Digital Counting of Individual Molecules by Stochastic Attachment of Diverse Labels

Abstract

Compositions, methods and kits are disclosed for high-sensitivity single molecule digital counting by the stochastic labeling of a collection of identical molecules by attachment of a diverse set of labels. Each copy of a molecule randomly chooses from a non-depleting reservoir of diverse labels. Detection may be by a variety of methods including hybridization based or sequencing. Molecules that would otherwise be identical in information content can be labeled to create a separately detectable product that is unique or approximately unique in a collection. This stochastic transformation relaxes the problem of counting molecules from one of locating and identifying identical molecules to a series of binary digital questions detecting whether preprogrammed labels are present. The methods may be used, for example, to estimate the number of separate molecules of a given type or types within a sample.

Description

RELATED APPLICATIONS

[0001] This application is a continuation of U.S. patent application Ser. No. 14/281,706, filed May 19, 2014, which is a continuation of U.S. patent application Ser. No. 12/969,581, filed Dec. 15, 2010, which claims priority to U.S. Provisional application No. 61/286,768 filed Dec. 15, 2009, and is also a continuation of U.S. patent application Ser. No. 13/327,526, filed Dec. 15, 2011, which is a continuation-in-part of U.S. patent application Ser. No. 12/969,581, filed Dec. 15, 2010, which claims priority to U.S. Provisional application No. 61/286,768 filed Dec. 15, 2009, the entire disclosures of which are incorporated herein by reference in their entirety.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Aug. 20, 2014, is named 41977-701.309_SL.txt and is 479,340 bytes in size.

FIELD OF THE INVENTION

[0003] Methods, compositions and products for counting individual molecules by stochastic attachment of diverse labels from a set of labels, followed by amplification and detection are disclosed.

BACKGROUND OF THE INVENTION

[0004] Many processes are characterized or regulated by the absolute or relative amounts of a plurality of items. For example, in biology, the level of expression of particular genes or groups of genes or the number of copies of chromosomal regions can be used to characterize the status of a cell or tissue. Analog methods such as microarray hybridization methods and real-time PCR are alternatives, but digital readout methods such as those disclosed herein have advantages over analog methods. Methods for estimating the abundance or relative abundance of genetic material having increased accuracy of counting would be beneficial.

[0005] The availability of convenient and efficient methods for the accurate identification of genetic variation and expression patterns among large sets of genes may be applied to understanding the relationship between an organism's genetic make-up and the state of its health or disease, Collins et al, Science, 282: 682-689 (1998). In this regard, techniques have been developed for the analysis of large populations of polynucleotides based either on specific hybridization of probes to microarrays, e.g. Lockhart et al. Hacia et al, Nature Genetics, 21: 4247 (1999), or on the counting of tags or signatures of DNA fragments, e.g. Velculescu et al, Science, 270: 484487 (1995); Brenner et al, Nature Biotechnology, 18: 630-634 (2000). These techniques have been used in discovery research to identify subsets of genes that have coordinated patterns of expression under a variety of circumstances or that are correlated with, and predictive of events, of interest, such as toxicity, drug responsiveness, risk of relapse, and the like, e.g. Golub et al, Science, 286: 531-537 (1999); Alizadeh et al, Nature, 403: 503-511 (2000); Perou et al, Nature, 406: 747-752 (2000); Shipp et al, Nature Medicine, 8: 68-74 (2002); Hakak et al, Proc. Natl. Acad. Sci., 98: 47454751 (2001); Thomas et al, Mol. Pharmacol., 60: 1189-1194 (2001); De Primo et al, BMC Cancer 2003, 3:3; and the like. Not infrequently the subset of genes found to be relevant has a size in the range of from ten or under to a few hundred.

[0006] In addition to gene expression, techniques have also been developed to measure genome-wide variation in gene copy number. For example, in the field of oncology, there is interest in measuring genome-wide copy number variation of local regions that characterize many cancers and that may have diagnostic or prognostic implications. For a review see Zhang et al. Annu. Rev. Genomics Hum. Genet. 2009. 10:451-81.

[0007] While such hybridization-based techniques offer the advantages of scale and the capability of detecting a wide range of gene expression or copy number levels, such measurements may be subject to variability relating to probe hybridization differences and cross-reactivity, element-to-element differences within microarrays, and microarray-to-microarray differences, Audic and Claverie, Genomic Res., 7: 986-995 (1997); Wittes and Friedman, J. Natl. Cancer Inst. 91: 400-401 (1999).

[0008] On the other hand, techniques that provide digital representations of abundance, such as SAGE (Velculescu et al, cited above) or MPSS (Brenner et al, cited above), are statistically more robust; they do not require repetition or standardization of counting experiments as counting statistics are well-modeled by the Poisson distribution, and the precision and accuracy of relative abundance measurements may be increased by increasing the size of the sample of tags or signatures counted, e.g. Audic and Claverie (cited above).

[0009] Both digital and non-digital hybridization-based assays have been implemented using oligonucleotide tags that are hybridized to their complements, typically as part of a detection or signal generation schemes that may include solid phase supports, such as microarrays, microbeads, or the like, e.g. Brenner et al, Proc. Natl. Acad. Sci., 97: 1665-1670 (2000); Church et al, Science, 240: 185-188 (1988); Chee, Nucleic Acids Research, 19: 3301-3305 (1991); Shoemaker et al., Nature Genetics, 14: 450456 (1996); Wallace, U.S. Pat. No. 5,981,179; Gerry et al, J. Mol. Biol., 292: 251-262 (1999); Fan et al., Genome Research, 10: 853-860 (2000); Ye et al., Human Mutation, 17: 305-316 (2001); and the like. Bacterial transcript imaging by hybridization of total RNA to nucleic acid arrays may be conducted as described in Saizieu et al., Nature Biotechnology, 16:45-48 (1998). Accessing genetic information using high density DNA arrays is further described in Chee et al., Science 274:610-614 (1996). Tagging approaches have also been used in combination with next-generation sequencing methods, see for example, Smith et al. NAR (May 11, 2010), 1-7.

[0010] A common feature among all of these approaches is a one-to-one correspondence between probe sequences and oligonucleotide tag sequences. That is, the oligonucleotide tags have been employed as probe surrogates for their favorable hybridizations properties, particularly under multiplex assay conditions.

[0011] Determining small numbers of biological molecules and their changes is essential when unraveling mechanisms of cellular response, differentiation or signal transduction, and in performing a wide variety of clinical measurements. Although many analytical methods have been developed to measure the relative abundance of different molecules through sampling (e.g., microarrays and sequencing), few techniques are available to determine the absolute number of molecules in a sample. This can be an important goal, for example in single cell measurements of copy number or stochastic gene expression, and is especially challenging when the number of molecules of interest is low in a background of many other species. As an example, measuring the relative copy number or expression level of a gene across a wide number of genes can currently be performed using PCR, hybridization to a microarray or by direct sequence counting. PCR and microarray analysis rely on the specificity of hybridization to identify the target of interest for amplification or capture respectively, then yield an analog signal proportional to the original number of molecules. A major advantage of these approaches is in the use of hybridization to isolate the specific molecules of interest within the background of many other molecules, generating specificity for the readout or detection step. The disadvantage is that the readout signal to noise is proportional to all molecules (specific and non-specific) specified by selective amplification or hybridization. The situation is reversed for sequence counting. No intended sequence specificity is imposed in the sequence capture step, and all molecules are sequenced. The major advantage is that the detection step simply yields a digital list of those sequences found, and since there is no specificity in the isolation step, all sequences must be analyzed at a sufficient statistical depth in order to learn about a specific sequence. Although very major technical advances in sequencing speed and throughput have occurred, the statistical requirements imposed to accurately measure small changes in concentration of a specific gene within the background of many other sequences requires measuring many sequences that don't matter to find the ones that do matter. Each of these techniques, PCR, array hybridization and sequence counting is a comparative technique in that they primarily measure relative abundance, and do not typically yield an absolute number of molecules in a solution. A method of absolute counting of nucleic acids is digital PCR (B. Vogelstein, K. W. Kinzler, Proc Natl Acad Sci USA 96, 9236 (Aug. 3, 1999)), where solutions are progressively diluted into individual compartments until there is an average probability of one molecule per two wells, then detected by PCR. Although digital PCR can be used as a measure of absolute abundance, the dilutions must be customized for each type of molecule, and thus in practice is generally limited to the analysis of a small number of different molecules.

SUMMARY OF THE INVENTION

[0012] High-sensitivity single molecule digital counting by the stochastic labeling of a collection of identical molecules is disclosed. Each copy of a molecule randomly chooses from a non-depleting reservoir of diverse labels. The uniqueness of each labeled molecule is determined by the statistics of random choice, and depends on the number of copies of identical molecules in the collection compared to the diversity of labels. The size of the resulting set of labeled molecules is determined by the stochastic nature of the labeling process, and analysis reveals the original number of molecules. When the number of copies of a molecule to the diversity of labels is low, the labeled molecules are highly unique, and the digital counting efficiency is high. This stochastic transformation relaxes the problem of counting molecules from one of locating and identifying identical molecules to a series of yes/no digital questions detecting whether preprogrammed labels are present. The conceptual framework for stochastic mapping of a variety of molecule types is developed and the utility of the methods are demonstrated by stochastically labeling 360,000 different fragments of the human genome. The labeled fragments for a target molecule of choice are detected with high specificity using a microarray readout system, and with DNA sequencing. The results are consistent with a stochastic process, and yield highly precise relative and absolute counting statistics of selected molecules within a vast background of other molecules.

[0013] Methods are disclosed herein for digital counting of individual molecules of one or more targets. In preferred embodiments the targets are nucleic acids, but may be a variety of biological or non-biological elements. Targets are labeled so that individual occurrences of the same target are marked by attachment of a different label to difference occurrences. The attachment of the label confers a separate, determinable identity to each occurrence of targets that may otherwise be indistinguishable. Preferably the labels are different sequences that tag or mark each target occurrence uniquely. The resulting modified target comprises the target sequence and the unique identifier (which may be referred to herein as tag, counter, label, or marker). The junction of the target and identifier forms a uniquely detectable mechanism for counting the occurrence of that copy of the target. The attachment of the identifier to each occurrence of the target is a random sampling event. Each occurrence of target could choose any of the labels. Each identifier is present in multiple copies so selection of one copy does not remove that identifier sequence from the pool of identifiers so it is possible that the same identifier will be selected twice. The probability of that depends on the number of target occurrences relative to the number of different identifier sequences.

[0014] Each stochastic attachment event, where a target occurrence is attached to a unique identifier, results in the creation of a novel sequence formed at the junction of the identifier and the target. For a given target, all resulting products will contain the same target portion, but each will contain a different identifier sequence (T1L1, T1L2, . . . T1LN where N is the number of different occurrences of target1, "T1" and L is the identifier, L1, L2 . . . LN). In preferred aspects the occurrences are detected by hybridization. In some aspects the methods and systems include a probe array comprising features, wherein each feature has a different combination of target sequence with identifiers, 1 to N wherein N is the number of unique identifiers in the pool of identifiers. The array has N features for each target, so if there are 8 targets to be analyzed there are 8 times N features on the array to interrogate the 8 targets.

BRIEF DESCRIPTION OF THE DRAWINGS

[0015] FIG. 1 is a schematic of a method of stochastic labeling and counting by hybridization to an array of support bound probes.

[0016] FIG. 2A shows a schematic of labeling target molecules with a pool of labels.

[0017] FIG. 2B shows a schematic of detection of labeled targets on an array having features that are label specific and target specific.

[0018] FIG. 2C shows a schematic of the digital counting method.

[0019] FIG. 3 shows a schematic of a method for circularizing targets and amplifying with gene specific primers.

[0020] FIG. 4 shows a schematic of a method for detection of ligation products by hybridization to array probes that are complementary to the sequence resulting from the ligation.

[0021] FIG. 5 shows a schematic of a method for target preparation.

[0022] FIG. 6 shows a method for stochastic counting by fragmentation where the unique end of the fragment is the label used for counting.

[0023] FIG. 7 provides an example of a genomic target ligated at either end to a label adaptor.

[0024] FIG. 8 shows a schematic of the arrangement and position of the adaptors, PCR primers, and the biotinylated array-ligation probe in one exemplary sample prep method.

[0025] FIG. 9 is a schematic of a method for using ligation based read out on arrays to detect labeled targets and minimize partial target hybridization.

[0026] FIG. 10 shows the arrangement of the adaptors, labels and primers used to convert the labeled sample into sequencing template.

[0027] FIG. 11 is a plot of the number of labels from a non-depleting reservoir of 960 labels that are predicted to be captures at least once, exactly once or exactly twice.

[0028] FIG. 12 is a plot of counting results for 4 different DNA copy number titrations using microarray hybridization (on left) or DNA sequencing in (on right).

[0029] FIG. 13 shows relative copy ratios of three tested gene targets representing copy number 1, 2 or 3 at different dilutions as analyzed using the disclosed methods.

[0030] FIG. 14 shows a comparison between experimentally observed label usage with those predicted from stochastic modeling.

[0031] FIG. 15 shows a plot of the expected label usage (y-axis) when ligating to a given number of target molecules (x-axis).

[0032] FIG. 16 shows a plot of number of target molecules (x-axis) compared to counting efficiency (y-axis).

[0033] FIG. 17 shows a schematic of a method for attaching labels to targets using a splint having a variable region.

[0034] FIG. 18 shows a schematic of a method for enriching for molecules that contain labels, target or both.

[0035] FIG. 19 shows a scatter plot of a series of different target plus label combinations.

[0036] FIG. 20 shows a plot of counting efficiency versus copies of target as the number of labels varies. The inset is a magnification of the upper left portion of the graph.

[0037] FIG. 21 is a plot of labels the array intensity observed compared to the number of fragments when fragments are binned according to size.

[0038] FIG. 22 shows labels observed by microarray hybridization plotted against intensity (y-axis) for each of 960 labels for the Chr 4 gene target.

[0039] FIG. 23 shows frequency plots (y-axis, log-scale) of intensity distributions of the 960 labels in the microarray experiments with the counting threshold applied indicated by the dashed line.

[0040] FIG. 24 shows plots showing fragment size distribution and mean raw intensity on chr22 tiling probes on the "CNVtype" array.

[0041] FIG. 25 shows a simulated PCR run showing the replication outcome for 500 molecules of a target fragment ligated to a library of 960 label counters.

[0042] FIG. 26 shows intensities of 1,152 array probes associated with a single gene target on chromosome 4 in the upper panel and a histogram of the intensity data corresponding to 960 labels in the lower panel.

[0043] FIG. 27 shows a plot of the number of times each of the 960 labels was observed in ligations with low DNA target amounts.

[0044] FIG. 28 shows an example of a replication process on a collection of 390 uniquely labeled target molecules resulting from 960 diverse labels independently marked with 500 copies of a target molecule.

[0045] FIG. 29 shows plots of labels observed in the mapped reads from the first sequencing run for chromosome 4 with the horizontal dashed line indicating the counting threshold applied and the vertical dashed line indicating the break separating the 192 negative controls from the expected labels (controls to the right of the line).

DETAILED DESCRIPTION OF THE INVENTION

[0046] Reference will now be made in detail to exemplary embodiments of the invention. While the invention will be described in conjunction with the exemplary embodiments, it will be understood that they are not intended to limit the invention to these embodiments. On the contrary, the invention is intended to cover alternatives, modifications and equivalents, which may be included within the spirit and scope of the invention.

[0047] The invention has many preferred embodiments and relies on many patents, applications and other references for details known to those of the art. Therefore, when a patent, application, or other reference, such as a printed publication, is cited or repeated below, it should be understood that it is incorporated by reference in its entirety for all purposes and particularly for the proposition that is recited.

[0048] As used in this application, the singular form "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "an agent" includes a plurality of agents, including mixtures thereof

[0049] An individual is not limited to a human being, but may also be other organisms including, but not limited to, mammals, plants, bacteria, or cells derived from any of the above.

[0050] Throughout this disclosure, various aspects of this invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0051] The practice of the present invention may employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry, and immunology, which are within the skill of the art. Such conventional techniques include polymer array synthesis, hybridization, ligation, and detection of hybridization using a label. Specific illustrations of suitable techniques can be had by reference to the example herein below. However, other equivalent conventional procedures can, of course, also be used. Such conventional techniques and descriptions can be found in standard laboratory manuals such as Genome Analysis: A Laboratory Manual Series (Vols. I-IV), Using Antibodies: A Laboratory Manual, Cells: A Laboratory Manual, PCR Primer: A Laboratory Manual, and Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press), Gait, "Oligonucleotide Synthesis: A Practical Approach" 1984, IRL Press, London, Nelson and Cox (2000), Lehninger et al., (2008) Principles of Biochemistry 5th Ed., W.H. Freeman Pub., New York, N.Y. and Berg et al. (2006) Biochemistry, 6.sup.th Ed., W.H. Freeman Pub., New York, N.Y., all of which are herein incorporated in their entirety by reference for all purposes.

[0052] The present invention can employ solid substrates, including arrays in some preferred embodiments. Methods and techniques applicable to polymer (including protein) array synthesis have been described in U.S. Patent Pub. No. 20050074787, WO 00/58516, U.S. Pat. Nos. 5,143,854, 5,242,974, 5,252,743, 5,324,633, 5,384,261, 5,405,783, 5,424,186, 5,451,683, 5,482,867, 5,491,074, 5,527,681, 5,550,215, 5,571,639, 5,578,832, 5,593,839, 5,599,695, 5,624,711, 5,631,734, 5,795,716, 5,831,070, 5,837,832, 5,856,101, 5,858,659, 5,936,324, 5,968,740, 5,974,164, 5,981,185, 5,981,956, 6,025,601, 6,033,860, 6,040,193, 6,090,555, 6,136,269, 6,269,846 and 6,428,752, in PCT Publication No. WO 99/36760 and WO 01/58593, which are all incorporated herein by reference in their entirety for all purposes.

[0053] Patents that describe synthesis techniques in specific embodiments include U.S. Pat. Nos. 5,412,087, 6,147,205, 6,262,216, 6,310,189, 5,889,165, and 5,959,098. Nucleic acid arrays are described in many of the above patents, but the same techniques may be applied to polypeptide arrays.

[0054] The present invention also contemplates many uses for polymers attached to solid substrates. These uses include gene expression monitoring, profiling, library screening, genotyping and diagnostics. Gene expression monitoring and profiling methods can be shown in U.S. Pat. Nos. 5,800,992, 6,013,449, 6,020,135, 6,033,860, 6,040,138, 6,177,248 and 6,309,822. Genotyping and uses therefore are shown in U.S. Patent Publication Nos. 20030036069 and 20070065816 and U.S. Pat. Nos. 5,856,092, 6,300,063, 5,858,659, 6,284,460, 6,361,947, 6,368,799 and 6,333,179. Other uses are embodied in U.S. Pat. Nos. 5,871,928, 5,902,723, 6,045,996, 5,541,061, and 6,197,506.

[0055] The present invention also contemplates sample preparation methods in certain embodiments. Prior to or concurrent with analysis, the sample may be amplified by a variety of mechanisms. In some aspects nucleic acid amplification methods such as PCR may be combined with the disclosed methods and systems. See, for example, PCR Technology: Principles and Applications for DNA Amplification (Ed. H. A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (Eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (Eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159, 4,965,188, and 5,333,675, each of which is incorporated herein by reference in their entireties for all purposes. Enzymes and related methods of use in molecular biology that may be used in combination with the disclosed methods and systems are reviewed, for example, in Rittie and Perbal, J. Cell Commun. Signal. (2008) 2:25-45. The sample may be amplified on the array. See, for example, U.S. Pat. No. 6,300,070 and which is incorporated herein by reference in its entirety for all purposes.

[0056] Many of the methods and systems disclosed herein utilize enzyme activities. A variety of enzymes are well known, have been characterized and many are commercially available from one or more supplier. For a review of enzyme activities commonly used in molecular biology see, for example, Rittie and Perbal, J. Cell Commun. Signal. (2008) 2:25-45, incorporated herein by reference in its entirety. Exemplary enzymes include DNA dependent DNA polymerases (such as those shown in Table 1 of Rittie and Perbal), RNA dependent DNA polymerase (see Table 2 of Rittie and Perbal), RNA polymerases, ligases (see Table 3 of Rittie and Perbal), enzymes for phosphate transfer and removal (see Table 4 of Rittie and Perbal), nucleases (see Table 5 of Rittie and Perbal), and methylases.

[0057] Other methods of genome analysis and complexity reduction include, for example, AFLP, see U.S. Pat. No. 6,045,994, which is incorporated herein by reference, and arbitrarily primed-PCR (AP-PCR) see McClelland and Welsh, in PCR Primer: A laboratory Manual, (1995) eds. C. Dieffenbach and G. Dveksler, Cold Spring Harbor Lab Press, for example, at p 203, which is incorporated herein by reference in its entirety. Additional methods of sample preparation and techniques for reducing the complexity of a nucleic sample are described in Dong et al., Genome Research 11, 1418 (2001), in U.S. Pat. Nos. 6,361,947, 6,391,592, 6,458,530 and U.S. Patent Publication Nos. 20030039069, 20050079536, 20030096235, 20030082543, 20040072217, 20050142577, 20050233354, 20050227244, 20050208555, 20050074799, 20050042654 and 20040067493, which are each incorporated herein by reference in their entireties.

[0058] The design and use of allele-specific probes for analyzing polymorphisms is described by e.g., Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP 235,726, and WO 89/11548. Allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms in the respective segments from the two individuals.

[0059] The term "WGSA (Whole Genome Sampling Assay) Genotyping Technology" refers to a technology that allows the genotyping of thousands of SNPs simultaneously in complex DNA without the use of locus-specific primers. WGSA reduces the complexity of a nucleic acid sample by amplifying a subset of the fragments in the sample. In this technique, a nucleic acid sample is fragmented with one or more restriction enzymes of interest and adaptors are ligated to the digested fragments. A single primer that is complementary of the adaptor sequence is used to amplify fragments of a desired size, for example, 400-800, 400-2000 bps, using PCR. Fragments that are outside the selected size range are not efficiently amplified. WGSA is disclosed in, for example, U.S. Patent Publication Nos. 20040185475, 20040157243 (also PCT Application published as WO04/044225), 20040146890, 20030186279, 20030186280, 20030232353, 20040067493, 20030025075, 20020142314, 20070065816 and U.S. patent application Ser. No. 10/646,674, each of which is hereby incorporated by reference in its entirety for all purposes. In U.S. Patent Publication Nos. 20040185475, US20030186279, and US20030186280, the accuracy of genotype calls was determined in two ways: through the use of genotypes obtained by independent genotyping methods, and by dideoxynucleotide sequencing of discordant genotype calls. U.S. Patent Publication No. 20020142314, arrays are designed to detect specific SNPS or simply to detect the presence of a region known to frequently contain SNPS. In the latter case, other techniques such as sequencing could be employed to identify the SNP. In U.S. Patent Publication No. 20070065816, methods that may be used to determine the identity of an allele include, but are not limited to, detecting hybridization of a molecular beacon probe, electrical pore analysis, electrical conductance analysis, atomic force microscopy analysis, pyrosequencing, MALDI-TOF mass spectrometry, Surface Enhanced Raman Scattering, current amplitude analysis, use of an eSensor system, and use of electrochemical DNA biosensors.

[0060] Sample preparation methods are also contemplated in many embodiments. Prior to or concurrent with analysis, the genomic sample may be amplified by a variety of mechanisms, some of which may employ PCR. See, e.g., PCR Technology: Principles and Applications for DNA Amplification (Ed. H. A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (Eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (Eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159 4,965,188, and 5,333,675, and each of which is incorporated herein by reference in their entireties for all purposes. See also U.S. Pat. No. 6,300,070 which is incorporated herein by reference. Additional methods of sample preparation and techniques for reducing the complexity of a nucleic sample are described in Dong et al., Genome Research 11, 1418 (2001), in U.S. Pat. Nos. 6,361,947, 6,391,592 and U.S. Patent Pub. Nos. 20030096235, 20030082543 and 20030036069.

[0061] Other suitable amplification methods include the ligase chain reaction (LCR) (for example, Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988) and Barringer et al. Gene 89:117 (1990)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989) and WO88/10315), self-sustained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990) and WO90/06995), selective amplification of target polynucleotide sequences (U.S. Pat. No. 6,410,276), consensus sequence primed polymerase chain reaction (CP-PCR) (U.S. Pat. No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR) (U.S. Pat. Nos. 5,413,909, 5,861,245), rolling circle amplification (RCA) (for example, Fire and Xu, PNAS 92:4641 (1995) and Liu et al., J. Am. Chem. Soc. 118:1587 (1996)) and nucleic acid based sequence amplification (NABSA). (See, U.S. Pat. Nos. 5,409,818, 5,554,517, and 6,063,603, each of which is incorporated herein by reference). Other amplification methods that may be used are described in, U.S. Pat. Nos. 6,582,938, 5,242,794, 5,494,810, 4,988,617, and US Pub. No. 20030143599 each of which is incorporated herein by reference.

[0062] Molecular inversion probes may also be used for amplification of selected targets. MIPs may be generated so that the ends of the pre-circle probe are complementary to regions that flank the region to be amplified. The gap can be closed by extension of the end of the probe so that the complement of the target is incorporated into the MIP prior to ligation of the ends to form a closed circle. The closed circle can be amplified as previously disclosed in Hardenbol et al., Genome Res. 15:269-275 (2005) and in U.S. Pat. No. 6,858,412.

[0063] In some embodiments, amplification may include the use of a strand displacing polymerase that may be primed by selected primers or by a mixture of primers, for example, random hexamers. See for example Lasken and Egholm, Trends Biotechnol. 2003 21(12):531-5; Barker et al. Genome Res. 2004 May; 14(5):901-7; Dean et al. Proc Natl Acad Sci USA 2002; 99(8):5261-6; and Paez, J. G., et al. Nucleic Acids Res. 2004; 32(9):e71. Other amplification methods that may be used include: Qbeta Replicase, described in PCT Patent Application No. PCT/US87/00880, isothermal amplification methods such as SDA, described in Walker et al. 1992, Nucleic Acids Res. 20(7):1691-6, 1992, and rolling circle amplification, described in U.S. Pat. No. 5,648,245. DNA may also be amplified by multiplex locus-specific PCR or using adaptor-ligation and single primer PCR. Other available methods of amplification, such as balanced PCR (Makrigiorgos, et al. (2002), Nat Biotechnol, Vol. 20, pp. 936-9), may also be used. Balanced PCR operates by digesting the two genomes to be compared (target A and control B) with a restriction enzyme (SAU3A1, a four-base cutter) and then ligating composite linkers LN1 and LN2 to each of the two DNA populations. Each linker contains a sequence (P1) found in both linkers and a sequence tag unique to each DNA sample. These unique tags are included in the 3' end of the sequences P2a and P2b. Therefore, primer extension by P2a or P2b can occur only when DNA ligated to LN1 or LN2, respectively, is encountered. The ligated genomes are mixed and amplified in a single PCR reaction with the P1 common primer until the desired amount of final product is obtained. Subsequently, the mixed genomes can be distinguished by two methods: differential fluorescent labeling of one or the other DNA population in the mixture using the unique sequences P2a or P2b in a single primer-extension reaction, or reseparation of the two genomes by a low-cycle PCR reaction.

[0064] Methods of ligation will be known to those of skill in the art and are described, for example in Sambrook et at. (2001) and the New England BioLabs catalog both of which are incorporated herein by reference for all purposes. Methods include using T4 DNA Ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl termini in duplex DNA or RNA with blunt and sticky ends; Taq DNA Ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl termini of two adjacent oligonucleotides which are hybridized to a complementary target DNA; E. coli DNA ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5'-phosphate and 3'-hydroxyl termini in duplex DNA containing cohesive ends; and T4 RNA ligase which catalyzes ligation of a 5' phosphoryl-terminated nucleic acid donor to a 3' hydroxyl-terminated nucleic acid acceptor through the formation of a 3'->5' phosphodiester bond, substrates include single-stranded RNA and DNA as well as dinucleoside pyrophosphates; or any other methods described in the art. Fragmented DNA may be treated with one or more enzymes, for example, an endonuclease, prior to ligation of adaptors to one or both ends to facilitate ligation by generating ends that are compatible with ligation.

[0065] Fixed content mapping arrays are available from Affymetrix, for example, the SNP 6.0 array. Methods for using mapping arrays see, for example, Kennedy et al., Nat. Biotech. 21:1233-1237 (2003), Matsuzaki et al., Genome Res. 14:414-425 (2004), Matsuzaki et al., Nat. Meth. 1:109-111 (2004) and U.S. Patent Pub. Nos. 20040146890 and 20050042654, each incorporated herein by reference. Applications of microarrays for SNP genotyping have been described in e.g., U.S. Pat. Nos. 6,300,063, 6,361,947, 6,368,799 and US Patent Publication Nos. 20040067493, 20030232353, 20030186279, 20050260628, 20070065816 and 20030186280, all incorporated herein by reference in their entireties for all purposes. In U.S. Pat. No. 6,300,063, a wide variety of methods can be used to identify specific polymorphisms. For example, repeated sequencing of genomic material from large numbers of individuals, although extremely time consuming, can be used to identify such polymorphisms. In U.S. Pat. No. 6,361,947, arrays are designed to detect specific SNPS or simply to detect the presence of a region known to frequently contain SNPS. In the latter case, other techniques such as sequencing could be employed to identify the SNP.

[0066] Selected panels of SNPs can also be interrogated using a panel of locus specific probes in combination with a universal array as described in Hardenbol et al., Genome Res. 15:269-275 (2005) and in U.S. Pat. No. 6,858,412. Universal tag arrays and reagent kits for performing such locus specific genotyping using panels of custom molecular inversion probes (MIPs) are available from Affymetrix.

[0067] Computer implemented methods for determining genotype using data from mapping arrays are disclosed, for example, in Liu, et al., Bioinformatics 19:2397-2403 (2003), Rabbee and Speed, Bioinformatics, 22:7-12 (2006), and Di et al., Bioinformatics 21:1958-63 (2005). Computer implemented methods for linkage analysis using mapping array data are disclosed, for example, in Ruschendorf and Nurnberg, Bioinformatics 21:2123-5 (2005) and Leykin et al., BMC Genet. 6:7, (2005). Computer methods for analysis of genotyping data are also disclosed in U.S. Patent Pub. Nos. 20060229823, 20050009069, 20040138821, 20060024715, 20050250151 and 20030009292.

[0068] Methods for analyzing chromosomal copy number using mapping arrays are disclosed, for example, in Bignell et al., Genome Res. 14:287-95 (2004), Lieberfarb, et al., Cancer Res. 63:4781-4785 (2003), Zhao et al., Cancer Res. 64:3060-71 (2004), Huang et al., Hum Genomics 1:287-299 (2004), Nannya et al., Cancer Res. 65:6071-6079 (2005), Slater et al., Am. J. Hum. Genet. 77:709-726 (2005) and Ishikawa et al., Biochem. and Biophys. Res. Comm., 333:1309-1314 (2005). Computer implemented methods for estimation of copy number based on hybridization intensity are disclosed in U.S. Patent Pub. Nos. 20040157243, 20050064476, 20050130217, 20060035258, 20060134674 and 20060194243.

[0069] Additional methods of sample preparation and techniques for reducing the complexity of a nucleic sample are described in Dong et al., Genome Research 11, 1418 (2001), in U.S. Pat. Nos. 6,361,947, 6,391,592 and 6,872,529 and U.S. Patent Publication Nos. 20030036069, 20030096235 and 20030082543. Additional methods of using a genotyping array are disclosed, for example, in U.S. Patent Publication Nos. 20040146883, 20030186280, 20030186279, 20040067493, 20030232353, 20060292597, 20050233354, 20050074799, 20070065816 and 20040185475.

[0070] Methods for conducting polynucleotide hybridization assays have been well developed in the art. Hybridization assay procedures and conditions will vary depending on the application and are selected in accordance with known general binding methods, including those referred to in: Maniatis et al. Molecular Cloning: A Laboratory Manual (2.sup.nd Ed. Cold Spring Harbor, N.Y, 1989); Berger and Kimmel Methods in Enzymology, Vol. 152, Guide to Molecular Cloning Techniques (Academic Press, Inc., San Diego, Calif., 1987); Young and Davis, P.N.A.S, 80: 1194 (1983). Methods and apparatus for carrying out repeated and controlled hybridization reactions have been described in U.S. Pat. Nos. 5,871,928, 5,874,219, 6,045,996 and 6,386,749, 6,391,623 each of which are incorporated herein by reference.

[0071] The present invention also contemplates signal detection of hybridization between ligands in certain preferred embodiments. See U.S. Pat. Nos. 5,143,854, 5,578,832, 5,631,734, 5,834,758, 5,936,324, 5,981,956, 6,025,601, 6,141,096, 6,185,030, 6,201,639, 6,218,803, and 6,225,625 in U.S. Patent Pub. No. 20040012676 and in PCT Application PCT/US99/06097 (published as WO99/47964), each of which also is hereby incorporated by reference in its entirety for all purposes.

[0072] Methods and apparatus for signal detection and processing of intensity data are disclosed in, for example, U.S. Pat. Nos. 5,143,854, 5,547,839, 5,578,832, 5,631,734, 5,800,992, 5,834,758, 5,856,092, 5,902,723, 5,936,324, 5,981,956, 6,025,601, 6,090,555, 6,141,096, 6,185,030, 6,201,639; 6,218,803; and 6,225,625, in U.S. Patent Pub. Nos. 20040012676 and 20050059062 and in PCT Application PCT/US99/06097 (published as WO99/47964), each of which also is hereby incorporated by reference in its entirety for all purposes.

[0073] The practice of the present invention may also employ conventional biology methods, software and systems. Computer software products of the invention typically include computer readable medium having computer-executable instructions for performing the logic steps of the method of the invention. Suitable computer readable medium include floppy disk, CD-ROM/DVD/DVD-ROM, hard-disk drive, flash memory, ROM/RAM, magnetic tapes, etc. The computer-executable instructions may be written in a suitable computer language or combination of several languages. Basic computational biology methods are described in, for example, Setubal and Meidanis et al., Introduction to Computational Biology Methods (PWS Publishing Company, Boston, 1997); Salzberg, Searles, Kasif, (Ed.), Computational Methods in Molecular Biology, (Elsevier, Amsterdam, 1998); Rashidi and Buehler, Bioinformatics Basics: Application in Biological Science and Medicine (CRC Press, London, 2000) and Ouelette and Bzevanis Bioinformatics: A Practical Guide for Analysis of Gene and Proteins (Wiley & Sons, Inc., 2.sup.nd ed., 2001). See U.S. Pat. No. 6,420,108.

[0074] The present invention may also make use of various computer program products and software for a variety of purposes, such as probe design, management of data, analysis, and instrument operation. See, U.S. Pat. Nos. 5,593,839, 5,795,716, 5,733,729, 5,974,164, 6,066,454, 6,090,555, 6,185,561, 6,188,783, 6,223,127, 6,229,911 and 6,308,170. Computer methods related to genotyping using high density microarray analysis may also be used in the present methods, see, for example, US Patent Pub. Nos. 20050250151, 20050244883, 20050108197, 20050079536 and 20050042654.

[0075] Additionally, the present disclosure may have preferred embodiments that include methods for providing genetic information over networks such as the Internet as shown in U.S. Patent Pub. Nos. 20030097222, 20020183936, 20030100995, 20030120432, 20040002818, 20040126840, and 20040049354.

[0076] An allele refers to one specific form of a genetic sequence (such as a gene) within a cell, an individual or within a population, the specific form differing from other forms of the same gene in the sequence of at least one, and frequently more than one, variant sites within the sequence of the gene. The sequences at these variant sites that differ between different alleles are termed "variances", "polymorphisms", or "mutations". At each autosomal specific chromosomal location or "locus" an individual possesses two alleles, one inherited from one parent and one from the other parent, for example one from the mother and one from the father. An individual is "heterozygous" at a locus if it has two different alleles at that locus. An individual is "homozygous" at a locus if it has two identical alleles at that locus.

[0077] Single nucleotide polymorphisms (SNPs) are positions at which two alternative bases occur at appreciable frequency (>1%) in a given population. SNPs are the most common type of human genetic variation. A polymorphic site is frequently preceded by and followed by highly conserved sequences (e.g., sequences that vary in less than 1/100 or 1/1000 members of the populations).

[0078] The term genotyping refers to the determination of the genetic information an individual carries at one or more positions in the genome. For example, genotyping may comprise the determination of which allele or alleles an individual carries for a single SNP or the determination of which allele or alleles an individual carries for a plurality of SNPs. For example, a particular nucleotide in a genome may be an A in some individuals and a C in other individuals. Those individuals who have an A at the position have the A allele and those who have a C have the C allele. In a diploid organism the individual will have two copies of the sequence containing the polymorphic position so the individual may have an A allele and a C allele or alternatively two copies of the A allele or two copies of the C allele. Those individuals who have two copies of the C allele are homozygous for the C allele, those individuals who have two copies of the A allele are homozygous for the C allele, and those individuals who have one copy of each allele are heterozygous. The array may be designed to distinguish between each of these three possible outcomes. A polymorphic location may have two or more possible alleles and the array may be designed to distinguish between all possible combinations.

[0079] Normal cells that are heterozygous at one or more loci may give rise to tumor cells that are homozygous at those loci. This loss of heterozygosity (LOH) may result from structural deletion of normal genes or loss of the chromosome carrying the normal gene, mitotic recombination between normal and mutant genes, followed by formation of daughter cells homozygous for deleted or inactivated (mutant) genes; or loss of the chromosome with the normal gene and duplication of the chromosome with the deleted or inactivated (mutant) gene.

[0080] The term "array" as used herein refers to an intentionally created collection of molecules which can be prepared either synthetically or biosynthetically. The molecules in the array can be identical or different from each other. The array can assume a variety of formats, for example, libraries of soluble molecules; libraries of compounds tethered to resin beads, silica chips, microparticles, nanoparticles or other solid supports.

[0081] The term "complementary" as used herein refers to the hybridization or base pairing between nucleotides or nucleic acids, such as, for instance, between the two strands of a double stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid to be sequenced or amplified. See, M. Kanehisa Nucleic Acids Res. 12:203 (1984), incorporated herein by reference.

[0082] The term "copy number variation" or "CNV" refers to differences in the copy number of genetic information. In many aspects it refers to differences in the per genome copy number of a genomic region. For example, in a diploid organism the expected copy number for autosomal genomic regions is 2 copies per genome. Such genomic regions should be present at 2 copies per cell. For a recent review see Zhang et al. Annu. Rev. Genomics Hum. Genet. 2009. 10:451-81. CNV is a source of genetic diversity in humans and can be associated with complex disorders and disease, for example, by altering gene dosage, gene disruption, or gene fusion. They can also represent benign polymorphic variants. CNVs can be large, for example, larger than 1 Mb, but many are smaller, for example between 100 bp and 1 Mb. More than 38,000 CNVs greater than 100 bp (and less than 3 Mb) have been reported in humans. Along with SNPs these CNVs account for a significant amount of phenotypic variation between individuals. In addition to having deleterious impacts, e.g. causing disease, they may also result in advantageous variation.

[0083] Digital PCR is a technique where a limiting dilution of the sample is made across a large number of separate PCR reactions so that most of the reactions have no template molecules and give a negative amplification result. Those reactions that are positive at the reaction endpoint are counted as individual template molecules present in the original sample in a 1 to 1 relationship. See Kalina et al. NAR 25:1999-2004 (1997) and Vogelstein and Kinzler, PNAS 96:9236-9241 (1999). This method is an absolute counting method where solutions are partitioned into containers until there is an average probability of one molecule per two containers or when, P.sub.0=(1-e.sup.n/c)=1/2; where n is the number of molecules and c is the number of containers, or n/c is 0.693. Quantitative partitioning is assumed, and the dynamic range is governed by the number of containers available for stochastic separation. The molecules are then detected by PCR and the number of positive containers is counted. Each successful amplification is counted as one molecule, independent of the actual amount of product. PCR-based techniques have the additional advantage of only counting molecules that can be amplified, e.g. that are relevant to the massively parallel PCR step in the sequencing workflow. Because digital PCR has single molecule sensitivity, only a few hundred library molecules are required for accurate quantification. Elimination of the quantification bottleneck reduces the sample input requirement from micrograms to nanograms or less, opening the way for minute and/or precious samples onto the next-generation sequencing platforms without the distorting effects of pre-amplification. Digital PCR has been used to quantify sequencing libraries to eliminate uncertainty associated with the construction and application of standard curves to PCR-based quantification and enable direct sequencing without titration runs. See White et al. BMC Genomics 10: 116 (2009).

[0084] To vary dynamic range, micro-fabrication can be used to substantially increase the number of containers. See, Fan et al. Am J Obstet Gynecol 200, 543 el (May, 2009).

[0085] Similarly, in stochastic labeling as disclosed herein, the same statistical conditions are met when P.sub.0=(1-e.sup.n/m)=1/2; where m is the number of labels, and one half of the labels will be used at least once when n/m=0.693. The dynamic range is governed by the number of labels used, and the number of labels can be easily increased to extend the dynamic range. The number of containers in digital PCR plays the same role as the number of labels in stochastic labeling and by substituting containers for labels identical statistical equations may be applied. Using the principles of physical separation, digital PCR stochastically expands identical molecules into physical space, whereas the principle governing stochastic labeling is identity based and expands identical molecules into identity space.

[0086] The term "hybridization" as used herein refers to the process in which two single-stranded polynucleotides bind noncovalently to form a stable double-stranded polynucleotide; triple-stranded hybridization is also theoretically possible. The resulting (usually) double-stranded polynucleotide is a "hybrid." The proportion of the population of polynucleotides that forms stable hybrids is referred to herein as the "degree of hybridization." Hybridizations may be performed under stringent conditions, for example, at a salt concentration of no more than 1 M and a temperature of at least 25.degree. C. For example, conditions of 5.times.SSPE (750 mM NaCl, 50 mM NaPhosphate, 5 mM EDTA, pH 7.4) and a temperature of 25-30.degree. C. are suitable for allele-specific probe hybridizations. For stringent conditions, see, for example, Sambrook, Fritsche and Maniatis. "Molecular Cloning A laboratory Manual" 2.sup.nd Ed. Cold Spring Harbor Press (1989) which is hereby incorporated by reference in its entirety for all purposes above. In some aspects salt concentrations for hybridization are preferably between about 200 mM and about 1M or between about 200 mM and about 500 mM. Hybridization temperatures can be as low as 5.degree. C., but are typically greater than 22.degree. C., more typically greater than about 30.degree. C., and preferably in excess of about 37.degree. C. Longer fragments may require higher hybridization temperatures for specific hybridization. As other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents and extent of base mismatching, the combination of parameters is more important than the absolute measure of any one alone.

[0087] The term "mixed population" or sometimes refer by "complex population" as used herein refers to any sample containing both desired and undesired nucleic acids. As a non-limiting example, a complex population of nucleic acids may be total genomic DNA, total genomic RNA or a combination thereof. Moreover, a complex population of nucleic acids may have been enriched for a given population but include other undesirable populations. For example, a complex population of nucleic acids may be a sample which has been enriched for desired messenger RNA (mRNA) sequences but still includes some undesired ribosomal RNA sequences (rRNA).

[0088] The term "mRNA" or sometimes refer by "mRNA transcripts" as used herein, include, but not limited to pre-mRNA transcript(s), transcript processing intermediates, mature mRNA(s) ready for translation and transcripts of the gene or genes, or nucleic acids derived from the mRNA transcript(s). Transcript processing may include splicing, editing and degradation. As used herein, a nucleic acid derived from an mRNA transcript refers to a nucleic acid for whose synthesis the mRNA transcript or a subsequence thereof has ultimately served as a template. Thus, a cDNA reverse transcribed from an mRNA, an RNA transcribed from that cDNA, a DNA amplified from the cDNA, an RNA transcribed from the amplified DNA, etc., are all derived from the mRNA transcript and detection of such derived products is indicative of the presence and/or abundance of the original transcript in a sample. Thus, mRNA derived samples include, but are not limited to, mRNA transcripts of the gene or genes, cDNA reverse transcribed from the mRNA, cRNA transcribed from the cDNA, DNA amplified from the genes, RNA transcribed from amplified DNA, and the like.

[0089] The term "nucleic acid" as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides, deoxyribonucleotides or peptide nucleic acids (PNAs), that comprise purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of the polynucleotide can comprise sugars and phosphate groups, as may typically be found in RNA or DNA, or modified or substituted sugar or phosphate groups. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. The sequence of nucleotides may be interrupted by non-nucleotide components. Thus the terms nucleoside, nucleotide, deoxynucleoside and deoxynucleotide generally include analogs such as those described herein. These analogs are those molecules having some structural features in common with a naturally occurring nucleoside or nucleotide such that when incorporated into a nucleic acid or oligonucleoside sequence, they allow hybridization with a naturally occurring nucleic acid sequence in solution. Typically, these analogs are derived from naturally occurring nucleosides and nucleotides by replacing and/or modifying the base, the ribose or the phosphodiester moiety. The changes can be tailor made to stabilize or destabilize hybrid formation or enhance the specificity of hybridization with a complementary nucleic acid sequence as desired.

[0090] The term "oligonucleotide" or sometimes refer by "polynucleotide" as used herein refers to a nucleic acid ranging from at least 2, preferable at least 8, and more preferably at least 20 nucleotides in length or a compound that specifically hybridizes to a polynucleotide. Polynucleotides of the present invention include sequences of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) which may be isolated from natural sources, recombinantly produced or artificially synthesized and mimetics thereof. A further example of a polynucleotide of the present invention may be peptide nucleic acid (PNA). The invention also encompasses situations in which there is a nontraditional base pairing such as Hoogsteen base pairing which has been identified in certain tRNA molecules and postulated to exist in a triple helix. "Polynucleotide" and "oligonucleotide" are used interchangeably in this application.

[0091] The term "polymorphism" as used herein refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population. A polymorphic marker or site is the locus at which divergence occurs. Preferred markers have at least two alleles, each occurring at frequency of greater than 1%, and more preferably greater than 10% or 20% of a selected population. A polymorphism may comprise one or more base changes, an insertion, a repeat, or a deletion. A polymorphic locus may be as small as one base pair. Polymorphic markers include restriction fragment length polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, and insertion elements such as Alu. The first identified allelic form is arbitrarily designated as the reference form and other allelic forms are designated as alternative or variant alleles. The allelic form occurring most frequently in a selected population is sometimes referred to as the wildtype form. Diploid organisms may be homozygous or heterozygous for allelic forms. A diallelic polymorphism has two forms. A triallelic polymorphism has three forms. Single nucleotide polymorphisms (SNPs) are included in polymorphisms.

[0092] The term "primer" as used herein refers to a single-stranded oligonucleotide capable of acting as a point of initiation for template-directed DNA synthesis under suitable conditions for example, buffer and temperature, in the presence of four different nucleoside triphosphates and an agent for polymerization, such as, for example, DNA or RNA polymerase or reverse transcriptase. The length of the primer, in any given case, depends on, for example, the intended use of the primer, and generally ranges from 15 to 30 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. A primer need not reflect the exact sequence of the template but must be sufficiently complementary to hybridize with such template. The primer site is the area of the template to which a primer hybridizes. The primer pair is a set of primers including a 5' upstream primer that hybridizes with the 5' end of the sequence to be amplified and a 3' downstream primer that hybridizes with the complement of the 3' end of the sequence to be amplified.

[0093] The term "probe" as used herein refers to a surface-immobilized molecule that can be recognized by a particular target. See U.S. Pat. No. 6,582,908 for an example of arrays having all possible combinations of probes with 10, 12, and more bases. Examples of probes that can be investigated by this invention include, but are not restricted to, agonists and antagonists for cell membrane receptors, toxins and venoms, viral epitopes, hormones (for example, opioid peptides, steroids, etc.), hormone receptors, peptides, enzymes, enzyme substrates, cofactors, drugs, lectins, sugars, oligonucleotides, nucleic acids, oligosaccharides, proteins, and monoclonal antibodies.

[0094] The term "solid support", "support", and "substrate" as used herein are used interchangeably and refer to a material or group of materials having a rigid or semi-rigid surface or surfaces. In many embodiments, at least one surface of the solid support will be substantially flat, although in some embodiments it may be desirable to physically separate synthesis regions for different compounds with, for example, wells, raised regions, pins, etched trenches, or the like. According to other embodiments, the solid support(s) will take the form of beads, resins, gels, microspheres, or other geometric configurations. See U.S. Pat. No. 5,744,305 and US Patent Pub. Nos. 20090149340 and 20080038559 for exemplary substrates.

[0095] A stochastic process is the counterpart to a deterministic process. Instead of dealing with only one possible "reality" of how the process might evolve under time, in a stochastic or random process there is some indeterminacy in its future evolution described by probability distributions. This means that even if the initial condition (or starting point) is known, there are many possibilities the process might go to, but some paths are more probable and others less.

[0096] In the simplest possible case, a stochastic process amounts to a sequence of random variables known as a time series (for example, see Markov chain). Another basic type of a stochastic process is a random field, whose domain is a region of space, in other words, a random function whose arguments are drawn from a range of continuously changing values. One approach to stochastic processes treats them as functions of one or several deterministic arguments ("inputs", in most cases regarded as "time") whose values ("outputs") are random variables: non-deterministic (single) quantities which have certain probability distributions. Random variables corresponding to various times (or points, in the case of random fields) may be completely different. The main requirement is that these different random quantities all have the same "type". Although the random values of a stochastic process at different times may be independent random variables, in most commonly considered situations they exhibit complicated statistical correlations.

[0097] Familiar examples of processes modeled as stochastic time series include stock market and exchange rate fluctuations, signals such as speech, audio and video, medical data such as a patient's EKG, EEG, blood pressure or temperature, and random movement such as Brownian motion or random walks. Examples of random fields include static images, random terrain (landscapes), or composition variations of an heterogeneous material.

[0098] The stochastic labeling process can be generalized as follows. Consider n copies of a given target molecule T, where T={t.sub.i,i=1,2, . . . , n}, and a non-depleting reservoir of m diverse labels L, where L={l.sub.j, j=1,2, . . . , m}. T reacts with L stochastically, such that each t.sub.i will choose exactly one l.sub.j(i), 1.ltoreq.j.ltoreq.m to take on a new identity t.sub.il.sub.j(i), and may be identified by its label subscript. Therefore, the new collection of molecules T* may be denoted as T*={tl.sub.j(i),i=1,2, . . . , n, 1.ltoreq.j(i).ltoreq.m}.

[0099] When different copies of the target molecules react with the same label, j(i) for those molecules will assume the same value, therefore, the number of uniquely labeled target molecules k cannot be greater than m. The stochastic mapping of the set of labels on a target may be described by a stochastic operator S with m members, acting upon a target population of n, such that S(m)T(n)=T*(m, n) generating the set T*={tl.sub.j(i),i=1,2, . . . , n, 1.ltoreq.j(i).ltoreq.m}. For simplicity, we may write T*={tl.sub.k}. Furthermore, since S operates on all molecules randomly, it will independently act on many different target sequences and the method can be expanded to count copies of multiple target sequences, w,

simultaneously: ST.sup.w=ST.sub.1+ST.sub.2+ . . . +ST.sub.w=T.sub.1*+T.sub.2*+ . . . +T.sub.w.sup.*={tl.sub.k}.sub.1+{tl.sub.k}.sub.2+ . . . ++{tl.sub.k}.sub.w, where each T.sub.1*, i=1,2, . . . , w consists of a set {tl.sub.k}.sub.1. The net result of S operating on a specific target population is to map the number of molecules, n, of that target, to the number of labels captured, k, which is a random variable.

[0100] Since target molecules randomly react with a label with probability

1 m , ##EQU00001##

the probability of a label being captured by exactly x out of n copies of a target molecule can be modeled as a Binomial distribution,

P ( x ) = n ! x ! ( n - x ) ! ( 1 m ) x ( 1 - 1 m ) n - x , ##EQU00002##

where x! denotes the factorial of x. The probability that a label will not be captured by any copy of the target molecule is P(0)=(1-1/m).sup.n, and the probability that a label will be captured at least once is 1-P(0). When n.fwdarw..infin. and 1/m.fwdarw.0 in the way that n/m.fwdarw..lamda., P(x) converges to the Poisson distribution with mean .lamda., i.e.,

P ( x ) = .lamda. x x ! - .lamda. . ##EQU00003##

[0101] To compute the number of unique counters captured by n copies of a target molecule, we introduce an index random variable, X.sub.i, which is 1 if a counter has been captured at least once, and 0 otherwise. The number of unique counters captured is thus k=.SIGMA..sub.i=1.sup.mX.sub.i. The mean and variance of k can be derived,

E [ k ] = m [ 1 - ( 1 - 1 m ) n ] ( 1 ) Var [ k ] = m [ 1 - ( 1 - 1 m ) n ] ( 1 - 1 m ) n + m ( m - 1 ) [ ( 1 - 2 m ) n - ( 1 - 1 m ) 2 n ] ( 2 ) ##EQU00004##

[0102] To compute the number of unique labels captured by n copies of a target molecule, we introduce an index random variable, X.sub.i, which is 1 if a label has been captured at least once, and 0 otherwise. The number of unique labels captured is thus k=.SIGMA..sub.i=1.sup.mX.sub.i. The mean and variance of k can be derived,

E [ k ] = m [ 1 - ( 1 - 1 m ) n ] ( 1 ) Var [ k ] = m [ 1 - ( 1 - 1 m ) n ] ( 1 - 1 m ) n + m ( m - 1 ) [ ( 1 - 2 m ) n - ( 1 - 1 m ) 2 n ] ( 2 ) ##EQU00005##

[0103] Similarly, to compute the number of labels captured by exactly x copies of a target molecule, we introduce another index random variable, Y.sub.i, which is 1 if a label has been captured exactly x times, and 0 otherwise. The number of labels captured x times is thus=.SIGMA..sub.i=1.sup.mY.sub.i The mean and variance of t are,

E [ t ] = m n ! x ! ( n - x ) ! ( 1 m ) x ( 1 - 1 m ) n - x ( 3 ) Var [ t ] = A ( 1 - A ) + ( m - 1 ) m ( n 2 k ) ( 2 m ) 2 x ( 1 - 2 m ) n - 2 x ( 2 x x ) ( 1 2 ) 2 x ( 4 ) ##EQU00006##

where = m ( n x ) ( 1 m ) x ( 1 - 1 m ) n - x , ##EQU00007##

and the combination

( n x ) = n ! x ! ( n - x ! . ##EQU00008##

[0104] The equations were experimentally validated by performing numerical simulations with 5000 independent runs for each simulated case. Complete agreement with the analytical solutions was observed.

Stochastic Labeling of Individual Molecules

[0105] Methods are disclosed herein that may be applied to determining small numbers of biological molecules and their changes in response to, for example, cellular response, differentiation or signal transduction. The methods may also be used in performing a wide variety of clinical measurements. Although many analytical methods have been developed to measure the relative abundance of different molecules through sampling (e.g., microarrays and sequencing), the methods disclosed herein are able to determine the absolute number of molecules in a sample.

[0106] Methods for performing single molecule digital counting by the stochastic labeling of a collection of identical molecules are disclosed. As illustrated in FIGS. 1, 2A and 2B, each copy of a molecule (from a collection of identical target molecules 103) randomly captures a label by choosing from a large, non-depleting reservoir of diverse labels 101. The uniqueness of each labeled molecule is governed by the statistics of random choice, and depends on the number of copies of identical molecules in the collection compared to the diversity of labels. Once the molecules are labeled each has been given a unique identity and can now be separately detected. In some aspects, it is preferable to first amplify the labeled targets prior to detection so that simple present/absent threshold detection methods can be used. Counting the number of labels is used to determine the original number of molecules in solution. In some aspects, the molecules to be counted are each members of a class that shares some common feature, for example, they may each be a single copy of a particular gene sequence or nucleic acid sequence. Counting may be applied, for example, to mRNA targets, splice products, alternatively spliced products, structural RNAs, tRNA, miRNA, siRNA, microRNA and the like. Similarly, counting may be applied to DNA, for example, gene copy number, chromosome number, mitochondrial DNA, bacterial genomes, pathogen nucleic acid, viral nucleic acids and the like. Counting may be applied in research of disease in humans or other mammals or agricultural organisms, e.g. cattle, chicken, wheat, rice, fish, etc. Counting may also be applied to counting aspects of microbes, such as environmental measurements, e.g. water quality testing. The methods may be particularly useful where small numbers of items are to be counted and an accurate count is desirable rather than a relative estimate.

[0107] One embodiment is illustrated schematically in FIG. 1. The library of different label-tag sequences 101 is combined with a sample that includes an unknown number of targets of interest 103. Three different species of target are shown, 103a, 103b and 103c, present at 4, 6 and 3 copies respectively. The individual label-tag oligonucleotides from library 101 are covalently attached to the different targets to form target-label-tag molecules 105. Each target has a collection of different label-tag molecules 105a, 105b and 105c and within each target-specific collection the members differ in the label-tag oligo that is attached. On the array 107, each target is tiled in combination with all possible label-tag combinations represented with each different combination being present at a different known or determinable location on the array. In the figure each different possible combination of target and label-tag is represented by a single probe for illustration purposes, but on the array each different probe is preferably present in a feature having multiple copies of the same probe sequence. The array is divided into subarrays 107a, 107b and 107c for illustrative purposes. The upper portion 109 of the probes varies at each feature according to the different label-tag. The lower portion 113 is the same for all features of each subarray and is complementary to the target. After hybridization individual features of the array are labeled through hybridization of the complementary target-label-tag molecule to the feature. The figure shows a detectable label 111 may be used to detect features where a target-label-tag is hybridized.

[0108] FIG. 2A illustrates the attachment of different labels from the pool 101 to each of 4 different copies of the same target "t". Label 20 is attached to t1, label 107 to t2, label 477 to t3 and label 9 to t4. The labeled targets are then amplified to generate four unique populations, each population representing a single occurrence of the target in the starting sample.

[0109] FIG. 2B illustrates the method for a comparison of two samples, sample 1 and 2. The target 201 Gene A is present in 2 copies in sample 1 and 9 copies in sample 2. Both samples have non-target molecules 203. The labels 205 are combined with the samples and target molecules are attached to individual label-tag molecules in a stochastic manner. The targets with attached label-tags are hybridized to an array 211 having many features, there is a feature for each possible target-label-tag combination. Some of the features are labeled, for example, 209 and others are not, for example, 207. The labeled features indicate the presence of a specific target-label-tag combination and each corresponds to a count. As shown for gene A in sample 1 there are two labeled features so the count is 2. For Gene A in sample 2 there are 9 labeled features so the count is 9.

[0110] FIG. 2C illustrates a comparison of traditional analog methods where the quantity of a target is inferred from the signal strength or hybridization intensity at a single feature or a collection of target specific features and the digital counting method. The labeled target on the left is labeled generically, i.e. all targets have the same label and specificity is through target specific hybridization to the array. For digital counting on the right each target-label-tag combination is detected by a different feature, with positive features being shaded grey in the illustration. Quantity is determined by counting features with signal above background. There are 7 features that are positive for hybridization so the counting method indicates 7 copies of the target in the starting sample. These illustrations show counting for a single target, but multiple targets can be counted as well. For each different target to be counted a collection of target-label-tag features is included on the array. T1:LI, T1:L2. T1:LN; T2:L1, T2:L2 . . . T2:LN etc.

[0111] The stochastic labeling process can be generalized as follows for illustrative purposes. Consider a given target sequence defined as T={t.sub.1, t.sub.2 . . . t.sub.n}; where n is the number of copies of T. A set of labels is defined as L={l.sub.1, l.sub.2 . . . l.sub.m}; where m is the number of different labels. T reacts stochastically with L, such that each t becomes attached to one 1. If the l's are in non-depleting excess, each t will choose one l randomly, and will take on a new identity l.sub.it.sub.j; where l, is chosen from L and j is the j.sup.th copy from the set of n molecules. We identify each new molecule l.sub.it.sub.j by its label subscript and drop the subscript for the copies of T, because they are identical. The new collection of molecules becomes T*=l.sub.1t+l.sub.2t+ . . . l.sub.it; where l.sub.i is the i.sup.th choice from the set of m labels. It is important to emphasize that the subscripts of l at this point refer only to the i.sup.th choice and provide no information about the identity of each l. In fact, l.sub.1 and l.sub.2 will have some probability of being identical, depending upon the diversity m of the set of labels. Overall, T* will contain a set of k unique labels resulting from n targets choosing from the non-depleting reservoir of m labels. Or, T*(m,n)={tl.sub.k}; where k represents the number of unique labels that have been captured. In all cases, k will be smaller than m, approaching m only when n becomes very large. We can define the stochastic attachment of the set of labels on a target using a stochastic operator S with m members, acting upon a target population of n, such that S(m)T(n)=T*(m,n) generating the set {tl.sub.k}. Furthermore, since S operates on all molecules randomly, it can independently act on many different target sequences. Hence, the method can simultaneously count copies of multiple target sequences. The distribution of outcomes generated by the number of trials n, from a diversity of m, can be approximated by the Poisson equation, P.sub.x=.sup.x/x! e.sup.-(n/m). P.sub.0 is the probability that a label will not be chosen in n trials, and therefore, 1-P.sub.0 is the probability that a label will occur at least once. It follows that the number of unique labels captured is given by: k=m(1-P.sub.0)=m(1-e.sup.-(n/m)).

[0112] Given k, we can calculate n. In addition to using the Poisson approximation, the relationship for k, n and m can be described analytically using the binomial distribution, or simulated using a random number generator, each yielding similar results (see SOM).

[0113] The outcome of stochastic labeling is illustrated by examining the graph of k verses n (curve 3201 in FIG. 11) calculated using a label diversity (m) of 960. As expected, the number of unique labels captured depends on the ratio of molecules to labels, n/m. When n is much smaller than m, each molecule almost always captures a unique label, and counting k is equivalent to counting n. As n increases, k increases more slowly as given by eq. 1, and yet remains a very precise estimate of n. For example, when n/m is .about.0.01, the ratio of unique labels to molecules k/n.about.0.99, and we expect an increase of 10 molecules will generate 10+/-X new labels. As n/m approaches 0.5 (i.e., .about.480 molecules reacted with 960 labels), k/n.about.0.79 and .about.6+/-X new labels are expected with an increase of 10 molecules. At high n/m, k increases more slowly as labels in the library are more likely to be captured more than once. Curve 3202 in FIG. 11 shows the number of labels chosen exactly once, and curve 3203 shows the number of labels chosen exactly twice as n increases. Curve 3201 shows the number of labels captured at least once. A more complete description of the number of times a label is chosen as a function of n is shown in FIG. 15.

[0114] The methods and examples below demonstrate that a population of indistinguishable molecules can be stochastically expanded to a population of uniquely identifiable and countable molecules. High-sensitivity threshold detection of single molecules is demonstrated, and the process can be used to count both the absolute and relative number of molecules in a sample. The method should be well suited for determining the absolute number of multiple target molecules in a specified container, for example in high-sensitivity clinical assays, or for determining the number of transcripts in single cells. The approach should also be compatible with other molecular assay systems. For example, antibodies could be stochastically labeled with DNA fragments and those that bind antigen harvested. After amplification, the number of labels detected will reflect the original number of antigens in solutions. In the examples shown here, DNA is used because of the great diversity of sequences available, and because it is easily detectable. In principle, any molecular label could be used, for example fluorescent groups or mass spectroscopy tags, as long as they are easily detected and they have sufficient diversity for the desired application. Although many of the examples refer to populations

[0115] It is instructive to contrast the attributes of stochastic labeling with other quantitative methods. Microarray and sequencing technologies are commonly used to obtain relative abundance of multiple targets in a sample. In the case of microarray analysis, intensity values reflect the relative amount of hybridization bound target and can be used to compare to the intensity of other targets in the sample. In the case of sequencing, the relative number of times a sequence is found is compared to the number of times other sequences are found. Although the techniques differ by using intensity in one case and a digital count in the other, they both provide relative comparisons of the number of molecules in solution. In order to obtain absolute numbers, quantitative capture of all sequences would need to be assured; however in practice the efficiency of capture with microarray and sequencing technologies is unknown.

[0116] Digital PCR is an absolute counting method where solutions are stochastically partitioned into multi-well containers until there is an average probability of one molecule per two containers, then detected by PCR(4). This condition is satisfied when, P.sub.0=(1-e.sup.-n/c)=1/2; where n is the number of molecules and c is the number of containers, or n/c is 0.693. Quantitative partitioning is assumed, and the dynamic range is governed by the number of containers available for stochastic separation. Once the molecules are partitioned, high efficiency PCR detection gives the yes/no answer and absolute counting enabled. To vary dynamic range, micro-fabrication can be used to substantially increase the number of containers (5). Similarly, in stochastic labeling, the same statistical conditions are met when P.sub.0=(1-e.sup.-n/m)=1/2; where m is the number of labels, and one half of the labels will be used at least once when n/m=0.693. The dynamic range is governed by the number of labels used, and the number of labels can be easily increased to extend the dynamic range. The number of containers in digital PCR plays the same role as the number of labels in stochastic labeling and by substituting containers for labels we can write identical statistical equations. Using the principles of physical separation, digital PCR stochastically expands identical molecules into physical space, whereas the principle governing stochastic labeling is identity based and expands identical molecules into identity space.

[0117] New methods and compositions for single molecule counting employing the use of stochastic labeling are disclosed herein. In preferred aspects, a diverse set of labels is randomly attached to a population of identical molecules is converted into a population of distinct molecules suitable for threshold detection. Random attachment as used herein refers to a process whereby any label can be attached to a given molecule with the same probability. To demonstrate stochastic labeling methods experimentally the absolute and relative number of selected genes were determined after stochastically labeling 360,000 different fragments of the human genome. The approach does not require the physical separation of molecules and may take advantage of highly parallel methods such as microarray and sequencing technologies to simultaneously count absolute numbers of multiple targets. In some embodiments, stochastic labeling may be used for determining the absolute number of RNA or DNA molecules within single cells.

[0118] The methods disclosed herein may be used to take quantitative measurements of copies of identical molecules in a solution by transformation of the information to a digital process for detecting the presence of different labels. The stochastic properties of the method have been measured, and the relative and absolute digital counting of nucleic acid molecules is demonstrated. The method is extremely sensitive, quantitative, and can be multiplexed to high levels. In some aspects a microarray-based detection method is used, but the method is extendable to many other detection formats.

[0119] In some aspects, the methods are based on probability theory, where the outcome of chemical reactions occurring between a set of labeling molecules and a set of target molecules is modeled and tested. When all of the molecules in a uniform mixture of fixed volume collide and react randomly, the chemical events follow a stochastic process governed in part by the molecule concentration of each species (D. T. Gillespie, The Journal of Physical Chemistry 81, 2340 (1977)).

[0120] Methods for analyzing genomic information often utilize a correlation between a measurement of the amount of material associated with a location. The location can be, for example, a feature of an array that contains a specific sequence that is known or can be determined or any type of solid support such as a bead, particle, membrane, etc. A common aspect to these methods is often hybridization of a target to be measured to a complementary probe attached to the solid support. The probe may be, for example, an oligonucleotide of known or determinable sequence, but may also be BACs, PACs, or PCR amplicons.

[0121] Because of the density of different features that can be obtained using synthesis methods such as photolithography, microarrays can be applied to high density applications. For example, at feature sizes of 1 micron square an array can have about 10.sup.8 features per cm.sup.2. Within a feature, depending on the chemistry used for synthesis, the probes are spaced typically at about 10 nm spacing resulting in about 104 molecules in a micron.sup.2. At approximately full saturation about 10% of those probes are hybridized with target. There are then about 640 functional molecules in an array having 1 micron.sup.2 spacing between features (.about.800 nm.sup.2 functional area). This relatively small number of functional molecules in a feature limits the dynamic range for estimating relative concentration from hybridization signal intensity.

[0122] Methods are disclosed herein to overcome the dynamic range limitations observed with small feature sizes and small numbers of molecules on the array surface, by using a counting or digital readout as a substitute for the typical analog signal resulting from array hybridization.

[0123] Methods that use signal intensity to estimate relative concentrations of targets typically label the targets with a detectable label, often after an amplification step, and through hybridization of the labeled target to the probe, the probe and thus the feature is also labeled. The amount of label is detected and correlated with a measurement of the amount of target in the sample. The estimate of amount of a given target in a sample is typically relative to other targets in the sample or to previously obtained measurements and may be based on comparison to targets present in the sample at known or expected levels or to controls within the sample. This type of analysis can and has been used successfully, for example, to estimate genomic copy number to detect copy number variation in individuals or in cell populations (see, for example, Pinkel & Albertson, Annu. Rev. Genomics Hum. Genet. 6, 331-354 (2005), Lucito et al. Genome Res. 13, 229102305 (2004), Sebat et al. Science 305, 525-528 (2004), Zhou et al., Nat. Biotechnol. 19, 78-81 (2001) and Zhao et al. Cancer Res. 65, 5561-5570 (2005) and US Patent Pub. Nos. 20040157243 and 20060035258) or to estimate gene expression levels (see, for example, Lockhart et al., Nat. Biotechnol. 14:1675-1680 (1996), and Wodicka et al., Nat. Biotechnol. 15:1359-1367 (1997)).

[0124] Correlating intensity of hybridization signal or signal intensity with concentration of target molecules has limitations and can typically provide only an estimate of the absolute amount of a target, and may not be an accurate count of the actual amount of target present. The estimate may be an under or over estimate, particularly when comparing different targets or different samples. This is the result of many different factors, including but not limited to, differences between probes, feature specific effects, sample specific effects, feature size (as it decreases the ability to correlate accurately decreases) and experimental variation. Much of this variation can be addressed by data analysis methods, but the methods do not provide counting of individual molecules or events and are therefore subject to estimation errors.

[0125] In preferred aspects methods are disclosed for attaching a different label-tag sequence to each molecule of a particular target sequence or more preferably a collection of target sequences of interest. For example, a sample having 100 molecules of target type 1 is mixed with an excess, for example, 1000 different label-tag sequences, forming a library of label-tag sequences under ligation conditions. Multiple copies of the library of label-tag sequences are added so there are preferably many copies of each label-tag. Different label-tag sequences from the library are appended to each of the 100 target molecules so that each of the 100 molecules of the first target sequence has a unique label-tag sequence appended thereto. This results in 100 different target-label-tag combinations. The target-label-tag molecules may then be amplified to enrich the target-label-tag products relative to other non-targets. Amplification after labeling alters the absolute amount of the target, but because each occurrence in the original sample has been uniquely labeled this will not alter the count. The amplified target-label-tag products, whether amplified or not, can then be labeled with a detectable label, and hybridized to an array of probes. The features of the array that have target-label-tag hybridized thereto can be detected, for example, by labeling the hybridization complex with a fluorescent label and detecting the presence of signal at the features. In this example, because there are 1000 different labels possible and a single target being analyzed, there are 1000 different possible label-target sequences that might be generated so an array having a different feature for each of the 1000 different possibilities can be used. Assuming each target is labeled and no label is used twice, 100 of the 1000 different features should be detectable, indicating the corresponding label has been used.

[0126] Consider 1 copy of a target molecule in solution identified as t.sub.1. React this target against a set of 10 labels, L.sub.m {l.sub.1,l.sub.2, . . . l.sub.10}. Each label has a 0.1 probability of being chosen. Next consider multiple copies of the target, t.sub.n, reacted against the set of L.sub.m (assume non-depelting reservoir of labels). For simplicity, consider 3 copies of t: t.sub.1, t.sub.2 and t.sub.3. Target t.sub.1 will choose a label, t.sub.2 has a 0.9 probability of choosing a different label, t.sub.3 has a predictable probability of choosing the same label as t.sub.1 or t.sub.2. For n copies choosing from m labels, outcomes can be modeled by the binomial distribution as discussed above. For 3 targets and 10 labels, the probability of a label not being chosen, P.sub.0 is (1-( 1/10)).sup.3=0.729. The probability P.sub.1 of being chosen exactly once is ( 3/10)(1-( 1/10)).sup.2=0.243. The probability of being chosen twice, P.sub.2 is 0.027 and the probability P.sub.3 of being chosen 3 times is 0.001. Since P.sub.0 is the probability of not being chosen, 1-P.sub.0 is the probability of being chosen at least once. We define k=m(1-P.sub.0) as the number of labels we expect to see in an experiment. Conversely, if we know m, and observe k we can solve for the number of molecules. In the previous example where n=3 and m=10 we expect to see 10(1-P.sub.0) or 2.71 labels as our most probable outcome. Increasing m dramatically increases our counting efficiency, accuracy and dynamic range, e.g. for m=1,000, k(number of labels expected for n=10, k=9.96, for n=20, k=19.8.

[0127] Once the target molecules are labeled with the counter they can be amplified freely without impacting the counting since the readout is either yes, indicating detection or no indication not detected. In one aspect, a simple detector having m elements for each target sequence can be constructed. The detector may be an array. An array having 10.sup.8 features or elements could assay 10.sup.5 different targets using 10.sup.3 different labels, for example. Other detection methods do not require individual elements for each counter, for example, sequencing.

[0128] In preferred aspects the "counter library" or "label-tag library" has approximately the same number of copies of each label-tag in the library. The label-tag sequences are not target specific, but are like the tags that have been used for other tagging applications, for example, the Affymetrix GENFLEX tag array. Preferably all label-tags in a set of label-tags will have similar hybridization characteristics so that the label-tags of the set can be detected under similar conditions.

[0129] For each target there are a series of features on the array, preferably one feature for each label-tag. In each of these features the portion of the probe that hybridizes to the target (or target complement) is the same but the label-tag complement is different in each feature. For example, to detect a first target RNA, "RNA1", there would be a series of features each having a different probe (RNA1-tag1, RNA1-tag2, . . . RNA1-tagN). For each target to be detected there is a similar set of features, e.g. RNA2-tag1, RNA2-tag2, . . . RNA2-tagN. The set of label-tags is N tags and it is the unique combination of the label-tag with the target sequence that creates a novel sequence to be detected, for example, by hybridization.

[0130] Label-tag attachment to individual targets is a stochastic process whereby the probability of any given label-tag being attached to any target is stochastic. There is a random selection of label-tags by attaching the label-tags to the end of a known target sequence in a sequence independent manner. The label-tag is attached without requirement for it to hybridize to any portion of the target so there is no or minimal bias as to which label-tag sequence is attached. Individual molecules all look the same for the purpose of attachment of the label-tag.

[0131] The label-tag may be attached to the target by any method available. In one embodiment, the label-tag is attached by ligation of the label-tag to one of the ends of the target. In preferred aspects the probes of the array are complementary to a predicted junction between target and label so it is preferable that the labels are attached to all occurrences of a target at the same position. This is facilitated if the termini of each occurrence of a selected target are the same and are known. In one aspect, target occurrences are fragmented with a restriction enzyme so that defined ends of known sequence are formed.

[0132] After label-tag attachment in some embodiments the target-label-tag segment is amplified. Attachment of universal primers to either end followed by PCR amplification is one method for amplifying. The universal primers may be added along with the label or at a subsequent ligation step.

[0133] For RNA targets an RNA ligase, such as T4 RNA ligase may be used. T4 RNA ligase 1 catalyses the ligation of a 5' phosphryl-terminated nucleic acid donor to a 3' hydroxyl-terminated nucleic acid acceptor. Substrates include single-stranded RNA and DNA. See, for example, Romaniuk, P. and Uhlenbeck, O. (1983) R. Wu, L. Grossman and K. Moldave (Eds.), Methods Enzymol., 100, pp. 52-56. New York: Academic Press and Moore, M. J. and Sharp, P.A. (1992) Science, 256, 992-997. RNA targets may also be circularized and used as template for rolling circle amplification using an enzyme having reverse transcriptase activity. T4 RNA ligase 1 may be used for circularization of RNA by ligating the ends of the molecule together. T4 RNA ligase 1 can also be used to ligated RNA to DNA.

[0134] Full-length mRNA can be selected by treating total or poly(A) RNA with calf intestinal phosphatase (CIP) to remove the 5' phosphate from all molecules which contain free 5' phosphates (e.g. ribosomal RNA, fragmented mRNA, tRNA and genomic DNA). Full-length mRNAs are not affected. The RNA can them be treated with tobacco acid pyrophosphatase (TAP) to remove the cap structure from the full-length mRNA leaving a 5'-monophosphate. A synthetic RNA adapter can be ligated to the RNA population. Only molecules containing a 5'-phosphate, (i.e. the uncapped, full-length mRNAs) will ligate to the adapters. Preferably the adapter has a variable label sequence, and may also have a constant sequence for priming. Preferably, the constant sequence is 5' of the variable sequence. In some aspects, the adapter ligated mRNA may then be copied to form a first strand cDNA by, for example, random priming or priming using oligo dT. The cDNA may subsequently be amplified by, for example, PCR.

[0135] T4 RNA ligase may also be used for ligation of a DNA oligo to single stranded DNA. See, for example, Troutt et al., (1992) Proc. Natl, Acad. Sci. USA, 89, 9823-9825.

[0136] In other aspects, the ligated target-label-tag molecule may be enriched in the sample relative to other nucleic acids or other molecules. This enrichment may be, for example, by preferentially amplifying the target-label-tag methods, using for example, a DNA or RNA polymerase, or by degrading non target-label-tag molecules preferentially.

[0137] In one aspect, the target-label-tag molecule may be nuclease resistant while the unligated target and unligated label molecules may be nuclease sensitive. A nuclease can be added to the sample after ligation so that ligated target-label-tag molecules are not digested but non-ligated molecules are digested. For example, the targets may be resistant to a 5' exonuclease (but not a 3' exonuclease) while the labels are resistant to a 3' exonuclease but not a 5' exonuclease. Ligating target to label generates a molecule that is resistant to 5' and 3' exonuclease activity. After ligation the sample may be treated with a 5' exonuclease activity, a 3' exonuclease activity or both 5' and 3' exonuclease activities. For examples of nucleases see Rittie and Perbal, J. Cell Commun. Signal. (2008) 2:25-45, which is incorporated by reference (in particular see Table 5). Exo VII, for example degrades single stranded DNA from both the 5' and 3' ends so the sample could be treated with Exo VII after ligation to degrade molecules that are not ligation products.

[0138] In another aspect amplification may include a rolling circle amplification (RCA) step. See for example, Baner et al. (1998) NAR 26:5073, Lizardi et al. (1998) Nat. Genet. 19:225, Fire and Xu, (1995) PNAS 92:4641-5, Zhao et al. Angew Chem Int Ed Engl. 2008; 47:6330-6337 and Nilsson et al. (2008), Trends in Biotechnology, 24:83-88. The targets may be ligated so that they have a label and a universal priming (UP) sequence attached to the 5' end of the targets. The UP-label-target is then ligated to form a circle. A primer complementary to the UP is then hybridized to the circles and extended using a strand displacing polymerase. The resulting amplification product contains multiple copies of the complement of the circle, UP-target-L.

[0139] In another aspect, targets may be labeled in a copying step. For example, a primer having a 3' target specific region and a 5' variable label region may be hybridized to the targets, either RNA or DNA, and extended to create a single complimentary copy of the target. Each extension product will have a different label and the junction between the label and the target specific region is known. The extension may be performed in the presence of nuclease resistant nucleotides so that the extension product is resistant to nuclease but the unextended primers are not. After extension the reaction is treated with a 3'-5' exonuclease activity to digest unextended primer. Exonuclease I, for example, removes nucleotides from single stranded DNA in the 3' to 5' direction and Exo III removes nucleotides from the 3' termini of duplex DNA. Exonuclease T (or RNase T) is a single-stranded RNA or DNA specific nuclease that requires a free 3' terminus and removes nucleotides in the 3' to 5' direction. The extension products are then detected by hybridization to probes that are complementary to the primers and include the unique label portion and the constant target specific portion. If the target is RNA it can be digested with RNase H after extension. The extension product may also be amplified before hybridization.

[0140] In some aspects the probability that any two targets are labeled with the same label may be decreased by using two or more labeling steps. For example, a first labeling step where each target has a label selected from a set of labels followed by a second labeling set using the same set of labels. The first labeling event will be independent of the second so the probability that the first and second labeling events will both be the same in two independent targets is the product of the probability of two targets having the same label in either step. If there are N possible labels, and the first target is labeled first with label N1 and then with label N4, the probability that a second target will be labeled also with N1 and then N4 is 1/N.sup.2. So if there are 100 different labels, the probability that two targets will be labeled with the same label in the first round and the same label in the second round is 1/10,000.

[0141] In another aspect a first round of labeling may be done with 16 probes (for example, all possible 2 base combinations) and then a second round of labeling is done using the same 16 probes. The chance of any one probe attaching to a given target occurrence in the first round is 1 out of 16, the chance that the same probe will attach to the second target is 1/16 and the chance that the same two probes will attach is 1/16.times.1/16 or 1/256.

[0142] In another aspect reversible terminators are used to add a sequence to the end of each target being counted. For example, a 6 base sequence may be added and the chance of two being the same is 1 in 4.sup.6 or 1 in 4096. See, for example, WO 93/06121 and U.S. Pat. No. 6,140,493 which disclose stochastic methods for synthesizing random oligomers.

[0143] There is a finite set of labels, L.sub.1-x and each target to be detected is present in the sample at a certain integer occurrence (T1.sub.1-t.sup.1, T2.sub.1-t.sup.2, . . . TN.sub.1-t.sup.n). In a preferred aspect, the method is used to count the number of each of the different targets, (e.g. how many occurrences of T1, how many of T2, . . . how many of TN) in the sample. The targets are independently labeled with the label molecules. Labeling is stochastic, so that any given target occurrence can be labeled with any one of the labels. For example, T1-1/L689, T1-2/L3, T1-3/L4,567 and so on. For Target 2, any given occurrence can also be labeled with any of the label molecules. This might generate, for example, (T2-1, L5), (T2-2, L198), (T2-3, L34) and so on. There are multiple copies of each label so T2-1 might be labeled with L5 and T1-500 may also be labeled with L5.

[0144] The methods disclosed herein may be used to measure random cell-to-cell variations in gene expression within an isogenic population of cells. Such variation can lead to transitions between alternative states for individual cells. For example, cell-to-cell variation in the expression of comK in B. subtilis has been shown to select cells for transition to the competent state in which genes encoding for DNA uptake proteins are expressed. See, Maamar et al. Science 317:526-529 (2007) which is incorporated herein by reference.

[0145] In some aspects the labels are generated within the target to be counted. For example, the label may be a unique cleavage site in a target fragment as shown in FIG. 6. Each of the copies of the target to be counted 601 have a common sequence at one end identified in the figure as 603. This may be a common sequence that has been added to the targets through ligation or primer extension or it may be a naturally occurring sequence in the target. The targets are fragmented randomly, for example by shearing or sonnication resulting in cleavage at the points indicated by the arrows to generate cleavage products 604. Cleavage is at a different and unique site in each of the fragments and results in a unique sequence in the target immediately to the left of the point of cleavage in the illustration (indicated by circles in fragments 607). This unique sequence can function as a label for the disclosed methods. A second common sequence 605 may be attached to each of the targets immediately downstream of the cleavage point, through for example ligation of an adaptor sequence. The resulting targets 607 can be analyzed directly to determine how many unique sequences are present and using this number as an indication of the number of targets in the starting sample. This is illustrated for nucleic acids, but could similarly be applied to proteins or other contiguous strings of monomers or units that are assembled in a non repeating pattern.

[0146] FIG. 7 shows a strategy for selecting probes for target fragments. For a double stranded fragment there are 4 possible junctions that can be targeted with array probes 3001, 3003, 3005 and 3007. Each of these junction regions as shown has a counter region 3011 denoted by N's, a fixed sequence 3013 that is defined by the restriction enzyme used for fragmentation and a target specific region 3015. The region 3015 is shown as N's but in preferred aspects it is a known and predictable sequence of the target that is adjacent to the selected restriction site. In a preferred aspect, the array probes are complementary to at least a portion of 3011, a portion of 3015 and all of 3013. For each target sequence-counter combination there are 4 different probes that could be included on the array. For example, if the targets are 10 loci from each of 4 chromosomes and 4 probes per fragment are included for 1200 different labels (1000 specific plus 200 non-specific) the array would have 192,000 total probes (4.times.10.times.4.times.1200).

[0147] In some aspects methods for selecting a collection of labels optimized for use in the disclosed methods is contemplated. For example, a list of all possible 14 mers may be used as a starting pool (4.sup.14 is .about.268 million different sequences). Different label lengths can be used resulting in different numbers of starting sequences. Eliminate all labels that are not at least 50% GC content. Eliminate all labels that do not use each of the 4 possible nucleotides at least twice. Eliminate all labels that have more than two Gs or Cs in tandem, e.g. a probe with GGG or CCC would be eliminated, or with more than three As or Ts in tandem, e.g. AAAA or TTTT would be removed. Remove labels that contain a selected restriction site. Remove labels having a Tm that is outside of the range (38.5 to 39.5.degree. C.). In other embodiments the range may be about 38 to 40, 38-39, or 39-40. Remove probes that have self complementarity beyond a selected threshold. Perform a hierarchical clustering to maximize sequence differences between labels to minimize cross hybridization, same label to same probe. Minimize self-complementarity within the collection to reduce tendency of two labels binding to each other.

[0148] FIG. 8 shows a counter adaptor 3101 that includes a counter region 3103, a constant region for priming 3105 and a sticky end 3107 for ligation to an overhang created by restriction digestion, for example with BamHI. After ligation of the adaptors 3101 to the target fragment 3109 there are two adaptors ligated to the target fragment, one at either end. It is probable that the counters on the two ends will be different although there is a predictable probability of having the same counter ligated to both ends of the same fragment. After adaptor ligation the fragment 3111 can be amplified by PCR using a common primer to the 3103 region of the adaptor. The adaptor may first be filled in to make it double stranded. The PCR amplification may be used to preferentially amplify fragments of a selected size range, for example, 300 to 2 kb. Smaller fragments are not amplified as efficiently because of self complementarity between the ends of the individual strands (capable of forming a panhandle structure that inhibits amplification) and longer fragments (longer than about 3 kb) also don't amplify well.

[0149] After circularization, the uncircularized fragments can be digested using an exonuclease, for example. The circularized fragments can be amplified using target specific primers to generate amplification product 3113. In the figure the target specific primers are identified as TS primer F and TS primer R. Whereas the primers used to amplify 3111 are common to all adaptor ligated fragments and will amplify all fragments that are in the size range to be amplified using PCR, the TS primers are specific for selected targets to be analyzed. The amplification product 3113 has in the 5' to 3' direction, target specific sequence, overhang sequence, a first counter, first adaptor sequence, circularization junction 3115, second adaptor sequence, second counter, second overhang sequence and a second target specific sequence. The first and second counter are different (although they may be the same at a low probability) and the first and second target sequence are different. The product 3113 or preferably fragments thereof can be detected by a variety of methods, for example, an array of probes as exemplified by probe 3117 can be used. The array probe 3117 is complementary to a region of the target, the overhang region and the counter. When hybridized the target will have an overhanging single stranded region that corresponds to the adaptor sequence. A labeled probe 3119 that is complementary to one strand of the adaptor can be hybridized and the ligated to the array probe as shown, and as described below.

[0150] FIG. 9 shows a method for reading out the labeled targets on arrays. On the left, the target with G.sub.1 ligated to L.sub.1, "G.sub.1L.sub.1", is shown hybridizing to the complementary array probe over the entire length of the probe. On the right target G.sub.1 ligated to label L.sub.2 is shown partially hybridized to the G.sub.1L.sub.1 probe on the array. On the left the biotin labeled constant segment can hybridize to the G.sub.1L.sub.1 target and ligate to the 5' end of the G.sub.1L.sub.1 array probe. The constant segment can hybridize to the L.sub.2 segment but will not ligate to L.sub.1. This allows for labeling of properly hybridized target-label pairs with both hybridization and ligation discrimination. The lower panel shows an example where the target or G portion is not matching with the probe on the array. This will not ligate efficiently because it hybridizes less stably.

[0151] The left panel shows the results when target G.sub.1 ligated to label L.sub.1 to form G.sub.1L.sub.1 hybridizes to the complementary G.sub.1L.sub.1 probe on the array. The constant region (in white) can hybridize to its labeled complement so that the 3' end of the labeled complement is juxtaposed with the 5' end of the L.sub.1 region of the probe on the array and the ends can be ligated. In the center panel the target hybridizing to the G.sub.1L.sub.1 probe is non-cognate, the label region is L.sub.2 and not L.sub.1 so it does not hybridize to the L.sub.1 region of the probe. The labeled oligo can hybridize to the partially hybridized target but it is not juxtaposed with the 5' end of the L.sub.1 region of the probe so it should not ligate to the probe. In the right panel the target shown hybridized has the L.sub.1 region and is complementary to the array probe at that region, but the array probe has a G region that is not G.sub.1 so the G.sub.1L.sub.1 target does not hybridize. The labeled oligo can hybridize to the target but because the L1:L1 region is short the duplex is not stable and the labeled oligo does not ligate to the end of the array probe.

[0152] If you have N targets T (T.sub.1, T.sub.2, . . . TN) and each is present at a number of copies C (C.sub.1, C.sub.2, . . . CO where X varies from target to target (X.sub.T1, X.sub.T2, . . . X) and you ligate to a set of Y different labels (L.sub.1, L.sub.2, . . . L.sub.Y) then you generate, for example, T.sub.1C.sub.1L.sub.1, T.sub.1C.sub.2L.sub.2 . . . T.sub.NC.sub.XL.sub.XT1, where X<<<Y). So, for example, if T1 is gene A and T2 is gene B and gene A is present in the sample at 500 copies and gene B is present at 100 copies, each copy of gene A, 1 to 500, will be attached to a different label (so there will be .about.500 different labels attached to the gene A copies), and each copy of gene B, 1 to 100, will be attached to a different label.

[0153] A method for counting the number of occurrences of each of a plurality of same targets in a mixture of targets comprising multiple occurrences of each type of a plurality of different targets. In preferred aspects, the mixture of targets is a nucleic acid sample that contains different amounts of multiple target sequences. For example, there may be target sequences 1, 2, 3, 4 and 5 that are expression products from 5 different genes, occur in the sample as follows: 1000 copies of target 1,100 copies of target 2,500 copies of target 3, 10 copies of target 4 and 50 copies of target 5. The targets are preferably of known sequence and are treated so that they may be ligated to a label-tag sequence.

[0154] FIG. 1 shows one embodiment of the method. Labels or counters 101 are combined with assay targets 103 so that each target is combined with one label to form label-targets 105. The process of combining an individual target with individual label molecules is a stochastic process. The number of labels each target type combines with is directly proportional to the number of individual targets of that target type or the copy number of the target. The number of labels is counted by hybridization to arrays where individual label-targets are detected at different features.

[0155] The targets are mixed with a collection of label-tag sequences, each label-tag being a different sequence and the collection having a number that is preferably 10 times the number of copies of the most abundant target to be counted. In a preferred aspect, the label-tags are a collection of known sequences such as a collection of all possible 6mers (N.sub.6). Each of the label-tag sequences is present in multiple copies in the mixture, but all are present at approximately equal amounts. The label-tag sequences are ligated to the targets. Ligation is random so that any given label-tag has about the same probability of ligating to any one target occurrence. So if there are 1000 different targets each could be ligated to a different label-tag sequence and the probability that any two target occurrences will have the same label-tag ligated is low. Because the ligation is a random stochastic process there is a known probability that if there are C copies of a given target and N different label-tags that any two copies of a target T will have the same label. T1, T2, . . . TN. C1, C2, . . . CX, L1, L2, . . . LY where T are the different targets and there are N different targets, C are the different copies of a target and there are X copies of that target and L are the different label label-tags and there are Y label tags. X varies for each target and determining X is one of the objects of the present invention. The relationship between X and Y determines the probability that two C's will have the same L. In preferred aspects Y is greater than X for each target to be counted. This reduces the probability of undercounting due to double labeling. If C1 and C2 of T1 are both labeled with L3 both copies will be counted as a single occurrence, resulting in under counting. Undercounting can also be adjusted for by estimating the number of copies that are likely to be multiply labeled and adjusting the final count upwards to take those into account. For example, if there is a likelihood that 5 of 1000 copies will be labeled with the same label tag then the final number should be adjusted up by 0.5%.

[0156] In preferred aspects, the detection is by hybridization to an array of probes. The array has a collection of features for each target that includes a different feature for each label tag. For example, if there are X label tags there are X features for each target, T1L1, T1L2, . . . T1LX and the same for target 2, T2L1, T2L2, . . . T2LX, out to TNL1, TNL2, . . . TNLX. The number of features of the array is on the order of X times N. Each probe has a target complementary sequence and a label tag complementary sequence. Within a set of probes for a given target the target segment of the probe would remain constant and the label tag portion varies from feature to feature so that each label tag sequence is represented by at least one feature for each target.

[0157] In one aspect, the methods may be used to count the number of copies of each of a plurality of targets in a sample. The amount of target containing sample mixed with the label tags may be diluted so that the number of copies of each target to be counted is less than the number of label tags. For example, if the targets to be counted are present at about 1,000 copies per cell and there are 10,000 label tags you want to have the amount of sample in the mixture to be about the equivalent of one cell's worth of RNA. You can mix that with multiple copies of each label-tag, but you want to keep the absolute number of copies of target below the number of types of label tag sequences. Dilution of the sample and use of an appropriately small amount of starting material may be used. If a target sequence is present at low copy number per cell it is possible to use the nucleic acid from a larger number of cells. For example, to measure the DNA copy number of a chromosomal region relative to other chromosomal regions the expected copy number is low (e.g. 2 for normal) so if there are 10,000 different label tags, the number of genomes that can be added to the sample for attachment of label tags can be high, e.g. 500 to 1000.

[0158] In one aspect, the methods are used to identify regions of genomic amplification and chromosomal abnormalities. For example, the methods may be used to detect trisomy. Most of the chromosomal regions will be present in 2 copies per cell and the region of trisomy will be present in 3 copies per cell. You would expect to observe a 3:2 ratio in your count. For example, if you have 500 genomes you would have 1000 copies of most regions and 1500 copies of the trisomy regions. Small errors in the counting, resulting from undercounting, would have little or no effect on the counting.

[0159] In some aspects, controls of known copy number may be spiked in to a sample to determine accuracy.

[0160] Stochastic labeling of t.sub.1,N (collection of essential identical molecules of copy 1, 2 . . . N of target 1) by (effectively an infinite reservoir of diversity m when m is much greater than N). This allows for complete or near complete resolution of members of t.sub.1,N, by imparting separate identities to the members of the collection of t.sub.1,N (provided that M is sufficiently smaller than N in the labeling). This provides for a stochastic or random projection of t.sub.1,N onto L.sub.1,m. In some aspects is a library and the members of the library that are associated with t.sub.1,N can be counted to determine the number of copies of the target. In some aspects the methods can be described as indexing the members of the target. This provides a method to follow individual molecules that are members of a type of molecule that would not otherwise be distinguishable one from another.

[0161] Because stochastic labeling can impart identifiability to otherwise non-identifiable molecules it can impart identifiability to any two targets that may be very similar, but different. Examples of targets that may be highly similar but could be separately counted using the disclosed methods, include, for example, alternative splice forms of a gene, and sequences that have one or more variations, including a variation in a single base (e.g. SNP or indels (insertion or deletions of short regions, e.g. 1-5 bases). In some aspects the methods impart a clonal labeling, that allows a single copy to be separately detected and separately isolated from the solution.

[0162] Some nucleic acid sequencing reactions use methods that stochastically attach targets to a solid support followed by amplification of the attached target and analysis. The target attaches in an unknown location and the location can be determined by sequencing the amplified target at specific locations. In contrast, the disclosed methods provide for clonal amplification of known targets in a known location. The stochastic nature of the formation of the target-label-tag molecule provides a mechanism for isolating single occurrences of selected targets that can be subsequently amplified and analyzed. In some aspects the label can be used as a handle for isolating clonal populations of targets. The labeling step generates an indexed library that has a variety of applications. For example, the indexed library could be used for sequencing applications. The method adds distinguishability to any set of molecules, even molecules that are not distinguishable by other mechanisms because they may share common regions or even been identical. The indexed library can be stored and used multiple times to generate samples for analysis. Some applications include, for example, genotyping polymorphisms, studying RNA processing, and selecting clonal representatives to do sequencing.

[0163] In some aspects the methods are used to stochastically label a polyclonal antibody population. This may be used to identify different polyclonal populations.

[0164] The methods may be used to convert an analog readout of hybridization signal intensities on arrays into a measurable process that can be scored digitally on the arrays. The method leverages a random process where the tagging of assayed molecules is governed by stochastic behavior. In a random process, the more copies of a given target, the greater the probability of being tagged with multiple labels. A count of the number of incorporated labels for each target can approximate the abundance level of a given target of interest. The ability to count labels on microarrays would be a clear cost-advantage over the other existing techniques.

[0165] Serial analysis of gene expression (SAGE) is another method for analysis of gene expression patterns. SAGE relies on short sequence tags (10-14 bp) within transcripts as an indicator of the presence of a given transcript. The tags are separated from the rest of the RNA and collected. The tags can be linked together to form long serial molecules that can be cloned and sequenced. Quantitation of the number of times a particular tag is observed provides an estimate of the relative expression level of the corresponding transcript, relative to other tagged transcripts. See, for example, Velculescu et al. Science 270, 484-487 (1995) and Velculescu et al. Cell 88 (1997). Again this method provides a relative estimate of the abundance of a transcript and not an actual count of the number of times that transcript appears. Other methods based on counting and estimating relative abundance have also been described. See, for example, Wang et al. Nat. Rev. Genet. 10, 57-63 (2009). Additional methods for digital profiling are disclosed, for example, in U.S. Patent Pub. 20050250147 and U.S. Pat. No. 7,537,897.

[0166] A stochastic counting assay system as described herein can also be a sub-system within a much larger bio-analysis system. The bio-analysis system could include all the aspects of sample preparation prior to, for example, optical detection, the post processing of data collected in the optical detection phase and finally decision making based on these results. Sample preparation may include steps such as: extraction of the sample from the tested subject (human, animal, plant environment etc.); separation of different parts of the sample to achieve higher concentration and purity of the molecules under investigation; sample amplification (e.g. through PCR); attachment of fluorescence tags or markers to different parts of the sample; and transfer of the sample or a portion of the sample into a reaction vessel or site on a substrate. The post processing of the collected data may include: normalization; background and noise reduction; and statistical analysis such as averaging over repeated tests or correlation between different tests. The decision making may include: testing against a predefined set of rules and comparison to information stored in external data-bases.

[0167] The applications and uses of the stochastic labeling and counting methods and systems described herein can produce one or more result useful to diagnose a disease state of an individual, for example, a patient. In one embodiment, a method of diagnosing a disease comprises reviewing or analyzing data relating to the presence and/or the concentration level of a target in a sample. A conclusion based review or analysis of the data can be provided to a patient, a health care provider or a health care manager. In one embodiment the conclusion is based on the review or analysis of data regarding a disease diagnosis. It is envisioned that in another embodiment that providing a conclusion to a patient, a health care provider or a health care manager includes transmission of the data over a network.

[0168] Accordingly, business methods relating to the stochastic labeling and counting methods and methods related to use thereof as described herein are provided. One aspect of the invention is a business method comprising screening patient test samples for the amount of a biologically active analyte present in the sample to produce data regarding the analyte, collecting the analyte data, providing the analyte data to a patient, a health care provider or a health care manager for making a conclusion based on review or analysis of the data regarding a disease diagnosis or prognosis or to determine a treatment regimen. In one embodiment the conclusion is provided to a patient, a health care provider or a health care manager includes transmission of the data over a network.

[0169] Applications for the disclosed methods include diagnosing a cancerous condition or diagnosing viral, bacterial, and other pathological or nonpathological infections, as described in U.S. Pat. No. 5,800,992. Additional applications of the disclosed methods and systems include, pathogens detection and classification; chemical/biological warfare real-time detection; chemical concentration control; dangerous substance (e.g., gas, liquid) detection and alarm; sugar and insulin levels detection in diabetic patients; pregnancy testing; detection of viral and bacterial infectious diseases (e.g. AIDS, Bird Flu, SARS, West Nile virus); environmental pollution monitoring (e.g., water, air); and quality control in food processing.

[0170] Any available mechanism for detection of the labels may be used. While many of the embodiments discussed above use an array readout form, it will be obvious to one of skill in the art that other methods for readout may be used. For example, sequencing may be preferred in some embodiments.

[0171] In some aspects the readout is on an array. The array may be a solid support having immobilized nucleic acid probes attached to the surface in an ordered arrangement. The probes may be, for example, synthesized in situ on the support in known locations using photolithography or the probes may be spotted onto the support in an array format. As discussed above, in some embodiments the array includes a probe feature for each possible label-target combination. A feature preferably includes many copies of a single probe sequence. The feature may also have some probes that are not full length, resulting from truncation of synthesis. The photo activation process may not be 100% efficient so some probes are terminated at each step without having subsequent bases added. These truncated probes have the sequence of a portion of the full length probe.

[0172] Sequencing readout. After attachment of the labels to the targets in a stochastic manner, the targets may be amplified according to any of the methods disclosed herein and the amplification product may be subjected to any available sequencing method.

[0173] A number of alternative sequencing techniques have been developed and many are available commercially. For a review see, for example, Ansorge New Biotechnology 25(4):195-203 (2009), which is incorporated herein by reference. These include the use of microarrays of genetic material that can be manipulated so as to permit parallel detection of the ordering of nucleotides in a multitude of fragments of genetic material. The arrays typically include many sites formed or disposed on a substrate. Additional materials, typically single nucleotides or strands of nucleotides (oligonucleotides) are introduced and permitted or encouraged to bind to the template of genetic material to be sequenced, thereby selectively marking the template in a sequence dependent manner. Sequence information may then be gathered by imaging the sites. In certain current techniques, for example, each nucleotide type is tagged with a fluorescent tag or dye that permits analysis of the nucleotide attached at a particular site to be determined by analysis of image data.

[0174] In another aspect, mass spec analysis may be used to detect the labels and count the targets. The labels can be distinguishable based on size or other property that can be detected. Many of the examples provided herein identify the label based on unique nucleic acid sequence but any distinguishable label may be used, for example, the pool of labels may be labels that are differentially detectable based on fluorescence emission at a unique wavelength.

[0175] FIG. 9 shows a method for reading out the labeled targets on arrays. On the left, the target with G.sub.1 ligated to L.sub.1, "G.sub.1L.sub.1", is shown hybridizing to the complementary array probe over the entire length of the probe. On the right target G.sub.1 ligated to label L.sub.2 is shown partially hybridized to the G.sub.1L.sub.1 probe on the array. On the left the biotin labeled constant segment can hybridize to the G.sub.1L.sub.1 target and ligate to the 5' end of the G.sub.1L.sub.1 array probe. The constant segment can hybridize to the L.sub.2 segment but will not ligate to L.sub.1. This allows for labeling of properly hybridized target-label pairs with both hybridization and ligation discrimination. The lower panel shows an example where the target or G portion is not matching with the probe on the array. This will not ligate efficiently because it hybridizes less stably.

[0176] The left panel shows the results when target G.sub.1 ligated to label L.sub.1 to form G.sub.1L.sub.1 hybridizes to the complementary G.sub.1L.sub.1 probe on the array. The constant region (in white) can hybridize to its labeled complement so that the 3' end of the labeled complement is juxtaposed with the 5' end of the L.sub.1 region of the probe on the array and the ends can be ligated. In the center panel the target hybridizing to the G.sub.1L.sub.1 probe is non-cognate, the label region is L.sub.2 and not L.sub.1 so it does not hybridize to the L.sub.1 region of the probe. The labeled oligo can hybridize to the partially hybridized target but it is not juxtaposed with the 5' end of the L.sub.1 region of the probe so it should not ligate to the probe. In the right panel the target shown hybridized has the L.sub.1 region and is complementary to the array probe at that region, but the array probe has a G region that is not G.sub.1 so the G.sub.1L.sub.1 target does not hybridize. The labeled oligo can hybridize to the target but because the L1:L1 region is short the duplex is not stable and the labeled oligo does not ligate to the end of the array probe.

[0177] The methods are broadly applicable to counting a population of molecules by performing a stochastic operation on the population to generate a stochastic population of identifiable molecules. The targets need not be identical. For example, the methods may be used to count the absolute number of members of a group. In one aspect, a sample having an unknown number of copies of a selected nucleic acid target is fragmented randomly so that on average each copy of the target has a different end resulting from a distinct fragmentation event. A common adaptor sequence can be ligated to the end of each fragment and used for amplification of the fragments. Each ligation event generates a new molecule having a junction formed by the end of the random fragment and the adaptor sequence. The new junction can be detected by, for example, sequencing using a primer complementary to the adaptor or a region of the adaptor. Because the fragmentation was a stochastic process the number of different ends detected is a count of the number of different starting target molecules, assuming one fragment per starting target molecule.

[0178] The examples provided herein demonstrate the concept of using a stochastic labeling strategy in the high sensitivity detection and counting of individual DNA molecules. The difficult task of quantifying single nucleic acid molecules is converted into a simple qualitative assay that leverages the statistics of random probability; and at the same time, the requirement of single molecule detection sensitivity is achieved with PCR for the robust amplification of single DNA molecules. In some aspects improved methods for amplification will be used. For example, linear amplification methods may be used to mitigate the representation distortions created by exponential cycling in PCR. Given the lack of available techniques for single molecule counting, and the increasing need for its use, the new concept of stochastic labeling is likely to find numerous applications in the near future.

EXAMPLES

[0179] To demonstrate stochastic labeling, we performed an experiment to count small numbers of nucleic acid molecules in solution. Genomic DNA from a male individual with Trisomy 21 was used to determine the absolute and relative number of DNA copies of chromosomes X, 4 and 21, representing 1, 2 and 3 target copies of each chromosome, respectively. Genomic DNA isolated from cultured B-Lymphocytes of a male caucasion with Trisomy 21 was purchased from The Coriell Institute for Medical Research (Catalog # GM01921). The DNA quantity was determined by PICOGREEN dye (Invitrogen) measurements using the lambda phage DNA provided in the kit as reference standard. DNA quality was assessed by agarose gel electrophoresis.

[0180] The DNA concentration in the stock solution was measured by quantitative staining with picogreen fluorescent dye, and dilutions containing 3.62 ng, 1.45 ng, 0.36 ng and 0.036 ng were prepared. In each dilution, the number of copies of target molecules in the sample was calculated from a total DNA mass of 3.5 pg per haploid nucleus (see, T. R. Gregory et al., Nucleic Acids Res 35, D332 (2007), and represent approximately 500, 200, 50 and 5 haploid genomes. The absolute quantity of DNA in the sample was determined by optical density measurements and quantitative staining with PICOGREEN fluorescent dye (Invitrogen) prior to making dilutions.

[0181] As outlined in FIG. 3, the genomic DNA sample 1901 was first digested to completion with the BamHI restriction endonuclease to produce 360,679 DNA fragments 1905. A diverse set of labels consisting of 960 14-nucleotide sequences was synthesized as adaptors harboring BamHI overhangs (SEQ ID Nos. 44-1963). Genomic DNA was digested to completion with BamHI (New England BioLabs, NEB) and ligated to a pool of adaptors consisting of an equal concentration of 960 distinct labels. Each adaptor consists of a universal PCR priming site, a 14 nucleotide long counter sequence and a BamHI overhang (similar to the form of the adaptor shown in FIG. 7). The sequence of the label adaptors SEQ ID Nos. 44-1963 were selected from an all-possible 4.sup.14 nucleotide combination to be of similar melting temperature, minimal self-complementation, and maximal differences between one-another. Homopolymer runs and the sequence of the BamHI restriction site were avoided. Each pair, for example, SEQ ID Nos. 44 and 45, form an adaptor pair that has a region of complementarity starting at base 12 in SEQ ID No. 44 and base 5 in SEQ ID No. 45:

TABLE-US-00001 SEQ ID 44 5' CGACAGACGCCTGATCTTTTGTTAGCCGGAGT 3' SEQ ID 45 3' ACTAGAAAACAATCGGCCTCACTAG5'

The adaptors have a 5' overhang of 11 bases in the even numbered SEQ IDs and 4 bases (GATC) in the odd numbered SEQ IDs. Oligonucleotides were synthesized (Integrated DNA Technologies) and annealed to form double-stranded adaptors prior to pooling. For ligation, the digested DNA was diluted to the desired quantity and added to 100 pmoles (equivalent to 6.times.10.sup.13 molecules) of pooled label-adaptors, and 2.times.10.sup.6 units (equivalent to 1.times.10.sup.13 molecules) of T4 DNA ligase (NEB) in a 30 .mu.l reaction. The reaction was incubated at 20.degree. C. for 3 hours until inactivation at 65.degree. C. for 20 minutes.

[0182] For the stochastic labeling reaction, each DNA fragment-end randomly attaches to a single label by means of enzymatic ligation of compatible cohesive DNA ends to generate labeled fragments 1907. High coupling efficiency is achieved through incubation with a large molar excess of labels and DNA ligase enzyme (.about.10.sup.13 molecules each). At this stage, the labeling process is complete, and the samples can be amplified as desired for detection. A universal primer may be added added, and the entire population of labeled DNA fragments may be PCR amplified. The PCR reaction preferentially amplifies approximately 80,000 fragments in the 150 bp-2 kb size range (FIG. 21). Adaptor-ligated fragments were amplified in a 50 .mu.l reaction containing 1.times. TITANIUM Taq PCR buffer (Clontech), 1M betaine (Sigma-Aldrich), 0.3 mM dNTPs, 4 .mu.M PCROO4StuA primer (SEQ ID No. 1974), 2.5U Taq DNA Polymerase (USB), and 1.times. TITANIUM Taq DNA polymerase (Clontech). An initial PCR extension was performed with 5 minutes at 72.degree. C.; 3 minutes at 94.degree. C.; followed by 5 cycles of 94.degree. C. for 30 seconds, 45.degree. C. for 45 seconds and 68.degree. C. for 15 seconds. This was followed by 25 cycles of 94.degree. C. for 30 seconds, 60.degree. C. for 45 seconds and 68.degree. C. for 15 seconds and a final extension step of 7 minutes at 68.degree. C. PCR products were assessed with agarose gel electrophoresis and purified using the QIAQUICK PCR purification kit (Qiagen).

[0183] The purified PCR product was denatured at 95.degree. C. for 3 minutes prior to phosphorylation with T4 polynucleotide kinase (NEB). The phosphorylated DNA was ethanol precipitated and circularized using the CIRCLIGASE II ssDNA Ligase Kit (Epicentre). Circularization was performed at 60.degree. C. for 2 hours followed by 80.degree. C. inactivation for 10 minutes in a 4 .mu.l reaction consisting of 1.times. CIRCLIGASE II reaction buffer, 2.5 mM MnCl.sub.2, 1M betaine, and 200U CIRCLIGASE II ssDNA ligase. Uncirculated DNAs were removed by treatment with 20U Exonuclease I (Epicentre) at 37.degree. C. for 30 minutes. Remaining DNA was purified with ethanol precipitation and quantified with OD.sub.260 measurement.

[0184] Amplification of gene targets. Three assay regions were tested: One on each of chromosomes 4, 21 and X. The genomic location (fragment starting and ending positions are provided), of the selected fragments are as follows: Chr4 106415806.sub.--106416680 (SEQ ID No. 1), Chr2138298439.sub.--38299372 (SEQ ID No. 2), and ChrX 133694723.sub.--133695365 (SEQ ID No. 3). The lengths are 875, 934 and 643 bases respectively. The circularized DNA was amplified with gene specific primers (SEQ ID Nos. 4-9) in a multiplex inverse PCR reaction. PCR primers were picked using Primer3 (available from the FRODO web site hosted by MIT) to yield amplicons ranging between 121 and 168 bp. PCR was carried out with 1.times. TITANIUM Taq PCR buffer (Clontech), 0.3 mM dNTPs, 0.4 .mu.M each primer, 1.times. TITANIUM Taq DNA Polymerase (Clontech), and .about.200 ng of the circularized DNA. After denaturation at 94.degree. C. for 2 minutes, reactions were cycled 30 times as follows: 94.degree. C. for 20 seconds, 60.degree. C. for 20 seconds, and 68.degree. C. for 20 seconds, with a 68.degree. C. final hold for 4 minutes. PCR products were assessed on a 4-20% gradient polyacrylamide gel (Invitrogen) and precipitated with ethanol.

[0185] The amplified DNA was fragmented with DNase I, end-labeled with Biotin, and hybridized to a whole-genome tiling array which spans the entire non-repetitive portion of the genome with uniform coverage at an average probe spacing of .about.200 nt (see Matsuzaki et al., Genome Biol 10, R125 (2009) and Wagner et al. Systematic Biology 43, 250(1994)). Probe intensity ("Array Intensity") from the whole-genome tiling array (y-axis) is grouped into 200 nt bins by the length of the BamHI fragment on which it resides. High probe intensity demonstrates the amplification of fragments in the 600 bp-1.2 kb size range (x-axis, log-scale). The computed size distribution of BamHI restricted fragments in the reference genome sequence (NCBI Build 36) is shown by the curve labeled "Number of Fragments". After circularization of the amplified products to obtain circles 1909, three test target fragments were isolated using gene-specific PCR; one on each of chromosomes X, 4, and 21, and prepared for detection.

[0186] The three labeled targets were counted using two sampling techniques: DNA microarrays and next-generation sequencing. For the array counting, a custom DNA array detector capable of distinguishing the set of labels bound to the targets was constructed by dedicating one array element for each of the 960 target-label combinations. Each array element consists of a complementary target sequence adjacent to one of the complements of the 960 label sequences (as shown in FIG. 3).

[0187] Array Design: For each gene target assayed, the array probes tiled consist of all possible combinations of the 960 counter sequences connected to the two BamHI genomic fragment ends (FIG. 8). An additional 192 counter sequences that were not included in the adaptor pool were also tiled to serve as non-specific controls. This tiling strategy enables counter detection separately at each paired end, since each target fragment is ligated to two independent counters (one on either end).

[0188] Arrays were synthesized following standard Affymetrix GENECHIP manufacturing methods utilizing lithography and phosphoramidite nucleoside monomers bearing photolabile 5'-protecting groups. Array probes were synthesized with 5' phosphate ends to allow for ligation. Fused-silica wafer substrates were prepared by standard methods with trialkoxy aminosilane as previously described in Fodor et al., Science 251:767 (1991). After the final lithographic exposure step, the wafer was de-protected in an ethanolic amine solution for a total of 8 hrs prior to dicing and packaging.

[0189] Hybridization to Arrays: PCR products were digested with Stu I (NEB), and treated with Lambda exonuclease (USB). 5 .mu.g of the digested DNA was hybridized to a GeneChip array in 112.5 .mu.l of hybridization solution containing 80 .mu.g denatured Herring sperm DNA (Promega), 25% formamide, 2.5 pM biotin-labeled gridding oligo, and 70 .mu.l hybridization buffer (4.8M TMACl, 15 mM Tris pH 8, and 0.015% Triton X-100). Hybridizations were carried out in ovens for 16 hours at 50.degree. C. with rotation at 30 rpm. Following hybridization, arrays were washed in 0.2.times.SSPE containing 0.005% Trition X-100 for 30 minutes at 37.degree. C., and with TE (10 mM Tris, 1 mM EDTA, pH 8) for 15 minutes at 37.degree. C. A short biotin-labeled oligonucleotide (see 3119 in FIG. 8) was annealed to the hybridized DNAs, and ligated to the array probes with E. coli DNA ligase (USB). Excess unligated oligonucleotides were removed with TE wash for 10 minutes at 50.degree. C. The arrays were stained with Streptavidin, R-phycoerythrin conjugate (Invitrogen) and scanned on the GCS3000 instrument (Affymetrix).

[0190] In order to maximize the specificity of target-label hybridization and scoring, we employed a ligation labeling procedure on the captured sequences (FIG. 8). We set thresholds to best separate the intensity data from the array into two clusters, one of low intensity and one of high intensity to classify labels as either being used or not (FIGS. 22, 23 and 29). We score a label as "present" and counted if its signal intensity exceeded the threshold. To count labels we set thresholds for the array intensity, or the number of sequencing reads. Appropriate thresholds were straightforward to determine when used and un-used labels fall into two distinct clusters separated by a significant gap. In situations where a gap was not obvious, the function normalmixEM in the R package mixtools was used to classify labels. This function uses the Expectation Maximization (EM) algorithm to fit the data by mixtures of two normal distributions iteratively. The two normal distributions correspond to the two clusters to be identified. The cluster of labels with a high value is counted as "used", and the other as "not used". The average of the minimum and maximum of the two clusters, (I.sub.min+I.sub.max)/2, was applied as the threshold for separating the two clusters.

[0191] Sampling error calculation. A sampling error can be introduced when preparing dilutions of the stock DNA solution. This error is a direct consequence of random fluctuations in the number of molecules in the volume of solution sampled. For example, when exactly 10 .mu.l of a 100 .mu.l solution containing 100 molecules is measured, the actual number of molecules in the sampled aliquot may not be exactly 10. The lower the concentration of the molecules in the entire solution, the higher the sampling error, and the more likely the actual abundance in the sampled aliquot will deviate from the expected abundance (n=10). To calculate sampling errors, we determined the number of molecules for each chromosome target in our stock DNA solution and performed numerical simulations to follow our dilution steps in preparing the test samples (3.62 ng, 1.45 ng, 0.36 ng and 0.036 ng). To illustrate, if the dilution step is sampling 1 .mu.l of a 25 .mu.l solution containing 250 molecules, we create 25 bins and randomly assign each of the 250 molecules into one of the bins. We randomly choose one bin and count the number of molecules assigned to that bin to simulate the process of sampling 1/25.sup.th of the entire solution. If a serial dilution was performed, we would repeat the simulation process accordingly. For each dilution, the observed copy number ratios of Chr 4:X or 21:X for 10,000 independent trials are summarized as observed medians, along with the 10.sup.th and 90.sup.th percentiles and shown in FIGS. 12 and 13.

[0192] As an alternate form of detection, the samples were submitted to two independent DNA sequencing runs (FIG. 10). The arrangement and position of the adaptors and PCR primers used to convert the DNA sample hybridized to microarrays into sequencing templates are shown in the figure. The circularized junction 3115 is located between the two counter labels. PCR primers that have restriction sites are used to amplify two fragments. The fragments are digested with the restriction enzymes to generate ends compatible with ligation to sequencing adaptors. The sequencing adaptors are ligated to the ends to generate a fragment that has the label sequence and a portion of the target that is 48 to 94 base pairs in length are flanked by sequences for use with SOLID sequencing. Validation by DNA sequencing (First SOLID run). DNA targets that were used for hybridization to arrays were converted to libraries for sequencing on the SOLID instrument (ABI). P1 and P2 SOLID amplification primers were added to the DNA ends through adaptor ligation and strand extension from gene-specific primers flanked by P1 or P2 sequences (FIG. 10). Each sample received a unique ligation adaptor harboring a 4-base encoder (SEQ ID Nos. 34-43) that unambiguously identifies the originating sample of any resulting read. Each adaptor includes two strands, SEQ ID Nos. 34 and 35, 36 and 37, 38 and 39, 40 and 41 or 42 and 43, that hybridize to form a double stranded region of 29 base pairs and a single stranded 4 base overhang (GATC). Individual libraries were prepared for each sample, and quantified with picogreen before equal amounts of each sample was combined into a single pooled library. DNA sequencing was performed on SOLID v3 by Cofactor Genomics. A total of .about.46 million 50 base reads were generated. Each read is composed of three segments, corresponding to the sample encoder, label sequence and gene fragment (FIG. 10). We removed reads if: uncalled color bases were present, the average Quality Value (aQV) of the whole read <10, the aQV of the sample encoder <20, or the aQV of the label sequence <18. 40% of the raw reads were removed. Filtered reads were mapped to reference sequences using the program Short Oligonucleotide Color Space (SOCS), available from ABI with a maximum tolerance of 4 color mismatches between the first 45 color bases in each read and reference sequences (the last 5 color bases on 3' end of each read were trimmed in alignment). About 64.3% reads were uniquely mapped to reference sequences, of which 89.5% (16 million) have high mapping quality, i.e., with no mismatch in the sample encoder and at most 1 mismatch in the label sequence. These high-quality reads, accounting for .about.35% of the total reads generated, were used in subsequent counting analysis.

[0193] Sequencing replication (Second SOLID run). An aliquot of the exact same DNA library originally sequenced by Cofactor Genomics was subsequently re-sequenced by Beckman Coulter Genomics. Approximately 50 million 35 base reads were generated, and processed following the same rules. Approximately 61% of the raw reads passed quality filters, of which 81% uniquely mapped to a reference sequence with a maximum tolerance of 3 color mismatches (An adjusted mismatch tolerance was applied in the alignment step to account for the shorter length of these reads). Of the mapped reads, 91% (22.5 million) are of high mapping quality, i.e., with perfect match in the sample encoder and at most 1 mismatch in the label sequence. These high-quality reads (45% of the total raw reads generated) were used for counting analysis.

[0194] Between several hundred thousand to several million reads were used to score the captured labels. Table 1 shows the number of mapped reads from SOLID DNA sequencing.

TABLE-US-00002 TABLE 1 5 2 0.5 0.05 O DNA sample ng ng ng ng ng Chr4 Left 1.sup.st SOLiD run 709,076 252,211 237,380 316,629 1,204 side 2.sup.nd SOLiD run 621,372 73,962 189,937 237,520 411 Right 1.sup.st SOLiD run 1,724,955 1,662,958 1,114,246 2,201,078 3,353 side 2.sup.nd SOLiD run 1,422,673 1,359,512 839,775 980,616 2,386 Chr21 Left 1.sup.st SOLiD run 1,615,416 1,474,208 832,234 1,428,540 1,851 side 2.sup.nd SOLiD run 1,296,685 1,038,456 622,429 930,461 840 Right 1.sup.st SOLiD run 1,124,772 886,421 551,192 849,204 821 side 2.sup.nd SOLiD run 910,298 522,358 367,207 479,621 224 ChrX Left 1.sup.st SOLiD run 444,960 316,975 254,386 515,213 744 side 2.sup.nd SOLiD run 266,606 157,860 137,706 220,121 5 Right 1.sup.st SOLiD run 1,227,047 921,214 777,033 1,064,531 64 side 2.sup.nd SOLiD run 1,043,475 768,296 559,038 695,873 43

[0195] We set thresholds for the number of sequencing reads observed for each label, and score a label as "present" and counted if the number of sequencing reads exceeded the threshold. Label usage summaries from experimental observations or from the stochastic modeling are shown in Table 2. The number of attached labels, k, detected for each target in each dilution either by microarray counting or sequence counting is presented in Table 2, and plotted in FIGS. 4 and 5.

[0196] Several dilutions (3.62 ng, 1.45 ng, 0.36 ng and 0.036 ng) of DNA isolated from cultured of a Trisomy 21 male individual were processed for microarray hybridization (FIG. 12 left) and DNA sequencing (FIG. 12 right). Three gene targets were tested from chromosome X, 4 and 21, and observed numbers of detected labels are shown ("observed"). The number of target molecules for each sample was determined from the amount of DNA used, assuming a single haploid nucleus corresponds to 3.5 pg. For comparison, the calculated number of labels expected to appear using a stochastic model are also plotted ("calculated"). Numerical values are provided in Table 4. Relative copy ratios of the three gene targets (FIG. 13): ChrX (right bar), Chr4 (left bar) and Chr21 (center bar) representing one, two and three copies per cell, respectively. Different dilutions (3.62 ng, 1.45 ng, 0.36 ng and 0.036 ng) of the DNA isolated from cultured lymphoblasts of a Trisomy 21 male individual were processed for microarray hybridization and DNA sequencing. The calculated number of target molecules was determined from the number of labels detected on microarrays (Table 4, column 9) or from the SOLiD sequencing data. For each sample dilution, the copy number ratio of each gene target relative to ChrX is shown for Microarray (FIG. 13 left) and SOLiD sequencing (FIG. 13 right). For comparison, relative copy ratios obtained from in silico sampling simulations are also shown in (FIG. 13 left) and (FIG. 13 right), where circles indicate the median values from 10,000 independent trials and error bars indicate the 10.sup.th and 90.sup.th percentiles. The 90.sup.th percentile values of the relative copy ratios at the lowest concentration (0.036 ng) are explicitly labeled in the plots.

TABLE-US-00003 TABLE 2 3.62 1.45 0.36 0.036 O DNA sample ng ng ng ng ng Chr4 Stochastic Model 633 336 98 10 0 Left Microarray 501 260 102 14 0 side 1.sup.st SOLiD run 513 251 101 14 0 2.sup.nd SOLiD run 516 273 102 14 0 Right Array 525 256 107 14 0 side 1.sup.st SOLiD run 544 291 103 13 1 2.sup.nd SOLiD run 557 307 103 13 1 Chr21 Stochastic Model 769 457 143 15 0 Left Microarray 651 335 160 20 0 side 1.sup.st SOLiD run 678 381 152 20 0 2.sup.nd SOLiD run 665 358 161 18 0 Right Microarray 627 341 157 20 0 side 1.sup.st SOLiD run 650 381 146 19 0 2.sup.nd SOLiD run 653 379 146 19 0 ChrX Stochastic Model 400 186 50 5 0 Left Microarray 281 148 50 11 0 side 1.sup.st SOLiD run 290 149 43 11 0 2.sup.nd SOLiD run 300 150 45 11 0 Right Microarray 306 133 48 10 1 side 1.sup.st SOLiD run 336 153 50 12 0 2.sup.nd SOLiD run 344 167 43 11 0

[0197] The counting results span a range of approximately 1,500 to 5 molecules, and it is useful to consider the results in two counting regimes, below and above 200 molecules. There is a striking agreement between the experimentally observed number of molecules and that expected from dilution in the first regime where the ratio of molecules to labels (n/m)<0.2 (Table 2). Below 200 molecules the data are in tight agreement, including the data from the lowest number of molecules, 5, 10 and 15 where the counting results are all within the expected sampling error for the experiment (The sampling error for 10 molecules is estimated to be 10.+-.6.4, where 10 and 6.4 are the mean and two standard deviations from 10,000 independent simulation trials).

[0198] In the second regime above 200 molecules, there is an approximate 10-25% undercounting of molecules, increasing as the number of molecules increases. We attribute this deviation to be due to a distortion in the amplification reaction. PCR-introduced distortion occurs from small amounts of any complex template due to the differences in amplification efficiency between individual templates (2, 3). In the present case, stochastic labeling will produce only one (at low n/m ratios), and increasingly several copies (at higher n/m ratios) of each template. Modeling suggests that simple random dropout of sequences (PCR efficiencies under 100%) generate significant distortion in the final numbers of each molecule after amplification. At any labeling ratio, random dropout of sequences due to PCR efficiency will result in an undercount of the original number of molecules. At high n/m ratios, the number of labels residing on multiple targets will increase and have a statistical survival advantage through the PCR reaction causing greater distortion. In support of this argument, we observe a wide range of intensities on the microarray and a wide range in the number of occurrences of specific sequences in the sequencing experiments (FIGS. 23, 29). This effect can be reduced by carrying out the reaction at n/m ratios near or less than 0.2, increasing the number of labels m, further optimization of the amplification reaction, or by employing a linear amplification method. Other factors, such as errors from inaccurate pipetting, could also contribute.

[0199] The lymphoblast cell line used in this study provides an internal control for the relative measurement of copy number for genes residing on chromosomes X, 4 and 21. FIG. 13 presents the relative number of molecules from all three chromosomes normalized to copy number 1 for the X chromosome. As shown, the measurements above 50 molecules all yield highly precise relative copy number values. At low numbers of molecules (0.036 ng), uncertainty results because the stochastic variation of molecules captured by sampling an aliquot for dilution are significant. Numerical simulations were performed to estimate the sampling variation, and summarized medians, along with the 10.sup.th and 90.sup.th percentiles of the copy number ratios and are shown in FIGS. 12 and 13 as circles and range bars, respectively. At the most extreme dilutions, where .about.5, 10, and 15 molecules are expected for the chromosome X, 4 and 21 genes, the copy number ratios fall within the expected sampling error.

[0200] Overall, the identity of labels detected on the microarrays and in sequencing are in good agreement, with only a small subset of labels unique to each process (Table 7). Despite a high sequencing sampling depth (Table 1), a small number of labels with high microarray intensity appear to be missing or under-represented in the sequencing results. In contrast, labels that appear in high numbers in the sequencing reaction always correlate with high microarray intensities. No trivial explanation could be found for the labels that are missing from any given sequencing experiment. While under-represented in some experiments, the same labels appear as present with high sequence counts in other experiments, suggesting that the sequences are compatible with the sequencing reactions.

[0201] PCR validation. We used PCR as an independent method to investigate isolated cases of disagreement, and demonstrated that the labels were present in the samples used for the sequencing runs.

[0202] PCR was used to detect the presence of 16 label sequences (Table 3) which were either observed as high or low hybridization intensity on microarrays, and observed with either high or low numbers of mapped reads in SOLID sequencing. The Chr4 gene target was PCR amplified with 3 dilutions (0.1 pg, 1 pg, and 10 pg) of the 3.62 ng NA01921 sample, using the DNA target that was hybridized to microarrays, or the prepared SOLID library template. PCR products were resolved on 4% agarose gels and fluorescent DNA bands were detected after ethidium bromide staining

TABLE-US-00004 TABLE 3 (SEQ ID NOS 1980-1995) 1st 2nd Microarray SOLiD SOLiD SOLiD Microarray target library Label Label Sequence reads reads intensity template template 112 AGATCTTGTGTCCG 0 2 15,907 1 2 182 ATCTTCGACACTGG 0 1 10,304 3 4 779 TCGAGATGGTGTTC 0 4 9,411 5 6 782 TCGGATAGAGAGCA 0 0 6,716 7 8 783 TCGGTACCAACAAC 1 4 13,132 9 10 290 CCAAGGTTTGGTGA 1 17 10,777 11 12 780 TCGCAAGAGGTAAG 1 1 8,915 13 14 570 GGAGTTACGGCTTT 1 2 8,252 15 16 741 TCAACCAGTAAGCC 794 400 466 17* 18* 424 CTGTAAACAACGCC 1,191 1,292 527 19* 20* 242 CACGATAGTTTGCC 905 781 1,103 21* 22 859 TGTACTAACACGCC 920 892 1,107 23* 24* 83 ACGCTAACTCCTTG 8,629 7,704 19,500 25 26 383 CGTTTACGATGTGG 7,278 6,402 19,022 27 28 804 TCTTAGGAAACGCC 0 0 70 29* 30* 834 TGCAATAGACGACC 0 1 72 31* 32*

[0203] Table 3. PCR detection for the presence of label sequences in the processed DNA sample that was hybridized to microarray, or in the DNA sequencing library. Each PCR contained 0.1 pg of template, which represents approximately 1.times.10.sup.6 DNA molecules. The number of mapped sequencing reads and the microarray intensity of each of the 16 labels for this selected gene target (Chr4, 3.62 ng) are listed. The last 2 columns show the gel lane number containing the indicated sample. Those numbers indicated by an * correspond to reactions where PCR failed to detect the label sequence in the sample.

[0204] Although we can clearly confirm their presence in the sequencing libraries, it is unclear as to why these labels are missing or under-represented in the final sequencing data.

[0205] To test the stochastic behavior of label selection, we pooled the results of multiple reactions at low target concentrations (0.36 and 0.036 ng), where the probability that a label will be chosen more than once is small.

[0206] FIG. 14 shows that the number of times each label is used closely follows modeling for 1,064 data points obtained from microarray counting. The graph is a comparison between experimentally observed label usage rates (microarray results) with those predicted from stochastic model (stochastic model). At low target molecule numbers, the chance of multiple target ligations to the same label sequence is low. It is therefore reasonable to consider data from experiments with low target numbers (0.036 ng and 0.36 ng of DNA), from those experiments, a total of 1,064 labels were observed, with the total frequency of label usage ranging from 0 to 6. The theoretically expected label usage frequency for 1,064 target molecules was obtained by performing 5000 simulation runs, with multiple independent reactions simulated in each run. The error bars indicate one standard deviation from the corresponding means.

[0207] Furthermore, since each end of a target sequence chooses a label independently, we can compare the likely hood of the same label occurring on both ends of a target at high copy numbers. Table 4 columns 10-11 present the experimentally observed frequency of labels occurring in common across both ends of a target and their expected frequency from numerical simulations. No evidence of non-stochastic behavior was observed in this data.

TABLE-US-00005 TABLE 4 Expected # # of Expected # Estimated Expected of labels in molecules of labels in Microarray Genomic # of # of common inferred from common observed # DNA molecules labels across Microarray observed microarray across of labels in Gene amount at either at either paired- # of labels observed # paired- common across target (ng) end end ends L R Avg of labels ends paired-ends Chr4 3.62 1034 633 417.68 .+-. 11.35 501 525 513 733 273.96 .+-. 10.24 303 1.45 414 336 117.92 .+-. 7.83 260 256 258 300 69.22 .+-. 6.43 63 0.36 103 98 9.93 .+-. 2.81 102 107 104 110 11.26 .+-. 2.99 20 0.036 10 10 0.11 .+-. 0.32 14 14 14 14 0.20 .+-. 0.44 0 0 0 0 0 0 0 0 0 0 0 Chr21 3.62 1551 769 616.74 .+-. 11.94 651 627 639 1051 425.28 .+-. 11.37 453 1.45 620 457 217.36 .+-. 9.51 335 341 338 416 118.79 .+-. 7.83 130 0.36 155 143 21.37 .+-. 3.98 160 157 158 172 25.86 .+-. 4.38 32 0.036 15 15 0.24 .+-. 0.48 20 20 20 20 0.40 .+-. 0.62 0 0 0 0 0 0 0 0 0 0 0 ChrX 3.62 517 400 166.63 .+-. 8.81 281 306 294 351 90.14 .+-. 7.08 103 1.45 207 186 36.26 .+-. 4.98 148 133 140 151 20.34 .+-. 3.94 23 0.36 51 50 2.58 .+-. 1.52 50 48 49 50 2.45 .+-. 1.51 4 0.036 5 5 .sup. 0.03 .+-.0.16 11 10 10 10 0.10 .+-. 0.31 2 0 0 0 0 0 1 0 0 0 0 1 2 3 4 5 6 7 8 9 10 11

Labels detected on microarray experiments are quantified in Table 4. Indicated quantities (col. 2) of genomic DNA derived from a Trisomy 21 male sample were tested on 3 chromosome targets (col. 1). The estimated number of copies of target molecules (or haploid genome equivalents, col. 3), the number of labels expected by the stochastic model (col. 4), and the actual number of labels detected on microarrays (col. 6-8) are summarized. Because each gene target fragment paired-end consists of random, independent label ligation events at the left (L) and the right (R) termini, the number of identical labels expected (col. 5) can be predicted from computer simulations, and compared to the number actually detected (col. 11). Given the number of labels detected (col. 8), we obtain the corresponding number of copies of target molecules (col. 9) in our stochastic model, and the predicted occurrences of identical labels across paired-ends (col. 10). The numbers in col. 5 and 10 are the means from 5,000 independent simulation runs along with one standard deviation of the corresponding means, given the number of labels at either end (col. 4 and col. 9).

[0208] The detailed column information for Table 4 is as follows: column 1: name of tested gene targets; column 2: estimated number of target molecules at either left or right end, this number is determined by PICOGREEN dye measurement (Molecular Probes, Inc.), the DNA concentration is also listed in this column; column 3: number of labels expected to be observed/used at either end (predicted by theoretical models), given the estimated number of target molecules in 2nd column; column 4: number of labels expected to be observed in common across the paired-ends (predicted by theoretical models), given the estimated number of target molecules in 2nd column; column 5: empirically observed number of labels used at the left end of gene target; column 6: empirically observed number of labels used at the right end of gene target; column 7: empirically observed number of labels used in common across the paired-ends; column 8: number of target molecules predicted by theoretical models, based on the empirically observed number of labels used (i.e., number in 7th column); column 9: number of labels expected to be observed in common across the paired-ends, given the number of target molecules in 8th column; column 10: empirically observed number of labels that were used in common across the paired-ends of the gene target.

Example X

[0209] An array was designed having 48 target sequences. Each target was paired with one of 3840 labels or "counters" for a total of 48.times.3840 or 184,320 probes. The probes were 30 mers (30 nucleotides in length) and the assay was designed to test whether or not the 30 mer imparts sufficient discrimination. Of the 30 bases, 15 bases are from the labels and the other 15 bases are derived from the targets. The probes were assayed to determine if each label-target combination hybridizes specifically. A phage RNA ligase was used to join labels with targets. Universal priming sites of 18 bases were included on the 5' end of the labels and the 3' end of the targets, facilitating PCR amplification of the joined label-targets. The method is diagramed in FIG. 3.

[0210] The 3840 distinct label oligos (counters) were single stranded oligos pooled from the Ddel TACL primer panel (40 primer plates by 96 wells per plate for 3840 different oligos). An example label oligo 301 is shown (SEQ ID NO: 1964) 5'TCGATGGTTTGGCGCGCCGGTAGTTTGAACCATCCAT-3'. The 48 different primers used as "targets" were synthesized using as target 48 different 21 nucleotide sequences from the Affymetrix TrueTag 5K_A array. An example target oligo 307 is shown (SEQ ID NO: 1965) 5'GCCATTTACAAACTAGGTATTAATCGATCCTGCATGCC-3'.

[0211] The "label" or "counter" oligo has an 18 nt common sequence at the 5' end and a 15-28 nt "label" (or "counter") sequence at the 3' end. An example "label" 305 is shown. The universal primer 303 common to all or a group of the label oligos has sequence 5' TCGATGGTTTGGCGCGCC-3' (SEQ ID NO: 1966) at the 5' end and each target oligonucleotide has common sequence 311 5' AATCGATCCTGCATGCCA-3' (SEQ ID NO: 1967) at the 3' end as universal priming sequence. The target oligos vary in sequence at the 5' ends 309.

[0212] A 1:1 dilution of each of the 3840 counters was mixed with various dilutions of each of the 48 target oligos to simulate different expression levels under ligation conditions so that the 5' end of the target oligos can be ligated to the 3' end of the label oligos. In preferred aspects T4 RNA ligase may be used to join the ends of the single stranded oligos. The 5' and 3' ends of the target oligos are phosphorylated and the 5' and 3' ends of the label oligos are hydroxylated. After the ligation the products are amplified by PCR using primers to the universal priming sequences. Only those fragments that have both universal priming sequences 303 and 311 will amplify efficiently.

[0213] Each of the 48 target sequences may be tiled with each of the 3,840 counters, resulting in a total number of features on array=48.times.3,840=184,320. This is the number of different possible combinations of target with label. The product of the ligation and amplification reactions is hybridized to the array. For each target, the number of features that light up is determined and can be compared to the known copy number of each target in the input sample.

[0214] To test the digital counting methods, also referred to as stochastic labeling a collection of label-tag sequences was provided. Each has a common 5' universal priming sequence, preferably 15-20 bases in length to facilitate amplification, and a 3' label sequence, preferably 17-21 bases in length. Each type of primer in the collection has the same universal priming sequence but each type has a label sequence that is different from all of the other types in the collection. In one aspect there are about 4,000 to 5,000 different types of label sequences in the collection to be used. For testing the method, a set of 50 target sequences was synthesized. The target sequences each have a universal priming sequence at the 3' end (5'GCTAGGGCTAATATC-3'SEQ ID NO: 1968, was used in this experiment). Each of the 50 oligo target sequences that were generated has a different 21 base sequence from the GENFLEX array collection of sequences, for example, 5' GCCATTTACAAACTAGGTATT'3' SEQ ID NO: 1971[[0]]. The collection of label-tag oligos and the collection of target oligos was mixed. Various dilutions of the different targets were used in the mixture of targets to simulate a mixed population present at different levels, for example, different expression or copy number levels. T4 RNA ligase was added to ligate the label-tag oligos to the target oligos. There are 5000 different types of label oligos and 50 different types of target oligos so the majority of the target oligos of the same type will be labeled with a type of label oligo that is different from all of the other target oligos of that type. So target oligo type 1, occurrence 1 will be labeled with a label oligo type A (11A) and target oligo type 1, occurrence 2, will be labeled with a different label oligo, label oligo type B (12B). There is a finite and calculable probability that two or more occurrences of the same target type will be labeled with the same label oligo (11A and 12A), but that probability decreases as the number of different types of label oligos increases relative to the number of occurrences of any given type of target.

[0215] The ligated target/label oligos are then amplified using primers to the universal priming sites. Labels can be incorporated during amplification. The labeled amplification product is then hybridized to an array. For each different possible combination of target (50) and label (5000) there is a different probe on the array that targets that junction of the target ligated to the label. There will therefore be 50.times.5000 different probes on the array or 250,000 different probes.

[0216] Scanned images of the 48.times.3840 array were analyzed and compared to expected results. A total of 8 of the 48 targets were ligated to a pool of 3840 labels (counters). The assay was as shown in FIG. 3. The conditions were single strand deoxyoligonucleotide ligation using a phage RNA ligase to join the labels with targets. Universal priming sites on the targets and labels were included to enable PCR amplification of the joined label-targets. The ligation conditions were essentially as described in (Tessier, D. C. et al. (1986) Anal Biochem. 158, 171-178, 50 mM Tris-HCl, pH 8, 10 mM MgCl2; 10 ug/mL BSA, 25% PEG, 1 mM HCC, 20 uM ATP; 5:1 acceptor (labels) to donor (the 8 targets) ratio at 25 C overnight. The products were amplified using PCR, purified, biotin labeled with TdT, hybridized to the array, washed, stained, and scanned. The expected 8 blocks show hybridization to the array in the expected patterns.

[0217] Different ligation conditions were also tested by ligating either a single target or a pool of 48 targets to the 3,840 counters. The concentrations of the targets used in the experiment were high as in the previous experiment so most counters will be ligated to targets. In ligation 1 a single target was ligated to 3,840 labels. In ligation 2, 48 targets at 1:1 copy number were ligated to 3,840 labels. Ligation 3 is a negative control for PCR so no DNA was added. PCR with the pair of universal primers was performed using the ligation products as template and the products separated on a gel. As expected a band was observed from ligations 1 and 2, but not 3. The PCR products were labeled and hybridized to the array and the scan images after array hybridization were analyzed. As expected no signal was observed for ligation 3, all of the targets were observed for ligation 2 and the single expected target was observed for ligation 1. The single target lights up in the correct region of the chip, but background signal was also observed in unexpected locations. Increased stringency of hybridization conditions can be used to minimize hybridization to unexpected probes of the array.

[0218] In another example, conditions for optimization of hybridization to decrease cross hybridization were tested. The products used were as described above and hybridization was performed with formamide and with or without non-specific competitor (herring sperm DNA). The non-specific signal is significantly decreased in the presence of formamide, with and without non specific competitor. This demonstrates that even though the targets and counters alone have 15 bases of complementarity to probes on the array, the combination of target plus counter and the resulting increase to 30 bases of complementarity to the probes, results in specific hybridization. Within the block of 3,480 probes, there is heterogeneity in the hybridization intensity. Preliminary sequence analysis shows a strong correlation of GC content with high signals. To minimize this array probes may be selected to have similar melting temps for the counters or the target-counter combination may be optimized to obtain similar hybridization stabilities. For example, if two targets are to be analyzed the portions of each target that are to be part of the probe may be selected to have similar TMs.

[0219] To test the efficiency of T4 RNA ligase in the ligation of labels to targets, DNA ligase from E. coli was tested. This required a slight modification of the sample prep (as depicted in FIG. 7) by creating an overhang site for duplex ligation. The target in this example has a double stranded target specific portion and a single stranded overhang. The overhang may be, for example, a run of inosine bases, for example 6 to 9, or a string of random bases, for example, N6-16. DNA ligase is used to close the gap and generate a ligated product that includes the target strand and a label/counter from the pool of 3,840 counters. The PCR is carried out in the same manner as above using common primers.

[0220] The expected targets were observed, but some non-specific bands were also detected in the amplified DNA, even in the absence of the target. This suggests that the some of the 3,840 labels are combining with each other when this method is used. Selection of an optimized pool of labels may be used to mitigate such interference.

[0221] In another example random primed PCR was tested. Instead of a ligation step, the targets have a 3' random region, that can be, for example, a degenerate region or an inosine region. The labels hybridize to the random region and the random region is used as a primer for extension through the label during the PCR step to append a copy of the label and the universal priming site at the 5' end of the label oligo to the 3' end of the target. The extended target has a copy of the label sequence and the universal priming sequence and can be amplified by PCR.

[0222] In another example, a purification method for removing excess un-ligated counters was tested. The method is shown schematically in FIG. 11. The counters 101 and the targets 2103 are ligated to form counter-target molecules as shown previously. A support bound probe that is complementary to the universal primer at the end of the target oligonucleotides 2105, is used to separate counter-targets and targets from un-ligated counters. The support 2109 may be, for example, a magnetic bead. A second separation can be used to separate counter-targets from un-ligated targets. The second separation uses a support bound probe complementary to the universal priming sequence at the end of the counters 2107. The single capture reduces background amplification. A double round of capture may also be used.

[0223] In FIG. 18 a scatter plot is shown to illustrate one way of representing the combinations of different target occurrences ligated randomly to different labels in the set. The plot shows combinations for 20 different target occurrences (labeled 1 to 20) representing 20 copies of the same target. The Y-axis represents different labels identified by a number from 1 to 1000. Each of the targets can be labeled with any of the 1000 labels, for example target 1 is labeled with label 351 and has coordinates (1, 351). The labels are distinct and distinguishable while the targets are the same in this example.

[0224] FIG. 19 shows a schematic where genomic DNA 1901 is fragmented, for example at restriction sites 1903 to produce fragments 1905. The fragments are ligated with labels to form fragments labeled at both ends 1907. All fragments can be ligated to the labels The label-ligated fragments are circularized, for example, by ligation of the label ends to form closed circles 1909 with first and second labels forming a single label 1911. The circularized fragments can be treated with exonuclease to remove unligated fragments. The circle and label can be amplified using gene-specific PCR primers 1913. The PCR product has the label region 1911 flanked by target specific regions. The array probe is preferably complementary to the junction between the target specific region and the label. There are two such junctions 1915 and 1917 in the PCR product and each could be targeted on either strand (since the product is double stranded). The products may be fragmented, labeled and hybridized to an array of probes to the junctions. The label-target combination can be hybridized to an array for counting.

[0225] FIG. 20 shows a graph of counting efficiency on Y axis and copies of target on X axis. The different lines represent different numbers of labels being used, from 1000 to 10,000. The inset graph is a blow up of the upper left hand region of the larger graph and shows how counting efficiency changes with the number of labels. Fewer labels results in a more rapid decrease in counting efficiency as the number of targets increases.

[0226] FIG. 21 is a plot of labels observed per target as the copies of targets increases and the number of label types increases.

[0227] In another embodiment, illustrated schematically in FIG. 5, genomic DNA 1901 is fragmented with a restriction enzyme, for example, BamHI, which generates a single stranded overhang for sticky ended ligation. The fragments 1905 are ligated to adaptors 2207 that include a label 2205 and a universal priming site 2203. Different adaptors vary in the label portion 2205 but have a common priming site 2203. The label is 3' of the universal priming site so that it is between the fragment and the universal priming site. The adaptor ligated fragments are amplified by PCR using primer 2209. The PCR product can be fragmented, labeled with a detectable label and hybridized to an array. The resulting strands are detected by hybridization to an array having target-label probes 2210 and includes different features for each target-label combination. The array has a different feature for each target-label-tag combination. The PCR amplicons may be fragmented prior to array hybridization. Preferably the fragments are labeled, for example, by TdT incorporation of a nucleotide that can be detected, such as a biotin containing nucleotide.

[0228] The probes of the array are complementary to the junction between the label and the restriction fragment. The sequences at the ends of the individual strands of the restriction fragments are predicted based on in silico digestion of the human genome. Also, fragments are targeted that are within the size range that is known to amplify efficiently by adaptor ligation PCR, for example, 200 bases to 2 kb. The adaptor 2201 had two segments, a constant priming region 2203 and a variable label region 2205. Together 2203 and 2205 form the label adaptor 2207. The primer 2209 has the same sequence 5' to 3' as the 2203. The schematic is drawn showing only one strand, but one of skill in the art would understand that in a preferred embodiment the genomic DNA is double stranded and the restriction fragments have two strands, which may be referred to as a top strand and a bottom strand. The convention is that the top strand is drawn 5' to 3' left to right and the bottom strand is the complement of the top strand and is drawn 3' to 5' left to right. Adaptors are preferably double stranded for at least a portion of the adaptor, they may have single stranded overhangs, for example to have "sticky ends" that facilitate hybridization and ligation to the overhang resulting from restriction digestion. In a preferred aspect, the same adaptor can be ligated to the two ends of a strand of a restriction fragment and may be ligated to one or both strands. The adaptor may be ligated to the ends of the top strand in opposite orientations as shown in FIG. 22, so that the label is internal to the priming site at both ends. The adaptor may have a top and a bottom strand and the top strand may be ligated to the top strand of the fragment and the bottom strand ligated to the bottom strand of the fragment. The top and bottom strands of the adaptor may be complementary over the entire length, but often have single stranded regions at one end to facilitate sticky ended ligation to an overhang created by a restriction enzyme.

[0229] To test this method several adaptors were generated. The test adaptor has PCR002 (SEQ ID No. 1969) as top or sense strand and BamAdaAS (SEQ ID No. 1970) as bottom or antisense strand.

TABLE-US-00006 PCR002 5' ATTATGAGCACGACAGACGCCTGATCT (1969) BamAdaAS 3'AATACTCGTGCTGTCTGCGGACTAGACTAG 5'P (1970)

The single stranded region on the right is the BamHI single stranded overhang. Te adaptor also has a half Bgl II site. The "full length-label" adaptor has SEQ ID No. 1972 as top or sense strand and SEQ ID No. 1973 as bottom or antisense strand.

TABLE-US-00007 Sense 5'ATTATGAGCACGACAGACGCCTGATCTNNNNNNNNNNNNNNT AntiSense 3'AATACTCGTGCTGTCTGCGGACTAGANNNNNNNNNNNNNNACTAG

A 5' phosphate may be added to one or both strands of the adaptor using, for example, T4 polynucleotide kinase. In some aspects a truncated adaptor may be used. An example of such an adaptor is shown in FIG. 7, the top or sense strand is SEQ ID No. 1974 and the bottom or antisense strand is SEQ ID No. 1975. The portion of the sequence that has a line through it for both SEQ ID NOs. 1974 and 1975 indicates bases missing as compared to SEQ ID NOs. 1972 and 1973 respectively. The N's in SEQ ID Nos. 1972-1975 indicate a variable sequence in the adaptor that is different for each different label. For example, if there are 1,920 different labels to be used then the N14 represents the 1,920 different labels.

[0230] In some aspects it is preferable to use shorter oligos. The full length adaptor in includes 87 bases. The truncated adaptor has 57 bases. Since 2 different oligos must be synthesized for each different label adaptor (e.g. 1,920 labels requires 3,840 different oligos) shorter adaptors are more economical. The separate oligos are preferably annealed together prior to being combined into a pool for ligation to fragments. The primer may be, for example, SEQ ID NO. 1969 or the 5' 17 bases of SEQ ID No. 1974.

[0231] FIG. 24 shows the results of a control experiment where the test adaptor was ligated to fragmented genomic DNA and analyzed on an array having genomic probes. The DNA was subjected to fragmentation with a BamHI, the test adaptor was ligated to the ends and SEQ ID No. 1969 was used as a primer for PCR amplification. The PCR products were fragmented and end labeled using TdT and hybridized to a CNVtype and HG49 arrays. The upper plot is the number of probes (number of different features where each feature corresponds to a different probe sequence) complementary to restriction fragments in the different size bins shown on the X-axis. The sizes and sequences of restriction fragments from a selected genome can be predicted and binned according to size. The probes of the tiling array (probes essentially all non-redundant sequences in the genome) can be assigned to the restriction fragment to which the probe is complementary. Longer fragments will have larger numbers of probes that are complementary to that fragment, simply because the fragment is longer. Restriction fragment size is distributed based on the frequency of the occurrence of the recognition site. Note that the X axis does not increase linearly. While there are more probes that are complementary to fragments in the bins of size greater than 3000, particularly in the bins between 9000 and 30,000, but the intensity in those size bins is less than the intensity of the bins that are about 400 to about 1800. The larger fragments, greater than 9000 bases, for example, do not amplify efficiently with PCR, resulting in lower representation of those large fragments in the hybridization.

[0232] In another example, a truncated label adaptor was used (SEQ ID Nos. 1974 and 1975). The adaptor ligated fragments were extended to fill in the ends with polymerase prior to PCR. Hybridization was done in duplicate to either the CNV-type array or HG49 design C. Fragmented DNA and non-fragmented DNA were plotted. The intensity of the DNA that was not fragmented prior to hybridization is less than the intensity of the fragmented DNA. The peak of the intensity for both plots is at a fragment size of about 900 base pairs.

[0233] FIG. 11 shows a theoretical modeling of the number of counters predicted to be observed at least once 3201, exactly once 3202 or exactly twice 3203. A non-depleting reservoir of 960 diverse labels was considered. Equation (1) was used to calculate the at least once curve, equation (2) the exactly once curve and equation (3) the exactly twice curve. The error bars indicate one standard deviation from the corresponding mean value.

E [ k ] = m [ 1 - ( 1 - 1 m ) n ] ( 1 ) Var [ k ] = m [ 1 - ( 1 - 1 m ) n ] ( 1 - 1 m ) n + m ( m - 1 ) [ ( 1 - 2 m ) n - ( 1 - 1 m ) 2 n ] ( 2 ) ##EQU00009##

[0234] FIG. 12 shows counting results for DNA copy number titrations using microarray hybridization in (A) or DNA sequencing in (B). Dilutions (3.62 ng, 1.45 ng, 0.36 ng and 0.036 ng) of a DNA sample isolated from cultured lymphoblasts of a Trisomy 21 male individual were processed for microarray hybridization (left) and DNA sequencing (right). Three chromosome targets were tested and observed numbers of counters (Y-axis) are shown (curve 1201). The number of target molecules for each sample (X-axis) was determined from the amount of DNA used, assuming a single cell corresponds to 10 pg. For comparison, the theoretical counter usage rates from the stochastic model equation are also plotted 1202. Numerical values are provided in Table 4.

[0235] BamHI cuts the human genome into an estimated 360,679 fragments with a size distribution of 6 bp to 30,020,000 bp. The median size is 5142 bp and the mean is 8320 bp. There are 79,517 fragments in the size range of 150 bp to 2 kb. For testing it may be desirable to choose fragments that meet selected criteria, for example, within a selected size range, select fragments that have more than 1 probe on the HG49m array, exclude fragments that are in known CNV regions, or exclude fragments having a SNP in the first or last 20-30 bases.

[0236] The upper panel of FIG. 26 shows the intensities of 1,152 array probes associated with one gene target on chromosome 4, chr4.sub.--01s. The data are from the array with 5 ng DNA, i.e., 1000 copies of the tested gene target. The 1,152 probes shown share the same genomic sequence portion, but have different label sequences. Each black dot represents one label sequence. The left 960 dots (on the left side of the red vertical line) correspond to specific labels (i.e., labels used in ligation reaction), and the right 192 dots correspond to non-specific labels (i.e., labels not used in ligation reaction). The probe intensities were plotted in natural log scale on the y-axis. The blue horizontal line is the threshold determined by analysis algorithm (see Materials and Methods), which has a value of 3,800.

[0237] The array design for the experiment represented in FIG. 26 is as follows. For each gene target assayed, the array probe consists of all possible combinations of the 960 label sequence and either of the two BamHI genomic fragment ends. An additional 192 label sequences that were not included in the adaptor pool were also tiled to serve as non-specific controls. This tiling strategy enables consistency check on the number of labels used at the paired ends, since each target fragment is ligated to two independent labels (one on either end), and for the same target fragment, the counts on the left and right side should be very similar.

[0238] The lower panel shows the histogram of the intensity data corresponding to 960 specific labels. Also shown in the figure are the 2 fitted normal distributions, designated by red and green curves, respectively. The fitted distributions have the mean and standard deviation of 1447.+-.680 and 12186.+-.3580, respectively. The blue vertical line is the threshold, which has the same value as the blue horizontal line shown in the upper panel. Based on such threshold, 501 probes (i.e., labels) were counted as "used".

[0239] FIG. 27 shows the number of times observed for each of the 960 specific labels. Empirically, we did not observe 349 labels in any of the 20 cases. By model, we would expect to observe 643.05.+-.9.96 labels at least once, which means we expect not to observe 307.about.327 labels. This result shown was obtained by grouping labels used in independent ligation reactions together. To more accurately estimate the frequency of usage of labels, only data from experiments with low concentrations (0.05 ng and 0.5 ng of DNA ligation amount) were considered. Under each concentration, 5 different gene targets independently ligated to labels at both ends. Therefore, a total of 20 independent reactions (2 concentrations.times.5 gene targets.times.2 ends) were grouped together. Of these reactions, 1,064 labels were observed; some were observed more often than the others, the frequency of usage of labels ranges from 0 to 6.

[0240] FIG. 28 shows one example of the replication process of 500 copies of a gene target. In each subplot, copies of target molecules were plotted in the same order. The y-axis is the relative ratio of the number of amplified molecules over the minimal number of amplified molecules in each PCR cycle. Before PCR, all copies are of equal amount, i.e., each copy has one molecule at cycle 0 (subplot (a)). As the PCR process goes on, we start to see differences in the number of amplified molecules corresponding to different copies of target molecules. For example, in cycle 3 (subplot (b)), the ratio between most and least abundant of amplified molecules is 4. Such ratio becomes larger as the number of PCR cycle increases. In cycle 8 and 15, the ratio becomes 26 and 30, in cycles 8 and 15 respectively (see subplots (c) and (d)). This suggests that the differential usage of labels may be observed before PCR is started. Such difference in the amount of molecules associated with different labels will carry on as PCR process goes on.

[0241] PCR simulation. We defined n copies of a gene fragment T, each ligated to a single counter randomly selected from an infinite pool of m unique counters to generate a collection of k resulting counter-ligated gene target molecules T*={tl.sub.i,i=1,2, . . . , k}. We assumed that each counter-ligated gene target molecule tl.sub.i replicates randomly and independently of other target molecules; and that the replication probability p (i.e., amplification efficiency) of different molecules, tl.sub.i remains constant throughout the PCR process. For each tl.sub.i we denote the number of molecules at PCR cycle c as N.sub.i.sup.c. When c=0, N.sub.i.sup.0 is the initial number of t4. The PCR process at cycle c+1 can be modeled as a series of N.sub.i.sup.c independent trials that determine the replicability of each of the N.sub.i.sup.c molecules with replication probability p. Let .DELTA.N.sub.i.sup.c represent the number of molecules replicated at cycle c+1, then the number of molecule tl.sub.i after cycle c+1 is N.sub.i.sup.c+1=N.sub.i.sup.c+.DELTA.N.sub.i.sup.c, where the probability of .DELTA.N.sub.i.sup.c is

p ( .DELTA. N i c | N i c ) = ( N i c .DELTA. N i c ) p .DELTA. N i c ( 1 - p ) N i c - .DELTA. N i c ( 2 ) . ##EQU00010##

We determined the relative abundance of different counter-ligated gene target molecules di upon completion of the simulated PCR run for n=500, 50, or 5, and p=0.8, 0.7 or 0.6 (Table 5). In each case, we performed 1,000 independent runs to simulate 30 cycles of adaptor PCR, followed by 30 cycles of gene-specific PCR.

[0242] Table 5. Shows summary statistics drawn from 100 independent simulation runs modeling PCR, ligation at each end of targets is considered.

TABLE-US-00008 Initial copy number N = 5 N = 50 N = 500 Side Left Right Left Right Left Right #of labels 5 5 48.61 0.99 48.64 1.09 388.91 6.85 389.27 7.18 observed Max (1.43 0.19) (1.43 0.19) (2.18 0.49) (2.13 0.47) (4.52 0.59) (4.44 0.55) * 10{circumflex over ( )}11 * 10{circumflex over ( )}11 * 10{circumflex over ( )}10 * 10{circumflex over ( )}10 * 10{circumflex over ( )}9 * 10{circumflex over ( )}9 Min (5.73 2.27) (5.73 2.27) (2.35 1.06) (2.35 1.06) (1.15 0.49) (1.23 0.49) * 10{circumflex over ( )}10 * 10{circumflex over ( )}10 * 10{circumflex over ( )}9 * 10{circumflex over ( )}9 * 10{circumflex over ( )}8 * 10{circumflex over ( )}8 Ratio btw 3.13 2.44 3.13 2.44 14.10 11.41 13.87 13.42 43.42 25.66 44.92 30.04 max & min Mean (1.00 0.16) (1.00 0.16) (1.03 0.06) (1.03 0.06) (1.27 0.03) (1.27 0.03) * 10{circumflex over ( )}1.1 * 10{circumflex over ( )}1.1 .sup. * 10{circumflex over ( )}1.0 .sup. * 10{circumflex over ( )}1.0 * 10{circumflex over ( )}9 * 10{circumflex over ( )}9 Standard (3.44 1.02) (3.44 1.02) (3.98 0.52) (3.94 0.54) (6.75 0.41) (6.69 0.40) deviation * 10{circumflex over ( )}10 * 10{circumflex over ( )}10 * 10{circumflex over ( )}9 * 10{circumflex over ( )}9 * 10{circumflex over ( )}8 * 10{circumflex over ( )}8 Coef. of 0.36 0.13 0.36 0.13 0.39 0.05 0.38 0.05 0.53 0.03 0.53 0.03 variation

[0243] Focusing on the experiments with concentrations of 0.5 and 0.05 ng, (3.sup.rd and 4.sup.th in each group of 5), which provide the most accurate count of labels, there are 20 different opportunities for a given label to be observed (2 concentrations.times.5 amplicons.times.2 sides (left or right)). We observed 1,064 labels over the 20 opportunities.

[0244] To observe the distortion of the relative abundance of DNA molecules in the reaction resulting from the PCR process, dispersion in the quantitative distribution of PCR amplified DNA molecules was analyzed. A model of the PCR process was generated to understand the dispersion in the distribution of amplified molecules (FIG. 25, Table 6). A series of 1,000 independent simulation runs were performed to simulate the replication of uniquely labeled target molecules through PCR processes. For each run, we measured the distribution of the final amount of PCR products and quantified the dispersion of distribution using two measures: ratio of the maximal to the minimal amount, and coefficient of variation of final PCR products. This demonstrates that the degree of dispersion increases with the incidence of replicate use of identical counters, which may be in-part responsible for the deviation observed when assaying high target copy numbers. Table 6 lists the ratio and CV for distributions corresponding to different concentrations and replication probabilities (one sided ligation considered).

TABLE-US-00009 TABLE 6 Replication probability n = 5 n = 50 n = 500 Ratio of max to min p = 0.6 5.69 .+-. 4.95 26.16 .+-. 23.78 124.18 .+-. 88.04 amount of PCR p = 0.7 4.59 .+-. 8.03 16.22 .+-. 15.53 71.55 .+-. 55.13 amplified product p = 0.8 2.82 .+-. 1.51 11.54 .+-. 9.53 42.24 .+-. 27.49 Coefficient of p = 0.6 0.48 .+-. 0.16 0.51 .+-. 0.06 0.62 .+-. 0.03 Variation (CV) p = 0.7 0.41 .+-. 0.14 0.44 .+-. 0.05 0.57 .+-. 0.02 p = 0.8 0.34 .+-. 0.12 0.36 .+-. 0.05 0.52 .+-. 0.02

[0245] Example 1 of a method for selecting a collection of labels starting with all possible 14 mers (4.sup.14 or -268 million possible labels). Step 1: clustering based on the last 7 bases: all sequences with the same last 7 bases are grouped together; within each cluster, randomly pick one sequence, this gives us 11,025 sequences, denoted by set A. Step 2: clustering based on the first 7 bases: all sequences with the same first 7 bases are grouped together; within each cluster, randomly pick one sequence, this gives us 13,377 sequences, denoted by set B. Step 3: get the union set of set A and B, the combined set has 24,073 sequences. Then do clustering based on the middle 6 bases, randomly pick one sequence out of every cluster, this gives us 3,084 sequences, denoted by set C. Step 4: calculate the all-against-all alignment score of set C, which gives us a 3,084.times.3,084 self-similarity score matrix, denoted by S. Step 5: filter based on the score matrix. If an element of the score matrix S(i,j) has a high value, that means, the corresponding sequences i and j are very similar to each other. Starting from the elements with top self-similarity score, randomly pick one and discard the other; repeat this process until the number of retained sequences <2000. Until this step, 1,927 sequences were retained.

[0246] For the retained 1,927 sequences, an all-against-all complement score was calculated for each. This gave a 1,927.times.1,927 cross complement score matrix. A step similar to step 5 was performed, to avoid labels with maximal cross-complement with other labels. Starting from the pairs with top cross-complement score, one was randomly pick and the other discarded. This process was repeated until the number of retained sequences was 1920. Next the 1920 labels were split into 2 sets, with one set (denoted by set A) consisting of sequences that are maximum different from one-another; and the other set (denoted by set B) consisting of the remaining sequences. The procedure used to split sequences was as follows. Starting from the original 1920 by 1920 similarity score matrix, for each sequence, (1) sum up all its similarity scores with the rest of the sequences in the pool, that is, for each sequence, calculate a total similarity score. (2) Sort the total similarity scores of all sequences and select the sequence with the lowest total score, and move it to set A. (3) Remove the row and column corresponding to the selected sequence, i.e., both the number of rows and columns in the similarity score matrix are reduced by 1. Repeat steps 1-3, until the number of rows and columns in the similarity score matrix reaches 960 or half of the original. The selected sequences belong to set A and the remaining sequences belong to set B.

[0247] In another embodiment a collection of labels is selected using the following steps. Starting with all possible 14 mers (4.sup.14 or .about.268 million possible labels) eliminate all that do not have 50% GC content. Eliminate those were each nucleotide does not occur at least twice. Eliminate those that have more than two G/C in tandem or more than three A/T in tandem. Eliminate those that contain a selected restriction site. That reduces the original set to .about.33 million or 12.43% of the original set. From that set select those that have a Tm within the range of 38.5.degree. C. to 39.5.degree. C. This step results in a set of .about.7 million or 2.73% of the original set. Remove those that have regions of self-complementarity. The resulting set in this example was now 521,291. A hierarchical clustering was performed to identify a set that has maximum sequence difference between one-another. The resulting set contained 1,927 labels. Labels were removed if the sequence had a tendency to bind to other labels in the set. This reduced the set to 1,920 labels. A final set of 960 labels was selected from the 1,920 as being maximally different for the "specific" labels and 192 additional counters to tile on the array as "non-specific" controls.

[0248] Selection of Targets and design of test array. Regions selected to assay as targets included Chr X, Chr Y, Chr 4 as a reference and Chr 21 for Trisomy. Locations on the chromosomes for assaying were selected to avoid centromeres and telomeres. Fragments were selected based on Bam HI fragments of between about 400 and 600 base pairs. Fragment intensity was checked using HG49 array hybridization. The first and the last 26 nucleotides of the fragments (from and including the Bam HI site) were tiled. Repeats were avoided and GC % was optimized.

[0249] The array format was 100/25. Feature size is 5 um. There are 436.times.436 features or 190,096 features. Synthesis was NNPOC, 43 mer probes, 5' up, no phosphate. The chip name is STCL-test2. The gridding probe used was the same as the HG49. No QC probes were included.

[0250] Aside from reducing whole chromosomes into 360,679 smaller molecular weight DNA pieces more suitable for ligation reactions, restriction digestion also serves to reduce the overall sequence complexity of the sample, as only an estimated 79,517 fragments reside in the 150 bp-2 kb size range that is effectively amplified by PCR. To detect and quantify counters that have been selected by the target molecules, the labeled genomic target fragments may be circularized and PCR amplified to prepare for analysis, for example, using microarray hybridization or DNA sequencing. A representative BamHI target fragment was sampled for each of the three test chromosomes. Simultaneous measurements of all three chromosomes serve as an internal control independent of dilution or other systematic errors. A suitable DNA array detector capable of distinguishing the set of counters bound to copies of the target molecules was constructed using photolithography (S. P. Fodor et al., Science 251, 767 (Feb. 15, 1991).). Each array element for a target to be evaluated consists of a target complementary sequence adjacent to one of the complements to the 960 counter sequences (FIGS. 1 and 2A). For increased specificity, a ligation-readout was performed on the microarray after hybridization to avoid false positive detection of the cross-hybridization of identical targets with different counters. As a means of validation through a secondary measure, samples hybridized to microarrays were subsequently sampled by DNA sequencing (FIGS. 10 and 29).

[0251] An equation to model the stochastic labeling of target molecules with a small library of 960 counters, and validate our equation model with numerical simulations is disclosed. In the model, the diversity of counters selected by, and ligated to target molecules in the reaction solution (simplified as `used`) is dictated by the number of copies of molecules present for each target fragment in the reaction (FIG. 12). Under conditions where the size of the counter library is much greater than the number of copies of a given target molecule, the counting efficiency is high, and counting the number of counters used is equivalent to counting the number of copies of the original target molecules (FIG. 16). When the number of target copies approaches and exceeds the number of different counters in the reaction, any counter in the library is more likely to be used multiple times (FIG. 15). The number of counters used at least once is an important measure because it serves as the basis for drawing yes/no conclusions in our digital readout on microarrays. Under stochastic labeling conditions, we expect that the absolute quantity of single DNA molecules can be accurately determined by proxy counts of labeling events. Indeed, microarray experiments demonstrate a high degree of correlation between the number of copies of target molecules added to the reaction and the number of counters used, as detected on microarrays (FIG. 12). In particular, counter usage precisely profiles the number of target molecules under conditions of high counting efficiency. Subtle deviations from the model may represent minor dilution errors in the preparation of the sample. However, within that sample dilution, the relative counter ratios of the three internally built-in markers are highly accurate (FIG. 13). FIG. 13 shows comparison of relative copy ratios of the three gene targets tested: ChrX, Chr4 and Chr21 representing genetic material of one, two and three copies per cell. Different dilutions (5 ng, 2 ng, 0.5 ng and 0.05 ng) of a DNA sample isolated from cultured lymphoblasts of a Trisomy 21 male individual were processed for microarray hybridization and DNA sequencing. The calculated number of target molecules (see, Table 4, column 9) was inferred from the number of counters detected on microarrays (A), and was also calculated for the SOLID sequencing data (B). For each sample dilution, the target copy number ratio of each gene target relative to ChrX is shown.

[0252] On the other hand, when target copies exceed .about.100, detected labeling events appear to indicate fewer than actual molecules in solution (FIG. 12 inset in graph on left). This deviation was reproducible and consistently observed across multiple microarray experiments, and was also observed in the DNA sequencing experiments (FIG. 12 inset in graph on right). Under-counts of expected labeling events may originate from inadequate detection sensitivity of the microarray platform or from other systematic or indeterminate deficiencies in the sample preparation procedure. PCR, for example, is prone to amplification bias (T. Kanagawa, J Biosci Bioeng 96, 317 (2003) and M. F. Polz, C. M. Cavanaugh, Appl Environ Microbiol 64, 3724 (1998)), which could hinder the comprehensive detection of labeling events that may be genuinely stochastic.

[0253] To confirm the microarray results, a digital sequence counting of individual molecules in the DNA samples hybridized to microarrays was used as a means of validation, and to detect the presence of any false negatives that may have escaped microarray detection. Analysis of mapped sequence reads resulted in counts in agreement to the microarray observations. Furthermore, a second, independent sequencing run was repeated with similar findings (Table 3).

[0254] An additional feature of digital sequence counting is that unlike the microarray intensity data (FIGS. 22 and 23), which offers lower resolution into the measurement of the concentration dispersion of PCR amplified molecules, sequence counting clearly demonstrates significant variation in the representation of amplified targets (FIG. 29), This is consistent with the computed PCR model. Overall, detected counters on the microarray and sequencing experiments correlate well, but a small subset of counters appear to be unique to each process (Table 7). The observed number of labels in common between the microarray and the two sets of sequencing experiments are summarized in the table. The number of labels in each category is included. The categories are as follows: A+1+2 for labels detected in each of the 3 experiments, 1+2 for labels detected only in sequencing runs 1 and 2, 1+A for labels detected in sequencing run 1 and by array, and so on for the amounts of DNA shown in column 3.

TABLE-US-00010 TABLE 7 A + 1 + DNA sample 2 1 + 2 1 + A 2 + A 1 2 A Chr4 Left 0.036 ng 13 0 0 0 0 0 1 side 0.36 ng 96 3 0 1 2 2 5 1.45 ng 228 13 4 22 6 10 6 3.62 ng 484 23 2 3 4 6 12 Right 0.036 ng 14 0 0 0 0 0 0 side 0.36 ng 100 1 0 0 2 2 7 1.45 ng 249 25 2 0 15 33 5 3.62 ng 511 22 2 1 9 23 11 Chr21 Left 0.036 ng 18 0 2 0 0 0 0 side 0.36 ng 150 0 2 4 0 7 4 1.45 ng 324 17 8 1 32 16 2 3.62 ng 637 14 10 0 17 14 4 Right 0.05 ng 18 0 1 1 0 0 0 side 0.36 ng 144 0 2 2 0 0 9 1.45 ng 330 34 2 3 15 12 6 3.62 ng 615 29 1 7 5 2 4 ChrX Left 0.036 ng 11 0 0 0 0 0 0 side 0.36 ng 42 0 0 0 1 3 8 1.45 ng 137 3 1 5 8 5 5 3.62 ng 274 12 0 2 4 12 5 Right 0.036 ng 10 1 0 0 1 0 0 side 0.36 ng 43 0 3 0 4 0 2 1.45 ng 127 15 0 0 11 25 6 3.62 ng 298 12 3 3 24 31 2

[0255] For the reverse scenario, high numbers of mapped sequence reads were always observed to correlate with high microarray intensities in these examples. No systematic or sequence correlations, or explanations were identified for the counters that are absent from any given sequencing experiment for which the microarray readout demonstrates a strong signal. While obviously underrepresented in some experiments, the same counters are sometimes present in high sequence counts in other experiments, suggesting that they are available for sequencing. PCR was used to resolve these isolated cases of disagreement and demonstrate these were false negatives in the sequencing experiments (Table 3). Despite their presence in the sequencing library, it is unclear why the counters were not observed or were underrepresented in the original sequencing run, and also in the subsequent replicate sequencing run.

[0256] Aside from the comparative analysis of absolute and relative counts of the numbers of target molecules and counter labels, additional ways to assess the stochasticity of the labeling process were evaluated. First, if the labeling process is random, the frequency of incorporation of identical counters in independent events across the paired left and right termini of target fragments should closely resemble outcomes from numerical simulation. Observed counts on microarrays do in fact match closely with numbers obtained from computer simulations (Table 4, columns 10-11). Second, if the target molecules are labeled randomly with an equal likelihood of incorporation for any member of the 960 counters in the library, we would expect the number of repeated observations of counters to follow a stochastic nature. For this analysis, we accumulated a total of 1,064 counter observations over several microarray experiments restricted to low target copy numbers. Exclusion of data from high copy targets was necessary to avoid undercounting labeling events from multiple incidences of identical counters attaching individually to numerous target copies. As a further and final demonstration of stochastic labeling, results show that the frequency of label usage follows a pattern consistent with outcomes from numerical simulation.

CONCLUSION

[0257] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby. All cited references, including patent and non-patent literature, are incorporated herein by reference in their entireties for all purposes and particularly to disclose and describe the methods or materials in connection with which the publications are cited.

Sequence CWU 1

1

19971875DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 1gatccaccaa tccatacatg agacggccca atccagttag tccttatcca aactcttcac 60acacttcaga tatctatgga agcaccagcc ctatgaactt ctattccacc tcatctcaag 120ctgcaggttc atatttgaat tcttctaatc ccatgaaccc ttaccctggg cttttgaatc 180agaataccca atatccatca tatcaatgca atggaaacct atcagtggac aactgctccc 240catatctggg ttcctattct ccccagtctc agccgatgga tctgtatagg tatccaagcc 300aagaccctct gtctaagctc agtctaccac ccatccatac actttaccag ccaaggtttg 360gaaatagcca gagttttaca tctaaatact taggttatgg aaaccaaaat atgcagggag 420atggtttcag cagttgtacc attagaccaa atgtacatca tgtagggaaa ttgcctcctt 480atcccactca tgagatggat ggccacttca tgggagccac ctctagatta ccacccaatc 540tgagcaatcc aaacatggac tataaaaatg gtgaacatca ttcaccttct cacataatcc 600ataactacag tgcagctccg ggcatgttca acagctctct tcatgccctg catctccaaa 660acaaggagaa tgacatgctt tcccacacag ctaatgggtt atcaaagatg cttccagctc 720ttaaccatga tagaactgct tgtgtccaag gaggcttaca caaattaagt gatgctaatg 780gtcaggaaaa gcagccattg gcactagtcc agggtgtggc ttctggtgca gaggacaacg 840atgaggtctg gtcagacagc gagcagagct ttctg 8752934DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 2gatccaggac tgttttcatg ctagtctggc tcacagaacg ctagcaggtt gtactgacct 60tcaggacaag cgtaagtaag acctacgatg ctcgtttgat cccaacagtt atctcccctt 120tctcagttcc tgtcttctcc cagagggtgg caggtagctg gggaagagat gactgggagt 180ggagaggtgc cgctgaccat tatggtggca gctactcatt cagggtgctc tcctcctaat 240tctgctggag aacactattt tgggacaatt tgtcatcttg gctggagggt cctttcctaa 300agtctagcac tgatagaaca caaggacgta agtgctgcct tttaaccagg aaggcgaagg 360caaacttttc tttaaaggag agagttgcag gtaatccctg gtgttttttt ttttcaatag 420ttagcaactg caggggaagg gaaaggctgt aacacccttc agctcagacg cacaatggga 480atattaattt gagcagtttc catttcagtc ccttgtcatg ttaattttga agtctggtat 540acgcccctca attctagttg atgataagct ctaaaagatg gcaagattgg tgaggccaaa 600atgcagctga caaactgagc ttacttagag attttcaaac tatttgtaag actggcatct 660ccaataacac ttttgtcatt cctgccattc aaacaggaac tgttccctgg aagaccctta 720aataaacctg tgctttcaac ccactcacct gccagaggtg gagcctgaaa gaactggggt 780gtgggcttat catcccagtt gggtctcctt tatttcccac tggtgttttc tgaccatgcc 840agggaaagca aacagtggct acattccagc ccctccacag tcaactaagt ttcattcttc 900cctctggctg agggtctgtt ggaggtgagc ccag 9343643DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 3gatcctgtgt gccttctcct gccatggtac acacactcac acaccccctc atacacaagt 60cctttgttga gccctgaggc aggaaatggg aaattcaaaa ggaagagcct gagaaaccat 120tttatttcat ttcagggggc ttctcaccat cccttgaagg aggcagcccc aagtgatata 180gaccagaacc cctctcacag agtcttagtt cacatcctag atataaaaca gagaacttcc 240ggggcttaga agttttgtct gttgggggaa atctctgcag gctcaaaaag taacccaggg 300ttggccttat gggtgtggtg gatttgtgtt tcagtgaagt gaacacagaa aagaggtgag 360tatatatgta cacacagaaa tcacaggaaa aaactccaaa aactcacttg tgctaagtct 420tgagggccag tccagcagaa agatacttgc ctttctcctt cagacttcgt tgtcagtctc 480gttttctttg tcctgtggag tagcggggag atttggagtt catgaggatg gacgcacagg 540cagtatgtgc cccaaagccc ttgaccaggc agtaatgggg gcctcaggaa tagctagggc 600tgtttcctca gagaactggt catgtgaaag gacaaaggct ttg 643420DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 4ggacaacgat gaggtctggt 20520DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 5tagggctggt gcttccatag 20620DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 6gcccctccac agtcaactaa 20720DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 7cgcttgtcct gaaggtcagt 20820DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 8ggcctcagga atagctaggg 20920DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 9tgtgtatgag ggggtgtgtg 201020DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 10tgatctagat cttgtgtccg 201120DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 11tgatctatct tcgacactgg 201220DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 12tgatcttcga gatggtgttc 201320DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 13tgatcttcgg atagagagca 201420DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 14tgatcttcgg taccaacaac 201520DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 15tgatctccaa ggtttggtga 201620DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 16tgatcttcgc aagaggtaag 201720DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 17tgatctggag ttacggcttt 201820DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 18tgatcttcaa ccagtaagcc 201920DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 19tgatctctgt aaacaacgcc 202020DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 20tgatctcacg atagtttgcc 202120DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 21tgatcttgta ctaacacgcc 202220DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 22tgatctacgc taactccttg 202320DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 23tgatctcgtt tacgatgtgg 202420DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 24tgatcttctt aggaaacgcc 202520DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 25tgatcttgca atagacgacc 202641DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 26ccactacgcc tccgctttcc tctctatggg cagtcggtga t 412720DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 27ctgccccggg ttcctcattc 202827DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 28ggagctcgga caacgatgag gtctggt 272927DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 29ggagctctag ggctggtgct tccatag 273027DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 30ggagctcgcc cctccacagt caactaa 273127DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 31ggagctccgc ttgtcctgaa ggtcagt 273227DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 32ggagctcggc ctcaggaata gctaggg 273327DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 33ggagctctgt gtatgagggg gtgtgtg 273429DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 34ttcctctcta tgggcagtcg gtgatcgaa 293533DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 35gatcttcgat caccgactgc ccatagagag gaa 333629DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 36ttcctctcta tgggcagtcg gtgatgttg 293733DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 37gatccaacat caccgactgc ccatagagag gaa 333829DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 38ttcctctcta tgggcagtcg gtgataaga 293933DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 39gatctcttat caccgactgc ccatagagag gaa 334029DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 40ttcctctcta tgggcagtcg gtgattttc 294133DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 41gatcgaaaat caccgactgc ccatagagag gaa 334229DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 42ttcctctcta tgggcagtcg gtgattacc 294333DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 43gatcggtaat caccgactgc ccatagagag gaa 334432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 44cgacagacgc ctgatctttt gttagccgga gt 324525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 45gatcactccg gctaacaaaa gatca 254632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 46cgacagacgc ctgatctttt ctcgaccact gt 324725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 47gatcacagtg gtcgagaaaa gatca 254832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 48cgacagacgc ctgatctttt ctagctaccg ct 324925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 49gatcagcggt agctagaaaa gatca 255032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 50cgacagacgc ctgatctttt cgttaggagg ct 325125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 51gatcagcctc ctaacgaaaa gatca 255232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 52cgacagacgc ctgatctttt cctgaacgac ct 325325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 53gatcaggtcg ttcaggaaaa gatca 255432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 54cgacagacgc ctgatctttt ccatagcgtc ct 325525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 55gatcaggacg ctatggaaaa gatca 255632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 56cgacagacgc ctgatctttt cactacggct ct 325725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 57gatcagagcc gtagtgaaaa gatca 255832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 58cgacagacgc ctgatctttt caccagtcca gt 325925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 59gatcactgga ctggtgaaaa gatca 256032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 60cgacagacgc ctgatctttt actgcgacct ct 326125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 61gatcagaggt cgcagtaaaa gatca 256232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 62cgacagacgc ctgatctttt acgcctctga ct 326325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 63gatcagtcag aggcgtaaaa gatca 256432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 64cgacagacgc ctgatctttt acctggactg ct 326525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 65gatcagcagt ccaggtaaaa gatca 256632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 66cgacagacgc ctgatctttt acaggagagc gt 326725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 67gatcacgctc tcctgtaaaa gatca 256832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 68cgacagacgc ctgatctttt aactgaggcg gt 326925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 69gatcaccgcc tcagttaaaa gatca 257032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 70cgacagacgc ctgatctttt aaccaggagc gt 327125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 71gatcacgctc ctggttaaaa gatca 257232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 72cgacagacgc ctgatctttg ttccacctca gt 327325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 73gatcactgag gtggaacaaa gatca 257432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 74cgacagacgc ctgatctttg ttaggcaggt ct 327525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 75gatcagacct gcctaacaaa gatca 257632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 76cgacagacgc ctgatctttg tgtagaccgt gt 327725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 77gatcacacgg tctacacaaa gatca 257832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 78cgacagacgc ctgatctttg tatcctcacg ct 327925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 79gatcagcgtg aggatacaaa gatca 258032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 80cgacagacgc ctgatctttg tagacagagc gt 328125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 81gatcacgctc tgtctacaaa gatca 258232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 82cgacagacgc ctgatctttg tacgtgtagg ct 328325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 83gatcagccta cacgtacaaa gatca 258432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 84cgacagacgc ctgatctttg gttaaggctc gt 328525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 85gatcacgagc cttaaccaaa gatca 258632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 86cgacagacgc ctgatctttg gtctcaaggt gt 328725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 87gatcacacct tgagaccaaa gatca 258832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 88cgacagacgc ctgatctttg gagagaacag ct 328925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 89gatcagctgt tctctccaaa gatca 259032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 90cgacagacgc ctgatctttg gaatctgctg gt 329125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 91gatcaccagc agattccaaa gatca

259232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 92cgacagacgc ctgatctttg gaatcaggac gt 329325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 93gatcacgtcc tgattccaaa gatca 259432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 94cgacagacgc ctgatctttg gaagacgaga ct 329525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 95gatcagtctc gtcttccaaa gatca 259632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 96cgacagacgc ctgatctttg ctctactcac gt 329725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 97gatcacgtga gtagagcaaa gatca 259832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 98cgacagacgc ctgatctttg ctaaccagga ct 329925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 99gatcagtcct ggttagcaaa gatca 2510032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 100cgacagacgc ctgatctttg cgtgagagat ct 3210125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 101gatcagatct ctcacgcaaa gatca 2510232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 102cgacagacgc ctgatctttg catctcacca gt 3210325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 103gatcactggt gagatgcaaa gatca 2510432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 104cgacagacgc ctgatctttg cagatgagga ct 3210525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 105gatcagtcct catctgcaaa gatca 2510632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 106cgacagacgc ctgatctttg atgtgagcct gt 3210725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 107gatcacaggc tcacatcaaa gatca 2510832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 108cgacagacgc ctgatctttg atggaacgga ct 3210925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 109gatcagtccg ttccatcaaa gatca 2511032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 110cgacagacgc ctgatctttg agcacaagga gt 3211125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 111gatcactcct tgtgctcaaa gatca 2511232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 112cgacagacgc ctgatctttg acgtatggag ct 3211325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 113gatcagctcc atacgtcaaa gatca 2511432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 114cgacagacgc ctgatctttg acggagatga ct 3211525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 115gatcagtcat ctccgtcaaa gatca 2511632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 116cgacagacgc ctgatctttg acacgaagag gt 3211725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 117gatcacctct tcgtgtcaaa gatca 2511832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 118cgacagacgc ctgatctttc ttggagtagc gt 3211925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 119gatcacgcta ctccaagaaa gatca 2512032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 120cgacagacgc ctgatctttc tgagtgtgac gt 3212125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 121gatcacgtca cactcagaaa gatca 2512232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 122cgacagacgc ctgatctttc tccgacactt gt 3212325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 123gatcacaagt gtcggagaaa gatca 2512432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 124cgacagacgc ctgatctttc gaggttgaca gt 3212525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 125gatcactgtc aacctcgaaa gatca 2512632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 126cgacagacgc ctgatctttc gaagagaacg gt 3212725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 127gatcaccgtt ctcttcgaaa gatca 2512832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 128cgacagacgc ctgatctttc cttcaactcg gt 3212925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 129gatcaccgag ttgaaggaaa gatca 2513032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 130cgacagacgc ctgatctttc ctggagacac tt 3213125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 131gatcaagtgt ctccaggaaa gatca 2513232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 132cgacagacgc ctgatctttc ctctgaaacc gt 3213325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 133gatcacggtt tcagaggaaa gatca 2513432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 134cgacagacgc ctgatctttc ctattgaccg ct 3213525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 135gatcagcggt caataggaaa gatca 2513632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 136cgacagacgc ctgatctttc cggtgatgat gt 3213725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 137gatcacatca tcaccggaaa gatca 2513832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 138cgacagacgc ctgatctttc cgacaagact ct 3213925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 139gatcagagtc ttgtcggaaa gatca 2514032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 140cgacagacgc ctgatctttc catgtcgagt ct 3214125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 141gatcagactc gacatggaaa gatca 2514232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 142cgacagacgc ctgatctttc cacgttagtc ct 3214325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 143gatcaggact aacgtggaaa gatca 2514432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 144cgacagacgc ctgatctttc caagaagcca gt 3214525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 145gatcactggc ttcttggaaa gatca 2514632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 146cgacagacgc ctgatctttc atgaaggacg gt 3214725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 147gatcaccgtc cttcatgaaa gatca 2514832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 148cgacagacgc ctgatctttc ataaccgagc ct 3214925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 149gatcaggctc ggttatgaaa gatca 2515032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 150cgacagacgc ctgatctttc aggttggtag ct 3215125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 151gatcagctac caacctgaaa gatca 2515232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 152cgacagacgc ctgatctttc aggagccaat ct 3215325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 153gatcagattg gctcctgaaa gatca 2515432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 154cgacagacgc ctgatctttc accggatctt ct 3215525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 155gatcagaaga tccggtgaaa gatca 2515632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 156cgacagacgc ctgatctttc aagtggagac gt 3215725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 157gatcacgtct ccacttgaaa gatca 2515832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 158cgacagacgc ctgatctttc aaacggagag gt 3215925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 159gatcacctct ccgtttgaaa gatca 2516032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 160cgacagacgc ctgatcttta tgtcagaggc gt 3216125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 161gatcacgcct ctgacataaa gatca 2516232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 162cgacagacgc ctgatcttta tgtacgctcg gt 3216325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 163gatcaccgag cgtacataaa gatca 2516432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 164cgacagacgc ctgatcttta tggcgtggat ct 3216525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 165gatcagatcc acgccataaa gatca 2516632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 166cgacagacgc ctgatcttta tgagcgacga gt 3216725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 167gatcactcgt cgctcataaa gatca 2516832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 168cgacagacgc ctgatcttta tccacgacag ct 3216925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 169gatcagctgt cgtggataaa gatca 2517032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 170cgacagacgc ctgatcttta tagtcgcgtg gt 3217125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 171gatcaccacg cgactataaa gatca 2517232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 172cgacagacgc ctgatcttta taaggccacc gt 3217325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 173gatcacggtg gccttataaa gatca 2517432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 174cgacagacgc ctgatcttta gtttcggcag gt 3217525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 175gatcacctgc cgaaactaaa gatca 2517632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 176cgacagacgc ctgatcttta gtgtactggc gt 3217725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 177gatcacgcca gtacactaaa gatca 2517832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 178cgacagacgc ctgatcttta gtctccaccg at 3217925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 179gatcatcggt ggagactaaa gatca 2518032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 180cgacagacgc ctgatcttta gtatgctcgc ct 3218125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 181gatcaggcga gcatactaaa gatca 2518232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 182cgacagacgc ctgatcttta gcctccaatc gt 3218325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 183gatcacgatt ggaggctaaa gatca 2518432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 184cgacagacgc ctgatcttta gaactctggc gt 3218525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 185gatcacgcca gagttctaaa gatca 2518632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 186cgacagacgc ctgatcttta gaacgcgaga gt 3218725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 187gatcactctc gcgttctaaa gatca 2518832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 188cgacagacgc ctgatcttta gaaccgacac ct 3218925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 189gatcaggtgt cggttctaaa gatca 2519032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 190cgacagacgc ctgatcttta ctcagaaccg ct 3219125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 191gatcagcggt tctgagtaaa gatca 2519232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 192cgacagacgc ctgatcttta cgagaggcaa ct

3219325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 193gatcagttgc ctctcgtaaa gatca 2519432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 194cgacagacgc ctgatcttta ccttggagcc tt 3219525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 195gatcaaggct ccaaggtaaa gatca 2519632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 196cgacagacgc ctgatcttta ccagacaagc ct 3219725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 197gatcaggctt gtctggtaaa gatca 2519832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 198cgacagacgc ctgatcttta aggcgagaca gt 3219925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 199gatcactgtc tcgccttaaa gatca 2520032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 200cgacagacgc ctgatcttta aggacgcaag gt 3220125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 201gatcaccttg cgtccttaaa gatca 2520232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 202cgacagacgc ctgatcttta agcggaactg gt 3220325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 203gatcaccagt tccgcttaaa gatca 2520432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 204cgacagacgc ctgatcttta agccatctcc gt 3220525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 205gatcacggag atggcttaaa gatca 2520632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 206cgacagacgc ctgatcttta acgatcctgc ct 3220725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 207gatcaggcag gatcgttaaa gatca 2520832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 208cgacagacgc ctgatcttta accggacact ct 3220925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 209gatcagagtg tccggttaaa gatca 2521032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 210cgacagacgc ctgatcttta acatcggcct ct 3221125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 211gatcagaggc cgatgttaaa gatca 2521232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 212cgacagacgc ctgatcttta acaagcggag gt 3221325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 213gatcacctcc gcttgttaaa gatca 2521432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 214cgacagacgc ctgatcttta aagcacggag gt 3221525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 215gatcacctcc gtgctttaaa gatca 2521632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 216cgacagacgc ctgatcttgt ttagcacctc ct 3221725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 217gatcaggagg tgctaaacaa gatca 2521832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 218cgacagacgc ctgatcttgt tctgaaggct gt 3221925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 219gatcacagcc ttcagaacaa gatca 2522032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 220cgacagacgc ctgatcttgt tatgaggacg ct 3222125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 221gatcagcgtc ctcataacaa gatca 2522232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 222cgacagacgc ctgatcttgt gtacaagcag gt 3222325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 223gatcacctgc ttgtacacaa gatca 2522432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 224cgacagacgc ctgatcttgt ggttcatacg gt 3222525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 225gatcaccgta tgaaccacaa gatca 2522632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 226cgacagacgc ctgatcttgt ggattactgg ct 3222725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 227gatcagccag taatccacaa gatca 2522832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 228cgacagacgc ctgatcttgt gaagatgcct gt 3222925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 229gatcacaggc atcttcacaa gatca 2523032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 230cgacagacgc ctgatcttgt ctgacctcca tt 3223125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 231gatcaatgga ggtcagacaa gatca 2523232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 232cgacagacgc ctgatcttgt ctacactccg at 3223325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 233gatcatcgga gtgtagacaa gatca 2523432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 234cgacagacgc ctgatcttgt cggagaacaa gt 3223525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 235gatcacttgt tctccgacaa gatca 2523632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 236cgacagacgc ctgatcttgt cataggcgtt ct 3223725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 237gatcagaacg cctatgacaa gatca 2523832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 238cgacagacgc ctgatcttgt cactcttcac gt 3223925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 239gatcacgtga agagtgacaa gatca 2524032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 240cgacagacgc ctgatcttgt atttccgagg ct 3224125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 241gatcagcctc ggaaatacaa gatca 2524232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 242cgacagacgc ctgatcttgt atgactgtgg ct 3224325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 243gatcagccac agtcatacaa gatca 2524432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 244cgacagacgc ctgatcttgt actgcaactg gt 3224525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 245gatcaccagt tgcagtacaa gatca 2524632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 246cgacagacgc ctgatcttgt actaacacgc ct 3224725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 247gatcaggcgt gttagtacaa gatca 2524832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 248cgacagacgc ctgatcttgt acctcctgca tt 3224925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 249gatcaatgca ggaggtacaa gatca 2525032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 250cgacagacgc ctgatcttgg tgtacttagc gt 3225125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 251gatcacgcta agtacaccaa gatca 2525232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 252cgacagacgc ctgatcttgg tggtcaaagt ct 3225325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 253gatcagactt tgaccaccaa gatca 2525432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 254cgacagacgc ctgatcttgg tcgaacaaga gt 3225525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 255gatcactctt gttcgaccaa gatca 2525632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 256cgacagacgc ctgatcttgg tacaatagcg gt 3225725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 257gatcaccgct attgtaccaa gatca 2525832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 258cgacagacgc ctgatcttgg cttctaatcg gt 3225925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 259gatcaccgat tagaagccaa gatca 2526032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 260cgacagacgc ctgatcttgg cttaccaact gt 3226125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 261gatcacagtt ggtaagccaa gatca 2526232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 262cgacagacgc ctgatcttgg ctattacgtg gt 3226325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 263gatcaccacg taatagccaa gatca 2526432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 264cgacagacgc ctgatcttgg caaaccacta gt 3226525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 265gatcactagt ggtttgccaa gatca 2526632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 266cgacagacgc ctgatcttgg atagccgaag at 3226725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 267gatcatcttc ggctatccaa gatca 2526832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 268cgacagacgc ctgatcttgg agatcaaacg gt 3226925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 269gatcaccgtt tgatctccaa gatca 2527032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 270cgacagacgc ctgatcttgg agagcacaat gt 3227125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 271gatcacattg tgctctccaa gatca 2527232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 272cgacagacgc ctgatcttgg agagaaccga tt 3227325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 273gatcaatcgg ttctctccaa gatca 2527432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 274cgacagacgc ctgatcttgc ttaggaatcg gt 3227525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 275gatcaccgat tcctaagcaa gatca 2527632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 276cgacagacgc ctgatcttgc ttaccactga ct 3227725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 277gatcagtcag tggtaagcaa gatca 2527832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 278cgacagacgc ctgatcttgc tcaaagctac ct 3227925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 279gatcaggtag ctttgagcaa gatca 2528032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 280cgacagacgc ctgatcttgc gatagtggtt ct 3228125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 281gatcagaacc actatcgcaa gatca 2528232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 282cgacagacgc ctgatcttgc gaagtagaga ct 3228325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 283gatcagtctc tacttcgcaa gatca 2528432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 284cgacagacgc ctgatcttgc ctaaacgatc ct 3228525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 285gatcaggatc gtttaggcaa gatca 2528632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 286cgacagacgc ctgatcttgc caacttctct gt 3228725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 287gatcacagag aagttggcaa gatca 2528832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 288cgacagacgc ctgatcttgc caactatacc gt 3228925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 289gatcacggta tagttggcaa gatca 2529032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 290cgacagacgc ctgatcttgc atcttcactg gt 3229125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 291gatcaccagt gaagatgcaa gatca 2529232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 292cgacagacgc ctgatcttgc atatccttcc gt 3229325DNAArtificial SequenceDescription of

Artificial Sequence Synthetic oligonucleotide 293gatcacggaa ggatatgcaa gatca 2529432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 294cgacagacgc ctgatcttgc aatcctacgt ct 3229525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 295gatcagacgt aggattgcaa gatca 2529632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 296cgacagacgc ctgatcttgc aatagacgac ct 3229725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 297gatcaggtcg tctattgcaa gatca 2529832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 298cgacagacgc ctgatcttga tttacctcgc ct 3229925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 299gatcaggcga ggtaaatcaa gatca 2530032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 300cgacagacgc ctgatcttga ttagttccgc ct 3230125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 301gatcaggcgg aactaatcaa gatca 2530232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 302cgacagacgc ctgatcttga ttactccgtg ct 3230325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 303gatcagcacg gagtaatcaa gatca 2530432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 304cgacagacgc ctgatcttga tggttcactg gt 3230525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 305gatcaccagt gaaccatcaa gatca 2530632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 306cgacagacgc ctgatcttga tgagaagacg ct 3230725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 307gatcagcgtc ttctcatcaa gatca 2530832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 308cgacagacgc ctgatcttga tccgtccaaa gt 3230925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 309gatcactttg gacggatcaa gatca 2531032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 310cgacagacgc ctgatcttga tccacaacga gt 3231125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 311gatcactcgt tgtggatcaa gatca 2531232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 312cgacagacgc ctgatcttga tcaacacctc gt 3231325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 313gatcacgagg tgttgatcaa gatca 2531432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 314cgacagacgc ctgatcttga tatcctgtgc gt 3231525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 315gatcacgcac aggatatcaa gatca 2531632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 316cgacagacgc ctgatcttga tactcaacgg ct 3231725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 317gatcagccgt tgagtatcaa gatca 2531832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 318cgacagacgc ctgatcttga gtccagaagg tt 3231925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 319gatcaacctt ctggactcaa gatca 2532032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 320cgacagacgc ctgatcttga ggttacaagg ct 3232125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 321gatcagcctt gtaacctcaa gatca 2532232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 322cgacagacgc ctgatcttga ggtcttcgga tt 3232325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 323gatcaatccg aagacctcaa gatca 2532432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 324cgacagacgc ctgatcttga gcaactgaag gt 3232525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 325gatcaccttc agttgctcaa gatca 2532632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 326cgacagacgc ctgatcttga gagttgccat gt 3232725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 327gatcacatgg caactctcaa gatca 2532832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 328cgacagacgc ctgatcttga gacaaccact gt 3232925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 329gatcacagtg gttgtctcaa gatca 2533032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 330cgacagacgc ctgatcttga ctctctacgc tt 3233125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 331gatcaagcgt agagagtcaa gatca 2533232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 332cgacagacgc ctgatcttga ctactcaccg tt 3233325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 333gatcaacggt gagtagtcaa gatca 2533432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 334cgacagacgc ctgatcttga cgaaactgga gt 3233525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 335gatcactcca gtttcgtcaa gatca 2533632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 336cgacagacgc ctgatcttga ccttcaacct gt 3233725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 337gatcacaggt tgaaggtcaa gatca 2533832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 338cgacagacgc ctgatcttga caagtcacac ct 3233925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 339gatcaggtgt gacttgtcaa gatca 2534032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 340cgacagacgc ctgatcttga atctctgcca ct 3234125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 341gatcagtggc agagattcaa gatca 2534232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 342cgacagacgc ctgatcttga aggactacgg tt 3234325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 343gatcaaccgt agtccttcaa gatca 2534432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 344cgacagacgc ctgatcttga agcaacctga gt 3234525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 345gatcactcag gttgcttcaa gatca 2534632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 346cgacagacgc ctgatcttga acaccttctg gt 3234725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 347gatcaccaga aggtgttcaa gatca 2534832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 348cgacagacgc ctgatcttga aatactccgc ct 3234925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 349gatcaggcgg agtatttcaa gatca 2535032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 350cgacagacgc ctgatcttct ttgataccgc ct 3235125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 351gatcaggcgg tatcaaagaa gatca 2535232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 352cgacagacgc ctgatcttct ttccagcagt ct 3235325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 353gatcagactg ctggaaagaa gatca 2535432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 354cgacagacgc ctgatcttct ttaggatgcg gt 3235525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 355gatcaccgca tcctaaagaa gatca 2535632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 356cgacagacgc ctgatcttct taggaaacgc ct 3235725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 357gatcaggcgt ttcctaagaa gatca 2535832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 358cgacagacgc ctgatcttct taactcgtgc ct 3235925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 359gatcaggcac gagttaagaa gatca 2536032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 360cgacagacgc ctgatcttct gtcctccgaa tt 3236125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 361gatcaattcg gaggacagaa gatca 2536232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 362cgacagacgc ctgatcttct ggaatgaggc tt 3236325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 363gatcaagcct cattccagaa gatca 2536432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 364cgacagacgc ctgatcttct gccaaagact ct 3236525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 365gatcagagtc tttggcagaa gatca 2536632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 366cgacagacgc ctgatcttct ctgaaactgc ct 3236725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 367gatcaggcag tttcagagaa gatca 2536832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 368cgacagacgc ctgatcttct cgttggaagt ct 3236925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 369gatcagactt ccaacgagaa gatca 2537032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 370cgacagacgc ctgatcttct ccaggttcac at 3237125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 371gatcatgtga acctggagaa gatca 2537232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 372cgacagacgc ctgatcttct ccaaggtgtc tt 3237325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 373gatcaagaca ccttggagaa gatca 2537432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 374cgacagacgc ctgatcttct caaggacaac gt 3237525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 375gatcacgttg tccttgagaa gatca 2537632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 376cgacagacgc ctgatcttct caacatggct ct 3237725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 377gatcagagcc atgttgagaa gatca 2537832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 378cgacagacgc ctgatcttct atcacaaggc gt 3237925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 379gatcacgcct tgtgatagaa gatca 2538032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 380cgacagacgc ctgatcttct aggtatgcgg tt 3238125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 381gatcaaccgc atacctagaa gatca 2538232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 382cgacagacgc ctgatcttct agcaacggaa ct 3238325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 383gatcagttcc gttgctagaa gatca 2538432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 384cgacagacgc ctgatcttct aacggtggtc tt 3238525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 385gatcaagacc accgttagaa gatca 2538632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 386cgacagacgc ctgatcttct aaagcgtcca ct 3238725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 387gatcagtgga cgctttagaa gatca 2538832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 388cgacagacgc ctgatcttct aaagaccgca ct 3238925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 389gatcagtgcg gtctttagaa gatca 2539032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 390cgacagacgc ctgatcttcg taggagaagc tt 3239125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 391gatcaagctt ctcctacgaa gatca 2539232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 392cgacagacgc ctgatcttcg tacctccaag at 3239325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 393gatcatcttg

gaggtacgaa gatca 2539432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 394cgacagacgc ctgatcttcg taatacgctc ct 3239525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 395gatcaggagc gtattacgaa gatca 2539632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 396cgacagacgc ctgatcttcg gttagattgg ct 3239725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 397gatcagccaa tctaaccgaa gatca 2539832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 398cgacagacgc ctgatcttcg gtaccaacaa ct 3239925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 399gatcagttgt tggtaccgaa gatca 2540032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 400cgacagacgc ctgatcttcg gatagagagc at 3240125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 401gatcatgctc tctatccgaa gatca 2540232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 402cgacagacgc ctgatcttcg gaaagacgta gt 3240325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 403gatcactacg tctttccgaa gatca 2540432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 404cgacagacgc ctgatcttcg caagaggtaa gt 3240525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 405gatcacttac ctcttgcgaa gatca 2540632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 406cgacagacgc ctgatcttcg agatggtgtt ct 3240725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 407gatcagaaca ccatctcgaa gatca 2540832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 408cgacagacgc ctgatcttcg aagaagatgc ct 3240925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 409gatcaggcat cttcttcgaa gatca 2541032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 410cgacagacgc ctgatcttcg aactacacag ct 3241125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 411gatcagctgt gtagttcgaa gatca 2541232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 412cgacagacgc ctgatcttcc ttacggactc at 3241325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 413gatcatgagt ccgtaaggaa gatca 2541432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 414cgacagacgc ctgatcttcc tgttggtgaa gt 3241525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 415gatcacttca ccaacaggaa gatca 2541632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 416cgacagacgc ctgatcttcc tggatggaag tt 3241725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 417gatcaacttc catccaggaa gatca 2541832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 418cgacagacgc ctgatcttcc tcaagttcgt ct 3241925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 419gatcagacga acttgaggaa gatca 2542032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 420cgacagacgc ctgatcttcc taccggactt tt 3242125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 421gatcaaaagt ccggtaggaa gatca 2542232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 422cgacagacgc ctgatcttcc gtgaaaggaa gt 3242325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 423gatcacttcc tttcacggaa gatca 2542432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 424cgacagacgc ctgatcttcc ggatatgttg ct 3242525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 425gatcagcaac atatccggaa gatca 2542632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 426cgacagacgc ctgatcttcc gctaaatgtc ct 3242725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 427gatcaggaca tttagcggaa gatca 2542832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 428cgacagacgc ctgatcttcc gaaactatgc ct 3242925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 429gatcaggcat agtttcggaa gatca 2543032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 430cgacagacgc ctgatcttcc actaggcaaa ct 3243125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 431gatcagtttg cctagtggaa gatca 2543232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 432cgacagacgc ctgatcttcc acgaatagca ct 3243325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 433gatcagtgct attcgtggaa gatca 2543432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 434cgacagacgc ctgatcttcc acgaaggaat ct 3243525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 435gatcagattc cttcgtggaa gatca 2543632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 436cgacagacgc ctgatcttcc accagagaac tt 3243725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 437gatcaagttc tctggtggaa gatca 2543832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 438cgacagacgc ctgatcttcc acatacaggc tt 3243925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 439gatcaagcct gtatgtggaa gatca 2544032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 440cgacagacgc ctgatcttcc aagtccgttt ct 3244125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 441gatcagaaac ggacttggaa gatca 2544232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 442cgacagacgc ctgatcttca ttctggcact ct 3244325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 443gatcagagtg ccagaatgaa gatca 2544432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 444cgacagacgc ctgatcttca tgtagtgtgg ct 3244525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 445gatcagccac actacatgaa gatca 2544632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 446cgacagacgc ctgatcttca tggttgtgga ct 3244725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 447gatcagtcca caaccatgaa gatca 2544832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 448cgacagacgc ctgatcttca tcttacacgg ct 3244925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 449gatcagccgt gtaagatgaa gatca 2545032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 450cgacagacgc ctgatcttca tacggaacac ct 3245125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 451gatcaggtgt tccgtatgaa gatca 2545232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 452cgacagacgc ctgatcttca taacactcgg ct 3245325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 453gatcagccga gtgttatgaa gatca 2545432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 454cgacagacgc ctgatcttca gtgaccaaac ct 3245525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 455gatcaggttt ggtcactgaa gatca 2545632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 456cgacagacgc ctgatcttca gtcattccgt ct 3245725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 457gatcagacgg aatgactgaa gatca 2545832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 458cgacagacgc ctgatcttca gcatggaaag gt 3245925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 459gatcaccttt ccatgctgaa gatca 2546032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 460cgacagacgc ctgatcttca gcaaagagtc ct 3246125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 461gatcaggact ctttgctgaa gatca 2546232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 462cgacagacgc ctgatcttca gagtagagcg tt 3246325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 463gatcaacgct ctactctgaa gatca 2546432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 464cgacagacgc ctgatcttca gaaggagttg ct 3246525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 465gatcagcaac tccttctgaa gatca 2546632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 466cgacagacgc ctgatcttca cttagcggaa ct 3246725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 467gatcagttcc gctaagtgaa gatca 2546832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 468cgacagacgc ctgatcttca cggaggaaat gt 3246925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 469gatcacattt cctccgtgaa gatca 2547032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 470cgacagacgc ctgatcttca cacctggaaa ct 3247125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 471gatcagtttc caggtgtgaa gatca 2547232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 472cgacagacgc ctgatcttca caatctcagg ct 3247325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 473gatcagcctg agattgtgaa gatca 2547432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 474cgacagacgc ctgatcttca atgagtgtcc gt 3247525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 475gatcacggac actcattgaa gatca 2547632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 476cgacagacgc ctgatcttca atcacagagc ct 3247725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 477gatcaggctc tgtgattgaa gatca 2547832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 478cgacagacgc ctgatcttca aggctgaaag gt 3247925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 479gatcaccttt cagccttgaa gatca 2548032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 480cgacagacgc ctgatcttca agactaaccg ct 3248125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 481gatcagcggt tagtcttgaa gatca 2548232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 482cgacagacgc ctgatcttca accagtaagc ct 3248325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 483gatcaggctt actggttgaa gatca 2548432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 484cgacagacgc ctgatcttca aagtatccgc ct 3248525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 485gatcaggcgg atactttgaa gatca 2548632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 486cgacagacgc ctgatcttat tgccgagttc ct 3248725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 487gatcaggaac tcggcaataa gatca 2548832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 488cgacagacgc ctgatcttat tgccaccaca gt 3248925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 489gatcactgtg gtggcaataa gatca 2549032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 490cgacagacgc ctgatcttat tccgaacctg ct 3249125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 491gatcagcagg ttcggaataa gatca 2549232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 492cgacagacgc ctgatcttat tcagccgttc ct 3249325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 493gatcaggaac ggctgaataa gatca

2549432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 494cgacagacgc ctgatcttat gttgccaggt gt 3249525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 495gatcacacct ggcaacataa gatca 2549632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 496cgacagacgc ctgatcttat gcacacagac ct 3249725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 497gatcaggtct gtgtgcataa gatca 2549832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 498cgacagacgc ctgatcttat gcaaggagtc gt 3249925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 499gatcacgact ccttgcataa gatca 2550032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 500cgacagacgc ctgatcttat ctcgactgcc tt 3250125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 501gatcaaggca gtcgagataa gatca 2550232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 502cgacagacgc ctgatcttat cgccaagaag gt 3250325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 503gatcaccttc ttggcgataa gatca 2550432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 504cgacagacgc ctgatcttat cgcacctcaa gt 3250525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 505gatcacttga ggtgcgataa gatca 2550632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 506cgacagacgc ctgatcttat cgattggctg gt 3250725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 507gatcaccagc caatcgataa gatca 2550832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 508cgacagacgc ctgatcttat cattgccgac ct 3250925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 509gatcaggtcg gcaatgataa gatca 2551032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 510cgacagacgc ctgatcttat caggtgttcg ct 3251125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 511gatcagcgaa cacctgataa gatca 2551232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 512cgacagacgc ctgatcttat aggcggaaac gt 3251325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 513gatcacgttt ccgcctataa gatca 2551432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 514cgacagacgc ctgatcttat aggagcgagc at 3251525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 515gatcatgctc gctcctataa gatca 2551632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 516cgacagacgc ctgatcttat agaacgcacg gt 3251725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 517gatcaccgtg cgttctataa gatca 2551832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 518cgacagacgc ctgatcttat acggcacaag gt 3251925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 519gatcaccttg tgccgtataa gatca 2552032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 520cgacagacgc ctgatcttat accttgtgcc gt 3252125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 521gatcacggca caaggtataa gatca 2552232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 522cgacagacgc ctgatcttat aagccttgcc gt 3252325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 523gatcacggca aggcttataa gatca 2552432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 524cgacagacgc ctgatcttag ttaacaccgc ct 3252525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 525gatcaggcgg tgttaactaa gatca 2552632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 526cgacagacgc ctgatcttag tctatggcgg tt 3252725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 527gatcaaccgc catagactaa gatca 2552832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 528cgacagacgc ctgatcttag taccgctttg gt 3252925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 529gatcaccaaa gcggtactaa gatca 2553032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 530cgacagacgc ctgatcttag gtggctttac gt 3253125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 531gatcacgtaa agccacctaa gatca 2553232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 532cgacagacgc ctgatcttag gtacggcttt gt 3253325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 533gatcacaaag ccgtacctaa gatca 2553432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 534cgacagacgc ctgatcttag gcttcactgg tt 3253525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 535gatcaaccag tgaagcctaa gatca 2553632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 536cgacagacgc ctgatcttag gccatcaaca ct 3253725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 537gatcagtgtt gatggcctaa gatca 2553832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 538cgacagacgc ctgatcttag gattgaacgg ct 3253925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 539gatcagccgt tcaatcctaa gatca 2554032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 540cgacagacgc ctgatcttag ctcaaacgtc ct 3254125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 541gatcaggacg tttgagctaa gatca 2554232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 542cgacagacgc ctgatcttag cggattggtt ct 3254325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 543gatcagaacc aatccgctaa gatca 2554432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 544cgacagacgc ctgatcttag atttccacgg ct 3254525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 545gatcagccgt ggaaatctaa gatca 2554632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 546cgacagacgc ctgatcttag attgccgagt gt 3254725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 547gatcacactc ggcaatctaa gatca 2554832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 548cgacagacgc ctgatcttag aacgtggaag ct 3254925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 549gatcagcttc cacgttctaa gatca 2555032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 550cgacagacgc ctgatcttag aaactccgca ct 3255125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 551gatcagtgcg gagtttctaa gatca 2555232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 552cgacagacgc ctgatcttac ttcggacaac ct 3255325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 553gatcaggttg tccgaagtaa gatca 2555432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 554cgacagacgc ctgatcttac tgtatccgcc tt 3255525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 555gatcaaggcg gatacagtaa gatca 2555632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 556cgacagacgc ctgatcttac tgctgactcc tt 3255725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 557gatcaaggag tcagcagtaa gatca 2555832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 558cgacagacgc ctgatcttac tcgtgaaagc ct 3255925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 559gatcaggctt tcacgagtaa gatca 2556032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 560cgacagacgc ctgatcttac tcgaagccaa ct 3256125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 561gatcagttgg cttcgagtaa gatca 2556232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 562cgacagacgc ctgatcttac tccagtttgc ct 3256325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 563gatcaggcaa actggagtaa gatca 2556432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 564cgacagacgc ctgatcttac tattgtggcg gt 3256525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 565gatcaccgcc acaatagtaa gatca 2556632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 566cgacagacgc ctgatcttac tagacacacg ct 3256725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 567gatcagcgtg tgtctagtaa gatca 2556832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 568cgacagacgc ctgatcttac ggtctttcca ct 3256925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 569gatcagtgga aagaccgtaa gatca 2557032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 570cgacagacgc ctgatcttac ctaacagccg at 3257125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 571gatcatcggc tgttaggtaa gatca 2557232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 572cgacagacgc ctgatcttac cggtggttag tt 3257325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 573gatcaactaa ccaccggtaa gatca 2557432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 574cgacagacgc ctgatcttac cataagtgcc gt 3257525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 575gatcacggca cttatggtaa gatca 2557632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 576cgacagacgc ctgatcttac caatgtccag ct 3257725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 577gatcagctgg acattggtaa gatca 2557832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 578cgacagacgc ctgatcttac atgttcgctc ct 3257925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 579gatcaggagc gaacatgtaa gatca 2558032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 580cgacagacgc ctgatcttac atcatccagc gt 3258125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 581gatcacgctg gatgatgtaa gatca 2558232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 582cgacagacgc ctgatcttac acaagatcgc ct 3258325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 583gatcaggcga tcttgtgtaa gatca 2558432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 584cgacagacgc ctgatcttac aaagtccgtc ct 3258525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 585gatcaggacg gactttgtaa gatca 2558632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 586cgacagacgc ctgatcttaa ttcgtccgtc ct 3258725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 587gatcaggacg gacgaattaa gatca 2558832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 588cgacagacgc ctgatcttaa tgaggagcac gt 3258925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 589gatcacgtgc tcctcattaa gatca 2559032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 590cgacagacgc ctgatcttaa gtgaagaccg ct 3259125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 591gatcagcggt cttcacttaa gatca 2559232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 592cgacagacgc ctgatcttaa gtcgtggttc gt 3259325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 593gatcacgaac cacgacttaa gatca 2559432DNAArtificial SequenceDescription of Artificial Sequence Synthetic

oligonucleotide 594cgacagacgc ctgatcttaa gctctccgtt gt 3259525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 595gatcacaacg gagagcttaa gatca 2559632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 596cgacagacgc ctgatcttaa gccactccag at 3259725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 597gatcatctgg agtggcttaa gatca 2559832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 598cgacagacgc ctgatcttaa gagaggtgcc at 3259925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 599gatcatggca cctctcttaa gatca 2560032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 600cgacagacgc ctgatcttaa gacctcaccg at 3260125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 601gatcatcggt gaggtcttaa gatca 2560232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 602cgacagacgc ctgatcttaa ctcaaccgga ct 3260325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 603gatcagtccg gttgagttaa gatca 2560432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 604cgacagacgc ctgatcttaa cctctcgctt gt 3260525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 605gatcacaagc gagaggttaa gatca 2560632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 606cgacagacgc ctgatcttaa ccgctttcct gt 3260725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 607gatcacagga aagcggttaa gatca 2560832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 608cgacagacgc ctgatcttaa cactctggca ct 3260925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 609gatcagtgcc agagtgttaa gatca 2561032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 610cgacagacgc ctgatcttaa atgcggagga ct 3261125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 611gatcagtcct ccgcatttaa gatca 2561232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 612cgacagacgc ctgatcttaa ataggctggc gt 3261325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 613gatcacgcca gcctatttaa gatca 2561432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 614cgacagacgc ctgatcttaa acctcggaca ct 3261525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 615gatcagtgtc cgaggtttaa gatca 2561632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 616cgacagacgc ctgatctgtt tgaaccgagg at 3261725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 617gatcatcctc ggttcaaaca gatca 2561832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 618cgacagacgc ctgatctgtt tcgacttcac gt 3261925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 619gatcacgtga agtcgaaaca gatca 2562032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 620cgacagacgc ctgatctgtt tcacgaccaa gt 3262125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 621gatcacttgg tcgtgaaaca gatca 2562232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 622cgacagacgc ctgatctgtt tatgccactc gt 3262325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 623gatcacgagt ggcataaaca gatca 2562432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 624cgacagacgc ctgatctgtt taatcgaccg ct 3262525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 625gatcagcggt cgattaaaca gatca 2562632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 626cgacagacgc ctgatctgtt gtaatggctc gt 3262725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 627gatcacgagc cattacaaca gatca 2562832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 628cgacagacgc ctgatctgtt ggttcaagtc gt 3262925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 629gatcacgact tgaaccaaca gatca 2563032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 630cgacagacgc ctgatctgtt ggtaactggc tt 3263125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 631gatcaagcca gttaccaaca gatca 2563232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 632cgacagacgc ctgatctgtt ggcataacga gt 3263325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 633gatcactcgt tatgccaaca gatca 2563432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 634cgacagacgc ctgatctgtt ggaacagcaa gt 3263525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 635gatcacttgc tgttccaaca gatca 2563632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 636cgacagacgc ctgatctgtt gctctcaacc tt 3263725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 637gatcaaggtt gagagcaaca gatca 2563832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 638cgacagacgc ctgatctgtt gctcaatctc gt 3263925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 639gatcacgaga ttgagcaaca gatca 2564032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 640cgacagacgc ctgatctgtt gcaggaaagt ct 3264125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 641gatcagactt tcctgcaaca gatca 2564232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 642cgacagacgc ctgatctgtt gcaaacctct ct 3264325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 643gatcagagag gtttgcaaca gatca 2564432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 644cgacagacgc ctgatctgtt gaatgccgta gt 3264525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 645gatcactacg gcattcaaca gatca 2564632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 646cgacagacgc ctgatctgtt ctggaggcat tt 3264725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 647gatcaaatgc ctccagaaca gatca 2564832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 648cgacagacgc ctgatctgtt ctgcaacctc tt 3264925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 649gatcaagagg ttgcagaaca gatca 2565032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 650cgacagacgc ctgatctgtt cgaggaagac at 3265125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 651gatcatgtct tcctcgaaca gatca 2565232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 652cgacagacgc ctgatctgtt cctatcacgc tt 3265325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 653gatcaagcgt gataggaaca gatca 2565432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 654cgacagacgc ctgatctgtt ccgaaagcaa gt 3265525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 655gatcacttgc tttcggaaca gatca 2565632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 656cgacagacgc ctgatctgtt cagttccacc at 3265725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 657gatcatggtg gaactgaaca gatca 2565832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 658cgacagacgc ctgatctgtt cagagatggc at 3265925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 659gatcatgcca tctctgaaca gatca 2566032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 660cgacagacgc ctgatctgtt cacagccaaa gt 3266125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 661gatcactttg gctgtgaaca gatca 2566232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 662cgacagacgc ctgatctgtt caaatgcgga gt 3266325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 663gatcactccg catttgaaca gatca 2566432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 664cgacagacgc ctgatctgtt atgaagcacc gt 3266525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 665gatcacggtg cttcataaca gatca 2566632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 666cgacagacgc ctgatctgtt agttgatgcc gt 3266725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 667gatcacggca tcaactaaca gatca 2566832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 668cgacagacgc ctgatctgtt agaaagcgca gt 3266925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 669gatcactgcg ctttctaaca gatca 2567032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 670cgacagacgc ctgatctgtt acacagctcc at 3267125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 671gatcatggag ctgtgtaaca gatca 2567232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 672cgacagacgc ctgatctgtg tcattagcgg at 3267325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 673gatcatccgc taatgacaca gatca 2567432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 674cgacagacgc ctgatctgtg tatgttcgca gt 3267525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 675gatcactgcg aacatacaca gatca 2567632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 676cgacagacgc ctgatctgtg tataccgcct tt 3267725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 677gatcaaaggc ggtatacaca gatca 2567832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 678cgacagacgc ctgatctgtg taaaccgcat gt 3267925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 679gatcacatgc ggtttacaca gatca 2568032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 680cgacagacgc ctgatctgtg gtcaattcgt gt 3268125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 681gatcacacga attgaccaca gatca 2568232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 682cgacagacgc ctgatctgtg cttcaaaggt gt 3268325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 683gatcacacct ttgaagcaca gatca 2568432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 684cgacagacgc ctgatctgtg cagaggaaac tt 3268525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 685gatcaagttt cctctgcaca gatca 2568632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 686cgacagacgc ctgatctgtg caatatcggt gt 3268725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 687gatcacaccg atattgcaca gatca 2568832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 688cgacagacgc ctgatctgtg aggttccagt tt 3268925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 689gatcaaactg gaacctcaca gatca 2569032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 690cgacagacgc ctgatctgtg aattccttgc gt 3269125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 691gatcacgcaa ggaattcaca gatca 2569232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 692cgacagacgc ctgatctgtg aagtaagccg at 3269325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 693gatcatcggc ttacttcaca gatca 2569432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 694cgacagacgc ctgatctgtc tttgaacgtg gt

3269525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 695gatcaccacg ttcaaagaca gatca 2569632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 696cgacagacgc ctgatctgtc tgaaaccacc at 3269725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 697gatcatggtg gtttcagaca gatca 2569832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 698cgacagacgc ctgatctgtc tcgaaacctg tt 3269925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 699gatcaacagg tttcgagaca gatca 2570032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 700cgacagacgc ctgatctgtc gtaagaggca at 3270125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 701gatcattgcc tcttacgaca gatca 2570232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 702cgacagacgc ctgatctgtc gaaacttggt gt 3270325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 703gatcacacca agtttcgaca gatca 2570432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 704cgacagacgc ctgatctgtc ctatgttgcc at 3270525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 705gatcatggca acataggaca gatca 2570632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 706cgacagacgc ctgatctgtc cacctaaacg at 3270725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 707gatcatcgtt taggtggaca gatca 2570832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 708cgacagacgc ctgatctgtc caaatcacag ct 3270925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 709gatcagctgt gatttggaca gatca 2571032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 710cgacagacgc ctgatctgtc caaagctacc at 3271125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 711gatcatggta gctttggaca gatca 2571232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 712cgacagacgc ctgatctgtc actttgcatc ct 3271325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 713gatcaggatg caaagtgaca gatca 2571432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 714cgacagacgc ctgatctgtc aaacagccat ct 3271525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 715gatcagatgg ctgtttgaca gatca 2571632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 716cgacagacgc ctgatctgta tttggacacg ct 3271725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 717gatcagcgtg tccaaataca gatca 2571832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 718cgacagacgc ctgatctgta tttccgaccg tt 3271925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 719gatcaacggt cggaaataca gatca 2572032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 720cgacagacgc ctgatctgta ttgacgcttg gt 3272125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 721gatcaccaag cgtcaataca gatca 2572232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 722cgacagacgc ctgatctgta tacgcaaacc gt 3272325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 723gatcacggtt tgcgtataca gatca 2572432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 724cgacagacgc ctgatctgta taacgccacc at 3272525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 725gatcatggtg gcgttataca gatca 2572632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 726cgacagacgc ctgatctgta gtgtcaaagc gt 3272725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 727gatcacgctt tgacactaca gatca 2572832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 728cgacagacgc ctgatctgta ggcggatttc tt 3272925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 729gatcaagaaa tccgcctaca gatca 2573032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 730cgacagacgc ctgatctgta ggcaaacggt at 3273125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 731gatcataccg tttgcctaca gatca 2573232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 732cgacagacgc ctgatctgta cgtcctttcc at 3273325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 733gatcatggaa aggacgtaca gatca 2573432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 734cgacagacgc ctgatctgta ccacacgctt at 3273525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 735gatcataagc gtgtggtaca gatca 2573632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 736cgacagacgc ctgatctgta atgttgtccg ct 3273725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 737gatcagcgga caacattaca gatca 2573832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 738cgacagacgc ctgatctgta atccgagcca tt 3273925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 739gatcaatggc tcggattaca gatca 2574032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 740cgacagacgc ctgatctgta agttccgcat gt 3274125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 741gatcacatgc ggaacttaca gatca 2574232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 742cgacagacgc ctgatctgta agtccgttgg tt 3274325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 743gatcaaccaa cggacttaca gatca 2574432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 744cgacagacgc ctgatctgta acgtttgctg gt 3274525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 745gatcaccagc aaacgttaca gatca 2574632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 746cgacagacgc ctgatctgta aattggcacg gt 3274725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 747gatcaccgtg ccaatttaca gatca 2574832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 748cgacagacgc ctgatctgta aacgatggca gt 3274925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 749gatcactgcc atcgtttaca gatca 2575032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 750cgacagacgc ctgatctggt ttcaatgtcg gt 3275125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 751gatcaccgac attgaaacca gatca 2575232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 752cgacagacgc ctgatctggt tgatgacctg tt 3275325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 753gatcaacagg tcatcaacca gatca 2575432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 754cgacagacgc ctgatctggt tgaccgaaag at 3275525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 755gatcatcttt cggtcaacca gatca 2575632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 756cgacagacgc ctgatctggt tcttccacca at 3275725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 757gatcattggt ggaagaacca gatca 2575832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 758cgacagacgc ctgatctggt tcttaccacg tt 3275925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 759gatcaacgtg gtaagaacca gatca 2576032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 760cgacagacgc ctgatctggt tctattgccg at 3276125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 761gatcatcggc aatagaacca gatca 2576232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 762cgacagacgc ctgatctggt tccaatcacg at 3276325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 763gatcatcgtg attggaacca gatca 2576432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 764cgacagacgc ctgatctggt tcaacattcg gt 3276525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 765gatcaccgaa tgttgaacca gatca 2576632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 766cgacagacgc ctgatctggt taaagccgag at 3276725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 767gatcatctcg gctttaacca gatca 2576832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 768cgacagacgc ctgatctggt gttaccgatg tt 3276925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 769gatcaacatc ggtaacacca gatca 2577032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 770cgacagacgc ctgatctggt gaaccaaatg ct 3277125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 771gatcagcatt tggttcacca gatca 2577232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 772cgacagacgc ctgatctggt gaaatcgcaa gt 3277325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 773gatcacttgc gatttcacca gatca 2577432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 774cgacagacgc ctgatctggt ccaattctcg tt 3277525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 775gatcaacgag aattggacca gatca 2577632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 776cgacagacgc ctgatctggt cacaaacacc tt 3277725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 777gatcaaggtg tttgtgacca gatca 2577832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 778cgacagacgc ctgatctggt ataacgagcg at 3277925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 779gatcatcgct cgttatacca gatca 2578032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 780cgacagacgc ctgatctggt aggtttcagc at 3278125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 781gatcatgctg aaacctacca gatca 2578232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 782cgacagacgc ctgatctggt actccaaacg at 3278325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 783gatcatcgtt tggagtacca gatca 2578432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 784cgacagacgc ctgatctggt acacaaatcg ct 3278525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 785gatcagcgat ttgtgtacca gatca 2578632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 786cgacagacgc ctgatctggt acaaacactg ct 3278725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 787gatcagcagt gtttgtacca gatca 2578832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 788cgacagacgc ctgatctggt aagacgcaat gt 3278925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 789gatcacattg cgtcttacca gatca 2579032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 790cgacagacgc ctgatctggt aaatgcaacg gt 3279125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 791gatcaccgtt gcatttacca gatca 2579232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 792cgacagacgc ctgatctggt aaagcacatc gt 3279325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 793gatcacgatg tgctttacca gatca 2579432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 794cgacagacgc ctgatctggc ttcctaaacg tt 3279525DNAArtificial SequenceDescription of

Artificial Sequence Synthetic oligonucleotide 795gatcaacgtt taggaagcca gatca 2579632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 796cgacagacgc ctgatctggc taaatgacgt gt 3279725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 797gatcacacgt catttagcca gatca 2579832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 798cgacagacgc ctgatctggc taaacacctc at 3279925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 799gatcatgagg tgtttagcca gatca 2580032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 800cgacagacgc ctgatctggc ctcaaatacc at 3280125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 801gatcatggta tttgaggcca gatca 2580232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 802cgacagacgc ctgatctggc atttcaacca gt 3280325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 803gatcactggt tgaaatgcca gatca 2580432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 804cgacagacgc ctgatctggc acaagaggat tt 3280525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 805gatcaaatcc tcttgtgcca gatca 2580632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 806cgacagacgc ctgatctggc aatttgacag gt 3280725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 807gatcacctgt caaattgcca gatca 2580832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 808cgacagacgc ctgatctggc aacttcatcc tt 3280925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 809gatcaaggat gaagttgcca gatca 2581032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 810cgacagacgc ctgatctggc aacaatccat ct 3281125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 811gatcagatgg attgttgcca gatca 2581232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 812cgacagacgc ctgatctgga tttcatgtgc gt 3281325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 813gatcacgcac atgaaatcca gatca 2581432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 814cgacagacgc ctgatctgga ttgtttcacg gt 3281525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 815gatcaccgtg aaacaatcca gatca 2581632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 816cgacagacgc ctgatctgga ttgtcactgg tt 3281725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 817gatcaaccag tgacaatcca gatca 2581832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 818cgacagacgc ctgatctgga ttagctccgt tt 3281925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 819gatcaaacgg agctaatcca gatca 2582032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 820cgacagacgc ctgatctgga tgtttacgct gt 3282125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 821gatcacagcg taaacatcca gatca 2582232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 822cgacagacgc ctgatctgga tcacaacatg ct 3282325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 823gatcagcatg ttgtgatcca gatca 2582432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 824cgacagacgc ctgatctgga gttacggctt tt 3282525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 825gatcaaaagc cgtaactcca gatca 2582632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 826cgacagacgc ctgatctgga ggacttcgtt tt 3282725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 827gatcaaaacg aagtcctcca gatca 2582832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 828cgacagacgc ctgatctgga ctccacacaa tt 3282925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 829gatcaattgt gtggagtcca gatca 2583032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 830cgacagacgc ctgatctgga ctattctgcg tt 3283125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 831gatcaacgca gaatagtcca gatca 2583232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 832cgacagacgc ctgatctgga caccatttcg at 3283325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 833gatcatcgaa atggtgtcca gatca 2583432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 834cgacagacgc ctgatctgga caatcaccag tt 3283525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 835gatcaactgg tgattgtcca gatca 2583632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 836cgacagacgc ctgatctgga attgtgcctt gt 3283725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 837gatcacaagg cacaattcca gatca 2583832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 838cgacagacgc ctgatctgga attgtacgca gt 3283925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 839gatcactgcg tacaattcca gatca 2584032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 840cgacagacgc ctgatctgga atgcaaactg gt 3284125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 841gatcaccagt ttgcattcca gatca 2584232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 842cgacagacgc ctgatctgga agatgccgtt at 3284325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 843gatcataacg gcatcttcca gatca 2584432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 844cgacagacgc ctgatctgga acatcagcct tt 3284525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 845gatcaaaggc tgatgttcca gatca 2584632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 846cgacagacgc ctgatctgga acatagagcg tt 3284725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 847gatcaacgct ctatgttcca gatca 2584832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 848cgacagacgc ctgatctgga aactaaggcg tt 3284925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 849gatcaacgcc ttagtttcca gatca 2585032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 850cgacagacgc ctgatctgga aacaccttgg at 3285125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 851gatcatccaa ggtgtttcca gatca 2585232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 852cgacagacgc ctgatctgct ttcacacttc gt 3285325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 853gatcacgaag tgtgaaagca gatca 2585432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 854cgacagacgc ctgatctgct ttaatgcgag gt 3285525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 855gatcacctcg cattaaagca gatca 2585632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 856cgacagacgc ctgatctgct tgaaccatcc tt 3285725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 857gatcaaggat ggttcaagca gatca 2585832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 858cgacagacgc ctgatctgct ggaaagtgaa ct 3285925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 859gatcagttca ctttccagca gatca 2586032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 860cgacagacgc ctgatctgct gaagacaacc tt 3286125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 861gatcaaggtt gtcttcagca gatca 2586232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 862cgacagacgc ctgatctgct ccataaagcc tt 3286325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 863gatcaaggct ttatggagca gatca 2586432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 864cgacagacgc ctgatctgct catttcctcg at 3286525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 865gatcatcgag gaaatgagca gatca 2586632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 866cgacagacgc ctgatctgct caccaacaga tt 3286725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 867gatcaatctg ttggtgagca gatca 2586832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 868cgacagacgc ctgatctgct cacaaatacc gt 3286925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 869gatcacggta tttgtgagca gatca 2587032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 870cgacagacgc ctgatctgct atttggcgat ct 3287125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 871gatcagatcg ccaaatagca gatca 2587232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 872cgacagacgc ctgatctgct atttacgcca ct 3287325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 873gatcagtggc gtaaatagca gatca 2587432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 874cgacagacgc ctgatctgct attgctcctg at 3287525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 875gatcatcagg agcaatagca gatca 2587632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 876cgacagacgc ctgatctgct accaaaccag tt 3287725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 877gatcaactgg tttggtagca gatca 2587832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 878cgacagacgc ctgatctgct aaggcaaact gt 3287925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 879gatcacagtt tgccttagca gatca 2588032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 880cgacagacgc ctgatctgct aaagagtggc at 3288125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 881gatcatgcca ctctttagca gatca 2588232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 882cgacagacgc ctgatctgcg tttactcctc at 3288325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 883gatcatgagg agtaaacgca gatca 2588432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 884cgacagacgc ctgatctgcg ttaatcctcc tt 3288525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 885gatcaaggag gattaacgca gatca 2588632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 886cgacagacgc ctgatctgcg aatctcttgt gt 3288725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 887gatcacacaa gagattcgca gatca 2588832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 888cgacagacgc ctgatctgcg aaatacaggt gt 3288925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 889gatcacacct gtatttcgca gatca 2589032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 890cgacagacgc ctgatctgcg aaacattgag gt 3289125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 891gatcacctca atgtttcgca gatca 2589232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 892cgacagacgc ctgatctgcc ttaaactccg at 3289325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 893gatcatcgga gtttaaggca gatca 2589432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 894cgacagacgc ctgatctgcc tggaaattgt gt 3289525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 895gatcacacaa

tttccaggca gatca 2589632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 896cgacagacgc ctgatctgcc tccttaatcg tt 3289725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 897gatcaacgat taaggaggca gatca 2589832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 898cgacagacgc ctgatctgcc ggataaaggt tt 3289925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 899gatcaaacct ttatccggca gatca 2590032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 900cgacagacgc ctgatctgcc gcaaataatc ct 3290125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 901gatcaggatt atttgcggca gatca 2590232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 902cgacagacgc ctgatctgcc attgaaacac ct 3290325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 903gatcaggtgt ttcaatggca gatca 2590432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 904cgacagacgc ctgatctgcc ataatgacac gt 3290525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 905gatcacgtgt cattatggca gatca 2590632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 906cgacagacgc ctgatctgcc aattgacctc tt 3290725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 907gatcaagagg tcaattggca gatca 2590832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 908cgacagacgc ctgatctgcc aatatcctcg tt 3290925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 909gatcaacgag gatattggca gatca 2591032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 910cgacagacgc ctgatctgca ttccaactac gt 3291125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 911gatcacgtag ttggaatgca gatca 2591232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 912cgacagacgc ctgatctgca ttaccagacg at 3291325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 913gatcatcgtc tggtaatgca gatca 2591432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 914cgacagacgc ctgatctgca tgatttggct ct 3291525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 915gatcagagcc aaatcatgca gatca 2591632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 916cgacagacgc ctgatctgca tatacgccac tt 3291725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 917gatcaagtgg cgtatatgca gatca 2591832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 918cgacagacgc ctgatctgca tataccaccg tt 3291925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 919gatcaacggt ggtatatgca gatca 2592032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 920cgacagacgc ctgatctgca tacaaggctc at 3292125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 921gatcatgagc cttgtatgca gatca 2592232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 922cgacagacgc ctgatctgca taaagatgcc gt 3292325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 923gatcacggca tctttatgca gatca 2592432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 924cgacagacgc ctgatctgca catatcaacc gt 3292525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 925gatcacggtt gatatgtgca gatca 2592632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 926cgacagacgc ctgatctgca cactttatcc gt 3292725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 927gatcacggat aaagtgtgca gatca 2592832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 928cgacagacgc ctgatctgca atttggtcga gt 3292925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 929gatcactcga ccaaattgca gatca 2593032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 930cgacagacgc ctgatctgca atacacgtca ct 3293125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 931gatcagtgac gtgtattgca gatca 2593232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 932cgacagacgc ctgatctgca agttagtcgg at 3293325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 933gatcatccga ctaacttgca gatca 2593432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 934cgacagacgc ctgatctgca actcctcatg tt 3293525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 935gatcaacatg aggagttgca gatca 2593632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 936cgacagacgc ctgatctgca acattcagac ct 3293725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 937gatcaggtct gaatgttgca gatca 2593832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 938cgacagacgc ctgatctgca aatgatccac ct 3293925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 939gatcaggtgg atcatttgca gatca 2594032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 940cgacagacgc ctgatctgca aagcctcact at 3294125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 941gatcatagtg aggctttgca gatca 2594232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 942cgacagacgc ctgatctgca aactctcaac gt 3294325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 943gatcacgttg agagtttgca gatca 2594432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 944cgacagacgc ctgatctgca aacctgtcct at 3294525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 945gatcatagga caggtttgca gatca 2594632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 946cgacagacgc ctgatctgat tggtgcttac gt 3294725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 947gatcacgtaa gcaccaatca gatca 2594832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 948cgacagacgc ctgatctgat tctgattggc gt 3294925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 949gatcacgcca atcagaatca gatca 2595032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 950cgacagacgc ctgatctgat tcgcatctcc tt 3295125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 951gatcaaggag atgcgaatca gatca 2595232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 952cgacagacgc ctgatctgat tatcgttgcc gt 3295325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 953gatcacggca acgataatca gatca 2595432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 954cgacagacgc ctgatctgat gctaaaccgt gt 3295525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 955gatcacacgg tttagcatca gatca 2595632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 956cgacagacgc ctgatctgat ctccatcgct tt 3295725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 957gatcaaagcg atggagatca gatca 2595832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 958cgacagacgc ctgatctgat ctacgccaca at 3295925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 959gatcattgtg gcgtagatca gatca 2596032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 960cgacagacgc ctgatctgat ccttgcacct tt 3296125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 961gatcaaaggt gcaaggatca gatca 2596232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 962cgacagacgc ctgatctgat atttgctcgc ct 3296325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 963gatcaggcga gcaaatatca gatca 2596432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 964cgacagacgc ctgatctgat atttgcgcct gt 3296525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 965gatcacaggc gcaaatatca gatca 2596632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 966cgacagacgc ctgatctgat agtgctttgc gt 3296725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 967gatcacgcaa agcactatca gatca 2596832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 968cgacagacgc ctgatctgat aatgccgtgt gt 3296925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 969gatcacacac ggcattatca gatca 2597032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 970cgacagacgc ctgatctgat aatcaccgcc at 3297125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 971gatcatggcg gtgattatca gatca 2597232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 972cgacagacgc ctgatctgat aagtcgtggc at 3297325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 973gatcatgcca cgacttatca gatca 2597432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 974cgacagacgc ctgatctgat aactgtggcg at 3297525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 975gatcatcgcc acagttatca gatca 2597632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 976cgacagacgc ctgatctgag ttgaaatgcc gt 3297725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 977gatcacggca tttcaactca gatca 2597832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 978cgacagacgc ctgatctgag tcaaactccg tt 3297925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 979gatcaacgga gtttgactca gatca 2598032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 980cgacagacgc ctgatctgag taatccgcac at 3298125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 981gatcatgtgc ggattactca gatca 2598232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 982cgacagacgc ctgatctgag gtttgttcac gt 3298325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 983gatcacgtga acaaacctca gatca 2598432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 984cgacagacgc ctgatctgag gccattgttt gt 3298525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 985gatcacaaac aatggcctca gatca 2598632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 986cgacagacgc ctgatctgag gataaacggc tt 3298725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 987gatcaagccg tttatcctca gatca 2598832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 988cgacagacgc ctgatctgag cgaaatcatg gt 3298925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 989gatcaccatg atttcgctca gatca 2599032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 990cgacagacgc ctgatctgag cctccacaat tt 3299125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 991gatcaaattg tggaggctca gatca 2599232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 992cgacagacgc ctgatctgag atacaaccgc tt 3299325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 993gatcaagcgg ttgtatctca gatca 2599432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 994cgacagacgc ctgatctgag ataacgctcg at 3299525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 995gatcatcgag cgttatctca gatca

2599632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 996cgacagacgc ctgatctgag acttatgcgg tt 3299725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 997gatcaaccgc ataagtctca gatca 2599832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 998cgacagacgc ctgatctgag accacacact tt 3299925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 999gatcaaagtg tgtggtctca gatca 25100032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1000cgacagacgc ctgatctgag aatgctacgg tt 32100125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1001gatcaaccgt agcattctca gatca 25100232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1002cgacagacgc ctgatctgag aaccttgagc at 32100325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1003gatcatgctc aaggttctca gatca 25100432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1004cgacagacgc ctgatctgac tttgacggtt gt 32100525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1005gatcacaacc gtcaaagtca gatca 25100632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1006cgacagacgc ctgatctgac ttggatggct tt 32100725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1007gatcaaagcc atccaagtca gatca 25100832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1008cgacagacgc ctgatctgac ttccaaaccg at 32100925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1009gatcatcggt ttggaagtca gatca 25101032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1010cgacagacgc ctgatctgac taactgcacc at 32101125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1011gatcatggtg cagttagtca gatca 25101232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1012cgacagacgc ctgatctgac gtttcctcca tt 32101325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1013gatcaatgga ggaaacgtca gatca 25101432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1014cgacagacgc ctgatctgac cattcttccg at 32101525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1015gatcatcgga agaatggtca gatca 25101632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1016cgacagacgc ctgatctgac caactaaccg tt 32101725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1017gatcaacggt tagttggtca gatca 25101832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1018cgacagacgc ctgatctgac atgctttacg gt 32101925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1019gatcaccgta aagcatgtca gatca 25102032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1020cgacagacgc ctgatctgac aatggagacg tt 32102125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1021gatcaacgtc tccattgtca gatca 25102232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1022cgacagacgc ctgatctgaa tttgtccagc gt 32102325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1023gatcacgctg gacaaattca gatca 25102432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1024cgacagacgc ctgatctgaa tttgagcgga ct 32102525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1025gatcagtccg ctcaaattca gatca 25102632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1026cgacagacgc ctgatctgaa tttcagagcg gt 32102725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1027gatcaccgct ctgaaattca gatca 25102832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1028cgacagacgc ctgatctgaa tgtctctcgc tt 32102925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1029gatcaagcga gagacattca gatca 25103032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1030cgacagacgc ctgatctgaa tggtcttggc tt 32103125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1031gatcaagcca agaccattca gatca 25103232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1032cgacagacgc ctgatctgaa tgcctcttcc at 32103325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1033gatcatggaa gaggcattca gatca 25103432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1034cgacagacgc ctgatctgaa tgattgccga gt 32103525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1035gatcactcgg caatcattca gatca 25103632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1036cgacagacgc ctgatctgaa tgaactgagc gt 32103725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1037gatcacgctc agttcattca gatca 25103832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1038cgacagacgc ctgatctgaa tcgagaagcc tt 32103925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1039gatcaaggct tctcgattca gatca 25104032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1040cgacagacgc ctgatctgaa tcctcaccga at 32104125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1041gatcattcgg tgaggattca gatca 25104232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1042cgacagacgc ctgatctgaa tcatttggcg gt 32104325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1043gatcaccgcc aaatgattca gatca 25104432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1044cgacagacgc ctgatctgaa tatgcctcgg tt 32104525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1045gatcaaccga ggcatattca gatca 25104632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1046cgacagacgc ctgatctgaa gttgttgacc gt 32104725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1047gatcacggtc aacaacttca gatca 25104832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1048cgacagacgc ctgatctgaa gttcgcaaga gt 32104925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1049gatcactctt gcgaacttca gatca 25105032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1050cgacagacgc ctgatctgaa gttatggcac gt 32105125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1051gatcacgtgc cataacttca gatca 25105232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1052cgacagacgc ctgatctgaa ggcaattcga gt 32105325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1053gatcactcga attgccttca gatca 25105432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1054cgacagacgc ctgatctgaa gactcgttgg at 32105525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1055gatcatccaa cgagtcttca gatca 25105632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1056cgacagacgc ctgatctgaa gacacttccg at 32105725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1057gatcatcgga agtgtcttca gatca 25105832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1058cgacagacgc ctgatctgaa ctctttcacg ct 32105925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1059gatcagcgtg aaagagttca gatca 25106032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1060cgacagacgc ctgatctgaa cgtactcacc at 32106125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1061gatcatggtg agtacgttca gatca 25106232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1062cgacagacgc ctgatctgaa ccttgcttcc tt 32106325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1063gatcaaggaa gcaaggttca gatca 25106432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1064cgacagacgc ctgatctgaa attcgtgctg gt 32106525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1065gatcaccagc acgaatttca gatca 25106632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1066cgacagacgc ctgatctgaa attcctcgcc tt 32106725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1067gatcaaggcg aggaatttca gatca 25106832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1068cgacagacgc ctgatctgaa atgcttggac gt 32106925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1069gatcacgtcc aagcatttca gatca 25107032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1070cgacagacgc ctgatctgaa agtccaccga tt 32107125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1071gatcaatcgg tggactttca gatca 25107232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1072cgacagacgc ctgatctgaa actctgcaac ct 32107325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1073gatcaggttg cagagtttca gatca 25107432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1074cgacagacgc ctgatctgaa acggatggct at 32107525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1075gatcatagcc atccgtttca gatca 25107632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1076cgacagacgc ctgatctgaa accattccac gt 32107725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1077gatcacgtgg aatggtttca gatca 25107832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1078cgacagacgc ctgatctctt tgacggagtg tt 32107925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1079gatcaacact ccgtcaaaga gatca 25108032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1080cgacagacgc ctgatctctt tgaaggcagg at 32108125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1081gatcatcctg ccttcaaaga gatca 25108232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1082cgacagacgc ctgatctctt tcctaagccg tt 32108325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1083gatcaacggc ttaggaaaga gatca 25108432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1084cgacagacgc ctgatctctt gtgaggcgta tt 32108525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1085gatcaatacg cctcacaaga gatca 25108632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1086cgacagacgc ctgatctctt gccaacagaa ct 32108725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1087gatcagttct gttggcaaga gatca 25108832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1088cgacagacgc ctgatctctt gatatggcgg tt 32108925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1089gatcaaccgc catatcaaga gatca 25109032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1090cgacagacgc ctgatctctt gaggttagcg at 32109125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1091gatcatcgct aacctcaaga gatca 25109232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1092cgacagacgc ctgatctctt gaacacagca ct 32109325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1093gatcagtgct gtgttcaaga gatca 25109432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1094cgacagacgc ctgatctctt cttgaatcgc ct 32109525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1095gatcaggcga ttcaagaaga gatca 25109632DNAArtificial SequenceDescription of Artificial Sequence

Synthetic oligonucleotide 1096cgacagacgc ctgatctctt cgcaatgaac ct 32109725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1097gatcaggttc attgcgaaga gatca 25109832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1098cgacagacgc ctgatctctt ccaagaatcg ct 32109925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1099gatcagcgat tcttggaaga gatca 25110032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1100cgacagacgc ctgatctctt caacaagacg ct 32110125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1101gatcagcgtc ttgttgaaga gatca 25110232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1102cgacagacgc ctgatctctt agaggcgaac at 32110325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1103gatcatgttc gcctctaaga gatca 25110432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1104cgacagacgc ctgatctctt acatgaggcg tt 32110525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1105gatcaacgcc tcatgtaaga gatca 25110632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1106cgacagacgc ctgatctctt acagcaaagg ct 32110725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1107gatcagcctt tgctgtaaga gatca 25110832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1108cgacagacgc ctgatctctt aaggtggctg tt 32110925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1109gatcaacagc caccttaaga gatca 25111032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1110cgacagacgc ctgatctctt aaagcggatg ct 32111125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1111gatcagcatc cgctttaaga gatca 25111232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1112cgacagacgc ctgatctctg tttaagtggc gt 32111325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1113gatcacgcca cttaaacaga gatca 25111432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1114cgacagacgc ctgatctctg ttgtgaagtg ct 32111525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1115gatcagcact tcacaacaga gatca 25111632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1116cgacagacgc ctgatctctg taaacaacgc ct 32111725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1117gatcaggcgt tgtttacaga gatca 25111832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1118cgacagacgc ctgatctctg gtaaagtggc tt 32111925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1119gatcaagcca ctttaccaga gatca 25112032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1120cgacagacgc ctgatctctg gatcaaacgg tt 32112125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1121gatcaaccgt ttgatccaga gatca 25112232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1122cgacagacgc ctgatctctg ctaagaaccg tt 32112325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1123gatcaacggt tcttagcaga gatca 25112432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1124cgacagacgc ctgatctctg cataacgagg tt 32112525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1125gatcaacctc gttatgcaga gatca 25112632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1126cgacagacgc ctgatctctg cagaaaggag tt 32112725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1127gatcaactcc tttctgcaga gatca 25112832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1128cgacagacgc ctgatctctg acaggtggaa at 32112925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1129gatcatttcc acctgtcaga gatca 25113032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1130cgacagacgc ctgatctctg aataaggcgg at 32113125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1131gatcatccgc cttattcaga gatca 25113232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1132cgacagacgc ctgatctctg aacttggtgg tt 32113325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1133gatcaaccac caagttcaga gatca 25113432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1134cgacagacgc ctgatctctg aaccgcctaa at 32113525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1135gatcatttag gcggttcaga gatca 25113632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1136cgacagacgc ctgatctctg aaataccgcc tt 32113725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1137gatcaaggcg gtatttcaga gatca 25113832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1138cgacagacgc ctgatctctc tccgaaactg tt 32113925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1139gatcaacagt ttcggagaga gatca 25114032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1140cgacagacgc ctgatctctc gttgtaatgc ct 32114125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1141gatcaggcat tacaacgaga gatca 25114232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1142cgacagacgc ctgatctctc gacaaagagg tt 32114325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1143gatcaacctc tttgtcgaga gatca 25114432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1144cgacagacgc ctgatctctc gaatcaagcc tt 32114525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1145gatcaaggct tgattcgaga gatca 25114632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1146cgacagacgc ctgatctctc cggaaacact tt 32114725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1147gatcaaagtg tttccggaga gatca 25114832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1148cgacagacgc ctgatctctc caaacgagct at 32114925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1149gatcatagct cgtttggaga gatca 25115032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1150cgacagacgc ctgatctctc atttgtacgg ct 32115125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1151gatcagccgt acaaatgaga gatca 25115232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1152cgacagacgc ctgatctctc atcatttcgg ct 32115325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1153gatcagccga aatgatgaga gatca 25115432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1154cgacagacgc ctgatctctc agaatgccac at 32115525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1155gatcatgtgg cattctgaga gatca 25115632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1156cgacagacgc ctgatctctc aatcaggcac at 32115725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1157gatcatgtgc ctgattgaga gatca 25115832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1158cgacagacgc ctgatctctc aacggtcttc tt 32115925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1159gatcaagaag accgttgaga gatca 25116032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1160cgacagacgc ctgatctcta ttgccacgac tt 32116125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1161gatcaagtcg tggcaataga gatca 25116232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1162cgacagacgc ctgatctcta tgtttcacgg ct 32116325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1163gatcagccgt gaaacataga gatca 25116432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1164cgacagacgc ctgatctcta tcttggtgcg at 32116525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1165gatcatcgca ccaagataga gatca 25116632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1166cgacagacgc ctgatctcta gttggtgcag tt 32116725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1167gatcaactgc accaactaga gatca 25116832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1168cgacagacgc ctgatctcta gtggcaaggt tt 32116925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1169gatcaaacct tgccactaga gatca 25117032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1170cgacagacgc ctgatctcta ggtaaacggc at 32117125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1171gatcatgccg tttacctaga gatca 25117232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1172cgacagacgc ctgatctcta gagtgtgcgt tt 32117325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1173gatcaaacgc acactctaga gatca 25117432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1174cgacagacgc ctgatctcta ctgcgaaaca ct 32117525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1175gatcagtgtt tcgcagtaga gatca 25117632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1176cgacagacgc ctgatctcta atcacggcaa ct 32117725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1177gatcagttgc cgtgattaga gatca 25117832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1178cgacagacgc ctgatctcta agttgcgagg at 32117925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1179gatcatcctc gcaacttaga gatca 25118032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1180cgacagacgc ctgatctcta agtgctggtg tt 32118125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1181gatcaacacc agcacttaga gatca 25118232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1182cgacagacgc ctgatctcta aggaactgcg at 32118325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1183gatcatcgca gttccttaga gatca 25118432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1184cgacagacgc ctgatctcta aatgtccacg ct 32118525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1185gatcagcgtg gacatttaga gatca 25118632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1186cgacagacgc ctgatctcta aatcgccaac gt 32118725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1187gatcacgttg gcgatttaga gatca 25118832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1188cgacagacgc ctgatctcta aatacgtgcg gt 32118925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1189gatcaccgca cgtatttaga gatca 25119032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1190cgacagacgc ctgatctcta aaggcgatgg tt 32119125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1191gatcaaccat cgcctttaga gatca 25119232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1192cgacagacgc ctgatctcgt ttggaatggt ct 32119325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1193gatcagacca ttccaaacga gatca 25119432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1194cgacagacgc ctgatctcgt ttctcacagg tt 32119525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1195gatcaacctg tgagaaacga gatca 25119632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1196cgacagacgc ctgatctcgt ttcgaggtag tt

32119725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1197gatcaactac ctcgaaacga gatca 25119832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1198cgacagacgc ctgatctcgt ttacgatgtg gt 32119925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1199gatcaccaca tcgtaaacga gatca 25120032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1200cgacagacgc ctgatctcgt tgtgtgaagt ct 32120125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1201gatcagactt cacacaacga gatca 25120232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1202cgacagacgc ctgatctcgt tggtaattcg gt 32120325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1203gatcaccgaa ttaccaacga gatca 25120432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1204cgacagacgc ctgatctcgt tggaatctgg tt 32120525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1205gatcaaccag attccaacga gatca 25120632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1206cgacagacgc ctgatctcgt tggaagacag at 32120725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1207gatcatctgt cttccaacga gatca 25120832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1208cgacagacgc ctgatctcgt tcgttaggtg at 32120925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1209gatcatcacc taacgaacga gatca 25121032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1210cgacagacgc ctgatctcgt tcctcaacag at 32121125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1211gatcatctgt tgaggaacga gatca 25121232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1212cgacagacgc ctgatctcgt tcatttccga gt 32121325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1213gatcactcgg aaatgaacga gatca 25121432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1214cgacagacgc ctgatctcgt tcaactactg ct 32121525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1215gatcagcagt agttgaacga gatca 25121632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1216cgacagacgc ctgatctcgt tatggatgtg ct 32121725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1217gatcagcaca tccataacga gatca 25121832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1218cgacagacgc ctgatctcgt taagtctcgg tt 32121925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1219gatcaaccga gacttaacga gatca 25122032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1220cgacagacgc ctgatctcgt gtttaggtcg at 32122125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1221gatcatcgac ctaaacacga gatca 25122232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1222cgacagacgc ctgatctcgt ggcaataaag gt 32122325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1223gatcaccttt attgccacga gatca 25122432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1224cgacagacgc ctgatctcgt ggaaacagga tt 32122525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1225gatcaatcct gtttccacga gatca 25122632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1226cgacagacgc ctgatctcgt gacatttggt gt 32122725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1227gatcacacca aatgtcacga gatca 25122832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1228cgacagacgc ctgatctcgt atatcgcacc tt 32122925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1229gatcaaggtg cgatatacga gatca 25123032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1230cgacagacgc ctgatctcgt ataaggtcgc at 32123125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1231gatcatgcga ccttatacga gatca 25123232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1232cgacagacgc ctgatctcgt agtaaagcgg at 32123325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1233gatcatccgc tttactacga gatca 25123432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1234cgacagacgc ctgatctcgt aatgacgaag ct 32123525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1235gatcagcttc gtcattacga gatca 25123632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1236cgacagacgc ctgatctcgt aacataacgg ct 32123725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1237gatcagccgt tatgttacga gatca 25123832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1238cgacagacgc ctgatctcgt aacaagcact ct 32123925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1239gatcagagtg cttgttacga gatca 25124032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1240cgacagacgc ctgatctcgt aaatgcggaa gt 32124125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1241gatcacttcc gcatttacga gatca 25124232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1242cgacagacgc ctgatctcgt aaagtcggag at 32124325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1243gatcatctcc gactttacga gatca 25124432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1244cgacagacgc ctgatctcgt aaacaggagc tt 32124525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1245gatcaagctc ctgtttacga gatca 25124632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1246cgacagacgc ctgatctcgg ttgtattcgg at 32124725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1247gatcatccga atacaaccga gatca 25124832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1248cgacagacgc ctgatctcgg ttatttcgag ct 32124925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1249gatcagctcg aaataaccga gatca 25125032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1250cgacagacgc ctgatctcgg tgttaatgtg ct 32125125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1251gatcagcaca ttaacaccga gatca 25125232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1252cgacagacgc ctgatctcgg tatacaaggc at 32125325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1253gatcatgcct tgtataccga gatca 25125432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1254cgacagacgc ctgatctcgg taagtttgtg ct 32125525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1255gatcagcaca aacttaccga gatca 25125632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1256cgacagacgc ctgatctcgg taacaacctg at 32125725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1257gatcatcagg ttgttaccga gatca 25125832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1258cgacagacgc ctgatctcgg cgaatttatg gt 32125925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1259gatcaccata aattcgccga gatca 25126032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1260cgacagacgc ctgatctcgg atcacctttg tt 32126125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1261gatcaacaaa ggtgatccga gatca 25126232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1262cgacagacgc ctgatctcgg aacacaccta tt 32126325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1263gatcaatagg tgtgttccga gatca 25126432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1264cgacagacgc ctgatctcgc ttatctgtgg at 32126525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1265gatcatccac agataagcga gatca 25126632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1266cgacagacgc ctgatctcgc gatgtttaag gt 32126725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1267gatcacctta aacatcgcga gatca 25126832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1268cgacagacgc ctgatctcgc ctttaacctt gt 32126925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1269gatcacaagg ttaaaggcga gatca 25127032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1270cgacagacgc ctgatctcgc caaagaggta tt 32127125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1271gatcaatacc tctttggcga gatca 25127232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1272cgacagacgc ctgatctcga tttggttacg gt 32127325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1273gatcaccgta accaaatcga gatca 25127432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1274cgacagacgc ctgatctcga tctggtttgg at 32127525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1275gatcatccaa accagatcga gatca 25127632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1276cgacagacgc ctgatctcga ggcaaatagg tt 32127725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1277gatcaaccta tttgcctcga gatca 25127832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1278cgacagacgc ctgatctcga atgtgtgact gt 32127925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1279gatcacagtc acacattcga gatca 25128032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1280cgacagacgc ctgatctcga acttctggtg at 32128125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1281gatcatcacc agaagttcga gatca 25128232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1282cgacagacgc ctgatctcga aatctaggcg at 32128325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1283gatcatcgcc tagatttcga gatca 25128432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1284cgacagacgc ctgatctcga aacagtggag tt 32128525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1285gatcaactcc actgtttcga gatca 25128632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1286cgacagacgc ctgatctcct ttcagtgtcc at 32128725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1287gatcatggac actgaaagga gatca 25128832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1288cgacagacgc ctgatctcct ttaaggagcg at 32128925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1289gatcatcgct ccttaaagga gatca 25129032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1290cgacagacgc ctgatctcct tctattcggc at 32129125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1291gatcatgccg aatagaagga gatca 25129232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1292cgacagacgc ctgatctcct tattccagcg tt 32129325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1293gatcaacgct ggaataagga gatca 25129432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1294cgacagacgc ctgatctcct taactttgcc gt 32129525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1295gatcacggca aagttaagga gatca 25129632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1296cgacagacgc ctgatctcct taaagcggac at 32129725DNAArtificial SequenceDescription

of Artificial Sequence Synthetic oligonucleotide 1297gatcatgtcc gctttaagga gatca 25129832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1298cgacagacgc ctgatctcct gatttggacg at 32129925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1299gatcatcgtc caaatcagga gatca 25130032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1300cgacagacgc ctgatctcct gaattgctcc tt 32130125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1301gatcaaggag caattcagga gatca 25130232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1302cgacagacgc ctgatctcct gaagaatggc at 32130325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1303gatcatgcca ttcttcagga gatca 25130432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1304cgacagacgc ctgatctcct ctttgaagcc tt 32130525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1305gatcaaggct tcaaagagga gatca 25130632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1306cgacagacgc ctgatctcct cgcaaaggtt at 32130725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1307gatcataacc tttgcgagga gatca 25130832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1308cgacagacgc ctgatctcct atggaagcga at 32130925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1309gatcattcgc ttccatagga gatca 25131032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1310cgacagacgc ctgatctcct atcaaagcgg tt 32131125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1311gatcaaccgc tttgatagga gatca 25131232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1312cgacagacgc ctgatctcct aattgtcgtg ct 32131325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1313gatcagcacg acaattagga gatca 25131432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1314cgacagacgc ctgatctcct aattcgtgcc tt 32131525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1315gatcaaggca cgaattagga gatca 25131632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1316cgacagacgc ctgatctcct aagattcgcc at 32131725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1317gatcatggcg aatcttagga gatca 25131832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1318cgacagacgc ctgatctcct aacgaaagcc tt 32131925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1319gatcaaggct ttcgttagga gatca 25132032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1320cgacagacgc ctgatctccg tgtggaattt gt 32132125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1321gatcacaaat tccacacgga gatca 25132232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1322cgacagacgc ctgatctccg tatttcagcc tt 32132325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1323gatcaaggct gaaatacgga gatca 25132432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1324cgacagacgc ctgatctccg gtaatgtgtg tt 32132525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1325gatcaacaca cattaccgga gatca 25132632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1326cgacagacgc ctgatctccg gcttaaacaa ct 32132725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1327gatcagttgt ttaagccgga gatca 25132832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1328cgacagacgc ctgatctccg gaggaattga at 32132925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1329gatcattcaa ttcctccgga gatca 25133032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1330cgacagacgc ctgatctccg gaatttggaa ct 32133125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1331gatcagttcc aaattccgga gatca 25133232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1332cgacagacgc ctgatctccg gaaattgatg ct 32133325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1333gatcagcatc aatttccgga gatca 25133432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1334cgacagacgc ctgatctccg cggaattaaa gt 32133525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1335gatcacttta attccgcgga gatca 25133632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1336cgacagacgc ctgatctccg atttgtgatg ct 32133725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1337gatcagcatc acaaatcgga gatca 25133832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1338cgacagacgc ctgatctccg atttaccgtc tt 32133925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1339gatcaagacg gtaaatcgga gatca 25134032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1340cgacagacgc ctgatctccg attgtgtagg tt 32134125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1341gatcaaccta cacaatcgga gatca 25134232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1342cgacagacgc ctgatctcca tttcacggtc tt 32134325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1343gatcaagacc gtgaaatgga gatca 25134432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1344cgacagacgc ctgatctcca tttaggcagg tt 32134525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1345gatcaacctg cctaaatgga gatca 25134632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1346cgacagacgc ctgatctcca ttgttagcgt ct 32134725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1347gatcagacgc taacaatgga gatca 25134832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1348cgacagacgc ctgatctcca ttgaacgaac ct 32134925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1349gatcaggttc gttcaatgga gatca 25135032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1350cgacagacgc ctgatctcca ttaggcgaga at 32135125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1351gatcattctc gcctaatgga gatca 25135232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1352cgacagacgc ctgatctcca tgatgtgaac gt 32135325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1353gatcacgttc acatcatgga gatca 25135432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1354cgacagacgc ctgatctcca tagaatccgc at 32135525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1355gatcatgcgg attctatgga gatca 25135632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1356cgacagacgc ctgatctcca tacttgtcgc tt 32135725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1357gatcaagcga caagtatgga gatca 25135832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1358cgacagacgc ctgatctcca taacgtgtcc at 32135925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1359gatcatggac acgttatgga gatca 25136032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1360cgacagacgc ctgatctcca gttgttcctc at 32136125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1361gatcatgagg aacaactgga gatca 25136232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1362cgacagacgc ctgatctcca gttatgttcg ct 32136325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1363gatcagcgaa cataactgga gatca 25136432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1364cgacagacgc ctgatctcca gtgttgagtg tt 32136525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1365gatcaacact caacactgga gatca 25136632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1366cgacagacgc ctgatctcca ggtgaaagtg at 32136725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1367gatcatcact ttcacctgga gatca 25136832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1368cgacagacgc ctgatctcca gaaggttgtc at 32136925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1369gatcatgaca accttctgga gatca 25137032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1370cgacagacgc ctgatctcca ctggtggaaa tt 32137125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1371gatcaatttc caccagtgga gatca 25137232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1372cgacagacgc ctgatctcca cgttgagaag at 32137325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1373gatcatcttc tcaacgtgga gatca 25137432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1374cgacagacgc ctgatctcca cattagcgtt ct 32137525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1375gatcagaacg ctaatgtgga gatca 25137632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1376cgacagacgc ctgatctcca caagttccga tt 32137725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1377gatcaatcgg aacttgtgga gatca 25137832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1378cgacagacgc ctgatctcca atttagccac gt 32137925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1379gatcacgtgg ctaaattgga gatca 25138032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1380cgacagacgc ctgatctcca attgcgtctt ct 32138125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1381gatcagaaga cgcaattgga gatca 25138232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1382cgacagacgc ctgatctcca attacagacg ct 32138325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1383gatcagcgtc tgtaattgga gatca 25138432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1384cgacagacgc ctgatctcca aggtttggtg at 32138525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1385gatcatcacc aaaccttgga gatca 25138632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1386cgacagacgc ctgatctcca agagtggtca at 32138725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1387gatcattgac cactcttgga gatca 25138832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1388cgacagacgc ctgatctcca agaatacggc tt 32138925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1389gatcaagccg tattcttgga gatca 25139032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1390cgacagacgc ctgatctcca acactggaac tt 32139125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1391gatcaagttc cagtgttgga gatca 25139232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1392cgacagacgc ctgatctcca aactgctgaa ct 32139325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1393gatcagttca gcagtttgga gatca 25139432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1394cgacagacgc ctgatctcca aacattagcc gt 32139525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1395gatcacggct aatgtttgga gatca 25139632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1396cgacagacgc ctgatctcat ttgtgcggta gt 32139725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1397gatcactacc

gcacaaatga gatca 25139832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1398cgacagacgc ctgatctcat ttgcgacctt ct 32139925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1399gatcagaagg tcgcaaatga gatca 25140032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1400cgacagacgc ctgatctcat ttgatcgtgg ct 32140125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1401gatcagccac gatcaaatga gatca 25140232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1402cgacagacgc ctgatctcat ttcatgcggt ct 32140325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1403gatcagaccg catgaaatga gatca 25140432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1404cgacagacgc ctgatctcat ttactggtgc gt 32140525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1405gatcacgcac cagtaaatga gatca 25140632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1406cgacagacgc ctgatctcat tgttctaccg ct 32140725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1407gatcagcggt agaacaatga gatca 25140832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1408cgacagacgc ctgatctcat tgtggatgct gt 32140925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1409gatcacagca tccacaatga gatca 25141032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1410cgacagacgc ctgatctcat tggaacggac tt 32141125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1411gatcaagtcc gttccaatga gatca 25141232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1412cgacagacgc ctgatctcat tgaactctcg ct 32141325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1413gatcagcgag agttcaatga gatca 25141432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1414cgacagacgc ctgatctcat tctaaggcgg tt 32141525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1415gatcaaccgc cttagaatga gatca 25141632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1416cgacagacgc ctgatctcat tcgtagttgg ct 32141725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1417gatcagccaa ctacgaatga gatca 25141832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1418cgacagacgc ctgatctcat tccaatgtcg ct 32141925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1419gatcagcgac attggaatga gatca 25142032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1420cgacagacgc ctgatctcat tatgtcacgc ct 32142125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1421gatcaggcgt gacataatga gatca 25142232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1422cgacagacgc ctgatctcat tatggtgcgt ct 32142325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1423gatcagacgc accataatga gatca 25142432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1424cgacagacgc ctgatctcat taaccgtccg at 32142525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1425gatcatcgga cggttaatga gatca 25142632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1426cgacagacgc ctgatctcat ggtgattgtc gt 32142725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1427gatcacgaca atcaccatga gatca 25142832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1428cgacagacgc ctgatctcat ggccaaactt ct 32142925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1429gatcagaagt ttggccatga gatca 25143032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1430cgacagacgc ctgatctcat gacaggtggt tt 32143125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1431gatcaaacca cctgtcatga gatca 25143232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1432cgacagacgc ctgatctcat ctcaagtccg tt 32143325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1433gatcaacgga cttgagatga gatca 25143432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1434cgacagacgc ctgatctcat cgagaaatgg ct 32143525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1435gatcagccat ttctcgatga gatca 25143632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1436cgacagacgc ctgatctcat cgaagacacc tt 32143725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1437gatcaaggtg tcttcgatga gatca 25143832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1438cgacagacgc ctgatctcat agttaccgcc at 32143925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1439gatcatggcg gtaactatga gatca 25144032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1440cgacagacgc ctgatctcat agtcgtttgg ct 32144125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1441gatcagccaa acgactatga gatca 25144232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1442cgacagacgc ctgatctcat acttgagcgg at 32144325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1443gatcatccgc tcaagtatga gatca 25144432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1444cgacagacgc ctgatctcat aattcgcgtg gt 32144525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1445gatcaccacg cgaattatga gatca 25144632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1446cgacagacgc ctgatctcag ttgtagttgc gt 32144725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1447gatcacgcaa ctacaactga gatca 25144832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1448cgacagacgc ctgatctcag gttcacttcc at 32144925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1449gatcatggaa gtgaacctga gatca 25145032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1450cgacagacgc ctgatctcag gcgaggttta tt 32145125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1451gatcaataaa cctcgcctga gatca 25145232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1452cgacagacgc ctgatctcag gaataagcgg tt 32145325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1453gatcaaccgc ttattcctga gatca 25145432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1454cgacagacgc ctgatctcag attctttccg ct 32145525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1455gatcagcgga aagaatctga gatca 25145632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1456cgacagacgc ctgatctcag atcctttgcc at 32145725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1457gatcatggca aaggatctga gatca 25145832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1458cgacagacgc ctgatctcac tttccgttga ct 32145925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1459gatcagtcaa cggaaagtga gatca 25146032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1460cgacagacgc ctgatctcac tttaagcacc gt 32146125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1461gatcacggtg cttaaagtga gatca 25146232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1462cgacagacgc ctgatctcac tgttattcgc ct 32146325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1463gatcaggcga ataacagtga gatca 25146432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1464cgacagacgc ctgatctcac tcttgtaacg ct 32146525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1465gatcagcgtt acaagagtga gatca 25146632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1466cgacagacgc ctgatctcac tccaaggtca at 32146725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1467gatcattgac cttggagtga gatca 25146832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1468cgacagacgc ctgatctcac tagtttgcgt ct 32146925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1469gatcagacgc aaactagtga gatca 25147032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1470cgacagacgc ctgatctcac taatgaacgg ct 32147125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1471gatcagccgt tcattagtga gatca 25147232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1472cgacagacgc ctgatctcac gttatcttgg ct 32147325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1473gatcagccaa gataacgtga gatca 25147432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1474cgacagacgc ctgatctcac ggagatggtt tt 32147525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1475gatcaaaacc atctccgtga gatca 25147632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1476cgacagacgc ctgatctcac ggaagagatg tt 32147725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1477gatcaacatc tcttccgtga gatca 25147832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1478cgacagacgc ctgatctcac gatttagcac ct 32147925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1479gatcaggtgc taaatcgtga gatca 25148032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1480cgacagacgc ctgatctcac gatagtttgc ct 32148125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1481gatcaggcaa actatcgtga gatca 25148232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1482cgacagacgc ctgatctcac cttattgcac gt 32148325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1483gatcacgtgc aataaggtga gatca 25148432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1484cgacagacgc ctgatctcac ctccggttaa at 32148525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1485gatcatttaa ccggaggtga gatca 25148632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1486cgacagacgc ctgatctcac ctatgcgaaa ct 32148725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1487gatcagtttc gcataggtga gatca 25148832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1488cgacagacgc ctgatctcac attggcagaa ct 32148925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1489gatcagttct gccaatgtga gatca 25149032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1490cgacagacgc ctgatctcac ataggagcgt tt 32149125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1491gatcaaacgc tcctatgtga gatca 25149232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1492cgacagacgc ctgatctcac aatgttgcct ct 32149325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1493gatcagaggc aacattgtga gatca 25149432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1494cgacagacgc ctgatctcac aatatgtccg ct 32149525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1495gatcagcgga catattgtga gatca 25149632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1496cgacagacgc ctgatctcaa ttcgagcaac ct 32149725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1497gatcaggttg ctcgaattga gatca

25149832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1498cgacagacgc ctgatctcaa tgttgctgag gt 32149925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1499gatcacctca gcaacattga gatca 25150032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1500cgacagacgc ctgatctcaa tggatgacgg at 32150125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1501gatcatccgt catccattga gatca 25150232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1502cgacagacgc ctgatctcaa tcttcgttgg ct 32150325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1503gatcagccaa cgaagattga gatca 25150432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1504cgacagacgc ctgatctcaa tcctttctgc gt 32150525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1505gatcacgcag aaaggattga gatca 25150632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1506cgacagacgc ctgatctcaa gtttgagtgg ct 32150725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1507gatcagccac tcaaacttga gatca 25150832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1508cgacagacgc ctgatctcaa gtagtcggtg tt 32150925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1509gatcaacacc gactacttga gatca 25151032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1510cgacagacgc ctgatctcaa gccttggaaa ct 32151125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1511gatcagtttc caaggcttga gatca 25151232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1512cgacagacgc ctgatctcaa gcatgtgagg at 32151325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1513gatcatcctc acatgcttga gatca 25151432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1514cgacagacgc ctgatctcaa gattccgtcc at 32151525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1515gatcatggac ggaatcttga gatca 25151632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1516cgacagacgc ctgatctcaa gaattggagc gt 32151725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1517gatcacgctc caattcttga gatca 25151832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1518cgacagacgc ctgatctcaa gaagtgtgtg ct 32151925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1519gatcagcaca cacttcttga gatca 25152032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1520cgacagacgc ctgatctcaa gaactggtgg at 32152125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1521gatcatccac cagttcttga gatca 25152232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1522cgacagacgc ctgatctcaa ctttgatccg ct 32152325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1523gatcagcgga tcaaagttga gatca 25152432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1524cgacagacgc ctgatctcaa cgtggtttct gt 32152525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1525gatcacagaa accacgttga gatca 25152632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1526cgacagacgc ctgatctcaa cacctcttgg at 32152725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1527gatcatccaa gaggtgttga gatca 25152832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1528cgacagacgc ctgatctcaa attgcctcgt ct 32152925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1529gatcagacga ggcaatttga gatca 25153032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1530cgacagacgc ctgatctcaa atgatgcgga gt 32153125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1531gatcactccg catcatttga gatca 25153232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1532cgacagacgc ctgatctcaa atccttcgct gt 32153325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1533gatcacagcg aaggatttga gatca 25153432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1534cgacagacgc ctgatctcaa atcatcggct ct 32153525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1535gatcagagcc gatgatttga gatca 25153632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1536cgacagacgc ctgatctcaa atacaggtcg ct 32153725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1537gatcagcgac ctgtatttga gatca 25153832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1538cgacagacgc ctgatctcaa ataagcggtg gt 32153925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1539gatcaccacc gcttatttga gatca 25154032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1540cgacagacgc ctgatctcaa agaggtttgg ct 32154125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1541gatcagccaa acctctttga gatca 25154232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1542cgacagacgc ctgatctcaa acgtgttcct ct 32154325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1543gatcagagga acacgtttga gatca 25154432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1544cgacagacgc ctgatctatt tggcagaggt ct 32154525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1545gatcagacct ctgccaaata gatca 25154632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1546cgacagacgc ctgatctatt tgaggacacg gt 32154725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1547gatcaccgtg tcctcaaata gatca 25154832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1548cgacagacgc ctgatctatt tccggttgag gt 32154925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1549gatcacctca accggaaata gatca 25155032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1550cgacagacgc ctgatctatt tatcggagcg gt 32155125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1551gatcaccgct ccgataaata gatca 25155232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1552cgacagacgc ctgatctatt ggcaaggaga ct 32155325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1553gatcagtctc cttgccaata gatca 25155432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1554cgacagacgc ctgatctatt gccaagtcct ct 32155525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1555gatcagagga cttggcaata gatca 25155632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1556cgacagacgc ctgatctatt ctatggtccg ct 32155725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1557gatcagcgga ccatagaata gatca 25155832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1558cgacagacgc ctgatctatt ccaacgacca gt 32155925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1559gatcactggt cgttggaata gatca 25156032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1560cgacagacgc ctgatctatt atgcgagagg ct 32156125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1561gatcagcctc tcgcataata gatca 25156232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1562cgacagacgc ctgatctatt aggacacacg gt 32156325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1563gatcaccgtg tgtcctaata gatca 25156432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1564cgacagacgc ctgatctatt acgtaccagc ct 32156525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1565gatcaggctg gtacgtaata gatca 25156632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1566cgacagacgc ctgatctatt acctcagtcg ct 32156725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1567gatcagcgac tgaggtaata gatca 25156832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1568cgacagacgc ctgatctatt acaaggcgag gt 32156925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1569gatcacctcg ccttgtaata gatca 25157032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1570cgacagacgc ctgatctatt aaggcaccac ct 32157125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1571gatcaggtgg tgccttaata gatca 25157232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1572cgacagacgc ctgatctatt aactgcctcc gt 32157325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1573gatcacggag gcagttaata gatca 25157432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1574cgacagacgc ctgatctatg tttcaggtcg gt 32157525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1575gatcaccgac ctgaaacata gatca 25157632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1576cgacagacgc ctgatctatg ttagacgcag gt 32157725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1577gatcacctgc gtctaacata gatca 25157832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1578cgacagacgc ctgatctatg tgtatcaggc gt 32157925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1579gatcacgcct gatacacata gatca 25158032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1580cgacagacgc ctgatctatg gttactgctc gt 32158125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1581gatcacgagc agtaaccata gatca 25158232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1582cgacagacgc ctgatctatg gaggctttgt ct 32158325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1583gatcagacaa agcctccata gatca 25158432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1584cgacagacgc ctgatctatg cttgtggact ct 32158525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1585gatcagagtc cacaagcata gatca 25158632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1586cgacagacgc ctgatctatg ctaaaggtcg gt 32158725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1587gatcaccgac ctttagcata gatca 25158832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1588cgacagacgc ctgatctatg cctttacctc gt 32158925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1589gatcacgagg taaaggcata gatca 25159032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1590cgacagacgc ctgatctatg atgtctgtgc ct 32159125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1591gatcaggcac agacatcata gatca 25159232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1592cgacagacgc ctgatctatg agaagccagt gt 32159325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1593gatcacactg gcttctcata gatca 25159432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1594cgacagacgc ctgatctatg acctgttgtg gt 32159525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1595gatcaccaca acaggtcata gatca 25159632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1596cgacagacgc ctgatctatg aagtcacgag gt 32159725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1597gatcacctcg tgacttcata gatca 25159832DNAArtificial SequenceDescription of Artificial Sequence

Synthetic oligonucleotide 1598cgacagacgc ctgatctatc ttgaggtgtg ct 32159925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1599gatcagcaca cctcaagata gatca 25160032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1600cgacagacgc ctgatctatc ttcgacactg gt 32160125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1601gatcaccagt gtcgaagata gatca 25160232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1602cgacagacgc ctgatctatc tccaagcaca gt 32160325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1603gatcactgtg cttggagata gatca 25160432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1604cgacagacgc ctgatctatc taccgaacac gt 32160525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1605gatcacgtgt tcggtagata gatca 25160632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1606cgacagacgc ctgatctatc gaatgagcag gt 32160725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1607gatcacctgc tcattcgata gatca 25160832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1608cgacagacgc ctgatctatc cgtattgagc ct 32160925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1609gatcaggctc aatacggata gatca 25161032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1610cgacagacgc ctgatctatc catgagcaac ct 32161125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1611gatcaggttg ctcatggata gatca 25161232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1612cgacagacgc ctgatctatc atgcctaacc gt 32161325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1613gatcacggtt aggcatgata gatca 25161432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1614cgacagacgc ctgatctatc aggtgaatgg ct 32161525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1615gatcagccat tcacctgata gatca 25161632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1616cgacagacgc ctgatctatc accatgttcc gt 32161725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1617gatcacggaa catggtgata gatca 25161832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1618cgacagacgc ctgatctatc aacagtccag ct 32161925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1619gatcagctgg actgttgata gatca 25162032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1620cgacagacgc ctgatctata ttaccgcgac ct 32162125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1621gatcaggtcg cggtaatata gatca 25162232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1622cgacagacgc ctgatctata tggacgaacg gt 32162325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1623gatcaccgtt cgtccatata gatca 25162432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1624cgacagacgc ctgatctata tgcggtgtct gt 32162525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1625gatcacagac accgcatata gatca 25162632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1626cgacagacgc ctgatctata tctcgtgtgc ct 32162725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1627gatcaggcac acgagatata gatca 25162832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1628cgacagacgc ctgatctata tccaaccagc gt 32162925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1629gatcacgctg gttggatata gatca 25163032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1630cgacagacgc ctgatctata taaggcaggc gt 32163125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1631gatcacgcct gccttatata gatca 25163232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1632cgacagacgc ctgatctata gtgcaagtcg gt 32163325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1633gatcaccgac ttgcactata gatca 25163432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1634cgacagacgc ctgatctata gtgagaacgg ct 32163525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1635gatcagccgt tctcactata gatca 25163632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1636cgacagacgc ctgatctata ggcaggtttc gt 32163725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1637gatcacgaaa cctgcctata gatca 25163832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1638cgacagacgc ctgatctata gatcgatggc gt 32163925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1639gatcacgcca tcgatctata gatca 25164032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1640cgacagacgc ctgatctata ctctgttccg ct 32164125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1641gatcagcgga acagagtata gatca 25164232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1642cgacagacgc ctgatctata ctaacggacg ct 32164325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1643gatcagcgtc cgttagtata gatca 25164432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1644cgacagacgc ctgatctata cgttctgctc ct 32164525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1645gatcaggagc agaacgtata gatca 25164632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1646cgacagacgc ctgatctata atctcgaccg ct 32164725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1647gatcagcggt cgagattata gatca 25164832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1648cgacagacgc ctgatctata agcggagtgt ct 32164925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1649gatcagacac tccgcttata gatca 25165032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1650cgacagacgc ctgatctata agcctggaac gt 32165125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1651gatcacgttc caggcttata gatca 25165232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1652cgacagacgc ctgatctata agacggtgag ct 32165325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1653gatcagctca ccgtcttata gatca 25165432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1654cgacagacgc ctgatctata agaacctccg ct 32165525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1655gatcagcgga ggttcttata gatca 25165632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1656cgacagacgc ctgatctata aatggccgga gt 32165725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1657gatcactccg gccatttata gatca 25165832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1658cgacagacgc ctgatctagt tggcctgaaa gt 32165925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1659gatcactttc aggccaacta gatca 25166032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1660cgacagacgc ctgatctagt tgcatctctg gt 32166125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1661gatcaccaga gatgcaacta gatca 25166232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1662cgacagacgc ctgatctagt tctccgactt gt 32166325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1663gatcacaagt cggagaacta gatca 25166432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1664cgacagacgc ctgatctagt tctcaaccag ct 32166525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1665gatcagctgg ttgagaacta gatca 25166632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1666cgacagacgc ctgatctagt tatggaagcc gt 32166725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1667gatcacggct tccataacta gatca 25166832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1668cgacagacgc ctgatctagt gtctaatgcg gt 32166925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1669gatcaccgca ttagacacta gatca 25167032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1670cgacagacgc ctgatctagt ggtttcgtca gt 32167125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1671gatcactgac gaaaccacta gatca 25167232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1672cgacagacgc ctgatctagt cggaaccttt gt 32167325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1673gatcacaaag gttccgacta gatca 25167432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1674cgacagacgc ctgatctagt caacgacatc ct 32167525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1675gatcaggatg tcgttgacta gatca 25167632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1676cgacagacgc ctgatctagt caacaccagt ct 32167725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1677gatcagactg gtgttgacta gatca 25167832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1678cgacagacgc ctgatctagt atagccaccg at 32167925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1679gatcatcggt ggctatacta gatca 25168032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1680cgacagacgc ctgatctagt agtacgaggc at 32168125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1681gatcatgcct cgtactacta gatca 25168232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1682cgacagacgc ctgatctagt agaacatgcg gt 32168325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1683gatcaccgca tgttctacta gatca 25168432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1684cgacagacgc ctgatctagt actgtgcttg gt 32168525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1685gatcaccaag cacagtacta gatca 25168632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1686cgacagacgc ctgatctagt acacatcacc gt 32168725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1687gatcacggtg atgtgtacta gatca 25168832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1688cgacagacgc ctgatctagg tttacgcctt ct 32168925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1689gatcagaagg cgtaaaccta gatca 25169032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1690cgacagacgc ctgatctagg ttcttagcgt gt 32169125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1691gatcacacgc taagaaccta gatca 25169232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1692cgacagacgc ctgatctagg ctttatccgt gt 32169325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1693gatcacacgg ataaagccta gatca 25169432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1694cgacagacgc ctgatctagg cttcttcaca ct 32169525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1695gatcagtgtg aagaagccta gatca 25169632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1696cgacagacgc ctgatctagg caaagttcag gt 32169725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1697gatcacctga actttgccta gatca 25169832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1698cgacagacgc ctgatctagg accttaccac at

32169925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1699gatcatgtgg taaggtccta gatca 25170032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1700cgacagacgc ctgatctagg aatgtatcgg ct 32170125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1701gatcagccga tacattccta gatca 25170232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1702cgacagacgc ctgatctagg aatcatcagc gt 32170325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1703gatcacgctg atgattccta gatca 25170432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1704cgacagacgc ctgatctagc tccatttacc gt 32170525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1705gatcacggta aatggagcta gatca 25170632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1706cgacagacgc ctgatctagc taaagcaggt ct 32170725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1707gatcagacct gctttagcta gatca 25170832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1708cgacagacgc ctgatctagc gtttactgag gt 32170925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1709gatcacctca gtaaacgcta gatca 25171032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1710cgacagacgc ctgatctagc ctttgtcact ct 32171125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1711gatcagagtg acaaaggcta gatca 25171232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1712cgacagacgc ctgatctagc cttcattcct gt 32171325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1713gatcacagga atgaaggcta gatca 25171432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1714cgacagacgc ctgatctagc ctattgttcc gt 32171525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1715gatcacggaa caataggcta gatca 25171632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1716cgacagacgc ctgatctagc ctatacaccg at 32171725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1717gatcatcggt gtataggcta gatca 25171832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1718cgacagacgc ctgatctagc ctaaaccact gt 32171925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1719gatcacagtg gtttaggcta gatca 25172032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1720cgacagacgc ctgatctagc caaagtatcc gt 32172125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1721gatcacggat actttggcta gatca 25172232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1722cgacagacgc ctgatctagc attgtctcac ct 32172325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1723gatcaggtga gacaatgcta gatca 25172432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1724cgacagacgc ctgatctagc atagtgaacc gt 32172525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1725gatcacggtt cactatgcta gatca 25172632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1726cgacagacgc ctgatctagc aactaccatc gt 32172725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1727gatcacgatg gtagttgcta gatca 25172832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1728cgacagacgc ctgatctagc aacatctacg gt 32172925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1729gatcaccgta gatgttgcta gatca 25173032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1730cgacagacgc ctgatctagc aaagtggagt ct 32173125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1731gatcagactc cactttgcta gatca 25173232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1732cgacagacgc ctgatctaga tgtggtgttc ct 32173325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1733gatcaggaac accacatcta gatca 25173432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1734cgacagacgc ctgatctaga tgtaagtgcc gt 32173525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1735gatcacggca cttacatcta gatca 25173632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1736cgacagacgc ctgatctaga tgccttcctt gt 32173725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1737gatcacaagg aaggcatcta gatca 25173832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1738cgacagacgc ctgatctaga tgattccggt gt 32173925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1739gatcacaccg gaatcatcta gatca 25174032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1740cgacagacgc ctgatctaga tcttgtgtcc gt 32174125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1741gatcacggac acaagatcta gatca 25174232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1742cgacagacgc ctgatctaga tcctcattcg ct 32174325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1743gatcagcgaa tgaggatcta gatca 25174432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1744cgacagacgc ctgatctaga tagtgttcgg ct 32174525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1745gatcagccga acactatcta gatca 25174632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1746cgacagacgc ctgatctaga ggttgttgtc ct 32174725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1747gatcaggaca acaacctcta gatca 25174832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1748cgacagacgc ctgatctaga ggaacttgac gt 32174925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1749gatcacgtca agttcctcta gatca 25175032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1750cgacagacgc ctgatctaga ctacaatccg ct 32175125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1751gatcagcgga ttgtagtcta gatca 25175232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1752cgacagacgc ctgatctaga ccacttacac gt 32175325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1753gatcacgtgt aagtggtcta gatca 25175432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1754cgacagacgc ctgatctaga cagccacctt at 32175525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1755gatcataagg tggctgtcta gatca 25175632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1756cgacagacgc ctgatctaga caacctctgg at 32175725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1757gatcatccag aggttgtcta gatca 25175832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1758cgacagacgc ctgatctaga caaaccttcc gt 32175925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1759gatcacggaa ggtttgtcta gatca 25176032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1760cgacagacgc ctgatctaga atcactacgc ct 32176125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1761gatcaggcgt agtgattcta gatca 25176232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1762cgacagacgc ctgatctact ttgtggagag ct 32176325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1763gatcagctct ccacaaagta gatca 25176432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1764cgacagacgc ctgatctact tggtaagagc gt 32176525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1765gatcacgctc ttaccaagta gatca 25176632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1766cgacagacgc ctgatctact tgagcagaac ct 32176725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1767gatcaggttc tgctcaagta gatca 25176832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1768cgacagacgc ctgatctact tcgttgagtc ct 32176925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1769gatcaggact caacgaagta gatca 25177032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1770cgacagacgc ctgatctact tcgagttgtc ct 32177125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1771gatcaggaca actcgaagta gatca 25177232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1772cgacagacgc ctgatctact tagaagcgac ct 32177325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1773gatcaggtcg cttctaagta gatca 25177432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1774cgacagacgc ctgatctact tagaacaggc gt 32177525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1775gatcacgcct gttctaagta gatca 25177632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1776cgacagacgc ctgatctact taagcgagga ct 32177725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1777gatcagtcct cgcttaagta gatca 25177832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1778cgacagacgc ctgatctact ggtgtttgga ct 32177925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1779gatcagtcca aacaccagta gatca 25178032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1780cgacagacgc ctgatctact gatgagttgg ct 32178125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1781gatcagccaa ctcatcagta gatca 25178232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1782cgacagacgc ctgatctact cggaacattg gt 32178325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1783gatcaccaat gttccgagta gatca 25178432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1784cgacagacgc ctgatctact caatagaccg ct 32178525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1785gatcagcggt ctattgagta gatca 25178632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1786cgacagacgc ctgatctact acactgaacc gt 32178718DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1787gatcacggtt cagtgtag 18178832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1788cgacagacgc ctgatctact acaagtccac gt 32178918DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1789gatcacgtgg acttgtag 18179032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1790cgacagacgc ctgatctact aagagttgcc gt 32179125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1791gatcacggca actcttagta gatca 25179232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1792cgacagacgc ctgatctacg ttctccttag ct 32179325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1793gatcagctaa ggagaacgta gatca 25179432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1794cgacagacgc ctgatctacg tgtaggtgtt ct 32179525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1795gatcagaaca cctacacgta gatca 25179632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1796cgacagacgc ctgatctacg tagttggtct gt 32179725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1797gatcacagac caactacgta gatca 25179832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1798cgacagacgc ctgatctacg ctaactcctt gt 32179925DNAArtificial SequenceDescription

of Artificial Sequence Synthetic oligonucleotide 1799gatcacaagg agttagcgta gatca 25180032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1800cgacagacgc ctgatctacg ccaaatccta gt 32180125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1801gatcactagg atttggcgta gatca 25180232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1802cgacagacgc ctgatctacg attctgtgag gt 32180325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1803gatcacctca cagaatcgta gatca 25180432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1804cgacagacgc ctgatctacg attccaccaa gt 32180525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1805gatcacttgg tggaatcgta gatca 25180632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1806cgacagacgc ctgatctacg atattgcctc ct 32180725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1807gatcaggagg caatatcgta gatca 25180832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1808cgacagacgc ctgatctacg atagaggttg ct 32180925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1809gatcagcaac ctctatcgta gatca 25181032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1810cgacagacgc ctgatctacg aatgactgga gt 32181125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1811gatcactcca gtcattcgta gatca 25181232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1812cgacagacgc ctgatctacg aaatcctagc ct 32181325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1813gatcaggcta ggatttcgta gatca 25181432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1814cgacagacgc ctgatctacc ttagtagccg at 32181525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1815gatcatcggc tactaaggta gatca 25181632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1816cgacagacgc ctgatctacc tggtgtttac gt 32181725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1817gatcacgtaa acaccaggta gatca 25181832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1818cgacagacgc ctgatctacc tggcctcttt at 32181925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1819gatcataaag aggccaggta gatca 25182032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1820cgacagacgc ctgatctacc tggaaaggac tt 32182125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1821gatcaagtcc tttccaggta gatca 25182232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1822cgacagacgc ctgatctacc tgaggtgttt gt 32182325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1823gatcacaaac acctcaggta gatca 25182432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1824cgacagacgc ctgatctacc tattctgtgc gt 32182525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1825gatcacgcac agaataggta gatca 25182632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1826cgacagacgc ctgatctacc gttgttagtc ct 32182725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1827gatcaggact aacaacggta gatca 25182832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1828cgacagacgc ctgatctacc gtgtatggtt gt 32182925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1829gatcacaacc atacacggta gatca 25183032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1830cgacagacgc ctgatctacc ggtgtaagag at 32183125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1831gatcatctct tacaccggta gatca 25183232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1832cgacagacgc ctgatctacc ggaaatggat gt 32183325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1833gatcacatcc atttccggta gatca 25183432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1834cgacagacgc ctgatctacc gattgaggag at 32183525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1835gatcatctcc tcaatcggta gatca 25183632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1836cgacagacgc ctgatctacc atctgtcttc gt 32183725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1837gatcacgaag acagatggta gatca 25183832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1838cgacagacgc ctgatctacc agttgacttc ct 32183925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1839gatcaggaag tcaactggta gatca 25184032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1840cgacagacgc ctgatctacc actttcggat ct 32184125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1841gatcagatcc gaaagtggta gatca 25184232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1842cgacagacgc ctgatctacc aatagcggat ct 32184325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1843gatcagatcc gctattggta gatca 25184432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1844cgacagacgc ctgatctacc aaggtatgca gt 32184525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1845gatcactgca taccttggta gatca 25184632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1846cgacagacgc ctgatctacc aaatagctcc gt 32184725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1847gatcacggag ctatttggta gatca 25184832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1848cgacagacgc ctgatctaca tttgacctcc gt 32184925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1849gatcacggag gtcaaatgta gatca 25185032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1850cgacagacgc ctgatctaca tgttcctctc gt 32185125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1851gatcacgaga ggaacatgta gatca 25185232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1852cgacagacgc ctgatctaca tgtgtggagt ct 32185325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1853gatcagactc cacacatgta gatca 25185432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1854cgacagacgc ctgatctaca tacctagccg at 32185525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1855gatcatcggc taggtatgta gatca 25185632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1856cgacagacgc ctgatctaca gttcgttgag gt 32185725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1857gatcacctca acgaactgta gatca 25185832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1858cgacagacgc ctgatctaca ggaattgagg ct 32185925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1859gatcagcctc aattcctgta gatca 25186032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1860cgacagacgc ctgatctaca gaagttgagc ct 32186125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1861gatcaggctc aacttctgta gatca 25186232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1862cgacagacgc ctgatctaca cctaatgacc gt 32186325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1863gatcacggtc attaggtgta gatca 25186432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1864cgacagacgc ctgatctaca ataggtgctc gt 32186525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1865gatcacgagc acctattgta gatca 25186632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1866cgacagacgc ctgatctaca acgataggct ct 32186725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1867gatcagagcc tatcgttgta gatca 25186832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1868cgacagacgc ctgatctaca acaggtcttc ct 32186925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1869gatcaggaag acctgttgta gatca 25187032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1870cgacagacgc ctgatctaat tggtctcgtg gt 32187125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1871gatcaccacg agaccaatta gatca 25187232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1872cgacagacgc ctgatctaat tctgctctcg gt 32187325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1873gatcaccgag agcagaatta gatca 25187432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1874cgacagacgc ctgatctaat tcgaccacca gt 32187525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1875gatcactggt ggtcgaatta gatca 25187632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1876cgacagacgc ctgatctaat tcacctctgg ct 32187725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1877gatcagccag aggtgaatta gatca 25187832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1878cgacagacgc ctgatctaat tagctggacg gt 32187925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1879gatcaccgtc cagctaatta gatca 25188032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1880cgacagacgc ctgatctaat gtcctggttg gt 32188125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1881gatcaccaac caggacatta gatca 25188232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1882cgacagacgc ctgatctaat ggagtcaagg ct 32188325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1883gatcagcctt gactccatta gatca 25188432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1884cgacagacgc ctgatctaat gatacggcag gt 32188525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1885gatcacctgc cgtatcatta gatca 25188632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1886cgacagacgc ctgatctaat ctatccacgg ct 32188725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1887gatcagccgt ggatagatta gatca 25188832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1888cgacagacgc ctgatctaat ctaccttgcc gt 32188925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1889gatcacggca aggtagatta gatca 25189032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1890cgacagacgc ctgatctaat cgaaggtagg ct 32189125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1891gatcagccta ccttcgatta gatca 25189232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1892cgacagacgc ctgatctaat ccttgcctct gt 32189325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1893gatcacagag gcaaggatta gatca 25189432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1894cgacagacgc ctgatctaat ccgtcttgtc ct 32189525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1895gatcaggaca agacggatta gatca 25189632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1896cgacagacgc ctgatctaat cactgtctcc gt 32189725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1897gatcacggag acagtgatta gatca 25189832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1898cgacagacgc ctgatctaat attcggaggc gt 32189925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1899gatcacgcct

ccgaatatta gatca 25190032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1900cgacagacgc ctgatctaat attcgcctcc gt 32190125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1901gatcacggag gcgaatatta gatca 25190232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1902cgacagacgc ctgatctaat atgccgaggt gt 32190325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1903gatcacacct cggcatatta gatca 25190432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1904cgacagacgc ctgatctaat agttggctcg gt 32190525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1905gatcaccgag ccaactatta gatca 25190632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1906cgacagacgc ctgatctaat accacctgac gt 32190725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1907gatcacgtca ggtggtatta gatca 25190832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1908cgacagacgc ctgatctaag ttggtgtcct gt 32190925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1909gatcacagga caccaactta gatca 25191032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1910cgacagacgc ctgatctaag ttgctcctgt ct 32191125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1911gatcagacag gagcaactta gatca 25191232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1912cgacagacgc ctgatctaag ttcggttagg ct 32191325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1913gatcagccta accgaactta gatca 25191432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1914cgacagacgc ctgatctaag ttcctcggtt gt 32191525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1915gatcacaacc gaggaactta gatca 25191632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1916cgacagacgc ctgatctaag tgtagaagcc gt 32191725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1917gatcacggct tctacactta gatca 25191832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1918cgacagacgc ctgatctaag tacatcaggc gt 32191925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1919gatcacgcct gatgtactta gatca 25192032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1920cgacagacgc ctgatctaag gttgcttctg gt 32192125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1921gatcaccaga agcaacctta gatca 25192232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1922cgacagacgc ctgatctaag gttctctcac gt 32192325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1923gatcacgtga gagaacctta gatca 25192432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1924cgacagacgc ctgatctaag gcctttacca ct 32192525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1925gatcagtggt aaaggcctta gatca 25192632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1926cgacagacgc ctgatctaag gatctttcgg ct 32192725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1927gatcagccga aagatcctta gatca 25192832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1928cgacagacgc ctgatctaag gataactcgg ct 32192925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1929gatcagccga gttatcctta gatca 25193032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1930cgacagacgc ctgatctaag gaatactggc gt 32193125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1931gatcacgcca gtattcctta gatca 25193232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1932cgacagacgc ctgatctaac tttccggtct ct 32193325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1933gatcagagac cggaaagtta gatca 25193432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1934cgacagacgc ctgatctaac ttagagtggc gt 32193525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1935gatcacgcca ctctaagtta gatca 25193632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1936cgacagacgc ctgatctaac gtcttctcag gt 32193725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1937gatcacctga gaagacgtta gatca 25193832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1938cgacagacgc ctgatctaac gtatggagag ct 32193925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1939gatcagctct ccatacgtta gatca 25194032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1940cgacagacgc ctgatctaac gaactcacct gt 32194125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1941gatcacaggt gagttcgtta gatca 25194232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1942cgacagacgc ctgatctaac cggttcttct ct 32194325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1943gatcagagaa gaaccggtta gatca 25194432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1944cgacagacgc ctgatctaaa ttggctcctc ct 32194525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1945gatcaggagg agccaattta gatca 25194632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1946cgacagacgc ctgatctaaa ttcggagagg ct 32194725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1947gatcagcctc tccgaattta gatca 25194832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1948cgacagacgc ctgatctaaa tgacctccac gt 32194925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1949gatcacgtgg aggtcattta gatca 25195032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1950cgacagacgc ctgatctaaa tcaggctcca ct 32195125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1951gatcagtgga gcctgattta gatca 25195232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1952cgacagacgc ctgatctaaa gttccagctc ct 32195325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1953gatcaggagc tggaacttta gatca 25195432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1954cgacagacgc ctgatctaaa gtaacctcgc ct 32195525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1955gatcaggcga ggttacttta gatca 25195632DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1956cgacagacgc ctgatctaaa ggtgtctggt ct 32195725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1957gatcagacca gacaccttta gatca 25195832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1958cgacagacgc ctgatctaaa gctgttcctc ct 32195925DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1959gatcaggagg aacagcttta gatca 25196032DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1960cgacagacgc ctgatctaaa ctggacacct ct 32196125DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1961gatcagaggt gtccagttta gatca 25196232DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1962cgacagacgc ctgatctaaa cctatccgag ct 32196325DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1963gatcagctcg gataggttta gatca 25196437DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1964tcgatggttt ggcgcgccgg tagtttgaac catccat 37196538DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1965gccatttaca aactaggtat taatcgatcc tgcatgcc 38196618DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1966tcgatggttt ggcgcgcc 18196718DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1967aatcgatcct gcatgcca 18196815DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1968gctagggcta atatc 15196927DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1969attatgagca cgacagacgc ctgatct 27197033DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1970gatcagatca ggcgtctgtc gtcgtgctca taa 33197121DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1971gccatttaca aactaggtat t 21197242DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1972attatgagca cgacagacgc ctgatctnnn nnnnnnnnnn nt 42197346DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1973gatcannnnn nnnnnnnnna gatcaggcgt ctgtcgtgct cagtaa 46197432DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1974cgacagacgc ctgatctnnn nnnnnnnnnn nt 32197525DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1975gatcannnnn nnnnnnnnna gatca 251976103DNAArtificial SequenceDescription of Artificial Sequence Synthetic polynucleotide 1976tgatctnnnn nnnnnnnnnn tgatccnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60nnnnnnnnnn nnnnnnngga tcannnnnnn nnnnnnnaga tca 103197725DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1977aaggccttca cgacagacgc ctgat 25197832DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1978cgacagacgc ctgatctnnn nnnnnnnnnn nt 32197924DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1979ctagannnnn nnnnnnnnna ctag 24198014DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1980agatcttgtg tccg 14198114DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1981atcttcgaca ctgg 14198214DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1982tcgagatggt gttc 14198314DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1983tcggatagag agca 14198414DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1984tcggtaccaa caac 14198514DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1985ccaaggtttg gtga 14198614DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1986tcgcaagagg taag 14198714DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1987ggagttacgg cttt 14198814DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1988tcaaccagta agcc 14198914DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1989ctgtaaacaa cgcc 14199014DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1990cacgatagtt tgcc 14199114DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1991tgtactaaca cgcc 14199214DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1992acgctaactc cttg 14199314DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1993cgtttacgat gtgg 14199414DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1994tcttaggaaa cgcc 14199514DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1995tgcaatagac gacc 14199639DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1996gccatttaca aactaggtat taatcgatcc tgcatgcca 39199724DNAArtificial SequenceDescription of Artificial Sequence Synthetic oligonucleotide 1997gatcannnnn nnnnnnnnna gatc 24

Claims

1. A method comprising: a) amplifying a population of different target DNA molecules from a tagged genomic sample thereby producing a population of amplified target DNA molecules, wherein the different target DNA molecules that comprise a polymorphic site are tagged with different label-tags, wherein the label-tags comprise nucleotides selected from purine bases, pyrimidine bases, natural nucleotide bases, chemically modified nucleotide bases, biochemically modified nucleotide bases, non-natural nucleotide bases and derivatized nucleotide bases; and wherein each of the population of amplified target DNA molecules comprises the polymorphic site and an associated label-tag of the different label-tags; and b) detecting the plurality of amplified target DNA molecules by sequencing, thereby producing a plurality of readouts, wherein the plurality of readouts comprises: (i) at least a portion of the target region; and (ii) an associated label-tag of the label-tags.

2. The method of claim 1, further comprising: c) assessing a presence of an allele of the polymorphic site in the tagged genomic sample based on: (i) a determination of a number of the different label-tags that are associated with the allele; and (ii) a determination of a number of readouts that comprise each of the different label-tags that are associated with the allele.

3. The method of claim 2, wherein the assessing step is done by a computer that is programmed to perform the assessing step.

4. The method of claim 2, wherein: the assessing step further comprises independently assessing a presence of an additional allele of the polymorphic site in the tagged genomic sample based on: (i) a determination of a number of the different label-tags that are associated with the additional allele of the polymorphic site; and (ii) a determination of a number of readouts that comprise each of the different label-tags that are associated with the additional allele.

5. The method of claim 2, wherein the assessing of step c) comprises performing a statistical analysis.

6. The method of claim 2, wherein the method further comprises determining an amount of the allele in the tagged genomic sample.

7. The method of claim 1, wherein the population of different target DNA molecules is made by ligating a set of adaptors that comprise the label-tags to an initial nucleic acid sample.

8. The method of claim 7, wherein the initial nucleic acid sample is an amplification product.

9. The method of claim 1, wherein the population of different target DNA molecules is made by extending a set of primers that comprises the label-tags, using an initial nucleic acid sample as a template.

10. The method of claim 9, wherein the initial nucleic acid sample is an amplification product.

11. The method of claim 1, wherein the method comprises, prior to the amplifying step (a), enriching the population of different target DNA molecules from an initial nucleic acid sample.

12. The method of claim 1, wherein the label-tags comprise at least 2 nucleotide bases, wherein each of the at least 2 nucleotide bases is selected from purine bases, pyrimidine bases, natural nucleotide bases, chemically modified nucleotide bases, biochemically modified nucleotide bases, non-natural nucleotide bases and derivatized nucleotide bases.

13. The method of claim 12, wherein the label-tags comprise at least 8 nucleotide bases, wherein each of the at least 8 nucleotide bases is selected from purine bases, pyrimidine bases, natural nucleotide bases, chemically modified nucleotide bases, biochemically modified nucleotide bases, non-natural nucleotide bases and derivatized nucleotide bases.

14. The method of claim 12, wherein the label-tags comprise from 2 to 20 nucleotide bases, wherein each of the 2 to 20 nucleotide bases is selected from purine bases, pyrimidine bases, natural nucleotide bases, chemically modified nucleotide bases, biochemically modified nucleotide bases, non-natural nucleotide bases and derivatized nucleotide bases.

15. The method of claim 1, wherein the label-tag is used to correct estimation errors.

16. The method of claim 1, wherein the different target DNA molecules that comprise a polymorphic site are tagged with a unique sequence tag that is used to distinguish target DNA molecules from different samples.

17. The method of claim 1, wherein the tagged genomic sample is a mixed sample comprising nucleic acid molecules from different samples, wherein each of the samples is associated with a different unique sequence tag.

18. The method of claim 17, wherein each of the different samples is derived from a human subject.

19. The method of claim 17, wherein each of the different samples comprises nucleic acids from tumor cells.

20. The method of claim 1, wherein the tagged genomic samples comprise nucleic acids from tumor cells.

21. The method of claim 1, wherein the tagged genomic sample comprises polynucleotides from bacteria and/or polynucleotides encoding viral epitopes.

22. The method of claim 1, wherein the tagged genomic sample comprises human genomic DNA and the polymorphic site comprises a single nucleotide polymorphism of a human genome.

23. The method of claim 1, detecting the population of amplified target DNA molecules by sequencing comprises sequencing the plurality of amplified target DNA molecules on a next-generation sequencing platform.

24. The method of claim 1, wherein the amplifying step is done by polymerase chain reaction.

25. The method of claim 16, wherein each of the population of amplified target DNA molecules further comprises the unique sequence tag.

26. The method of claim 25, wherein the plurality of readouts further comprises the unique sequence tag.

27. A method of sequencing, comprising: a) amplifying a population of distinct initial target DNA molecules from a tagged genomic sample thereby producing a population of amplified target DNA molecules, wherein the distinct initial target DNA molecules that comprise a polymorphic target sequence are tagged with: (i) different degenerate base region (DBR) sequences, wherein said DBR sequences comprise at least one nucleotide base selected from: R, Y, S, W, K, M, B, D, H, V, N and modified versions thereof and (ii) a unique multiplex identifier (MID) sequence that identifies a source for each of the initial target DNA molecules to which it is associated, and wherein each of a plurality of the amplified target DNA molecules comprises said polymorphic target sequence, an associated DBR sequence of said different DBR sequences and said unique MID sequence; and b) sequencing the plurality of the amplified target DNA molecules, thereby producing a plurality of sequence reads, wherein the sequencing step provides, for each of the amplified target DNA molecules that are sequenced: the nucleotide sequence of: (i) at least a portion of the polymorphic target sequence; (ii) an associated DBR sequence of said DBR sequences; and (iii) said unique MID sequence.

28. The method of claim 27, further comprising: c) assessing the presence of an allele of said polymorphic target sequence region in said tagged genomic sample based on: (i) a determination of the number of said different DBR sequences that are associated with said allele; (ii) a determination of the number of said sequence reads that comprise each of the different DBR sequences that are associated with said allele.

29. The method of claim 28, wherein the assessing step is done by a computer that is programmed to perform the assessing step.

30. The method of claim 28, wherein: the assessing step further comprises independently assessing the presence of an additional allele of the polymorphic target sequence in said tagged genomic sample based on: (i) a determination of the number of said different DBR sequences that are associated with the additional allele of said polymorphic target sequence; and (ii) a determination of the number of said sequence reads that comprise each of the different DBR sequences that are associated with the additional allele.

31. The method of claim 28, wherein the assessing step comprises performing a maximum likelihood analysis.

32. The method of claim 28, wherein the method further comprises determining the amount of the allele in the tagged genomic sample.

33. The method of claim 27, wherein said population of distinct initial target DNA molecules is made by ligating a set of adaptors that comprise said DBR sequences to an initial nucleic acid sample.

34. The method of claim 33, wherein said initial nucleic acid sample is an amplification product.

35. The method of claim 27, wherein said population of distinct initial target DNA molecules is made by extension of a set of primers that comprises said DBR sequences, using an initial nucleic acid sample as a template.

36. The method of claim 35, wherein said initial nucleic acid sample is an amplification product.

37. The method of claim 27, wherein the method comprises, prior to the amplifying step (a), enriching said population of distinct initial target DNA molecules from an initial nucleic acid sample.

38. The method of claim 27, wherein said DBR sequences comprise at least 2 nucleotide bases, wherein each of the at least 2 nucleotide bases are selected from: R, Y, S, W, K, M, B, D, H, V, N, and modified versions thereof.

39. The method of claim 38, wherein the DBR sequences comprise 10 or more nucleotide bases, wherein each of the 10 or more nucleotide bases is selected from: R, Y, S, W, K, M, B, D, H, V, N, and modified versions thereof.

40. The method of claim 38, wherein the DBR sequences comprise from 3 to 10 nucleotide bases, wherein each of the 3 to 10 nucleotide bases is selected from: R, Y, S, W, M, B, D, H, V, N, and modified versions thereof.

41. The method of claim 27, wherein the DBR sequences comprise an error correcting code.

42. The method of claim 27, wherein said tagged genomic sample is a pooled sample comprising nucleic acid molecules from several different sources, where each of said sources is associated with a different MID sequence.

43. The method of claim 42, wherein each of the sources is derived from a human subject.

44. The method of claim 42, wherein each of the sources is derived from different sections of a tumor.

45. The method of claim 42, wherein each of the sources is derived from different tumors of a subject.

46. The method of claim 32, wherein each of the sources is derived from a subject at different times.

47. The method of claim 27, wherein the tagged genomic sample comprises polynucleotides from a tumor.

48. The method of claim 27, wherein the tagged genomic sample comprises polynucleotides from a microorganism and/or a virus.

49. The method of claim 27, wherein the tagged genomic sample comprises human genomic DNA and said polymorphic target sequence comprises a single nucleotide polymorphism of the human genome.

50. The method of claim 27, wherein the sequencing step b) comprises sequencing said plurality of amplified target DNA molecules on a next-generation sequencing platform.

51. The method of claim 27, wherein the amplifying step is done by polymerase chain reaction.