U.S. patent application number 14/579180 was filed with the patent office on 2015-04-16 for selenocysteine mediated hybrid antibody molecules.
The applicant listed for this patent is The U.S.A., as represented by the Secretary, Department of Health and Human Services, The U.S.A., as represented by the Secretary, Department of Health and Human Services. Invention is credited to Terrence R. Burke, JR., Thomas Hofer, Christoph Rader, Joshua Thomas.
Application Number | 20150104383 14/579180 |
Document ID | / |
Family ID | 39722591 |
Filed Date | 2015-04-16 |
United States Patent
Application |
20150104383 |
Kind Code |
A1 |
Rader; Christoph ; et
al. |
April 16, 2015 |
SELENOCYSTEINE MEDIATED HYBRID ANTIBODY MOLECULES
Abstract
The invention provides methods and compositions employing hybrid
molecules of a synthetic molecule and antibody or antibody fragment
comprising a selenocysteine residue, wherein the synthetic molecule
is covalently linked to the antibody or antibody fragment at the
selenocysteine residue. The invention also provides a composition
comprising a hybrid molecule as described above and a
pharmaceutically acceptable carrier. The invention further provides
for methods of making the hybrid molecules, and methods of using
the hybrid molecule described above to inhibit cell surface
receptor binding.
Inventors: |
Rader; Christoph; (Jupiter,
FL) ; Hofer; Thomas; (Zurich, CH) ; Burke,
JR.; Terrence R.; (Bethesda, MD) ; Thomas;
Joshua; (Frederick, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The U.S.A., as represented by the Secretary, Department of Health
and Human Services |
Bethesda |
MD |
US |
|
|
Family ID: |
39722591 |
Appl. No.: |
14/579180 |
Filed: |
December 22, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12570796 |
Sep 30, 2009 |
8916159 |
|
|
14579180 |
|
|
|
|
PCT/US2008/059135 |
Apr 2, 2008 |
|
|
|
12570796 |
|
|
|
|
60909665 |
Apr 2, 2007 |
|
|
|
Current U.S.
Class: |
424/1.49 ;
424/178.1; 424/179.1 |
Current CPC
Class: |
A61K 47/68 20170801;
A61K 47/6867 20170801; A61P 25/00 20180101; B82Y 5/00 20130101;
A61K 47/6809 20170801; A61P 35/00 20180101; A61P 35/04 20180101;
A61K 47/6898 20170801; A61K 47/6849 20170801; A61K 51/10 20130101;
A61K 47/6803 20170801; A61K 47/6811 20170801 |
Class at
Publication: |
424/1.49 ;
424/178.1; 424/179.1 |
International
Class: |
A61K 47/48 20060101
A61K047/48; A61K 51/10 20060101 A61K051/10 |
Claims
1. A composition comprising (a) a hybrid molecule comprising a
synthetic molecule and an antibody or antibody fragment selected
from the group consisting of Fc, F(ab')2, Fab, scFv, IgG.DELTA.CH2,
scFv2CH3, scFv4, scFv3, scFv2, dsFv, and scFv-Fc, wherein the
antibody or antibody fragment comprises at least one selenocysteine
residue, wherein the at least one selenocysteine residue is located
within 300 amino acids of a C-terminus of the antibody or antibody
fragment in a constant domain of the antibody or antibody fragment,
and wherein the synthetic molecule is covalently linked to the
antibody or antibody fragment at the selenocysteine residue, and
(b) a pharmaceutically acceptable carrier.
2. The composition of claim 1, wherein the antibody is selected
from the group consisting of IgA, IgD, IgE, IgG, and IgM.
3. The composition of claim 1, wherein the antibody is
rituximab.
4-5. (canceled)
6. The composition of claim 1, wherein the antibody fragment is an
Fc domain.
7. The composition of claim 1, wherein the antibody fragment is an
Fab domain.
8. The composition of claim 1, wherein the antibody or antibody
fragment comprises only one selenocysteine residue.
9. The composition of claim 1, wherein the antibody or antibody
fragment comprises more than one selenocysteine residue.
10. (canceled)
11. The composition of claim 1, wherein the at least one
selenocysteine residue is located within 150 amino acids of the
C-terminus of the antibody or antibody fragment in a constant
domain of the antibody or antibody fragment.
12. The composition of claim 1, wherein the at least one
selenocysteine residue is located within 50 amino acids of the
C-terminus of the antibody or antibody fragment in a constant
domain of the antibody or antibody fragment.
13. The composition of claim 1, wherein the antibody or antibody
fragment is produced using a eukaryotic expression system.
14. The composition of claim 13, wherein the antibody or antibody
fragment is produced using a mammalian expression system.
15. The composition of claim 1, wherein the synthetic molecule
comprises an iodoacetamide, bromoacetamide, chloroacetamide,
maleimide, or acrylamide moiety.
16. The composition of claim 1, wherein the synthetic molecule
comprises a binding moiety for an integrin selected from the group
consisting of .alpha..sub.4.beta..sub.1, .alpha..sub.4.beta..sub.7,
.alpha..sub.v.beta..sub.3, .alpha..sub.v.beta..sub.5,
.alpha..sub.V.beta..sub.6, .alpha..sub.5.beta..sub.1, and
.alpha..sub.IIB.beta..sub.3.
17. The composition of claim 1, wherein the synthetic molecule
comprises a binding moiety for a receptor selected from the group
consisting of CCR5, LHRH, CXCR4, TPO, folate, endothelin, and
vitamin B12.
18. The composition of claim 16, wherein the synthetic molecule
comprises both an .alpha..sub.4.beta..sub.1 and an
.alpha..sub.4.beta..sub.7 integrin binding moiety.
19. The composition of claim 1, wherein the synthetic molecule
comprises a biotin moiety.
20. The composition of claim 1, wherein the synthetic molecule
comprises an .alpha.4.beta.1 integrin binding moiety, a biotin
moiety, and a maleimide moiety.
21. The composition of claim 1, wherein the synthetic molecule
comprises a radioisotope.
22. The composition of claim 1, wherein the synthetic molecule
comprises a cytotoxic agent.
23. The composition of claim 22, wherein the cytotoxic agent is
selected from the group consisting of doxorubicin, calicheamicin,
maytansinoid, and auristatin.
24. The composition of claim 1, wherein the synthetic molecule is
covalently linked to the selenocysteine residue by a polyethylene
glycol (PEG) linker.
25. The composition of claim 24, wherein the PEG linker comprises
poly(ethylene glycol)-succinamide-lysine-lysine-maleimide.
26-65. (canceled)
66. The composition of claim 1, wherein the at least one
selenocysteine residue is cotranslationally incorporated at a UGA
stop codon of the antibody or antibody fragment that was recoded
from termination to selenocysteine insertion.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application is a continuation-in-part of
International Patent Application PCT/US08/59135, filed Apr. 2,
2008, which claims the benefit of U.S. Provisional Patent
Application No. 60/909,665 filed Apr. 2, 2007, each of which is
incorporated herein by reference.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] Incorporated by reference in its entirety herein is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: One 4203 Byte ANSI
(Text) file named "SequenceListing_ST25.TXT," created on Sep. 25,
2009.
BACKGROUND OF THE INVENTION
[0003] Existing cancer treatments, such as cytotoxic therapy, can
be effective at destroying tumors and other malignant cells. In the
process, however, such therapies can also damage healthy cells and
tissues. Some of the undesirable side effects associated with
cancer treatments such as cytotoxic therapy include anemia,
immunosuppression, decreased wound healing, and damage to mucosal
tissues. Similar problems exist in conventional treatments for
other conditions such as autoimmune or inflammatory disorders as
well as infectious diseases. Many of the undesirable side effects
associated with treatments for these conditions are caused by
interactions between the treatment agent and non-diseased
cells.
[0004] Targeted drug therapies are increasingly favored for use in
treating conditions such as cancer, autoimmune or inflammatory
disorders, and infectious diseases. Targeted therapies can act
directly on diseased cells with relatively less activity toward
non-diseased cells. Therefore, targeted therapies can be
administered with a greater efficacy and/or a relatively lower dose
than non-targeted therapies.
BRIEF SUMMARY OF THE INVENTION
[0005] The invention provides a hybrid molecule of a synthetic
molecule and antibody or antibody fragment comprising a
selenocysteine residue, wherein the synthetic molecule is
covalently linked to the antibody or antibody fragment at the
selenocysteine residue, as well as compositions and methods
involving same.
[0006] In particular, the invention provides a composition
comprising such a hybrid molecule and a pharmaceutically acceptable
carrier. The invention also provides for methods of using such a
hybrid molecule to inhibit cell surface receptor binding. The
invention further provides for methods of preparing such a hybrid
molecule comprising (i) providing a gene encoding an antibody or an
antibody fragment, wherein the gene comprises (a) a UGA codon, and
(b) a selenocysteine insertion sequence element; (ii) expressing
the gene in a mammalian expression system, in a medium comprising
sodium selenite, to produce an antibody or antibody fragment; (iii)
purifying the expressed antibody or antibody fragment; and (iv)
incubating the antibody or antibody fragment with the small
synthetic molecule, a buffer, and a reducing agent to provide a
hybrid molecule comprising the small molecule and the antibody or
antibody fragment, wherein the small molecule is covalently bound
to the antibody or antibody fragment at the selenocysteine
residue.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0007] FIG. 1A is a schematic representation of an IgG1 antibody
molecule containing two identical light chains (white) and two
identical heavy chains (gray). The light chain consists of one N
terminal variable domain (V.sub.L) followed by one constant domain
(C.sub.L). The heavy chain consists of one N-terminal variable
domain (V.sub.H) followed by three constant domains (CH.sub.1,
CH.sub.2, and CH.sub.3). The antigen binding site exists at the
convergence of six complementarity determining regions (CDRs),
three provided by each of V.sub.H and V.sub.L. F(ab').sub.2 and Fc
fragments are also indicated.
[0008] FIG. 1B is a schematic representation of a mammalian
expression vector based on pCEP4 (Invitrogen, Carlsbad, Calif.)
encoding a human Fc protein with a C-terminal selenocysteine. In
the presence of 1 .mu.M sodium selenite, approximately 1 mg Fc
protein with histidine tag (Fc-Sec-His) was purified from 500 mL
supernatant of transiently transfected human embryonic kidney (HEK)
293F cells (20%), while approximately 4 mg Fc without histidine tag
(Fc-stop) was purified (80%).
[0009] FIG. 1C is a schematic representation of an antibody protein
produced using the expression cassette shown in FIG. 1B along with
an antibody protein produced using a similar but modified
expression cassette, wherein an Fc protein is produced with a
cysteine in the position of the selenocysteine (Fc-Cys-His) and
with a N297A mutation that diminishes Fc receptor interactions
(Fc*-Sec-His).
[0010] FIG. 2 is a LC-MS/MS mass spectrometry plot of purified
Fc-Sec-His protein separated by non-reducing SDS-PAGE, stained with
Coomassie dye, and isolated and digested with trypsin. Each peak
represents a portion of the tryptic peptide SLSLSPGAUR, where U is
the single letter code for selenocysteine.
[0011] FIG. 3 is a flow cytometry plot of Fc-Sec-His after
incubation with PBMC expressing the Fc receptor, as compared to
Fc*-Sec-His, and Fc-stop.
[0012] FIG. 4 depicts the chemical structure of
LLP2A/biotin/maleimide, having a human integrin
.alpha..sub.4.beta..sub.1 binding moiety, a biotin moiety, and a
maleimide moiety;
[0013] FIG. 5 is a flow cytometry plot of the Fc-Sec-His protein
after incubation with HEK 293F cells expressing the integrin
binding moiety, as compared to the Fc-stop protein or the integrin
binding moiety alone.
[0014] FIG. 6 is a flow cytometry plot of LLP2A-biotin after
incubation with primary human chronic lymphocytic leukemia (CLL)
cells from two patients with lymphadenopathy and two patients
without lymphadenopathy.
[0015] FIG. 7 is a flow cytometry plot of Fc-Sec-His conjugated to
LLP2A-biotin-maleimide after incubation with primary human CLL
cells from two patients with lymphadenopathy and two patients
without lymphadenopathy.
[0016] FIG. 8 depicts the relative number of cells adhering to
coated VCAM-1, as determined by flow cytometry. Shown are
mean.+-.SD of triplicates.
[0017] FIG. 9A is a flow cytometry plot comparing the circulatory
half-life of Fc-Sec-His/LLP2A-biotin and free LLP2A-biotin in mice
at various time points. Typical results based on three individual
mice in each treatment group are shown.
[0018] FIG. 9B is a flow cytometry plot for comparison of the
efficacy of transcytosis following intragastric delivery of
Fc-stop, Fc-Sec-His/LLP2A-biotin, and Fc-Sec-His/biotin, as well as
an equimolar amount of free LLP2A-biotin to neonatal mice. Typical
results based on two individual neonatal mice in each treatment
group are shown for Fc-stop, Fc-Sec-His/biotin, and free
LLP2A-biotin (all negative). The results of both mice (solid and
dotted line) are shown for Fc-Sec-His/LLP2A-biotin.
[0019] FIG. 10A is a schematic overview of the engineered
immunoglobulin (Ig) proteins Rituximab-Sec-His light and heavy
chains in a bi-directional vector.
[0020] FIG. 10B is a schematic overview of Rituximab-Sec-His.
[0021] FIG. 10C is a schematic overview of Rituxi-Fab-Sec-His.
[0022] FIG. 11A is a flow cytometry plot of
Rituximab-Sec-His/biotin, Rituxi-Fab-Sec-His/biotin, and Rituximab,
incubated with Raji cells and stained with PE coupled goat
anti-human Fab polyclonal antibodies.
[0023] FIG. 11B is a flow cytometry plot of the specific binding of
Rituximab-Sec-His/biotin as compared with Rituximab.
[0024] FIG. 11C is a flow cytometry plot of Rituximab-Sec-His and
Rituximab-stop, upon exposure to a FITC derivative with an
electrophilic maleimide moiety followed by incubation with Raji
cells.
[0025] FIG. 12A is a flow cytometry plot of Rituximab, rabbit
serum, Rituximab in combination with rabbit serum, and a negative
control, using propium iodide staining as a marker of dead/dying
cells.
[0026] FIG. 12B is a flow cytometry plot of Rituxi-Fab-Sec-His,
rabbit serum, Rituxi-Fab-Sec-His in combination with rabbit serum,
and a negative control, using propium iodide staining as a marker
of dead/dying cells.
[0027] FIG. 12C is a flow cytometry plot of Rituximab-Sec-His/FITC,
alone and in combination with rabbit serum.
[0028] FIG. 12D is a flow cytometry plot of
Rituximab-Sec-His/Geldanamycin, alone and in combination with
rabbit serum.
[0029] FIG. 13 depicts the chemical structure of the
PEG-SU-Lys-Lys-mal trifunctional linker, showing sites of
attachment for bitoin and LLP2A, with R showing the intended site
of Fc-Sec attachment.
[0030] FIG. 14 is a flow cytometry plot of Fc-Sec-LLP2A, coupled
using the PEG-SU-Lys-Lys-mal trifunctional linker, alone and in
combination with a monoclonal mouse anti-human integrin
.alpha..sub.4 antibody. Streptavidin coupled phycoerythrin
(Strep-PE) was used for detection and as a negative control.
[0031] FIG. 15 is a flow cytometry plot of Rituxi-Sec (without His
tag) as compared to Rituxi-stop as separated by monomeric avidin
affinity chromatography. Rituxi-Sec-His/biotin and Rituximab served
as controls. Only the heavy chain (.about.50 kDa) of IgGSec/biotin
and IgG-Sec-His/biotin was biotinylated, confirming selective
conjugation at the Sec interface.
[0032] FIG. 16A is a size-exclusion chromatography plot showing
conjugated (peak 1) and unconjugated (peak 2) Rituxi-Fab-Sec-His.
Rituxi-Fab-stop subjected to the same conjugation and separation
conditions was included for comparison.
[0033] FIG. 16B is a flow cytometry plot of the separated fractions
(peak 1 and peak 2). Rituxi-Sec-His/Biotin and
Fc-Sec-His/PEG-biotin served as controls.
[0034] FIG. 16C is a flow cytometry plot of serum levels of
Rituximab, Rituxi-Fab-Sec-His/PEGbiotin, and Fab-Stop at 30 min, 24
hours, 48 hours, 72 hours, and 96 hours. Typical results based on
three individual mice in each treatment group are shown.
[0035] FIG. 17 is a flow cytometry plot of Fc-Sec-His/Folate as
compared to Fc-biotin and Folate-biotin.
[0036] FIG. 18 is a flow cytometry plot of KYK2.0
IgG-Sec-His/LLP2A-biotin as compared to LLP2A-biotin and negative
controls.
DETAILED DESCRIPTION OF THE INVENTION
[0037] The invention provides a hybrid molecule of a synthetic
molecule and antibody or antibody fragment comprising a
selenocysteine residue, wherein the synthetic molecule is
covalently linked to the antibody or antibody fragment at the
selenocysteine residue. The invention also provides a composition
comprising a pharmaceutically acceptable carrier.
[0038] The antibody or antibody fragment comprises one or more
selenocysteine residues. Selenocysteine is a cysteine residue
analog with a selenium-containing selenol group in place of the
sulfur-containing thiol group in cysteine. Although cysteine and
selenocysteine are related amino acids and can undergo many of the
same reactions, selenols are thought to be more reactive than
thiols. The selenol of free selenocysteine has a pKa of 5.2, while
the thiol of free cysteine has a pKa of 8.3. Without being bound by
any particular theory, it is thought that, by controlling the pH of
the alkylation reaction, selenocysteine may be selectively
alkylated while leaving cysteine residues unaffected. See, e.g.,
Johansson et al., Nature Methods, 1:1-6 (2004).
[0039] In some embodiments, the antibody or antibody fragment
comprises exactly one selenocysteine residue. In other embodiments,
the antibody or antibody fragment comprises more than one
selenocysteine residue. The antibody or antibody fragment can
comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, 20 or more, 30 or
more, 40 or more, 50 or more, or 100 or more selenocysteine
residues. It is expected that the antibody or antibody fragment
will usually comprise fewer than 500 selenocysteine residues.
[0040] It is believed that selenocysteine is cotranslationally
incorporated at a predefined UGA stop codon that has been recoded
from termination to selenocysteine insertion. In native mammalian
proteins containing selenocysteine, recoding of UGA from a stop to
a selenocysteine is believed to require specific secondary
structures in the 3' untranslated region of the mRNA, termed
"selenocysteine insertion sequence (SECTS) elements," as well as a
unique tRNA, a SECIS binding protein and a specialized elongation
factor. Kruyukov et al., Science, 300: 1439-1443 (2003).
Accordingly, it is preferred that the selenocysteine residue is
located near the C terminus of the translated protein. In some
embodiments, the selenocysteine residue can be located within 200
amino acids of the C-terminus of the antibody or antibody fragment.
In other embodiments, the selenocysteine residue can be located
within 100 amino acids of the C-terminus of the antibody or
antibody fragment. In still other embodiments, the selenocysteine
residue can be located within 50, 40, 30, 25, 20, 19, 18, 17, 16,
15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acids of
the C-terminus of the antibody or antibody fragment. The
selenocysteine residue can also be located at the C-terminus of the
antibody or antibody fragment.
[0041] The antibody can be any antibody, including without
limitation, IgA, IgD, IgE, IgG, and IgM. The antibody fragment can
be Fc, F(ab').sub.2, Fv, scFv, IgG.DELTA.CH.sub.2, minibody (also
designated scFv.sub.2CH.sub.3), Fab, V.sub.L, V.sub.H, tetrabody
(also designated scFv4), triabody (also designated scFv3), diabody
(also designated scFv2), dsFv, or scFv-Fc. Without being bound by
any particular theory, it is thought that antibodies or antibody
fragments may be capable of inhibiting protein-protein
interactions, which are frequently involved in the pathogenesis of
cancer progression. Additionally, or alternatively, antibodies may
act through multiple mechanisms including target binding as well as
activation of effector functions such as complement-dependent
cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity
(ADCC). In a particularly preferred embodiment, the antibody is a
therapeutically active antibody, such as Rituximab (RITUXAN.RTM.).
In other embodiments, the antibody is a fully human antibody such
as KYK2.0, described in Kwong et al., J. Mol. Biol., 384: 1143-56
(2008).
[0042] In a preferred embodiment, the antibody fragment is an Fc
fragment, also called an Fc protein or an Fc domain. As used
herein, the term "antibody protein" can encompass both antibodies
and antibody fragments.
[0043] The antibody or antibody fragment can be produced using any
suitable eukaryotic expression system. In a preferred embodiment,
the antibody or antibody fragment is produced using a mammalian
expression system.
[0044] The synthetic molecule can be any suitable synthetic
molecule. While the synthetic molecule can have any suitable size
(e.g., molecular weight), generally the synthetic molecule will be
relatively small and will have a molecular weight of about 5000
Daltons or less, e.g., 4000 Daltons or less, 3000 Daltons or less,
2000 Daltons or less, or 1000 Daltons or less.
[0045] The synthetic molecule can include any alkylating
electrophile. In some embodiments, the synthetic molecule comprises
an iodoacetamide, bromoacetamide, chloroacetamide, maleimide, or
acrylamide moiety. In a preferred embodiment, the synthetic
molecule comprises a maleimide moiety.
[0046] The synthetic molecule can further comprise a binding moiety
for a target such as a cell surface receptor. In some embodiments,
the target can be an integrin such as .alpha..sub.4.beta..sub.1,
.alpha..sub.4.beta..sub.7, .alpha..sub.v.beta..sub.3,
.alpha..sub.v.beta..sub.5, .alpha..sub.V.beta..sub.6,
.alpha..sub.5.beta..sub.1, .alpha..sub.IIB.beta..sub.3. The target
can also be a receptor, such as a receptor of CCR5, LHRH, CXCR4,
TPO, folate, endothelin, or vitamin B12. In a preferred embodiment,
the synthetic molecule can comprise a binding moiety for an
integrin-binding receptor. In a more preferred embodiment, the
synthetic molecule comprises both an .alpha..sub.4.beta..sub.1 and
an .alpha..sub.4.beta..sub.7 integrin binding moiety.
[0047] In some embodiments, the synthetic molecule comprises a
marker to facilitate identification of the hybrid molecules. In
some preferred embodiments, the marker comprises a biotin moiety.
In other preferred embodiments, the marker can comprise a
radioisotope, a fluorescent moiety, or a luminescent moiety.
[0048] In some preferred embodiments, the synthetic molecule
comprises an .alpha.4.beta.1 integrin binding moiety, a biotin
moiety, and a maleimide moiety. In a particularly preferred
embodiment, the .alpha.4.beta.1 integrin binding moiety can be
LLP2A.
[0049] The synthetic molecule can additionally or alternatively
comprise a cytotoxic agent. The cytotoxic agent can be any suitable
cytotoxic agent, and many such cytotoxic agents are known to one of
ordinary skill in the art. For example, the cytotoxic agent can be
an alkylating agent, an antimetabolite, a natural cytotoxic product
or derivative thereof, a microtubule affecting agent, and the
like.
[0050] Alkylating agents useful as cytotoxic agents can be, without
limitation, nitrogen mustards, ethylenimine derivatives, alkyl
sulfonates, nitrosoureas, and triazenes), such as Uracil mustard,
Chlormethine, Cyclophosphamide (CYTOXAN.RTM.), Ifosfamide,
Melphalan, Chlorambucil, Pipobroman, Triethylene-melamine,
Triethylenethiophosphoramine, Busulfan, Carmustine, Lomustine,
Streptozocin, Dacarbazine, Temozolomide, and the like.
[0051] Antimetabolites useful as cytotoxic agents can be, without
limitation, folic acid antagonists, pyrimidine analogs, purine
analogs, and adenosine deaminase inhibitors, such as Methotrexate,
5-Fluorouracil, Floxuridine, Cytarabine, 6-Mercaptopurine,
6-Thioguanine, Fludarabine phosphate, Pentostatine, Gemcitabine,
and the like.
[0052] Natural products and their derivatives useful as cytotoxic
chemotherapy can be, without limitation, vinca alkaloids, antitumor
antibiotics, enzymes, lymphokines and epipodophyllotoxins,
including Vinblastine, Vincristine, Vindesine, Bleomycin,
Dactinomycin, Daunorubicin, Doxorubicin, Epirubicin, Idarubicin,
Ara-C, paclitaxel (TAXOL.RTM.) Mithramycin, Deoxyco-formycin,
Mitomycin-C, L-Asparaginase, Interferons (especially IFN-a),
Etoposide, Teniposide, calicheamicin, maytansinoid, and the
like.
[0053] Anti-proliferative agents useful as cytotoxic agents can
include navelbene, CPT-11, anastrazole, letrazole, capecitabine,
reloxafine, cyclophosphamide, ifosamide, and droloxafine. Preferred
classes of antiproliferative cytotoxic agents are the EGFR
inhibitors, Her-2 inhibitors, and CDK inhibitors. Some preferred
anti-proliferative cytostatic agents are paclitaxel, cis-platin,
carboplatin, epothilones, gemcytabine, CPT-11,5-fluorouracil,
tegafur, leucovorin, and EGFR inhibitors such as IRESSA.RTM. (ZD
1839,
4-(3-chloro-4-fluorophenylamino)-7-methoxy-6-(3-(4-morpholinyl)propoxy)qu-
i nazoline and OSI-774
(4-(3-ethynylphenylamino)-6,7-bis(2-methoxyethoxy)quinazoline).
[0054] Microtubule affecting agents useful as cytotoxic agents
include, but are not limited to, allocolchicine (NSC 406042),
Halichondrin B (NSC 609395), colchicine (NSC 757), colchicine
derivatives (e.g., NSC 33410), dolastatin 10 (NSC 376128),
maytansine (NSC 153858), rhizoxin (NSC 332598), paclitaxel
(TAXOL.RTM. NSC 125973), paclitaxel derivatives (e.g., derivatives
(e.g., NSC 608832), thiocolchicine (NSC 361792), trityl cysteine
(NSC 83265)), vinblastine sulfate (NSC 49842), vincristine sulfate
(NSC 67574), natural and synthetic epothilones including but not
limited to epothilone A, epothilone B, auristatin, and
discodermolide (see Service, Science, 274: 2009 (1996))
estramustine, nocodazole, MAP4, and the like. Examples of such
agents are also described in the scientific and patent literature,
see, e.g., Bulinski, J. Cell Sci., 110: 3055-3064 (1997); Panda,
Proc. Natl. Acad. Sci. USA, 94: 10560-10564 (1997); Muhlradt,
Cancer Res., 57: 3344-3346 (1997); Nicolaou, Nature, 387: 268-272
(1997); Vasquez, Mol. Biol. Cell., 8: 973-985 (1997); Panda, J.
Biol. Chem., 271: 29807-29812 (1996).
[0055] Microtubule affecting agents useful as cytotoxic agents
include, but are not limited to, microtubule-stabilizing agents
such as paclitaxel, docetaxel (TAXOTERE.RTM.),
7-O-methylthiomethylpaclitaxel (disclosed in U.S. Pat. No.
5,646,176), 4-desacetyl-4-methylcarbonatepaclitaxel, C-4 methyl
carbonate paclitaxel (disclosed in International Patent Application
Publication WO 94/14787), epothilone A, epothilone B, epothilone C,
epothilone D, desoxyepothilone A, desoxyepothilone B, and
derivatives thereof, as well as microtubule-disruptor agents.
[0056] Additional suitable cytotoxic agents include melphalan,
hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate,
dacarbazine, L-asparaginase, camptothecin, topotecan, bicalutamide,
flutamide, leuprolide, pyridobenzoindole derivatives, interferons,
and interleukins.
[0057] Most preferably, the cytotoxic agent is a moiety that is
known or in clinical use when conjugated to an antibody, such as
the moieties bound to the antibodies used in ibritumomab
tiutiuxetan (ZEVALIN.RTM.), tositumomab-.sup.131I (BEXXAR.RTM.),
and gemtuzumab ozogamicin (MYLOTARG.RTM.).
[0058] The invention further provides a method of inhibiting cell
surface receptor binding in cells. The method comprises contacting
cells with the hybrid molecule, i.e., the hybrid molecule as
described herein which comprises an antibody or antibody fragment
and a synthetic molecule, wherein the antibody or antibody fragment
comprises a selenocysteine residue, and wherein the synthetic
molecule is covalently linked to the antibody or antibody fragment
at the selenocysteine residue. The cells are contacted directly
with the inventive composition comprising the hybrid molecule and a
pharmaceutically acceptable carrier.
[0059] The cells can be any cells having cell surface receptors. In
a preferred embodiment, the cells are human peripheral blood
mononuclear cells (PBMC), leukocytes (lymphocytes and myelocytes),
endothelial cells, or tumor cells. The cells can be either
malignant or non-malignant. The cells can be metastatic or
non-metastatic.
[0060] Preferably, the cells are located in a patient. The cells
can also be in vitro. In other aspects, the cells can be in a
tissue sample taken from the patient. The patient is preferably a
mammal, and more preferably a human of any age or sex.
[0061] The inventive methods can be used to treat any patient
afflicted with a condition that can benefit from administration of
the inventive composition to the patient. Such conditions include
cancer, infectious diseases, inflammatory diseases, and autoimmune
diseases. In some embodiments, the cancer is a hematologic
malignancy or a solid malignancy. The cancer can be leukemia, such
as acute myelogenous leukemia (AML) or chronic lymphocytic leukemia
(CLL). In other embodiments, the condition is an autoimmune disease
such as multiple sclerosis, or acute or chronic graft-versus-host
(GVH) disease.
[0062] In addition, the invention provides a method of preparing
the hybrid molecule comprising a synthetic molecule and an antibody
or an antibody fragment. The method comprises (i) providing a gene
encoding an antibody or an antibody fragment comprising an Fc
domain, wherein the gene comprises (a) a UGA codon in the region
encoding the Fc domain, and (b) a SECIS element; (ii) expressing
the gene in a mammalian expression system, in a medium including
sodium selenite, to produce the antibody or the antibody fragment;
(iii) purifying the antibody or antibody fragment; and (iv)
incubating the antibody or antibody fragment with the synthetic
molecule, a buffer, and a reducing agent to produce the hybrid
molecule comprising the synthetic molecule and the antibody or
antibody fragment.
[0063] A schematic representation of a gene that can be used in the
production methods of the invention is provided in FIG. 1B. It is
generally preferred that the UGA codon, which is the codon used to
encode selenocysteine, is inserted near the 3' end of the
translated region of the gene. Without being bound by any
particular theory, it is thought that the likelihood of successful
translation of the UGA stop codon to a selenocysteine is increased
by relative proximity of the UGA codon to the SECIS element.
Preferably, the UGA codon is located within about 1000 nucleotides
of the 3' end of the translated region. More preferably, the UGA
codon is located within about 800, 700, 600, 500, 400, 300, 200,
150, 120, 90, 75, 60, 50, 40, 30, 20, 10, 9, or 6 codons of the 3'
end of the translated region. Alternatively, the UGA codon can be
the final codon of the 3' translated region.
[0064] The selenocysteine-containing antibody protein can be
expressed in any suitable eukaryotic expression system. Preferably,
a mammalian expression system is used, although one of ordinary
skill in the art can select any naturally occurring or modified
expression system able to supply selenocysteine tRNA, a SECIS
binding protein, and the specialized elongation element required
for successful selenocysteine transcription. Preferably, sodium
selenite (Na.sub.2SeO.sub.3) is added to the culture medium,
although one of ordinary skill in the art will understand that
other selenium supplementation can also be used.
[0065] The selenocysteine-containing antibody protein can be
purified by any method known to one of skill in the art. For
example, protein G affinity chromatography or immobilized metal
affinity chromatography (IMAC) can be used, as described in Harlow
and Lane (1988), Antibodies: A Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y. See also Terpe (2003),
Appl. Microbiol. Biotechnol. 60, 523-533.
[0066] To conjugate the selenocysteine-containing antibody protein
to the synthetic molecule, the protein can be incubated with the
synthetic molecule in the presence of a reducing agent and a
buffer. The pH of the incubation solution is preferably maintained
between about 3 and about 7, preferably about 4 to about 6, more
preferably at about 5. In some embodiments, the pH of the
incubation solution is approximately 5.2. The reducing agent can be
any reducing agent such as DTT. The synthetic molecule is
preferably provided in at least a 3-fold excess to the
selenocysteine-containing antibody protein. One of ordinary skill
in the art will also understand that reaction conditions can be
modified or optimized to the synthetic molecule, if necessary.
[0067] The composition of the invention desirably comprises a
pharmaceutically acceptable carrier. The pharmaceutically
acceptable carrier can be any suitable pharmaceutically acceptable
carrier. The term "pharmaceutically acceptable carrier" as used
herein means one or more compatible solid or liquid fillers,
diluents, other excipients, or encapsulating substances which are
suitable for administration into a human or veterinary patient. The
term "carrier" denotes an organic or inorganic ingredient, natural
or synthetic, with which the active ingredient is combined to
facilitate the application. The pharmaceutically acceptable carrier
can be co-mingled with one or more of active components, e.g., the
hybrid molecule, and with each other, when more than one
pharmaceutically acceptable carrier is present in the composition
in a manner so as not to substantially impair the desired
pharmaceutical efficacy. "Pharmaceutically acceptable" materials
are capable of administration to a patient without the production
of significant undesirable physiological effects such as nausea,
dizziness, rash, or gastric upset. It is, for example, desirable
for a composition comprising a pharmaceutically acceptable carrier
not to be immunogenic when administered to a human patient for
therapeutic purposes.
[0068] The pharmaceutical composition can contain suitable
buffering agents, including, for example, acetic acid in a salt,
citric acid in a salt, boric acid in a salt, and phosphoric acid in
a salt. The pharmaceutical compositions also optionally can contain
suitable preservatives, such as benzalkonium chloride,
chlorobutanol, parabens, and thimerosal.
[0069] The pharmaceutical composition can be presented in unit
dosage form and can be prepared by any suitable method, many of
which are well known in the art of pharmacy. Such methods include
the step of bringing the active agent into association with a
carrier that constitutes one or more accessory ingredients. In
general, the composition is prepared by uniformly and intimately
bringing the hybrid molecule into association with a liquid
carrier, a finely divided solid carrier, or both, and then, if
necessary, shaping the product.
[0070] A composition suitable for parenteral administration
conveniently comprises a sterile aqueous preparation of the
inventive composition, which preferably is isotonic with the blood
of the recipient. This aqueous preparation can be formulated
according to known methods using suitable dispersing or wetting
agents and suspending agents. The sterile injectable preparation
also can be a sterile injectable solution or suspension in a
non-toxic parenterally-acceptable diluent or solvent, for example,
as a solution in 1,3-butane diol. Among the acceptable vehicles and
solvents that can be employed are water, Ringer's solution, and
isotonic sodium chloride solution. In addition, sterile, fixed oils
are conventionally employed as a solvent or suspending medium. For
this purpose any bland fixed oil can be employed, such as synthetic
mono- or di-glycerides. In addition, fatty acids such as oleic acid
can be used in the preparation of injectables. Carrier formulations
suitable for oral, subcutaneous, intravenous, intramuscular, etc.
administrations can be found in Remington's Pharmaceutical
Sciences, Mack Publishing Co., Easton, Pa., which is incorporated
herein in its entirety by reference thereto.
[0071] The delivery systems useful in the context of the invention
include time-released, delayed release, and sustained release
delivery systems such that the delivery of the inventive
composition occurs prior to, and with sufficient time to cause,
sensitization of the site to be treated. The inventive composition
can be used in conjunction with other therapeutic agents or
therapies. Such systems can avoid repeated administrations of the
inventive composition, thereby increasing convenience to the
subject and the physician, and may be particularly suitable for
certain compositions of the invention.
[0072] Many types of release delivery systems are available and
known to those of ordinary skill in the art. They include polymer
base systems such as poly(lactide-glycolide), copolyoxalates,
polycaprolactones, polyesteramides, polyorthoesters,
polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the
foregoing polymers containing drugs are described in, for example,
U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer
systems that are lipids including sterols such as cholesterol,
cholesterol esters, and fatty acids or neutral fats such as
mono-di- and tri-glycerides; hydrogel release systems; sylastic
systems; peptide based systems; wax coatings; compressed tablets
using conventional binders and excipients; partially fused
implants; and the like. Specific examples include, but are not
limited to: (a) erosional systems in which the active composition
is contained in a form within a matrix such as those described in
U.S. Pat. Nos. 4,452,775, 4,667,014, 4,748,034, and 5,239,660 and
(b) diffusional systems in which an active component permeates at a
controlled rate from a polymer such as described in U.S. Pat. Nos.
3,832,253 and 3,854,480. In addition, pump-based hardware delivery
systems can be used, some of which are adapted for
implantation.
[0073] The following examples further illustrate the invention but,
of course, should not be construed as in any way limiting its
scope.
Example 1
[0074] This example demonstrates that selenocysteine can be
incorporated into an antibody molecule expressed in mammalian
cells.
[0075] Preparing a Plasmid.
[0076] The Fc portion of human IgG1 including the hinge region was
amplified by PCR using the previously described PIGG vector as a
template, described in Rader et al., FASEB J., 16: 2000-2002
(2002), and the following primers: Fc-5'
(gggtaccatggactggacctggaggatcctatcttggtggcagcagccacaggagctcactccgagcccaaa-
tcttctgacaaaactca caca) (SEQ ID NO:1) and Fc-3'
(cggagacaagcttaggctcttctgcgtgtagtggttgtgcag) (SEQ ID NO:2). The 5'
primer fuses the human IgG1 signal sequence to Fc.gamma.1, thereby
enabling the expressed Fc-protein to be secreted into the medium.
Cysteine 5 in the .gamma.1 hinge (EPKSCDKTHTCPPCP) (SEQ ID NO:3)
forming a disulfide bridge with a cysteine in constant region of
the light chain was mutated to a serine as described in Lo et al.,
Protein Eng., 6: 495-500 (1998). A silent Hind III site was
introduced through the 3' primer, replacing the codons of leucine
121, serine 122, and leucine 123 in the C-terminus (119 KSLSLSPGK
130) (SEQ ID NO:18) of the .gamma.1 CH.sub.3 domain upstream of the
natural stop codon without changing the amino acid sequence. The
isolated PCR fragment was cloned into pCEP4 vector (Invitrogen) by
KpnI/HindIII-ligation, thereby deleting the last 4 codons of the
.gamma.1 CH.sub.3 domain including the stop codon. This construct,
termed pCEP-Fc, served as parental template for all further
Fc-constructs.
[0077] This Fc construct was then modified by the incorporation of
a selenocysteine and an adjacent (His).sub.6 tag at the C-terminus
of Fc. A PCR fragment containing the last 4 codons of Fc, the
selenocysteine-encoding opal stop codon TGA, 6 histidine codons,
the ochre stop codon TAA, and a portion of the 3'-untranslated
region (UTR) of the thioredoxin reductase 1 (TrxR1) (described in
Nalvarte et al., J. Biol. Chem., 279: 54510-54517 (2004) gene was
synthesized using human genomic DNA as a template.
[0078] An internal HindIII site in the TrxR1 3' untranslated region
was deleted by site-directed mutagenesis: First, two individual PCR
fragments were amplified using the following primer pairs:
Fc-Sec-His 5'
(gcctaagcttgtctccgggtgcctgacatcaccatcaccatcactaagccccagtgtggatgctgttg)
(SEQ ID NO:4) and HindIII deletion 3' (agaagctccaagaactgctggcag)
(SEQ ID NO:5) as well as HindIII deletion 5'
(cctgccagcagttcttggagcttct) (SEQ ID NO:6) and Fc-Sec-His 3'
(agctctcgaggccaaatgagatgaggacgtgag) (SEQ ID NO:7). In a second
step, the fragments were assembled by PCR amplification and the
resulting fragment was HindIII/XhoI-digested and cloned into
pCEP-Fc resulting in pCEP-Fc-Sec-His. In the control plasmid
pCEP-Fc-Cys-His, the selenocysteine codon was replaced by the
cysteine-encoding triplet TGC using the primer Fc-Cys-His 5'
(gcctaagcttgtctccgggtgcctgccatcaccatcaccatcactaagccccagtgtggatgctgttg)
(SEQ ID NO:8).
[0079] For the analysis of selenocysteine incorporation by mass
spectrometry, an additional arginine codon was inserted between the
opal stop codon and the His tag. The additional arginine enabled
the cleavage of the His tag during the in-gel trypsin digestion
necessary for mass spectrometric analysis. This construct was
generated by replacing the Fc-Sec-His 5' primer with Fc-Sec-Arg-His
5'
(gcctaagcttgtctccgggtgcctgacggcatcaccatcaccatcactaagccccagtgtggatgctgttg)
(SEQ ID NO:9), resulting in pCEP-Fc-Sec-Arg-His.
[0080] Plasmid pCEP-Fc*-Sec-His, a pCEP-Fc-Sec-His-derived
construct carrying the mutation N297A, was generated using the
following primers pairs: (a) 5'Primer N297A
(aggagcagtacgccagcacgtaccgtgtggt) (SEQ ID NO:10) and EBV reverse
(gtggtttgtccaaactcatc; Invitrogen) (SEQ ID NO:11), and (b) 3'Primer
N297A (accacacggtacgtgctggcgtactgctcct) (SEQ ID NO:12) and pCEP
forward (agcagagctcgtttagtgaaccg; Invitrogen) (SEQ ID NO:13). The
amplified fragments were assembled by PCR amplification, and the
resulting fragment was KpnI/XhoI-digested and cloned into pCEP-Fc
resulting in pCEP-Fc*-Sec-His.
[0081] Expression of a Sec Protein.
[0082] The plasmids described above were transiently transfected
into HEK 293F cells (Invitrogen) with 293fectin (Invitrogen) using
conditions detailed in the manufacturer's protocol. Transfected HEK
293F cells were cultured in FreeStyle serum-free medium
(Invitrogen), supplemented with 1 .mu.M sodium selenite
(Na.sub.2SeO.sub.3), in spin flasks (Integra Biosciences,
Switzerland) under constant rotation at 75 rpm in a humidified
atmosphere containing 8% CO.sub.2 at 37.degree. C.
[0083] Purifying a Sec Protein.
[0084] Three days after transfection, the medium was collected
after centrifugation, replaced for two additional days, and
collected again. The combined supernatants were filtered through a
0.45-1 .mu.m membrane and tenfold concentrated using an
ultrafiltration device with a 10-kDa cutoff membrane (Millipore).
The concentrate was 1:1 diluted with phosphate-buffered saline
(PBS) and loaded on a 1-mL recombinant Protein G HiTrap column (GE
Healthcare). PBS was used for column equilibration and washing, 0.5
M acetic acid (pH 3.0) was used for elution, and 1 M Tris-HCl (pH
8.0) was used for immediate neutralization. The neutralized eluate
was dialyzed at 4.degree. C. overnight against PBS using
Slide-A-Lyzer cassettes with 10-kDa cutoff (Pierce) and
concentrated with 10-kDa cutoff centrifugal filter devices
(Millipore). In order to separate Fc-Sec-His from the byproduct
Fc-stop, the concentrated Fc-solution was 10.times. diluted in
loading/washing buffer (500 mM NaCl and 25 mM imidazol in PBS) and
loaded on a 1-mL HisTrap column (GE Healthcare). The flow through
of the column containing the Fc-stop protein was collected.
Subsequently, the column was washed with 50 mL loading/washing
buffer and the bound Fc-Sec-His protein was eluted with elution
buffer (500 mM NaCl and 500 mM imidazol in PBS). Both eluate and
flow through were again dialyzed at 4.degree. C. overnight against
PBS using Slide-A-Lyzer cassettes with 10-kDa cutoff (Pierce) and
concentrated with 10-kDa cutoff centrifugal filter devices
(Millipore).
[0085] Western Blots.
[0086] Western blots were performed on the concentrated supernatant
to confirm the incorporation of selenocysteine into the Fc protein,
based on detection of the histidine tag. Purified protein (1 .mu.g)
or concentrated culture supernatant (50 .mu.L of 10.times.
concentrated) was electrophoresed on a NuPage 4-12% gradient gel
(Invitrogen), blotted on a nitrocellulose membrane (GE Healthcare),
and blocked with Western Blocking Reagent (Roche). Fc protein
without the selenocysteine and histidine tag (Fc-stop) was used as
a control.
[0087] To detect Fc-Sec-His, that is, Fc protein in which the UGA
stop codon was successfully translated as selenocysteine and
followed by a histidine tag, the monoclonal mouse Pentahis antibody
(Qiagen) was diluted to 1 .mu.g/mL in Western Blocking Reagent
followed by polyclonal horseradish peroxidase-coupled goat
anti-mouse antibodies (Jackson ImmunoResearch Laboratories)
(1:10,000). Immunoreactive bands were developed using SuperSignal
West Pico Chemoluminescent Substrate (Pierce) and visualized using
BioMax MR autoradiography film (Kodak). Although Fc protein was
detected in both the control Fc-stop and the concentrated culture
supernatant, the strong anti-histidine tag signal was only detected
in the supernatant of the Fc-Sec-His transfected cells.
[0088] Autoradiography.
[0089] To confirm that selenocysteine had been incorporated, HEK
293F cells as described above were transfected with either
Fc-Sec-His or Fc-Cys-His, a negative control in which the opal
codon TGA of the Fc-Sec-His protein was replaced by the
cysteine-encoding triplet TGC. Transfected and untransfected cells
were incubated for 24 h with or without 50 mCi of
[.sup.75Se]O.sub.4, radioactive selenate, in place of sodium
selenite. The supernatant was harvested, concentrated, processed by
electrophoresis and blotting as described above, and analyzed by
radiography, results of which showed successful incorporation of
selenocysteine.
[0090] Mass Spectrometry.
[0091] Additional verification of the selenocysteine incorporation
was performed using mass spectrometry on cultured protein prepared
as above, but with an arginine residue inserted between the
selenocysteine and the histidine tag (Fc-Sec-Arg-His). This
modified protein was purified with G protein affinity
chromatography and immobilized metal affinity chromatography.
Tandem mass spectrometry (LC/MS-MS), results of which are shown in
FIG. 2, confirmed the presence of selenocysteine (represented by
the single letter designation "U") in histidine-tag purified Fc
proteins.
[0092] Therefore, based on these results, selenocysteine was
selectively incorporated into an antibody molecule expressed in
mammalian cells.
Example 2
[0093] This example demonstrates that a synthetic molecule can be
selectively bound to a selenocysteine-containing antibody
protein.
[0094] Conjugating the Small Synthetic Molecule to the
Selenocysteine-Containing Antibody Protein.
[0095] A biotin reporter molecule (PEO-Iodoacetyl Biotin, molecular
weight 542.43 g/mol, Pierce) was covalently attached to the
selenocysteine of the Fc-Sec-His proteins described above.
Fc-Sec-His and controls including Fc-stop and Fc-Cys-His were
diluted in 15 mL 100 mM sodium acetate (pH 5.1) and concentrated to
a 4 .mu.M solution using 10-kDa cutoff centrifugal filter devices
(Millipore). DTT (0.1 mM final concentration) as well as the biotin
reporter molecule (40 .mu.M final concentration) were added to the
proteins and incubated for 50 min in the dark. The proteins were
diluted in 15 mL 100 mM sodium acetate (pH 5.1) and 100.times.
concentrated using again 10-kDa cutoff centrifugal filter devices
(Millipore). The same step was repeated once with 100 mM sodium
acetate (pH 5.1) and subsequently twice with PBS.
[0096] ELISA.
[0097] To confirm selective conjugation of PEO-Iodoacetyl Biotin,
each well of a 96-well Costar 3690 plate (Corning) was incubated
with 200 ng Fc-protein and derivatives thereof (Fc-Sec-His or Fc
controls including Fc-Cys-His and Fc-stop, incubated with the
biotin reporter molecule) in 25 .mu.L PBS for 1 h at 37.degree. C.
Subsequent incubations were all for 1 h at 37.degree. C. After
blocking with 3% (w/v) BSA/PBS, either 1 .mu.g/mL streptavidin
conjugated to horseradish peroxidase (50 ng/well) or a 1:1,000
dilution of donkey anti-human IgG polyclonal antibodies conjugated
to horseradish peroxidase (Jackson ImmunoResearch Laboratories) in
1% (w/v) BSA/PBS were added, incubated and washed with H.sub.2O
(10.times.200 .mu.L/well). Colorimetric detection was performed
using 2,2'-Azino-bis(3-ethylbenzthiazoline)-6-sulfonic acid (Roche)
as substrate according to the manufacturer's directions. All of the
Fc-containing proteins showed activity to the IgG polyclonal
antibodies, but only Fc-Sec-His showed reactivity to the
streptavidin.
[0098] Western Blot.
[0099] Western blots were also performed to confirm detection of
iodoacetyl-coupled biotinylation of Fc-Sec-His as compared to
Fc-Cys-His or Fc-stop control proteins. Using the methods described
above, horseradish peroxidase-conjugated streptavidin (BD
Biosciences) or horseradish peroxidase-coupled polyclonal donkey
anti-human IgG antibodies (Jackson ImmunoResearch Laboratories)
(both 1:1,000 diluted) in Western Blocking Reagent were used to
demonstrate that the Fc-Sec-His protein was selectively
biotinylated.
[0100] SDS-PAGE.
[0101] To evaluate the quantitative biotinylation of Fc-Sec-His,
Fc-Sec-His and Fc-stop were incubated with the biotin reporter
molecule. Both proteins were incubated separately with magnetic
streptavidin beads. The supernatant and the extensively washed
beads were analyzed by reducing SDS PAGE followed by staining with
Coomassie dye. Fc-Sec-His bound extensively to the magnetic
streptavidin beads, indicating near quantitative biotinylation,
while the Fc-stop control remained in the supernatant.
[0102] These results confirm that the synthetic molecule was
selectively added to the selenocysteine-containing protein
Example 3
[0103] This example demonstrates that activity is retained in vitro
for an antibody molecule bound to a synthetic small molecule.
[0104] The biotin reporting moiety described above was incubated
with Fc-Sec-His along with Fc*-Sec-His and Fc*-stop, two control
proteins prepared as the Fc-Sec-His and Fc-stop proteins described
above but having a mutation (N297A) that impairs Fc-receptor
binding. An SDS-PAGE/Coomassie analysis of Fc-Sec-His, Fc*-Sec-His,
and Fc-stop showed that selenocysteine was incorporated into
Fc*-Sec-His at a similar level to Fc-Sec-His, wherein Fc*-Sec-His
has a lower molecular weight due to the removal of the
glycosylation site in the CH.sub.2 portion of the Fc protein.
[0105] Binding to peripheral blood mononuclear cells (PBMC), which
express the Fc receptor, was analyzed using flow cytometry. Five
.mu.g of Fc-Sec-His, Fc*-Sec-His, and Fc*-stop were incubated with
PBMC, and then stained with a streptavidin/PE conjugate. As shown
in FIG. 3, the non-mutated Fc-Sec-His protein retained its ability
to bind the Fc receptor even after conjugation to the biotin
reporting moiety, while the mutated Fc* proteins could not bind to
the Fc receptor protein regardless of selenocysteine incorporation
or biotin moiety attachment.
Example 4
[0106] This example demonstrates that activity is retained in vitro
for a synthetic small molecule bound to an antibody molecule.
[0107] An integrin-binding moiety (LLP2A-biotin-maleimide, as shown
in FIG. 4) was incubated with Fc-Sec-His and Fc-Stop as described
above. The moiety was prepared using protocols as provided in Song
et al., Bioorg. Med. Chem. Lett., 14: 161-165 (2004), and Peng et
al., Nat. Chem. Biol., 2: 381-389 (2006). Binding to HEK 293F
cells, which express human integrin .alpha..sub.4.beta..sub.1, was
analyzed by flow cytometry using 10 micrograms/mL of treated
Fc-Sec-His, Fc-stop as a negative control, and the integrin binding
moiety alone as a positive control.
[0108] As shown in FIG. 5, Fc-Sec-His bound strongly to the
integrin-expressing cells, but Fc-stop did not. These results
confirm that the integrin binding property of the moiety can be
conferred on the hybrid molecule.
Example 5
[0109] This example demonstrates in a clinical context that binding
activity of a synthetic small molecule is maintained when the
synthetic small molecule is bound to an antibody molecule.
[0110] Peripheral Blood Mononuclear Cells (PBMC) from untreated
B-CLL patients were either freshly prepared or thawed up
immediately before use. After 1 h incubation in 10% (v/v) FCS/PBS,
cells were centrifuged, resuspended in 1% (v/v) FCS/PBS and
aliquots of 50 .mu.L containing 5.times.10.sup.5 cells were
distributed into a V-bottom 96-well plate (Corning).
Fc-LLP2A-derived proteins (prepared as in Example 4) as well as
biotinylated mouse anti-human Integrin .alpha.4 antibody were added
to the cells at 5 .mu.g/mL final concentration and incubated for 1
h. Subsequently, the cells were washed twice with 1% (v/v) FCS/PBS
and incubated for 1 h with a 1:25 dilution of PE-conjugated
streptavidin (BD Biosciences) in 1% (v/v) FCS/PBS. After two
washing steps, the cells were resuspended in 400 .mu.L in 1% (v/v)
FCS/PBS and analyzed using a FACScan instrument (Becton-Dickinson).
All steps were carried out on ice.
[0111] When compared to a control profile of known integrin binding
moiety LLP2A-biotin (FIG. 6), flow cytometry of Fc-Sec-His
conjugated to the LLPA-biotin-maleimide integrin binding moiety
(shown in FIG. 4) indicates similar patterns of binding to integrin
receptors in patients having increased receptor expression versus
patients not having increased receptor expression (FIG. 7).
[0112] These results show that an antibody conjugated to a
synthetic molecule can be employed in a clinical context with
similar effect to the un-conjugated synthetic molecule alone.
Example 6
[0113] This example demonstrates that the serum half-life of a
synthetic small molecule bound to an antibody molecule in vivo is
greater than the serum half-life of the synthetic small molecule
alone in vivo.
[0114] Each mouse received a single 100-.mu.L tail vein injection
of 10 mg/mL (200 .mu.M) of the Fc-Sec-His/LLP2A-biotin in PBS
(group 1) or 360 .mu.g/mL (200 .mu.M) free LLP2A-biotin in DMSO
(group 2) on day 1. Thirty minutes after the tail vein injection
one retro-orbital blood draw of approximately 50 .mu.L from each
mouse was taken. This blood draw was repeated after 24, 48, 72, and
96 hours for each mouse. Serum of each blood draw was isolated,
10.times. diluted, and incubated with Raji cells. Binding of
Fc-LLP2A and LLP2A to the cells was detected as described in
Example 5.
[0115] Whereas free LLP2A-biotin was undetectable 24 hours after
injection, Fc-Sec-His/LLP2A-biotin was still present after 4
days.
[0116] These results demonstrate that that the circulatory
half-life of a synthetic small molecule bound to an antibody
molecule is increased compared to the synthetic small molecule
alone.
Example 7
[0117] This example demonstrates that in vitro activity is retained
for an antibody bound to a small molecule.
[0118] LLP2A was previously shown to interfere with the interaction
of integrin .alpha..sub.4.beta..sub.1 and VCAM-1 (Peng et al., Nat.
Chem. Biol., 2: 381-389 (2006)). A cell adhesion assay was
performed to determine whether Fc-Sec-His/LLP2A-biotin and free
LLP2A-biotin similarly interfered with the
.alpha..sub.4.beta..sub.1 and VCAM-1 interaction. A 96-well Costar
3690 plate (Corning) was coated with 1 .mu.g recombinant human
VCAM-1 (R&D Systems) in 25 .mu.L PBS and blocked with 3% (w/v)
BSA/PBS. Raji cells (1.times.10.sup.5 cells in 50 .mu.L PBS) were
incubated with 10 .mu.g/ml Fc-Sec-His/LLP2A-biotin, a mouse
anti-human integrin .alpha..sub.4.beta..sub.1 mAb (R&D
Systems), or an equimolar concentration of free LLP2A-biotin, and
added to the prepared plate. Non-adherent cells were removed by
washing twice with PBS. Adherent cells were subsequently detached
by vigorous pipetting, and their number was determined by flow
cytometry using AccuCount blank particles (Spherotech) for
normalization. All incubations were for 1 hour at 37.degree. C.
[0119] Fc-Sec-His/LLP2A-biotin and free LLP2A-biotin were found to
block the binding of Raji cells to immobilized human VCAM-1 as
potently as a mouse anti-human integrin .alpha..sub.4.beta..sub.1
mAb (FIG. 8). When tested over a concentration range from 0.02 to
200 nM, Fc-Sec-His/LLP2A-biotin was found to be as potent as free
LLP2A-biotin (data not shown). Therefore, conjugation to the
generic Fc protein did not weaken the pharmacological activity.
Similar results (data not shown) were obtained for the binding of
Raji cells to TNF.alpha.-activated human umbilical vein endothelial
cells.
[0120] This study shows that an antibody conjugated to a synthetic
molecule can maintain the biological activity of the synthetic
molecule.
Example 8
[0121] This example demonstrates the use of generic Fc protein
conjugated to a small synthetic molecule for exploitation of FcRn
binding.
[0122] Soluble human FcRn consisting of .alpha.-chain and 132
microglobulin was designed, expressed, and purified based on the
previously reported generation and crystallization of soluble rat
FcRn (Gastinel, Proc. Natl. Acad. Sci. USA, 89: 638-642 (1992)).
Using the mammalian expression vector PIGG as described in Rader et
al., FASEB J., 16: 200-2002 (2002), .alpha.-chain and .beta.2
microglobulin of heterodimeric human FcRn were expressed by an
engineered bidirectional CMV promoter cassette. A PCR fragment
encoding human .beta.2 microglobulin was amplified from a
full-length cDNA plasmid (OriGene) by PCR using primers beta-5' and
beta-3' and cloned into PIGG by SacI/SalI ligation. A PCR fragment
encoding the extracellular part of the human FcRn .alpha.-chain
(nucleotides 70-1095) was amplified from a full-length cDNA plasmid
(OriGene) by overlap extension PCR using primer pairs
alpha-5'/HindIII-mut3' and HindIII-mut5'/alpha-3' and cloned into
PIGG by HindIII/XbaI ligation. Both expression cassettes were
verified by DNA sequencing.
[0123] Transient transfection of the soluble human FcRn expression
vector into HEK 293F cells, culturing of the cells, and
concentration of the supernatant was carried out as described above
for Fc protein expression. The concentrated supernatant was
subsequently brought into acidic PBS (pH 6.0). For purification,
Fc-stop protein was immobilized to an NHS HiTrap column (GE
Healthcare) using the manufacturer's protocol. After loading the
concentrated supernatant in acidic PBS (pH 6.0), the column was
washed with 30 mL acidic PBS (pH 6.0), and bound soluble human FcRn
was eluted with neutral PBS (pH 7.4). Purified soluble human FcRn
(5 .mu.g) was analyzed by electrophoresis on a NuPage 4-12%
gradient gel (Invitrogen) followed by staining with SimplyBlue
SafeStain (Invitrogen). The binding of Fc-Sec-His/LLP2A-biotin and
Fc*-Sec-His/LLP2A-biotin to soluble human FcRn was analyzed by
ELISA. All steps were carried out side-by-side in acidic PBS (pH
6.0) or neutral PBS (pH 7.4) for 1 h at 37.degree. C. First, 500 ng
of soluble human FcRn in 25 .mu.L PBS was coated on a 96-well
Costar 3690 plate (Corning). After blocking with 3% (w/v) BSA/PBS,
the plate was incubated with Fc-Sec-His/LLP2A-biotin or
Fc*-Sec-His/LLP2A-biotin at 4 .mu.g/mL (200 ng/well) followed by
washing with acidic or neutral PBS (10.times.200 4/well) and
incubation with HRP-coupled streptavidin (50 ng/well) in 1% (w/v)
BSA/PBS. The plate was washed with acidic or neutral PBS as before,
and colorimetric detection was performed using
2,2'-azino-bis(3-ethylbenzthiazoline)-6-sulfonic acid (Roche) as
substrate according to the manufacturer's directions.
[0124] Fc-Sec-His/LLP2A-biotin and Fc*-Sec-His/LLP2A-biotin were
then analyzed by ELISA for binding to purified human FcRn at pH 6.0
and at pH 7.4. Both Fc conjugates were found to bind to FcRn at pH
6.0, but not at pH 7.4. Thus, these results demonstrate that the Fc
conjugates have the same characteristic and physiologically
relevant pH-dependent interaction with FcRn through which both IgG
recycling and transcytosis have previously been shown to be
mediated (Roopenian et al., Nat. Rev. Immunol., 7: 715-725
(2007)).
Example 9
[0125] This example demonstrates a physiologically relevant
interaction of Fc-Sec-His/LLP2A-biotin with FcRn in vivo.
[0126] Transcytosis capacity of the Fc-Sec-His/LLP2A-biotin
conjugate was evaluated in the neonatal intestine model as
described in Roopenian et al., Nat. Rev. Immunol., 7: 715-725
(2007)). For this evaluation, 0.5 mg of Fc-stop,
Fc-Sec-His/LLP2A-biotin, and Fc-Sec-His conjugated to commercially
available biotin-iodoacetamide, as well as an equimolar amount of
free LLP2A-biotin, were administered intragastrically to 10-day old
mice. Sera prepared after 24 hours from cardiac puncture bleeds
were analyzed by flow cytometry using Raji cells and by Western
blotting.
[0127] Both mouse studies were carried out by Biocon (Rockville,
Md.) in accordance with the Guide for the Care and Use of
Laboratory Animals published by the National Institutes of Health.
Blood clearance. Two groups of three C57BL/6 mice each were
injected i.v. (tail vein) with 100 .mu.L of 10 mg/mL (200 .mu.M)
Fc-Sec-His/LLP2A-biotin in PBS or with 100 .mu.L 360 .mu.g/mL (200
.mu.M) free LLP2A-biotin in DMSO. Sera from retro-orbital bleeds
were prepared 30 min, 24 h, 48 h, 72 h, and 96 h after injection.
Sera were tenfold diluted in 1% (v/v) FCS/PBS and analyzed by flow
cytometry using Raji cells as described above. Transcytosis. Four
groups of two 10-day old C57BL/6 mice each received Fc-stop,
Fc-Sec-His/LLP2A-biotin, Fc-Sec-His/biotin, or free LLP2A-biotin;
0.5 mg protein or an equimolar amount of free LLP2A-biotin was
combined with 80 .mu.g soybean trypsin inhibitor in a total volume
of 50 .mu.L PBS and administered intragastrically using a 2.54 cm
(1-inch) straight gavage needle with a 1.25-mm diameter ball. No
toxicity was noted. After 24 h, the mice were anesthetized with
ketamine xylazine anesthesia cocktail and bled out via cardiac
puncture. Sera were tenfold diluted in 1% (v/v) FCS/PBS and
analyzed by flow cytometry using Raji cells as described above.
[0128] These analyses revealed that transcytosis of
Fc-Sec-His/LLP2A-biotin was highly efficient (FIG. 9B). Western
blotting across timepoints of 30 minutes, 24 hours, 48 hours, 72
hours, and 96 hours confirmed the blood clearance of
Fc-Sec-His/LLP2A-biotin following reducing SDS-PAGE. In addition,
transcytosis of Fc-Sec-His/LLP2A-biotin was as efficient as
transcytosis of Fc-stop and Fc-Sec-His/biotin.
[0129] With its preserved ability to enter the blood stream through
FcRn-mediated transcytosis, the generic Fc protein provides a
vehicle for alternative administration routes of small synthetic
molecules across epithelial or endothelial cell barriers. For
example, the expression of FcRn in human upper airway epithelial
cells mediates the transport of aerosolized IgG and Fc fusion
proteins from the lung to the blood with an efficacy as high as
i.v. injection (Roopenian et al., Nat. Rev. Immunol., 7: 715-725
(2007); Spiekermann et al., J. Exp. Med., 196: 303-310 (2002)).
[0130] The results of this study demonstrate that the Fc conjugates
are capable of entering the bloodstream via transcytosis, and that
certain in vivo administration methods, such as a model for inhaled
aerosols, can be used in the antibody-small molecule conjugate.
Example 10
[0131] This example demonstrates the preparation and use of an
IgG-Sec conjugate using the commercially available CD20 antibody
Rituximab (RITUXAN.RTM.).
[0132] PIGG-Rituximab-Sec-His.
[0133] The sequences of the variable domains VL and VH of Rituximab
were obtained from Anderson et al., U.S. Pat. No. 5,736,137. DNA
sequences optimized for human cell expression were custom
synthesized (GenScript) and cloned by XbaI/HindIII (VL) and
ApaI/SacI (VH) into the previously described bidirectional Vector
PIGG. In this vector, heavy and light chains are expressed by an
engineered bidirectional CMV promoter cassette. For the expression
of a C-terminal selenocysteine in the heavy chain, a SacII/SalI
fragment of the previously described pCEP4-Fc-Sec-His was cloned
into PIGG-Rituximab by SacII/SalI ligation. This fragment consisted
of the end of CH.sub.3, a TGA codon, followed by six His codons, a
TAA codon, an engineered SaII site, and a portion of the 3'-UTR of
the thioredoxin reductase 1 gene containing the SECIS element for
recoding of the TGA stop codon to selenocysteine insertion. The
resulting plasmid was named PIGG-Rituximab-Sec-His. See FIGS.
10A-B.
[0134] PIGG-Rituxi-Fab-Sec-His.
[0135] For the generation of a plasmid expressing
Rituxi-Fab-Sec-His (FIG. 10C), an ApaI/SalI fragment of
PIGG-Rituximab-Sec-His was replaced by a fragment expressing the
C.sub.H1 portion downstream of the ApaI site, followed by a TGA
codon, six His codons, a TAA codon, and the SECIS
element-containing 3'UTR portion as described above. This new
fragment was generated by PCR using PIGG-Rituximab-Sec-His as a
template. Using primer pairs (a)
IX-5'(ccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggca)
(SEQ ID NO:14) and IX-3'
(atgtcatgtgtgagttttgtcacaagatttgggctcaactttctt) (SEQ ID NO:15), (b)
X-5'
(tcttgtgacaaaactcacacatgacatcaccatcaccatcactaagccccagtgtggatgctgttgcca)
(SEQ ID NO:16) and X-3' (ctaggtcgactttatttgccaaatgagatgaggacgtgag)
(SEQ ID NO:17), two PCR fragments amplified with these two primer
pairs were fused by overlap extension PCR and cloned by ApaI/SalI
ligation.
[0136] The mammalian expression vectors described above were
transiently transfected into HEK 293F cells (Invitrogen) with
293fectin (Invitrogen) using conditions detailed in the
manufacturer's protocol. Transfected HEK 293F cells were cultured
in FreeStyle serum-free medium (Invitrogen), supplemented with 1
.mu.M Na.sub.2SeO.sub.3 (Sigma), in spin flasks (Integra
Biosciences) under constant rotation at 75 rpm in a humidified
atmosphere containing 8% CO.sub.2 at 37.degree. C. Three days after
transfection, the medium was collected after centrifugation,
replaced for two additional days, and collected again. This
procedure was repeated once for two additional days. The combined
supernatants were filtered through a 0.45-.mu.m membrane and
tenfold concentrated using an ultrafiltration device with a 10-kDa
cutoff membrane (Millipore). While the concentrate containing
Rituximab-Sec-His was loaded on a 1-mL recombinant Protein G HiTrap
column (GE Healthcare), Rituxi-Fab-Sec-His was purified using a
1-mL NHS-activated HiTrap column coated with goat anti-human Fab
polyclonal IgG (Bethyl Laboratories). PBS was used for column
equilibration and washing, 0.5 M acetic acid (pH 3.0) for elution,
and 1 M Tris-HCl (pH 8.0) for immediate neutralization. The
neutralized eluate was dialyzed at 4.degree. C. overnight against
PBS using Slide-A-Lyzer cassettes with 10-kDa cutoff (Pierce) and
concentrated with 10-kDa cutoff centrifugal filter devices
(Millipore). In order to separate Rituxi-Ig proteins with inserted
selenocysteine (Rituxi-Ig-Sec-His) from those without
(Rituxi-Ig-stop), the purified Ig proteins were tenfold diluted in
loading/washing buffer (500 mM NaCl and 25 mM imidazol in PBS) and
loaded on a 1-mL IMAC column (HisTrap; GE Healthcare). The
flow-through of the column containing Rituxi-Ig-stop was collected.
Subsequently, the column was washed with 50 mL loading/washing
buffer, and the bound Rituxi-Ig-Sec-His proteins were eluted with
elution buffer (500 mM NaCl and 500 mM imidazol in PBS). Both
eluate and flow-through were dialyzed and concentrated as
before.
[0137] For selective conjugation at the Sec interface,
Rituxi-Ig-Sec-His and Rituxi-Fab-Sec-His proteins and negative
controls (Rituxi-Ig-stop and Rituxi-Fab-stop) were diluted in 15 mL
100 mM sodium acetate (pH 5.2) and concentrated to 4 .mu.M using a
10-kDa cutoff centrifugal filter device. DTT at 0.1 mM followed by
either fluorescein-5-maleimide, maleimide-PEO.sub.2-biotin (both
from Pierce), or 7.5 kDa biotin-poly(ethyleneglycol)-maleimide
(biotin-peg-maleimide; JenKem Technology) at 10 .mu.M final
concentration were added to the protein and incubated for 50 min at
room temperature in the dark. The conjugated proteins were
subsequently diluted in 15 mL 100 mM sodium acetate (pH 5.2) and
concentrated to 250 .mu.L as described above. This step was
repeated once with 15 mL 100 mM sodium acetate (pH 5.2) and
subsequently twice with 15 mL PBS to remove unconjugated compounds.
Both proteins were selectively biotinylated. Proteins without Sec
remained unbiotinylated. ELISAs prepared on coated
Rituximab-Sec-His and Rituxi-Fab-Sec-His detected biotin with
HRP-coupled streptavidin and with HRP-coupled donkey anti-human IgG
polyclonal antibodies. Commercial Rituximab (RITUXAN.RTM.) served
as a control. After selective biotinylation at the Sec interface,
the correct assembly of both Ig chains of Rituxi-Fab-Sec/biotin was
confirmed by non-reducing SDS-PAGE and Coomassie staining.
Untreated Rituxi-Fab-Sec-His and Rituxi-Fab-stop served as
controls.
[0138] Selective conjugation of Rituximab-Sec-His and
Rituxi-Fab-Sec-His preserved the correct assembly the protein
chains. Following selective biotinylation, 5 mg of
Rituximab-Sec-His/biotin and Rituximab-stop were analyzed by
non-reducing SDS-PAGE followed by Coomassie staining. Rituximab
served as a control. The correct size of the protein and comparison
with Rituximab indicated that neither selective modification at the
Sec interface (Rituximab-Sec-His/biotin) nor incubation in the
conjugation buffer (Ritximab-stop) affects the tetrameric structure
of the protein.
[0139] Soluble human FcRn was engineered and expressed as described
above. Briefly, both cDNA sequences of the heterodimeric human
FcRn, .alpha.-chain and 132 microglobulin, were cloned into the
bidirectional CMV promoter cassette of the PIGG vector. Transient
transfection of the soluble human FcRn expression vector into HEK
293F cells, culturing of the cells, and concentration of the
supernatant were carried out as described for Rituximab expression.
The concentrated supernatant was subsequently brought into acidic
PBS (pH 6.0). For purification, Fc-stop protein was immobilized to
an NHS HiTrap column (GE Healthcare) using the manufacturer's
protocol. After loading the concentrated supernatant in acidic PBS
(pH 6.0), the column was washed with 30 mL acidic PBS (pH 6.0), and
bound soluble human FcRn was eluted with neutral PBS (pH 7.4).
[0140] Analysis of Selective Conjugation.
[0141] To confirm selective biotinylation at the Sec interface
through (+)-biotinyl-iodoacetamidyl-3,6-dioxaoctanediamine, wells
of a 96-well Costar 3690 plate (Corning) were incubated with 200 ng
Rituximab-Sec-His/biotin, Rituximab-stop,
Rituxi-Fab-Sec-His-biotin, Fab-stop, or Rituximab in 25 .mu.L PBS.
After blocking with 3% (w/v) BSA/PBS, the plate was incubated with
either HRP-coupled streptavidin (50 ng/well) or a 1:1,000 dilution
of HRP-coupled donkey anti-human IgG polyclonal antibodies (Jackson
ImmunoResearch Laboratories) in 1% (w/v) BSA/PBS. After washing
with water (10.times.200 .mu.L/well), colorimetric detection was
performed using 2,2'-azino-bis(3-ethylbenzthiazoline)-6-sulfonic
acid (Roche) as substrate according to the manufacturer's
directions.
[0142] Analysis of Fc Receptor Binding.
[0143] To analyze and compare the binding of Rituximab and
specifically conjugated Rituximab-Sec-His to commercially available
soluble human Fc.gamma.RI, Fc.gamma.RIIA, and Fc.gamma.RIIIA (all
from R&D Systems) as well as to soluble human FcRn, 500 ng of
each Fc receptor was coated and blocked on a 96-well plate as
described above. The plate was then incubated with Rituximab,
Rituximab-Sec-His/biotin, and Rituximab-Sec-His/fluorescein for
FcRn binding at 8 .mu.g/mL (400 ng/well) followed by washing with
H.sub.2O, incubation with HRP-coupled streptavidin (50 ng/well) or
HRP-coupled donkey anti-human IgG polyclonal antibodies (1:1000) in
1% (w/v) BSA/PBS, and colorimetric detection as described in
Example 8 above. For multimeric binding of
Rituximab-Sec-His/biotin, 1 .mu.g of the Fc conjugates was
pre-incubated with 250 ng HRP-coupled streptavidin followed by
incubation with coated and blocked Fc.gamma.RIIA, washing with
H.sub.2O, and colorimetric detection. For binding of Rituximab,
Rituximab-Sec-His/biotin, and Rituximab-Sec-His/fluorescein to
FcRn, all steps were carried out side-by-side in acidic PBS (pH
6.0) or neutral PBS (pH 7.4). Binding for both Rituximab conjugates
was detectable at pH 6.0, but not at pH 7.4. Rituximab was used as
a positive control.
[0144] For detecting multimeric IgG binding in the Fc.gamma.
receptor binding assay, 1 mg of rituximab-based IgG-Sec-His/biotin
and Rituxan.RTM. (negative control) were pre-incubated with 250 ng
HRPcoupled streptavidin followed by incubation with coated and
blocked Fc.gamma.RIIA and Fc.gamma.RIIIA, washing, and colorimetric
detection. All incubations were for 1 hour at 37.degree. C.
[0145] Flow cytometry assays were conducted on the resulting
conjugates. Human Burkitt's lymphoma cell line Raji was purchased
from ATCC. All incubations were for 1 hour on ice. Cells were
centrifuged and resuspended in 1% (v/v) FCS/PBS, and aliquots of 50
.mu.L containing 5.times.1.sup.05 cells were distributed into a
V-bottom 96-well plate (Corning). The cells were then incubated
with Rituximab, Rituximab-Sec-His/biotin, a
Rituximab-Sec-His/fluorescein, Rituximab-stop,
Rituxi-Fab-Sec-His/biotin, and CAMPATH.RTM. along with other
corresponding negative controls (all 0.6 .mu.M). After washing
twice with 1% (v/v) FCS/PBS, the cells were incubated with a 1:25
dilution of PE-coupled streptavidin (BD Biosciences) or with
FITC-coupled goat anti-human Fab polyclonal (Fab').sub.2 fragments
(Jackson ImmunoResearch Laboratories). This step was skipped for
cells that had been incubated with Rituximab-Sec-His/fluorescein.
After washing twice as before, the cells were resuspended in 400
.mu.L 1% (v/v) FCS/PBS and analyzed using a FACScan instrument
(Becton-Dickinson). For the competition experiment, the cells were
first incubated with the anti-CD52 monoclonal antibody CAMPATH.RTM.
or Rituximab (all 0.6 .mu.M). For detection, a 1:25 dilution of
PE-coupled streptavidin (BD Biosciences) was used.
[0146] Rituximab-Sec-His/biotin and Rituximab bound to Raji cells
with equal affinities, indicating that Sec-mediated conjugation
does not impair binding characteristics. In contrast, due to the
monovalent binding of Rituxi-Fab-Sec-His/biotin, binding intensity
is slightly reduced (FIG. 11A). The specific binding of
Rituximab-Sec-His/biotin can compete with Rituximab. While
pre-incubation with the anti CD52 monoclonal antibody CAMPATH.RTM.
did not affect binding of Rituximab-Sec-His/biotin, pre-incubation
with commercial Rituximab (RITUXAN.RTM.) strongly reduced
Rituximab-Sec-His/biotin binding (FIG. 11B), demonstrating the high
specificity of Sec-modified Rituximab.
[0147] Rituximab-Sec-His and Rituximab-stop were exposed to a FITC
derivative with an electrophilic maleimide moiety followed by
incubation with Raji cells. While incubation of Raji cells with
Rituximab-Sec-His/FITC resulted in a clear and homogenous signal,
exposure with FITC-treated Rituximab-stop reached only basal levels
like the corresponding unconjugated proteins and Strep-PE alone
(FIG. 11C). Sec-mediated conjugation with FITC was therefore found
to be highly efficient and selective.
[0148] Following selective biotinylation at the Sec interface,
Rituximab-Sec-His/biotin was analyzed for binding to immobilized
recombinant Fc.gamma.RI, Fc.gamma.RIIA, and Fc.gamma.RIIIA with
HRP-coupled streptavidin and HRP-conjugated goat anti-human Fab
polyclonal F(ab').sub.2 fragments. Rituximab was used as a positive
control. The avidity of Rituximab-Sec-His/biotin to Fc.gamma.RIIA
strongly increased after pre-incubation with HRP-coupled
streptavidin for multimerization. FcRn receptor binding of
Rituximab-Sec His/biotin and Rituximab-Sec His/fluorescin were
evaluated using ELISA as above. Rituximab-Sec His/biotin and
Rituximab-Sec His/fluorescin were analyzed for binding to
immobilized recombinant human FcRn with HRP-coupled
streptavidin.
[0149] To determine whether Sec-conjugation had any effect on the
cytotoxic effects of Rituximab, Raji cells were centrifuged and
resuspended in 1% (v/v) FCS/PBS, and aliquots of 50 .mu.L
containing 5.times.10.sup.5 cells were distributed into a V-bottom
96-well plate (Corning). After incubation with Rituximab,
Rituxi-Sec-His/fluorescein, or Rituxi-Fab-Sec-His/biotin (0.6
.mu.M) for 1 hour on ice, cells were washed twice and incubated
with 10% rabbit complement of 3-4 weeks old rabbits (Pel-Freez) for
2 hours at 37.degree. C. After the addition of 100 .mu.g/ml
propidium iodide (PI), dead cells were detected by PI accumulation
using a FACScan instrument (Becton-Dickinson).
Rituxi-Sec-His/fluorescein was as potent as Rituximab in mediating
CDC. Rituximab served as a positive control, and Rituxi-Fab-sec-His
was used as a negative control, and was found to be incapable of
mediating CDC. In contrast to the strong cytotoxic effect of
Rituximab in combination with the rabbit serum, neither the
antibody nor rabbit serum alone mediated complement-dependent
cytotoxicity (FIG. 12A). Incubation of Raji cells with
Rituximab-Sec-His specifically conjugated with FITC (FIG. 12B) or
Geldanamycin (GA) (FIG. 12C) indicated equal cytotoxicity when
co-incubated with rabbit serum, indicating that Sec-specific
conjugation of Rituximab-Sec-His does not affect the ability to
mediate complement-dependent cytotoxicity.
[0150] The results of this study demonstrate that
Rituximab-Sec-His/biotin interacts with Fc.gamma. receptors in a pH
dependent manner but that Sec conjugation has no effect on
complement dependent cytotoxicity.
Example 11
[0151] This example demonstrates that a mixture of proteins with
and without C-terminal selenocysteine can be separated following
selective biotinylation.
[0152] A mammalian expression vector was cloned that was identical
to PIGG-rituximab-Sec-His but without the (His).sub.6-encoding
sequence. To express rituximab with a C-terminal Sec but without a
His tag, mammalian expression vector pCEP4-Fc-Sec was prepared
using the same methods used to construct pCEP4-Fc-Sec-His as
described in Example 1. Using pCEP4-Fc-Sec-His as template, a PCR
fragment was amplified with primer pair VIII-5'
(gcctaagcttgtetccgggtgcctgataagccccagtgtggatgctgttg) (SEQ ID NO:19)
and VIII-3' (agctctcgaggccaaatgagatgaggacgtgag) (SEQ ID NO:20) and
cloned into pCEP4-Fc by HindIII/XhoI ligation. The resulting
plasmid was designated pCEP4-Fc-Sec. An Fc-Sec encoding portion of
pCEP4-Fc-Sec was subsequently transferred into PIGG-rituximab by
SacII/SalI ligation, resulting in PIGG-rituximab-Sec.
[0153] A mixture of IgG-Sec and IgG-stop protein was purified from
supernatants of transiently transfected HEK 293F cells by Protein G
affinity chromatography. The purified mixture of Rituxi-Sec
(without His tag) and IgG-stop was subjected to selective
conjugation to biotinmaleimide followed by monomeric avidin
affinity chromatography. Subsequent analysis by Western blotting
revealed efficient separation of IgG-Sec/biotin (eluate) and
IgG-stop (flow-through). This analysis also confirmed selective
conjugation at the Sec interface as reflected by a biotinylated
heavy chain and a non-biotinylated light chain band.
[0154] Further analysis by flow cytometry using PE-coupled
streptavidin showed that purified Rituxi-Sec/biotin binds to Raji
cells as efficiently as Rituxi-Sec-His/biotin (FIG. 15).
[0155] These results demonstrate that a His tag is convenient but
not necessary for separating mixtures of proteins with and without
C-terminal Sec as long as the conjugated compound contains a handle
for protein purification.
Example 12
[0156] This example demonstrates the preparation of a pegylated
Rituxi-Fab-Sec-His conjugate as well as effects of this pegylation
on serum concentration levels by administration of
Rituxi-Fab-Sec-His/PEG-biotin in a mouse model.
[0157] Using the selective conjugation conditions described in
Example 10, purified Rituxi-Fab-Sec-His was reacted with a
commercially available 7.5-kDa biotin-PEG-maleimide compound.
Size-exclusion chromatography following selective conjugation
resulted in the separation of two protein fractions, indicated by
peak 1 and peak 2 in a ratio of approximately 2:1 (FIG. 16A). By
contrast, rituximab-based Fab-stop, subjected to same conjugation
conditions in the presence of biotin-PEG-maleimide, only revealed
peak 2 (FIG. 16A). Flow cytometry using the concomitantly
conjugated biotin group for detection confirmed that peak 1
contained the rituximab-based Fab-Sec-His/PEG-biotin fraction and
peak 2 contained the unconjugated Fab fraction. As shown in FIG.
16B, peak 1, but not peak 2, revealed strong binding to Raji cells.
As previously observed for rituximab-based Fab-Sec-His/biotin and
attributed to lower avidity (FIG. 11A), the binding of
Fab-Sec-His/PEG-biotin was found to be somewhat weaker than the
binding of IgG-Sec-His/biotin. The remaining weak binding activity
in peak 2, which was slightly above the background defined by
negative control conjugate Fc-Sec-His/PEG-biotin (FIG. 5B), can be
explained by an incomplete separation of peak 1 and peak 2. The
presence of Rituxi-Fab in both peak 1 and peak 2 was confirmed by
flow cytometry (FIG. 16B) and Western blotting, using donkey
anti-human Fab polyclonal antibodies for detection.
[0158] In vivo tests in a mouse model were then conducted to
investigate whether PEGylation extended the circulatory half-life
of the Fab molecule.
[0159] The mouse study was carried out by Biocon, Inc. (Rockville,
Md.) in accordance with the Guide for the Care and Use of
Laboratory Animals published by the National Institutes of Health.
Each of three groups of three adult C57BL/6 mice was injected i.v.
(tail vein) with 100 .mu.L of 3 mg/mL Fab-Sec-His/PEG-biotin,
Fab-stop, or Rituximab (RITUXAN.RTM.) in PBS. Sera from
retro-orbital bleeds were prepared 30 min, 24 h, 48 h, 72 h, and 96
h after injection. Sera were diluted ten-fold in 1% (v/v) FCS/PBS
and analyzed by flow cytometry using Raji cells and Cy5-coupled
goat anti-human F(ab').sub.2 polyclonal antibodies (Jackson
ImmunoResearch) or PE-coupled streptavidin as described in Example
10 (FIG. 16C).
[0160] Consistent with a previously reported half-life of 199 h for
human IgG1 in SCID mice (Zuckier et al., Cancer Res., 58: 3905-08
(1998)), Rituximab (RITUXAN.RTM.) revealed only marginal weakening
over the course of the experiment. Although the signals obtained
for both Fab preparations indicated much shorter circulatory
half-lives, the 7.5-kDa PEG group was found to delay the clearance
of the Fab molecule, rendering it detectable 24 h after intravenous
injection (FIG. 16C). The retained Fab-Sec-His/PEG-biotin conjugate
was detectable with both donkey anti-human Fab polyclonal
antibodies (FIG. 16C) and streptavidin, confirming the previously
noted stability of C-terminal Sec conjugates in vivo.
[0161] These results demonstrate that the PEGylated Rituxi-Sec-Fab
had an extended circulatory half-life compared to the unconjugated
Rituxi-Sec-Fab.
Example 13
[0162] This example demonstrates the use of a flexible
trifunctional poly(ethylene
glycol)-succinamide-Lysine-Lysine-maleimide (PEG-SU-Lys-Lys-mal)
linker to prepare an Fc-Sec-LLP2A antibody-drug conjugate as shown
in FIG. 13.
[0163] Using solid-phase synthesis techniques as described in
Thomas et al., Bioorg. Medicinal Chem. Letters, 18: 5785-88 (2008),
the PEG-SU-Lys-Lys-mal linker was used to couple LLP2A to Fc-Sec. A
biotin reporter molecule was employed as described in Example 2 to
allow detection of Fc covalent adducts by avidin pull-down
experiments followed by ELISA visualization. The Fc-Sec-LLP2A
conjugate was then incubated with integrin
.alpha..sub.4.beta..sub.1-expressing cells. The cells were washed
and then treated with Cy5-labeled rabbit anti-human IgG. Under
these conditions, cells only fluoresced if both the Fc and LLP2A
components of the hybrid construct were present.
[0164] Competition experiments with an anti-integrin .alpha..sub.4
mAb (purchased from Serotec) indicated that the Fc-Sec-LLP2A
conjugate and the anti-integrin .alpha..sub.4 mAb exhibited
identical/overlapping epitopes as evidenced by the diminished
binding of the Fc-Sec-LLP2A conjugate to lymphoma cells in the
presence of the anti-integrin .alpha..sub.4 mAb (FIG. 14).
[0165] These results demonstrate that the binding of the
Fc-Sec-LLP2A conjugate to the cells is mediated by the
peptidomimetic LLP2A and not by the Fc protein portion, and that
the targeting specificity of the parent peptidomimetic for integrin
.alpha..sub.4 is retained in Fc-Sec-LLP2A conjugates using the
PEG-SU-Lys-Lys-mal linker.
Example 14
[0166] This example demonstrates that the synthetic molecule bound
to a selenocysteine-antibody conjugate can be equipped with
additional agents.
[0167] A maleimide derivative of folate was incubated with
Fc-Sec-His and Fc-Stop as described in Examples 3-4. Binding to
ovarian carcinoma cell line SKOV-3, which expresses folate
receptor, was analyzed by flow cytometry using 10 micrograms/mL of
treated Fc-Sec-His/folate-biotin, Fc-biotin as a negative control,
and folate-biotin as a positive control. The results are depicted
in the flow cytometry plot of FIG. 17.
[0168] As is apparent from the data reflected in FIG. 17,
Fc-Sec-His/Folate-biotin bound strongly to the folate-receptor
expressing cells, but Fc-biotin did not.
[0169] The folate was further equipped with an alkyne group using
methods described in Thomas et al., Poster MEDI-409, 238th ACS
National Meeting, Washington, D.C. (Aug. 16-20, 2009). Using
azide-alkyne Huisgen cycloaddition ("click chemistry") under
various reaction conditions, biotin-azide was added to the
resulting Fc-Sec-His/folate-alkyne. The results of three reaction
conditions are also depicted in the flow cytometry plot of FIG.
17.
[0170] As is apparent from the data reflected in FIG. 17,
biotin-azide was successfully clicked onto
Fc-Sec-His/folate-alkyne, and the conjugate retained its folate
binding properties.
[0171] These results demonstrate that a selenocysteine-conjugated
antibody can be modified to carry an alkyne functionality onto
which azide derivatives of various compounds can be clicked.
Example 15
[0172] This example demonstrates the preparation of a IgG-Sec
conjugate using the anti-NKG2D monoclonal antibody KYK2.0, which is
a fully human IgG. NKG2D is an activating receptor found on natural
killer (NK) cells and a costimulatory receptor on certain T
cells.
[0173] The KYK2.0-IgG, described in Kwong et al., J. Mol. Biol.,
384: 1143-56 (2008), was expressed as an IgG-Sec conjugate using
the PIGG expression vector as described in Example 10. The
resulting KYK2.0-Sec construct was incubated with LLP2A-biotin as
described in Example 4. The correct assembly of
KYK2.0-Sec/LLP2A-biotin was confirmed by non-reducing SDS-PAGE and
Coomassie staining, ELISA, and Western Blotting.
[0174] Binding of the resulting conjugates was analyzed for
KYK2.0-Sec/LLP2A-biotin using JeKo-1 cells. Flow cytometry of these
conjugates as compared to LLP2A-biotin, a positive control,
confirmed the potency of binding against .alpha..sub.4.beta..sub.1
expressing cells (KYK2.0-Sec/LLP2A-biotin) (FIG. 18).
Example 16
[0175] This example demonstrates the preparation and use of an
IgG-Sec/folate-biotin conjugate using the anti-NKG2D monoclonal
antibody KYK2.0, as well as the cancer cell killing ability of such
a conjugate.
[0176] The KYK2.0-IgG, described in Kwong et al., J. Mol. Biol.,
384: 1143-56 (2008), is expressed as an IgG-Sec conjugate using the
PIGG expression vector as described in Example 10. The resulting
KYK2.0-Sec construct is incubated with folate-biotin as described
in Example 14. The correct assembly of KYK2.0-Sec/folate-biotin is
confirmed by non-reducing SDS-PAGE and Coomassie staining, ELISA,
and Western Blotting.
[0177] Binding of the resulting conjugates is analyzed for
KYK2.0-Sec-His/folate-biotin using ovarian carcinoma cell line
SKOV-3 as described in Example 14. Flow cytometry of these
conjugates as compared to appropriate positive and negative
controls confirms the potency of binding against folate-receptor
expressing cells (KYK2.0-Sec-His/folate-biotin).
[0178] Cancer cell killing mediated by KYK-2.0 Fab (or
IgG1)-Sec-His/LLP2A-biotin and KYK-2.0 Fab (or
IgG1)-Sec-His/folate-biotin is determined by release of the
intracellular enzyme lactase dehydrogenase (LDH) using effector and
target cells prepared as follows.
[0179] Effector Cells:
[0180] PBMC are isolated from whole blood of healthy volunteers and
stored at 37.degree. C. overnight in RPMI 1640 plus 10% (v/v) fetal
bovine serum (FBS), 20 mM Hepes (pH 7.4), and 100 U/mL human IL-2.
Alternatively, human NK cells (CD16+ CD56+) are negatively selected
and purified from human PBMC by magnetic activated cell sorting
using the NK Cell Isolation Kit (Miltenyi Biotec) and expanded for
1 week in the presence of 10 ng/mL recombinant human IL-15 and
artificial antigen presenting cells (see, e.g., Zhang et al., J.
Immunol., 179: 4910-8 (2007)) expressing human 4-1BBL and human
IL-15R.alpha. at a ratio of 1-2 to 1 (cell line 2D11).
[0181] Target Cells:
[0182] Human mantle cell lymphoma cell line Jeko-1 (which expresses
integrin .alpha..sub.4.beta..sub.1) or human ovarian carcinoma cell
line SKOV-3 (which were grown in folate-deficient medium for
several weeks and express folate receptor FOLR1) are plated at
1.times.10.sup.5 cells per well in a 96-well plate in (regular or
folate-deficient) RPMI 1640 plus 5% (v/v) FBS and 15 mM Hepes (pH
7.4). The cells are incubated with 0.01 to 1 .mu.g/mL KYK-2.0 Fab
(or IgG1)-Sec-His/LLP2A-biotin and KYK-2.0 Fab (or
IgG1)-Sec-His/folate-biotin, respectively, for 1 h at 37.degree. C.
Subsequently, the cells are washed to remove unbound conjugate.
[0183] Combining Effector and Target Cells:
[0184] The prepared target cells (T) are incubated with the
prepared effector cells (E) in RPMI 1640 plus 5% (v/v) FBS and 15
mM Hepes (pH 7.4) for 4 h at 37.degree. C. at E:T ratios of 1:1,
10:1, and 20:1. Target cell lysis is determined by release of LDH
using the CytoTox 96 Non-Radioactive Cytotoxicity Assay kit
(Promega) according to the manufacturer's protocol. The amount of
LDH released is proportionate to target cell lysis. Samples are
performed in triplicate and statistically analyzed.
[0185] The results are expected to show that the KYK2.0 conjugates
can kill target cells by recruiting NKG2D-expressing effector
cells.
[0186] All references, including publications, patent applications,
and patents, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein.
[0187] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0188] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations of those preferred embodiments may
become apparent to those of ordinary skill in the art upon reading
the foregoing description. The inventors expect skilled artisans to
employ such variations as appropriate, and the inventors intend for
the invention to be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
Sequence CWU 1
1
20194DNAArtificial SequenceSynthetic Polynucleotide 1gggtaccatg
gactggacct ggaggatcct cttcttggtg gcagcagcca caggagctca 60ctccgagccc
aaatcttctg acaaaactca caca 94242DNAArtificial SequenceSynthetic
Polynucleotide 2cggagacaag cttaggctct tctgcgtgta gtggttgtgc ag
42315PRTArtificial SequenceSynthetic Polynucleotide 3Glu Pro Lys
Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15
468DNAArtificial SequenceSynthetic Polynucleotide 4gcctaagctt
gtctccgggt gcctgacatc accatcacca tcactaagcc ccagtgtgga 60tgctgttg
68524DNAArtificial SequenceSynthetic Polynucleotide 5agaagctcca
agaactgctg gcag 24625DNAArtificial SequenceSynthetic Polynucleotide
6cctgccagca gttcttggag cttct 25733DNAArtificial SequenceSynthetic
Polynucleotide 7agctctcgag gccaaatgag atgaggacgt gag
33868DNAArtificial SequenceSynthetic Polynucleotide 8gcctaagctt
gtctccgggt gcctgccatc accatcacca tcactaagcc ccagtgtgga 60tgctgttg
68971DNAArtificial SequenceSynthetic Polynucleotide 9gcctaagctt
gtctccgggt gcctgacggc atcaccatca ccatcactaa gccccagtgt 60ggatgctgtt
g 711031DNAArtificial SequenceSynthetic Polynucleotide 10aggagcagta
cgccagcacg taccgtgtgg t 311120DNAArtificial SequenceSynthetic
Polynucleotide 11gtggtttgtc caaactcatc 201231DNAArtificial
SequenceSynthetic Polynucleotide 12accacacggt acgtgctggc gtactgctcc
t 311323DNAArtificial SequenceSynthetic Polynucleotide 13agcagagctc
gtttagtgaa ccg 231457DNAArtificial SequenceSynthetic Polynucleotide
14ccaagggccc atcggtcttc cccctggcac cctcctccaa gagcacctct gggggca
571545DNAArtificial SequenceSynthetic Polynucleotide 15atgtcatgtg
tgagttttgt cacaagattt gggctcaact ttctt 451669DNAArtificial
SequenceSynthetic Polynucleotide 16tcttgtgaca aaactcacac atgacatcac
catcaccatc actaagcccc agtgtggatg 60ctgttgcca 691740DNAArtificial
SequenceSynthetic Polynucleotide 17ctaggtcgac tttatttgcc aaatgagatg
aggacgtgag 40189PRTArtificial SequenceSynthetic Polynucleotide
18Lys Ser Leu Ser Leu Ser Pro Gly Lys 1 5 1950DNAArtificial
SequenceSynthetic Polynucleotide 19gcctaagctt gtctccgggt gcctgataag
ccccagtgtg gatgctgttg 502033DNAArtificial SequenceSynthetic
Polynucleotide 20agctctcgag gccaaatgag atgaggacgt gag 33
* * * * *