl, alkenyl, and
alkynyl groups employed in the invention contain about 1-10
aliphatic carbon atoms. In yet other embodiments, the alkyl,
alkenyl, and alkynyl groups employed in the invention contain about
1-8 aliphatic carbon atoms. In still other embodiments, the alkyl,
alkenyl, and alkynyl groups employed in the invention contain about
1-6 aliphatic carbon atoms. In yet other embodiments, the alkyl,
alkenyl, and alkynyl groups employed in the invention contain about
1-4 carbon atoms. Illustrative aliphatic groups thus include, but
are not limited to, for example, methyl, ethyl, n-propyl,
isopropyl, allyl, n-butyl, sec-butyl, isobutyl, tert-butyl,
n-pentyl, sec-pentyl, isopentyl, tert-pentyl, n-hexyl, sec-hexyl,
moieties and the like, which again, may bear one or more
substituents.
[0073] Alkenyl groups include, but are not limited to, for example,
ethenyl, propenyl, butenyl, and the like. Representative alkynyl
groups include, but are not limited to, ethynyl, 2-propynyl and the
like.
[0074] The term "lower alkylene" as used herein refers to a
hydrocarbon chain which links together two other groups, i.e. is
bonded to another group at either end, for example methylene,
ethylene, butylene and the like. Such a substituent is preferably
from 1 to 10 carbons and more preferably from 1 to 5 carbons. Such
groups may be substituted, preferably with an amino, acetylamino (a
lower alkylcarbonyl group bonded via a nitrogen atom), or cyclo
lower alkyl group. By the latter is meant a saturated hydrocarbon
ring, preferably with a total of 3 to 10 methylenes (inclusive of
the attachment carbons), more preferably 3 to 6.
[0075] The term "alicyclic", as used herein, refers to compounds
which combine the properties of aliphatic and cyclic compounds and
include but are not limited to monocyclic, or polycyclic aliphatic
hydrocarbons and bridged cycloalkyl compounds, which are optionally
substituted with one or more functional groups.
[0076] As will be appreciated by one of ordinary skill in the art,
"alicyclic" is intended herein to include, but is not limited to,
cycloalkyl, cycloalkenyl, and cycloalkynyl moieties, which are
optionally substituted with one or more functional groups.
[0077] Illustrative alicyclic groups thus include, but are not
limited to, for example, cyclopropyl, --CH.sub.1-cyclopropyl,
cyclobutyl, --CH.sub.2-cyclobutyl, cyclopentyl, --CH.sub.2--
cyclopentyl, cyclohexyl, --CH.sub.2-cyclohexyl, cyclohexenylethyl,
cyclohexanylethyl, norbornyl moieties and the like, which again,
may bear one or more substituents.
[0078] The term "alkoxy" or "alkyloxy", as used herein refers to a
saturated or unsaturated parent molecular moiety through an oxygen
atom. In certain embodiments, the alkyl group contains about 1-20
aliphatic carbon atoms. In certain other embodiments, the alkyl
group contains about 1-10 aliphatic carbon atoms. In yet other
embodiments, the alkyl group employed in the invention contains
about 1-8 aliphatic carbon atoms. In still other embodiments, the
alkyl group contains about 1-6 aliphatic carbon atoms. In yet other
embodiments, the alkyl group contains about 1-4 aliphatic carbon
atoms. Examples of alkoxy, include but are not limited to, methoxy,
ethoxy, isopropoxy, n-butoxy, i-butoxy, sec-butoxy, tert-butoxy,
neopentoxy, n-hexloxy and the like.
[0079] The term "lower alkoxy" as used herein refers to a lower
alkyl as defined above which may be branched or unbranched as also
defined above and which is bonded by an oxygen to another group
(i.e. alkyl ethers).
[0080] The term "thioalkyl" as used herein refers to a saturated or
unsaturated (i.e., S-alkenyl and S-alkynyl) group attached to the
parent molecular moiety through a sulfur atom. In certain
embodiments, the alkyl group contains about 1-20 aliphatic carbon
atoms. In certain other embodiments, the alkyl group contains about
1-10 aliphatic carbon atoms. In yet other embodiments, the alkyl
group employed in the invention contains about 1-8 aliphatic carbon
atoms. In still other embodiments, the alkyl group contains about
1-6 aliphatic carbon atoms. In yet other embodiments, the alkyl
group contains about 1-4 aliphatic carbon atoms. Examples of
thioalkyl include, but are not limited to, methylthio, ethylthio,
propylthio, isopropylthio, n-butylthio, and the like.
[0081] The term "lower alkylthio" as used herein refers to a lower
alkyl group bonded through a divalent sulfur atom, for example, a
methylmercapto or an isopropylmercapto group. By lower alkylenethio
is meant such a group which is bonded at each end.
[0082] The term "alkylamino" refers to a group having the
structure-NHR' wherein R' is alkyl, as defined herein. The term
"aminoalkyl" refers to a group having the structure NH.sub.2R'--,
wherein as defined herein. In certain embodiments, the alkyl group
contains about 1-20 aliphatic carbon atoms. In certain other
embodiments, the alkyl group contains about 1-10 aliphatic carbon
atoms. In yet other embodiments, the alkyl group employed in the
invention contains about aliphatic carbon atoms. In still other
embodiments, the alkyl group contains about 1-6 aliphatic carbon
atoms. In yet other embodiments, the alkyl group contains about 1-4
aliphatic carbon atoms. Examples of alkylamino include, but are not
limited to, methylamino, and the like.
[0083] Some examples of substituents of the above-described
aliphatic (and other) moieties of compounds of the invention
include, but are not limited to aliphatic; alicyclic;
heteroaliphatic; heterocyclic; aromatic; heteroaromatic; aryl;
heteroaryl; alkylaryl; heteroalkylaryl; alkylheteroaryl;
heteroalkylheteroaryl; alkoxy; aryloxy; heteroalkoxy;
heteroaryloxy; alkylthio; arylthio; heteroalkylthio; R.sub.x
independently includes, but is not limited to, aliphatic,
alicyclic, heteroaliphatic, heterocyclic, aryl, heteroaryl, alkyl
aryl, alkylheteroaryl, heteroalkyl aryl or heteroalkylheteroaryl,
wherein any of the aliphatic, alicyclic, heteroaliphatic,
heterocyclic, alkylaryl, or alkylheteroaryl substituents described
above and herein may be substituted or unsubstituted, branched or
unbranched, saturated or unsaturated, and wherein any of the aryl
or heteroaryl substituents described above and herein may be
substituted or unsubstituted. Additional examples of generally
applicable substituents are illustrated by the specific embodiments
shown in the Examples that are described herein.
[0084] In general, the term "aromatic moiety", as used herein,
refers to a stable mono- or polycyclic, unsaturated moiety having
preferably 3-14 carbon atoms, each of which may be substituted or
unsubstituted. In certain embodiments, the term "aromatic moiety"
refers to a planar ring having p-orbitals perpendicular to the
plane of the ring at each ring atom and satisfying the Huckel rule
where the number of pi electrons in the ring is (4n+2) wherein n is
an integer. A mono- or polycyclic, unsaturated moiety that does not
satisfy one or all of these criteria for aromaticity is defined
herein as "non-aromatic", and is encompassed by the term
"alicyclic".
[0085] In general, the term "heteroaromatic moiety", as used
herein, refers to a stable mono- or polycyclic, unsaturated moiety
having preferably 3-14 carbon atoms, each of which may be
substituted or unsubstituted; and comprising at least one
heteroatom selected from O, S, and N within the ring in place of a
ring carbon atom). In certain embodiments, the term "heteroaromatic
moiety" refers to a planar ring comprising at least one heteroatom,
having p-orbitals perpendicular to the plane of the ring at each
ring atom, and satisfying the Huckel rule where the number of pi
electrons in the ring is (4n+2) wherein n is an integer.
[0086] It will also be appreciated that aromatic and heteroaromatic
moieties, as defined herein may be attached via an alkyl or
heteroalkyl moiety and thus also include -(alkyl) aromatic,
-(heteroalkyl) aromatic, -(heteroalkyl) heteroaromatic, and
-(heteroalkyl) heteroaromatic moieties. Thus, as used herein, the
phrases"aromatic or heteroaromatic moieties" and "aromatic,
(heteroalkyl) aromatic, -(heteroalkyl) heteroaromatic, and
(heteroalkyl) heteroaromatic" are interchangeable. Substituents
include, but are not limited to, any of the previously mentioned
substituents, e., the substituents recited for aliphatic moieties,
or for other moieties as disclosed herein, resulting in the
formation of a stable compound.
[0087] The term "aryl", as used herein, does not differ
significantly from the common meaning of the term in the art, and
refers to an unsaturated cyclic moiety comprising at least one
aromatic ring. In certain embodiments, "aryl" refers to a mono- or
bicyclic carbocyclic ring system having one or two aromatic rings
including, but not limited to, phenyl, naphthyl,
tetrahydronaphthyl, indanyl, indenyl and the like.
[0088] The term "heteroaryl" as used herein, does not differ
significantly from the common meaning of the term in the art, and
refers to a cyclic aromatic radical having from five to ten ring
atoms of which one ring atom is selected from S, and N; zero, one
or two ring atoms are additional heteroatoms independently selected
from S, and N; and the remaining ring atoms are carbon, the radical
being joined to the rest of the molecule via any of the ring atoms,
such as, for example, pyridyl, pyrazinyl, pyrimidinyl, pyrrolyl,
pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl,
thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl,
isoquinolinyl, and the like.
[0089] It will be appreciated that aryl and heteroaryl groups
(including bicyclic aryl groups) can be unsubstituted or
substituted, wherein substitution includes replacement of one or
more of the hydrogen atoms thereon independently with any one or
more of the following moieties including, but not limited to:
aliphatic; alicyclic; heteroaliphatic; heterocyclic; aromatic;
heteroaromatic; aryl; heteroaryl; alkylaryl; heteroalkylaryl;
alkylheteroaryl; heteroalkylheteroaryl; alkoxy; aryloxy;
heteroalkoxy; heteroaryloxy; alkylthio; arylthio; heteroalkylthio;
heteroarylthio; F; Cl; Br; I; --OH; --NO.sub.2; --CN; --CF.sub.3;
--CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(.dbd.O)R.sub.x;
--C(.dbd.O)N(R.sub.x).sub.2; --OC(.dbd.O)R.sub.x;
--OCO.sub.2R.sub.x; --OC(.dbd.O)N(R.sub.x).sub.2;
--N(R.sub.x).sub.2; --S(O).sub.2R.sub.x; --NR.sub.x(CO)R.sub.x
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aromatic, heteroaromatic, aryl, heteroaryl,
-(alkyl)aryl or -(alkyl)heteroaryl substituents described above and
herein may be substituted or unsubstituted. Additionally, it will
be appreciated, that any two adjacent groups taken together may
represent a 4, 5, 6, or 7-membered substituted or unsubstituted
alicyclic or heterocyclic moiety. Additional examples of generally
applicable substituents are illustrated by the specific embodiments
shown in the Examples that are described herein.
[0090] The term "cycloalkyl", as used herein, refers specifically
to groups having three to seven, preferably three to ten carbon
atoms. Suitable cycloalkyls include, but are not limited to
cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and
the like, which, as in the case of aliphatic, alicyclic,
heteroaliphatic or heterocyclic moieties, may optionally be
substituted with substituents including, but not limited to
aliphatic; alicyclic; heteroaliphatic; heterocyclic; aromatic;
heteroaromatic; aryl; heteroaryl; alkylaryl; heteroalkylaryl;
alkylheteroaryl; heteroalkylheteroaryl; alkoxy; aryloxy;
heteroalkoxy; heteroaryloxy; alkylthio; heteroarylthio; F; Cl; Br;
I; --OH; --NO.sub.2; --CN; --CF.sub.3; --CH.sub.2CF.sub.3;
--CHCl.sub.2; --CH.sub.2OH; --CH.sub.2CH.sub.2OH;
--CH.sub.2NH.sub.2; --CH.sub.2SO.sub.2CH.sub.3; --C(.dbd.O)R.sub.x;
--C(.dbd.O)N(R.sub.x).sub.2; --OC(.dbd.O)R.sub.x;
--OCO.sub.2R.sub.x; --OC(.dbd.O)N(R.sub.x).sub.2;
--N(R.sub.x).sub.2; --S(O).sub.2R.sub.x; --NR.sub.x(CO)R.sub.x
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl, wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aromatic, heteroaromatic, aryl or heteroaryl
substituents described above and herein may be substituted or
unsubstituted. Additional examples of generally applicable
substituents are illustrated by the specific embodiments shown in
the Examples that are described herein.
[0091] The term "heteroaliphatic", as used herein, refers to
aliphatic moieties in which one or more carbon atoms in the main
chain have been substituted with a heteroatom. Thus, a
heteroaliphatic group refers to an aliphatic chain which contains
one or more oxygen, sulfur, nitrogen, phosphorus or silicon atoms,
e. place of carbon atoms. Heteroaliphatic moieties may be linear or
branched, and saturated or unsaturated. In certain embodiments,
heteroaliphatic moieties are substituted by independent replacement
of one or more of the hydrogen atoms thereon with one or more
moieties including, but not limited to aliphatic; alicyclic;
heteroaliphatic; heterocyclic; aromatic; heteroaromatic; aryl;
heteroaryl; alkylaryl; alkylheteroaryl; alkoxy; aryloxy;
heteroalkoxy; heteroaryloxy; alkylthio; arylthio; heteroarylthio;
F; Cl; Br; I; --OH; --NO.sub.2; --CN; --CF.sub.3;
--CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(.dbd.O)R.sub.x;
--C(.dbd.O)N(R.sub.x).sub.2; --OC(.dbd.O)R.sub.x;
--OCO.sub.2R.sub.x; --OC(.dbd.O)N(R.sub.x).sub.2;
--N(R.sub.x).sub.2; --S(O).sub.2R.sub.x; --NR.sub.x(CO)R.sub.x
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl, wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aromatic, heteroaromatic, aryl or heteroaryl
substituents described above and herein may be substituted or
unsubstituted. Additional examples of generally applicable
substituents are illustrated by the specific embodiments shown in
the Examples that are described herein.
[0092] The term "heterocycloalkyl", "heterocycle" or
"heterocyclic", as used herein, refers to compounds which combine
the properties of heteroaliphatic and cyclic compounds and include,
but are not limited to, saturated and unsaturated mono- or
polycyclic cyclic ring systems having 5-16 atoms wherein at least
one ring atom is a heteroatom selected from S and N (wherein the
nitrogen and sulfur heteroatoms may be optionally be oxidized),
wherein the ring systems are optionally substituted with one or
more functional groups, as defined herein. In certain embodiments,
the term "heterocycloalkyl", "heterocycle" or "heterocyclic" refers
to a non-aromatic 5-, 6- or 7-membered ring or a polycyclic group
wherein at least one ring atom heteroatom selected from S and N
(wherein the nitrogen and sulfur heteroatoms may be optionally be
oxidized), including, but not limited to, a bi- or tri-cyclic
group, comprising fused six-membered rings having between one and
three heteroatoms independently selected from oxygen, sulfur and
nitrogen, wherein (i) each 5-membered ring has 0 to 2 double bonds,
each 6-membered ring has 0 to 2 double bonds and each 7-membered
ring has 0 to 3 double bonds, (ii) the nitrogen and sulfur
heteroatoms may be optionally be oxidized, (iii) the nitrogen
heteroatom may optionally be quaternized, and (iv) any of the above
heterocyclic rings may be fused to an aryl or heteroaryl ring.
Representative heterocycles include, but are not limited to,
heterocycles such as furanyl, pyranyl, pyrrolyl, thienyl,
pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl,
imidazolidinyl, piperidinyl, piperazinyl, oxazolyl, oxazolidinyl,
isooxazolyl, isoxazolidinyl, dioxazolyl, thiadiazolyl, oxadiazolyl,
tetrazolyl, triazolyl, thiatriazolyl, thiadiazolyl, oxadiazolyl,
morpholinyl, thiazolyl, thiazolidinyl, isothiazolyl,
isothiazolidinyl, dithiazolyl, dithiazolidinyl, tetrahydrofuryl,
and benzofused derivatives thereof. In certain embodiments, a
"substituted heterocycle, or heterocycloalkyl or heterocyclic"
group is utilized and as used herein, refers to a heterocycle, or
heterocycloalkyl or heterocyclic group, as defined above,
substituted by the independent replacement of one, two or three of
the hydrogen atoms thereon with but are not limited to aliphatic;
alicyclic; heteroaliphatic; heterocyclic; aromatic; heteroaromatic;
aryl; heteroaryl; alkylaryl; heteroalkylaryl; alkylheteroaryl;
heteroalkylheteroaryl; alkoxy; aryloxy; heteroalkoxy;
heteroaryloxy; alkylthio; arylthio; heteroalkylthio;
heteroarylthio; F; Cl; Br; I; --OH; --NO.sub.2; --CN; --CF.sub.3;
--CH.sub.2CF.sub.3; --CHCl.sub.2; --CH.sub.2OH;
--CH.sub.2CH.sub.2OH; --CH.sub.2NH.sub.2;
--CH.sub.2SO.sub.2CH.sub.3; --C(.dbd.O)R.sub.x;
--C(.dbd.O)N(R.sub.x).sub.2, --OC(.dbd.O)R.sub.x;
--OCO.sub.2R.sub.x; --OC(.dbd.O)N(R.sub.x).sub.2;
--N(R.sub.x).sub.2; --S(O).sub.2R.sub.x; --NR.sub.x(CO)R.sub.x,
wherein each occurrence of R.sub.x independently includes, but is
not limited to, aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl or
heteroalkylheteroaryl, wherein any of the aliphatic, alicyclic,
heteroaliphatic, heterocyclic, alkylaryl, or alkylheteroaryl
substituents described above and herein may be substituted or
unsubstituted, branched or unbranched, saturated or unsaturated,
and wherein any of the aromatic, heteroaromatic, aryl or heteroaryl
described above and herein may be substituted or unsubstituted.
Additionally, it will be appreciated that any of the alicyclic or
heterocyclic moieties described above and herein may comprise an
aryl or heteroaryl moiety fused thereto.
[0093] The terms "halo" and "halogen" used herein refer to an atom
selected from fluorine, chlorine, bromine and iodine.
[0094] The term "haloalkyl" denotes an alkyl group, as defined
above, having one, two, or three halogen atoms attached thereto and
is exemplified by such groups as chloromethyl, bromoethyl,
trifluoromethyl, and the like.
[0095] The term "amino" as used herein, refers to a primary
(--NH.sub.2), secondary (--NHR.sub.x), tertiary
(--NR.sub.xR.sub.y), or quaternary amine
(--N.sup.-R.sub.xR.sub.yR.sub.z), where R.sub.y and R.sub.z are
independently an aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic or heteroaromatic moiety, as defined herein.
Examples of amino groups include, but are not limited to,
methylamino, dimethylamino, ethylamino, diethylamino,
diethylaminocarbonyl, iso-propylamino, piperidino, trimethylamino,
and propylamino.
[0096] The term "acyl", as used herein, refers to a group having
the general formula --C(.dbd.O)R, where R is an aliphatic,
alicyclic, heteroaliphatic, heterocyclic, aromatic or
heteroaromatic moiety, as defined herein.
[0097] The term "sulfonamido" as used herein, refers to a group of
the general formula --SO2NRxRy where Rx and Ry are independently
hydrogen, or an aliphatic, alicyclic, heteroaliphatic,
heterocyclic, aromatic, heteroaromatic or acyl moiety, as defined
herein.
[0098] The term "benzamido", as used herein, refers to a group of
the general formula PhNRx, where Rx is hydrogen, or an aliphatic,
alicyclic, heteroaliphatic, heterocyclic, aromatic, heteroaromatic
or acyl moiety, as defined herein.
[0099] The term "C1-6 alkylidene" as used herein, refers to a
substituted or unsubstituted, linear or branched saturated divalent
radical consisting solely of carbon and hydrogen atoms, having from
one to six carbon atoms, having a free valence "-" at both ends of
the radical.
[0100] The term "C2-6 alkylidene" as used herein, refers to a
substituted or unsubstituted, linear or branched unsaturated
divalent radical consisting solely of carbon and hydrogen atoms,
having from two to six carbon atoms, having a free valence "-" at
both ends of the radical, and wherein the unsaturation is present
only as double bonds and wherein a double bond can exist between
the first carbon of the chain and the rest or the molecule.
[0101] As used herein, the terms "aliphatic", "heteroaliphatic",
"alkyl", "alkenyl", "alkynyl", "heteroalkyl","heteroalkenyl",
"heteroalkynyl", and the like encompass substituted and
unsubstituted, saturated and unsaturated, and linear and branched
groups. Similarly, the terms, "alicyclic", "heterocyclic",
heterocycloalkyl", "heterocycle" and the like, encompass
substituted and unsubstituted, and saturated and unsaturated
groups. Additionally, the terms "cycloalkyl", cycloalkenyl",
cycloalkynyl", "heterocycloalkyl"
"heterocycloalkenyl","heterocycloalkynyl","aromatic","heteroaromatic","ar-
yl", "heteroaryl" and the like encompass both substituted and
unsubstituted groups.
[0102] The term "natural amino acid" as used herein refers to any
one of the common, naturally occurring L-amino acids found in
naturally occurring proteins: glycine (Gly), alanine (Ala), valine
(Val), leucine (Len), isoleucine (Ile), lysine (Lys), arginine
(Arg), histidine (His), proline (Pro), serine (Ser), threonine
(Thr), phenylalanine (Phe), tyrosine (Tyr), tryptophan (Trp),
aspartic acid (Asp), glutamic acid (Glu), asparagine (Asn),
glutamine (Gln), cysteine (Cys) and methionine (Met).
[0103] The term "unnatural amino acid" as used herein refers to all
amino acids which are not natural amino acids. This includes, for
example, .alpha.-, .beta.-, D-, L-amino acid residues, and
compounds of the general formula:
##STR00001##
wherein the side chain R is other than the amino acid side chains
occurring in nature.
[0104] More generally, the term "amino acid", as used herein,
encompasses natural amino acids and unnatural amino acids.
[0105] The term "bioisosteres", as used herein, generally refers to
two or more compounds or moieties that possess similar molecular
shapes and/or volumes. In certain embodiments, bioisosteres have
approximately the same distribution of electrons. In certain other
embodiments, bioisosteres exhibit similar biological properties. In
preferred embodiments, bioisosteres possess similar molecular
shapes and volumes; have approximately the same distribution of
electrons; and exhibit similar biological properties.
[0106] The term "pharmaceutically acceptable derivative", as used
herein, denotes any pharmaceutically acceptable salt, ester, or
salt of such ester, of such compound, or any other adduct or
derivative which, upon administration to a patient, is capable of
providing (directly or indirectly) a compound as otherwise
described herein, or a metabolite or residue thereof.
Pharmaceutically acceptable derivatives thus include among others
pro-drugs. A pro-drug is a derivative of a compound, usually with
significantly reduced pharmacological activity, which contains an
additional moiety, which is susceptible to removal in vivo yielding
the parent molecule as the pharmacologically active species. An
example of a pro-drug is an ester, which is cleaved in vivo to
yield a compound of interest. Pro-drugs of a variety of compounds,
and materials and methods for derivatizing the parent compounds to
create the pro-drugs, are known and may be adapted to the present
invention. Certain exemplary pharmaceutical compositions and
pharmaceutically acceptable derivatives will be discussed in more
detail herein below.
[0107] As used herein, the term pharmaceutically acceptable salt"
refers to those salts which are suitable for pharmaceutical use,
preferably for use in the tissues of humans and lower animals
without undue irritation, allergic response and the like.
Pharmaceutically acceptable salts of amines, carboxylic acids, and
other types of compounds, are well known in the art. For example,
S. M. Berge, et al., describe pharmaceutically acceptable salts in
detail in J Pharmaceutical Sciences, 66: 1-19 (1977), incorporated
herein by reference. The salts can be prepared in situ during the
final isolation and purification of the compounds of the invention,
or separately by reacting a free base or free acid function with a
suitable reagent, as described generally below. For example, a free
base function can be reacted with a suitable acid. Furthermore,
where the compounds of the invention carry an acidic moiety,
suitable pharmaceutically acceptable salts thereof may, include
metal salts such as alkali metal salts, e.g. sodium or potassium
salts; and alkaline earth metal salts, e.g. calcium or magnesium
salts. Examples of pharmaceutically acceptable, nontoxic acid
addition salts are salts of an amino group formed with inorganic
acids such as hydrochloric acid, hydrobromic acid, phosphoric acid,
sulfuric acid and perchloric acid or with organic acids such as
acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid,
succinic acid or malonic acid or by using other methods used in the
art such as ion exchange. Other pharmaceutically acceptable salts
include adipate, alginate, ascorbate, aspartate, benzoate,
bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate,
cyclopentanepropionate, digluconate, dodecylsulfate, formate,
fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate,
heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate,
lactobionate, lactate, laurate, lauryl sulfate, malate, maleate,
malonate, methanesulfonate, nicotinate, nitrate, oleate, oxalate,
palmitate, pectinate, persulfate, 3-phenylpropionate, phosphate,
picrate, pivalate, propionate, stearate, succinate, sulfate,
tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate
salts, and the like. Representative alkali or alkaline earth metal
salts include sodium, lithium, potassium, calcium, magnesium, and
the like. Further pharmaceutically acceptable salts include, when
appropriate, nontoxic ammonium, quaternary ammonium, and amine
cations formed using counterions such as halide, hydroxide,
carboxylate, sulfate, phosphate, nitrate, sulfonate and aryl
sulfonate.
[0108] As used herein, the term "pharmaceutically acceptable ester"
refers to esters that hydrolyze in vivo and include those that
break down readily in the human body to leave the parent compound
or a salt thereof. Suitable ester groups include, for example,
those derived from pharmaceutically acceptable aliphatic alcohol
compounds, particularly alkanes, alkenes, ethylene glycol,
cycloalkanes, and the like in which each alkyl or alkenyl moiety
advantageously has not more than 6 carbon atoms. These are
exemplary only and in no way limit the possibilities or esters
known in the art.
[0109] As used herein, the term "pharmaceutically acceptable
prodrugs" refers to those prodrugs of the compounds of the present
invention which are suitable for pharmaceutical use, preferably for
use with the tissues of humans and lower animals with undue
toxicity, irritation, allergic response, and the like, and
effective for their intended use, as well as the zwitterionic
forms, where possible, of the compounds of the invention. The term
"prodrug" refers to compounds that are rapidly transformed in vivo
to yield the parent compound of the above formula, for example by
hydrolysis in blood. A thorough discussion is provided in T.
Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems, Vol. 14
of the A. C. S. Symposium Series, and in Edward B. Roche, ed.,
Bioreversible Carriers in Drug Design, American Pharmaceutical
Association and Pergamon Press, 1987, both of which are
incorporated herein by reference.
B. Exemplary Compounds of the Method
[0110] In one embodiment, compounds useful in the methods of the
present invention include compounds of Formula I:
##STR00002##
where R.sup.1 and R.sup.2 are each independently hydrogen, an amino
acid side chain, --(CH.sub.2).sub.mOH, --(CH2).sub.maryl,
--(CH2).sub.mheteroaryl, wherein m is 0-6,
--CH(R.sup.1A)(OR.sup.1B), --CH(R.sup.1A)(NHR.sup.1B), U-T-Q, or an
aliphatic, alicyclic, heteroaliphatic or heteroalicyclic moiety
optionally substituted with U-T-Q; wherein U may be absent or one
of the following: --O--, --S(O).sub.0-2--, --SO.sub.2N(R.sup.1A),
--N(R.sup.1A)--, --N(R.sup.1A)C(.dbd.O)--,
--N(R.sup.1A)C(.dbd.O)--O--, --N(R.sup.1A)C(.dbd.O)--N(R.sup.1B)--,
--N(R.sup.1A)--SO.sub.2--, --C(.dbd.O)--, --C(.dbd.O)--O--,
--O--C(.dbd.O)--, aryl, heteroaryl, alkylaryl, alkylheteroaryl,
--C(.dbd.O)--N(R.sup.1A)--, --OC(.dbd.O)N(R.sup.1A)--,
--C(.dbd.N--R.sup.1E)--, --C(.dbd.N--R.sup.1E)--O--,
--C(.dbd.N--R.sup.1E)--N(R.sup.1A)--,
--O--C(.dbd.N--R.sup.1E)--N(R.sup.1A)--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--O--,
--N(R.sup.1A)C(.dbd.N--R.sup.1E)--N(R.sup.1B)--,
--P(.dbd.O)(OR.sup.1A)--O--, or --P(.dbd.O)(R.sup.1A)--O--; wherein
T is absent or, an aliphatic, heteroaliphatic, aryl, heteroaryl,
alkylaryl or alkylheteroaryl moiety; and Q is hydrogen, halogen,
cyano, isocyanate, --OR.sup.1B; --SR.sup.1B; --N(R.sup.1B).sub.2,
--NHC(.dbd.O)OR.sup.1B, --NHC(.dbd.O)N(R.sup.1B).sub.2,
--NHC(.dbd.O)R.sup.1B, --NHSO.sub.2R.sup.1B,
NHSO.sub.2N(R.sup.1B).sub.2, --NHSO.sub.2NHC(.dbd.O)OR.sup.1B,
--NHC(.dbd.O)NHSO.sub.2R.sup.1B, --C(.dbd.O)NHC(.dbd.O)OR.sup.1B,
C(.dbd.O)NHC(.dbd.O)R.sup.1B,
--C(.dbd.O)NHC(.dbd.O)N(R.sup.1B).sub.2,
--C(.dbd.O)NHSO.sub.2R.sup.1B,
--C(.dbd.O)NHSO.sub.2N(R.sup.1B).sub.2, C(.dbd.S)N(R.sup.1B).sub.2,
--SO.sub.2R.sup.1B, --SO.sub.2OR.sup.1B,
--SO.sub.2N(R.sup.1B).sub.2, SO.sub.2--NHC(.dbd.O)OR.sup.1B,
--OC(.dbd.O)--N(R.sup.1B).sub.2, --OC(.dbd.O)R.sup.1B,
--OC(.dbd.O)NHC(.dbd.O)R.sup.1B, --OC(.dbd.O)NHSO.sub.2R.sup.1B,
--OSO.sub.2R.sup.1B, or an aliphatic heteroaliphatic, aryl or
heteroaryl moiety, or wherein R.sup.1 and R.sup.2 taken together
are an alicyclic or heterocyclic moiety, or together are
##STR00003##
wherein each occurrence or R.sup.1A and R.sup.1B is independently
hydrogen, an aliphatic, alicyclic, heteroaliphatic, heterocyclic,
aryl, heteroaryl, alkylaryl or alkylheteroaryl moiety,
--C(.dbd.O)R.sup.1C, or --C(.dbd.O)NR.sup.1CR.sup.1D; wherein each
occurrence of R.sup.1C and R.sup.1D is independently hydrogen,
hydroxyl, or an aliphatic, heteroaliphatic, aryl, heteroaryl,
alkylaryl or alkylheteroaryl moiety; and R.sup.1E is hydrogen, an
aliphatic, alicyclic, heteroaliphatic, heterocyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety, --CN, --OR.sup.1C,
--NR.sup.1CR.sup.1D or --SO2R.sup.1C; where R.sup.3 is
--C(.dbd.O)OR.sup.3A, --C(.dbd.O)H, --CH.sub.2OR.sup.3A,
--CH.sub.2OC(.dbd.O)-alkyl, --C(.dbd.O)NH(R.sup.3A).
--CH.sub.2X.sup.0; wherein each occurrence of R.sup.3A is
independently hydrogen, a protecting group, an aliphatic,
alicyclic, heteroaliphatic, heteroalicyclic, aryl, heteroaryl,
alkylaryl, alkylheteroaryl, heteroalkylaryl, heteroalkylheteroaryl
moiety, or a pharmaceutically acceptable salt or ester, or
R.sup.3A, taken together with R.sup.1 and R.sup.2, forms a
heterocyclic moiety; wherein X.sup.0 is a halogen selected from F,
Br or I; R.sup.4 for each occurrence, is independently hydrogen,
halogen, --CN, --NO.sub.2, an aliphatic, alicyclic,
heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety, or is GR.sup.G1 wherein G is --O--, --S--,
NR.sup.G2--, --CO--, --SO--, --SO.sub.2--, C(.dbd.O)O--,
--C(.dbd.O)NR.sup.G2--, C(.dbd.O)--, --NR.sup.G2C(.dbd.O)-- or
--SO.sub.2NR.sup.G2--, and R.sup.G1 and R.sup.G2 are independently
hydrogen, an aliphatic, alicyclic, heteroaliphatic,
heteroalicyclic, aryl, heteroaryl, alkylaryl or alkylheteroaryl
moiety; n is an integer from 0-4; AR.sup.1 is a monocyclic or
polycyclic aryl, heteroaryl, alkylaryl, alkylheteroaryl, alicyclic
or heterocyclic moiety; A, B, D and E are connected by either a
single or double bond, as valency permits; wherein each occurrence
of A, D and E is independently C.dbd.O, CR.sup.iR.sup.ii, NR.sup.i,
CR.sup.i, N, O, S, --S(.dbd.O) or SO.sub.2; wherein each occurrence
of R.sup.i is independently hydrogen, halogen, --CN, --NO2, an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety, or is -GR.sup.G1
wherein G is --O--, --S--, --NR.sup.G2, --CO--, --SO--,
--C(.dbd.O)O--, --C(.dbd.O)NR.sup.G2--, --OC(.dbd.O)--,
--NR.sup.G2C(.dbd.O)-- or --SO.sub.2NR.sup.G2--, and R.sup.G1 and
R.sup.G2 are independently hydrogen, an aliphatic, alicyclic,
heteroaliphatic, heteroalicyclic, aryl, heteroaryl, alkylaryl or
alkylheteroaryl moiety, or any two adjacent occurrences of taken
together, represent an alicyclic, heteroalicyclic, aryl, or
heteroaryl moiety; p is an integer from 0-4; and, L is absent or is
V-W-X-Y-Z, wherein each occurrence of V, W, X, Y and Z is
independently absent, C.dbd.O, NR.sup.L1, --O--,
--C(R.sup.L1).dbd., .dbd.C(R.sup.L1)--, --C(R.sup.L1)(R.sup.L2),
C(.dbd.N--OR.sup.L1), C(.dbd.NR.sup.L1), --N.dbd., S(O).sub.0-2; a
substituted or unsubstituted C.sub.1-6 alkenylidene or C.sup.2-6
alkenylidine chain wherein up to two non-adjacent methylene units
are independently optionally replaced by --C(.dbd.O)--,
--CO.sub.2--, --C(.dbd.O)C(.dbd.O)--, --C(C.dbd.O)NR.sup.L3--,
--OC(.dbd.O)--, --OC(.dbd.O)NR.sup.L3--, --NR.sup.L3NR.sup.L4--,
--NR.sup.L3NR.sup.L4C(.dbd.O)--, --NR.sup.L3C(.dbd.O)--,
NR.sup.L3CO.sub.2--, NR.sup.L3C(.dbd.O)NR.sup.L4--, --S(.dbd.O)--,
--SO.sub.2--, --NR.sup.L3SO.sub.2--, --SO.sub.2NR.sup.L3,
--NR.sup.L3SO.sub.2NR.sup.L4, --O--, --S--, or --NR.sup.L3--;
wherein each occurrence of R.sup.L3 and R.sup.L4 is independently
hydrogen, alkyl, heteroalkyl, aryl, heteroaryl or acyl; or an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety; and each
occurrence of R.sup.L1 and R.sup.L2 is independently hydrogen,
hydroxyl, protected hydroxyl, amino, protected amino, thio,
protected thio, halogen, cyano, isocyanate, carboxy, carboxyalkyl,
formyl, formyloxy, azido, nitro, ureido, thioureido, thiocyanato,
alkoxy, aryloxy, mercapto, sulfonamido, benzamido, tosyl, or an
aliphatic, alicyclic, heteroaliphatic, heteroalicyclic, aryl,
heteroaryl, alkylaryl or alkylheteroaryl moiety, or wherein one or
more occurrences of R.sup.L1 and R.sup.L2, taken together, or taken
together with one of V, W, X, Y or Z form an alicyclic or
heterocyclic moiety or form an aryl or heteroaryl moiety.
[0111] Some preferred embodiments of the method of the present
invention are of Formula II:
##STR00004##
where R.sup.28 is one of the following groups:
##STR00005##
And R.sup.27 is one of the following groups:
##STR00006##
and R.sup.29 is hydrogen, a pharmaceutically acceptable salt or
ester.
[0112] Some preferred embodiments of the invention are compounds of
the Formula II'
##STR00007##
where the substitution is as in Formula II.
[0113] Some particularly preferred embodiments of compounds of the
method of the present invention are compounds of Formulas IIA, IIB
and IIC:
##STR00008##
where R.sup.17 respectively can be each be chosen from the group of
hydrogen, pharmaceutically acceptable salts and esters.
[0114] Another set of preferred embodiments of compounds of the
method of the invention are compounds of the Formula III:
##STR00009##
where Cy is an aromatic carbocycle, aromatic heterocycle or a
non-aromatic carbocycle or heterocycle optionally substituted with
hydroxyl (--OH), mercapto (--SH), thioalkyl, halogen (e.g. F, Cl,
Br, I), oxo (.dbd.O), thio (.dbd.S), amino, aminoalkyl, amidine
(--C(NH)--NH.sub.2), guanidine (--NH.sub.2--C(NH)--NH.sub.2),
nitro, alkyl or alkoxy. In a particular embodiment, Cy is a 3-5
member ring. In a preferred embodiment, Cy is a 5- or 6-member
non-aromatic heterocycle optionally substituted with hydroxyl,
mercapto, halogen (preferably F or Cl), oxo (.dbd.O), thio
(.dbd.S), amino, amidine, guanidine, nitro, alkyl or alkoxy. In a
more preferred embodiment, Cy is a 5-member non-aromatic
heterocycle optionally substituted with hydroxyl, oxo, thio, Cl,
C.sub.1-4 alkyl (preferably methyl), or C.sub.1-4 alkanoyl
(preferably acetyl, propanoyl or butanoyl). More preferably the
non-aromatic heterocycle comprises one or heteroatoms (N, O or S)
and is optionally substituted with hydroxyl, oxo, mercapto, thio,
methyl, acetyl, propanoyl or butyl. In particular embodiments the
non-aromatic heterocycle comprises at least one nitrogen atom that
is optionally substituted with methyl or acetyl. In a particularly
preferred embodiment, the non-aromatic heterocycle is selected from
the group consisting of piperidine, piperazine, morpholine,
tetrahydrofuran, tetrahydrothiophene, oxazolidine, thiazolidine
optionally substituted with hydroxy, oxo, mercapto, thio, alkyl or
alkanoyl. In a most preferred embodiment Cy is a non-aromatic
heterocycle selected from the group consisting of
tetrahydrofuran-2-yl, thiazolidin-5-yl, thiazolidin-2-one-5-yl, and
thiazolidin-2-thione-5-yl and cyclopropapyrrolidine. In a preferred
embodiment, Cy is a 5- or 6-member aromatic carbocycle or
heterocycle optionally substituted with hydroxyl, mercapto, halogen
(preferably F or Cl), oxo (.dbd.O), thio (.dbd.S), amino, amidine,
guanidine, nitro, alkyl or alkoxy. In a more preferred embodiment,
Cy is a 5-member aromatic carbocycle or heterocycle optionally
substituted with hydroxyl, oxo, thio, C.sub.1, C.sub.1-4 alkyl
(preferably methyl), or C.sub.1-4 alkanoyl (preferably acetyl,
propanoyl or butanoyl). More preferably the aromatic or heterocycle
comprises one or heteroatoms (N, O or S) and is optionally
substituted with hydroxyl, oxo, mercapto, thio, methyl, acetyl,
propanoyl or butyl.
[0115] In another preferred embodiment Cy is a 3-6 member
carbocycle optionally substituted with hydroxyl, mercapto, halogen,
oxo, thio, amino, amidine, guanidine, alkyl, alkoxy or acyl. In a
particular embodiment the carbocycle is saturated or partially
unsaturated. In particular embodiments Cy is a carbocycle selected
from the group consisting of cyclopropyl, cyclopropenyl,
cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl
and cyclohexenyl. X.sub.2 is a C.sub.1-5 divalent hydrocarbon
linker optionally having one or more carbon atoms replaced with N,
O, S, SO or SO.sub.2 and optionally being substituted with
hydroxyl, mercapto, halogen, amino, aminoalkyl, nitro, oxo or thio.
In a preferred embodiment X.sub.2 will have at least one carbon
atom. Replacements and substitutions may form an amide moiety
(--NRC(.dbd.O)-- or --C(.dbd.O)NR--) within the hydrocarbon chain
or at either or both ends. Other moieties include sulfonamide
(--NRSO.sub.2-- or --SO.sub.2NR), acyl, ether, thioether and amine.
In a particularly preferred embodiment X.sub.2 is the group
--CH.sub.2--NR.sup.10--C(O)-- wherein the carbonyl --C(O)-- portion
thereof is adjacent (i.e. covalently bound) to Cy and R.sup.10 is
alkyl i.e. methyl and more preferably H.
K is a carbocycle or heterocycle optionally substituted with
hydroxyl, mercapto, halogen, oxo, thio, a hydrocarbon, a
halo-substituted hydrocarbon, amino, amidine, guanidine, cyano,
nitro, alkoxy or acyl. In particular embodiment, K is aryl or
heteroaryl optionally substituted with halogen or hydroxyl. In a
particularly preferred embodiment, K is phenyl, furan-2-yl,
thiophene-2-yl, phenyl substituted with a halogen (preferably Cl)
or hydroxyl, preferably at the meta position. L.sub.2 is a divalent
hydrocarbon optionally having one or more carbon atoms replaced
with N, O, S, SO or SO.sub.2 and optionally being substituted with
hydroxyl, halogen oxo, or thio; or three carbon atoms of the
hydrocarbon are replaced with an amino acid residue. Preferably
L.sub.2 is less than 10 atoms in length and more preferably 5 or
less and most preferably 5 or 3 atoms in length. In particular
embodiments, L.sub.2 is selected from the group consisting of
--CH.dbd.CH--C(O)--NR.sup.10--CH.sub.2--,
--CH.sub.2--NR.sup.10--C(O)--, --C(O)--NR.sup.10--, --CH.sub.2--,
--CH(OH)--(CH.sub.2).sub.2--, --(CH.sub.2).sub.2--, --CH(OH)--,
--(CH.sub.2).sub.3--, --C(O)--NR.sup.10--CH(R.sub.7)C(O)NR.sup.10,
NR.sup.10C(O)CH(R.sup.16)NR.sup.10C(O), CH(OH)CH.sub.2O and
CH(OH)CF.sub.2CH.sub.2 wherein each R.sup.10 is independently H or
alkyl and R.sup.16 is an amino acid side chain. Preferred amino
acid side chains include non-naturally occurring side chains such
as phenyl or naturally occurring side chains. Preferred side chains
are those from Phe, Tyr, Ala, Gln and Asn. In a preferred
embodiments L.sub.2 is --CH.dbd.CH--C(O)--NR.sup.10--CH.sub.2--
wherein the --CH.dbd.CH-- moiety thereof is adjacent (i.e.
covalently bound) to K. In another preferred embodiment, L.sub.2 is
--CH.sub.2--NR.sup.10--C(O)-- wherein the methylene moiety
(CH.sub.2) thereof is adjacent to K. R.sup.5 is H, OH, amino,
O-carbocycle or alkoxy optionally substituted with amino, a
carbocycle, a heterocycle, or a pharmaceutically acceptable salt or
ester. In a preferred embodiment, R.sup.5 is H, phenyl or C.sub.1-4
alkoxy optionally substituted with a carbocycle such as phenyl. In
a particular embodiment R.sup.5 is H. In another particular
embodiment R.sup.5 is methoxy, ethoxy, propyloxy, butyloxy,
isobutyloxy, s-butyloxy, t-butyloxy, phenoxy or benzyloxy. In yet
another particular embodiment R.sup.5 is NH.sub.2. In a
particularly preferred embodiment R.sup.5 is ethoxy. In another
particularly preferred embodiment R.sup.5 is isobutyloxy. In
another particularly preferred embodiment R.sup.5 is alkoxy
substituted with amino, for example 2-aminoethoxy,
N-morpholinoethoxy, N,N-dialkyaminoethoxy, quaternary ammonium
hydroxy alkoxy (e.g. trimethylammoniumhydroxyethoxy). R.sup.6-9 are
independently H, hydroxyl, mercapto, halogen, cyano, amino,
amidine, guanidine, nitro or alkoxy; or R.sup.7 and R.sup.8
together form a fused carbocycle or heterocycle optionally
substituted with hydroxyl, halogen, oxo, thio, amino, amidine,
guanidine or alkoxy. In a particular embodiment R.sup.6 and R.sup.7
are independently H, F, Cl, Br or I. In another particular
embodiment, R.sup.8 and R.sup.9 are both H. In another particular
embodiment, one of R.sup.6 and R.sup.7 is a halogen while the other
is hydrogen or a halogen. In a particularly preferred embodiment,
R.sup.7 is Cl while R.sup.6, R.sup.8 and R.sup.9 are each H. In
another particularly preferred embodiment, R.sup.6 and R.sup.7 are
both Cl while R.sup.8 and R.sup.9 are both H. R.sup.10 is H or a
hydrocarbon chain optionally substituted with a carbocycle or a
heterocycle. In a preferred embodiment, R.sup.10 is H or alkyl i.e.
methyl, ethyl, propyl, butyl, i-butyl, s-butyl or t-butyl. In a
particular embodiment R.sup.10 is H.
[0116] Further preferred embodiments of the method of the present
invention are compounds of the Formula IV:
##STR00010##
where R'.sup.1 is a group of the formula
##STR00011##
where A is hydrogen, hydroxy, amino, or halogen and B is amino,
carboxy, hydrogen, hydroxy, cyano, trifluoromethyl, halogen, lower
alkyl, or lower alkoxy; R.sup.12 is a group of the formula:
##STR00012##
where R.sup.13 is hydrogen, carboxy, or lower alkyl; n is 0 or 1;
U.sub.2, V.sub.2, and W.sub.2 are independently hydrogen, halogen,
or lower alkyl provided U.sub.2 and V.sub.2 are not both hydrogen;
X.sub.3 is carbonyl, phenyl-substituted lower alkylene, imino,
substituted imino, or sulfonyl; Y.sub.2 is lower alkylene which may
be substituted by one or more of amino, substituted amino, lower
alkyl, or cyclo lower alkyl, or Y.sub.2 is lower alkenylene or
lower alkylenethio; k is 0 or 1; when k is 1, Z.sub.2 is hydrogen,
lower alkylthio, --COOH, --CONH.sub.2, amino; and when k is 0 or 1,
Z.sub.2 is 1-adamantyl, diphenylmethyl,
3-[[(5-chloropyridin-2-yl)amino]carbonyl]pyrazin-2-yl, hydroxy,
phenylmethoxy,
2-chloro-4-[[[(3-hydroxyphenyl)methyl]amino]carbonyl]phenyl,
[2,6-dichlorophenyl)methoxy]phenyl; further when k is 0 or 1,
Z.sub.2 may be cycloalkyl or aryl containing 0 to 3 heteroatoms
which may be the same or different, or a fused ring system
containing two or three rings which rings are independently
cycloalkyl or aryl containing 0 to 3 heteroatoms which may be the
same or different, any of which rings may be unsubstituted, or
substituted with at least one of halogen, cyano, amino, substituted
amino, aminosulfonyl, nitro, oxo, hydroxy, aryl, aryloxy,
unsubstituted lower alkyl, halogen-substituted lower alkyl, lower
alkoxy-substituted lower alkyl, lower alkoxy, lower alkanesulfonyl,
lower alkylthio, acetyl, aminocarbonyl, hydrazino, carboxy,
alkoxycarbonyl, acetoxy, or also in addition with amino lower
alkyl; and R.sup.20 is hydrogen, a pharmaceutically acceptable salt
or ester.
[0117] A preferred embodiment of compounds of Formula IV has
stereochemistry as indicated in Formula IV:
##STR00013##
[0118] Another set of preferred embodiments of the compounds of the
method of the present invention are compounds of Formula V:
##STR00014##
where R.sup.14 is a group of the formula:
##STR00015##
where R.sup.15 is hydrogen, carboxy, or lower alkyl; U.sub.3,
V.sub.3, and W.sub.3 are independently hydrogen, halogen; or
U.sub.3, V.sub.3, and W.sub.3 are lower alkyl provided that U.sub.3
and V.sub.3 are not both hydrogen; X.sub.4 is carbonyl,
phenyl-substituted lower alkylene, imino, substituted imino which
includes cyano, or sulfonyl; Y.sub.3 is lower alkenylene, lower
alkylenethio, or is lower alkylene which may be substituted by
amino, acetylamino, or cyclo-lower alkyl; k.sub.2 is 0 or 1; when
k.sub.2 is 1, Z is hydrogen, lower alkylthio, --COOH, --CONH.sub.2,
or amino; when k.sub.2 is 0 or 1, Z.sub.3 is 1-adamantyl,
diphenylmethyl,
3-[[(5-chloropyridin-2-yl)amino]carbonyl]pyrazin-2-yl; and when
k.sub.2 is 0 or 1, Z may be cycloalkyl or aryl containing 0 to 3
heteroatoms which may be the same or different, or a fused ring
system containing two or three rings which rings are independently
cycloalkyl or aryl containing 0 to 3 heteroatoms which may be the
same or different, any of which rings may be unsubstituted, or
substituted with at least one of halogen, cyano, amino, substituted
amino, aminosulfonyl, nitro, oxo, hydroxy, aryl, aryloxy,
unsubstituted lower alkyl, halogen-substituted lower alkyl, lower
alkoxy-substituted lower alkyl, lower alkoxy, carboxy,
alkoxycarbonyl, or acetoxy; and, R.sup.21 is hydrogen,
pharmaceutically acceptable salts or esters thereof.
[0119] A preferred embodiment of compounds of Formula V has the
stereochemistry as indicated in Formula V':
##STR00016##
[0120] Another class of preferred compounds of the method are
represented by Formula VI
##STR00017##
where D.sub.4 is a mono-, bi-, or tricyclic saturated, unsaturated,
or aromatic ring, each ring having 5-, 6- or 7 atoms in the ring
where the atoms in the ring are carbon or from one to four
heteroatoms selected from the group nitrogen, oxygen, and sulfur,
where any carbon or sulfur ring atom may optionally be oxidized,
each ring substituted with 0-3 R.sup.31;
[0121] L.sub.3 is a bivalent linking group selected from the
group
-L.sup.3-L.sup.2-L.sup.1-,
-L.sup.4-L.sup.3-L.sup.2-L.sup.1- and
-L.sup.5-L.sup.4-L.sup.3-L.sup.2-L.sup.1-,
[0122] where L' is selected from oxo (--O--), S(O).sub.s,
C(.dbd.O), CR.sup.32, R.sup.32, CR.sup.32 het, NR.sup.30 and N,
L.sup.2 is selected from oxo (--O--), S(O).sub.s, C(.dbd.O),
C(.dbd.N--O--R.sup.33),
CR.sup.34R.sup.34', CR.sup.34, het NR.sup.30 and N,
[0123] L.sup.3 is selected from oxo (--O--), S(O).sub.s, C(.dbd.O),
C(.dbd.N--O--R.sup.33), CR.sup.35R.sup.35', CR.sup.35, het
NR.sup.30 and N, L.sup.4 is absent or is selected from oxo (--O--),
S(O).sub.s, C(.dbd.O), C(.dbd.N--O--R.sup.33), CR.sup.36R.sup.36',
CR.sup.36, NR.sup.30 and N, L.sup.5 is absent or selected from oxo
(--O--), S(O).sub.s, C(.dbd.O), CR.sup.37R.sup.37', CR.sup.37,
NR.sup.30 and N, provided that only one of L.sup.1-L.sup.3 may be
het and that when one of L.sup.1-L.sup.3 is het the other
L.sup.1-L.sup.5 may be absent, where R.sup.32, R.sup.32', R.sup.34,
R.sup.34', R.sup.35, R.sup.35', R.sup.36, R.sup.36', R.sup.37 and
R.sup.37' each are independently selected from R.sup.38, R.sup.39
and
U-Q-V-W,
[0124] optionally, R.sup.24 and R.sup.34' separately or together
may form a saturated, unsaturated or aromatic fused ring with
B.sub.3 through a substituent RP on B, the fused ring containing 5,
6 or 7 atoms in the ring and optionally containing 1-3 heteroatoms
selected from the group O, S and N, where any S or N may optionally
be oxidized; optionally, R.sup.35 and R.sup.35 separately or
together and R.sup.36 and R.sup.36' separately or together may form
a saturated, unsaturated or aromatic fused ring with D.sub.3
through a substituent R.sup.31 on D.sub.3, the fused ring
containing 5, 6 or 7 atoms in the ring and optionally containing
1-3 heteroatoms selected from the group O, S and N, where any S or
N may optionally be oxidized; also optionally, each
R.sup.32--R.sup.37, NR.sup.30 or N in L.sup.1-L.sup.5 together with
any other R.sup.32--R.sup.37, NR.sup.30 or N in L.sup.1-L.sup.5 may
form a 5, 6 or 7 member homo- or heterocycle either saturated,
unsaturated or aromatic optionally containing 1-3 additional
heteroatoms selected from N, O and S, where any carbon or sulfur
ring atom may optionally be oxidized, each cycle substituted with
0-3 R.sup.31; and where s is 0-2; B is selected from the group
##STR00018##
is a fused hetero- or homocyclic ring containing 5, 6 or 7 atoms,
the ring being unsaturated, partially saturated or aromatic, the
heteroatoms selected from 1-3 O, S and N, Y.sub.3 is selected from
CH and NR.sup.30; n is 0-3: G3 is selected from hydrogen and
C.sub.1-C.sub.6alkyl, optionally G taken together with T may form a
C.sub.1-C.sub.6cycloalkyl optionally substituted with -V-W; T.sub.3
is selected from the group a naturally occurring .alpha.-amino-acid
side chain,
and U.sub.4-Q.sub.4-V.sub.4-W.sub.4;
[0125] U.sub.4 is an optionally substituted bivalent radical
selected from the group C.sub.1-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q, C.sub.2-C.sub.6alkenyl-Q, and
C.sub.2-C.sub.6alkynyl-Q: where the substituents on any alkyl,
alkenyl or alkynyl are 1-3 R.sup.38; Q.sub.4 is absent or is
selected from the group --O--, --S(O).sub.s--,
--SO.sub.2--N(R.sup.30)--, --N(R.sup.30)--,
--N(R.sup.30)--C(.dbd.O)--, --N(R.sup.30)--C(.dbd.O)--N(R.sup.30)
--, --N(R.sup.30)--C(.dbd.O)--O--, --N(R.sup.30)--SO.sub.2--,
--C(.dbd.O)--, --C(.dbd.O)--O--, -het-, --C(.dbd.O)--N(R.sup.30)--,
--O--C(.dbd.O)--N(R.sup.30)--, --PO(OR.sup.30)O-- and --P(O)O--;
where s is 0-2 and het is a mono- or bicyclic 5, 6, 7, 9 or 10
member heterocyclic ring, each ring containing 1-4 heteroatoms
selected from N, O and S, where the heterocyclic ring may be
saturated, partially saturated, or aromatic and any N or S being
optionally oxidized, the heterocyclic ring being substituted with
0-3 R.sup.41; V.sub.4 is absent or is an optionally substituted
bivalent group selected from C.sub.1-C.sub.6alkyl,
C.sub.3-C.sub.8cycloalkyl,
C.sub.0-C.sub.6alkyl-C.sub.6-C.sub.10aryl, and
C.sub.0-C.sub.6alky-het; where the substituents on any alkyl are
1-3 R.sup.38 and the substituents on any aryl or het are 1-3
R.sup.31; W.sub.4 is selected from the group hydrogen, OR.sup.33,
SR.sup.42, NR.sup.30R.sup.30, NH--C(.dbd.O)--O--R.sup.43,
NH--C(.dbd.O)--NR.sup.nR.sup.n, NH--C(.dbd.O)--R.sup.43,
NH--SO.sub.2--R.sup.37, NH--SO.sub.2--NR.sup.30R.sup.30,
NH--SO.sub.2--NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NH--SO.sub.2--R.sup.37,
C(.dbd.O)--NH--C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)NR.sup.30R.sup.30',
C(.dbd.O)--NH--SO.sub.2--R.sup.37,
C(.dbd.O)--NH--SO.sub.2--NR.sup.30R.sup.30',
C(.dbd.S)NR.sup.30R.sup.30', SO.sub.2--R.sup.37,
SO.sub.2--O--R.sup.37, SO.sub.2--NR.sup.37R.sup.37',
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43,
SO.sub.2--NH--C(.dbd.O)--NR.sup.30R.sup.30',
SO.sub.2--NH--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NR.sup.30R.sup.30', O--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
O--C(.dbd.O)--NH--SO.sub.2R.sup.46 and O--SO.sub.2--R.sup.37;
R.sup.44 is selected from C(.dbd.O)--R.sup.45, C(.dbd.O)--H,
CH.sub.2(OH), and CH.sub.2O--C(.dbd.O)--C.sub.1-C.sub.6alkyl;
R.sup.38 is R.sup.38' or R.sup.38'' substituted with 1-3 R.sup.38';
where R.sup.38' is selected from the group hydrogen, halo(F, Cl,
Br, I), cyano, isocyanate, carboxy, carboxy-C.sub.1-C.sub.11alkyl,
amino, amino-C.sub.1-C.sub.8alkyl, aminocarbonyl, carboxamido,
carbamoyl, carbamoyloxy, formyl, formyloxy, azido, nitro,
imidazoyl, ureido, thioureido, thiocyanato, hydroxy,
C.sub.1-C.sub.6alkoxy, mercapto, sulfonamido, het, phenoxy, phenyl,
benzamido, tosyl, morpholino, morpholinyl, piperazinyl,
piperidinyl, pyrrolinyl, imidazolyl, and indolyl; R.sup.38'' is
selected from the group
C.sub.0-C.sub.10alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.10alkenyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.10alkynyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.3-C.sub.11cycloalkyl-C.sub.0-C.sub.6alkyl,
C.sub.3-C.sub.10cycloalkenyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12 aryl-Q-C.sub.0-C.sub.6alkyl,
C.sub.6-C.sub.10 aryl-C.sub.1-C.sub.6alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-het-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q-het-C.sub.0-C.sub.6alkyl,
het-C.sub.0-C.sub.6alkyl-Q-C.sub.0-C.sub.6alkyl,
C.sub.0-C.sub.6alkyl-Q-C.sub.6-C.sub.12aryl, and
-Q-C.sub.1-C.sub.6alky; R.sup.43 is selected from hydrogen and
substituted or unsubstituted C.sub.2-C.sub.10alkenyl,
C.sub.2-C.sub.10alkynyl, C.sub.3-C.sub.11cycloalkyl,
C.sub.3-C.sub.10cycloalkenyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12aryl,
C.sub.6-C.sub.10aryl-C.sub.1-C.sub.6alkyl,
C.sub.1-C.sub.6alkyl-het, het-C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.12aryl and het, where the substituents on any alkyl,
alkenyl or alkynyl are 1-3 R.sup.38 and the substituents on any
aryl or het are 1-3 R.sup.31; R.sup.31 is selected from R.sup.40
and R.sup.41; R.sup.41 is selected from the group OH, OCF.sub.3,
OR.sup.43, SR.sup.42, halo(F, Cl. Br, I), CN, isocyanate, NO.sub.2,
CF.sub.3, C.sub.0-C.sub.6alkyl-NR.sup.30R.sup.30',
C.sub.0-C.sub.6alkyl-C(.dbd.O)NR.sup.30R.sup.30',
C.sub.0-C.sub.6alkyl-C(.dbd.O)--R.sup.38, C.sub.1-C.sub.6alkyl,
C.sub.1-C.sub.6alkoxy, C.sub.2-C.sub.8alkenyl,
C.sub.2-C.sub.6alkynyl, C.sub.3-C.sub.6cycloalkyl,
C.sub.3-C.sub.6cycloalkenyl, C.sub.1-C.sub.6alkyl-phenyl,
phenyl-C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkyloxycarbonyl,
phenyl-C.sub.0-C.sub.6alkyloxy, C.sub.1-C.sub.6alkyl-het,
het-C.sub.1-C.sub.6alkyl, SO.sub.2-het, --O--C.sub.6-C.sub.12aryl,
--SO.sub.2--C.sub.6-C.sub.12aryl, --SO.sub.2--C.sub.1-C.sub.6alkyl
and het, where any alkyl, alkenyl or alkynyl may optionally be
substituted with 1-3 groups selected from OH, halo(F, Cl, Br, I),
nitro, amino and aminocarbonyl and the substituents on any aryl or
het are 1-2 hydroxy, halo(F, Cl, Br, I), CF.sub.3,
C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkoxy, nitro and amino;
R.sup.42 is selected from S--C.sub.1-C.sub.6alkyl,
C(.dbd.O)--C.sub.1-C.sub.6alkyl, C(.dbd.O)NR.sup.30R.sup.30',
C.sub.1-C.sub.6alkyl, halo(F, Cl, Br, I)-C.sub.1-C.sub.6alkyl,
benzyl and phenyl; R.sup.30 is selected from the group R.sup.43,
NH--C(.dbd.O)--O--R.sup.43, NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NHR.sup.43, NH--SO.sub.2--R.sup.46,
NH--SO.sub.2--NH--C(.dbd.O)--R.sup.43,
NH--C(.dbd.O)--NH--SO.sub.2--R.sup.37, C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--R.sup.43, C(.dbd.O)--NHR.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--O--R.sup.43,
C(.dbd.O)--NH--C(.dbd.O)--R.sup.43,
C(.dbd.O)--NH--SO.sub.2--R.sup.46,
C(.dbd.O)--NH--SO.sub.2--NHR.sup.37, SO.sub.2--R.sup.37,
SO.sub.2--O--R.sup.37, SO.sub.2--N(R.sup.43).sub.2,
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43,
SO.sub.2--NH--C(.dbd.O)--O--R.sup.43 and
SO.sub.2--NH--C(.dbd.O)--R.sup.43; R.sup.30' is selected from
hydrogen, hydroxy and substituted or unsubstituted
C.sub.1-C.sub.11alkyl, C.sub.1-C.sub.11 alkoxy,
C.sub.2-C.sub.10alkenyl, C.sub.2-C.sub.10alkynyl,
C.sub.3-C.sub.11cycloalkyl, C.sub.3-C.sub.10cycloalkenyl,
C.sub.1-C.sub.6alkyl-C.sub.6-C.sub.12aryl,
C.sub.6-C.sub.10aryl-C.sub.1-C.sub.6 alkyl,
C.sub.6-C.sub.10aryl-C.sub.0-C.sub.6alkyloxy,
C.sub.1-C.sub.6alkyl-het, het-C.sub.1-C.sub.6alkyl,
C.sub.6-C.sub.12aryl, het, C.sub.1-C.sub.6alkylcarbonyl,
C.sub.1-C.sub.8alkoxycarbonyl, C.sub.3-C.sub.8cycloalkylcarbonyl,
C.sub.3-C.sub.8cycloalkoxycarbonyl,
C.sub.6-C.sub.11aryloxycarbonyl,
C.sub.7-C.sub.11arylalkoxycarbonyl, heteroarylalkoxycarbonyl,
heteroarylalkylcarbonyl, heteroarylcarbonyl,
heteroarylalkylsulfonyl, heteroarylsulfonyl,
C.sub.1-C.sub.6alkylsulfonyl, and C.sub.6-C.sub.10arylsulfonyl,
where the substituents on any alkyl, alkenyl or alkynyl are 1-3
R.sup.38 and the substituents on any aryl, het or heteroaryl are
1-3 R.sup.31; R.sup.30 and R.sup.30' taken together with the common
nitrogen to which they are attached may from an optionally
substituted heterocycle selected from morpholinyl, piperazinyl,
thiamorpholinyl, pyrrolidinyl, imidazolidinyl, indolinyl,
isoindolinyl, 1,2,3,4-tetrahydro-quinolinyl,
1,2,3,4-tetrahydro-isoquinolinyl, thiazolidinyl and
azabicyclononyl, where the substituents are 1-3 R.sup.38; R.sup.33
is selected from hydrogen and substituted or unsubstituted
C.sub.1-C.sub.6alkyl, C.sub.1-C.sub.6alkylcarbonyl,
C.sub.2-C.sub.6alkenyl, C.sub.2-C.sub.6alkynyl,
C.sub.3-C.sub.8cycloalkyl and benzoyl, where the substituents on
any alkyl are 1-3 R.sup.38 and the substituents on any aryl are 1-3
R.sup.40; R.sup.40 is selected from the group OH, halo(F, Cl. Br,
I), CN, isocyanate, OR.sup.43, SR.sup.42, SOR.sup.43, NO.sub.2,
CF.sub.3, R.sup.43, NR.sup.30R.sup.30',
NR.sup.30C(.dbd.O)--O--R.sup.43, NRC(.dbd.O)--R.sup.43,
C.sub.0-C.sub.6alkyl-SO.sub.2--R.sup.43,
C.sub.0-C.sub.6alkyl-SO.sub.2--NR.sup.30R.sup.30',
C(.dbd.O)--R.sup.43, O--C(.dbd.O)--R.sup.43,
C(.dbd.O)--O--R.sup.43, and C(.dbd.O)NR.sup.30R.sup.30', where the
substituents on any alkyl, alkenyl or alkynyl are 1-3 R'' and the
substituents on any aryl or het are 1-3 R.sup.31; R.sup.46 is a
substituted or unsubstituted group selected from
C.sub.1-C.sub.8alkyl, C.sub.2-C.sub.8alkenyl,
C.sub.2-C.sub.8alkynyl, C.sub.3-C.sub.8cycloalkyl,
C.sub.3-C.sub.6cycloalkenyl, C.sub.0-C.sub.6alkyl-phenyl,
phenyl-C.sub.0-C.sub.6alkyl, C.sub.0-C.sub.6alkyl-het and
het-C.sub.0-C.sub.6alkyl, where the substituents on any alkyl,
alkenyl or alkynyl are 1-3 R.sup.38 and the substituents on any
aryl or het are 1-3 R.sup.31; R.sup.45 is a substituted or
unsubstituted group selected from hydroxy, C.sub.1-C.sub.11alkoxy,
C.sub.3-C.sub.12cycloalkoxy, C.sub.8-C.sub.12aralkoxy,
C.sub.8-C.sub.12arcycloalkoxy, C.sub.6-C.sub.10aryloxy,
C.sub.3-C.sub.10 alkylcarbonyloxyalkyloxy, C.sub.3-C.sub.10
alkoxycarbonyloxyalkyloxy, C.sub.3-C.sub.10alkoxycarbonylalkyloxy,
C.sub.5-C.sub.10 cycloalkylcarbonyloxyalkyloxy,
C.sub.5-C.sub.10cycloalkoxycarbonyloxyalkyloxy,
C.sub.5-C.sub.10cycloalkoxycarbonylalkyloxy,
C.sub.8-C.sub.12aryloxycarbonylalkyloxy,
C.sub.8-C.sub.12aryloxycarbonyloxyalkyloxy,
C.sub.8-C.sub.12arylcarbonyloxyalkyloxy,
C.sub.5-C.sub.10alkoxyalkylcarbonyloxyalkyloxy,
(R.sup.30)(R.sup.30)N(C.sub.1-C.sub.10alkoxy)-,
##STR00019##
where the substituents on any alkyl, alkenyl or alkynyl are 1-3
R.sup.38 and the substituents on any aryl or het are 1-3 R.sup.31
and pharmaceutically acceptable salts thereof. Compounds of
Formulas I-VI also include pharmaceutically acceptable salts, and
esters including pro-drug compounds of Formula I-VI, where
R.sup.3A, R.sup.5, R.sup.10, R.sup.17, R.sup.18, R.sup.19,
R.sup.20, R.sup.21, R.sup.29, and a carboxylic ester at R.sup.44
may be lower alkyl or --CH.sub.2CH.sub.2--R.sup.22 where R.sup.22
is one of the following:
##STR00020##
where R.sup.23 is hydrogen or methyl and R.sup.24 is lower alkyl or
lower cycloalkyl.
[0126] A preferred embodiment of compounds of Formula VI has the
stereochemistry indicated in Formula VI'.
##STR00021##
[0127] Some of the compounds described herein may comprise one or
more asymmetric centers, and thus may comprise individual
stereoisomers, individual diastereomers and any mixtures therein.
Further, compounds of the invention may contain geometric isomers
of double bonds, comprising Z and E isomers, and may be present as
pure geometric isomers or mixtures thereof.
[0128] In some preferred embodiments, the methods of the present
invention are performed with the following compounds or a
pharmaceutically acceptable salt or ester thereof:
##STR00022##
[0129] Compounds of the present invention include the following
compounds or a pharmaceutically acceptable salt or ester
thereof:
##STR00023## ##STR00024## ##STR00025## ##STR00026## ##STR00027##
##STR00028## ##STR00029## ##STR00030## ##STR00031## ##STR00032##
##STR00033##
[0130] The compounds of the invention may be prepared by methods
well known to those skilled in the art and may be purified in a
number of ways, including by crystallization or precipitation under
varied conditions to yield one or more polymorphs. Thus, the
present invention encompasses the above described inventive
compounds, their polymorphs, their pharmaceutically acceptable
salts, their pharmaceutically acceptable solvates, and
pharmaceutically acceptable compositions containing them.
[0131] The above examples of preferred embodiments are meant to
illustrate some of the potential therapeutic agents, and are not
meant to limit the invention in any way. The method of the
invention can be practiced with antibodies, fragments of
antibodies, peptides and other synthetic molecules that can be
identified using the methods described above to identify a
therapeutic agent that is a selective, potent and directly
competitive inhibitor of the interaction between LFA-1 and ICAM-1,
in order to treat dry eye disease.
[0132] Also provided herein are business methods which employ the
compounds and diagnostic and therapeutic methods described herein.
One business method involves the identification of LFA-1
antagonistic properties of peptides or small molecules and
developing the compounds for treatment of LFA-1 mediated diseases,
preferably by topical delivery. As the compounds are not
administered systemically, the systemic pharmacokinetic profiles of
these drugs are typically not determined and hence the candidate
pool of drugs available for development is larger. In one
embodiment, the LFA-1 antagonists are developed into ocular
formulations and then promoted and sold for treatment of eye
disorders, such as dry eye. The Hut78 assay is typically used to
determine LFA-1 antagonistic properties. In addition to LFA-1
antagonistic properties, leukocyte antagonistic properties can be
determined.
III. Administration
[0133] The method of present invention may draw upon many suitable
modes of administration to deliver the LFA-1 antagonist of the
methods described herein. Such delivery to affected regions of the
body may be achieved either via local or systemic administration.
Suitable formulations and additional carriers are described in
Remington "The Science and Practice of Pharmacy" (20.sup.th Ed.,
Lippincott Williams & Wilkins, Baltimore Md.), the teachings of
which are incorporated by reference in their entirety herein.
[0134] In some embodiments, the invention provides a pharmaceutical
composition for administration to a subject containing: (i) an
effective amount of a therapeutic agent; and (ii) a pharmaceutical
excipient suitable for oral administration. In some embodiments,
the composition further contains: (iii) an effective amount of a
second therapeutic agent.
[0135] In order to reduce inflammation in eye disorders, the
pharmaceutical composition of the invention is preferably delivered
to the ocular surface, interconnecting innervation, conjuncitva,
lacrimal glands, or meibomian glands. It is envisioned that
effective treatment can encompass administering therapeutic agents
of the present invention via oral administration, topical
administration, via injection, intranasally, rectally,
transdermally, via an impregnated or coated device such as an
ocular insert or implant, or iontophoretically, amongst other
routes of administration.
[0136] For administration via injection, the pharmaceutical
composition can be injected intramuscularly, intra-arterially,
subcutaneously, or intravenously. A pump mechanism may be employed
to administer the pharmaceutical composition over a preselected
period. For some embodiments of the invention it is desirable to
deliver drug locally, thus injections may be made periocularly,
intraocularly, subconjunctively, retrobulbarly, or intercamerally.
For some embodiments of the invention, systemic delivery is
preferred.
[0137] For systemic administration, the compounds of the invention
can be formulated for and administered orally. For administration
that may result in either regional or systemic distribution of the
therapeutic agents, the composition of the invention may be
administered intranasally, transdermally, or via some forms of oral
administration, e.g. with use of a mouthwash or lozenge
incorporating a compound of the invention that is poorly absorbed
from the G.I. For administration that may result in regional or
local delivery of the composition of the invention, iontophoretic
or topical administration may be used.
[0138] Additionally, the pharmaceutical compositions of the present
invention may be administered to the ocular surface via a
pump-catheter system, or released from within a continuous or
selective release device such as, e.g., membranes such as, but not
limited to, those employed in the Ocusert.TM. System (Alza Corp,
Palo Alto, Calif.). The pharmaceutical compositions can be
incorporated within, carried by or attached to contact lenses which
are then worn by the subject. The pharmaceutical compositions can
be sprayed onto ocular surface.
[0139] The pharmaceutical compositions of the invention may be
administered in combination with other therapies for the treatment
of the disorder or underlying disease. For example, the LFA-1
antagonist of the invention is administered at the same Lime, or
separately during the treatment period for which a subject receives
immunosuppressive therapies, such as azathioprine,
cyclophosphoramide, methotrextate, antimalarial drugs, mycophenolan
mofetile, daclizumab, intravenous immunoglobin therapy, and the
like. In another example, the LFA-1 antagonist of the invention is
administered at the same time or separately during the treatment
period for which a subject receives other anti-inflammatory
treatments, such as cyclosporin A, corticosteroids, NSAIDS, asprin,
doxycycline, and the like. In a further example, the LFA-1
antagonist of the invention is administered at the same time or
separately during the treatment period for which a subject receives
hormone therapy, and the like. In yet a further example, the LFA-1
antagonist of the invention is administered at the same time or
separately during the treatment period for which a subject receives
anti-allergy therapy, palliative care for dry eye including
artificial tears or artificial saliva, muscarinic M3 receptor
agonists to increase aqueous secretions, autologous serum, sodium
hyaluronate drops, and the like. These examples are illustrative
only and are not meant to limit the invention. In some embodiments,
the LFA-1 antagonist is administered in a single dose. A single
dose of a LFA-1 antagonist may also be used when it is
co-administered with another substance (e.g. an analgesic) for
treatment of an acute condition. In some embodiments, the LFA-1
antagonist (by itself or in combination with other drugs) is
administered in multiple doses. Dosing may be about once, twice,
three times, four times, five times, six times, seven times, eight
times, nine times, ten times or more than ten times per day. Dosing
may be about once a month, once every two weeks, once a week, or
once every other day. In one embodiment the drug is an analgesic.
In another embodiment the LFA-1 antagonist and another therapeutic
substance are administered together about once per day to about 10
times per day. In another embodiment the administration of the
LFA-1 antagonist and another therapeutic substance continues for
less than about 7 days. In yet another embodiment the
co-administration continues for more than about 6, 10, 14, 28 days,
two months, six months, or one year. In some cases, co-administered
dosing is maintained as long as necessary, e.g., dosing for chronic
inflammation. Administration of the compositions of the invention
may continue as long as necessary. In some embodiments, a
composition of the invention is administered for more than 1, 2, 3,
4, 5, 6, 7, 14, or 28 days. In some embodiments, a composition of
the invention is administered for less than 28, 14, 7, 6, 5, 4, 3,
2, or 1 day. In some embodiments, a composition of the invention is
administered chronically on an ongoing basis, e.g., for the
treatment of chronic pain.
[0140] Dosing for the LFA-1 antagonist in the method of the
invention may be found by routine experimentation. The daily dose
can range from about 1.times.10.sup.-7 g to 5000 mg. Daily dose
range may depend on the form of LFA-1 antagonist e.g., the esters
or salts used, and/or route of administration, as described herein.
For example, for systemic administration, typical daily dose ranges
are, e.g. about 1-5000 mg, or about 1-3000 mg, or about 1-2000 mg,
or about 1-1000 mg, or about 1-500 mg, or about 1-100 mg, or about
10-5000 mg, or about 10-3000 mg, or about 10-2000 mg, or about
10-1000 mg, or about 10-500 mg, or about 10-200 mg, or about 10-100
mg, or about 20-2000 mg or about 20-1500 mg or about 20-1000 mg or
about 20-500 mg, or about 20-100 mg, or about 50-5000 mg, or about
50-4000 mg, or about 50-3000 mg, or about 50-2000 mg, or about
50-1000 mg, or about 50-500 mg, or about 50-100 mg, about 100-5000
mg, or about 100-4000 mg, or about 100-3000 mg, or about 100-2000
mg, or about 100-1000 mg, or about 100-500 mg. In some embodiments,
the daily dose of LFA-1 antagonist is about 100, 200, 300, 400,
500, 600, 700, 800, 900, or 1000 mg. In some embodiments, the daily
dose of the LFA-1 antagonist is 10 mg. In some embodiments, the
daily dose of the LFA-1 antagonist is 100 mg. In some embodiments,
the daily dose of LFA-1 antagonist is 500 mg. In some embodiments,
the daily dose of LFA-1 antagonist is 1000 mg.
[0141] For topical delivery to the ocular surface, the typical
daily dose ranges are, e.g. about 1.times.10.sup.-7 g to 5.0 g, or
about 1.times.10.sup.-7 g to 2.5 g, or about 1.times.10.sup.-7 g to
1.00 g, or about 1.times.10.sup.-7 g to 0.5 g, or about
1.times.10.sup.-7 g to 0.25 g, or about 1.times.10.sup.-7 g to 0.1
g, or about 1.times.10.sup.-7 g to 0.05 g, or about
1.times.10.sup.-7 g to 0.025 g, or about 1.times.10.sup.-7 g to
1.times.10.sup.-2 g, or about 1.times.10.sup.-7 g to
5.times.10.sup.-3 g, or about 1.times.10.sup.-7 g to
2.5.times.10.sup.-3 g, or about 1.times.10.sup.-7 g to
1.times.10.sup.-3 g, or about 1.times.10.sup.-7 g to
5.times.10.sup.-4 g, or about 1.times.10.sup.-6 g to 5.0 g, or
about 1.times.10.sup.-6 g to 2.5 g, or about 1.times.10.sup.-6 g to
1 g, or about 1.times.10.sup.-6 g to 0.5 g, or about
1.times.10.sup.-6 g to 0.25 g, or about 1.times.10.sup.-6 g to 0.1
g, or about 1.times.10.sup.-6 g to 5.times.10.sup.-2 g, or about
1.times.10.sup.-6 g to 5.times.10.sup.-2 g, or about
1.times.10.sup.-6 g to 2.5.times.10.sup.-2 g, or about
1.times.10.sup.-6 g to 1.times.10.sup.-2 g, or about
1.times.10.sup.-6 g to 5.times.10.sup.-3 g, or about
1.times.10.sup.-6 g to 2.5.times.10.sup.-3 g, or about
1.times.10.sup.-6 g to 1.times.10.sup.-3 g, or about
1.times.10.sup.-6 g to 5.times.10.sup.-4 g, or about
1.times.10.sup.-5 g to 5 g, or about 1.times.10.sup.-5 g to 2.5 g,
or about 1.times.10.sup.-5 g to 1 g, or about 1.times.10.sup.-5 g
to 0.5 g, or about 1.times.10.sup.-5 g to 0.25 g, or about
1.times.10.sup.-5 g to 0.1 g, or about 1.times.10.sup.-5 g to 0.05
g, or about 1.times.10.sup.-5 g to 2.5.times.10.sup.-2 g, or about
1.times.10.sup.-5 g to 1.times.10.sup.-2 g, or about
1.times.10.sup.-5 g to 5.times.10.sup.-3 g, or about
1.times.10.sup.-5 g to 2.5.times.10.sup.-3 g, or about
1.times.10.sup.-5 g to 1.times.10.sup.-3 g, or about
1.times.10.sup.-5 g to 5.times.10.sup.-4 g. In some embodiments,
the daily dose of LFA-1 antagonist is about 1.times.10.sup.-7,
1.times.10.sup.-6, 1.times.10.sup.-5, 1.times.10.sup.-4,
1.times.10.sup.-3 g, 1.times.10.sup.-2 g, 1.times.10.sup.1 g, or 1
g. In some embodiments, the daily dose of the LFA-1 antagonist is
1.times.10.sup.-7 g. In some embodiments, the daily dose of the
LFA-1 antagonist is 1.times.10.sup.-5 g. In some embodiments, the
daily dose of LFA-1 antagonist is 1.times.10.sup.-3 g. In some
embodiments, the daily dose of LFA-1 antagonist is
1.times.10.sup.-2 g. In some embodiments the individual dose ranges
from about 1.times.10.sup.-7 g to 5.0 g, or about 1.times.10.sup.-7
g to 2.5 g, or about 1.times.10.sup.-7 g to 1.00 g, or about
1.times.10.sup.-7 g to 0.5 g, or about 1.times.10.sup.-7 g to 0.25
g, or about 1.times.10.sup.-7 g to 0.1 g, or about
1.times.10.sup.-7 g to 0.05 g, or about 1.times.10.sup.-7 g to
0.025 g, or about 1.times.10.sup.-7 g to 1.times.10.sup.-2 g, or
about 1.times.10.sup.-7 g to 5.times.10.sup.-3 g, or about
1.times.10.sup.-7 g to 2.5.times.10.sup.-3 g, or about
1.times.10.sup.-7 g to 1.times.10.sup.-3 g, or about
1.times.10.sup.-7 g to 5.times.10.sup.-4 g, or about
1.times.10.sup.-6 g to 5.0 g, or about 1.times.10.sup.-6 g to 2.5
g, or about 1.times.10.sup.-6 g to 1 g, or about 1.times.10.sup.-6
g to 0.5 g, or about 1.times.10.sup.-6 g to 0.25 g, or about
1.times.10.sup.-6 g to 0.1 g, or about 1.times.10.sup.-6 g to
5.times.10.sup.-2 g, or about 1.times.10.sup.-6 g to
5.times.10.sup.-2 g, or about 1.times.10.sup.-6 g to
2.5.times.10.sup.-2 g, or about 1.times.10.sup.-6 g to
1.times.10.sup.-2 g, or about 1.times.10.sup.-6 g to
5.times.10.sup.-3 g, or about 1.times.10.sup.-6 g to
2.5.times.10.sup.-3 g, or about 1.times.10.sup.-6 g to
1.times.10.sup.-3 g, or about 1.times.10.sup.-6 g to
5.times.10.sup.-4 g, or about 1.times.10.sup.-5 g to 5 g, or about
1.times.10.sup.-5 g to 2.5 g, or about 1.times.10.sup.-5 g to 1 g,
or about 1.times.10.sup.-5 g to 0.5 g, or about 1.times.10.sup.-5 g
to 0.25 g, or about 1.times.10.sup.-5 g to 0.1 g, or about
1.times.10.sup.-5 g to 0.05 g, or about 1.times.10.sup.-5 g to
2.5.times.10.sup.-2 g, or about 1.times.10.sup.-5 g to
1.times.10.sup.-2 g, or about 1.times.10.sup.-5 g to
5.times.10.sup.-3 g, or about 1.times.10.sup.-5 g to
2.5.times.10.sup.-3 g, or about 1.times.10.sup.-5 g to
1.times.10.sup.-3 g, or about 1.times.10.sup.-5 g to
5.times.10.sup.-4 g. In some embodiments, the individual doses as
described above, is repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times
per day.
[0142] For other forms of administration, the daily dosages may
range about the range described for systemic administration or may
range about the range described for topical administration.
IV. Formulations
[0143] The compounds of the invention may be formulated as a
sterile solution or suspension, in suitable vehicles, well known in
the art. Suitable formulations and additional carriers are
described in Remington "The Science and Practice of Pharmacy"
(20.sup.th Ed., Lippincott Williams & Wilkins, Baltimore Md.),
the teachings of which are incorporated by reference in their
entirety herein.
[0144] For injectable formulations, the vehicle may be chosen from
those known in art to be suitable, including aqueous solutions or
oil suspensions, or emulsions, with sesame oil, corn oil,
cottonseed oil, or peanut oil, as well as elixirs, mannitol,
dextrose, or a sterile aqueous solution, and similar pharmaceutical
vehicles.
[0145] The concentration of drug may be adjusted, the pH of the
solution buffered and the isotonicity adjusted to be compatible
with intravenous injection, as is well known in the art.
[0146] Oral formulations can be tablets, capsules, troches, pills,
wafers, chewing gums, lozenges, aqueous solutions or suspensions,
oily suspensions, syrups, elixirs, or dispersible powders or
granules, and the like and may be made in any way known in the art.
Oral formulations may also contain sweetening, flavoring, coloring
and preservative agents. Pharmaceutically acceptable excipients for
tablet forms may comprise nontoxic ingredients such as inert
diluents, such as calcium carbonate, sodium carbonate, lactose,
calcium phosphate, or sodium phosphate, and the like.
[0147] In the case of tablets for oral use, carriers which are
commonly used include lactose and corn starch, and lubricating
agents such as magnesium stearate are commonly added. For oral
administration in capsule form, useful carriers include lactose and
corn starch. Further nonlimiting examples of carriers and
excipients include milk, sugar, certain types of clay, gelatin,
stearic acid or salts thereof, calcium stearate, talc, vegetable
fats or oils, gums and glycols.
[0148] Surfactant which can be used to form pharmaceutical
compositions and dosage forms of the invention include, but are not
limited to, hydrophilic surfactants, lipophilic surfactants, and
mixtures thereof. That is, a mixture of hydrophilic surfactants may
be employed, a mixture of lipophilic surfactants may be employed,
or a mixture of at least one hydrophilic surfactant and at least
one lipophilic surfactant may be employed.
[0149] A suitable hydrophilic surfactant may generally have an HLB
value of at least 10, while suitable lipophilic surfactants may
generally have an HLB value of or less than about 10. An empirical
parameter used to characterize the relative hydrophilicity and
hydrophobicity of non-ionic amphiphilic compounds is the
hydrophilic-lipophilic balance ("HLB" value). Surfactants with
lower HLB values are more lipophilic or hydrophobic, and have
greater solubility in oils, while surfactants with higher HLB
values are more hydrophilic, and have greater solubility in aqueous
solutions. Hydrophilic surfactants are generally considered to be
those compounds having an HLB value greater than about 10, as well
as anionic, cationic, or zwitterionic compounds for which the HLB
scale is not generally applicable. Similarly, lipophilic (i.e.,
hydrophobic) surfactants are compounds having an HLB value equal to
or less than about 10. However, HLB value of a surfactant is merely
a rough guide generally used to enable formulation of industrial,
pharmaceutical and cosmetic emulsions.
[0150] Hydrophilic surfactants may be either ionic or non-ionic.
Suitable ionic surfactants include, but are not limited to,
alkylammonium salts; fusidic acid salts; fatty acid derivatives of
amino acids, oligopeptides, and polypeptides; glyceride derivatives
of amino acids, oligopeptides, and polypeptides; lecithins and
hydrogenated lecithins; lysolecithins and hydrogenated
lysolecithins; phospholipids and derivatives thereof;
lysophospholipids and derivatives thereof; carnitine fatty acid
ester salts; salts of alkylsulfates; fatty acid salts; sodium
docusate; acyl lactylates; mono- and di-acetylated tartaric acid
esters of mono- and di-glycerides; succinylated mono- and
di-glycerides; citric acid esters of mono- and di-glycerides; and
mixtures thereof.
[0151] Within the aforementioned group, preferred ionic surfactants
include, by way of example: lecithins, lysolecithin, phospholipids,
lysophospholipids and derivatives thereof; carnitine fatty acid
ester salts; salts of alkylsulfates; fatty acid salts; sodium
docusate; acyl lactylates; mono- and di-acetylated tartaric acid
esters of mono- and di-glycerides; succinylated mono- and
di-glycerides; citric acid esters of mono- and di-glycerides; and
mixtures thereof.
[0152] Ionic surfactants may be the ionized forms of lecithin,
lysolecithin, phosphatidylcholine, phosphatidylethanolamine,
phosphatidylglycerol, phosphatidic acid, phosphatidylserine,
lysophosphatidylcholine, lysophosphatidylethanolamine,
lysophosphatidylglycerol, lysophosphatidic acid,
lysophosphatidylserine, PEG-phosphatidylethanolamine,
PVP-phosphatidylethanolamine, lactylic esters of fatty acids,
stearoyl-2-lactylate, stearoyl lactylate, succinylated
monoglycerides, mono/diacetylated tartaric acid esters of
mono/diglycerides, citric acid esters of mono/diglycerides,
cholylsarcosine, caproate, caprylate, caprate, laurate, myristate,
palmitate, oleate, ricinoleate, linoleate, linolenate, stearate,
lauryl sulfate, teracecyl sulfate, docusate, lauroyl carnitines,
palmitoyl carnitines, myristoyl carnitines, and salts and mixtures
thereof.
[0153] Hydrophilic non-ionic surfactants may include, but not
limited to, alkylglucosides; alkylmaltosides; alkylthioglucosides;
lauryl macrogolglycerides; polyoxyalkylene alkyl ethers such as
polyethylene glycol alkyl ethers; polyoxyalkylene alkylphenols such
as polyethylene glycol alkyl phenols; polyoxyalkylene alkyl phenol
fatty acid esters such as polyethylene glycol fatty acids
monoesters and polyethylene glycol fatty acids diesters;
polyethylene glycol glycerol fatty acid esters; polyglycerol fatty
acid esters; polyoxyalkylene sorbitan fatty acid esters such as
polyethylene glycol sorbitan fatty acid esters; hydrophilic
transesterification products of a polyol with at least one member
of the group consisting of glycerides, vegetable oils, hydrogenated
vegetable oils, fatty acids, and sterols; polyoxyethylene sterols,
derivatives, and analogues thereof; polyoxyethylated vitamins and
derivatives thereof; polyoxyethylene-polyoxypropylene block
copolymers; and mixtures thereof; polyethylene glycol sorbitan
fatty acid esters and hydrophilic transesterification products of a
polyol with at least one member of the group consisting of
triglycerides, vegetable oils, and hydrogenated vegetable oils. The
polyol may be glycerol, ethylene glycol, polyethylene glycol,
sorbitol, propylene glycol, pentaerythritol, or a saccharide.
[0154] Other hydrophilic-non-ionic surfactants include, without
limitation, PEG-10 laurate, PEG-12 laurate, PEG-20 laurate, PEG-32
laurate, PEG-32 dilaurate, PEG-12 oleate, PEG-15 oleate, PEG-20
oleate, PEG-20 dioleate, PEG-32 oleate, PEG-200 oleate, PEG-400
oleate, PEG-15 stearate, PEG-32 distearate, PEG-40 stearate,
PEG-100 stearate, PEG-20 dilaurate, PEG-25 glyceryl trioleate,
PEG-32 dioleate, PEG-20 glyceryl laurate, PEG-30 glyceryl laurate,
PEG-20 glyceryl stearate, PEG-20 glyceryl oleate, PEG-30 glyceryl
oleate, PEG-30 glyceryl laurate, PEG-40 glyceryl laurate, PEG-40
palm kernel oil, PEG-50 hydrogenated castor oil, PEG-40 castor oil,
PEG-35 castor oil, PEG-60 castor oil, PEG-40 hydrogenated castor
oil, PEG-60 hydrogenated castor oil, PEG-60 corn oil, PEG-6
caprate/caprylate glycerides, PEG-8 caprate/caprylate glycerides,
polyglyceryl-10 laurate, PEG-30 cholesterol, PEG-25 phyto sterol,
PEG-30 soya sterol, PEG-20 trioleate, PEG-40 sorbitan oleate,
PEG-80 sorbitan laurate, polysorbate 20, polysorbate 80, POE-9
lauryl ether, POE-23 lauryl ether, POE-10 oleyl ether, POE-20 oleyl
ether, POE-20 stearyl ether, tocopheryl PEG-100 succinate, PEG-24
cholesterol, polyglyceryl-10oleate, Tween 40, Tween 60, sucrose
monostearate, sucrose monolaurate, sucrose monopalmitate, PEG
10-100 nonyl phenol series, PEG 15-100 octyl phenol series, and
poloxamers.
[0155] Suitable lipophilic surfactants include, by way of example
only: fatty alcohols; glycerol fatty acid esters; acetylated
glycerol fatty acid esters; lower alcohol fatty acids esters;
propylene glycol fatty acid esters; sorbitan fatty acid esters;
polyethylene glycol sorbitan fatty acid esters; sterols and sterol
derivatives; polyoxyethylated sterols and sterol derivatives;
polyethylene glycol alkyl ethers; sugar esters; sugar ethers;
lactic acid derivatives of mono- and di-glycerides; hydrophobic
transesterification products of a polyol with at least one member
of the group consisting of glycerides, vegetable oils, hydrogenated
vegetable oils, fatty acids and sterols; oil-soluble
vitamins/vitamin derivatives; and mixtures thereof. Within this
group, preferred lipophilic surfactants include glycerol fatty acid
esters, propylene glycol fatty acid esters, and mixtures thereof,
or are hydrophobic transesterification products of a polyol with at
least one member of the group consisting of vegetable oils,
hydrogenated vegetable oils, and triglycerides.
[0156] Surfactants may be used in any formulation of the invention
where its use is not otherwise contradicted. In some embodiments of
the invention, the use of no surfactants or limited classes of
surfactants are preferred.
[0157] When formulating compounds of the invention for oral
administration, it may be desirable to utilize gastroretentive
formulations to enhance absorption from the gastrointestinal (GI)
tract. A formulation which is retained in the stomach for several
hours may release compounds of the invention slowly and provide a
sustained release that may be preferred in some embodiments of the
invention. Disclosure of such gastro-retentive formulations are
found in Klausner, E. A.; Lavy, E.; Barta, M.; Cserepes, E.;
Friedman, M.; Hoffman, A. 2003 "Novel gastroretentive dosage forms:
evaluation of gastroretentivity and its effect on levodopa in
humans." Pharm. Res. 20, 1466-73, Hoffman, A.; Stepensky, D.; Lavy,
E.; Eyal, S. Klausner, E.; Friedman, M. 2004 "Pharmacokinetic and
pharmacodynamic aspects of gastroretentive dosage forms" Int. J.
Pharm. 11, 141-53, Streuhel, A.; Siepmann, J.; Bodmeier, R.; 2006
"Gastroretentive drug delivery systems" Expert Opin. Drug Deliver.
3, 217-3, and Chavanpatil, M.D.; Jain, P.; Chaudhari, S.; Shear,
R.; Vavia, P. R. "Novel sustained release, swellable and
bioadhesive gastroretentive drug delivery system for olfoxacin"
Int. J. Pharm. 2006 epub March 24. Expandable, floating and
bioadhesive techniques may be utitlized to maximize absorption of
the compounds of the invention.
[0158] Intranasal administration may utilize an aerosol suspension
of respirable particles comprised of the compounds of the
invention, which the subject inhales. The compound of the invention
are absorbed into the bloodstream via pulmonary absorption or
contact the lacrimal tissues via nasolacrimal ducts, and
subsequently be delivered to the lacrimal tissues in a
pharmaceutically effective amount. The respirable particles may be
solid or liquid, with suitably sized particles, as is known in the
art to be effective for absorption. Compositions for inhalation or
insufflation include solutions and suspensions in pharmaceutically
acceptable, aqueous or organic solvents, or mixtures thereof, and
powders. The liquid or solid compositions may contain suitable
pharmaceutically acceptable excipients as described supra.
Preferably the compositions are administered by the oral or nasal
respiratory route for local or systemic effect. Compositions in
preferably pharmaceutically acceptable solvents may be nebulized by
use of inert gases. Nebulized solutions may be inhaled directly
from the nebulizing device or the nebulizing device may be attached
to a face mask tent, or intermittent positive pressure breathing
machine. Solution, suspension, or powder compositions may be
administered, preferably orally or nasally, from devices that
deliver the formulation in an appropriate manner.
[0159] For transdermal administration, any suitable formulation
known in the art may be utilized, either as a solution, suspension,
gel, powder, cream, oil, solids, dimethylsulfoxide (DMSO)-based
solutions or liposomal Formulation for use in a patch or other
delivery system known in the art. The pharmaceutical compositions
also may comprise suitable solid or gel phase carriers or
excipients, which are compounds that allow increased penetration
of, or assist in the delivery of, therapeutic molecules across the
stratum corneum permeability barrier of the skin. There are many of
these penetration-enhancing molecules known to those trained in the
art of topical formulation. Examples of such carriers and
excipients include, but are not limited to, humectants (e.g.,
urea), glycols (e.g., propylene glycol), alcohols (e.g., ethanol),
fatty acids (e.g., oleic acid), surfactants (e.g., isopropyl
myristate and sodium lauryl sulfate), pyrrolidones, glycerol
monolaurate, sulfoxides, terpenes (e.g., menthol), amines, amides,
alkanes, alkanols, water, calcium carbonate, calcium phosphate,
various sugars, starches, cellulose derivatives, gelatin, and
polymers such as polyethylene glycols. The construction and use of
transdermal patches for the delivery of pharmaceutical agents is
well known in the art. See, e.g., U.S. Pat. Nos. 5,023,252,
4,992,445 and 5,001,139. Such patches may be constructed for
continuous, pulsatile, or on demand delivery of pharmaceutical
agents.
[0160] For topical administration, all the formulations for topical
ocular administration used in the field of ophthalmology (e.g., eye
drops, inserts, eye packs, impregnated contact lenses, pump
delivery systems, dimethylsulfoxide (DMSO)-based solutions
suspensions, liposomes, and eye ointment) and all the formulations
for external use in the fields of dermatology and otolaryngology
(e.g., ointment, cream, gel, powder, salve, lotion, crystalline
forms, foam, and spray) may be utilized as is known in the art.
Additionally all suitable formulations for topical administration
to skin and mucus membranes of the nasal passages may be utilized
to deliver the compounds of the invention. The pharmaceutical
compositions of the present invention may be a liposomal
formulation for topical or oral administration, any of which are
known in the art to be suitable for the purpose of this
invention.
[0161] Lubricants which can be used to Form pharmaceutical
compositions and dosage forms of the invention include, but are not
limited to, calcium stearate, magnesium stearate, mineral oil,
light mineral oil, glycerin, sorbitol, mannitol, polyethylene
glycol, other glycols, stearic acid, sodium lauryl sulfate, talc,
hydrogenated vegetable oil (e.g., peanut oil, cottonseed oil,
sunflower oil, sesame oil, olive oil, corn oil, and soybean oil),
zinc stearate, ethyl oleate, ethyl laureate, agar, or mixtures
thereof. Additional lubricants include, for example, a syloid
silica gel, a coagulated aerosol of synthetic silica, or mixtures
thereof. A lubricant can optionally be added, in an amount of less
than about 1 weight percent of the pharmaceutical composition.
[0162] It is envisioned additionally, that the compounds of the
invention may be attached releasably to biocompatible polymers for
use in sustained release formulations on, in or attached to inserts
for topical or systemic administration. The controlled release from
a biocompatible polymer may be utilized with a water soluble
polymer to form a instillable formulation, as well.
[0163] Eye drops may be prepared by dissolving the active
ingredient in a sterile aqueous solution such as physiological
saline, buffering solution, etc., or by combining powder
compositions to be dissolved before use. Other vehicles may be
chosen, as is known in the art, including but not limited to:
balance salt solution, saline solution, water soluble polyethers
such as polyethyene glycol, polyvinyls, such as polyvinyl alcohol
and povidone, cellulose derivatives such as methylcellulose and
hydroxypropyl methylcellulose, petroleum derivatives such as
mineral oil and white petrolatum, animal fats such as lanolin,
polymers of acrylic acid such as carboxypolymethylene gel,
vegetable fats such as peanut oil and polysaccharides such as
dextrans, and glycosaminoglycans such as sodium hyaluronate. If
desired, additives ordinarily used in the eye drops can be added.
Such additives include isotonizing agents (e.g., sodium chloride,
etc.), buffer agent (e.g., boric acid, sodium monohydrogen
phosphate, sodium dihydrogen phosphate, etc.), preservatives (e.g.,
benzalkonium chloride, benzethonium chloride, chlorobutanol, etc.),
thickeners (e.g., saccharide such as lactose, mannitol, maltose,
etc.; e.g., hyaluronic acid or its salt such as sodium hyaluronate,
potassium hyaluronate, etc.; e.g., mucopolysaccharide such as
chondroitin sulfate, etc.; e.g., sodium polyacrylate, carboxyvinyl
polymer, crosslinked polyacrylate, polyvinyl alcohol, polyvinyl
pyrrolidone, methyl cellulose, hydroxy propyl methylcellulose,
hydroxyethyl cellulose, carboxymethyl cellulose, hydroxy propyl
cellulose or other agents known to those skilled in the art).
[0164] The solubility of the components of the present compositions
may be enhanced by a surfactant or other appropriate co-solvent in
the composition. Such cosolvents include polysorbate 20, 60, and
80, Pluronic F68, F-84 and P-103, cyclodextrin, or other agents
known to those skilled in the art. Such co-solvents may be employed
at a level or from about 0.01% to 2% by weight.
[0165] The composition of the invention can be formulated as a
sterile unit dose type containing no preservatives. The
compositions of the invention may be packaged in multidose form.
Preservatives may be preferred to prevent microbial contamination
during use. Suitable preservatives include: benzalkonium chloride,
thimerosal, chlorobutanol, methyl paraben, propyl paraben,
phenylethyl alcohol, edetate disodium, sorbic acid, Onamer M, or
other agents known to those skilled in the art. In the prior art
ophthalmic products, such preservatives may be employed at a level
of from 0.004% to 0.02%. In the compositions or the present
application the preservative, preferably benzalkonium chloride, may
be employed at a level of from 0.001% to less than 0.01%, e.g. from
0.001% to 0.008%, preferably about 0.005% by weight. It has been
found that a concentration of benzalkonium chloride of 0.005% may
be sufficient to preserve the compositions of the present invention
from microbial attack.
[0166] The amount or administration and the number of
administrations of the active ingredient used in the present
invention vary according to sex, age and body weight of patient,
symptoms to be treated, desirable therapeutic effects,
administration routes and period of treatment. For eye drops for an
adult, the formulations containing the compounds of the invention
may range in concentration from about 0.0001 to 10.0 W/V %, about
0.005 to 10.0 W/V %, about 0.01 to 10.0 W/V %, about 0.05 to 10.0
W/V %, about 0.1 to 10.0 W/V %, about 0.5 to 10.0 W/V %, about 1.0
to 10.0 W/V %, about 20 to 10.0 W/V %, about 3.0 to 10.0 W/V %,
about 4.0 to 10.0 W/V %, or about 5.0 to 10.0 W/V %. One embodiment
of the invention has a formulation of about 1.0 to 10.0 W/V % of
the compounds of the invention. One embodiment of the invention has
a formulation of about 0.01 to 10.0 W/V % of the compounds of the
invention. One embodiment of the invention has a formulation of
about 5.0 to 10.0 W/V % of the compounds of the invention. The
administration may be administered several times a day per eye,
preferably one to ten times, more preferably one to four times,
most preferably once a day. The size of the drop administered may
be in the range of about 10-100 .mu.l, about 10-90 .mu.l, about
10-80 .mu.l, about 10-70 .mu.l, about 10-60 .mu.l, about 10-50
.mu.l, about 10-40 .mu.l, about 10-30 .mu.l, about 20-100 .mu.l,
about 20-90 .mu.l, about 20-80 .mu.l, about 20-70 .mu.l, about
20-60 .mu.l, about 20-50 .mu.l, about 20-40 .mu.l, or about 20-30
.mu.l. One embodiment of the invention administers a drop in the
range of 10-30 .mu.l. One embodiment of the invention administers a
drop in the range of 10-100 .mu.l. One embodiment of the invention
administers a drop in the range of 20-50 .mu.l. One embodiment of
the invention administers a drop in the range of 10-60 .mu.l.
[0167] The formulations of the invention may be administered
several drops per time, one to four drops, preferably one to three
drops, more preferably one to two drops, and most preferably one
drop per day.
[0168] In formulations for ointment, cream, lotion or spray, the
concentration of the compounds of the invention in the formulations
may range about 0.0001 10.0 W/V %, about 0.005 to 10.0 W/V %, about
0.01 to 10.0 W/V %, about 0.05 to 10.0 W/V %, about 0.1 to 10.0 W/V
%, about 0.5 to 10.0 W/V %, about 1.0 to 10.0 W/V %, about 20 to
10.0 W/V %, about 3.0 to 10.0 W/V %, about 4.0 to 10.0 W/V %, or
about 5.0 to 10.0 W/V %. One embodiment of the invention has a
formulation of about 1.0 to 10.0 W/V % of the compounds of the
invention. One embodiment oldie invention has a formulation of
about 0.01 to 10.0 W/V % of the compounds of the invention. One
embodiment of the invention has a formulation of about 5.0 to 10.0
W/V % of the compounds of the invention. These formulations may be
applied or sprayed several times a day, preferably one to six
times, more preferably one to four times, and most preferably once
a day. The compounding ratio of each ingredient may be suitably
increased or decreased based on the degree of inflammations or
infections.
[0169] The formulations of the invention can further include other
pharmacological active ingredients as far as they do not contradict
the purpose of the present invention. In a combination of plural
active ingredients, their respective contents may be suitably
increased or decreased in consideration of their effects and
safety.
V. Kits
[0170] The invention also provides kits. The kits include a
compound of the invention in suitable packaging, and written
material that can include instructions for use, discussion of
clinical studies, listing of side effects, and the like. The kit
may further contain another therapeutic agent that is
co-administered with the LFA-1 antagonist of the invention. In some
embodiments, the therapeutic agent and the LFA-1 antagonist of the
invention are provided as separate compositions in separate
containers within the kit. In some embodiments, the therapeutic
agent and the LFA-1 antagonist of the invention are provided as a
single composition within a container in the kit. Suitable
packaging and additional articles for use (e.g., measuring cup for
liquid preparations, foil wrapping to minimize exposure to air,
dispensers, and the like) are known in the art and may be included
in the kit.
VI. Method to Identify New Compounds Useful in the Method of
Treatment
A. Background of the Assay Method
[0171] 1. Dependence of Ligand Affinities on Divalent Cations
[0172] Divalent cations play a critical role in integrin/ligand
binding and their presence is essential in experimental
investigations of these interactions. See Hynes, R. O. 1992.
Integrins: Versatility, modulation, and signaling in cell adhesion,
Cell, 69: 11-25; Humphries, M. J. 1996. Integrin activation: the
link between ligand binding and signal transduction, Curr. Op. Cell
Biol., 8: 632-640. The affinities of ICAM-1-Ig and compounds 1, 3,
and 4 (structures shown in FIG. 4) for LFA-1 under two sets of
commonly used divalent cation conditions were measured using
fluorescence polarization. The affinity of compound 1 for LFA-1 was
first measured in a direct binding assay, and then the affinities
of ICAM-1-Ig and compounds 3 and 4 for LFA-1 were measured in
competition with compound 1 for LFA-1 (FIG. 4, and Table 1 in FIG.
5). The affinity of the A-286982, which binds to the IDAS, was not
measured as it does not compete with compound 1 for binding to
LFA-1 (see below). Similar changes in the affinities of compounds
1, 3 and 4 for LFA-1 were measured under the different cation
conditions as for ICAM-1-Ig. The small molecule affinities increase
at least ten-fold in the presence of MnCl.sub.2 over those measured
in CaCl.sub.2 and MgCl.sub.2. These small molecules do not bind to
LFA-1 in the absence of divalent cations (data not shown).
Similarly, the binding affinities of the soluble protein,
ICAM-1-Ig, for LFA-1 in solution, as measured by the same method,
in the presence of MnCl.sub.2, is at least four-fold better than
the affinity in the presence of CaCl.sub.2 and MgCl.sub.2. Thus,
unlike the classes of LFA-1 antagonists including A-286982 that are
known to bind to the IDAS region of the I domain (Liu, G., Huth, J.
R., Olejniczak, F. T., Mendoza, R., DeVries, P., Leitza, S.,
Reilly, F. R., Okasinski, G. F., Fesik, S. W., and von Geldern, T.
W. 2001. Novel p-arylthio cinnamides as antagonists of leukocyte
function-associated antigen-1/intracellular adhesion molecule-1
interaction. 2. Mechanism of inhibition and structure-based
improvement of pharmaceutical properties, J. Med. Chem., 44: 1202
1210., Huth, J. R., Olejniczak, E. T., Mendoza, R., Liang, H.,
Harris, E. A. S., Lupher, M. L. Jr., Wilson, A. E., Fesik, S. W.,
and Staunton, D. E. 2000. NMR and mutagenesis evidence for an I
domain allosteric site that regulates lymphocyte
function-associated antigen 1 ligand binding, Proc. Natl. Acad.
Sci. USA., 97: 5231-5236.) and are reported to bind to LFA-1 in a
cation-independent manner (Welzenbach, K., Hommel, U., and
Weitz-Schmidt, G. 2002. Small molecule inhibitors induce
conformational changes in the I domain and the I-like domain of
Lymphocyte Function-Associated Antigen-1, J. Biol. Chem., 277:
10590-10598), both ICAM-1-Ig and the class of LFA-1 antagonists
represented by compounds 1-4 share a divalent cation sensitivity
for LFA-1 binding (Table 1). Consequently, in order to identify
antagonists of LFA-1/ICAM-1 which hind in a similar manner to that
of ICAM-1-Ig and compounds 1-4, all binding assays reported herein
were performed under similar conditions, in the presence of
MnCl.sub.2, which is known to maximize the binding of both ICAM-1
and these cation-sensitive antagonists.
[0173] 2. Crosslinking of Compound 5 to the .alpha.L Subunit of
LFA-1
[0174] To identify the binding site of small molecule antagonists,
compound 5, a tritium-labeled, photoactivatable analogue of
compound 3 was bound to LFA-1 and then photocrosslinked. To
maximize specific, high affinity crosslinking, it was necessary to
gel filter the samples to remove unbound or weakly bound compound 5
prior to irradiation (FIG. 6, lanes e vs. f and g vs. h). In the
absence of gel filtration, there was significant crosslinking of
compound 5 to LFA-1.alpha. subunit, .beta. subunit, and heterodimer
(the band at approximately 200,000), whereas nonspecific
crosslinking was not observed in the gel filtered samples (data not
shown). Under gel filtration conditions, compound 5 specifically
crosslinked only to the .alpha.L subunit (FIG. 6, lanes c and g).
Moreover, the presence of compound 3 during the incubation
substantially reduced the incorporation of tritium into the
.alpha.L subunit (FIG. 6, lane e vs. g). Similarly, in the presence
of compound 3, there was a slight reduction of tritium
incorporation into the .alpha.L subunit, .beta.2 subunit and
heterodimer in the absence of gel filtration (FIG. 6, lane f vs.
h). No crosslinking of compound 5 occurred when gel filtered
samples of the isolated, structurally intact .alpha.L or .beta.2
subunits were used (data not shown). Thus, the high affinity
binding site necessary to crosslink after gel filtration is
provided by the intact LFA-1 heterodimer. The absence of a high
affinity site in the isolated .alpha.L subunit is consistent with a
previous study demonstrating lack of interaction of XVA143 with the
isolated I domain (Welzenbach et al. 2002).
[0175] The site of crosslinking was further defined by fragmenting
the affinity-labeled .alpha.L subunit with hydroxylamine,
electrophoretically separating the fragments, and then performing
N-terminal sequencing on the radiolabeled fragments to determine
their locations within the protein sequence. Two sequences were
identified, the first starting with residue 1 (sequence found:
YNLDVRGARSFS) and the second with residue 30 (sequence found:
GVIVGAPGEGNST) (Larson, R. S., Corbi, A. L., Berman, L., and
Springer, T. 1989. Primary structure of the leukocyte
function-associated molecule-1 alpha subunit: an integrin with an
embedded domain defining a protein superfamily, J. Cell Biol,. 108:
703-712). Both peptides were approximately 500 amino acids long as
judged by their sizes on SDS-PAGE (50-60 kDa); this fragment size
is consistent with the next two predicted cleavage sites (N-G) for
hydroxylamine, N507 and N530 (Larson et al. 1989, Bornstein, P.
1969. The nature of a hydroxylamine-sensitive bond in collagen,
Biochem. Biophys. Res. Comm., 36: 957-964). No label was
incorporated into the C-terminal half of the subunit. Attempts to
refine the crosslinking site further were not successful. No
definable labeled peptides were recoverable after limited digestion
or the labeled .alpha.L subunit with either cyanogen bromide or
Lys-C.
[0176] 3. Lack of Binding of Compound 2B to LFA-1 Lacking the I
Domain
[0177] The role of the I domain in the binding of compound 2B and
related analogs to LFA-1 was demonstrated by preparing a construct
of the .alpha.L subunit lacking the I domain. The .beta.2 construct
alone (mock) or together with the construct lacking the I domain or
wild type .alpha.L was transfected into 293 cells, and the binding
of compound 2B to the transfected cells was examined (FIG. 7).
Compound 2B showed substantial binding to the wild type .alpha.L
transfected cells but demonstrated no significant binding to the
cells transfected with .alpha.L lacking the I domain relative to
binding to mock (.beta.2) transfected cells. Transfectants were
also tested for their ability to adhere to ICAM-1-Ig, and as
expected, the LFA-1 transfected cells lacking the I domain and mock
transfectants showed indistinguishable background levels of
binding, while the wild type .alpha.L transfected cells showed
robust adhesion (FIG. 7B) (Yalamanchili, P., Lu, C., Oxvig, C., and
Springer T. A. 2000. Folding and function of I domain-deleted Mac-1
and lymphocyte function-associated antigen-1, J. Biol. Chem., 275:
21877-21882). Evaluation or the binding or a panel of LFA-1
antibodies to the transfected cells indicated that, apart from loss
of binding by antibodies that mapped to the I domain, the LFA-1
heterodimer appeared to be intact in the transfected cells lacking
the .alpha.L I domain (data not shown).
[0178] The data support the conclusion that compound 3 and related
molecules bind to a high affinity site on LFA-1 that overlaps with
the ICAM-1 binding site which has previously been shown to include
the MIDAS motif of the I domain in the at subunit of LFA-1
(Shimaoka, M., Xiao, T., Liu, J.-H., Yang, Y., Dong, Y., Jun, C-D.,
McCormack, A. Zhang, R., Joachimiak, A., Takagi, J., Wang, J.-H.,
and Springer, T. A. 2003a. Structures of the alpha L I domain and
its complex with ICAM-1 reveal a shape-shifting pathway for
integrin regulation, Cell, 112: 99-111.).
[0179] Corroborating evidence for the close proximity of the ICAM-1
and small molecule antagonist binding sites on LFA-1 can be seen in
the common effect of the deletion of the I domain on the binding of
both ICAM-1-Ig and compound 2B. Both compound 2B and ICAM-1 were
unable to bind to LFA-1 lacking the I domain, the domain in which
the ICAM-1 binding site is located. Moreover, the ability of
A-286982 to allosterically modify the binding of both ICAM-1-Ig and
compound 2B is consistent with a close proximity of their binding
sites to the A-286982 binding site in the IDAS motif in the I
domain of the LFA-1 .alpha. subunit (Liu, G. 2001b. Small molecule
antagonists of the LFA-1/ICAM-1 interaction as potential
therapeutic agents, Expert Opin. Ther. Patents, 11: 1383-1393, Liu
et al. 2001). The selective photochemical crosslinking of compound
5 to the .alpha. chain of LFA-1 localizes its binding site to
within residues 30-507 of this subunit. All of the findings noted
above are consistent with a single high affinity small molecule
binding site located in the I domain of the .alpha. chain of
LFA-1.
[0180] Close examination of the photochemical crosslinking study
performed with a relatively high concentration of compound 5 (4.1
.mu.M, FIG. 6) affords direct evidence for an additional low
affinity small molecule binding site on LFA-1. Dramatically
different protein and crosslinking patterns are observed in the
presence and absence of gel filtration. When samples are gel
filtered to remove unbound and weakly bound molecules prior to
irradiation, only high affinity labeling of the .alpha. subunit is
observed. However, in the absence of the gel filtration step,
irradiation of the complex of compound 5 with LFA-1 results in high
intensity crosslinking to the .alpha. subunit and lower intensity
crosslinking to a low affinity binding site in the .beta. subunit
whose complex with compound 5 is too weak to survive gel
filtration. Under both conditions, the observed crosslinking is
partially inhibited by a large excess (290 .mu.M) of compound 3
(FIG. 6, lanes e and g, f and h), demonstrating the specific nature
of the binding to both sites. Attempts to crosslink compound 5 to
either of the isolated .alpha. or .beta. subunits failed to afford
high affinity complexes capable of surviving the gel filtration
process. Consequently, it appears that the high affinity
competitive binding of the class of compounds represented by
compound 3 requires the presence of an intact full length LFA-1
heterodimer. Attempts to capture this binding site in constructs of
either of the LFA-1 subunits or the isolated I domain results in
diminished affinity of LFA-1 for ICAM-1 and small molecule analogs
of compound 3 (e.g. XVA143) (Shimaoka, M., Lu, C., Palframan, R.
T., von Andrian, U. H., McCormack, A., Takagi, J., and Springer, T.
A. 2001. Reversibly locking a protein fold in an active
conformation with a disulfide bond: integrin alphaL I domains with
high affinity and antagonist activity in vivo, Proc. Natl. Acad.
Sci, U.S.A., 98: 6009-6014., Welzenbach et al. 2002). It is
particularly interesting to note the presence of a minor LFA-1
heterodimer band that appears in the absence or gel filtration
(FIG. 6, band at >200,000 daltons.) The intensity of the LFA-1
band as judged by both Coomassie blue staining and autoradiography
is consistent with low affinity binding to a second site on the
.beta. chain that stabilizes the heterodimer.
[0181] It appears, from published gel stabilization studies
(Shimaoka, M., Salas, A., Yang, W., Weitz-Schmidt, G. and Springer,
T. 2003b. Small molecule integrin antagonists that bind to the
.beta..sub.2 subunit I-like domain and activate signals in one
direction and block them in another, Immunity, 19: 391-402, Salas,
A., Shimaoka, M., Kogan, A. N., Harwood, C., von Andrian, U. H.,
and Springer, T. A., 2004. Rolling adhesion through an extended
conformation of integrin .alpha..sub.L.beta..sub.2 and relation to
.alpha. I and .beta. I-like domain interaction, Immunity, 20:
393-406, Yang, W., Shimaoka, M., Salas, A., Takagi, J., and
Springer, T. A. 2004. Intersubunit signal transmission in integrins
by a receptor-like interaction with a pull spring. PNAS, 101:
2906-2911), that the binding site responsible for the stabilization
of LFA-1 to SDS-PAGE resides in the I-like domain of the subunit.
The data presented herein shows that this .beta. subunit binding
site is not related to the high affinity binding site in the
.alpha. subunit which is responsible for the direct competitive
inhibition of ICAM-1 binding. However, the .beta. subunit binding
site responsible for LFA-1 stabilization by compound 3 may be the
same as the low affinity .beta. subunit crosslinking site we have
observed.
[0182] Overall, the crosslinking and binding experiment results
presented herein indicate that there are two distinct binding sites
for the class of LFA-1 small molecule antagonist probes used
herein. The first is a high affinity binding site in the .alpha.L
subunit of LFA-1 through which the small molecule and LFA-1 form a
complex which is stable enough (e.g. K.sub.d<25 nM) to survive
the gel filtration process. It is this small molecule binding site
that has been characterized in the binding experiments reported
here as overlapping the ICAM-1 binding site and that correlates
with: the potent inhibition of LFA-1/ICAM-1 binding by compounds 3
and 4 (compound 4 IC.sub.50=1.4 nM); their potent inhibition of
LFA-1 induced lymphocyte proliferation (compound 4 IC.sub.50=3 nM)
in vitro; and their inhibition of the immune system's response in
vivo (Gadek et al. 2002). The second site is a lower affinity
binding site (e.g. K.sub.d>1 .mu.M) in the .beta. subunit which
is involved with stabilization of the LFA-1 heterodimer under
SDS-PAGE. This site is more dynamic by nature (i.e. faster off
rate) and does not survive the gel filtration/photolysis process.
The characteristics of this second low affinity site are consistent
with those of the recently described .alpha./.beta. I-like
allosteric antagonist binding site in the I-like domain of the
.beta. subunit (Welzenbach et al. 2002, Shimaoka et al. 2003b,
Salas et al. 2004, Yang et al. 2004). The low affinity binding of
the ICAM-1 mimetics described herein to the .beta. subunit of
LFA-1, presumably to the I-like domain, is likely due to the
sequence homology between the I and I-like domains, particularly
with regard to similarities in MIDAS motifs and their affinities
for the carboxylic acid moiety common to this class of antagonists.
Given that the .beta.2 family of integrins, including MAC-1, share
this subunit, the affinity of compounds for the I-like domain in
the .beta.2 subunit must be attenuated in order to select
antagonists which are specific to LFA-1 (Keating, S., Marsters, J.,
Beresini, M., Ladner, C., Zioncheck, K., Clark, K., Arellano, F.,
and Bodary, S. 2000. Putting the pieces together: Contribution of
fluorescence polarization assays to small molecule lead
optimization, SPIE Proceedings, 3913: 128-137).
[0183] The experiments described above substantiate the high
affinity binding of compounds 3 and 4 to LFA-1 in a manner that is
similar to that of ICAM-1, at a site overlapping the ICAM-1 binding
site involving the MIDAS motif within the I domain of the LFA-1
.alpha. subunit (Shimaoka, M., Xiao, T., Liu, J.-H., Yang, Y.,
Dong, Y., Jun, C-D., McCormack, A. Zhang, R., Joachimiak, A.,
Takagi, J., Wang, J.-H., and Springer, T. A. 2003a. Structures of
the alpha L I domain and its complex with ICAM-1 reveal a
shape-shifting pathway for integrin regulation, Cell, 112:
99-111.). This is consistent with their proposed mimicry of the
ICAM-1 epitope (Gadek et al. 2002), and inconsistent with any
conclusion that they function as .alpha./.beta. I-like allosteric
antagonists of LFA-1/ICAM-1 (Shimaoka et al. 2003b, Shimaoka, M.,
and Springer, T. A. 2004. Therapeutic antagonists and the
conformational regulation of the .beta.2 integrins, Curr. Topics
Med. Chem., 4: 1485-1495). The binding of these ICAM-1 mimetics to
the .beta.2 integrin subunit, albeit with lower affinity, raises
the question of whether ICAM-1 itself binds to a second site in the
I-like domain (Welzenbach et al. 2002, Shimaoka et al. 2003b, Salas
et al. 2004, Yang et al. 2004, Shimaoka and Springer 2004) as part
of a feedback mechanism. The requirements for divalent cations, to
ensure the formation of the active conformation of LFA-1, and
physical corroboration that probe molecules 1-5, known modulators
of LFA-1, compete directly with ICAM-1, are experimental details
used in the present invention to form a method of identifying new
antagonists which are direct competitive antagonists of LFA-1. The
method is useful to identify new antagonists of LFA-1, to be used
in the method of the invention to treat dry eye disease.
[0184] It has been shown, supra, that small molecules can bind with
high affinity to the .alpha.-L subunit, which is unique to LFA-1.
Consequently these compounds can be selective for LFA-1
(.alpha.L.beta.2) over Mac-1 (.alpha.M.beta.2). One preferred
embodiment of the invention is to identify and utilize selective
inhibitors of LFA-1, which may confer advantages in therapeutic
safety.
B. Assay Methodology: Competitive Binding Experiments
[0185] 1. Antagonist Competition in the LFA-1/ICAM-1 and
LFA-1/Small Molecule ELISA.
[0186] Compounds 2A and 3, A-286982, and sICAM-1 were used to
demonstrate the method. In order to illustrate inhibition of
binding of ICAM-1-Ig to LFA-1, these antagonists were titrated into
the LFA-1/ICAM-1 ELISA. The experiment was performed by the
addition of 1/5 serial dilutions of compound 3 (-.lamda.-),
compound 2A (-.sigma.-), A-286982 (-.diamond-solid.-) and sICAM-1
(-.tau.-) were incubated with either ICAM-1-Ig (A) or compound 2B
(B) on plates containing captured LFA-1. The data shown are the
average of two plates from a single experiment and are
representative of several independent measurements. The solid lines
are the fits of the data. The IC.sub.50 values (nM) are provided in
the legends.
[0187] Typical competition curves for these inhibitors in the ELISA
are shown in FIG. 8A. Compound 3 potently inhibited the binding of
ICAM-1-Ig to LFA-1 with a 2 nM IC.sub.50. Compound 2A, an analogue
of compound 3, inhibited binding but with an approximately 10-fold
higher IC.sub.50 value. A-286982 and sICAM-1 inhibited ICAM-1-Ig
binding to LFA-1 but with IC.sub.50 values that were more than
100-fold that of compound 3.
[0188] The ability of these same compounds to inhibit the binding
of a FITC labeled small molecule antagonist, compound 2B, to LFA-1
was also demonstrated (FIG. 8B). The potencies of compounds 2A and
3 and soluble ICAM-1 as inhibitors of compound 2B binding
paralleled their potencies as inhibitors of ICAM-1-Ig binding.
Compound 3, compound 2A and sICAM-1 inhibited the binding of
compound 2B to LFA-1 with IC.sub.50 values of 3, 56, and 1200 nM,
respectively. A-286982 did not inhibit but rather enhanced the
binding of compound 2B to LFA-1 as indicated by the transient
increase in the absorbance values, reaching a maximal effect at
approximately 4 .mu.M before decreasing.
[0189] The evaluation of IC.sub.50 values in the LFA-1/small
molecule and LFA-1/ICAM-1 ELISAs was extended to a larger set of
compounds including a group of kistrin-derived peptides and small
molecules representing the evolution of this class of LFA-1 small
molecule antagonists (Gadek et al. 2002). As shown in FIG. 9
(Correlation of IC50 values from antagonist competition in the
LFA-1:ICAM-1 and LFA-1: small molecules ELISAs. The IC.sub.50
values of a diverse group of compounds (4 peptides, 5 small
molecules and sICAM-1) in competition with compound 2B are plotted
against the IC.sub.50 values determined in competition with
ICAM-1-Ig for binding to LFA-1. The slope of the plot is 0.964,
y-intercept, 0.237 and R=0.940. Each data point is the average of
IC.sub.50 values from two plates), there is a good correlation
(R=0.94) between the IC.sub.50 values for competition in each of
the two ligand binding assays for this diverse set of compounds,
including sICAM-1, compounds 2A and 3, across five log units of
potency. The common trend in potencies between the two antagonist
competition ELISAs with ICAM-1-Ig and compound 2B as ligands
reveals that each compound disrupts the binding of both ICAM-1 and
small molecule ligands in a mechanistically similar fashion. This
parallel in potency of inhibition demonstrates that ICAM-1-Ig and
compound 2B are binding to the same site on LFA-1 (Wong, A., Hwang,
S. M., Johanson, K., Samanen, J., Bennett, D., Landvatter, S. W.,
Chen, W Heys, J. R., Ali, F. E., Ku, T. W., Bondinell, W., Nichols,
A. J., Powers, D. A., and Stadel, J. M. 1998. Binding of
[3H]-SK&F 107260 and [3H]-SB 214857 to purified integrin
alphaHbbeta3: evidence for a common binding site for cyclic
arginyl-glycinyl-aspartic acid peptides and nonpeptides, J.
Pharmacol. Exp. Therapeutics, 285: 228-235).
[0190] 2. Antagonist Modulation of Ligand Binding in LFA-1/ICAM-1
and LFA-1/Small Molecule ELISAs.
[0191] An antagonist, which inhibits through direct competition
with the ligand of interest, exhibits a non-saturable rightward
shift of the ligand binding curves to higher apparent EC.sub.50
values with increasing antagonist concentration and no reduction in
the maximal binding of the ligand (Lutz, M., and Kenakin, T. 1999.
Quantitative Molecular Pharmacology and Informatics in Drug
Discovery, John Wiley & Sons, Ltd., New York, Pratt, W. B., and
Taylor, P. 1990. Principles of Drug Action: The Basis of
Pharmacology, Churchill Livingstone, New York Matthews, J. C. 1993.
Fundamentals of Receptor, Enzyme, and Transport Kinetics, CRC
Press, Boca Raton, Kenakin, T. 1997. Pharmacologic Analysis of
Drug-Receptor Interaction, Lippincott-Raven, Philadelphia).
Inhibition will be surmountable but will require increasing amounts
of ligand in the presence of increasing concentrations of a direct
competitive inhibitor (Gaddum, J. H., Hameed, K. A., Hathway, D.
E., and Stephens, F. F. 1955. Quantitative studies of antagonists
for 5-hydroxytryptamine, Q. J. Exp. Physiol., 40: 49-74). The
effects of directly competitive compound 3, A-286982 and sICAM-1 on
the binding curves of ICAM-1-Ig and compound 2B to LFA-1 are shown
in FIG. 10 as examples of antagonists displaying direct
competition. Titration of ICAM-1-Ig (A, C, E) or compound 2B (B, D,
F) in the absence (-.diamond.-) or presence of antagonist in the
LFA-1/ICAM-1 and LFA-1/small molecule ELISAs. The antagonists were
added in two-fold dilutions starting at 2.4 (A) and 2.7 (B) .mu.M
sICAM-1, 0.040 (C) and 0.10 (D) .mu.M compound 3 and 20 (E) and 50
(F) .mu.M A-286982. The order or antagonist concentrations was,
-.quadrature.- (lowest added antagonist concentration), -.DELTA.-,
-.mu.-, -.diamond-solid.-, -.box-solid.-, -.sigma.- to -.lamda.-
(highest antagonist concentration). The fits of the data are shown
as the solid lines. The data shown are from one plate and are
representative of a minimum of two experiments. (Note that A-286982
(F) resulted in increased binding of compound 2B to LFA-1.) In
contrast, an allosteric inhibitor may alter the ligand binding
curves by causing a reduction in maximal binding or saturation in
the rightward shifts of the curves (Lutz and Kenakin 1999, Matthews
1993). As shown in FIG. 10A, the presence of increasing
concentrations of sICAM-1 clearly shifted the ICAM-1-Ig binding
curves rightward to higher EC.sub.50 values. Additionally, the same
maximal extent of binding of ICAM-1-Ig to LFA-1 was observed in the
presence and absence of sICAM-1 as expected when two molecular
forms of the same natural ligand are competing directly for binding
to one site on a receptor (Lutz and Kenakin 1999, Pratt, W. B., and
Taylor, P. 1990. Principles of Drug Action: The Basis of
Pharmacology, Churchill Livingstone, New York, Matthews 1993,
Kenakin, T. 1997. Pharmacologic Analysis of Drug-Receptor
Interaction, Lippincott-Raven, Philadelphia). Similarly, increasing
concentrations of compound 3 also shifted the binding of ICAM-1-Ig
to higher EC.sub.50 values with minimal variation in maximal
ICAM-1-Ig binding (FIG. 10C). Although the rightward shifts in the
ligand binding curves in the presence of a competitive antagonist
are typically parallel, this is not always the case (Coultrap, S.
J., Sun, H., Tenner, T. E. Jr. and Machu, T. K. 1999. Competitive
antagonism or the mouse 5-hydroxytryptamine3 receptor by
bisindolylmaleimide I, a "selective" protein kinase C inhibitor,
Journal of Pharmacology and Experimental Therapeutics. 290: 76-82).
The nonparallel slopes for the LFA-1/ICAM-1-Ig binding curves in
the presence and absence of compound 3 may be due to an inability
to attain complete equilibrium under the heterogeneous ligand
binding ELISA conditions with this compound. In the LFA-1/compound
2B format of the ligand binding ELISA, increasing concentrations of
compound 3 also clearly shifted the compound 2B binding curves to
higher EC.sub.50 values with no reduction in maximal binding (FIG.
10D). Increasing concentrations of sICAM-1 also showed a similar
effect (FIG. 10B), although the extent of the shift in the curves
was limited by the maximum achievable concentration of sICAM-1 at
2.7 .mu.M. Thus, the effects of both sICAM-1 and compound 3 on
ICAM-1-Ig and compound 2B binding to LFA-1 are characteristic of
direct competition as described above.
[0192] The effect of A-286982 on ICAM-1-Ig and compound 2B binding
to the receptor was clearly different (FIGS. 10E and 10F). In the
LFA-1/ICAM-1 ELISA, the ICAM-1-Ig curves were shifted rightward to
higher EC.sub.50 values; however, the maximum binding of ICAM-1-Ig
to LFA-1 decreased considerably with increasing concentrations of
A-286982. The reduction in maximal binding and rightward shift of
the ligand binding curves with increasing A-286982 concentration
are reflective of allosteric inhibition as described above.
A-286982 causes reductions in both ligand affinity and binding
capacity (Lutz, M., and Kenakin, T. 1999. Quantitative Molecular
Pharmacology and Informatics in Drug Discovery, John Wiley &
Sons, Ltd., New York, Matthews 1993); this demonstrates that
A-286982 is an insurmountable antagonist of CAM-1-Ig binding. In
contrast, in the LFA/small molecule ELISA, the presence of A-286982
at micromolar concentrations shifted the compound 2B binding curves
to lower EC.sub.50 values and appeared to enhance the binding of
compound 2B to LFA-1 (FIG. 10F). The contrasting effects of
A-286982 on compound 2B and ICAM-1-Ig binding may be due to the
known allosteric effect of the compound binding to the IDAS site on
LFA-1. The A-286982 binding data serve as an illustration for
allosteric inhibition for small molecule and protein ligand binding
to LFA-1 in the binding experiments demonstrated in this
method.
[0193] Schild analysis can be also used to investigate whether a
compound inhibits ligand binding through direct competition for a
single binding site (Lutz and Kenakin 1999, Pratt and Taylor 1990,
Matthews 1993, Kenakin 1997, Coultrap 1999). This model is based
upon the assumptions that equiactive responses in an assay are the
result of equivalent occupancy of receptor by ligand and that
maximal binding is unchanged by the presence of antagonist. In a
Schild analysis, the dose ratio is the ratio of the EC.sub.50
values in the presence and absence of antagonist and is a measure
of the ligand concentrations leading to equiactive responses. This
dose ratio was determined for each concentration of antagonist and
the Schild regressions were plotted as shown in FIG. 11. A linear
response with a slope or 1 in a Schild regression indicates that
inhibition by an antagonist is directly competitive and reversible
(Lutz and Kenakin 1999, Kenakin 1997). The Schild analysis would
yield a nonlinear relationship and/or a slope that deviates
significantly from 1 in the case of an allosteric inhibitor that
does not result in a reduction of maximal binding (Lutz and Kenakin
1999, Kenakin 1997). The Schild regressions for both sICAM-1 and
compound 3 are shown in FIG. 11 with comparable slopes of 1.26 and
1.24, respectively. Schild regressions of s-ICAM-1 (-.sigma.-) and
compound 3 (-.lamda.-) antagonism in the LFA-1/ICAM-1 ligand
binding ELISA are plotted from the data in FIGS. 5 (A) and (C),
respectively. The slope of the plot for compound 3 is 1.24 with a
y-intercept of 10.9 and R=0.99832. The slope of the sICAM-1 plot is
1.26, y-intercept, 8.51 and R=0.99131. Although the Schild analysis
requires a linear regression with a slope close to 1 to demonstrate
direct competitive inhibition, there is no guidance in the
extensive literature as to what range of Schild values are
acceptable. Slopes of 1.24 and 1.26 fall within the bounds of many
published Schild values used to support competitive binding
conclusions, and therefore, these slope values are not considered
significantly different than 1. The linearity of the regression
plots and the similarity in slopes of the relationships are
consistent with binding of ligand (ICAM-1-Ig) and both antagonists
(sICAM-1 and compound 3) to the same site in a similar manner.
[0194] The binding experiments described above and the analyses
discussed are used to form a method for identifying directly
competitive inhibitors or LFA-1. Potentially directly competitive
therapeutic agents can be investigated using one or more of the
experiment types described herein to ascertain whether the agent of
interest does compete with known natural and synthetic ligands to
compete for binding at the same LFA-1 site at which ICAM-1 binds.
The directly competitive antagonist therapeutic agents thus
identified are used in the method of the invention to treat a
subject in need of treatment for inflammatory disorders mediated by
LFA-1 and its interaction with ICAM-1.
VII. Method of Identifying Compounds Useful in Treating Human
Disease
[0195] A refined searching method is described herein using the
pattern of the inhibition of cell growth by siRNA (small
interfering RNA sequences) directed against a cellular target
involved in cell growth and human disease to identify compounds
with a similar pattern of cell growth inhibition in a group of
cultured cell lines. The use of siRNA data is desirable because
siRNA silences the target's gene and is directly linked to the
inhibition of cell growth by that target. Therefore siRNA data is
useful to correlate the inhibition of a target's function and the
inhibition of cell growth. Compounds identified in this manner are
useful in the treatment of human diseases.
[0196] FIG. 12 is a flow chart for the identification or compounds
for the treatment or human diseases using siRNA growth inhibition
data.
[0197] The method includes choosing a cellular target (for example,
a protein or other biopolymer whose formation is controlled by the
transcription and/or translation of a gene) involved in the growth
of cells containing said target whose inhibition would be useful in
the control of cell growth is selected. This selection can be from
lists of such targets in the public domain including the scientific
literature and includes enzymes, receptors and proteins involved in
protein-protein interactions. One such useful target is the
association of beta-catenin with proteins of the TCF family such as
TCF-4. These proteins are in the Wnt pathway and are involved in
the growth and proliferation of a number of human tumors including
common cancer. A compound which binds to beta-catenin and blocks
its association with TCF-4 is useful in preventing selected gene
transcription and the growth of tumors in human cancers,
particularly colon cancer. Small interfering RNA (siRNA) sequences
unique to the target are purchased from commercial suppliers such
as Dharmacon, Boulder Colo. Cell lines from the National Cancer
Institute's panel of 60 cell lines relevant to cancer (for example
the Colon and Breast derived NCI cell lines) and/or inflammation
(for example the NCI leukemia cell lines) can be grown in the
presence of increasing amounts of the siRNA directed against the
target until the growth of the cells is inhibited. Alternatively, a
single concentration of siRNA can be used against all of the cell
lines and the relative inhibition of cell growth can be measured.
Cell lines whose growth is dependent on the presence of the target
will be inhibited, while other cell lines may be less dependent and
consequently their growth will be less inhibited. Thus the
inhibition of the panel of the NCI's 60 cell lines will produce a
pattern of growth inhibition for each siRNA and target tested. The
use of cell lines not currently in the NCI-60 cell line panel are
also envisioned as part of this method. It is envisioned
additionally that reagents, e.g. Lipofectin.TM., Lipofectamine.TM.,
and the like, can modulate the delivery or siRNA to cells. The
NCI's existing data for dose titration effects of compounds on the
growth of the same 60 cell lines can be searched using the NCI's
COMPARE program or to identify compounds which have a similar
pattern of activity (for example, the concentration of compound
which inhibits the growth of cells by 50% compared to its
uninhibited growth, the GI50 value for a compound). The similarity
can be quantified by statistical or other methods including the
Pearson correlation used in the NCI COMPARE program. Search
algorithms other than NCI COMPARE can be used to define compound
and siRNA similarities. Data from the NCI can be analyzed online
via the world wide web, or it can be downloaded to a computer or
network of computers and analyzed offline. Additional databases
including public and proprietary databases linking compound
structure to their inhibition of cell growth are also useful for
the purposes or this invention. For each target, the structures of
compounds whose cell growth activity pattern is similar to the
pattern of growth inhibition produced by the siRNA experiment will
contain common substructural features (for example phenyl groups,
carboxylic acid groups, hydrogen bond donor group, etc.) which can
define a structure activity relationship (SAR). Such SAR
relationships are commonly used by medicinal chemists skilled in
the art of drug discovery to link the activity of compounds against
a target to a common structural motif. The development and
refinement of an SAR is useful in identifying and designing
structurally analogous compounds with a probability or likelihood
of showing similar or improved cellular activities. SAR are
developed and refined by comparing activities of structurally
related compounds. Useful compounds can be synthesized or
identified in computer searches of the NCI database or other
databases of commercially available compounds or computer generated
libraries of compounds with interesting and diverse structural
features and computed properties (such as `druglikeness`).
Compounds from commercial or synthetic sources can be tested in the
cell growth assays for improved potency in the inhibition of cell
growth and the data (both for improvements and declines in potency)
can be used to refine the SAR for inhibition of cell growth
mediated by a target. Iterative cycles of data acquisition, SAR
refinement, compound procurement, compound testing/data acquisition
can identify a compound with a potency below 10 micromolar in the
inhibition of cell growth. Such a compound can be useful in drug
discovery because it is often possible to achieve circulating
levels in excess of 10 micromolar in an animal used as a model of
human disease (e.g., a mouse xenograft model of human cancer, as a
non-limiting example). Further testing in animal models relevant to
the target for improved potency, efficacy and duration of action
can identify a candidate molecule for the clinical treatment of
human diseases including cancer and inflammatory diseases of
aberrant cell growth. Alternatively, the identification of
compounds which fit an activity pattern opposite of the inhibition
of cell growth by siRNA can be stimulants of cell growth useful in
diseases and conditions of slow cell growth. Enhanced cell growth
could be useful in wound healing and other clinical settings. The
method described herein may also utilize the transfection of a gene
for a known protein regulator of the target to aid in identifying a
pattern of inhibition sufficiently distinctive to be able to
identify molecules with a similar pattern of activity.
[0198] This method is useful in the identification of potent
compounds with significant potencies below 10 micromolar in the
inhibition of cell growth. These compounds can be used in animal
models of human cancer and inflammation. More preferred are
compounds whose inhibition of cell growth (GI50) is below 1
micromolar. Even more preferred are compounds whose growth
inhibition (GI50) is less than 100 nM. Most preferred are compounds
with GI50 values below 10 nM. The methods or this invention can
also be used to identify useful inhibitors or LFA-1, the B-cell
receptor BR3, Grb2 (a protein downstream of growth factor receptors
in signaling cascades) and other protein targets inside and outside
of cells. It is particularly useful against targets in the Wnt
pathway including beta-catenin for the treatment of human colon
cancer. It is also useful against additional disease related
targets in lymphoma, leukemia, colon cancer, melanoma, breast
cancer, brain cancer, lung cancer, kidney cancer and other human
cancers. The method is useful in identifying compounds useful in
the treatment of human inflammatory diseases mediated by the growth
and proliferation of inflammatory cells. These include but are not
limited to Psoriasis, Eczema, Asthma, rheumatoid arthritis and Dry
Eye. Compounds which are identified in the above manner and active
in animal models of human disease are useful as treatments of human
diseases including cancer and inflammatory diseases. Targets
involved in diseases other than cancer and inflammation which
involve aberrant cell proliferation can also be used in this
method.
[0199] Additionally, a method is envisioned to use siRNA cellular
activity data for target or selection of targets by searching
public and/or proprietary databases of compound cellular activity
for a pattern of similar cellular activity in response to a
compound or collection of compounds as a method to identify
compounds useful in the identification of a human
pharmaceutical.
VIII. Examples
A. Materials
[0200] Full length recombinant human membrane-bound LFA-1 and
recombinant human 5-domain ICAM-1-Ig fusion (ICAM-1-Ig) were
produced in human 293 cells and purified as described (Fisher et
al. 1997, Keating et al. 2000). sICAM-1 (a truncated form of native
ICAM-1 without the transmembrane and cytoplasmic domains for ease
of use in in vitro assays, but with the intact LFA-1 binding
epitope) and MEM-48 were from R&D Systems (Minneapolis, Minn.).
Mouse monoclonal anti-human .beta.2 integrin (clone PLM2) was
generated using standard procedures (Fisher et al. 1997). Small
molecules and peptide antagonists were synthesized as described
(Gadek et al. 2002, Burdick 1999, Liu et al. 2000). Compounds 15
and A-286982 are shown in FIG. 4. Compounds 1, 2A and 2B, are
similar to compound 3 but with the addition of linkers to enable
conjugation to fluorescein (compounds 1 and 2B; 2A was not
conjugated to fluorescein). Fluorescein conjugates were prepared
via coupling of an amine functionality with
fluorescein-5-isothiocyanate (FITC) (Keating et al. 2000).
Additional molecules analyzed include compounds 6 and 7 (Gadek et
al. 2002), kistrin (Dennis et al. 1990), the non-Kistrin
heptapeptides, H.sub.2N--C G F D M P C--CO.sub.2H and H.sub.2N--C G
Y.sup.(m)D M P C--CO.sub.2H, cyclic kistrin peptide C R I P R G D M
P D D R C and tetrapeptide, H.sub.2N--C N.sup.(F) P C--CO.sub.2H,
wherein Y.sup.(m) is meta-tyrosine and N.sup.(m) is
N'-3-phenylpropyl asparagine.
##STR00034##
[0201] All small molecule antagonists were stored as 10 mM
solutions in 50% DMSO at -20.degree. C. Compound 5 was a gift from
Hoffman-La Roche Inc. (Nutley, N.J.).
B. Experiments
Example 1
Affinity Measurements
[0202] The affinities of the small molecules for LFA-1 were
measured using fluorescence polarization (FP) (Lakowicz 1999,
Panvera 1995) in a competitive format with a small molecule
antagonist, compound 1 (FIG. 2), as previously described (Keating
et al. 2000). All measurements were performed in buffer containing
50 mM Hepes, pH 7.2, 150 mM NaCl, 0.05% n-octyglucoside and 0.05%
bovine gamma globulins (BGG) and either 1 mM MnCl.sub.2, or 1 mM
CaCl.sub.2 and 1 mM MgCl.sub.2. The affinity of compound 1 for
LFA-1 was first measured by addition of 2 nM compound 1 to serial
dilutions of LFA-1 starting from 1 .mu.M in buffer containing
either MnCl.sub.2 or CaCl.sub.2 and MgCl.sub.2. Competition
experiments were performed by addition of serial dilutions of
antagonists to 2 nM compound 1 (using either 3 nM LFA-1 (in
MnCl.sub.2) or 40 nM LFA-1 (in CaCl.sub.2 and MgCl.sub.2)). In the
ICAM-1-Ig competition experiments, the LFA-1 concentrations were
reduced to 2 and 20 nM LFA-1 in the two divalent cation buffer
conditions to maximize inhibition by ICAM-1-Ig. The different LFA-1
concentrations used in the experiments were taken into account in
the affinity calculations (see below). The solutions were incubated
in 96-well black HE96 plates (Molecular Devices, Sunnyvale, Calif.)
for 2 hours at 37.degree. C. Fluorescence Polarization (FP)
measurements were performed on an Analyst platereader (Molecular
Devices, Sunnyvale, Calif.) using 485 nm excitation, 530 nm
emission and 505 nm dichroic filters. All raw intensity data were
corrected for background emissions by subtraction of the
intensities measured from the appropriate samples without compound
1. The LFA-1 binding and antagonist competition data were analyzed
using a non linear least squares fit of a lour-parameter equation
with KaleidaGraph software (Synergy Software, Reading, Pa.) to
obtain the EC.sub.50 values for the LFA-1 titration and the
IC.sub.50 values of the antagonists. The equation used to fit the
data is Y=((A-D)/(1+(X/C) B))+D, where Y is the assay response, A
is Y--value at the upper asymptote, B is the slope factor, C is the
IC.sub.50 or EC.sub.50 and D is Y the value at the lower asymptote.
In general, the data measured in both the homogeneous FP and
heterogeneous ELISA formats described below, contain relatively
large signal to background ratios and the error estimates in the
fits are typically less than 10% of the final value of the fitted
parameter. The equilibrium dissociation constants (K.sub.d) of
LFA-1 for compound 1 with and without A-286982 were calculated
using Klotz and Hill analyses (Panvera, 1995). The affinities (KO
of the antagonists for LFA-1 were calculated using the IC.sub.50
values, the K.sub.5 of compound 1/LFA-1, and the concentrations of
compound 1 and LFA-1 in the competition experiments (Keating et al.
2000, Jacobs et al. 1975).
Example 2
LFA-1/ICAM-1 and LFA-1/Small Molecule Enzyme-Linked Immunosorbent
Assays (ELISAs)
[0203] (A) Antagonist Competition:
[0204] Small molecules and sICAM-1 were assayed for the ability to
disrupt binding of ICAM-1-Ig or a fluorescein-labeled small
molecule antagonist, compound 2B, to LFA-1 in a competitive format
(Gadek et al. 2002, Burdick 1999, Quan et al. 1998). Compound 2B is
similar to compound 1, but with a longer linker between the small
molecule and fluorescein to maximize the binding of the
anti-fluorescein detection antibody. 96-well plates were coated
with 5 .mu.g/ml (33.3 nM) mouse anti-human .beta.2 integrin (a
non-function blocking antibody) in phosphate-buffered saline (PBS)
overnight at 4.degree. C. The plates were blocked with assay buffer
(20 mM Hepes, pH 7.2, 140 mM NaCl, 1 mM MnCl.sub.2, 0.5% bovine
serum albumin (BSA) and 0.05% Tween-20) for 1 hour at room
temperature. After washing in buffer (5(1 mM Tris-HCl, pH 7.5, 100
mM NaCl, 1 mM MnCl.sub.2, and 0.05% Tween-20), 8 nM LFA-1
(LFA-1/ICAM-1 ELISA) or 2 nM LFA-1 (LFA-1/small molecule ELISA)
were added, followed by incubation for 1 h at 37.degree. C. The
plates were washed, and for the LFA-1/ICAM-1 ELISA, serial
dilutions of the small molecule antagonists or sICAM-1 were added
to the plates for 30 minutes, followed by addition of 0.89 nM
ICAM-1-Ig (final concentration) for 2 hour at 37.degree. C. After
an additional wash, goat anti-huIgG (Fc specific)-HRP was added and
incubated for one hour at 37.degree. C. In the LFA-1/small molecule
ELISA, the diluted antagonists and 25 nM compound 2B were added
concurrently to the plates, followed by a 2-hour incubation at
37.degree. C. Sheep anti-fluorescein-HRP was added after a wash and
incubated for one hour at 37.degree. C. For both assays, after
washing, the bound HRP-conjugated antibodies were detected by
addition of tetramethylbenzidine (TMB) followed by measurement of
the absorbance of the product at 450 nm after the addition of 1M
H.sub.3PO.sub.4 to stop the reaction. The IC.sub.50 values for each
curve were determined by fitting to the four-parameter equation
described above using KaleidaGraph software. The format and results
from this form of the LFA-1/ICAM-1 assay are similar to those
previously reported (Gadek et al. 2002, Burdick 1999); however,
this format is more robust due to antibody capture of the LFA-1
rather than direct coating onto the ELISA plate.
[0205] (B) Ligand Binding:
[0206] The LFA-1/ICAM-1 and LFA-1/small molecule ELISAs were
performed as described above except that serial dilutions of either
ICAM-1-Ig or compound 2B were added to plates either in the
presence or absence of antagonist. In all cases the ligand was
added concurrently with the antagonist. The plates were incubated
for 6 h at 37.degree. C. to approach equilibrium conditions after
antagonist and ligand addition, before wash and addition of the
detection antibody. The EC.sub.50 values for each curve were
determined by fitting with a four parameter model as described
above. The EC.sub.50 values generated in the presence and absence
of antagonist were analyzed by Schild regression (Arunlakshana and
Schild 1959, Lutz and Kenakin 1999, Pratt and Taylor 1990, Matthews
1993, Kenakin, 1997). The Schild plots of Log (Conc. ratio -1) vs.
antagonist concentration are calculated from, (Conc. ratio
-1)=((ligand EC.sub.50 with antagonist)/(ligand EC.sub.50 without
antagonist))-1. The slopes of the plots of the Log (Conc. ratio -1)
vs. Antagonist concentration are calculated by fitting the line to
the linear equation, Y=A+BX.
Example 3
Crosslinking of a Radiolabeled, Photoactivatable Analogue of
Compound 3 to LFA-1
[0207] Full length human membrane-associated LFA-1 or BSA (0.35
mg/mL [1.4 and 5.3 .mu.M, respectively] in 20 mM Hepes, 150 mM
NaCl, 5 mM CaCl.sub.2, 5 mM MgCl.sub.2, 1 mM MnCl.sub.2, and 1%
n-octylglucoside, pH 7.2) was incubated overnight at 37.degree. C.
with 4.1 .mu.M compound 5, a tritium-labeled photoactivatable
analogue of compound 3 (Kauer et al. 1986), in either the presence
or absence of 290 .mu.M compound 3. The molar ratio of compound 5
to LFA-1 was 3:1. A 96-well plate precoated with 1% BSA was used
for the incubation. Just prior to crosslinking, excess compound 5
was rapidly removed by gel filtration with a G-25 microspin column
in a 96-well format equilibrated with the same buffer. The
LFA-1/compound 5 complex was crosslinked by exposure to a
high-pressure mercury-vapor lamp (450 watts, Ace glass, Vineland,
N.J.). During irradiation, samples were cooled on ice and protected
by a 5-mm thick plate of borosilicate glass to minimize protein
degradation. Residual unlinked compound 5 was removed by gel
filtration (G-25) as above. The crosslinked complex was then
denatured in 8M guanidine hydrochloride (CiuHCl) and reduced and
alkylated. The treated proteins were subjected to SDS-PAGE followed
by Coomassie blue staining. Radiolabeled proteins were visualized
by audioradiography.
[0208] To identify compound 5 binding sites, the treated .alpha.L
and .beta.2 subunits were separated by size exclusion
chromatography in the presence of 6M GuHCl, 20 mM Hepes, 10 mM
EDTA, pH 6.8 and then chemically cleaved with 2.6 M hydroxylamine
in 10% acetic acid with 7M GuHCl for 4 h at 75.degree. C. The
radiolabeled protein fragments were separated by SDS-PAGE and
either visualized by autoradiography or transferred onto a
polyvinylidene fluoride membrane, stained with Coomassie blue, and
then identified by N-terminal protein sequencing.
Example 4
Generation of the .mu.L Construct Lacking the I Domain
[0209] The construct used, pLFA.huID..DELTA.p, contains the
sequence of the .alpha.L gene from the Nar1 restriction site 5' of
the I domain to the second PflM1 restriction site 3' of the I
domain in which the first PflM1 restriction site 3' of the I domain
was abolished (Edwards et al. 1995). In order to generate the
mutant lacking the I domain, the following primers were made: the
forward primer
CACTGTGGCGCCCTGGTTTTCAGGAAGGTAGTGGATCAGGCACAAGCAAACAGGACCTGACTTC,
containing the sequence from the Nar1 site to the start of the I
domain, a sequence of DNA encoding GSGSG and the 23 by of the
.alpha.L sequence after the end of the I domain, and the reverse
primer TCTGAGCCATGTGCTGGTATCGAGGGGC, which primes at the second
PflM1 restriction site after the I domain. PCR was performed using
these primers and the pLFA.huID..DELTA.p linearized with Bgl II,
which cut at a site within the I domain. A DNA fragment was
amplified that contained the sequence from the Nar 1 site to the
second PflM1 site and in which the entire I domain, from C125
through G311, was replaced with a DNA sequence encoding GSGSG. This
piece of DNA was purified, digested with Nar1 and PflM1 and
inserted into the human .alpha.L plasmid (pRKLFA.mu.m) at the
corresponding Nar1 and PflM1 sites. Correct insertion of the DNA
sequence encoding GSGSG was confirmed by sequence analysis.
Example 5
Binding of LFA-1 Lacking the I domain to ICAM-1 or Compound 2B
[0210] 293 cells were transfected with the .beta.2 construct alone
(mock) or with either the wild-type .mu.L construct (wt) or the at
construct lacking the 1 domain (1-less) and allowed to recover for
3 days. The cells were detached and resuspended in adhesion buffer
(0.02M HEPES, pH 7.2, 0.14M NaCl, 0.2% glucose). Binding to plate
bound ICAM-1-Ig was performed as described (Edwards et al. 1998).
For binding of compound 2B, 2.times.10.sup.5 cells were added per
well in a round bottom 96-well plate in adhesion buffer containing
0.5% BGG, 0.1 mM MnCl.sub.2, 1 .mu.g/ml anti-02 activating antibody
MEM-48 and 1 .mu.M compound 2B. The cells were incubated for 1 hour
at 37.degree. C., washed with cold PBS and fixed with 1%
formaldehyde/PBS. The cells were then incubated with a 1:500
dilution of sheep anti-fluorescein-HRP for 1 hour at room
temperature, washed with PBS and incubated with TMB for 15 minutes.
The reaction was stopped with 1M H.sub.3PO.sub.4 and read at 450
nm. In parallel, the transfectants were tested for the structural
integrity of the surface-expressed .alpha.L/.beta.2 complexes and
for the presence or absence of the I domain by FACS analysis using
a panel of antibodies with known binding epitopes (Edwards et al.
1998).
Example 6
Human T-Cell Adhesion Assay (Cell Attachment Assay)
[0211] The T-cell adhesion assay is performed using a human
T-lymphoid cell line HuT 78. Goat anti-HuIgG (Fc) is diluted to 2
mg/ml in PBS and 96-well plates are coated with 50 ml/well at
37.degree. C. for 1 h. Plates are washed with PBS and blocked for 1
h at room temperature with 1% BSA in PBS. 5 domain ICAM-Ig is
diluted to 100 ng/ml in PBS and 50 ml/well was added to the plates
0/N at 4.degree. C. HuT 78 cells are centrifuged at 100 g and the
cell pellet is treated with 5 mM EDTA for about 5 minutes at
37.degree. C. in a 5% CO.sub.2 incubator. Cells are washed in 0.14M
NaCl, 0.02M Hepes, 0.2% glucose and 0.1 mM MnCl.sub.2 (assay
buffer) and centrifuged. The cells are resuspended in assay buffer
to 3.0.times.10.sup.6 e.ml. Inhibitors are diluted in assay buffer
to a 2.times. final concentration and pre-incubated with HuT78
cells for 30 minutes at room temperature. 100 .mu.l/well of cells
and inhibitors are added to the plates and incubated at room
temperature for 1 h. 100 .mu.l/well of PBS is added and the plates
are sealed and centrifuged inverted at 100 g for 5 minutes.
Unattached cells are flicked out of the plate and excess PBS is
blotted on a paper towel. 60 .mu.l/well p-nitrophenyl
n-acetyl-b-D-glucosaminide (0.257 g to 100 ml citrate buffer) is
added to the plate and incubated for 1.5 h at 37.degree. C. The
enzyme reaction is stopped with 90 .mu.l/well 50 mM glycione/5 mM
EDTA and read on a platereader at 405 nM. HUT 78 cell adhesion to
5dICAM-Ig is measured using the p-nitrophenyl method of Langegren,
U. (1984). J. Immunol. Methods 57, 379-388.
Example 7
T-Cell Proliferation Assay
[0212] This assay is an in vitro model of lymphocyte proliferation
resulting from activation, induced by engagement of the T-cell
receptor and LFA-1, upon interaction with antigen presenting cells.
(Springer, et. al. 1990, Nature) Microtiter plates (Nunc 96 well
ELISA certified) are pre-coated overnight at 4.degree. C. with 50
.mu.l of 2 .mu.g/ml of goat anti-human Fc (Caltag H10700) and 50
.mu.l of 0.07 .mu.g/ml monoclonal antibody to CD3 (Immunotech 0178)
in sterile PBS.
[0213] The next day coat solutions are aspirated. Plates are then
washed twice with PBS and 100 .mu.l of 17 ng/ml 5d-ICAM-Ig is added
for 4 hours at 37.degree. C. Plates are washed twice with PBS prior
to addition of CD4+ T cells. Lymphocytes from peripheral blood are
separated from heparinized whole blood drawn from healthy donors.
An alternative method is to obtain whole blood from healthy donors
through leukophoresis. Blood is diluted 1:1 with saline, layered,
and centrifuged at 2500.times.g for 30 minutes on LSM (6.2 g Ficoll
and 9.4 g sodium diztrizoate per 100 ml) (Organon Technica, NJ).
Monocytes are depleted using a myeloid cell depletion reagent
method (Myeloclear, Labs, Hornby, Ontario, Canada). PBLs are
resuspended in 90% heat-inactivated Fetal Bovine serum and 10%
DMSO, aliquoted, and stored in liquid nitrogen. After thawing,
cells are resuspended in RPMI 1640 medium (Gibco, Grand Island,
N.Y.) supplemented with 10% heat-inactivated Fetal Bovine serum
(Intergen, Purchase, NY), 1 mM sodium pyruvate, 3 mM L-glutamine, 1
mM nonessential amino acids, 500 .mu.g/ml penicillin, 50 .mu.g/ml
streptomycin, 50 .mu.g/ml gentamycin (Gibco).
[0214] Purification of CD4+ T cells are obtained by negative
selection method (Human CD4 Cell Recovery Column Kit # CL110-5
Accurate). 100,000 purified CD4+ T cells (90% purity) per
microtiter plate well are cultured for 72 hours at 37.degree. C. in
5% CO.sub.2 in 100 ml of culture medium (RPMI 1640 (Gibco)
supplemented with 10% heat inactivated FBS (Intergen), 0.1 mM
non-essential amino acids, 1 nM Sodium Pyruvate, 100 units/ml
Penicillin, 100 .mu.g/ml Streptomycin, 50 .mu.g/ml Gentamicin, 10
mM Hepes and 2 mM Glutamine). Inhibitors are added to the plate at
the initiation of culture. Proliferative responses in these
cultures are measured by addition of 1 .mu.Ci/well titrated
thymidine during the last 6 hours before harvesting of cells.
Incorporation of radioactive label is measured by liquid
scintillation counting (Packard 96 well harvester and counter).
Results are expressed in counts per minute (cpm).
Example 8
In-Vitro Mixed Lymphocyte Culture Model
[0215] The mixed lymphocyte culture model, which is an in vitro
model of transplantation (A. J. Cunningham, "Understanding
Immunology, Transplantation Immunology" pages 157-159 (1978)
examines the effects of various LFA-1 antagonists in both the
proliferative and effector arms of the human mixed lymphocyte
response.
[0216] Isolation of Cells: Mononuclear cells from peripheral blood
(PBMC) are separated from heparanized whole blood drawn from
healthy donors. Blood is diluted 1:1 with saline, layered, and
centrifuged at .times.2500 g for 30 minutes on LSM (6.2 g Ficoll
and 9.4 g sodium diztrizoate per 100 ml) (Organon Technica, NJ). An
alternative method is to obtain whole blood from healthy donors
through leukophoresis. PBMCs are separated as above, resuspended in
90% heat inactivated Fetal Bovine serum and 10% DMSO, aliquoted and
stored in liquid nitrogen. After thawing, cells are resuspended in
RPMI 1640 medium (Gibco, Grand Island, N.Y.) supplemented with 10%
heat-inactivated Fetal Bovine serum (Intergen, Purchase, NY), 1 mM
sodium pyruvate, 3 mM L-glutamine, 1 mM nonessential amino acids,
500 .mu.g/ml penicillin, 50 .mu.g/ml streptomycin, 50 .mu.g/ml
gentamycin (Gibco).
[0217] Mixed Lymphocyte Response (MLR): One-way human mixed
lymphocyte cultures are established in 96-well flat-bottomed
microtiter plates. 1.5.times.10.sup.5 responder PBMCs are
co-cultured with an equal number of allogeneic irradiated (3000
rads for 3 minutes, 52 seconds stimulator PBMSc in 200 .mu.l of
complete medium. LFA-1 antagonists are added at the initiation of
cultures.
[0218] Cultures are incubated at 37.degree. C. in 5% CO.sub.2 for 6
days, then pulsed with of .sup.3H-thymidine (6.7 Ci/mmol, NEN,
Boston, Mass.) for 6 hours. Cultures are harvested on a Packard
cell harvester (Packard, Canberra, Canada). [.sup.3H] TdR
incorporation is measured by liquid scintillation counting. Results
are expressed as counts per minute (cpm).
Example 9
Rabbit Model to Reverse the Onset of Dry Eve
[0219] Dry eye is created in rabbits by surgically closing the
lacrimal gland excretory duct, and allowing the rabbits to remain
untreated for at least four weeks. See Gilbard, J. P, 1996 "Dry
Eye: phramcological approaches, effects, and progress" CLAO J. 22,
141-145. After confirming dry eye by Schirmer test, and ocular
surface staining, LFA-1 antagonists of the invention is instilled
as a solution at concentrations of 0.01, 0.1, and 1.0% in neutral,
isotonic buffered aqueous solution. Administration is one 50
microliter drop to the ocular surface up to 5 times a day, every
day for 4 weeks. The symptoms of dry eye are monitored once a week
for 4 weeks and an increase in Schirmer scores and/or a decrease in
the amount of ocular surface staining indicates the efficacy of the
LFA-1 antagonist in the treatment of dry eye disease.
Example 10
Phase 1 Human Study
[0220] Up to 56 healthy individuals are enrolled. A randomized,
controlled, dose escalation trial of both single and multiple
administrations of LFA-1 antagonist is conducted. Cohorts of 7
subjects each (5 treatment, 2 placebo) are treated at each of 6-8
dose levels of LFA-1 antagonists formulated as sterile, neutral,
isotonic, buffered aqueous solutions. Subjects receive a single
intra-ocular administration on Day 1. Samples are obtained for
pharmacokinetic and pharmacodynamic assessments over the subsequent
week. Starting Day 8, subjects receive the same dose of LFA-1
antagonist daily for a total of 14 days. PK/PD assessments, safety
laboratory studies, Schirmer testing, conical staining and
conjunctival biopsies are assessed.
Example 11
Phase II Human Study
[0221] 150 adult patients with dry eye as defined by key
inclusion/exclusion criteria are enrolled. The patients may or may
not have Sjogren's syndrome or Sjogren's disease. A randomized,
controlled dose finding trial or LFA-1 antagonists is conducted.
Three groups of patients receive either Restasis at the labeled
dose, or, one of two dose levels of LFA-1 antagonist, formulated as
a neutral, buffered, isotonic aqueous solution, daily for twelve
weeks. Patients are followed for safety and for evidence of
improvement in Schirmer's test, corneal staining and overall
disease severity index for a follow up period of three months.
Conjunctival biopsies are obtained in a subset of patients.
[0222] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. It is intended that the following claims
define the scope of the invention and that methods and structures
within the scope of these claims and their equivalents be covered
thereby.
Sequence CWU 1
1
9112PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 1Tyr Asn Leu Asp Val Arg Gly Ala Arg Ser Phe Ser
1 5 10 213PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 2Gly Val Ile Val Gly Ala Pro Gly Glu Gly Asn Ser
Thr 1 5 10 37PRTArtificial SequenceDescription of Artificial
Sequence Synthetic peptide 3Cys Gly Phe Asp Met Pro Cys 1 5
47PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 4Cys Gly Tyr Asp Met Pro Cys 1 5 513PRTArtificial
SequenceDescription of Artificial Sequence Synthetic cyclic peptide
5Cys Arg Ile Pro Arg Gly Asp Met Pro Asp Asp Arg Cys 1 5 10
64PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 6Cys Asn Pro Cys 1 764DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7cactgtggcg ccctggtttt caggaaggta gtggatcagg cacaagcaaa caggacctga
60cttc 6485PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 8Gly Ser Gly Ser Gly 1 5 928DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
9tctgagccat gtgctggtat cgaggggc 28
* * * * *