U.S. patent application number 14/484646 was filed with the patent office on 2015-03-05 for modulation of osteoclast differentiation.
This patent application is currently assigned to OSTEOBUILD LTD.. The applicant listed for this patent is OSTEOBUILD LTD.. Invention is credited to Refael AHARON, Zvi BAR-SHAVIT.
Application Number | 20150065427 14/484646 |
Document ID | / |
Family ID | 37492359 |
Filed Date | 2015-03-05 |
United States Patent
Application |
20150065427 |
Kind Code |
A1 |
BAR-SHAVIT; Zvi ; et
al. |
March 5, 2015 |
MODULATION OF OSTEOCLAST DIFFERENTIATION
Abstract
Provided are methods for treating a pathological condition
associated with unbalanced osteoclast differentiation by providing
an AQP-9 modulator. The modulator can be an AQP-9 inhibitor or an
AQP-9 inducer. Also provided are methods for modulating osteoclast
differentiation, methods for treating pathological conditions
associated with unbalanced osteoclast differentiation, as well as
pharmaceutical composition including such modulators.
Inventors: |
BAR-SHAVIT; Zvi; (Jerusalem,
IL) ; AHARON; Refael; (Modi'in, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
OSTEOBUILD LTD. |
Jerusalem |
|
IL |
|
|
Assignee: |
OSTEOBUILD LTD.
Jerusalem
IL
|
Family ID: |
37492359 |
Appl. No.: |
14/484646 |
Filed: |
September 12, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11992234 |
Feb 16, 2011 |
8835390 |
|
|
PCT/IL2006/001095 |
Sep 19, 2006 |
|
|
|
14484646 |
|
|
|
|
60717762 |
Sep 19, 2005 |
|
|
|
Current U.S.
Class: |
514/16.8 ;
435/377; 514/685; 530/350; 568/331 |
Current CPC
Class: |
A61P 1/02 20180101; A61P
29/00 20180101; A61P 35/00 20180101; A61K 31/12 20130101; A61K
38/191 20130101; A61P 31/00 20180101; A61P 19/08 20180101; A61P
19/10 20180101; A61P 19/02 20180101 |
Class at
Publication: |
514/16.8 ;
514/685; 568/331; 530/350; 435/377 |
International
Class: |
A61K 38/19 20060101
A61K038/19; A61K 31/12 20060101 A61K031/12 |
Claims
1.-46. (canceled)
47. A method for modulating unbalanced osteoclast differentiation,
comprising: providing osteoclasts, osteoclast precursor cells, or a
mixture thereof, with an amount of an AQP-9 modulator, the amount
of said modulator being effective to affect AQP-9 activity in one
or more of said osteoclast cells and osteoclast precursor
cells.
48. The method according to claim 47, for inhibiting osteoclast
differentiation, comprising: providing said osteoclasts, osteoclast
precursor cells, or mixture thereof, with an amount of an AQP-9
inhibitor, the amount of said inhibitor being effective to reduce
AQP-9 activity in one or more of said osteoclast cells and
osteoclast precursor cells.
49. The method according to claim 48, wherein said osteoclast
precursor cells are mononuclear osteoclast cells.
50. The method according to claim 48, wherein said AQP-9 activity
is affected by reducing or preventing expression of said AQP-9 in
said osteoclast, osteoclast precursor cells, or mixture thereof, or
by blocking said AQP-9 activity in one or more of said osteoclast
cells and osteoclast precursor cells.
51. The method according to claim 48, wherein said AQP-9 inhibitor
is an AQP-9 channel blocker, an AQP 9 expression inhibitor, or an
AQP 9 translation inhibitor.
52. The method according to claim 48, wherein an effect on the
AQP-9 activity is exhibited by one or more of the following
reduction in size of osteoclasts; reduction in number of
osteoclasts; and reduction in number of nuclei in an
osteoclast.
53. The method according to claim 47, wherein said modulator is an
AQP-9 inducer.
54. A method for inducing osteoclast differentiation, comprising:
providing osteoclasts, osteoclast precursor cells, or a mixture
thereof, with an amount of an AQP-9 inducer, the amount of said
inducer being effective to elevate AQP-9 activity in one or more of
said osteoclast cells and osteoclast precursor cells.
55. A method for treating a pathological condition associated with
unbalanced osteoclast differentiation in a subject, comprising:
administering to a subject in need thereof, a pharmaceutical
composition comprising a therapeutically effective amount of an
AQP-9 modulator, the amount of said AQP-9 modultor being effective
to affect AQP-9 activity in unbalanced osteoclasts.
56. The method according to claim 55, wherein said AQP-9 modulator
is an AQP-9 inhibitor.
57. The method according to claim 55, wherein said unbalanced
osteoclast differentiation comprises excessive osteoclast
differentiation.
58. The method according to claim 55, wherein said pathological
condition is associated with bone resorption.
59. The method according to claim 55, wherein said pathological
condition is osteoporosis, an inflammation-associated bone disease,
a cancer-associated bone disease, an infection-associated bone
disease, periodontal disease, or aseptic loosening of prosthetic
implants.
60. The method according to claim 55, wherein said pathological
condition is osteoporosis, osteomyelitis, rheumatoid arthritis, or
Paget's disease.
61. The method according to claim 56, wherein said inhibitor is an
AQP-9 channel blocker or an AQP-9 expression inhibitor.
62. The method according to claim 61, wherein said AQP-9 channel
blocker is phloretin.
63. The method according to claim 55, wherein said AQP-9 modulator
is an AQP-9 inducer.
64. The method according to claim 63, wherein the pathological
condition is associated with osteoclast deficiency.
65. The method according to claim 64, wherein the pathological
condition is associated with overly dense bones.
66. The method according to claim 65, wherein said pathological
condition is osteopetrosis.
67. The method according to claim 55, wherein said AQP-9 modulator
is administered to said subject by injection to said subject's bone
marrow or to the subject's blood stream.
68. The method according to claim 55, wherein said AQP-9 modulator
is orally administered to said subject.
69. A pharmaceutical composition comprising as an active ingredient
an amount of AQP-9 modulator, the amount of said AQP-9 modulator
being effective to affect AQP-9 activity in osteoclast cells or
osteoclast precursor cells.
70. The method according to claim 48, wherein said AQP-9 inhibitor
is an AQP-9 expression inhibitor, or an AQP-9 translation inhibitor
Description
FIELD OF THE INVENTION
[0001] This invention relates to bone remodeling processes and in
particular to osteoclast differentiation.
LIST OF PRIOR ART
[0002] 1. Suda, T., et al. (1999) Endocr. Rev. 20, 345-357; [0003]
2. Teitelbaum, S. L. (2000) Science 289:1504-1508; [0004] 3.
Teitelbaum, S. L., and Ross, F. P. (2003). Nat Rev Genet.
4:638-649; [0005] 4. Lacey, D. L., et. al. (1998) Cell 93:165-176;
[0006] 5. Yasuda, H., et al. (1998). Proc. Natl. Acad. Sci. USA.
95:3597-3602;
BACKGROUND OF THE INVENTION
Aquaporins
[0007] The discovery of aquaporins (water channels) in 1992 by Agre
and colleagues [Preston, G. M., et al. (1992) Science 256, 687-698]
dramatically changed the concept of regulation of water transport
through biological membranes. Aquaporins are .about.30 kDa
tetrameric proteins [King, L. S., et al. (2004) Nat. Rev. Mol.
Cell. Biol. 5, 800-806] characterized by six transmembrane-spanning
helices, and both termini are cytosolic. Aquaporins are expressed
across all organisms and control water transport in all cells
[Maurel, C. (1997) Annu. Rev. Plant Physiol. Plant Mol. Biol. 48,
399-429; Mobasheri, A., et al. (2004) Vet. J. 168, 143-150; Agre,
P., et al. King, L. S (2002) J. Physiol. 1, 3-16]. Eleven mammalian
aquaporins have been identified so far and they have cellular and
subcellular distributions in different organs that indicate
probable functional roles. Studies in animals and humans have
revealed that aquaporins participate in a wide range of
physiological and pathological processes.
Osteoclasts
[0008] Osteoclast is the principal, if not the exclusive,
resorptive cell of bone, playing a central role in the formation,
growth and remodeling of the skeleton. This multinucleated cell is
formed by the fusion of mononuclear progenitors of the
monocyte/macrophage family [Suda, T., et al. (1999) Endocr. Rev.
20, 345-357; Teitelbaum, S. L. (2000) Science 289:1504-1508;
Teitelbaum, S. L., and Ross, F. P. (2003). Nat Rev Genet.
4:638-649]. The differentiation of the osteoclast from its
precursor cells requires the presence of osteoblasts or marrow
stromal cells [Suda, T., (1999) ibid.]. Two factors, macrophage
colony-stimulating factor (M-CSF) and receptor activator of nuclear
factor kappa B (NF-.kappa.B) (RANK) ligand (RANKL), expressed by
the accessory cells are essential and sufficient to promote
osteoclastogenesis [Lacey, D. L., et. al. (1998) Cell 93:165-176;
Yasuda, H., et al. (1998). Proc. Natl. Acad. Sci. USA.
95:3597-3602]. Excessive osteoclastic activity leads to progressive
loss of bone mass causing weakening of the skeleton, manifested by
a variety of pathological conditions such as osteoporosis. Reduced
osteoclast activity results in the formation of overly dense bones,
as found in osteopetrosis. Thus, regulation of osteoclastogenesis
plays an important role in maintaining a healthy skeleton.
SUMMARY OF THE INVENTION
[0009] It has now been shown that a member of the aquaporin
(aquaglyceroporin) family, AQP-9, plays a role in the
differentiation of the bone-resorbing cell, the osteoclast.
Specifically, the present invention is based on the finding that
expression of aquaporin 9 (AQP-9) is increased in osteoclasts and
precursors thereof and that this increased expression leads to
osteoclast differentiation. Further, the invention is based on the
finding that in the presence of an AQP-9 inhibitor, phloretin, the
size or number of osteoclasts or number of nuclei in an osteoclast
is reduced. Thus, it was envisaged by the inventors that AQP-9
inhibitors may have a therapeutic beneficial effect in pathological
conditions associates with osteoclast formation and
differentiation, such as diseases and conditions manifested
excessive bone loss.
[0010] Thus, in accordance with a first of its aspects, the present
invention provides for the use of an aquaprin-9 (AQP-9) modulator
for the preparation of a pharmaceutical composition for treating or
preventing a pathological condition associates with unbalanced
osteoclast differentiation.
[0011] In accordance with one embodiment, the "inhibitory
embodiment", the invention provides the use of an aquaprin-9
(AQP-9) inhibitor for the preparation of a pharmaceutical
composition for treating or preventing a pathological condition
associates with unbalanced osteoclast differentiation.
[0012] In accordance with another embodiment, the "inducing
embodiment", the invention provides the use of an aquaprin-9
(AQP-9) inducer for the preparation of a pharmaceutical composition
for treating or preventing a pathological condition associates with
unbalanced osteoclast differentiation.
[0013] The invention also provides a method for modulating
unbalanced osteoclast differentiation, the method comprising
providing osteoclasts, osteoclast precursor cells or a mixture of
same with an amount of an AQP-9 modulator, the amount of said
modulator being effective to affect AQP-9 activity in said
osteoclast cells or said precursor cells. In accordance with the
inhibitory embodiment, the modulator is an AQP-9 inhibitor for
inhibiting AQP-9 activity, while in accordance with the inducing
embodiment; the modulator is an AQP-9 inducer, for inducing AQP-9
activity.
[0014] In accordance with a third aspect, the present invention
provides a method for treating or preventing in a subject a
pathological condition associates with unbalanced osteoclast
differentiation, the method comprises providing said subject with
an amount an AQP-9 modulator, the amount of said AQP-9 modulator
being effective to affect AQP-9 activity in said unbalanced
osteoclasts. In accordance with the inhibitory embodiment, the
method provides treatment of prevention of a pathological condition
associated with increased osteoclast differentiation, while in
accordance with the inducing embodiment; the method provides
treatment or prevention of a pathological condition associated with
osteoclast deficiency.
[0015] Finally, in accordance with a fourth aspect, the invention
provides a pharmaceutical composition for the treatment of
prevention of a pathological condition associates with unbalanced
osteoclast differentiation, the composition comprising as an active
ingredient an amount of AQP-9 modulator, the amount of said AQP-9
modulator being effective to affect AQP-9 activity in osteoclast
cells or osteoclast precursor cells.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to understand the invention and to see how it may
be carried out in practice, a preferred embodiment will now be
described, by way of non-limiting example only, with reference to
the accompanying drawings, in which:
[0017] FIG. 1 is a bar graph showing the relative expression of
AQP-9 and matrix metalloproteinase-9 (MMP-9) in formed osteoclasts
following treatment with RANKL (+RANKL) as compared to non-treated
precursor (Control, bone marrow not treated with RANKL);
[0018] FIG. 2 is a graph showing the kinetics of induction of AQP-9
and MMP-9 expression during osteoclast differentiation by treatment
with RANKL. Bars represent the standard error of the mean of at
least 4 independent replicates;
[0019] FIG. 3 is a Western blot analysis of AQP-9 in osteoclast
lineage cells using anti-AQP-9 and anti-actin antibodies. Two
independent samples are presented;
[0020] FIGS. 4A-4D are images showing the modulation of osteoclast
differentiation by phloretin, following treatment with RANKL (FIGS.
4B and 4D) or without RANKL (FIGS. 4A and 4C) and with 50 .mu.M
phloretin (FIGS. 4C and 4D) or without phloretin (FIGS. 4A and
4D);
[0021] FIG. 5 is bar graph showing the effect of phloretin on
methylene blue (MB) uptake in bone marrow cells in the presence or
absence of RANKL.
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0022] The differentiation of the osteoclast includes fusion of
mononuclear precursors to form the multinucleated osteoclast. Upon
fusion of the precursors, the volume of the mature osteoclast
increases more dramatically than its surface, resulting in the
addition of new cytosol into the cells. Water, being the major
cytosolic component led to the understanding that aquaporin(s) are
associated with the enhanced water influx.
[0023] The inventors have found that following induction of RANKL,
a ligand associated with osteoclast differentiation, there was an
increased expression AQP-9 and that this increase in expression
precedes osteoclast precursor fusion. This finding led to the
understanding that the water channel plays a role in the formation
of a large multinucleated osteoclast, probably, by mediating rapid
water influx to enable the increase in cell volume and that
preventing this rapid water influx may inhibit osteoclast formation
or lead to the dehydration of osteoclasts which is followed by a
decrease in their size, thereby preventing uncontrolled effects of
osteoclast formation.
[0024] Thus, in its broadest aspect, the present invention concerns
the use of one or more modulators of the AQP-9 for the preparation
of a pharmaceutical composition for treating or preventing a
pathological condition associates with unbalanced osteoclast
differentiation. As appreciated, while the invention is described
in the following detailed description with reference to the above
use, it is to be understood that also encompassed within the
present invention methods for modulating osteoclast differentiation
making use of the AQP-9 modulator; methods of treating or
preventing a pathological condition comprising providing a subject
in need of treatment an amount of the modulator; as well as
pharmaceutical compositions comprising as the active principle
ingredient (API) AQP-9 modulator.
[0025] For the purpose of understanding the invention the following
terms are used and should be understood as comprising the indicated
meaning:
[0026] AQP-9 modulator--Aquaporins (AQPs) are membrane water
channels that play critical roles in controlling the water contents
of cells. More than eleven different AQPs have been found in human
body, and several diseases, and are sequentially numbered as AQP-0
to AQP-9. Thus, the term "AQP-9 modulator" is used herein to denote
any agent, being a polymeric substance, of high or medium (e.g.
oligomer) molecular weight, or a small molecular weight compound
which has a statistically significant affect the water/glycerol
transferring activity of the AQP-9 channel in a treated experiment
(i.e. either in vivo or in vitro) as compared to the untreated
control. The effect on AQP-9 channel activity may be exhibited by a
change in osteoclast formation/differentiation in the treated
experiment, which may be determined by measuring a change in one or
more member of the following parameters: number of formed
osteoclasts, size of formed osteoclasts, and number of nuclei in an
osteoclast in a treated experiment. The change may be an increase
or a decrease in one or more of said parameters. It is noted that
when the effect comprises a decrease in number or size, it does not
necessarily mean complete abolishment of any formation, or growth
in size or number of nuclei.
[0027] AQP-9 inhibition or AQP-9 inhibitor--refers to any agent as
defined above, wherein the modulation is exhibited by a
statistically significant decrease in the water/glycerol
transferring activity of the aqauproin-9 channel as compared to an
untreated control. This term does not necessarily mean abolishment
of the AQP-9 activity.
[0028] AQP-9 channel blockers--refers to any agent that may block
directly the channel and thus prevent or decrease its
water/glycerol transferring properties. Examples of such agents are
phloretin (2',4',6-Trihydroxy-3-(4-hydroxyphenyl)-propiophenone,
mercury, cytoskeletal inhibitors were shown to play a role in
insertion of AQP-2 to membranes and the microtubular network has
been implicated in this process. Both vanadate, a rather
nonspecific inhibitor of ATPases, and
erythro-9(3-(2-hydroxynonyl))adenine, a relatively specific
inhibitor of dynein, inhibit the antidiuretic response in toad
bladder (All inhibitors cited from: J Am Soc Nephrol 10:647-663,
1999); silver and gold compounds (FEBS Lett. 2002 Nov. 20;531(3):
443-7.).
[0029] Antibodies from circulating blood may be directed to the
active site of AQP-9 (i.e. to the protein's loops that are exposed
at the surface of the cell).
[0030] AQP-9 expression/translation reducing agents--refers to any
agent that may affect AQP-9 activity by reducing the expression of
the AQP-9 gene (for example by using antisense to the gene or
antisense to the mRNA); by decreasing the amount of mRNA available
for translation (by using siRNA against the mRNA; by using
ribozymes capable of specifically degrading the AQP-9 mRNA, by
using microRNA). In all the above "expression reducing agents", the
agents may be administered to the cells directly ("naked" siRNA
etc) or may be introduced into the cells together with transfection
agents. The "expression reducing agents" may also be introduced
into the cells via expression vectors enabling their expression and
production inside the cell.
[0031] AQP-9 induction or AQP-9 inducer--refers to any agent as
defined above, wherein the modulation is exhibited by a
statistically significant increase in the water/glycerol
transferring activity of the aqauproin-9 channel as compared to an
untreated control.
[0032] Osteoclast differentiation--which may be used
interchangeably with the term "osteoclast formation" refers to the
process osteoclast precursor (progenitor) cells are recruited from
haematopoietic compartments, and then proliferate and differentiate
toward mature osteoclasts. During this multi-step differentiation
process postmitotic osteoclast precursors progressively express
osteoclast-associated markers, such as cathepsin-K, MMP-9,
calcitonin receptor and tartrate-resistant acid phosphatase (TRAP),
while, losing some of their macrophage characteristics. Then,
mononuclear preosteoclasts fuse together to form multinucleated
giant cells. Terminal osteoclast differentiation eventually leads
to active bone-resorbing cells. Once formed, the osteoclast may be
referred to as large osteoclasts which are typically those
characterized by a plurality of nuclei (up to several dozens) or
small osteoclasts containing few nuclei (as few as three).
[0033] Unbalanced osteoclast differentiation--refers to a condition
of unbalanced bone remodelling in which bone resorption is followed
by new bone formation, thereby maintaining mechanical strength and
structure of an adults skeleton. This process couples the balanced
formation of osteoclasts which are known as the bone-resorbing
cells and osteoblasts, known as the bone-forming cells (which are
of mesenchymal origin). Thus, the term "unbalanced osteoclast
differentiation" denotes any condition where this delicate balance
between osteoclasts and osteoblasts formation is disrupted. Such
disruption may results either in an undesired increase or in an
undesired decrease in the number and/or size osteoclasts as well as
to an increase or decrease in the number of nuclei in an
osteoclast.
[0034] Treatment or prevention--and the like are used herein to
refer to obtaining a desired pharmacological and physiological
effect. The effect may be prophylactic in terms of preventing or
partially preventing a disease, symptom or pathological condition
and/or may be therapeutic in terms of a partial or complete cure of
a disease, condition, symptom or adverse effect attributed to a
pathological condition. Thus, "treatment" covers any treatment of a
disease in a mammal, particularly a human, and includes: (a)
preventing a pathological condition from occurring in an individual
which may be predisposed to develop a pathological condition but
has not yet been diagnosed as having it, i.e., causing the clinical
symptoms of a pathological condition not to develop in a subject
that may be predisposed to develop the condition but does not yet
experience or display symptoms of the condition; (b) inhibiting,
i.e., arresting or reducing the development of the pathological
condition or its clinical symptoms; or (c) relieving symptoms
associating with the pathological condition
[0035] The term "pathological condition" used herein denotes any
condition which is associated with unbalanced osteoclast formation
and differentiation, which requires for improving the well-being of
the subject the delivery of an AQP-9 modulator (being an inhibitor
or an inducer thereof, as defined hereinbefore). This includes,
inter alia, any condition which requires the reduction or induction
of osteoclast formation/differentiation so as to affect the process
of bone formation in said subject. In accordance with one aspect of
the invention, the pathological condition is associated with the
formation/differentiation of osteoclasts at a rate which is higher
than the rate of osteoblast formation (i.e. an increased osteoclast
formation). Such an increased osteoclast formation may lead to
excessive bone resorption. In accordance with another aspect of the
invention, the pathological condition is associated with the
formation/differentiation of osteoclasts at a rate which is lower
than the rate of osteoblast formation (i.e. a reduced osteoclast
formation). Reduced osteoclast formation may lead to overly dense
bone.
[0036] As indicated above, the AQP-9 modulator may be an AQP-9
inhibitor or AQP-9 inducer.
[0037] In accordance with the inhibitory embodiment, AQP-9
inhibitor may be an AQP-9 channel blocker, an AQP-9 expression
inhibitor, an AQP-9 translation inhibitor, or activity blocking
antibody, modified or non-modified AQP-9 like proteins. One
non-limiting example of an AQP-9 channel blocker is phloretin or a
functional derivative thereof (e.g. a chemical derivative of
phloretin that has essentially a similar inhibitory effect on
AQP-9).
[0038] The AQP-9 inhibitor may be used for preparing a
pharmaceutical composition for the treatment or prevention of a
pathological condition associated with excessive bone resorption. A
non-limiting list of conditions known to be involved with excessive
bone resorption include, without being limited thereto,
osteoporosis, an inflammation-associated bone disease, a
cancer-associated bone disease, an infection-associated bone
disease, periodontal disease, Paget's disease.
[0039] Osteoporosis is characterized by a reduction in bone mass
and deterioration in bone architecture. The most common cause of
osteoporosis in women is loss of estrogen, which occurs at
menopause. The increase in bone loss is mediated by an increase in
osteoclast number and size. Current therapies for osteoporosis
include estrogen and Selective Estrogen Receptor Modulators
(SERMs), which inhibit osteoclast differentiation, and
bisphosphonates, which inhibit osteoclastic bone resorption.
[0040] Rheumatoid arthritis (RA) is a chronic inflammatory disease
characterized by focal regions of subchondral osteoclastic bone
resorption. Subjects having RA are at risk for development of a
generalized form of bone loss. Macrophages, which are capable of
differentiating into osteoclasts, accuinulate in the rheumatoid
synovial membrane in the inflammatory state. Human synovial
fibroblasts and T-cells, which have been shown to express RANKL,
are also present in the rheumatoid joint. T-cells from rheumatoid
patients are capable of supporting osteoclast differentiation from
hematopoietic cells without the participation of other cells.
[0041] Cancer-associated bone diseases which may be understood
interchangeably with the term malignant bone diseases may be any
pathological condition involved with hyperproliferation and which
are manifested in associateion with AQP-9 activity, such as,
without being limited thereto, multiple myeloma, immoral
hypercalcemia of malignancy, and tumor metastasis, all of which are
currently treated with inhibitors of bone resorption.
Bisphosphonates, which inhibit osteoclastic bone resorption, have
been shown to decrease skeletal events in patients with multiple
myeloma and those with bone metastases from breast cancer, as well
as correcting hypercalcemia in cancer.
[0042] Infection associated bone diseases refer to any pathological
condition where an infection causes unbalanced osteoclast or
osteoblast differentiation. A non-limiting example is osteomyelitis
which is an acute or chronic inflammatory process of the bone and
its structures secondary to infection with pyogenic organisms. The
infection associated with osteomyelitis may be localized or it may
spread through the periosteum, cortex, marrow, and cancellous
tissue. The bacterial pathogen varies on the basis of the patient's
age and the mechanism of infection.
[0043] Periodontal disease in humans is characterized by alveolar
bone destruction and tooth loss. Periodontitis is implicated in the
increased risk of systemic diseases such as heart failure, stroke
and bacterial pneumonia. Bacterial infections and their associated
immunological response contribute to the bone loss associated with
periodontitis. However, the mechanisms behind this disorder are not
clearly understood. This term should be understood to also include
aseptic loosening of prosthetic implants and the like.
[0044] Paget's disease of bone is characterized by local regions of
increased osteoclast numbers and activity. The increase in bone
resorption is compensated by an increase in bone formation and
local bone turnover; however, the newly formed bone is abnormally
weak and prone to fracture or bowing. Bisphosphonates and
calcitonin are used clinically to treat the increased bone
resorption in Paget's disease.
[0045] The AQP-9 inducer may be used for the preparation of a
pharmaceutical composition for the treatment or prevention of a
pathological condition associated with osteoclast deficiency which
may result in overly dense bones. Without being limited thereto, an
example of such a condition is osteopetrosis, which is an inherited
disorder, characterized by an increase in bone density. In severe
forms the bone marrow cavity may be obliterated. Long-term therapy
with interferon gamma has been shown to increase bone resorption
and hematopoiesis and improves leukocyte function.
[0046] The invention also concerns a method of modulating
unbalanced osteoclast differentiation. The method comprising
providing osteoclasts (large and/or small), osteoclast precursor
(progenitor) cells or a mixture of same with an amount of an AQP-9
modulator, the amount of said modulator being effective to affect
AQP-9 activity in said osteoclast cells or said precursor
cells.
[0047] The method of the invention may be performed in vitro, e.g.
for research purposes, or in vivo, for therapeutic purposes. An
effect on the AQP-9 activity may be exhibited by measuring a change
in one or more of the following parameters: [0048] in size of
osteoclasts; [0049] in number of osteoclasts; and [0050] in number
of nuclei in a osteoclast;
[0051] When the AQP-9 modulator is an AQP-9 channel blocker, it
preferable that the blocker is selectively introduced to the bone
marrow of a treated subject. This can be performed by choosing
injection to the blood stream or direct administration to the
marrow, or by oral administration. The modulator may be conjugated
or complexed to targeting moieties which selectively target
osteoclast precursors /osteoclasts.
[0052] When a subject is to be treated with an AQP-9 expression
reducing or translation inhibiting agents it is preferable that the
latter is either targeted to the bone marrow, either by the direct
administration to the bone marrow or by complexing/conjugation the
expression reducing agent, or the respective expression vectors, to
chemical entities capable of selectively targeting osteoclast
precursors or against osteoclasts.
[0053] Examples of such targeting agents are either antibodies to
the marker CD11b (Fujikawa Y, Sabokbar A, Neale S, Athanasou N A.
1996. Human osteoclast formation and bone resorption by monocytes
and synovial macrophages in rheumatoid arthritis. Ann Rheum Dis.
55:816-822) or CD14 (Husheem M, Nyman J K, Vaaraniemi J, Vaananen H
K, Hentunen T A. 2005. Characterization of circulating human
osteoclast progenitors: development of in vitro resorption assay.
Calcif Tissue Int. 76:222-230)
[0054] Another option is chemical entities such as antibodies that
bind to osteoclasts themselves which will prevent the formation of
larger osteoclasts. Preferably these are agents which bind
osteoclast markers such as antibodies against .alpha.v.uparw.3.
[0055] By another option the selectivity to the osteoclast
precursors may be not by the administration/targeting but rather by
placing the sequences coding for the AQP-9 expression-reducing
agent (such as antisense, siRNS. Ribozyme) under the expression
control of a promoter that is selectively in osteoclast precursors
such as the TRAP or cathepsin K promoters.
[0056] When administered a subject, it is preferable that the AQP-9
modulator is formulated together with a pharmaceutically and
physiologically acceptable carrier to form an appropriate
pharmaceutical composition. The amount of the AQP-9 modulator
within the composition is such that a therapeutic effect is
manifested (so as to treat or prevent a pathological condition
associates with unbalanced osteoclasts formation). To this end, the
subject in need of treatment is administered with an amount of the
AQP-9 modulator, the amount of said AQP-9 modulator being effective
to affect AQP-9 activity in said unbalanced osteoclasts.
[0057] A pharmaceutically and physiologically acceptable carrier
refers to any excipient that is useful in preparing a
pharmaceutical composition or formulation that is generally safe,
non-toxic and neither biologically nor otherwise undesirable, and
includes a carrier that is acceptable for veterinary use as well as
human pharmaceutical use. The carrier may at times have the effect
of the improving the delivery or penetration of the AQP-9 modulator
to the target cell, for improving the stability of the modulator,
for slowing clearance rates, for imparting slow release properties,
for reducing undesired side effects etc. The carrier may also be a
substance that stabilizes the composition (e.g. a preservative),
for providing the composition with an edible flavor, etc. The
carrier will be selected based on the desired form of the
composition and the modulator to be included therein. For examples
of carriers, stabilizers and adjuvants, see E. W. Martin,
REMINGTON'S PHARMACEUTICAL SCIENCES, MacK Pub Co (June, 1990).
[0058] In accordance with one embodiment of the invention, the
carrier is suitable for administration of the AQP-9 modulator by
injection.
[0059] In accordance with another embodiment, the carrier is
suitable for formulating the AQP-9 modulator in a form suitable for
oral intake. The carrier may be a pharmaceutical carrier or a
neutraceutical carrier (so as to provide the modulator as a food
supplement).
[0060] An effective amount of the modulator may be determined by
any consideration known to those versed in the art. The amount of
the modulator (the inhibitor or inducer) effective to achieve a
desired therapeutic result, i.e. treatment of a pathological
condition or prevention of same from development, may be varied or
adjusted, depending upon the particular application, the delivery
system (formulation) of the modulator, the release profile of the
modulator from said system, the delivery route, the potency of the
particular modulator, and the desired concentration at the treated
site, etc. The effective amount is typically determined in
appropriately designed clinical trials (dose range studies) and the
person versed in the art will know how to properly conduct such
trials in order to determine the effective amount. As generally
known, an effective amount depends on a variety of factors
including the affinity of the modulator to a target site, the
selection of delivery system, the distribution profile of the
modulator within the body after being administered, a variety of
pharmacological parameters such as half life in the body, on
undesired side effects, if any, and on other factors such as age
and gender of the treated subject, etc.
[0061] The pharmaceutical composition comprising the AQP-9
modulator may be administered over an extended period of time in a
single daily dose, several doses a day, or on each consecutive day
and the like. The treatment period will generally have a length
proportional to the length of the disease process and the specific
modulator effectiveness and the patient species being treated, all
as being appreciated by those versed in the art.
[0062] As used herein, the forms "a", "an" and "the" include
singular as well as plural references unless the context clearly
dictates otherwise. For example, the term "an AQP-9 modulator"
includes one or more agents which are capable of specifically
affecting AQP-9 activity, thereby fully or partially affecting
water/glycerol transport osteoclast influx.
[0063] Further, as used herein, the term "comprising" is intended
to mean that the composition include the recited API, i.e. AQP-9
modulator, but not excluding other elements, such as
physiologically acceptable carriers and excipients as well as other
active agents. The term "consisting essentially of" is used to
define compositions which include the recited elements but exclude
other elements that may have an essential significance on bone
modeling (osteoclast formation). "consisting of" shall thus mean
excluding more than trace elements of other elements. Embodiments
defined by each of these transition terms are within the scope of
this invention.
[0064] Further, all numerical values, e.g. when referring the
amounts or ranges of the elements constituting the composition
comprising the AQP-9 modulator as an active ingredient, are
approximations which are varied (+) or (-) by up to 20%, at times
by up to 10% of from the stated values. It is to be understood,
even if not always explicitly stated that all numerical
designations are preceded by the term "about".
[0065] The invention will now be exemplified in the following
description of experiments that were carried out in accordance with
the invention. It is to be understood that these examples are
intended to be in the nature of illustration rather than of
limitation. Obviously, many modifications and variations of these
examples are possible in light of the above teaching. It is
therefore, to be understood that within the scope of the appended
claims, the invention may be practiced otherwise, in a myriad of
possible ways, than as specifically described hereinbelow.
Non-Limiting Exemplary Embodiments
Cells
[0066] Bone marrow cells (BMMs) were prepared from the long bones
of 7-9 week old BALB/c male mice. Primary BMMs were prepared by
flushing mouse femurs and tibias with .alpha.-MEM. Cells were
cultured in Petri dishes, in complete .alpha.-MEM, supplemented
with 10% CMG14-12 culture supernatant, which served as a source of
M-CSF. After 3 days of culture, plates were washed 3 to 4 times
with PBS to remove non-adherent cells. Adherent cells were removed
with trypsin-EDTA solution, centrifuged and resuspended in a fresh
medium. Murine macrophage-like RAW264.7 cell line was maintained in
RPMI 1640 medium supplemented with 10% fetal calf serum (FCS) in
the presence of antibiotics (penicillin and streptomycin). Cells
were cultured at 37.degree. C. incubator in a humidified atmosphere
with 5% CO.sub.2, and media were changed every other day. BMMs
(7.times.10.sup.3/well in .alpha.-MEM containing 10% FCS and
supernatant from CMG14-12 [1:20]) or RAW264.7 cells
(3.times.10.sup.3/well in RPMI-1640 containing 10% FCS) were
incubated in 96-well plates (0.2 ml/well). To induce cells to
differentiate into osteoclasts, bacterially-produced recombinant
RANKL was added at the time of plating. On day 3, medium was
changed and on day 5, osteoclast formation was evaluated (see
below).
Tartrate-Resistant Acid Phosphatase (TRAP)
[0067] A commercial kit (Cat. No. 387-A, Sigma) was used according
to the manufacturer instructions. TRAP-positive cells containing
three or more nuclei were scored as osteoclasts.
RNA Extraction and cDNA Preparation
[0068] BMMs (2.5.times.10.sup.5/plate) and RAW 264.7 cells
(1.3.times.10.sup.5/plate) were plated in 35-mm tissue culture
plates as described before [Amcheslaysky, A., and Bar-Shavit, Z.
(2006) J. Cell. Physiol. 207, 244-250]. Total cellular RNA was
isolated using EZ-RNA kit (Biological Industries Co., Beit Haemek,
Israel) according to the manufacturer's instructions. For RT-PCR,
RNA was purified using a DNA-free RNA kit (Zymo Research). The RNA
was treated with DNase (RQ1-RNase-free DNase, Promega Corporation,
USA) and tested for being essentially DNA-free by a PCR reaction as
a negative control. First-strand cDNA was synthesized from 1 .mu.g
of total RNA using the Superscript II pre-amplification system
(Gibco BRL Life Technologies, UK) according to the manufacturer's
instructions. Aquaporins primers sequences and Tm temperature for
each gene are shown in Table 1.
TABLE-US-00001 TABLE 1 Primers used for the semi-quantitative
RT-PCR analysis Gene Genebank name Primer Forward Primer Reverse
Tm.degree. NM 007393 Actin TGAGAGGGAAATCGTGCGTGA (SEQ ID NO. 1)
TGCTGGAAGGTGGACAGTGA (SEQ ID NO: 2) 60.0 BC020407 GAPDH
ATTCAACGGCACAGTCAAGG (SEQ ID NO: 3) AAGGTGGAAGAGTGGGAGTT (SEQ ID
NO: 4) 57.7 NM022026 AQP-0 GAAACCTAGCGCTCAACACG (SEQ ID NO: 5)
ATTGGAGTCACTGGGTCTGG (SEQ ID NO: 6) 58.7 NM007472 AQP-1
TCGTCTTCATCAGCATTGGTT (SEQ ID NO: 7) CATGCGGTCTGTGAAGTCG (SEQ ID
NO: 8) 57.8 NM 009699 AQP-2 CCTTCGAGCTGCCTTCTAC (SEQ ID NO: 9)
TCTTGGTCGAGGGGAACAG (SEQ ID NO: 10)) 57.2 NM016689 AQP-3
CCTCTGGACACTTGGACATGG (SEQ ID NO: 11) CAGCTTCACATTCTCTTCCTC (SEQ ID
NO: 12) 58.1 NM009700 AQP-4 TGGCTCAGAAAACCCCTTAC (SEQ ID NO: 13)
TGTAGCTCCCTTTTGTCTGC (SEQ ID NO: 14) 56.8 NM009701 AQP-5
AAGGAGGTGTGTTCAGTTGCC (SEQ ID NO: 15) CCTGGTGTTGTGTTGTTGCTG (SEQ ID
NO: 16) 60.0 NM175087 AQP-6 TCGCCATCACCTTCAATCTGG (SEQ ID NO: 17)
GAACTTCCCAACAATGACGGC (SEQ ID NO: 18) 59.9 NM007473 AQP-7
TGGCAGCTATCTCGGTGTC (SEQ ID NO: 19) TGTGGTATGCTGGGGTGAAT (SEQ ID
NO: 20) 58.1 NM007474 AQP-8 CTCCGCTCTCTTCATCTTCA (SEQ ID NO: 21)
AGCCTAATGAGCAGTCCTAC (SEQ ID NO: 22) 55.9 NM022026 AQP-9
TTGTGATGGCTCTTTATGCG (SEQ ID NO: 23) CAGAGTTGAGTCCGAGAGAA (SEQ ID
NO: 24) 55.6
Real-Time PCR (RT-PCR)
[0069] Primers and probes for the AQP-9, GAPDH, L-32, and MMP9
genes were all Assays-on-Demand products from Applied Biosystems
and reactions were set up according to the manufacturer's
instructions. Real time PCR was performed in triplicates in 25
.mu.l reactions on the ABI Prism 7000 Sequence Detection System.
The relative level of each mRNA was determined using the
comparative C.sub.T method for relative quantification using L-32
as an endogenous reference.
Western Blotting
[0070] BMMs (7.5.times.10.sup.5/35 mm tissue culture plate) and RAW
264.7 cells (1.3.times.10.sup.5/plate) were plated in 35-mm tissue
culture plates as described before [Amcheslaysky, A, (2006),
ibid.]. Whole cell lysates were prepared by direct lysis in 200
.mu.l of lysis buffer (10 mM of Tris-HCl, pH 7.4, 150 mM of NaCl, 1
mM of EDTA, 1% Triton X-100, and protease inhibitors [10 ng/ml of
aprotinin (Sigma), 10 ng/ml of leupeptin (Sigma), and 50 mM of
4(2-aminoethyl)benzensulfonyl fluoride (AEBSF; Sigma)). 80 .mu.g of
lysates were loaded onto 12.5% SDS-polyacrylamide gels. Proteins
were transferred onto a nitro-cellulose membrane (Millipore
Corporation, Bedford, Mass.) and processed for western blotting.
Antibodies were used at the following dilutions: chicken anti-AQP-9
antibody (1:1000, Alpha diagnostic, USA), mouse anti .beta.-actin
antibody (1:10000, Alpha diagnostic, USA), goat anti-mouse antibody
conjugated to horseradish peroxidase (1:10000, Alpha diagnostic,
USA), rabbit anti-chicken antibody conjugated to horseradish
peroxidase (1:10000). Immunoreactivity was assayed using an ECL
chemiluminescence kit (Pierce Biotechnology, Inc., Rockford, Ill.)
according to the manufacturer's instructions.
Surface Area Measurements
[0071] The surface area occupied by osteoclasts and their
precursors was quantified using a computerized image analysis
system (Olympus BX50, DP50, software: ImagePro Plus, Media
Cybernetics).
Methylene Blue Uptake
[0072] Cells were seeded as for the osteoclast differentiation
assay (see above). Monolayers were fixed and methylene blue uptake
was measured as described [Goldman, R., and Bar-Shavit, Z. (1979)
J. Natl. Cancer Inst. 63, 1009-1016].
Data Analysis
[0073] All experiments were repeated at least twice, and each
experimental treatment was performed with six replications, unless
stated otherwise. Data were analyzed with the JMP statistics
package (version 4.1, from SAS Institute Inc., Cary, N.C. 27513
USA).
EXAMPLE 1
Aquaporin Expression in Osteoclasts
[0074] Using semi-quantitative PCR we measured the expression of
aquaporins in osteoclast lineage cells (Table 2). We found that out
of 10 aquaporin genes examined, only aquaporin-9 (AQP-9), an
aqua-glycerol channel was expressed in osteoclasts and their
precursors. RNA preparations obtained from kidney and eye were used
as positive controls for certain aquaporins.
TABLE-US-00002 TABLE 2 Expression of aquaporins in various mouse
cells and tissues RAW264.7 Bone marrow Kidney Eye AQP-1 - - - - + +
AQP-2 - - - - + - AQP-3 - - - - + + AQP-4 - - - - + - AQP-5 - - - -
- n.d. AQP-6 - - - - + n.d. AQP-7 - - - - + n.d. AQP-8 - - - - +
n.d. AQP-9 + + + + + - AQP-0 - - - - - + + denotes the presence of
RANKL; - denotes the absence of RANKL; n.d. denotes not
determined
EXAMPLE 2
Increase in AQP-9 Expression in Differentiated Osteoclasts
[0075] The expression of AQP-9 mRNA (using real time PCR) in
osteoclasts and in their precursors (FIG. 1) was compared. A
dramatic increase in AQP-9 expression was exhibited in osteoclast
as compared to the precursors. MMP-9 is served as a marker for the
osteoclastic differentiation. Detailed kinetic studies (FIG. 2) of
the increase in AQP-9 and MMP-9 expression in response to RANKL
showed that the increase in AQP-9 precedes the increase in
MMP-9.
[0076] Using specific anti-AQP-9-antibodies (FIG. 3) and western
blotting it was shown that the protein expression is greater in
osteoclasts (RANKL-treated cells) than in their precursors.
EXAMPLE 3
Aquaporin 9 Activity in Osteoclast Differentiation
[0077] In the following assay the significance of the activity of
AQP-9 to osteoclast differentiation was determined. To this end,
the effect of the AQP-9 inhibitor phloretin
(2',4',6'-Trihydroxy-3-(4-hydroxyphenyl)-propiophenone on
RANKL-induced osteoclast differentiation was examined. Cells were
incubated with RANKL for 5 days, and phloretin was added for the
last day, when most fusion occurs. (Phloretin stock solution is in
DMSO, and therefore DMSO at the amount comparable to the phloretin
containing wells was added to the control cultures). A dramatic
reduction in osteoclast number (FIG. 4A-4D), and size (FIGS. 4A-4D,
Table 3) were observed in cultures containing phloretin.
[0078] The inhibitor did not exhibit a significant effect on number
(FIG. 4A-4D), and size (FIGS. 4A-4D, right and Table 3) of the
mononuclear precursors in cells not treated with RANKL.
TABLE-US-00003 TABLE 3 The effect of phloretin on osteoclast
lineage cells size (.mu.m.sup.2) -RANKL +RANKL Control 255 .+-. 5
236323 .+-. 6170 Phloretin 267 .+-. 6 23722 .+-. 4351
[0079] (Bars represent the standard error of the mean of at least
50 cells per treatment)
[0080] The above results demonstrated for the first time the
involvement of a specific aquaporin (AQP-9) in the process of
osteoclast differentiation: i) AQP-9 is the only aquaporin
expressed in osteoclasts and their precursor cell; ii) osteoclast
differentiation is associated with a marked increase in AQP-9
expression and finally, iii) inhibition of AQP-9 activity results
in inhibition of osteoclast differentiation.
[0081] Most cases of pathological bone loss (such as osteoporosis)
results from increased osteoclastic activity, and therefore
fighting these diseases usually involve inhibition of osteoclast
production and activity. We propose therefore, that inhibiting
AQP-9 is expected to inhibit pathological bone loss.
[0082] The effect of phloretin on methylene blue uptake is shown in
FIG. 5. No effect was observed on mononuclear precursors (BMMs
grown in the absence of RANKL). Methylene blue stains both nuclei
and cytoplasm and is a reliable measurement of relative cell
numbers when there is no difference in cell size between the
examined populations. Thus, phloretin does not inhibit mononuclear
cell proliferation and size. In contrast, a marked inhibition of
methylene blue uptake was observed in RANKL-treated cells,
reflecting the decreased cell size.
Sequence CWU 1
1
24121DNAArtificial sequencePrimer forward derived from Mus musculus
Actin, Genebank accession no. NM_007393 1tgagagggaa atcgtgcgtg
21220DNAArtificial sequencePrimer reverse derived from Mus musculus
Actin, Genebank accession no. NM_007393 2tgctggaagg
20320DNAArtificial sequencePrimer forward derived from Mus musculus
GAPDH, Genebank accession no. BCO20407 3attcaacggc
20420DNAArtificial sequencePrimer reverse derived from Mus musculus
GAPDH, Genebank accession no. BCO20407 4aaggtggaag
20520DNAArtificial sequencePrimer forward derived from Homo sapiens
AQP-0, Genebank accession no. NM_022026 5gaaacctagc
20620DNAArtificial sequencePrimer reverse derived from Homo sapiens
AQP-0, Genebank accession no. NM_022026 6attggagtca
20721DNAArtificial sequencePrimer forward derived from Homo sapiens
AQP-1, Genebank accession no. NM_007472 7tcgtcttcat cagcattggt
21819DNAArtificial sequencePrimer reverse derived from Homo sapiens
AQP-1, Genebank accession no. NM_007472 8catgcggtct
19919DNAArtificial sequencePrimer forward derived from Homo sapiens
AQP-2, Genebank accession no. NM_009699 9ccttcgagct
191019DNAArtificial sequencePrimer reverse derived from Homo
sapiens AQP-2, Genebank accession no. NM_009699 10tcttggtcga
191121DNAArtificial sequencePrimer forward derived from Homo
sapiens AQP-3, Genebank accession no. NM_016689 11cctctggaca
cttggacatg 211221DNAArtificial sequencePrimer reverse derived from
Homo sapiens AQP-3, Genebank accession no. NM_016689 12cagcttcaca
ttctcttcct 211320DNAArtificial sequencePrimer forward derived from
Homo sapiens AQP-4, Genebank accession no. NM_009700 13tggctcagaa
201420DNAArtificial sequencePrimer reverse derived from Homo
sapiens AQP-4, Genebank accession no. NM_009700 14tgtagctccc
201521DNAArtificial sequencePrimer forward derived from Homo
sapiens AQP-5, Genebank accession no. NM_009701 15aaggaggtgt
gttcagttgc 211621DNAArtificial sequencePrimer reverse derived from
Homo sapiens AQP-5, Genebank accession no. NM_009701 16cctggtgttg
tgttgttgct 211721DNAArtificial sequencePrimer forward derived from
Homo sapiens AQP-6, Genebank accession no. NM_175087 17tcgccatcac
cttcaatctg 211821DNAArtificial sequencePrimer reverse derived from
Homo sapiens AQP-6, Genebank accession no. NM_175087 18gaacttccca
acaatgacgg 211919DNAArtificial sequencePrimer forward derived from
Homo sapiens AQP-7, Genebank accession no. NM_007473 19tggcagctat
192020DNAArtificial sequencePrimer reverse derived from Homo
sapiens AQP-7, Genebank accession no. 007473 20tgtggtatgc
202120DNAArtificial sequencePrimer forward derived from Homo
sapiens AQP-8 Genebank accession no. NM_007474 21ctccgctctc
202220DNAArtificial sequencePrimer reverse derived from Homo
sapiens AQP-8, Genebank accession no. NM_007474 22agcctaatga
202320DNAArtificial sequencePrimer forward derived from Homo
sapiens AQP-9, Genebank accession no. NM_022026 23ttgtgatggc
202420DNAArtificial sequencePrimer reverse derived from HOMO
sapiens AQP-9, Genebank accession no. NM_022026 24cagagttgag 20
* * * * *