Modulation Of Osteoclast Differentiation

BAR-SHAVIT; Zvi ;   et al.

Patent Application Summary

U.S. patent application number 14/484646 was filed with the patent office on 2015-03-05 for modulation of osteoclast differentiation. This patent application is currently assigned to OSTEOBUILD LTD.. The applicant listed for this patent is OSTEOBUILD LTD.. Invention is credited to Refael AHARON, Zvi BAR-SHAVIT.

Application Number20150065427 14/484646
Document ID /
Family ID37492359
Filed Date2015-03-05

United States Patent Application 20150065427
Kind Code A1
BAR-SHAVIT; Zvi ;   et al. March 5, 2015

MODULATION OF OSTEOCLAST DIFFERENTIATION

Abstract

Provided are methods for treating a pathological condition associated with unbalanced osteoclast differentiation by providing an AQP-9 modulator. The modulator can be an AQP-9 inhibitor or an AQP-9 inducer. Also provided are methods for modulating osteoclast differentiation, methods for treating pathological conditions associated with unbalanced osteoclast differentiation, as well as pharmaceutical composition including such modulators.


Inventors: BAR-SHAVIT; Zvi; (Jerusalem, IL) ; AHARON; Refael; (Modi'in, IL)
Applicant:
Name City State Country Type

OSTEOBUILD LTD.

Jerusalem

IL
Assignee: OSTEOBUILD LTD.
Jerusalem
IL

Family ID: 37492359
Appl. No.: 14/484646
Filed: September 12, 2014

Related U.S. Patent Documents

Application Number Filing Date Patent Number
11992234 Feb 16, 2011 8835390
PCT/IL2006/001095 Sep 19, 2006
14484646
60717762 Sep 19, 2005

Current U.S. Class: 514/16.8 ; 435/377; 514/685; 530/350; 568/331
Current CPC Class: A61P 1/02 20180101; A61P 29/00 20180101; A61P 35/00 20180101; A61K 31/12 20130101; A61K 38/191 20130101; A61P 31/00 20180101; A61P 19/08 20180101; A61P 19/10 20180101; A61P 19/02 20180101
Class at Publication: 514/16.8 ; 514/685; 568/331; 530/350; 435/377
International Class: A61K 38/19 20060101 A61K038/19; A61K 31/12 20060101 A61K031/12

Claims



1.-46. (canceled)

47. A method for modulating unbalanced osteoclast differentiation, comprising: providing osteoclasts, osteoclast precursor cells, or a mixture thereof, with an amount of an AQP-9 modulator, the amount of said modulator being effective to affect AQP-9 activity in one or more of said osteoclast cells and osteoclast precursor cells.

48. The method according to claim 47, for inhibiting osteoclast differentiation, comprising: providing said osteoclasts, osteoclast precursor cells, or mixture thereof, with an amount of an AQP-9 inhibitor, the amount of said inhibitor being effective to reduce AQP-9 activity in one or more of said osteoclast cells and osteoclast precursor cells.

49. The method according to claim 48, wherein said osteoclast precursor cells are mononuclear osteoclast cells.

50. The method according to claim 48, wherein said AQP-9 activity is affected by reducing or preventing expression of said AQP-9 in said osteoclast, osteoclast precursor cells, or mixture thereof, or by blocking said AQP-9 activity in one or more of said osteoclast cells and osteoclast precursor cells.

51. The method according to claim 48, wherein said AQP-9 inhibitor is an AQP-9 channel blocker, an AQP 9 expression inhibitor, or an AQP 9 translation inhibitor.

52. The method according to claim 48, wherein an effect on the AQP-9 activity is exhibited by one or more of the following reduction in size of osteoclasts; reduction in number of osteoclasts; and reduction in number of nuclei in an osteoclast.

53. The method according to claim 47, wherein said modulator is an AQP-9 inducer.

54. A method for inducing osteoclast differentiation, comprising: providing osteoclasts, osteoclast precursor cells, or a mixture thereof, with an amount of an AQP-9 inducer, the amount of said inducer being effective to elevate AQP-9 activity in one or more of said osteoclast cells and osteoclast precursor cells.

55. A method for treating a pathological condition associated with unbalanced osteoclast differentiation in a subject, comprising: administering to a subject in need thereof, a pharmaceutical composition comprising a therapeutically effective amount of an AQP-9 modulator, the amount of said AQP-9 modultor being effective to affect AQP-9 activity in unbalanced osteoclasts.

56. The method according to claim 55, wherein said AQP-9 modulator is an AQP-9 inhibitor.

57. The method according to claim 55, wherein said unbalanced osteoclast differentiation comprises excessive osteoclast differentiation.

58. The method according to claim 55, wherein said pathological condition is associated with bone resorption.

59. The method according to claim 55, wherein said pathological condition is osteoporosis, an inflammation-associated bone disease, a cancer-associated bone disease, an infection-associated bone disease, periodontal disease, or aseptic loosening of prosthetic implants.

60. The method according to claim 55, wherein said pathological condition is osteoporosis, osteomyelitis, rheumatoid arthritis, or Paget's disease.

61. The method according to claim 56, wherein said inhibitor is an AQP-9 channel blocker or an AQP-9 expression inhibitor.

62. The method according to claim 61, wherein said AQP-9 channel blocker is phloretin.

63. The method according to claim 55, wherein said AQP-9 modulator is an AQP-9 inducer.

64. The method according to claim 63, wherein the pathological condition is associated with osteoclast deficiency.

65. The method according to claim 64, wherein the pathological condition is associated with overly dense bones.

66. The method according to claim 65, wherein said pathological condition is osteopetrosis.

67. The method according to claim 55, wherein said AQP-9 modulator is administered to said subject by injection to said subject's bone marrow or to the subject's blood stream.

68. The method according to claim 55, wherein said AQP-9 modulator is orally administered to said subject.

69. A pharmaceutical composition comprising as an active ingredient an amount of AQP-9 modulator, the amount of said AQP-9 modulator being effective to affect AQP-9 activity in osteoclast cells or osteoclast precursor cells.

70. The method according to claim 48, wherein said AQP-9 inhibitor is an AQP-9 expression inhibitor, or an AQP-9 translation inhibitor
Description



FIELD OF THE INVENTION

[0001] This invention relates to bone remodeling processes and in particular to osteoclast differentiation.

LIST OF PRIOR ART

[0002] 1. Suda, T., et al. (1999) Endocr. Rev. 20, 345-357; [0003] 2. Teitelbaum, S. L. (2000) Science 289:1504-1508; [0004] 3. Teitelbaum, S. L., and Ross, F. P. (2003). Nat Rev Genet. 4:638-649; [0005] 4. Lacey, D. L., et. al. (1998) Cell 93:165-176; [0006] 5. Yasuda, H., et al. (1998). Proc. Natl. Acad. Sci. USA. 95:3597-3602;

BACKGROUND OF THE INVENTION

Aquaporins

[0007] The discovery of aquaporins (water channels) in 1992 by Agre and colleagues [Preston, G. M., et al. (1992) Science 256, 687-698] dramatically changed the concept of regulation of water transport through biological membranes. Aquaporins are .about.30 kDa tetrameric proteins [King, L. S., et al. (2004) Nat. Rev. Mol. Cell. Biol. 5, 800-806] characterized by six transmembrane-spanning helices, and both termini are cytosolic. Aquaporins are expressed across all organisms and control water transport in all cells [Maurel, C. (1997) Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 399-429; Mobasheri, A., et al. (2004) Vet. J. 168, 143-150; Agre, P., et al. King, L. S (2002) J. Physiol. 1, 3-16]. Eleven mammalian aquaporins have been identified so far and they have cellular and subcellular distributions in different organs that indicate probable functional roles. Studies in animals and humans have revealed that aquaporins participate in a wide range of physiological and pathological processes.

Osteoclasts

[0008] Osteoclast is the principal, if not the exclusive, resorptive cell of bone, playing a central role in the formation, growth and remodeling of the skeleton. This multinucleated cell is formed by the fusion of mononuclear progenitors of the monocyte/macrophage family [Suda, T., et al. (1999) Endocr. Rev. 20, 345-357; Teitelbaum, S. L. (2000) Science 289:1504-1508; Teitelbaum, S. L., and Ross, F. P. (2003). Nat Rev Genet. 4:638-649]. The differentiation of the osteoclast from its precursor cells requires the presence of osteoblasts or marrow stromal cells [Suda, T., (1999) ibid.]. Two factors, macrophage colony-stimulating factor (M-CSF) and receptor activator of nuclear factor kappa B (NF-.kappa.B) (RANK) ligand (RANKL), expressed by the accessory cells are essential and sufficient to promote osteoclastogenesis [Lacey, D. L., et. al. (1998) Cell 93:165-176; Yasuda, H., et al. (1998). Proc. Natl. Acad. Sci. USA. 95:3597-3602]. Excessive osteoclastic activity leads to progressive loss of bone mass causing weakening of the skeleton, manifested by a variety of pathological conditions such as osteoporosis. Reduced osteoclast activity results in the formation of overly dense bones, as found in osteopetrosis. Thus, regulation of osteoclastogenesis plays an important role in maintaining a healthy skeleton.

SUMMARY OF THE INVENTION

[0009] It has now been shown that a member of the aquaporin (aquaglyceroporin) family, AQP-9, plays a role in the differentiation of the bone-resorbing cell, the osteoclast. Specifically, the present invention is based on the finding that expression of aquaporin 9 (AQP-9) is increased in osteoclasts and precursors thereof and that this increased expression leads to osteoclast differentiation. Further, the invention is based on the finding that in the presence of an AQP-9 inhibitor, phloretin, the size or number of osteoclasts or number of nuclei in an osteoclast is reduced. Thus, it was envisaged by the inventors that AQP-9 inhibitors may have a therapeutic beneficial effect in pathological conditions associates with osteoclast formation and differentiation, such as diseases and conditions manifested excessive bone loss.

[0010] Thus, in accordance with a first of its aspects, the present invention provides for the use of an aquaprin-9 (AQP-9) modulator for the preparation of a pharmaceutical composition for treating or preventing a pathological condition associates with unbalanced osteoclast differentiation.

[0011] In accordance with one embodiment, the "inhibitory embodiment", the invention provides the use of an aquaprin-9 (AQP-9) inhibitor for the preparation of a pharmaceutical composition for treating or preventing a pathological condition associates with unbalanced osteoclast differentiation.

[0012] In accordance with another embodiment, the "inducing embodiment", the invention provides the use of an aquaprin-9 (AQP-9) inducer for the preparation of a pharmaceutical composition for treating or preventing a pathological condition associates with unbalanced osteoclast differentiation.

[0013] The invention also provides a method for modulating unbalanced osteoclast differentiation, the method comprising providing osteoclasts, osteoclast precursor cells or a mixture of same with an amount of an AQP-9 modulator, the amount of said modulator being effective to affect AQP-9 activity in said osteoclast cells or said precursor cells. In accordance with the inhibitory embodiment, the modulator is an AQP-9 inhibitor for inhibiting AQP-9 activity, while in accordance with the inducing embodiment; the modulator is an AQP-9 inducer, for inducing AQP-9 activity.

[0014] In accordance with a third aspect, the present invention provides a method for treating or preventing in a subject a pathological condition associates with unbalanced osteoclast differentiation, the method comprises providing said subject with an amount an AQP-9 modulator, the amount of said AQP-9 modulator being effective to affect AQP-9 activity in said unbalanced osteoclasts. In accordance with the inhibitory embodiment, the method provides treatment of prevention of a pathological condition associated with increased osteoclast differentiation, while in accordance with the inducing embodiment; the method provides treatment or prevention of a pathological condition associated with osteoclast deficiency.

[0015] Finally, in accordance with a fourth aspect, the invention provides a pharmaceutical composition for the treatment of prevention of a pathological condition associates with unbalanced osteoclast differentiation, the composition comprising as an active ingredient an amount of AQP-9 modulator, the amount of said AQP-9 modulator being effective to affect AQP-9 activity in osteoclast cells or osteoclast precursor cells.

BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to understand the invention and to see how it may be carried out in practice, a preferred embodiment will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:

[0017] FIG. 1 is a bar graph showing the relative expression of AQP-9 and matrix metalloproteinase-9 (MMP-9) in formed osteoclasts following treatment with RANKL (+RANKL) as compared to non-treated precursor (Control, bone marrow not treated with RANKL);

[0018] FIG. 2 is a graph showing the kinetics of induction of AQP-9 and MMP-9 expression during osteoclast differentiation by treatment with RANKL. Bars represent the standard error of the mean of at least 4 independent replicates;

[0019] FIG. 3 is a Western blot analysis of AQP-9 in osteoclast lineage cells using anti-AQP-9 and anti-actin antibodies. Two independent samples are presented;

[0020] FIGS. 4A-4D are images showing the modulation of osteoclast differentiation by phloretin, following treatment with RANKL (FIGS. 4B and 4D) or without RANKL (FIGS. 4A and 4C) and with 50 .mu.M phloretin (FIGS. 4C and 4D) or without phloretin (FIGS. 4A and 4D);

[0021] FIG. 5 is bar graph showing the effect of phloretin on methylene blue (MB) uptake in bone marrow cells in the presence or absence of RANKL.

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS

[0022] The differentiation of the osteoclast includes fusion of mononuclear precursors to form the multinucleated osteoclast. Upon fusion of the precursors, the volume of the mature osteoclast increases more dramatically than its surface, resulting in the addition of new cytosol into the cells. Water, being the major cytosolic component led to the understanding that aquaporin(s) are associated with the enhanced water influx.

[0023] The inventors have found that following induction of RANKL, a ligand associated with osteoclast differentiation, there was an increased expression AQP-9 and that this increase in expression precedes osteoclast precursor fusion. This finding led to the understanding that the water channel plays a role in the formation of a large multinucleated osteoclast, probably, by mediating rapid water influx to enable the increase in cell volume and that preventing this rapid water influx may inhibit osteoclast formation or lead to the dehydration of osteoclasts which is followed by a decrease in their size, thereby preventing uncontrolled effects of osteoclast formation.

[0024] Thus, in its broadest aspect, the present invention concerns the use of one or more modulators of the AQP-9 for the preparation of a pharmaceutical composition for treating or preventing a pathological condition associates with unbalanced osteoclast differentiation. As appreciated, while the invention is described in the following detailed description with reference to the above use, it is to be understood that also encompassed within the present invention methods for modulating osteoclast differentiation making use of the AQP-9 modulator; methods of treating or preventing a pathological condition comprising providing a subject in need of treatment an amount of the modulator; as well as pharmaceutical compositions comprising as the active principle ingredient (API) AQP-9 modulator.

[0025] For the purpose of understanding the invention the following terms are used and should be understood as comprising the indicated meaning:

[0026] AQP-9 modulator--Aquaporins (AQPs) are membrane water channels that play critical roles in controlling the water contents of cells. More than eleven different AQPs have been found in human body, and several diseases, and are sequentially numbered as AQP-0 to AQP-9. Thus, the term "AQP-9 modulator" is used herein to denote any agent, being a polymeric substance, of high or medium (e.g. oligomer) molecular weight, or a small molecular weight compound which has a statistically significant affect the water/glycerol transferring activity of the AQP-9 channel in a treated experiment (i.e. either in vivo or in vitro) as compared to the untreated control. The effect on AQP-9 channel activity may be exhibited by a change in osteoclast formation/differentiation in the treated experiment, which may be determined by measuring a change in one or more member of the following parameters: number of formed osteoclasts, size of formed osteoclasts, and number of nuclei in an osteoclast in a treated experiment. The change may be an increase or a decrease in one or more of said parameters. It is noted that when the effect comprises a decrease in number or size, it does not necessarily mean complete abolishment of any formation, or growth in size or number of nuclei.

[0027] AQP-9 inhibition or AQP-9 inhibitor--refers to any agent as defined above, wherein the modulation is exhibited by a statistically significant decrease in the water/glycerol transferring activity of the aqauproin-9 channel as compared to an untreated control. This term does not necessarily mean abolishment of the AQP-9 activity.

[0028] AQP-9 channel blockers--refers to any agent that may block directly the channel and thus prevent or decrease its water/glycerol transferring properties. Examples of such agents are phloretin (2',4',6-Trihydroxy-3-(4-hydroxyphenyl)-propiophenone, mercury, cytoskeletal inhibitors were shown to play a role in insertion of AQP-2 to membranes and the microtubular network has been implicated in this process. Both vanadate, a rather nonspecific inhibitor of ATPases, and erythro-9(3-(2-hydroxynonyl))adenine, a relatively specific inhibitor of dynein, inhibit the antidiuretic response in toad bladder (All inhibitors cited from: J Am Soc Nephrol 10:647-663, 1999); silver and gold compounds (FEBS Lett. 2002 Nov. 20;531(3): 443-7.).

[0029] Antibodies from circulating blood may be directed to the active site of AQP-9 (i.e. to the protein's loops that are exposed at the surface of the cell).

[0030] AQP-9 expression/translation reducing agents--refers to any agent that may affect AQP-9 activity by reducing the expression of the AQP-9 gene (for example by using antisense to the gene or antisense to the mRNA); by decreasing the amount of mRNA available for translation (by using siRNA against the mRNA; by using ribozymes capable of specifically degrading the AQP-9 mRNA, by using microRNA). In all the above "expression reducing agents", the agents may be administered to the cells directly ("naked" siRNA etc) or may be introduced into the cells together with transfection agents. The "expression reducing agents" may also be introduced into the cells via expression vectors enabling their expression and production inside the cell.

[0031] AQP-9 induction or AQP-9 inducer--refers to any agent as defined above, wherein the modulation is exhibited by a statistically significant increase in the water/glycerol transferring activity of the aqauproin-9 channel as compared to an untreated control.

[0032] Osteoclast differentiation--which may be used interchangeably with the term "osteoclast formation" refers to the process osteoclast precursor (progenitor) cells are recruited from haematopoietic compartments, and then proliferate and differentiate toward mature osteoclasts. During this multi-step differentiation process postmitotic osteoclast precursors progressively express osteoclast-associated markers, such as cathepsin-K, MMP-9, calcitonin receptor and tartrate-resistant acid phosphatase (TRAP), while, losing some of their macrophage characteristics. Then, mononuclear preosteoclasts fuse together to form multinucleated giant cells. Terminal osteoclast differentiation eventually leads to active bone-resorbing cells. Once formed, the osteoclast may be referred to as large osteoclasts which are typically those characterized by a plurality of nuclei (up to several dozens) or small osteoclasts containing few nuclei (as few as three).

[0033] Unbalanced osteoclast differentiation--refers to a condition of unbalanced bone remodelling in which bone resorption is followed by new bone formation, thereby maintaining mechanical strength and structure of an adults skeleton. This process couples the balanced formation of osteoclasts which are known as the bone-resorbing cells and osteoblasts, known as the bone-forming cells (which are of mesenchymal origin). Thus, the term "unbalanced osteoclast differentiation" denotes any condition where this delicate balance between osteoclasts and osteoblasts formation is disrupted. Such disruption may results either in an undesired increase or in an undesired decrease in the number and/or size osteoclasts as well as to an increase or decrease in the number of nuclei in an osteoclast.

[0034] Treatment or prevention--and the like are used herein to refer to obtaining a desired pharmacological and physiological effect. The effect may be prophylactic in terms of preventing or partially preventing a disease, symptom or pathological condition and/or may be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to a pathological condition. Thus, "treatment" covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing a pathological condition from occurring in an individual which may be predisposed to develop a pathological condition but has not yet been diagnosed as having it, i.e., causing the clinical symptoms of a pathological condition not to develop in a subject that may be predisposed to develop the condition but does not yet experience or display symptoms of the condition; (b) inhibiting, i.e., arresting or reducing the development of the pathological condition or its clinical symptoms; or (c) relieving symptoms associating with the pathological condition

[0035] The term "pathological condition" used herein denotes any condition which is associated with unbalanced osteoclast formation and differentiation, which requires for improving the well-being of the subject the delivery of an AQP-9 modulator (being an inhibitor or an inducer thereof, as defined hereinbefore). This includes, inter alia, any condition which requires the reduction or induction of osteoclast formation/differentiation so as to affect the process of bone formation in said subject. In accordance with one aspect of the invention, the pathological condition is associated with the formation/differentiation of osteoclasts at a rate which is higher than the rate of osteoblast formation (i.e. an increased osteoclast formation). Such an increased osteoclast formation may lead to excessive bone resorption. In accordance with another aspect of the invention, the pathological condition is associated with the formation/differentiation of osteoclasts at a rate which is lower than the rate of osteoblast formation (i.e. a reduced osteoclast formation). Reduced osteoclast formation may lead to overly dense bone.

[0036] As indicated above, the AQP-9 modulator may be an AQP-9 inhibitor or AQP-9 inducer.

[0037] In accordance with the inhibitory embodiment, AQP-9 inhibitor may be an AQP-9 channel blocker, an AQP-9 expression inhibitor, an AQP-9 translation inhibitor, or activity blocking antibody, modified or non-modified AQP-9 like proteins. One non-limiting example of an AQP-9 channel blocker is phloretin or a functional derivative thereof (e.g. a chemical derivative of phloretin that has essentially a similar inhibitory effect on AQP-9).

[0038] The AQP-9 inhibitor may be used for preparing a pharmaceutical composition for the treatment or prevention of a pathological condition associated with excessive bone resorption. A non-limiting list of conditions known to be involved with excessive bone resorption include, without being limited thereto, osteoporosis, an inflammation-associated bone disease, a cancer-associated bone disease, an infection-associated bone disease, periodontal disease, Paget's disease.

[0039] Osteoporosis is characterized by a reduction in bone mass and deterioration in bone architecture. The most common cause of osteoporosis in women is loss of estrogen, which occurs at menopause. The increase in bone loss is mediated by an increase in osteoclast number and size. Current therapies for osteoporosis include estrogen and Selective Estrogen Receptor Modulators (SERMs), which inhibit osteoclast differentiation, and bisphosphonates, which inhibit osteoclastic bone resorption.

[0040] Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by focal regions of subchondral osteoclastic bone resorption. Subjects having RA are at risk for development of a generalized form of bone loss. Macrophages, which are capable of differentiating into osteoclasts, accuinulate in the rheumatoid synovial membrane in the inflammatory state. Human synovial fibroblasts and T-cells, which have been shown to express RANKL, are also present in the rheumatoid joint. T-cells from rheumatoid patients are capable of supporting osteoclast differentiation from hematopoietic cells without the participation of other cells.

[0041] Cancer-associated bone diseases which may be understood interchangeably with the term malignant bone diseases may be any pathological condition involved with hyperproliferation and which are manifested in associateion with AQP-9 activity, such as, without being limited thereto, multiple myeloma, immoral hypercalcemia of malignancy, and tumor metastasis, all of which are currently treated with inhibitors of bone resorption. Bisphosphonates, which inhibit osteoclastic bone resorption, have been shown to decrease skeletal events in patients with multiple myeloma and those with bone metastases from breast cancer, as well as correcting hypercalcemia in cancer.

[0042] Infection associated bone diseases refer to any pathological condition where an infection causes unbalanced osteoclast or osteoblast differentiation. A non-limiting example is osteomyelitis which is an acute or chronic inflammatory process of the bone and its structures secondary to infection with pyogenic organisms. The infection associated with osteomyelitis may be localized or it may spread through the periosteum, cortex, marrow, and cancellous tissue. The bacterial pathogen varies on the basis of the patient's age and the mechanism of infection.

[0043] Periodontal disease in humans is characterized by alveolar bone destruction and tooth loss. Periodontitis is implicated in the increased risk of systemic diseases such as heart failure, stroke and bacterial pneumonia. Bacterial infections and their associated immunological response contribute to the bone loss associated with periodontitis. However, the mechanisms behind this disorder are not clearly understood. This term should be understood to also include aseptic loosening of prosthetic implants and the like.

[0044] Paget's disease of bone is characterized by local regions of increased osteoclast numbers and activity. The increase in bone resorption is compensated by an increase in bone formation and local bone turnover; however, the newly formed bone is abnormally weak and prone to fracture or bowing. Bisphosphonates and calcitonin are used clinically to treat the increased bone resorption in Paget's disease.

[0045] The AQP-9 inducer may be used for the preparation of a pharmaceutical composition for the treatment or prevention of a pathological condition associated with osteoclast deficiency which may result in overly dense bones. Without being limited thereto, an example of such a condition is osteopetrosis, which is an inherited disorder, characterized by an increase in bone density. In severe forms the bone marrow cavity may be obliterated. Long-term therapy with interferon gamma has been shown to increase bone resorption and hematopoiesis and improves leukocyte function.

[0046] The invention also concerns a method of modulating unbalanced osteoclast differentiation. The method comprising providing osteoclasts (large and/or small), osteoclast precursor (progenitor) cells or a mixture of same with an amount of an AQP-9 modulator, the amount of said modulator being effective to affect AQP-9 activity in said osteoclast cells or said precursor cells.

[0047] The method of the invention may be performed in vitro, e.g. for research purposes, or in vivo, for therapeutic purposes. An effect on the AQP-9 activity may be exhibited by measuring a change in one or more of the following parameters: [0048] in size of osteoclasts; [0049] in number of osteoclasts; and [0050] in number of nuclei in a osteoclast;

[0051] When the AQP-9 modulator is an AQP-9 channel blocker, it preferable that the blocker is selectively introduced to the bone marrow of a treated subject. This can be performed by choosing injection to the blood stream or direct administration to the marrow, or by oral administration. The modulator may be conjugated or complexed to targeting moieties which selectively target osteoclast precursors /osteoclasts.

[0052] When a subject is to be treated with an AQP-9 expression reducing or translation inhibiting agents it is preferable that the latter is either targeted to the bone marrow, either by the direct administration to the bone marrow or by complexing/conjugation the expression reducing agent, or the respective expression vectors, to chemical entities capable of selectively targeting osteoclast precursors or against osteoclasts.

[0053] Examples of such targeting agents are either antibodies to the marker CD11b (Fujikawa Y, Sabokbar A, Neale S, Athanasou N A. 1996. Human osteoclast formation and bone resorption by monocytes and synovial macrophages in rheumatoid arthritis. Ann Rheum Dis. 55:816-822) or CD14 (Husheem M, Nyman J K, Vaaraniemi J, Vaananen H K, Hentunen T A. 2005. Characterization of circulating human osteoclast progenitors: development of in vitro resorption assay. Calcif Tissue Int. 76:222-230)

[0054] Another option is chemical entities such as antibodies that bind to osteoclasts themselves which will prevent the formation of larger osteoclasts. Preferably these are agents which bind osteoclast markers such as antibodies against .alpha.v.uparw.3.

[0055] By another option the selectivity to the osteoclast precursors may be not by the administration/targeting but rather by placing the sequences coding for the AQP-9 expression-reducing agent (such as antisense, siRNS. Ribozyme) under the expression control of a promoter that is selectively in osteoclast precursors such as the TRAP or cathepsin K promoters.

[0056] When administered a subject, it is preferable that the AQP-9 modulator is formulated together with a pharmaceutically and physiologically acceptable carrier to form an appropriate pharmaceutical composition. The amount of the AQP-9 modulator within the composition is such that a therapeutic effect is manifested (so as to treat or prevent a pathological condition associates with unbalanced osteoclasts formation). To this end, the subject in need of treatment is administered with an amount of the AQP-9 modulator, the amount of said AQP-9 modulator being effective to affect AQP-9 activity in said unbalanced osteoclasts.

[0057] A pharmaceutically and physiologically acceptable carrier refers to any excipient that is useful in preparing a pharmaceutical composition or formulation that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes a carrier that is acceptable for veterinary use as well as human pharmaceutical use. The carrier may at times have the effect of the improving the delivery or penetration of the AQP-9 modulator to the target cell, for improving the stability of the modulator, for slowing clearance rates, for imparting slow release properties, for reducing undesired side effects etc. The carrier may also be a substance that stabilizes the composition (e.g. a preservative), for providing the composition with an edible flavor, etc. The carrier will be selected based on the desired form of the composition and the modulator to be included therein. For examples of carriers, stabilizers and adjuvants, see E. W. Martin, REMINGTON'S PHARMACEUTICAL SCIENCES, MacK Pub Co (June, 1990).

[0058] In accordance with one embodiment of the invention, the carrier is suitable for administration of the AQP-9 modulator by injection.

[0059] In accordance with another embodiment, the carrier is suitable for formulating the AQP-9 modulator in a form suitable for oral intake. The carrier may be a pharmaceutical carrier or a neutraceutical carrier (so as to provide the modulator as a food supplement).

[0060] An effective amount of the modulator may be determined by any consideration known to those versed in the art. The amount of the modulator (the inhibitor or inducer) effective to achieve a desired therapeutic result, i.e. treatment of a pathological condition or prevention of same from development, may be varied or adjusted, depending upon the particular application, the delivery system (formulation) of the modulator, the release profile of the modulator from said system, the delivery route, the potency of the particular modulator, and the desired concentration at the treated site, etc. The effective amount is typically determined in appropriately designed clinical trials (dose range studies) and the person versed in the art will know how to properly conduct such trials in order to determine the effective amount. As generally known, an effective amount depends on a variety of factors including the affinity of the modulator to a target site, the selection of delivery system, the distribution profile of the modulator within the body after being administered, a variety of pharmacological parameters such as half life in the body, on undesired side effects, if any, and on other factors such as age and gender of the treated subject, etc.

[0061] The pharmaceutical composition comprising the AQP-9 modulator may be administered over an extended period of time in a single daily dose, several doses a day, or on each consecutive day and the like. The treatment period will generally have a length proportional to the length of the disease process and the specific modulator effectiveness and the patient species being treated, all as being appreciated by those versed in the art.

[0062] As used herein, the forms "a", "an" and "the" include singular as well as plural references unless the context clearly dictates otherwise. For example, the term "an AQP-9 modulator" includes one or more agents which are capable of specifically affecting AQP-9 activity, thereby fully or partially affecting water/glycerol transport osteoclast influx.

[0063] Further, as used herein, the term "comprising" is intended to mean that the composition include the recited API, i.e. AQP-9 modulator, but not excluding other elements, such as physiologically acceptable carriers and excipients as well as other active agents. The term "consisting essentially of" is used to define compositions which include the recited elements but exclude other elements that may have an essential significance on bone modeling (osteoclast formation). "consisting of" shall thus mean excluding more than trace elements of other elements. Embodiments defined by each of these transition terms are within the scope of this invention.

[0064] Further, all numerical values, e.g. when referring the amounts or ranges of the elements constituting the composition comprising the AQP-9 modulator as an active ingredient, are approximations which are varied (+) or (-) by up to 20%, at times by up to 10% of from the stated values. It is to be understood, even if not always explicitly stated that all numerical designations are preceded by the term "about".

[0065] The invention will now be exemplified in the following description of experiments that were carried out in accordance with the invention. It is to be understood that these examples are intended to be in the nature of illustration rather than of limitation. Obviously, many modifications and variations of these examples are possible in light of the above teaching. It is therefore, to be understood that within the scope of the appended claims, the invention may be practiced otherwise, in a myriad of possible ways, than as specifically described hereinbelow.

Non-Limiting Exemplary Embodiments

Cells

[0066] Bone marrow cells (BMMs) were prepared from the long bones of 7-9 week old BALB/c male mice. Primary BMMs were prepared by flushing mouse femurs and tibias with .alpha.-MEM. Cells were cultured in Petri dishes, in complete .alpha.-MEM, supplemented with 10% CMG14-12 culture supernatant, which served as a source of M-CSF. After 3 days of culture, plates were washed 3 to 4 times with PBS to remove non-adherent cells. Adherent cells were removed with trypsin-EDTA solution, centrifuged and resuspended in a fresh medium. Murine macrophage-like RAW264.7 cell line was maintained in RPMI 1640 medium supplemented with 10% fetal calf serum (FCS) in the presence of antibiotics (penicillin and streptomycin). Cells were cultured at 37.degree. C. incubator in a humidified atmosphere with 5% CO.sub.2, and media were changed every other day. BMMs (7.times.10.sup.3/well in .alpha.-MEM containing 10% FCS and supernatant from CMG14-12 [1:20]) or RAW264.7 cells (3.times.10.sup.3/well in RPMI-1640 containing 10% FCS) were incubated in 96-well plates (0.2 ml/well). To induce cells to differentiate into osteoclasts, bacterially-produced recombinant RANKL was added at the time of plating. On day 3, medium was changed and on day 5, osteoclast formation was evaluated (see below).

Tartrate-Resistant Acid Phosphatase (TRAP)

[0067] A commercial kit (Cat. No. 387-A, Sigma) was used according to the manufacturer instructions. TRAP-positive cells containing three or more nuclei were scored as osteoclasts.

RNA Extraction and cDNA Preparation

[0068] BMMs (2.5.times.10.sup.5/plate) and RAW 264.7 cells (1.3.times.10.sup.5/plate) were plated in 35-mm tissue culture plates as described before [Amcheslaysky, A., and Bar-Shavit, Z. (2006) J. Cell. Physiol. 207, 244-250]. Total cellular RNA was isolated using EZ-RNA kit (Biological Industries Co., Beit Haemek, Israel) according to the manufacturer's instructions. For RT-PCR, RNA was purified using a DNA-free RNA kit (Zymo Research). The RNA was treated with DNase (RQ1-RNase-free DNase, Promega Corporation, USA) and tested for being essentially DNA-free by a PCR reaction as a negative control. First-strand cDNA was synthesized from 1 .mu.g of total RNA using the Superscript II pre-amplification system (Gibco BRL Life Technologies, UK) according to the manufacturer's instructions. Aquaporins primers sequences and Tm temperature for each gene are shown in Table 1.

TABLE-US-00001 TABLE 1 Primers used for the semi-quantitative RT-PCR analysis Gene Genebank name Primer Forward Primer Reverse Tm.degree. NM 007393 Actin TGAGAGGGAAATCGTGCGTGA (SEQ ID NO. 1) TGCTGGAAGGTGGACAGTGA (SEQ ID NO: 2) 60.0 BC020407 GAPDH ATTCAACGGCACAGTCAAGG (SEQ ID NO: 3) AAGGTGGAAGAGTGGGAGTT (SEQ ID NO: 4) 57.7 NM022026 AQP-0 GAAACCTAGCGCTCAACACG (SEQ ID NO: 5) ATTGGAGTCACTGGGTCTGG (SEQ ID NO: 6) 58.7 NM007472 AQP-1 TCGTCTTCATCAGCATTGGTT (SEQ ID NO: 7) CATGCGGTCTGTGAAGTCG (SEQ ID NO: 8) 57.8 NM 009699 AQP-2 CCTTCGAGCTGCCTTCTAC (SEQ ID NO: 9) TCTTGGTCGAGGGGAACAG (SEQ ID NO: 10)) 57.2 NM016689 AQP-3 CCTCTGGACACTTGGACATGG (SEQ ID NO: 11) CAGCTTCACATTCTCTTCCTC (SEQ ID NO: 12) 58.1 NM009700 AQP-4 TGGCTCAGAAAACCCCTTAC (SEQ ID NO: 13) TGTAGCTCCCTTTTGTCTGC (SEQ ID NO: 14) 56.8 NM009701 AQP-5 AAGGAGGTGTGTTCAGTTGCC (SEQ ID NO: 15) CCTGGTGTTGTGTTGTTGCTG (SEQ ID NO: 16) 60.0 NM175087 AQP-6 TCGCCATCACCTTCAATCTGG (SEQ ID NO: 17) GAACTTCCCAACAATGACGGC (SEQ ID NO: 18) 59.9 NM007473 AQP-7 TGGCAGCTATCTCGGTGTC (SEQ ID NO: 19) TGTGGTATGCTGGGGTGAAT (SEQ ID NO: 20) 58.1 NM007474 AQP-8 CTCCGCTCTCTTCATCTTCA (SEQ ID NO: 21) AGCCTAATGAGCAGTCCTAC (SEQ ID NO: 22) 55.9 NM022026 AQP-9 TTGTGATGGCTCTTTATGCG (SEQ ID NO: 23) CAGAGTTGAGTCCGAGAGAA (SEQ ID NO: 24) 55.6

Real-Time PCR (RT-PCR)

[0069] Primers and probes for the AQP-9, GAPDH, L-32, and MMP9 genes were all Assays-on-Demand products from Applied Biosystems and reactions were set up according to the manufacturer's instructions. Real time PCR was performed in triplicates in 25 .mu.l reactions on the ABI Prism 7000 Sequence Detection System. The relative level of each mRNA was determined using the comparative C.sub.T method for relative quantification using L-32 as an endogenous reference.

Western Blotting

[0070] BMMs (7.5.times.10.sup.5/35 mm tissue culture plate) and RAW 264.7 cells (1.3.times.10.sup.5/plate) were plated in 35-mm tissue culture plates as described before [Amcheslaysky, A, (2006), ibid.]. Whole cell lysates were prepared by direct lysis in 200 .mu.l of lysis buffer (10 mM of Tris-HCl, pH 7.4, 150 mM of NaCl, 1 mM of EDTA, 1% Triton X-100, and protease inhibitors [10 ng/ml of aprotinin (Sigma), 10 ng/ml of leupeptin (Sigma), and 50 mM of 4(2-aminoethyl)benzensulfonyl fluoride (AEBSF; Sigma)). 80 .mu.g of lysates were loaded onto 12.5% SDS-polyacrylamide gels. Proteins were transferred onto a nitro-cellulose membrane (Millipore Corporation, Bedford, Mass.) and processed for western blotting. Antibodies were used at the following dilutions: chicken anti-AQP-9 antibody (1:1000, Alpha diagnostic, USA), mouse anti .beta.-actin antibody (1:10000, Alpha diagnostic, USA), goat anti-mouse antibody conjugated to horseradish peroxidase (1:10000, Alpha diagnostic, USA), rabbit anti-chicken antibody conjugated to horseradish peroxidase (1:10000). Immunoreactivity was assayed using an ECL chemiluminescence kit (Pierce Biotechnology, Inc., Rockford, Ill.) according to the manufacturer's instructions.

Surface Area Measurements

[0071] The surface area occupied by osteoclasts and their precursors was quantified using a computerized image analysis system (Olympus BX50, DP50, software: ImagePro Plus, Media Cybernetics).

Methylene Blue Uptake

[0072] Cells were seeded as for the osteoclast differentiation assay (see above). Monolayers were fixed and methylene blue uptake was measured as described [Goldman, R., and Bar-Shavit, Z. (1979) J. Natl. Cancer Inst. 63, 1009-1016].

Data Analysis

[0073] All experiments were repeated at least twice, and each experimental treatment was performed with six replications, unless stated otherwise. Data were analyzed with the JMP statistics package (version 4.1, from SAS Institute Inc., Cary, N.C. 27513 USA).

EXAMPLE 1

Aquaporin Expression in Osteoclasts

[0074] Using semi-quantitative PCR we measured the expression of aquaporins in osteoclast lineage cells (Table 2). We found that out of 10 aquaporin genes examined, only aquaporin-9 (AQP-9), an aqua-glycerol channel was expressed in osteoclasts and their precursors. RNA preparations obtained from kidney and eye were used as positive controls for certain aquaporins.

TABLE-US-00002 TABLE 2 Expression of aquaporins in various mouse cells and tissues RAW264.7 Bone marrow Kidney Eye AQP-1 - - - - + + AQP-2 - - - - + - AQP-3 - - - - + + AQP-4 - - - - + - AQP-5 - - - - - n.d. AQP-6 - - - - + n.d. AQP-7 - - - - + n.d. AQP-8 - - - - + n.d. AQP-9 + + + + + - AQP-0 - - - - - + + denotes the presence of RANKL; - denotes the absence of RANKL; n.d. denotes not determined

EXAMPLE 2

Increase in AQP-9 Expression in Differentiated Osteoclasts

[0075] The expression of AQP-9 mRNA (using real time PCR) in osteoclasts and in their precursors (FIG. 1) was compared. A dramatic increase in AQP-9 expression was exhibited in osteoclast as compared to the precursors. MMP-9 is served as a marker for the osteoclastic differentiation. Detailed kinetic studies (FIG. 2) of the increase in AQP-9 and MMP-9 expression in response to RANKL showed that the increase in AQP-9 precedes the increase in MMP-9.

[0076] Using specific anti-AQP-9-antibodies (FIG. 3) and western blotting it was shown that the protein expression is greater in osteoclasts (RANKL-treated cells) than in their precursors.

EXAMPLE 3

Aquaporin 9 Activity in Osteoclast Differentiation

[0077] In the following assay the significance of the activity of AQP-9 to osteoclast differentiation was determined. To this end, the effect of the AQP-9 inhibitor phloretin (2',4',6'-Trihydroxy-3-(4-hydroxyphenyl)-propiophenone on RANKL-induced osteoclast differentiation was examined. Cells were incubated with RANKL for 5 days, and phloretin was added for the last day, when most fusion occurs. (Phloretin stock solution is in DMSO, and therefore DMSO at the amount comparable to the phloretin containing wells was added to the control cultures). A dramatic reduction in osteoclast number (FIG. 4A-4D), and size (FIGS. 4A-4D, Table 3) were observed in cultures containing phloretin.

[0078] The inhibitor did not exhibit a significant effect on number (FIG. 4A-4D), and size (FIGS. 4A-4D, right and Table 3) of the mononuclear precursors in cells not treated with RANKL.

TABLE-US-00003 TABLE 3 The effect of phloretin on osteoclast lineage cells size (.mu.m.sup.2) -RANKL +RANKL Control 255 .+-. 5 236323 .+-. 6170 Phloretin 267 .+-. 6 23722 .+-. 4351

[0079] (Bars represent the standard error of the mean of at least 50 cells per treatment)

[0080] The above results demonstrated for the first time the involvement of a specific aquaporin (AQP-9) in the process of osteoclast differentiation: i) AQP-9 is the only aquaporin expressed in osteoclasts and their precursor cell; ii) osteoclast differentiation is associated with a marked increase in AQP-9 expression and finally, iii) inhibition of AQP-9 activity results in inhibition of osteoclast differentiation.

[0081] Most cases of pathological bone loss (such as osteoporosis) results from increased osteoclastic activity, and therefore fighting these diseases usually involve inhibition of osteoclast production and activity. We propose therefore, that inhibiting AQP-9 is expected to inhibit pathological bone loss.

[0082] The effect of phloretin on methylene blue uptake is shown in FIG. 5. No effect was observed on mononuclear precursors (BMMs grown in the absence of RANKL). Methylene blue stains both nuclei and cytoplasm and is a reliable measurement of relative cell numbers when there is no difference in cell size between the examined populations. Thus, phloretin does not inhibit mononuclear cell proliferation and size. In contrast, a marked inhibition of methylene blue uptake was observed in RANKL-treated cells, reflecting the decreased cell size.

Sequence CWU 1

1

24121DNAArtificial sequencePrimer forward derived from Mus musculus Actin, Genebank accession no. NM_007393 1tgagagggaa atcgtgcgtg 21220DNAArtificial sequencePrimer reverse derived from Mus musculus Actin, Genebank accession no. NM_007393 2tgctggaagg 20320DNAArtificial sequencePrimer forward derived from Mus musculus GAPDH, Genebank accession no. BCO20407 3attcaacggc 20420DNAArtificial sequencePrimer reverse derived from Mus musculus GAPDH, Genebank accession no. BCO20407 4aaggtggaag 20520DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-0, Genebank accession no. NM_022026 5gaaacctagc 20620DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-0, Genebank accession no. NM_022026 6attggagtca 20721DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-1, Genebank accession no. NM_007472 7tcgtcttcat cagcattggt 21819DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-1, Genebank accession no. NM_007472 8catgcggtct 19919DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-2, Genebank accession no. NM_009699 9ccttcgagct 191019DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-2, Genebank accession no. NM_009699 10tcttggtcga 191121DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-3, Genebank accession no. NM_016689 11cctctggaca cttggacatg 211221DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-3, Genebank accession no. NM_016689 12cagcttcaca ttctcttcct 211320DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-4, Genebank accession no. NM_009700 13tggctcagaa 201420DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-4, Genebank accession no. NM_009700 14tgtagctccc 201521DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-5, Genebank accession no. NM_009701 15aaggaggtgt gttcagttgc 211621DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-5, Genebank accession no. NM_009701 16cctggtgttg tgttgttgct 211721DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-6, Genebank accession no. NM_175087 17tcgccatcac cttcaatctg 211821DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-6, Genebank accession no. NM_175087 18gaacttccca acaatgacgg 211919DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-7, Genebank accession no. NM_007473 19tggcagctat 192020DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-7, Genebank accession no. 007473 20tgtggtatgc 202120DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-8 Genebank accession no. NM_007474 21ctccgctctc 202220DNAArtificial sequencePrimer reverse derived from Homo sapiens AQP-8, Genebank accession no. NM_007474 22agcctaatga 202320DNAArtificial sequencePrimer forward derived from Homo sapiens AQP-9, Genebank accession no. NM_022026 23ttgtgatggc 202420DNAArtificial sequencePrimer reverse derived from HOMO sapiens AQP-9, Genebank accession no. NM_022026 24cagagttgag 20

* * * * *


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed