U.S. patent application number 14/558456 was filed with the patent office on 2015-04-02 for compositions and methods for inhibiting expression of cd45 gene.
The applicant listed for this patent is ALNYLAM PHARMACEUTICALS, INC., UNITED STATES ARMY. Invention is credited to Sina Bavari, Anna Borodovsky, Antonin de Fougerolles, Tatiana Novobrantseva, Pamela Tan, Kelly Lynn Warfield.
Application Number | 20150093417 14/558456 |
Document ID | / |
Family ID | 41265242 |
Filed Date | 2015-04-02 |
United States Patent
Application |
20150093417 |
Kind Code |
A1 |
de Fougerolles; Antonin ; et
al. |
April 2, 2015 |
Compositions And Methods For Inhibiting Expression Of CD45 Gene
Abstract
The invention relates to a double-stranded ribonucleic acid
(dsRNA) for inhibiting the expression of the CD45 gene.
Inventors: |
de Fougerolles; Antonin;
(Brookline, MA) ; Tan; Pamela; (Kulmbach, DE)
; Borodovsky; Anna; (Cambridge, MA) ;
Novobrantseva; Tatiana; (Wellesley, MA) ; Bavari;
Sina; (Frederick, MD) ; Warfield; Kelly Lynn;
(Adamstown, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ALNYLAM PHARMACEUTICALS, INC.
UNITED STATES ARMY |
CAMBRIDGE
FREDERICK |
MA
MD |
US
US |
|
|
Family ID: |
41265242 |
Appl. No.: |
14/558456 |
Filed: |
December 2, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13612521 |
Sep 12, 2012 |
8912316 |
|
|
14558456 |
|
|
|
|
12867230 |
Oct 27, 2010 |
8288525 |
|
|
PCT/US2009/033931 |
Feb 12, 2009 |
|
|
|
13612521 |
|
|
|
|
61028162 |
Feb 12, 2008 |
|
|
|
Current U.S.
Class: |
424/278.1 ;
435/320.1; 435/325; 435/355; 435/375; 536/24.5 |
Current CPC
Class: |
A61P 37/02 20180101;
A61P 25/00 20180101; A61P 31/14 20180101; C12N 2310/17 20130101;
A61P 37/00 20180101; A61P 31/16 20180101; C12N 15/1138 20130101;
A61P 31/20 20180101; C12N 2310/113 20130101; C12N 2310/315
20130101; A61P 31/12 20180101; C12N 2310/321 20130101; C12N
2310/3521 20130101; C12N 2310/321 20130101; C12N 2310/3515
20130101; C12N 2310/14 20130101; C12N 15/1137 20130101 |
Class at
Publication: |
424/278.1 ;
536/24.5; 435/325; 435/375; 435/320.1; 435/355 |
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Goverment Interests
GOVERNMENT SUPPORT
[0003] This invention was made with government support under
HDTRA1-07-C-0082 awarded by the Defense/Defense Threat Reduction
Agency, and HHSN266200600012C awarded by the Department of Health
and Human Services/NIH/NAIAD. The government has certain rights in
the invention.
Claims
1. An isolated double-stranded ribonucleic acid (dsRNA), wherein
said dsRNA comprises a sense strand and an antisense strand that
are substantially complementary to each other and are each 15-30
nucleotides in length, and the antisense strand comprising a region
of complementarity that is substantially complementary to an mRNA
encoding a CD45.
2. The dsRNA of claim 1, wherein said dsRNA, upon contact with a
cell expressing said CD45, inhibits expression of said CD45 by at
least 20%.
3. The dsRNA of claim 1, wherein said dsRNA comprises at least one
modified nucleotide.
4. The dsRNA of claim 3, wherein said modified nucleotide is chosen
from the group consisting of: a 2'-O-methyl modified nucleotide, a
nucleotide comprising a 5'-phosphorothioate group, and a terminal
nucleotide linked to a cholesteryl derivative or dodecanoic acid
bisdecylamide group.
5. The dsRNA of claim 3, wherein said modified nucleotide is chosen
from the group consisting of: a 2'-deoxy-2'-fluoro modified
nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an
abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified
nucleotide, morpholino nucleotide, a phosphoramidate, and a
non-natural base comprising nucleotide.
6. The dsRNA of claim 1, wherein said region of complementarity is
at least 15 nucleotides in length.
7. The dsRNA of claim 1, wherein said region of complementarity is
19-24 nucleotides in length.
8. The dsRNA of claim 1, wherein said dsRNA, upon contact with a
cell expressing CD45, inhibits expression of CD45 by at least 20%
as measured in the P388D1 cell assay.
9. The dsRNA of claim 1, wherein said region of complementarity is
complementary to at least 15 contiguous nucleotides of one of SEQ
ID NOS:97-144.
10. A cell comprising the dsRNA of claim 1.
11. A pharmaceutical composition comprising the dsRNA of claim 1,
and a pharmaceutically acceptable carrier.
12. The pharmaceutical composition of claim 11, wherein said dsRNA,
upon contact with a cell expressing said CD45 gene, inhibits
expression of said CD45 gene by at least 20%, as measured in a
P388D1 cell assay.
13. A method for inhibiting expression of a CD45 gene in a cell,
the method comprising: (a) introducing into the cell the dsRNA of
claim 1; and (b) maintaining the cell produced in step (a) for a
time sufficient to obtain degradation of an mRNA transcript of the
CD45 gene, thereby inhibiting expression of the CD45 gene in the
cell.
14. The method of claim 13, wherein the cell produced in step (a)
is maintained for a time sufficient inhibit expression expression
of the CD45 gene by 20%.
15. A method of treating or managing an autoimmune disease
comprising administering to a patient in need of such treatment or
management a effective amount of the dsRNA of claim 1.
16. The method of claim 15, wherein the autoimmune disease is
Graves' disease or multiple sclerosis.
17. A method of treating or managing a viral infection comprising
administering to a patient in need of such treatment or management
a therapeutically effective amount of the dsRNA of claim 1.
18. The method of claim 17, wherein the infection is caused by a
virus of the group consisting of Ebola, influenza, anthrax,
hepatitis B and hepatitis C.
19. A vector for inhibiting the expression of a CD45 gene in a
cell, said vector comprising a regulatory sequence operably linked
to a nucleotide sequence that encodes at least one strand of the
dsRNA of claim 1.
20. A cell comprising the vector of claim 19.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 13/612,521 filed Sep. 12, 2012, (allowed), which is a
continuation of U.S. application Ser. No. 12/867,230, now U.S. Pat.
No. 8,288,525, issued Oct. 16, 2012, which is the National Stage of
International Application No. PCT/US2009/033931, filed Feb. 12,
2009, all which claim the benefit of U.S. Provisional Application
No. 61/028,162, filed Feb. 12, 2008. The entire contents of these
applications are hereby incorporated by reference in the present
application.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted via EFS-Web and is hereby incorporated by
reference in its entirety. Said ASCII copy, created on Nov. 7,
2014, is named 28122US_CRF_sequencelisting.txt and is 126,484 bytes
in size.
FIELD OF THE INVENTION
[0004] This invention relates to double-stranded ribonucleic acid
(dsRNA), and its use in mediating RNA interference to inhibit the
expression of the CD45 gene and the use of the dsRNA to treat
infectious diseases and autoimmune disease.
BACKGROUND OF THE INVENTION
[0005] CD45 is a hematopoietic cell-specific transmembrane protein
tyrosine phosphatase essential for T and B cell antigen
receptor-mediated signaling and also plays a important role in
cytokine receptor signaling, chemokine and cytokine response and
apoptosis regulation in multiple different leukocyte cell subsets
(T cells, B cells, NK cells, myeloid cells, granulocytes, and
dendritic cells). CD45 constitutes nearly 10% of T and B cell
surface protein. The protein includes a large extracellular domain,
and a phosphatase containing cytosolic domain. CD45 may act as both
a positive and negative regulator depending on the nature of the
stimulus and the cell type involved. CD45 RNA transcripts are
alternatively spliced at the N-terminus, which results in
extracellular domains of various sizes. The protein controls the
activity of Src-family kinases, which if left unregulated, can
cause cancer and autoimmunity. Mice and humans lacking CD45
expression have been shown to be immunodeficient.
[0006] Multiple human or rodent mutations that result in altered
CD45 expression or functional activity are associated with distinct
malignancies, including autoimmunity, immunodeficiency, overt
activation of T cells, susceptibility to infection, type I or type
II associated immune disorders, and haemotologic malignancies
(reviewed in Tchilian and Beverly, Trends in Immunology, 2006).
[0007] Double-stranded RNA molecules (dsRNA) have been shown to
block gene expression in a highly conserved regulatory mechanism
known as RNA interference (RNAi). WO 99/32619 (Fire et al.)
discloses the use of a dsRNA of at least 25 nucleotides in length
to inhibit the expression of the unc-22 gene in C. elegans. dsRNA
has also been shown to degrade target RNA in other organisms,
including plants (see, e.g., WO 99/53050, Waterhouse et al.; and WO
99/61631, Heifetz et al.), Drosophila (see, e.g., Yang, D., et al.,
Curr. Biol. (2000) 10:1191-1200), and mammals (see WO 00/44895,
Limmer; and DE 101 00 586.5, Kreutzer et al.).
SUMMARY OF THE INVENTION
[0008] The invention provides double-stranded ribonucleic acid
(dsRNA), as well as compositions and methods for inhibiting the
expression of the CD45 gene in a cell or mammal using such dsRNA.
The invention also provides compositions and methods for treating
pathological conditions and diseases caused by the expression of
the CD45 gene, such as infectious disease and autoimmune disease.
The dsRNA featured in the invention includes an RNA strand (the
antisense strand) having a region which is less than 30 nucleotides
in length, generally 19-24 nucleotides in length, and which is
substantially complementary or fully complementary to the
corresponding region of an mRNA transcript of the CD45 gene.
[0009] In one aspect, the invention features, double-stranded
ribonucleic acid (dsRNA) molecules for inhibiting the expression of
the CD45 gene. The dsRNA includes at least two sequences that are
complementary, e.g., substantially or fully complementary, to each
other. The dsRNA includes a sense strand including a first sequence
and an antisense strand including a second sequence. The antisense
strand includes a nucleotide sequence which is substantially or
fully complementary to the corresponding region of an mRNA encoding
CD45, and the region of complementarity is less than 30 nucleotides
in length, generally 19-24 nucleotides in length, e.g., 19 to 21
nucleotides in length. In some embodiments, the dsRNA is from about
10 to about 15 nucleotides, and in other embodiments the dsRNA is
from about 25 to about 30 nucleotides in length. In another
embodiment, the dsRNA is at least 15 nucleotides in length. The
dsRNA, upon contacting with a cell expressing the CD45, e.g., in an
assay described herein, e.g., in a P388D1 cell assay as described
herein (or an assay based on a cell with similar properties),
inhibits the expression of the CD45 gene by at least 20% or 25%,
and preferably by at least 35%, or preferably by at least 40%. In
one embodiment, the CD45 dsRNA is formulated in a stable nucleic
acid particle (SNALP).
[0010] The dsRNA molecules featured in the invention include dsRNAs
that cleave a CD45 mRNA in a target sequence selected from the
group consisting of SEQ ID NOs:97-144. The dsRNAs featured herein
also include dsRNAs having a first sequence selected from the group
consisting of the sense sequences of Tables 2, 4 and 5, and a
second sequence selected from the group consisting of the antisense
sequences of Tables 2, 4 and 5. The dsRNA molecules featured in the
invention can include naturally occurring nucleotides or can
included at least one modified nucleotide, such as a 2'-O-methyl
modified nucleotide, a nucleotide including a 5'-phosphorothioate
group, and a terminal nucleotide linked to a cholesteryl derivative
or dodecanoic acid bisdecylamide group. Alternatively, the modified
nucleotide may be chosen from the group of: a 2'-deoxy-2'-fluoro
modified nucleotide, a 2'-deoxy-modified nucleotide, a locked
nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide,
2'-alkyl-modified nucleotide, morpholino nucleotide, a
phosphoramidate, and a non-natural base comprising nucleotide.
Generally, the first sequence of the dsRNA is selected from the
group consisting of the sense sequences of Tables 2, 4 and 5, and
the second sequence is selected from the group consisting of the
antisense sequences of Tables 2, 4 and 5.
[0011] In another aspect, the invention provides a cell including a
dsRNA targeting CD45. The cell can be a mammalian cell, such as a
human cell.
[0012] In another aspect, the invention features a pharmaceutical
composition containing a dsRNA, such as a dsRNA described herein,
e.g., in Tables 2, 4 and 5, and a pharmaceutically acceptable
carrier. In one embodiment, the pharmaceutical composition does not
include another agent that silences gene expression. In another
embodiment, the pharmaceutical composition does not include another
dsRNA, e.g., a dsRNA of a length or overhang structure described
herein. In another embodiment, the pharmaceutical composition
consists of or consists essentially of the subject dsRNA. In
another embodiment, the pharmaceutical composition includes more
than one dsRNA. In yet other embodiments, the pharmaceutical
composition includes more than one but not more than 2, 3 or 4
dsRNAs.
[0013] In another aspect, the invention provides a method for
inhibiting the expression of the CD45 gene in a cell, including the
following steps: [0014] (a) introducing into the cell a
double-stranded ribonucleic acid (dsRNA), e.g., a dsRNA described
herein, e.g., a dsRNA that cleaves a CD45 mRNA in a target sequence
selected from the group consisting of SEQ ID NOs:97-144, wherein
the dsRNA includes at least two sequences that are complementary,
e.g., substantially or fully complementary, to each other. The
dsRNA includes a sense strand including a first sequence and an
antisense strand including a second sequence. The antisense strand
includes a region of complementarity which is substantially or
fully complementary to the corresponding region of an mRNA encoding
CD45, and wherein the region of complementarity is less than 30
nucleotides in length, generally 19-24 nucleotides in length, and
preferably, wherein the dsRNA, upon contact with a cell expressing
the CD45, inhibits expression of the CD45 gene by at least 20%, at
least 25%, or at least 40%; and [0015] (b) maintaining the cell
produced in step (a) for a time sufficient to obtain degradation of
the mRNA transcript of the CD45 gene, thereby inhibiting expression
of the CD45 gene in the cell.
[0016] In another aspect, the invention provides methods for
treating, preventing or managing infectious disease by
administering to a patient in need of such treatment, prevention or
management a therapeutically or prophylactically effective amount
of one or more of the CD45 dsRNAs featured in the invention.
[0017] In another aspect, the invention provides methods for
treating, preventing or managing autoimmune disease, including
administering to a patient in need of such treatment, prevention or
management a therapeutically or prophylactically effective amount
of one or more of the CD45 dsRNAs featured in the invention.
[0018] In another aspect, the invention provides methods for
treating, preventing or managing inflammation, including
administering to a patient in need of such treatment, prevention or
management a therapeutically or prophylactically effective amount
of one or more of the CD45 dsRNAs featured in the invention.
[0019] In another aspect, the invention provides methods for
treating, preventing or managing a viral infection, including
administering to a patient in need of such treatment, prevention or
management a therapeutically or prophylactically effective amount
of one or more of the CD45 dsRNAs featured in the invention.
[0020] In another aspect, the invention provides vectors for
inhibiting the expression of the CD45 gene in a cell, including a
regulatory sequence operably linked to a nucleotide sequence that
encodes at least one strand of one of the dsRNAs featured in the
invention.
[0021] In another aspect, the invention provides a cell including a
vector for inhibiting the expression of the CD45 gene in a cell.
The vector includes a regulatory sequence operably linked to a
nucleotide sequence that encodes at least one strand of one of the
CD45 dsRNAs featured in the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0022] FIGS. 1A and 1B are graphs showing that a lipid-formulated
dsRNA targeting CD45 delivered to mice intraperitoneally inhibited
protein expression of CD45 in vivo in peritoneal macrophages as
compared to an irreleveant similarly formulated dsRNA targeting
GFP. FIG. 1A demonstrates reduction in CD45 protein expression
following a single injection with 10 mg/kg formulated CD45 siRNA as
compared to saline or irrelevant siRNA. FIG. 1B shows two
independent dose response experiments demonstrating that
substantial reduction in CD45 expression is seen in vivo following
a single injection of 0.6-15 mg/kg formulated CD45 siRNA relative
to irrelevant siRNA.
[0023] FIG. 2 is a bar graph showing in vitro RNAi-mediated
silencing of CD45 in primary mouse bone-marrow derived monocytes
using a lipodoid formulation.
[0024] FIG. 3 is a graph showing that genetically modified mice
expressing different levels of CD45 are protected from
30,000.times.LD50 Ebola-Zaire virus challenge.
[0025] FIG. 4 is a bar graph showing in vitro RNAi-mediated
silencing of CD45 in KG1, a human leukemia cell line using a
lipodoid formulation.
[0026] FIGS. 5A and 5B illustrate the sequence of human CD45 cDNA
(SEQ ID NO: 339) as recorded at GenBank Accession No.
NM.sub.--002838.2 (version dated Jan. 13, 2008).
[0027] FIGS. 6A and 6B illustrate the sequence of mouse CD45 cDNA
(SEQ ID NO: 340) as recorded at GenBank Accession No.
NM.sub.--011210 (version dated Jan. 27, 2008).
[0028] FIGS. 7A and 7B illustrate the sequence of rhesus CD45 cDNA
(SEQ ID NO: 341) as recorded at GenBank Accession No.
XR.sub.--012672.1 (version dated Jun. 14, 2006).
DETAILED DESCRIPTION OF THE INVENTION
[0029] The invention provides double-stranded ribonucleic acid
(dsRNA), as well as compositions and methods for inhibiting the
expression of the CD45 gene in a cell or mammal using the dsRNA.
The invention also provides compositions and methods for treating
pathological conditions and diseases in a mammal caused by the
expression of the CD45 gene using dsRNA. dsRNA directs the
sequence-specific degradation of mRNA through a process known as
RNA interference (RNAi). The process occurs in a wide variety of
organisms, including mammals and other vertebrates.
[0030] The dsRNAs featured in the invention includes an RNA strand
(the antisense strand) having a region which is less than 30
nucleotides in length, generally 19-24 nucleotides in length, and
is substantially or fully complementary to at least part of an mRNA
transcript of the CD45 gene. The use of these dsRNAs enables the
targeted degradation of mRNAs of genes that are implicated in
autoimmunity and infectious disease in mammals. Using cell-based
and animal assays, the present inventors have demonstrated that
very low dosages of these dsRNA can specifically and efficiently
mediate RNAi, resulting in significant inhibition of expression of
the CD45 gene. Thus, the methods and compositions featured in the
invention including these dsRNAs are useful for treating
autoimmunity and infectious disease.
[0031] The following detailed description discloses how to make and
use the dsRNA and compositions containing dsRNA to inhibit the
expression of a target CD45 gene, as well as compositions and
methods for treating diseases and disorders caused by the
expression of CD45, such as an infectious disease or autoimmune
disease. The pharmaceutical compositions featured in the invention
include a dsRNA having an antisense strand having a region of
complementarity which is less than 30 nucleotides in length,
generally 19-24 nucleotides in length, and is substantially
complementary to at least part of an RNA transcript of the CD45
gene, together with a pharmaceutically acceptable carrier.
[0032] Accordingly, certain aspects featured in the invention
provide pharmaceutical compositions including a dsRNA targeting
CD45 together with a pharmaceutically acceptable carrier, methods
of using the compositions to inhibit expression of the CD45 gene,
and methods of using the pharmaceutical compositions to treat
diseases caused by expression of the CD45 gene.
I. DEFINITIONS
[0033] For convenience, the meaning of certain terms and phrases
used in the specification, examples, and appended claims, are
provided below. If there is an apparent discrepancy between the
usage of a term in other parts of this specification and its
definition provided in this section, the definition in this section
shall prevail.
[0034] "G," "C," "A," "T" and "U" each generally stand for a
nucleotide that contains guanine, cytosine, adenine, thymidine and
uracil as a base, respectively. However, it will be understood that
the term "ribonucleotide" or "nucleotide" can also refer to a
modified nucleotide, as further detailed below, or a surrogate
replacement moiety. The skilled person is well aware that guanine,
cytosine, adenine, thymidine and uracil may be replaced by other
moieties without substantially altering the base pairing properties
of an oligonucleotide including a nucleotide bearing such
replacement moiety. For example, without limitation, a nucleotide
including inosine as its base may base pair with nucleotides
containing adenine, cytosine, or uracil. Hence, nucleotides
containing uracil, guanine, or adenine may be replaced in the
dsRNAs featured in the invention by a nucleotide containing, for
example, inosine. In another example, adenine and cytosine anywhere
in the oligonucleotide can be replaced with guanine and uracil,
respectively to form G-U Wobble base pairing with the target mRNA.
Sequences including such replacement moieties are embodiments
featured in the invention.
[0035] By "CD45" as used herein is meant a CD45 mRNA, protein,
peptide, or polypeptide. The term "CD45" is also known in the art
as PTPRC (protein tyrosine phosphatase, receptor type, C), B220,
GP180, LCA, LY5, and T200. The sequence of human CD45 cDNA is
recorded at GenBank Accession No. NM.sub.--002838.2 (version dated
Jan. 13, 2008) (see FIGS. 5A and 5B). Other human CD45 sequences
are recorded at GenBank Accession Nos. NM.sub.--080921.2,
NM.sub.--080922.2, NM.sub.--080923.2, Y00062.1, Y00638.1,
BC014239.2, BC017863.1, BC031525.1, BC121086.1, BC121087.1,
BC127656.1, BC127657.1, AY429565.1, AY567999.1, AK130573.1,
DA670254.1, DA948670.1, AY429566.1, and CR621867.1. Mouse CD45 mRNA
sequences are found at GenBank Accession Nos. NM.sub.--011210.2,
AK054056.1, AK088215.1, AK154893.1, AK171802.1, BC028512.1,
EF101553.1, L36091.1, M11934.1, M14342.1, M14343.1, M15174.1,
M17320.1, and M92933.1. Rhesus monkey CD45 mRNA sequence are found
at GenBank Accession No. XR.sub.--012672.1.
[0036] As used herein, "target sequence" refers to a contiguous
portion of the nucleotide sequence of an mRNA molecule formed
during the transcription of the CD45 gene, including mRNA that is a
product of RNA processing of a primary transcription product.
[0037] As used herein, the term "strand including a sequence"
refers to an oligonucleotide including a chain of nucleotides that
is described by the sequence referred to using the standard
nucleotide nomenclature.
[0038] The terms "complementary", "fully complementary" and
"substantially complementary" herein may be used with respect to
the base matching between the sense strand and the antisense strand
of a dsRNA, or between the antisense strand of a dsRNA and a target
sequence, as will be understood from the context of their use.
[0039] As used herein, and unless otherwise indicated, the term
"complementary," when used to describe a first nucleotide sequence
in relation to a second nucleotide sequence, refers to the ability
of an oligonucleotide or polynucleotide including the first
nucleotide sequence to hybridize and form a duplex structure under
certain conditions with an oligonucleotide or polynucleotide
including the second nucleotide sequence, as will be understood by
the skilled person. Complimentary includes both fully complimentary
and substantially complimentary states. Fully complimentary means
comlimentarity at each nucleotide pair of to compared sequences,
e.g., an antisence strand and the corresponding portion of a target
mRNA. For substantial complementarity, such conditions can, for
example, be stringent conditions, where stringent conditions may
include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C.
or 70.degree. C. for 12-16 hours followed by washing. Other
conditions, such as physiologically relevant conditions as may be
encountered inside an organism, can apply. The skilled person will
be able to determine the set of conditions most appropriate for a
test of complementarity of two sequences in accordance with the
ultimate application of the hybridized nucleotides. In other
embodiments, substantial complimentarity can mean not more than 4,
3 or 2 mismatched base pairs upon hybridization, while retaining
the ability to hybridize under the conditions most relevant to
their ultimate application. Where two oligonucleotides are designed
to form, upon hybridization, one or more single stranded overhangs,
such overhangs shall not be regarded as mismatches with regard to
the determination of complementarity. For example, a dsRNA
including one oligonucleotide 21 nucleotides in length and another
oligonucleotide 23 nucleotides in length, wherein the longer
oligonucleotide includes a sequence of 21 nucleotides that is fully
complementary to the shorter oligonucleotide, may yet be referred
to as "fully complementary" for the purposes of the invention.
[0040] "Complementary" sequences, as used herein, may also include,
or be formed entirely from, non-Watson-Crick base pairs and/or base
pairs formed from non-natural and modified nucleotides, in as far
as the above requirements with respect to their ability to
hybridize are fulfilled. Such non-Watson-Crick base pairs includes,
but not limited to, G:U Wobble or Hoogstein base pairing.
[0041] As used herein, a polynucleotide which is "substantially
complementary to at least part of" a messenger RNA (mRNA) refers to
a polynucleotide which is substantially complementary to a
contiguous portion of the mRNA of interest (e.g., encoding CD45).
For example, a polynucleotide is complementary to at least a part
of a CD45 mRNA if the sequence is substantially complementary to a
non-interrupted portion of an mRNA encoding CD45.
[0042] The term "double-stranded RNA" or "dsRNA", as used herein,
refers to a ribonucleic acid molecule, or complex of ribonucleic
acid molecules, having a duplex structure including two
anti-parallel and substantially complementary, as defined above,
nucleic acid strands. The two strands forming the duplex structure
may be different portions of one larger RNA molecule, or they may
be separate RNA molecules. Where the two strands are part of one
larger molecule, and therefore are connected by an uninterrupted
chain of nucleotides between the 3'-end of one strand and the 5'
end of the respective other strand forming the duplex structure,
the connecting RNA chain is referred to as a "hairpin loop". Where
the two strands are connected covalently by means other than an
uninterrupted chain of nucleotides between the 3'-end of one strand
and the 5' end of the respective other strand forming the duplex
structure, the connecting structure is referred to as a "linker."
The RNA strands may have the same or a different number of
nucleotides. The maximum number of base pairs is the number of
nucleotides in the shortest strand of the dsRNA. In addition to the
duplex structure, a dsRNA may comprise one or more nucleotide
overhangs. A dsRNA as used herein is also referred to as a "small
inhibitory RNA" or "siRNA."
[0043] As used herein, a "nucleotide overhang" refers to the
unpaired nucleotide or nucleotides that protrude from the duplex
structure of a dsRNA when a 3'-end of one strand of the dsRNA
extends beyond the 5'-end of the other strand, or vice versa.
"Blunt" or "blunt end" means that there are no unpaired nucleotides
at that end of the dsRNA, i.e., no nucleotide overhang. A "blunt
ended" dsRNA is a dsRNA that is double-stranded over its entire
length, i.e., no nucleotide overhang at either end of the
molecule.
[0044] The term "antisense strand" refers to the strand of a dsRNA
which includes a region that is substantially complementary to the
corresponding sequence of a target sequence. As used herein, the
term "region of complementarity" refers to the region on the
antisense strand that is substantially complementary to a sequence,
for example a target sequence, as defined herein. Where the region
of complementarity is not fully complementary to the target
sequence, the mismatches may be in the internal or terminal regions
of the molecule. Generally, the most tolerated mismatches are in
the terminal regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of
the 5' and/or 3' terminus.
[0045] The term "sense strand," as used herein, refers to the
strand of a dsRNA that includes a region that is substantially
complementary to a region of the antisense strand.
[0046] The term "identity" is the relationship between two or more
polynucleotide sequences, as determined by comparing the sequences.
Identity also means the degree of sequence relatedness between
polynucleotide sequences, as determined by the match between
strings of such sequences. While there exist a number of methods to
measure identity between two polynucleotide sequences, the term is
well known to skilled artisans (see, e.g., Sequence Analysis in
Molecular Biology, von Heinje, G., Academic Press (1987); and
Sequence Analysis Primer, Gribskov., M. and Devereux, J., eds., M.
Stockton Press, New York (1991)). "Substantially identical," as
used herein, means there is a very high degree of homology
(preferably 100% sequence identity) between the sense strand of the
dsRNA and the corresponding part of the target gene. However, dsRNA
having greater than 90% or 95% sequence identity may be used in the
present invention, and thus sequence variations that might be
expected due to genetic mutation, strain polymorphism, or
evolutionary divergence can be tolerated. Although 100% identity is
typical, the dsRNA may contain single or multiple base-pair random
mismatches between the RNA and the target gene.
[0047] As used herein, the term "SNALP" refers to a stable nucleic
acid-lipid particle. A SNALP represents a vesicle of lipids coating
a reduced aqueous interior comprising a nucleic acid such as an
iRNA agent or a plasmid from which an iRNA agent is transcribed.
SNALPs are described, e.g., in U.S. Patent Application Publication
Nos. 20060240093, 20070135372, and U.S. Ser. No. 61/045,228 filed
Apr. 15, 2008. These applications are hereby incorporated by
reference.
[0048] "Introducing into a cell," when referring to a dsRNA, means
facilitating uptake or absorption into the cell, as is understood
by those skilled in the art. Absorption or uptake of dsRNA can
occur through unaided diffusive or active cellular processes, or by
auxiliary agents or devices. The meaning of this term is not
limited to cells in vitro; a dsRNA may also be "introduced into a
cell," wherein the cell is part of a living organism. In such
instance, introduction into the cell will include the delivery to
the organism. For example, for in vivo delivery, dsRNA can be
injected into a tissue site or administered systemically. In vivo
delivery can also be by a beta-glucan delivery system, such as
those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S.
Publication No. 2005/0281781. U.S. Pat. Nos. 5,032,401 and
5,607,677, and U.S. Publication No. 2005/0281781 are hereby
incorporated by reference in their entirety. In vitro introduction
into a cell includes methods known in the art such as
electroporation and lipofection.
[0049] The terms "silence" and "inhibit the expression of,"
"down-regulate the expression of," "suppress the expression of,"
and the like, in as far as they refer to the CD45 gene, herein
refer to the at least partial suppression of the expression of the
CD45 gene, as manifested by a reduction of the amount of CD45 mRNA,
which may be isolated from a first cell or group of cells in which
the CD45 gene is transcribed, and which has or have been treated
such that the expression of the CD45 gene is inhibited, as compared
to a second cell or group of cells substantially identical to the
first cell or group of cells but which has or have not been so
treated (control cells). The degree of inhibition is usually
expressed in terms of
( mRNA in control cells ) - ( mRNA in treated cells ) ( mRNA in
control cells ) 100 % ##EQU00001##
[0050] Alternatively, the degree of inhibition may be given in
terms of a reduction of a parameter that is functionally linked to
CD45 gene expression, e.g. the amount of protein encoded by the
CD45 gene which is present on the cell surface, or the number of
cells displaying a certain phenotype, e.g apoptosis. In principle,
CD45 gene silencing may be determined in any cell expressing the
CD45, either constitutively or by genomic engineering, and by any
appropriate assay. However, when a reference is needed in order to
determine whether a given siRNA inhibits the expression of the CD45
gene by a certain degree and therefore is encompassed by the
instant invention, the assays provided in the Examples below shall
serve as such reference.
[0051] For example, in certain instances, expression of the CD45
gene is suppressed by at least about 20%, 25%, 30%, 35%, 40%, 45%,
or 50% by administration of the double-stranded oligonucleotide
featured in the invention. In one embodiment, the CD45 gene is
suppressed by at least about 50%, 60%, or 70% by administration of
the double-stranded oligonucleotide featured in the invention. In
another embodiment, the CD45 gene is suppressed by at least about
75%, 80%, 90% or 95% by administration of the double-stranded
oligonucleotide featured in the invention.
[0052] The terms "treat," "treatment," and the like, refer to
relief from or alleviation of an infectious disease or an
autoimmune disease. In the context of the present invention insofar
as it relates to any of the other conditions recited herein below
(e.g., a CD45-mediated condition other than an infectious disease
or autoimmune disease), the terms "treat," "treatment," and the
like mean to relieve or alleviate at least one symptom associated
with such condition, or to slow or reverse the progression of such
condition.
[0053] As used herein, the term "CD45-mediated condition or
disease" and related terms and phrases refer to a condition or
disorder characterized by inappropriate, e.g., greater than normal,
CD45 activity. Inappropriate CD45 functional activity might arise
as the result of CD45 expression in cells which normally do not
express CD45 or increased CD45 expression (leading to, e.g.,
autoimmune disease). A CD45-mediated condition or disease may be
completely or partially mediated by inappropriate CD45 functional
activity. However, a CD45-mediated condition or disease is one in
which modulation of CD45 results in some effect on the underlying
condition or disorder (e.g., a CD45 inhibitor results in some
improvement in patient well-being in at least some patients).
[0054] As used herein, the phrases "therapeutically effective
amount" and "prophylactically effective amount" refer to an amount
that provides a therapeutic benefit in the treatment, prevention,
or management of an infectious disease or an overt symptom of
infection, or an autoimmune disease. The specific amount that is
therapeutically effective can be readily determined by ordinary
medical practitioner, and may vary depending on factors known in
the art, such as, e.g. the type of infection or autoimmune disease,
the patient's history and age, the stage of the disease, and the
administration of other agents.
[0055] As used herein, a "pharmaceutical composition" includes a
pharmacologically effective amount of a dsRNA and a
pharmaceutically acceptable carrier. As used herein,
"pharmacologically effective amount," "therapeutically effective
amount" or simply "effective amount" refers to that amount of a RNA
effective to produce the intended pharmacological, therapeutic or
preventive result. For example, if a given clinical treatment is
considered effective when there is at least a 25% reduction in a
measurable parameter associated with a disease or disorder, a
therapeutically effective amount of a drug for the treatment of
that disease or disorder is the amount necessary to effect at least
a 25% reduction in that parameter.
[0056] The term "pharmaceutically acceptable carrier" refers to a
carrier for administration of a therapeutic agent. Such carriers
include, but are not limited to, saline, buffered saline, dextrose,
water, glycerol, ethanol, and combinations thereof. The term
specifically excludes cell culture medium. For drugs administered
orally, pharmaceutically acceptable carriers include, but are not
limited to pharmaceutically acceptable excipients such as inert
diluents, disintegrating agents, binding agents, lubricating
agents, sweetening agents, flavoring agents, coloring agents and
preservatives. Suitable inert diluents include sodium and calcium
carbonate, sodium and calcium phosphate, and lactose, while corn
starch and alginic acid are suitable disintegrating agents. Binding
agents may include starch and gelatin, while the lubricating agent,
if present, will generally be magnesium stearate, stearic acid or
talc. If desired, the tablets may be coated with a material such as
glyceryl monostearate or glyceryl distearate, to delay absorption
in the gastrointestinal tract.
[0057] As used herein, a "transformed cell" is a cell into which a
vector has been introduced from which a dsRNA molecule may be
expressed.
II. DOUBLE-STRANDED RIBONUCLEIC ACID (DSRNA)
[0058] In one embodiment, the invention provides double-stranded
ribonucleic acid (dsRNA) molecules for inhibiting the expression of
the CD45 gene in a cell or mammal. The dsRNA includes an antisense
strand including a region of complementarity which is complementary
to the corresponding region of an mRNA formed in the expression of
the CD45 gene, and wherein the region of complementarity is less
than 30 nucleotides in length, generally 19-24 nucleotides in
length. In another embodiment the dsRNA, upon contact with a cell
expressing said CD45 gene, inhibits the expression of said CD45
gene, e.g., in an assay described herein, e.g., in a P388D1 cell
assay (or an assay based on a similar cell) as described herein, by
at least 20%, or preferably by at least 40%. The dsRNA includes two
RNA strands that are sufficiently complementary to hybridize to
form a duplex structure. The sense strand includes a region which
is complementary to the antisense strand, such that the two strands
hybridize and form a duplex structure when combined under suitable
conditions. Generally, the duplex structure is between 15 and 30,
more generally between 18 and 25, yet more generally between 19 and
24, and most generally between 21 and 23 base pairs in length.
Similarly, the region of complementarity to the target sequence is
between 15 and 30, more generally between 18 and 25, yet more
generally between 19 and 24, and most generally between 19 and 21
nucleotides in length. In some embodiments, the dsRNA is between 10
and 15 nucleotides in length, and in other embodiments, the dsRNA
is between 25 and 30 nucleotides in length. The dsRNA featured in
the invention may further include one or more single-stranded
nucleotide overhang(s).
[0059] The dsRNA can be synthesized by standard methods known in
the art as further discussed below, e.g., by use of an automated
DNA synthesizer, such as are commercially available from, for
example, Biosearch, Applied Biosystems, Inc. In one embodiment, the
CD45 gene is the human CD45 gene. In some embodiments, the
antisense strand of the dsRNA includes a sense sequence from Tables
2, 4 and 5, and the sense strand of the dsRNA includes a sense
sequence from Tables 2, 4 and 5.
[0060] In other embodiments, the dsRNA includes at least one
nucleotide sequence selected from the groups of sequences provided
in Tables 2, 4 and 5. In other embodiments, the dsRNA includes at
least two sequences selected from this group, wherein one of the at
least two sequences is complementary to another of the at least two
sequences, and one of the at least two sequences is substantially
complementary to a sequence of an mRNA generated in the expression
of the CD45 gene. Generally, the dsRNA includes two
oligonucleotides, wherein one oligonucleotide is described as a
sense strand in Tables 2, 4, or 5, and the second oligonucleotide
is described as an antisense strand in Tables 2, 4 or 5.
[0061] The skilled person is well aware that dsRNAs including a
duplex structure of between 20 and 23, but specifically 21, base
pairs have been identified as particularly effective in inducing
RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888).
However, others have found that shorter or longer dsRNAs can be
effective as well. In the embodiments described above, by virtue of
the nature of the oligonucleotide sequences provided in Tables 2,
4, or 5, the dsRNAs featured in the invention can include at least
one strand of a length of minimally 21 nt. It can be reasonably
expected that shorter dsRNAs including one of the sequences of
Table 2, 4 or 5, minus only a few nucleotides on one or both ends
may be similarly effective as compared to the dsRNAs described
above. Hence, dsRNAs including a partial sequence of at least 15,
16, 17, 18, 19, 20, or more contiguous nucleotides from one of the
sequences of Table 2, 4 or 5, and differing in their ability to
inhibit the expression of the CD45 gene in a FACS assay as
described herein below by not more than 5, 10, 15, 20, 25, or 30%
inhibition from a dsRNA including the full sequence, are
contemplated by the invention.
[0062] In addition, the dsRNA agents provided in Tables 2, 4 and 5
identify sites in the CD45 mRNA that are susceptible to RNAi based
cleavage. As such, the invention further includes dsRNAs that
target within the sequence targeted by one of the agents featured
in the present invention. As used herein, a second dsRNA is said to
target within the sequence of a first dsRNA if the second dsRNA
cleaves the message anywhere within the mRNA that is complementary
to the antisense strand of the first dsRNA. Such a second agent
will generally consist of at least 15 contiguous nucleotides from
one of the sequences provided in Tables 2, 4 and 5 coupled to
additional nucleotide sequences taken from the region contiguous to
the selected sequence in the CD45 gene.
[0063] The dsRNA featured in the invention can contain one or more
mismatches to the target sequence. In one embodiment, the dsRNA
targeting CD45 contains no more than 3 mismatches. If the antisense
strand of the dsRNA contains mismatches to a target sequence, it is
preferable that the area of mismatch not be located in the center
of the region of complementarity. If the antisense strand of the
dsRNA contains mismatches to the target sequence, it is preferable
that the mismatch be restricted to 5 nucleotides from either end,
for example 5, 4, 3, 2, or 1 nucleotide from either the 5' or 3'
end of the region of complementarity. For example, for a 23
nucleotide dsRNA strand which is complementary to a region of the
CD45 gene, the dsRNA generally does not contain any mismatch within
the central 13 nucleotides. The methods described within the
invention can be used to determine whether a dsRNA containing a
mismatch to a target sequence is effective in inhibiting the
expression of the CD45 gene. Consideration of the efficacy of
dsRNAs with mismatches in inhibiting expression of the CD45 gene is
important, especially if the particular region of complementarity
in the CD45 gene is known to have polymorphic sequence variation
within the population.
[0064] In one embodiment, at least one end of the dsRNA has a
single-stranded nucleotide overhang of 1 to 4, generally 1 or 2
nucleotides. dsRNAs having at least one nucleotide overhang have
unexpectedly superior inhibitory properties than their blunt-ended
counterparts. In one embodiment the presence of only one nucleotide
overhang strengthens the interference activity of the dsRNA,
without affecting its overall stability. dsRNA having only one
overhang has proven particularly stable and effective in vivo, as
well as in a variety of cells, cell culture mediums, blood, and
serum. Generally, the single-stranded overhang is located at the
3'-terminal end of the antisense strand or, alternatively, at the
3'-terminal end of the sense strand. The dsRNA may also have a
blunt end, generally located at the 5'-end of the antisense strand.
Such dsRNAs have improved stability and inhibitory activity, thus
allowing administration at low dosages, i.e., less than 5 mg/kg
body weight of the recipient per day. In one embodiment, the
antisense strand of the dsRNA has a 1-10 nucleotide overhang at the
3' end and/or the 5' end. In one embodiment, the sense strand of
the dsRNA has a 1-10 nucleotide overhang at the 3' end and/or the
5' end. In another embodiment, one or more of the nucleotides in
the overhang is replaced with a nucleoside thiophosphate.
[0065] In yet another embodiment, the dsRNA is chemically modified
to enhance stability. The nucleic acids featured in the invention
may be synthesized and/or modified by methods well established in
the art, such as those described in "Current protocols in nucleic
acid chemistry", Beaucage, S. L. et al. (Edrs.), John Wiley &
Sons, Inc., New York, N.Y., USA, which is hereby incorporated
herein by reference. Specific examples of dsRNA compounds useful in
this invention include dsRNAs containing modified backbones or no
natural internucleoside linkages. As defined in this specification,
dsRNAs having modified backbones include those that retain a
phosphorus atom in the backbone and those that do not have a
phosphorus atom in the backbone. For the purposes of this
specification, and as sometimes referenced in the art, modified
dsRNAs that do not have a phosphorus atom in their internucleoside
backbone can also be considered to be oligonucleosides.
[0066] Modified dsRNA backbones include, for example,
phosphorothioates, chiral phosphorothioates, phosphorodithioates,
phosphotriesters, aminoalkylphosphotriesters, methyl and other
alkyl phosphonates including 3'-alkylene phosphonates and chiral
phosphonates, phosphinates, phosphoramidates including 3'-amino
phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates having normal
3'-5' linkages, 2'-5' linked analogs of these, and those) having
inverted polarity wherein the adjacent pairs of nucleoside units
are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed
salts and free acid forms are also included.
[0067] Representative U.S. patents that teach the preparation of
the above phosphorus-containing linkages include, but are not
limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111;
5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is
herein incorporated by reference
[0068] Modified dsRNA backbones that do not include a phosphorus
atom therein have backbones that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or
cycloalkyl internucleoside linkages, or ore or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and
CH.sub.2 component parts.
[0069] Representative U.S. patents that teach the preparation of
the above oligonucleosides include, but are not limited to, U.S.
Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141;
5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
5,677,437; and, 5,677,439, each of which is herein incorporated by
reference.
[0070] In other dsRNA mimetics, both the sugar and the
internucleoside linkage, i.e., the backbone, of the nucleotide
units are replaced with novel groups. The base units are maintained
for hybridization with an appropriate nucleic acid target compound.
One such oligomeric compound, a dsRNA mimetic that has been shown
to have excellent hybridization properties, is referred to as a
peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of
a dsRNA is replaced with an amide containing backbone, in
particular an aminoethylglycine backbone. The nucleobases are
retained and are bound directly or indirectly to aza nitrogen atoms
of the amide portion of the backbone. Representative U.S. patents
that teach the preparation of PNA compounds include, but are not
limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262,
each of which is herein incorporated by reference. Further teaching
of PNA compounds can be found in Nielsen et al., Science, 1991,
254, 1497-1500.
[0071] Typical embodiments include dsRNAs with phosphorothioate
backbones and oligonucleosides with heteroatom backbones, and in
particular --CH.sub.2--NH--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above-referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above-referenced U.S. Pat. No. 5,602,240. Other
suitable dsRNAs have morpholino backbone structures of the
above-referenced U.S. Pat. No. 5,034,506.
[0072] Modified dsRNAs may also contain one or more substituted
sugar moieties. Typical dsRNAs include one of the following at the
2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-,
S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and
alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10
alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Other dsRNAs
include O[(CH.sub.2).sub.nO].sub.mCH.sub.3,
O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2,
O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. Other typical dsRNAs include one of the
following at the 2' position: C.sub.1 to C.sub.10 lower alkyl,
substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl,
SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3,
SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an dsRNA, or a group for improving
the pharmacodynamic properties of an dsRNA, and other substituents
having similar properties. In one embodiment, the modification
includes 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also
known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Hely.
Chim. Acta, 1995, 78, 486-504), i.e., an alkoxy-alkoxy group.
Another suitable modification includes 2'-dimethylaminooxyethoxy,
i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as
2'-DMAOE, as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in
examples hereinbelow.
[0073] Other suitable modifications include 2'-methoxy
(2'-OCH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F).
Similar modifications may also be made at other positions on the
dsRNA, particularly the 3' position of the sugar on the 3' terminal
nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5'
terminal nucleotide. DsRNAs may also have sugar mimetics such as
cyclobutyl moieties in place of the pentofuranosyl sugar.
Representative U.S. patents that teach the preparation of such
modified sugar structures include, but are not limited to, U.S.
Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878;
5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427;
5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265;
5,658,873; 5,670,633; and 5,700,920, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0074] dsRNAs may also include nucleobase (often referred to in the
art simply as "base") modifications or substitutions. As used
herein, "unmodified" or "natural" nucleobases include the purine
bases adenine (A) and guanine (G), and the pyrimidine bases thymine
(T), cytosine (C) and uracil (U). Modified nucleobases include
other synthetic and natural nucleobases such as 5-methylcytosine
(5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and
guanine, 2-propyl and other alkyl derivatives of adenine and
guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine,
5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo
uracil, cytosine and thymine, 5-uracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl
anal other 8-substituted adenines and guanines, 5-halo,
particularly 5-bromo, 5-trifluoromethyl and other 5-substituted
uracils and cytosines, 7-methylguanine and 7-methyladenine,
8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine
and 3-deazaguanine and 3-deazaadenine. Further nucleobases include
those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The
Concise Encyclopedia Of Polymer Science And Engineering, pages
858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these
disclosed by Englisch et al., Angewandte Chemie, International
Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S.,
Chapter 15, DsRNA Research and Applications, pages 289-302, Crooke,
S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these
nucleobases are particularly useful for increasing the binding
affinity of the oligomeric compounds featured in the invention.
These include 5-substituted pyrimidines, 6-azapyrimidines and N-2,
N-6 and 0-6 substituted purines, including 2-aminopropyladenine,
5-propynyluracil and 5-propynylcytosine. 5-methylcytosine
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and
Lebleu, B., Eds., DsRNA Research and Applications, CRC Press, Boca
Raton, 1993, pp. 276-278) and are suitable base substitutions,
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0075] Representative U.S. patents that teach the preparation of
certain of the above noted modified nucleobases as well as other
modified nucleobases include, but are not limited to, the above
noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205;
5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187;
5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469;
5,594,121, 5,596,091; 5,614,617; and 5,681,941, each of which is
herein incorporated by reference, and U.S. Pat. No. 5,750,692, also
herein incorporated by reference.
[0076] Another modification of the dsRNAs featured in the invention
involves chemically linking to the dsRNA one or more moieties or
conjugates which enhance the activity, cellular distribution or
cellular uptake of the dsRNA. Such moieties include but are not
limited to lipid moieties such as a cholesterol moiety (Letsinger
et al., Proc. Natl. Acid. Sci. USA, 199, 86, 6553-6556), cholic
acid (Manoharan et al., Biorg. Med. Chem. Let., 1994 4 1053-1060),
a thioether, e.g., beryl-5-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306-309; Manoharan et al., Biorg. Med. Chem.
Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al.,
Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g.,
dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J,
1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259,
327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-Hphosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron
Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine
or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937).
[0077] Representative U.S. patents that teach the preparation of
such dsRNA conjugates include, but are not limited to, U.S. Pat.
Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313;
5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124;
5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718;
5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737;
4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830;
5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022;
5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;
5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667;
5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371;
5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of
which is herein incorporated by reference.
[0078] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within a dsRNA. The present
invention also includes dsRNA compounds which are chimeric
compounds. "Chimeric" dsRNA compounds or "chimeras," in the context
of this invention, are dsRNA compounds, particularly dsRNAs, which
contain two or more chemically distinct regions, each made up of at
least one monomer unit, i.e., a nucleotide in the case of a dsRNA
compound. These dsRNAs typically contain at least one region
wherein the dsRNA is modified so as to confer upon the dsRNA
increased resistance to nuclease degradation, increased cellular
uptake, and/or increased binding affinity for the target nucleic
acid. An additional region of the dsRNA may serve as a substrate
for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way
of example, RNase H is a cellular endonuclease which cleaves the
RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore,
results in cleavage of the RNA target, thereby greatly enhancing
the efficiency of dsRNA inhibition of gene expression.
Consequently, comparable results can often be obtained with shorter
dsRNAs when chimeric dsRNAs are used, compared to phosphorothioate
deoxydsRNAs hybridizing to the same target region. Cleavage of the
RNA target can be routinely detected by gel electrophoresis and, if
necessary, associated nucleic acid hybridization techniques known
in the art.
[0079] In certain instances, the dsRNA may be modified by a
non-ligand group. A number of non-ligand molecules have been
conjugated to dsRNAs in order to enhance the activity, cellular
distribution or cellular uptake of the dsRNA, and procedures for
performing such conjugations are available in the scientific
literature. Such non-ligand moieties have included lipid moieties,
such as cholesterol (Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem.
Lett., 1994, 4:1053), a thioether, e.g., hexyl-5-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan
et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol
(Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic
chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et
al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990,
259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res.,
1990, 18:3777), a polyamine or a polyethylene glycol chain
(Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or
adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995,
36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta,
1995, 1264:229), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277:923). Representative United States
patents that teach the preparation of such dsRNA conjugates have
been listed above. Typical conjugation protocols involve the
synthesis of dsRNAs bearing an aminolinker at one or more positions
of the sequence. The amino group is then reacted with the molecule
being conjugated using appropriate coupling or activating reagents.
The conjugation reaction may be performed either with the dsRNA
still bound to the solid support or following cleavage of the dsRNA
in solution phase. Purification of the dsRNA conjugate by HPLC
typically affords the pure conjugate. The use of a cholesterol
conjugate is particularly suitable since such a moiety can increase
targeting vaginal epithelium cells, a site of CD45 expression.
[0080] Vector Encoded dsRNA Agents
[0081] The dsRNA featured in the invention can also be expressed
from recombinant viral vectors intracellularly in vivo. The
recombinant viral vectors featured in the invention comprise
sequences encoding the dsRNA and any suitable promoter for
expressing the dsRNA sequences. Suitable promoters include, for
example, the U6 or H1 RNA pol III promoter sequences and the
cytomegalovirus promoter. Selection of other suitable promoters is
within the skill in the art. The recombinant viral vectors can also
comprise inducible or regulatable promoters for expression of the
dsRNA in a particular tissue or in a particular intracellular
environment. The use of recombinant viral vectors to deliver dsRNA
to cells in vivo is discussed in more detail below.
[0082] dsRNA featured in the invention can be expressed from a
recombinant viral vector either as two separate, complementary RNA
molecules, or as a single RNA molecule with two complementary
regions.
[0083] Any viral vector capable of accepting the coding sequences
for the dsRNA molecule(s) to be expressed can be used, for example
vectors derived from adenovirus (AV); adeno-associated virus (AAV);
retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine
leukemia virus); herpes virus, and the like. The tropism of viral
vectors can be modified by pseudotyping the vectors with envelope
proteins or other surface antigens from other viruses, or by
substituting different viral capsid proteins, as appropriate.
[0084] For example, lentiviral vectors can be pseudotyped with
surface proteins from vesicular stomatitis virus (VSV), rabies,
Ebola, Mokola, and the like. AAV vectors can be made to target
different cells by engineering the vectors to express different
capsid protein serotypes. For example, an AAV vector expressing a
serotype 2 capsid on a serotype 2 genome is called AAV 2/2. This
serotype 2 capsid gene in the AAV 2/2 vector can be replaced by a
serotype 5 capsid gene to produce an AAV 2/5 vector. Techniques for
constructing AAV vectors which express different capsid protein
serotypes are within the skill in the art; see, e.g., Rabinowitz J
E et al. (2002), J Virol 76:791-801, the entire disclosure of which
is herein incorporated by reference.
[0085] Selection of recombinant viral vectors suitable for use in
the invention, methods for inserting nucleic acid sequences for
expressing the dsRNA into the vector, and methods of delivering the
viral vector to the cells of interest are within the skill in the
art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310;
Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990),
Hum Gene Therap. 1: 5-14; Anderson W F (1998), Nature 392: 25-30;
and Rubinson D A et al., Nat. Genet. 33: 401-406, the entire
disclosures of which are herein incorporated by reference.
[0086] Typical viral vectors are those derived from AV and AAV. In
one embodiment, the dsRNA featured in the invention is expressed as
two separate, complementary single-stranded RNA molecules from a
recombinant AAV vector including, for example, either the U6 or H1
RNA promoters, or the cytomegalovirus (CMV) promoter.
[0087] A suitable AV vector for expressing the dsRNA featured in
the invention, a method for constructing the recombinant AV vector,
and a method for delivering the vector into target cells, are
described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.
[0088] Suitable AAV vectors for expressing the dsRNA featured in
the invention, methods for constructing the recombinant AV vector,
and methods for delivering the vectors into target cells are
described in Samulski R et al. (1987), J. Virol. 61: 3096-3101;
Fisher K J et al. (1996), J. Virol, 70: 520-532; Samulski R et al.
(1989), J. Virol. 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat.
No. 5,139,941; International Patent Application No. WO 94/13788;
and International Patent Application No. WO 93/24641, the entire
disclosures of which are herein incorporated by reference.
III. PHARMACEUTICAL COMPOSITIONS INCLUDING DSRNA
[0089] The invention provides pharmaceutical compositions including
a dsRNA, as described herein, and a pharmaceutically acceptable
carrier. The pharmaceutical composition including the dsRNA is
useful for treating a disease or disorder associated with the
expression or activity of the CD45 gene, such as pathological
processes mediated by CD45 expression. Such pharmaceutical
compositions are formulated based on the mode of delivery. One
example is compositions that are formulated for systemic
administration via parenteral delivery.
[0090] The pharmaceutical compositions featured in the invention
are administered in dosages sufficient to inhibit expression of the
CD45 gene. The present inventors have found that, because of their
improved efficiency, compositions including the dsRNA can be
administered at surprisingly low dosages. Dosages of 0.6 mg or
greater of dsRNA per kilogram body weight of recipient per day is
sufficient to suppress expression of the CD45 gene by greater than
35%, with higher dosages capable of achieving 65% reduction in
expression of the CD45 gene.
[0091] In general, a suitable dose of dsRNA will be in the range of
0.01 to 200.0 milligrams per kilogram body weight of the recipient
per day, generally in the range of 0.02 to 50 mg per kilogram body
weight per day. For example, the dsRNA can be administered at 0.01,
0.1, 0.05 mg/kg, 0.5 mg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 5 mg/kg, 10
mg/kg, 20 mg/kg, 30 mg/kg, 40 mg/kg, or 50 mg/kg per single dose.
The pharmaceutical composition may be administered once daily, or
the dsRNA may be administered as two, three, or more sub-doses at
appropriate intervals throughout the day or even using continuous
infusion or delivery through a controlled release formulation. In
that case, the dsRNA contained in each sub-dose must be
correspondingly smaller in order to achieve the total daily dosage.
The dosage unit can also be compounded for delivery over several
days, e.g., using a conventional sustained release formulation
which provides sustained release of the dsRNA over a several day
period. Sustained release formulations are well known in the art
and are particularly useful for vaginal delivery of agents, such as
could be used with the dsRNAs featured in the invention. In this
embodiment, the dosage unit contains a corresponding multiple of
the daily dose.
[0092] The skilled artisan will appreciate that certain factors may
influence the dosage and timing required to effectively treat a
subject, including but not limited to the severity of the disease
or disorder, previous treatments, the general health and/or age of
the subject, and other diseases present. Moreover, treatment of a
subject with a therapeutically effective amount of a composition
can include a single treatment or a series of treatments. Estimates
of effective dosages and in vivo half-lives for the individual
dsRNAs encompassed by the invention can be made using conventional
methodologies or on the basis of in vivo testing using an
appropriate animal model, as described elsewhere herein.
[0093] Advances in mouse genetics have generated a number of mouse
models for the study of various human diseases, such as
pathological processes mediated by CD45 expression. Such models are
used for in vivo testing of dsRNA, as well as for determining a
therapeutically effective dose.
[0094] The present invention also includes pharmaceutical
compositions and formulations which include dsRNA targeting CD45.
The pharmaceutical compositions may be administered in a number of
ways depending upon whether local or systemic treatment is desired
and upon the area to be treated. Administration may be topical
(e.g., by a transdermal patch), pulmonary (e.g., by inhalation or
insufflation of powders or aerosols, including by nebulizer;
intratracheal, intranasal, epidermal and transdermal), oral or
parenteral. Administration may also be designed to result in
preferential localization to particular tissues through local
delivery, e.g., by direct intraarticular injection into joints, by
rectal administration for direct delivery to the gut and
intestines, by intravaginal administration for delivery to the
cervix and vagina, by intravitreal administration for delivery to
the eye. Parenteral administration includes intravenous,
intraarterial, intraarticular, subcutaneous, intraperitoneal or
intramuscular injection or infusion; subdermal, e.g., via an
implanted device; or intracranial, e.g., by intrathecal or
intraventricular administration.
[0095] Pharmaceutical compositions and formulations for topical
administration may include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily
bases, thickeners and the like may be necessary or desirable.
Coated condoms, gloves and the like may also be useful. Typical
topical formulations include those in which the dsRNAs featured in
the invention are in admixture with a topical delivery agent such
as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents and surfactants. Typical lipids and liposomes
include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG),
and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). DsRNAs featured the
invention may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes.
Alternatively, dsRNAs may be complexed to lipids, in particular to
cationic lipids. Typical fatty acids and esters include but are not
limited arachidonic acid, oleic acid, eicosanoic acid, lauric acid,
caprylic acid, capric acid, myristic acid, palmitic acid, stearic
acid, linoleic acid, linolenic acid, dicaprate, tricaprate,
monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C.sub.1-10 alkyl ester (e.g., isopropylmyristate IPM),
monoglyceride, diglyceride or pharmaceutically acceptable salt
thereof. Topical formulations are described in detail in U.S.
patent application Ser. No. 09/315,298 filed May 20, 1999, which is
incorporated herein by reference in its entirety.
[0096] In one embodiment, a dsRNA featured in the invention is
fully encapsulated in the lipid formulation (e.g., to form a SPLP,
pSPLP, SNALP, or other nucleic acid-lipid particle). As used
herein, the term "SNALP" refers to a stable nucleic acid-lipid
particle, including SPLP. As used herein, the term "SPLP" refers to
a nucleic acid-lipid particle comprising plasmid DNA encapsulated
within a lipid vesicle. SNALPs and SPLPs typically contain a
cationic lipid, a non-cationic lipid, and a lipid that prevents
aggregation of the particle (e.g., a PEG-lipid conjugate). SNALPs
and SPLPs are extremely useful for systemic applications, as they
exhibit extended circulation lifetimes following intravenous (i.v.)
injection and accumulate at distal sites (e.g., sites physically
separated from the administration site). SPLPs include "pSPLP,"
which include an encapsulated condensing agent-nucleic acid complex
as set forth in PCT Publication No. WO 00/03683. The particles of
the present invention typically have a mean diameter of about 50 nm
to about 150 nm, more typically about 60 nm to about 130 nm, more
typically about 70 nm to about 110 nm, most typically about 70 to
about 90 nm, and are substantially nontoxic.
[0097] In addition, the nucleic acids when present in the nucleic
acid-lipid particles of the present invention are resistant in
aqueous solution to degradation with a nuclease. Nucleic acid-lipid
particles and their method of preparation are disclosed in, e.g.,
U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410;
6,815,432; and PCT Publication No. WO 96/40964.
[0098] In one embodiment, the lipid to drug ratio (mass/mass ratio)
(e.g., lipid to dsRNA ratio) will be in the range of from about 1:1
to about 50:1, from about 1:1 to about 25:1, from about 3:1 to
about 15:1, from about 4:1 to about 10:1, from about 5:1 to about
9:1, or about 6:1 to about 9:1.
[0099] The cationic lipid may be, for example,
N,N-dioleyl-N,N-dimethylammonium chloride (DODAC),
N,N-distearyl-N,N-dimethylammonium bromide (DDAB),
N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTAP), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA),
1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP),
1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC),
1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA),
1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP),
1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA),
1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP),
1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt
(DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride
salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane
(DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP),
3-(N,N-Dioleylamino)-1,2-propanedio (DOAP),
1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane
(DLin-EG-DMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane
(DLin-K-DMA), or a mixture thereof. The cationic lipid may comprise
from about 20 mol % to about 50 mol % or about 40 mol % of the
total lipid present in the particle. The non-cationic lipid may be
an anionic lipid or a neutral lipid including, but not limited to,
distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), dipalmitoylphosphatidylcholine (DPPC),
dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoyl-phosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoyl-phosphatidylethanolamine (POPE),
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or
a mixture thereof. The non-cationic lipid may be from about 5 mol %
to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol
is included, of the total lipid present in the particle.
[0100] The conjugated lipid that inhibits aggregation of particles
may be, for example, a polyethyleneglycol (PEG)-lipid including,
without limitation, a PEG-diacylglycerol (DAG), a
PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide
(Cer), or a mixture thereof. The PEG-DAA conjugate may be, for
example, a PEG-dilauryloxypropyl (Ci.sub.2), a
PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl
(Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated
lipid that prevents aggregation of particles may be from 0 mol % to
about 20 mol % or about 2 mol % of the total lipid present in the
particle.
[0101] In some embodiments, the nucleic acid-lipid particle further
includes cholesterol at, e.g., about 10 mol % to about 60 mol % or
about 48 mol % of the total lipid present in the particle.
[0102] In one embodiment, the lipidoid ND98.4HCl (MW 1487) (Formula
1), Cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar
Lipids) can be used to prepare lipid-siRNA nanoparticles (i.e.,
LNP01 particles). Stock solutions of each in ethanol can be
prepared as follows: ND98, 133 mg/mL; Cholesterol, 25 mg/mL,
PEG-Ceramide C16, 100 mg/mL. The ND98, Cholesterol, and
PEG-Ceramide C16 stock solutions can then be combined in a, e.g.,
42:48:10 molar ratio. The combined lipid solution can be mixed with
aqueous siRNA (e.g., in sodium acetate pH 5) such that the final
ethanol concentration is about 35-45% and the final sodium acetate
concentration is about 100-300 mM. Lipid-siRNA nanoparticles
typically form spontaneously upon mixing. Depending on the desired
particle size distribution, the resultant nanoparticle mixture can
be extruded through a polycarbonate membrane (e.g., 100 nm cut-off)
using, for example, a thermobarrel extruder, such as Lipex Extruder
(Northern Lipids, Inc). In some cases, the extrusion step can be
omitted. Ethanol removal and simultaneous buffer exchange can be
accomplished by, for example, dialysis or tangential flow
filtration. Buffer can be exchanged with, for example, phosphate
buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH
7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.
##STR00001##
[0103] LNP01 formulations are described, e.g., in International
Application Publication No. WO 2008/042973, which is hereby
incorporated by reference.
[0104] Formulations prepared by either the standard or
extrusion-free method can be characterized in similar manners. For
example, formulations are typically characterized by visual
inspection. They should be whitish translucent solutions free from
aggregates or sediment. Particle size and particle size
distribution of lipid-nanoparticles can be measured by light
scattering using, for example, a Malvern Zetasizer Nano ZS
(Malvern, USA). Particles should be about 20-300 nm, such as 40-100
nm in size. The particle size distribution should be unimodal. The
total siRNA concentration in the formulation, as well as the
entrapped fraction, is estimated using a dye exclusion assay. A
sample of the formulated siRNA can be incubated with an RNA-binding
dye, such as Ribogreen (Molecular Probes) in the presence or
absence of a formulation disrupting surfactant, e.g., 0.5%
Triton-X100. The total siRNA in the formulation can be determined
by the signal from the sample containing the surfactant, relative
to a standard curve. The entrapped fraction is determined by
subtracting the "free" siRNA content (as measured by the signal in
the absence of surfactant) from the total siRNA content. Percent
entrapped siRNA is typically >85%. For SNALP formulation, the
particle size is at least 30 nm, at least 40 nm, at least 50 nm, at
least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at
least 100 nm, at least 110 nm, and at least 120 nm. The suitable
range is typically about at least 50 nm to about at least 110 nm,
about at least 60 nm to about at least 100 nm, or about at least 80
nm to about at least 90 nm.
[0105] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
may be desirable. Typical oral formulations are those in which
dsRNAs featured in the invention are administered in conjunction
with one or more penetration enhancers surfactants and chelators.
Typical surfactants include fatty acids and/or esters or salts
thereof, bile acids and/or salts thereof. Typical bile acids/salts
include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic
acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid,
glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic
acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate
and sodium glycodihydrofusidate. Typical fatty acids include
arachidonic acid, undecanoic acid, oleic acid, lauric acid,
caprylic acid, capric acid, myristic acid, palmitic acid, stearic
acid, linoleic acid, linolenic acid, dicaprate, tricaprate,
monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a monoglyceride, a diglyceride or a pharmaceutically acceptable
salt thereof (e.g. sodium). Suitable combinations of penetration
enhancers include, for example, fatty acids/salts in combination
with bile acids/salts. One typical combination is the sodium salt
of lauric acid, capric acid and UDCA. Further penetration enhancers
include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl
ether. DsRNAs featured in the invention may be delivered orally, in
granular form including sprayed dried particles, or complexed to
form micro or nanoparticles. DsRNA complexing agents include
poly-amino acids; polyimines; polyacrylates; polyalkylacrylates,
polyoxethanes, polyalkylcyanoacrylates; cationized gelatins,
albumins, starches, acrylates, polyethyleneglycols (PEG) and
starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines,
pollulans, celluloses and starches. Typical complexing agents
include chitosan, N-trimethylchitosan, poly-L-lysine,
polyhistidine, polyornithine, polyspermines, protamine,
polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE),
polyaminostyrene (e.g. p-amino), poly(methylcyanoacrylate),
poly(ethylcyanoacrylate), poly(butylcyanoacrylate),
poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate),
DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide,
DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG). Oral formulations for dsRNAs and their
preparation are described in detail in U.S. application. Ser. No.
08/886,829 (filed Jul. 1, 1997), Ser. No. 09/108,673 (filed Jul. 1,
1998), Ser. No. 09/256,515 (filed Feb. 23, 1999), Ser. No.
09/082,624 (filed May 21, 1998) and Ser. No. 09/315,298 (filed May
20, 1999), each of which is incorporated herein by reference in
their entirety.
[0106] Compositions and formulations for parenteral, intrathecal or
intraventricular administration may include sterile aqueous
solutions which may also contain buffers, diluents and other
suitable additives such as, but not limited to, penetration
enhancers, carrier compounds and other pharmaceutically acceptable
carriers or excipients.
[0107] Pharmaceutical compositions featured in the invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions may be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids.
[0108] The pharmaceutical formulations featured in the invention,
which may conveniently be presented in unit dosage form, may be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general, the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0109] The compositions featured in the invention may be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions featured in the
invention may also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions may further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension may also contain stabilizers.
[0110] In one embodiment, the pharmaceutical composition may be
formulated and used as a foam. Pharmaceutical foams include
formulations such as, but not limited to, emulsions,
microemulsions, creams, jellies and liposomes. While basically
similar in nature these formulations vary in the components and the
consistency of the final product. The preparation of such
compositions and formulations is generally known to those skilled
in the pharmaceutical and formulation arts and may be applied to
the formulation of the compositions featured herein.
[0111] Emulsions
[0112] The compositions featured in the invention may be prepared
and formulated as emulsions. Emulsions are typically heterogenous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter (Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p.
335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems including two immiscible liquid phases intimately
mixed and dispersed with each other. In general, emulsions may be
of either the water-in-oil (w/o) or the oil-in-water (o/w) variety.
When an aqueous phase is finely divided into and dispersed as
minute droplets into a bulk oily phase, the resulting composition
is called a water-in-oil (w/o) emulsion. Alternatively, when an
oily phase is finely divided into and dispersed as minute droplets
into a bulk aqueous phase, the resulting composition is called an
oil-in-water (o/w) emulsion. Emulsions may contain additional
components in addition to the dispersed phases, and the active drug
which may be present as a solution in either the aqueous phase,
oily phase or itself as a separate phase. Pharmaceutical excipients
such as emulsifiers, stabilizers, dyes, and anti-oxidants may also
be present in emulsions as needed. Pharmaceutical emulsions may
also be multiple emulsions that are comprised of more than two
phases such as, for example, in the case of oil-in-water-in-oil
(o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex
formulations often provide certain advantages that simple binary
emulsions do not. Multiple emulsions in which individual oil
droplets of an o/w emulsion enclose small water droplets constitute
a w/o/w emulsion. Likewise a system of oil droplets enclosed in
globules of water stabilized in an oily continuous phase provides
an o/w/o emulsion.
[0113] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
may be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that may be incorporated into either
phase of the emulsion. Emulsifiers may broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0114] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (Rieger, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199).
Surfactants are typically amphiphilic and comprise a hydrophilic
and a hydrophobic portion. The ratio of the hydrophilic to the
hydrophobic nature of the surfactant has been termed the
hydrophile/lipophile balance (HLB) and is a valuable tool in
categorizing and selecting surfactants in the preparation of
formulations. Surfactants may be classified into different classes
based on the nature of the hydrophilic group: nonionic, anionic,
cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 285).
[0115] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0116] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0117] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0118] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that may
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used may be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0119] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for
oral delivery have been very widely used because of ease of
formulation, as well as efficacy from an absorption and
bioavailability standpoint (Rosoff, in Pharmaceutical Dosage Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New
York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base
laxatives, oil-soluble vitamins and high fat nutritive preparations
are among the materials that have commonly been administered orally
as o/w emulsions.
[0120] In one embodiment, the compositions of dsRNAs and nucleic
acids are formulated as microemulsions. A microemulsion may be
defined as a system of water, oil and amphiphile which is a single
optically isotropic and thermodynamically stable liquid solution
(Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245). Typically, microemulsions are systems that are prepared by
first dispersing an oil in an aqueous surfactant solution and then
adding a sufficient amount of a fourth component, generally an
intermediate chain-length alcohol to form a transparent system.
Therefore, microemulsions have also been described as
thermodynamically stable, isotropically clear dispersions of two
immiscible liquids that are stabilized by interfacial films of
surface-active molecules (Leung and Shah, in: Controlled Release of
Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH
Publishers, New York, pages 185-215). Microemulsions commonly are
prepared via a combination of three to five components that include
oil, water, surfactant, cosurfactant and electrolyte. Whether the
microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w)
type is dependent on the properties of the oil and surfactant used
and on the structure and geometric packing of the polar heads and
hydrocarbon tails of the surfactant molecules (Schott, in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton,
Pa., 1985, p. 271).
[0121] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions
(Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0122] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (M0310), hexaglycerol monooleate (PO310), hexaglycerol
pentaoleate (PO500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750),
decaglycerol decaoleate (DAO750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions may, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase may typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase may include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0123] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (Constantinides et al., Pharmaceutical Research, 1994, 11,
1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13,
205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (Constantinides
et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.
Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form
spontaneously when their components are brought together at ambient
temperature. This may be particularly advantageous when formulating
thermolabile drugs, peptides or dsRNAs. Microemulsions have also
been effective in the transdermal delivery of active components in
both cosmetic and pharmaceutical applications. It is expected that
the microemulsion compositions and formulations featured in the
invention will facilitate the increased systemic absorption of
dsRNAs and nucleic acids from the gastrointestinal tract, as well
as improve the local cellular uptake of dsRNAs and nucleic acids
within the gastrointestinal tract, vagina, buccal cavity and other
areas of administration.
[0124] Microemulsions may also contain additional components and
additives such as sorbitan monostearate (Grill 3), Labrasol, and
penetration enhancers to improve the properties of the formulation
and to enhance the absorption of the dsRNAs and nucleic acids
featured in the invention. Penetration enhancers used in
microemulsions may be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0125] Liposomes
[0126] There are many organized surfactant structures besides
microemulsions that have been studied and used for the formulation
of drugs. These include monolayers, micelles, bilayers and
vesicles. Vesicles, such as liposomes, have attracted great
interest because of their specificity and the duration of action
they offer from the standpoint of drug delivery. As used herein,
the term "liposome" means a vesicle composed of amphiphilic lipids
arranged in a spherical bilayer or bilayers.
[0127] Liposomes are unilamellar or multilamellar vesicles which
have a membrane formed from a lipophilic material and an aqueous
interior. The aqueous portion contains the composition to be
delivered. Cationic liposomes possess the advantage of being able
to fuse to the cell wall. Non-cationic liposomes, although not able
to fuse as efficiently with the cell wall, are taken up by
macrophages in vivo.
[0128] In order to cross intact mammalian skin, lipid vesicles must
pass through a series of fine pores, each with a diameter less than
50 nm, under the influence of a suitable transdermal gradient.
Therefore, it is desirable to use a liposome which is highly
deformable and able to pass through such fine pores.
[0129] Further advantages of liposomes include; liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated drugs in their internal
compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Important considerations in the preparation of liposome
formulations are the lipid surface charge, vesicle size and the
aqueous volume of the liposomes.
[0130] Liposomes are useful for the transfer and delivery of active
ingredients to the site of action. Because the liposomal membrane
is structurally similar to biological membranes, when liposomes are
applied to a tissue, the liposomes start to merge with the cellular
membranes and as the merging of the liposome and cell progresses,
the liposomal contents are emptied into the cell where the active
agent may act.
[0131] Liposomal formulations have been the focus of extensive
investigation as the mode of delivery for many drugs. There is
growing evidence that for topical administration, liposomes present
several advantages over other formulations. Such advantages include
reduced side-effects related to high systemic absorption of the
administered drug, increased accumulation of the administered drug
at the desired target, and the ability to administer a wide variety
of drugs, both hydrophilic and hydrophobic, into the skin.
[0132] Several reports have detailed the ability of liposomes to
deliver agents including high-molecular weight DNA into the skin.
Compounds including analgesics, antibodies, hormones and
high-molecular weight DNAs have been administered to the skin. The
majority of applications resulted in the targeting of the upper
epidermis
[0133] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged DNA molecules to form a stable complex. The positively
charged DNA/liposome complex binds to the negatively charged cell
surface and is internalized in an endosome. Due to the acidic pH
within the endosome, the liposomes are ruptured, releasing their
contents into the cell cytoplasm (Wang et al., Biochem. Biophys.
Res. Commun., 1987, 147, 980-985).
[0134] Liposomes which are pH-sensitive or negatively-charged,
entrap DNA rather than complex with it. Since both the DNA and the
lipid are similarly charged, repulsion rather than complex
formation occurs. Nevertheless, some DNA is entrapped within the
aqueous interior of these liposomes. pH-sensitive liposomes have
been used to deliver DNA encoding the thymidine kinase gene to cell
monolayers in culture. Expression of the exogenous gene was
detected in the target cells (Zhou et al., Journal of Controlled
Release, 1992, 19, 269-274).
[0135] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0136] Several studies have assessed the topical delivery of
liposomal drug formulations to the skin. Application of liposomes
containing interferon to guinea pig skin resulted in a reduction of
skin herpes sores while delivery of interferon via other means
(e.g. as a solution or as an emulsion) were ineffective (Weiner et
al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an
additional study tested the efficacy of interferon administered as
part of a liposomal formulation to the administration of interferon
using an aqueous system, and concluded that the liposomal
formulation was superior to aqueous administration (du Plessis et
al., Antiviral Research, 1992, 18, 259-265).
[0137] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems including non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations including Novasome.TM. I (glyceryl
dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and
Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporin-A into different layers
of the skin (Hu et al. S. T. P. Pharma. Sci., 1994, 4, 6, 466).
[0138] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes including one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) includes one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765).
[0139] Various liposomes including one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes including (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes including
sphingomyelin. Liposomes including
1,2-sn-dimyristoylphosphat-idylcholine are disclosed in WO 97/13499
(Lim et al).
[0140] Many liposomes including lipids derivatized with one or more
hydrophilic polymers, and methods of preparation thereof, are known
in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778)
described liposomes including a nonionic detergent, 2C.sub.1215G,
that contains a PEG moiety. Illum et al. (FEBS Lett., 1984, 167,
79) noted that hydrophilic coating of polystyrene particles with
polymeric glycols results in significantly enhanced blood
half-lives. Synthetic phospholipids modified by the attachment of
carboxylic groups of polyalkylene glycols (e.g., PEG) are described
by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al.
(FEBS Lett., 1990, 268, 235) described experiments demonstrating
that liposomes including phosphatidylethanolamine (PE) derivatized
with PEG or PEG stearate have significant increases in blood
circulation half-lives. Blume et al. (Biochimica et Biophysica
Acta, 1990, 1029, 91) extended such observations to other
PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the
combination of distearoylphosphatidylethanolamine (DSPE) and PEG.
Liposomes having covalently bound PEG moieties on their external
surface are described in European Patent No. EP 0 445 131 B1 and WO
90/04384 to Fisher. Liposome compositions containing 1-20 mole
percent of PE derivatized with PEG, and methods of use thereof, are
described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633)
and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No.
EP 0 496 813 B1). Liposomes including a number of other
lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat.
No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky
et al.) Liposomes including PEG-modified ceramide lipids are
described in WO 96/10391 (Choi et al). U.S. Pat. No. 5,540,935
(Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.)
describe PEG-containing liposomes that can be further derivatized
with functional moieties on their surfaces.
[0141] A limited number of liposomes including nucleic acids are
known in the art. WO 96/40062 to Thierry et al. discloses methods
for encapsulating high molecular weight nucleic acids in liposomes.
U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded
liposomes and asserts that the contents of such liposomes may
include an dsRNA RNA. U.S. Pat. No. 5,665,710 to Rahman et al.
describes certain methods of encapsulating oligodeoxynucleotides in
liposomes. WO 97/04787 to Love et al. discloses liposomes including
dsRNA dsRNAs targeted to the raf gene.
[0142] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes may be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g. they are self-optimizing (adaptive to the shape of pores
in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0143] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0144] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0145] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0146] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0147] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0148] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in Pharmaceutical Dosage
Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0149] Penetration Enhancers
[0150] In one embodiment, various penetration enhancers are used to
effect the efficient delivery of nucleic acids, particularly
dsRNAs, to the skin of animals. Most drugs are present in solution
in both ionized and nonionized forms. However, usually only lipid
soluble or lipophilic drugs readily cross cell membranes. It has
been discovered that even non-lipophilic drugs may cross cell
membranes if the membrane to be crossed is treated with a
penetration enhancer. In addition to aiding the diffusion of
non-lipophilic drugs across cell membranes, penetration enhancers
also enhance the permeability of lipophilic drugs.
[0151] Penetration enhancers may be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.
92). Each of the above mentioned classes of penetration enhancers
are described below in greater detail.
[0152] Surfactants (or "surface-active agents") are chemical
entities, which when dissolved in an aqueous solution, reduce the
surface tension of the solution or the interfacial tension between
the aqueous solution and another liquid, with the result that
absorption of dsRNAs through the mucosa is enhanced. In addition to
bile salts and fatty acids, these penetration enhancers include,
for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether
and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews
in Therapeutic Drug Carrier Systems, 1991, p. 92); and
perfluorochemical emulsions, such as FC-43. Takahashi et al., J.
Pharm. Pharmacol., 1988, 40, 252).
[0153] Fatty acids: Various fatty acids and their derivatives which
act as penetration enhancers include, for example, oleic acid,
lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin,
caprylic acid, arachidonic acid, glycerol 1-monocaprate,
1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C.sub.1-10 alkyl esters thereof (e.g., methyl, isopropyl and
t-butyl), and mono- and di-glycerides thereof (i.e., oleate,
laurate, caprate, myristate, palmitate, stearate, linoleate, etc.)
(Lee et al., Critical Reviews in Therapeutic Drug Carryier Systems,
1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug
Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm.
Pharmacol., 1992, 44, 651-654).
[0154] Bile salts: The physiological role of bile includes the
facilitation of dispersion and absorption of lipids and fat-soluble
vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The
Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al.
Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural
bile salts, and their synthetic derivatives, act as penetration
enhancers. Thus the term "bile salts" includes any of the naturally
occurring components of bile as well as any of their synthetic
derivatives. The bile salts include, for example, cholic acid (or
its pharmaceutically acceptable sodium salt, sodium cholate),
dehydrocholic acid (sodium dehydrocholate), deoxycholic acid
(sodium deoxycholate), glucholic acid (sodium glucholate),
glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate),
taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic
acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA),
sodium tauro-24,25-dihydro-fusidate (STDHF), sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee
et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical
Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa.,
1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm.
Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990,
79, 579-583).
[0155] "Chelating Agents" are defined as compounds that remove
metallic ions from solution by forming complexes therewith, with
the result that absorption of dsRNAs through the mucosa is
enhanced. With regards to their use as penetration enhancers,
chelating agents have the added advantage of also serving as DNase
inhibitors, as most characterized DNA nucleases require a divalent
metal ion for catalysis and are thus inhibited by chelating agents
(Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents
include but are not limited to disodium ethylenediaminetetraacetate
(EDTA), citric acid, salicylates (e.g., sodium salicylate,
5-methoxysalicylate and homovanilate), N-acyl derivatives of
collagen, laureth-9 and N-amino acyl derivatives of beta-diketones
(enamines) (Lee et al., Critical Reviews in Therapeutic Drug
Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in
Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J.
Control Rel., 1990, 14, 43-51).
[0156] Non-chelating non-surfactants: As used herein, non-chelating
non-surfactant penetration enhancing compounds can be defined as
compounds that demonstrate insignificant activity as chelating
agents or as surfactants but that nonetheless enhance absorption of
dsRNAs through the alimentary mucosa (Muranishi, Critical Reviews
in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of
penetration enhancers include, for example, unsaturated cyclic
ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et
al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991,
page 92); and non-steroidal anti-inflammatory agents such as
diclofenac sodium, indomethacin and phenylbutazone (Yamashita et
al., J. Pharm. Pharmacol., 1987, 39, 621-626).
[0157] Agents that enhance uptake of dsRNAs at the cellular level
may also be added to the pharmaceutical and other compositions
featured in the invention. For example, cationic lipids, such as
lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic
glycerol derivatives, and polycationic molecules, such as
polylysine (Lollo et al., PCT Application WO 97/30731), are also
known to enhance the cellular uptake of dsRNAs.
[0158] Other agents may be utilized to enhance the penetration of
the administered nucleic acids, including glycols such as ethylene
glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and
terpenes such as limonene and menthone.
[0159] Carriers
[0160] Certain compositions featured herein also incorporate
carrier compounds in the formulation. As used herein, "carrier
compound" or "carrier" can refer to a nucleic acid, or analog
thereof, which is inert (i.e., does not possess biological activity
per se), but is recognized as a nucleic acid by in vivo processes
that reduce the bioavailability of a nucleic acid having biological
activity by, for example, degrading the biologically active nucleic
acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate dsRNA in hepatic tissue can be reduced
when it is coadministered with polyinosinic acid, dextran sulfate,
polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et
al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA
& Nucl. Acid Drug Dev., 1996, 6, 177-183.
[0161] Excipients
[0162] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
may be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc).
[0163] Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration, and that do not
deleteriously react with nucleic acids, can also be used to
formulate the compositions featured in the present invention.
Suitable pharmaceutically acceptable carriers include, but are not
limited to, water, salt solutions, alcohols, polyethylene glycols,
gelatin, lactose, amylose, magnesium stearate, talc, silicic acid,
viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and
the like.
[0164] Formulations for topical administration of nucleic acids may
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions may also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0165] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
[0166] Other Components
[0167] The compositions featured in the invention may additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions may contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or may contain additional materials useful in physically
formulating various dosage forms of the compositions featured in
the present invention, such as dyes, flavoring agents,
preservatives, antioxidants, opacifiers, thickening agents and
stabilizers. However, such materials, when added, should not unduly
interfere with the biological activities of the components of the
compositions featured in the invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0168] Aqueous suspensions may contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension may
also contain stabilizers.
[0169] Certain embodiments featured in the invention provide
pharmaceutical compositions containing (a) one or more antisense
compounds and (b) one or more other therapeutic agents which
function by a non-antisense mechanism. For example, the one or more
other therapeutic agents include antibiotic or antiviral agents.
Exemplary antibiotics include, e.g., amphotericin B, norfloxacin,
miconazole nitrate, ofloxacin, idoxuridine, chloramphenicol,
colistin sodium methanesulfonate, carbenicillin sodium, beta-lactam
antibiotics, cefoxitin, n-formanidolthienamycin and other
thienamycin derivatives, tetracyclines, neomycin, carbenicillin,
colistin, penicillin G, polymyxin B, vancomycin, cefazolin,
cephaloridine, chibrorifamycin, gramicidin, bacitracin and
sulfonamides. Exemplary antiviral agents include, e.g., acyclovir
and interferon. For the treatment of autoimmune disease the one or
more other therapeutic agents can include, e.g., interferon beta
(e.g., IFNbeta-1a and IFN-1b, gliatriamer acetate (Copaxone),
cyclophosphamide, methotrexate, azathioprine (Imuran), cladribine
(Leustatin), cyclosporine, mitoxantrone, and glucocorticoids (e.g.,
adrenocorticotropic hormone (ACTH), methylprednisolone, and
dexamethasone). For treatment of Graves' disease, for example, the
additional therapeutic agent can be, e.g., an antithyroid drug,
such as propylthiouracil (PTU) or methimazole. The invention also
includes methods of treating a disorder described herein by
administration of a dsRNA described herein and one or more other
therapeutic agents which function by a non-antisense mechanism,
e.g., one or more of the agents listed above. The agents can be
administered in a single formulation or may be administered
separately, at the same or at different times.
[0170] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. Suitable compounds
typically exhibit high therapeutic indices.
[0171] The data obtained from cell culture assays and animal
studies can be used in formulation a range of dosage for use in
humans. The dosage of compositions featured in the invention lies
generally within a range of circulating concentrations that include
the ED50 with little or no toxicity. The dosage may vary within
this range depending upon the dosage form employed and the route of
administration utilized. For any compound used in the methods
featured in the invention, the therapeutically effective dose can
be estimated initially from cell culture assays. A dose may be
formulated in animal models to achieve a circulating plasma
concentration range of the compound or, when appropriate, of the
polypeptide product of a target sequence (e.g., achieving a
decreased concentration of the polypeptide) that includes the IC50
(i.e., the concentration of the test compound which achieves a
half-maximal inhibition of symptoms) as determined in cell culture.
Such information can be used to more accurately determine useful
doses in humans. Levels in plasma may be measured, for example, by
high performance liquid chromatography.
[0172] In addition to their administration individually or as a
plurality, as discussed above, the dsRNAs featured in the invention
can be administered in combination with other known agents
effective in treatment of pathological processes mediated by CD45
expression. In any event, the administering physician can adjust
the amount and timing of dsRNA administration on the basis of
results observed using standard measures of efficacy known in the
art or described herein.
[0173] Methods for Treating Diseases Caused by Expression of the
CD45 Gene
[0174] In one embodiment, the invention provides a method for
treating a subject having a pathological condition mediated by the
expression of the CD45 gene, such as an autoimmune disease or an
infectious disease. In this embodiment, the dsRNA acts as a
therapeutic agent for controlling the expression of the CD45
protein. The method includes administering a pharmaceutical
composition featured in the invention to the patient (e.g., human),
such that expression of the CD45 gene is silenced. Because of their
high specificity, the dsRNAs featured in the invention specifically
target mRNAs of the CD45 gene.
[0175] As used herein, the term "CD45-mediated condition or
disease" and related terms and phrases refer to a condition or
disorder characterized by unwanted or inappropriate, e.g., abnormal
CD45 activity. Inappropriate CD45 functional activity might arise
as the result of CD45 expression in cells which normally do not
express CD45, increased CD45 expression and/or activity (leading
to, e.g., autoimmune disorders and diseases, or increased
susceptibility to disease). A CD45-mediated condition or disease
may be completely or partially mediated by inappropriate CD45
functional activity which may result by way of inappropriate
activation of CD45. Regardless, a CD45-mediated condition or
disease is one in which modulation of CD45 via RNA interference
results in some effect on the underlying condition or disorder
(e.g., a CD45 inhibitor results in some improvement in patient
well-being in at least some patients).
[0176] The anti-CD45 dsRNAs featured in the present invention may
be used to treat or diagnose an infection or immune disorder in a
subject. The methods include administering to a subject an
anti-CD45 dsRNA in an amount effective to treat an infectious
disease or autoimmune disorder.
[0177] Pathological processes refer to a category of biological
processes that produce a deleterious effect. For example,
unregulated expression of CD45 is associated with autoimmunity and
infectious disease. A compound featured in the invention can
typically modulate a pathological process when the compound reduces
the degree or severity of the process. For instance, autoimmunity
or an infection may be prevented or related pathological processes
can be modulated by the administration of compounds that reduce or
modulate in some way the expression or at least one activity
CD45.
[0178] The dsRNA molecules featured herein may, therefore, be used
to treat an autoimmune or infectious disease. Autoimmune diseases
that can be treated with a dsRNA that targets CD45 include, but are
not limited to, Graves' disease, Hashimoto's thyroiditis, multiple
sclerosis, and systemic sclerosis. In one embodiment, a dsRNA
targeting CD45 is administered to a patient who has received an
organ transplant, such as to reduce the risk of damage to the organ
(e.g., from ischemia and reperfusion, such as caused by an
inflammatory response) and the risk of organ rejection. Infectious
diseases that can be treated with a dsRNA that targets CD45 include
but are not limited to influenza, anthrax, Ebola, human
immunodeficiency virus (HIV), vesicular stomatitis virus (VSV),
rabies, Mokola, Rous sarcoma virus, and hepatitis, such as
hepatitis A, B and C strains.
[0179] The pharmaceutical compositions encompassed by the invention
may be administered by any means known in the art including, but
not limited to oral or parenteral routes, including intravenous,
intramuscular, intraarticular, intraperitoneal, subcutaneous,
intravitreal, transdermal, airway (aerosol), nasal, rectal, vaginal
and topical (including buccal and sublingual) administration, and
epidural administration. In some embodiments, the pharmaceutical
compositions are administered intraveneously by infusion or
injection.
[0180] Before administration of a full dose of a dsRNA targeting
CD45, a patient can be administered a smaller dose, such as a 5%
infusion reaction, and monitored for adverse effects, such as an
allergic reaction. In another example, the patient can be monitored
for unwanted immunostimulatory effects, such as increased cytokine
(e.g., TNF-alpha or INF-alpha) levels.
[0181] Many CD45-associated diseases and disorders are hereditary.
Therefore, a patient in need of a dsRNA targeting CD45 can be
identified by taking a family history. A healthcare provider, such
as a doctor, nurse, or family member, can take a family history
before prescribing or administering a dsRNA. A DNA test may also be
performed on the patient to identify a mutation in the target gene,
before a dsRNA is administered to the patient.
[0182] Methods for Inhibiting Expression of the CD45 Gene
[0183] In yet another aspect, the invention provides a method for
inhibiting the expression of the CD45 gene in a mammal. The method
includes administering a CD45 dsRNA to the mammal such that
expression of the target CD45 gene is silenced. Because of their
high specificity, the dsRNAs specifically target RNAs (primary or
processed) of the target CD45 gene. Compositions and methods for
inhibiting the expression of the CD45 gene using dsRNAs can be
performed as described elsewhere herein.
[0184] In one embodiment, the method includes administering a
composition including a dsRNA, wherein the dsRNA includes a
nucleotide sequence which is complementary to at least a part of an
RNA transcript of the CD45 gene of the mammal to be treated. When
the organism to be treated is a mammal such as a human, the
composition may be administered by any means known in the art
including, but not limited to oral or parenteral routes, including
intravenous, intramuscular, intraarticular, intracranial,
subcutaneous, intravitreal, transdermal, airway (aerosol), nasal,
rectal, vaginal and topical (including buccal and sublingual)
administration. In some embodiments, the compositions are
administered by intraveneous infusion or injection.
TABLE-US-00001 TABLE 1 Target positions of duplex dsRNAs Human
Reference NM_002838.2 sequence of total 23-mer Duplex Name ID #
pos. in 23 mer SEQ ID NO: target site AD-14008 69 2206-2228 97
CAGAAUAAAAACCGUUAUGUUGA AD-14009 225 2213-2235 98
AAAACCGUUAUGUUGACAUUCUU AD-14010 211 1927-1949 99
UUUCUGAUUAUUGUGACAUCAAU AD-14011 224 2210-2232 100
AUAAAAACCGUUAUGUUGACAUU AD-14012 233 2326-2348 101
GAACCCAGGAAAUACAUUGCUGC AD-14013 222 2204-2226 102
ACCAGAAUAAAAACCGUUAUGUU AD-14014 223 2205-2227 103
CCAGAAUAAAAACCGUUAUGUUG AD-14015 235 2409-2431 104
CACAGUUAUUGUCAUGGUCACUC AD-14016 454 2207-2229 105
AGAAUAAAAACCGUUAUGUUGAC AD-14017 463 2329-2351 106
CCCAGGAAAUACAUUGCUGCACA AD-14018 1389 2212-2234 107
AAAAACCGUUAUGUUGACAUUCU AD-14019 610 2211-2233 108
UAAAAACCGUUAUGUUGACAUUC AD-14020 1094 2215-2237 109
AACCGUUAUGUUGACAUUCUUCC AD-14021 611 2214-2236 110
AAACCGUUAUGUUGACAUUCUUC AD-14022 1388 2209-2231 111
AAUAAAAACCGUUAUGUUGACAU AD-14023 1095 2216-2238 112
ACCGUUAUGUUGACAUUCUUCCU AD-14024 1147 2408-2430 113
CCACAGUUAUUGUCAUGGUCACU AD-14025 725 1929-1951 114
UCUGAUUAUUGUGACAUCAAUAG AD-14026 1364 1930-1952 115
CUGAUUAUUGUGACAUCAAUAGC AD-14027 1124 2330-2352 116
CCAGGAAAUACAUUGCUGCACAA AD-14028 1050 2028-2050 117
UGUUGAAAGGGAUGAUGAAAAAC AD-14029 609 2208-2230 118
GAAUAAAAACCGUUAUGUUGACA AD-14030 724 1928-1950 119
UUCUGAUUAUUGUGACAUCAAUA AD-14031 1123 2327-2349 120
AACCCAGGAAAUACAUUGCUGCA AD-14032 1125 2331-2353 121
CAGGAAAUACAUUGCUGCACAAG AD-14033 1146 2407-2429 122
GCCACAGUUAUUGUCAUGGUCAC AD-14034 1403 2436-2458 123
UGAAGAAGGAAACAGGAACAAGU AD-14035 1365 1931-1953 124
UGAUUAUUGUGACAUCAAUAGCC AD-14036 1394 2328-2350 125
ACCCAGGAAAUACAUUGCUGCAC AD-14037 1154 2431-2453 126
CGAUGUGAAGAAGGAAACAGGAA AD-14038 1022 1932-1954 127
GAUUAUUGUGACAUCAAUAGCCC AD-14039 1121 2324-2346 128
AAGAACCCAGGAAAUACAUUGCU AD-14040 1122 2325-2347 129
AGAACCCAGGAAAUACAUUGCUG AD-14041 760 2405-2427 130
AAGCCACAGUUAUUGUCAUGGUC AD-14042 1401 2429-2451 131
CUCGAUGUGAAGAAGGAAACAGG AD-14043 1153 2430-2452 132
UCGAUGUGAAGAAGGAAACAGGA AD-14044 1402 2432-2454 133
GAUGUGAAGAAGGAAACAGGAAC AD-14045 1155 2433-2455 134
AUGUGAAGAAGGAAACAGGAACA AD-14046 744 2217-2239 135
CCGUUAUGUUGACAUUCUUCCUU AD-14047 1701 2406-2428 136
AGCCACAGUUAUUGUCAUGGUCA AD-14048 1704 2439-2461 137
AGAAGGAAACAGGAACAAGUGUG AD-14049 1833 2435-2457 138
GUGAAGAAGGAAACAGGAACAAG AD-14050 1564 2133-2155 139
UCUGGCUGAAUUUCAGAGCAUCC AD-14051 1657 2027-2049 140
UUGUUGAAAGGGAUGAUGAAAAA AD-14052 1673 2132-2154 141
UUCUGGCUGAAUUUCAGAGCAUC AD-14053 1648 1926-1948 142
AUUUCUGAUUAUUGUGACAUCAA AD-14054 1703 2437-2459 143
GAAGAAGGAAACAGGAACAAGUG AD-14055 1647 1925-1947 144
CAUUUCUGAUUAUUGUGACAUCA
TABLE-US-00002 TABLE 2 Sense and Antisense sequences of duplex
dsRNAs Sense Antisense SEQ strand sequence SEQ strand sequence
Duplex ID (5' to 3') Double ID (5' to 3') Double Name NO: Name
overhang design NO: Name overhang design AD-14008 1 A22737
GAAuAAAAAccGuuAuGuuTsT 2 A22738 AAcAuAACGGUUUUuAUUCTsT AD-14009 3
A22739 AAccGuuAuGuuGAcAuucTsT 4 A22740 GAAUGUcAAcAuAACGGUUTsT
AD-14010 5 A22741 ucuGAuuAuuGuGAcAucATsT 6 A22742
UGAUGUcAcAAuAAUcAGATsT AD-14011 7 A22743 AAAAAccGuuAuGuuGAcATsT 8
A22744 UGUcAAcAuAACGGUUUUUTsT AD-14012 9 A22745
AcccAGGAAAuAcAuuGcuTsT 10 A22746 AGcAAUGuAUUUCCUGGGUTsT AD-14013 11
A22747 cAGAAuAAAAAccGuuAuGTsT 12 A22748 cAuAACGGUUUUuAUUCUGTsT
AD-14014 13 A22749 AGAAuAAAAAccGuuAuGuTsT 14 A22750
AcAuAACGGUUUUuAUUCUTsT AD-14015 15 A22751 cAGuuAuuGucAuGGucAcTsT 16
A22752 GUGACcAUGAcAAuAACUGTsT AD-14016 17 A22753
AAuAAAAAccGuuAuGuuGTsT 18 A22754 cAAcAuAACGGUUUUuAUUTsT AD-14017 19
A22755 cAGGAAAuAcAuuGcuGcATsT 20 A22756 UGcAGcAAUGuAUUUCCUGTsT
AD-14018 21 A22757 AAAccGuuAuGuuGAcAuuTsT 22 A22758
AAUGUcAAcAuAACGGUUUTsT AD-14019 23 A22759 AAAAccGuuAuGuuGAcAuTsT 24
A22760 AUGUcAAcAuAACGGUUUUTsT AD-14020 25 A22761
ccGuuAuGuuGAcAuucuuTsT 26 A22762 AAGAAUGUcAAcAuAACGGTsT AD-14021 27
A22763 AccGuuAuGuuGAcAuucuTsT 28 A22764 AGAAUGUcAAcAuAACGGUTsT
AD-14022 29 A22765 uAAAAAccGuuAuGuuGAcTsT 30 A22766
GUcAAcAuAACGGUUUUuATsT AD-14023 31 A22767 cGuuAuGuuGAcAuucuucTsT 32
A22768 GAAGAAUGUcAAcAuAACGTsT AD-14024 33 A22769
AcAGuuAuuGucAuGGucATsT 34 A22770 UGACcAUGAcAAuAACUGUTsT AD-14025 35
A22771 uGAuuAuuGuGAcAucAAuTsT 36 A22772 AUUGAUGUcAcAAuAAUcATsT
AD-14026 37 A22773 GAuuAuuGuGAcAucAAuATsT 38 A22774
uAUUGAUGUcAcAAuAAUCTsT AD-14027 39 A22775 AGGAAAuAcAuuGcuGcAcTsT 40
A22776 GUGcAGcAAUGuAUUUCCUTsT AD-14028 41 A22777
uuGAAAGGGAuGAuGAAAATsT 42 A22778 UUUUcAUcAUCCCUUUcAATsT AD-14029 43
A22779 AuAAAAAccGuuAuGuuGATsT 44 A22780 UcAAcAuAACGGUUUUuAUTsT
AD-14030 45 A22781 cuGAuuAuuGuGAcAucAATsT 46 A22782
UUGAUGUcAcAAuAAUcAGTsT AD-14031 47 A22783 cccAGGAAAuAcAuuGcuGTsT 48
A22784 cAGcAAUGuAUUUCCUGGGTsT AD-14032 49 A22785
GGAAAuAcAuuGcuGcAcATsT 50 A22786 UGUGcAGcAAUGuAUUUCCTsT AD-14033 51
A22787 cAcAGuuAuuGucAuGGucTsT 52 A22788 GACcAUGAcAAuAACUGUGTsT
AD-14034 53 A22789 AAGAAGGAAAcAGGAAcAATsT 54 A22790
UuGUUCCuGUUUCCUUCUUTsT AD-14035 55 A22791 AuuAuuGuGAcAucAAuAGTsT 56
A22792 CuAUUGAUGUcAcAAuAAUTsT AD-14036 57 A22793
ccAGGAAAuAcAuuGcuGcTsT 58 A22794 GcAGcAAUGuAUUUCCUGGTsT AD-14037 59
A22795 AuGuGAAGAAGGAAAcAGGTsT 60 A22796 CCUGUUUCCUUCUUcAcAUTsT
AD-14038 61 A22797 uuAuuGuGAcAucAAuAGcTsT 62 A22798
GCuAUUGAUGUcAcAAuAATsT AD-14039 63 A22799 GAAcccAGGAAAuAcAuuGTsT 64
A22800 cAAUGuAUUUCCUGGGUUCTsT AD-14040 65 A22801
AAcccAGGAAAuAcAuuGcTsT 66 A22802 GcAAUGuAUUUCCUGGGUUTsT AD-14041 67
A22803 GccAcAGuuAuuGucAuGGTsT 68 A22804 CcAUGAcAAuAACUGUGGCTsT
AD-14042 69 A22805 cGAuGuGAAGAAGGAAAcATsT 70 A22806
UGUUUCCUUCUUcAcAUCGTsT AD-14043 71 A22807 GAuGuGAAGAAGGAAAcAGTsT 72
A22808 CUGUUUCCUUCUUcAcAUCTsT AD-14044 73 A22809
uGuGAAGAAGGAAAcAGGATsT 74 A22810 UCCUGUUUCCUUCUUcAcATsT AD-14045 75
A22811 GuGAAGAAGGAAAcAGGAATsT 76 A22812 UUCCUGUUUCCUUCUUcACTsT
AD-14046 77 A22813 GuuAuGuuGAcAuucuuccTsT 78 A22814
GGAAGAAUGUcAAcAuAACTsT AD-14047 79 A22815 ccAcAGuuAuuGucAuGGuTsT 80
A22816 ACcAUGAcAAuAACUGUGGTsT AD-14048 81 A22817
AAGGAAAcAGGAAcAAGuGTsT 82 A22818 cACUUGUUCCUGUUUCCUUTsT AD-14049 83
A22819 GAAGAAGGAAAcAGGAAcATsT 84 A22820 uGUUCCuGUUUCCUUCUUCTsT
AD-14050 85 A22821 uGGcuGAAuuucAGAGcAuTsT 86 A22822
AUGCUCUGAAAUUcAGCcATsT AD-14051 87 A22823 GuuGAAAGGGAuGAuGAAATsT 88
A22824 UUUcAUcAUCCCUUUcAACTsT AD-14052 89 A22825
cuGGcuGAAuuucAGAGcATsT 90 A22826 UGCUCUGAAAUUcAGCcAGTsT AD-14053 91
A22827 uucuGAuuAuuGuGAcAucTsT 92 A22828 GAUGUcAcAAuAAUcAGAATsT
AD-14054 93 A22829 AGAAGGAAAcAGGAAcAAGTsT 94 A22830
CUuGUUCCuGUUUCCUUCUTsT AD-14055 95 A22831 uuucuGAuuAuuGuGAcAuTsT 96
A22832 AUGUcAcAAuAAUcAGAAATsT
TABLE-US-00003 TABLE 3 Efficacy of duplex dsRNAs IC80 Duplex
Percent IC20 (nM) IC50 (nM) (nM) IC20 (nM) IC50 (nM) IC80 (nM) Name
Inhibition.sup.a SD.sup.b (FACS) (FACS) (FACS) (bDNA) (bDNA) (bDNA)
AD-14008 86% 1% 0.8895931 #N/A #N/A 0.03996853 0.2361971 #N/A
AD-14009 34% 2% AD-14010 38% 3% AD-14011 11% 4% AD-14012 62% 5%
AD-14013 60% 1% AD-14014 10% 8% AD-14015 71% 3% AD-14016 16% 10%
AD-14017 46% 6% AD-14018 84% 0% 0.01773181 0.12385771 #N/A AD-14019
50% 6% AD-14020 75% 3% AD-14021 83% 5% 0.05351334 0.28749645 #N/A
0.00767305 0.06871733 3.50954466 AD-14022 18% 9% AD-14023 82% 3%
0.16806395 1.15022087 #N/A 0.01854289 0.18153564 42.4598925
AD-14024 45% 8% AD-14025 72% 3% AD-14026 68% 4% AD-14027 20% 2%
AD-14028 79% 3% 0.04248737 0.28602921 #N/A AD-14029 54% 1% AD-14030
74% 3% AD-14031 79% 4% 0.6082823 1.9630781 #N/A AD-14032 61% 10%
AD-14033 23% 6% AD-14034 55% 4% AD-14035 25% 0% AD-14036 63% 2%
AD-14037 78% 7% AD-14038 12% 1% AD-14039 33% 5% AD-14040 17% 3%
AD-14041 32% 0% AD-14042 78% 4% 0.00990567 0.08334966 #N/A AD-14043
44% 5% AD-14044 59% 6% AD-14045 58% 4% AD-14046 50% 5% AD-14047 65%
2% AD-14048 12% 4% AD-14049 72% 2% AD-14050 52% 9% AD-14051 64% 3%
AD-14052 89% 4% 0.06652968 0.30445773 #N/A 0.00543153 0.04500437
1.02650598 AD-14053 78% 3% 0.01679891 0.14666108 #N/A AD-14054 70%
8% AD-14055 26% 3% .sup.aPercent inhibition of CD45 expression
(relative to irrelevant control siRNA-treated cells; mean of three
screens); by bDNA assay, 50 nM in P388D1. .sup.bStandard Deviation
(mean of three screens)
TABLE-US-00004 TABLE 4 Exemplary unmodified dsRNAs targeting CD45.
position of Sense Antisense 5' base on SEQ strand sequence SEQ
strand sequence transcript ID (5' to 3') Double ID (5' to 3')
Double NM_002838.2 NO: overhang Design NO: overhang design 2208 147
GAAUAAAAACCGUUAUGUU 148 AACAUAACGGUUUUUAUUC 2215 149
AACCGUUAUGUUGACAUUC 150 GAAUGUCAACAUAACGGUU 1929 151
UCUGAUUAUUGUGACAUCA 152 UGAUGUCACAAUAAUCAGA 2212 153
AAAAACCGUUAUGUUGACA 154 UGUCAACAUAACGGUUUUU 2328 155
ACCCAGGAAAUACAUUGCU 156 AGCAAUGUAUUUCCUGGGU 2206 157
CAGAAUAAAAACCGUUAUG 158 CAUAACGGUUUUUAUUCUG 2207 159
AGAAUAAAAACCGUUAUGU 160 ACAUAACGGUUUUUAUUCU 2411 161
CAGUUAUUGUCAUGGUCAC 162 GUGACCAUGACAAUAACUG 2209 163
AAUAAAAACCGUUAUGUUG 164 CAACAUAACGGUUUUUAUU 2331 165
CAGGAAAUACAUUGCUGCA 166 UGCAGCAAUGUAUUUCCUG 2214 167
AAACCGUUAUGUUGACAUU 168 AAUGUCAACAUAACGGUUU 2213 169
AAAACCGUUAUGUUGACAU 170 AUGUCAACAUAACGGUUUU 2217 171
CCGUUAUGUUGACAUUCUU 172 AAGAAUGUCAACAUAACGG 2216 173
ACCGUUAUGUUGACAUUCU 174 AGAAUGUCAACAUAACGGU 2211 175
UAAAAACCGUUAUGUUGAC 176 GUCAACAUAACGGUUUUUA 2218 177
CGUUAUGUUGACAUUCUUC 178 GAAGAAUGUCAACAUAACG 2410 179
ACAGUUAUUGUCAUGGUCA 180 UGACCAUGACAAUAACUGU 1931 181
UGAUUAUUGUGACAUCAAU 182 AUUGAUGUCACAAUAAUCA 1932 183
GAUUAUUGUGACAUCAAUA 184 UAUUGAUGUCACAAUAAUC 2332 185
AGGAAAUACAUUGCUGCAC 186 GUGCAGCAAUGUAUUUCCU 2030 187
UUGAAAGGGAUGAUGAAAA 188 UUUUCAUCAUCCCUUUCAA 2210 189
AUAAAAACCGUUAUGUUGA 190 UCAACAUAACGGUUUUUAU 1930 191
CUGAUUAUUGUGACAUCAA 192 UUGAUGUCACAAUAAUCAG 2329 193
CCCAGGAAAUACAUUGCUG 194 CAGCAAUGUAUUUCCUGGG 2333 195
GGAAAUACAUUGCUGCACA 196 UGUGCAGCAAUGUAUUUCC 2409 197
CACAGUUAUUGUCAUGGUC 198 GACCAUGACAAUAACUGUG 2438 199
AAGAAGGAAACAGGAACAA 200 UUGUUCCUGUUUCCUUCUU 1933 201
AUUAUUGUGACAUCAAUAG 202 CUAUUGAUGUCACAAUAAU 2330 203
CCAGGAAAUACAUUGCUGC 204 GCAGCAAUGUAUUUCCUGG 2433 205
AUGUGAAGAAGGAAACAGG 206 CCUGUUUCCUUCUUCACAU 1934 207
UUAUUGUGACAUCAAUAGC 208 GCUAUUGAUGUCACAAUAA 2326 209
GAACCCAGGAAAUACAUUG 210 CAAUGUAUUUCCUGGGUUC 2327 211
AACCCAGGAAAUACAUUGC 212 GCAAUGUAUUUCCUGGGUU 2407 213
GCCACAGUUAUUGUCAUGG 214 CCAUGACAAUAACUGUGGC 2431 215
CGAUGUGAAGAAGGAAACA 216 UGUUUCCUUCUUCACAUCG 2432 217
GAUGUGAAGAAGGAAACAG 218 CUGUUUCCUUCUUCACAUC 2434 219
UGUGAAGAAGGAAACAGGA 220 UCCUGUUUCCUUCUUCACA 2435 221
GUGAAGAAGGAAACAGGAA 222 UUCCUGUUUCCUUCUUCAC 2219 223
GUUAUGUUGACAUUCUUCC 224 GGAAGAAUGUCAACAUAAC 2408 225
CCACAGUUAUUGUCAUGGU 226 ACCAUGACAAUAACUGUGG 2441 227
AAGGAAACAGGAACAAGUG 228 CACUUGUUCCUGUUUCCUU 2437 229
GAAGAAGGAAACAGGAACA 230 UGUUCCUGUUUCCUUCUUC 2135 231
UGGCUGAAUUUCAGAGCAU 232 AUGCUCUGAAAUUCAGCCA 2029 233
GUUGAAAGGGAUGAUGAAA 234 UUUCAUCAUCCCUUUCAAC 2134 235
CUGGCUGAAUUUCAGAGCA 236 UGCUCUGAAAUUCAGCCAG 1928 237
UUCUGAUUAUUGUGACAUC 238 GAUGUCACAAUAAUCAGAA 2439 239
AGAAGGAAACAGGAACAAG 240 CUUGUUCCUGUUUCCUUCU 1927 241
UUUCUGAUUAUUGUGACAU 242 AUGUCACAAUAAUCAGAAA Exemplary dsRNAs having
NN-dinucleotide overhangs and targeting CD45. position of Sense
Antisense 5' base on SEQ strand sequence SEQ strand sequence
transcript ID (5' to 3') Double ID (5' to 3') Double NM_002838.2
NO: overhang Design NO: overhang design 2208 243
GAAUAAAAACCGUUAUGUUNN 244 AACAUAACGGUUUUUAUUCNN 2215 245
AACCGUUAUGUUGACAUUCNN 246 GAAUGUCAACAUAACGGUUNN 1929 247
UCUGAUUAUUGUGACAUCANN 248 UGAUGUCACAAUAAUCAGANN 2212 249
AAAAACCGUUAUGUUGACANN 250 UGUCAACAUAACGGUUUUUNN 2328 251
ACCCAGGAAAUACAUUGCUNN 252 AGCAAUGUAUUUCCUGGGUNN 2206 253
CAGAAUAAAAACCGUUAUGNN 254 CAUAACGGUUUUUAUUCUGNN 2207 255
AGAAUAAAAACCGUUAUGUNN 256 ACAUAACGGUUUUUAUUCUNN 2411 257
CAGUUAUUGUCAUGGUCACNN 258 GUGACCAUGACAAUAACUGNN 2209 259
AAUAAAAACCGUUAUGUUGNN 260 CAACAUAACGGUUUUUAUUNN 2331 261
CAGGAAAUACAUUGCUGCANN 262 UGCAGCAAUGUAUUUCCUGNN 2214 263
AAACCGUUAUGUUGACAUUNN 264 AAUGUCAACAUAACGGUUUNN 2213 265
AAAACCGUUAUGUUGACAUNN 266 AUGUCAACAUAACGGUUUUNN 2217 267
CCGUUAUGUUGACAUUCUUNN 268 AAGAAUGUCAACAUAACGGNN 2216 269
ACCGUUAUGUUGACAUUCUNN 270 AGAAUGUCAACAUAACGGUNN 2211 271
UAAAAACCGUUAUGUUGACNN 272 GUCAACAUAACGGUUUUUANN 2218 273
CGUUAUGUUGACAUUCUUCNN 274 GAAGAAUGUCAACAUAACGNN 2410 275
ACAGUUAUUGUCAUGGUCANN 276 UGACCAUGACAAUAACUGUNN 1931 277
UGAUUAUUGUGACAUCAAUNN 278 AUUGAUGUCACAAUAAUCANN 1932 279
GAUUAUUGUGACAUCAAUANN 280 UAUUGAUGUCACAAUAAUCNN 2332 281
AGGAAAUACAUUGCUGCACNN 282 GUGCAGCAAUGUAUUUCCUNN 2030 283
UUGAAAGGGAUGAUGAAAANN 284 UUUUCAUCAUCCCUUUCAANN 2210 285
AUAAAAACCGUUAUGUUGANN 286 UCAACAUAACGGUUUUUAUNN 1930 287
CUGAUUAUUGUGACAUCAANN 288 UUGAUGUCACAAUAAUCAGNN 2329 289
CCCAGGAAAUACAUUGCUGNN 290 CAGCAAUGUAUUUCCUGGGNN 2333 291
GGAAAUACAUUGCUGCACANN 292 UGUGCAGCAAUGUAUUUCCNN 2409 293
CACAGUUAUUGUCAUGGUCNN 294 GACCAUGACAAUAACUGUGNN 2438 295
AAGAAGGAAACAGGAACAANN 296 UUGUUCCUGUUUCCUUCUUNN 1933 297
AUUAUUGUGACAUCAAUAGNN 298 CUAUUGAUGUCACAAUAAUNN 2330 299
CCAGGAAAUACAUUGCUGCNN 300 GCAGCAAUGUAUUUCCUGGNN 2433 301
AUGUGAAGAAGGAAACAGGNN 302 CCUGUUUCCUUCUUCACAUNN 1934 303
UUAUUGUGACAUCAAUAGCNN 304 GCUAUUGAUGUCACAAUAANN 2326 305
GAACCCAGGAAAUACAUUGNN 306 CAAUGUAUUUCCUGGGUUCNN 2327 307
AACCCAGGAAAUACAUUGCNN 308 GCAAUGUAUUUCCUGGGUUNN 2407 309
GCCACAGUUAUUGUCAUGGNN 310 CCAUGACAAUAACUGUGGCNN 2431 311
CGAUGUGAAGAAGGAAACANN 312 UGUUUCCUUCUUCACAUCGNN 2432 313
GAUGUGAAGAAGGAAACAGNN 314 CUGUUUCCUUCUUCACAUCNN 2434 315
UGUGAAGAAGGAAACAGGANN 316 UCCUGUUUCCUUCUUCACANN 2435 317
GUGAAGAAGGAAACAGGAANN 318 UUCCUGUUUCCUUCUUCACNN 2219 319
GUUAUGUUGACAUUCUUCCNN 320 GGAAGAAUGUCAACAUAACNN 2408 321
CCACAGUUAUUGUCAUGGUNN 322 ACCAUGACAAUAACUGUGGNN 2441 323
AAGGAAACAGGAACAAGUGNN 324 CACUUGUUCCUGUUUCCUUNN 2437 325
GAAGAAGGAAACAGGAACANN 326 UGUUCCUGUUUCCUUCUUCNN 2135 327
UGGCUGAAUUUCAGAGCAUNN 328 AUGCUCUGAAAUUCAGCCANN 2029 329
GUUGAAAGGGAUGAUGAAANN 330 UUUCAUCAUCCCUUUCAACNN 2134 331
CUGGCUGAAUUUCAGAGCANN 332 UGCUCUGAAAUUCAGCCAGNN 1928 333
UUCUGAUUAUUGUGACAUCNN 334 GAUGUCACAAUAAUCAGAANN 2439 335
AGAAGGAAACAGGAACAAGNN 336 CUUGUUCCUGUUUCCUUCUNN 1927 337
UUUCUGAUUAUUGUGACAUNN 338 AUGUCACAAUAAUCAGAAANN
[0185] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the invention,
suitable methods and materials are described below. All
publications, patent applications, patents, and other references
mentioned herein are incorporated by reference in their entirety.
In case of conflict, the present specification, including
definitions, will control. In addition, the materials, methods, and
examples are illustrative only and not intended to be limiting.
EXAMPLES
Example 1
In Silico Selection of siRNAs Targeting CD45
[0186] siRNA design was carried out to identify siRNAs targeting
CD45 (also known PTPRC, B220, CD45, GP180, LCA, LY5, and T200).
Human mRNA sequences to CD45, RefSeq ID number: NM.sub.--002838.3,
NM.sub.--080921.2, NM.sub.--080922.2, NM.sub.--080923.2, Y00062.1,
Y00638.1, BC014239.2, BC017863.1, BC031525.1, BC121086.1,
BC121087.1, BC127656.1, BC127657.1, AY429565.1, AY567999.1,
AK130573.1, DA670254.1, DA948670.1, AY429566.1, and CR621867.1 were
used. Mouse mRNA sequences to CD45, RefSeq ID number:
NM.sub.--011210.2, AK054056.1, AK088215.1, AK154893.1, AK171802.1,
BC028512.1, EF101553.1, L36091.1, M11934.1, M14342.1, M14343.1,
M15174.1, M17320.1, and M92933.1 were used. Rhesus monkey mRNA
sequence to CD45, RefSeqID number; XR.sub.--012672.1 was also
used.
[0187] siRNA duplexes cross-reactive to human, mouse and rhesus
CD45 transcripts were designed. Forty-eight duplexes were
synthesized and screened as outlined in Tables 1-3.
[0188] The sequences for human, mouse and partial rhesus CD45 mRNAs
were downloaded from NCBI Nucleotide database and the human
sequence (Human CD45: NM.sub.--002838.3, 5330 bp) was further used
as reference sequence.
[0189] For identification of further rhesus CD45 sequences, a blast
search with the human reference sequence was conducted at NCBI
against the rhesus reference genome. The downloaded rhesus sequence
and the hit regions in the blast hit were assembled to a rhesus
consensus sequence with 91% identity to human CD45 reference
sequence over the full-length.
[0190] All conserved 19mers were extracted from the human mRNA
reference sequence, resulting in the pool of candidate target sites
corresponding to 5312 (sense strand) sequences. Human-mouse-rhesus
cross-reactivity was defined as a prerequisite for in silico
selection of siRNAs out of this candidate pool. As no conserved
regions are present in all human and/or mouse variants, the
criterion for selection was relaxed to cross-reactivity to most
relevant human and mouse CD45 sequences, which we assumed to be
RefSeq sequences as well as other mRNAs for which protein
expression has been described.
[0191] To determine cross-reactivity to human and mouse CD45
variants and rhesus-reactive siRNAs, the presence of each candidate
siRNA target site was searched in the sequences.
[0192] Further, the predicted specificity of the siRNA was used as
criterion for selection out of the pool of human-mouse-rhesus
cross-reactive siRNAs, manifested by targeting human CD45 mRNA
sequences, but not other human mRNAs.
[0193] The specificity of an siRNA can be expressed via its
potential to target other genes, which are referred to as
"off-target genes." For predicting the off-target potential of an
siRNA, the following assumptions were made: (1) off-target
potential of a strand can be deduced from the number and
distribution of mismatches to an off-target; (2) the most relevant
off-target, that is the gene predicted to have the highest
probability to be silenced due to tolerance of mismatches,
determines the off-target potential of the strand; (3) positions 2
to 9 (counting 5' to 3') of a strand (seed region) may contribute
more to off-target potential than the rest of the sequence (that is
non-seed and cleavage site region); (4) positions 10 and 11
(counting 5' to 3') of a strand (cleavage site region) may
contribute more to off-target potential than non-seed region (that
is positions 12 to 18, counting 5' to 3'); (5) positions 1 and 19
of each strand are not relevant for off-target interactions; (6)
off-target potential can be expressed by the off-target score of
the most relevant off-target, calculated based on number and
position of mismatches of the strand to the most homologous region
in the off-target gene considering assumptions 3 to 5; and (7)
off-target potential of antisense and sense strand will be
relevant, whereas potential abortion of sense strand activity by
internal modifications introduced is likely.
[0194] SiRNAs with low off-target potential were defined as
preferable and assumed to be more specific.
[0195] In order to identify human CD45-specific siRNAs, all other
human transcripts that were considered potential off-targets, were
searched for potential target regions for human-mouse-rhesus
cross-reactive 19mer sense strand sequences as well as
complementary antisense strands. For this, the fastA algorithm was
used to determine the most homologous hit region in each sequence
of the human RefSeq database, which we assume to represent the
comprehensive human transcriptome.
[0196] FastA output files were analyzed further by a Perl script to
rank all potential off-targets according to assumptions 3' to 5',
and thus to identify the most relevant off-target gene and its
off-target score.
[0197] The script extracted the following off-target properties for
each 19mer input sequence and each off-target gene to calculate the
off-target score:
[0198] Number of mismatches in non-seed region, number of
mismatches in seed region, and number of mismatches in cleavage
site region.
[0199] The off-target score was calculated by considering
assumptions 3 to 5 as follows:
Off - target score = number of seed mismatches * 10 + number of
cleavage site mismatches * 1.2 + number of non - seed mismatches *
1 ##EQU00002##
[0200] The most relevant off-target gene for each 19mer sequence
was defined as the gene with the lowest off-target score.
Accordingly, the lowest off-target score was defined as
representative for the off-target potential of a strand.
[0201] For the siRNA set in Table 2, cross-reactivity to rhesus,
all human and mouse RefSeq sequences as well as to most variants
with described protein was defined as prerequisite for selection.
Further criterion was an off-target score of 1 or more for the
antisense strand, whereas all sequences containing 4 or more
consecutive G's (poly-G sequences) were excluded. 48
human-mouse-rhesus cross-reactive sequences that do not possess
most-relevant off-targets predicted to be expressed in immune cells
were selected (Tables 1 and 2).
[0202] Table 1 shows CD45 target sequences, Table 2 shows CD45
siRNAs, and Table 3 shows the IC values for the siRNAs tested in a
dose response assay. Table 4 shows exemplary CD45 siRNAs that are
not modified, and Table 5 shows exemplary CD45 siRNAs having
dinucleotide overhangs.
[0203] Nucleic acid sequences are represented below using standard
nomenclature, and specifically the abbreviations of Table 6.
TABLE-US-00005 TABLE 6 Abbreviations of nucleotide monomers used in
nucleic acid sequence representation. It will be understood that
these monomers, when present in an oligonucleotide, are mutually
linked by 5'-3'-phosphodiester bonds. Abbreviation.sup.a
Nucleotide(s) A Adenosine C cytidine G guanosine T thymidine U
uridine N any nucleotide (G, A, C, U, T) a 2'-O-methyladenosine c
2'-O-methylcytidine g 2'-O-methylguanosine u 2'-O-methyluridine dT
2'-deoxythymidine s a phosphorothioate linkage
Example 2
Screening Assay
[0204] 48 human-mouse-rhesus cross-reactive siRNAs were first
screened at 50 nM single dose (three independent screens, each done
in quadruplicate) by bDNA assay in P388D1 cells. For the most
potent siRNAs, dose response was performed by bDNA analysis in
P388D1 to identify the IC20, IC50 and IC80 dose that lowers the
level of CD45 transcript by 20, 50 and 80%, respectively. siRNAs
with the best IC values in the bDNA assay were screened by flow
cytometry to identify the IC20, IC50 and IC80 dose required to
lower the amount of CD45 protein by 20, 50 and 80%,
respectively.
[0205] Cell Line.
[0206] A P388D1 mouse macrophage cell line was obtained from the
American Type Culture Collection (ATCC, Rockville Md., USA; ATCC #
TIB-63) and grown in DMEM containing 10% heat-inactivated fetal
bovine serum (FBS), 4 mM L-glutamine, 1.5 g/L sodium bicarbonate at
37.degree. C. under a 5% CO2/95% air atmosphere at 37.degree.
C.
[0207] Cell Culture, siRNA Transfection.
[0208] P388D1 cells were plated in 24-well plates at
8.times.10.sup.4 cells per well in 0.4 ml growth medium a day
before transfection. P388D1 cells were 80% confluent the day of
siRNA transfection. Before transfection, cells are fed with 0.25 ml
growth medium.
[0209] Prior to adding to cells, 1.5 ml (50 .mu.l per well) Optimem
I (Invitrogen) and 90 .mu.l (3 .mu.l per well) Lipofectamin 2000
(Invitrogen), the amount sufficient for transfection of one 24 well
plate, were combined in a 2 ml Sarstedt tube and incubated for
10-15 minutes at room temperature. The appropriate amount of siRNA
dissolved in transfection buffer is then added to the
Optimem/lipofectamine 2000 mixture to give the desired final
concentration, mixed, and incubated an additional 15-25 minutes at
room temperature. 50 .mu.l of the siRNA/reagent complex was then
added dropwise to each well as dictated by the experimental design.
Plates were then gently rocked to ensure complete mixing and
incubated at 37.degree. C. at 5% CO.sub.2/95% air for 48 hours. The
cells were lysed and CD45 mRNA transcript was quantitated in
relation to a house-keeping gene transcript by branched DNA (bDNA)
assay. CD45 protein expression level was determined by flow
cytometry, for this assay cells were harvested by pipetting without
lysing.
[0210] siRNA to CD45 Silenced CD45 in Mouse Macrophages In Vivo
[0211] C57B1/6J mice (Jackson Labs) were injected intraperitoneally
with 1 mL of 4% Brewers thioglycollate medium (Difco) 3 days prior
to injecting 10 mg/kg of 98N12-5 formulated siCD45 or siGFP i.p. (4
mice per group). The thioglycollate acted as a sterile inflammation
stimulus. Peritoneal lavage was collected 4 days later and stained
with fluorophore conjugated antibodies to CD11b, Gr1 and CD45 (BD
Biosciences). Flow cytometry samples were run on the LSRII flow
cytometer (BD Biosciences) and FlowJo software (Treestar) was used
to identify the CD11b.sup.high Gr1.sup.low macrophage population
and quantify CD45 expression. A 65% reduction of CD45 protein
expression was observed in the peritoneal macrophage population
when treated with the formulated CD45 siRNA (FIG. 1). Two
independent dose response experiments were conducted examining the
effect of 0.6-15.0 mg/kg administration of 98N12-5 formulated
siCD45 or siGFP i.p. (2-3 mice per group). These experiments were
conducted identically to those described above and demonstrated
effective specific in vivo silencing of CD45 protein expression at
all concentrations tested when treated with the formulated CD45
siRNA (FIG. 1, top panel). The 98N12-5 formulation is a lipidoid
synthesized by addition of acrylamides or acrylates to amines.
[0212] The sequences for the sense and antisense strands of the
CD45 siRNA are as follows.
TABLE-US-00006 sense 5'-cuGGcuGAAuuucAGAGcATsT-3' (SEQ ID NO: 89
single strand # A22825) antisense 5'-UGCUCUGAAAUUcAGCcAGTsT-3' (SEQ
ID NO: 90 single strand #_A22826) The siGFP sequences are as
follows: sense (SEQ ID NO: 145) 5'-CcAcAuGAAGcAGcACGACusU-3'
(single strand # AL4545) antisense (SEQ ID NO: 146)
5'-AAGUCGUGCUGCUUCAUGUGgsusC-3' (single strand # AL4381)
[0213] 2'-O-Me modified nucleotides are in lower case, and
phosphorothioate linkages are represented by an "s". siRNAs were
generated by annealing equimolar amounts of complementary sense and
antisense strands.
[0214] All procedures used in animal studies were approved by the
Institutional Animal Care and Use Committee (IACUC) and were
consistent with local, state, and federal regulations as
applicable.
[0215] Lipidoid-based siRNA formulations included lipidoid,
cholesterol, poly(ethylene glycol)-lipid (PEG-lipid), and siRNA.
Formulations were prepared using a protocol similar to that
described by Semple and colleagues (Maurer et al. Biophys. J.
80:2310-2326, 2001; Semple et al., Biochim. Biophys. Acta
1510:152-166, 2001). Stock solutions of 98N12-5(1).4HCl MW 1489,
mPEG2000-Ceramide C16 (Avanti Polar Lipids) MW 2634 or mPEG2000-DMG
MW 2660, and cholesterol MW 387 (Sigma-Aldrich) were prepared in
ethanol and mixed to yield a molar ratio of 42:10:48. Mixed lipids
were added to 125 mM sodium acetate buffer pH 5.2 to yield a
solution containing 35% ethanol, resulting in spontaneous formation
of empty lipidoid nanoparticles. Resulting nanoparticles were
extruded through a 0.08.mu. membrane (2 passes). siRNA in 35%
ethanol and 50 mM sodium acetate pH 5.2 was added to the
nanoparticles at 1:7.5 (wt:wt) siRNA:total lipids and incubated at
37.degree. C. for 30 min. Ethanol removal and buffer exchange of
siRNA-containing lipidoid nanoparticles was achieved by tangential
flow filtration against phosphate buffered saline using a 100,000
MWCO membrane. Finally, the formulation was filtered through a
0.2.mu. sterile filter. Particle size was determined using a
Malvern Zetasizer NanoZS (Malvern, UK). siRNA content was
determined by UV absorption at 260 nm and siRNA entrapment
efficiency was determined by Ribogreen assay 32. Resulting
particles had a mean particle diameter of approximately 50 nm, with
peak width of 20 nm, and siRNA entrapment efficiency of >95%.
See also PCT/US2007/080331.
Example 3
Bone Marrow-Derived Macrophage Transfection
[0216] Murine bone marrow derived macrophages were cultured
according to standard protocol (Cunnick et al., J. Immunol. Methods
311:96-105, 2006). Cells were cultured in 12-well dishes for five
days in the presence of 8 ng/mL of M-CSF. The optimal siRNA to
lipidoid ratio was determined for each lipidoid (a ratio of either
5 or 10 wt:wt was used). Mixtures of irrelevant control siRNA or
siCD45 (SEQ ID NOs:89 and 90, above) with lipidoids were prepared
as described above. siRNA-lipidoid mixtures were added to
macrophage cultures at the desired concentrations for 6 hours.
Media was exchanged and GFP expression was analyzed by flow
cytometry five days later. The formulated CD45 siRNA were shown to
effectively silence primary murine bone marrow-derived macrophages
with 65% protein reduction (FIG. 2)
Example 4
CD45 as a Cellular Protein Target that Regulates Infection from a
Broad Range of Pathogens
[0217] CD45 mitigates viral and bacterial infections.
Genetically-modified mice with reduced expression level of CD45
were protected from B. anthracis, influenza, and Ebola (see FIG.
3). Given the ability of formulated CD45 siRNA to inhibit CD45
expression in vitro and in vivo by up to 65%, it is notable that
significant protective effects against lethal Ebola challenge were
seen in genetically-modified mice when CD45 expression was reduced
by 11-65% (FIG. 3).
Example 5
CD45 siRNA Silenced CD45 Expression in Human Cells In Vitro
[0218] The human acute myelogenous leukemia cell line, KG-1, was
cultured according to standard protocol. Cells were plated into 96
wells and then untreated or treated with CD45 siRNA-lipidoid
mixtures (as outlined for FIGS. 1 and 2) at the desired
concentrations for 6 hours. Media was exchanged and CD45 expression
was analyzed by flow cytometry four days later. The liposomally
formulated CD45 siRNA were shown to effectively silence in human
cells in vitro (FIG. 4). These results are consistent with the fact
that the CD45 siRNA has 100% sequence identity to human and rodent
CD45 and was shown to be active in reducing murine CD45 in vitro
and in vivo (Table 3; FIGS. 1 and 2).
Example 6
dsRNA Synthesis
[0219] Source of Reagents
[0220] Where the source of a reagent is not specifically given
herein, such reagent may be obtained from any supplier of reagents
for molecular biology at a quality/purity standard for application
in molecular biology.
[0221] siRNA synthesis
[0222] Single-stranded RNAs were produced by solid phase synthesis
on a scale of 1 .mu.mole using an Expedite 8909 synthesizer
(Applied Biosystems, Applera Deutschland GmbH, Darmstadt, Germany)
and controlled pore glass (CPG, 500 .ANG., Proligo Biochemie GmbH,
Hamburg, Germany) as solid support. RNA and RNA containing
2'-O-methyl nucleotides were generated by solid phase synthesis
employing the corresponding phosphoramidites and 2'-O-methyl
phosphoramidites, respectively (Proligo Biochemie GmbH, Hamburg,
Germany). These building blocks were incorporated at selected sites
within the sequence of the oligoribonucleotide chain using standard
nucleoside phosphoramidite chemistry such as described in Current
protocols in nucleic acid chemistry, Beaucage, S. L. et al.
(Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA.
Phosphorothioate linkages were introduced by replacement of the
iodine oxidizer solution with a solution of the Beaucage reagent
(Chruachem Ltd, Glasgow, UK) in acetonitrile (1%). Further
ancillary reagents were obtained from Mallinckrodt Baker
(Griesheim, Germany).
[0223] Deprotection and purification of the crude
oligoribonucleotides by anion exchange HPLC were carried out
according to established procedures. Yields and concentrations were
determined by UV absorption of a solution of the respective RNA at
a wavelength of 260 nm using a spectral photometer (DU 640B,
Beckman Coulter GmbH, Unterschlei.beta.heim, Germany). Double
stranded RNA was generated by mixing an equimolar solution of
complementary strands in annealing buffer (20 mM sodium phosphate,
pH 6.8; 100 mM sodium chloride), heated in a water bath at
85-90.degree. C. for 3 minutes and cooled to room temperature over
a period of 3-4 hours. The annealed RNA solution was stored at
-20.degree. C. until use.
[0224] For the synthesis of 3'-cholesterol-conjugated siRNAs
(herein referred to as -Chol-3), an appropriately modified solid
support is used for RNA synthesis. The modified solid support is
prepared as follows:
Diethyl-2-azabutane-1,4-dicarboxylate AA
##STR00002##
[0226] A 4.7 M aqueous solution of sodium hydroxide (50 mL) is
added into a stirred, ice-cooled solution of ethyl glycinate
hydrochloride (32.19 g, 0.23 mole) in water (50 mL). Then, ethyl
acrylate (23.1 g, 0.23 mole) is added and the mixture is stirred at
room temperature until completion of the reaction is ascertained by
TLC. After 19 h the solution is partitioned with dichloromethane
(3.times.100 mL). The organic layer is dried with anhydrous sodium
sulfate, filtered and evaporated. The residue is distilled to
afford AA (28.8 g, 61%).
3-{Ethoxycarbonylmethyl-[6-(9H-fluoren-9-ylmethoxycarbonyl-amino)-hexanoyl-
]-amino}-propionic acid ethyl ester AB
##STR00003##
[0228] Fmoc-6-amino-hexanoic acid (9.12 g, 25.83 mmol) is dissolved
in dichloromethane (50 mL) and cooled with ice.
Diisopropylcarbodiimde (3.25 g, 3.99 mL, 25.83 mmol) is added to
the solution at 0.degree. C. It is then followed by the addition of
Diethyl-azabutane-1,4-dicarboxylate (5 g, 24.6 mmol) and
dimethylamino pyridine (0.305 g, 2.5 mmol). The solution is brought
to room temperature and stirred further for 6 h. Completion of the
reaction is ascertained by TLC. The reaction mixture is
concentrated under vacuum and ethyl acetate is added to precipitate
diisopropyl urea. The suspension is filtered. The filtrate is
washed with 5% aqueous hydrochloric acid, 5% sodium bicarbonate and
water. The combined organic layer is dried over sodium sulfate and
concentrated to give the crude product which is purified by column
chromatography (50% EtOAC/Hexanes) to yield 11.87 g (88%) of
AB.
3-[(6-Amino-hexanoyl)-ethoxycarbonylmethyl-amino]-propionic acid
ethyl ester AC
##STR00004##
[0230]
3-{Ethoxycarbonylmethyl-[6-(9H-fluoren-9-ylmethoxycarbonylamino)-he-
xanoyl]-amino}-propionic acid ethyl ester AB (11.5 g, 21.3 mmol) is
dissolved in 20% piperidine in dimethylformamide at 0.degree. C.
The solution is continued stirring for 1 h. The reaction mixture is
concentrated under vacuum, water is added to the residue, and the
product is extracted with ethyl acetate. The crude product is
purified by conversion into its hydrochloride salt.
3-({6-[17-(1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,1-
5,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxycarbonylamino]-h-
exanoyl}ethoxycarbonylmethyl-amino)-propionic acid ethyl ester
AD
##STR00005##
[0232] The hydrochloride salt of
3-[(6-Amino-hexanoyl)-ethoxycarbonylmethyl-amino]-propionic acid
ethyl ester AC (4.7 g, 14.8 mmol) is taken up in dichloromethane.
The suspension is cooled to 0.degree. C. on ice. To the suspension
diisopropylethylamine (3.87 g, 5.2 mL, 30 mmol) is added. To the
resulting solution cholesteryl chloroformate (6.675 g, 14.8 mmol)
is added. The reaction mixture is stirred overnight. The reaction
mixture is diluted with dichloromethane and ished with 10%
hydrochloric acid. The product is purified by flash chromatography
(10.3 g, 92%).
1-{6-[17-(1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15-
,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxycarbonylamino]-he-
xanoyl}-4-oxo-pyrrolidine-3-carboxylic acid ethyl ester AE
##STR00006##
[0234] Potassium t-butoxide (1.1 g, 9.8 mmol) is slurried in 30 mL
of dry toluene. The mixture is cooled to 0.degree. C. on ice and 5
g (6.6 mmol) of diester AD is added slowly with stirring within 20
mins. The temperature is kept below 5.degree. C. during the
addition. The stirring is continued for 30 mins at 0.degree. C. and
1 mL of glacial acetic acid is added, immediately followed by 4 g
of NaH.sub.2PO.sub.4.H.sub.2O in 40 mL of water The resultant
mixture is extracted twice with 100 mL of dichloromethane each and
the combined organic extracts are washed twice with 10 mL of
phosphate buffer each, dried, and evaporated to dryness. The
residue is dissolved in 60 mL of toluene, cooled to 0.degree. C.
and extracted with three 50 mL portions of cold pH 9.5 carbonate
buffer. The aqueous extracts are adjusted to pH 3 with phosphoric
acid, and extracted with five 40 mL portions of chloroform which
are combined, dried and evaporated to dryness. The residue is
purified by column chromatography using 25% ethylacetate/hexane to
afford 1.9 g of b-ketoester (39%).
[6-(3-Hydroxy-4-hydroxymethyl-pyrrolidin-1-yl)-6-oxo-hexyl]-carbamic
acid
17-(1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,1-
7-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester AF
##STR00007##
[0236] Methanol (2 mL) is added dropwise over a period of 1 h to a
refluxing mixture of b-ketoester AE (1.5 g, 2.2 mmol) and sodium
borohydride (0.226 g, 6 mmol) in tetrahydrofuran (10 mL). Stirring
is continued at reflux temperature for 1 h. After cooling to room
temperature, 1 N HCl (12.5 mL) is added, the mixture is extracted
with ethylacetate (3.times.40 mL). The combined ethylacetate layer
is dried over anhydrous sodium sulfate and concentrated under
vacuum to yield the product which is purified by column
chromatography (10% MeOH/CHCl.sub.3) (89%).
(6-{3-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-pyrrolidin-1-
-yl}-6-oxo-hexyl)-carbamic acid
17-(1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,1-
7-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester AG
##STR00008##
[0238] Diol AF (1.25 gm 1.994 mmol) is dried by evaporating with
pyridine (2.times.5 mL) in vacuo. Anhydrous pyridine (10 mL) and
4,4'-dimethoxytritylchloride (0.724 g, 2.13 mmol) are added with
stirring. The reaction is carried out at room temperature
overnight. The reaction is quenched by the addition of methanol.
The reaction mixture is concentrated under vacuum and to the
residue dichloromethane (50 mL) is added. The organic layer is
washed with 1M aqueous sodium bicarbonate. The organic layer is
dried over anhydrous sodium sulfate, filtered and concentrated. The
residual pyridine is removed by evaporating with toluene. The crude
product is purified by column chromatography (2% MeOH/Chloroform,
Rf=0.5 in 5% MeOH/CHCl.sub.3) (1.75 g, 95%).
[0239] Succinic acid
mono-(4-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-1-{6-[17-(1,5-dimet-
hyl-hexyl)-10,13-dimethyl
2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H
cyclopenta[a]phenanthren-3-yloxycarbonylamino]-hexanoyl}-pyrrolidin-3-yl)-
ester AH
##STR00009##
[0240] Compound AG (1.0 g, 1.05 mmol) is mixed with succinic
anhydride (0.150 g, 1.5 mmol) and DMAP (0.073 g, 0.6 mmol) and
dried in a vacuum at 40.degree. C. overnight. The mixture is
dissolved in anhydrous dichloroethane (3 mL), triethylamine (0.318
g, 0.440 mL, 3.15 mmol) is added and the solution is stirred at
room temperature under argon atmosphere for 16 h. It is then
diluted with dichloromethane (40 mL) and washed with ice cold
aqueous citric acid (5 wt %, 30 mL) and water (2.times.20 mL). The
organic phase is dried over anhydrous sodium sulfate and
concentrated to dryness. The residue is used as such for the next
step.
Cholesterol Derivatised CPG AI
##STR00010##
[0242] Succinate AH (0.254 g, 0.242 mmol) is dissolved in a mixture
of dichloromethane/acetonitrile (3:2, 3 mL). To that solution DMAP
(0.0296 g, 0.242 mmol) in acetonitrile (1.25 mL),
2,2'-Dithio-bis(5-nitropyridine) (0.075 g, 0.242 mmol) in
acetonitrile/dichloroethane (3:1, 1.25 mL) are added successively.
To the resulting solution triphenylphosphine (0.064 g, 0.242 mmol)
in acetonitrile (0.6 ml) is added. The reaction mixture turned
bright orange in color. The solution is agitated briefly using a
wrist-action shaker (5 mins). Long chain alkyl amine-CPG (LCAA-CPG)
(1.5 g, 61 mM) is added. The suspension is agitated for 2 h. The
CPG is filtered through a sintered funnel and washed with
acetonitrile, dichloromethane and ether successively. Unreacted
amino groups are masked using acetic anhydride/pyridine. The
achieved loading of the CPG is measured by taking UV measurement
(37 mM/g).
[0243] The synthesis of siRNAs bearing a 5'-12-dodecanoic acid
bisdecylamide group (herein referred to as "5'-C32-") or a
5'-cholesteryl derivative group (herein referred to as "5'-Chol-")
is performed as described in WO 2004/065601, except that, for the
cholesteryl derivative, the oxidation step is performed using the
Beaucage reagent in order to introduce a phosphorothioate linkage
at the 5'-end of the nucleic acid oligomer.
[0244] Other embodiments are in the claims.
Sequence CWU 1
1
341121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 1gaauaaaaac cguuauguut t
21221DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 2aacauaacgg uuuuuauuct t
21321DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 3aaccguuaug uugacauuct t
21421DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 4gaaugucaac auaacgguut t
21521DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 5ucugauuauu gugacaucat t
21621DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 6ugaugucaca auaaucagat t
21721DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 7aaaaaccguu auguugacat t
21821DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 8ugucaacaua acgguuuuut t
21921DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic oligonucleotide 9acccaggaaa uacauugcut t
211021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 10agcaauguau uuccugggut t
211121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 11cagaauaaaa accguuaugt t
211221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 12cauaacgguu uuuauucugt t
211321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 13agaauaaaaa ccguuaugut t
211421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 14acauaacggu uuuuauucut t
211521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 15caguuauugu cauggucact t
211621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 16gugaccauga caauaacugt t
211721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 17aauaaaaacc guuauguugt t
211821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 18caacauaacg guuuuuauut t
211921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 19caggaaauac auugcugcat t
212021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 20ugcagcaaug uauuuccugt t
212121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 21aaaccguuau guugacauut t
212221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 22aaugucaaca uaacgguuut t
212321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 23aaaaccguua uguugacaut t
212421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 24augucaacau aacgguuuut t
212521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 25ccguuauguu gacauucuut t
212621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 26aagaauguca acauaacggt t
212721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 27accguuaugu ugacauucut t
212821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 28agaaugucaa cauaacggut t
212921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 29uaaaaaccgu uauguugact t
213021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 30gucaacauaa cgguuuuuat t
213121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 31cguuauguug acauucuuct t
213221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 32gaagaauguc aacauaacgt t
213321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 33acaguuauug ucauggucat t
213421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 34ugaccaugac aauaacugut t
213521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 35ugauuauugu gacaucaaut t
213621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 36auugauguca caauaaucat t
213721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 37gauuauugug acaucaauat t
213821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 38uauugauguc acaauaauct t
213921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 39aggaaauaca uugcugcact t
214021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 40gugcagcaau guauuuccut t
214121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 41uugaaaggga ugaugaaaat t
214221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 42uuuucaucau cccuuucaat t
214321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 43auaaaaaccg uuauguugat t
214421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 44ucaacauaac gguuuuuaut t
214521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 45cugauuauug ugacaucaat t
214621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 46uugaugucac aauaaucagt t
214721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 47cccaggaaau acauugcugt t
214821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 48cagcaaugua uuuccugggt t
214921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 49ggaaauacau ugcugcacat t
215021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 50ugugcagcaa uguauuucct t
215121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 51cacaguuauu gucaugguct t
215221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 52gaccaugaca auaacugugt t
215321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 53aagaaggaaa caggaacaat t
215421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 54uuguuccugu uuccuucuut t
215521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 55auuauuguga caucaauagt t
215621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 56cuauugaugu cacaauaaut t
215721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 57ccaggaaaua cauugcugct t
215821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 58gcagcaaugu auuuccuggt t
215921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 59augugaagaa ggaaacaggt t
216021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 60ccuguuuccu ucuucacaut t
216121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 61uuauugugac aucaauagct t
216221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 62gcuauugaug ucacaauaat t
216321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 63gaacccagga aauacauugt t
216421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 64caauguauuu ccuggguuct t
216521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 65aacccaggaa auacauugct t
216621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 66gcaauguauu uccuggguut t
216721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 67gccacaguua uugucauggt t
216821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 68ccaugacaau aacuguggct t
216921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 69cgaugugaag aaggaaacat t
217021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 70uguuuccuuc uucacaucgt t
217121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 71gaugugaaga aggaaacagt t
217221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 72cuguuuccuu cuucacauct t
217321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 73ugugaagaag gaaacaggat t
217421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 74uccuguuucc uucuucacat t
217521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 75gugaagaagg aaacaggaat t
217621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 76uuccuguuuc cuucuucact t
217721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 77guuauguuga cauucuucct t
217821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 78ggaagaaugu caacauaact t
217921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 79ccacaguuau ugucauggut t
218021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 80accaugacaa uaacuguggt t
218121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 81aaggaaacag gaacaagugt t
218221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 82cacuuguucc uguuuccuut t
218321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 83gaagaaggaa acaggaacat t
218421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 84uguuccuguu uccuucuuct t
218521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 85uggcugaauu ucagagcaut t
218621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 86augcucugaa auucagccat t
218721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 87guugaaaggg augaugaaat t
218821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 88uuucaucauc ccuuucaact t
218921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 89cuggcugaau uucagagcat t
219021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 90ugcucugaaa uucagccagt t
219121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 91uucugauuau ugugacauct t
219221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 92gaugucacaa uaaucagaat t
219321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 93agaaggaaac aggaacaagt t
219421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 94cuuguuccug uuuccuucut t
219521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 95uuucugauua uugugacaut t
219621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 96augucacaau aaucagaaat t
219723RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 97cagaauaaaa accguuaugu uga
239823RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 98aaaaccguua uguugacauu cuu
239923RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 99uuucugauua uugugacauc aau
2310023RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 100auaaaaaccg uuauguugac auu
2310123RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 101gaacccagga aauacauugc ugc
2310223RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 102accagaauaa aaaccguuau guu
2310323RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 103ccagaauaaa aaccguuaug uug
2310423RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 104cacaguuauu gucaugguca cuc
2310523RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 105agaauaaaaa ccguuauguu gac
2310623RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 106cccaggaaau acauugcugc aca
2310723RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 107aaaaaccguu auguugacau ucu
2310823RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 108uaaaaaccgu uauguugaca uuc
2310923RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 109aaccguuaug uugacauucu ucc
2311023RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 110aaaccguuau guugacauuc uuc
2311123RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 111aauaaaaacc guuauguuga cau
2311223RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 112accguuaugu ugacauucuu ccu
2311323RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 113ccacaguuau ugucaugguc acu
2311423RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 114ucugauuauu gugacaucaa uag
2311523RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 115cugauuauug ugacaucaau agc
2311623RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 116ccaggaaaua cauugcugca caa
2311723RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 117uguugaaagg gaugaugaaa aac
2311823RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 118gaauaaaaac cguuauguug aca
2311923RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 119uucugauuau ugugacauca aua
2312023RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 120aacccaggaa auacauugcu gca
2312123RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 121caggaaauac auugcugcac aag
2312223RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 122gccacaguua uugucauggu cac
2312323RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 123ugaagaagga aacaggaaca agu
2312423RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 124ugauuauugu gacaucaaua gcc
2312523RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 125acccaggaaa uacauugcug cac
2312623RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 126cgaugugaag aaggaaacag gaa
2312723RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 127gauuauugug acaucaauag ccc
2312823RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 128aagaacccag gaaauacauu gcu
2312923RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 129agaacccagg aaauacauug cug
2313023RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 130aagccacagu uauugucaug guc
2313123RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 131cucgauguga agaaggaaac agg
2313223RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 132ucgaugugaa gaaggaaaca gga
2313323RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 133gaugugaaga aggaaacagg aac
2313423RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 134augugaagaa ggaaacagga aca
2313523RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 135ccguuauguu gacauucuuc cuu
2313623RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 136agccacaguu auugucaugg uca
2313723RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 137agaaggaaac aggaacaagu gug
2313823RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 138gugaagaagg aaacaggaac aag
2313923RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 139ucuggcugaa uuucagagca ucc
2314023RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 140uuguugaaag ggaugaugaa aaa
2314123RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 141uucuggcuga auuucagagc auc
2314223RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 142auuucugauu auugugacau caa
2314323RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 143gaagaaggaa acaggaacaa gug
2314423RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 144cauuucugau uauugugaca uca
2314521RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 145ccacaugaag cagcacgacu u
2114623RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 146aagucgugcu gcuucaugug guc
2314719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 147gaauaaaaac cguuauguu
1914819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 148aacauaacgg uuuuuauuc
1914919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 149aaccguuaug uugacauuc
1915019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 150gaaugucaac auaacgguu
1915119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 151ucugauuauu gugacauca
1915219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 152ugaugucaca auaaucaga
1915319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 153aaaaaccguu auguugaca
1915419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 154ugucaacaua acgguuuuu
1915519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 155acccaggaaa uacauugcu
1915619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 156agcaauguau uuccugggu
1915719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 157cagaauaaaa accguuaug
1915819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 158cauaacgguu uuuauucug
1915919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 159agaauaaaaa ccguuaugu
1916019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 160acauaacggu uuuuauucu
1916119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 161caguuauugu cauggucac
1916219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 162gugaccauga caauaacug
1916319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 163aauaaaaacc guuauguug
1916419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 164caacauaacg guuuuuauu
1916519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 165caggaaauac auugcugca
1916619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 166ugcagcaaug uauuuccug
1916719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 167aaaccguuau guugacauu
1916819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 168aaugucaaca uaacgguuu
1916919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 169aaaaccguua uguugacau
1917019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 170augucaacau aacgguuuu
1917119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 171ccguuauguu gacauucuu
1917219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 172aagaauguca acauaacgg
1917319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 173accguuaugu ugacauucu
1917419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 174agaaugucaa cauaacggu
1917519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 175uaaaaaccgu uauguugac
1917619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 176gucaacauaa cgguuuuua
1917719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 177cguuauguug acauucuuc
1917819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 178gaagaauguc aacauaacg
1917919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 179acaguuauug ucaugguca
1918019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 180ugaccaugac aauaacugu
1918119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 181ugauuauugu gacaucaau
1918219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 182auugauguca caauaauca
1918319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 183gauuauugug acaucaaua
1918419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 184uauugauguc acaauaauc
1918519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 185aggaaauaca uugcugcac
1918619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 186gugcagcaau guauuuccu
1918719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 187uugaaaggga ugaugaaaa
1918819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 188uuuucaucau cccuuucaa
1918919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 189auaaaaaccg uuauguuga
1919019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 190ucaacauaac gguuuuuau
1919119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 191cugauuauug ugacaucaa
1919219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 192uugaugucac aauaaucag
1919319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 193cccaggaaau acauugcug
1919419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 194cagcaaugua uuuccuggg
1919519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 195ggaaauacau ugcugcaca
1919619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 196ugugcagcaa uguauuucc
1919719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 197cacaguuauu gucaugguc
1919819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 198gaccaugaca auaacugug
1919919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 199aagaaggaaa caggaacaa
1920019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 200uuguuccugu uuccuucuu
1920119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 201auuauuguga caucaauag
1920219RNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 202cuauugaugu
cacaauaau 1920319RNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 203ccaggaaaua cauugcugc
1920419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 204gcagcaaugu auuuccugg
1920519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 205augugaagaa ggaaacagg
1920619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 206ccuguuuccu ucuucacau
1920719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 207uuauugugac aucaauagc
1920819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 208gcuauugaug ucacaauaa
1920919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 209gaacccagga aauacauug
1921019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 210caauguauuu ccuggguuc
1921119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 211aacccaggaa auacauugc
1921219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 212gcaauguauu uccuggguu
1921319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 213gccacaguua uugucaugg
1921419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 214ccaugacaau aacuguggc
1921519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 215cgaugugaag aaggaaaca
1921619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 216uguuuccuuc uucacaucg
1921719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 217gaugugaaga aggaaacag
1921819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 218cuguuuccuu cuucacauc
1921919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 219ugugaagaag gaaacagga
1922019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 220uccuguuucc uucuucaca
1922119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 221gugaagaagg aaacaggaa
1922219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 222uuccuguuuc cuucuucac
1922319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 223guuauguuga cauucuucc
1922419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 224ggaagaaugu caacauaac
1922519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 225ccacaguuau ugucauggu
1922619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 226accaugacaa uaacugugg
1922719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 227aaggaaacag gaacaagug
1922819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 228cacuuguucc uguuuccuu
1922919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 229gaagaaggaa acaggaaca
1923019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 230uguuccuguu uccuucuuc
1923119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 231uggcugaauu ucagagcau
1923219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 232augcucugaa auucagcca
1923319RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 233guugaaaggg augaugaaa
1923419RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 234uuucaucauc ccuuucaac
1923519RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 235cuggcugaau uucagagca
1923619RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 236ugcucugaaa uucagccag
1923719RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 237uucugauuau ugugacauc
1923819RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 238gaugucacaa uaaucagaa
1923919RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 239agaaggaaac aggaacaag
1924019RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 240cuuguuccug uuuccuucu
1924119RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 241uuucugauua uugugacau
1924219RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 242augucacaau aaucagaaa
1924321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 243gaauaaaaac cguuauguun n
2124421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 244aacauaacgg uuuuuauucn n
2124521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 245aaccguuaug uugacauucn n
2124621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 246gaaugucaac auaacgguun n
2124721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 247ucugauuauu gugacaucan n
2124821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 248ugaugucaca auaaucagan n
2124921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 249aaaaaccguu auguugacan n
2125021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 250ugucaacaua acgguuuuun n
2125121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 251acccaggaaa uacauugcun n
2125221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 252agcaauguau uuccugggun n
2125321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 253cagaauaaaa accguuaugn n
2125421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 254cauaacgguu uuuauucugn n
2125521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 255agaauaaaaa ccguuaugun n
2125621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 256acauaacggu uuuuauucun n
2125721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 257caguuauugu cauggucacn n
2125821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 258gugaccauga caauaacugn n
2125921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 259aauaaaaacc guuauguugn n
2126021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 260caacauaacg guuuuuauun n
2126121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 261caggaaauac auugcugcan n
2126221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 262ugcagcaaug uauuuccugn n
2126321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 263aaaccguuau guugacauun n
2126421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 264aaugucaaca uaacgguuun n
2126521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 265aaaaccguua uguugacaun n
2126621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 266augucaacau aacgguuuun n
2126721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 267ccguuauguu gacauucuun n
2126821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 268aagaauguca acauaacggn n
2126921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 269accguuaugu ugacauucun n
2127021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 270agaaugucaa cauaacggun n
2127121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 271uaaaaaccgu uauguugacn n
2127221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 272gucaacauaa cgguuuuuan n
2127321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 273cguuauguug acauucuucn n
2127421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 274gaagaauguc aacauaacgn n
2127521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 275acaguuauug ucauggucan n
2127621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 276ugaccaugac aauaacugun n
2127721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 277ugauuauugu gacaucaaun n
2127821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 278auugauguca caauaaucan n
2127921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 279gauuauugug acaucaauan n
2128021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 280uauugauguc acaauaaucn n
2128121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 281aggaaauaca uugcugcacn n
2128221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 282gugcagcaau guauuuccun n
2128321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 283uugaaaggga ugaugaaaan n
2128421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 284uuuucaucau cccuuucaan n
2128521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 285auaaaaaccg uuauguugan n
2128621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 286ucaacauaac gguuuuuaun n
2128721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 287cugauuauug ugacaucaan n
2128821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 288uugaugucac aauaaucagn n
2128921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 289cccaggaaau acauugcugn n
2129021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 290cagcaaugua uuuccugggn n
2129121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 291ggaaauacau ugcugcacan n
2129221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 292ugugcagcaa uguauuuccn n
2129321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 293cacaguuauu gucauggucn n
2129421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 294gaccaugaca auaacugugn n
2129521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 295aagaaggaaa caggaacaan n
2129621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 296uuguuccugu uuccuucuun n
2129721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 297auuauuguga caucaauagn n
2129821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 298cuauugaugu cacaauaaun n
2129921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 299ccaggaaaua cauugcugcn n
2130021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 300gcagcaaugu auuuccuggn n
2130121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 301augugaagaa ggaaacaggn n
2130221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 302ccuguuuccu
ucuucacaun n 2130321DNAArtificial SequenceDescription of Combined
DNA/RNA Molecule Synthetic oligonucleotide 303uuauugugac aucaauagcn
n 2130421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 304gcuauugaug ucacaauaan n
2130521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 305gaacccagga aauacauugn n
2130621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 306caauguauuu ccuggguucn n
2130721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 307aacccaggaa auacauugcn n
2130821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 308gcaauguauu uccuggguun n
2130921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 309gccacaguua uugucauggn n
2131021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 310ccaugacaau aacuguggcn n
2131121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 311cgaugugaag aaggaaacan n
2131221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 312uguuuccuuc uucacaucgn n
2131321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 313gaugugaaga aggaaacagn n
2131421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 314cuguuuccuu cuucacaucn n
2131521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 315ugugaagaag gaaacaggan n
2131621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 316uccuguuucc uucuucacan n
2131721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 317gugaagaagg aaacaggaan n
2131821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 318uuccuguuuc cuucuucacn n
2131921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 319guuauguuga cauucuuccn n
2132021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 320ggaagaaugu caacauaacn n
2132121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 321ccacaguuau ugucauggun n
2132221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 322accaugacaa uaacuguggn n
2132321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 323aaggaaacag gaacaagugn n
2132421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 324cacuuguucc uguuuccuun n
2132521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 325gaagaaggaa acaggaacan n
2132621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 326uguuccuguu uccuucuucn n
2132721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 327uggcugaauu ucagagcaun n
2132821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 328augcucugaa auucagccan n
2132921DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 329guugaaaggg augaugaaan n
2133021DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 330uuucaucauc ccuuucaacn n
2133121DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 331cuggcugaau uucagagcan n
2133221DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 332ugcucugaaa uucagccagn n
2133321DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 333uucugauuau ugugacaucn n
2133421DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 334gaugucacaa uaaucagaan n
2133521DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 335agaaggaaac aggaacaagn n
2133621DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 336cuuguuccug uuuccuucun n
2133721DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 337uuucugauua uugugacaun n
2133821DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic oligonucleotide 338augucacaau aaucagaaan n
213395330DNAHomo sapiens 339agtatttttg gagaagttag taaaaccgaa
tctgacatca tcacctagca gttcatgcag 60ctagcaagtg gtttgttctt agggtaacag
aggaggaaat tgttcctcgt ctgataagac 120aacagtggag aaaggacgca
tgctgtttct tagggacacg gctgacttcc agatatgacc 180atgtatttgt
ggcttaaact cttggcattt ggctttgcct ttctggacac agaagtattt
240gtgacagggc aaagcccaac accttccccc actggattga ctacagcaaa
gatgcccagt 300gttccacttt caagtgaccc cttacctact cacaccactg
cattctcacc cgcaagcacc 360tttgaaagag aaaatgactt ctcagagacc
acaacttctc ttagtccaga caatacttcc 420acccaagtat ccccggactc
tttggataat gctagtgctt ttaataccac aggtgtttca 480tcagtacaga
cgcctcacct tcccacgcac gcagactcgc agacgccctc tgctggaact
540gacacgcaga cattcagcgg ctccgccgcc aatgcaaaac tcaaccctac
cccaggcagc 600aatgctatct cagatgtccc aggagagagg agtacagcca
gcacctttcc tacagaccca 660gtttccccat tgacaaccac cctcagcctt
gcacaccaca gctctgctgc cttacctgca 720cgcacctcca acaccaccat
cacagcgaac acctcagatg cctaccttaa tgcctctgaa 780acaaccactc
tgagcccttc tggaagcgct gtcatttcaa ccacaacaat agctactact
840ccatctaagc caacatgtga tgaaaaatat gcaaacatca ctgtggatta
cttatataac 900aaggaaacta aattatttac agcaaagcta aatgttaatg
agaatgtgga atgtggaaac 960aatacttgca caaacaatga ggtgcataac
cttacagaat gtaaaaatgc gtctgtttcc 1020atatctcata attcatgtac
tgctcctgat aagacattaa tattagatgt gccaccaggg 1080gttgaaaagt
ttcagttaca tgattgtaca caagttgaaa aagcagatac tactatttgt
1140ttaaaatgga aaaatattga aacctttact tgtgatacac agaatattac
ctacagattt 1200cagtgtggta atatgatatt tgataataaa gaaattaaat
tagaaaacct tgaacccgaa 1260catgagtata agtgtgactc agaaatactc
tataataacc acaagtttac taacgcaagt 1320aaaattatta aaacagattt
tgggagtcca ggagagcctc agattatttt ttgtagaagt 1380gaagctgcac
atcaaggagt aattacctgg aatccccctc aaagatcatt tcataatttt
1440accctctgtt atataaaaga gacagaaaaa gattgcctca atctggataa
aaacctgatc 1500aaatatgatt tgcaaaattt aaaaccttat acgaaatatg
ttttatcatt acatgcctac 1560atcattgcaa aagtgcaacg taatggaagt
gctgcaatgt gtcatttcac aactaaaagt 1620gctcctccaa gccaggtctg
gaacatgact gtctccatga catcagataa tagtatgcat 1680gtcaagtgta
ggcctcccag ggaccgtaat ggcccccatg aacgttacca tttggaagtt
1740gaagctggaa atactctggt tagaaatgag tcgcataaga attgcgattt
ccgtgtaaaa 1800gatcttcaat attcaacaga ctacactttt aaggcctatt
ttcacaatgg agactatcct 1860ggagaaccct ttattttaca tcattcaaca
tcttataatt ctaaggcact gatagcattt 1920ctggcatttc tgattattgt
gacatcaata gccctgcttg ttgttctcta caaaatctat 1980gatctacata
agaaaagatc ctgcaattta gatgaacagc aggagcttgt tgaaagggat
2040gatgaaaaac aactgatgaa tgtggagcca atccatgcag atattttgtt
ggaaacttat 2100aagaggaaga ttgctgatga aggaagactt tttctggctg
aatttcagag catcccgcgg 2160gtgttcagca agtttcctat aaaggaagct
cgaaagccct ttaaccagaa taaaaaccgt 2220tatgttgaca ttcttcctta
tgattataac cgtgttgaac tctctgagat aaacggagat 2280gcagggtcaa
actacataaa tgccagctat attgatggtt tcaaagaacc caggaaatac
2340attgctgcac aaggtcccag ggatgaaact gttgatgatt tctggaggat
gatttgggaa 2400cagaaagcca cagttattgt catggtcact cgatgtgaag
aaggaaacag gaacaagtgt 2460gcagaatact ggccgtcaat ggaagagggc
actcgggctt ttggagatgt tgttgtaaag 2520atcaaccagc acaaaagatg
tccagattac atcattcaga aattgaacat tgtaaataaa 2580aaagaaaaag
caactggaag agaggtgact cacattcagt tcaccagctg gccagaccac
2640ggggtgcctg aggatcctca cttgctcctc aaactgagaa ggagagtgaa
tgccttcagc 2700aatttcttca gtggtcccat tgtggtgcac tgcagtgctg
gtgttgggcg cacaggaacc 2760tatatcggaa ttgatgccat gctagaaggc
ctggaagccg agaacaaagt ggatgtttat 2820ggttatgttg tcaagctaag
gcgacagaga tgcctgatgg ttcaagtaga ggcccagtac 2880atcttgatcc
atcaggcttt ggtggaatac aatcagtttg gagaaacaga agtgaatttg
2940tctgaattac atccatatct acataacatg aagaaaaggg atccacccag
tgagccgtct 3000ccactagagg ctgaattcca gagacttcct tcatatagga
gctggaggac acagcacatt 3060ggaaatcaag aagaaaataa aagtaaaaac
aggaattcta atgtcatccc atatgactat 3120aacagagtgc cacttaaaca
tgagctggaa atgagtaaag agagtgagca tgattcagat 3180gaatcctctg
atgatgacag tgattcagag gaaccaagca aatacatcaa tgcatctttt
3240ataatgagct actggaaacc tgaagtgatg attgctgctc agggaccact
gaaggagacc 3300attggtgact tttggcagat gatcttccaa agaaaagtca
aagttattgt tatgctgaca 3360gaactgaaac atggagacca ggaaatctgt
gctcagtact ggggagaagg aaagcaaaca 3420tatggagata ttgaagttga
cctgaaagac acagacaaat cttcaactta tacccttcgt 3480gtctttgaac
tgagacattc caagaggaaa gactctcgaa ctgtgtacca gtaccaatat
3540acaaactgga gtgtggagca gcttcctgca gaacccaagg aattaatctc
tatgattcag 3600gtcgtcaaac aaaaacttcc ccagaagaat tcctctgaag
ggaacaagca tcacaagagt 3660acacctctac tcattcactg cagggatgga
tctcagcaaa cgggaatatt ttgtgctttg 3720ttaaatctct tagaaagtgc
ggaaacagaa gaggtagtgg atatttttca agtggtaaaa 3780gctctacgca
aagctaggcc aggcatggtt tccacattcg agcaatatca attcctatat
3840gacgtcattg ccagcaccta ccctgctcag aatggacaag taaagaaaaa
caaccatcaa 3900gaagataaaa ttgaatttga taatgaagtg gacaaagtaa
agcaggatgc taattgtgtt 3960aatccacttg gtgccccaga aaagctccct
gaagcaaagg aacaggctga aggttctgaa 4020cccacgagtg gcactgaggg
gccagaacat tctgtcaatg gtcctgcaag tccagcttta 4080aatcaaggtt
cataggaaaa gacataaatg aggaaactcc aaacctcctg ttagctgtta
4140tttctatttt tgtagaagta ggaagtgaaa ataggtatac agtggattaa
ttaaatgcag 4200cgaaccaata tttgtagaag ggttatattt tactactgtg
gaaaaatatt taagatagtt 4260ttgccagaac agtttgtaca gacgtatgct
tattttaaaa ttttatctct tattcagtaa 4320aaaacaactt ctttgtaatc
gttatgtgtg tatatgtatg tgtgtatggg tgtgtgtttg 4380tgtgagagac
agagaaagag agagaattct ttcaagtgaa tctaaaagct tttgcttttc
4440ctttgttttt atgaagaaaa aatacatttt atattagaag tgttaactta
gcttgaagga 4500tctgttttta aaaatcataa actgtgtgca gactcaataa
aatcatgtac atttctgaaa 4560tgacctcaag atgtcctcct tgttctactc
atatatatct atcttatata gtttactatt 4620ttacttctag agatagtaca
taaaggtggt atgtgtgtgt atgctactac aaaaaagttg 4680ttaactaaat
taacattggg aaatcttata ttccatatat tagcatttag tccaatgtct
4740ttttaagctt atttaattaa aaaatttcca gtgagcttat catgctgtct
ttacatgggg 4800ttttcaattt tgcatgctcg attattccct gtacaatatt
taaaatttat tgcttgatac 4860ttttgacaac aaattaggtt ttgtacaatt
gaacttaaat aaatgtcatt aaaataaata 4920aatgcaatat gtattaatat
tcattgtata aaaatagaag aatacaaaca tatttgttaa 4980atatttacat
atgaaattta atatagctat ttttatggaa tttttcattg atatgaaaaa
5040tatgatattg catatgcata gttcccatgt taaatcccat tcataacttt
cattaaagca 5100tttactttga atttctccaa tgcttagaat gtttttacca
ggaatggatg tcgctaatca 5160taataaaatt caaccattat ttttttcttg
tttataatac attgtgttat atgttcaaat 5220atgaaatgtg tatgcaccta
ttgaaatatg tttaatgcat ttattaacat ttgcaggaca 5280cttttacagg
ccccaattat ccaatagtct aataattgtt taagatctag 53303405247DNAMus
musculus 340gacatcacca tttagcagtg catgtagcta gcaagtggtt tgttcttagg
gtaagagagt 60aggaaacttg ctccccatct gataagacag agtgcaaagg agaccctatt
tcttaggggc 120acagctgatc tccagatatg accatgggtt tgtggctcaa
acttctggcc tttggatttg 180cccttctgga cacagaagtc tttgtcacag
ggcaaacacc tacacccagt gatggtgcca 240gcctcacaac tcttacacca
tccactctgg gccttgcaag cactgaccct ccaagcacaa 300ccatagctac
cacaacgaag caaacatgtg ctgccatgtt tgggaacatt actgtgaatt
360acacctatga atctagtaat cagactttta aggcagacct caaagatgtc
caaaatgcta 420agtgtggaaa tgaggattgt gaaaacgtgt taaataatct
agaagaatgc tcacagataa 480aaaacatcag tgtgtctaat gactcatgtg
ctccagctac aactatagat ttatatgtac 540caccagggac tgacaagttt
tcgctacatg actgcacacc aaaagaaaag gctaatactt 600caatttgttt
ggagtggaaa acaaaaaacc ttgatttcag aaaatgcaac agtgacaata
660tttcatatgt actccactgt gagccagaaa ataatacaaa atgcattaga
agaaatacat 720tcatacctga aagatgtcag ttggacaacc ttcgtgccca
aacaaattac acatgtgtag 780cagaaatctt atatcgcggt gtaaaactcg
tcaaaaatgt tataaatgtg cagacagatt 840tggggattcc agaaacgcct
aagcctagtt gtggggatcc agctgcaaga aaaacgttag 900tctcttggcc
tgagcctgta tctaaacctg agtctgcatc taaaccccat ggatatgttt
960tatgctataa gaacaattca gaaaaatgta aaagtttgcc taataatgtg
accagttttg 1020aggtggaaag cttgaaacct tataaatact atgaagtgtc
cctacttgcc tatgtcaatg 1080ggaagattca aagaaatggg actgctgaga
agtgcaattt tcacacaaaa gcagatcgtc 1140cggacaaggt caatggaatg
aaaacctccc ggccgacaga caatagtata aatgttacat 1200gtggtcctcc
ttatgaaact aatggcccta aaacctttta cattttggta gtcagaagtg
1260gaggttcttt tgttacaaaa tacaacaaga caaactgtca gttttatgta
gataatctct 1320actattcaac tgactatgag tttctggtct cttttcacaa
tggagtgtac gagggagatt 1380cagttataag aaatgagtca acaaatttta
atgctaaagc actgattata ttcctggtgt 1440ttctgattat tgtgacatca
atagccttgc ttgttgtttt gtataaaatc tatgatctgc 1500gcaagaaaag
atccagcaat ttagatgaac aacaggaact cgttgaaagg gatgatgaaa
1560agcagctgat ggatgtggag ccaatccatt ctgacatttt gttggaaaca
tacaaaagga 1620agattgctga tgagggcaga ctgttcctgg ctgaatttca
gagcattcca cgggtattca 1680gcaagtttcc catcaaagat gcccgaaagc
cccacaatca gaataaaaac cgttatgttg 1740acattcttcc ctatgattat
aaccgtgtgg aactctctga aataaatgga gatgcagggt 1800ccacctacat
aaatgccagc tacattgatg gcttcaagga acccaggaaa tacattgctg
1860cacaagggcc ccgggatgag acagttgatg acttctggag gatgatctgg
gagcaaaagg 1920ccacagttat tgtcatggtc acacgatgtg aagaaggaaa
caggaacaag tgcgcagaat 1980actggccaag catggaggaa ggcactcggg
ctttcaaaga tattgttgtg acaatcaatg 2040accacaaacg atgtcctgat
tacatcattc agaagctgaa cgttgcacat aaaaaagaaa 2100aagcaactgg
aagagaagtg actcatatcc aattcaccag ctggccagac catggggttc
2160ctgaagaccc tcacctgctc ctcaaacttc gacggagagt taatgctttt
agcaacttct 2220tcagtggtcc cattgtggtg cactgcagtg ctggtgttgg
gcgtacaggt acctacattg 2280gaattgatgc catgctggaa ggcctggaag
cagagggcaa agtggatgtc tatggttatg 2340ttgtcaagct aaggcgacag
aggtgtctga tggtgcaagt ggaggcacag tatatcctga 2400ttcatcaggc
tttagtggaa tacaatcagt ttggagaaac agaagtgaac ttgtctgagt
2460tacattcatg cctacacaac atgaagaaga gagatccacc cagtgacccc
tcccctctgg 2520aggctgaata ccagagactt ccttcataca ggagttggag
gacacagcac attggaaatc 2580aagaagaaaa taagaagaag aacaggaatt
ctaatgttgt tccatatgac tttaacagag 2640tgccacttaa gcatgaactg
gagatgagca aagagagtga gcctgaatca gatgagtctt 2700cagatgatga
cagtgactca gaagaaacca gcaaatacat taatgcatcc tttgtgatga
2760gttactggaa accagaaatg atgattgctg ctcaggggcc actaaaagaa
acgatcggtg 2820acttttggca gatgatattc caaagaaaag tcaaagttat
tgtgatgttg acagagttag 2880tgaatggaga ccaggaagtc tgtgctcagt
actggggcga aggaaagcag acttatggag 2940acatggaagt ggagatgaaa
gacacaaaca gagcctcagc ctacactctc cgaacttttg 3000agctgagaca
ttccaagagg aaggagccca gaactgtgta ccagtaccag tgtaccacat
3060ggaaagggga agagctgcct gcagaaccca aagacctggt gtctatgatt
caggacctca 3120aacagaagct tcccaaggct tccccagaag ggatgaagta
tcacaagcat gcatccatcc 3180tcgtccactg cagagatgga tcccagcaga
cagggttgtt ctgtgccttg ttcaatctct 3240tggaaagtgc agaaacagaa
gatgtggttg atgttttcca agtggtaaag tctctacgca 3300aagcacggcc
tggggtggtg tgcagctatg agcaatacca gttcctctat gacatcatcg
3360ccagcatcta tcccgcccag aatggacaag tcaagaaaac aaacagccaa
gacaaaattg 3420aatttcataa tgaagtggat ggaggcaagc aggatgctaa
ctgtgtccgt ccagatggtc 3480ctctgaataa agcccaggaa gacagcagag
gggtgggaac cccggagcct accaatagtg 3540ctgaggaacc agaacatgct
gccaatggtt ctgcgagccc agctccaacc cagagttcat 3600aggaaaggag
tcatgtggga caacgcagac tctcacatta gttctttcta tttttctaga
3660cctaatgaaa gaacatggct gtgcagtggt ttatggaatc tgtgttcacc
tttgccactg 3720tataaaaata tttaagtttg tcaaaacatt ttgtacagtt
ttatgcttat tttaaaagtg 3780tatctatgtc attcagcagg aatgtatatg
tgagagaggg tgtctgtgtg tgtgagagtg 3840tgtttatgta tgagtgactg
tgtgtgtgca tgtttgtgcg tgtgtatgac atctaaatgt 3900gattggagaa
tactttcaag ccatttcaaa tgctttcgag aaacagtgtg ccttttctcc
3960tcttgaggaa actatacatt ttatatctaa actgttaatt tgtttgaggg
attaattttt 4020taaaatccca ttgaaagtgg attcagttgt aagaataaca
atgtgtacca ttctggaatg 4080acctcaaggt gtcctccttg tcctgttgat
gatcttgtag tttaagatgc tctttttgga 4140tatagataag cgtatgtaag
agtgctgtgg gtgtgtacag ctgatctggg acgtgaacaa 4200aatcaacatg
tgagacttat gttccatata ctgtcatttc atcactatct cttaatgcat
4260atttaatcaa acatgaaaat ctcaagggag actatttttg tatccacatg
ggaagtagaa 4320cattgcaagt cagttgctgt ctacacaata gataaaaatt
actagttaat gctcttggtc 4380atatcgatat atgctatgaa cctaaataat
tgcccttagc caaatataat gtatgttaaa 4440aacacataga ataaaaacag
gggcatgaaa acttgtttgt actgaatatt tacataggta 4500acctcgtaca
gttagttctg ttatggaatt caccatttat gggaaatgta aaattgacta
4560tggccatttc ctatgcttaa gaccatcttt gacttgcatt actgtgtatt
tatcttgaat 4620ttccccactg ttttgtttac tcttactgag atataatatt
gataaccata ataaactttc 4680aactattatc ttctttgctt atgtggcgtg
tgttacatgt ttgtaattga cagtgaagca 4740atttcttctt caagctgaga
ttggttttcc cattttgttc attgatgaga aaaatgaata 4800attatcagat
aggcgcatca gaaggggata aagaggactc tgttttctca ctagccactc
4860acagatttct atctcatgtc atctgggaaa ggttctgttg ctctttgctg
gaaaacattg 4920tggaagtttg cagttctgat gctgatgtac cttcaggctg
gtttttatgt tgatttgtga 4980tttgtgattt gcttcagaat gctgatcatc
ttcaatgata tcttttggaa cacagtttac 5040ttagtagctg tttacttagc
agcacatttg caacagcatc aaaagctatg ttactataaa 5100atcagtgcgt
gaagtctgat ttacattttg ctcaaggatc tgggtaaagt tttctaccaa
5160gaatgttgag gactcatgaa aatgtgaagt tctccaactt ctaaaatttt
ttaggacttt 5220caataaacta taaaattatt caaaatc 52473415354DNAMacaca
mulatta 341atgaccatgt gtttgtggct taaacttttg gcatttgtct ttgcctttct
ggacacagaa 60gtatttgtga cagggcaagg ctcaacactt tcccccactg gctgtctgca
agctgaggag 120caaggaagcc aatcggagtc ccaaaacctc aaaagcaggg
aagctgacag tgcagcctca 180gtcagtggcc aaaggcctga gaaccctggc
aaatcactgg agacggagaa cgacaaagat 240gcccagtgtt ccactttcaa
gtgacccctt acctactcac accactgcat tctcacccgc 300aagcatctct
gaaagagaaa atgacttctc agagaccaca ccatctctta gttcagacaa
360tacttcaacc cacgtatccc cggactcttt ggataacgct agtgctttta
atacgacagg 420tgtttcatca gcactgacgc ctcaccttcc cacgcatgca
gactcgcaga cgccctctac 480tggaactgac acgcagacac ccagcggctc
cgccgccaat accacactca gccctacccc 540acgcagcaat gatatctcag
atgtcccagg agagaggagt acagccagca cctttcctac 600agacccaatt
tccccattag caaccaccct catccctgca cgcaacagct ctgctgcctt
660acctgcacgc acctccaaca ccaccatcac agcgaacacc tcagtttcct
accttaatgc 720ctctgaaaca accactccga gcccttctgg aagcactgtc
atttcaaccc caacaatagc 780tactactaca tctaagccaa catgtgctga
aaaatatgca accatccctg tggattactt 840atataacaac aaaactaaat
tatttacagc aaagctaaat gttaatgaga atgtggaatg 900tacaaacaat
aatcacacac acaatatttg cacaaacaat gaggtgctta atcttccaga
960atgtaaagaa atgaatgttt tcgtatctca taattcatgt acagatcgtc
ataaagaatt 1020aaaattagat gtgccaccag aggttgaaaa gtttcagtta
gatgattgta caccggatgt 1080agaagcaaat accactattt gtttaaaatg
gaaaattatt gaaacctttg cttgtgataa 1140aagtaaaatt acctacagat
ttcaatgtgg taataaaaca tataataagg aaggcattta 1200tttagaaaac
cttgaacctg aatatgagta taagtgtgac tcagaaatac tctataataa
1260ccacaagtat attaacataa ccaaacttat aaaaacagat tttgggattc
caggacagcc 1320tcagaatgtt gtttgtagac atgaagatgc acatcaagga
gtaattacct ggaatccccc 1380tcaaagatca tttcataatt ttactctctg
ttatgtaagc aagacagcaa aaaaatgcct 1440cagtctggat aaacacctga
caacatatca tttgcaaaat ttgaaacctt atacaaacta 1500tagtttatca
ttacatgcct acatcattgc aaaagtgcaa cgtaatggaa ctgctgcaac
1560atgtaatttc acaactgaaa gtgcacctcc aagccaggtc cagaacatga
ttgtctccac 1620atcagataat agtatgcgtg tcaagtgtga gggtcccagg
gacgttaatg gccccactgg 1680actttaccat ctggaagtcg aagctggaaa
tactctagtt agaaatctgt cacaatctaa 1740gtgcgatttc tctgtaaaca
atcttcaata ttcaacatac tacaatctta aggtaaaagt 1800atgctctcta
cattactata gtaccaacat acatgataat gattgattca tattcatata
1860tagcactccc tataattcta aggcactgat agcatttctg gcatttctga
ttattgtgac 1920atcaatagcc ctacttgttg ttctctataa aatctatgat
ctacataaga aaagatcctg 1980caatttggat gaacaacagg agcttgttga
aagggatgat gaaaaacaac tgatgaatgt 2040ggagccaatc catgcagata
ttttgttgga aacttataag aggaagattg ctgatgaagg 2100aagacttttt
ctggctgaat ttcagagcat cccgcgggtg ttcagcaagt ttcctataaa
2160ggaagctcga aagcccttta accagaataa aaaccgttat gttgacattc
ttccttatga 2220ttataaccgt gttgaactct ctgagataaa tggagatgca
gggtcaaact acataaatgc 2280cagctatatt gatggtttca aagaacccag
gaaatacatt gctgcacaag gtcccaggga 2340tgaaaccgtt gatgatttct
ggaggatgat ttgggaacag aaagccacag ttattgtcat 2400ggtcactcga
tgtgaagaag gaaacaggaa caagtgtgca gaatactggc cgtcaatgga
2460agagggcact cgggcttttg gagatgttgt tgtaaagatc aaccagcaca
aaagatgtcc 2520agattacatc attcagaaat tgaacattgt aaataaaaaa
gaaaaagcaa ctggaagaga 2580ggtgactcac attcagttta ccagctggcc
agaccacggg gtgcctgagg atcctcactt 2640gctcctcaaa ctgagaagga
gagtgaatgc cttcagcaat ttcttcagtg gtcccattgt 2700ggtgcactgc
agtgctggtg tcgggcgcac aggcacctat attggaattg atgccatgct
2760agaaggcctg gaagctgaga acaaagtaga tgtttatggt tacgttgtca
agctaaggcg 2820acagagatgc ctgatggttc aagtagaggc ccagtacatc
ttgatccatc aggctttggt 2880tgaatacaat cagtttggag aaacagaagt
gaatttgtct gaattacatc catatctaca 2940taacatgaag aaaagggatc
cacccagtga gccatctcca ctagaggctg aattccagag 3000acttccttca
tataggagct ggaggacaca gcacattgga aatcaggaag aaaataaaaa
3060taaaaacagg aattctaatg tcatcccata tgactataac agagtgccac
ttaaacatga 3120gctggaaatg agtaaagaga gtgaccatga ttcagatgaa
tcctctgatg atgacagtga 3180ttcagaggaa ccaagcaaat acatcaatgc
atcttttata atgagctact ggaaacctga 3240agtgatgatt gctgctcagg
gaccactgaa ggagaccatt ggtgactttt ggcagatgat 3300cttccaaaga
aaagtcaaag ttattgttat gctgacagaa ctgaaacacg gagaccagga
3360aatctgtgct cagtactggg gagaaggaaa gcaaacatat ggagatatcg
aagttgacat 3420gaaagacaca aacaaatctt caacttacac ccttcgtgtc
tttgaactga gacattccaa 3480gaggaaagac tctcgaactg tgtaccagta
ccaatataca aactggagtg tggagcagct 3540tcctgcagaa cccaaggaat
tagtctctct gattcaggtc ctcaaagaaa aacttcccca 3600gaagaattcc
tccgaaggga acaagcatca caagagtaca cctctcctca ttcactgcag
3660ggatggatct cagcaaacgg gaatattttg tgctttgtta aatctcttag
aaagtgcgga 3720aacagaagag gtagtggata tttttcaagt ggtaaaagct
ctacgcaaag ctaggcctgg 3780catggtttcc acatttgagc aataccaatt
cctatatgac atcattgcca gcacctaccc 3840tgctcagaat ggacaagtaa
agaaaaacaa ccatcaagaa gataaaattg aatttgataa 3900tgaagtggac
aaagtaaagc aggatgctaa ttgtgttaat ccacttggtg ccacagaaaa
3960gctccctgaa gcaaaggaac aggctacagg ttctgaaccc acaagtggca
ctgaggggcc 4020agaacattct gtcaatggtc ctgcaagtcc agctttaaat
caaggttcat aggaaaagac 4080ataaatgggg aaactccaaa cctcctgtta
gctgttattt ctatttttct agaagtagga 4140agtgaaaata gtatacagtg
gattaattaa atgtattgaa ccaatatttg tggaagggtt 4200ctattttact
actgtggaaa aatatttaag atagttttgc cagaacagtt tgtacagacg
4260tatgcttatt ttaaaatttt atttcttatt cagtaagaaa caacttcttt
gtaaccttta 4320catgtgtatg tatatgtgtg tatgcgtgtg tttgtgtgag
agagaaagag aattctttca 4380agtgaatcta aaagcttttg ctttgccttt
ttgtttttat caagaaaaaa tacattttat 4440attagaagtg tttacttagc
ttgaaggatc tgtttttaaa atcataaact gtgtgcagac 4500tataaaatca
tgtacatttc taaaatgacc tcaagatgtc ctccttgttc tactcatata
4560tatcttatat atcttatata gttccagatt ttacttctag agatagtaca
taaaagtggt 4620atgtgtgtgt atagctacta caaaacagtt aactaaatta
acatttggaa atcttatatt 4680ccatatatta tcatttaatc caatatcttt
ttaagcttat ttaattaaaa aatttccagt 4740gagcttatct ggctgtcttt
acatggggtt tacaattttt tatcatctat tattccctgt 4800acaatattta
aaatttattg cttgatactt ttgaccacga attatgtttt gtacaattga
4860acttaaataa acgtcattaa aataaaccaa tgcaatatgt attaatattc
attgtataaa 4920aataaaaaaa tacaaatata tttgttaaat gtttacatat
gaaatttaac atagctattt 4980ttatggaatt tttcattgat atgaaaaata
taatattgca tatgcatagg tctcatgtta 5040aataccattc ataactttca
ttaaagcatt tactttgaac ttctccaatg cttagattct 5100ttttaccggg
aatggatatc actaatcata ataaaattca acgatttttt tttcttgttt
5160ataatacatt gtgttatatg ttcaaatctg aaatgtgtat gcacctgttg
aaatatgttt 5220aatgcagtta ttaacatttg cagaacaatt ttacaggccc
cagttatcca atagtctaat 5280aattgtttaa gatctagaaa aaaatcaaga
atagtggtat gtttcatgaa gtaataaaaa 5340ctcattttca tgaa 5354
* * * * *