U.S. patent application number 14/455819 was filed with the patent office on 2015-04-23 for biomatrix scaffolds.
This patent application is currently assigned to THE UNIVERSITY OF NORTH CAROLINA AT CHAPEL HILL. The applicant listed for this patent is THE UNIVERSITY OF NORTH CAROLINA AT CHAPEL HILL. Invention is credited to Cai-Bin CUI, Lola Cynthia McAdams REID, Andrew Zhuang WANG, Yunfang WANG, Michael Edward WERNER, Mitsuo YAMAUCHI.
Application Number | 20150110753 14/455819 |
Document ID | / |
Family ID | 45402468 |
Filed Date | 2015-04-23 |
United States Patent
Application |
20150110753 |
Kind Code |
A1 |
WANG; Yunfang ; et
al. |
April 23, 2015 |
BIOMATRIX SCAFFOLDS
Abstract
The present invention provides biomatrix scaffolds, a tissue
extract enriched for extracellular matrix components and bound
growth factors, cytokines and hormones, and methods of making and
using same.
Inventors: |
WANG; Yunfang; (Beijing,
CN) ; REID; Lola Cynthia McAdams; (Chapel Hill,
NC) ; YAMAUCHI; Mitsuo; (Chapel Hill, NC) ;
CUI; Cai-Bin; (Carrboro, NC) ; WANG; Andrew
Zhuang; (Durham, NC) ; WERNER; Michael Edward;
(Lake Forest, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE UNIVERSITY OF NORTH CAROLINA AT CHAPEL HILL |
Chapel Hill |
NC |
US |
|
|
Assignee: |
THE UNIVERSITY OF NORTH CAROLINA AT
CHAPEL HILL
Chapel Hill
NC
|
Family ID: |
45402468 |
Appl. No.: |
14/455819 |
Filed: |
August 8, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13807253 |
Mar 14, 2013 |
8802081 |
|
|
PCT/US2011/042805 |
Jul 1, 2011 |
|
|
|
14455819 |
|
|
|
|
61360939 |
Jul 2, 2010 |
|
|
|
Current U.S.
Class: |
424/93.7 ;
435/377; 435/378; 435/395; 435/70.3 |
Current CPC
Class: |
C12N 2533/90 20130101;
C12N 5/067 20130101; C12N 2500/36 20130101; C12N 5/0693 20130101;
A61L 27/24 20130101; A61L 27/3683 20130101; C12N 5/0068 20130101;
C12N 5/0671 20130101; C12N 2500/25 20130101; C12N 2506/14 20130101;
A61L 27/3604 20130101; C12N 2533/54 20130101; C12N 2501/20
20130101; A61L 2430/28 20130101; C12N 7/00 20130101; C12N 2501/998
20130101; A61L 27/3691 20130101 |
Class at
Publication: |
424/93.7 ;
435/378; 435/395; 435/70.3; 435/377 |
International
Class: |
C12N 5/00 20060101
C12N005/00; C12N 5/071 20060101 C12N005/071; A61L 27/36 20060101
A61L027/36; C12N 5/09 20060101 C12N005/09 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under Grant
Nos. DK065933, DE019569, AA014243, CA016086 and DK034987 awarded by
the National Institutes of Health. The United States Government has
certain rights to this invention.
Claims
1-46. (canceled)
47. A method of producing a biomatrix scaffold from biological
tissue, comprising the steps of: a) perfusing the biological tissue
or homogenizing the biological tissue with a first medium, wherein
the osmolality of said first medium is from about 250 mOsm/kg to
about 350 mOsm/kg and said first medium is serum free and at
neutral pH; then b) perfusing the biological tissue or extracting
the homogenate of step (a) with a delipidating buffer comprising
lipases and/or detergents in said first medium; then c) perfusing
the tissue or extracting the homogenate of step (b) with a buffer
at a neutral pH and comprising a salt concentration from about 2.0M
NaCl to about 5.0M, the concentration chosen to keep insoluble
collagens identified in the biological tissue; then d) perfusing
the tissue or extracting the homogenate of step (c) with RNase and
DNase in a buffer; and then e) rinsing the tissue or homogenate of
step (d) with a second medium that is at neutral pH, is serum-free
and has an osomolality from about 250 mOsm/kg to about 350 mOsm/kg,
thereby producing an intact or homogenized biomatrix scaffold from
the biological tissue, said biomatrix scaffold comprising at least
95% of the collagens and most collagen-associated matrix components
and matrix bound growth factors, hormones and cytokines of the
biological tissue.
48. The method of claim 47, wherein the second medium comprises at
least one of the constituents present in interstitial fluid.
49. The method of claim 47, wherein the delipidating buffer
comprises from about 20 units/L to about 50 units/L phospholipase
A2 and about 1% sodium deoxycholate in the first medium.
50. The method of claim 47, wherein the salt concentration of the
buffer of step (c) is from about 3.4M NaCl to about 3.5M NaCl when
used for scaffold preparation from an adult liver and is from about
4.0M NaCl to about 4.5M NaCl when used for scaffold preparation
from a fetal liver.
51. The method of claim 47, wherein the buffer of step (c) further
comprises a protease inhibitor.
52. The method of claim 51, wherein the protease inhibitor is
soybean trypsin inhibitor.
53. The method of claim 47, wherein the buffer of step (d) further
comprises a protease inhibitor.
54. The method of claim 53, wherein the protease inhibitor is
soybean trypsin inhibitor.
55. The method of claim 47, wherein the biological tissue is
selected from the group consisting of liver tissue, lung tissue,
pancreatic tissue, thyroid tissue, intestinal tissue, skin tissue,
blood vessel tissue, bladder tissue, heart tissue and kidney
tissue.
56. A biomatrix scaffold produced by the method of claim 47.
57. A method of producing a cell culture, comprising: (a)
contacting the biomatrix scaffold of claim 56 with cell culture
medium in a culture apparatus; and (b) seeding the biomatrix
scaffold of step (b) with cells, thereby producing a cell
culture.
58. The method of claim 57, wherein the cell culture medium
comprises at least one of the constituents present in interstitial
fluid, wherein the osmolality of said medium is from about 250
mOsm/kg to about 350 mOsm/kg and wherein said medium is serum
free.
59. The method of claim 57, wherein the cells are selected from the
group consisting of embryonic stem (ES) cells, induced pluripotent
stem (iPS) cells, determined stem cells, perinatal stem cells,
amniotic fluid-derived stem cells (AFSCs), mesenchymal stem cells
(MSCs) from any source, committed progenitors or adult cells of any
tissue type, mature cells, normal cells, diseased cells, tumor
cells and any combination thereof.
60. The method of claim 57, wherein the cells are selected from the
group consisting of liver cells, parenchymal cells, stellate cells,
endothelial cells, hepatocytes, cholangiocytes, biliary tree cells
that are not cholangiocytes and pancreatic cells.
61. A method of producing a graft for transplantation into a host
animal, comprising: (a) contacting the biomatrix scaffold of claim
56 with cell culture medium in a culture apparatus; (b) seeding the
biomatrix scaffold with cells; (c) maintaining the biomatrix
scaffold under culture conditions; and (d) establishing a
population of the cells on the biomatrix scaffold, thereby
producing a tumor graft for transplantation into the host
animal.
62. The method of claim 61, further comprising the step of
transplanting the graft into the host animal.
63. The method of claim 61, wherein the graft is syngeneic,
allogeneic or xenogenic to the host animal.
64. A method of producing a protein of interest in cells cultured
on a biomatrix scaffold, comprising: (a) contacting the biomatrix
scaffold of claim 56 with cell culture medium in a culture
apparatus; (b) seeding the biomatrix scaffold with cells that
produce the protein of interest; (c) maintaining the cells on the
biomatrix scaffold under culture conditions; and (d) collecting the
protein of interest produced by the cells, thereby producing a
protein of interest in cells cultured on a biomatrix scaffold.
65. The method of claim 56, further comprising the step of
purifying the protein of interest.
Description
STATEMENT OF PRIORITY
[0001] This application is a divisional of U.S. application Ser.
No. 13/807,253, filed Mar. 14, 2013, now U.S. Pat. No. 8,802,081
which is a National Stage application of International Application
No. PCT/US2011/042805, filed Jul. 1, 2011, which claims the benefit
of U.S. Provisional Application Ser. No. 61/360,939, filed Jul. 2,
2010, the entire contents of which are incorporated by reference
herein.
FIELD OF THE INVENTION
[0003] This invention concerns biomatrix scaffolds and methods of
producing biomatrix scaffolds and their use in diverse applications
as intact scaffolds or as scaffolds that are sectioned or
pulverized and dispersed in various ways for specific experimental
and clinical uses.
BACKGROUND OF THE INVENTION
[0004] The ability to use differentiated cells ex vivo or in
clinical programs such as cell therapies depends on the ability to
maintain the cells with an adult phenotype and fully functional or
to be able to lineage restrict stem cells or progenitors
("stem/progenitors") to achieve that adult phenotype. The ongoing
revolution in stem cell research has made possible the
identification and isolation of stem/progenitor cell populations
including those from embryonic, fetal and postnatal tissues.sup.1.
The ability to identify and isolate the stem/progenitors for all
adult cell types and to expand and to differentiate them greatly
increases the potential for utilizing them for pharmaceutical and
other industrial research programs, for academic investigations and
for clinical programs such as cell based therapies, and tissue
engineering.sup.2.
[0005] Current methods for maintaining differentiated cells or of
lineage restricting stem cells to an adult fate ex vivo are
partially successful and involve plating the cells onto or embedded
into a substratum of an extracellular matrix component(s) and into
a medium comprised of specific hormones, growth factors and
nutrients tailored for the adult phenotype desired. For very
primitive stem cells such as embryonic stem (ES) cells or induced
pluripotent stem (iPS) or postnatally-derived ones that can go to
multiple adult fates, such as mesenchymal stem cells (MSCs) or
amniotic fluid-derived stem cells (AFSCs), the stem cells are
subjected to a mix of soluble signals and/extracellular matrix
components and must be treated with multiple sets of these signals
over weeks of time. Typically the adult phenotype achieved is
distinct with every preparation and has over or under expression of
certain adult-specific genes and/or aberrant regulation of one or
more of the adult tissue-specific genes.
[0006] Extracellular matrix is secreted by cells, is adjacent to
them on one of more of their surfaces, and has long been understood
to be the structural support for cells.sup.7. It is an
extraordinary complex scaffold composed of a variety of
biologically active molecules that are highly regulated and
critical for determining the morphology, growth, and
differentiation of the attached cells.sup.8. Tissue-specific gene
expression in cultured cells is improved by culturing the cells on
matrix extracts or purified matrix components.sup.9. However,
individual matrix components, alone or in combination, are unable
to recapitulate a tissue's complex matrix chemistry and
architecture. This is related to the fact that the matrix
components are in gradients associated with natural tissue zones
and with histological structures such as blood vessels. This
complexity of the tissue matrix is more readily achieved by
extractions that decellularize a tissue and leave behind the matrix
as a residue.sup.10,11. However, current decellularization
protocols result in major losses of some of the matrix components
due to the use of matrix-degrading enzymes or buffers that
solubilize matrix components.
[0007] The present invention provides biomatrix scaffolds and
methods of making and using such biomatrix scaffolds. The methods
of this invention result in the production of a tissue-specific
extract enriched in a majority of the collagens of the tissue and
with bound matrix components and matrix-bound hormones, growth
factors and cytokines that collectively yield more reproducible and
potent differentiation effects on both mature cells and in lineage
restriction of stem/progenitor cell populations.
SUMMARY OF THE INVENTION
[0008] The present invention provides, in one aspect, a method of
producing a biomatrix scaffold from biological tissue, comprising
the steps of: a) perfusing the biological tissue or homogenizing
the biological tissue with a first medium, wherein the osmolality
of said first medium is from about 250 mOsm/kg to about 350 mOsm/kg
and said first medium is serum free and at neutral pH; then b)
perfusing the biological tissue or extracting the homogenate of
step (a) with a delipidating buffer comprising lipases and/or
detergents in said first medium; then c) perfusing the tissue or
extracting the homogenate of step (b) with a buffer at a neutral pH
and comprising a salt concentration from about 2.0M NaCl to about
5.0M, the concentration chosen to keep insoluble collagens
identified in the biological tissue; then d) perfusing the tissue
or extracting the homogenate of step (c) with RNase and DNase in a
buffer; and then e) rinsing the tissue or homogenate of step (d)
with a second medium that is at neutral pH, is serum-free and has
an osomolality from about 250 mOsm/kg to about 350 mOsm/kg, thereby
producing an intact or homogenized biomatrix scaffold from the
biological tissue, said biomatrix scaffold comprising at least 95%
of the collagens and most collagen-associated matrix components and
matrix bound growth factors, hormones and cytokines of the
biological tissue.
[0009] Furthermore the present invention provides a biomatrix
scaffold comprising collagens, fibronectins, laminins,
nidogen/entactin, elastin, proteogylcans, glycosaminoglycans,
growth factors, cytokines or any combination thereof, all being
part of the biomatrix scaffold.
[0010] In additional aspects, the present invention provides a
method of producing a cell culture, comprising: a) producing a
biomatrix scaffold according to the methods of this invention; b)
contacting the biomatrix scaffold of step (a) with cell culture
medium in a culture apparatus; and c) seeding the biomatrix
scaffold of step (b) with cells, thereby producing a cell
culture.
[0011] A method is also provided herein of producing a cell
culture, comprising: a) producing a biomatrix scaffold according to
the methods of this invention; b) freezing the biomatrix scaffold
of step (a); c) preparing a frozen section from the biomatrix
scaffold of step (b) as a cell culture substratum; d) contacting
the cell culture substratum of step (c) with cell culture medium in
a culture apparatus; and e) seeding the cell culture substratum of
step (d) with cells, thereby producing a cell culture.
[0012] In addition, the present invention provides a method of
producing a cell culture, comprising: a) producing a biomatrix
scaffold according to the methods of this invention; b) grinding
the biomatrix scaffold of step (a) to a powder (e.g., in some
embodiments, after freezing the biomatrix scaffold of step (a); c)
coating at least part of a culture apparatus with the powder of
step (b) to produce a cell culture substratum; d) contacting the
cell culture substratum of (c) with cell culture medium in the
culture apparatus; and e) seeding the cell culture substratum of
(d) with cells, thereby producing a cell culture. In particular
embodiments of this method, the grinding of the biomatrix scaffold
can be carried out for example, in a freezer mill at or around
liquid nitrogen temperatures.
[0013] Further provided herein is the use of the tissue-specific
biomatrix scaffold of this invention to facilitate differentiating
embryonic stem cells or induced pluripotent cells towards a
specific fate, as well as the use of the tissue-specific biomatrix
scaffold of this invention to facilitate differentiating amniotic
fluid-derived stem cells or mesenchymal stem cells from bone
marrow, adipose tissue, or any fetal or postnatal tissue or any
determined stem cells (e.g., lung intestine, biliary tree, kidney,
skin, heart) towards a specific adult fate.
[0014] In additional embodiments, the present invention provides a
method of enhancing and accelerating differentiation of stem cells
and/or progenitors to mature cells, comprising producing a cell
culture according to the methods of this invention, wherein the
cells are stem cells and the cell culture medium is formulated for
mature cells, thereby enhancing and accelerating differentiation of
stem cells and/or progenitors to mature cells.
[0015] The present invention further provides a method of
delivering cells to a subject, comprising seeding the biomatrix
scaffold of this invention with cells and then transplanting the
biomatrix scaffold seeded with the cells into the subject.
[0016] Additionally provided herein is a method of identifying the
metastatic potential of tumor cells in a tissue type, comprising:
a) producing a biomatrix scaffold according to the methods of this
invention; b) contacting the biomatrix scaffold of (a) with cell
culture medium in a culture apparatus; c) seeding the biomatrix
scaffold of (b) with tumor cells; d) maintaining the biomatrix
scaffold of (c) under culture conditions; and e) monitoring growth
of the tumor cells on the biomatrix scaffold of (d), wherein growth
of tumor cells on the biomatrix scaffold identifies that the tumor
cells can colonize in vivo the type of tissue from which the
biomatrix scaffold was produced, thereby identifying the metastatic
potential of the tumor cells in the tissue type.
[0017] Furthermore, the present invention provides a method of
identifying a tumor cell as responsive to an anti-tumor treatment,
comprising: a) producing a biomatrix scaffold according to the
methods of this invention; b) contacting the biomatrix scaffold of
(a) with cell culture medium in a culture apparatus; c) seeding the
biomatrix scaffold of (b) with tumor cells; d) maintaining the
biomatrix scaffold of (c) under culture conditions; e) applying the
anti-tumor treatment to the tumor cells on the biomatrix scaffold;
and f) monitoring growth of the tumor cells on the biomatrix
scaffold of (e), wherein lack of growth of tumor cells and/or death
of tumor cells on the biomatrix scaffold of (e) identifies the
tumor cells as responsive to the antitumor treatment.
[0018] The present invention also provides a method of producing a
tumor graft for transplantation into a host animal, comprising: a)
producing a biomatrix scaffold according to the methods of this
invention; b) contacting the biomatrix scaffold of (a) with cell
culture medium in a culture apparatus; c) seeding the biomatrix
scaffold of (b) with tumor cells; d) maintaining the biomatrix
scaffold of (c) under culture conditions; and e) establishing a
population of the tumor cells on the biomatrix scaffold of (d),
thereby producing a tumor graft for transplantation into the host
animal. In some embodiments, this method can further comprise the
step of transplanting the tumor graft into the host animal.
[0019] In further embodiments, the present invention provides a
method of producing virus particles of a lineage dependent virus,
comprising: a) producing a biomatrix scaffold according to the
methods of this invention; b) contacting the biomatrix scaffold of
(a) with cell culture medium in a culture apparatus; c) seeding the
biomatrix scaffold of (b) with cells of a type and lineage stage
that can be infected with the lineage dependent virus; d) infecting
the cells of (c) with the lineage dependent virus; e) maintaining
the infected cells on the biomatrix scaffold under culture
conditions; and f) collecting virus particles produced in the
infected cells, thereby producing virus particles of the lineage
dependent virus.
[0020] The present invention also provides a method of producing an
organoid formed by recellularization of a biomatrix scaffold,
comprising: a) producing a biomatrix scaffold according to the
methods of this invention; b) contacting the biomatrix scaffold of
(a) with cell culture medium in a culture apparatus; c) seeding the
biomatrix scaffold of (b) with cells of the same tissue type as the
biological tissue used to prepare the biomatrix scaffold; d)
maintaining the cells on the biomatrix scaffold under culture
conditions, whereby organoids form from the cells, thereby
producing an organoid formed by recellularization of the biomatrix
scaffold.
[0021] Further provided herein is a method of producing a protein
of interest in cells cultured on a biomatrix scaffold, comprising:
a) producing a biomatrix scaffold according to the methods of this
invention; b) contacting the biomatrix scaffold of (a) with cell
culture medium in a culture apparatus; c) seeding the biomatrix
scaffold of (b) with cells that produce the protein of interest; d)
maintaining the cells of (c) on the biomatrix scaffold under
culture conditions; and f) collecting the protein of interest
produced by the cells of (d), thereby producing a protein of
interest in cells cultured on a biomatrix scaffold.
[0022] The foregoing and other aspects of the present invention
will now be described in more detail with respect to other
embodiments described herein. It should be appreciated that the
invention can be embodied in different forms and should not be
construed as limited to the embodiments set forth herein. Rather,
these embodiments are provided so that this disclosure will be
thorough and complete, and will fully convey the scope of the
invention to those skilled in the art.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1. Rat liver biomatrix scaffold preparation. (a)
Four-step decellularization process comprised of perfusion wash,
delipidation with PLA2 and SDC, high salt washes, and nuclease
treatment for nucleic acid removal. (b-d) Four stages in the
preparation of rat biomatrix scaffold. (b) After perfusion wash
with basal medium for 10 minutes the liver becomes pale; (c) during
delipidation, the liver becomes partially transparent under GC (d)
final intact scaffold looks transparent at 40 minutes of perfusion;
(e) biomatrix scaffold shown at low magnification. (e1)
Visualization of scaffold perfused with rhodamine-labeled dextran
particles demonstrates progressive flow from large vessels to the
fine blood vessel branches along the channels without leakage,
indicating patent vasculature in scaffolds. Corresponding
hematoxylin and eosin (H&E) staining of biomatrix scaffold in
different stages demonstrated that the histological structures such
as blood vessels and lace-like matrix enveloping the parenchyma are
preserved, whereas cells are removed. The normal rat hepatic portal
triad structure consisting of the portal vein (PV), hepatic artery
(HA), and bile duct (BD) (b1); the matrix fibers becoming apparent
as the cells are gradually removed during the decellularization
process (c1); decellularized portal triad region, compare (b1) with
that in (d1); d2 and d3 show that all of the cells are removed from
the matrix scaffold but mesh structures are preserved such as the
blood vessels, GC, and the lace-like matrix that surrounds muralia
of parenchymal cells.
[0024] FIG. 2. TEM (a-c) and SEM (d-h) images of rat liver
biomatrix scaffolds. (a) Low magnification of blood vessel (BV)
with a thick wall (W). Collagen Type I (large arrowhead) is
numerous and contains cross-sections of individual fibers that do
not take up heavy metal stains (white dots, small arrowheads). (b)
Higher magnification of a vessel wall shows basement membrane
(large arrow), amorphous elastin (*) and associated elastic fibers,
a rare membrane vesicle remnant (small arrowhead), a collagen Type
I banded fiber (arrowhead) and small fibrils (small arrows). The
small fibrils are probably fibrillin (Type VI collagen) that
associates closely with and helps organize Type I collagen. (c)
High magnification of Type I collagen with 64 nm banding pattern
(arrows). (d) Low magnification of a vessel with thin wall (BV) and
the wall of a larger vessel (W). (e) At higher magnification, the
large vessel wall (W) is scalloped, consistent with hepatic artery
of a portal triad, see (a). Beneath the wall are numerous Type I
collagen bundles (large arrow) linked by long branching thin,
reticular (Type III) collagen fibrils (small arrows). (f) A large
bundle of Type I collagen has characteristic parallel fibers (large
arrow) associated with a variety of smaller fibers (arrow) and
nodular or beaded fibers (arrowhead). (g) 3D-meshwork of
large/small fibers interlinked in a plane that forms a boundary
such as to a liver sinusoid. (h) Higher magnification of the
meshwork showing a variety of fibers (arrows): Type III collagen
(larger diameter straight), elastic fibers or Type VI collagen.
[0025] FIG. 3. Chemical analysis of collagens and expression of
extracellular matrix (ECM) components in biomatrix scaffolds. (a)
The content of three amino acids, all found in collagens:
hydroxyproline (Hyp), hydroxylysine (Hyl), and glycine (Gly). The
numbers represent the residues of each amino acid/1,000 amino
acids. The data indicate the dramatic increase in the collagen
content in the decellularization process going from <0.2% in
liver to more than 15% in the biomatrix scaffolds. (b)
Immunohistochemical staining of matrix molecules in biomatrix
scaffolds, shows distribution in liver biomatrix scaffolds of
laminin (LAM), heparan sulfate (HS), collagen type III (COL3) and
fibronectin (FN) and typical basement membrane proteins in
association with remnants of blood vessels. At higher
magnification, one can observe main members of basement membrane,
including type IV collagen (COL4), entactin (Ent; also called
nidogen), laminin (LAM) and perlecan (Per), a form of HS-PG in the
portion of the scaffolds near the portal triads.
[0026] FIG. 4. Pattern of ECM components from portal triad to
central vein in biomatrix scaffolds. Histological comparison from
portal triad (zone 1) to central vein (zone 3) of normal liver (a)
and liver biomatrix scaffold (b); both are hematoxylin/eosin
stained sections. (c) The model illustrating a stem cell and
maturational lineage system in the liver with representative matrix
components shown that form patterns associated with the liver
zonation. The components are listed in order of abundance from the
findings of immunohistochemistry. The known lineage stages within
human livers begin periportally in zone 1 (around portal triads)
and progress in maturation ending with apoptotic cells in zone 3.
The known matrix chemistry identified in the liver's stem cell
niche is comprised of hyaluronans, type III collagen, a form of
laminin that binds to .alpha.6.beta.4 integrin, and a weakly
sulfated form of CS-PG.sup.43,44. Just outside the stem cell niche
are found Type IV collagen, normally sulfated CS-PGs and HS-PGs and
forms of laminin binding to .alpha..beta.1 integrin. HP-PGs have
been documented to be located uniquely pericentrally.sup.45,46. (d)
The survey of matrix components and their location in liver versus
those in biomatrix scaffolds, data summarized from
immunohistochemistry findings (N/D=not tested. *Found by others to
be exclusively near central veins). Most components of the
cytoskeleton are lost during the washes, residues of some, but not
all, cytoskeletal proteins are present. The scaffolds are devoid of
detectable amounts of tubulin, desmin, and actin (phalloidin
assays). However, there are trace amounts of cytokeratins scattered
randomly in the scaffolds; trace amounts of .alpha.-smooth muscle
actin around remnants of blood vessels at the portal triads; and
low levels of vimentin throughout.
[0027] FIG. 5. Characterization of hHpSCs on liver biomatrix
scaffolds versus on type I collagen. Phase-contrast images (a-d)
show the morphologic changes of hHpSC colonies derived from the
same liver and cultured in serum-free Kubota's medium and on tissue
culture plastic (a), one of the conditions for self-replication,
versus in the differentiation conditions of the serum-free
differentiation medium for liver, and on type I collagen (b) versus
on bovine liver biomatrix scaffolds (c-e). Functional and fully
viable cultures did not last more than .about.2 weeks on type I
collagens. By contrast, those on the liver biomatrix scaffolds were
viable and healthy and with a full repertoire of functions lasting
at least a month. The cultures transitioned to cells by days 7-12
with increased cytoplasmic/nuclear ratio and marked glycogen
expression (c) and then to ones with classic polygonal hepatocyte
morphology interspersed by clear bile canaliculi (d), a culture
morphology that persisted thereafter, as indicated in the
representative culture at day 24 (e). RT-PCR assays show gene
expression changes of hHpSCs under self-replication conditions on
culture plastic (f) versus on rat liver biomatrix scaffolds on day
7 (g). We compared expression of hHpSC markers, including CXCR4 and
EpCAM; early hepatocytic genes including CK19 (KRT19), HNF6, FOXA2,
AFP and low levels of albumin; mature hepatocytic markers including
high levels of albumin (ALB), transferrin (TF), CYP450-3A4,
tyrosine aminotransferase (TAT), and glucose-6-phoshatase (G6PC)
and cholangiocytic genes, including CFTR, gamma glutamyl
transpeptidase (GGT1), anion exchange 2 (AE2) and apical
sodium-dependent bile acid transporter (ASBT). Biochemical assays
measuring urea (h) synthesized in cultures on type I collagen
versus on rat liver biomatrix scaffolds and CYP450-3A4 activity (i)
in cultures on type I collagen versus on biomatrix scaffolds
prepared from either rat or bovine livers. Table 7 provides a
summary of quantitative measures comparing attachment, viability,
growth, culture life span, and tissue-specific gene expression of
hHpSCs freshly isolated, under culture conditions for
self-replication (type III collagen), or under conditions for
differentiation on collagen I, versus liver biomatrix
scaffolds.
[0028] FIG. 6. Immunofluorescence staining of cells lineage
restricted from hHpSCs on biomatrix scaffolds. (a) Stained with
hepatic specific marker: albumin (Alb, light grey) and hepatic stem
cell surface marker: EpCAM (white). Note that cells plated on
biomatrix scaffold do not express EpCAM. Scale bar=200 .mu.m. (b)
Stained with early hepatic marker .alpha.-fetoprotein (AFP, light
grey) and with an antibody to human cholangiocyte marker,
cytokeratin 19 (CK19, white) that at this level of expression is
indicative of mature cholangiocytes. The antibody to CK19 assay is
human-specific and did not stain the residue at rat CK19 in the
scaffolds not seeded with cells. The AFP expression is low but
still evident at day 7. Scale bar=200 .mu.m. (c) Stained with Alb
(light grey) and hepatic stellate cell marker, .alpha.-smooth
muscle actin (ASMA, white). The expression of albumin and ASMA is a
strong indication that both maturing hepatocytes and stellate cells
are present. Scale bar=100 .mu.m. (d) Stained with functional
hepatic protein CYP450-3A4 (light grey) and cholangiocyte-specific
marker, secretin receptor (SR, white) showing that the maturing
hepatocytes and cholangiocytes are functional and express classic
markers for these two cell types. Scale bar=200 .mu.m.
[0029] FIG. 7. Stability of fully functional, mature human
hepatocytes on biomatrix scaffolds. Adult human hepatocytes plated
in the differentiation medium and onto type I collagen (a, b)
versus on bovine liver biomatrix scaffolds (c) that were
cryogenically pulverized, dispersed in medium and allowed to
sediment onto the plates. Cells on type I collagen are fully viable
and at their peak of differentiation from 7-12 days (A-shown at 7
days); they begin to deteriorate after .about.2 weeks, and by 20
days (b) they are dead, dying and nonfunctional. By contrast, those
plated onto liver biomatrix scaffolds (c) are functional for at
least 8 weeks (longer times have not been assessed yet); here is
shown after 21 days in culture on pulverized liver biomatrix
scaffolds. CYP450-3A4 assays on cultures of two separate
preparations of cryopreserved adult human liver cells plated onto
biomatrix scaffolds versus on type I collagen and assayed on day 12
(d). The sample ZHep-007 is representative of cryopreserved samples
with good attachment after thawing; the sample ZL-013 is
representative of those lots that have poor or no attachment after
thawing. Thus, even these poorer quality samples are able to attach
to biomatrix scaffolds and remain viable long term. In both samples
assayed, the levels of P450s are higher when cultured on liver
biomatrix scaffolds. With time on the biomatrix scaffolds, the lots
of poorer quality cryopreserved cells will improve.
[0030] FIG. 8. Activation of phospholipase A2 by sodium
deoxycholate to produce lysolecithin. Principle of the protocol:
Phospholipase A2 (PLA2) activated by sodium deoxycholate will
degrade the phosphoglyceride located on the cytoplasmic membrane
and mitochondrial membrane into lysolecithin, a powerful
surfactant, which induces cell necrosis.
[0031] FIG. 9. Analysis of the collagen composition of rat livers
versus rat liver biomatrix scaffolds. The amino acid composition of
biomatrix (black) and whole liver (light grey) presented in the
form of a Rose Diagram. A three-letter abbreviation is used for
each amino acid analyzed. Tryptophan and cysteine were not
analyzed. The numbers indicate the amino acid residues/1,000.
[0032] FIG. 10. Nucleic acid analysis of rat liver biomatrix
scaffold. Phase contrast photo (a) and fluorescent DAPI staining
(b) of the liver biomatrix slide, and quantitative assays on total
DNA and RNA from rat fresh liver tissue versus biomatrix scaffold
(c).
[0033] FIG. 11. Staining of the biomatrix scaffold after plating
hHpSCs onto the biomatrix scaffold. Live (calcein-AM, white)/Dead
(ethidium bromide or EtD-Bri, light grey) assay indicates hHpSCs
colonies were viable on biomatrix scaffold sections but did not
take up dye in the middle of the colonies (a, b) for the first few
days due to the known pumps in the stem cells (e.g., MDR1) that
eliminate the vital dyes. In (b) the fluorescence image is merged
with the phase one to indicate that the center of the colony
contains cells. By day 7, the cells throughout the colony had
differentiated and took up the vital dye in almost all the cells
throughout the colony (c).
[0034] FIG. 12. Comparison of rat hepatocytes cultured on type I
collagen to rat hepatocytes cultured on rat liver biomatrix
scaffolds. Adult rat hepatocytes cultured on type I collagen and
biomatrix scaffold at day 3 (a, c) and day 10 (b, d). They attached
within several minutes on liver biomatrix scaffolds and survived
for as long as tested, more than 8 weeks (c, d); longer time
periods were not tested. The cultures are very three-dimensional on
the biomatrix scaffolds. Urea synthesis (e) and cell viability
assay (f) at day 1, 3, 5, 7, 10, 14, 21 and 28, n=3.
[0035] FIG. 13. Comparison of a human pancreas to a human
pancreatic biomatrix scaffold. Human pancreas (a) vs human
pancreatic biomatrix scaffold (b-d) embedded in paraffin, sectioned
and stained with Hematoxylin and Eosin (H&E). Islet structures
have been outlined in (b). The acinar regions of pancreatic
biomatrix scaffolds are shown in (c, d).
[0036] FIG. 14. Comparison of representative matrix components and
one cytoskeletal component, vimentin, found in human pancreatic
tissue versus rat pancreatic biomatrix scaffolds. Other
cytoskeletal components (desmin, tubulin, actin) were not found in
detectable amounts or were found in trace amounts (cytokeratins).
The dashed lines encircle islets, note that syndecan1 and collagen
type VI are strongly positive in the islets both in pancreas tissue
and in biomatrix scaffolds. Syndecan 1 is found only in the islets
(dashed line) but not in the acinar cells (arrows); collagen type
III is more enriched in acinar cells and around blood vessels
(arrows), but not in the islets.
[0037] FIG. 15. Histological and immunohistochemistry staining of
human duodenum biomatrix scaffold. (a) Outside and lumen side of
human duodenum biomatrix scaffold. The multilayer structures
between the normal tissue (b) and biomatrix scaffold (c) were
compared in H&E stained sections and results show scaffolds
retained the villus and blood vessels in the mucosa and submucosa
layers. Lower panels show immunohistochemistry staining of human
duodenum biomatrix scaffold indicated variable amounts of
extracellular matrix proteins retained in the scaffold.
[0038] FIG. 16. Comparison of a human gallbladder tissue to a human
gallbladder biomatrix scaffold. Human gallbladder tissue (a, b)
versus biomatrix scaffolds (c, d) prepared from it. The tissue and
the biomatrix scaffolds were embedded in paraffin, sectioned and
stained with hematoxylin and eosin.
[0039] FIG. 17. Colon tumor cell lines HT29 (a) and SW480 (b) were
seeded onto biomatrix scaffolds and formed colonies of cells
comprised of hundreds to thousands of cells and that were quite
3-dimensional.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The present invention will now be described more fully
hereinafter. This invention may, however, be embodied in different
forms and should not be construed as limited to the embodiments set
forth herein. Rather, these embodiments are provided so that this
disclosure will be thorough and complete, and will fully convey the
scope of the invention to those skilled in the art.
[0041] The terminology used in the description of the invention
herein is for the purpose of describing particular embodiments only
and is not intended to be limiting of the invention. As used in the
description of the invention and the appended claims, the singular
forms "a," "an" and "the" are intended to include the plural forms
as well, unless the context clearly indicates otherwise.
[0042] Unless otherwise defined, all terms (including technical and
scientific terms) used herein have the same meaning as commonly
understood by one of ordinary skill in the art to which this
invention belongs. It will be further understood that terms, such
as those defined in commonly used dictionaries, should be
interpreted as having a meaning that is consistent with their
meaning in the context of the present application and relevant art
and should not be interpreted in an idealized or overly formal
sense unless expressly so defined herein. The terminology used in
the description of the invention herein is for the purpose of
describing particular embodiments only and is not intended to be
limiting of the invention. All publications, patent applications,
patents and other references mentioned herein are incorporated by
reference in their entirety.
[0043] Also as used herein, "and/or" refers to and encompasses any
and all possible combinations of one or more of the associated
listed items, as well as the lack of combinations when interpreted
in the alternative ("or").
[0044] Unless the context indicates otherwise, it is specifically
intended that the various features of the invention described
herein can be used in any combination. Moreover, the present
invention also contemplates that in some embodiments of the
invention, any feature or combination of features set firth herein
can be excluded or omitted. To illustrate, if the specification
states that a complex comprises components A, B and C, it is
specifically intended that any of A, B C, or a combination thereof,
can be omitted and disclaimed singularly or in any combination.
[0045] As used herein, the transitional phrase `consisting
essentially of` (and grammatical variants) is to be interpreted as
encompassing the recited materials or steps "and those that do not
materially affect the basic and novel characteristic(s)" of the
claimed invention. See, In re Herz, 537 F 2d 549, 551-52, 190
U.S.P.Q. 461, 463 (CCPA 1976) (emphasis in the original); see also
MPEP .sctn.2111.03. Thus, the term "consisting essentially of" as
used herein should not be interpreted as equivalent to
"comprising."
[0046] The term "about," as used herein when referring to a
measurable value such as an amount or concentration (e.g., the
percentage of collagen in the total proteins in the biomatrix
scaffold) and the like, is meant to encompass variations of 20%,
10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.
[0047] The present invention is directed to the discovery and
development of a biomatrix scaffold that has unexpected
improvements and advantages over decellularized tissue scaffolds
now known, some examples of the improvement and advantage being the
use of the biomatrix scaffold of this invention to efficiently
maintain mature cells and/or to lineage restrict and/or
differentiate stem cells to mature fates and/or to maintain such
matured cells as functional for an extended period of time. As a
further example, use of the biomatrix scaffolds of this invention
reduces the time to produce cells of mature fates from about three
to six weeks or more to about one to two weeks. The biomatrix
scaffolds of this invention are produced using specific protocols
that employ the appropriate balance of salt concentration and ionic
strength (different collagens have different solubility constants
(23)) for a given time, to allow for the retention of native
collagens present in that tissue in insoluble form, resulting in a
biomatrix scaffold that retains a high percent of native collagens
that provide signals to drive lineage restriction and
differentiation. In contrast, decellularized scaffolds produced
according to known protocols do not employ such a balance of salt
concentration and ionic strength to allow for retention of a high
percent of these native collagens and most of these native
collagens are lost when these known protocols are used.
Furthermore, the biomatrix scaffolds of this invention allow for
production of lineage dependent (e.g., differentiation dependent)
viruses and/or pathogens in amounts sufficient for experimental
and/or therapeutic use (e.g., for vaccine production).
[0048] Thus, in one embodiment, the present invention provides a
method of producing a biomatrix scaffold from biological tissue,
comprising the steps of: a) perfusing the biological tissue or
homogenizing the biological tissue with a first medium, wherein the
osmolality of said first medium is from about 250 mOsm/kg to about
350 mOsm/kg and said first medium is serum free and at neutral pH;
then b) perfusing the biological tissue or extracting the
homogenate of step (a) with a delipidating buffer comprising
lipases and/or detergents in said fast medium; then c) perfusing
the tissue or extracting the homogenate of step (b) with a buffer
at a neutral pH and comprising a salt concentration from about 2.0
M NaCl to about 5.0M, the concentration chosen to keep insoluble
collagens identified in the biological tissue; then d) perfusing
the tissue or extracting the homogenate of step (e) with RNase and
DNase in a butler; and then e) rinsing the tissue or homogenate of
step (d) with a second medium that is at neutral pH, is serum-free
and has an osomolality from about 250 mOsm/kg to about 350 mOsm/kg,
thereby producing an intact or homogenized biomatrix scaffold from
the biological tissue, said biomatrix scaffold comprising at least
95% (e.g., 80%, 35%, 90%, 95%, 98%, 99%, 100%) of the collagens and
most collagen-associated matrix components and matrix hound growth
factors, hormones and cytokines of the unprocessed biological
tissue. Also provided herein is a biomatrix scaffold produced by
any of the methods of this invention.
[0049] "Biomatrix scaffold" as used herein refers to an isolated
tissue extract enriched in extracellular matrix, as described
herein, which retains many or most of the collagens and
collagen-bound factors found naturally in the biological tissue. In
some embodiments essentially all of the collagens and
collagen-bound factors are retained and in other embodiments the
biomatrix scaffold comprises all of the collagens known to be in
the tissue. The biomatrix scaffold may comprise at least about 50%,
60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5% or 100% of
the collagens, collagen-associated matrix components, and/or matrix
bound growth factors, hormones and/or cytokines, in any
combination, found in the natural biological tissue. In some
embodiments the biomatrix scaffold comprises at least 95% of the
collagens and most of the collagen-associated matrix components and
matrix bound growth factors, hormones and/or cytokines of the
biological tissue. As described herein, "most of the
collagen-associated matrix components and matrix bound growth
factors, hormones and/or cytokines of the biological tissue" refers
to the biomatrix scaffold retaining about 50%, 60%, 70%, 75%, 80%,
85%, 90%, 95%, 97%, 98%, 99%, 99.5% or 100% of the
collagen-associated matrix components and matrix bound growth
factors, hormones and/or cytokines found in the natural (e.g.,
unprocessed) biological tissue.
[0050] Exemplary collagens include all types of collagen, such as
but not limited to Type I through Type XXIX collagens. The
biomatrix scaffold may comprise at least about 50%, 60%, 70%, 75%,
80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5% or more of one or more of
the collagens found in the natural biological tissue and/or may
have one or more of the collagens present at a concentration that
is at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%,
99%, 99.5% or more of that found in the natural biological tissue.
The amount of collagen in the biomatrix scaffold can be determined
by various methods known in the art and as described herein, such
as but not limited to determining the hydroxyproline content.
[0051] Exemplary collagen-associated matrix components include, but
are not limited to, adhesion molecules; adhesion proteins; L- and
P-selectin; heparin-binding growth-associated molecule (HR-GAM);
thrombospondin type I repeat (TSR); amyloid P (AP); laminins;
nidogens/entactins; fibronectins; elastins; vimentins;
proteoglycans (PGs); chondroitin sulfate-PGs (CS-PGs); dermatan
sulfate-PGs (DS-PGs); members of the small leucine-rich
proteoglycans (SLRP) family such as biglycan and decorins;
heparin-POs (HP-PGs); heparan sulfate-PGs (HS-POs) such as
glypicans, syndecans, and perlecans; and glycosaminoglycans (GAGs)
such as hyaluronans, heparin sulfates, chondroitin sulfates,
keratin sulfates, and heparins. In some embodiments the biomatrix
scaffold comprises, consists of, or consists essentially of
collagens, fibronectins, laminins, nidogens/entactins, elastins,
proteoglycans, glycosaminoglycans, growth factors, hormones, and
cytokines (in any combination) bound to various matrix components.
The biomatrix scaffold may comprise at least about 50%, 70%, 75%,
80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5% or more of one or more of
the collagen-associated matrix components, hormones and/or
cytokines found in the natural biological tissue and/or may have
one or more of these components present at a concentration that is
at least about 50%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%,
99.5% or more of that found in the natural biological tissue. In
some embodiments the biomatrix scaffold comprises all or most of
the collagen-associated matrix components, hormones and/or
cytokines known to be in the tissue. In other embodiments the
biomatrix scaffold comprises, consists essentially of or consists
of one or more of the collagen-associated matrix components,
hormones and/or cytokines at concentrations that are close to those
found in the natural biological tissue (e.g., about 50%, 60%, 70%,
75%, 80%, 85%, 90%, 95%, 98% or 100% of the concentration found in
the natural tissue).
[0052] Exemplary growth factors include, but are not limited to,
fibroblast growth factors (FGFs), nerve growth factors (NGFs),
epidermal growth factors (EGFs), transforming growth factors,
hepatocyte growth factors (HGFs), platelet-derived growth factors
(PDGFs), insulin-like growth factors (IGFs). IGF binding proteins,
basic fibroblast growth factors, and vascular endothelial growth
factors (VEGF). Exemplary cytokines include, but are not limited to
interleukins, lymphokines, monokines, colony stimulating factors,
chemokines, interferons and tumor necrosis factor (TNF). The
biomatrix scaffold may comprise at least about 50%, 60%, 70%, 75%,
80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 100% or more (in any
combination) of one or more of the matrix bound growth factors
and/or cytokines found in the natural biological tissue and/or may
have one or more of these growth factors and/or cytokines (in any
combination) present at a concentration that is at least about 50%,
60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, 100% or
more of that found in the natural biological tissue. In some
embodiments the biomatrix scaffold comprises physiological levels
or near-physiological levels of many or most of the matrix bound
growth factors, hormones and/or cytokines known to be in the
natural tissue and/or detected in the tissue and in other
embodiments the biomatrix scaffold comprises one or more of the
matrix bound growth factors, hormones and/or cytokines at
concentrations that are close to those physiological concentrations
found in the natural biological tissue (e.g., differing by no more
than about 30%, 25%, 20%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%,
0.5% in comparison). The amount or concentration of growth factors
or cytokines present in the biomatrix scaffold can be determined by
various methods known in the art and as described herein, such as
but not limited to various antibody assays and growth factor
assays.
[0053] "Biological tissue" as used herein refers to any tissue of a
living or deceased organism or any tissue derived from a living or
deceased organism. The term "natural biological tissue" and
variations thereof as used herein refer to the biological tissue as
it exists in its natural or unmodified state in the organism. The
biomatrix scaffolds of the present invention can be prepared from
any biological tissue. The biological tissue may include any single
tissue (e.g., a collection of cells that may be interconnected) or
a group of tissues making up an organ or part or region of the body
of an organism. The tissue may comprise a homogeneous cellular
material or it may be a composite structure such as that found in
regions of the body including the thorax which for instance can
include lung tissue, skeletal tissue, and/or muscle tissue.
[0054] Exemplary biological tissues of this invention include, but
are not limited to liver, lung, thyroid, skin, pancreas, blood
vessels, bladder, kidneys, brain, biliary tree, duodenum, abdominal
aorta, iliac vein, heart and intestines, including any combination
thereof. The organism (i.e., subject) from which the biological
tissue is associated with or derived from may be any animal,
including mammals and non-mammals such as invertebrates.
[0055] Exemplary subjects include, but are not limited to mammals,
such as but not limited to, humans, mice, rats, ferrets, hamsters,
rabbits, guinea pigs, pigs, porcine, dogs, cats, horses, cows,
sheep, monkeys, and chimpanzees, and non-mammals, such as but not
limited to birds, reptiles, and invertebrate animals. The subject
may be any age and/or size. The biological tissue may be healthy,
diseased, and/or have genetic mutations. In some embodiments the
biomatrix scaffolds of the present invention are tissue specific in
their chemistry and functionality, i.e., the biomatrix scaffolds
are representative or comparable to the biological tissue from
which they were created in terms of their chemistry and
functionality.
[0056] In some embodiments the native histology and patent
vasculatures are maintained in the biomatrix scaffolds. This may
include the recognizable remnants of major histological entities of
the biological tissue, such as but not limited to blood vessels and
other vasculature for any tissue; bile ducts and Glisson's capsule
(G(C) of the liver; pancreatic ducts, islets and acini of the
pancreas; bronchi, trachea, and alveoli of the lungs, etc. In other
embodiments the biomatrix scaffold's chemistry is matched to the
histology (e.g., matrix around blood vessels is distinct from that
around hepatocytes). In some embodiments the chemistry of the
biomatrix scaffold is in a gradient that is correlated with the
histology. For example, when the biological tissue is the liver,
the biomatrix scaffold may retain the gradient in the matrix
chemistry correlating with the hepatic acinar zones 1-3 from portal
triad to central vein and with histological entities such as
vascular channels and Glisson's capsule (GC). Further examples
include, but are not limited to, blood vessels where the chemistry
of the matrix around the blood vessels is replete with high levels
of network collagens (e.g., type IV and type VI), elastins, and
forms of ITS-PGs; around the hepatocytes in the periportal zone
(zone 1), where laminins are high in concentration along with a mix
of CS-PGs and HS-PGs, whereas around the pericentral zone (zone 3),
are hepatocytes surrounded by a mix of HS-POs and HP-PGs;
associated with the bile ducts where there are high levels of type
I collagen, fibronectins and forms of CS-PGs and DS-PGs. There are
parallel gradients in matrix chemistry in every tissue.
[0057] There are a number of rinse media, such as the first and
second medium, and buffers that may be utilized in the present
invention. In particular, any rinse medium or buffer may be used
that maintains the collagens and bound factors (e.g., matrix
components, growth factors, and cytokines) in an insoluble state.
When choosing a medium or buffer, the salt concentration, pH, and
ionic strength should be suitable to maintain the collagens and/or
most or many of the collagen-bound matrix components and other
factors (e.g., by virtue of their chemical connections directly or
indirectly with the collagens) in an insoluble state. Table 1
provides molar concentration ranges of sodium chloride for various
types of collagen to aid one of ordinary skill in the art in
providing media and buffers that ensure the collagens,
collagen-associated matrix components, and matrix bound growth
factors and cytokines remain insoluble. Deyl et al. ("Preparative
procedures and purity assessment of collagen proteins" Journal of
Chromatography B 790 (2003) 245-275) additionally provides
information on collagen chemistry that can facilitate
identification of the optimal conditions for maintaining collagens
and bound factors in an insoluble state and is incorporated herein
by reference in its entirety.
[0058] Table 1 demonstrates that pH is a variable working in
conjunction with salt concentration to define solubility. By having
high salt concentrations, the pH can be neutral. In some
embodiments of the present invention, the salt concentration chosen
is one that maintains all the collagens of the tissue in an
insoluble state, not just one of the collagens of the tissue in an
insoluble state. For example, the known collagens in fetal liver
are ones that are insoluble in salt concentrations of about 4.5M
NaCl and those in adult liver tissue that are insoluble in salt
concentrations of about 3.4M-3.5M NaCl.
[0059] The osmolality of any of the rinse media and/or buffers may
be, for example, from about 200 mOsm/kg to about 400 mOsm/kg, from
about 250 mOsm/kg to about 350 mOsm/kg, from about 275 mOsm/kg to
about 325 mOsm/kg, or from about 300 mOsm/kg to about 325 mOsm/kg,
including without limitation any values within these ranges not
explicitly recited herein. Distilled water and dilute buffers
(e.g., with osmolality <100 mOsm/kg) will result in the loss of
significant amounts of collagen, collagen-associated matrix
components and matrix bound growth factors and cytokines. Thus, in
some embodiments of the methods of this invention, distilled water
and dilute buffers are not included.
[0060] As one of ordinary skill in the art would recognize,
osmolality is an expression of solute osmotic concentration per
mass, whereas osmolarity is per volume of solvent. Thus, conversion
from osmolarity to osmolality can be made by multiplying by the
mass density. Osmolality can be measured using an osmometer which
measures colligative properties, such as freezing-point depression,
vapor pressure, and boiling-point elevation.
[0061] Osmolarity is the measure of solute concentration, defined
as the number of osmoles (Osm) of solute per liter (L) of solution
(Osm/L or Osm/L). The osmolarity of a solution is usually expressed
as Osm/L. Whereas molarity measures the number of moles of solute
per unit volume of solution, osmolarity measures the number of
osmoles of solute particles per unit volume of solution. Osmolality
is a measure of the osmoles of solute per kilogram of solvent
(osmol/kg or Osm/kg).
[0062] Molarity and osmolarity are not commonly used in osmometry
because they are temperature dependent. This is because water
changes its volume with temperature. However, if the concentration
of solutes is very low, osmolarity and osmolality are considered
equivalent.
[0063] The osmolarity of a solution can be calculated from the
following expression:
osmol / L = i .PHI. i n i C i , ##EQU00001##
where .phi. is the osmotic coefficient, which accounts for the
degree of non-ideality of the solution; n is the number of
particles (e.g. ions) into which a molecule dissociates; C is the
molar concentration of the solute; and the index i represents the
identity of a particular solute. In the simplest case .phi. is the
degree of dissociation of the solute. Then, .phi. is between 0 and
1 where 1 indicates 100% dissociation. However, .phi. can also be
larger than 1 (e.g., for sucrose). For salts, electrostatic effects
cause .phi. to be smaller than 1 even if 100% dissociation
occurs.
[0064] Perfusion of the biological tissue with any medium or buffer
may be accomplished by forcing the medium or buffer through the
relevant vasculature of the biological tissue. For example, if the
biological tissue is the liver, then the medium or buffer may be
perfused through the portal vein of the liver. Alternatively, the
medium or buffer may be poured over the biological tissue and/or
allowed to diffuse through the biological tissue. For example, the
biological tissue may be submerged and/or dialyzed in the medium or
buffer allowing the medium or buffer to diffuse through the
biological tissue. While submerged and/or dialyzed in the medium or
buffer the solution and biological tissue may be shaken, such as on
a rocker, and/or stirred. In some embodiments the media and buffers
are perfused through the relevant vasculature of the biological
tissue.
[0065] Alternatively, the tissue may be homogenized in the initial
medium and the buffers and media used thereafter being for
extraction of the homogenate. The homogenized versions of the
biomatrix scaffolds are prepared from large organs (e.g., from cow
or pig tissues), are then pulverized into powder at liquid nitrogen
temperatures, and the powder used on dishes for culture
studies.
[0066] In some embodiments the first medium and/or the second
medium is a basal medium, such as but not limited to RPMI 1640,
DME/F2, DME, F12, BME, DMEM, Waymouth's, or William's medium. Other
exemplary basal media are known in the art and are commercially
available. The first medium and/or second medium can comprise,
consist essentially of or consist of components that are combined
to keep most collagens insoluble and as native molecules, as
described herein (e.g., by the particular combination of osmolality
and ionic strength as well as the absence of serum). The first
medium and/or second medium may comprise, consist of, or consist
essentially of constituents present or similar to or mimicking
those present in the interstitial fluid such as but not limited to
water, salts such as but not limited to inorganic salts; vitamins;
minerals; amino acids such as but not limited to glycine, serine,
threonine, cysteine, asparagine, and/or glutamine; sugars; fatty
acids; coenzymes; hormones; and neurotransmitters. In certain
embodiments where the first medium and/or second medium comprises
constituents present or similar to or mimicking those present in
the interstitial fluid, the constituents can yield an osmolality
approximately equivalent to the osmolality of commercially
available basal medium or yield an osmolality from about 250
mOsm/kg to about 350 mOsm/kg. In some embodiments the first medium
and/or second medium includes media that are serum free, comprise
constituents present in interstitial fluid, and/or have an
osmolality from about 250 mOsm/kg to about 350 mOsm/kg. Such media
can also be at neutral pH. The specific composition of the first
medium and/or second medium is determined, in particular
embodiments, by the insolubility constants of the collagens of the
biological tissue used to make the biomatrix scaffold, as would be
known to one of ordinary skill in the art.
[0067] The delipidating buffer of the present invention should be
effective and yet gentle. The delipidating buffer may comprise,
consist of, or consist essentially of detergents or surfactants,
basal medium, salts, and/or lipases. When choosing components for
the delipidating buffer, harsh detergents (e.g., sodium dodecyl
sulfate; TritonX-100) should be avoided to minimize loss of matrix
components. Exemplary detergents of this invention include but are
not limited to anionic detergents, such as salts of deoxycholic
acid, 1-heptanesulfonic acid, N-laurylsarcosine, lauryl sulfate,
l-octane sulfonic acid and taurocholic acid; cationic detergents
such as benzalkonium chloride, cetylpyridinium, methylbenzethonium
chloride, and decamethonium bromide; zwitterionic detergents such
as alkyl betaines, alkyl amidoalkyl betaines,
N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate, and
phosphatidylcholine; and non-ionic detergents such as n-decyl
.alpha.-D-glucopyranoside, n-decyl .beta.-D-maltopyranoside,
n-dodecyl .beta.-D-maltoside, n-octyl .beta.-D-glucopyranoside,
sorbitan esters, n-tetradecyl .beta.-D-maltoside, tritons,
Nonidet-P-40, Poloxamer 188, and any of the Tween group of
detergents; sodium lauryl sulfate; and sodium deoxycholate. In some
embodiments the delipidating buffer comprises sodium
deoxycholate.
[0068] Exemplary lipases include, but are not limited to,
phospholipases such as phospholipase A2, human pancreatic lipase,
sphingomyelinases, lysosomal lipase, endothelial lipase, and
hepatic lipase. In some embodiments the delipidating buffer
comprises phospholipase A2. In other embodiments the delipidating
buffer comprises sodium deoxycholate and phospholipase A2. This
combination, in some embodiments, can comprise from about 20 to
about 50 units/L phospholipase A2 and about 1% sodium deoxycholate
prepared in a basal medium of neutral pH and serum-free, which can
be for example, the first medium. The combination of sodium
deoxycholate and phospholipase A2 rapidly degrades the
phosphoglyceride located on the cytoplasm membrane and
mitochondrial membrane into lysolecithin, a powerful surfactant,
which can induce necrosis and cytolysis. As one of ordinary skill
in the art would recognize, the amount and type of lipase and/or
detergent may depend on the biological tissue.
[0069] The step of perfusing the biological tissue with the
delipidating buffer is carried out, in some embodiments, until the
tissue becomes transparent. In other embodiments the step of
perfusing the biological tissue with the delipidating buffer is
carried out until the effusion becomes clear. In some embodiments
the delipidating step is carried out until the tissue becomes
transparent and the effusion becomes clear.
[0070] In some embodiments prolonged exposure of the biomatrix
scaffolds to enzymes from the disrupted cells is avoided since it
can greatly decrease the content of elastin and the content of
glycosaminoglycans such as heparan sulfates, chondroitin sulfates,
dermatan sulfates and heparins, which are sites at which cytokines
and growth factors bind. Exposure to the enzymes from the disrupted
cells may be avoided, for instance, during delipidation and/or the
subsequent washes after delipidation. In some embodiments, use of a
protease inhibitor and/or careful control of the pH, temperature,
and/or time can be employed to limit the activity of the proteases
and/or other enzymes from disrupted cells.
[0071] Exemplary protease inhibitors include but are not limited to
serine protease inhibitors such as but not limited to antipain,
aprotinin, chymostatin, elastatinal, phenylmethylsulfonyl fluoride
(PMSF), APMSF, TLCK, TPCK, leupeptin and soybean trypsin inhibitor;
cysteine proteases such as but not limited to IAA (indoleacetic
acid) and E-64; aspartic protease inhibitors such as but not
limited to pepstatin and VdLPFFVdL; metalloproteases such as but
not limited to EDTA, 1,10-phenanthroline and phosphoramodon;
exopeptidases such as but not limited to amastatin, bestatin,
diprotin A and diprotin B; thiol proteases;
.alpha.-2-macroglobulin, soybean or lima bean trypsin inhibitor,
pancreatic protease inhibitor; egg white ovostatin; egg white
cystatin; and combinations of protease inhibitors, commonly
referred to as a "protease inhibition cocktail" by commercial
suppliers of such inhibitors.
[0072] The pH of the biomatrix scaffold, buffers, and/or media can
be maintained at from about 6.0 to about 9.0, from about 6.5 to
about 8.5, from about 7.0 to about 8.0, or from about 7.5 to about
8.0. In some embodiments, the biomatrix scaffold, buffers, and/or
media are maintained at a pH of from about 7.5 to about 8.0 or are
maintained at a pH of about 7.3 to about 7.5, including without
limitation, any value encompassed within these ranges but not
explicitly recited herein. In other embodiments the biomatrix
scaffold, buffers, and/or media are maintained at neutral pH. The
temperature of the biomatrix scaffold (e.g., during and/or after
preparation), buffers, and/or media can be from about 0.degree. C.
to about 30.degree. C., from about 5.degree. C. to about 25.degree.
C., or from about 10.degree. C. to about 20.degree. C., including
without limitation, any value encompassed within these ranges but
not explicitly recited herein. In some embodiments the temperature
is maintained at about 20.degree. C. The time for perfusing the
biological tissue with any medium or buffer can be from about 5
hours or less, about 3 hours or less, about 1 hour or less, about
30 minutes or less, or about 15 minutes or less. In some
embodiments the step of perfusing the biological tissue with the
delipidating buffer is about 30 minutes or less. In some
embodiments where acidic pHs are used, the salt concentrations for
maintaining the collagens and collagen-associated components
insoluble can be different; the concentrations can be determined by
the extant literature on collagen chemistry by choosing salt
concentrations that maintain insolubility of the collagens.
[0073] Exemplary buffers include but are not limited to sodium
chloride, sodium lactate, sodium acetate, sodium phosphate, sodium
citrate, sodium borate, sodium gluconate, citrate buffers, bis\tris
buffers, phosphate buffers, potassium phosphate, citrate/dextrose,
sodium bicarbonate, ammonium chloride,
3-{[tris(hydroxymethyl)methyl]amino}propanesulfonic acid,
tris(hydroxymethyl)methylamine, N-tris(hydroxymethyl)methylglycine,
4-2-hydroxyethyl-1-piperazineethanesulfonic acid, and
3-(N-morpholino)propanesulfonic acid.
[0074] In some embodiments the buffer of this invention (e.g., the
buffer used in step 0 described herein) can comprise a salt in a
concentration from about 2.0M or more. For example, in some
embodiments the salt may be in a concentration from about 2.0M to
about 5.0M, from about 2.5M to about 5.0M, from about 3.0M to about
4.5M, or from about 3.0M to about 4.0M, including without
limitation, any value encompassed within these ranges but not
explicitly recited herein. For instance, in some embodiments the
buffer utilized in the methods of the present invention can
comprise a salt such as sodium chloride in a concentration from
about 2.0M NaCl to about 4.5M NaCl. In other embodiments, such as
those for adult livers, the buffer utilized can comprise from about
3.4M to about 3.5M NaCl. In embodiments such as those for fetal
liver, the buffer utilized can comprise a salt such as sodium
chloride in a concentration from about 4.0M to about 4.50M. In some
embodiments the perfusion of the biological tissue with a salt
wash, such as that of step c) of the exemplary methods described
herein, is carried out until the perfusate (i.e., the fluid used
for the perfusion, such as the fluid that has been forced through
the vasculature) is negative for proteins by optical density (OD)
at 280 nm.
[0075] Any of the media and/or buffers of the present invention may
comprise a protease inhibitor. Exemplary protease inhibitors are
described above. In some embodiments the buffer such as that in
step (c) of the exemplary methods described herein comprises a
protease inhibitor, such as soybean trypsin inhibitor. In other
embodiments the buffer of step (d) comprises one or more protease
inhibitors, such as soybean trypsin inhibitor.
[0076] The media and/or buffers of the present invention may
comprise one or more nucleases, which in some embodiments can be
prepared in the standard buffers recommended by the commercial
suppliers of these enzymes. For instance, in some embodiments the
buffer of step d) comprises one or more nucleases, such as but not
limited to RNase and DNase. Perfusion with nucleases eliminates
residues of nucleic acids. In other embodiments the buffer of step
d) comprises RNase, DNase, and one or more protease inhibitors. In
some embodiments the perfusion of the biological tissue with one or
more nucleases is carried out until the perfusate (i.e., the fluid
used for the perfusion, such as the fluid that has been forced
through the vasculature) is negative for nucleic acids by optical
density (OD) at 260 am. In some embodiments, the nucleases
eliminate 75%, 80%, 85%, 90%, 95%, 98%, or 100% of nucleic acids in
the biological tissue.
[0077] The second medium (e.g., final rinse medium) can be any
medium that ensures that the collagens and bound factors (e.g.,
matrix components, growth factors, and cytokines) will remain
insoluble, as described above. Exemplary final rinse media are
described above in reference to the first medium and are
serum-free, at neutral pH, and with an osmolality of 250-350
mOsm/kg. For instance, in some embodiments the second medium
comprises a basal medium. In some embodiments the second medium is
a serum-free basal medium. In other embodiments, the second medium
is a serum-free, hormonally defined medium (HDM) comprising
hormones, growth factors, lipids, and serum albumin and is tailored
to the need of the cells to be cultured. An exemplary second medium
is Kubota's medium (Kubota and Reid, PNAS 97:12132-12137, 2000),
which is designed for hepatic stem cells, hepatoblasts and other
progenitors. In certain embodiments the second medium may or may
not comprise supplementation with serum or a factor derived from
serum, such as but not limited to human serum albumin. In some
embodiments, rinsing the tissue with the second medium eliminates
residues of the delipidating buffer and the nucleases. In other
embodiments the wash with the second medium and/or any subsequent
buffer or medium equilibrates the biomatrix scaffold with the
medium or buffer. In some embodiments the first medium and second
medium can be the same and in some embodiments, the first medium
and second medium can be different, thereby producing a biomatrix
scaffold from the biological tissue.
[0078] In some embodiments one or more of the media and/or buffer
utilized in the preparation of the biomatrix scaffold are free of
(i.e., do not contain a detectable amount of) one or more enzymes
that degrade extracellular matrix components. In other embodiments
all of the media and buffers utilized in the preparation of the
biomatrix scaffold are free of (i.e., do not contain a detectable
amount of) one or more enzymes that degrade extracellular matrix
components. Exemplary enzymes include, but are not limited to
collagenases; proteases; glycosidases such as heparinase,
heparitinase, chondroitinase, and hyaluronidase; and elastases.
[0079] Sterilization of the biological tissue, homogenate and/or
biomatrix scaffold of this invention can be accomplished by any
method known in the art, with the caveat that methods using a
factor that can bind to the biomatrix scaffold (e.g., ethylene
oxide) should be avoided. Exemplary methods of sterilization
include but are not limited to gamma irradiation, radio frequency
glow discharges (RFGD) plasma sterilization, electron beam
sterilization, and super critical carbon dioxide sterilization. In
some embodiments sterilization of the tissue, homogenate and/or
biomatrix scaffold is accomplished with gamma irradiation at about
5.000 rads. If the scaffolds are to be used immediately for
decellularization, and if sterile procedures were used in the
decellularization process (especially after the high salt
extraction), then sterilization may not be required.
[0080] Storage of the biomatrix scaffold can be accomplished by any
method known in the art. In some embodiments (e.g., when the
scaffold is to be used intact), the biomatrix scaffold can be
stored at about 4.degree. C. and in other embodiments (e.g., when
the scaffold is to be dispersed into sect the biomatrix scaffold is
frozen, for example, at about -80.degree. C.
[0081] In some embodiments the biomatrix scaffold comprises,
consists of, or consists essentially of collagens, fibronectins,
laminins, nidogen/entactin, elastin, proteogylcans,
glycosaminoglycans and any combination thereof, all being part of
the biomatrix scaffold (e.g., bound to the biomatrix scaffold). In
some embodiments, the biomatrix scaffold lacks a detectable amount
of a collagen, fibronectin, laminin, nidogen/entactin, elastin,
proteoglycan, glycosaminoglycan and any combination thereof.
[0082] The biomatrix scaffolds of the present invention have proven
to be potent differentiation substrata for cells and may be used
for many cell types, such as but not limited to any mature cell or
for various stem cell populations. These include, e.g., embryonic
stem (ES) cells, induced pluripotent stem (iPS) cells, germ layer
stem cells (e.g., definitive endodermal stem cells), determined
stem cells (e.g., hepatic, lung, pancreatic or intestinal stem
cells), human hepatic stem cells (hHpSCs), perinatal stem cells
(e.g., amniotic fluid-derived stem cells (AFSCs)), mesenchymal stem
cells (MSCs) such as from bone marrow or from adipose tissue,
committed progenitors, adult cells of any tissue type, diseased
cells, tumor cells, mature cells, parenchymal cells, stellate
cells, cholangiocytes, biliary tree cells such as those that are
not cholangiocytes, hepatocytes, kidney cells, urothelial cells,
mesenchymal cells, smooth or skeletal muscle cells, myocytes
(muscle stem cells), fibroblasts, chondrocytes, adipocytes,
fibromyoblasts, endothelial cells, ectodermal cells, including
ductile and skin cells, neural cells, Islet cells, cells present in
the intestine, osteoblasts, other cells forming bone or cartilage,
and any combination thereof. These cells may be normal or
diseased.
[0083] In some embodiments the biomatrix scaffolds are used for
biological, pharmaceutical, genetic, molecular, and/or virological
studies of cells, whether freshly isolated from tissue or from
lineage-restricted stem cells. In other embodiments the biomatrix
scaffolds are used for implantable, vascularized engineered organs,
such as but not limited to the liver. Other exemplary uses for the
biomatrix scaffolds include, but are not limited to, protein
manufacturing, drug toxicity testing, drug development, antibody
screening, and/or virus production for vaccine preparations of
viruses. Virus production of lineage-dependent viruses (e.g.,
papilloma virus and hepatitis C) can be achieved by plating stem
cell populations on a tissue-specific biomatrix scaffold and then
culturing in a medium that works in combination with the biomatrix
scaffold to fully induce differentiation of the cells. The mature
virions will be produced when the cells fully mature. As long as
the virus itself does not affect cell viability, the mature cells
infected with the virus can be maintained for at least eight weeks
offering a means of generating large amounts of virus with a stable
culture system.
[0084] The biomatrix scaffolds can be used intact, such as but not
limited to use for 2-D and/or 3-D cultures for cells. In some
embodiments, the biomatrix scaffolds can be used in combination
with specific medium for differentiation in 2-D and/or 3-D cultures
for cell lines, such as but not limited to, normal or diseased
cells from any maturational lineage stage from stem cells to late
stage cells.
[0085] Alternatively, the biomatrix scaffolds can be frozen. These
frozen sections can be prepared and used as substrata. The
biomatrix scaffolds can be quickly frozen on dry ice and frozen
sections prepared with a Cryostat, placed onto culture apparati
(e.g., dishes, flasks, cloth, transwells, etc.), sterilized and
rehydrated in medium before seeding cells. In some embodiments, the
frozen biomatrix scaffold of this invention can be sectioned.
[0086] In some embodiments a cell culture is produced, comprising:
a) producing a biomatrix scaffold according to the methods of this
invention; b) contacting the biomatrix scaffold of step (a) with
cell culture medium in a culture apparatus; and c) seeding the
biomatrix scaffold of step (b) with cells, thereby producing a cell
culture.
[0087] In some embodiments a cell culture is produced, comprising:
a) producing a biomatrix scaffold of the present invention; b)
freezing the biomatrix scaffold of step (a); c) preparing a frozen
section from the biomatrix scaffold of step (b) as a cell culture
substratum; d) contacting the cell culture substratum of step (c)
with cell culture medium in a culture apparatus; and c) seeding the
cell culture substratum of step (d) with cells, thereby producing a
cell culture.
[0088] In other embodiments the biomatrix scaffolds can be ground
to a powder. One method of grinding the biomatrix scaffold to a
powder comprises grinding the biomatrix scaffold to a powder in a
freezer mill at temperatures at or near liquid nitrogen
temperatures. Other apparatus for grinding at liquid nitrogen or
equivalent temperatures (e.g., freezing with dry ice) are known in
the art. The powder can be brought to room temperature at which it
acquires the consistency of a paint that can be coated onto culture
apparati using a sterilized paint brush or equivalent apparatus.
The powder or the plates can be sterilized.
[0089] Thus, in some embodiments a cell culture is produced
comprising: a) producing a biomatrix scaffold of the present
invention; b) grinding the biomatrix scaffold of step (a) to a
powder, c) coating a culture apparatus with the powder of step (b)
to produce a cell culture substratum; d) contacting the cell
culture substratum of (c) with cell culture medium in the culture
apparatus; and e) seeding the cell culture substratum of (d) with
cells, thereby producing a cell culture. In some embodiments of
this method, the grinding of the biomatrix can be carried out in a
freezer mill (e.g., cryogenic grinding) at or near liquid nitrogen
temperature.
[0090] In some embodiments before seeding the cells for the cell
culture, a portion of the medium is added to the culture apparatus
since the cells may attach within seconds. The cells, in some
embodiments attach within seconds to minutes for normal adult cells
and within minutes to a few hours for various types of stem cells.
In some embodiments the attachment of the cells may depend on how
the biomatrix scaffolds are dispersed for use in cultures. The cell
medium can be any medium that is suitable for producing a cell
culture. In some embodiments the cell culture medium comprises at
least one constituent present in interstitial fluid, wherein the
osmolality of said medium is from about 250 mOsm/kg to about 350
mOsm/kg, wherein said medium is serum free and wherein the pH is
neutral. In other embodiments the cell culture medium can be a
basal medium, such as but not limited to RPMI-1640, DME/F12, Ham's
medium, Kubota's medium, etc.
[0091] The cell cultures produced with the biomatrix scaffolds, in
some embodiments, comprise, consist essentially of or consist of,
the same type of cells as the cells of the biological tissue that
was used to make the biomatrix scaffold. Nonlimiting examples of
the cells of this invention include embryonic stem (ES) cells,
induced pluripotent stem (iPS) cells, determined stem cells,
perinatal stem cells, amniotic fluid-derived stem cells (AFSCs),
mesenchymal stem cells (MSCs) from any source, committed
progenitors or adult cells of any tissue type, mature cells, normal
cells, diseased cells, tumor cells and any combination thereof.
Additional nonlimiting examples include liver cells, parenchymal
cells, stellate cells, endothelial cells, hepatocytes,
cholangiocytes, biliary tree cells that are not cholangiocytes and
pancreatic cells.
[0092] In some embodiments, the primitive stem cells (whether ES,
iPS, MSC or AFSC) will lineage-restrict the cells, at least
partially, to the tissue type used to make the biomatrix scaffold.
Determined stem cells of a given germ layer will lineage restrict
to the tissue type used to make the biomatrix scaffold when the
scaffold is prepared from a tissue derived from that germ layer and
may partially differentiate to the adult fate if on a scaffold from
a tissue derived from a different germ layer. Thus, the ability of
adult cells to fully differentiate may be dictated by the tissue
type of the biomatrix scaffold. In parallel, the fate of stem cells
may be partially or fully dictated by the tissue type of the
biomatrix scaffold or the fate of stems cells may be fully dictated
by the tissue type of the biomatrix scaffold. In some embodiments,
the cells of the cell culture are of a different type than the
cells of the biological tissue used to make the biomatrix scaffold.
As described in detail above, exemplary types of cells that may be
used in producing a cell culture include but are not limited to
embryonic stem cells, induced pluripotent stem cells, mesenchymal
stem cells, amniotic fluid derived stem cells, determined stem
cells, mature cells, normal cells, diseased cells, tumor cells and
any combination thereof. These cells may be from any biological
tissue as described herein.
[0093] In some embodiments the biomatrix scaffolds induce slow
growth or growth arrest correlated with differentiation of the
normal cells, whether stem cells or mature cells. The mature cells,
in some embodiments, become fully differentiated within hours and
remain stably differentiated for at least eight weeks thereafter.
In some embodiments adult cells (i.e., fully mature cells) attach
to the scaffolds within minutes and retain their full
differentiation thereafter for more than eight weeks. Stem cells,
in some embodiments, undergo a few divisions and then go into
growth arrest and fully differentiate. The stem cells remain stably
in growth arrest viable and fully differentiated for at least eight
weeks. In some embodiments, stem cells seeded onto biomatrix
scaffolds go into growth arrest or slowed growth, lose stem cell
markers and differentiate to mature, functional cells in
approximately one week, retaining stable phenotypes and viabilities
for at least eight weeks or more (e.g., 40%, 50%, 60%, 70%, 80%,
90%, 95%, or 100% viability for an extended period of time (e.g.,
at least one week, at least two weeks, at least three weeks, at
least four weeks, at least five weeks, at least six weeks, at least
seven weeks, at least eight weeks, at least nine weeks, at least
ten weeks, at least 11 weeks, at least 12 weeks, at least 13 weeks,
at least 14 weeks, at least 15 weeks, at least 16 weeks, at least
one month, at least two months, at least three months, at least
four months, at least five months, at least six months, at least
seven months, at least eight months, at least nine months, at least
ten months, at least 11 months, at least one year, etc.)
[0094] In other embodiments the biomatrix scaffold is used to
differentiate embryonic stem (ES) cells and/or induce pluripotent
stem (IPS) cells to a specific fate. For instance, in some
embodiments a tissue-specific biomatrix scaffold is used to
facilitate differentiating embryonic stem cells or induced
pluripotent cells towards a specific fate.
[0095] In certain embodiments of the present invention the
biomatrix scaffold is used to differentiate amniotic fluid-derived
stem cells (AFSCs) or mesenchymal stem cells (MSCs) from bone
marrow or from adipose tissue or from any fetal or postnatal tissue
or any determined stem cells (e.g., lung, intestine, biliary tree,
kidney, skin, heart, etc.) towards a specific adult fate. In some
embodiments the biomatrix scaffolds of the present invention are
used to enhance and accelerate differentiation of stem cells to
mature cells by producing a cell culture.
In other embodiments the present invention provides a method of
enhancing and/or accelerating differentiation of stem cells and/or
progenitors to mature cells, comprising producing a cell culture
according to the methods of this invention, wherein the cells are
stem cells and the cell culture medium is formulated for mature
cells, thereby enhancing and/or accelerating differentiation of
stem cells and/or progenitors to mature cells. The cell culture
medium can be any medium that is formulated for mature cells. The
constituents in the medium are distinct for each cell type.
Differentiation means that the conditions cause the cells to mature
to adult cell types that produce adult specific gene products.
Cells employed in these methods can be adult cells of any type or
stem cells or progenitors, nonlimiting examples of which include
embryonic stem cells, induced pluripotent stem cells, germ layer
stem cells, determined stem cells, perinatal stem cells, amniotic
fluid-derived stem cells, mesenchymal stem cells, transit
amplifying cells or committed progenitors of any tissue type.
[0096] Cells seeded onto the biomatrix scaffolds (e.g., intact
biomatrix scaffolds, sections of scaffolds or powdered biomatrix
scaffolds mixed into/onto other implantable materials) can be
transplanted into animals or humans as a method of grafting cells
in vivo. In some embodiments a method of delivering cells to a
subject is provided comprising contacting the subject with the
biomatrix scaffold of the present invention, where the biomatrix
scaffold comprises cells. In other embodiments a method of
delivering cells to a subject is provided that comprises seeding
the biomatrix scaffold of the present invention with cells and then
transplanting the biomatrix scaffold seeded with the cells into the
subject. In some embodiments, a biomatrix scaffold that has not
been seeded with any cells can be transplanted into a subject.
[0097] In some embodiments, the biomatrix scaffold can be used as a
graft that can be used to regenerate the tissue or organ in the
subject.
[0098] The biomatrix scaffolds of the present invention may be used
for establishing bioartificial organs, which may be useful for
analytical and/or clinical programs. The biomatrix scaffolds may
also be used for identifying specific gene products or facets of
disease states. In some embodiments the biomatrix scaffolds are
prepared from tissues of mutant animals and subsequently used to
define relevant factor(s) associated with the mutation(s). In other
embodiments the biomatrix scaffolds are prepared from diseased
tissues and used to define changes in the matrix relevant to the
disease.
[0099] Additional nonlimiting examples of uses of the biomatrix
scaffolds of this invention include: 1) use of the scaffold for
culturing malignant cells to define metastatic potential (the
ability of tumor cells to form growing colonies of cells on a given
type of biomatrix scaffold is predictive of the ability of the
cells to metastasize to the tissue from which that scaffold was
prepared; 2) putting grafts of tissue on the scaffold to be used
for transplantation into a subject); 3) production of organoids
formed by recellularization of scaffolds to be used as assist
devices, such as, for example, a liver organoid that is then
connected to a subject with liver failure, 4) use of the scaffold
for protein manufacturing (cells on the scaffold produce a factor
that can be isolated from the medium and/or from the cells and then
purified; and 5) use of the scaffold for production of lineage
dependent viruses; e.g., for production of viruses that require
differentiated cells to yield sufficient particles for use as a
vaccine.
[0100] Thus, the present invention provides a method of identifying
the metastatic potential of tumor cells in a tissue type,
comprising a) producing a biomatrix scaffold according to the
methods of this invention; b) contacting the biomatrix scaffold of
(a) with cell culture medium in a culture apparatus; c) seeding the
biomatrix scaffold of (b) with tumor cells; d) maintaining the
biomatrix scaffold of (c) under culture conditions; and e)
monitoring growth of the tumor cells on the biomatrix scaffold of
(d), wherein growth of tumor cells on the biomatrix scaffold
identifies that the tumor cells can colonize in vivo the type of
tissue from which the biomatrix scaffold was produced, thereby
identifying the metastatic potential of the tumor cells in the
tissue type.
[0101] Also provided herein is a method of identifying a tumor cell
as responsive to an anti-tumor treatment, comprising: a) producing
a biomatrix scaffold according to the methods of this invention; b)
contacting the biomatrix scaffold of (a) with cell culture medium
in a culture apparatus; c) seeding the biomatrix scaffold of (b)
with tumor cells; d) maintaining the biomatrix scaffold of (c)
under culture conditions; e) applying the anti-tumor treatment to
the tumor cells on the biomatrix scaffold; and f) monitoring growth
of the tumor cells on the biomatrix scaffold of (e), wherein lack
of growth of tumor cells and/or death of tumor cells on the
biomatrix scaffold of (e) identifies the tumor cells as responsive
to the anti-tumor treatment. Nonlimiting examples of anti-tumor
treatment include chemotherapeutic agents, antibodies, radiation
therapy, immunotherapy, hormonal therapy etc., as would be well
known in the art. In some embodiments, tumor cells from a subject
can be seeded unto different biomatrix scaffolds of this invention
and exposed to respective anti-tumor treatments. Pursuant to the
results of these respective analysis of different anti-tumor
treatments, an anti-tumor treatment that is effective against the
subject's tumor cells can be selected and that anti-tumor treatment
can be administered to the subject to treat the subject's
tumor.
[0102] In further embodiments, the present invention provides a
method of producing a tumor graft for transplantation into a host
animal, comprising: a) producing a biomatrix scaffold according to
the methods of this invention; b) contacting the biomatrix scaffold
of (a) with cell culture medium in a culture apparatus; c) seeding
the biomatrix scaffold of (b) with tumor cells; d) maintaining the
biomatrix scaffold of (c) under culture conditions; and e)
establishing a population of the tumor cells on the biomatrix
scaffold of (d), thereby producing a tumor graft for
transplantation into the host animal. In some embodiments, this
method can further comprise the step of transplanting the tumor
graft into the host animal. In various embodiments, the tumor graft
can be syngeneic, allogeneic or xenogenic to the host animal.
[0103] Also provided herein is a method of producing virus
particles of a lineage dependent virus, comprising: a) producing a
biomatrix scaffold according to the methods of this invention; b)
contacting the biomatrix scaffold of (a) with cell culture medium
in a culture apparatus; c) seeding the biomatrix scaffold of (b)
with cells of a type and lineage stage that can be infected with
the lineage dependent virus; d) infecting the cells of (c) with the
lineage dependent virus; e) maintaining the infected cells on the
biomatrix scaffold under culture conditions; and t) collecting
virus particles produced in the infected cells, thereby producing
virus particles of the lineage dependent virus.
[0104] Nonlimiting examples of a lineage dependent virus of this
invention include hepatitis C virus, hepatitis B virus, norovirus
human papilloma virus and any other virus now known or later
identified to be lineage dependent. By lineage dependent is meant
that the cell in which the virus is present must mature or
differentiate to a particular stage before the virus can
successfully replicate in the cell and produce virus particles, as
is known in the art.
[0105] Furthermore, the present invention provides a method of
producing an organoid formed by recellularization of a biomatrix
scaffold, comprising: a) producing a biomatrix scaffold according
to the methods of this invention; b) contacting the biomatrix
scaffold of (a) with cell culture medium in a culture apparatus; c)
seeding the biomatrix scaffold of (b) with cells of the same tissue
type as the biological tissue used to prepare the biomatrix
scaffold; and d) maintaining the cells on the biomatrix scaffold
under culture conditions, whereby organoids form from the cells,
thereby producing an organoid formed by recellularization of the
biomatrix scaffold. This method can further comprise the step of
contacting the organoid produced by steps (a) through (d) with a
subject, for use as an assist device, as is known in the art. Any
cell type that can be used to produce the biomatrix scaffold of
this invention can be used in this method. In some embodiments, the
cells are liver cells.
[0106] The present invention additionally provides a method of
producing a protein of interest in cells cultured on a biomatrix
scaffold, comprising: a) producing a biomatrix scaffold according
to the methods of this invention; b) contacting the biomatrix
scaffold of (a) with cell culture medium in a culture apparatus; c)
seeding the biomatrix scaffold of (b) with cells that produce the
protein of interest; d) maintaining the cells of (c) on the
biomatrix scaffold under culture conditions; and e) collecting the
protein of interest produced by the cells of (d), thereby producing
a protein of interest in cells cultured on a biomatrix scaffold.
This method can comprise the further step of purifying the protein
of interest collected in step (f). The protein of interest of this
invention can be any protein produced by a cell, either from an
endogenous gene and/or as a recombinant protein, in an amount that
can be collected from the cells in culture and/or the culture
medium. Numerous examples of such proteins of interest are known in
the art.
[0107] The present invention is explained in greater detail in the
following non-limiting examples.
EXAMPLES
Example 1
Lineage Restriction of Human Hepatic Stem Cells to Mature Fates is
Made Efficient by Tissue-Specific Biomatrix Scaffolds
[0108] Abstract.
[0109] Current protocols for differentiation of stem cells make use
of multiple treatments of soluble signals and/or matrix factors and
result typically in partial differentiation to mature cells with
under- or overexpression of adult tissue-specific genes. In the
present invention, a strategy was developed for rapid and efficient
differentiation of stem cells using substrata of biomatrix
scaffolds, tissue-specific extracts enriched in extracellular
matrix, and associated growth factors and cytokines, in combination
with a serum-free, hormonally defined medium (HDM) tailored for the
adult cell type of interest. The studies described herein
demonstrate the efficacy of the biomatrix scaffolds of this
invention in differentiating human hepatic stem cells (hHpSCs) to
mature fates and in maintaining mature parenchymal cells as fully
functional for long periods of time. Biomatrix scaffolds were
prepared by a novel four-step perfusion decellularization protocol
using conditions designed to keep all collagen types insoluble. The
scaffolds maintained native histology, patent vasculatures and
approximately 1% of the tissue proteins but >95% of its
collagens, most of the tissue's collagen-associated matrix
components, and physiological levels of matrix bound growth factors
and cytokines. Collagens increased from almost undetectable levels
to >15% of the scaffold's proteins with the remainder including
laminins, fibronectins, elastin, nidogen/entactin, proteoglycans,
and matrix-bound cytokines and growth factors in patterns that
correlated with histology. Human hepatic stem cells (hHpSCs),
seeded onto liver biometrix scaffolds and in an HDM tailored for
adult liver cells, lost stem cell markers and differentiated to
mature, functional parenchymal cells in approximately one week,
remaining viable and with stable mature cell phenotypes for more
than eight weeks. Thus, the biomatrix scaffolds of this invention
can be used for biological and pharmaceutical studies of
lineage-restricted stem cells, for maintenance of mature cells, and
for implantable, vascularized engineered tissues or organs.
[0110] Procedure for Decellularization.
[0111] After anesthesia with ketamine-xylazine, the rat abdominal
cavity was opened and a sleevelet with a cannula was inserted into
the portal vein to perfuse the entire liver. (1) Perfusion is done
with RPMI 1640 for 10 mins; followed by (2) delipidation with a
lipase (e.g., 20-50 units of phospholipase A2-PLA2) combined with a
gentle detergent such as 1% sodium deoxycholate (SDC) for about
30-60 mins until the tissue becomes transparent and the effusion
becomes clear (3) perfusion with high salt washes (for fetal
livers: 4.5M NaCl and for adult livers 3.4M-3.5M NaCl) is done
until the perfusate is negative for proteins by optical density
(OD) at 280 nm; (4) perfusion with nucleases (DNase, RNase) in RPMI
1640 until the perfusate is negative for nucleic acids by OD 260;
and (5) final rinse with RPMI 1640 for 2 hours or more.
[0112] The biomatrix scaffolds are quickly frozen on dry ice and
frozen sections prepared with a Cryostat, placed onto 24-well cell
culture plates, sterilized by gamma irradiation (5000 rads) and
rehydrated in medium (KM) for 30 min before seeding cells. The
sections of biomatrix scaffolds covered .about.95% of well surface
in the 24-well plate.
[0113] An alternative method for distributing the biomatrix
scaffolds onto culture dishes consisted of pulverizing it to a
powder using a freezer mill filled with liquid nitrogen. The
pulverized powder, when brought to room temperature, acquires the
consistency of paint, and can be coated onto any surface, such as
dishes, slides, cloth, filters or other surfaces used for attaching
cells and/or cell culture. Pulverizing the scaffolds eliminates the
gradients of matrix components and signals, but the mix of
components present still elicits potent differentiation effects.
The scaffolds also can be used intact and reseeded with cells in
preparation of engineered organs for transplantation in vivo or for
3-D cultures.
[0114] Alternate methods were developed for use with porcine and
bovine livers. Pig and bovine livers were obtained from a USDA
certified meat processing facility (CT). See Example 3 for an
outline of a representative protocol. Each liver was USDA inspected
and received the USDA stamp prior to leaving the facility. Livers
were transported in ESP-Gro medium (Gigacyte, Branford, Conn.;
catalog #1101-250). Livers received in the laboratory were weighed,
photo-documented and prepared for perfusion. After grinding, the
mixture was thawed and diluted to a media:biomatrix ratio of 1:48.
This biomatrix slurry was then used for coating plates. After
drying, the biomatrix was washed three times and then cells were
applied. Adult liver cells attached within 10 minutes to the
plates. Stem/progenitors can take longer (a few hours). However,
for both stem/progenitors and adult liver cells, essentially 100%
of the viable cells attach.
[0115] Media and Solutions.
[0116] All media were sterile-filtered (0.22-.mu.m filter) and kept
in the dark at 4.degree. C. before use. To keep collagens stable in
the biomatrix, the pH of the perfusion media for biomatrix scaffold
preparation was kept at 7.5-8.0. RPMI-1640 (Gibco/Invitrogen,
Carlsbad, Calif.) was used as the basal medium for preparation of
biomatrix scaffolds and for hepatocyte or hepatic stem cell
cultures. All reagents except those noted were obtained from Sigma
(St. Louis, Mo.).
[0117] Perfusion Media for Biometrix Scaffold Preparation. [0118]
(1). Perfusion wash and perfusion rinse: serum-free basal medium
(e.g., RPMI-1640); [0119] (2). Perfusion with detergent 36 units/L
PLA2 plus 1% SDC; [0120] (3). Perfusion with high salt: 3.4M NaCl
with 0.1 mg/ml Soybean trypsin inhibitor, [0121] (4). Perfusion
with nucleases: 5 mg/100 ml RNase, 1 mg/100 ml DNase and 0.1 mg/ml
soybean trypsin inhibitor (e.g., prepared in RPMI 1640).
[0122] Kubota's Medium.
[0123] KM was designed originally for hepatoblasts.sup.47 and now
has been found effective for human hepatic progenitors.sup.48 and
for other endodermal progenitors including ones from biliary tree
(Wang et al. "Multipotent stem/progenitor cells in human biliary
tree give rise to hepatocytes, cholangiocytes and pancreatic
islets" Hepatology, 2011, in press) and pancreas (Wang, Y and Reid
L, unpublished data). It consists of any basal medium (here being
RPMI 1640) with no copper, low calcium (0.3 mM), 10.sup.-9 M
Selenium, 0.1% BSA, 4.5 mM Nicotinamide, 0.1 nM Zinc Sulfate
heptahydrate (from Specpure, Johnson Matthew Chemicals, Royston,
England), 10.sup.-8 M hydrocortisone, 5 .mu.g/ml trasferrin/Fe, 5
.mu.g/ml insulin, 10 .mu.g/ml high density lipoprotein, and a
mixture of free fatty acids that are added bound to purified human
serum albumin.
[0124] To differentiate cells to an adult fate, a serum-free,
hormonally defined medium (HDM) tailored to the adult cell type
desired can be used. For example, we used an HDM for the adult
liver fate consisting of KM supplemented further with calcium to
achieve a 0.6 mM concentration, 10.sup.-12 M copper, 1 nM
tri-iodothyronine (T3), 7 ng/ml glucagon, 20 ng/ml of FGF, 2 g/L
galactose, 10 ng/ml Oncostatin M (OSM), 10 ng/ml epidermal growth
factor (EGF), 20 ng/ml hepatocyte growth factor (HGF), and
10.sup.-8 M hydrocortisone.
[0125] The cells were seeded in this HDM serum-free if plating on
the scaffolds; in circumstances in which enzymes were used for
processing cells or tissues, then we supplemented the HDM with 5%
FBS (HyClone, Waltham, Mass.) for a few hours and then switched to
scrum-free HDM thereafter. In parallel, control experiments,
cultures were kept in the HDM with 5% FBS throughout, but we found
that the presence of serum caused cells to lose differentiated
functions with time. The soluble factors requirements are less than
normal for cultures on other substrata given that so many of the
factors are bound to the biomatrix scaffolds. The soluble factors
requirements are less than normal for cultures on other substrata
given that so many of the factors are bound to the biomatrix
scaffolds.
[0126] Characterization of Intact Vascular Trees in the Liver
Biomatrix Scaffolds.
[0127] The branching and ramifying matrix remnants of the
vasculature including the network of capillaries in the rat liver
biomatrix scaffold have been visualized by light and fluorescence
microscopy, respectively. Rhodamine-labeled 250 kDa dextran
particles were injected into the liver biomatrix scaffold through
the remnant of the portal vein to check the integrity of the matrix
remnants of the vasculature system in the biomatrix scaffolds. A
movie was prepared using a Leica MZ16FA fluorescence dissecting
microscope (motorized).
[0128] Human Fetal Liver Processing.
[0129] Fetal liver tissues were provided by an accredited agency
(Advanced Biological Resources, San Francisco, Calif.) from fetuses
between 16-20 weeks gestational age obtained by elective pregnancy
terminations. The research protocol was reviewed and approved by
the Institutional Review Board for Human Research Studies at the
University of North Carolina at Chapel Hill. Suspensions of fetal
human liver cells were prepared as described previously.sup.48,49.
Briefly, processing was conducted in RPMI 1640 supplemented with
0.1% bovine serum albumin, 1 nM selenium and antibiotics. Enzymatic
processing buffer contained 300 U/ml type IV collagenase and 0.3
mg/ml deoxyribonuclease at 32.degree. C. with frequent agitation
for 15-20 min. Enriched suspensions were pressed through a 75 gauge
mesh and spun at 1200 RPM for 5 min before resuspension. Estimated
cell viability by trypan blue exclusion was routinely higher than
95%.
[0130] Enrichment of hHpSCs and Culture on Biometrix Scaffolds.
[0131] We used two methods for the hHpSCs purification or
enrichment:
[0132] 1) Culture selection. Approximately 3.times.10.sup.5 cells
were plated on a 10 cm tissue culture dish and in KM. Medium was
changed every 3 days. Colonies formed within 5-7 days and were
observed for up to 3 months. We picked colonies by hand after 14-18
days using an inverted microscope (1X-FLAIII; Olympus, Japan and
Melville, N.Y.).
[0133] 2) Magnetic immunoselection of multipotent hepatic
progenitor subpopulations (hHpSCs and hHBs) was achieved by
selection of cells positive for epithelial cell adhesion molecule
(BpCAM, CD326) using magnetic bead immunoselection technologies
with the Miltenyi Biotech MACS system (Bergisch Gladbach, Germany)
following the manufacturer's instructions.sup.50. Briefly, the
dissociated cells were incubated with EpCAM antibody bound to
magnetic microbeads for 30 min at 4 C, and were separated using a
magnetic column separation system from Miltenyi following the
manufacturer's recommended procedures.
[0134] Cultures were seeded with either 250 hHpSC colonies, or
5.times.10.sup.5 enriched hHpSCs or 2.5.times.10.sup.5 primary
adult hepatocytes. Medium was replaced daily and collected medium
was stored at -20.degree. C. for further analysis. Cells cultured
on Collagen type I coating 24-well plates served as control.
[0135] Adult Rat Hepatocyte Isolation.
[0136] Freshly isolated suspensions of rat hepatocytes were
obtained from 3-month old adult male Lewis rats (Charles River
Laboratories, Wilmington, Mass.) weighing 200-250 g. An improved
two-step perfusion method as previously described.sup.49 was used
for rat hepatocyte isolation and purification. The liver was
perfused for 10-15 minutes with a calcium-free buffer containing
EGTA and then collagenase in a calcium-containing buffer for 10-15
minutes. The liver was then mechanically dissociated by pressing
the digested liver through cheese cloth and then sequentially
filtering the cell suspension through sieves of narrowing mesh
size. The cells were washed twice and then pelleted at 50 g.
Viability was defined by counting the cells after trypan blue
staining. Routinely, 200-300 million cells per rat were isolated
with 89-96% viability and >99% purity.
[0137] Human Adult Liver Cell Isolation and Culture.
[0138] Fresh human liver cell suspensions were obtained from
CellzDirect, (now a part of Invitrogen, RTP, NC). Suspensions were
processed per CellzDirect methods then resuspended in HeptoMAIN
medium (Catalog #1103-250; GigaCyte, Branford, Conn.) plated at
1.88.times.10.sup.5 cells/cm.sup.2 into multi-well plates coated
with liver biomatrix scaffolds or onto type I collagen (1 .mu.g/ml;
Meridian Catalog #A33704H).
[0139] Collagen Chemistry Analysis.
[0140] The amount of collagen in biomatrix scaffolds was evaluated
based on the hydroxyproline (hyp) content. Samples of whole livers
and of biomatrix scaffolds were pulverized, washed and lyophilized.
Aliquots were then hydrolyzed and subjected to amino acid
analysis.sup.51, and the collagen content per total protein was
estimated based on the hyp value of 300 residues/collagen.
[0141] Quantitative Analysis of DNA and RNA Content.
[0142] To assess total DNA remaining in the decellularized liver
biometrix, both fresh rat liver tissue and decellularized biomatrix
were weighed, cut and digested with Proteinase K and total cellular
DNA was isolated.sup.52. To assess total RNA remaining in the
decellularized liver biomatrix, both fresh rat liver tissue and
decellularized rat liver biomatrix were weighed and then
homogenized in TRIzol solution (Invitrogen), and total cellular RNA
was isolated.
[0143] Growth Factor Assays.
[0144] Samples of rat livers, rat liver biomatrix scaffolds, human
bile duct tissue and human bile duct biomatrix scaffolds (two
samples each) were sent to RayBiotech, Inc (Norcross, Ga.) for
analysis of growth factors. The samples were homogenized, prepared
as lysates, and then assayed with 1 mg/ml protein, yielding
fluorescence, defined in fluorescent intensity units (FIUs).
Semi-quantitative growth factor assays were done using the
RayBio.RTM. Human Growth Factor Arrays, G Series 1. The FIUs were
reduced by that from negative controls for non-specific binding and
normalized to protein concentration. The data from the duplicates
were averaged. Four arrays were used enabling the survey for
.about.40 growth factors. Although the assay was developed for
human growth factors, there is sufficient overlap in cross-reaction
to rat growth factors to permit use for both the rat and human
samples.
[0145] Transmission and Scanning Electron Microscopy (TEM and
SEM).
[0146] For TEM, the biomatrix scaffolds were rinsed with phosphate
buffered saline (PBS) and fixed in 3% glutaraldehyde/0.1 sodium
cacodylate, pH 7.4 overnight. Following three rinses with sodium
cacodylate buffer, the biomatrix scaffolds were postfixed for 1
hour in 1% osmium tetroxide/0.1 sodium cacodylate buffer. After
rinsing in deionized water, it was dehydrated and embedded in
Polybed 812 epoxy resin (Polysciences, Niles, Ill.). The biomatrix
scaffolds were sectioned perpendicular to the substrate at 70 nm
using a diamond knife. Ultrathin sections were collected on 200
mesh copper grids and stained with 4% aqueous uranyl acetate for 15
minutes, followed by Reynolds' lead citrate for 7 minutes. Samples
were viewed using a LEO EM910 transmission electron microscope
operating at 80 kV (LEO Electron Microscopy, Oberkochen, Germany).
Digital images were acquired using a Gatan Orius SC1000 CCD Digital
Camera and Digital Micrograph 3.11.0 (Gatan, Pleasanton,
Calif.).
[0147] For SEM, after fixation and rinses, the biomatrix scaffolds
were dehydrated and transferred in 100% ethanol to the Balzers
CPD-020 critical point dryer (Bal-Tec AG, Balzers, Switzerland),
and dried using carbon dioxide as the transition solvent. The
matrix was mounted on aluminum specimen supports with carbon
adhesive tabs, and coated with a 10 nm thickness of gold-palladium
metal (60:40 alloy) using a Hummer X sputter coater (Anatech,
Worcester Mass.). Samples were examined using a Zeiss Supra 55
FESEM at an acceleration voltage of 5 kV and digital images were
acquired using Zeiss SmartSEM software (Carl Zeiss SMT, Germany and
Thornwood, N.Y.).
[0148] Immunocytochemistry and Immunohistology.
[0149] For the fluorescent staining of cultured cells on biomatrix
scaffolds, cells were fixed with 4% paraformaldehyde (PFA) for 20
min at room temperature, rinsed with HBSS, blocking with 10% goat
serum in HBSS for 2 h, and rinsed. Fixed cells were incubated with
primary antibodies at 4.degree. C. overnight, washed, incubated for
1 h with labeled isotype-specific secondary antibodies, washed,
counterstained with 4',6-diamidino-2-phenylindole (DAPI) for
visualization of cell nuclei and viewed using a Leica DMIRB
inverted microscope (Leica, Houston, Tex.).
[0150] For immunohistochemistry, the biomatrix scaffolds were fixed
in 4% PFA overnight and stored in 70% ethanol. They were embedded
in paraffin and cut into 5-.mu.m sections. Sections were
deparaffinized, and the antigens were retrieved. Endogenous
peroxidases were blocked by incubation for 30 min in 0.3%
H.sub.2O.sub.2 solution. After blocking with 10% horse serum,
primary antibody was applied at 4.degree. C. overnight; secondary
antibody and ABC staining were performed using the RTU Vectastain
kit (Vector Laboratories, Burlingame, Calif.). Vector Nova RED was
used as substrate. Sections were dehydrated, fixed and embedded in
Eukitt Mounting Media (Electron Microscopy Sciences, Hatfield,
Pa.), and were analyzed using an inverted microscope. Antibodies
used for liver sections and for cultures are listed in Table 4.
[0151] Reverse-Transcription Polymerase Chain Reaction (RT-PCR)
Analysis.
[0152] The hHpSCs are cultured on cell culture plates, and the
colonies were transferred onto biomatrix scaffold. After further
culture for 7 days, the colonies were lysed for RT-PCR. Total RNA
was extracted using an RNeasy Plus Mini Kit (Qiagen GmbH, Valencia
Calif.) as per the manufacturer's instructions. Reverse
transcription was carried out with the SuperScript First-Strand
Synthesis System for RT-PCR (invitrogen, Carlsbad, Calif.).
HotStarTaq Master Mix Kit (Qiagen) was used for PCR. PCR primers
were listed in Table 5.
[0153] LIVE/DEAD Assay and Cell Viability Assay.
[0154] A LIVE/DEAD viability assay kit (Molecular
Probes/Invitrogen, Carlsbad, Calif.) was used for the adhesion and
proliferation assays. The hHpSCs or hepatocytes were incubated with
two probes, calcein-AM (Live, light grey) and ethidium homodimer-1
(EtdD-1, Dead), for intracellular esterase activity and plasma
membrane integrity, respectively. Specimens were observed under a
fluorescence Olympus SZX12 stereomicroscope (OLYMPUS, Japan and
Melville, N.Y.). A resazurin cell viability assay kit (Biotium,
Hayward, Calif.) was used following the manufacturer's manual.
Briefly, 10% of resazurin solution was added into culture medium
and incubated at 37.degree. C. overnight. Absorbance
OD.sub.570-OD.sub.600 was obtained using a Biotek Synergy HT
multi-detection microplate reader (Winooski, VI) and the viability
curve plotted. All experiments were carried out three times using a
minimum of three samples per experimental condition.
[0155] Hepatic Specific Functional Assays.
[0156] CYP450 3A4 activity was detected using a P450-(Glo.TM.
Screening System (Promega, Madison, Wis.). Briefly, the cultured
cells were incubated with medium containing the luminogenic CYP3A4
substrate, luciferin-PPXE for CYP, for 4 hours at 37.degree. C. The
luciferin detection and analysis was performed per the
manufacturer's instructions with a Wallace Victor2 Multilabel
Counter (now part of Perkins/Elmer in Waltham, Mass.). Quantitative
albumin secretion was done using a human albumin ELISA quantitation
kit (Bethyl Laboratories, Montgomery, Tex.). For urea synthesis
assays, the cells were incubated with 2 mM ammonium for 24 hours
and the supernatant was collected and assayed with the Quantichrom
urea assay kit (Bioassay Systems, Hayward, Calif.). The supernatant
from one sample for each culture condition was assayed in
triplicate and the experiment was repeated 3 times.
[0157] Statistical Analysis.
[0158] Experiments were repeated at least 2-3 times with duplicate
or triplicate samples for each condition. Data from representative
experiments are presented, whereas similar trends were seen in
multiple trials. All error bars represent S.E.M.
[0159] Biomatrix Scaffolds are Prepared with a Novel Four-Step
Protocol.
[0160] Biomatrix scaffolds were prepared using a protocol comprised
of delipidation followed by high salt extractions and using
perfusion methods (FIG. 1). A detailed presentation of the protocol
is given in the methods. This is achieved by a novel four step
protocol: 1) gentle delipidation; 2) washes with buffers with salt
concentrations from about 2.0 M to about 5.0 M (e.g., 2.0M-2.5M,
2.6M-3.0 M; 3.1M-3.5M, 3.6M-4.0 M, 4.1M-4.5M; 4.6M-5.0M), salt
concentrations known to maintain the collagens in an insoluble
state.sup.23 (the exact concentration and the pH of the buffers is
dictated by the collagen types in the tissue), concentrations known
to maintain collagens in an insoluble state.sup.23; 3) nuclease
treatment to eliminate residual nucleic acids; and 4) rinses with a
basal medium to eliminate the detergent, salt and nuclease residues
as well as to equilibrate the matrix components with the medium
(FIG. 1A).
[0161] The choices of the rinse media or the buffers for the
nucleases can be any of a number of options as long as the salt
concentration and ionic strength are such as to maintain the matrix
components in an insoluble state. The choice of the delipidation
method is critical to be effective and yet gentle. We chose a
combination of sodium deoxycholate (SDC) and Phospholipase A2
(PLA2) to rapidly degrade the phosphoglyceride located on the
cytoplasm membrane and mitochondrial membrane into lysolecithin, a
powerful surfactant, which can induce necrosis and cytolysis. The
reactive formula is shown in FIG. 8. We avoided harsh detergents,
such as sodium dodecyl sulfate (SDS) or Triton-X 100, which might
dissolve some matrix components such as the glycosaminoglycans (See
review by Gilbert et al. "Decellularization of tissues and organs"
Biomaterials 27:3675-3683 (2006)).
[0162] We avoided prolonged exposure of the scaffolds to the
enzymes from the disrupted cells during delipidation and the high
salt washes, because they can greatly decrease the content of
elastin and the content of glycosaminoglycans (GAGs) such as
heparan sulfates (HS), chondroitin sulfates (CS), dermatan sulfates
(DS) and heparins (HP), which are sites at which cytokines and
growth factors bind.sup.24. We used soybean trypsin inhibitor and
careful control of the pH (7.5-8.0), temperature (20.degree. C.),
and time (30-60 mins) to limit the activity of the proteases
derived from disrupted cells.
[0163] We perfused the whole tissue through relevant vasculature
(e.g., portal vein in the liver), enabling us to rapidly isolate
(within a few hours) a biomatrix scaffold with minimal loss of
matrix components. The rapidity of the isolation is due to the
initial step with detergent that delipidates the tissue within
approximately 30-60 minutes (not hours or days as in protocols used
by others). The resulting biomatrix scaffolds are translucent or
white (FIG. 1). Moreover, using this perfusion method, we
maintained the primary vasculature channels, portal and hepatic
vein and most of the vascular branches in the liver, which
increased the decellularization efficiency. Fluorescent
rhodamine-labeled dextran particles perfused through the biomatrix
scaffolds remained within the remnants of the vasculature
demonstrating that they are patent (FIG. 1E) There is a progressive
flow of the dye from large vessels to the fine blood vessel
branches along the channels without leakage. This fact will be
helpful in revascularization of the scaffolds as a means of
preparing engineered tissues for either three-dimensional culture
and/or for implantation ex vivo.
[0164] When sectioned, the scaffolds retain the histological
structure of the original tissue, including the recognizable
remnants of major histological entities such as the blood vessels,
bile ducts, and Glisson's capsule (GC) (FIG. 1). Compare FIGS. 1B1
and 1D1, in which a section of the liver tissue is contrasted with
that of a biomatrix scaffold. The matrix remnants of the muralia of
parenchymal cells consisted of a lace-like network (FIGS.
1D2-1D3).
[0165] Collagen, Collagen Associate Proteins and Bound Cytokines
are Unmaintained in the Biomatrix Scaffolds.
[0166] The amount of collagen in biomatrix scaffolds was evaluated
by amino acid analysis by methods used previously.sup.25. Because
hydroxyproline (Hyp) is unique to collagens and collagenous
proteins, the collagen composition relative to total protein was
expressed as residues of Hyp per 1,000 amino acids. The results
demonstrated that the collagen content increased from almost
undetectable levels, i.e., less than 0.2 residues of hydroxyproline
(Hyp)/1,000 in liver, to .about.13 residues of Hyp/1,000 in
biomatrix scaffolds. This indicates that delipidation and the high
salt washes, described above, did not remove collagens, leaving
almost all of the collagens in the biomatrix scaffolds. Detection
of significant levels of hydroxylysine (Hyl), another
collagen-associated amino acid, and higher levels of glycine (Gly)
in biomatrix scaffold support our conclusion that collagen is
markedly enriched in biomatrix scaffolds (FIGS. 2A, 9 and Table
2).
[0167] Using immunohistochemical and ultrastructural studies, we
were able to identify in the scaffolds all known forms of collagens
found in liver in situ including fibrillar collagens (collagen
types I, III and V, 10-30 nm in diameter for fibrils and 500-3,000
nm for assembled fibers) and beaded filaments (possibly type VI).
Those fibers and filaments are present in the subcapsular
connective tissue layer lying beneath the mesothelial layer.
Although typical structures of basement membranes were not found
along the sinusoids from portal triads to central veins, we found
that collagen type IV and some bound small fibrils form net-like,
porous 3D lattices, serving as scaffolding for the parenchymal
cells (FIG. 2). Collagen type I bundles can be viewed as the
principal structure of the scaffolds to which other collagen types,
glycoproteins, and proteoglycans are attached. In the space of
Disse we found small bundles of collagen type I and fibers of
collagen types III and VI as well as some type V, which is more
abundant near portal triads and central veins. Representative
immunohistochemistry data are presented in FIG. 3B, and a summary
of matrix components and their location in normal liver tissue
versus those in the biomatrix scaffolds are listed in FIG. 4D.
Early studies in the development of the protocols for biomatrix
scaffold preparation indicated that the bulk of the cytoskeletal
components are lost in the washes. Still, we assessed the scaffolds
by immunohistochemistry and found no evidence for tubulin, desmin
or actin, trace amounts of cytokeratins 18 and 19, and low levels
of vimentin scattered throughout the scaffolds.
[0168] The matrix associated with the bile ducts and portions of
the hepatic vascular systems (arterial and venous vessels) consists
of typical basement membrane structures and so is quite distinctive
from the thin layers of the matrix associated with the vascular
structures found in the sinusoids. Laminin, entactin/nidogen,
perlecan and collagen type IV are found in the portal triad,
whereas only perlecan and some collagen type IV are found in the
Space of Disse. Enormous amounts of hydrophobic, wavy elastin are
present; it crosslinks together and forms sheets and fibers
restricted primarily to the subcapsular connective tissue, portal
regions, and arterial walls. Fibronectins are ubiquitous and
prevalent throughout the hepatic matrix and are especially abundant
in the Space of Disse, where they form either fine filaments or
granular deposits (FIGS. 2 and 3).
[0169] Immunohistochemistry indicates that the known proteoglycans
in the tissue are preserved in the biomatrix scaffolds (FIGS. 3B,
4D). Among heterogeneous proteoglycans identified, syndecan was
found intercalated and continuously along the sinusoids, and
perlecan is more punctuate in the space of Disse. The forms of
HS-PGs and CS-PGs are found throughout the remnants of the
sinusoids in the biomatrix scaffolds and in patterns correlating
with the known zonation of the liver tissue.
[0170] Proteoglycans and other matrix components are important
reservoirs for cytokines and growth factors that bind tightly to
their GAGs.sup.26. Most of the growth factors and hormones are
found in the biomatrix scaffolds near to the concentrations found
in the original tissue. In Table 6 the data are given from the
lysates of rat livers versus rat liver biomatrix scaffolds, and in
Table 3, parallel data are provided from human bile duct tissue
versus bile duct biomatrix scaffolds. Interestingly, there were a
few examples (e.g., bFGF) that were strongly enriched in liver
biomatrix scaffolds over that found in liver lysates. The growth
factors and cytokines bound are distinct qualitatively and
quantitatively between the scaffolds of the liver versus bile duct
tissue, implicating either tissue-specificity or
species-specificity. Alternatively, it may be due, in part, to the
fact that the bile duct scaffolds were prepared, from necessity, by
shaking the tissue in the buffers on a rocker and not by perfusion
through vasculature.
[0171] The Chemistry of the Biomatrix Scaffolds Correlates with
Histology.
[0172] A significant feature of this new protocol is the retention
of the matrix chemistry in patterns correlating with the hepatic
acinar zones 1-3 from portal triad to central vein and with
histological entities such as vascular channels and Glisson's
Capsule (GC) as shown in FIGS. 4A-C. The matrix chemistry
periportally in zone 1 is similar to that found in fetal livers and
consists, in part, of type III collagen, laminin, and forms of
CS-PGs. It transitions to a different matrix chemistry in the
mid-acinar (zone 2) and pericentral zones (zone 3) ending with a
very stable matrix with high levels of type IV collagen and
HP-PGs.sup.27.
[0173] Myriad proteins (e.g., growth factors and hormones,
coagulation proteins, various enzymes) are known to bind to the
matrix and to be held stably via binding to the discrete and
specific sulfation patterns in the GAGs or to other matrix
components.sup.24. Thus, the matrix chemistry transitions from its
start point in the stem cell niche having labile matrix chemistry
associated with high turnover and minimal sulfation to stable
matrix chemistries and having increasing amounts of sulfation with
progression towards the pericentral zone. We expect that the
maintenance of the natural architecture and matrix chemistry
correlating with histology will facilitate recellularization in
tissue engineering processes by guiding cells to specific sites on
the biomatrix scaffolds and/or providing the proper mix of signals
to drive expansion and/or differentiation into mature cells.
[0174] Biometrix Scaffold can be Prepared from Different Tissues
and Species.
[0175] The biomatrix scaffolds can be easily prepared from any
tissue, normal or diseased and from any species. In FIGS. 13-16 we
show biomatrix scaffolds from human pancreas, biliary tree, and
duodenum and from rat and porcine pancreas. In FIGS. 5-7 and FIG.
12 are shown effects of bovine or of rat liver biomatrix scaffolds
on hepatic cells. In addition, biomatrix scaffolds have been
prepared from human abdominal aorta, iliac vein and from rat and
pig intestine. Histological, ultrastructural, and
immunohistochemical studies on the biomatrix scaffolds indicate a
marked tissue specificity, but not species specificity, in their
structure, chemical composition, and functions.
[0176] Biomatrix Scaffolds Induced and/or Maintained
Differentiation of Cells.
[0177] Plating hHpSCs onto dishes with sections of liver biomatrix
scaffolds and in HDM tailored for adult liver cells resulted in
essentially 100% of the viable cells attached within a few hours
onto biomatrix scaffolds; whether intact or after cryogenic
pulverization. The colonies of cells that initially formed on the
sections of scaffolds retained some of their stem cell phenotype as
the cells in the center of the colonies were able to resist
staining with dyes (FIG. 11) and expressed classic hepatic
progenitor markers, such as chemokine (C--X--C motif) receptor 4
(CXCR4) and epithelial cell adhesion molecule (EpCAM) (FIG. 5).
They divided once or twice and then transitioned into cell cycle
arrest and into 3-dimensional (3-D) cord-like morphologies typical
for cultures of mature parenchymal cells (FIGS. 5 and 6 for stem
cell differentiation; compare with FIG. 7 and FIG. 12). The HDM
used did not require all the usual cytokines or growth factors,
since these are present bound to the biomatrix scaffolds. The
transition to growth arrest correlated with staining throughout the
colonies with viability dyes (FIG. 12), with loss of expression of
EpCAM and CXCR4 and with a steady increase in the expression of
adult-specific hepatocytic and cholangiocytic genes such as urea
and cytochrome P450 3A4. (FIG. 5).
[0178] Normal adult rat and adult human hepatocytes were plated
onto type I collagen or on biomatrix scaffolds from rat or bovine
livers and into HDM for adult cells. The adult parenchymal cells
were able to attach to scaffolds within 10 minutes (even in
serum-free medium) versus within hours on type I collagen, remained
in growth arrest from the point of attachment; and remained viable
and fully functional for more than more than 8 weeks on scaffolds
versus only about .about.2 weeks on type I collagen. (FIGS. 7 and
12). The levels of functions of the mature liver cells on biomatrix
scaffolds for weeks proved to be the same or similar to findings of
others of freshly isolated, adult hepatocytes.sup.28. The dramatic
distinctions are that the cultures on type I collagen deteriorate
rapidly after 2 weeks, while those on biomatrix scaffolds remained
stable morphologically and functionally for as long as the cultures
were maintained (so far .about.8 weeks).
[0179] Biomatrix scaffolds contain most of the tissue's
extracellular matrix components and matrix-bound cytokines and
growth factors providing a composite set of chemical signals that
can be used as an insoluble, stable scaffolding with an
extraordinary ability to induce hHpSCs to adult liver fates as well
as maintain adult cells fully differentiated for weeks. In
comparing the extant types of matrix extracts prepared by
investigators with that of biomatrix scaffold of the present
invention, it is clear that physical, enzymatic, and chemical
treatments have substantial effects on the composition, mechanical
behavior, and host responses to biological scaffolds derived from
the decellularization of native tissues and organs, and
accordingly, have important implications for their in vitro and in
vivo applications. All other existing methods for preparation of
substrata or scaffolds result in the removal of a large portion of
the matrix components either through the use of matrix-degrading
enzymes.sup.16 or using buffers that dissolve major portions of the
matrix.sup.11. Physical methods (e.g., snap freezing and agitation)
can work to prepare matrix extracts from tissues with a layered
structure such as dermis (e.g., SIS, BSM).sup.29 but are not useful
for organs with complex tissue structures such as liver. By
contrast, our method for biomatrix scaffolds resulted in loss of
most cellular proteins but preserved essentially all or at least
most of the collagens and collagen-associated components including
the matrix-bound cytokines, hormones and growth factors.
[0180] The extracellular matrix is embedded in a mosaic lipid
bilayer, which in even the simplest organism is a complex,
heterogeneous and dynamic environment. The delipidation method is a
critical facet of the protocol. The commonly used methods for
decellularization of tissues involve ionic detergents such as SDC
and sodium dodecyl sulfate (SDS). SDC is relatively milder than
SDS, tends to cause less disruption to the native tissue
architecture, and is less effective at solubilizing both
cytoplasmic and nuclear cellular membranes.sup.30. There are no
reports of tissue decellularization using SDC alone. Many studies
have made use of a harsh non-ionic detergent (e.g., Triton
X-100).sup.31 or zwitterionic detergents (e.g.,
3-(3-cholamidopropyl)dimethylammonio)-1-propenesulfonate,
CHAPS).sup.32. By contrast, our method of using a combination of
SDC and PLA2 delipidated the tissue rapidly and gently.
[0181] At least twenty-nine types of collagens (I-XXIX) have been
identified so far in vertebrates with functional roles in cell
adhesion, differentiation, growth, tissue development and
structural integrity.sup.33,34. The main structural components in
the matrix, collagens, are known to remain insoluble in high salt
concentrations and at neutral pH.sup.35,36, a finding that is the
basis of our strategy in the preparation of biomatrix scaffolds.
The strategy has the added advantages that the collagens enable
preservation of the matrix components bound to them, such as
laminins and fibronectins (FNs), small leucine-rich proteoglycans
(PGs) and GAGs that in turn preserve the cytokines, growth factors
or cell surface receptors that are bound to them.
[0182] The biomatrix scaffolds are unique in their profound ability
to induce rapid and consistent differentiation of stem/progenitor
cells such as hHpSCs to adult fates and to maintain those
lineage-restricted cells and to maintain those lineage-restricted
cells or too maintain adult cells plated onto the scaffolds, as
viable and fully functional cells for many weeks (>8 weeks).
[0183] Differentiation of stem cells, such as embryonic stem (ES)
cells, induced pluripotent stem (iPS) cells or varying forms of
mesenchymal stem cells (MSC) into fully mature liver cell types
requires multiple sets of signals (soluble and matrix) presented in
stages, with induction by one set required priming to respond to a
different set, and can take many weeks, up to 6 weeks of culture,
to generate cells having the adult liver fate.sup.37. Moreover,
lineage restriction of MSCs to liver fates gives inconsistent
results with adult cells having mixed hepatocyte and MSC
phenotypes. The differentiation of ES cells, iPS cells and MSCs
results in hepatocyte-like cells that express some, but never all,
of the major liver-specific genes; with variability in which genes
are observed; and the protein levels for those hepatic genes
expressed are usually low.sup.40 or high for one hepatic gene and
negligible for others.sup.41,42. By contrast, the differentiation
of the hHpSCs on biomatrix scaffolds resulted in essentially all of
the cells expressing a classic adult phenotype and with urea,
albumin and CYP450 activities at levels that are near normal after
a week in culture.
[0184] The hepatocyte-like cells from any of these precursors and
differentiated by protocols other than with biomatrix scaffolds,
express some, but never all, of the major liver-specific genes,
with variability in which genes are observed, and with the protein
levels for hepatic genes being usually low or high for one hepatic
gene and negligible for others. For reasons unknown, the results
are different from preparation to preparation. It is expected that
utilization of the biomatrix scaffolds of this invention should
result in more rapid differentiation of these stem cell populations
and with greater consistency in achievement of cells with a stable
adult phenotype.
[0185] Differentiation of determined stem cell populations, such as
hHpSCs on biomatrix scaffolds resulted in essentially all cells
expressing a classic adult repertoire of genes and with urea,
albumin, and CYP450 activities at near normal levels within 1 to 2
weeks in culture and with stability of that phenotype for many
weeks. Thus, the biomatrix scaffolds of the present invention have
the potential to greatly facilitate differentiation of determined
stem cell populations to an adult liver phenotype.
[0186] The ability to differentiate stem cells on biomatrix
scaffolds to achieve mature and functional cells and tissues offers
considerable opportunities for academic, industrial and clinical
programs enabling the use of well differentiated cell types for
every type of analytical study, and, most excitingly, enabling the
generation of implantable, revascularized tissues or even organs
that might be used for basic research and clinical programs.
REFERENCES FOR EXAMPLE
[0187] 1. Lanza, R. et al. Handbook of Stem Cells. Vol. 2 volumes.
(Elsevier Academic Press, New York City; 2004). [0188] 2. Vacanti,
J. P. & Langer, R. Tissue engineering: the design and
fabrication of living replacement devices for surgical
reconstruction and transplantation. Lancet 354 Suppl 1, S132-34
(1999). [0189] 3. *Schmelzer, E. et al. Human hepatic stem cells
from fetal and postnatal donor. Journal of Experimental Medicine
204, 1973-1987 [*co-equal first authors; **co-equal senior authors]
(2007). [0190] 4. Zhang, L., Theise, N., Chua, M. & Reid, L. M.
Human hepatic stem cells and hepatoblasts: Symmetry between Liver
Development and Liver Regeneration. Hepatology 48, 1598-1607
(2008). [0191] 5. Kubota, I I. & Reid, L. M. Clonogenic
hepatoblasts, common precursors for hepatocytic and biliary
lineages, are lacking classical major histocompatibility complex
class I antigens. Proceedings of the National Academy of Sciences
of the United States of America 97, 12132-12137 (2000). [0192] 6.
Wauthier, E. et al. Hepatic stem cells and hepatoblasts:
identification, isolation and ex vivo maintenance Methods for Cell
Biology (Methods for Stem Cells) 86, 137-225 (2008). [0193] 7.
Rhodes, J. M. & Simons, M. The extracellular matrix and blood
vessel formation: not just a scaffold. Journal of Cell and
Molecular Medicine 11, 176-205 (2007). [0194] 8. Chen, S. S.
Fitsgerald, W., Zimmerberg, J., Kleinman, H. K. & Margolis, L.
Cell-cell and cell-extracellular matrix interactions regulation
embryonic stem cell differentiation. Stem Cells 25, 553-561 (2007).
[0195] 9. Daley, W. P., Peters, S. B. & Larsen, M.
Extracellular matrix dynamics in development and regenerative
medicine. Journal of Cell Science 21, 255-264 (2008). [0196] 10.
Chun, S. Y. et al. Identification and characterization of bioactive
factors in bladder submucosa matrix. Biomaterials 28, 4251-4256
(2007). [0197] 11. Huber, J. E., Spievack, A., Simmons-Byrd, A.,
Ringel, R. L. & Badylak, S. Extracellular matrix as a scaffold
for laryngeal reconstruction. Ann Otol Rhinol Laryngol 112, 428-433
(2003). [0198] 12. Liotta, L. A., Lee, C. W. & Morakis, D. J.
New method for preparing large surfaces of intact human basement
membrane for tumor invasion studies. Cancer Letters 11, 141-152
(1980). [0199] 13. Kleinman, H. K., McCarvey, M. L., Hassell, J. R.
& Martin, G. R. Formation of a supramolecular complex is
involved in the reconstitution of basement membrane components.
Biochemistry 22, 4969-4974 (1983). [0200] 14. Vlodavsky, I., Levi,
A., Lax, I., Fuks, Z. & Schlessinger, J. Induction of cell
attachment and morphological differentiation in a pheochromocytoma
cell line and embryonal sensory cells by the extracellular matrix.
Developmental Biology (Orlando) 93, 285-300 (1982). [0201] 15.
Gospodarowicz, D., Delgado, D. & Vlodavsky, I. Permissive
effect of the extracellular matrix on cell proliferation in vitro.
Proceedings of the National Academy of Sciences of the United
States of America 77, 4094-4098 (1980). [0202] 16. Badylak, S. F.
The extracellular matrix as a scaffold for tissue reconstruction.
Semin Cell Dev Biol 13, 377-383 (2002). [0203] 17. Gilbert, T. W.
et al. Collagen fiber alignment and biaxial mechanical behavior of
porcine urinary bladder-derived extracellular matrix. Biomaterials
16 (2008). [0204] 18. Lee, M., Chang, P. C. & Dunn, J. C.
Evaluation of small intestinal submucosa as scaffolds for
intestinal tissue engineering. Journal of Surgical Research 147,
168-171 (2008). [0205] 19. Martin, N. D. et al. In vivo behavior of
decellularized vein allografts. Journal of Surgical Research 129,
17-23 (2005). [0206] 20. Ott, H. C. et al. Perfusion-decellularize
matrix using nature's platform to engineer a bioartificial heart.
Nature Medicine 14, 213-221 (2008). [0207] 21. Macchianni, P. et
al. Clinical transplantation of a tissue-engineered airway. Lancet
372, 2023-2030 (2008). [0208] 22. Franklin, M. B., Jr. et al. The
use of porcine small intestinal submucosa as a prosthetic material
for laparoscopic hernia repair in infected and potentially
contaminated fields: long-term follow-up. Surgical Endoscopy 22,
1941-1946 (2008). [0209] 23. Miller, E. J. & Rhodes, R. K.
Preparation and characterization of the different types of
collagen. Methods in Enzymology 82, Part A, 33-64 (1982). [0210]
24. Yayon, A. Klagsbrun, M., Esko, J. D., Leder, P. & Omitz, D.
M. Cell surface, heparin-like molecules are required for binding of
basic fibroblast growth factor to its high affinity receptor. Cell
Molecular Life Science 64, 841-848 (1991). [0211] 25. Yamuchi, M.
& Shiba, M. Lysine hydroxylation and cross-linking of collagen.
Methods in Molecular Biology 446, 95-108 (2008). [0212] 26. Liu,
Y., Cai, S., Shu, X. Z., Shelby, J. & Prestwich, G. D. Release
of basic fibroblast growth factor from a crosslinked
glycosaminoglycan hydrogel promotes wound healing. Wound Repair
Regen 15, 245-251 (2007). [0213] 27. Martinez-Hernandez, A.,
Delgado, F. M. & Amenta, P. S. The extracellular matrix in
hepatic regeneration. Localization of collagen types I, III, IV,
laminin, and fibronectin [published erratum appears in Lab Invest
1991 August; 65(2):257]. Laboratory Investigation 64, 157-166
(1991). [0214] 28. LeCluyse, E. L. Human hepatocyte culture systems
for the in vitro evaluation of cytochrome P450 expression and
regulation. Eur J Pharm Set 13, 343-368. (2001). [0215] 29. Brown,
B., Lindberg, K., Reing, J., Stolz, D. B. & Badylak, S. F. The
basement membrane component of biologic scaffolds derived from
extracellular matrix. Tissue Engineering 12, 519-526 (2006). [0216]
30. Seddon, A. M., Curnow, P. & Booth, P. J. Membrane proteins,
lipids and detergents, not just a soap opera. Biochimica Biophysica
Acta 1666, 105-117 (2004). [0217] 31. Ozeki, M. et al. Evaluation
of decellularized esophagus as a scaffold for cultured esophageal
epithelial cells. Journal of Biomedical Materials. Research A 79,
771-778 (2006). [0218] 32. Rieder, E. et al. Decellularization
protocols of porcine heart valves differ importantly in efficiency
of cell removal and susceptibility of the matrix to
decellularization with human vascular cells. Journal of Thoracic
Cardiovascular Surgery 127, 399-405 (2004). [0219] 33. Olsen, B. R.
& Ninomiya, Y. Collagens: Guidebook to the Extracellular Matrix
and Adhesion Proteins. (Oxford University Press, Oxford; 1993).
[0220] 34. Yurchenco, P. D. & O'Rear, J. J. Basement membrane
assembly. Methods Enzymol 245, 489-518 (1994). [0221] 35. Seyer, J.
M., Hutcheson, E. T. & Kang, A. H. Collagen polymorphism in
normal and cirrhotic human liver. J Clin Invest 59, 241-248 (1977).
[0222] 36. Traub, W. & Pier, K. A. The chemistry and structure
of collagen. Advances in Protein Chemistry 25, 243-352 (1971).
[0223] 37. D'Amour, K. A. et al. Production of pancreatic
hormone-expressing endocrine cells from human embryonic stem cells.
Nature Biotechnology 24, 1392-1401 (2006). [0224] 38. Pittenger, M.
F. et al. Multilineage potential of adult human mesenchymal stem
cells. Science 284, 143-147. (1999). [0225] 39. Kazemnejad, S. et
al. Biochemical and molecular characterization of hepatocyte-like
cells derived from human bone marrow mesenchymal stem cells on a
novel three-dimensional biocompatible nanofibrous scaffold. Journal
of Gastroenterology and Hepatology 24, 278-287 (2009). [0226] 40.
Lysy, P. A., Smets, F., Najimi, M. & Sokal, E. M. Leukemia
inhibitory factor contributes to hepatocyte-like differentiation of
human bone marrow mesenchymal stem cells. Differentiation 76,
1057-1067 (2008). [0227] 41. Campard, D., Lysy, P. A., Najimi, M.
& Sokal, B. M. Native Umbilical Cord Matrix Stem Cells Express
Hepatic Markers and Differentiate Into Hepatocyte-like Cells.
Gastroenterology 134, 833-848 (2008). [0228] 42. Song, Z. et al.
Efficient generation of hepatocyte-like cells from human induced
pluripotent stem cells. Cell Research, In press. Epub on Sep. 8,
2009. [0229] 43. Hayes, A., Tudor, D., Nowell, M., Caterson, B.
& Hughes, C. Unique forms of chondroitin sulfate proteoglycans
in stem cell niches. Journal of Histochemistry and Cytochemistry
56, 125-138. (2007). [0230] 44. Couvelard, A. et al. Expression of
integrins during liver organogenesis in humans. Hepatology 27,
839-847 (1998). [0231] 45. Lyon, M., Deakin, J. A. & Gallagher,
J. T. Liver heparan sulfate structure. A novel molecular design.
Journal of Biological Chemistry 269, 11208-11215 (1994). [0232] 46.
Vongchan, P. et al. Structural characterization of human liver
heparan sulfate. Biochim Biophys Acta 1721, 1-8 (2005). [0233] 47.
Wauthier, E. et al. Hepatic stem cells and hepatoblasts:
identification, isolation and ex vivo maintenance Methods for Cell
Biology (Methods for Stem Cells) 86, 137-225 (2008). [0234] 48.
Kubota, H. & Reid, L. M. Clonogenic hepatoblasts, common
precursors for hepatocytic and biliary lineages, are lacking
classical major histocompatibility complex class I antigens.
Proceedings of the National Academy of Sciences of the United
States of America 97, 12132-12137 (2000). [0235] 49. *Schmelzer, E.
et al. Human hepatic stem cells from fetal and postnatal donors.
Journal of Experimental Medicine 294, 1973-1987 [*co-equal first
authors;**co-equal senior authors](2007). [0236] 50. Schmelzer, E.,
Wauthier, E. & Reid, L. M. Phenotypes of pluripotent human
hepatic progenitors. Stem Cell 24, 1852-1858 (2006). [0237] 51.
Yamauchi, M. & Shiiba, M. Lysine hydroxylation and
cross-linking of collagen. Methods Molecular Biology 446, 95-108
(2008). [0238] 52. Gilbert et al. Quantification of DNA in biologic
scaffold materials. Journal of Surgical Research 152:135-139
(2009).
Example 2
Use of Biomatrix Scaffolds for Cultures of Tumor Cell Lines or
Primary Cultures of Tumors
[0239] The biomatrix scaffolds of this invention can be used for
producing cultures of tumor cell lines or of primary cultures of
tumors. The ability to do this means that a patient's tumor can be
assessed for sensitivity to various therapies in an ex vivo
assay.
[0240] The biomatrix scaffolds of this invention can also be used
as substrata for grafts of tumors (whether syngeneic, allogeneic,
or xenogenic) transplanted into hosts.
[0241] The biomatrix scaffolds of this invention can also be used
to assess the motastatic potential of a tumor. Tumor cells are
seeded at low cell densities onto substrata of biomatrix scaffolds
from various tissues. The tumor cells will attach and survive on
many types of biomatrix scaffolds. They will grow and form colonies
preferentially on some of them. Their ability to form colonies on a
specific type of biomatrix scaffold is predictive of the tumor
cells' ability to colonize the tissue from which the biomatrix
scaffold was prepared.
[0242] Colorectal cancers that had metastasized to the liver were
resected and the tissue prepared as primary cultures in Kubota's
medium and when on various substrata. Shown in Table 9 are findings
from six patients. Some of the patients had tumors that also had
metastasized to the lungs. The cells were cultured on either tissue
culture plastic, dishes coated with type I collagen ("collagen"),
or dishes coated with biomatrix scaffolds from rat colon, liver or
lung. All of the wells were seeded with 20,000 cells/well in 96
well plates and fed with Kubota's medium. The cells attached and
survived on all the substrata (see FIGS. 17A-B). However, they were
able to grow and form colonies best on certain substrata. The
conditions supporting the highest number of colonies correlated
with the ability of the cells to grow in vivo in those particular
tissues from which a scaffold was prepared. The amount of matrix or
matrix components proved a variable in obtaining any colonies at
all. In Table 8 is shown the amount of the matrix/well needed to
observe colonies Clearly, the amount needed from colon, the site of
the primary tumor, was the least. Significant data are highlighted
in bold.
[0243] The foregoing is illustrative of the present invention, and
is not to be construed as limiting thereof. The invention is
defined by the following claims, with equivalents of the claims to
be included therein. All publications, patent applications,
patents, patent publications, sequences identified by GenBank
Database and/or SNP accession numbers, and other references cited
herein are incorporated by reference in their entireties for the
teachings relevant to the sentence and/or paragraph in which the
reference is presented.
TABLE-US-00001 TABLE 1 Molar concentration ranges of NaCl for
Collagen Types I-V Molar Concentration range of NaCl for
precipitation (therefore, insolubility at the concentration
specified and/or at concentrations Collagen above that listed) Type
Source Acidic pH Neutral pH I Skin 0.7-0.9 2.6 I Trimer Skin
0.7-0.9 4.0 III Skin 0.7-09 1.5-1.7 IV Placenta 1.2 1.7-2.0 V
Amnion and 1.2 3.6-4.5 chorion; placenta Reference: Paul Bornstein
and Helene Sage (1980) Structurally Distinct Collagen Types. Annual
Review of Bioehemistry. 49:957-1003.
[0244] These data are representative of conditions for insolubility
of types of collagens. One has to identify the collagen types
within a tissue and then use the highest salt concentration
identified for those collagens in the tissue and as that for the
buffers used for preparing the biomatrix scaffolds. For example,
for skin, one would use a buffer at neutral pH and with a salt
concentration of 4.0M, a salt concentration that would keep
insoluble type I and III collagens. By contrast, for placenta, one
would use a buffer at neutral pH and 4.5M salt to keep insoluble
both type IV and type V collagen.
[0245] The types of collagens present in a tissue are distinct at
different ages of a host. For example, fetal livers have high
levels of type III, IV and V collagens (requiring salt
concentrations above 4.0M), whereas adult livers have a mix of type
I, III, IV, V, VI and XVIII collagens (requiring lower salt
concentrations). Thus, the salt concentration needed for a
biomatrix scaffold preparation is dictated by the repertoire of
collagens that are dominant in the tissue. See reference 23 of
Example 1 for further details.
TABLE-US-00002 TABLE 2 Analyses of Collagen Content in Liver
Biomatrix Scaffold BIOMATRIX SCAFFOLDS (N = 4) LIVER TISSUE (N = 3)
Amino sample 1 sample 2 sample 3 Sample 4 sample 1 sample 2 sample
3 acids Res/1000 Res/1000 Res/1000 Res/1000 AVERAGE SD Res/1000
Res/1000 Res/1000 AVERAGE SD Hyp 10.0 13.8 15.3 12.1 12.8 2.3 0.0*
0.0* 0.0* 0.0* 0.0* Asp 82.7 77.1 78.4 85.5 80.9 3.9 93.0 94.5 90.8
92.8 1.8 Thr 52.6 51.1 45.6 52.4 50.4 3.3 52.2 51.0 53.7 52.3 1.3
Ser 56.5 53.7 61.9 62.4 58.6 4.2 57.7 57.0 62.0 58.9 2.7 Glu 112.0
107.0 117.4 118.1 113.6 5.2 123.9 122.0 130.1 125.4 4.2 Pro 52.3
52.2 55.7 51.6 52.9 1.9 46.6 45.9 46.4 46.3 0.4 Gly 118.7 134.0
125.4 109.4 121.9 10.4 88.2 84.6 89.1 87.3 2.4 Ala 88.3 86.1 89.5
83.6 86.9 2.6 79.0 78.2 90.6 82.6 7.0 Val 64.3 57.2 54.8 65.9 60.6
5.4 71.6 71.3 70.1 71.0 0.8 Met 21.7 20.6 20.7 20.4 20.8 0.6 21.4
21.4 21.7 21.5 0.2 Ile 51.8 47.7 47.4 41.7 47.2 4.2 49.6 50.1 42.3
47.3 4.3 Leu 92.7 83.8 109.7 87.5 93.4 11.5 93.8 95.1 92.7 93.9 1.2
Tyr 30.8 26.9 22.4 28.1 27.0 3.5 31.8 32.1 27.5 30.5 2.6 Phe 45.5
40.7 42.4 42.8 42.8 2.0 47.8 51.0 43.7 47.5 3.7 His 21.0 18.8 13.2
21.8 18.7 3.9 21.8 21.5 24.1 22.5 1.4 Hyl 1.0 1.8 1.6 4.3 2.2 1.5
0.0** 0.0** 0.0** 0.0** 0.0** Lys 40.6 70.0 49.8 66.2 56.7 13.8
74.6 78.5 73.0 75.3 2.8 Arg 57.5 57.6 48.7 46.1 52.5 6.0 47.0 46.0
42.0 45.0 4.6 Note: *less than 0.2 res/1,000; **not detected.
TABLE-US-00003 TABLE 3 Analyses of Growth Factors Bound to Bile
Duct Biomatrix Scaffolds Human Human Bile Duct Bile Biomatrix NAME
CYTOKINE FULL NAME Ducts Scaffolds % bFGF Basic fibroblast growth
factor 58299 128 0% b-NGF Nerve growth factor (beta 516 81 16%
polypeptide) EGF Epidermal growth factor 91 108 119% EGF R
Epidermal growth factor receptor 479 145 30% FGF-4 Fibroblast
growth factor-4 31 36 116% FGF-6 Fibroblast growth factor-6 14 17
121% FGF-7 Fibroblast glowth factor-7 149 23 15% GCSF
Granulocyte-colony stimulating 207 233 113% Factor GDNF
Glial-derived neurotrophic factor 53 49 92% GM-CSF Granulocyte
macrophage-colony 108 97 90% stimulating factor HB-EGF
Heparin-binding epidermal 28 23 82% growth factor IGFBP-1
Insulin-like growth factor 431 61 14% binding proteins 1 IGFBP-2
Insulin-like growth factor 255 20 8% binding proteins 2 IGFBP-3
Insulin-like growth factor 77 54 70% binding proteins 3 IGFBP-4
Insulin -like growth factor 81 58 72% binding proteins 4 IGFBP-6
Insulin-like growth factor 783 107 14% binding proteins 6 IGF-I
Insulin-like growth factor-I 18 6 33% IGF-I SR Insulin-like growth
factor-I 89 25 28% IGF-II Insulin-like growth factor-2 2873 3945
137% M-CSF Macrophage-colony 149 105 70% stimulating factor M-CSF R
Macrophage colony stimulating 358 71 20% factor receptor NT-3
Neurotrophin-3 71 71 100% NT-4 Neurotrophin -4 75 58 77% PDGF R a
Platelet-derived growth 104 63 61% factor receptor alpha PDGF R b
Platelet-derived growth 489 110 22% factor receptor beta PDGF-AA
Platelet-derived growth factor AA 114 52 46% PDGF-AB
Platelet-derived growth factor AB 87 65 75% PDGF-BB
Platelet-derived growth factor BB 155 75 48% PIGF
Phosphatidylinositol glycan anchor 146 14 10% biosynthesis, class F
SCF Stromal cell-derived factor-1 39 22 56% SCF R Stromal
cell-derived factor 159 31 19% receptor TGF-a Transforming growth
factor alpha 52 25 48% TGF-b Transforming growth factor-beta 234
277 118% TGF-b 2 transforming growth factor-beta 2 103 121 117%
TGF-b 3 Transforming growth factor-beta 3 28 16 57% VEGF Vascular
endothelial growth factor 74 35 47% VEGF R2 Vascular endothetial
growth 108 33 31% factor receptor 2 VEGF R3 Vascular endothelial
growth 45 40 89% factor receptor 3
TABLE-US-00004 TABLE 4 Antibodies Utilized Antibody's name Host and
isotype Company Catalog NO. Dilution Primary Antibodies to
extracellularmatrix components 1. collagen 1 mouse IgG1 Sigma C2456
1/2000 2. collagen 3A1 Mouse IgG1 Sigma C7805 1/2000 3. collagen
4A1 Goat IgG Santa Cruz sc-9302 1/50 4. collagen 5A1 Rabbit IgG
Santa Cruz sc-20648 1/50 5. collagen 6 Rabbit IgG Santa Cruz
Sc-20649 1/50 6. chondroitin sulfate mouse IgM Sigma C8035 1/200 7.
Elastin Rabbit IgG Abcam ab21610 1/200 8. entactin ( nidogen 1) Rat
IgG GeneTex GTX72367 1/200 9. heparan sulfate Mouse IgM Seiko,
Japan 270426 1/200 10. HS-PG: perlecan Mouse IgG2a NeoMarkers
RT-794 1/200 11. HS-PG: syndecan-1 Goat IgG R&D AF2780 1/100
12. Fibronectin Mouse IgG1 Sigma F7387 1/200 13. Laminin Mouse IgG1
Sigma L8271 1/1000 Primary Antibodies to other proteins 1. AFP
Rabbit IgG Novus NB100- 1/200 Biologicals 1611 2. Albumin Rabbit
IgG Novus NB 600- 1/200 Biologicals 570 3. ASMA mouse igG2a Sigma
A2547 1/300 4. Ck18 mouse lgG2b Sigma SAB3300016 1/400 5. hCK19
mouse igG2a Abcam ab7754 1/250 6. CK19 Rabbit IgG Abcam Ab52625
1/200 7. CYP3A4 Mouse IgG Abnova H00001576- 1/200 B01P 8. Desmin
Rabbit IgG Abcam Ab8592 1/200 9. EpCAM Mouse IgG1 NeoMarkers MS-181
1/200 10. secretin receptor Rabbit IgG Santa Cruz sc-28633 1/100
11. PAN CK Mouse Ig1 Abcam ab-7753 1/300 12. Tubulin-a Mouse IgG1
Neomarkers MS-581 1/1000 13. Vimentin Mouse IgG1 Abcam Ab8978 1/200
Secondary Antibodies or dyes for fluorescent cellstain or tissue
immunahistochemistry 1. Alexa Flor .RTM. 488/594 goat anti-mouse
IgG or 2a or anti rabbit IgG Molecular 1/500 Probes 2. VECTASTAIN
.RTM. ABC system Vector Laboratories 3. NovaRED .TM. SUBSTRATE KIT
Vector Laboratories 4. Phalloidin 488 Molecular Probes 1/500
TABLE-US-00005 TABLE 5 Primers Utilized for RT-PCR GenBank Amplicon
No. Name Full name Accession Sequence (5'->3') Tm Size 1 CXCR-4
chemokine (C-X-C motif) AJ224869 TACACCGAGGAAATGGGCTCA 63 112
receptor 4 AGATGATGGAGTAGATGGTGGG 60.4 2 EpCAM epithelial cell
adhesion NM 002354 ATAACCTGCTCTGAGCGAGTG 61.6 104 molecule
TGAAGTGCAGTCCGCAAACT 62.3 3 KRT19 keratin 19 NM 002276
ACCAAGTTTGAGACGGAACAG 60.2 181 CCCTCAGCGTACTGATTTCCT 61.3 4 HNF6
hepatocyte nuclear NM 004498 ATGTGGAAGTGGCTGCAGGA 60.7 105 factor
6, alpha TGTGTTGCCTCTATCCTTCCC 61.2 5 FOXA2 forkhead box A2 NM
021784 GCGACCCCAAGACCTACAG 61.7 162 GGTTCTGCCGGTAGAAGGG 61.7 6
PROX1 prospero homeobox 1 NM 002763 TTGACATTGGAGTGAAAAGGACG 61 100
TGCTCAGAACCTTGGGATTC 61.8 7 AFP alpha-fetoprotien NM 001134
CTTGCACACAAAAAGCCCACT 61.9 138 GGGATGCCTTCTTGCTATCTCAT 61.8 8 ALB
albumin M12523 TTTATGCCCCGGAACTCCTTT 61.4 90 ACAGGCAGGCAGCTTTATCAG
62.4 9 TF tranferrin NM 001063 CCTCCTACCTTGATTGCATCAG 60.2 137
TTTGACCCATAGAACTCTGCC 60 10 CYP3A4 cytochrome P450, family NM
017460 AAGTCGCCTCGAAGATACACA 60.9 174 3, subfamily A,
AAGGAGAGAACACTGCTCGTG 61.7 polypeptide 4 11 TAT tyrosine NM 000353
TTTGGGACCCTCTACCATTGT 61 102 aminotransferase GCATTGGACTTGAGGAAGCTC
61 12 G6PC glucose-6-phosphatase, NM 000151 TCAGGGAAAGATAAAGCCGACC
61.8 105 catalytic subunit AGGTAGATTCGTGACAGACAGAC 61.1 13 CFTR
cystic fibrosis NM 000492 AAAAGGCCAGCGTTGTCTCC 63 170 transmembrane
TGAAGCCAGCTCTCTATCCCA 62.1 conductance regulator 14 GGT1
gamma-glutamyltransferase 1 J05235 GGGGAGATCGAGGGCTATGAG 63 150
GATGACGGTCCGCTTGTTTTC 61.8 15 AE2 SLC4A2 NM 003040
GCCAAGGGCGCAGATTCTT 63 103 CCAGGGTGCGGTGAAGTTC 62.9 16 ASBT SLC10A2
NM 00452 TGTGTTGGCTTCCTCTGTCAG 62 115 GGCAGCATCCTATAATGAGCAC 60.9
17 GAPDH glyceraldehyde-3-phosphate NM 002046
CATGAGAAGTATGACAACAGCCT 60 113 dehydrogenase AGTCCTTCCACGATACCAAAGT
60.8
TABLE-US-00006 TABLE 6 Analyses of Growth Factor Bound to Liver
Biomatrix Scaffolds Rat Rat Biomatrix Name Cytokine Full Name
Livers Scaffolds Percent bFGF Basoc fibroblast growth factor 100.06
394.14 394 EGF Epidermal growth factor 74.81 76.02 102 EGF R
Epidermal growth factor 92.81 81.64 88 receptor FGF-4 Fibroblast
growth factor-4 15.06 13.21 88 FGF-6 Fibroblast growth factor-6
4.81 3.77 78 FGF-7 Fibroblast growth factor-7 10.06 6.32 63 GCSF
Granulocyte-colony 348.06 338.20 97 stimulating factor GDNF
Glial-derived neurotrophic 81.31 43.59 54 factor GM-CSF Granulocyte
macrophage-colony 133.56 105.38 79 stimulating factor HB-EGF
Heparin -binding 44.56 38.23 86 epidermal growth factor IGFBP-1
Insulin-like growth factor 67.81 70.40 104 binding proteins 1
IGFBP-3 Insulin-like growth factor 140.81 201.90 143 binding
proteins 3 IGFBP-4 Insulin-like growth factor 83.56 58.92 71
binding proteins 4 IGFBP-6 Insulin-like growth factor 91.81 72.19
79 binding proteins 6 IGF-I Insulin-like growth factor-I 1.56 1.98
127 IGF-I SR Insulin-like growth factor-I 7.31 3.51 48 IGF-II
Insulin-like growth factor-2 3749.06 3482.52 93 M-CSF
Macrophage-colony 170.31 134.68 79 stimulating factor M-CSF R
Macrophage-colony 70.56 50.47 72 stimulating factor NT-3
Neurotrophin-3 25.56 5.03 20 NT-4 Neurotrophin-4 55.06 43.59 79
PDGF R a Platelet-derived growth 10.56 21.11 200 factor receptor
alpha PDGE R b Platelet-derived growth 113.81 85.46 75 factor
receptor beta PDGF-AA Platelet-derived growth 62.06 108.40 171
factor AA PDGF-AB Platelet-derived growth 19.31 19.34 100 factor AB
PDGF-BB Platelet-derived growth 9.56 14.23 149 factor BB PIGF
Phosphatidylinositol glycan 4.81 8.36 174 anchor biosynthesis,
class F SCF Stromal cell-derived factor-1 2.08 42.58 2064 SCF R
Stromal cell-derived 17.06 17.80 104 factor receptor TGF-a
Transforming growth 21.31 21.63 102 factor alpha TGF-b Transforming
growth 330.31 342.77 104 factor-beta TGF-b 2 Transforming growth
134.06 152.34 114 factor-beta 2 TGF-b 3 Transforming growth 1.06
0.18 17 factor-beta 3 VEGF Vascular endothelial 70.56 94.14 133
growth factor VEGF R2 Vascular endothelial growth 13.66 11.93 88
factor receptor 2 VEGF R3 Vascular endothelial growth 459.66 46.91
10 factor receptor3
TABLE-US-00007 TABLE 7 Properties of human hepatic stem cells
(hHpSCs) after isolation and in culture hHpSCs Self -Replication
Conditions Differentiation Conditions freshly (Day 12) (Day 12)
Properties Isolated KM and TCP or Type III collagen DM andType I
Collagen DM and Biomatrix Scaffolds How long to attach -- ~4-5
hours on TCP; ~3 hours on type III 7-12 hours ~3 hours collagen %
attachment of -- 60-80% on TCP and ~100% on type III ~100% viable
cells collagen Morphology 2-dimensional (monolayer) colonies Cords
of cells. somewhat Cords of cells; of colonies cuboidal very
3-dimensional Doubling time -- A division every ~36 hrs on TCP and
A division every ~40-50 Only a few divisions (division rate) ~24-26
hours on type III collagen hours transitioning to growth
transitioning to growth arrest by 7-10 days arrest by ~5 days
Duration >6 months (remaining as stem cells) ~2 weeks >8
weeks as differentiated cells of Viability (not tested yet for
longer) Percentage of Cells Expressing the Specified Marker EpCAM
100% Present on membranes of small cholangiocytes; no expression at
all in mature hepatocytes NCAM >80% None CD133/1 90% None SOX 17
100% None CK 8/18, E-cadherin l00% 100% CK19 90% Present in
cholangiocytes but not in hepatocytes .alpha.-fetoprotein None; If
any, then due to contamination with Moderate expression in most
Expression in first 2-3 days, hepatoblasts cells at 10-12 days
decreases dramatically thereafter, no expession from day 7 on.
P450s None or negligible levels 100% (~18,000 RLU)* 100% (~35,000
RLU)* Urea synthesized None ~2.5 mgs/dL ~7 mgs/dL Markers: Most of
the cells have none; those expressing do so albumin; transferrin
protein, tyrosine mature weakly (e.g. albumin); all express
aminotransferase (TAT), glycogen. Weak levels on hepatocytes
transferrin mRNA but no transferrin protein collagen I versus
strong on biomatrix scaffolds Markers: Most none; those expressing
any do so weakly: (e.g.. Secretin receptor, AE2, ABAT, CFTR, GGT1,
AE2, mature CFTR, GGT1, AE2: no expression of ASBT and ASBT, but
with weak levels on collagen cholangiocytes late aquaporins I
versus verystrong on biomatrix scaffolds KM = Kubota's Medium, a
serum-free medium used for hHpSCs and progenitors; HDM-L =
differentiation medium derived from KM and with hormones and
factors given in the methods. TCP = tissue culture plastic. *See
FIG. 5F; **See FIG. 5E
TABLE-US-00008 TABLE 8 Amount of the matrix/well needed to observe
colonies Amount of matrix in ug/CM.sup.2 Collagen Colon Liver Lung
Low 5 3 10 30 Medium 50 5 25 50 High 100 7 150 100
TABLE-US-00009 TABLE 9 Results from six patients # of Colonies
Plastic Colon Liver Lung Collagen Patient 1 Low 6 5.5 7.5 5.5 4
concentration of matrix Medium 7.5 14.5 14 1.5 concentration of
matrix High 9 9.5 19 2 concentration of matrix Patient 2 Low 5 15
13.5 25 1 concentration of matrix Medium 9 2.5 24 2.5 concentration
of matrix High 5 19.5 23.5 3 concentration of matrix Patient 3 Low
6 7 5 5.5 1.5 concentration of matrix Medium 10.5 40.5 28 3.5
concentration of matrix High 9.5 18.5 21 5.5 concentration of
matrix Patient 4 Low 5.5 5.5 9 12 3 concentration of matrix Medium
5.5 11 16 2 concentration of matrix High 7 5 13.5 18 1
concentration of matrix Patient 5 Low 5 8 10.5 14.5 4 concentration
of matrix Matrix 6.5 12.5 20 2.5 concentration of matrix High 6.5
13 24.5 1.5 concentration of matrix Patient 6 Low 3.5 5.5 9 19 2.5
concentration of matrix Medium 6.5 15.5 18 3.5 concentration of
matrix High 4.5 16.5 25.5 3.5 concentration of matrix
Sequence CWU 1
1
34121DNAArtificialRT-PCR primer 1tacaccgagg aaatgggctc a
21222DNAArtificialRT-PCR primer 2agatgatgga gtagatggtg gg
22321DNAArtificialRT-PCR primer 3ataacctgct ctgagcgagt g
21420DNAArtificialRT-PCR primer 4tgaagtgcag tccgcaaact
20521DNAArtificialRT-PCR primer 5accaagtttg agacggaaca g
21621DNAArtificialRT-PCR primer 6ccctcagcgt actgatttcc t
21720DNAArtificialRT-PCR primer 7atgtggaagt ggctgcagga
20821DNAArtificialRT-PCR primer 8tgtgttgcct ctatccttcc c
21919DNAArtificialRT-PCR primer 9gcgaccccaa gacctacag
191019DNAArtificialRT-PCR primer 10ggttctgccg gtagaaggg
191123DNAArtificialRT-PCR primer 11ttgacattgg agtgaaaagg acg
231221DNAArtificialRT-PCR primer 12tgctcagaac cttggggatt c
211321DNAArtificialRT-PCR primer 13cttgcacaca aaaagcccac t
211423DNAArtificialRT-PCR primer 14gggatgcctt cttgctatct cat
231521DNAArtificialRT-PCR primer 15tttatgcccc ggaactcctt t
211621DNAArtificialRT-PCR primer 16acaggcaggc agctttatca g
211722DNAArtificialRT-PCR primer 17cctcctacct tgattgcatc ag
221822DNAArtificialRT-PCR primer 18ttttgaccca tagaactctg cc
221921DNAArtificialRT-PCR primer 19aagtcgcctc gaagatacac a
212021DNAArtificialRT-PCR primer 20aaggagagaa cactgctcgt g
212121DNAArtificialRT-PCR primer 21tttgggaccc tgtaccattg t
212221DNAArtificialRT-PCR primer 22gcattggact tgaggaagct c
212322DNAArtificialRT-PCR primer 23tcagggaaag ataaagccga cc
222423DNAArtificialRT-PCR primer 24aggtagattc gtgacagaca gac
232520DNAArtificialRT-PCR primer 25aaaaggccag cgttgtctcc
202621DNAArtificialRT-PCR primer 26tgaagccagc tctctatccc a
212721DNAArtificialRT-PCR primer 27ggggagatcg agggctatga g
212821DNAArtificialRT-PCR primer 28gatgacggtc cgcttgtttt c
212919DNAArtificialRT-PCR primer 29gccaagggcg cagattctt
193019DNAArtificialRT-PCR primer 30ccagggtgcg gtgaagttc
193121DNAArtificialRT-PCR primer 31tgtgttggct tcctctgtca g
213222DNAArtificialRT-PCR primer 32ggcagcatcc tataatgagc ac
223323DNAArtificialRT-PCR primer 33catgagaagt atgacaacag cct
233422DNAArtificialRT-PCR primer 34agtccttcca cgataccaaa gt 22
* * * * *