U.S. patent application number 14/548164 was filed with the patent office on 2015-03-26 for methods and nucleic acids for analyses of cellular proliferative disorders.
The applicant listed for this patent is Epigenomics AG. Invention is credited to Juergen Distler, Thomas Hildmann, Ralf Lesche, Catherine Lofton-Day, Fabian Model, Matthias Schuster, Andrew Z. Sledziewski, Xiaoling Song, Reimo Tetzner.
Application Number | 20150086989 14/548164 |
Document ID | / |
Family ID | 36746665 |
Filed Date | 2015-03-26 |
United States Patent
Application |
20150086989 |
Kind Code |
A1 |
Distler; Juergen ; et
al. |
March 26, 2015 |
METHODS AND NUCLEIC ACIDS FOR ANALYSES OF CELLULAR PROLIFERATIVE
DISORDERS
Abstract
Aspects of the invention provide methods, nucleic acids and kits
for detecting, or for detecting and distinguishing between or among
liver cell proliferative disorders or for detecting, or for
detecting and distinguishing between or among colorectal cell
proliferative disorders. Particular aspects disclose and provide
genomic sequences the methylation patterns of which have
substantial utility for the improved detection of and
differentiation between said class of disorders, thereby enabling
the improved diagnosis and treatment of patients.
Inventors: |
Distler; Juergen; (Berlin,
DE) ; Hildmann; Thomas; (Berlin, DE) ; Lesche;
Ralf; (Berlin, DE) ; Lofton-Day; Catherine;
(Seattle, WA) ; Model; Fabian; (Berlin, DE)
; Schuster; Matthias; (Berlin, DE) ; Sledziewski;
Andrew Z.; (Shoreline, WA) ; Tetzner; Reimo;
(Berlin, DE) ; Song; Xiaoling; (Woodinville,
WA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Epigenomics AG |
Berlin |
|
DE |
|
|
Family ID: |
36746665 |
Appl. No.: |
14/548164 |
Filed: |
November 19, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13096932 |
Apr 28, 2011 |
8900829 |
|
|
14548164 |
|
|
|
|
11911617 |
Dec 6, 2007 |
7951563 |
|
|
PCT/US2006/014131 |
Apr 17, 2006 |
|
|
|
13096932 |
|
|
|
|
60787402 |
Mar 30, 2006 |
|
|
|
60723602 |
Oct 4, 2005 |
|
|
|
60709318 |
Aug 17, 2005 |
|
|
|
60704860 |
Aug 1, 2005 |
|
|
|
60697521 |
Jul 8, 2005 |
|
|
|
60676997 |
May 2, 2005 |
|
|
|
60672242 |
Apr 15, 2005 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 2600/106 20130101;
C12Q 2600/154 20130101; C12Q 1/6806 20130101; C12Q 2600/158
20130101; C12Q 1/6886 20130101; C12Q 2600/112 20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for detecting and/or classifying a colorectal carcinoma
or pre-cancerous colorectal cell proliferative disorder in a human
subject, comprising: contacting genomic DNA from a biological
sample obtained from a human subject, having a colorectal carcinoma
or pre-cancerous colorectal cell proliferative disorder, with at
least one agent that provides for determination of a CpG
methylation status of the TMEFF2 gene; determining, based on the
contacting, a CpG methylation status of the TMEFF2 gene; and
detecting and/or classifying a colorectal carcinoma or precancerous
colorectal cell proliferative disorder in the subject based on
increased CpG methylation of the TMEFF2 gene, relative to that of a
control sample or standard value.
2. The method of claim 1, wherein the cell proliferative disorder
is colorectal cancer.
3. The method of claim 1, wherein the colorectal carcinoma is
detected or classified.
4. The method of claim 1, wherein contacting genomic DNA comprises
contacting the genomic DNA with at least one reagent, or series of
reagents that distinguishes between methylated and non-methylated
CpG dinucleotides within at least one target region of the genomic
DNA, wherein the target region comprises, or hybridizes under
stringent conditions to a sequence of at least 16 contiguous
nucleotides of SEQ ID NO: 26, wherein the contiguous nucleotides
comprise at least one CpG dinucleotide sequence.
5. The method of claim 4, comprising: extracting or otherwise
isolating genomic DNA from the biological sample obtained from the
subject; treating the extracted or otherwise isolated genomic DNA,
or a fragment thereof with one or more reagents to convert cytosine
bases that are unmethylated in the 5-position thereof to uracil or
to another base that is detectably dissimilar to cytosine in terms
of hybridization properties; contacting the treated genomic DNA, or
the treated fragment thereof, with an amplification enzyme and at
least one primer comprising, a contiguous sequence of at least 9
nucleotides that is complementary to, or hybridizes under
moderately stringent or stringent conditions to a sequence selected
from the group consisting of SEQ ID NOs: 34, 35, 46 and SEQ ID NO:
47, and complements thereof, wherein the treated genomic DNA or the
fragment thereof is either amplified to produce at least one
amplificate, or is not amplified; and determining, based on a
presence or absence of, or on a property of the amplificate, the
methylation state or level of at least one CpG dinucleotide of SEQ
ID NO: 26, or an average, or a value reflecting an average
methylation state or level of a plurality of CpG dinucleotides of
SEQ ID NO: 26.
6. The method of claim 4, wherein treating the genomic DNA, or the
fragment thereof, comprises use of a reagent selected from the
group consisting of bisulfate, hydrogen sulfite, disulfite, and
combinations thereof.
7. The method of claim 4, comprising: extracting or otherwise
isolating genomic DNA from the biological sample obtained from the
subject; digesting the extracted or otherwise isolated genomic DNA,
or a fragment thereof, with at least one methylation sensitive
restriction enzyme; contacting the DNA restriction enzyme digest
with an amplification enzyme and at least two primers suitable for
the amplification of a sequence comprising at least one CpG
dinucleotide of SEQ ID NO: 26; and determining, based on a presence
or absence of an amplificate, the methylation state or level of at
least one CpG dinucleotide of SEQ ID NO: 26.
8. The method of claim 7, wherein the presence or absence of an
amplificate is determined by means of hybridization to at least one
nucleic acid or peptide nucleic acid which is identical,
complementary, or hybridizes under stringent or highly stringent
conditions to an at least 16 base long segment of SEQ ID NO: 26.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 13/096,932 filed Apr. 28, 2011, now issued as
U.S. Pat. No. 8,900,829; which is a divisional application of U.S.
application Ser. No. 11/911,617 filed Dec. 6, 2007, now issued as
U.S. Pat. No. 7,951,563; which is a 35 USC .sctn.371 National Stage
application of International Application No. PCT/US2006/014131
filed Apr. 17, 2006; which claims the benefit under 35 USC
.sctn.119(e) to U.S. Application Ser. No. 60/787,402 filed Mar. 30,
2006, U.S. Application Ser. No. 60/723,602 filed Oct. 4, 2005, U.S.
Application Ser. No. 60/709,318 filed Aug. 17, 2005, U.S.
Application Ser. No. 60/704,860 filed Aug. 1, 2005, U.S.
Application Ser. No. 60/697,521 filed Jul. 8, 2005, U.S.
Application Ser. No. 60/676,997 filed May 2, 2005 and U.S.
Application Ser. No. 60/672,242 filed Apr. 15, 2005, all now
expired. The disclosure of each of the prior applications is
considered part of and is incorporated by reference in the
disclosure of this application.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to genomic DNA sequences that
exhibit altered expression patterns in disease states relative to
normal. Particular embodiments provide, inter alia, novel methods,
nucleic acids, nucleic acid arrays and kits useful for detecting,
or for detecting and differentiating between or among cell
proliferative disorders. Preferably, the methods, nucleic acids,
nucleic acid arrays and kits for the detection and diagnosis of
cell proliferative disorders are used for the diagnosis of cancer
and in particular colorectal and/or liver cancer.
[0004] 2. Background Information
[0005] Incidence and Diagnosis of Cancer.
[0006] Cancer is the second leading cause of death of the United
States. Mortality rates could be significantly improved if current
screening methods would be improved in terms of patient compliance,
sensitivity and ease of screening. Current recommended methods for
diagnosis of cancer are often expensive and are not suitable for
application as population wide screening tests.
[0007] Hepatocellular cancer (HCC) is the fourth most common cancer
in the world, its incidence varies from 2.1 per 100,000 in North
America to 80 per 100,000 in China. In the United States, it is
estimated that there will be 17,550 new cases diagnosed in 2005 and
15,420 deaths due to this disease. Ultrasound of the liver, alpha
fetoprotein levels and conventional CT scan are regularly obtained
in the diagnostic evaluation of HCC (hepatocellular cancer or
primary liver cancer), but they are often too insensitive to detect
multi-focal small lesions and for treatment planning.
[0008] In the United States the annual incidence of colorectal
cancer is approximately 150,000, with 56,600 individuals dying form
colorectal cancer each year. The lifetime risk of colorectal cancer
in the general population is about 5 to 6 percent. Despite
intensive efforts in recent years in screening and early detection
of colon cancer, until today most cases are diagnosed in an
advanced stage with regional or distant metastasis. While the
therapeutic options include surgery and adjuvant or palliative
chemotherapy, most patients die from progression of their cancer
within a few months. Identifying the molecular changes that
underlie the development of colon cancer may help to develop new
monitoring, screening, diagnostic and therapeutic options that
could improve the overall poor prognosis of these patients.
[0009] The current guidelines for colorectal screening according to
the American Cancer Society utilizes one of five different options
for screening in average risk individuals 50 years of age or older.
These options include 1) fecal occult blood test (FOBT) annually,
2) flexible sigmoidoscopy every five years, 3) annual FPBT plus
flexible sigmoidoscopy every five years, 4) double contrast barium
enema (DCBE) every five years or 5) colonoscopy every ten years.
Even though these testing procedures are well accepted by the
medical community, the implementation of widespread screening for
colorectal cancer has not been realized. Patient compliance is a
major factor for limited use due to the discomfort or inconvenience
associated with the procedures. FOBT testing, although a
non-invasive procedure, requires dietary and other restrictions 3-5
days prior to testing. Sensitivity levels for this test are also
very low for colorectal adenocarcinoma with wide variability
depending on the trial. Sensitivity measurements for detection of
adenomas is even less since most adenomas do not bleed. In
contrast, sensitivity for more invasive procedures such as
sigmoidoscopy and colonoscopy are quite high because of direct
visualization of the lumen of the colon. No randomized trials have
evaluated the efficacy of these techniques, however, using data
from case-control studies and data from the National Polyp Study
(U.S.) it has been shown that removal of adenomatous polyps results
in a 76-90% reduction in CRC incidence. Sigmoidoscopy has the
limitation of only visualizing the left side of the colon leaving
lesions in the right colon undetected. Both scoping procedures are
expensive, require cathartic preparation and have increased risk of
morbidity and mortality. Improved tests with increased sensitivity,
specificity, ease of use and decreased costs are clearly needed
before general widespread screening for colorectal cancer becomes
routine.
[0010] Early colorectal cancer detection is generally based on the
fecal occult blood test (FOBT) performed annually on asymptomatic
individuals. Current recommendations adapted by several healthcare
organizations, including the American Cancer Society, call for
fecal occult blood testing beginning at age 50, repeated annually
until such time as the patient would no longer benefit from
screening. A positive FOBT leads to colonoscopic examination of the
bowel; an expensive and invasive procedure, with a serious
complication rate of one per 5,000 examinations. Only 12% of
patients with heme positive stool are diagnosed with cancer or
large polyps at the time of colonoscopy. A number of studies show
that FOBT screening does not improve cancer-related mortality or
overall survival. Compliance with occult blood testing has been
poor; less than 20 percent of the population is offered or
completes FOBT as recommended. If FOBT is properly done, the
patient collects a fecal sample from three consecutive bowel
movements. Samples are obtained while the patient adheres to
dietary guidelines and avoids medications known to induce occult
gastrointestinal bleeding. In reality, physicians frequently fail
to instruct patients properly, patients frequently fail to adhere
to protocol, and some patients find the task of collecting fecal
samples difficult or unpleasant, hence compliance with annual
occult blood testing is poor. If testing sensitivity and
specificity can be improved over current methods, the frequency of
testing could be reduced, collection of consecutive samples would
be eliminated, dietary and medication schedule modifications would
be eliminated, and patient compliance would be enhanced.
Compounding the problem of compliance, the sensitivity and
specificity of FOBT to detect colon cancer is poor. Poor test
specificity leads to unnecessary colonoscopy, adding considerable
expense to colon cancer screening.
[0011] Specificity of the FOBT has been calculated at best to be
96%, with a sensitivity of 43% (adenomas) and 50% (colorectal
carcinoma). Sensitivity can be improved using an immunoassay FOBT
such as that produced under the tradename InSure.RTM., with an
improved sensitivity of 77% (adenomas) and 88.9% (colorectal
carcinoma.
[0012] Molecular Disease Markers.
[0013] Molecular disease markers offer several advantages over
other types of markers, one advantage being that even samples of
very small sizes and/or samples whose tissue architecture has not
been maintained can be analysed quite efficiently. Within the last
decade a number of genes have been shown to be differentially
expressed between normal and colon carcinomas. However, no single
or combination of marker has been shown to be sufficient for the
diagnosis of colon carcinomas. High-dimensional mRNA based
approaches have recently been shown to be able to provide a better
means to distinguish between different tumor types and benign and
malignant lesions. However its application as a routine diagnostic
tool in a clinical environment is impeded by the extreme
instability of mRNA, the rapidly occurring expression changes
following certain triggers (e.g., sample collection), and, most
importantly, the large amount of mRNA needed for analysis
(Lipshutz, R. J. et al., Nature Genetics 21:20-24, 1999; Bowtell,
D. D. L. Nature genetics suppl. 21:25-32, 1999), which often cannot
be obtained from a routine biopsy.
[0014] The use of biological markers to further improve sensitivity
and specificity of FOBT has been suggested, examples of such tests
include the PreGen-Plus.TM. stool analysis assay available from
EXACT Sciences which has a sensitivity of 20% (adenoma) and 52%
(colorectal carcinoma) and a specificity of 95% in both cases. This
test assays for the presence of 23 DNA mutations associated with
the development of colon neoplasms. The use of DNA methylation as
colon cancer markers is known. For example Sabbioni et al.
(Molecular Diagnosis 7:201-207, 2003) detected hypermethylation of
a panel of genes consisting TPEF, HIC1, DAPK and MGMT in peripheral
blood in 98% of colon carcinoma patients. However, this does
provide a suitable basis for a commercially marketable test, as the
specificity of such a test must also be sufficiently high.
[0015] The current model of colorectal pathogenesis favours a
stepwise progression of adenomas, which includes the development of
dysplasia and finally signs of invasive cancer. The molecular
changes underlying this adenoma-carcinoma sequence include genetic
and epigenetic alterations of tumor suppressor genes (APC, p53,
DCC), the activation of oncogenes (K-ras) and the inactivation of
DNA mismatch repair genes. Recently, further molecular changes and
genetic defects have been revealed. Thus, activation of the Wnt
signalling pathway not only includes mutations of the APC gene, but
may also result from .beta.-catenin mutations. Furthermore,
alterations in the TGF-.beta. signalling pathway together with its
signal transducers SMAD4 and SMAD2 have been linked to the
development of colon cancer.
[0016] Despite recent progress in the understanding of the
pathogenesis of adenomas and carcinomas of the colon and their
genetic and molecular changes, the genetic and epigenetic changes
underlying the development of metastasis are less well understood.
It is, however, generally well accepted that the process of
invasion and proteolysis of the extracellular matrix, as well as
infiltration of the vascular basement membrane involve adhesive
proteins, such as members of the family of integrin receptors, the
cadherins, the immunoglobulin superfamily, the laminin binding
protein and the CD44 receptor. Apart from adhesion, the process of
metastasis formation also includes the induction and regulation of
angiogenesis (VEGF, bFGF), the induction of cell proliferation
(EGF, HGF, IGF) and the activation of proteolytic enzymes (MMPs,
TIMPs, uPAR), as well as the inhibition of apoptosis (Bcl-2,
Bcl-X). More recently other groups have compared the genetic and
molecular changes in metastatic lesions to the changes found in
primary colorectal cancers. Thus, Kleeff et al. reported the loss
of DOC-2, a candidate tumor suppressor gene, both in primary and
metastatic colorectal cancer. Furthermore, Zauber et al. reported
that in their series of 42 colorectal cancers Ki-ras mutations in
the primary cancers were identical in all of the 42 paired primary
and synchronous metastatic lesions. Similarly loss of
heterozygosity at the APC locus was identical for 39 paired
carcinomas and synchronous metastasis. The authors concluded that
for Ki-ras and APC genes the genetic changes in metastasis are
identical to the primary colorectal cancer. However, other groups
have found genetic and molecular changes in metastatic colon
cancers, that are not present in the primary cancers. Thus, the
development of LOH of chromosome 3p in colorectal metastasis has
been reported. In addition, using comparative genomic hybridization
several alterations were found in liver metastasis that were unique
to metastastic lesions (-9q, -11q, and -17q).
[0017] CpG Island Methylation.
[0018] Apart from mutations aberrant methylation of CpG islands has
been shown to lead to the transcriptional silencing of certain
genes that have been previously linked to the pathogenesis of
various cancers. CpG islands are short sequences which are rich in
CpG dinucleotides and can usually be found in the 5' region of
approximately 50% of all human genes. Methylation of the cytosines
in these islands leads to the loss of gene expression and has been
reported in the inactivation of the X chromosome and genomic
imprinting.
[0019] Recently several groups have also analysed the methylation
of various genes in colorectal cancer and reported the
transcriptional silencing by promoter methylation for p16INK4,
p14ARF, p15INK4b, MGMT, hMLH1, GSTP1, DAPK, CDH1, TIMP-3 and APC
among others. Thus apart from mutational inactivation of certain
genes, the hypermethylation of these genes also contributes
significantly to the pathogenesis of this disease.
[0020] In recent years several genes that are methylated in colon
cancer have been identified by MS-APPCR. This group of genes, among
others, includes TPEF/HPP1 which is frequently methylated in colon
cancers and which was independently identified by two different
groups using the MS-APPCR method (see, e.g., Young J, Biden K G,
Simms L A, Huggard P, Karamatic R, Eyre H J, Sutherland G R, Herath
N, Barker M, Anderson G J, Fitzpatrick D R, Ramm G A, Jass J R,
Leggett B A. HPP1: a transmembrane protein-encoding gene commonly
methylated in colorectal polyps and cancers. Proc Natl Acad Sci USA
98:265-270, 2001).
[0021] Multifactorial Approach.
[0022] Cancer diagnostics has traditionally relied upon the
detection of single molecular markers (e.g., gene mutations,
elevated PSA levels). Unfortunately, cancer is a disease state in
which single markers have typically failed to detect or
differentiate many forms of the disease. Thus, assays that
recognize only a single marker have been shown to be of limited
predictive value. A fundamental aspect of this invention is that
methylation-based cancer diagnostics and the screening, diagnosis,
and therapeutic monitoring of such diseases will provide
significant improvements over the state-of-the-art that uses single
marker analyses by the use of a selection of multiple markers. The
multiplexed analytical approach is particularly well suited for
cancer diagnostics since cancer is not a simple disease, this
multi-factorial "panel" approach is consistent with the
heterogeneous nature of cancer, both cytologically and
clinically.
[0023] Key to the successful implementation of a panel approach to
methylation based diagnostic tests is the design and development of
optimized panels of markers that can characterize and distinguish
disease states. The present invention describes a plurality of
particularly efficient and unique panels of genes, the methylation
analysis of one or a combination of the members of the panel
enabling the detection of colon cell proliferative disorders with a
particularly high sensitivity, specificity and/or predictive
value.
[0024] Development of Medical Tests.
[0025] Two key evaluative measures of any medical screening or
diagnostic test are its sensitivity and specificity, which measure
how well the test performs to accurately detect all affected
individuals without exception, and without falsely including
individuals who do not have the target disease (predicitive value).
Historically, many diagnostic tests have been criticized due to
poor sensitivity and specificity.
[0026] A true positive (TP) result is where the test is positive
and the condition is present. A false positive (FP) result is where
the test is positive but the condition is not present. A true
negative (TN) result is where the test is negative and the
condition is not present. A false negative (FN) result is where the
test is negative but the condition is not present. In this context:
Sensitivity=TP/(TP+FN); Specificity=TN/(FP+TN); and Predictive
value=TP/(TP+FP).
[0027] Sensitivity is a measure of a test's ability to correctly
detect the target disease in an individual being tested. A test
having poor sensitivity produces a high rate of false negatives,
i.e., individuals who have the disease but are falsely identified
as being free of that particular disease. The potential danger of a
false negative is that the diseased individual will remain
undiagnosed and untreated for some period of time, during which the
disease may progress to a later stage wherein treatments, if any,
may be less effective. An example of a test that has low
sensitivity is a protein-based blood test for HIV. This type of
test exhibits poor sensitivity because it fails to detect the
presence of the virus until the disease is well established and the
virus has invaded the bloodstream in substantial numbers. In
contrast, an example of a test that has high sensitivity is
viral-load detection using the polymerase chain reaction (PCR).
High sensitivity is achieved because this type of test can detect
very small quantities of the virus. High sensitivity is
particularly important when the consequences of missing a diagnosis
are high.
[0028] Specificity, on the other hand, is a measure of a test's
ability to identify accurately patients who are free of the disease
state. A test having poor specificity produces a high rate of false
positives, i.e., individuals who are falsely identified as having
the disease. A drawback of false positives is that they force
patients to undergo unnecessary medical procedures treatments with
their attendant risks, emotional and financial stresses, and which
could have adverse effects on the patient's health. A feature of
diseases which makes it difficult to develop diagnostic tests with
high specificity is that disease mechanisms, particularly in
cancer, often involve a plurality of genes and proteins.
Additionally, certain proteins may be elevated for reasons
unrelated to a disease state. n example of a test that has high
specificity is a gene-based test that can detect a p53 mutation.
Specificity is important when the cost or risk associated with
further diagnostic procedures or further medical intervention are
very high.
[0029] Pronounced Need in the Art.
[0030] It is generally accepted that there is a pronounced need in
the art for improved screening and early detection of cancers. As
an example, if colon cancer screening specificity can be increased,
the problem of false positive test results leading to unnecessary
colonoscopic examination would be reduced leading to cost savings
and improved safety.
[0031] In view of the incidence of cancers in general and more
particularly the disadvantages associated with current colorectal
and hepatocelluar cell proliferative disorder screening methods
there is a substantial need in the art for improved methods for the
early detection of cancer, in particular colon cancer, to be used
in addition to or as a substitute for currently available
tests.
[0032] Background of the Genes of the Present Invention.
[0033] The human Septin 9 gene (also known as MLL septin-like
fusion protein, MLL septin-like fusion protein MSF-A, Slpa,
Eseptin, Msf, septin-like protein Ovarian/Breast septin (Ov/Br
septin) and Septin D1) is located on chromosome 17q25 within contig
AC068594.15.1.168501 and is a member of the Septin gene family.
FIG. 1 provides the Ensembl annotation of the Septin 9 gene, and
shows 4 transcript variants, the Septin 9 variants and the Q9HC74
variants (which are truncated versions of the Septin 9
transcripts). SEQ ID NO:1 provides the sequence of said gene,
comprising regions of both the Septin 9 and Q9HC74 transcripts and
promoter regions. SEQ ID NO:2 and SEQ ID NO:3 are sub-regions
thereof that provide the sequence of CpG rich promoter regions of
Septin 9 and Q9HC74 transcripts respectively.
[0034] It has been postulated that members of the Septin gene
family are associated with multiple cellular functions ranging from
vesicle transport to cytokinesis. Disruption of the action of
Septin 9 results in incomplete cell division, see Surka, M. C.,
Tsang, C. W., and Trimble, W. S. Mol Biol Cell, 13: 3532-45 (2002).
Septin 9 and other proteins have been shown to be fusion partners
of the proto-oncogene MLL suggesting a role in tumorogenesis, see
Osaka, M, Rowley, J. D. and Zeleznik-Le, N. J. PNAS, 96:6428-6433
(1999). Burrows et al. reported an in depth study of expression of
the multiple isoforms of the Septin 9 gene in ovarian cancer and
showed tissue specific expression of various transcripts, see
Burrows, J. F., Chanduloy, et al. S.E.H. Journal of Pathology,
201:581-588 (2003).
[0035] A recent study (post-priority date published prior art) of
over 7000 normal and tumor tissues indicates that there is
consistent over-expression of Septin 9 isoforms in a number of
tumor tissues, see Scott, M., Hyland, P. L., et al. Oncogene, 24:
4688-4700 (2005). The authors speculate that the gene is likely a
type II cancer gene where changes in RNA transcript processing
control regulation of different protein products, and the levels of
these altered protein isoforms may provide answers to the gene's
role in malignancy.
[0036] The MSF (migration stimulating factor) protein transcribed
from the FN1 gene has also been implicated in carcinogenesis (see
WO99/31233); however, it should be noted that this protein is not
the subject of the present application, and is currently not known
to be associated with the Septin 9/MSF gene and transcribed
products thereof.
[0037] From the references cited above it can be seen that the
biological mechanisms linking said gene to tumorigenesis remain
unclear. In WO 2004/074441 it is claimed that increased copy number
and over-expression of the gene is a marker of cancer, and further
provides means for diagnosis and treatment thereof according to
said observation. WO 2004/074441 is accordingly the closest prior
art as it has the greatest number of features in common with the
method and nucleic acids of the present invention, and because it
relates to the same field (cancer diagnosis). A major difference
between the present invention and that of WO 2004/074441 is that
the present invention shows for the first time that
under-expression of the gene Septin 9 is associated with cancer.
More particularly this is illustrated by means of methylation
analysis. The correlation between expression and DNA methylation,
and methods for determining DNA methylation are known in the art
(see WO 99/28498). Nonetheless, it would not be obvious to the
person skilled in the art that under-expression would be also
associated with the development of cancer, in particular as WO
2004/074441 describes the modulation of said expression to lower
levels as a potential therapy for cancer.
[0038] SEQ ID NO:28 provides a CpG rich sequence located on
chromosome 17q in the overlapping promotor regions of the
Vitronectin (VTN, OMIM 193190, Accession number NM.sub.--000638)
and SARM genes (Steril Alpha And Heat/Armadillo Motifs-Containing
Protein, OMIM 607732).
[0039] The VTN gene encodes a 75-kD glycoprotein (also called serum
spreading factor or complement S-protein) that promotes attachment
and spreading of animal cells in vitro, inhibits cytolysis by the
complement C5b-9 complex, and modulates antithrombin III-thrombin
action in blood coagulation. Higher expression of Vitronectin has
been observed in colon cancer cells (Exp Cell Res. 1994 September;
214(1):303-12.). Furthermore, expression of this gene has been
linked to progression and invasiveness of cancer cells. It is
suggest that VTN is activated in tumours and blocking of the
vitronectin receptor by a specific peptide reduces tumour size
(Bloemendal H J, de Boer H C, Koop E A, van Dongen A J,
Goldschmeding R, Landman W J, Logtenberg T, Gebbink M F, Voest E E.
Cancer Immunol Immunother. 2004 September; 53(9):799-808.; Haier J,
Goldmann U, Hotz B, Runkel N, Keilholz U. Clin Exp Metastasis.
2002; 19(8):665-72.).
[0040] The SARM protein consists of 690 amino acids and contains a
65-amino acid sterile alpha (SAM) domain surrounded by short
HEAT/armadillo repeat sequences. Northern blot analysis has shown
that the SARM antisense RNA is detectable at elevated levels in
cancer cell lines irrespective of the tissue origin or metastatic
potential (Mink, M.; Fogelgren, B.; Olszewski, K.; Maroy, P.;
Csiszar, K. Genomics 74: 234-244, 2001.). Said study further
demonstrated that the protein-encoding SARM transcript was only
expressed one prostate carcinoma cell line of those studied.
[0041] SEQ ID NO:24 provides a CpG rich sequence located on
chromosome 3q23, downstream of the gene Forkhead Transcription
Factor L2 gene (FOXL2, Pituitary Forkhead Factor, OMIM 605597). SEQ
ID NO:24 has heretofore not been associated with cancer of any
type. FOXL2 coding region is highly conserved among mammals.
Immunohistochemical evidence indicates that FOXL2 is a nuclear
protein specifically expressed in eyelids and in fetal and adult
ovarian follicular cells. It is suggested that FOXL2 may play a
role in ovarian somatic cell differentiation and in further
follicle development and/or maintenance (J. Med. Genet. 39:
916-922, 2002.).
[0042] Moreover, mutations in the FOXL2 gene are associated with
the blepharophimosis/ptosis/epicanthus inversus syndrome (BPES), a
syndrome which affects the eyelids and the ovary (Am. J. Hum.
Genet. 72: 478-487, 2003.; Hum. Mutat. 24: 189-193, 2004). The
FOXL2 gene has heretofore not been associated with cancer, however
other members of the FOX family have been implicated in
oncogenesis. The FOXA1 gene is amplified and overexpressed in
esophageal and lung cancer, the FOXM1 gene is up-regulated in
pancreatic cancer and basal cell carcinoma due to the
transcriptional regulation by Sonic Hedgehog (SHH) pathway.
[0043] SEQ ID NO:27 presents part of the Six6 (Homeobox protein
SIX6) gene, located on Chromosome 14q, synonyms include Homeodomain
protein OPTX2, Optic homeobox 2, OPTX2, Sine oculis homeobox
homolog 6, sine oculis homeobox homolog 6 (Drosophila), Six9, SIX9.
The Six6 gene is associated in development pathways and its
aberrant expression has been linked T-cell acute lymphoblastic
leukemia oncogenesis.
[0044] SEQ ID NO:25 is located on chromosome 17q21.31 and comprises
the promotor region of the NGFR gene as well as parts of the NGFR
gene itself (Nerve Growth Factor Receptor also known as p75, OMIM
162010). NGFR binds alone or in combination with other receptors to
neurotrophins and neurite outgrowth inhibitory factors. It has been
shown that NGFR plays a role in apoptosis, in myelination of
peripheral nerves and in inhibition of central nervous system
regeneration after axon lesion (Dobrowsky, R. T.; Werner, M. H.;
Castellino, A. M.; Chao, M. V.; Hannun, Y. A. Science 265:
1596-1599, 1994; Cosgaya, J. M.; Chan, J. R.; Shooter, E. M.
Science 298: 1245-1248, 2002; Wang, K. C.; Kim, J. A.;
Sivasankaran, R.; Segal, R.; He, Z. Nature 420: 74-78, 2002.).
Methylation of the NGFR gene has previously been associated with
the development of colon cancer (PCT/US04/20336).
[0045] SEQ ID NO:26 is located on chromosome 17q21.31 and comprises
the promoter region of the gene TMEFF2. Methylation of TMEFF2 has
been linked to colon cancer Cancer Res. 2000 Sep. 1;
60(17):4907-12.
SUMMARY OF THE INVENTION
[0046] The present invention provides a method for detecting and/or
classifying cell proliferative disorders in a subject comprising
determining the expression levels of at least one gene or genomic
sequence selected from the group consisting of Septin 9 (including
all transcript variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1,
FAT and SEQ ID NOS:160 to SEQ ID NO:165 in a biological sample
isolated from said subject wherein underexpression and/or CpG
methylation is indicative of the presence or class of said
disorder. Various aspects of the present invention provide an
efficient and unique genetic marker, whereby expression analysis of
said marker enables the detection of cellular proliferative
disorders with a particularly high sensitivity, specificity and/or
predictive value. Furthermore, said marker enables the
differentiation of neoplastic cellular proliferative disorders
(including pre-cancerous conditions) from benign cellular
proliferative disorders. The marker of the present invention is
particularly suited for detection of colorectal and hepatocellular
carcinomas. In the context of colorectal carcinoma the inventive
testing methods have particular utility for the screening of
at-risk populations. The inventive methods have advantages over
prior art methods (including the industry standard FOBT), because
of improved sensitivity, specificity and likely patient
compliance.
[0047] The methods and nucleic acids of the present invention are
most preferably utilised for detecting liver cancer or
distinguishing it from other liver cell proliferative disorders or
for detecting colorectal carcinoma or pre-cancerous colorectal cell
proliferative disorders.
[0048] In one embodiment the invention provides a method for
detecting and/or classifying cell proliferative disorders in a
subject comprising determining the expression levels of at least
one gene or genomic sequence selected from the group consisting of
Septin 9 (including all transcript variants thereof), FOXL2, SARM1,
VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 in a
biological sample isolated from said subject wherein
underexpression and/or CpG methylation is indicative of the
presence or class of said disorder. In one embodiment said
expression level is determined by detecting the presence, absence
or level of mRNA transcribed from said gene. In a further
embodiment said expression level is determined by detecting the
presence, absence or level of a polypeptide encoded by said gene or
sequence thereof.
[0049] In a further preferred embodiment said expression is
determined by detecting the presence or absence of CpG methylation
within said gene, wherein the presence of methylation indicates the
presence of a cell proliferative disorder. Said method comprises
the following steps: i) contacting genomic DNA isolated from a
biological sample (preferably selected from the group consisting of
blood plasma, blood serum, whole blood, isolated blood cells, cells
isolated from the blood) obtained from the subject with at least
one reagent, or series of reagents that distinguishes between
methylated and non-methylated CpG dinucleotides within at least one
target region of the genomic DNA, wherein the nucleotide sequence
of said target region comprises at least one CpG dinucleotide
sequence of at least one gene or genomic sequence selected from the
group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NO:160 to
SEQ ID NO:165; and ii) detecting and/or classifying cell
proliferative disorders, at least in part. Preferably the target
region comprises, or hybridizes under stringent conditions to a
sequence of at least 16 contiguous nucleotides of at least one
sequence selected from the group consisting of SEQ ID NOS:1 to SEQ
ID NO3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID
NO:167.
[0050] Preferably, the sensitivity of said detection is from about
75% to about 96%, or from about 80% to about 90%, or from about 80%
to about 85%. Preferably, the specificity is from about 75% to
about 96%, or from about 80% to about 90%, or from about 80% to
about 85%.
[0051] The method is novel as no methods currently exist that
enable the detection of cancer by analysis of body fluids, with a
sensitivity and specificity high enough for use in a commercially
available and regulatory body approved assay. For example, current
methods used to detect and diagnose colorectal carcinoma include
colonoscopy, sigmoidoscopy, and fecal occult blood colon cancer. In
comparison to these methods, the disclosed invention is much less
invasive than colonoscopy, and as, if not more sensitive than
sigmoidoscopy and FOBT. The development of a body fluid assay
represents a clear technical advantage over current methods known
in the art in that it is anticipated that at least for colorectal
carcinoma screening patient compliance for a single body fluid
based test will be higher than the triplicate analysis of stool
currently recommended for FOBT.
[0052] As a further illustration current methods used to detect and
diagnose liver cancers include PET and MRI imaging and cytology
screening of aspirate or biopsy. Radiological screening methods do
not usually detect cancers at early stages and are expensive and
time consuming to carry out. Cytological screening presents risks
associated with biopsy (internal bleeding) and aspiration
(needle-track seeding and haemorrhage, bile peritonitis, and
pneumothorax) Accordingly, detection of liver cancer at an early
stage is currently not possible, furthermore as patient prognosis
is greatly improved by early detection there exists a need in the
art for such a screening test.
[0053] A particular embodiment the method comprises the use of at
least one gene or genomic sequence selected from the group
consisting of Septin 9 (including all transcript variants thereof),
FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID
NO:165 as a marker for the detection and distinguishing of cellular
proliferative disorders. The present invention is particularly
suited for the detection of neoplastic cellular proliferative
disorders (including at the pre-neoplastic stage). Furthermore the
methods and nucleic acids of the present invention enable the
differentiation of malignant from benign cellular proliferative
disorders. The methods and nucleic acids of the present invention
are particularly effective in the detection of colorectal or liver
neoplastic disorders and pre-neoplastic. Furthermore they have
utility in differentiating between neoplastic and benign cellular
proliferative colorectal and hepatocellular disorders.
[0054] Said use of the gene may be enabled by means of any analysis
of the expression of the gene, by means of mRNA expression analysis
or protein expression analysis. However, in the most preferred
embodiment of the invention, the detection, differentiation and
distinguishing of colorectal or liver cell proliferative disorders
is enabled by means of analysis of the methylation status of at
least one gene or genomic sequence selected from the group
consisting of Septin 9 (including all transcript variants thereof),
FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID
NO:165, and its promoter or regulatory elements.
[0055] The invention provides a method for the analysis of
biological samples for features associated with the development of
cellular proliferative disorders, the method characterised in that
at least one nucleic acid, or a fragment thereof, from the group
consisting of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID
NO:28, SEQ ID NOS:159 to SEQ ID NO:167 is contacted with a reagent
or series of reagents capable of distinguishing between methylated
and non methylated CpG dinucleotides within the genomic sequence,
or sequences of interest.
[0056] The present invention provides a method for ascertaining
epigenetic parameters of genomic DNA associated with the
development of neoplastic cellular proliferative disorders (e.g.,
cancers). The method has utility for the improved diagnosis,
treatment and monitoring of said diseases.
[0057] Preferably, the source of the test sample is selected from
the group consisting of cells or cell lines, histological slides,
biopsies, paraffin-embedded tissue, body fluids, ejaculate, stool,
urine, blood, and combinations thereof. More preferably, the source
is selected from the group consisting of stool, blood plasma, blood
serum, whole blood, isolated blood cells, cells isolated from the
blood obtained from the subject.
[0058] Specifically, the present invention provides a method for
detecting neoplastic cellular proliferative disorders (preferably
colorectal and/or liver cell) including at the early pre-cancerous
stage, and for differentiating between neoplastic and benign
cellular proliferative disorders, comprising: obtaining a
biological sample comprising genomic nucleic acid(s); contacting
the nucleic acid(s), or a fragment thereof, with one reagent or a
plurality of reagents sufficient for distinguishing between
methylated and non methylated CpG dinucleotide sequences within at
least one target sequence of the subject nucleic acid, wherein the
target sequence comprises, or hybridises under stringent conditions
to, a sequence comprising at least 16 contiguous nucleotides of a
sequence selected from the group consisting SEQ ID NOS:1 to SEQ ID
NO3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167,
said contiguous nucleotides comprising at least one CpG
dinucleotide sequence; and determining, based at least in part on
said distinguishing, the methylation state of at least one target
CpG dinucleotide sequence, or an average, or a value reflecting an
average methylation state of a plurality of target CpG dinucleotide
sequences.
[0059] Preferably, distinguishing between methylated and non
methylated CpG dinucleotide sequences within the target sequence
comprises methylation state-dependent conversion or non-conversion
of at least one such CpG dinucleotide sequence to the corresponding
converted or non-converted dinucleotide sequence within a sequence
selected from the group consisting of SEQ ID NOS:4 to SEQ ID NO:15,
SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ
ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID
NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203, and
contiguous regions thereof corresponding to the target
sequence.
[0060] Additional embodiments provide a method for the detection of
neoplastic cellular proliferative disorders (or distinguishing them
from benign cellular proliferative disorders), most preferably
colorectal or hepatocellular, comprising: obtaining a biological
sample having subject genomic DNA; extracting the genomic DNA;
treating the genomic DNA, or a fragment thereof, with one or more
reagents to convert 5-position unmethylated cytosine bases to
uracil or to another base that is detectably dissimilar to cytosine
in terms of hybridization properties; contacting the treated
genomic DNA, or the treated fragment thereof, with an amplification
enzyme and at least two primers comprising, in each case a
contiguous sequence at least 9 nucleotides in length that is
complementary to, or hybridizes under moderately stringent or
stringent conditions to a sequence selected from the group
consisting SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID
NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID
NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203, and complements thereof,
wherein the treated DNA or the fragment thereof is either amplified
to produce an amplificate, or is not amplified; and determining,
based on a presence or absence of, or on a property of said
amplificate, the methylation state or an average, or a value
reflecting an average of the methylation level of at least one, but
more preferably a plurality of CpG dinucleotides of a sequence
selected from the group consisting of SEQ ID NO:1 to SEQ ID NO:3,
SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.
[0061] Preferably, determining comprises use of at least one method
selected from the group consisting of: I) hybridizing at least one
nucleic acid molecule comprising a contiguous sequence at least 9
nucleotides in length that is complementary to, or hybridizes under
moderately stringent or stringent conditions to a sequence selected
from the group consisting of SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID
NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID
NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID
NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203, and
complements thereof; ii) hybridizing at least one nucleic acid
molecule, bound to a solid phase, comprising a contiguous sequence
at least 9 nucleotides in length that is complementary to, or
hybridizes under moderately stringent or stringent conditions to a
sequence selected from the group consisting of SEQ ID NOS:4 to SEQ
ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NO:30 to SEQ ID
NO:31, SEQ ID NO:42 to SEQ ID NO:43, SEQ ID NO:38 to SEQ ID NO:39,
SEQ ID NO:50 to SEQ ID NO:51, SEQ ID NO:168 to SEQ ID NO:203, and
complements thereof; iii) hybridizing at least one nucleic acid
molecule comprising a contiguous sequence at least 9 nucleotides in
length that is complementary to, or hybridizes under moderately
stringent or stringent conditions to a sequence selected from the
group consisting of SEQ ID NO:4 to SEQ ID NO 15, SEQ ID NOS:28 to
SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ
ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203, and complements thereof,
and extending at least one such hybridized nucleic acid molecule by
at least one nucleotide base; and iv) sequencing of the
amplificate.
[0062] Further embodiments provide a method for the analysis (i.e.,
detection and/or classification) of cell proliferative disorders,
comprising: obtaining a biological sample having subject genomic
DNA; extracting the genomic DNA; contacting the genomic DNA, or a
fragment thereof, comprising one or more sequences selected from
the group consisting of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24,
SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 or a sequence that
hybridizes under stringent conditions thereto, with one or more
methylation-sensitive restriction enzymes, wherein the genomic DNA
is either digested thereby to produce digestion fragments, or is
not digested thereby; and determining, based on a presence or
absence of, or on property of at least one such fragment, the
methylation state of at least one CpG dinucleotide sequence of at
least one genomic sequence selected form the group consisting of
SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID
NOS:159 to SEQ ID NO:167, or an average, or a value reflecting an
average methylation state of a plurality of CpG dinucleotide
sequences thereof. Preferably, the digested or undigested genomic
DNA is amplified prior to said determining.
[0063] Additional embodiments provide novel genomic and chemically
modified nucleic acid sequences, as well as oligonucleotides and/or
PNA-oligomers for analysis of cytosine methylation patterns within
sequences from the group consisting of SEQ ID NOS:1 to SEQ ID NO:3,
SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.
BRIEF DESCRIPTION OF THE DRAWINGS
[0064] FIG. 1 shows the Ensembl human genome annotation of the
Septin 9 and Q9HC74 gene transcripts. The relative locations of SEQ
ID NO:2 and SEQ ID NO:3 are also shown.
[0065] FIG. 2 provides three plots. The two plots on the left show
the sensitivity of the assay of SEQ ID NO:1 (Assay 2) in colorectal
carcinoma and blood samples in Example 2. The plot to the right
provides a ROC of the colorectal carcinoma detection.
[0066] FIG. 3 shows the methylation levels measured in other
cancers according to Example 4.
[0067] FIG. 4 shows the methylation levels measured in other
non-cancerous diseases, according to Example 4.
[0068] FIGS. 5 to 29 provide matrices of the bisulfite sequencing
data according to Example 5. Each column of the matrices represents
the sequencing data for a replicate of one sample, all replicates
of each sample are grouped together in one block. Each row of a
matrix represents a single CpG site within the fragment. The CpG
number of the amplificate is shown to the left of the matrices. The
amount of measured methylation at each CpG position is represented
by colour from light grey (0% methylation), to medium grey (50%
methylation) to dark grey (100% methylation). Some amplificates,
samples or CpG positions were not successfully sequenced and these
are shown in white.
[0069] FIGS. 5 to 12 provide an overview of the sequencing of the
bisulfite converted amplificates of the genomic sequence according
to Table 21 in 4 samples that had previously been quantified (by
HeavyMethyl.RTM. assay) as having between 10% and 20%
methylation.
[0070] FIGS. 13 to 20 provide an overview of the sequencing of the
bisulfite converted amplificate of the genomic sequence according
to Table 21 in 2 samples that had previously been quantified (by
HeavyMethyl.RTM. assay) as having greater than 20% methylation.
[0071] FIGS. 21 to 22 provide an overview of the sequencing of the
bisulfite converted amplificate of the genomic sequence according
to Table 21 in blood samples from 3 healthy subjects.
[0072] FIGS. 23 to 29 provide an overview of the sequencing of the
bisulfite converted amplificate of the genomic sequence according
to Table 21 in 6 samples that had previously been quantified (by
HeavyMethyl.RTM. assay) as having less than 10% (but greater than
0%) methylation.
[0073] FIGS. 30 to 37 each provide three plots. The two plots on
the left show the sensitivity of the assay according to table 12 in
colorectal carcinoma and blood samples in Example 2. The upper plot
shows a binary distribution of two sample types, whereas the lower
plot provides a mulitclass distribution. The Y-Axis of said plots
shows the proportion of analysed samples with a methylation level
greater than the quantified value shown on the X-axis. The plot to
the right provides a ROC of the colorectal carcinoma detection.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0074] The term "Observed/Expected Ratio" ("O/E Ratio") refers to
the frequency of CpG dinucleotides within a particular DNA
sequence, and corresponds to the [number of CpG sites/(number of C
bases.times.number of G bases)]/band length for each fragment.
[0075] The term "CpG island" refers to a contiguous region of
genomic DNA that satisfies the criteria of (1) having a frequency
of CpG dinucleotides corresponding to an "Observed/Expected
Ratio">0.6, and (2) having a "GC Content">0.5. CpG islands
are typically, but not always, between about 0.2 to about 1 KB, or
to about 2 kb in length.
[0076] The term "methylation state" or "methylation status" refers
to the presence or absence of 5-methylcytosine ("5-mCyt") at one or
a plurality of CpG dinucleotides within a DNA sequence. Methylation
states at one or more particular CpG methylation sites (each having
two CpG dinucleotide sequences) within a DNA sequence include
"unmethylated," "fully-methylated" and "hemi-methylated."
[0077] The term "hemi-methylation" or "hemimethylation" refers to
the methylation state of a double stranded DNA wherein only one
strand thereof is methylated.
[0078] The term `AUC` as used herein is an abbreviation for the
area under a curve. In particular it refers to the area under a
Receiver Operating Characteristic (ROC) curve. The ROC curve is a
plot of the true positive rate against the false positive rate for
the different possible cut points of a diagnostic test. It shows
the trade-off between sensitivity and specificity depending on the
selected cut point (any increase in sensitivity will be accompanied
by a decrease in specificity). The area under an ROC curve (AUC) is
a measure for the accuracy of a diagnostic test (the larger the
area the better, optimum is 1, a random test would have a ROC curve
lying on the diagonal with an area of 0.5; for reference: J.P.
Egan. Signal Detection Theory and ROC Analysis, Academic Press, New
York, 1975).
[0079] The term "hypermethylation" refers to the average
methylation state corresponding to an increased presence of 5-mCyt
at one or a plurality of CpG dinucleotides within a DNA sequence of
a test DNA sample, relative to the amount of 5-mCyt found at
corresponding CpG dinucleotides within a normal control DNA
sample.
[0080] The term "hypomethylation" refers to the average methylation
state corresponding to a decreased presence of 5-mCyt at one or a
plurality of CpG dinucleotides within a DNA sequence of a test DNA
sample, relative to the amount of 5-mCyt found at corresponding CpG
dinucleotides within a normal control DNA sample.
[0081] The term "microarray" refers broadly to both "DNA
microarrays," and `DNA chip(s),` as recognized in the art,
encompasses all art-recognized solid supports, and encompasses all
methods for affixing nucleic acid molecules thereto or synthesis of
nucleic acids thereon.
[0082] "Genetic parameters" are mutations and polymorphisms of
genes and sequences further required for their regulation. To be
designated as mutations are, in particular, insertions, deletions,
point mutations, inversions and polymorphisms and, particularly
preferred, SNPs (single nucleotide polymorphisms).
[0083] "Epigenetic parameters" are, in particular, cytosine
methylation. Further epigenetic parameters include, for example,
the acetylation of histones which, however, cannot be directly
analysed using the described method but which, in turn, correlate
with the DNA methylation.
[0084] The term "bisulfite reagent" refers to a reagent comprising
bisulfite, disulfite, hydrogen sulfite or combinations thereof,
useful as disclosed herein to distinguish between methylated and
unmethylated CpG dinucleotide sequences.
[0085] The term "Methylation assay" refers to any assay for
determining the methylation state of one or more CpG dinucleotide
sequences within a sequence of DNA.
[0086] The term "MS.AP-PCR" (Methylation-Sensitive
Arbitrarily-Primed Polymerase Chain Reaction) refers to the
art-recognized technology that allows for a global scan of the
genome using CG-rich primers to focus on the regions most likely to
contain CpG dinucleotides, and described by Gonzalgo et al., Cancer
Research 57:594-599, 1997.
[0087] The term "MethyLight" refers to the art-recognized
fluorescence-based real-time PCR technique described by Eads et
al., Cancer Res. 59:2302-2306, 1999.
[0088] The term "HeavyMethyl.RTM." assay, in the embodiment thereof
implemented herein, refers to an assay, wherein methylation
specific blocking probes (also referred to herein as blockers)
covering CpG positions between, or covered by the amplification
primers enable methylation-specific selective amplification of a
nucleic acid sample.
[0089] The term "HeavyMethyl.RTM. MethyLight" assay, in the
embodiment thereof implemented herein, refers to a HeavyMethyl.RTM.
MethyLight assay, which is a variation of the MethyLight assay,
wherein the MethyLight assay is combined with methylation specific
blocking probes covering CpG positions between the amplification
primers.
[0090] The term "Ms-SNuPE" (Methylation-sensitive Single Nucleotide
Primer Extension) refers to the art-recognized assay described by
Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997.
[0091] The term "MSP" (Methylation-specific PCR) refers to the
art-recognized methylation assay described by Herman et al. Proc.
Natl. Acad. Sci. USA 93:9821-9826, 1996, and by U.S. Pat. No.
5,786,146.
[0092] The term "COBRA" (Combined Bisulfite Restriction Analysis)
refers to the art-recognized methylation assay described by Xiong
& Laird, Nucleic Acids Res. 25:2532-2534, 1997.
[0093] The term "MCA" (Methylated CpG Island Amplification) refers
to the methylation assay described by Toyota et al., Cancer Res.
59:2307-12, 1999, and in WO 00/26401A1.
[0094] The term "hybridisation" is to be understood as a bond of an
oligonucleotide to a complementary sequence along the lines of the
Watson-Crick base pairings in the sample DNA, forming a duplex
structure.
[0095] "Stringent hybridisation conditions," as defined herein,
involve hybridising at 68.degree. C. in
5.times.SSC/5.times.Denhardt's solution/1.0% SDS, and washing in
0.2.times.SSC/0.1% SDS at room temperature, or involve the
art-recognized equivalent thereof (e.g., conditions in which a
hybridisation is carried out at 60.degree. C. in 2.5.times.SSC
buffer, followed by several washing steps at 37.degree. C. in a low
buffer concentration, and remains stable). Moderately stringent
conditions, as defined herein, involve including washing in
3.times.SSC at 42.degree. C., or the art-recognized equivalent
thereof. The parameters of salt concentration and temperature can
be varied to achieve the optimal level of identity between the
probe and the target nucleic acid. Guidance regarding such
conditions is available in the art, for example, by Sambrook et
al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring
Harbor Press, N.Y.; and Ausubel et al. (eds.), 1995, Current
Protocols in Molecular Biology, (John Wiley & Sons, N.Y.) at
Unit 2.10.
[0096] The terms "Methylation-specific restriction enzymes" or
"methylation-sensitive restriction enzymes" shall be taken to mean
an enzyme that selectively digests a nucleic acid dependant on the
methylation state of its recognition site. In the case of such
restriction enzymes which specifically cut if the recognition site
is not methylated or hemimethylated, the cut will not take place,
or with a significantly reduced efficiency, if the recognition site
is methylated. In the case of such restriction enzymes which
specifically cut if the recognition site is methylated, the cut
will not take place, or with a significantly reduced efficiency if
the recognition site is not methylated. Preferred are
methylation-specific restriction enzymes, the recognition sequence
of which contains a CG dinucleotide (for instance cgcg or cccggg).
Further preferred for some embodiments are restriction enzymes that
do not cut if the cytosine in this dinucleotide is methylated at
the carbon atom C5.
[0097] "Non-methylation-specific restriction enzymes" or
"non-methylation-sensitive restriction enzymes" are restriction
enzymes that cut a nucleic acid sequence irrespective of the
methylation state with nearly identical efficiency. They are also
called "methylation-unspecific restriction enzymes."
[0098] The term "gene" shall be taken to include all transcript
variants thereof (e.g., the term "Septin 9" shall include for
example its truncated transcript Q9HC74) and all promoter and
regulatory elements thereof. Furthermore as a plurality of SNPs are
known within said gene the term shall be taken to include all
sequence variants thereof.
[0099] The term "pre-cancerous" or "pre-neoplastic" and equivalents
thereof shall be taken to mean any cellular proliferative disorder
which is undergoing malignant transformation. Examples of such
conditions include, in the context of colorectal cellular
proliferative disorders, cellular proliferative disorders with a
high degree of dysplasia and the following classes of adenomas:
[0100] Level 1: penetration of malignant glands through the
muscularis mucosa into the submucosa, within the polyp head; [0101]
Level 2: the same submucosal invasion, but present at the junction
of the head to the stalk; [0102] Level 3: invasion of the stalk;
and [0103] Level 4: invasion of the stalk's base at the connection
to the colonic wall (this level corresponds to stage Dukes A).
[0104] Overview:
[0105] The present invention provides a method for detecting and/or
classifying cell proliferative disorders in a subject comprising
determining the expression levels of at least one gene or genomic
sequence selected from the group consisting of Septin 9 (including
all transcript variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1,
FAT and SEQ ID NOS:160 to SEQ ID NO:165 in a biological sample
isolated from said subject wherein underexpression and/or CpG
methylation is indicative of the presence or class of said
disorder. Said markers may be used for the diagnosis of neoplastic
cellular proliferative disorders (cancer), including early
detection during the pre-cancerous stages of the disease, and
furthermore for the differentiation of neoplastic from benign
cellular proliferative disorders. The present invention discloses a
method wherein a neoplastic cell proliferative disorder is
distinguished from a benign cell proliferative disorder said method
characterized in that underexpression and/or the presence of CpG
methylation is indicative of the presence of a neoplastic cell
proliferative disorder or pre-neoplastic disorder and the absence
thereof is indicative of the presence of a benign cell
proliferative disorder.
[0106] The markers of the present invention are particularly
efficient in detecting or distinguishing between liver cell
proliferative disorders or alternatively for detecting or
distinguishing between colorectal cell proliferative disorders,
thereby providing improved means for the early detection,
classification and treatment of said disorders.
[0107] In addition to the embodiments above wherein the methylation
analysis of at least one gene or genomic sequence selected from the
group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160
to SEQ ID NO:165 is analysed, the invention presents further panels
of genes comprising at least one gene or genomic sequence selected
from the group consisting of Septin 9 (including all transcript
variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID
NOS:160 to SEQ ID NO:165 with novel utility for the detection of
cancers, in particular liver and/or colorectal cancer.
[0108] In a first further embodiment the present invention is based
upon the analysis of CpG methylaton status of at least one gene or
genomic sequence selected from the group consisting of Septin 9
(including all transcript variants thereof), FOXL2, SARM1, VTN,
PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165. It is
further preferred that the sequences of said genes are as according
to TABLE 1.
[0109] Bisulfite Modification of DNA is an Art-Recognized Tool Used
to Assess CpG Methylation Status.
[0110] 5-methylcytosine is the most frequent covalent base
modification in the DNA of eukaryotic cells. It plays a role, for
example, in the regulation of the transcription, in genetic
imprinting, and in tumorigenesis. Therefore, the identification of
5-methylcytosine as a component of genetic information is of
considerable interest. However, 5-methylcytosine positions cannot
be identified by sequencing, because 5-methylcytosine has the same
base pairing behavior as cytosine. Moreover, the epigenetic
information carried by 5-methylcytosine is completely lost during,
e.g., PCR amplification.
[0111] The most frequently used method for analysing DNA for the
presence of 5-methylcytosine is based upon the specific reaction of
bisulfite with cytosine whereby, upon subsequent alkaline
hydrolysis, cytosine is converted to uracil which corresponds to
thymine in its base pairing behavior. Significantly, however,
5-methylcytosine remains unmodified under these conditions.
Consequently, the original DNA is converted in such a manner that
methylcytosine, which originally could not be distinguished from
cytosine by its hybridization behavior, can now be detected as the
only remaining cytosine using standard, art-recognized molecular
biological techniques, for example, by amplification and
hybridization, or by sequencing. All of these techniques are based
on differential base pairing properties, which can now be fully
exploited.
[0112] The prior art, in terms of sensitivity, is defined by a
method comprising enclosing the DNA to be analysed in an agarose
matrix, thereby preventing the diffusion and renaturation of the
DNA (bisulfite only reacts with single-stranded DNA), and replacing
all precipitation and purification steps with fast dialysis (Olek
A, et al., A modified and improved method for bisulfite based
cytosine methylation analysis, Nucleic Acids Res. 24:5064-6, 1996).
It is thus possible to analyse individual cells for methylation
status, illustrating the utility and sensitivity of the method. An
overview of art-recognized methods for detecting 5-methylcytosine
is provided by Rein, T., et al., Nucleic Acids Res., 26:2255,
1998.
[0113] The bisulfite technique, barring few exceptions (e.g.,
Zeschnigk M, et al., Eur J Hum Genet. 5:94-98, 1997), is currently
only used in research. In all instances, short, specific fragments
of a known gene are amplified subsequent to a bisulfite treatment,
and either completely sequenced (Olek & Walter, Nat Genet. 1997
17:275-6, 1997), subjected to one or more primer extension
reactions (Gonzalgo & Jones, Nucleic Acids Res., 25:2529-31,
1997; WO 95/00669; U.S. Pat. No. 6,251,594) to analyse individual
cytosine positions, or treated by enzymatic digestion (Xiong &
Laird, Nucleic Acids Res., 25:2532-4, 1997). Detection by
hybridisation has also been described in the art (Olek et al., WO
99/28498). Additionally, use of the bisulfite technique for
methylation detection with respect to individual genes has been
described (Grigg & Clark, Bioessays, 16:431-6, 1994; Zeschnigk
M, et al., Hum Mol. Genet., 6:387-95, 1997; Feil R, et al., Nucleic
Acids Res., 22:695-, 1994; Martin V, et al., Gene, 157:261-4, 1995;
WO 9746705 and WO 9515373).
[0114] The present invention provides for the use of the bisulfite
technique, in combination with one or more methylation assays, for
determination of the methylation status of CpG dinucleotide
sequences within at least one sequence selected from the group
consisting SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28,
SEQ ID NOS:159 to SEQ ID NO:167. Genomic CpG dinucleotides can be
methylated or unmethylated (alternatively known as up- and
down-methylated respectively). However the methods of the present
invention are suitable for the analysis of biological samples of a
heterogeneous nature, e.g., a low concentration of tumor cells
within a background of blood or stool. Accordingly, when analysing
the methylation status of a CpG position within such a sample the
person skilled in the art may use a quantitative assay for
determining the level (e.g., percent, fraction, ratio, proportion
or degree) of methylation at a particular CpG position as opposed
to a methylation state. Accordingly the term methylation status or
methylation state should also be taken to mean a value reflecting
the degree of methylation at a CpG position. Unless specifically
stated the terms "hypermethylated" or "upmethylated" shall be taken
to mean a methylation level above that of a specified cut-off
point, wherein said cut-off may be a value representing the average
or median methylation level for a given population, or is
preferably an optimized cut-off level. The "cut-off" is also
referred herein as a "threshold". In the context of the present
invention the terms "methylated", "hypermethylated" or
"upmethylated" shall be taken to include a methylation level above
the cut-off be zero (0) % (or equivalents thereof) methylation for
all CpG positions within and associated with (e.g., in promoter or
regulatory regions) the genes or genomic sequence selected from the
group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160
to SEQ ID NO:165.
[0115] According to the present invention, determination of the
methylation status of CpG dinucleotide sequences within SEQ ID
NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to
SEQ ID NO:167 has utility both in the diagnosis and
characterization of cellular proliferative disorders. Methylation
Assay Procedures. Various methylation assay procedures are known in
the art, and can be used in conjunction with the present invention.
These assays allow for determination of the methylation state of
one or a plurality of CpG dinucleotides (e.g., CpG islands) within
a DNA sequence. Such assays involve, among other techniques, DNA
sequencing of bisulfite-treated DNA, PCR (for sequence-specific
amplification), Southern blot analysis, and use of
methylation-sensitive restriction enzymes
[0116] For example, genomic sequencing has been simplified for
analysis of DNA methylation patterns and 5-methylcytosine
distribution by using bisulfate treatment (Frommer et al., Proc.
Natl. Acad. Sci. USA 89:1827-1831, 1992). Additionally, restriction
enzyme digestion of PCR products amplified from bisulfate-converted
DNA is used, e.g., the method described by Sadri & Hornsby
(Nucl. Acids Res. 24:5058-5059, 1996), or COBRA (Combined Bisulfite
Restriction Analysis) (Xiong & Laird, Nucleic Acids Res.
25:2532-2534, 1997).
[0117] COBRA.
[0118] COBRA.TM. analysis is a quantitative methylation assay
useful for determining DNA methylation levels at specific gene loci
in small amounts of genomic DNA (Xiong & Laird, Nucleic Acids
Res. 25:2532-2534, 1997). Briefly, restriction enzyme digestion is
used to reveal methylation-dependent sequence differences in PCR
products of sodium bisulfite-treated DNA. Methylation-dependent
sequence differences are first introduced into the genomic DNA by
standard bisulfite treatment according to the procedure described
by Frommer et al. (Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992).
PCR amplification of the bisulfite converted DNA is then performed
using primers specific for the CpG islands of interest, followed by
restriction endonuclease digestion, gel electrophoresis, and
detection using specific, labeled hybridization probes. Methylation
levels in the original DNA sample are represented by the relative
amounts of digested and undigested PCR product in a linearly
quantitative fashion across a wide spectrum of DNA methylation
levels. In addition, this technique can be reliably applied to DNA
obtained from microdissected paraffin-embedded tissue samples.
[0119] Typical reagents (e.g., as might be found in a typical
COBRA.TM.-based kit) for COBRA.TM. analysis may include, but are
not limited to: PCR primers for specific gene (or bisulfite treated
DNA sequence or CpG island); restriction enzyme and appropriate
buffer; gene-hybridization oligonucleotide; control hybridization
oligonucleotide; kinase labeling kit for oligonucleotide probe; and
labeled nucleotides. Additionally, bisulfite conversion reagents
may include DNA denaturation buffer; sulfonation buffer; DNA
recovery reagents or kits (e.g., precipitation, ultrafiltration,
affinity column); desulfonation buffer; and DNA recovery
components.
[0120] Preferably, assays such as "MethyLight" (a
fluorescence-based real-time PCR technique) (Eads et al., Cancer
Res. 59:2302-2306, 1999), Ms-SNuPE (Methylation-sensitive Single
Nucleotide Primer Extension) reactions (Gonzalgo & Jones,
Nucleic Acids Res. 25:2529-2531, 1997), methylation-specific PCR
("MSP"; Herman et al., Proc. Natl. Acad. Sci. USA 93:9821-9826,
1996; U.S. Pat. No. 5,786,146), and methylated CpG island
amplification ("MCA"; Toyota et al., Cancer Res. 59:2307-12, 1999)
are used alone or in combination with other of these methods.
[0121] The "HeavyMethyl.RTM." assay, technique is a quantitative
method for assessing methylation differences based on methylation
specific amplification of bisulfite treated DNA. Methylation
specific blocking probes (also referred to herein as blockers)
covering CpG positions between, or covered by the amplification
primers enable methylation-specific selective amplification of a
nucleic acid sample.
[0122] The term "HeavyMethyl.RTM. MethyLight" assay, in the
embodiment thereof implemented herein, refers to a HeavyMethyl.RTM.
MethyLight assay, which is a variation of the MethyLight assay,
wherein the MethyLight assay is combined with methylation specific
blocking probes covering CpG positions between the amplification
primers. The HeavyMethyl.RTM. assay may also be used in combination
with methylation specific amplification primers.
[0123] Typical reagents (e.g., as might be found in a typical
MethyLight-based kit) for HeavyMethyl.RTM. analysis may include,
but are not limited to: PCR primers for specific genes (or
bisulfite treated DNA sequence or CpG island); blocking
oligonucleotides; optimized PCR buffers and deoxynucleotides; and
Taq polymerase.
[0124] MSP.
[0125] MSP (methylation-specific PCR) allows for assessing the
methylation status of virtually any group of CpG sites within a CpG
island, independent of the use of methylation-sensitive restriction
enzymes (Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826,
1996; U.S. Pat. No. 5,786,146). Briefly, DNA is modified by sodium
bisulfite converting all unmethylated, but not methylated cytosines
to uracil, and subsequently amplified with primers specific for
methylated versus unmethylated DNA. MSP requires only small
quantities of DNA, is sensitive to 0.1% methylated alleles of a
given CpG island locus, and can be performed on DNA extracted from
paraffin-embedded samples. Typical reagents (e.g., as might be
found in a typical MSP-based kit) for MSP analysis may include, but
are not limited to: methylated and unmethylated PCR primers for
specific gene (or bisulfite treated DNA sequence or CpG island),
optimized PCR buffers and deoxynucleotides, and specific
probes.
[0126] MethyLight.
[0127] The MethyLight assay is a high-throughput quantitative
methylation assay that utilizes fluorescence-based real-time PCR
(TagMan.RTM.) technology that requires no further manipulations
after the PCR step (Eads et al., Cancer Res. 59:2302-2306, 1999).
Briefly, the MethyLight process begins with a mixed sample of
genomic DNA that is converted, in a sodium bisulfite reaction, to a
mixed pool of methylation-dependent sequence differences according
to standard procedures (the bisulfite process converts unmethylated
cytosine residues to uracil). Fluorescence-based PCR is then
performed in a "biased" (with PCR primers that overlap known CpG
dinucleotides) reaction. Sequence discrimination can occur both at
the level of the amplification process and at the level of the
fluorescence detection process.
[0128] The MethyLight assay may be used as a quantitative test for
methylation patterns in the genomic DNA sample, wherein sequence
discrimination occurs at the level of probe hybridization. In this
quantitative version, the PCR reaction provides for a methylation
specific amplification in the presence of a fluorescent probe that
overlaps a particular putative methylation site. An unbiased
control for the amount of input DNA is provided by a reaction in
which neither the primers, nor the probe overlie any CpG
dinucleotides. Alternatively, a qualitative test for genomic
methylation is achieved by probing of the biased PCR pool with
either control oligonucleotides that do not "cover" known
methylation sites (a fluorescence-based version of the
HeavyMethyl.RTM. and MSP techniques), or with oligonucleotides
covering potential methylation sites.
[0129] The MethyLight process can by used with any suitable probes
e.g., "TaqMan.RTM.", Lightcycler.RTM., etc. For example,
double-stranded genomic DNA is treated with sodium bisulfite and
subjected to one of two sets of PCR reactions using TaqMan.RTM.
probes; e.g., with MSP primers and/or HeavyMethyl.RTM. blocker
oligonucleotides and TaqMan.RTM. probe. The TaqMan.RTM. probe is
dual-labeled with fluorescent "reporter" and "quencher" molecules,
and is designed to be specific for a relatively high GC content
region so that it melts out at about 10.degree. C. higher
temperature in the PCR cycle than the forward or reverse primers.
This allows the TaqMan.RTM. probe to remain fully hybridized during
the PCR annealing/extension step. As the Taq polymerase
enzymatically synthesizes a new strand during PCR, it will
eventually reach the annealed TaqMan.RTM. probe. The Taq polymerase
5' to 3' endonuclease activity will then displace the TaqMan.RTM.
probe by digesting it to release the fluorescent reporter molecule
for quantitative detection of its now unquenched signal using a
real-time fluorescent detection system.
[0130] Typical reagents (e.g., as might be found in a typical
MethyLight-based kit) for MethyLight analysis may include, but are
not limited to: PCR primers for specific gene (or bisulfite treated
DNA sequence or CpG island); TaqMan.RTM. or Lightcycler.RTM.
probes; optimized PCR buffers and deoxynucleotides; and Taq
polymerase.
[0131] The QM (quantitative methylation) assay is an alternative
quantitative test for methylation patterns in genomic DNA samples,
wherein sequence discrimination occurs at the level of probe
hybridization. In this quantitative version, the PCR reaction
provides for unbiased amplification in the presence of a
fluorescent probe that overlaps a particular putative methylation
site. An unbiased control for the amount of input DNA is provided
by a reaction in which neither the primers, nor the probe overlie
any CpG dinucleotides. Alternatively, a qualitative test for
genomic methylation is achieved by probing of the biased PCR pool
with either control oligonucleotides that do not "cover" known
methylation sites (a fluorescence-based version of the
HeavyMethyl.RTM. and MSP techniques), or with oligonucleotides
covering potential methylation sites.
[0132] The QM process can by used with any suitable probes e.g.,
"TaqMan.RTM.", Lightcycler.RTM. etc. . . . in the amplification
process. For example, double-stranded genomic DNA is treated with
sodium bisulfite and subjected to unbiased primers and the
TaqMan.RTM. probe. The TaqMan.RTM. probe is dual-labeled with
fluorescent "reporter" and "quencher" molecules, and is designed to
be specific for a relatively high GC content region so that it
melts out at about 10.degree. C. higher temperature in the PCR
cycle than the forward or reverse primers. This allows the
TaqMan.RTM. probe to remain fully hybridized during the PCR
annealing/extension step. As the Taq polymerase enzymatically
synthesizes a new strand during PCR, it will eventually reach the
annealed TaqMan.RTM. probe. The Taq polymerase 5' to 3'
endonuclease activity will then displace the TaqMan.RTM. probe by
digesting it to release the fluorescent reporter molecule for
quantitative detection of its now unquenched signal using a
real-time fluorescent detection system. Typical reagents (e.g., as
might be found in a typical QM-based kit) for QM analysis may
include, but are not limited to: PCR primers for specific gene (or
bisulfite treated DNA sequence or CpG island); TaqMan.RTM. or
Lightcycler.RTM. probes; optimized PCR buffers and
deoxynucleotides; and Taq polymerase.
[0133] Ms-SNuPE.
[0134] The Ms-SNuPE technique is a quantitative method for
assessing methylation differences at specific CpG sites based on
bisulfite treatment of DNA, followed by single-nucleotide primer
extension (Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531,
1997). Briefly, genomic DNA is reacted with sodium bisulfite to
convert unmethylated cytosine to uracil while leaving
5-methylcytosine unchanged. Amplification of the desired target
sequence is then performed using PCR primers specific for
bisulfite-converted DNA, and the resulting product is isolated and
used as a template for methylation analysis at the CpG site(s) of
interest. Small amounts of DNA can be analysed (e.g.,
microdissected pathology sections), and it avoids utilization of
restriction enzymes for determining the methylation status at CpG
sites.
[0135] Typical reagents (e.g., as might be found in a typical
Ms-SNuPE based kit) for Ms-SNuPE analysis may include, but are not
limited to: PCR primers for specific gene (or bisulfite treated DNA
sequence or CpG island); optimized PCR buffers and
deoxynucleotides; gel extraction kit; positive control primers;
Ms-SNuPE primers for specific gene; reaction buffer (for the
Ms-SNuPE reaction); and labelled nucleotides. Additionally,
bisulfite conversion reagents may include DNA denaturation buffer;
sulfonation buffer; DNA recovery regents or kit (e.g.,
precipitation, ultrafiltration, affinity column); desulfonation
buffer; and DNA recovery components.
[0136] The Genomic Sequence According to SEQ ID NOS:1 TO SEQ ID
NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 TO SEQ ID NO:167,
and Non-naturally Occurring Treated Variants Thereof According to
SEQ ID NOS:4 TO SEQ ID NO:15, SEQ ID NOS:28 TO SEQ ID NO:33, SEQ ID
NOS:30 TO SEQ ID NO:31, SEQ ID NOS:42 TO SEQ ID NO:43, SEQ ID
NOS:38 TO SEQ ID NO:39, SEQ ID NOS:50 TO SEQ ID NO:51, SEQ ID
NOS:168 TO SEQ ID NO:203, were Determined to have Novel Utility for
the Early Detection, Classification and/or Treatment of Cellular
Proliferative Disorders, in Particular Colorectal and/or Liver Cell
Proliferative Disorders.
[0137] In one embodiment the invention of the method comprises the
following steps: i) contacting genomic DNA (preferably isolated
from body fluids) obtained from the subject with at least one
reagent, or series of reagents that distinguishes between
methylated and non-methylated CpG dinucleotides within at least one
gene or genomic sequence selected from the group consisting of
Septin 9 (including all transcript variants thereof), FOXL2, SARM1,
VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165
(including their promoter and regulatory regions); and ii)
detecting, or detecting and distinguishing between or among colon
or liver cell proliferative disorders afforded with a sensitivity
of greater than or equal to 80% and a specificity of greater than
or equal to 80%.
[0138] Preferably, the sensitivity is from about 75% to about 96%,
or from about 80% to about 90%, or from about 80% to about 85%.
Preferably, the specificity is from about 75% to about 96%, or from
about 80% to about 90%, or from about 80% to about 85%.
[0139] Genomic DNA may be isolated by any means standard in the
art, including the use of commercially available kits. Briefly,
wherein the DNA of interest is encapsulated in by a cellular
membrane the biological sample must be disrupted and lysed by
enzymatic, chemical or mechanical means. The DNA solution may then
be cleared of proteins and other contaminants, e.g., by digestion
with proteinase K. The genomic DNA is then recovered from the
solution. This may be carried out by means of a variety of methods
including salting out, organic extraction or binding of the DNA to
a solid phase support. The choice of method will be affected by
several factors including time, expense and required quantity of
DNA. All clinical sample types comprising neoplastic matter or
pre-neoplastic matter are suitable for use in the present method,
preferred are cell lines, histological slides, biopsies,
paraffin-embedded tissue, body fluids, stool, colonic effluent,
urine, blood plasma, blood serum, whole blood, isolated blood
cells, cells isolated from the blood and combinations thereof. Body
fluids are the preferred source of the DNA; particularly preferred
are blood plasma, blood serum, whole blood, isolated blood cells
and cells isolated from the blood.
[0140] The genomic DNA sample is then treated with at least one
reagent, or series of reagents that distinguishes between
methylated and non-methylated CpG dinucleotides within at least one
target region of the genomic DNA, wherein the target region
comprises, or hybridizes under stringent conditions to a sequence
of at least 16 contiguous nucleotides of at least one sequence
selected from the group consisting of SEQ ID NOS:1 to SEQ ID NO:3,
SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167
respectively, wherein said contiguous nucleotides comprise at least
one CpG dinucleotide sequence.
[0141] It is particularly preferred that said reagent converts
cytosine bases which are unmethylated at the 5'-position to uracil,
thymine, or another base which is dissimilar to cytosine in terms
of hybridisation behaviour. However in an alternative embodiment
said reagent may be a methylation sensitive restriction enzyme.
[0142] Wherein the genomic DNA sample is treated in such a manner
that cytosine bases which are unmethylated at the 5'-position are
converted to uracil, thymine, or another base which is dissimilar
to cytosine in terms of hybridization behavior It is preferred that
this treatment is carried out with bisulfate (hydrogen sulfite,
disulfite) and subsequent alkaline hydrolysis. Such a treatment
results in the conversion of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID
NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 to SEQ ID
NOS:4 to SEQ ID NO:15, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:38
to SEQ ID NO:39, SEQ ID NOS:168 to SEQ ID NO:185, (respectively)
wherein said CpG dinucleotides are methylated or SEQ ID NOS:28 to
SEQ ID NO:33, SEQ ID NOs:42 to SEQ ID NO:43, SEQ ID NOS:50 to SEQ
ID NO:51, SEQ ID NOS:186 to SEQ ID NO:203 wherein said CpG
dinucleotides are unmethylated.
[0143] The treated DNA is then analysed in order to determine the
methylation state of the target gene sequences (at least one gene
or genomic sequence selected from the group consisting of Septin 9
(including all transcript variants thereof), FOXL2, SARM1, VTN,
PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 prior to the
treatment). It is particularly preferred that the target region
comprises, or hybridizes under stringent conditions to at least 16
contiguous nucleotides of at least one gene or genomic sequence
selected from the group consisting of Septin 9 (including all
transcript variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT
and SEQ ID NOS:160 to SEQ ID NO:165. It is preferred that the
sequence of said genes according to SEQ ID NOS:1 to SEQ ID NO:3,
SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 are
analysed. The method of analysis may be selected from those known
in the art, including those listed herein. Particularly preferred
are MethyLight, MSP and the use of blocking oligonucleotides
(HeavyMethyl.RTM.) as described herein. It is further preferred
that any oligonucleotides used in such analysis (including primers,
blocking oligonucleotides and detection probes) should be reverse
complementary, identical, or hybridise under stringent or highly
stringent conditions to an at least 16-base-pair long segment of
the base sequences of one or more of SEQ ID NOS:4 to SEQ ID NO:15,
SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ
ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID
NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203 and
sequences complementary thereto.
[0144] Aberrant methylation, more specifically hypermethylation of
the genes or genomic sequence selected from the group consisting of
Septin 9 (including all transcript variants thereof), FOXL2, SARM1,
VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165
(including their promoter and/or regulatory regions) is associated
with the presence of neoplastic cellular proliferative disorders,
and is particularly prevalent in colorectal and hepatocellular
carcinomas. Accordingly wherein a biological sample presents within
any degree of methylation, said sample should be determined as
neoplastic.
[0145] Analysis of one the genes or genomic sequence selected from
the group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160
to SEQ ID NO:165 enables for the first time detecting, or detecting
and distinguishing between or among colon or liver cell
proliferative disorders afforded with a sensitivity of greater than
or equal to 80% and a specificity of greater than or equal to 80%.
Sensitivity is calculated as: (detected neoplasia/all neoplasia;
e.g., (detected colon neoplasia/all colon neoplasia); and
specificity is calculated as (non-detected negatives/total
negatives).
[0146] Preferably, the sensitivity is from about 75% to about 96%,
or from about 80% to about 90%, or from about 80% to about 85%.
Preferably, the specificity is from about 75% to about 96%, or from
about 80% to about 90%, or from about 80% to about 85%.
[0147] Colon neoplasia is herein defined as all colon malignancies
and adenomas greater than 1 cm., or subsets thereof. Negatives can
be defined as healthy individuals.
[0148] In one embodiment the method discloses the use of at least
one gene or genomic sequence selected from the group consisting of
Septin 9 (including all transcript variants thereof), FOXL2, SARM1,
VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 (or
promoter and/or regulatory regions thereof) as a marker for the
differentiation, detection and distinguishing of cellular
proliferative disorders (in particular neoplastic, colon or liver
disorders).
[0149] Said method may be enabled by means of any analysis of the
expression of an RNA transcribed therefrom or polypeptide or
protein translated from said RNA, preferably by means of mRNA
expression analysis or polypeptide expression analysis.
Accordingly, the present invention also provides diagnostic assays
and methods, both quantitative and qualitative for detecting the
expression of at least one gene or genomic sequence selected from
the group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160
to SEQ ID NO:165 in a subject and determining therefrom upon the
presence or absence of cancer in said subject.
[0150] Aberrant expression of mRNA transcribed from the genes or
genomic sequences selected from the group consisting of Septin 9
(including all transcript variants thereof), FOXL2, SARM1, VTN,
PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 are
associated with the presence of cancer in a subject. According to
the present invention, under expression (and/or presence
methylation) is associated with the presence of cancer, and vice
versa over-expression (and/or absence of methylation) is associated
with the absence of cancer. It is particularly preferred that the
expression of at least one of the transcript variants as disclosed
in SEQ ID NOS:16 to SEQ ID NO:19 of the gene Septin 9 is
determined.
[0151] To detect the presence of mRNA encoding a gene or genomic
sequence, a sample is obtained from a patient. The sample may be
any suitable sample comprising cellular matter of the tumour.
Suitable sample types include cell lines, histological slides,
biopsies, paraffin-embedded tissue, body fluids, stool, colonic
effluent, urine, blood plasma, blood serum, whole blood, isolated
blood cells, cells isolated from the blood and all possible
combinations thereof. It is preferred that said sample types are
stool or body fluids selected from the group consisting colonic
effluent, urine, blood plasma, blood serum, whole blood, isolated
blood cells, cells isolated from the blood.
[0152] The sample may be treated to extract the RNA contained
therein. The resulting nucleic acid from the sample is then
analysed. Many techniques are known in the state of the art for
determining absolute and relative levels of gene expression,
commonly used techniques suitable for use in the present invention
include in situ hybridisation (e.g., FISH), Northern analysis,
RNase protection assays (RPA), microarrays and PCR-based
techniques, such as quantitative PCR and differential display PCR
or any other nucleic acid detection method.
[0153] Particularly preferred is the use of the reverse
transcription/polymerisation chain reaction technique (RT-PCR). The
method of RT-PCR is well known in the art (for example, see Watson
and Fleming, supra).
[0154] The RT-PCR method can be performed as follows. Total
cellular RNA is isolated by, for example, the standard guanidium
isothiocyanate method and the total RNA is reverse transcribed. The
reverse transcription method involves synthesis of DNA on a
template of RNA using a reverse transcriptase enzyme and a 3' end
oligonucleotide dT primer and/or random hexamer primers. The cDNA
thus produced is then amplified by means of PCR. (Belyaysky et al,
Nucl Acid Res 17:2919-2932, 1989; Krug and Berger, Methods in
Enzymology, Academic Press, N.Y., Vol. 152, pp. 316-325, 1987 which
are incorporated by reference). Further preferred is the
"Real-time" variant of RT-PCR, wherein the PCR product is detected
by means of hybridisation probes (e.g., TagMan.RTM.,
Lightcycler.RTM., Molecular Beacons & Scorpion) or SYBR green.
The detected signal from the probes or SYBR green is then
quantitated either by reference to a standard curve or by comparing
the Ct values to that of a calibration standard. Analysis of
housekeeping genes is often used to normalize the results.
[0155] In Northern blot analysis total or poly(A)+ mRNA is run on a
denaturing agarose gel and detected by hybridisation to a labelled
probe in the dried gel itself or on a membrane. The resulting
signal is proportional to the amount of target RNA in the RNA
population.
[0156] Comparing the signals from two or more cell populations or
tissues reveals relative differences in gene expression levels.
Absolute quantitation can be performed by comparing the signal to a
standard curve generated using known amounts of an in vitro
transcript corresponding to the target RNA. Analysis of
housekeeping genes, genes whose expression levels are expected to
remain relatively constant regardless of conditions, is often used
to normalize the results, eliminating any apparent differences
caused by unequal transfer of RNA to the membrane or unequal
loading of RNA on the gel.
[0157] The first step in Northern analysis is isolating pure,
intact RNA from the cells or tissue of interest. Because Northern
blots distinguish RNAs by size, sample integrity influences the
degree to which a signal is localized in a single band. Partially
degraded RNA samples will result in the signal being smeared or
distributed over several bands with an overall loss in sensitivity
and possibly an erroneous interpretation of the data. In Northern
blot analysis, DNA, RNA and oligonucleotide probes can be used and
these probes are preferably labelled (e.g., radioactive labels,
mass labels or fluorescent labels). The size of the target RNA, not
the probe, will determine the size of the detected band, so methods
such as random-primed labelling, which generates probes of variable
lengths, are suitable for probe synthesis. The specific activity of
the probe will determine the level of sensitivity, so it is
preferred that probes with high specific activities, are used.
[0158] In an RNase protection assay, the RNA target and an RNA
probe of a defined length are hybridised in solution. Following
hybridisation, the RNA is digested with RNases specific for
single-stranded nucleic acids to remove any unhybridized,
single-stranded target RNA and probe. The RNases are inactivated,
and the RNA is separated e.g., by denaturing polyacrylamide gel
electrophoresis. The amount of intact RNA probe is proportional to
the amount of target RNA in the RNA population. RPA can be used for
relative and absolute quantitation of gene expression and also for
mapping RNA structure, such as intron/exon boundaries and
transcription start sites. The RNase protection assay is preferable
to Northern blot analysis as it generally has a lower limit of
detection.
[0159] The antisense RNA probes used in RPA are generated by in
vitro transcription of a DNA template with a defined endpoint and
are typically in the range of 50-600 nucleotides. The use of RNA
probes that include additional sequences not homologous to the
target RNA allows the protected fragment to be distinguished from
the full-length probe. RNA probes are typically used instead of DNA
probes due to the ease of generating single-stranded RNA probes and
the reproducibility and reliability of RNA:RNA duplex digestion
with RNases (Ausubel et al. 2003), particularly preferred are
probes with high specific activities.
[0160] Particularly preferred is the use of microarrays. The
microarray analysis process can be divided into two main parts.
First is the immobilization of known gene sequences onto glass
slides or other solid support followed by hybridisation of the
fluorescently labelled cDNA (comprising the sequences to be
interrogated) to the known genes immobilized on the glass slide (or
other solid phase). After hybridisation, arrays are scanned using a
fluorescent microarray scanner. Analysing the relative fluorescent
intensity of different genes provides a measure of the differences
in gene expression.
[0161] DNA arrays can be generated by immobilizing presynthesized
oligonucleotides onto prepared glass slides or other solid
surfaces. In this case, representative gene sequences are
manufactured and prepared using standard oligonucleotide synthesis
and purification methods. These synthesized gene sequences are
complementary to the RNA transcript(s) of the genes of interest (in
this case the genes or genomic sequences selected from the group
consisting of Septin 9 (including all transcript variants thereof),
FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID
NO:165) and tend to be shorter sequences in the range of 25-70
nucleotides. In a preferred embodiment said oligonucleotides or
polynucleotides comprise at least 9, 18 or 25 bases of a sequence
complementary to or hybridising to at least one sequence selected
from the group consisting of SEQ ID NOS:16 to SEQ ID NO:19 and
sequences complementary thereto. Alternatively, immobilized oligos
can be chemically synthesized in situ on the surface of the slide.
In situ oligonucleotide synthesis involves the consecutive addition
of the appropriate nucleotides to the spots on the microarray;
spots not receiving a nucleotide are protected during each stage of
the process using physical or virtual masks. Preferably said
synthesized nucleic acids are locked nucleic acids.
[0162] In expression profiling microarray experiments, the RNA
templates used are representative of the transcription profile of
the cells or tissues under study. RNA is first isolated from the
cell populations or tissues to be compared. Each RNA sample is then
used as a template to generate fluorescently labelled cDNA via a
reverse transcription reaction. Fluorescent labelling of the cDNA
can be accomplished by either direct labelling or indirect
labelling methods. During direct labelling, fluorescently modified
nucleotides (e.g., Cy.RTM.3- or Cy.RTM.5-dCTP) are incorporated
directly into the cDNA during the reverse transcription.
Alternatively, indirect labelling can be achieved by incorporating
aminoallyl-modified nucleotides during cDNA synthesis and then
conjugating an N-hydroxysuccinimide (NHS)-ester dye to the
aminoallyl-modified cDNA after the reverse transcription reaction
is complete. Alternatively, the probe may be unlabelled, but may be
detectable by specific binding with a ligand which is labelled,
either directly or indirectly. Suitable labels and methods for
labelling ligands (and probes) are known in the art, and include,
for example, radioactive labels which may be incorporated by known
methods (e.g., nick translation or kinasing). Other suitable labels
include but are not limited to biotin, fluorescent groups,
chemiluminescent groups (e.g., dioxetanes, particularly triggered
dioxetanes), enzymes, antibodies, and the like.
[0163] To perform differential gene expression analysis, cDNA
generated from different RNA samples are labelled with Cy.RTM.3.
The resulting labelled cDNA is purified to remove unincorporated
nucleotides, free dye and residual RNA. Following purification, the
labelled cDNA samples are hybridised to the microarray. The
stringency of hybridisation is determined by a number of factors
during hybridisation and during the washing procedure, including
temperature, ionic strength, length of time and concentration of
formamide. These factors are outlined in, for example, Sambrook et
al. (Molecular Cloning: A Laboratory Manual, 2nd ed., 1989). The
microarray is scanned post-hybridisation using a fluorescent
microarray scanner. The fluorescent intensity of each spot
indicates the level of expression of the analysed gene; bright
spots correspond to strongly expressed genes, while dim spots
indicate weak expression.
[0164] Once the images are obtained, the raw data must be analysed.
First, the background fluorescence must be subtracted from the
fluorescence of each spot. The data is then normalized to a control
sequence, such as exogenously added nucleic acids (preferably RNA
or DNA), or a housekeeping gene panel to account for any
non-specific hybridisation, array imperfections or variability in
the array set-up, cDNA labelling, hybridisation or washing. Data
normalization allows the results of multiple arrays to be
compared.
[0165] Another aspect of the invention relates to a kit for use in
diagnosis of cancer in a subject according to the methods of the
present invention, said kit comprising: a means for measuring the
level of transcription of genes or genomic sequences selected from
the group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160
to SEQ ID NO:165. In a preferred embodiment the means for measuring
the level of transcription comprise oligonucleotides or
polynucleotides able to hybridise under stringent or moderately
stringent conditions to the transcription products of a gene or
genomic sequence selected from the group consisting of Septin 9
(including all transcript variants thereof), FOXL2, SARM1, VTN,
PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165. Preferably
said oligonucleotides or polynucleotides are able to hybridise
under stringent or moderately stringent conditions to at least one
of the transcription products of a gene or genomic sequence
selected from the group consisting of Septin 9 (including all
transcript variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT
and SEQ ID NOS:160 to SEQ ID NO:165 as provided in SEQ ID NOS:16 to
SEQ ID NO:19. In one embodiment said oligonucleotides or
polynucleotides comprise at least 9, 18 or 25 bases of a sequence
complementary to or hybridising to at least one sequence selected
from the group consisting of SEQ ID NOS:16 to SEQ ID NO:19 and
sequences complementary thereto.
[0166] In a most preferred embodiment the level of transcription is
determined by techniques selected from the group of Northern Blot
analysis, reverse transcriptase PCR, real-time PCR, RNAse
protection, and microarray. In another embodiment of the invention
the kit further comprises means for obtaining a biological sample
of the patient. Preferred is a kit, which further comprises a
container which is most preferably suitable for containing the
means for measuring the level of transcription and the biological
sample of the patient, and most preferably further comprises
instructions for use and interpretation of the kit results.
[0167] In a preferred embodiment the kit comprises (a) a plurality
of oligonucleotides or polynucleotides able to hybridise under
stringent or moderately stringent conditions to the transcription
products of at least one gene or genomic sequence selected from the
group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160
to SEQ ID NO:165; (b) a container, preferably suitable for
containing the oligonucleotides or polynucleotides and a biological
sample of the patient comprising the transcription products wherein
the oligonucleotides or polynucleotides can hybridise under
stringent or moderately stringent conditions to the transcription
products, (c) means to detect the hybridisation of (b); and
optionally, (d) instructions for use and interpretation of the kit
results. It is further preferred that said oligonucleotides or
polynucleotides of (a) comprise in each case at least 9, 18 or 25
bases of a sequence complementary to or hybridising to at least one
sequence selected from the group consisting of SEQ ID NOS:16 to SEQ
ID NO:19 and sequences complementary thereto.
[0168] The kit may also contain other components such as
hybridisation buffer (where the oligonucleotides are to be used as
a probe) packaged in a separate container. Alternatively, where the
oligonucleotides are to be used to amplify a target region, the kit
may contain, packaged in separate containers, a polymerase and a
reaction buffer optimised for primer extension mediated by the
polymerase, such as PCR. Preferably said polymerase is a reverse
transcriptase. It is further preferred that said kit further
contains an Rnase reagent.
[0169] The present invention further provides for methods for the
detection of the presence of the polypeptide encoded by said gene
sequences in a sample obtained from a patient.
[0170] Aberrant levels of polypeptide expression of the
polypeptides encoded by the genes or genomic sequences selected
from the group consisting of Septin 9 (including all transcript
variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID
NOS:160 to SEQ ID NO:165 are associated with the presence of
cancer.
[0171] According to the present invention, under expression of said
polypeptides is associated with the presence of cancer. It is
particularly preferred that said polypeptides are according to at
least one of the amino acid sequences provided in SEQ ID NOS:20 to
SEQ ID NO:23 polypeptides transcribed from the Septin 9 gene).
[0172] Any method known in the art for detecting polypeptides can
be used. Such methods include, but are not limited to
mass-spectrometry, immunodiffusion, immunoelectrophoresis,
immunochemical methods, binder-ligand assays, immunohistochemical
techniques, agglutination and complement assays (e.g., see Basic
and Clinical Immunology, Sites and Ten, eds., Appleton & Lange,
Norwalk, Conn. pp 217-262, 1991 which is incorporated by
reference). Preferred are binder-ligand immunoassay methods
including reacting antibodies with an epitope or epitopes and
competitively displacing a labelled polypeptide or derivative
thereof.
[0173] Certain embodiments of the present invention comprise the
use of antibodies specific to the polypeptide encoded by a gene or
genomic sequence selected from the group consisting of Septin 9
(including all transcript variants thereof), FOXL2, SARM1, VTN,
PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165. It is
particularly preferred that said polypeptides are according to at
least one of the amino acid sequences provided in SEQ ID NOS:20 to
SEQ ID NO:23.
[0174] Such antibodies are useful for cancer diagnosis. In certain
embodiments production of monoclonal or polyclonal antibodies can
be induced by the use of an epitope encoded by a polypeptide of SEQ
ID NOS:20 to SEQ ID NO:23 as an antigene. Such antibodies may in
turn be used to detect expressed polypeptides as markers for cancer
diagnosis. The levels of such polypeptides present may be
quantified by conventional methods. Antibody-polypeptide binding
may be detected and quantified by a variety of means known in the
art, such as labelling with fluorescent or radioactive ligands. The
invention further comprises kits for performing the above-mentioned
procedures, wherein such kits contain antibodies specific for the
investigated polypeptides.
[0175] Numerous competitive and non-competitive polypeptide binding
immunoassays are well known in the art. Antibodies employed in such
assays may be unlabelled, for example as used in agglutination
tests, or labelled for use a wide variety of assay methods. Labels
that can be used include radionuclides, enzymes, fluorescers,
chemiluminescers, enzyme substrates or co-factors, enzyme
inhibitors, particles, dyes and the like. Preferred assays include
but are not limited to radioimmunoassay (RIA), enzyme immunoassays,
e.g., enzyme-linked immunosorbent assay (ELISA), fluorescent
immunoassays and the like. Polyclonal or monoclonal antibodies or
epitopes thereof can be made for use in immunoassays by any of a
number of methods known in the art.
[0176] In an alternative embodiment of the method the proteins may
be detected by means of western blot analysis. Said analysis is
standard in the art, briefly proteins are separated by means of
electrophoresis, e.g., SDS-PAGE. The separated proteins are then
transferred to a suitable membrane (or paper), e.g.,
nitrocellulose, retaining the spacial separation achieved by
electrophoresis. The membrane is then incubated with a blocking
agent to bind remaining sticky places on the membrane, commonly
used agents include generic protein (e.g., milk protein). An
antibody specific to the protein of interest is then added, said
antibody being detectably labelled for example by dyes or enzymatic
means (e.g., alkaline phosphatase or horseradish peroxidase). The
location of the antibody on the membrane is then detected.
[0177] In an alternative embodiment of the method the proteins may
be detected by means of immunohistochemistry (the use of antibodies
to probe specific antigens in a sample). Said analysis is standard
in the art, wherein detection of antigens in tissues is known as
immunohistochemistry, while detection in cultured cells is
generally termed immunocytochemistry. Briefly, the primary antibody
to be detected by binding to its specific antigen. The
antibody-antigen complex is then bound by a secondary enzyme
conjugated antibody. In the presence of the necessary substrate and
chromogen the bound enzyme is detected according to coloured
deposits at the antibody-antigen binding sites. There is a wide
range of suitable sample types, antigen-antibody affinity, antibody
types, and detection enhancement methods. Thus optimal conditions
for immunohistochemical or immunocytochemical detection must be
determined by the person skilled in the art for each individual
case.
[0178] One approach for preparing antibodies to a polypeptide is
the selection and preparation of an amino acid sequence of all or
part of the polypeptide, chemically synthesising the amino acid
sequence and injecting it into an appropriate animal, usually a
rabbit or a mouse (Milstein and Kohler Nature 256:495-497, 1975;
Gulfre and Milstein, Methods in Enzymology: Immunochemical
Techniques 73:1-46, Langone and Banatis eds., Academic Press, 1981
which are incorporated by reference in its entirety). Methods for
preparation of the polypeptides or epitopes thereof include, but
are not limited to chemical synthesis, recombinant DNA techniques
or isolation from biological samples.
[0179] In the final step of the method the diagnosis of the patient
is determined, whereby under-expression (of at least one gene or
genomic sequence selected from the group consisting of Septin 9
(including all transcript variants thereof), FOXL2, SARM1, VTN,
PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165) is
indicative of the presence of cancer. The term under-expression
shall be taken to mean expression at a detected level less than a
pre-determined cut off which may be selected from the group
consisting of the mean, median or an optimised threshold value.
[0180] Another aspect of the invention provides a kit for use in
diagnosis of cancer in a subject according to the methods of the
present invention, comprising: a means for detecting polypeptides
at least one gene or genomic sequence selected from the group
consisting of Septin 9 (including all transcript variants thereof),
FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID
NO:165. Preferably the sequence of said polypeptides is as provided
in SEQ ID NOS:20 to SEQ ID NO:23. The means for detecting the
polypeptides comprise preferably antibodies, antibody derivatives,
or antibody fragments. The polypeptides are most preferably
detected by means of Western Blotting utilizing a labelled
antibody. In another embodiment of the invention the kit further
comprising means for obtaining a biological sample of the patient.
Preferred is a kit, which further comprises a container suitable
for containing the means for detecting the polypeptides in the
biological sample of the patient, and most preferably further
comprises instructions for use and interpretation of the kit
results. In a preferred embodiment the kit comprises: (a) a means
for detecting polypeptides at least one gene or genomic sequence
selected from the group consisting of Septin 9 (including all
transcript variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT
and SEQ ID NOS:160 to SEQ ID NO:165; (b) a container suitable for
containing the said means and the biological sample of the patient
comprising the polypeptides wherein the means can form complexes
with the polypeptides; (c) a means to detect the complexes of (b);
and optionally (d) instructions for use and interpretation of the
kit results. It is preferred that said means for detecting
polypeptides of at least one gene or genomic sequence selected from
the group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160
to SEQ ID NO:165 are specific for at least one of the polypeptide
sequences selected from SEQ ID NOS:20 to SEQ ID NO:23. The kit may
also contain other components such as buffers or solutions suitable
for blocking, washing or coating, packaged in a separate
container.
[0181] Particular embodiments of the present invention provide a
novel application of the analysis of methylation levels and/or
patterns within said sequences that enables a precise detection,
characterisation and/or treatment of liver and/or colorectal cell
proliferative disorders. Early detection of cancer is directly
linked with disease prognosis, and the disclosed method thereby
enables the physician and patient to make better and more informed
treatment decisions.
[0182] FURTHER IMPROVEMENTS: The present invention provides novel
uses for the genomic sequence SEQ ID NOS:1 TO SEQ ID NO:3, SEQ ID
NO:24, SEQ ID NO:28, SEQ ID NOS:159 TO SEQ ID NO:167. Additional
embodiments provide modified variants of SEQ ID NOS:1 to SEQ ID
NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167,
as well as oligonucleotides and/or PNA-oligomers for analysis of
cytosine methylation patterns within SEQ ID NOS:1 to SEQ ID NO:3,
SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.
[0183] An objective of the invention comprises analysis of the
methylation state of one or more CpG dinucleotides within at least
one sequence selected form the group consisting of SEQ ID NOS:1 to
SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID
NO:167 and sequences complementary thereto.
[0184] The disclosed invention provides treated nucleic acids,
derived from genomic SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ
ID NO:28, SEQ ID NO:159 to SEQ ID NO:167, wherein the treatment is
suitable to convert at least one unmethylated cytosine base of the
genomic DNA sequence to uracil or another base that is detectably
dissimilar to cytosine in terms of hybridization. The genomic
sequences in question may comprise one, or more consecutive
methylated CpG positions. Said treatment preferably comprises use
of a reagent selected from the group consisting of bisulfite,
hydrogen sulfite, disulfite, and combinations thereof. In a
preferred embodiment of the invention, the invention provides a
non-naturally occurring modified nucleic acid comprising a sequence
of at least 16 contiguous nucleotide bases in length of a sequence
selected from the group consisting of SEQ ID NOS:4 to SEQ ID NO:15,
SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS: 30 to SEQ ID NO:31, SEQ
ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID
NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203. In further
preferred embodiments of the invention said nucleic acid is at
least 50, 100, 150, 200, 250 or 500 base pairs in length of a
segment of the nucleic acid sequence disclosed in SEQ ID NOS:4 to
SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ
ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID
NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203. Particularly preferred is a nucleic acid molecule that is
not identical or complementary to all or a portion of the sequences
SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NO:28 to SEQ ID NO:33, SEQ ID
NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID
NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID
NOS:168 to SEQ ID NO:203 but not SEQ ID NOS:1 to SEQ ID NO:3, SEQ
ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 or other
naturally occurring DNA.
[0185] It is preferred that said sequence comprises at least one
CpG, TpA or CpA dinucleotide and sequences complementary thereto.
The sequences of SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ
ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID
NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203 provide non-naturally
occurring modified versions of the nucleic acid according to SEQ ID
NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS: 159
to SEQ ID NO:167, wherein the modification of each genomic sequence
results in the synthesis of a nucleic acid having a sequence that
is unique and distinct from said genomic sequence as follows. For
each sense strand genomic DNA, e.g., SEQ ID NO:1, four converted
versions are disclosed. A first version wherein "C" is converted to
"T," but "CpG" remains "CpG" (i.e., corresponds to case where, for
the genomic sequence, all "C" residues of CpG dinucleotide
sequences are methylated and are thus not converted); a second
version discloses the complement of the disclosed genomic DNA
sequence (i.e., antisense strand), wherein "C" is converted to "T,"
but "CpG" remains "CpG" (i.e., corresponds to case where, for all
"C" residues of CpG dinucleotide sequences are methylated and are
thus not converted). The `upmethylated` converted sequences of SEQ
ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159
to SEQ ID NO:167 correspond to SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID
NOS: 30 to SEQ ID NO:31, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID
NOS:168 to SEQ ID NO:185. A third chemically converted version of
each genomic sequences is provided, wherein "C" is converted to "T"
for all "C" residues, including those of "CpG" dinucleotide
sequences (i.e., corresponds to case where, for the genomic
sequences, all "C" residues of CpG dinucleotide sequences are
unmethylated); a final chemically converted version of each
sequence, discloses the complement of the disclosed genomic DNA
sequence (i.e., antisense strand), wherein "C" is converted to "T"
for all "C" residues, including those of "CpG" dinucleotide
sequences (i.e., corresponds to case where, for the complement
(antisense strand) of each genomic sequence, all "C" residues of
CpG dinucleotide sequences are unmethylated). The
`downmethylated`converted sequences of SEQ ID NOS:1 to SEQ ID NO:3,
SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167
correspond to SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:42 to SEQ
ID NO:43, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:186 to SEQ ID
NO:203.
[0186] Significantly, heretofore, the nucleic acid sequences and
molecules according SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to
SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ
ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203 were not implicated in or
connected with the detection, classification or treatment of
cellular proliferative disorders.
[0187] In an alternative preferred embodiment, the invention
further provides oligonucleotides or oligomers suitable for use in
the methods of the invention for detecting the cytosine methylation
state within genomic or treated (chemically modified) DNA,
according to SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID
NO:28, SEQ ID NOS:159 to SEQ ID NO:167, SEQ ID NOS:4 to SEQ ID
NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID
NO:31, SEQ ID NOD:42 to SEQ ID NO:43, SEQ ID NOD:38 to SEQ ID
NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203. Said oligonucleotide or oligomer nucleic acids provide
novel diagnostic means. Said oligonucleotide or oligomer comprising
a nucleic acid sequence having a length of at least nine (9)
nucleotides which is identical to, hybridizes, under moderately
stringent or stringent conditions (as defined herein above), to a
treated nucleic acid sequence according to SEQ ID NOS:4 to SEQ ID
NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID
NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID
NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203 and/or sequences complementary thereto, or to a genomic
sequence according to SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NOS:24,
SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 and/or sequences
complementary thereto.
[0188] Thus, the present invention includes nucleic acid molecules
(e.g., oligonucleotides and peptide nucleic acid (PNA) molecules
(PNA-oligomers)) that hybridize under moderately stringent and/or
stringent hybridization conditions to all or a portion of a
sequence selected form the group consisting of SEQ ID NOS:1 to SEQ
ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID
NO:167, SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID
NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID
NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203 or to the complements
thereof. Particularly preferred is a nucleic acid molecule that
hybridizes under moderately stringent and/or stringent
hybridization conditions to all or a portion of the sequences SEQ
ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID
NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID
NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID
NOS:168 to SEQ ID NO:203 but not SEQ ID NOS:1 to SEQ ID NO:3, SEQ
ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 or other
human genomic DNA.
[0189] The identical or hybridizing portion of the hybridizing
nucleic acids is typically at least 9, 16, 20, 25, 30 or 35
nucleotides in length. However, longer molecules have inventive
utility, and are thus within the scope of the present
invention.
[0190] Preferably, the hybridizing portion of the inventive
hybridizing nucleic acids is at least 95%, or at least 98%, or 100%
identical to the sequence, or to a portion thereof of a sequence
selected from the group consisting of SEQ ID NOS:1 to SEQ ID NO:3,
SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167, SEQ ID
NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30
to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to
SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ
ID NO:203, or to the complements thereof.
[0191] Hybridizing nucleic acids of the type described herein can
be used, for example, as a primer (e.g., a PCR primer), or a
diagnostic and/or prognostic probe or primer. Preferably,
hybridization of the oligonucleotide probe to a nucleic acid sample
is performed under stringent conditions and the probe is 100%
identical to the target sequence. Nucleic acid duplex or hybrid
stability is expressed as the melting temperature or Tm, which is
the temperature at which a probe dissociates from a target DNA.
This melting temperature is used to define the required stringency
conditions.
[0192] For target sequences that are related and substantially
identical to the corresponding sequence of SEQ ID NOS:1 to SEQ ID
NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167
(such as allelic variants and SNPs), rather than identical, it is
useful to first establish the lowest temperature at which only
homologous hybridization occurs with a particular concentration of
salt (e.g., SSC or SSPE). Then, assuming that 1% mismatching
results in a 1.degree. C. decrease in the Tm, the temperature of
the final wash in the hybridization reaction is reduced accordingly
(for example, if sequences having >95% identity with the probe
are sought, the final wash temperature is decreased by 5.degree.
C.). In practice, the change in Tm can be between 0.5.degree. C.
and 1.5.degree. C. per 1% mismatch.
[0193] Examples of inventive oligonucleotides of length X (in
nucleotides), as indicated by polynucleotide positions with
reference to, e.g., SEQ ID NO:1, include those corresponding to
sets (sense and antisense sets) of consecutively overlapping
oligonucleotides of length X, where the oligonucleotides within
each consecutively overlapping set (corresponding to a given X
value) are defined as the finite set of Z oligonucleotides from
nucleotide positions: [0194] n to (n+(X-1)); [0195] where n=1, 2,
3, . . . (Y-(X-1)); [0196] where Y equals the length (nucleotides
or base pairs) of SEQ ID NO:1 (219909); [0197] where X equals the
common length (in nucleotides) of each oligonucleotide in the set
(e.g., X=20 for a set of consecutively overlapping 20-mers); and
[0198] where the number (Z) of consecutively overlapping oligomers
of length X for a given SEQ ID NO of length Y is equal to Y-(X-1).
For example Z=219909-19=219890 for either sense or antisense sets
of SEQ ID NO:1, where X=20.
[0199] Preferably, the set is limited to those oligomers that
comprise at least one CpG, TpG or CpA dinucleotide.
[0200] Examples of inventive 20-mer oligonucleotides include the
following set of 219890 oligomers (and the antisense set
complementary thereto), indicated by polynucleotide positions with
reference to SEQ ID NO:1: [0201] 1-20, 2-21, 3-22, 4-23, 5-24, . .
. and 219890-219909.
[0202] Preferably, the set is limited to those oligomers that
comprise at least one CpG, TpG or CpA dinucleotide.
[0203] Likewise, examples of inventive 25-mer oligonucleotides
include the following set of 219885 oligomers (and the antisense
set complementary thereto), indicated by polynucleotide positions
with reference to SEQ ID NO:1: [0204] 1-25, 2-26, 3-27, 4-28, 5-29,
. . . and 219885-219909.
[0205] Preferably, the set is limited to those oligomers that
comprise at least one CpG, TpG or CpA dinucleotide.
[0206] The present invention encompasses, for each of SEQ ID NOS:1
to SEQ ID NO3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID
NO:167, SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS: 28 to SEQ ID
NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID
NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203 (sense and antisense),
multiple consecutively overlapping sets of oligonucleotides or
modified oligonucleotides of length X, where, e.g., X=9, 10, 17,
20, 22, 23, 25, 27, 30 or 35 nucleotides.
[0207] The oligonucleotides or oligomers according to the present
invention constitute effective tools useful to ascertain genetic
and epigenetic parameters of the genomic sequences selected from
the group consisting of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24,
SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167. Preferred sets of
such oligonucleotides or modified oligonucleotides of length X are
those consecutively overlapping sets of oligomers corresponding to
SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID
NOS:159 to SEQ ID NO:167, SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID
NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID
NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID
NOS:50 to SEQ ID NO:51, SEQ ID NO:168 to SEQ ID NO:203 (and to the
complements thereof). Preferably, said oligomers comprise at least
one CpG, TpG or CpA dinucleotide.
[0208] Particularly preferred oligonucleotides or oligomers
according to the present invention are those in which the cytosine
of the CpG dinucleotide (or of the corresponding converted TpG or
CpA dinculeotide) sequences is within the middle third of the
oligonucleotide; that is, where the oligonucleotide is, for
example, 13 bases in length, the CpG, TpG or CpA dinucleotide is
positioned within the fifth to ninth nucleotide from the
5'-end.
[0209] The oligonucleotides of the invention can also be modified
by chemically linking the oligonucleotide to one or more moieties
or conjugates to enhance the activity, stability or detection of
the oligonucleotide. Such moieties or conjugates include
chromophores, fluorophors, lipids such as cholesterol, cholic acid,
thioether, aliphatic chains, phospholipids, polyamines,
polyethylene glycol (PEG), palmityl moieties, and others as
disclosed in, for example, U.S. Pat. Nos. 5,514,758, 5,565,552,
5,567,810, 5,574,142, 5,585,481, 5,587,371, 5,597,696 and
5,958,773. The probes may also exist in the form of a PNA (peptide
nucleic acid) which has particularly preferred pairing properties.
Thus, the oligonucleotide may include other appended groups such as
peptides, and may include hybridization-triggered cleavage agents
(Krol et al., BioTechniques 6:958-976, 1988) or intercalating
agents (Zon, Pharm. Res. 5:539-549, 1988). To this end, the
oligonucleotide may be conjugated to another molecule, e.g., a
chromophore, fluorophor, peptide, hybridization-triggered
cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
[0210] The oligonucleotide may also comprise at least one
art-recognized modified sugar and/or base moiety, or may comprise a
modified backbone or non-natural internucleoside linkage.
[0211] The oligonucleotides or oligomers according to particular
embodiments of the present invention are typically used in `sets,`
which contain at least one oligomer for analysis of each of the CpG
dinucleotides of a genomic sequence selected from the group
consisting SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28,
SEQ ID NOS:159 to SEQ ID NO:167 and sequences complementary
thereto, or to the corresponding CpG, TpG or CpA dinucleotide
within a sequence of the treated nucleic acids according to SEQ ID
NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30
to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to
SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ
ID NO:203 and sequences complementary thereto. However, it is
anticipated that for economic or other factors it may be preferable
to analyse a limited selection of the CpG dinucleotides within said
sequences, and the content of the set of oligonucleotides is
altered accordingly.
[0212] Therefore, in particular embodiments, the present invention
provides a set of at least two (2) (oligonucleotides and/or
PNA-oligomers) useful for detecting the cytosine methylation state
in treated genomic DNA (SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28
to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to
SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ
ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203), or in genomic DNA (SEQ
ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOD:159
to SEQ ID NO:167 and sequences complementary thereto). These probes
enable diagnosis, classification and/or therapy of genetic and
epigenetic parameters of liver and/or colorectal cell proliferative
disorders. The set of oligomers may also be used for detecting
single nucleotide polymorphisms (SNPs) in treated genomic DNA (SEQ
ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID
NOS:30 to SEQ ID NO:31, SEQ ID NO:42 to SEQ ID NO:43, SEQ ID NO:38
to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to
SEQ ID NO:203), or in genomic DNA (SEQ ID NOS:1 to SEQ ID NO:3, SEQ
ID NO:24, SEQ ID NO:28, SEQ ID NO:159 to SEQ ID NOS:167 and
sequences complementary thereto).
[0213] In preferred embodiments, at least one, and more preferably
all members of a set of oligonucleotides is bound to a solid
phase.
[0214] In further embodiments, the present invention provides a set
of at least two (2) oligonucleotides that are used as `primer`
oligonucleotides for amplifying DNA sequences of one of SEQ ID
NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to
SEQ ID NO:167, SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ
ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID
NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS: 50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203 and sequences complementary
thereto, or segments thereof.
[0215] It is anticipated that the oligonucleotides may constitute
all or part of an "array" or "DNA chip" (i.e., an arrangement of
different oligonucleotides and/or PNA-oligomers bound to a solid
phase). Such an array of different oligonucleotide- and/or
PNA-oligomer sequences can be characterized, for example, in that
it is arranged on the solid phase in the form of a rectangular or
hexagonal lattice. The solid-phase surface may be composed of
silicon, glass, polystyrene, aluminium, steel, iron, copper,
nickel, silver, or gold. Nitrocellulose as well as plastics such as
nylon, which can exist in the form of pellets or also as resin
matrices, may also be used. An overview of the Prior Art in
oligomer array manufacturing can be gathered from a special edition
of Nature Genetics (Nature Genetics Supplement, Volume 21, January
1999, and from the literature cited therein). Fluorescently
labelled probes are often used for the scanning of immobilized DNA
arrays. The simple attachment of Cy3 and Cy5 dyes to the 5'-OH of
the specific probe are particularly suitable for fluorescence
labels. The detection of the fluorescence of the hybridised probes
may be carried out, for example, via a confocal microscope. Cy3 and
Cy5 dyes, besides many others, are commercially available.
[0216] It is also anticipated that the oligonucleotides, or
particular sequences thereof, may constitute all or part of an
"virtual array" wherein the oligonucleotides, or particular
sequences thereof, are used, for example, as `specifiers` as part
of, or in combination with a diverse population of unique labeled
probes to analyse a complex mixture of analytes. Such a method, for
example is described in US 2003/0013091 (U.S. Ser. No. 09/898,743,
published 16 Jan. 2003). In such methods, enough labels are
generated so that each nucleic acid in the complex mixture (i.e.,
each analyte) can be uniquely bound by a unique label and thus
detected (each label is directly counted, resulting in a digital
read-out of each molecular species in the mixture).
[0217] It is particularly preferred that the oligomers according to
the invention are utilised for at least one of: detection of;
detection and differentiation between or among subclasses of;
diagnosis of; prognosis of; treatment of; monitoring of; and
treatment and monitoring of liver and/or colorectal cell
proliferative disorders. This is enabled by use of said sets for
the detection or detection and differentiation of one or more of
the following classes of tissues: colorectal carcinoma, colon
adenoma, inflammatory colon tissue, grade 2 dysplasia colon
adenomas less than 1 cm, grade 3 dysplasia colon adenomas larger
than 1 cm, normal colon tissue, non-colon healthy tissue and
non-colon cancer tissue.
[0218] Particularly preferred are those sets of oligomers according
to the Examples.
[0219] In the most preferred embodiment of the method, the presence
or absence of a cellular proliferative disorder, most preferably a
neoplastic cellular proliferation or differentiation thereof from
benign disorders is determined. This is achieved by analysis of the
methylation status of at least one target sequence comprising at
least one CpG position said sequence comprising, or hybridizing
under stringent conditions to at least 16 contiguous nucleotides of
a sequence selected from the group consisting SEQ ID NOS:1 to SEQ
ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID
NO:167 and complements thereof. The present invention further
provides a method for ascertaining genetic and/or epigenetic
parameters of the genomic sequence according to SEQ ID NOS:1 to SEQ
ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID
NO:167 within a subject by analysing cytosine methylation and
single nucleotide polymorphisms. Said method comprising contacting
a nucleic acid comprising SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID
NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167 in a
biological sample obtained from said subject with at least one
reagent or a series of reagents, wherein said reagent or series of
reagents, distinguishes between methylated and non-methylated CpG
dinucleotides within the target nucleic acid.
[0220] In a preferred embodiment, said method comprises the
following steps: In the first step, a sample of the tissue to be
analysed is obtained. The source may be any suitable source, such
as cell lines, histological slides, biopsies, paraffin-embedded
tissue, body fluids, stool, colonic effluent, urine, blood plasma,
blood serum, whole blood, isolated blood cells, cells isolated from
the blood and all possible combinations thereof. It is preferred
that said sources of DNA are stool or body fluids selected from the
group consisting colonic effluent, urine, blood plasma, blood
serum, whole blood, isolated blood cells, cells isolated from the
blood.
[0221] The genomic DNA is then isolated from the sample. Genomic
DNA may be isolated by any means standard in the art, including the
use of commercially available kits. Briefly, wherein the DNA of
interest is encapsulated in by a cellular membrane the biological
sample must be disrupted and lysed by enzymatic, chemical or
mechanical means. The DNA solution may then be cleared of proteins
and other contaminants e.g., by digestion with proteinase K. The
genomic DNA is then recovered from the solution. This may be
carried out by means of a variety of methods including salting out,
organic extraction or binding of the DNA to a solid phase support.
The choice of method will be affected by several factors including
time, expense and required quantity of DNA.
[0222] Wherein the sample DNA is not enclosed in a membrane (e.g.,
circulating DNA from a blood sample) methods standard in the art
for the isolation and/or purification of DNA may be employed. Such
methods include the use of a protein degenerating reagent e.g.,
chaotropic salt, e.g., guanidine hydrochloride or urea; or a
detergent e.g., sodium dodecyl sulphate (SDS), cyanogen bromide.
Alternative methods include but are not limited to ethanol
precipitation or propanol precipitation, vacuum concentration
amongst others by means of a centrifuge. The person skilled in the
art may also make use of devices such as filter devices, e.g.,
ultrafiltration, silica surfaces or membranes, magnetic particles,
polystyrol particles, polystyrol surfaces, positively charged
surfaces, and positively charged membranes, charged membranes,
charged surfaces, charged switch membranes, charged switched
surfaces.
[0223] Once the nucleic acids have been extracted, the genomic
double stranded DNA is used in the analysis.
[0224] In the second step of the method, the genomic DNA sample is
treated in such a manner that cytosine bases which are unmethylated
at the 5'-position are converted to uracil, thymine, or another
base which is dissimilar to cytosine in terms of hybridisation
behaviour. This will be understood as `pre-treatment` or
`treatment` herein.
[0225] This is preferably achieved by means of treatment with a
bisulfite reagent. The term "bisulfite reagent" refers to a reagent
comprising bisulfite, disulfite, hydrogen sulfite or combinations
thereof, useful as disclosed herein to distinguish between
methylated and unmethylated CpG dinucleotide sequences. Methods of
said treatment are known in the art (e.g., PCT/EP2004/011715, which
is incorporated by reference in its entirety). It is preferred that
the bisulfite treatment is conducted in the presence of denaturing
solvents such as but not limited to n-alkylenglycol, particularly
diethylene glycol dimethyl ether (DME), or in the presence of
dioxane or dioxane derivatives. In a preferred embodiment the
denaturing solvents are used in concentrations between 1% and 35%
(v/v). It is also preferred that the bisulfite reaction is carried
out in the presence of scavengers such as but not limited to
chromane derivatives, e.g., 6-hydroxy-2,5,7,8, -tetramethylchromane
2-carboxylic acid or trihydroxybenzoe acid and derivates thereof,
e.g., Gallic acid (see: PCT/EP2004/011715 which is incorporated by
reference in its entirety). The bisulfite conversion is preferably
carried out at a reaction temperature between 30.degree. C. and
70.degree. C., whereby the temperature is increased to over
85.degree. C. for short periods of times during the reaction (see:
PCT/EP2004/011715 which is incorporated by reference in its
entirety). The bisulfite treated DNA is preferably purified priori
to the quantification. This may be conducted by any means known in
the art, such as but not limited to ultrafiltration, preferably
carried out by means of MICROCON.RTM. columns (manufactured by
MILLIPORE.RTM.). The purification is carried out according to a
modified manufacturer's protocol (see: PCT/EP2004/011715 which is
incorporated by reference in its entirety).
[0226] In the third step of the method, fragments of the treated
DNA are amplified, using sets of primer oligonucleotides according
to the present invention, and an amplification enzyme. The
amplification of several DNA segments can be carried out
simultaneously in one and the same reaction vessel. Typically, the
amplification is carried out using a polymerase chain reaction
(PCR). Preferably said amplificates are 100 to 2,000 base pairs in
length. The set of primer oligonucleotides includes at least two
oligonucleotides whose sequences are each reverse complementary,
identical, or hybridise under stringent or highly stringent
conditions to an at least 16-base-pair long segment of the base
sequences of one of SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to
SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ
ID NO:43, SEQ ID NOs:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203 and sequences complementary
thereto.
[0227] In an alternate embodiment of the method, the methylation
status of pre-selected CpG positions within at least one nucleic
acid sequences selected from the group consisting SEQ ID NOS:1 to
SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID
NO:167 may be detected by use of methylation-specific primer
oligonucleotides. This technique (MSP) has been described in U.S.
Pat. No. 6,265,171 to Herman. The use of methylation status
specific primers for the amplification of bisulfite treated DNA
allows the differentiation between methylated and unmethylated
nucleic acids. MSP primers pairs contain at least one primer which
hybridises to a bisulfite treated CpG dinucleotide. Therefore, the
sequence of said primers comprises at least one CpG dinucleotide.
MSP primers specific for non-methylated DNA contain a "T' at the
position of the C position in the CpG. Preferably, therefore, the
base sequence of said primers is required to comprise a sequence
having a length of at least 9 nucleotides which hybridises to a
treated nucleic acid sequence according to one of SEQ ID NOS:4 to
SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ
ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID
NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203 and sequences complementary thereto, wherein the base
sequence of said oligomers comprises at least one CpG dinucleotide.
A further preferred embodiment of the method comprises the use of
blocker oligonucleotides (the HeavyMethyl.RTM. assay). The use of
such blocker oligonucleotides has been described by Yu et al.,
BioTechniques 23:714-720, 1997. Blocking probe oligonucleotides are
hybridised to the bisulfite treated nucleic acid concurrently with
the PCR primers. PCR amplification of the nucleic acid is
terminated at the 5' position of the blocking probe, such that
amplification of a nucleic acid is suppressed where the
complementary sequence to the blocking probe is present. The probes
may be designed to hybridize to the bisulfite treated nucleic acid
in a methylation status specific manner. For example, for detection
of methylated nucleic acids within a population of unmethylated
nucleic acids, suppression of the amplification of nucleic acids
which are unmethylated at the position in question would be carried
out by the use of blocking probes comprising a `CpA` or `TpA` at
the position in question, as opposed to a `CpG` if the suppression
of amplification of methylated nucleic acids is desired.
[0228] For PCR methods using blocker oligonucleotides, efficient
disruption of polymerase-mediated amplification requires that
blocker oligonucleotides not be elongated by the polymerase.
Preferably, this is achieved through the use of blockers that are
3'-deoxyoligonucleotides, or oligonucleotides derivitized at the 3'
position with other than a "free" hydroxyl group. For example,
3'-O-acetyl oligonucleotides are representative of a preferred
class of blocker molecule.
[0229] Additionally, polymerase-mediated decomposition of the
blocker oligonucleotides should be precluded. Preferably, such
preclusion comprises either use of a polymerase lacking 5'-3'
exonuclease activity, or use of modified blocker oligonucleotides
having, for example, thioate bridges at the 5'-terminii thereof
that render the blocker molecule nuclease-resistant. Particular
applications may not require such 5' modifications of the blocker.
For example, if the blocker- and primer-binding sites overlap,
thereby precluding binding of the primer (e.g., with excess
blocker), degradation of the blocker oligonucleotide will be
substantially precluded. This is because the polymerase will not
extend the primer toward, and through (in the 5'-3' direction) the
blocker--a process that normally results in degradation of the
hybridized blocker oligonucleotide.
[0230] A particularly preferred blocker/PCR embodiment, for
purposes of the present invention and as implemented herein,
comprises the use of peptide nucleic acid (PNA) oligomers as
blocking oligonucleotides. Such PNA blocker oligomers are ideally
suited, because they are neither decomposed nor extended by the
polymerase.
[0231] Preferably, therefore, the base sequence of said blocking
oligonucleotides is required to comprise a sequence having a length
of at least 9 nucleotides which hybridises to a treated nucleic
acid sequence according to one of SEQ ID NOS:4 to SEQ ID NO:15, SEQ
ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID
NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID
NOS:50 to SEQ ID NO:51, SEQ ID NOs:168 to SEQ ID NO:203 and
sequences complementary thereto, wherein the base sequence of said
oligonucleotides comprises at least one CpG, TpG or CpA
dinucleotide.
[0232] The fragments obtained by means of the amplification can
carry a directly or indirectly detectable label. Preferred are
labels in the form of fluorescence labels, radionuclides, or
detachable molecule fragments having a typical mass which can be
detected in a mass spectrometer. Where said labels are mass labels,
it is preferred that the labelled amplificates have a single
positive or negative net charge, allowing for better delectability
in the mass spectrometer. The detection may be carried out and
visualized by means of, e.g., matrix assisted laser
desorption/ionization mass spectrometry (MALDI) or using electron
spray mass spectrometry (ESI).
[0233] Matrix Assisted Laser Desorption/Ionization Mass
Spectrometry (MALDI-TOF) is a very efficient development for the
analysis of biomolecules (Karas & Hillenkamp, Anal Chem.,
60:2299-301, 1988). An analyte is embedded in a light-absorbing
matrix. The matrix is evaporated by a short laser pulse thus
transporting the analyte molecule into the vapor phase in an
unfragmented manner. The analyte is ionized by collisions with
matrix molecules. An applied voltage accelerates the ions into a
field-free flight tube. Due to their different masses, the ions are
accelerated at different rates. Smaller ions reach the detector
sooner than bigger ones. MALDI-TOF spectrometry is well suited to
the analysis of peptides and proteins. The analysis of nucleic
acids is somewhat more difficult (Gut & Beck, Current
Innovations and Future Trends, 1:147-57, 1995). The sensitivity
with respect to nucleic acid analysis is approximately 100-times
less than for peptides, and decreases disproportionally with
increasing fragment size. Moreover, for nucleic acids having a
multiply negatively charged backbone, the ionization process via
the matrix is considerably less efficient. In MALDI-TOF
spectrometry, the selection of the matrix plays an eminently
important role. For desorption of peptides, several very efficient
matrixes have been found which produce a very fine crystallisation.
There are now several responsive matrixes for DNA, however, the
difference in sensitivity between peptides and nucleic acids has
not been reduced. This difference in sensitivity can be reduced,
however, by chemically modifying the DNA in such a manner that it
becomes more similar to a peptide. For example, phosphorothioate
nucleic acids, in which the usual phosphates of the backbone are
substituted with thiophosphates, can be converted into a
charge-neutral DNA using simple alkylation chemistry (Gut &
Beck, Nucleic Acids Res. 23: 1367-73, 1995). The coupling of a
charge tag to this modified DNA results in an increase in MALDI-TOF
sensitivity to the same level as that found for peptides. A further
advantage of charge tagging is the increased stability of the
analysis against impurities, which makes the detection of
unmodified substrates considerably more difficult.
[0234] In the fourth step of the method, the amplificates obtained
during the third step of the method are analysed in order to
ascertain the methylation status of the CpG dinucleotides prior to
the treatment.
[0235] In embodiments where the amplificates were obtained by means
of MSP amplification, the presence or absence of an amplificate is
in itself indicative of the methylation state of the CpG positions
covered by the primer, according to the base sequences of said
primer.
[0236] Amplificates obtained by means of both standard and
methylation specific PCR may be further analysed by means of
based-based methods such as, but not limited to, array technology
and probe based technologies as well as by means of techniques such
as sequencing and template directed extension.
[0237] In one embodiment of the method, the amplificates
synthesised in step three are subsequently hybridized to an array
or a set of oligonucleotides and/or PNA probes. In this context,
the hybridization takes place in the following manner: the set of
probes used during the hybridization is preferably composed of at
least 2 oligonucleotides or PNA-oligomers; in the process, the
amplificates serve as probes which hybridize to oligonucleotides
previously bonded to a solid phase; the non-hybridized fragments
are subsequently removed; said oligonucleotides contain at least
one base sequence having a length of at least 9 nucleotides which
is reverse complementary or identical to a segment of the base
sequences specified in the present Sequence Listing; and the
segment comprises at least one CpG, TpG or CpA dinucleotide. The
hybridizing portion of the hybridizing nucleic acids is typically
at least 9, 15, 20, 25, 30 or 35 nucleotides in length. However,
longer molecules have inventive utility, and are thus within the
scope of the present invention.
[0238] In a preferred embodiment, said dinucleotide is present in
the central third of the oligomer. For example, wherein the
oligomer comprises one CpG dinucleotide, said dinucleotide is
preferably the fifth to ninth nucleotide from the 5'-end of a
13-mer. One oligonucleotide exists for the analysis of each CpG
dinucleotide within a sequence selected from the group consisting
SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID
NOS:159 to SEQ ID NO:167, and the equivalent positions within SEQ
ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID
NOs:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID
NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID
NOS:168 to SEQ ID NO:203.
[0239] Said oligonucleotides may also be present in the form of
peptide nucleic acids. The non-hybridised amplificates are then
removed. The hybridised amplificates are then detected. In this
context, it is preferred that labels attached to the amplificates
are identifiable at each position of the solid phase at which an
oligonucleotide sequence is located.
[0240] In yet a further embodiment of the method, the genomic
methylation status of the CpG positions may be ascertained by means
of oligonucleotide probes (as detailed above) that are hybridised
to the bisulfite treated DNA concurrently with the PCR
amplification primers (wherein said primers may either be
methylation specific or standard).
[0241] A particularly preferred embodiment of this method is the
use of fluorescence-based Real Time Quantitative PCR (Heid et al.,
Genome Res. 6:986-994, 1996; also see U.S. Pat. No. 6,331,393)
employing a dual-labelled fluorescent oligonucleotide probe
(TagMan.RTM. PCR, using an ABI Prism 7700 Sequence Detection
System, Perkin Elmer Applied Biosystems, Foster City, Calif.). The
TagMan.RTM. PCR reaction employs the use of a non-extendible
interrogating oligonucleotide, called a TagMan.RTM. probe, which,
in preferred embodiments, is designed to hybridise to a CpG-rich
sequence located between the forward and reverse amplification
primers. The TagMan.RTM. probe further comprises a fluorescent
"reporter moiety" and a "quencher moiety" covalently bound to
linker moieties (e.g., phosphoramidites) attached to the
nucleotides of the TagMan.RTM. oligonucleotide. For analysis of
methylation within nucleic acids subsequent to bisulfite treatment,
it is required that the probe be methylation specific, as described
in U.S. Pat. No. 6,331,393, (hereby incorporated by reference in
its entirety) also known as the MethyLight assay. Variations on the
TagMan.RTM. detection methodology that are also suitable for use
with the described invention include the use of dual-probe
technology (Lightcycler.RTM.) or fluorescent amplification primers
(Sunrise.TM. technology). Both these techniques may be adapted in a
manner suitable for use with bisulfite treated DNA, and moreover
for methylation analysis within CpG dinucleotides.
[0242] In a further preferred embodiment of the method, the fourth
step of the method comprises the use of template-directed
oligonucleotide extension, such as Ms-SNuPE as described by
Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997.
[0243] In yet a further embodiment of the method, the fourth step
of the method comprises sequencing and subsequent sequence analysis
of the amplificate generated in the third step of the method
(Sanger F., et al., Proc Natl Acad Sci USA 74:5463-5467, 1977).
[0244] Best Mode:
[0245] In the most preferred embodiment of the method the genomic
nucleic acids are isolated and treated according to the first three
steps of the method outlined above, namely: [0246] a) obtaining,
from a subject, a biological sample having subject genomic DNA;
[0247] b) extracting or otherwise isolating the genomic DNA; [0248]
c) treating the genomic DNA of b), or a fragment thereof, with one
or more reagents to convert cytosine bases that are unmethylated in
the 5-position thereof to uracil or to another base that is
detectably dissimilar to cytosine in terms of hybridization
properties; and wherein [0249] d) amplifying subsequent to
treatment in c) is carried out in a methylation specific manner,
namely by use of methylation specific primers or blocking
oligonucleotides, and further wherein [0250] e) detecting of the
amplificates is carried out by means of a real-time detection
probe, as described above.
[0251] Preferably, where the subsequent amplification of d) is
carried out by means of methylation specific primers, as described
above, said methylation specific primers comprise a sequence having
a length of at least 9 nucleotides which hybridises to a treated
nucleic acid sequence according to one of SEQ ID NOS:4 to SEQ ID
NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID
NO:31, SEQ ID NO:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39,
SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOs:168 to SEQ ID NO:203 and
sequences complementary thereto, wherein the base sequence of said
oligomers comprise at least one CpG dinucleotide.
[0252] Step e) of the method, namely the detection of the specific
amplificates indicative of the methylation status of one or more
CpG positions of at least one sequences of the group comprising SEQ
ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159
to SEQ ID NO:167 is carried out by means of real-time detection
methods as described above.
[0253] Additional embodiments of the invention provide a method for
the analysis of the methylation status of genomic DNA according to
the invention (SEQ ID NOs:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID
NO:28, SEQ ID NOS:159 to SEQ ID NO:167, and complements thereof)
without the need for bisulfite conversion. Methods are known in the
art wherein a methylation sensitive restriction enzyme reagent, or
a series of restriction enzyme reagents comprising methylation
sensitive restriction enzyme reagents that distinguishes between
methylated and non-methylated CpG dinucleotides within a target
region are utilized in determining methylation, for example but not
limited to DMH.
[0254] In the first step of such additional embodiments, the
genomic DNA sample is isolated from tissue or cellular sources.
Genomic DNA may be isolated by any means standard in the art,
including the use of commercially available kits. Briefly, wherein
the DNA of interest is encapsulated in by a cellular membrane the
biological sample must be disrupted and lysed by enzymatic,
chemical or mechanical means. The DNA solution may then be cleared
of proteins and other contaminants, e.g., by digestion with
proteinase K. The genomic DNA is then recovered from the solution.
This may be carried out by means of a variety of methods including
salting out, organic extraction or binding of the DNA to a solid
phase support. The choice of method will be affected by several
factors including time, expense and required quantity of DNA. All
clinical sample types comprising neoplastic or potentially
neoplastic matter are suitable for use in the present method,
preferred are cell lines, histological slides, biopsies,
paraffin-embedded tissue, body fluids, stool, colonic effluent,
urine, blood plasma, blood serum, whole blood, isolated blood
cells, cells isolated from the blood and combinations thereof. Body
fluids are the preferred source of the DNA; particularly preferred
are blood plasma, blood serum, whole blood, isolated blood cells
and cells isolated from the blood.
[0255] Once the nucleic acids have been extracted, the genomic
double-stranded DNA is used in the analysis.
[0256] In a preferred embodiment, the DNA may be cleaved prior to
treatment with methylation sensitive restriction enzymes. Such
methods are known in the art and may include both physical and
enzymatic means. Particularly preferred is the use of one or a
plurality of restriction enzymes which are not methylation
sensitive, and whose recognition sites are AT rich and do not
comprise CG dinucleotides. The use of such enzymes enables the
conservation of CpG islands and CpG rich regions in the fragmented
DNA. The non-methylation-specific restriction enzymes are
preferably selected from the group consisting of MseI, BfaI, Csp6I,
Tru1l, Tvu1I, Tru9I, Tvu9I, MaeI and XspI. Particularly preferred
is the use of two or three such enzymes. Particularly preferred is
the use of a combination of MseI, BfaI and Csp6I.
[0257] The fragmented DNA may then be ligated to adaptor
oligonucleotides in order to facilitate subsequent enzymatic
amplification. The ligation of oligonucleotides to blunt and sticky
ended DNA fragments is known in the art, and is carried out by
means of dephosphorylation of the ends (e.g., using calf or shrimp
alkaline phosphatase) and subsequent ligation using ligase enzymes
(e.g., T4 DNA ligase) in the presence of dATPs. The adaptor
oligonucleotides are typically at least 18 base pairs in
length.
[0258] In the third step, the DNA (or fragments thereof) is then
digested with one or more methylation sensitive restriction
enzymes. The digestion is carried out such that hydrolysis of the
DNA at the restriction site is informative of the methylation
status of a specific CpG dinucleotide of at least one gene or
genomic sequence selected from the group consisting of Septin 9
(including all transcript variants thereof), FOXL2, SARM1, VTN,
PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165.
[0259] Preferably, the methylation-specific restriction enzyme is
selected from the group consisting of Bsi E1, Hga I HinPl, Hpy99I,
Ava I, Bce AI, Bsa HI, BisI, BstUI, BshI236I, AccII, BstFNI, McrBC,
GlaI, MvnI, HpaII (HapII), HhaI, Acil, SmaI, HinP1I, HpyCH4IV, EagI
and mixtures of two or more of the above enzymes. Preferred is a
mixture containing the restriction enzymes BstUI, HpaII,
HpyCH.sub.4IV and HinP1I.
[0260] In the fourth step, which is optional but a preferred
embodiment, the restriction fragments are amplified. This is
preferably carried out using a polymerase chain reaction, and said
amplificates may carry suitable detectable labels as discussed
above, namely fluorophore labels, radionuclides and mass labels.
Particularly preferred is amplification by means of an
amplification enzyme and at least two primers comprising, in each
case a contiguous sequence at least 16 nucleotides in length that
is complementary to, or hybridizes under moderately stringent or
stringent conditions to a sequence selected from the group
consisting SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28,
SEQ ID NOS:159 to SEQ ID NO:167, and complements thereof.
Preferably said contiguous sequence is at least 16, 20 or 25
nucleotides in length. In an alternative embodiment said primers
may be complementary to any adaptors linked to the fragments.
[0261] In the fifth step the amplificates are detected. The
detection may be by any means standard in the art, for example, but
not limited to, gel electrophoresis analysis, hybridisation
analysis, incorporation of detectable tags within the PCR products,
DNA array analysis, MALDI or ESI analysis. Preferably said
detection is carried out by hybridisation to at least one nucleic
acid or peptide nucleic acid comprising in each case a contiguous
sequence at least 16 nucleotides in length that is complementary
to, or hybridizes under moderately stringent or stringent
conditions to a sequence selected from the group consisting SEQ ID
NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to
SEQ ID NO:167, and complements thereof. Preferably said contiguous
sequence is at least 16, 20 or 25 nucleotides in length.
[0262] Subsequent to the determination of the methylation state or
level of the genomic nucleic acids the presence, absence or class
of cellular proliferative disorder is deduced based upon the
methylation state or level of at least one CpG dinucleotide
sequence of at least one sequence selected from the group
consisting SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28,
SEQ ID NOS:159 to SEQ ID NO:167, or an average, or a value
reflecting an average methylation state of a plurality of CpG
dinucleotide sequences of at least one sequence selected from the
group consisting SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID
NO:28, SEQ ID NOS:159 to SEQ ID NO:167 wherein methylation is
associated with a neoplastic or pre-neoplastic cellular
proliferative disorder. Wherein said methylation is determined by
quantitative means the cut-off point for determining said the
presence of methylation is preferably zero (i.e., wherein a sample
displays any degree of methylation it is determined as having a
methylated status at the analysed CpG position). Nonetheless, it is
foreseen that the person skilled in the art may wish to adjust said
cut-off value in order to provide an assay of a particularly
preferred sensitivity or specificity. Accordingly said cut-off
value may be increased (thus increasing the specificity), said cut
off value may be within a range selected from the group consisting
of 0%-5%, 5%-10%, 10%-15%, 15%-20%, 20%-30% and 30%-50%.
Particularly preferred are the cut-offs 10%, 15%, 25%, and 30%.
[0263] In an alternative embodiment of the method wherein a panel
of genes comprising the Septin 9 or its truncated transcript Q9HC74
and at least one gene selected from the group consisting FOXL2,
NGFR, TMEFF2, SIX6, SARM1, VTN and ZDHHC22 subsequent to the
determination of the methylation state of the genomic nucleic acids
the presence, absence or subclass of cellular proliferative
disorders, in particular liver and/or colorectal cell proliferative
disorder is deduced based upon the methylation state of at least
one CpG dinucleotide sequence of SEQ ID NO:1 and at least one CpG
dinucleotide sequence of SEQ ID NO:24 to SEQ ID NO:29, or an
average, or a value reflecting an average methylation state of a
plurality of CpG dinucleotide sequences thereof wherein
hypermethylation is associated with cancers, in particular liver
and/or colorectal cancer.
[0264] Diagnostic and Prognostic Assays for Cellular Proliferative
Disorders:
[0265] The present invention enables diagnosis of events which are
disadvantageous to patients or individuals in which important
genetic and/or epigenetic parameters within at least one gene or
genomic sequence selected from the group consisting of Septin 9
(including all transcript variants thereof), FOXL2, SARM1, VTN,
PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 may be used
as markers. Said parameters obtained by means of the present
invention may be compared to another set of genetic and/or
epigenetic parameters, the differences serving as the basis for a
diagnosis and/or prognosis of events which are disadvantageous to
patients or individuals.
[0266] More specifically the present invention enables the
screening of at-risk populations for the early detection of
cancers, most preferably liver cancer and/or colorectal carcinomas.
Furthermore, the present invention enables the differentiation of
neoplastic (e.g., malignant) from benign (i.e., non-cancerous)
cellular proliferative disorders. For example, it enables the
differentiation of a colorectal carcinoma from small colon adenomas
or polyps. Neoplastic cellular proliferative disorders present
decreased methylation (i.e., decreased expression) within at least
one gene or genomic sequence selected from the group consisting of
Septin 9 (including all transcript variants thereof), FOXL2, SARM1,
VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165, as
opposed to said benign disorders which do not.
[0267] Specifically, the present invention provides for diagnostic
and classification cancer assays based on measurement of
differential expression (preferably methylation) of one or more CpG
dinucleotide sequences of at least one sequence selected from the
group consisting SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID
NO:28, SEQ ID NOS:159 to SEQ ID NO:167 that comprise such a CpG
dinucleotide sequence. Typically, such assays involve obtaining a
sample from a subject, performing an assay to measure the
expression of at least one gene or genomic sequence selected from
the group consisting of Septin 9 (including all transcript variants
thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160
to SEQ ID NO:165, preferably by determining the methylation status
of at least one sequence selected from the group consisting SEQ ID
NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to
SEQ ID NO:167, derived from the sample, relative to a control
sample, or a known standard and making a diagnosis based
thereon.
[0268] In particular preferred embodiments, inventive oligomers are
used to assess the CpG dinucleotide methylation status, such as
those based on SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID
NO:28, SEQ ID NOS:159 to SEQ ID NO:167, SEQ ID NOS:4 to SEQ ID
NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID
NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID
NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203, or arrays thereof, as well as in kits based thereon and
useful for the diagnosis and/or classification of cellular
proliferative disorders.
[0269] Kits:
[0270] Moreover, an additional aspect of the present invention is a
kit comprising: a means for determining methylation of at least one
gene or genomic sequence selected from the group consisting of
Septin 9 (including all transcript variants thereof), FOXL2, SARM1,
VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165. The
means for determining methylation comprise preferably a
bisulfite-containing reagent; one or a plurality of
oligonucleotides consisting whose sequences in each case are
identical, are complementary, or hybridise under stringent or
highly stringent conditions to a 9 or more preferably 18 base long
segment of a sequence selected from SEQ ID NOS:4 to SEQ ID NO:15,
SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ
ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID
NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203; and
optionally instructions for carrying out and evaluating the
described method of methylation analysis. In one embodiment the
base sequence of said oligonucleotides comprises at least one CpG,
CpA or TpG dinucleotide.
[0271] In a further embodiment, said kit may further comprise
standard reagents for performing a CpG position-specific
methylation analysis, wherein said analysis comprises one or more
of the following techniques: Ms-SNuPE, MSP, MethyLight,
HeavyMethyl.RTM., COBRA and nucleic acid sequencing. However, a kit
along the lines of the present invention can also contain only part
of the aforementioned components.
[0272] In a preferred embodiment the kit may comprise additional
bisulfite conversion reagents selected from the group consisting of
DNA denaturation buffer; sulfonation buffer; DNA recovery reagents
or kits (e.g., precipitation, ultrafiltration, affinity column);
desulfonation buffer; and DNA recovery components.
[0273] In a further alternative embodiment, the kit may contain,
packaged in separate containers, a polymerase and a reaction buffer
optimised for primer extension mediated by the polymerase, such as
PCR. In another embodiment of the invention the kit further
comprising means for obtaining a biological sample of the patient.
Preferred is a kit, which further comprises a container suitable
for containing the means for determining methylation of at least
one gene or genomic sequence selected from the group consisting of
Septin 9 (including all transcript variants thereof), FOXL2, SARM1,
VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165 in the
biological sample of the patient, and most preferably further
comprises instructions for use and interpretation of the kit
results. In a preferred embodiment the kit comprises: (a) a
bisulfite reagent; (b) a container suitable for containing the said
bisulfite reagent and the biological sample of the patient; (c) at
least one set of primer oligonucleotides containing two
oligonucleotides whose sequences in each case are identical, are
complementary, or hybridise under stringent or highly stringent
conditions to a 9 or more preferably 18 base long segment of a
sequence selected from SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28
to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to
SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS: 50 to SEQ
ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203; and optionally (d)
instructions for use and interpretation of the kit results. In an
alternative preferred embodiment the kit comprises: (a) a bisulfite
reagent; (b) a container suitable for containing the said bisulfite
reagent and the biological sample of the patient; (c) at least one
oligonucleotides and/or PNA-oligomer having a length of at least 9
or 16 nucleotides which is identical to or hybridises to a
pre-treated nucleic acid sequence according to one of SEQ ID NOS:4
to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to
SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ
ID NO:39, SEQ ID NOS: 50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203 and sequences complementary thereto; and optionally (d)
instructions for use and interpretation of the kit results.
[0274] In an alternative embodiment the kit comprises: (a) a
bisulfite reagent; (b) a container suitable for containing the said
bisulfite reagent and the biological sample of the patient; (c) at
least one set of primer oligonucleotides containing two
oligonucleotides whose sequences in each case are identical, are
complementary, or hybridise under stringent or highly stringent
conditions to a 9 or more preferably 18 base long segment of a
sequence selected from SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28
to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to
SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ
ID NO:51, SEQ ID NOS:168 to SEQ ID NO:203; (d) at least one
oligonucleotides and/or PNA-oligomer having a length of at least 9
or 16 nucleotides which is identical to or hybridises to a
pre-treated nucleic acid sequence according to one of SEQ ID NOS:4
to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to
SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ
ID NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203 and sequences complementary thereto; and optionally (e)
instructions for use and interpretation of the kit results.
[0275] The kit may also contain other components such as buffers or
solutions suitable for blocking, washing or coating, packaged in a
separate container.
[0276] Typical reagents (e.g., as might be found in a typical
COBRA-based kit) for COBRA.TM. analysis may include, but are not
limited to: PCR primers for at least one gene or genomic sequence
selected from the group consisting of Septin 9 (including all
transcript variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT
and SEQ ID NOS:160 to SEQ ID NO:165; restriction enzyme and
appropriate buffer; gene-hybridization oligo; control hybridization
oligo; kinase labeling kit for oligo probe; and labeled
nucleotides. Typical reagents (e.g., as might be found in a typical
MethyLight-based kit) for MethyLight analysis may include, but are
not limited to: PCR primers for the bisulfite converted sequence of
at least one gene or genomic sequence selected from the group
consisting of Septin 9 (including all transcript variants thereof),
FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID
NO:165; bisulfite specific probes (e.g., TaqMan.RTM. or
Lightcycler.RTM.); optimized PCR buffers and deoxynucleotides; and
Taq polymerase.
[0277] Typical reagents (e.g., as might be found in a typical
Ms-SNuPE-based kit) for Ms-SNuPE analysis may include, but are not
limited to: PCR primers for specific gene (or bisulfite treated DNA
sequence or CpG island); optimized PCR buffers and
deoxynucleotides; gel extraction kit; positive control primers;
Ms-SNuPE primers for the bisulfite converted sequence of at least
one gene or genomic sequence selected from the group consisting of
Septin 9 (including all transcript variants thereof), FOXL2, SARM1,
VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID NO:165;
reaction buffer (for the Ms-SNuPE reaction); and labelled
nucleotides.
[0278] Typical reagents (e.g., as might be found in a typical
MSP-based kit) for MSP analysis may include, but are not limited
to: methylated and unmethylated PCR primers for the bisulfite
converted sequence of or genomic sequence selected from the group
consisting of Septin 9 (including all transcript variants thereof),
FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID
NO:165, optimized PCR buffers and deoxynucleotides, and specific
probes.
[0279] Moreover, an additional aspect of the present invention is
an alternative kit comprising a means for determining methylation
of at least one gene or genomic sequence selected from the group
consisting of Septin 9 (including all transcript variants thereof),
FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID NOS:160 to SEQ ID
NO:165, wherein said means comprise preferably at least one
methylation specific restriction enzyme; one or a plurality of
primer oligonucleotides (preferably one or a plurality of primer
pairs) suitable for the amplification of a sequence comprising at
least one CpG dinucleotide of a sequence selected from SEQ ID NO:1
to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ
ID NO:167; and optionally instructions for carrying out and
evaluating the described method of methylation analysis.
[0280] In one embodiment the base sequence of said oligonucleotides
are identical, are complementary, or hybridise under stringent or
highly stringent conditions to an at least 18 base long segment of
a sequence selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24,
SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167.
[0281] In a further embodiment said kit may comprise one or a
plurality of oligonucleotide probes for the analysis of the digest
fragments, preferably said oligonucleotides are identical, are
complementary, or hybridise under stringent or highly stringent
conditions to an at least 16 base long segment of a sequence
selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID
NO:28, SEQ ID NOS:159 to SEQ ID NO:167.
[0282] In a preferred embodiment the kit may comprise additional
reagents selected from the group consisting: buffer (e.g.,
restriction enzyme, PCR, storage or washing buffers); DNA recovery
reagents or kits (e.g., precipitation, ultrafiltration, affinity
column) and DNA recovery components.
[0283] In a further alternative embodiment, the kit may contain,
packaged in separate containers, a polymerase and a reaction buffer
optimised for primer extension mediated by the polymerase, such as
PCR. In another embodiment of the invention the kit further
comprising means for obtaining a biological sample of the patient.
In a preferred embodiment the kit comprises: (a) a methylation
sensitive restriction enzyme reagent; (b) a container suitable for
containing the said reagent and the biological sample of the
patient; (c) at least one set of oligonucleotides one or a
plurality of nucleic acids or peptide nucleic acids which are
identical, are complementary, or hybridise under stringent or
highly stringent conditions to an at least 9 base long segment of a
sequence selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24,
SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167; and optionally (d)
instructions for use and interpretation of the kit results.
[0284] In an alternative preferred embodiment the kit comprises:
(a) a methylation sensitive restriction enzyme reagent; (b) a
container suitable for containing the said reagent and the
biological sample of the patient; (c) at least one set of primer
oligonucleotides suitable for the amplification of a sequence
comprising at least one CpG dinucleotide of a sequence selected
from SEQ ID NOs:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ
ID NOS:159 to SEQ ID NO:167; and optionally (d) instructions for
use and interpretation of the kit results.
[0285] In an alternative embodiment the kit comprises: (a) a
methylation sensitive restriction enzyme reagent; (b) a container
suitable for containing the said reagent and the biological sample
of the patient; (c) at least one set of primer oligonucleotides
suitable for the amplification of a sequence comprising at least
one CpG dinucleotide of a sequence selected from SEQ ID NOS:1 to
SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID
NO:167; (d) at least one set of oligonucleotides one or a plurality
of nucleic acids or peptide nucleic acids which are identical, are
complementary, or hybridise under stringent or highly stringent
conditions to an at least 9 base long segment of a sequence
selected from SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID
NO:28, SEQ ID NOS:159 to SEQ ID NO:167 and optionally (e)
instructions for use and interpretation of the kit results.
[0286] The kit may also contain other components such as buffers or
solutions suitable for blocking, washing or coating, packaged in a
separate container.
[0287] The invention further relates to a kit for use in providing
a diagnosis of the presence of a cell proliferative disorder in a
subject by means of methylation-sensitive restriction enzyme
analysis. Said kit comprises a container and a DNA microarray
component. Said DNA microarray component being a surface upon which
a plurality of oligonucleotides are immobilized at designated
positions and wherein the oligonucleotide comprises at least one
CpG methylation site. At least one of said oligonucleotides is
specific for the at least one gene or genomic sequence selected
from the group consisting of Septin 9 (including all transcript
variants thereof), FOXL2, SARM1, VTN, PRDM6, NR2E1, FAT and SEQ ID
NOS:160 to SEQ ID NO:165 and comprises a sequence of at least 15
base pairs in length but no more than 200 bp of a sequence
according to one of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ
ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167. Preferably said sequence
is at least 15 base pairs in length but no more than 80 bp of a
sequence according to one of SEQ ID NOS:1 to SEQ ID NO:3, SEQ ID
NO:24, SEQ ID NO:28, SEQ ID NOS:159 to SEQ ID NO:167. It is further
preferred that said sequence is at least 20 base pairs in length
but no more than 30 bp of a sequence according to one of SEQ ID
NOs:1 to SEQ ID NO:3, SEQ ID NO:24, SEQ ID NO:28, SEQ ID NOS:159 to
SEQ ID NO:167.
[0288] Said test kit preferably further comprises a restriction
enzyme component comprising one or a plurality of
methylation-sensitive restriction enzymes.
[0289] In a further embodiment said test kit is further
characterized in that it comprises at least one
methylation-specific restriction enzyme, and wherein the
oligonucleotides comprise a restriction site of said at least one
methylation specific restriction enzymes.
[0290] The kit may further comprise one or several of the following
components, which are known in the art for DNA enrichment: a
protein component, said protein binding selectively to methylated
DNA; a triplex-forming nucleic acid component, one or a plurality
of linkers, optionally in a suitable solution; substances or
solutions for performing a ligation e.g., ligases, buffers;
substances or solutions for performing a column chromatography;
substances or solutions for performing an immunology based
enrichment (e.g., immunoprecipitation); substances or solutions for
performing a nucleic acid amplification, e.g., PCR; a dye or
several dyes, if applicable with a coupling reagent, if applicable
in a solution; substances or solutions for performing a
hybridization; and/or substances or solutions for performing a
washing step.
[0291] The described invention further provides a composition of
matter useful for detecting, differentiation and distinguishing
between colon cell proliferative disorders. Said composition
comprising at least one nucleic acid 18 base pairs in length of a
segment of the nucleic acid sequence disclosed in SEQ ID NOS:4 to
SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ
ID NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID
NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203, and one or more substances taken from the group comprising:
1-5 mM Magnesium Chloride, 100-500 .mu.M dNTP, 0.5-5 units of taq
polymerase, bovine serum albumen, an oligomer in particular an
oligonucleotide or peptide nucleic acid (PNA)-oligomer, said
oligomer comprising in each case at least one base sequence having
a length of at least 9 nucleotides which is complementary to, or
hybridizes under moderately stringent or stringent conditions to a
pretreated genomic DNA according to one of the SEQ ID NOS:4 to SEQ
ID NO:15, SEQ ID NOS:28 to SEQ ID NO:33, SEQ ID NOS:30 to SEQ ID
NO:31, SEQ ID NOS:42 to SEQ ID NO:43, SEQ ID NOS:38 to SEQ ID
NO:39, SEQ ID NOS:50 to SEQ ID NO:51, SEQ ID NOS:168 to SEQ ID
NO:203 and sequences complementary thereto. It is preferred that
said composition of matter comprises a buffer solution appropriate
for the stabilization of said nucleic acid in an aqueous solution
and enabling polymerase based reactions within said solution.
Suitable buffers are known in the art and commercially
available.
[0292] In further preferred embodiments of the invention said at
least one nucleic acid is at least 50, 100, 150, 200, 250 or 500
base pairs in length of a segment of the nucleic acid sequence
disclosed in SEQ ID NOS:4 to SEQ ID NO:15, SEQ ID NOS:28 to SEQ ID
NO:33, SEQ ID NOS:30 to SEQ ID NO:31, SEQ ID NOS:42 to SEQ ID
NO:43, SEQ ID NOS:38 to SEQ ID NO:39, SEQ ID NOS:50 to SEQ ID
NO:51, SEQ ID NOS:168 to SEQ ID NO:203.
[0293] While the present invention has been described with
specificity in accordance with certain of its preferred
embodiments, the following examples serve only to illustrate the
invention and are not intended to limit the invention within the
principles and scope of the broadest interpretations and equivalent
configurations thereof.
Example 1
[0294] In the following example the sequences listed below were
analysed by means of MSP and/or HeavyMethyl.RTM. assay. The assays
are designed to be run on the Lightcycler.RTM. platform (Roche
Diagnostics), but other such instruments commonly used in the art
are also suitable.
[0295] MSP amplificates are detected by means of TaqMan.RTM. style
fluorescent labelled detection probes, HeavyMethyl.RTM.
amplificates are detected by means of Lightcycler.RTM. style dual
probes.
[0296] Genomic Region of Interest: [0297] SEQ ID NO:165 [0298]
Assay type: HeavyMethyl.RTM. [0299] Primers: SEQ ID NO:249 [0300]
SEQ ID NO:250 [0301] Blockers: SEQ ID NO:251 [0302] Probes: SEQ ID
NO:252 [0303] SEQ ID NO:253
[0304] Temperature Cycling Program:
TABLE-US-00001 Activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) 72.degree. C. 10 sec (20.degree. C./s) Melting:
95.degree. C. 10 sec 20 35.degree. C. 20 sec 20 detection
95.degree. C. 0 sec 0.1
[0305] Genomic Region of Interest: [0306] SEQ ID NO:24 [0307] Assay
type: HeavyMethyl.RTM. [0308] Primers: SEQ ID NO:254 [0309] SEQ ID
NO:255 [0310] Blockers: SEQ ID NO:256 [0311] Probes: SEQ ID NO:257
(fluo labelled) [0312] SEQ ID NO:258 (Red640 labelled)
[0313] Temperature Cycling Program:
TABLE-US-00002 Denaturation at 95.degree. C.: 95.degree. C. 10 min
55 cycles: Denaturation at 95.degree. C. 10 sec (20.degree. C./s)
Annealing 56.degree. C. 30 sec (20.degree. C./s) Extension
72.degree. C. 10 sec (20.degree. C./s) Melting: 95.degree. C. 10
sec 20 35.degree. C. 20 sec 20 95.degree. C. 0 sec 0.1
[0314] Genomic region of interest: [0315] SEQ ID NO:24 [0316] Assay
type: HeavyMethyl.RTM. [0317] Primers: SEQ ID NO:264 [0318] SEQ ID
NO:265 [0319] Blockers: SEQ ID NO:266 [0320] Probes: SEQ ID NO:267
(fluo labelled) [0321] SEQ ID NO:268 (Red640 labelled)
[0322] Temperature Cycling Program:
TABLE-US-00003 Denaturation at 95.degree. C.: 95.degree. C. 10 min
55 cycles: Denaturation at 95.degree. C. 10 sec (20.degree. C./s)
Annealing 56.degree. C. 30 sec (20.degree. C./s) Extension
72.degree. C. 10 sec (20.degree. C./s) Melting 95.degree. C. 10 sec
20 35.degree. C. 20 sec 20 95.degree. C. 0 sec 0.1
[0323] Genomic Region of Interest: [0324] SEQ ID NO:28 [0325] Assay
type: MSP [0326] Primers: SEQ ID NO:274 [0327] SEQ ID NO:275 [0328]
Taqman probes: SEQ ID NO:276
[0329] Temperature Cycling Program:
TABLE-US-00004 Activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 15 sec (20.degree. C./s) 62.degree. C. 45 sec
(20.degree. C./s) Cooling: 40.degree. C. 5 sec
[0330] Genomic Region of Interest: [0331] SEQ ID NO:1 [0332] Assay
type: MSP [0333] Primers: SEQ ID NO:277 [0334] SEQ ID NO:278 [0335]
Taqman probes: SEQ ID NO:279
[0336] Temperature Cycling Program:
TABLE-US-00005 Activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 15 sec (20.degree. C./s) 62.degree. C. 45 sec
(20.degree. C./s) Cooling: 40.degree. C. 5 sec
[0337] Genomic Region of Interest: [0338] SEQ ID NO:28 [0339] Assay
type: MSP [0340] Primers: SEQ ID NO:280 [0341] SEQ ID NO:281 [0342]
Taqman probes: SEQ ID NO:282
[0343] Temperature Cycling Profile:
TABLE-US-00006 Activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 15 sec (20.degree. C./s) 62.degree. C. 45 sec
(20.degree. C./s)
[0344] Genomic Region of Interest: [0345] SEQ ID NO:1 [0346] Assay
type: MSP [0347] Primers: SEQ ID NO:283 [0348] SEQ ID NO:284 [0349]
Taqman probes: SEQ ID NO:285
[0350] Temperature Cycling Profile:
TABLE-US-00007 Activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 15 sec (20.degree. C./s) 62.degree. C. 45 sec
(20.degree. C./s)
[0351] Genomic Region of Interest: [0352] SEQ ID NO:28 [0353] Assay
type: HeavyMethyl.RTM. [0354] Primers: SEQ ID NO:286 [0355] SEQ ID
NO:287 [0356] Blockers: SEQ ID NO:288 [0357] Probes: SEQ ID NO:289
[0358] SEQ ID NO:290
[0359] Temperature Cycling Profile:
TABLE-US-00008 Activation at 95.degree. C. 95.degree. C. 10 min 5o
cycles: Denaturation at 95.degree. C. 10 sec (20.degree. C./s)
Annealing 56.degree. C. 30 sec (20.degree. C./s) Extension
72.degree. C. 10 sec (20.degree. C./s) Melting 95.degree. C. 10 sec
20 40.degree. C. 10 sec 20 70.degree. C. 0 sec 0.1 Cooling
40.degree. C. 5 sec
[0360] Genomic Region of Interest: [0361] SEQ ID NO:1 [0362] Assay
type: HeavyMethyl.RTM. [0363] Primers: SEQ ID NO:291 [0364] SEQ ID
NO:292 [0365] Blockers: SEQ ID NO:293 [0366] Probes: SEQ ID NO:294
[0367] SEQ ID NO:295
[0368] Temperature Cycling Profile:
TABLE-US-00009 Activation at 95.degree. C. 95.degree. C. 10 min 5o
cycles: Denaturation at 95.degree. C. 10 sec (20.degree. C./s)
Annealing 56.degree. C. 30 sec (20.degree. C./s) Extension
72.degree. C. 10 sec (20.degree. C./s) Melting 95.degree. C. 10 sec
20 40.degree. C. 10 sec 20 70.degree. C. 0 sec 0.1 Cooling
40.degree. C. 5 sec
[0369] Genomic Region of Interest: [0370] SEQ ID NO:1 [0371] Assay
type: HeavyMethyl.RTM. [0372] Primers: SEQ ID NO:296 [0373] SEQ ID
NO:297 [0374] Blockers: SEQ ID NO:289 [0375] Probes: SEQ ID NO:299
[0376] SEQ ID NO:300
[0377] Temperature Cycling Profile:
TABLE-US-00010 Activation at 95.degree. C. 95.degree. C. 10 min 5o
cycles: Denaturation at 95.degree. C. 10 sec (20.degree. C./s)
Annealing 56.degree. C. 30 sec (20.degree. C./s) Extension
72.degree. C. 10 sec (20.degree. C./s) Melting 95.degree. C. 10 sec
20 40.degree. C. 10 sec 20 70.degree. C. 0 sec 0.1 Cooling
40.degree. C. 5 sec
[0378] Genomic Region of Interest: [0379] SEQ ID NO:166 [0380]
Assay type: HeavyMethyl.RTM. [0381] Primers: SEQ ID NO:259 [0382]
SEQ ID NO:260 [0383] Blockers: SEQ ID NO:261 [0384] Probes: SEQ ID
NO:262 [0385] SEQ ID NO:263
[0386] Temperature Cycling Profile:
TABLE-US-00011 Activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 10 sec 58.degree. C. 30 sec 72.degree. C. 10 sec
Melting curve: 95.degree. C. 10 sec 35.degree. C. 20 sec 95.degree.
C. 0 sec Cooling: 40.degree. C. 5 sec
[0387] Genomic Region of Interest: [0388] SEQ ID NO:167 [0389]
Assay type: HeavyMethyl.RTM. [0390] Primers: SEQ ID NO:269 [0391]
SEQ ID NO:270 [0392] Blockers: SEQ ID NO:271 [0393] Probes: SEQ ID
NO:272 [0394] SEQ ID NO:273
[0395] Temperature Cycling Profile:
TABLE-US-00012 Denaturation at 95.degree. C. 95.degree. C. 10 min
55 cycles: Denaturation at 95.degree. C. 10 sec Annealing
56.degree. C. 30 sec Extension 72.degree. C. 10 sec Melting
95.degree. C. 10 sec 40.degree. C. 10 sec
Example 2
[0396] The following analysis was performed in order to select
preferred panels suitable for colorectal carcinoma screening and/or
diagnosis based on analysis of DNA methylation within whole
blood.
[0397] The performance of each marker was analysed using an assay
platform (Lightcycler.RTM.) and real time assays (MSP and/or
HeavyMethyl.RTM.) as would be suitable for use in a reference or
clinical laboratory setting. The performance of each marker was
tested independently in colorectal carcinoma tissue and whole
blood, in order to provide an indication of the accuracy of each
marker.
[0398] The panels were selected from the group of markers
consisting:
[0399] SEQ ID NO:376
[0400] SEQ ID NO:378
[0401] SEQ ID NO:27
[0402] SEQ ID NO:26
[0403] SEQ ID NO:24
[0404] SEQ ID NO:1
[0405] SEQ ID NO:165
[0406] SEQ ID NO:25
[0407] SEQ ID NO:28
[0408] SEQ ID NO:378
[0409] SEQ ID NO:163
[0410] Each marker was analysed by means of at least one
methylation specific assay, namely MSP and/or HeavyMethyl.RTM., as
shown in Table 2.
[0411] A further assay (not methylation specific), hereinafter
referred to as the C3 assay was performed in order to quantify the
total amount of DNA in each sample. The C3 assay is a bisulfite DNA
assay that detects total DNA irrespective of methylation state. The
following primers and probes were used:
TABLE-US-00013 SEQ ID NO: 62 Primer: GGAGTGGAGGAAATTGAGAT SEQ ID
NO: 63 Primer: CCACACAACAAATACTCAAAAC SEQ ID NO: 64 Probe:
TGGGTGTTTGTAATTTTTGTTTTGTGTTAGGTT
[0412] Each assay was run in duplicate on colorectal carcinoma,
normal adjacent tissue and/or whole blood samples as shown in Table
3.
[0413] DNA extraction was carried out using commercially available
kits, and bisulfite conversion was carried out with minor
modifications according to the method described in Olek et al.
(1996).
[0414] All assays (C3 and methylation specific) were performed
using the Lightcycler.RTM. platform.
[0415] Data interpretation: Calculation of DNA concentration. The
Cp (crossing point values) and intensity curves as calculated by
the Lightcycler.RTM. instrument software were used to determine DNA
concentration. The DNA concentration was calculated by reference of
the CP value of each well to a standard curve for both the
methylation assays and the C3 assay.
[0416] Sample replicates: In most cases each assay was run twice
per sample, resulting in multiple measurements per sample. For each
sample a score is calculated as follows: [0417] 1. Calculate the
ratio v1/v2 for all sample pairs [0418] 2. If both are below a
threshold of 0.1 ng, the ratio is set to =, if one is =and the
other is above threshold, set the ratio to 100 [0419] 3. For each
assay samples whose ratio exceeds 2.5 are not analysed further
[0420] 4. For samples not having exactly two replicates the average
is taken without taking any scores
[0421] Percentage methylation: All samples that measured less than
1 ng DNA using the C3 assay were not further considered. For each
sample the detected percentage methylation was calculated as the
measured concentration of DNA quantified using the methylation
assays over the concentration of DNA in the sample as quantified by
the C3 assay.
[0422] Detection of methylation was determined at three different
threshold levels, see tables) as well as at all methylation levels
(i.e., any samples wherein methylation was detected were deemed
positive).
[0423] The sensitivity of each assay was determined from the
colorectal carcinoma sample positive detection rate, wherein
sensitivity was determined as the % samples wherein methylation was
positively detected (i.e., true positives).
[0424] The specificity of each assay was determined from the whole
blood sample negative detection rate (i.e., true negative detection
rate) wherein false positives were discounted from the total number
of analysed samples.
[0425] Results: The proportion of the analysed samples with
methylation measured within various thresholds by individual assays
are shown in Tables 4 (colorectal carcinoma tissue), 5 (normal
adjacent tissue) and 6 (whole blood).
[0426] FIGS. 30 to 37 show the binary distribution plot(upper left
hand side of the figure) and where relevant multiclass distribution
plot (lower left hand side of the figure) of the proportion
(Y-axis) of colorectal carcinoma tissue and whole blood, (and in
some cases normal adjacent tissues) samples with a measured
methylation level above a specified cut-off point (X-axis). On the
right hand side of each figure is a ROC plot of sensitivity against
specificity. The ROC curve is a plot of the true positive rate
against the false positive rate for the different possible
cutpoints of a diagnostic test. It shows the trade-off between
sensitivity and specificity depending on the selected cutpoint (any
increase in sensitivity will be accompanied by a decrease in
specificity). The area under an ROC curve (AUC) is a measure for
the accuracy of a diagnostic test (the larger the area the better,
optimum is 1, a random test would have a ROC curve lying on the
diagonal with an area of 0.5; for reference: J.P. Egan. Signal
Detection Theory and ROC Analysis, Academic Press, New York, 1975).
The AUC of each ROC plot and the Wilcoxon p-value are shown in
Table 12.
[0427] Stage: A further analysis of the colorectal carcinoma
results according to stage of the carcinoma is shown in Table 7. In
said table marker sensitivity based on two different methylation
thresholds (>10% and >20%) is shown for all stages of CRC.
For most markers, sensitivity is uniform across all CRC stages so
these markers would be suitable for detection of all stages of CRC
in a screening or monitoring test. There seems to be a trend for
higher sensitivity in Stage II cancers. The less sensitive, more
specific markers tend to identify earlier stage cancers (e.g., SEQ
ID NO:25 (Assay 3)) and could add to the sensitivity of a
screening/monitoring test but also may be useful for other
applications (biopsies, stool tests, etc).
[0428] Panel: The proportion of the analysed samples with
methylation measured within various thresholds by combinations of
assays in colorectal carcinoma and whole blood is shown in Tables
8-11. In each case, the tables show the proportion of samples
within the given threshold, and additionally, the gain in detected
samples of using both markers, as opposed to only the first
marker.
Example 3
[0429] The following analysis was performed in order to confirm the
gene Septin 9, (including its transcript variant Q9HC74) and panels
thereof as a suitable marker for colorectal carcinoma screening
and/or diagnosis based on analysis of DNA methylation in whole
blood by validating the performance of assays in a large sample
set.
[0430] The performance of the marker was analysed using an assay
platform (Lightcycler.RTM.) and real time assays (MSP and/or
HeavyMethyl.RTM.) as would be suitable for use in a reference or
clinical laboratory setting. The performance of each marker was
tested independently in colorectal tissue (normal adjacent tissue),
colorectal carcinoma tissue and whole blood, in order to provide an
indication of the accuracy of the marker.
[0431] The following primers and probes were used: [0432] SEQ ID
NO:1 (Assay 7) using the Lightcycler.RTM. probes according to Table
2 was performed using the following protocol:
TABLE-US-00014 [0432] water Fill up to final volume of 10 .mu.l
MgCl2 3.5 Primer forward 0.3 Primer reverse 0.3 Blocker 4 detect.
Probe (fluo) 0.15 detect. Probe (red) 0.15 1a + 1b reagent
FastStart mix 1 DNA
[0433] Lightcycler.RTM. program:
TABLE-US-00015 activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1 cooling: 40.degree. C. 5 sec
[0434] SEQ ID NO:1 (Assay 7) using the TaqMan.RTM. probes according
to Table 2 was performed using the following protocol:
[0435] protocol:
TABLE-US-00016 water Fill up to final volume of 10 .mu.l MgCl2 3.5
Primer 1 0.3 Primer 2 0.3 Blocker 4 TaqMan probe 0.15 1a + 1b
reagent (FastStart) 1 DNA 10 .mu.l
[0436] Cycling Conditions:
TABLE-US-00017 activation: 95.degree. C. 10 min 50 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1 cooling: 40.degree. C. 5 sec
[0437] The C3 assay was performed in order to quantify the total
amount of DNA in each sample. The C3 assay was performed as above
in Example 2.
[0438] Each assay was run in duplicate on colorectal carcinoma,
normal adjacent tissue and/or whole blood samples. Two sets of
samples were analysed, sample set 1 as shown in Table 13 and sample
set 2 as shown in Table 14.
[0439] Sample set 1 was analysed using the following assays
detailed in Table 2:
[0440] SEQ ID NO:1 (Assay 2)
[0441] SEQ ID NO:26 (Assay 6)
[0442] SEQ ID NO:24 (Assay 5)
[0443] SEQ ID NO:25 (Assay 3)
[0444] Sample set 2 was analysed using the following assays as
detailed in Table 2: [0445] SEQ ID NO:1 (Assay 7) both
Lightcycler.RTM. (LC) and TagMan.RTM. (Taq) variants and the
following assays [0446] SEQ ID NO:28 (Assay 2) [0447] SEQ ID NO:24
(Assay 5b) [0448] SEQ ID NO:29 (Assay 2b) [0449] as detailed in
Table 17.
[0450] Only samples with greater than 4 ng of DNA were analysed. In
sample set 1 27 blood samples and 91 colorectal cancer samples were
analysed. In sample set 2 26 blood samples 22 non-adjacent
colorectal tissue samples and 81 colorectal cancer samples were
analysed.
[0451] All assays (C3 and methylation specific) were performed
using the Lightcycler.RTM. platform.
[0452] DNA Extraction and Bisulfite Treatment:
[0453] The DNA was isolated from the all samples by means of the
Magna Pure method (Roche) according to the manufacturer's
instructions. The eluate resulting from the purification was then
converted according to the following bisulfite reaction.
[0454] The eluate was mixed with 354 .mu.l of bisulfite solution
(5.89 mol/l) and 146 .mu.A of dioxane containing a radical
scavenger (6-hydroxy-2,5,7,8-tetramethylchromane 2-carboxylic acid,
98.6 mg in 2.5 ml of dioxane). The reaction mixture was denatured
for 3 min at 99.degree. C. and subsequently incubated at the
following temperature program for a total of 7 h min 50.degree. C.;
one thermospike (99.9.degree. C.) for 3 min; 1.5 h 50.degree. C.;
one thermospike (99.degree. C.) for 3 min; 3 h 50.degree. C. The
reaction mixture was subsequently purified by ultrafiltration using
a Millipore MICROCON.RTM. column. The purification was conducted
essentially according to the manufacturer's instructions. For this
purpose, the reaction mixture was mixed with 300 .mu.l of water,
loaded onto the ultrafiltration membrane, centrifuged for 15 min
and subsequently washed with 1.times.TE buffer. The DNA remains on
the membrane in this treatment. Then desulfonation is performed.
For this purpose, 0.2 mol/l NaOH was added and incubated for 10
min. A centrifugation (10 min) was then conducted, followed by a
washing step with 1.times.TE buffer. After this, the DNA was
eluted. For this purpose, the membrane was mixed for 10 minutes
with 75 .mu.l of warm 1.times.TE buffer (50.degree. C.). The
membrane was turned over according to the manufacturer's
instructions. Subsequently a repeated centrifugation was conducted,
with which the DNA was removed from the membrane. 10 .mu.l of the
eluate was utilized for the Lightcycler.RTM. Real Time PCR
assay.
Reaction Solutions and Thermal Cycling Conditions
[0455] SEQ ID NO:26 Assay 6 (HeavyMethyl.RTM. Assay)
[0456] Reaction solution:
TABLE-US-00018 water MgCl2 3.50 mM (buffer include 1 mM!) Primer
mix 0.30 .mu.M (each) Blocker 4.00 .mu.M detect. probes mix 0.15
.mu.M (each) 1a + 1b reagent FastStart mix 1.00 x
[0457] Thermal cycling conditions:
TABLE-US-00019 activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1 cooling: 40.degree. C. 5 sec
[0458] SEQ ID NO:25 Assay 3 (HeavyMethyl.RTM. Assay)
[0459] Reaction solution:
TABLE-US-00020 water MgCl2 3.50 mM (buffer include 1 mM!) Primer
mix 0.30 .mu.M (each) Blocker 4.00 .mu.M detect. probes mix 0.15
.mu.M (each) 1a + 1b reagent FastStart mix 1.00 x
[0460] Thermal cycling conditions:
TABLE-US-00021 activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1 cooling: 40.degree. C. 5 sec
[0461] SEQ ID NO:24 Assay 5B (HeavyMethyl.RTM. Assay)
[0462] Reaction solution:
TABLE-US-00022 water MgCl2 3.00 MM * Primer forward 0.30 .mu.M
Primer reverse 0.30 .mu.M Blocker 4.00 .mu.M detect. probes fluo
0.15 .mu.M detect. probes red 0.15 .mu.M 1a + 1b reagent mix 1.00
x
[0463] Thermal cycling conditions:
TABLE-US-00023 denat at 95.degree. C. 95.degree. C. 10 min 55
cycles: denat at 95.degree. C. 10 sec (20.degree. C./s) Annealing
58.degree. C. 30 sec (20.degree. C./s) detection extension
72.degree. C. 10 sec (20.degree. C./s) melting 95.degree. C. 10 sec
20 35.degree. C. 20 sec 20 95.degree. C. 0 sec 0.1
[0464] SEQ ID NO:24 Assay 5 (HeavyMethyl.RTM. Assay)
[0465] Reaction solution:
TABLE-US-00024 water MgCl2 3.00 mM (buffer include mM!) Primer
forward 0.30 .mu.M Primer reverse 0.30 .mu.M Blocker 4.00 .mu.M
Lightcycler .RTM. Probe 0.15 .mu.M Lightcycler .RTM. Probe 0.15
.mu.M 1a + 1b reagent mix 1.00 x
[0466] Thermal cycling conditions:
TABLE-US-00025 denat at 95.degree. C. 95.degree. C. 10 min 55
cycles: denat at 95.degree. C. 10 sec (20.degree. C./s) Annealing
58.degree. C. 30 sec (20.degree. C./s) detection extension
72.degree. C. 10 sec (20.degree. C./s) melting 95.degree. C. 10 sec
20 35.degree. C. 20 sec 20 95.degree. C. 0 sec 0.1
[0467] SEQ ID NO:1 Assay 2 (MSP Assay)
[0468] Reaction solution:
TABLE-US-00026 Water (3315932) MgCl2 (2239272) 3.50 MM (*) Primer
forward 0.60 .mu.M Primer reverse 0.60 .mu.M detect. Probe 0.30
.mu.M 1a + 1b reagent FastStart mix 1.00 x
[0469] Thermal cycling conditions:
TABLE-US-00027 activation: 95.degree. C. 10 min 50 cycles:
95.degree. C. 15 sec 62.degree. C. 45 sec cooling: 40.degree. C. 5
sec
[0470] SEQ ID NO:1 Assay 7 (Lightcycler.RTM. probe HeavyMethyl.RTM.
Assay)
[0471] Reaction solution:
TABLE-US-00028 water MgCl2 3.50 mM (buffer include mM!) Primer 1
0.30 .mu.M Primer 2 0.30 .mu.M Blocker 4.00 .mu.M detect. Probe
(fluo) 0.15 .mu.M detect. Probe (red) 0.15 .mu.M 1a + 1b reagent
(FastStart) 1.00 x
[0472] Thermal cycling conditions:
TABLE-US-00029 activation: 95.degree. C. 10 min 50 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1 cooling: 40.degree. C. 5 sec
[0473] SEQ ID NO:1 Assay 7 (TaqMan.RTM. HeavyMethyl.RTM. Assay)
[0474] Reaction solution:
TABLE-US-00030 water MgCl2 3.50 mM (buffer include mM!) Primer 1
0.30 .mu.M Primer 2 0.30 .mu.M Blocker 4.00 .mu.M detection probe 1
0.15 .mu.M detection probe 2 0.15 .mu.M 1a + 1b reagent mix 1.00
x
[0475] Thermal cycling conditions:
TABLE-US-00031 activation: 95.degree. C. 10 min 50 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1 cooling: 40.degree. C. 5 sec
[0476] SEQ ID NO:28 Assay 2 (HeavyMethyl.RTM. Assay)
[0477] Reaction solution:
TABLE-US-00032 water MgCl2 3.50 mM (buffer include mM!) Primer 1
0.30 .mu.M Primer 2 0.30 .mu.M Blocker 4.00 .mu.M detection probe 1
0.15 .mu.M detection probe 2 0.15 .mu.M 1a + 1b reagent mix 1.00
x
[0478] Thermal cycling conditions:
TABLE-US-00033 activation: 95.degree. C. 10 min 50 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1 cooling: 40.degree. C. 5 sec
[0479] SEQ ID NO:29 Assay 2B (HeavyMethyl.RTM. Assay)
[0480] Reaction solution:
TABLE-US-00034 water 3.00 mM (buffer include mM!) MgCl2 Primer 1
0.30 .mu.M Primer 2 0.30 .mu.M Blocker 4.00 .mu.M detect. Probe
(fluo) 0.15 .mu.M detect. Probe (red) 0.15 .mu.M 1a + 1b reagent
(FastStart) 1.00 x
[0481] Thermal cycling conditions:
TABLE-US-00035 activation: 95.degree. C. 10 min 50 cycles:
95.degree. C. 10 sec (20.degree. C./s) 58.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1
[0482] SEQ ID NO:29 Assay 2 (HeavyMethyl.RTM. Assay)
[0483] Reaction solution:
TABLE-US-00036 water MgCl2 3.50 mM (buffer include mM!) Primer 1
0.30 .mu.M Primer 2 0.30 .mu.M Blocker 4.00 .mu.M detection probe 1
0.15 .mu.M detection probe 2 0.15 .mu.M 1a + 1b reagent mix 1.00
x
[0484] Thermal cycling conditions:
TABLE-US-00037 activation: 95.degree. C. 10 min 55 cycles:
95.degree. C. 10 sec (20.degree. C./s) 56.degree. C. 30 sec
(20.degree. C./s) detection 72.degree. C. 10 sec (20.degree. C./s)
melting curve: 95.degree. C. 10 sec 20 40.degree. C. 10 sec 20
70.degree. C. 0 sec 0.1 cooling: 40.degree. C. 5 sec
[0485] Data Interpretation: Calculation of DNA Concentration. The
Cp (crossing point values) as calculated by the Lightcycler.RTM.
instrument software were used to determine DNA concentration. The
DNA concentration was calculated by reference of the CP value of
each well to a standard curve for both the methylation assays and
the C3 assay.
[0486] In most cases each assay was run twice per sample, resulting
in multiple measurements per sample.
[0487] Percentage methylation: All samples that measured less than
4 ng DNA using the C3 assay were not further considered. For each
sample the detected percentage methylation was calculated as the
measured concentration of DNA quantified using the methylation
assays over the concentration of DNA in the sample as quantified by
the C3 assay.
[0488] Detection of methylation was determined at multiple
different threshold levels, see tables) as well as at all
methylation levels (i.e., any samples wherein methylation was
detected were deemed positive).
[0489] The sensitivity of each assay was determined from the
colorectal carcinoma sample positive detection rate, wherein
sensitivity was determined as the % samples wherein methylation was
positively detected (i.e., true positives).
[0490] The specificity of each assay was determined from the whole
blood sample negative detection rate (i.e., true negative detection
rate) wherein false positives were discounted from the total number
of analysed samples.
[0491] Results: The proportion or number of the analysed samples
with methylation measured within a given threshold by individual
assays are shown in Tables 15 (Sample set 1) and in Table 16
(Sample set 2). Wherein at least one of the two replicates tested
positive within a given threshold the sample was considered as
positive. The panel data was compiled by determining the proportion
or number of the analysed samples with methylation measured within
a given threshold using at least one assay of the panel. Wherein at
least one of the two replicates tested positive within a given
threshold the sample was considered as positive.
[0492] SEQ ID NO:1 Assay 2 was further tested in a set of 14 breast
cancer samples, 12 colorectal cancer samples and 10 whole blood
samples (Sample set 3). The proportion or number of the analysed
samples with methylation measured within a given threshold by
individual assays are shown in Tables 18.
Example 4
Other Cancers
[0493] The following analysis was performed in order to confirm the
gene Septin 9, (including its transcript variant Q9HC74) and panels
thereof as a suitable marker for the screening and/or diagnosis of
other cancers, based on analysis of DNA methylation in whole blood
by validating the performance of assays in a large sample set.
[0494] The performance of the marker was analysed using
HeavyMethyl.RTM. Assay 7 of SEQ ID NO:1 according to Table 2,
reactions conditions were as according to Example 2.
[0495] Table 20 shows the number of samples tested in each class,
and the number of samples wherein both replicates tested positive
for methylation. FIG. 3 shows the methylation levels measured in
other cancers, as can be seen the gene is methylated across
multiple cancer types. However, only liver cancer is methylated at
equal or higher rates than colorectal cancer. FIG. 4 shows the
methylation levels measured in other non-cancerous diseases, as can
be seen only pyleonephritis is methylated at equal or higher rates
than colorectal cancer.
Example 5
Bisulfite Sequencing
[0496] Sequencing of the Septin 9 gene: It has been postulated that
the gene Septin 9 has from 4 (see previous discussion regarding the
Ensembl database) to at least 6 different transcript variants (at
the 5' end, see Russell et al. Oncogene. 2001 Sep. 13;
20(41):5930-9). Of the variants referred to by Russell et al.
amplicons were designed to cover the CpG islands or CpG rich
regions covering for 4 variants (alpha, beta, gamma and epsilon).
There are 2 CpG islands overlapping 2 of the variants, epsilon and
gamma. The beta variant appears to be regulated by the gamma CPG
island.
[0497] Samples from 12 patients were analysed, the level of Septin
9 methylation having been previously quantified by means of
HeavyMethyl.RTM. assay, as described above. Two samples had greater
than 20% methylation (Sample C group), 4 samples had 10% to 20%
methylation (Sample B group) and 6 samples had previously displayed
up to 10% methylation (Sample A group).
[0498] Furthermore, DNA of 3 whole blood samples from subjects with
no apparent disease was also used for alpha and beta amplicons
(Sample N group).
DNA Extraction and Bisulfite Treatment
[0499] DNA was isolated with QIAGEN Genomic-Tip 500/G or 100/G
according to the manufacturer's instructions. The purified genomic
DNA was then converted according to the following bisulfite
reaction.
[0500] 2 ug of DNA in 100 ul was mixed with 354 .mu.l of bisulfite
solution (10.36 g sodium bisulfite and 2.49 g sodium sulfite in 22
ml nuclease-free water) and 146 .mu.l of dioxane containing a
radical scavenger (6-hydroxy-2,5,7,8-tetramethylchromane
2-carboxylic acid, 323 mg in 8.2 ml of dioxane). The bisulfite
reaction was as follows:
TABLE-US-00038 Time Speed Action 3 min Water bath 99.9.degree. C.
30 min 1000 rpm Thermomixer 60.degree. C. 3 min Water bath
99.9.degree. C. 1.5 hour 1000 rpm Thermomixer 60.degree. C. 3 min
Water bath 99.9.degree. C. 3 hour 1000 rpm Thermomixer 60.degree.
C.
[0501] The reaction mixture was subsequently purified by
ultrafiltration using a Millipore MICROCON.RTM. column. The
purification was conducted according to the manufacturer's
instructions. More specifically for desulfonation and washing:
TABLE-US-00039 Time Volume Speed Action 200 .mu.l Sterile water to
bisulfite reaction; mix, vortex & spin 400 .mu.l Bisulfite mix
to MICROCON .RTM. column 20 min 14,000 g Discard tube with flow
through; replace with new tube 400 .mu.l Remaining bisulfite mix to
the same MICROCON .RTM. filter 20 min 14,000 g Discard tube with
flow through; replace with new tube 400 .mu.l 0.2M NaOH 12 min
14,000 g Discard tube with flow through; replace with new tube 400
.mu.l 0.1M NaOH 12 min 14,000 g Discard tube with flow through;
replace with new tube 400 .mu.l ddH.sub.2O 12 min 14,000 g Discard
tube with flow through; replace with new tube 400 .mu.l ddH.sub.2O
12 min 14,000 g Discard tube with flow through; replace with new
tube
[0502] Then 50 .mu.l of Bisulfite TE buffer (pre-warmed to
50.degree. C.; 0.1 mM EDTA in 10 mM Tris) was added to the membrane
and incubated for 10 min under agitation (1000 rpm). The column was
inverted into a 1.7 ml low-retention tube and spun at 1000 g for 7
minutes to elute the DNA. The DNA concentration was determined by
real-time PCR assay of a control sequence (HB14).
[0503] Amplification: See Table 21 for amplicons and PCR primers.
Amplicons with "rc" in their names were amplified from the Bis2
strand, others from the Bis1 strand.
[0504] Fragments of interest were amplified using the following
conditions in 25 ul reactions.
[0505] PCR Reaction:
TABLE-US-00040 1x Final volume (ul) conc. 10X DyNAzyme EXT buffer
w/ MgCl.sub.2 2.5 1X 2 mM dNTPs 2.5 200 uM each Rev/For primer
combo (10uM stock) 1.25 0.5 uM each DyNAzyme EXT polymerase 1U/ul
0.5 0.5 unit total Bisulfite Treated DNA (@10 ng/ul) 2.5-5 25-50 ng
total DMSO 100% 0-0.5 0-2%
[0506] Cycling Conditions:
[0507] 3 min 94.degree. C.; 20 s 94.degree. C.; 30 s 54.degree. C.;
45 s 72.degree. C. (38-42 cycles); 10 min 72.degree. C.
[0508] Purification of the PCR product: PCR product was purified
with the Montage DNA Gel Extraction Kit according the
manufacturer's instruction. In brief, PCR reaction was run on 1%
modified TAE (containing 0.1 mM EDTA instead of the 1.0 mM EDTA in
standard TAE) agarose gel. The DNA band of interest was cut and
excised. The gel slice was place in a Montage DNA gel Extraction
Device, and span at 5000 g for 10 minutes to collect the DNA
solution. The purified DNA was further concentrated to 10 ul.
[0509] TA cloning: The PCR product was cloned and propagated with
the Invitrogen TOPO.RTM. TA Cloning kit according to manufacturer's
instruction. In brief, 2 ul of purified and concentrated PCR
product was used in a TOPO cloning reaction to clone it into the
vector pCR.RTM.2.1-TOPO. Transformation was done with the
chemically competent E. coli strain TOP10.
[0510] Sequencing: Individual colonies were picked and cultured in
LB (50 ug Carbenicillin/ml LB for selection). 1 ul of overnight
culture were used for colony PCR in a 20 ul volume:
[0511] PCR mix
[0512] 2.5 ul 10.times. DyNAzyme buffer
[0513] 2.5 ul 2 mM dNTPs
[0514] 1.25 ul M13 F primer (10 uM)
[0515] 1.25 ul M13R primer (10 uM)
[0516] 0.25 ul DyNAzyme Polymerase
[0517] 12.25 ul ddH2O
[0518] Cycling Conditions:
[0519] 3 min 94.degree. C.; 1 min 94.degree. C.; 1 min 55.degree.
C.; 1 min 72.degree. C. (36 cycles); 10 min 72.degree. C.
[0520] Colony PCR amplicon purification and sequencing reads were
done using standard protocols. Sequencing primers used were either
M13 reverse primer or one of the amplicon specific primers that
generated the initial PCR product.
[0521] Results:
[0522] FIGS. 5 to 29 provide matrices produced from bisulfite
sequencing data of the gamma amplicon analysed by the applicant's
proprietary software (See WO 2004/000463 for further information).
Each column of the matrices represents the sequencing data for a
replicate of one sample, all replicates of each sample are grouped
together in one block. Each row of a matrix represents a single CpG
site within the fragment. The CpG number of the amplificate is
shown to the left of the matrices.
[0523] The amount of measured methylation at each CpG position is
represented by colour from light grey (0% methylation), to medium
grey (50% methylation) to dark grey (100% methylation). Some
amplificates, samples or CpG positions were not successfully
sequenced and these are shown in white.
[0524] FIGS. 5 to 29 provide matrices of the bisulfite sequencing
data according to Example 5. Each column of the matrices represents
the sequencing data for a replicate of one sample, all replicates
of each sample are grouped together in one block. Each row of a
matrix represents a single CpG site within the fragment. The CpG
number of the amplificate is shown to the left of the matrices.
[0525] The amount of measured methylation at each CpG position is
represented by colour from light grey (0% methylation), to medium
grey (50% methylation) to dark grey (100% methylation). Some
amplificates, samples or CpG positions were not successfully
sequenced and these are shown in white.
[0526] FIGS. 5 to 12 provide an overview of the sequencing of the
bisulfite converted amplificates of the genomic sequence according
to Table 21 in 4 samples that had previously been quantified (by
HeavyMethyl.RTM. assay) as having between 10% and 20%
methylation.
[0527] FIGS. 13 to 20 provide an overview of the sequencing of the
bisulfite converted amplificate of the genomic sequence according
to Table 21 in 2 samples that had previously been quantified (by
HeavyMethyl.RTM. assay) as having greater than 20% methylation.
[0528] FIGS. 21 to 22 provide an overview of the sequencing of the
bisulfite converted amplificate of the genomic sequence according
to Table 21 in blood samples from 3 healthy subjects.
[0529] FIGS. 23 to 29 provide an overview of the sequencing of the
bisulfite converted amplificate of the genomic sequence according
to Table 21 in 6 samples that had previously been quantified (by
HeavyMethyl.RTM. assay) as having less than 10% (but greater than
0%) methylation.
Example 6
[0530] Further assays suitable for the analysis of bisulfite
treated variants of genomic sequences according to SEQ ID NO:159 to
SEQ I DNO: 163 are shown in Table 22. Bisulfite treatment of
genomic DNA may be carried out according to protocols known in the
art (e.g., Olek A, et al., A modified and improved method for
bisulfite based cytosine methylation analysis, Nucleic Acids Res.
24:5064-6, 1996). Suitable cycling conditions will be known to one
skilled in the art and may be deduced from the melting temperature
of the oligomer, as shown in Table 22.
TABLE-US-00041 TABLE 1 Genomic Sequences According to Sequence
Listing Methylated Methylated Unmethylated Unmethylated Ensembl
bisulfite bisulfite bisulfite bisulfite datanbase* Associated
converted converted converted converted SEQ Ensembl database*
genomic gene sequence sequence sequence sequence ID NO: location
location transcript(s)* (sense) (antisense) (sense) (antisense) 1
AC068594.15.1.168501 17 72789082 Septin 9 & 4 5 10 11 150580 to
151086 (+) to to 73008258 (+) Q9HC74 AC111170.11.1.158988 137268 to
138151 (+) 2 AC068594.15.1.168501 17 72789082 Septin 9 6 7 12 13
150580 to 151255 (+) to 72789757 (+) 3 AC111182.20.1.171898 17
72881422 Q9HC74 8 9 14 15 127830 to 129168 (+) to 72882760 (+) 24
AC092947.12.1.72207 3 140138862 FOXL2 30 31 42 43 58709 to 60723
(+) to 140140876 (+) 25 AC015656.9.1.147775 17 44929475 NGFR 32 33
44 45 12130 to 12961 (+) to 44930306 (-) 26 AC092644.3.1.171099 2
192884909 TMEFF2 34 35 46 47 148656 to 149604 (+) to 192885857 (+)
27 AL049874.3.1.193047 Chr. 14 SIX6 36 37 48 49 183 to 2782 (+)
60045491 to 60048090 (+) 28 AC002094.1.1.167101 Chr. 17 SARM1 &
38 39 50 51 27574 to 28353 (+) 23723867 VTN to 23724646 (-) 29
AC007375.6.1.180331: Chr. 14 ZDHHC22 40 41 52 53 23232 to 24323 (+)
76676531 to 76677622 (+) *Ensembl database
TABLE-US-00042 TABLE 2 Genomic SEQ ID As- NO: say Primer Primer
Blocker Probe Probe SEQ ID HM Gtagtagtagtaggg Catccccctacaacc
Caacctaaacaacac Cgcgggagagggc Tgttggcgatcggcg NO: tagagag (SEQ taaa
(SEQ ID actcccacacactaaa gtt (SEQ ID tttt (SEQ ID 26(Assay 2) ID
NO: 301) NO: 302) acac (SEQ ID NO: 304) NO: 305) NO: 303) SEQ ID
MSP GCGGTTTCGG CCTCCCGAAC Not applicable ACGCCCGAC Not applicable
NO: AGTGGTT CTAAAACGA GAACGCCAA 376(Assay (SEQ ID NO: (SEQ ID NO:
(SEQ ID NO: 2) 306) 307) 308) SEQ ID MSP TTTATGTTTT GAATCCTCAC Not
applicable CGCCCACTAC Not applicable NO: 378 TCGTTTTTCG ACCTCCAACC
ACCGCAAAC (Assay 21) TTCG (SEQ ID G (SEQ ID NO: AAATC (SEQ NO: 309)
310) ID NO: 311) SEQ ID MSP TTACGTGTGA ACGAAAATC Not applicable
TCCAAATAC Not applicable NO: 378 GGGGTTCG CACCAATCG GATAACCGA
(Assay 1) (SEQ ID NO: AAAC (SEQ ID TACCCGAAA 312) NO: 313) CG (SEQ
ID NO: 314) SEQ ID MSP Ggtattaggtcggtat Ctattaaaaacacgc Not
applicable Tcgttttcgcggttgt Ttcggaatcggaagt NO: 163 ttttcgt (SEQ ID
gacatcga (SEQ tcgttgt (SEQ ID tcgttgtttg (SEQ (Assay 1) NO: 315) ID
NO: 316) NO: 317) ID NO: 318) SEQ ID MSP gcgatttcgacgtcgg
Ctacgttctccgcctc Not applicable Agggtcgtatttaggt Tagtcgcgaaaaga NO:
378 t(SEQ ID NO: gtt (SEQ ID tgtcgtcgtta (SEQ ggttggagtaag (Assay
1) 319) NO: 320) ID NO: 321) (SEQ ID NO: 322) SEQ ID MSP
Gggtttcgggcgggt Atatcgcactcgctat Not applicable gagggcgacggtac
ttgggcgtcgttatt NO: 27 a (SEQ ID NO: cgcta (SEQ ID gttagaggt(SEQ
agttcggtc (Assay 1) 323) NO: 324) ID NO: 325) (SEQ ID NO: 326) SEQ
ID MSP gtcgggttggaggga atatcgcactcgctat Not applicable
gagggcgacggtac ttgggcgtcgttatta NO: 27 cgta(SEQ ID cgcta(SEQ ID
gttagaggt(SEQ ttcggtc (Assay 2) NO: 327) NO: 328) ID NO: 329) (SEQ
ID NO: 330) HM GttTttTttAttAG aAaCTaCAaCA CCTTaTCCAC CGtttACGGttC
CGttCGttTGtTT TTGGAAGAttT aaCCTTaTC(SEQ ACTaAAaCAaa GCGCG(SEQ
tAGCGCG(SEQ SEQ ID (SEQ ID NO: ID NO: 332) CAaaCAaCAC ID NO: 334)
ID NO: 335) NO: 28 331) ACAaaC(SEQ (Assay 2) ID NO: 333) SEQ ID HM
gaggtgttagaggag tccccctacaacctaa Acctaaacaacacac Cgagtcggcgcggg
agggcgttttgttggc NO: 26 tagtag (SEQ ID a(SEQ ID NO:
tcccacacactaaaac a(SEQ ID NO: gatc(SEQ ID (Assay 2) NO: 336) 337)
accaat(SEQ ID 339) NO: 340) NO: 338) SEQ ID HM aaaaaaaaaaaactc
ggttattgtttgggtt Acatacaccacaaat ttttttttttcggacg tcggtcgatgttttcg
NO: 26 ctctacatac(SEQ aataaatg(SEQ ID aaattaccaaaaacat tcgtt (SEQ
ID gtaa (Assay 6) ID NO: 341) NO: 342) caaccaa (SEQ NO: 344) (SEQ
ID NO: 345) ID NO: 343) SEQ ID HM tgagagagagagggt Tctaaataacaaaata
Ccattaccaacacaa CgaccCGccaacC CGcCGaaaCGC NO: 25 tgaaa(SEQ ID
cctccatt (SEQ cccaccaaccaa Gac (SEQ ID Gctc (SEQ ID (Assay 3) NO:
346) ID NO: 347) (SEQ ID NO: NO: 349) NO: 350) 348) SEQ ID HM
Tggttattaattatgt Accaaatatctaaata Tacaaccacaaacta tatgcgtttaacgtgt
tggcgggttttacgt NO: 165 ttatttttatag ctacaacc (SEQ ccaaaacccatattaa
ttttttgcg(SEQ ID tttttgtagt (Assay 1) (SEQ ID NO: 351) ID NO: 352)
acaacacac(SEQ NO: 354) (SEQ ID NO: 355) ID NO: 353) SEQ ID HM
GtAGtAGttAGtt CCCACCAaCC CATCATaTCA GaACCCCGCG Not applicable NO: 1
tAGtAtttAttTT ATCATaT(SEQ aACCCCACAa aTCAACGCG( (Assay 7) (SEQ ID
NO: ID NO: 357) TCAACACAC SEQ ID NO: 356) AaC(SEQ ID 359) NO: 358)
SEQ ID HM GtAGtAGttAGtt CCCACCAaCC CATCATaTCA GTtCGAAATG CGTTGAtCGC
NO: 1 tAGtAtttAttTT ATCATaT(SEQ aACCCCACAa ATtttATttAGtT
GGGGTtC(SEQ (Assay 7) (SEQ ID NO: ID NO: 361) TCAACACAC GC(SEQ ID
ID NO: 364) 360) AaC(SEQ ID NO: 14844363 NO: 362) SEQ ID HM
ccaaaacctaaactta Ggaaatttgaggggt Tacaacaccaccaa GTtAATTGCG
CGtCGttAGCG NO: 24 caac(SEQ ID aa(SEQ ID NO: caaacccaaaaacac
GGCGAtCGA( GGTGGG(SEQ (Assay 5) NO: 365) 366) aa(SEQ ID NO: SEQ ID
NO: ID NO: 369) 367) 368) SEQ ID MSP cggttgttgtaggcgt
gcaaaacacacgaaa Not applicable Cgcgtgtgtaggtcg Not applicable NO:
28 c(SEQ ID NO: acg(SEQ ID cgcgt(SEQ ID (Assay 1) 370) NO: 371) NO:
372) SEQ ID MSP aaaatcctctccaaca cgcgattcgttgttta Not applicable
CGgatttCGCGgt Not applicable NO: 1 cgtc(SEQ ID ttag taaCGCGtagtt
(Assay 2) NO: 373) (SEQ ID NO: 374) (SEQ ID NO: 375)
TABLE-US-00043 TABLE 3 Samples Analysed According to Example 2
Normal Total no Colorectal Adjacent Assay Samples Carcinoma Tissue
Blood SEQ ID NO: 165 (Assay 1) 33 26 0 7 SEQ ID NO: 24 (Assay 5)
106 79 0 27 SEQ ID NO: 25 (Assay 3) 109 82 0 27 SEQ ID NO: 26
(Assay 6) 113 86 0 27 SEQ ID NO: 1 (Assay 2) 115 87 0 28 MSP SEQ ID
NO: 376 127 91 16 20 (Assay 2) SEQ ID NO: 378 (Assay 1) 118 78 16
24 SEQ ID NO: 378 (Assay 21) 118 78 16 24 SEQ ID NO: 378 (Assay 1)
118 78 16 24 SEQ ID NO: 163 (Assay 1) 118 78 16 24 SEQ ID NO: 26
(Assay 2) 132 92 16 24 HM MSP SEQ ID NO: 27 128 89 15 24 (Assay
2)
TABLE-US-00044 TABLE 4 Proportion of Colorectal Carcinoma Samples
with Methylation within Various Thresholds above above above above
Assay 0.01 0.1 0.3 0.5 SEQ ID NO: 165 (Assay 1) 0.269 0.077 0 0 SEQ
ID NO: 24 (Assay 5) 0.911 0.557 0.152 0.076 SEQ ID NO: 25 (Assay 3)
0.573 0.402 0.232 0.073 SEQ ID NO: 26 (Assay 6) 0.919 0.756 0.43
0.186 SEQ ID NO: 1 (Assay 2) 0.885 0.816 0.506 0.218 MSP SEQ ID NO:
376 (Assay 2) 0.11 0 0 0 SEQ ID NO: 378 (Assay 1) 0 0 0 0 SEQ ID
NO: 378 (Assay 21) 0 0 0 0 SEQ ID NO: 378 (Assay 1) 0 0 0 0 SEQ ID
NO: 163 (Assay 1) 0 0 0 0 SEQ ID NO: 26 (Assay 2) HM 0.924 0.739
0.446 0.228 MSP SEQ ID NO: 27 (Assay 2) 0.843 0.551 0.169 0.056
TABLE-US-00045 TABLE 5 Proportion of Normal Adjacent Tissue Samples
with Methylation within Various Thresholds above above above above
Assay 0.001 0.01 0.1 0.3 MSP SEQ ID NO: 376 (Assay 2) 0.938 0.25 0
0 SEQ ID NO: 378 (Assay 1) 0 0 0 0 SEQ ID NO: 378 (Assay 21) 0 0 0
0 SEQ ID NO: 378 (Assay 1) 0.25 0 0 0 SEQ ID NO: 163 (Assay 1) 0 0
0 0 SEQ ID NO: 26 (Assay 2) HM 0.938 0.938 0 0 MSP SEQ ID NO: 27
(Assay 2) 0.933 0.533 0.067 0
TABLE-US-00046 TABLE 6 Proportion of Whole Blood Samples with
Methylation within Various Thresholds above above Above above Assay
0.0001 0.001 0.01 0.1 SEQ ID NO: 165 (Assay 1) 0.286 0.143 0.143
0.143 SEQ ID NO: 24 (Assay 5) 0.074 0 0 0 SEQ ID NO: 25 (Assay 3) 0
0 0 0 SEQ ID NO: 26 (Assay 6) 0.148 0.037 0 0 SEQ ID NO: 1 (Assay
2) 0.071 0 0 0 MSP SEQ ID NO: 376 (Assay 2) 0.4 0.2 0 0 SEQ ID NO:
378 (Assay 1) 0 0 0 0 SEQ ID NO: 378 (Assay 21) 0 0 0 0 SEQ ID NO:
378 (Assay 1) 0 0 0 0 SEQ ID NO: 163 (Assay 1) 0 0 0 0 SEQ ID NO:
26 (Assay 2) HM 0.292 0.083 0 0 SEQ ID NO: 27 (Assay 2 MSP) 0.083
0.042 0 0
TABLE-US-00047 TABLE 7 Proportion of Colorectal Carcinoma Samples
within Various Methylation Thresholds According to Stage of Disease
Stage I Stage II Stage III Stage IV Assay >10% >20% >10'%
>20% >10% >20% >10% >20% SEQ ID 38.5 23.1 90 60 53.8
23.1 57.1 42.9 NO: 24 (Assay 5 HM) SEQ ID 53.8 46.2 50 40 44.4 37
12.5 12.5 NO: 25 (Assay 3) SEQ ID 64.3 64.3 90 70 86.2 62.1 66.7
66.7 NO: 26 (Assay 6) SEQ ID 71.4 64.3 100 80 79.3 58.6 88.9 88.9
NO: 1 (Assay 2 MSP) SEQ ID 66.7 66.7 92.3 76.9 75 53.6 72.7 72.7
NO: 26 (Assay2) SEQ ID 55.6 33.3 69.2 38.5 44.4 18.5 80 50 NO: 27
(Assay2)
TABLE-US-00048 TABLE 8 Proportion of Colorectal Carcinoma Samples
Detected within Thresholds 1% to 10% Methylation 1% 5% 10% N 1%
methylation 5% methylation 10% methylation Panel samples
methylation gain methylation gain methylation gain SEQ ID NO: 24 73
0.917808219 0.006415814 0.767123288 0.070920756 0.643835616
0.086873591 (Assay 5)/SEQ ID NO: 25 (Assay 3) SEQ ID NO: 24 78
0.961538462 0.04293381 0.833333333 0.042635659 0.794871795
0.039057841 (Assay 5)/SEQ ID NO: 26 (Assay 6) SEQ ID NO: 24 78
0.987179487 0.075787082 0.884615385 0.045534925 0.884615385
0.068523431 (Assay 5)/SEQ ID NO: 1 (Assay 2) SEQ ID NO: 24 72
0.986111111 0.062198068 0.847222222 0.042874396 0.805555556
0.066425121 (Assay 5)/SEQ ID NO: 26 (Assay 2 HM) SEQ ID NO: 24 69
0.956521739 0.045129334 0.855072464 0.15844325 0.710144928
0.153182902 (Assay 5)/MSP SEQ ID NO: 27 (Assay 2) SEQ ID NO: 25 80
0.9125 0.006104651 0.8 0.009302326 0.7625 0.006686047 (Assay 3)/SEQ
ID NO: 26 (Assay 6) SEQ ID NO: 25 81 0.938271605 0.053214134
0.901234568 0.062154108 0.888888889 0.072796935 (Assay 3)/SEQ ID
NO: 1 (Assay 2) SEQ ID NO: 25 74 0.945945946 0.022032902
0.837837838 0.033490012 0.797297297 0.058166863 (Assay 3)/SEQ ID
NO: 26 (Assay 2 HM) SEQ ID NO: 25 72 0.916666667 0.073970037
0.791666667 0.095037453 0.680555556 0.129993758 (Assay 3)/MSP SEQ
ID NO: 27 (Assay2) SEQ ID NO: 26 85 0.976470588 0.057865937
0.894117647 0.055037187 0.882352941 0.066260987 (Assay 6)/SEQ ID
NO: 1 (Assay 2) SEQ ID NO: 26 78 0.974358974 0.050445931
0.871794872 0.067447046 0.833333333 0.07751938 (Assay 6)/SEQ ID NO:
26 (Assay 2 HM) SEQ ID NO: 26 75 1 0.081395349 0.893333333
0.102635659 0.853333333 0.09751938 (Assay 6)/MSP SEQ ID NO: 27.2)
SEQ ID NO: 1 79 0.974683544 0.050770501 0.898734177 0.059653717
0.886075949 0.069983995 (Assay 2)/SEQ ID NO: 26 (Assay 2 HM) SEQ ID
NO: 1 76 0.960526316 0.075468845 0.921052632 0.081972172
0.881578947 0.065486993 (Assay 2)/MSP SEQ ID NO: 27 (Assay 2) SEQ
ID NO: 26.2 87 0.954022989 0.030109945 0.850574713 0.046226887
0.793103448 0.053973013 HM)/MSP SEQ ID NO: 27 (Assay 2)
TABLE-US-00049 TABLE 9 Proportion of Colorectal Carcinoma Samples
Detected within Thresholds 15% to 25% Methylation 15% 20% 25% N 15%
methylation 20% methylation 25% methylation Panel samples
methylation gain methylation gain methylation gain SEQ ID NO: 24 73
0.589041096 0.146003121 0.493150685 0.163882392 0.410958904
0.130471099 (Assay 5)/SEQ ID NO: 25 (Assay 3) SEQ ID NO: 24 78
0.730769231 0.07960644 0.679487179 0.051580203 0.58974359
0.043231962 (Assay 5)/SEQ ID NO: 26 (Assay 6) SEQ ID NO: 24 78
0.820512821 0.061892131 0.717948718 0.039787798 0.602564103
0.027851459 (Assay 5)/SEQ ID NO: 1 (Assay 2) SEQ ID NO: 24 72 0.75
0.065217391 0.666666667 0.036231884 0.583333333 0.050724638 (Assay
5)/SEQ ID NO: 26 (Assay 2 HM) SEQ ID NO: 24 69 0.652173913
0.180263801 0.492753623 0.176297927 0.362318841 0.134470739 (Assay
5)/MSP SEQ ID NO: 27 (Assay2) SEQ ID NO: 25 80 0.6875 0.036337209
0.6625 0.034593023 0.575 0.028488372 (Assay 3)/SEQ ID NO: 26 (Assay
6) SEQ ID NO: 25 81 0.839506173 0.080885483 0.740740741 0.062579821
0.62962963 0.054916986 (Assay 3)/SEQ ID NO: 1 (Assay 2) SEQ ID NO:
25 74 0.743243243 0.058460635 0.702702703 0.07226792 0.594594595
0.061985899 (Assay 3)/SEQ ID NO: 26 (Assay 2 HM) SEQ ID NO: 25 72
0.611111111 0.139200999 0.5 0.170731707 0.402777778 0.122289973
(Assay 3)/MSP SEQ ID NO: 27 (Assay 2) SEQ ID NO: 26 85 0.835294118
0.076673428 0.776470588 0.098309669 0.729411765 0.154699121 (Assay
6)/SEQ ID NO: 1 (Assay 2) SEQ ID NO: 26 78 0.756410256 0.071627648
0.730769231 0.100334448 0.653846154 0.107334526 (Assay 6)/SEQ ID
NO: 26 (Assay 2 HM) SEQ ID NO: 26 75 0.72 0.068837209 0.693333333
0.065426357 0.586666667 0.040155039 (Assay 6)/MSP SEQ ID NO: 27.2)
SEQ ID NO: 1 79 0.835443038 0.076822348 0.797468354 0.119307435
0.696202532 0.121489888 (Assay 2)/SEQ ID NO: 26 (Assay 2 HM) SEQ ID
NO: 1 76 0.815789474 0.057168784 0.684210526 0.006049607
0.605263158 0.030550514 (Assay 2)/MSP SEQ ID NO: 27 (Assay 2) SEQ
ID NO: 26.2 87 0.954022989 0.030109945 0.850574713 0.046226887
0.793103448 0.053973013 HM)/MSP SEQ ID NO: 27 (Assay 2)
TABLE-US-00050 TABLE 10 Proportion of Colorectal Carcinoma Samples
Detected within Thresholds 30% to 50% Methylation Panel N samples
30% methylation 30% methylation gain 50% methylation SEQ ID NO: 24
(Assay 5)/SEQ ID NO: 25 73 0.315068493 0.083361176 0.123287671
(Assay 3) SEQ ID NO: 24 (Assay 5)/SEQ ID NO: 26 78 0.474358974
0.044126416 0.217948718 (Assay 6) SEQ ID NO: 24 (Assay 5)/SEQ ID
NO: 1 78 0.538461538 0.032714412 0.269230769 (Assay 2) SEQ ID NO:
24 (Assay 5)/SEQ ID NO: 72 0.486111111 0.040458937 0.263888889
26(Assay 2 HM) SEQ ID NO: 24 (Assay 5)/MSP SEQ ID 69 0.260869565
0.092330239 0.115942029 NO: 27(Assay 2) SEQ ID NO: 25 (Assay 3)/SEQ
ID NO: 26 80 0.475 0.044767442 0.2 (Assay 6) SEQ ID NO: 25 (Assay
3)/SEQ ID NO: 1 81 0.580246914 0.074499787 0.259259259 (Assay 2)
SEQ ID NO: 25 (Assay 3)/SEQ ID NO: 74 0.5 0.054347826 0.243243243
26(Assay 2 HM) SEQ ID NO: 25 (Assay 3)/MSP SEQ ID 72 0.333333333
0.101626016 0.097222222 NO: 27(Assay 2) SEQ ID NO: 26 (Assay 6)/SEQ
ID NO: 1 85 0.635294118 0.129546991 0.305882353 (Assay 2) SEQ ID
NO: 26 (Assay 6)/SEQ ID NO: 78 0.551282051 0.105629877 0.269230769
26(Assay 2 HM) SEQ ID NO: 26 (Assay 6)/MSP SEQ ID 75 0.48
0.049767442 0.186666667 NO: 27.2) SEQ ID NO: 1 (Assay 2)/SEQ ID NO:
79 0.620253165 0.114506038 0.303797468 26(Assay 2 HM) SEQ ID NO: 1
(Assay 2)/MSP SEQ ID 76 0.539473684 0.033726558 0.263157895 NO:
27(Assay 2) SEQ ID NO: 26.2 HM)/MSP SEQ ID NO: 87 0.471264368
0.025612194 0.252873563 27(Assay 2)
TABLE-US-00051 TABLE 11 Proportion of Whole Blood Samples Detected
within Thresholds 0.01% to 0.1% Methylation Panel N samples 0.01%
methylation 0.1% methylation SEQ ID NO: 24 (Assay 5)/SEQ ID NO: 25
(Assay 3) 26 0.076923077 0 SEQ ID NO: 24 (Assay 5)/SEQ ID NO: 26
(Assay 6) 26 0.192307692 0.038461538 SEQ ID NO: 24 (Assay 5)/SEQ ID
NO: 1 (Assay 2) 27 0.111111111 0 SEQ ID NO: 24 (Assay 5)/SEQ ID NO:
26(Assay 2 HM) 21 0.285714286 0.095238095 SEQ ID NO: 24 (Assay
5)/MSP SEQ ID NO: 27(Assay 2) 21 0.095238095 0.047619048 SEQ ID NO:
25 (Assay 3)/SEQ ID NO: 26 (Assay 6) 26 0.153846154 0.038461538 SEQ
ID NO: 25 (Assay 3)/SEQ ID NO: 1 (Assay 2) 27 0.074074074 0 SEQ ID
NO: 25 (Assay 3)/SEQ ID NO: 26 (Assay 2 HM) 21 0.285714286
0.095238095 SEQ ID NO: 25 (Assay 3)/MSP SEQ ID NO: 27(Assay 2) 21
0.095238095 0.047619048 SEQ ID NO: 26 (Assay 6)/SEQ ID NO: 1 (Assay
2) 27 0.185185185 0.037037037 SEQ ID NO: 26 (Assay 6)/SEQ ID NO:
26(Assay 2 HM) 21 0.333333333 0.095238095 SEQ ID NO: 26 (Assay
6)/MSP SEQ ID NO: 27(Assay 2) 21 0.142857143 0.047619048 SEQ ID NO:
1 (Assay 2)/SEQ ID NO: 26(Assay 2 HM) 22 0.272727273 0.090909091
SEQ ID NO: 1 (Assay 2)/MSP SEQ ID NO: 27(Assay 2) 22 0.136363636
0.045454545 SEQ ID NO: 26(Assay 2 HM)/MSP SEQ ID NO: 27 (Assay 2)
24 0.291666667 0.083333333
TABLE-US-00052 TABLE 12 Differentiation between Blood and
Colorectal Carcinoma Sample as Illustrated in FIGS. 30-37.*
Wilcoxon Figure Assay AUC of ROC Sensitivity/Specificity P-value 30
SEQ ID NO: 165 0.76 (0.58, 0.89) 0.62/0.86 0.371 (Assay 1) 31 SEQ
ID NO: 24 (Assay 0.98 (0.93, 1) 0.96/0.93 0 5) 32 SEQ ID NO: 25
(Assay 0.89 (0.82, 0.94) 0.78/1 0 3) 33 SEQ ID NO: 26 (Assay 0.99
(0.95, 1) 0.99/0.85 0 6) 34 SEQ ID NO: 1 (Assay 0.99 (0.95/1)
0.98/0.93 0 2) 35 SEQ ID NO: 376 0.57 (0.48, 0.65) 0.14/0.86 0.2399
(Assay 2 MSP) 36 SEQ ID NO: 26 (Assay 0.94 (0.87, 0.97) 0.86/0.88 0
2 HM) 37 SEQ ID NO: 27 (Assay 0.89 (0.82, 0.94) 0.81/0.87 0 2 MSP)
*confidence intervals are shown in brackets
TABLE-US-00053 TABLE 13 Sample Set 1 According to Example 3 Sample
Type Sex Age Stage T N M Location CRC F 39 III 4 1 0 sigmoid CRC F
65 III 3 2 0 ileo-cecum CRC M 58 IV rectum CRC M 63 III 3 1 0
rectum CRC M 71 II ascending CRC F 69 I 2 0 0 cecum CRC F 54 III 3
2 0 cecum CRC M 44 IV CRC F 75 IV transverse CRC F 60 II rectum CRC
M 76 I descending CRC M 69 IV sigmoid CRC M 73 I 1 0 0 rectum CRC M
II 3 0 0 ascending CRC M 62 III 3 1 CRC F 49 IV ascending CRC F 58
III 3 1 X ascending CRC M 42 IV 3 0 1 CRC M 64 I 2 0 0 sigmoid CRC
F 64 III rectum CRC F 70 III 3 1 0 terminal ileum CRC M 67 CRC M 80
III 3 1 0 rectosigmoid CRC F 72 IV sigmoid CRC M III rectum CRC M
56 I 2 0 0 sigmoid CRC M 72 III 2 1 0 rectum CRC M 45 IV 4 2 1
cecum CRC F II 3 0 0 CRC M 74 III 3 1 0 rectosigmoid CRC F 75 III 4
2 0 cecum wall CRC M III 3 1 0 CRC M I 2 0 0 ascending CRC F 74 I 2
0 0 cecum CRC M 62 I 2 0 0 rectosigmoid CRC F 60 II 3 0 0 rectum
CRC F 80 II ascending CRC F 70 III 4 2 0 rectum CRC M III 3 1 0 CRC
F 75 III 3 1 0 ascending CRC F 49 IV 4 X 1 rectum CRC F 47 I anus
CRC M 81 IV 1 CRC F 89 III 3 1 0 rectum CRC M 85 III 3 1 0 cecum
CRC M 52 III 2 1 0 CRC M 75 II sigmoid CRC M CRC F 71 CRC M III
rectum CRC M 61 3 x 0 descending CRC F 56 unk sigmoid CRC F 68 IV 3
2 1 sigmoid CRC F 65 III 3 2 0 ileo-cecum CRC M 88 II 3 0 0 flexure
CRC F 72 III cecum CRC M 61 IV 3 2 1 rectum CRC M III 3 2 CRC M 52
II 3 0 0 transverse CRC M 66 IV 2 0 1 rectum CRC M 64 III ascending
CRC F 65 II 3 0 0 CRC M 61 IV 3 2 1 sigmoid CRC M 64 III 3 1 0
ascending CRC M 76 0 0 sigmoid CRC M 64 I 2 0 0 ascending CRC M 56
I 2 0 0 transverse CRC F 67 II 3 0 0 sigmoid CRC M II 3 0 0
ascending CRC M 66 III 4 1 0 CRC M II 3 0 0 CRC F III CRC F 65 I 2
0 X rectum CRC M II 3 0 0 CRC M 40 I FAP CRC M 77 I 2 0 0
rectosigmoid CRC M 65 III 4 2 0 descending CRC M 68 IV sigmoid CRC
M 67 II rectum CRC M unk rectum CRC F 63 3 x 0 CRC M 68 unk
descending CRC F 53 III 3 1 0 ascending CRC M II 3 0 0 CRC M 68 I 2
0 0 rectum CRC M 84 III rectum CRC F 53 I 1 0 0 descending CRC M 72
III 4 1 0 CRC F 69 I 1 0 0 sigmoid CRC M II 3 0 0 descending CRC M
II 3 0 0 cecum Normal Blood F 62 n.a. n.a. n.a. n.a. n.a. Normal
Blood M 62 n.a. n.a. n.a. n.a. n.a. Normal Blood F 44 n.a. n.a.
n.a. n.a. n.a. Normal Blood F 57 n.a. n.a. n.a. n.a. n.a. Normal
Blood F 51 n.a. n.a. n.a. n.a. n.a. Normal Blood M 66 n.a. n.a.
n.a. n.a. n.a. Normal Blood M 65 n.a. n.a. n.a. n.a. n.a. Normal
Blood M 55 n.a. n.a. n.a. n.a. n.a. Normal Blood F 70 n.a. n.a.
n.a. n.a. n.a. Normal Blood M 40 n.a. n.a. n.a. n.a. n.a. Normal
Blood F 42 n.a. n.a. n.a. n.a. n.a. Normal Blood F 68 n.a. n.a.
n.a. n.a. n.a. Normal Blood F 67 n.a. n.a. n.a. n.a. n.a. Normal
Blood F 53 n.a. n.a. n.a. n.a. n.a. Normal Blood F n.a. n.a. n.a.
n.a. n.a. Normal Blood F 50 n.a. n.a. n.a. n.a. n.a. Normal Blood M
50 n.a. n.a. n.a. n.a. n.a. Normal Blood M 51 n.a. n.a. n.a. n.a.
n.a. Normal Blood M 56 n.a. n.a. n.a. n.a. n.a. Normal Blood M 58
n.a. n.a. n.a. n.a. n.a. Normal Blood M 67 n.a. n.a. n.a. n.a. n.a.
Normal Blood M 55 n.a. n.a. n.a. n.a. n.a. Normal Blood M 62 n.a.
n.a. n.a. n.a. n.a. Normal Blood M 66 n.a. n.a. n.a. n.a. n.a.
Normal Blood F 56 n.a. n.a. n.a. n.a. n.a. Normal Blood M 56 n.a.
n.a. n.a. n.a. n.a. Normal Blood F 69 n.a. n.a. n.a. n.a. n.a.
TABLE-US-00054 TABLE 14 Sample Set 2 According to Example 3 Sample
Type Sex Age Stage T N M Location CRC F 49 IV ascending CRC F 72 IV
sigmoid CRC M 69 IV sigmoid CRC F 58 III 3 1 X ascending CRC F 60
II rectum CRC F 74 I 2 0 0 cecum CRC F 70 III 3 1 0 terminal ileum
CRC F 69 I 2 0 0 cecum CRC F 39 III 4 1 0 sigmoid CRC M 56 I 2 0 0
sigmoid CRC F II 3 0 0 CRC M 64 I 2 0 0 sigmoid CRC M 45 IV 4 2 1
cecum CRC F 54 III 3 2 0 cecum CRC M 42 IV 3 0 1 CRC M 73 I 1 0 0
rectum CRC M 62 III 3 1 CRC M I 2 0 0 ascending CRC F 75 III 3 1 0
ascending CRC M 74 III 3 1 0 rectosigmoid CRC F 68 IV 3 2 1 sigmoid
CRC F 75 IV transverse CRC M 85 III 3 1 0 cecum CRC M 80 III 3 1 0
rectosigmoid CRC M 66 III 4 1 0 CRC F 70 III 4 2 0 rectum CRC F 89
III 3 1 0 rectum CRC M 67 CRC F 67 II 3 0 0 sigmoid CRC M 66 IV 2 0
1 rectum CRC F 56 unk sigmoid CRC M 72 III 2 1 0 rectum CRC F 80 II
ascending CRC M 75 II sigmoid CRC F 49 IV 4 X 1 rectum CRC M III
rectum CRC F 60 II 3 0 0 rectum CRC M 62 I 2 0 0 rectosigmoid CRC M
88 II 3 0 0 flexure CRC M 61 IV 3 2 1 sigmoid CRC M 61 3 x 0
descending CRC F 64 III rectum CRC M III rectum CRC M 52 II 3 0 0
transverse CRC F 71 CRC M 81 IV 1 CRC F 65 III 3 2 0 ileo-cecum CRC
M CRC F 65 II 3 0 0 CRC F 72 III cecum CRC M 61 IV 3 2 1 rectum CRC
M 52 III 2 1 0 CRC M II 3 0 0 CRC F 47 I anus CRC M II 3 0 0
ascending CRC M 64 III 3 1 0 ascending CRC M 64 I 2 0 0 ascending
CRC M 76 0 0 sigmoid CRC M 56 I 2 0 0 transverse CRC M 65 III 4 2 0
descending CRC M 40 I FAP CRC F 53 I 1 0 0 descending CRC M II 3 0
0 CRC M III 3 2 CRC M unk rectum CRC M 68 I 2 0 0 rectum CRC F 63 3
x 0 CRC F III CRC M 67 II rectum CRC F 65 I 2 0 X rectum CRC M 64
III ascending CRC M 68 IV sigmoid CRC M II 3 0 0 CRC M 72 III 4 1 0
CRC M 77 I 2 0 0 rectosigmoid CRC F 53 III 3 1 0 ascending CRC F 69
I 1 0 0 sigmoid CRC M 84 III rectum CRC M II 3 0 0 descending CRC M
68 unk descending CRC M II 3 0 0 cecum Normal Blood M 55 n.a. n.a.
n.a. n.a. n.a. Normal Blood M 62 n.a. n.a. n.a. n.a. n.a. Normal
Blood F 57 n.a. n.a. n.a. n.a. n.a. Normal Blood F 62 n.a. n.a.
n.a. n.a. n.a. Normal Blood M 65 n.a. n.a. n.a. n.a. n.a. Normal
Blood F n.a. n.a. n.a. n.a. n.a. Normal Blood F 44 n.a. n.a. n.a.
n.a. n.a. Normal Blood F 68 n.a. n.a. n.a. n.a. n.a. Normal Blood F
70 n.a. n.a. n.a. n.a. n.a. Normal Blood M 58 n.a. n.a. n.a. n.a.
n.a. Normal Blood M 62 n.a. n.a. n.a. n.a. n.a. Normal Blood F 53
n.a. n.a. n.a. n.a. n.a. Normal Blood F 42 n.a. n.a. n.a. n.a. n.a.
Normal Blood F 51 n.a. n.a. n.a. n.a. n.a. Normal Blood M 66 n.a.
n.a. n.a. n.a. n.a. Normal Blood M 51 n.a. n.a. n.a. n.a. n.a.
Normal Blood M 40 n.a. n.a. n.a. n.a. n.a. Normal Blood M 56 n.a.
n.a. n.a. n.a. n.a. Normal Blood F 56 n.a. n.a. n.a. n.a. n.a.
Normal Blood F 50 n.a. n.a. n.a. n.a. n.a. Normal Blood M 50 n.a.
n.a. n.a. n.a. n.a. Normal Blood F 67 n.a. n.a. n.a. n.a. n.a.
Normal Blood M 67 n.a. n.a. n.a. n.a. n.a. Normal Blood M 55 n.a.
n.a. n.a. n.a. n.a. Normal Blood M 66 n.a. n.a. n.a. n.a. n.a.
Normal Blood M 56 n.a. n.a. n.a. n.a. n.a.
TABLE-US-00055 TABLE 15 Proportion Samples from Sample Set 1
According to Example 3 with Methylation within Various Thresholds
CRC CRC CRC Blood Blood Blood Assays >10%** >20%** >30%**
2 of 2+* 1 of 2+** >1% SEQ ID NO: 1 (Assay 2) 75 62 46 1 1 0 %
82.41758 68.13187 50.54945 3.703704 3.703704 0 SEQ ID NO: 6 (Assay
6)/ 79 69 59 2 11 5 SEQ ID NO: 1.2 % 86.81319 75.82418 64.83516
7.407407 40.74074 18.51852 SEQ ID NO: 1 (Assay 2)/ 78 62 45 1 1 0
SEQ ID NO: 4 (Assay 5)/ SEQ ID NO: 15174 (Assay 3) % 85.71429
68.13187 49.45055 3.703704 3.703704 0 SEQ ID NO: 1 (Assay 2)/ 77 66
51 1 1 0 SEQ ID NO: 5 (Assay 3) % 84.61538 72.52747 56.04396
3.703704 3.703704 0 SEQ ID NO: 6 (Assay 6)/ 79 69 58 2 11 5 SEQ ID
NO: 1 (Assay 2)/ SEQ ID NO: 4 (Assay 5) % 86.81319 75.82418
63.73626 7.407407 40.74074 18.51852 SEQ ID NO: 1 (Assay 2)/ 78 66
51 1 1 0 SEQ ID NO: 4 (Assay 5)/ SEQ ID NO: 15174 (Assay 3) %
85.71429 72.52747 56.04396 3.703704 3.703704 0 SEQ ID NO: 1 (Assay
2)/ 79 69 59 2 11 0 SEQ ID NO: 6 (Assay 6)/ SEQ ID NO: 15174 (Assay
3) % 86.81319 75.82418 64.83516 7.407407 40.74074 0 *Both
replicates tested positive **One of two replicates tested positive
or measured within threshold
TABLE-US-00056 TABLE 16 Proportion Samples from Sample Set 2
According to Example 3 with Methylation within Various Thresholds
CRC CRC CRC Blood Blood NAT NAT NAT >10%* >20%* >30%*
Positive* >1%* <5%* 5-10%* >10%* SEQ ID NO: 1 66 54 37 2 1
15 6 1 (Assay 7)LC % 81.48148 66.66667 45.67901 7.692308 3.846154
68.18182 27.27273 4.545455 SEQ ID NO: 1 69 57 42 3 2 (Assay 7)-LC/
SEQ ID NO: 28 (Assay 2) % 85.18519 70.37037 51.85185 11.53846
7.692308 SEQ ID NO: 1 68 55 39 2 1 (Assay 7)-LC/ SEQ ID NO: 24
(Assay 5b) % 83.95062 67.90123 48.14815 7.692308 3.846154 SEQ ID
NO: 1 68 58 46 6 5 (Assay 7)- Taqman % 83.95062 71.60494 56.79012
23.07692 19.23077 *One of two replicates tested positive or
measured within threshold
TABLE-US-00057 TABLE 17 Assays According to Example 3 Genomic SEQ
ID NO: Assay Primer Primer Blocker SEQ ID NO: HM ccaaaacctaaacttaca
tctaaataacaaaatacct Tacaacaccaccaaca 24 (Assay 5) ac(SEQ ID NO:
ccatt(SEQ ID NO: aacccaaaaacacaa 102) 110) (SEQ ID NO: 104) SEQ ID
NO: HM GttTttTttAttAGTT aAaCTaCAaCAaa CCTTaTCCACA 28 (Assay 2)
GGAAGAttT CCTTaTC (SEQ CTaAAaCAaaCA (SEQ ID NO: 111) ID NO: 112)
aaCAaCACACAa aC (SEQ ID NO: 113) SEQ ID NO: HM ggtgttgtttattttagaga
CTCCCCTAaCC CTaTCCTTCACC 29 (Assay 2b) gtt (SEQ ID NO: CCTaTC (SEQ
ID ACCTTCCCAaC 116) NO: 117) ACTaCA (SEQ ID NO: 118) Genomic SEQ ID
NO: Probe Probe SEQ ID NO: GTtAATTGCGG CGtCGttAGCGG 24 (Assay 5)
GCGAtCGA(SEQ GTGGG(SEQ ID ID NO: 105) NO: 106) SEQ ID NO:
CGtttACGGttCG CGttCGttTGtTTt 28 (Assay 2) CGCG (SEQ ID AGCGCG (SEQ
NO: 114) ID NO: 115) SEQ ID NO: ttaggggggCGCGg gttagatgCGtCGtag 29
(Assay 2b) ga (SEQ ID NO: CGttg (SEQ ID 119) NO: 120)
TABLE-US-00058 TABLE 18 Proportion Samples from Sample Set 3
According to Example 3 with Methylation within Various Thresholds
CRC CRC CRC blood blood Blood BC BC BC >10% >20% >30%
>0.1 >1 >10 >10% >20% >30% SEQ ID NO: 1 6 5 5 0 0
0 4 2 2 (Assay 2) % 50 41.66667 41.66667 0 0 0 28.57143 14.28571
14.28571
TABLE-US-00059 TABLE 19 Sample Set 3 According to Example 3 Year
Sample of Type Birth Sex Race Diagnosis CRC 1938 F Asian M0, N0,
T3, adenocarcinoma, stage II, well differentiated CRC 1941 F Asian
M0, N1, T3, adenocarcinoma, mode rately differentiated, stage III,
sigmoid CRC 1956 F Asian M0, N1, T2, adenocarcinoma, stage III,
well differentiated CRC 1945 F Asian M0, T2, adenocarcinoma, grade
2, N0 CRC 1961 F Asian M0, N1, T3, adenocarcinoma, stage III, well
differentiated, sigmoid CRC 1945 F unknown M0, N0, T2,
adenocarcinoma, stage I, well differentiated, descending CRC 1970 F
Asian M0, N0, T3, adenocarcinoma, mode rately differentiated, stage
II, ascending CRC 1941 F Asian M0, N0, T3, adenocarcinoma, mode
rately differentiated, stage II, sigmoid CRC 1952 F White M1, T3,
ulcerative, low grade, cancer, sigmoid, stromal CRC 1948 F Asian
M0, N1, T3, adenocarcinoma, stage III, ascending, grade 1 CRC 1947
F Asian M0, N0, T3, adenocarcinoma, stage II, well differentiated,
grade 1 CRC 1955 F Asian M0, N0, T3, adenocarcinoma, stage II, well
differentiated, grade 1, rectum Sample Type Age Sex Blood 16 F
Blood 33 F Blood 33 F Blood 35 F Blood 23 F Blood 35 F Blood 19 F
Blood 36 F Blood 24 F Blood 37 F Sample MenopausalStageAt Type Age
Sex TimeOfDiagnosis BC StageNStageValue Breast 63 F postmenopausal
N1 Cancer Breast 59 F postmenopausal N0 Cancer Breast 56 F
postmenopausal N0 Cancer Breast 45 F premenopausal N2 Cancer Breast
85 F postmenopausal N0 Cancer Breast 65 F postmenopausal N0 Cancer
Breast 32 F premenopausal N2 Cancer Breast 47 F premenopausal N1
Cancer Breast 44 F premenopausal N0 Cancer Sample Type Year of
Birth Sex Race Diagnosis Breast 29 F premenopausal N1 Cancer Breast
37 F premenopausal N0 Cancer Breast 44 F premenopausal N0 Cancer
Breast 52 F postmenopausal N0 Cancer Breast 54 F premenopausal N0
Cancer
TABLE-US-00060 TABLE 20 Results of Example 4 Disease type total +
samples total sample # Other cancers Bladder 4 10 Breast 5 29 Liver
7 9 Lung 10 26 Prostate 5 29 Stomach 2 7 Pancreas 1 8 Other
diseases appendicitis 1 6 cholecystitis 3 10 IBD 4 17 diabetes 3 10
esophagitis 2 10 gastritis 3 11 chronic heart disease 5 10
pancreatitis 3 10 pyelonephritis 5 10 respiratory tract infection 3
10 severe allergy 4 11 diverticulosis/diverticulitis 0 5 rheumatoid
arthritis 0 9 chronic renal disease 0 9 non-rheumatoid arthritis 0
10
TABLE-US-00061 TABLE 21 Primers and Genomic Equivalents of
Amplificates According to Example 5 Genomic Ampicon Amplicon
equivalent Primer 1 Primer 2 Amplicon Amplicon name in SEQ ID PCR
SEQ ID PCR SEQ ID name size figures NO: primer 1 NO: primer 2 NO:
gamma-rc1 493 1 129 gamma-rc1F 130 gamma-rc1R 131 gamma-rc2 428 2
132 gamma-rc2F 133 gamma-rc2R 134 gamma-3-2 557 3 135 gamma-3F_2
136 gamma-3R 137 gamma-4 556 4 138 gamma-4F 139 gamma-4R 140
epsilon-1 529 5 141 epsilon-1F 142 epsilon-1R 143 epsilon-rc2 550 6
144 epsilon-rc2F 145 epsilon-rc2R 146 epsilon-rc3 423 7 147
epsilon-rc3F 148 epsilon-rc3R 149 beta-rc1 282 8 150 beta-rc1F 151
beta-rc1R 152 alpha-1 459 9 153 alpha-1F 154 alpha-1R 155 alpha 260
10 156 alpha-F 157 alpha-R 158 Note: Amplicons with "rc" in their
names were amplified from the Bis2 strand, others from the Bis1
strand.
TABLE-US-00062 TABLE 22 Oligomers According to Example 6 genomic
Oli- target gomer sequence SEQ ID Melting SEQ ID NO: NO: Sequence
Type of Oligomer Temp 159 204 ggtgggtggttagtgaa Forward Primer 44.3
205 ttattataacaataatacctaaaaaaaa Reverse Primer 46.06 206
ggtgagtaagcgtttacgtcg Probe 54.26 207 cgagcgtcggggagg Probe 52.37
208 aaaacacatcaaaaccacaaaatttacaaaaacacaaca Blocker 59.78 209
tttagtatgtttttaattagagtgttaa Forward Primer 49.12 210
cctaacaaacttaactactccc Reverse Primer 48.61 211 cgggatttaggcggtcg
Probe 51.86 212 attttcggaggttttcgattagg Probe 52.71 213
ctcccaaaccctcattccaacccca Blocker 58.58 214 ccccaaaccctccc Forward
Primer 41.62 215 tttgtttaggaatttgtagttgt Reverse Primer 47.21 216
cgggttaggaagttcgcg Probe 52.98 217 gacgtcgcgattgttttttg Probe 51.64
218 ccccaccacaaacacctaacctcccc Blocker 59.6 160 219
ccctctacctccctact Forward Primer 46.15 220 ggagagaatagggggt Reverse
Primer 42.66 221 ggtggggcgtcgtcg Probe 51.26 222
cgttacggtttttggtgtcg Probe 51.77 223
caaactaaacctatcaaaaatcttttacaatcaacaaccc Blocker 60.64 161 224
ctaaaccaaataaaaaaaaataaaaac Forward Primer 46.6 225
gatgggtaggtatagattttag Reverse Primer 46.36 226
ggatttttttcgaagcgttttttt Probe 51.89 227 taagagcgcgttttttatcgaa
Probe 53.76 228 aaataaaaacacactaaacacaccaccatacact Blocker 58.53
162 229 ttttgagtgagtttttaaatttt Forward Primer 45.08 230
cctcctccctccactaac Reverse Primer 48.57 231 tcgtttttttggaatgggcg
Probe 51.75 232 acgcgaggtacggattttagg Probe 55.05 233
taaccacctttctccatccaacatccca Blocker 58.99 234 agtggagggaaggatgt
Forward Primer 45.98 235 aactctacaaacccaaaataaa Reverse Primer
46.17 236 gagttcgttttgtagggcgg Probe 53.18 237 cgggcggttttggg Probe
46.11 238 taaacaaccccactcaaaccaaacaccc Blocker 57.79 239
ctatatattataaaaattataatccacc Forward Primer 46.43 240
gggttaaggtgttggtagt Reverse Primer 46.11 241
cgttagttttcggtaggtaggacg Probe 56.41 242 cgcggttgtttggcg Probe
49.99 243 ccacccaataacaacaaaacataccaccaattactaa Blocker 60.46 163
244 tacccttaataaaaaaactcc Forward Primer 43.53 245
ttaggttgaggttggaaag Reverse Primer 46.08 246 cgaaggggttagttgtcgttga
Probe 54.56 247 cgttagtacgtagatgtaattggttttcg Probe 57.45 248
ctcccacacctacaaaccaacactccacaa Blocker 61.25
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20150086989A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20150086989A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References