U.S. patent application number 14/279235 was filed with the patent office on 2015-02-19 for methods and reagents for treatment and diagnosis of vascular disorders and age-related macular degeneration.
This patent application is currently assigned to University of Iowa Research Foundation. The applicant listed for this patent is University of Iowa Research Foundation. Invention is credited to Gregory S. Hageman.
Application Number | 20150050646 14/279235 |
Document ID | / |
Family ID | 38924245 |
Filed Date | 2015-02-19 |
United States Patent
Application |
20150050646 |
Kind Code |
A1 |
Hageman; Gregory S. |
February 19, 2015 |
Methods and Reagents for Treatment and Diagnosis of Vascular
Disorders and Age-Related Macular Degeneration
Abstract
Disclosed are screening methods for determining a human
subject's propensity to develop a vascular disorder and/or
age-related macular degeneration (AMD), therapeutic or prophylactic
compounds for treating disease or inhibiting its development, and
methods of treating patients to alleviate symptoms of the disease,
prevent or delay its onset, or inhibit its progression. The
inventions are based on the discovery that persons with a genome
having a deletion of the CFHR-1 and/or CFHR-3 gene, which normally
lie on human chromosome 1 between DNA encoding CFH and CFHR-4, are
at reduced risk of developing AMD, and elevated risk of developing
vascular disease such as aneurysm.
Inventors: |
Hageman; Gregory S.; (Salt
Lake City, UT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Iowa Research Foundation |
Iowa City |
IA |
US |
|
|
Assignee: |
University of Iowa Research
Foundation
Iowa City
IA
|
Family ID: |
38924245 |
Appl. No.: |
14/279235 |
Filed: |
May 15, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12954425 |
Nov 24, 2010 |
|
|
|
14279235 |
|
|
|
|
11894667 |
Aug 20, 2007 |
7867727 |
|
|
12954425 |
|
|
|
|
PCT/US07/73514 |
Jul 13, 2007 |
|
|
|
11894667 |
|
|
|
|
60840073 |
Aug 23, 2006 |
|
|
|
60831018 |
Jul 13, 2006 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/6.12 |
Current CPC
Class: |
C12Q 2600/156 20130101;
C12Q 2600/172 20130101; A61P 9/00 20180101; C12Q 1/6883 20130101;
G01N 33/5023 20130101; C12Q 2600/158 20130101; G01N 33/564
20130101; A61P 17/00 20180101; A61P 27/02 20180101; G01N 2800/329
20130101; A61P 27/00 20180101; C12Q 2600/112 20130101; Y10T
436/143333 20150115; C12Q 2600/136 20130101 |
Class at
Publication: |
435/6.11 ;
435/6.12 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Goverment Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] This invention was made with government support under NIH
R01 EY11515 and R24 EY017404, awarded by the National Institutes of
Health. The government has certain rights in the invention.
Claims
1. A screening method for determining a human subject's propensity
to develop a vascular disorder and/or age-related macular
degeneration (AMD) comprising: analyzing a biological sample from
the subject to detect the presence or absence of a deletion in the
region of chromosome 1 between the 3' end of exon 22 of the
complement factor H (CFH) gene and the 5' end of exon 1 of
complement Factor H-related 4 (CFHR4) gene wherein the presence of
a deletion indicates the subject is at increased risk of developing
a vascular disorder and is at decreased risk of developing AMD.
2-44. (canceled)
Description
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001] This application is a Continuation of PCT/US07/73514 filed
Jul. 13, 2007, which claims priority to U.S. Provisional Patent
Application No. 60/840,073, filed Aug. 23, 2006, and to U.S.
Provisional Patent Application No. 60/831,018, filed Jul. 13, 2006.
All these applications are hereby incorporated by reference.
FIELD OF THE INVENTION
[0003] This invention relates to screening and therapeutic methods
for complement-mediated diseases such as age-related macular
degeneration and vascular diseases. The invention finds application
in the fields of biology and medicine.
BACKGROUND OF THE INVENTION
[0004] Complement Factor H (CFH) is a multifunctional protein that
acts as a key regulator of the complement system. See Zipfel, 2001,
"Factor H and disease: a complement regulator affects vital body
functions" Semin Thromb Hemost. 27:191-9. The Factor H protein
activities include: (1) binding to C-reactive protein (CRP), (2)
binding to C3b, (3) binding to heparin, (4) binding to sialic acid;
(5) binding to endothelial cell surfaces, (6) binding to cellular
integrin receptors (7) binding to pathogens, including microbes
(see FIG. 3 of U.S. patent publication No. 20070020647), and (8)
C3b co-factor activity. The Factor H gene, known as HF1, CFH and
HF, is located on human chromosome 1, at position 1q32. The 1q32
locus contains a number of complement pathway-associated genes. One
group of these genes, referred to as the regulators of complement
activation (RCA) gene cluster, contains the genes that encode
Factor H, five Factor H-related proteins (FHR-1, FHR-2, FHR-3,
FHR-4 and FHR-5 or CFHR1, CFHR2, CFHR3, CFHR4 and CFHR5,
respectively), and the gene encoding the beta subunit of
coagulation factor XIII. The Factor H and Factor H related proteins
are composed almost entirely of short consensus repeats (SCRs).
Factor H and FHL1 are composed of SCRs 1-20 and 1-7, respectively.
FHR-1, FHR-2, FHR-3, FHR-4 and FHR-5 are composed of 5, 4, 5, 5 and
8 SCRs, respectively. The order of genes, from centromere to
telomere is FH/FHL1, FHR-3, FHR-1, FHR-4, FHR-2 and FHR-5.
Factor H Gene
[0005] The Factor H cDNA encodes a polypeptide 1231 amino acids in
length having an apparent molecular weight of 155 kDa (see Ripoche
et al., 1988, Biochem J 249:593-602). There is an alternatively
spliced form of Factor H known as FHL-1 (and also has been referred
to as HFL1 or CFHT). FHL-1 corresponds essentially to exons 1
through 9 of Factor H (see Ripoche et al., 1988, Biochem J
249:593-602). The FHL1 cDNA encodes a polypeptide 449 amino acids
in length having an apparent molecular weight of 45-50 kDa. The
first 445 amino acids of FH1 and FHL1 are identical, with FHL1
having four unique C-terminal amino acids (encoded by alternative
exon 10A, which is located in the intron between exon 9 and exon
10. cDNA and amino acid sequence data for human Factor H and FHL1
are found in the EMBL/GenBank Data Libraries under accession
numbers Y00716 and X07523, respectively. The 3926 base nucleotide
sequence of the reference form of human Factor H cDNA has GenBank
accession number Y00716 and the polypeptide has GenBank accession
number Y00716. The 1658 base nucleotide sequence of the reference
form of HFL1, the truncated form of the human Factor H, has GenBank
accession number X07523, and the polypeptide sequence has GenBank
accession number X07523. The Factor H gene sequence (150626 bases
in length) has GenBank accession number AL049744. The Factor H
promoter is located 5' to the coding region of the Factor H
gene.
FHR-1 Gene
[0006] The FHR-1 gene is also known as CFHR1, CFHL1, CFHL, FHR1 and
HFL1. The FHR-1 cDNA encodes a polypeptide 330 amino acids in
length having an predicted molecular weight of 39 kDa (see Estaller
et al., 1991, J. Immunol. 146:3190-3196). cDNA and amino acid
sequence data for human FHR-1 are found in the EMBL/GenBank Data
Libraries under accession number M65292. The FHR-1 gene sequence is
found under GenBank accession number AL049741.
FHR-2 Gene
[0007] The FHR-2 gene is also known as CFHR2, CFHL2, FHR2 and HFL3.
The FHR-2 cDNA encodes a polypeptide 270 amino acids in length
having a predicted molecular weight of 31 kDa (see Strausberg et
al., Proc. Natl. Acad. Sci USA 99:16899-16903). cDNA and amino acid
sequence data for human FHR-2 are found in the EMBL/GenBank Data
Libraries under accession number BC022283. The FHR-2 gene sequence
is found under GenBank accession number AL139418.
FHR-3 Gene
[0008] The FHR-3 gene is also known as CFHR3, CFHL3, FHR3 and HLF4.
The FHR-3 cDNA encodes a polypeptide 330 amino acids in length
having a predicted molecular weight of 38 kDa (see Strausberg et
al., Proc. Natl. Acad. Sci USA 99:16899-16903). cDNA and amino acid
sequence data for human FHR-3 are found in the EMBL/GenBank Data
Libraries under accession number BC058009. The FHR-3 gene sequence
is found under GenBank accession number AL049741.
FHR-4 Gene
[0009] The FHR-4 gene is also known as CFHR4, CFHL4 and FHR4. The
FHR-4 cDNA encodes a polypeptide 331 amino acids in length having a
predicted molecular weight of 38 kDa (see Skerka et al., 1991, J.
Biol. Chem. 272:5627-5634). cDNA and amino acid sequence data for
human FHR-4 are found in the EMBL/GenBank Data Libraries under
accession number X98337. The FHR-4 gene sequence is found under
GenBank accession numbers AF190816 (5' end), AL139418 (3' end) and
BX248415.
FHR-5 Gene
[0010] The FHR-5 gene is also known as CFHR5, CFHL5 and FHR5. The
CFHR5 cDNA encodes a polypeptide 569 amino acids in length having
an apparent molecular weight of 65 kDa (see McRae et al., 2001, J.
Biol. Chem. 276:6747-6754). cDNA and amino acid sequence data for
human CFHR5 are found in the EMBL/GenBank Data Libraries under
accession number AF295327. The 2821 base nucleotide sequence of the
reference form of human CFHR5 has GenBank accession number
AF295327, and the polypeptide sequence has GenBank accession number
AAK15619. The CFHR5 genomic sequence is found under GenBank
accession numbers AL139418 (5' end) and AL353809 (3' end). The
FHR-5 promoter is located 5' to the coding region of the CFHR5
gene.
BRIEF SUMMARY OF THE INVENTION
[0011] In one aspect, the invention provides a screening method for
determining a human subject's propensity to develop a vascular
disorder and/or age-related macular degeneration (AMD), involving
analysis of a biological sample from the subject to detect the
presence or absence of a deletion in chromosome 1 between the 3'
end of exon 22 of the complement factor H (CFH) gene and the 5' end
of exon 1 of complement Factor H-related 4 (CFHR4) gene, wherein
the presence of a deletion is evidence that the subject is at an
increased risk of developing a vascular disorder and a decreased
risk of developing AMD.
[0012] Examples of vascular disorders include aneurysms, such as
abdominal aortic aneurysm (AAA) and brain intracranial
aneurysm.
[0013] In one embodiment, the method comprises detecting the
presence or absence of at least a portion of the complement Factor
H-related 3 (CFHR3) gene. In a related embodiment the entire
protein coding region of the CFHR3 gene is deleted. In a related
embodiment the entire CFHR3 gene is deleted. In a related
embodiment the entire CFHR3 gene and the region between the CFHR3
gene and complement Factor H-related 1 (CFHR1) gene are
deleted.
[0014] In one embodiment, the method comprises detecting the
presence or absence of at least a portion of the complement Factor
H-related 1 (CFHR1) gene. In a related embodiment the entire
protein coding region of the CFHR1 gene is deleted. In a related
embodiment the entire CFHR1 gene is deleted. In a related
embodiment the entire CFHR1 gene and the region between the CFHR1
gene and complement factor H-related 4 (CFHR4) gene are deleted. In
a related embodiment the entire CFHR1 gene and the region between
the CFHR1 gene and CFHR3 gene are deleted.
[0015] In one embodiment, the method comprises detecting the
presence or absence of at least a portion of the CFHR3 gene and at
least a portion of the CFHR1 gene. In a related embodiment both the
entire protein coding regions of the CFHR3 and CFHR1 genes are
deleted. In a related embodiment the entire CFHR3 and CFHR1 genes
are deleted.
[0016] In one embodiment, a deletion or a partial deletion of an
intergenic sequence selected from: a) a sequence between the CFH
gene and the CFHR3 gene; b) a sequence between the CFHR3 gene and
the CFHR1 gene; c) a sequence between the CFHR1 gene and the CFHR4
gene. In yet another embodiment, at least a portion of the CFH gene
is deleted (e.g., at least a portion of exon 22 is deleted).
[0017] In one embodiment, the presence or absence of the deletion
is detected by assaying for a gene product encoded in chromosome 1
between the 3' end of exon 22 of the complement factor H (CFH) gene
and the 5' end of exon 1 of complement Factor H-related 4 (CFHR4)
gene, where the absence of the gene product, or a reduced level of
expression of the gene product, indicates the presence of deletion.
In another embodiment, the presence or absence of a CFHR1 gene
product and/or a CFHR3 gene product is detected, where the absence
of a gene product is indicative of a deletion. In one instance, the
gene product is a protein. In another embodiment, detecting the
presence or absence of a deletion is performed by analyzing a
chromosome or nucleic acid (e.g., DNA or RNA) from the subject.
[0018] In one embodiment the presence or absence of the deletion is
detected by assaying for a truncated CFHR1 or CRHR3 gene product,
where detection of a truncated gene product is indicative of a
deletion. In a preferred embodiment, the CFHR1 gene is partially
deleted and expresses a truncated polypeptide gene product.
[0019] In one embodiment the subject has a genotype of T at
position 1277 of the coding region of the CFH gene of the
chromosome comprising the deletion.
[0020] The subject may be homozygous or heterozygous for deletions.
Thus, in one embodiment, deletions are present in both chromosomes
1 of the subject.
[0021] The presence or absence of the deletion may be detected in a
biological sample from a patient by, for example, analyzing a
chromosome or nucleic acid (e.g., DNA or RNA) sample from the
subject. The presence or absence of the deletion also may be
detected by, for example, determining the presence or absence of
protein encoded by the (deleted) DNA in a biological sample from
the subject, e.g., a body fluid or tissue sample of the subject, by
detecting a variant or truncated form of the CFHR1 or CFHR3
polypeptides in a body fluid or tissue sample of the subject, or by
measuring the level of CFHR1 or CFHR3 polypeptides in a body fluid
or tissue sample of the subject.
[0022] The biological sample is any sample taken from a patient
that is suitable for use in the invention. Examples of biological
samples that include body fluids include blood, serum, urine,
cerebral spinal fluid (CSF) and saliva. In one embodiment, the body
fluid is blood, serum or urine. Examples of biological samples that
comprise tissue samples include a skin biopsy and a cheek scraping.
In one embodiment, the tissue sample is a skin biopsy.
[0023] Proteins (amount or presence) may be detected, for example,
using an immunoassay such as a sandwich immunoassay, a competitive
immunoassay, a radioimmunoassay, fluorophore-labelled immunoassay,
an ELISA or a Western blot. Mass spectroscopy also may be used.
Variant proteins (amount or presence) may be detected, for example,
using variant-specific antibodies. Truncated proteins (amount or
presence) may be detected, for example, by a difference in the size
of the protein by Western blot analysis or mass spectroscopy.
[0024] In certain embodiments, the method comprises in the
detecting step determining the presence of a deletion, for example,
a deletion in a CFHR1 or CFHR3 gene, or the absence or a reduction
of corresponding gene product (e.g., the amount or activity of the
gene product) indicating a higher risk of the subject developing a
vascular disorder.
[0025] In other embodiments, the method comprises in the detecting
step determining the absence of a deletion, for example, the
presence of a CFHR1 or CFHR3 gene, or the presence or an increase
of the corresponding gene product (e.g., the amount or activity of
the gene product) indicating a lower risk of the subject developing
a vascular disorder.
[0026] In another embodiment, the method comprises in the detecting
step determining the presence of a deletion, for example, a
deletion in a CFHR1 or CFHR3 gene, or the absence or a reduction of
the corresponding gene product (e.g., the amount or activity of the
gene product) indicating a lower risk of the subject developing
AMD.
[0027] In yet another embodiment, the method comprises in the
detecting step determining the absence of a deletion, for example,
the presence of a CFHR1 or CFHR3 gene, or the presence or an
increase of the corresponding gene product (e.g., the amount or
activity of the gene product) indicating a higher risk of the
subject developing AMD. The increase in gene product, for example,
can be at least 10%, at least 20%, at least 50%, or more.
[0028] In certain embodiments, the method further comprises
detecting at least one other genetic variant or biomarker
indicative of AMD and/or vascular disease. Genetic variants that
may be detected in the invention include genetic variants of
complement factor H (CFH) gene, HTRA1 gene, complement factor B
(BF) gene and/or the complement component 2 (C2) gene. In an
embodiment, the genetic variants include one or a plurality of
polymorphic sites, such as those described herein.
[0029] In another aspect, the invention provides a method for
treating a subject having (i.e., exhibiting symptoms of), or is at
risk for developing, a vascular disorder, by administering a CFHR1
polypeptide and/or a CFHR3 polypeptide to the subject. The
polypeptide may be a full-length CFHR1 polypeptide or a fragment or
portion thereof. The polypeptide may be a full-length CFHR3
polypeptide or a fragment or portion thereof.
[0030] In another aspect the invention provides a pharmaceutical
composition comprising a CFHR3 protein or fragment thereof and at
least one pharmaceutically effective excipient. In another aspect
the invention provides a pharmaceutical composition comprising a
CFHR1 protein or fragment thereof and at least one pharmaceutically
effective excipient.
[0031] In another aspect the invention provides the use of a
protein comprising the gene product of at least a portion of the
CFHR3 and/or CFHR1 gene for the preparation of a medicament for the
treatment of a vascular disorder.
[0032] In another aspect the invention provides gene therapy
vectors comprising nucleic acid encoding a CFHR3 or CFHR1 protein,
or fragment thereof. The vector may include a promoter that drives
expression of the CFHR3 or CFHR1 gene in multiple cell types.
Alternatively, the vector may include a promoter that drives
expression of the CFHR3 or CFHR1 gene only in specific cell types,
for example, in cells of the retina or in cells of the kidney. In a
related aspect pharmaceutical compositions are provided containing
a gene therapy vector encoding a CFHR3 or CFHR1 protein or fragment
thereof and a pharmaceutically acceptable excipient.
[0033] In another aspect the invention provides a method of
treating a subject having (i.e., exhibiting symptoms of), or
susceptible to developing, age-related macular degeneration (AMD),
by administering an agent that reduces the expression of the CFHR1
and/or CFHR3 genes or reduces the activity or amount of a gene
product of the CFHR1 and/or CFHR3 genes. Agents include antisense
RNA, siRNA or ribozyme that reduces expression of the CFHR1 and/or
CFHR3 genes. In a related aspect the level of protein is reduced,
for example by using plasmaphoresis or antibody-based inhibition,
for example, using an anti-CFHR1 antibody and/or an anti-CFHR3
antibody.
[0034] In another aspect the invention provides a pharmaceutical
composition comprising an anti-CFHR1 antibody and a
pharmaceutically acceptable carrier. In one embodiment, an
anti-CFHR1 antibody specifically binds the amino-terminus of a
CFHR1 polypeptide. In another aspect the invention provides a
pharmaceutical composition comprising an anti-CFHR3 antibody and a
pharmaceutically acceptable carrier. In one embodiment, an
anti-CFHR3 antibody specifically binds the carboxyl-terminus of a
CFHR3 antibody.
[0035] In another aspect the invention provides a diagnostic kit
for diagnosing susceptibility to a vascular disorder and/or AMD in
a subject, comprising nucleic acid primers or probes that detect
the presence or absence of a deletion in the DNA sequence between
the 3' end of exon 22 of the complement factor H (CFH) gene and the
5' end of exon 1 of complement Factor H-related 4 (CFHR4) gene on
human chromosome 1.
[0036] In another aspect the invention provides a diagnostic device
comprising nucleic acid primers or probes that detect the presence
or absence of a deletion in the DNA sequence between the 3' end of
exon 22 of the complement factor H (CFH) gene and the 5' end of
exon 1 of complement Factor H-related 4 (CFHR4) gene on human
chromosome 1 immobilized on a substrate, such as a microarray.
[0037] In another aspect the invention provides a diagnostic kit
for diagnosing susceptibility to a vascular disorder and/or AMD in
a subject, comprising antibodies that detect the presence or
absence of the complement Factor H-related 3 (CFHR3) protein, or
variant or truncated forms thereof, and/or complement Factor H
related 1 (CFHR1) protein, or variant or truncated forms thereof,
in a body fluid or tissue sample of the subject.
[0038] In another aspect the invention provides a drug screening
method for screening for agents for use in treating a vascular
disorder. The method involves a) combining (i) a cell that
expresses CFHR3 and/or CFHR1 polypeptides; and (ii) a test agent;
b) measuring the level of CFHR3 and/or CFHR1 polypeptides secreted
into the medium; and c) comparing the level of CFHR3 and/or CFHR1
polypeptides secreted into the medium in the presence of the test
agent with a reference value, said reference value being the level
of CFHR3 and/or CFHR1 polypeptides secreted into the medium in the
absence of the test agent, where a higher level of CFHR3 and/or
CFHR1 polypeptides secreted into the medium in the presence of the
test agent indicates the test agent may be useful for treating the
vascular disorder.
[0039] In another aspect the invention provides a method for
identifying a CFH protein likely to protect against AMD
development, by identifying a subject with a deletion in the DNA
sequence between the 3' end of exon 22 of the complement factor H
(CFH) gene and the 5' end of exon 1 of complement Factor H-related
4 (CFHR4) gene on human chromosome 1; determining the sequence of
the CFH gene encoded by the gene contained in the chromosome
containing the deletion; and determining the sequence of the
protein encoded by the CFH gene, wherein said protein is different
from wild-type CFH, said protein being a CFH protein likely to
protect against AMD development. The invention also provides a
protective CFH protein obtained using the method.
BRIEF DESCRIPTION OF THE FIGURES
[0040] FIG. 1 is a diagram showing the organization of the
regulators-of-complement-activation (RCA) gene cluster on
chromosome 1q32 and the arrangement of approximately 60-amino acid
domains known as short consensus repeats (SCRs) in complement
Factor H (CFH), Factor H-Like 1 (CFHL1) and Factor H-Related 1, 2,
3, 4 and 5 (CFHR1, CFHR2, CFHR3, CFHR4 and CFHR5). CFH has 20 SCRs.
The interacting partners with some of these SCRs has been
determined and is shown on the top right (CRP, C reactive protein;
Hep, heparin). Complement factor H-like 1 (CFHL1) is a splice
isoform of CFH, while complement factor H-related proteins 1-5
(CFHR1-5) are each encoded by a unique gene (CFHRJ-5). The SCRs of
CFHR1-5 are similar to some of the SCRs in CFH, as denoted by the
numbers in the ovals. For example, CFHR5 has 9 SCRs, with the first
two being similar to SCRs 6 and 7 of Factor H and therefore having
CRP and heparin binding properties. SCRs 5-7 of CFHR5 have the
numbers 12-14 within the corresponding ovals because these SCRs are
similar to SCRs 12-14 of Factor H and have C3b and heparin binding
properties.
[0041] FIG. 2 shows regions of homology (genomic duplications) in
the genes encoding CFH and the Factor H-related proteins. Exons are
indicated as vertical lines. Regions labeled with the same letter
(e.g., A, A', and A') have substantially identical sequences.
[0042] FIG. 3 shows a Western blot of serum proteins from seven
patients using an anti-human CFH antibody. FHL-1, CFHR1 and CFHR2
indicate the positions of the truncated form of CFH, CFHR1 and
CFHR2, respectively. The anti-human CFH antibody employed also
cross-reacts with CFHR1 and CFHR2. No CFHR1 is detected in the
serum of two patients (197-02 and 325-02) that have a homozygous
deletion of the CFHR3 and CFHR1 genes, as determined by SSCP
analysis and direct DNA sequencing.
[0043] FIG. 4 shows a SSCP analysis of the CFH, CFHR3 and CFHR1
genes. 1, 2, 3, and 4 indicate four different SSCP patterns
observed using primers from exon 22 of the CFH gene to PCR amplify
DNA. SSCP patterns 1, 2 and 3 correspond to homozygous non-deletion
or heterozygous deletion of CFHR3 and CFHR1, and pattern 4
corresponds to homozygous deletion of CFHR3 and CFHR1.
[0044] FIG. 5 shows a PCR analysis of the CFH and CFH-related genes
1 to 5 in leukocytes from 20 patients that are separated into four
groups according to the SSCP patterns using the CFH exon 22 primers
(patterns 1-4 are as described in FIG. 4). From left to right, in
each panel (gel), 5 leukocyte-derived DNA samples each from
patients displaying SSCP patterns 1, 2, 3 and 4 were subjected to
PCR using primers specific for CFH, CFHR1, CFHR2, CFHR3, CFHR4 and
CFHR5, as indicated. When SSCP analysis and direct DNA sequencing
show a homozygous deletion of the CFHR3 and CFHR1 genes, no PCR
amplifiable CFHR3 and CFHR1 DNA are detected.
[0045] FIG. 6 shows an amino acid alignment of the CFH (SEQ ID NO:
2), CFHR1 (SEQ ID NO: 4), and CFHR3 (SEQ ID NO: 6) proteins.
[0046] FIG. 7 shows a nucleotide alignment of the CFH (SEQ ID NO:
1), CFHR1 (SEQ ID NO: 3), and CFHR3 genes (SEQ ID NO: 5).
DETAILED DESCRIPTION
1. Definitions
[0047] The following definitions are provided to aid in
understanding the invention. Unless otherwise defined, all terms of
art, notations and other scientific or medical terms or terminology
used herein are intended to have the meanings commonly understood
by those of skill in the arts of medicine and molecular biology. In
some cases, terms with commonly understood meanings are defined
herein for clarity and/or for ready reference, and the inclusion of
such definitions herein should not be assumed to represent a
substantial difference over what is generally understood in the
art.
[0048] A "vascular disorder" is a disease or condition of the
vascular system. One type of vascular disorder is an aneurysm such
as abdominal aortic aneurysm or brain intracranial aneurysm. Other
types of vascular disorder include hypertension, cerebral vascular
accidents, trans-ischemic accidents (e.g., stroke). Still other
types of vascular disorders include coronary artery disease,
peripheral artery disease, varicose veins, and peripheral vascular
disease.
[0049] A "nucleic acid", "polynucleotide" or "oligonucleotide" is a
polymeric form of nucleotides of any length, may be DNA or RNA, and
may be single- or double-stranded. Nucleic acids may include
promoters or other regulatory sequences. Oligonucleotides are
usually prepared by synthetic means. A reference to the sequence of
one strand of a double-stranded nucleic acid defines the
complementary sequence and except where otherwise clear from
context, a reference to one strand of a nucleic acid also refers to
its complement. For certain applications, nucleic acid (e.g., RNA)
molecules may be modified to increase intracellular stability and
half-life. Possible modifications include, but are not limited to,
the use of phosphorothioate or 2'-O-methyl rather than
phosphodiesterase linkages within the backbone of the molecule.
Modified nucleic acids include peptide nucleic acids (PNAs) and
nucleic acids with nontraditional bases such as inosine, queosine
and wybutosine and acetyl-, methyl-, thio-, and similarly modified
forms of adenine, cytidine, guanine, thymine, and uridine which are
not as easily recognized by endogenous endonucleases.
[0050] "Hybridization probes" are nucleic acids capable of binding
in a base-specific manner to a complementary strand of nucleic
acid. Such probes include nucleic acids and peptide nucleic acids
(Nielsen et al., 1991). Hybridization may be performed under
stringent conditions which are known in the art. For example, see,
e.g., Berger and Kimmel (1987) METHODS IN ENZYMOLOGY, VOL. 152:
GUIDE TO MOLECULAR CLONING TECHNIQUES, San Diego: Academic Press,
Inc.; Sambrook et al. (1989) MOLECULAR CLONING: A LABORATORY
MANUAL, 2nd Ed., Vols. 1-3, Cold Spring Harbor Laboratory; Sambook
(2001) 3rd Edition; Rychlik, W. and Rhoads, R. E., 1989, Nucl.
Acids Res. 17, 8543; Mueller, P. R. et al. (1993) In: CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY 15.5, Greene Publishing Associates,
Inc. and John Wiley and Sons, New York; and Anderson and Young,
QUANTITATIVE FILTER HYBRIDIZATION IN NUCLEIC ACID HYBRIDIZATION
(1985)). As used herein, the term "probe" includes primers. Probes
and primers are sometimes referred to as "oligonucleotides."
[0051] The term "primer" refers to a single-stranded
oligonucleotide capable of acting as a point of initiation of
template-directed DNA synthesis under appropriate conditions, in an
appropriate buffer and at a suitable temperature. The appropriate
length of a primer depends on the intended use of the primer but
typically ranges from 15 to 30 nucleotides. A primer sequence need
not be exactly complementary to a template but must be sufficiently
complementary to hybridize with a template. The term "primer site"
refers to the area of the target DNA to which a primer hybridizes.
The term "primer pair" means a set of primers including a 5'
upstream primer, which hybridizes to the 5' end of the DNA sequence
to be amplified and a 3' downstream primer, which hybridizes to the
complement of the 3' end of the sequence to be amplified.
[0052] Exemplary hybridization conditions for short probes and
primers is about 5 to 12 degrees C below the calculated Tm.
Formulas for calculating Tm are known and include: Tm=4.degree.
C..times.(number of G's and C's in the primer)+2.degree.
C..times.(number of A's and T's in the primer) for oligos <14
bases and assumes a reaction is carried out in the presence of 50
mM monovalent cations. For longer oligos, the following formula can
be used: Tm=64.9.degree. C.+41.degree. C..times.(number of G's and
C's in the primer-16.4)/N, where N is the length of the primer.
Another commonly used formula takes into account the salt
concentration of the reaction (Rychlik, supra, Sambrook, supra,
Mueller, supra.): Tm=81.5.degree. C.+16.6.degree. C..times.(log
10[Na+]+[K+])+0.41.degree. C..times.(% GC)-675/N, where N is the
number of nucleotides in the oligo. The aforementioned formulae
provide a starting point for certain applications; however, the
design of particular probes and primers may take into account
additional or different factors. Methods for design of probes and
primers for use in the methods of the invention are well known in
the art.
[0053] The term "polymorphism" refers to the occurrence of two or
more genetically determined alternative sequences or alleles in a
population. A "polymorphic site" is the locus at which sequence
divergence occurs. Polymorphic sites have at least two alleles. A
diallelic polymorphism has two alleles. A triallelic polymorphism
has three alleles. Diploid organisms may be homozygous or
heterozygous for allelic forms. A polymorphic site may be as small
as one base pair. Examples of polymorphic sites include:
restriction fragment length polymorphisms (RFLPs); variable number
of tandem repeats (VNTRs); hypervariable regions; minisatellites;
dinucleotide repeats; trinucleotide repeats; tetranucleotide
repeats; and simple sequence repeats. As used herein, reference to
a "polymorphism" can encompass a set of polymorphisms (i.e., a
haplotype).
[0054] A "single nucleotide polymorphism (SNP)" occurs at a
polymorphic site occupied by a single nucleotide, which is the site
of variation between allelic sequences. The site is usually
preceded by and followed by highly conserved sequences of the
allele. A SNP usually arises due to substitution of one nucleotide
for another at the polymorphic site. Replacement of one purine by
another purine or one pyrimidine by another pyrimidine is called a
transition. Replacement of a purine by a pyrimidine or vice versa
is called a transversion. A synonymous SNP refers to a substitution
of one nucleotide for another in the coding region that does not
change the amino acid sequence of the encoded polypeptide. A
non-synonymous SNP refers to a substitution of one nucleotide for
another in the coding region that changes the amino acid sequence
of the encoded polypeptide. A SNP may also arise from a deletion or
an insertion of a nucleotide or nucleotides relative to a reference
allele.
[0055] The term "deletion," when referring to a nucleic acid
sequence, has the usual meaning in genetics of an allele in which
one or more bases are missing compared to a reference or wild-type
sequence. Deletions may be as short as one base-pair. Deletions
detected in the present invention may be longer, such as a deletion
of at least 100 bp, at least 200 bp, at least 300 bp, at least 400
bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800
bp, at least 900 bp, at least 1000 bp, at least 1100 bp, at least
1200 bp, at least 1300 bp, at least 1400 bp, at least 1500 bp, at
least 1600 bp, at least 1700 bp, at least 1800 bp, at least 1900
bp, at least 2000 bp, at least 2500 bp, at least 3000 bp, at least
3500 bp, at least 4000 bp, at least 4500 bp, at least 5000 bp, at
least 6000 bp, at least 7000 bp, at least 8000 bp, at least 9000
bp, at least 10,000 bp, at least 15,000 bp, at least 20,000 bp, at
least 30,000 bp, at least 40,000 bp, at least 50,000 bp, at least
75,000 bp, at least 100,000 bp, at least 125,000 bp, at least
150,000 bp, at least 200,000 bp or at least 250,000 bp.
[0056] The term "haplotype" refers to the designation of a set of
polymorphisms or alleles of polymorphic sites within a gene of an
individual. For example, a "112" Factor H haplotype refers to the
Factor H gene comprising allele 1 at each of the first two
polymorphic sites and allele 2 at the third polymorphic site. A
"diplotype" is a haplotype pair.
[0057] An "isolated" nucleic acid means a nucleic acid species that
is the predominant species present in a composition. Isolated means
the nucleic acid is separated from at least one compound with which
it is associated in nature. A purified nucleic acid comprises (on a
molar basis) at least about 50, 80 or 90 percent of all
macromolecular species present.
[0058] Two amino acid sequences are considered to have "substantial
identity" when they are at least about 80% identical, preferably at
least about 90% identical, more preferably at least about 95%, at
least about 98% identical or at least about 99% identical.
Percentage sequence identity is typically calculated by determining
the optimal alignment between two sequences and comparing the two
sequences. Optimal alignment of sequences may be conducted by
inspection, or using the local homology algorithm of Smith and
Waterman, 1981, Adv. Appl. Math. 2: 482, using the homology
alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol.
48: 443, using the search for similarity method of Pearson and
Lipman, 1988, Proc. Natl. Acad. Sci. U.S.A. 85: 2444, by
computerized implementations of these algorithms (e.g., in the
Wisconsin Genetics Software Package, Genetics Computer Group, 575
Science Dr., Madison, Wis.) using default parameters for amino acid
comparisons (e.g., for gap-scoring, etc.). It is sometimes
desirable to describe sequence identity between two sequences in
reference to a particular length or region (e.g., two sequences may
be described as having at least 95% identity over a length of at
least 500 basepairs). Usually the length will be at least about 50,
100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 amino acids, or
the full length of the reference protein. Two amino acid sequences
can also be considered to have substantial identity if they differ
by 1, 2, or 3 residues, or by from 2-20 residues, 2-10 residues,
3-20 residues, or 3-10 residues.
[0059] "Linkage" describes the tendency of genes, alleles, loci or
genetic markers to be inherited together as a result of their
location on the same chromosome. Linkage can be measured by percent
recombination between the two genes, alleles, loci or genetic
markers. Typically, loci occurring within a 50 centimorgan (cM)
distance of each other are linked. Linked markers may occur within
the same gene or gene cluster. "Linkage disequilibrium" or "allelic
association" means the preferential association of a particular
allele or genetic marker with a specific allele or genetic marker
at a nearby chromosomal location more frequently than expected by
chance for any particular allele frequency in the population. A
marker in linkage disequilibrium can be particularly useful in
detecting susceptibility to disease, even if the marker itself does
not cause the disease.
[0060] The terms "susceptibility," "propensity," and "risk" refer
to either an increased or decreased likelihood of an individual
developing a disorder (e.g., a condition, illness, disorder or
disease) relative to a control population. In one example, the
control population may be individuals in the population (e.g.,
matched by age, gender, race and/or ethnicity) without the
disorder, or without the genotype or phenotype assayed for. In some
contexts, the terms diagnosing and screening are used
interchangeably (e.g., a person skilled in the art can diagnose a
propensity to develop the disease).
[0061] The term "diagnose" and "diagnosis" refer to the ability to
determine or identify whether an individual has a particular
disorder (e.g., a condition, illness, disorder or disease).
[0062] The term "screen" or "screening" as used herein has a broad
meaning. It includes processes intended for the diagnosis or for
determining the susceptibility, propensity, risk, or risk
assessment of an asymptomatic subject for developing a disorder
later in life. Screening also includes the prognosis of a subject,
i.e., when a subject has been diagnosed with a disorder,
determinating in advance the progress of the disorder as well as
the assessment of efficacy of therapy options to treat a
disorder.
[0063] The terms "portion," "fragment" and/or "truncated form" when
used in reference to a Factor H-related gene product (e.g., CFHR3
or CFHR1 gene product), refers to a nucleic acid or polypeptide
sequence that is less than the full-length sequence (i.e., a
portion of the full-length gene or polypeptide). A portion or
fragment or truncated form of CFHR3 or CFHR1 gene or polypeptide
can be at least 25, at least 50, at least 75, at least 100, at
least 150, at least 200, at least 250, or at least 300 nucleotides
or amino acids in length. Typically the portion includes at least
1, often at least two, and sometimes at least 3 or 4 complete
SCRs.
[0064] As used herein, the term "gene product" means an RNA (e.g.,
mRNA) or protein that is encoded by the gene. A "protein coding
region" is a region of DNA/RNA sequence within a gene that encodes
a polypeptide or protein.
[0065] An "assay" is a procedure wherein the presence or amount or
a property of a test substance, e.g., a nucleic acid or gene
product, is detected or measured.
[0066] The terms "inhibit" and "reduce" refer to any inhibition,
reduction, or decrease in expression or activity including partial
or complete inhibition of gene expression or gene product
activity.
2. Association of Polymorphisms in the CFHR1 and CFHR3 Genes and
Risk of Developing AMD and Vascular Disorders
[0067] A correlation between polymorphic sites and haplotypes in
the CFH gene and the likelihood of developing AMD has been
discovered. See Hageman et al., 2005, Proc. Natl. Acad. Sci. U.S.A.
102:7227-32; Haines et al., 2005, Science 308:419-21; Klein et al.,
2005, Science 308:385-9; Edwards et al., 2005, Science 308:421-4
and U.S. patent publication No. 20070020647, each incorporated by
reference in its entirety for all purposes. Both CFH risk
haplotypes and CFH protective haplotypes are known. Polymorphisms
particularly associated with increased risk include a variant
allele at: rs1061170 (402H; exon 9); rs203674 (intron 10) and the
polymorphism at residue 1210 (1210C; exon 22). Polymorphisms
particularly associated with decreased risk include the protective
H2 haplotype, which includes a variant allele in IVS6 (intron 6,
rs3766404) and the H4 haplotype, which includes a variant allele in
IVS1 (intron 1, rs529825) and a variant allele (162) (exon 2,
rs800292).
[0068] It has now been discovered that an AMD protective haplotype
is genetically linked to deletions in the DNA sequence between the
3' end of exon 22 of the complement factor H (CFH) gene and the 5'
end of exon 1 of complement Factor H-related 4 (CFHR4) gene on
human chromosome 1 (i.e., the DNA sequence encoding the CFHR1 and
CFHR3 proteins). See Example 1, infra. The discovery that deletions
at the CFHR1 and CFHR3 loci are associated with decreased risk of
developing AMD has a number of specific applications, including
screening individuals to ascertain risk of developing AMD and
identification of new and optimal therapeutic approaches for
individuals afflicted with, or at increased risk of developing,
AMD. As discussed in Example 1, below, the deletion genotype is
predominantly associated with the CFH H4 haplotype. See Hageman et
al., 2005, Proc. Natl. Acad. Sci. U.S.A. 102:7227-32. Thus, this
deletion acts as a marker for decreased risk of conditions for
which the H4 haplotype is protective.
[0069] Moreover, it has now been discovered that deletions in the
DNA sequence between the 3' end of exon 22 of the complement factor
H (CFH) gene and the 5' end of exon 1 of complement Factor
H-related 4 (CFHR4) gene on human chromosome 1 (i.e., the DNA
sequence encoding the CFHR1 and CFHR3 proteins) are associated with
increased risk of developing a vascular disease such as aortic
aneurysm. See Example 1, infra. The discovery that deletions at the
CFHR1 and CFHR3 loci are associated with increased risk of
developing a vascular disorder has a number of specific
applications, including screening individuals to ascertain risk of
developing a vascular disorder and identification of new and
optimal therapeutic approaches for individuals afflicted with, or
at increased risk of developing, vascular disorders.
3. Screening Methods
[0070] Based on the discoveries described herein, a subject's risk
for AMD or vascular disease can be assessed by determining whether
or not a the subject has a deletion within the region of chromosome
1 lying between the 3' end of exon 22 of the complement factor H
(CFH) gene and the 5' end of exon 1 of complement Factor H-related
4 (CFHR4). The extent of the deletion may vary in different
individuals or populations. For example, in one embodiment the all
of most of the region between CFH exon 22 and CFHR4 exon 1 is
deleted. Alternatively, a portion of the region may be deleted,
such as, for example, a deletion of less than the entire region
between CFH exon 22 and CFHR4 exon 1 but including the CFHR1
encoding sequence, or including the CFHR3 encoding sequence,
including both, or including a non-coding (e.g., intragenic)
sequence. An individual may be homozygous for deletion (both
chromosomes 1 have a deletion in the region) or may be heterozygous
for deletion.
[0071] For example and not limitation, the homozygous deletion of
CFHR1 and/or CFHR3 can be detected from the absence of CFHR1 and/or
CFHL3 protein in a body fluid or tissue sample (see FIG. 3), by the
absence of RNA encoded in the region between the 3' end of CFH exon
22 and the 5' end of CFHR4 exon 1 (e.g., absense of absence of
CFHR1 and/or CFHL3 mRNAs), or by absense of genomic DNA in the
region in the region between the 3' end of CFH exon 22 and the 5'
end of CFHR4 exon 1. The present or absense of DNA or RNA sequences
can be determined using art known methods, such as PCR. The absense
of a nucleic acid sequence is deduced from the absense of an
amplified PCR product in an assay of a tissue sample (see FIG. 5).
It will be understood that, although PCR is frequently cited herein
as a method for genetic analysis, many other analytical methods are
known and are suitable for detection of a deletion. For example and
not limitation several are described below in the section captioned
"Analysis of Nucleic Acid Samples."
[0072] The heterozygous deletion of CFHR1 and/or CFHR3 can be
determined, for illustration and not limitation, (1) from a
reduction in the amount of protein in a body fluid or tissue sample
as compared to the amount from a control having both alleles of
CFHR1 and/or CFHR3 genes, (2) from a reduction in the amount of
RNA, DNA, or amplified PCR product in a tissue sample as compared
to the amount from similar sample of a homozygote without the
deletion, or (3) by an assay using direct DNA sequencing,
quantitative PCR or other methods known in the art. For example,
the amount of a gene product may be reduced in a heterozygote by at
least 10%, at least 20%, at least 30%, about 50% or more compared
to a homozygote without the deletion. Quantitative PCR and methods
are available that would be able to detect a two-fold difference in
mRNA or DNA in a sample.
[0073] As noted, a deletion lies in the region between CFH exon 22
and CFHR4 exon 1 but need not span the entire region. Deletions of
a portion of the CFHR1 and/or CFHR3 genes ("partial deletions") may
result in truncated forms of CFHR1 and/or CFHR3 RNAs and
polypeptides. Such partial deletions can be identified by a
difference in size of a protein in a body fluid or tissue sample
compared to the full-length protein, by detecting a size difference
in the RNA, and by various methods well known in the art, including
PCR amplification of DNA or RNA in a biological sample using
primers selected to distinguish between a nucleic acid comprising a
deletion and a nucleic acid not containing a deletion. Methods
known in the art can be used to distinguish homozygotes from
heterozygotes (see, e.g., Example 1).
[0074] The selection, design and manufacture of suitable primers or
probes for analysis of nucleic acid is well known in the art. A
person of ordinary skill in the art can use suitable combinations
of primers to detect deletions. In an embodiment, the primers or
probes are designed to hybridize at any position in the DNA
sequence between the 3' end of exon 22 of the complement factor H
(CFH) gene and the 5' end of exon 1 of complement Factor H-related
4 (CFHR4) gene. For instance, both primers may be located in the
CHFR3 gene to detect its presence or absence. In another example.
In other examples, one or more primers are located within
intergenic (non-coding) sequence, e.g., intergenic sequence between
between CFHR3 and CFHR1 or between CFHR1 and CFHR4.
[0075] In another embodiment, the invention includes a method of
detecting a nonreciprocal transfer of genetic information, such as
gene conversion. In one instance, the gene conversion results in
replacement of a 3' portion of the CFH gene with a portion of the
3' CFHR1 gene, such that a chimeric protein with sequence derived
from both the CFH gene and the CFHR1 gene is produced.
3.1 Analysis of Nucleic Acid Samples
[0076] Methods for detection of polymorphisms and deletions in
genetic sequences are well known in the art and can be adapted for
use in the present invention.
[0077] In one embodiment, genomic DNA is analyzed. For assay of
genomic DNA, virtually any biological sample containing genomic DNA
or RNA, e.g., nucleated cells, is suitable. For example, genomic
DNA can be obtained from peripheral blood leukocytes collected from
case and control subjects (QIAamp DNA Blood Maxi kit, Qiagen,
Valencia, Calif.). Other suitable samples include saliva, cheek
scrapings, biopsies of retina, kidney, skin, or liver or other
organs or tissues; amniotic fluid, cerebral spinal fluid (CSF)
samples; and the like. Alternatively RNA or cDNA can be assayed.
Methods for purification or partial purification of nucleic acids
from patient samples for use in diagnostic or other assays are well
known
[0078] Methods for detecting polymorphisms and deletions in nucleic
acids include, without limitation, Southern blot analysis (see Kees
et al., "Homozygous Deletion of the p16/MTS1 Gene in Pediatric
Acute Lymphoblastic Leukemia Is Associated With Unfavorable
Clinical Outcome," Blood 89:4161-4166, Fizzotti et al., "Detection
of homozygous deletions of the cyclin-dependent kinase 4 inhibitor
(p16) gene in acute lymphoblastic leukemia and association with
adverse prognostic features," Blood 85(10):2685-2690, Kitada et
al., "Mutations in the parkin gene cause autosomal recessive
juvenile parkinsonism," Nature 392 (9):605-608); Northern Blot
Analysis (see Fieschi et al., "A novel form of complete IL-12/IL-23
receptor b1 deficiency with cell surface-expressed nonfunctional
receptors," Immunobiology 104(7):2095-2101) and amplification based
method such as PCR-based methods are used to detect deletions in
samples. PCR primers may be designed to target DNA sequences
flanking a known mutation, in which a change in PCR product size in
comparison to amplification reactions using WT DNA identifies a
mutant template. Primers may also be targeted to deleted sequences,
wherein an absence of a PCR product identifies a mutant template
(Kitada et al., "Mutations in the parkin gene cause autosomal
recessive juvenile parkinsonism," Nature 392:605-608) including
multiplex PCR (Chong et al., "Single-tube multiplex-PCR screen for
common deletional determinants of ca-thalassemia," Blood 95
(1):360-362).
[0079] Polymorphisms (e.g., deletions) can also be detected using
allele-specific probes; use of allele-specific primers; direct
sequence analysis; denaturing gradient gel electropohoresis (DGGE)
analysis; single-strand conformation polymorphism (SSCP) analysis;
and denaturing high performance liquid chromatography (DHPLC)
analysis. Other well known methods to detect polymorphisms in DNA
include use of: Molecular Beacons technology (see, e.g., Piatek et
al., 1998; Nat. Biotechnol. 16:359-63; Tyagi, and Kramer, 1996,
Nat. Biotechnology 14:303-308; and Tyagi, et al., 1998, Nat.
Biotechnol. 16:49-53), Invader technology (see, e.g., Neri et al.,
2000, Advances in Nucleic Acid and Protein Analysis 3826:117-125
and U.S. Pat. No. 6,706,471), nucleic acid sequence based
amplification (Nasba) (Compton, 1991), Scorpion technology
(Thelwell et al., 2000, Nuc. Acids Res, 28:3752-3761 and Solinas et
al., 2001, "Duplex Scorpion primers in SNP analysis and FRET
applications" Nuc. Acids Res, 29:20), restriction fragment length
polymorphism (RFLP) analysis, and the like.
[0080] The design and use of allele-specific probes for analyzing
polymorphisms are described by e.g., Saiki et al., 1986;
Dattagupta, EP 235,726; and Saiki, WO 89/11548. Briefly,
allele-specific probes are designed to hybridize to a segment of
target DNA from one individual but not to the corresponding segment
from another individual, if the two segments represent different
polymorphic forms. Hybridization conditions are chosen that are
sufficiently stringent so that a given probe essentially hybridizes
to only one of two alleles. Typically, allele-specific probes are
designed to hybridize to a segment of target DNA such that the
polymorphic site aligns with a central position of the probe.
[0081] Exemplary probes for analyzing deletions and polymorphisms
are shown in Table 1 of Example 1, but many others may be designed
by one of skill.
[0082] Allele-specific probes are often used in pairs, one member
of a pair designed to hybridize to the reference allele of a target
sequence and the other member designed to hybridize to the variant
allele. Several pairs of probes can be immobilized on the same
support for simultaneous analysis of multiple polymorphisms within
the same target gene sequence.
[0083] The design and use of allele-specific primers for analyzing
polymorphisms are described by, e.g., WO 93/22456 and Gibbs, 1989.
Briefly, allele-specific primers are designed to hybridize to a
site on target DNA overlapping a polymorphism and to prime DNA
amplification according to standard PCR protocols only when the
primer exhibits perfect complementarity to the particular allelic
form. A single-base mismatch prevents DNA amplification and no
detectable PCR product is formed. The method works best when the
polymorphic site is at the extreme 3'-end of the primer, because
this position is most destabilizing to elongation from the
primer.
[0084] Amplification products generated using PCR can be analyzed
by the use of denaturing gradient gel electrophoresis (DGGE).
Different alleles can be identified based on sequence-dependent
melting properties and electrophoretic migration in solution. See
Erlich, ed., PCR Technology, Principles and Applications for DNA
Amplification, Chapter 7 (W.H. Freeman and Co, New York, 1992).
[0085] Alleles of target sequences can be differentiated using
single-strand conformation polymorphism (SSCP) analysis. Different
alleles can be identified based on sequence- and
structure-dependent electrophoretic migration of single stranded
PCR products (Orita et al., 1989). Amplified PCR products can be
generated according to standard protocols, and heated or otherwise
denatured to form single stranded products, which may refold or
form secondary structures that are partially dependent on base
sequence.
[0086] Alleles of target sequences can be differentiated using
denaturing high performance liquid chromatography (DHPLC) analysis.
Different alleles can be identified based on base differences by
alteration in chromatographic migration of single stranded PCR
products (Frueh and Noyer-Weidner, 2003, Clin Chem Lab Med.
41(4):452-61). Amplified PCR products can be generated according to
standard protocols, and heated or otherwise denatured to form
single stranded products, which may refold or form secondary
structures that are partially dependent on the base sequence.
[0087] Direct sequence analysis of polymorphisms can be
accomplished using DNA sequencing procedures that are well-known in
the art. See Sambrook et al., MOLECULAR CLONING, A LABORATORY
MANUAL (2nd Ed., CSHP, New York 1989) and Zyskind et al.,
RECOMBINANT DNA LABORATORY MANUAL (Acad. Press, 1988).
[0088] Homozygote deletions can be identified by a variety of
methods known in the art. For example, in one approach DNA samples
are amplified for further analysis. In an embodiment, two
CFHR1-specific primer pairs are used, for instance, ("CFHL1ex6.F"
[5'-AGTCGGTTTGGACAGTG-3' (SEQ ID NO: 7)]& "CFHL1ex6R"
[5'-GCACAAGTTGGATACTCC-3' (SEQ ID NO: 8)]; and/or "CHFL1ex6.F2"
[5'-CATAGTCGGTTTGGACAGTG-3' (SEQ ID NO: 9)]& "CFHL1ex6.R"
[5'-GCACAAGTTGGATACTCC-3' (SEQ ID NO: 8)]). In another embodiment,
CFHR3-specific primer pairs are used. for instance, ("CFHL3ex3.F"
[5'-TCATTGCTATGTCCTTAGG-4' (SEQ ID NO: 10)]& "CFHL3ex3.R"
[5'-TCTGAGACTGTCGTCCG-3' (SEQ ID NO: 11)]; and/or "CFHL3ex3seq.F"
[5'-TTTTGGATGTTTATGCG-3' (SEQ ID NO: 12)]& "CFHL3ex3seq.R"
[5'-AAATAGGTCCGTTGGC-3' (SEQ ID NO: 13)]). Absence of the
correct-sized PCR product indicates that the CFHL1 and/or CFHL3
gene(s) are deleted.
[0089] Similarly, heterozygote deletions can be identified by a
variety of methods known in the art. For example, in one approach
DNA samples are amplified for further analysis, for example with
the same primers listed above, followed by direct sequencing.
Heterozygotes are characterized, for instance, by chromatograms in
which one peak is approximately half the height of the second peak
(in contrast to equal sized peaks) at the SNP positions (rs460897,
rs16840561, rs4230, rs414628 for CFHR1; rs1061170 for CFHR3). In
another embodiment, a protocol employing ParAllele genotyping data,
a copy number analysis is performed, in which samples that fail to
genotype key markers (MRD.sub.--3855, MRD.sub.--3856,
MRD.sub.--3857, rs385390, rs389897) in the region of these two
genes are identified. All samples assigned a copy number of 0
(designated CN0) allow the haplotypes that contain the deletion to
be defined. Having defined a deletion haplotype, linkage
disequilibrium is used to infer whether samples could not carry a
deletion. Specifically, if a sample is homozygous for a different
allele than one that defines the haplotype, then it does not carry
a deletion.
[0090] A wide variety of other methods are known in the art for
detecting polymorphisms in a biological sample. For example and not
limitation, see, e.g., Ullman et al. "Methods for single nucleotide
polymorphism detection" U.S. Pat. No. 6,632,606; Shi, 2002,
"Technologies for individual genotyping: detection of genetic
polymorphisms in drug targets and disease genes" Am J
Pharmacogenomics 2:197-205; and Kwok et al., 2003, "Detection of
single nucleotide polymorphisms" Curr Issues Biol. 5:43-60).
3.2 Analysis of Protein Samples
[0091] Methods for protein analysis that can be adapted for
detection of proteins such as the CFHR1 and CFHR3 gene products and
variants or fragments thereof are well known. These methods include
analytical biochemical methods such as electrophoresis (including
capillary electrophoresis and one- and two-dimensional
electrophoresis), chromatographic methods such as high performance
liquid chromatography (HPLC), thin layer chromatography (TLC),
hyperdiffusion chromatography, mass spectrometry, and various
immunological methods such as fluid or gel precipitin reactions,
immunodiffusion (single or double), immunoelectrophoresis,
radioimmnunoassay (RIA), enzyme-linked immunosorbent assays
(ELISAs), immunofluorescent assays, Western blotting and
others.
[0092] For example, a number of well established immunological
binding assay formats suitable for the practice of the invention
are known (see, e.g., Harlow, E.; Lane, D. ANTIBODIES: A LABORATORY
MANUAL. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory;
1988; and Ausubel et al., (2004) CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John Wiley & Sons, New York N.Y. The assay may be, for
example, competitive or non-competitive. Typically, immunological
binding assays (or immunoassays) utilize a "capture agent" to
specifically bind to and, often, immobilize the analyte. In one
embodiment, the capture agent is a moiety that specifically binds
to a variant or wild-type CFHR1 or CFHR3 polypeptide or subsequence
(e.g., a fragment or truncated form of CFHR1 or CFHR3). The bound
protein may be detected using, for example, a detectably labeled
anti-CFHR1 or anti-CFHR3 antibody.
3.3 Screening Using Multiple Polymorphisms and Markers
[0093] In diagnostic methods, analysis of CFHR1 and/or CFHR3
polymorphisms can be combined with analysis of polymorphisms in
other genes associated with AMD or vascular disease (e.g., AAA),
detection of protein markers of AMD (see, e.g., Hageman et al.,
patent publications US 20030017501; US 20020102581; WO0184149; and
WO0106262; and U.S. patent application Ser. No. 11/706,154
(entitled "Protective Complement Proteins and Age-Related Macular
Degeneration") and Ser. No. 11/706,074 (entitled "Variants in
Complement Regulatory Genes Predict Age-Related Macular
Degeneration"); Gorin et al., US20060281120; and Hoh,
WO2007/044897, each of which are incorporated herein by reference
in their entirety for all purposes), assessment of other risk
factors of AMD or vascular disease (such as family history).
[0094] For example, analysis of CFHR1 and/or CFHR3 polymorphisms
(e.g., deletions) can be combined with the analysis of
polymorphisms in the Complement Factor H gene (CFH). Genetic
variants of the CFH gene that may be detected include, but are not
limited to, a genotype of a T at position 1277 of the coding region
of human CFH, any one or more of rs529825; rs800292; rs3766404;
rs1061147; rs1061170; and rs203674; any one of more of intron 2
(IVS2 or insTT); rs2274700; exon 10A; and rs375046; one or both of
rs529825 and rs800292; one or more of rs1061147, rs1061170 and
rs203674; at least one of rs529825 and rs800292; and rs3766404; and
at least one of rs1061147, rs1061170 and rs203674; at least
rs529825, rs800292, rs3766404, rs1061170, and rs203674; and/or exon
22 (R1210C). See. e.g., Hartman et al., 2006, "HTRA1 promoter
polymorphism in wet age-related macular degeneration" Science
314:989-92, incorporated herein by reference.
[0095] In certain embodiments, the analysis of CFHR1 and/or CFHR3
polymorphisms can be combined with analysis of polymorphisms in the
HTRA1 gene (also known as the PRSS11 gene), the complement factor B
(BF) gene, and/or the complement component 2 (C2) gene. Genetic
variants of the HTRA1 gene that may be detected include, but are
not limited to, at least one of rs10490924, rs11200638, rs760336,
and rs763720. Each of the single nucleotide polymorphisms (SNPs)
within the HTRA1 gene are associated with increased risk of
developing AMD. The genetic variants of the BF gene that may be
detected include the presence of an A or G at rs641153 of the BF
gene, or an R or Q at position 32 of the BF protein; and/or an A or
T at rs4151667 of the BF gene, or L or H at position 9 of the BF
protein. The genetic variants of the C2 protein that may be
detected include a G or T at rs547154 of the C2 gene; and/or a C or
G at rs9332379 of the C2 gene, or E of D at position 318 of the C2
protein. See, e.g., Gold et al., 2006 "Variation in factor B (BF)
and complement component 2 (C2) genes is associated with
age-related macular degeneration" Nat Genet. 38:458-62.
[0096] In addition, the analysis of CFHR1 and/or CFHR3
polymorphisms can be combined with an analysis of protein markers
associated with AMD. The protein markers may include, but are not
limited to, fibulin-3, vitronectin, .beta.-crystallin A2,
.beta.-crystallin A3, .beta.-crystallin A4, .beta.-crystallin S,
glucose-regulated protein 78 kD (GRP-78), calreticulin, 14-3-3
protein epsilon, serotransferrin, albumin, keratin, pyruvate
carboxylase, villin 2, complement 1 q binding protein/hyaluronic
acid binding protein ("complement 1 q component"), amyloid A (al
amyloid A), amyloid P component, C5 and CSb-9 terminal complexes,
HLA-DR, fibrinogen, Factor X, prothrombin, complements 3, 5 and 9,
complement reactive protein (CRP), HLA-DR, apolipoprotein A,
apolipoprotein E, antichymotrypsin, p2 microglobulin,
thrombospondin, elastin, collagen, ICAM-1, LFA1, LFA3, B7, IL-1,
IL-6, IL-12, TNF-alpha, GM-CSF, heat shock proteins, colony
stimulating factors (GM-CSF, M-CSFs), and IL-10.
4. Therapeutic Methods
[0097] In an embodiment, the invention provides methods of
treatment and/or prophylaxis of diseases associated with a deletion
within a CFHR1 and/or CFHR3 gene, or with reduced amount or
activity of a CFHR1 and/or CFHR3 gene product, though the
administration of a CFHR1 or CFHR3 polypeptide, or at least one
portion of a CFHR1 and/or a CFHR3 polypeptide, or mixtures thereof,
to a subject. In one instance, the disease is vascular disease.
[0098] In an embodiment, the invention provides methods of
treatment and/or prophylaxis of diseases associated with an absence
of a deletion within a CFHR1 and/or CFHR3 gene, or with unchanged
or increased amount or activity of a CFHR1 and/or CFHR3 gene
product, though the administration of at least one agent that
reduces or inhibits CFHR1 or CFHR3 polypeptide to a subject. In one
instance, the disease is AMD.
4.1 Prevention and Treatment of Vascular Disorders
[0099] A subject identified as having an elevated likelihood of
developing a vascular disorder (e.g., aneurysm) can be treated by
administering CFHR1 and/or CFHR3 polypeptides or biologically
active fragments or variants thereof. The therapeutic polypeptide
can be administered systemically (e.g., by intravenous infusion) or
locally (e.g., directly to an organ or tissue, such as the eye or
the liver). The polypeptides may have the sequence of wild-type
(naturally occurring) polypeptides or may have an amino acid
sequence substantially identical to the naturally occurring
form.
[0100] CFHR1 and CFHR3 polypeptides or biologically active
fragments or variants thereof may be isolated from blood (serum or
plasma) or produced using conventional recombinant technology (see
Ausubel et al., 2004, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY,
Greene Publishing and Wiley-Interscience, New York). Recombinant
expression generally involved introducing the CFHR1 or CFHR3 gene
into an expression vector that include a promoter to drive
transcription of the DNA which is adapted for expression in
prokaryotic (e.g., E. coli) and eukaryotic (e.g., yeast, insect or
mammalian cells) hosts. Suitable host cells include bacteria such
as E. coli, yeast, filamentous fungi, insect cells, and mammalian
cells, which are typically immortalized, including mouse, hamster,
human, and monkey cell line. Usually, the promoter is a eukaryotic
promoter for expression in a mammalian cell. Usually, transcription
regulatory sequences comprise a heterologous promoter and
optionally an enhancer, which is recognized by the host cell.
Commercially available expression vectors can be used. Expression
vectors can include host-recognized replication systems,
amplifiable genes, selectable markers, host sequences useful for
insertion into the host genome, and the like.
[0101] In another embodiment the recombinant CFHR1 or CFHR3 is a
full-length polypeptide, a variant thereof, or fragment thereof. In
one embodiment the fragment is a biologically active fragment. In
this context, a biologically active CFHR1 or CFHR3 polypeptide has
an activity associated with wild-type CFHR1 or CFHR3. For example,
in some embodiments the fragment has heparin and/or CRP and/or
C3b-protein binding activity. Preferably the fragment has
substantial sequence identity to at least a portion of the
wild-type proteins. Biologically active fragments may comprise
varying lengths of sequence substantially identical to wild-type
proteins, such as, for example, at least 100, 200, 500, 700, 900 or
1100 residues. Alternatively, biologically active fragments may
comprise at least one SCR substantially identical to CFHR1 or
CFHR3, preferably at least 2, 3, 4, or 5 SCRs.
[0102] In specific embodiments, the biologically active fragment
includes at least SCR 6-7. In another embodiment, the biologically
active fragment includes at least SCR 19-20. In another embodiment,
the biologically active CFH includes at least SCR1.
[0103] In certain embodiments the therapeutic Factor H polypeptides
are chimeric or fusion proteins, and comprise sequence from other
proteins. For example, a therapeutic Factor H polypeptide may
contain portions of human CFHR1 or CFHR3 as well as portions
comprised, at least in part, of SCR (or CCP) consensus domains from
other proteins (e.g., CR1, MCP, DAF, C4BP, CR2, CFH) and/or
artificial SCR (CCP) consensus sequences. See U.S. Pat. No.
5,545,619, incorporated herein by reference.
4.1.1 Therapeutic Compositions Containing CFHR1 or CFHR3
Polypeptides
[0104] The invention provides therapeutic preparations of CFHR1 or
CFI-1R3 polypeptides, which may be wild-type or variants (e.g.,
neutral or protective variants), and may be full length forms,
truncated forms, or biologically active fragments, including splice
variants and recombinant fusion proteins. Therapeutic CFHR1 or
CFHR3 polypeptides can be made recombinantly. Therapeutic proteins
can be recombinantly produced (e.g., in cultured bacterial or
eukaryotic cells) and purified using methods well known in the art
and described herein. Alternatively, CFHR1 or CFHR3 polypeptides
can be isolated from cultured RPE cells (e.g., primary cultures) or
other cells that express CFHR1 or CFHR3 endogenously. Recombinant
or purified polypeptides subject to FDA approval must be tested for
potency and identity, be sterile, be free of extraneous material,
and all ingredients in a product (i.e., preservatives, diluents,
adjuvants, and the like) must meet standards of purity, quality,
and not be deleterious to the patient.
[0105] The invention provides a composition comprising a CFHR1
polypeptide or CFHR3 polypeptide, and a pharmaceutically acceptable
excipient or carrier. The term "pharmaceutically acceptable
excipient or carrier" refers to a medium that is used to prepare a
desired dosage form of a compound. A pharmaceutically acceptable
excipient or carrier can include one or more solvents, diluents, or
other liquid vehicles; dispersion or suspension aids; surface
active agents; isotonic agents; thickening or emulsifying agents;
preservatives; solid binders; lubricants; and the like. Remington's
Pharmaceutical Sciences, Fifteenth Edition, E.W. Martin (Mack
Publishing Co., Easton, Pa., 1975) and Handbook of Pharmaceutical
Excipients, Third Edition, A. H. Kibbe ed. (American Pharmaceutical
Assoc. 2000), disclose various carriers used in formulating
pharmaceutical compositions and known techniques for the
preparation thereof. The pharmaceutical compositions may be
formulated using slow release agents or biodegradeable agents
following techniques known in the art. In one embodiment, the
pharmaceutically acceptable excipient is not deleterious to a
mammal (e.g., human patient) if administered to the eye (e.g., by
intraocular injection). For intraocular administration, for example
and not limitation, the therapeutic agent can be administered in a
Balanced Salt Solution (BSS) or Balanced Salt Solution Plus (BSS
Plus) (Alcon Laboratories, Fort Worth; Texas, USA). In a related
aspect, the invention provides a sterile container, e.g. vial,
containing a therapeutically acceptable CFHR1 or CFHR3
polypeptides, optionally as a lyophilized preparation.
[0106] The amount of CFHR1 or CFHR3 polypeptide, or biologically
active fragment thereof, to be administered to an individual can be
determined. In one embodiment, exogenous CFHR1 or CFHR3 can be
administered to an individual in an amount sufficient to achieve a
level similar to the plasma concentration of CFHR1 or CFHR3 in a
healthy individual, i.e., an amount sufficient to achieve a plasma
level of from about 50 to 600 micrograms/ml, such as from about 100
to 560 micrograms/ml. The amount of CFHR1 or CFHR3 to be
administered to an individual (e.g., a 160 pound subject) can be,
for example and not for limitation, from about 10 milligrams to
about 5000 milligrams per dose, from about 50 milligrams to about
2000 milligrams per dose, from about 100 milligrams to about 1500
milligrams per dose, from about 200 milligrams to about 1000
milligrams per dose, or from about 250 milligrams to about 750
milligrams per dose. The frequency with which CFHR1 or CFHR3 can be
administered to an individual can be, for example and not for
limitation, twice per day, once per day, twice per week, once per
week, once every two weeks, once per month, once every two months,
once every six months, or once per year. The amount and frequency
of administration of CFHR1 or CFHR3 to an individual can be readily
determined by a physician by monitoring the course of
treatment.
[0107] Alternatively, the CFHR1 or CFHR3 polypeptide, or
biologically active fragment thereof, can be administered to an
individual using gene therapy or cell therapy methods as described
further below.
4.1.2 Gene Therapy Methods
[0108] In another approach, CFHR1 or CFHR3 polypeptide is
administered by in vivo expression of protein encoded by exogenous
polynucleotide (i.e., via gene therapy). In one example, gene
therapy involves introducing into a cell a vector that expresses
CFHR1 or CFHR3 polypeptides or biologically active fragments of
CFHR1 or CFHR3. The cell may be an endogenous cell (i.e., a cell
from the patient) or engineered exogenous cell.
[0109] Vectors can be viral or nonviral. A number of vectors
derived from animal viruses are available, including those derived
from adenovirus, adeno-associated virus, retroviruses, pox viruses,
alpha viruses, rhadboviruses, and papillomaviruses. Usually the
viruses have been attenuated to no longer replicate (see, e.g., Kay
et al. 2001, Nature Medicine 7:33-40).
[0110] The nucleic acid encoding the polypeptide is typically
linked to regulatory elements, such as a promoters and an
enhancers, which drive transcription of the DNA in the target cells
of an individual. The promoter may drive expression of the gene in
all cell types. Alternatively, the promoter may drive expression of
the CFHR1 or CFHR3 gene only in specific cell types, for example,
in cells of the retina, the liver or the kidney. The regulatory
elements, operably linked to the nucleic acid encoding the
polypeptide, are often cloned into a vector.
[0111] As will be understood by those of skill in the art, gene
therapy vectors contain the necessary elements for the
transcription and translation of the inserted coding sequence (and
may include, for example, a promoter, an enhancer, other regulatory
elements). Promoters can be constitutive or inducible. Promoters
can be selected to target preferential gene expression in a target
tissue, such as the RPE (for recent reviews see Sutanto et al.,
2005, "Development and evaluation of the specificity of a cathepsin
D proximal promoter in the eye" Curr Eye Res. 30:53-61; Zhang et
al., 2004, "Concurrent enhancement of transcriptional activity and
specificity of a retinal pigment epithelial cell-preferential
promoter" Mol Vis. 10:208-14; Esumi et al., 2004, "Analysis of the
VMD2 promoter and implication of E-box binding factors in its
regulation" J Biol Chem 279:19064-73; Camacho-Hubner et al., 2000,
"The Fugu rubripes tyrosinase gene promoter targets transgene
expression to pigment cells in the mouse" Genesis. 28:99-105; and
references therein).
[0112] Suitable viral vectors include DNA virus vectors (such as
adenoviral vectors, adeno-associated virus vectors, lentivirus
vectors, and vaccinia virus vectors), and RNA virus vectors (such
as retroviral vectors). In one embodiment, an adeno-associated
viral (AAV) vector is used. For recent reviews see Auricchio et
al., 2005, "Adeno-associated viral vectors for retinal gene
transfer and treatment of retinal diseases" Curr Gene Ther.
5:339-48; Martin et al., 2004, Gene therapy for optic nerve
disease, Eye 18:1049-55; Ali, 2004, "Prospects for gene therapy"
Novartis Found Symp. 255:165-72; Hennig et al., 2004, "AAV-mediated
intravitreal gene therapy reduces lysosomal storage in the retinal
pigmented epithelium and improves retinal function in adult MPS VII
mice" Mol Ther. 10:106-16; Smith et al., 2003, "AAV-Mediated gene
transfer slows photoreceptor loss in the RCS rat model of retinitis
pigmentosa" Mol Ther. 8:188-95; Broderick et al., 2005, "Local
administration of an adeno-associated viral vector expressing IL-10
reduces monocyte infiltration and subsequent photoreceptor damage
during experimental autoimmune uveitis" Mol Ther. 12:369-73; Cheng
et al., 2005, "Efficient gene transfer to retinal pigment
epithelium cells with long-term expression. Retina 25:193-201; Rex
et al., "Adenovirus-mediated delivery of catalase to retinal
pigment epithelial cells protects neighboring photoreceptors from
photo-oxidative stress. Hum Gene Ther. 15:960-7; and references
cited therein).
[0113] Gene therapy vectors must be produced in compliance with the
Good Manufacturing Practice (GMP) requirements rendering the
product suitable for administration to patients. The present
invention provides gene therapy vectors suitable for administration
to patients including gene therapy vectors that are produced and
tested in compliance with the GMP requirements. Gene therapy
vectors subject to FDA approval must be tested for potency and
identity, be sterile, be free of extraneous material, and all
ingredients in a product (i.e., preservatives, diluents, adjuvants,
and the like) must meet standards of purity, quality, and not be
deleterious to the patient. For example, the nucleic acid
preparation is demonstrated to be mycoplasma-free. See, e.g, Islam
et al., 1997, An academic centre for gene therapy research and
clinical grade manufacturing capability, Ann Med 29, 579-583.
[0114] Methods for administering gene therapy vectors are known. In
one embodiment, CFHR1 or CFHR3 expression vectors are introduced
systemically (e.g., intravenously or by infusion). In one
embodiment, expression vectors are introduced locally (i.e.,
directly to a particular tissue or organ, e.g., liver). In one
embodiment, expression vectors are introduced directly into the eye
(e.g., by intraocular injection). As will be understood by those of
skill in the art, the promoter chosen for the expression vectors
will be dependent upon the target cells expressing the CFHR1 or
CFHR3 polypeptides. In some embodiments, a cell type-specific
promoter is used and in other embodiments, a constitutive or
general promoter is used. For recent reviews see, e.g., Dinculescu
et al., 2005, "Adeno-associated virus-vectored gene therapy for
retinal disease" Hum Gene Ther. 16:649-63; Rex et al., 2004,
"Adenovirus-mediated delivery of catalase to retinal pigment
epithelial cells protects neighboring photoreceptors from
photo-oxidative stress" Hum Gene Ther. 15:960-7; Bennett, 2004,
"Gene therapy for Leber congenital amaurosis" Novartis Found Symp.
255:195-202; Hauswirth et al., "Range of retinal diseases
potentially treatable by AAV-vectored gene therapy" Novartis Found
Symp. 255:179-188, and references cited therein).
[0115] Thus in one aspect, the invention provides a preparation
comprising a gene therapy vector encoding a CFHR1 or CFHR3
polypeptide, optionally a viral vector, where the gene therapy
vector is suitable for administration to a human subject and in an
excipient suitable for administration to a human subject (e.g.,
produced using GLP techniques). Optionally the gene therapy vector
comprises a promoter that is expressed preferentially or
specifically in retinal pigmented epithelium cells.
[0116] Nonviral methods for introduction of CFHR1 or CFHR3 gene
sequences, such as encapsulation in biodegradable polymers (e.g.,
polylactic acid (PLA); polyglycolic acid (PGA); and co-polymers
(PLGA) can also be used (for recent reviews see, e.g., Bejjani et
al., 2005, "Nanoparticles for gene delivery to retinal pigment
epithelial cells" Mol Vis. 11:124-32; Mannermaa et al., 2005,
"Long-lasting secretion of transgene product from differentiated
and filter-grown retinal pigment epithelial cells after nonviral
gene transfer" Curr Eye Res. 2005 30:345-53; and references cited
therein). Alternatively, the nucleic acid encoding a CFHR1 or CFHR3
polypeptide may be packaged into liposomes, or the nucleic acid can
be delivered to an individual without packaging without using a
vector.
4.1.3. Cell Therapy Methods
[0117] In another approach, CFHR1 or CFHR3 polypeptide is
administered by in vivo expression of protein encoded by endogenous
or exogenous CFHR1 or CFHR3 polynucleotide (i.e., via cell
therapy). For example, hepatocyte transplantation has been used as
an alternative to whole-organ transplantation to support many forms
of hepatic insufficiency (see, e.g., Ohashi et al., Hepatocyte
transplantation: clinical and experimental application, J Mol Med.
2001 79:617-30). According to this method, hepatocytes or other
CFHR1- or CFHR3-expressing cells are administered (e.g., infused)
to a patient in need of treatment. These cells migrate to the liver
or other organ, and produce the therapeutic protein. Also see,
e.g., Alexandrova et al., 2005, "Large-scale isolation of human
hepatocytes for therapeutic application" Cell Transplant.
14(10):845-53; Cheong et al., 2004, "Attempted treatment of factor
H deficiency by liver transplantation" Pediatr Nephrol. 19:454-8;
Ohashi et al., 2001, "Hepatocyte transplantation: clinical and
experimental application" J Mol Med. 79:617-30; Serralta et al.,
2005, "Influence of preservation solution on the isolation and
culture of human hepatocytes from liver grafts" Cell Transplant.
14(10):837-43; Yokoyama et al., 2006, "In vivo engineering of
metabolically active hepatic tissues in a neovascularized
subcutaneous cavity" Am. J. Transplant. 6(1):50-9; Dhawan et al.,
2005, "Hepatocyte transplantation for metabolic disorders,
experience at King's College hospital and review of literature."
Acta Grastroenterol. Belg. 68(4):457-60; Bruns et al., 2005,
"Injectable liver: a novel approach using fibrin gel as a matrix
for culture and intrahepatic transplantation of hepatocytes" Tissue
Eng. 11(11-12):1718-26. Other cell types that may be used include,
for illustration and not limitation, kidney and pancreatic cells.
In one embodiment, the administered cells are engineered to express
a recombinant form of the CFHR1 or CFHR3 protein.
[0118] In another, related approach, therapeutic organ
transplantation is used. Most of the body's systemic CFHR1 and
CFHR3 is produced by the liver, making transplantation of liver
tissue the preferred method. See, Gerber et al., 2003, "Successful
(?) therapy of hemolytic-uremic syndrome with factor H abnormality"
Pediatr Nephrol. 18:952-5.
[0119] In another approach, a CFHR1 or CFHR3 protein is delivered
to the back of the eye by injection into the eye (e.g.,
intravitreal) or via encapsulated cells. Neurotech's Encapsulated
Cell Technology (ECT), as an example, is a unique technology that
allows for the sustained, longterm delivery of therapeutic factors
to the back of the eye. See (http://www.neurotech.fr). ECT implants
consist of cells that have been genetically modified to produce a
specific therapeutic protein that are encapsulated in a
semi-permeable hollow fiber membrane. The cells continuously
produce the therapeutic protein that diffuses out of the implant
and into the eye (Bush et al., 2004, "Encapsulated cell-based
intraocular delivery of ciliary neurotrophic factor in normal
rabbit: dose-dependent effects on ERG and retinal histology" Invest
Ophthalmol Vis Sci. 45:2420-30). CNTF delivered to the human eye by
ECT devices was recently shown to be completely successful and
associated with minimal complications in 10 patients enrolled in a
Phase I clinical trial (Sieving et al., 2006, "Ciliary neurotrophic
factor (CNTF) for human retinal degeneration: phase I trial of CNTF
delivered by encapsulated cell intraocular implants" Proc Natl Acad
Sci USA 103(10):3896-901). Also see Song et al., 2003,
"Photoreceptor protection by cardiotrophin-1 in transgenic rats
with the rhodopsin mutation s334ter" IOVS, 44(9):4069-75; Tao et
al., 2002, "Encapsulated Cell-Based Delivery of CNTF Reduces
Photoreceptor Degeneration in Animal Models of Retinitis
Pigmentosa" IOVS, 43 10:3292-3298; and Hammang et al., U.S. Pat.
No. 6,649,184.
[0120] In one embodiment of the present invention, a form of CFHR1
or CFHR3 is expressed in cells and administered in an encapsulated
form. In one embodiment, the cells used are the NTC-201 human RPE
line (ATCC #CRL-2302) available from the American Type Culture
Collection P.O. Box 1549, Manassas, Va. 20108.
4.2 Prevention and Treatment of AMD
[0121] A subject identified as having an elevated likelihood of
developing AMD, exhibiting symptoms of AMD, or susceptible to AMD,
can be treated by reducing the expression, activity or amount of a
gene product of the CFHR1 and/or CFHR3 genes. Any method of
reducing levels of CFHR1 or CFHR3 in the eye or systemically may be
used for treatment including, for example, inhibiting transcription
of a CFHR1 or CFHR3 gene, inhibiting translation of CFHR1 or CFHR3
RNA, decreasing the amount or activity of CFHR1 or CFHR3 proteins
(e.g., by plasmaphoresis, antibody-directed plasmaphoresis, or
complexing with a CFHR1 or CFHR3 binding moiety (e.g., heparin or
antibody), or by administration of inhibitory nucleic acids. In
some embodiments levels of CFHR1 or CFHR3 are preferentially
reduced in the eye (e.g., RPE) relative to other tissues. For
illustration and not limitation, several methods are briefly
described below.
4.2.1 Inhibitory Nucleic Acids
[0122] Inhibitory nucleic acids are known and include antisense
nucleic acids, interfering RNAs, ribozymes and others (see, e.g.,
Gomes et al., 2005, "Intraocular delivery of oligonucleotides" Curr
Pharm Biotechnol. 6:7-15; and Henry et al., 2004, "Setting sights
on the treatment of ocular angiogenesis using antisense
oligonucleotides" Trends Pharmacol Sci 25:523-7; PCT Publications
WO 98/53083; WO 99/32619; WO 99/53050; WO 00/44914; WO 01/36646; WO
01/75164; WO 02/44321; and U.S. Pat. No. 6,107,094; Sui et al.,
2002, "A DNA vector-based RNAi technology to suppress gene
expression in mammalian cells" Proc Natl Acad Sci USA 99:5515-20;
and Kasahara and Aoki, 2005, "Gene silencing using adenoviral RNA
vector in vascular smooth muscle cells and cardiomyocytes" Methods
Mol Med. 112:155-72; U.S. Pat. No. 6,180,399; U.S. Pat. No.
5,869,254; U.S. Pat. No. 6,025,167; U.S. Pat. No. 5,854,038; U.S.
Pat. No. 5,591,610; U.S. Pat. No. 5,667,969; U.S. Pat. No.
5,354,855;U.S. Pat. No. 5,093,246; U.S. Pat. No. 5,180,818; U.S.
Pat. No. 5,116,742; U.S. Pat. No. 5,037,746; and U.S. Pat. No.
4,987,071; Dawson et al., 2000, "Hammerhead ribozymes selectively
suppress mutant type I collagen mRNA in osteogenesis imperfecta
fibroblasts" Nucleic Acids Res. 28:4013-20; Blalock et al., 2004
"Hammerhead ribozyme targeting connective tissue growth factor mRNA
blocks transforming growth factor-beta mediated cell proliferation"
Exp Eye Res. 78:1127-36; Kuan et al., 2004, "Targeted gene
modification using triplex-forming oligonucleotides" Methods Mol
Biol. 262:173-94.
[0123] It will be understood that inhibitory nucleic acids can be
administered as a pharmaceutical composition or using gene therapy
or cell therapy methods.
4.2.2 Antibodies and Antibody Therapy
[0124] In one aspect, an anti-CFHR1 or anti-CFHR3 binding agents
(e.g., antibodies) that reduce the activity or amount of the
proteins is administered to an individual with or at risk for AMD.
The antibody can be administered systemically or locally (see,
e.g., Gaudreault et al., 2005, "Preclinical pharmacokinetics of
Ranibizumab (rhuFabV2) after a single intravitreal administration"
Invest Ophthalmol Vis Sci. 46:726-33).
[0125] In one embodiment, an anti-CFHR1 antibody specifically binds
an epitope of CFHR1, in particular human CFHR1. In certain
embodiments, an anti-CFHR1 antibody specifically binds an epitope
located within the amino-terminus of a CFHR1 polypeptide. In
particular, an anti-CFHR1 antibody specifically binds an epitope
located between amino acids 1-143 of SEQ ID NO: 4 as shown in FIG.
6. In other embodiments, an anti-CFHR1 antibody specifically binds
an epitope within the CFHR1 short consensus repeats (SCRs) 6 and/or
7 as shown in FIG. 1. The amino acid sequence of CFHR1 SCR6 is 35%
homologous to the corresponding CFH SCR, and the amino acid
sequence of CFHR SCR7 is 45% homologous to the corresponding CFH
SCR. Anti-CFHR1 antibodies of the invention specifically bind CFHR1
and do not cross-react with CFH or other factor H related proteins
including CFHT, CFHR2, CFHR3, CFHR4, or CFHR5. A variety of
immunoassay formats may be used to select antibodies that are
specifically immunoreactive with a particular protein. For example,
solid-phase ELISA immunoassays are routinely used to select
monoclonal antibodies specifically immunoreactive with an antigen.
See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold
Spring Harbor Publications, New York. Epitope mapping of the CFHR1
protein is within the skill of the art to determine epitopes that
are most immunogenic for the generation of anti-CFHR1
antibodies.
[0126] In another embodiment, an anti-CFHR3 antibody specifically
binds an epitope of CFHR3, in particular human CFHR3. In certain
embodiments, an anti-CFHR3 antibody specifically binds an epitope
located within the carboxyl-terminus of a CFHR3 polypeptide. For
example, an anti-CFHR3 antibody may specifically bind to an epitope
between amino acids 144-330 of SEQ ID NO: 6 as shown in FIG. 6. In
other embodiments, an anti-CFHR3 antibody specifically binds an
epitope within the CHFR3 SCRs 8, 19 and/or 20 as shown in FIG. 1.
The amino acid sequence of CFHR3 SCR8 is 63% homologous to the
corresponding CRH SCR, the amino acid sequence of CFHR3 SCR19 is
62% homologous to the corresponding CFH SCR, and the amino acid
sequence of CFHR3 SCR20 is 36% homologous to the corresponding CFH
SCR. Anti-CFHR3 antibodies of the invention specifically bind CFHR3
and do not cross-react with CFH or other factor H related proteins
including CFHT, CFHR1, CFHR2, CFHR4, or CFHR5. Epitope mapping of
the CFHR3 protein is within the skill of the art to determine
epitopes that may be immunogenic for the generation of anti-CFHR3
antibodies.
[0127] It is understood that each of the antibodies discussed above
can be an intact antibody, for example, a monoclonal antibody.
Alternatively, the binding protein can be an antigen binding
fragment of an antibody, or can be a biosynthetic antibody binding
site. Antibody fragments include Fab, Fab', (Fab').sub.2 or Fv
fragments. Techniques for making such antibody fragments are known
to those skilled in the art. A number of biosynthetic antibody
binding sites are known in the art and include, for example, single
Fv or sFv molecules, described, for example, in U.S. Pat. No.
5,476,786. Other biosynthetic antibody binding sites include
bispecific or bifunctional binding proteins, for example,
bispecific or bifunctional antibodies, which are antibodies or
antibody fragments that bind at least two different antigens. For
example, bispecific binding proteins can bind CFHR1, CFHR3, and/or
another antigen.
[0128] Methods for making bispecific antibodies are known in art
and, include, for example, by fusing hybridomas or by linking Fab'
fragments. See, e.g., Songsivilai et al. (1990) CLIN. EXP. IMMUNOL.
79: 315-325; Kostelny et al. (1992) J. IMMUNOL. 148: 1547-1553.
[0129] Anti-CFHR1 and anti-CFHR3 antibodies can be produced using
techniques well known in the art. Monoclonal antibodies can be
produced using standard fusion techniques for forming hybridoma
cells. See G. Kohler, et al., Nature, 256:456 (1975).
Alternatively, monoclonal antibodies can be produced from cells by
the method of Huse, et al., Science, 256:1275 (1989).
[0130] It is understood that the CDRs of the antibodies described
herein confer the binding specificity to CFHR1 or CFHR3. The
antibodies described herein can be used as diagnostic and/or
therapeutic agents. It is understood that the antibodies of the
invention can be modified to optimize performance depending upon
the intended use of the antibodies. For example, when the antibody
is being used as a therapeutic agent, the antibody can be modified
to reduce its inmmunogenicity in the intended recipient.
Alternatively or in addition, the antibody can be fused or coupled
to another protein or peptide, for example, a growth factor,
cytokine, or cytotoxin. Such modifications can be achieved by using
routine gene manipulation techniques known in the art.
[0131] Various techniques for reducing the antigenicity of
antibodies and antibody fragments are known in the art. These
techniques can be used to reduce or eliminate the antigenicity of
the antibodies of the invention. For example, when the antibodies
are to be administered to a human, the antibodies preferably are
engineered to reduce their antigenicity in humans. This process
often is referred to as humanization. Preferably, the humanized
binding proteins have the same or substantially the same affinity
for the antigen as the original non-humanized binding protein it
was derived from.
[0132] In one well known humanization approach, chimeric proteins
are created in which immunoglobulin constant regions of antibodies
from one species, e.g., mouse, are replaced with immunoglobulin
constant regions from a second, different species, e.g., a human.
In this example, the resulting antibody is a mouse-human chimera,
where the human constant region sequences, in principle, are less
immunogenic than the counterpart murine sequences. This type of
antibody engineering is described, for example, Morrison, et al.
(1984) Proc. Nat. Acad. Sci. 81: 6851-6855, Neuberger et al., 1984,
Nature 312: 604-608; U.S. Pat. No. 6,893,625 (Robinson); U.S. Pat.
No. 5,500,362 (Robinson); and U.S. Pat. No. 4,816,567
(Cabilly).
[0133] In another approach, known as CDR grafting, the CDRs of the
light and heavy chain variable regions of an antibody of interest
are grafted into frameworks (FRs) from another species. For
example, murine CDRs can be grafted into human FR sequences. In
some embodiments, the CDRs of the light and heavy chain variable
regions of an anti-CFHR1 antibody or an anti-CFHR3 antibody are
grafted into human FRs or consensus human FRs. In order to create
consensus human FRs, FRs from several human heavy chain or light
chain amino acid sequences are aligned to identify a consensus
amino acid sequence. CDR grafting is described, for example, in
U.S. Pat. No. 7,022,500 (Queen); U.S. Pat. No. 6,982,321 (Winter);
U.S. Pat. No. 6,180,370 (Queen); U.S. Pat. No. 6,054,297 (Carter);
U.S. Pat. No. 5,693,762 (Queen); U.S. Pat. No. 5,859,205 (Adair);
U.S. Pat. No. 5,693,761 (Queen); U.S. Pat. No. 5,565,332
(Hoogenboom); U.S. Pat. No. 5,585,089 (Queen); U.S. Pat. No.
5,530,101 (Queen); Jones et al. (1986) NATURE 321: 522-525;
Riechmann et al. (1988) NATURE 332: 323-327; Verhoeyen et al.
(1988) SCIENCE 239: 1534-1536; and Winter (1998) FEBS LETT 430:
92-94.
[0134] In addition, it is possible to create fully human antibodies
in mice. In this approach, human antibodies are prepared using a
transgenic mouse in which the mouse's antibody-producing genes have
been replaced by a substantial portion of the human antibody
producing genes. Such mice produce human immunoglobulin instead of
murine immunoglobulin molecules. See, e.g., WO 98/24893 (Jacobovitz
et al.) and Mendez et al., 1997, Nature Genetics 15: 146-156. Fully
human anti-CFHR1 and/or anti-CFHR3 monoclonal antibodies can be
produced using the following approach. Transgenic mice containing
human immunoglobulin genes are immunized with the antigen of
interest, e.g., CFHR1 or CFHR3. Lymphatic cells from the mice then
are obtained from the mice, which are then fused with a
myeloid-type cell line to prepare immortal hybridoma cell lines.
The hybridoma cell lines are screened and selected to identify
hybridoma cell lines that produce antibodies specific to CFHR1 or
CFHR3.
5. Drug Screening/Antagonists of Risk Variant Factor H or Variant
CFHR5
[0135] The invention provides a drug screening method for screening
for agents for use in treating vascular disorders. The method
involves combining (i) a cell that expresses CFHR3 and/or CFHR1
polypeptides; and (ii) a test agent; b) measuring the level of
CFHR3 and/or CFHR1 gene expression in the cell and c) comparing the
level of CFHR3 and/or CFHR1 gene expression in the cell with a
reference value, where the reference value is the level of CFHR3
and/or CFHR1 gene expression in the absence of the test agent,
where a higher level of CFHR3 and/or CFHR1 gene expression in the
presence of the test agent indicates the test agent may be useful
for treating the vascular disorders. Compounds from natural product
libraries or synthetic combinatorial libraries may be screened. The
level of CFHR3 and/or CFHR1 gene expression using a variety of
approaches including measuring protein levels, measuring mRNA
levels or other methods.
[0136] In one embodiment the method involves combining (i) a cell
that expresses CFHR3 and/or CFHR1 polypeptides; and (ii) a test
agent; b) measuring the level of CFHR3 and/or CFHR1 polypeptides
produced by the cell (e.g., secreted into the medium); and c)
comparing the level of CFHR3 and/or CFHR1 polypeptides secreted
into the medium in the presence of the test agent with a reference
value, said reference value being the level of CFHR3 and/or CFHR1
polypeptides produced (or secreted into the medium) in the absence
of the test agent, where a higher level of CFHR3 and/or CFHR1
polypeptides secreted into the medium in the presence of the test
agent indicates the test agent may be useful for treating the
vascular disorders. Compounds from natural product libraries or
synthetic combinatorial libraries may be screened.
6. Identifying Protective Forms of Complement Factor H Proteins
[0137] As described above, deletions at the CFHR1 and CFHR3 loci
are linked to the presence of a protective haplotype. Protective
haplotypes and protective forms of CFH proteins are described in
Hageman et al., 2005, Proc. Natl. Acad. Sci. U.S.A. 102:7227-32 and
U.S. patent publication No. 20070020647. In one aspect, the
invention provides a method for identifying a CFH protein likely to
protect against development of AMD when administered to a subject
having, or at risk of developing, AMD. The method involves
identifying a subject with a deletion in the DNA sequence between
the 3' end of exon 22 of the complement factor H (CFH) gene and the
5' end of exon 1 of complement Factor H-related 4 (CFHR4) gene on
human chromosome 1; determining the sequence of the CFH gene
encoded by the gene contained in the chromosome containing the
deletion; and determining the sequence of the protein encoded by
the CFH gene, wherein said protein is different from wild-type CFH,
said protein being a CFH protein likely to protect against AMD
development. The invention also provides a protective CFH protein
obtained using the method. U.S. patent publication No. 20070020647
discloses the use of protective forms of CFH protein to protect
against AMD development and to treat AMD.
7. Kits and Diagnostic Devices
[0138] The invention provides reagents, devices and kits for
detecting CFHR1 or CFHR3 deletions. A number of assay systems are
known in the art, and it is within the skill of the art to arrive
at means to determine the presence of variations associated with
vascular disorders or AMD. The kit reagents, such as multiple
primers, multiple probes, combinations of primers, or combinations
of probes, may be contained in separate containers prior to their
use for diagnosis or screening. In an embodiment, the kit contains
a first container containing a probe, primer, or primer pair for a
first CFHR1 or CFHR3 allele described herein, and a second
container containing a probe, primer, or primer pair for a second
CFHR1 or CFHR3 allele described herein.
[0139] The kits may contain one or more pairs of CFHR1 and/or CFHR3
allele-specific oligonucleotides hybridizing to different forms of
a polymorphism. The allele-specific oligonucleotides may be
provided immobilized on a substrate.
[0140] The invention also provides devices and reagents useful for
diagnostic, prognostic, drug screening, and other methods are
provided. In one aspect, a device comprising immobilized primer(s)
or probe(s) specific for detecting deletions in the CFHR1 and/or
CFHR3 genes and optionally also including immobilized primer(s) or
probe(s) specific for detecting polymorphic sites in CFH that are
associated with AMD. Exemplary probes and polymorphic sites are
described in U.S. patent publication No. 20070020647.
[0141] In one aspect, a device comprising immobilized primer(s) or
probe(s) specific for one or more Factor H and/or CFHR5 and/or
CFHR1 and/or CFHR3 gene products (polynucleotides or proteins) is
provided. The primers or probes can bind polynucleotides (e.g.,
based on hybridization to specific polymorphic sites) or
polypeptides (e.g., based on specific binding to a variant
polypeptide).
[0142] In one embodiment, an array format is used in which a
plurality (at least 2, usually at least 3 or more) of different
primers or probes are immobilized. The term "array" is used in its
usual sense and means that each of a plurality of primers or
probes, usually immobilized on a substrate, has a defined location
(address) e.g., on the substrate. The number of primers or probes
on the array can vary depending on the nature and use of the
device. For example, a dipstick format array can have as few as 2
distinct primers or probes, although usually more than 2 primers or
probes, and often many more, will be present. One method for
attaching the nucleic acids to a surface is by making high-density
oligonucleotide arrays (see, Fodor et al., 1991, Science
251:767-73; Lockhart et al., 1996, Nature Biotech 14:1675; and U.S.
Pat. Nos. 5,578,832; 5,556,752; and 5,510,270). It is also
contemplated that, in some embodiments, a device comprising a
single immobilized probe can be used.
[0143] In one embodiment, an array format is used in which a
plurality (at least 2, usually at least 3 or more) of different
primers or probes are immobilized. The term "array" is used in its
usual sense and means that each of a plurality of primers or
probes, usually immobilized on a substrate, has a defined location
(address) e.g., on the substrate. The number of primers or probes
on the array can vary depending on the nature and use of the
device.
[0144] In one embodiment, the immobilized probe is an antibody or
other CFHR1 or CFHR3 binding moiety.
[0145] It will be apparent to the skilled practitioner guided by
this disclosure than various polymorphisms and haplotypes can be
detected, and used in combination with a deletion in the DNA
sequence between the 3' end of exon 22 of the complement factor H
(CFH) gene and the 5' end of exon 1 of complement Factor H-related
4 (CFHR4) gene on human chromosome 1, to assess the propensity of
an individual to develop a Factor H related condition. Examples of
CFH polymorphisms that may be assayed for include the following
SNPs and combinations of SNPs: rs529825; rs800292; rs3766404;
rs1061147; rs1061170; rs203674; and optionally including exon 22
(R1210C). In one embodiment the array includes primers or probes to
determine the allele at at least one of the following polymorphic
sites: rs529825; rs800292; intron 2 (IVS2 or insTT); rs3766404;
rs1061147; rs1061170; exon 10A; rs203674; rs375046; and optionally
including exon 22 (R1210C). In an embodiment the array includes
primers or probes to determine the allele at at least one of the
following polymorphic sites: (a) rs3753394; (b) rs529825; (c)
rs800292; (d) intron 2 (IVS2 or insTT); (e) rs3766404; (f)
rs1061147; (g) rs1061170; (h) rs2274700; (i) rs203674; (j)
rs3753396; (j) rs1065489; and optionally including exon 22
(R1210C). In one embodiment, the array includes primers or probes
to determine the allele at at least one of the following
polymorphic sites: rs800292 (162V); IVS 2 (-18insTT); rs1061170
(Y402H); and rs2274700 (A473A). In one embodiment, the array
includes primers or probes to determine the allele at at least one
of the following polymorphic sites: rs9427661 (-249T>C);
rs9427662 (-20T>C); and rs12097550 (P46S).
[0146] The array can include primers or probes to determine the
allele at two of the above sites, at least three, at least four, at
least five or at least six. In one embodiment the primers or probes
distinguish alleles at rs529825. In one embodiment the primers or
probes distinguish alleles at rs800292. In one embodiment the
primers or probes distinguish alleles at rs3766404. In one
embodiment the primers or probes distinguish alleles at rs1061147.
In one embodiment the primers or probes distinguish alleles at
rs1061170. In one embodiment the primers or probes distinguish
alleles at rs203674. In one embodiment the primers or probes
distinguish alleles at exon 22 (R1210C). In one embodiment the
primers or probes distinguish alleles at rs529825 and rs800292. In
one embodiment the primers or probes distinguish alleles at two or
three of rs1061147, rs1061170 and rs203674. In one embodiment the
primers or probes distinguish alleles at rs529825 and rs800292, at
rs3766404, two or three of rs1061147, rs1061170 and rs203674. In
one embodiment the primers or probes distinguish alleles at
rs529825, rs800292, rs3766404, rs1061170 and rs203674. In one
embodiment, the primers or probes distinguish alleles at exon 22
(R1210C) and at rs529825; at rs800292; at rs3766404; at rs1061147;
at rs1061170; at rs203674; at rs529825 and rs800292; at two or
three of rs1061147, rs1061170 and rs203674; at rs529825 and
rs800292, rs3766404, and two or three of rs1061147, rs1061170 and
rs203674; or at rs529825, rs800292, rs3766404, rs1061170 and
rs203674. In one embodiment, the primers or probes distinguish
alleles at (a) any one or more of rs529825; rs800292; rs3766404;
rs1061147; rs1061170; and rs203674; (b) any one of more of intron 2
(IVS2 or insTT); rs2274700; exon 10A; and rs375046; (c) one or both
of rs529825 and rs800292; (d) one or more of rs1061147, rs1061170
and rs203674; (e) at least one of rs529825 and rs800292; and
rs3766404; and at least one of rs1061147, rs1061170 and rs203674;
(f) at least rs529825, rs800292, rs3766404, rs1061170, and
rs203674; (g) exon 22 (R1210C); (h) exon 22 (R1210C) and any of
(a)-(g); or (i) any one or more of rs529825; rs800292; rs3766404;
rs1061147; rs1061170; rs203674; intron 2 (IVS2 or insTT);
rs2274700; exon 10A; rs375046; and exon 22 (R1210C) and any one or
more of rs9427661, rs9427662 and rs12097550.
[0147] The array can include primers or probes to determine the
allele at two of the above sites, at least three, at least four, at
least five or at least six. In one embodiment the primers or probes
distinguish alleles at rs529825. In one embodiment the primers or
probes distinguish alleles at rs800292. In one embodiment the
primers or probes distinguish alleles at intron 2 (IVS2 or insTT).
In one embodiment the primers or probes distinguish alleles at
rs3766404. In one embodiment the primers or probes distinguish
alleles at rs1061147. In one embodiment the primers or probes
distinguish alleles at rs1061170. In one embodiment the primers or
probes distinguish alleles at exon 10A. In one embodiment the
primers or probes distinguish alleles at rs2274700. In one
embodiment the primers or probes distinguish alleles at rs203674.
In one embodiment the primers or probes distinguish alleles at
rs375046. In one embodiment the primers or probes distinguish
alleles at exon 22 (R1210C). In one embodiment the primers or
probes distinguish alleles at rs529825 and rs800292. In one
embodiment the primers or probes distinguish alleles at two or
three of rs1061147, rs1061170 and rs203674. In one embodiment the
primers or probes distinguish alleles at of rs529825 and rs800292,
at intron 2, at rs3766404, at two or three of rs1061147, rs1061170
and rs203674, at exon 10A, at rs2274700, and at rs375046. In one
embodiment the primers or probes distinguish alleles at rs529825,
rs800292, intron 2 (IVS2 or insTT), rs3766404, rs1061170, exon 10A,
rs2274700, rs203674, and rs375046. In one embodiment, the primers
or probes distinguish alleles at exon 22 (R1210C) and at either at
rs529825; at rs800292; at intron 2 (IVS2 or insTT); at rs3766404;
at rs1061147; at rs1061170; at rs2274700, at exon 10A; at rs203674;
at rs375046; at rs529825 and rs800292; at two or three of
rs1061147, rs1061170 and rs203674; at rs529825 and rs800292, intron
2 (IVS2 or insTT), rs3766404, two or three of rs1061147, rs1061170
and rs203674, rs2274700, exon 10A, and rs375046; or at rs529825,
rs800292, intron 2 (IVS2 or insTT), rs3766404, rs1061170,
rs2274700, exon 10A, rs203674, and rs375046. In one embodiment, the
device distinguishes any combination of allelles at the sites
listed above in the context of kits.
[0148] In one embodiment, the substrate comprises fewer than about
1000 distinct primers or probes, often fewer than about 100
distinct primers or probes, fewer than about 50 distinct primers or
probes, or fewer than about 10 distinct primers or probes. As used
in this context, a primer is "distinct" from a second primer if the
two primers do not specifically bind the same polynucleotide (i.e.,
such as cDNA primers for different genes). As used in this context,
a probe is "distinct" from a second probe if the two probes do not
specifically bind the same polypeptide or polynucleotide (i.e.,
such as cDNA probes for different genes). Primers or probes may
also be described as distinct if they recognize different alleles
of the same gene (i.e., CFH or CFHR5). Thus, in one embodiment
diagnostic devices of the invention detect alleles of CFH only,
CFHR5 only, CFH and CFHR5 only, or CFH, CFHR5 and up to 20,
preferably up to 10, or preferably up to 5 genes other than CFH
and/or CFHR5. That is, the device is particularly suited to
screening for AMD and related complement-associated diseases. In
one embodiment, the device comprises primers or probes that
recognize CFH and/or one or more of CFHR1-5 only. In a related
embodiment, the device contains primers and probes for up to 20,
preferably up to 10, or preferably up to 5 other genes than CFH or
CFHR1-5.
[0149] In one embodiment, the immobilized primer(s) is/are an
allele-specific primer(s) that can distinguish between alleles at a
polymorphic site in the Factor H or CHRF5 gene. Exemplary
allele-specific primers to identify alleles at polymorphic sites in
the Factor H gene are shown in TABLE 16A of U.S. patent publication
No. 20070020647, incorporated by reference in its entirety for all
purposes. The immobilized allele-specific primers hybridize
preferentially to nucleic acids, either RNA or DNA, that have
sequences complementary to the primers. The hybridization may be
detected by various methods, including single-base extension with
fluorescence detection, the oligonucleotide ligation assay, and the
like (see Shi, M. M., 2001, Enabling large-scale pharmacogenetic
studies by high-throughput mutation detection and genotyping
technologies" Clin. Chem. 47(2):164-172). Microarray-based devices
to detect polymorphic sites are commercially available, including
Affymetrix (Santa Clara, Calif.), Protogene (Menlo Park, Calif.),
Genometrix (The Woodland, Tex.), Motorola BioChip Systems
(Northbrook, Ill.), and Perlegen Sciences (Mountain View,
Calif.).
[0150] The invention provides reagents and kits for detecting CFHR1
and/or CFHR3 proteins. A number of assay systems are known in the
art, and it is within the skill of the art to arrive at means to
determine the presence or absence of CFHR1 and/or CFHR3, or variant
or truncated forms thereof, associated with vascular disorders or
AMD. The kit reagents, such as anti-CFHR3 or CFHR1 antibodies or
other CFHR3 or CFHR1 binding moieties, may be contained in separate
containers prior to their use for diagnosis or screening. In an
embodiment, the kit contains a first container containing an
antibody or binding moiety that specifically binds to CFHR1
protein, or a variant or truncated form thereof, and a second
container containing an antibody or binding moiety that
specifically binds to CFHR3 protein, or a variant or truncated form
thereof. In some embodiments the binding moieties is an aptamer,
such as a nucleic acid aptamer. Aptamers are RNA or DNA molecules
selected in vitro from vast populations of random sequence that
recognize specific ligands by forming binding pockets. Aptamers are
nucleic acids that are capable of three dimensional recognition
that bind specific proteins or other molecules. See, e.g.,
US20050176940 "Aptamers and Antiaptamers".
[0151] Thus, the invention provides reagents for conducting the
screening methods of the invention, comprising a binding moiety
capable of specifically binding CFHR1 and/or CFHR3 protein or a
portion thereof (e.g., a labeled binder that reacts preferentially
with CFHR1 and/or CFHR3 protein or a portion thereof or a labeled
binder that reacts preferentially with CFHR1 mRNA and/or CFHR3 mRNA
or a portion thereof, or a labeled binder that reacts
preferentially with CFHR1 DNA and/or CFHR3 DNA). The binding moiety
may comprise, for example, a member of a ligand-receptor pair,
i.e., a pair of molecules capable of having a specific binding
interaction (such as antibody-antigen, protein-protein, nucleic
acid-nucleic acid, protein-nucleic acid, or other specific binding
pair known in the art). Optionally the binding moiety is labeled
(e.g., directly labeled) or is accompanied by a labeled molecule
that reacts with the binding moiety (indirectly labeled).
Detectable labels can be directly attached to or incorporated into
the detection reagent by chemical or recombinant methods. Examples
of detectable labels include, but are not limited to,
radioisotopes, fluorophores, chromophores (e.g., colored
particles), mass labels, electron dense particles, magnetic
particles, spin labels, and molecules that emit chemiluminescence.
Methods for labeling are well known in the art.
[0152] The kits may contain an instruction manual with instructions
how to use the anti-CFHR3 or CFHR1 antibodies or other CFHR3 or
CFHR1 binding moieties to detect CFHR3 or CFHR1 proteins in body
fluids or in tissue samples.
[0153] The kits may contain a control antibody or binding moiety.
An example of a control antibody or binding moiety is an antibody
that specifically binds to CFH protein.
[0154] The kits may contain one or more pairs of antibodies or
binding moieties that specifically bind to different (i.e., not
wild-type or full-length) forms (e.g., variant or truncated) of
CFHR1 or CFHR3 proteins.
[0155] In one embodiment, the antibodies or binding moieties are
immobilized to a solid support such as an ordered array.
[0156] In one embodiment, the antibodies or binding moieties are
used in Western blots.
EXAMPLES
Example 1
[0157] Polymerase chain reaction (PCR) amplification, single-strand
conformation polymorphism (SSCP) analysis and direct DNA sequencing
were used to characterize a deletion in the CFHR3 and CFHR1 genes
located between the CFH and CFHR4 genes on chromosome 1. Examples
of primers that can be used for PCR amplification of the CFH gene
and CFH-related genes 1 to 5 are shown in Table 1A. Examples of
primers that can be used for SSCP analysis of the CFH and CFHR3
genes are shown in Table 1B. Examples of primers that can be used
for direct DNA sequencing of the CFH, CFHR1 and CFHR3 genes are
shown in Table 1C and 1D.
TABLE-US-00001 TABLE 1 Primers Used for Detecting the CFH and
CFHR1-5 Genes Product Forward 5'-3' Reverse 5'-3' Size (bp) A. PCR
Primers CFH ex22 GGTTTGGATAGTGTTTTGAG ACCGTTAGTTTTCCAGG 521 (SEQ ID
NO: 14) (SEQ ID NO: 15) CFHR1 ex6 AGTCGGTTTGGACAGTG
GCACAAGTTGGATACTCC 321 (SEQ ID NO: 7) (SEQ ID NO: 8) CFHR2 ex4
TGTGTTCATTCAGTGAG ATAGACATTTGGTAGGC 510 (SEQ ID NO: 16) (SEQ ID NO:
17) CFHR3 ex3 TCATTGCTATGTCCTTAGG TCTGAGACTGTCGTCCG 263 (SEQ ID NO:
10) (SEQ ID NO: 11) CFHR4 ex3 CTACAATGGGACTTTCTTAG
TTCACACTCATAGGAGGAC 378 (SEQ ID NO: 18) (SEQ ID NO: 19) CFHR5 ex2
AACCCTTTTTCCCAAG CACATCCTTCTCTATTCAC 193 (SEQ ID NO: 20) (SEQ ID
NO: 21) B. SSCP Primers CFH ex22 GGTTTGGATAGTGTTTTGAG
ATGTTGTTCGCAATGTG 283 (SEQ ID NO: 14) (SEQ ID NO: 22) CFHR3 ex3
TCATTGCTATGTCCTTAGG TCTGAGACTGTCGTCCG 263 (SEQ ID NO: 10) (SEQ ID
NO: 11) C. Sequencing Primers CFH ex22 GGTTTGGATAGTGTTTTGAG
ACCGTTAGTTTTCCAGG 521 (SEQ ID NO: 14) (SEQ ID NO: 15) CFHR3 ex3 seq
TTTTGGATGTTTATGCG AAATAGGTCCGTTGGC 420 (SEQ ID NO: 12) (SEQ ID NO:
13) CFHR1 ex6 AGTCGGTTTGGACAGTG GCACAAGTTGGATACTCC 321 (SEQ ID NO:
7) (SEQ ID NO: 8) Forward 5'-3' Reverse 5'-3' Product D. Primers
used for detecting the CFH and CFHR1-5 genes and results CFH (ex22)
GGTTTGGATAGTGTTTTGAG ATGTTGTTCGCAATGTG Yes (SEQ ID NO: 14) (SEQ ID
NO: 22) CFH (ex22) GGTTTGGATAGTGTTTTGAG ACCGTTAGTTTTCCAGG Yes (SEQ
ID NO: 14) (SEQ ID NO: 15) IVS 5' to CFHR3 CACGCTATTTGAAAGACAAACTT
AAGCAACCCTGCTCTACAATGT Yes (SEQ ID NO: 23) (SEQ ID NO: 24) IVS 5'
to CFHR3 GGAACCACATGGGTCAAATG GCACAACAAATAAAACTAGCAAATCAT Yes (SEQ
ID NO: 25) (SEQ ID NO: 26) IVS 5' to CFHR3 ATTGCTGCAATCTCAGAAGAAAA
TCAAAACGAACAAACAAACAGG No (SEQ ID NO: 27) (SEQ ID NO: 28) CFHR3
(ex2) TGCGTAGACCATACTTTCCAG CTCTCTTTAATCTTTTAAAGTTTTATACATGTG No
(SEQ ID NO: 29) (SEQ ID NO: 30) CFHR3 (ex3) TTTTGGATGTTTATGCG
AAATAGGTCCGTTGGC No (SEQ ID NO: 12) (SEQ ID NO: 13) CFHR3 (ex3)
TCATTGCTATGTCCTTAGG TCTGAGACTGTCGTCCG No (SEQ ID NO: 10) (SEQ ID
NO: 11) CFHR1 (ex2) TAAAGTGCTGTGTTTGTATTTGC GTGATTATTTTGTTACCAACAGC
No (SEQ ID NO: 31) (SEQ ID NO: 32) CFHR1 (ex6) AGTCGGTTTGGACAGTG
GCACAAGTTGGATACTCC No (SEQ ID NO: 7) (SEQ ID NO: 8) CFHR1 (ex6)
CATAGTCGGTTTGGACAGTG GCACAAGTTGGATACTCC No (SEQ ID NO: 9) (SEQ ID
NO: 8) CFHR2 TCCTTTTCTAGTTCATTAACATA AGTGATATGACACATGCTGAC Yes (SEQ
ID NO: 33) (SEQ ID NO: 34) CFHR2 CTACAGACTAACTTTCAATAATTT
GATACTTTTACATTTTCTTATGAT Yes (SEQ ID N0: 35) (SEQ ID NO: 36) CFHR2
ACATAGTTATATGATCGTTTTGAGT ACAGAGAAAGAACTTACTAATTG Yes (SEQ ID NO:
37) (SEQ ID NO: 38) CFHR2 TGTGTTCATTCAGTGAG ATAGACATTTGGTAGGC Yes
(SEQ ID NO: 16) (SEQ ID NO: 17) CFHR4 AGTATTAAATTGTTCAGTCCAG
AAACTAGTGTAAGAATGTATGAT Yes (SEQ ID NO: 39) (SEQ ID NO: 40) CFHR4
TAAGTTGAAAGAGATCTAAACAC ACTGTATGTAAGATTATGAAAGTAT Yes (SEQ ID NO:
41) (SEQ ID NO: 42) CFHR4 CTACAATGGGACTTTCTTAG TTCACACTCATAGGAGGAC
Yes (SEQ ID NO: 18) (SEQ ID NO: 19) CFHR5 AACCCTTTTTCCCAAG
CACATCCTTCTCTATTCAC Yes (SEQ ID NO: 20) (SEQ ID NO: 21)
[0158] In a study directed toward further characterization of CFH
and its associated haplotypes on chromosome 1q, a complete deletion
of the entire CFHL1 and CFHL3 genes was identified. In examining
SSCP gels generated using CFH exon 22 primers (Table 1), several
additional patterns of variation were observed due to the
amplification of CFHR1 in addition to CFH. By designing another set
of CFH-specific primers, it was determined that there were no
variations in exon 22 of CFH. CFHR1-specific primers were generated
and used to identify a deletion of CFHR1. Further analysis of the
CFHR1, CFHR2, CFHR3, CFHR4 and CFHR5 genes and intervening sequence
5' to CFHR3 (Table 1D) using specific primers revealed a deletion
that extends across the entire length of the CFHR1 and CFHR3 genes.
The precise boundaries of the complete deletion have not be
determined, but the mapping of the boundaries is within the skill
of the art.
[0159] SSCP analysis and direct DNA sequencing was used to
determine the frequency of the homozygous deletion of the CFHR3 and
CFHR1 genes in a set of 1074 patients with and without a clinical
history of AMD. The cohort included patients who had other systemic
diseases, including vascular diseases, irrespective of their AMD
status. As shown in Table 2, homozygous deletion of the CFHR1 and
CFHR3 genes was found in .about.2.7% of the persons tested.
TABLE-US-00002 TABLE 2 Frequency of homozygous deletion of CFHR1
and CFHR3 genes Genotype* Count Percent +/+, +/.DELTA. 1046 97.3%
.DELTA./.DELTA. 28 2.7% +/+, +/.DELTA., .DELTA./.DELTA. 1074 100%
*Genotype refers to the deletion (.DELTA.) or non-deletion (+) of
the CFHR1 and CFHR3 genes by SSCP analysis and direct
sequencing.
[0160] Initial analysis suggested that the deletion homozygotes
were more common in control individuals than in AMD cases. To
determine whether there was an association of the homozygous
deletion of the CFHR3 and CFHR1 genes with AMD, a subset of the
above patient population was analyzed by SSCP analysis and direct
DNA sequencing. As shown in Table 3, in a study of 576 AMD patients
and 352 age-matched non-AMD control patients, deletion homozygotes
make up 5.1% of controls and 1.2% of cases. The homozygous deletion
of CFHR1 and CFHR3 is strongly associated with controls, with
.chi.2=10.2 and P value=0.0014, demonstrating a highly significant
protective effect of the homozygous CFHR1/CFHR3 deletion for
AMD.
TABLE-US-00003 TABLE 3 Association of homozygous deletion of CFHR1
and CFHR3 genes with non-AMD Genotype Non-AMD patients AMD patients
Count +/+, +/.DELTA. 352 576 Count .DELTA./.DELTA. 18 7 Frequency
+/+, +/.DELTA. 0.951 0.988 Frequency .DELTA./.DELTA. 0.049 0.012
*Genotype refers to the deletion (.DELTA.) or non-deletion (+) of
the CFHR1 and CFHR3 genes by SSCP analysis and direct
sequencing.
[0161] To determine whether there was an association of the
homozygous deletion of the CFHR3 and CFHR1 genes with vascular
disorders, two subsets of the above patient population were
analyzed by SSCP analysis and direct DNA sequencing. As shown in
Table 4A, a study of 26 patients with abdominal aortic aneurysm
(AAA) and 133 non-AAA patients revealed that the homozygous
deletion of CFHR1 and CFHR3 was strongly associated with AAA, with
.chi..sup.2=6.982329 and P=0.0082. As shown in Table 4B, a second
study of 86 patients with abdominal aortic aneurysm (AAA) and 221
non-AAA patients revealed that the homozygous deletion of CFHR1 and
CFHR3 was associated with AAA, with .chi..sup.2=4.05 and
P=0.0442.
TABLE-US-00004 TABLE 4 Association of homozygous deletion of CFHR1
and CFHR3 genes with AAA Genotype Controls AAA A. Study 1 Count
+/+, +/.DELTA. 126 19 Count .DELTA./.DELTA. 7 7 Total +/+,
+/.DELTA., .DELTA./.DELTA. 133 26 B. Study 2 Count +/+, +/.DELTA.
221 86 Count .DELTA./.DELTA. 12 11 Total +/+, +/.DELTA.,
.DELTA./.DELTA. 233 97 *Genotype refers to the deletion (.DELTA.)
or non-deletion (+) of the CFHR1 and CFHR3 genes by SSCP analysis
and direct sequencing.
[0162] To determine whether previously identified protective
haplotypes in the CFH gene were associated with the del (.DELTA.)
CFHR1 allele, haplotype analysis was performed. As shown in Tables
5A-5E, the relationship between the del (.DELTA.) CFHR1 allele and
SNPs in the CFH gene revealed strong linkage disequilibrium. The
SNPs used in this haplotype analysis are described in U.S. patent
publication No. 20070020647. In the table, letters refer to
genotypes and numbers refer to SSCP shift patterns.
TABLE-US-00005 TABLE 5 CFH gene haplotype analysis in subjects with
the del/del (.DELTA./.DELTA.) CFHR1 allele A. Promoter 1 to Exon 3
Exon 2 Promoter 4 rs800292 rs3753394 I62V Exon 3a Exon 3 Promoter 1
C-257T G184A IVS2-18insTT same SNP as 3a 1 AA TT GG SS SS 2 AA CC
GG SS SS 3 AA CT GG SS SS 4 AA CC GG SS + G100R het SS + G100R het
5 AA CT GG SS SS 6 AA CT GG SS SS 7 AA CC GG SS SS 8 AA TT GG SS SS
9 AA CT GG SS SS 10 AA CC GG SS SS 11 AA CC GG SS SS 12 AA CC GG SS
SS 13 AA CT GG SS SS 14 GG SS 15 GG SS 16 GG SS 17 GG SS 18 GG SS
19 GG SS 20 GG SS 21 GA SS 22 GG SS 23 SS 24 SS 25 SS 26 SS B. IVS
6 to Exon 7b Exon 7b rs1061147 IVS 6 IVS 6 IVS6 IVS6 A307A shift N
or Del rs16840419 rs3766404 A921C 1 3 NN GA CT CC 2 5 NDel 5 (GG) 5
(CC?) CC 3 2 NN GG CC CC 4 2 NN GG CC CC 5 3 NN GA CT CC 6 1 NN AA
TT AC 7 5 NDel 5 (GG) 5 (CC?) CC 8 1 NN AA TT CC 9 3 NN GA CT CC 10
2 NN GG CC CC 11 No DNA (3) NN No DNA (GA) No DNA (CT) AC 12 2 NN
GG CC CC 13 1 NN AA TT CC 14 15 16 17 18 AA 19 20 21 22 23 24 25 26
C. Exon 9 to Exon 16b Exon 9 Exon 10a Exon 13b rs1061170 rs2274700
rs3753396 Exon 16b Y402H Exon 10A A473A Q672Q rs375046 C1204T
CFHtrunc G2016A A2089G IVS15 1 TT 1 AA AA 2 TT AA AA 3 TT 1 AA AA
AA 4 TT 1 AA AA AA 5 TT 1 AA AA 4 6 CT 1 GA AA 7 TT AA 8 TT 1 AA AA
AA 9 TT 1 AA AA AA 10 TT 1 AA AA AC? 11 CT 1 GA AA 12 TT AA 13 TT
14 TT 1 AA 15 TT 1 AA 16 CT 1 GA 17 TT 1 AA AA CC 18 CC 1 GG 19 TT
1 AA 20 TT 1 AA 21 TT 1 AA 22 TT 1 AA 23 TT 24 TT 25 TT 26 TT D.
Exon 17a to Exon 19a Exon 18a Exon 18b Exon 19a Exon 17b rs1065489
rs1065489 rs534399 A892V E936D E936D V1007L Exon 17a C2748T G2881T
G2881T G3092T 1 1 CC GG GG GG 2 1 CC 3 1 CC GG GG GG 4 1 CC GG GG
GG 5 1 CC GG GG GG 6 3 CC GG GG TT 7 1 8 1 CC GG GG GG 9 1 CC GG GG
GG 10 1 CC GG GG GG 11 1 CC GG GG GG 12 1 CC 13 1 CC 14 GG 15 GG 16
GG 17 GG 18 1 CC GG GG GG 19 GG 20 GG 21 GG 22 GG 23 GG 24 GG 25 GG
26 GG E. Exon 20b to Exon22 split (detects both CFH and CFHR1) Exon
22b Exon 22split Exon 20b 1191/1197/1210 1197 1 4 4 4 2 4 3 4 4 4 4
2 4 4 5 4 4 4
6 4 4 4 7 4 8 4 4 4 9 4 4 4 10 6 4 4 11 4 4 4 12 4 13 4 14 4 15 4 4
16 4 4 17 4 18 4 4 19 4 4 20 6 4 21 4 4 22 4 4 23 4 4 24 4 4 25 4 4
26 4 4
[0163] As shown in Table 6, in two studies it was found that the
deletion of the CFHR1 and CFHR3 genes was associated with
402T-containing haplotypes. This deletion is almost never found on
the same 402C-containing haplotype as the major CFH risk allele,
Y402H. The del (.DELTA.) CFHRJ mutation is predominantly associated
with the CFH H4 haplotype, a haplotype with T at position 1277 of
the coding region of CFH (codon 402) shown previously shown to be
protective for AMD. However, not every del (.DELTA.) CFHR1
chromosome is on H4, and the protection of del/del
(.DELTA./.DELTA.) CFHR1 homozygotes for AMD is even stronger than
H4 homozygotes. Heterozygous deletion of the CFHR3 and CFHR1 genes
was detected by direct DNA sequencing of the CFH, CFHR1 and CFHR3
genes using a CFH exon 22 primer.
TABLE-US-00006 TABLE 6 Association of homozygous deletion of CFHR1
and CFHR3 genes with the TT genotype at position 1277 of the coding
region of CFH (codon 402) CFH402 Genotype Genotype TT TC CC A.
Study 1 Count +/+, +/.DELTA. 102 209 150 Count .DELTA./.DELTA. 11 2
0 Count +/+, +/.DELTA., .DELTA./.DELTA. 113 211 150 B. Study 2
Count +/+, +/.DELTA. 192 393 283 Count .DELTA./.DELTA. 23 3 0 Count
+/+, +/.DELTA., .DELTA./.DELTA. 215 396 283 *Genotype refers to the
deletion (.DELTA.) or non-deletion (+) of the CFHR1 and CFHR3 genes
by SSCP analysis and direct sequencing. **CFH402 Genotype refers to
the nucleotide on both alleles at position 1277 of the coding
region of human CFH. A T results in a tyrosine at codon 402,
whereas a C results in a histidine at codon 402. ***Of the 474
patients, approximately 22 +/- 4% are heterozygous (+/.DELTA.) for
the deletion of the CFHR1 and CFHR3 genes, as determined by direct
DNA sequencing.
[0164] By Western blotting, it was determined that CFHR1 protein,
normally an abundant serum protein, is absent in sera derived from
individuals homozygous for the CFHR1/CFHR3 deletion. FIG. 3 shows a
representative Western blot of serum proteins from seven (out of a
sample set of 52) patients using an anti-human CFH antibody. Serum
proteins were separated by one-dimensional SDS-polyacrylamide gel
electrophoresis and transferred to a nitrocellulose membrane. After
transfer, the membrane was blocked with 5% non-fat dry milk,
washed, and then incubated with a goat anti-human CFH (Calbiochem,
1:1000 dilution). After incubation, the membrane was washed, and
then incubated with horse radish peroxidase-conjugated rabbit
anti-goat Ig antibody (Abcam, 1:4000 dilution). After incubation,
the membrane was washed, and then incubated with extravidin (1:1500
dilution). Samples 197-02 and 325-02 were from patients with a TT
402 genotype (protective CFH H4 haplotype) and have homozygous
deletion of CFHR1 and CFHR3 genes, as determined by SSCP analysis
and direct sequencing. FIG. 3 shows that no CFHR1 is detected in
the serum from patients having a homozygous deletion of the CFHR1
and CFHR3 genes.
[0165] Western blotting using the same anti-human CFH antibody was
used to detect CFH and CFHR1 in serum from an additional 40
patients, separated according to SSCP patterns using the CFH exon
22 primers. Patterns 1-3 correspond to homozygous, or heterozygous
for, non-deletion of CFHR1 and CFHR3 (+/+, +/.DELTA.), and pattern
4 corresponds to homozygous deletion of CFHR1 and CFHR3
(.DELTA./.DELTA.) (see FIG. 4). All 10 of the serum samples from
patients displaying SSCP pattern 4 show no CFHR1, whereas all 30 of
the serum samples from patients displaying SSCP patterns 1-3 show
at least some CFHR1 (data not shown). Thus, analysis of serum from
individuals with a CFHR1 del/del (.DELTA./.DELTA.) genotype shows
that they lack any detectable CFHR1 protein. This protein analysis
confirms that these individuals lack both the CFHR1 gene and
encoded protein. Individuals who are heterozygous for deletion of
CFHR1 and CFHR3 can be recognized by protein analysis of serum
samples by virtue of the intensity of the band corresponding to
CFHR1 being roughly half the intensity in heterozygous (+/.DELTA.)
patients as compared to homozygous non-deletion (+/+) patients.
[0166] PCR experiments using leukocyte-derived DNA were performed
to confirm that patients having a homozygous deletion of CFHR1 and
CFHR3 do not have CFHR1 and CFHR3 DNA. FIG. 5 shows a PCR analysis
of CFH and CFHR1-5 from DNA samples from 20 patients, separated
into four groups according to SSCP patterns using the CFH exon 22
primers mentioned above. Patterns 1-3 correspond to homozygous
non-deletion or heterozygous deletion of CFHR1 and CFHR3 (+/+,
+/.DELTA.), and pattern 4 corresponds to homozygous deletion of
CFHR1 and CFHR3 (.DELTA./.DELTA.). From left to right, 5 samples
each from patients displaying SSCP patterns 1, 2, 3 and 4 were
subjected to PCR using primers specific for CFH, CFHR1, CFHR2,
CFHR3, CFHR4 and CFHR5, as indicated. This figure shows that CFH,
CFHR4 and CFHR5 DNA are amplified in all of the samples, whereas
CFHR1 and CFHR3 DNA are amplified in samples from patients
displaying SSCP patterns 1-3, but not from patients displaying SSCP
pattern 4. The CFHR2 DNA was amplified in some, but not all, of the
samples. Thus, when SSCP and direct sequencing show a homozygous
deletion of the CFHR1 and CFHR3 genes, no PCR amplifiable CFHR1 and
CFHR3 DNA are detected in samples.
Example 2
Production of Anti-CFHR1 and Anti-CFHR3 Monoclonal Antibodies
[0167] Mice will be immunized with recombinant human CFHR1 or
CFHR3. Two mice with sera displaying the highest anti-CFHR1 and
anti-CFHR3 activity by Enzyme Linked Immunosorbent Assay (ELISA)
will be chosen for subsequent fusion and spleens and lymph nodes
from the appropriate mice will be harvested. B-cells will be
harvested and fused with an myeloma line. Fusion products will be
serially diluted on one or more plates to near clonality.
Supernatants from the resulting fusions will be screened for their
binding to hCFHR1 or hCFHR3 by ELISA. Supernatants identified as
containing antibodies to CFHR1 or CFHR3 will be further
characterized by in vitro functional testing as discussed below. A
panel of hybridomas will be selected and the hybridomas will be
subcloned and expanded. The monoclonal antibodies will then be
purified by affinity chromatography on Protein A/G resin under
standard conditions.
[0168] Anti-CFHR1 and anti-CFHR3 antibodies may be further
characterized by in vitro functional testing using complement
activation assays well known in the art. For example, complement
activation assays may be conducted in solution (e.g., fluid phase
in blood) or on immobilized surfaces. Exemplary assays may measure
the ability of the anti-CFHR1 and/or anti-CFHR3 antibodies to block
or reduce CFH, C3b, heparin and/or C-reactive protein (CRP) binding
to a substrate.
[0169] Although the present invention has been described in detail
with reference to specific embodiments, those of skill in the art
will recognize that modifications and improvements are within the
scope and spirit of the invention, as set forth in the claims which
follow. All publications and patent documents cited herein are
incorporated herein by reference as if each such publication or
document was specifically and individually indicated to be
incorporated herein by reference. Citation of publications and
patent documents (patents, published patent applications, and
unpublished patent applications) is not intended as an admission
that any such document is pertinent prior art, nor does it
constitute any admission as to the contents or date of the same.
The invention having now been described by way of written
description, those of skill in the art will recognize that the
invention can be practiced in a variety of embodiments and that the
foregoing description is for purposes of illustration and not
limitation of the following claims.
Sequence CWU 1
1
4213853DNAHomo sapiens 1atgagacttc tagcaaagat tatttgcctt atgttatggg
ctatttgtgt agcagaagat 60tgcaatgaac ttcctccaag aagaaataca gaaattctga
caggttcctg gtctgaccaa 120acatatccag aaggcaccca ggctatctat
aaatgccgcc ctggatatag atctcttgga 180aatgtaataa tggtatgcag
gaagggagaa tgggttgctc ttaatccatt aaggaaatgt 240cagaaaaggc
cctgtggaca tcctggagat actccttttg gtacttttac ccttacagga
300ggaaatgtgt ttgaatatgg tgtaaaagct gtgtatacat gtaatgaggg
gtatcaattg 360ctaggtgaga ttaattaccg tgaatgtgac acagatggat
ggaccaatga tattcctata 420tgtgaagttg tgaagtgttt accagtgaca
gcaccagaga atggaaaaat tgtcagtagt 480gcaatggaac cagatcggga
ataccatttt ggacaagcag tacggtttgt atgtaactca 540ggctacaaga
ttgaaggaga tgaagaaatg cattgttcag acgatggttt ttggagtaaa
600gagaaaccaa agtgtgtgga aatttcatgc aaatccccag atgttataaa
tggatctcct 660atatctcaga agattattta taaggagaat gaacgatttc
aatataaatg taacatgggt 720tatgaataca gtgaaagagg agatgctgta
tgcactgaat ctggatggcg tccgttgcct 780tcatgtgaag aaaaatcatg
tgataatcct tatattccaa atggtgacta ctcaccttta 840aggattaaac
acagaactgg agatgaaatc acgtaccagt gtagaaatgg tttttatcct
900gcaacccggg gaaatacagc caaatgcaca agtactggct ggatacctgc
tccgagatgt 960accttgaaac cttgtgatta tccagacatt aaacatggag
gtctatatca tgagaatatg 1020cgtagaccat actttccagt agctgtagga
aaatattact cctattactg tgatgaacat 1080tttgagactc cgtcaggaag
ttactgggat cacattcatt gcacacaaga tggatggtcg 1140ccagcagtac
catgcctcag aaaatgttat tttccttatt tggaaaatgg atataatcaa
1200aatcatggaa gaaagtttgt acagggtaaa tctatagacg ttgcctgcca
tcctggctac 1260gctcttccaa aagcgcagac cacagttaca tgtatggaga
atggctggtc tcctactccc 1320agatgcatcc gtgtcaaaac atgttccaaa
tcaagtatag atattgagaa tgggtttatt 1380tctgaatctc agtatacata
tgccttaaaa gaaaaagcga aatatcaatg caaactagga 1440tatgtaacag
cagatggtga aacatcagga tcaattagat gtgggaaaga tggatggtca
1500gctcaaccca cgtgcattaa atcttgtgat atcccagtat ttatgaatgc
cagaactaaa 1560aatgacttca catggtttaa gctgaatgac acattggact
atgaatgcca tgatggttat 1620gaaagcaata ctggaagcac cactggttcc
atagtgtgtg gttacaatgg ttggtctgat 1680ttacccatat gttatgaaag
agaatgcgaa cttcctaaaa tagatgtaca cttagttcct 1740gatcgcaaga
aagaccagta taaagttgga gaggtgttga aattctcctg caaaccagga
1800tttacaatag ttggacctaa ttccgttcag tgctaccact ttggattgtc
tcctgacctc 1860ccaatatgta aagagcaagt acaatcatgt ggtccacctc
ctgaactcct caatgggaat 1920gttaaggaaa aaacgaaaga agaatatgga
cacagtgaag tggtggaata ttattgcaat 1980cctagatttc taatgaaggg
acctaataaa attcaatgtg ttgatggaga gtggacaact 2040ttaccagtgt
gtattgtgga ggagagtacc tgtggagata tacctgaact tgaacatggc
2100tgggcccagc tttcttcccc tccttattac tatggagatt cagtggaatt
caattgctca 2160gaatcattta caatgattgg acacagatca attacgtgta
ttcatggagt atggacccaa 2220cttccccagt gtgtggcaat agataaactt
aagaagtgca aatcatcaaa tttaattata 2280cttgaggaac atttaaaaaa
caagaaggaa ttcgatcata attctaacat aaggtacaga 2340tgtagaggaa
aagaaggatg gatacacaca gtctgcataa atggaagatg ggatccagaa
2400gtgaactgct caatggcaca aatacaatta tgcccacctc cacctcagat
tcccaattct 2460cacaatatga caaccacact gaattatcgg gatggagaaa
aagtatctgt tctttgccaa 2520gaaaattatc taattcagga aggagaagaa
attacatgca aagatggaag atggcagtca 2580ataccactct gtgttgaaaa
aattccatgt tcacaaccac ctcagataga acacggaacc 2640attaattcat
ccaggtcttc acaagaaagt tatgcacatg ggactaaatt gagttatact
2700tgtgagggtg gtttcaggat atctgaagaa aatgaaacaa catgctacat
gggaaaatgg 2760agttctccac ctcagtgtga aggccttcct tgtaaatctc
cacctgagat ttctcatggt 2820gttgtagctc acatgtcaga cagttatcag
tatggagaag aagttacgta caaatgtttt 2880gaaggttttg gaattgatgg
gcctgcaatt gcaaaatgct taggagaaaa atggtctcac 2940cctccatcat
gcataaaaac agattgtctc agtttaccta gctttgaaaa tgccataccc
3000atgggagaga agaaggatgt gtataaggcg ggtgagcaag tgacttacac
ttgtgcaaca 3060tattacaaaa tggatggagc cagtaatgta acatgcatta
atagcagatg gacaggaagg 3120ccaacatgca gagacacctc ctgtgtgaat
ccgcccacag tacaaaatgc ttatatagtg 3180tcgagacaga tgagtaaata
tccatctggt gagagagtac gttatcaatg taggagccct 3240tatgaaatgt
ttggggatga agaagtgatg tgtttaaatg gaaactggac ggaaccacct
3300caatgcaaag attctacagg aaaatgtggg ccccctccac ctattgacaa
tggggacatt 3360acttcattcc cgttgtcagt atatgctcca gcttcatcag
ttgagtacca atgccagaac 3420ttgtatcaac ttgagggtaa caagcgaata
acatgtagaa atggacaatg gtcagaacca 3480ccaaaatgct tacatccgtg
tgtaatatcc cgagaaatta tggaaaatta taacatagca 3540ttaaggtgga
cagccaaaca gaagctttat tcgagaacag gtgaatcagt tgaatttgtg
3600tgtaaacggg gatatcgtct ttcatcacgt tctcacacat tgcgaacaac
atgttgggat 3660gggaaactgg agtatccaac ttgtgcaaaa agatagaatc
aatcataaag tgcacacctt 3720tattcagaac tttagtatta aatcagttct
caatttcatt ttttatgtat tgttttactc 3780ctttttattc atacgtaaaa
ttttggatta atttgtgaaa atgtaattat aagctgagac 3840cggtggctct ctt
385321231PRTHomo sapiens 2Met Arg Leu Leu Ala Lys Ile Ile Cys Leu
Met Leu Trp Ala Ile Cys 1 5 10 15 Val Ala Glu Asp Cys Asn Glu Leu
Pro Pro Arg Arg Asn Thr Glu Ile 20 25 30 Leu Thr Gly Ser Trp Ser
Asp Gln Thr Tyr Pro Glu Gly Thr Gln Ala 35 40 45 Ile Tyr Lys Cys
Arg Pro Gly Tyr Arg Ser Leu Gly Asn Val Ile Met 50 55 60 Val Cys
Arg Lys Gly Glu Trp Val Ala Leu Asn Pro Leu Arg Lys Cys 65 70 75 80
Gln Lys Arg Pro Cys Gly His Pro Gly Asp Thr Pro Phe Gly Thr Phe 85
90 95 Thr Leu Thr Gly Gly Asn Val Phe Glu Tyr Gly Val Lys Ala Val
Tyr 100 105 110 Thr Cys Asn Glu Gly Tyr Gln Leu Leu Gly Glu Ile Asn
Tyr Arg Glu 115 120 125 Cys Asp Thr Asp Gly Trp Thr Asn Asp Ile Pro
Ile Cys Glu Val Val 130 135 140 Lys Cys Leu Pro Val Thr Ala Pro Glu
Asn Gly Lys Ile Val Ser Ser 145 150 155 160 Ala Met Glu Pro Asp Arg
Glu Tyr His Phe Gly Gln Ala Val Arg Phe 165 170 175 Val Cys Asn Ser
Gly Tyr Lys Ile Glu Gly Asp Glu Glu Met His Cys 180 185 190 Ser Asp
Asp Gly Phe Trp Ser Lys Glu Lys Pro Lys Cys Val Glu Ile 195 200 205
Ser Cys Lys Ser Pro Asp Val Ile Asn Gly Ser Pro Ile Ser Gln Lys 210
215 220 Ile Ile Tyr Lys Glu Asn Glu Arg Phe Gln Tyr Lys Cys Asn Met
Gly 225 230 235 240 Tyr Glu Tyr Ser Glu Arg Gly Asp Ala Val Cys Thr
Glu Ser Gly Trp 245 250 255 Arg Pro Leu Pro Ser Cys Glu Glu Lys Ser
Cys Asp Asn Pro Tyr Ile 260 265 270 Pro Asn Gly Asp Tyr Ser Pro Leu
Arg Ile Lys His Arg Thr Gly Asp 275 280 285 Glu Ile Thr Tyr Gln Cys
Arg Asn Gly Phe Tyr Pro Ala Thr Arg Gly 290 295 300 Asn Thr Ala Lys
Cys Thr Ser Thr Gly Trp Ile Pro Ala Pro Arg Cys 305 310 315 320 Thr
Leu Lys Pro Cys Asp Tyr Pro Asp Ile Lys His Gly Gly Leu Tyr 325 330
335 His Glu Asn Met Arg Arg Pro Tyr Phe Pro Val Ala Val Gly Lys Tyr
340 345 350 Tyr Ser Tyr Tyr Cys Asp Glu His Phe Glu Thr Pro Ser Gly
Ser Tyr 355 360 365 Trp Asp His Ile His Cys Thr Gln Asp Gly Trp Ser
Pro Ala Val Pro 370 375 380 Cys Leu Arg Lys Cys Tyr Phe Pro Tyr Leu
Glu Asn Gly Tyr Asn Gln 385 390 395 400 Asn His Gly Arg Lys Phe Val
Gln Gly Lys Ser Ile Asp Val Ala Cys 405 410 415 His Pro Gly Tyr Ala
Leu Pro Lys Ala Gln Thr Thr Val Thr Cys Met 420 425 430 Glu Asn Gly
Trp Ser Pro Thr Pro Arg Cys Ile Arg Val Lys Thr Cys 435 440 445 Ser
Lys Ser Ser Ile Asp Ile Glu Asn Gly Phe Ile Ser Glu Ser Gln 450 455
460 Tyr Thr Tyr Ala Leu Lys Glu Lys Ala Lys Tyr Gln Cys Lys Leu Gly
465 470 475 480 Tyr Val Thr Ala Asp Gly Glu Thr Ser Gly Ser Ile Arg
Cys Gly Lys 485 490 495 Asp Gly Trp Ser Ala Gln Pro Thr Cys Ile Lys
Ser Cys Asp Ile Pro 500 505 510 Val Phe Met Asn Ala Arg Thr Lys Asn
Asp Phe Thr Trp Phe Lys Leu 515 520 525 Asn Asp Thr Leu Asp Tyr Glu
Cys His Asp Gly Tyr Glu Ser Asn Thr 530 535 540 Gly Ser Thr Thr Gly
Ser Ile Val Cys Gly Tyr Asn Gly Trp Ser Asp 545 550 555 560 Leu Pro
Ile Cys Tyr Glu Arg Glu Cys Glu Leu Pro Lys Ile Asp Val 565 570 575
His Leu Val Pro Asp Arg Lys Lys Asp Gln Tyr Lys Val Gly Glu Val 580
585 590 Leu Lys Phe Ser Cys Lys Pro Gly Phe Thr Ile Val Gly Pro Asn
Ser 595 600 605 Val Gln Cys Tyr His Phe Gly Leu Ser Pro Asp Leu Pro
Ile Cys Lys 610 615 620 Glu Gln Val Gln Ser Cys Gly Pro Pro Pro Glu
Leu Leu Asn Gly Asn 625 630 635 640 Val Lys Glu Lys Thr Lys Glu Glu
Tyr Gly His Ser Glu Val Val Glu 645 650 655 Tyr Tyr Cys Asn Pro Arg
Phe Leu Met Lys Gly Pro Asn Lys Ile Gln 660 665 670 Cys Val Asp Gly
Glu Trp Thr Thr Leu Pro Val Cys Ile Val Glu Glu 675 680 685 Ser Thr
Cys Gly Asp Ile Pro Glu Leu Glu His Gly Trp Ala Gln Leu 690 695 700
Ser Ser Pro Pro Tyr Tyr Tyr Gly Asp Ser Val Glu Phe Asn Cys Ser 705
710 715 720 Glu Ser Phe Thr Met Ile Gly His Arg Ser Ile Thr Cys Ile
His Gly 725 730 735 Val Trp Thr Gln Leu Pro Gln Cys Val Ala Ile Asp
Lys Leu Lys Lys 740 745 750 Cys Lys Ser Ser Asn Leu Ile Ile Leu Glu
Glu His Leu Lys Asn Lys 755 760 765 Lys Glu Phe Asp His Asn Ser Asn
Ile Arg Tyr Arg Cys Arg Gly Lys 770 775 780 Glu Gly Trp Ile His Thr
Val Cys Ile Asn Gly Arg Trp Asp Pro Glu 785 790 795 800 Val Asn Cys
Ser Met Ala Gln Ile Gln Leu Cys Pro Pro Pro Pro Gln 805 810 815 Ile
Pro Asn Ser His Asn Met Thr Thr Thr Leu Asn Tyr Arg Asp Gly 820 825
830 Glu Lys Val Ser Val Leu Cys Gln Glu Asn Tyr Leu Ile Gln Glu Gly
835 840 845 Glu Glu Ile Thr Cys Lys Asp Gly Arg Trp Gln Ser Ile Pro
Leu Cys 850 855 860 Val Glu Lys Ile Pro Cys Ser Gln Pro Pro Gln Ile
Glu His Gly Thr 865 870 875 880 Ile Asn Ser Ser Arg Ser Ser Gln Glu
Ser Tyr Ala His Gly Thr Lys 885 890 895 Leu Ser Tyr Thr Cys Glu Gly
Gly Phe Arg Ile Ser Glu Glu Asn Glu 900 905 910 Thr Thr Cys Tyr Met
Gly Lys Trp Ser Ser Pro Pro Gln Cys Glu Gly 915 920 925 Leu Pro Cys
Lys Ser Pro Pro Glu Ile Ser His Gly Val Val Ala His 930 935 940 Met
Ser Asp Ser Tyr Gln Tyr Gly Glu Glu Val Thr Tyr Lys Cys Phe 945 950
955 960 Glu Gly Phe Gly Ile Asp Gly Pro Ala Ile Ala Lys Cys Leu Gly
Glu 965 970 975 Lys Trp Ser His Pro Pro Ser Cys Ile Lys Thr Asp Cys
Leu Ser Leu 980 985 990 Pro Ser Phe Glu Asn Ala Ile Pro Met Gly Glu
Lys Lys Asp Val Tyr 995 1000 1005 Lys Ala Gly Glu Gln Val Thr Tyr
Thr Cys Ala Thr Tyr Tyr Lys 1010 1015 1020 Met Asp Gly Ala Ser Asn
Val Thr Cys Ile Asn Ser Arg Trp Thr 1025 1030 1035 Gly Arg Pro Thr
Cys Arg Asp Thr Ser Cys Val Asn Pro Pro Thr 1040 1045 1050 Val Gln
Asn Ala Tyr Ile Val Ser Arg Gln Met Ser Lys Tyr Pro 1055 1060 1065
Ser Gly Glu Arg Val Arg Tyr Gln Cys Arg Ser Pro Tyr Glu Met 1070
1075 1080 Phe Gly Asp Glu Glu Val Met Cys Leu Asn Gly Asn Trp Thr
Glu 1085 1090 1095 Pro Pro Gln Cys Lys Asp Ser Thr Gly Lys Cys Gly
Pro Pro Pro 1100 1105 1110 Pro Ile Asp Asn Gly Asp Ile Thr Ser Phe
Pro Leu Ser Val Tyr 1115 1120 1125 Ala Pro Ala Ser Ser Val Glu Tyr
Gln Cys Gln Asn Leu Tyr Gln 1130 1135 1140 Leu Glu Gly Asn Lys Arg
Ile Thr Cys Arg Asn Gly Gln Trp Ser 1145 1150 1155 Glu Pro Pro Lys
Cys Leu His Pro Cys Val Ile Ser Arg Glu Ile 1160 1165 1170 Met Glu
Asn Tyr Asn Ile Ala Leu Arg Trp Thr Ala Lys Gln Lys 1175 1180 1185
Leu Tyr Ser Arg Thr Gly Glu Ser Val Glu Phe Val Cys Lys Arg 1190
1195 1200 Gly Tyr Arg Leu Ser Ser Arg Ser His Thr Leu Arg Thr Thr
Cys 1205 1210 1215 Trp Asp Gly Lys Leu Glu Tyr Pro Thr Cys Ala Lys
Arg 1220 1225 1230 31189DNAHomo sapiens 3atgtggctcc tggtcagtgt
aattctaatc tcacggatat cctctgttgg gggagaagca 60acattttgtg attttccaaa
aataaaccat ggaattctat atgatgaaga aaaatataag 120ccattttccc
aggttcctac aggggaagtt ttctattact cctgtgaata taattttgtg
180tctccttcaa aatcattttg gactcgcata acatgcacag aagaaggatg
gtcaccaaca 240ccaaagtgtc tcagactgtg tttctttcct tttgtggaaa
atggtcattc tgaatcttca 300ggacaaacac atctggaagg tgatactgtg
caaattattt gcaacacagg atacagactt 360caaaacaatg agaacaacat
ttcatgtgta gaacggggct ggtccacccc tcccaaatgc 420aggtccactg
acacttcctg tgtgaatccg cccacagtac aaaatgctta tatagtgtcg
480agacagatga gtaaatatcc atctggtgag agagtacgtt atcaatgtag
gagcccttat 540gaaatgtttg gggatgaaga agtgatgtgt ttaaatggaa
actggacgga accacctcaa 600tgcaaagatt ctacgggaaa atgtgggccc
cctccaccta ttgacaatgg ggacattact 660tcattcccgt tgtcagtata
tgctccagct tcatcagttg agtaccaatg ccagaacttg 720tatcaacttg
agggtaacaa gcgaataaca tgtagaaatg gacaatggtc agaaccacca
780aaatgcttac atccgtgtgt aatatcccga gaaattatgg aaaattataa
catagcatta 840aggtggacag ccaaacagaa gctttatttg agaacaggtg
aatcagctga atttgtgtgt 900aaacggggat atcgtctttc atcacgttct
cacacattgc gaacaacatg ttgggatggg 960aaactggagt atccaacttg
tgcaaaaaga tagaatcaat cataaaatgc acacctttat 1020tcagaacttt
agtattaaat cagttcttaa tttaattttt aagtattgtt ttactccttt
1080ttattcatac gtaaaatttt ggattaattt gtgaaaatgt aattataagc
tgagaccggt 1140ggctctcttc ttaaaagcac catattaaaa cttggaaaac
tggaaaact 11894330PRTHomo sapiens 4Met Trp Leu Leu Val Ser Val Ile
Leu Ile Ser Arg Ile Ser Ser Val 1 5 10 15 Gly Gly Glu Ala Thr Phe
Cys Asp Phe Pro Lys Ile Asn His Gly Ile 20 25 30 Leu Tyr Asp Glu
Glu Lys Tyr Lys Pro Phe Ser Gln Val Pro Thr Gly 35 40 45 Glu Val
Phe Tyr Tyr Ser Cys Glu Tyr Asn Phe Val Ser Pro Ser Lys 50 55 60
Ser Phe Trp Thr Arg Ile Thr Cys Thr Glu Glu Gly Trp Ser Pro Thr 65
70 75 80 Pro Lys Cys Leu Arg Leu Cys Phe Phe Pro Phe Val Glu Asn
Gly His 85 90 95 Ser Glu Ser Ser Gly Gln Thr His Leu Glu Gly Asp
Thr Val Gln Ile 100 105 110 Ile Cys Asn Thr Gly Tyr Arg Leu Gln Asn
Asn Glu Asn Asn Ile Ser 115 120 125 Cys Val Glu Arg Gly Trp Ser Thr
Pro Pro Lys Cys Arg Ser Thr Asp 130 135 140 Thr Ser Cys Val Asn Pro
Pro Thr Val Gln Asn Ala Tyr Ile Val Ser 145 150 155 160 Arg Gln Met
Ser Lys Tyr Pro Ser Gly Glu Arg Val Arg Tyr Gln Cys 165 170 175 Arg
Ser Pro Tyr Glu Met Phe Gly Asp Glu Glu Val Met Cys Leu Asn 180 185
190 Gly Asn Trp Thr Glu Pro Pro Gln Cys Lys Asp Ser Thr Gly Lys Cys
195 200 205 Gly Pro Pro Pro Pro Ile Asp Asn Gly Asp Ile Thr Ser Phe
Pro Leu 210 215 220 Ser Val Tyr Ala Pro Ala Ser Ser Val Glu Tyr Gln
Cys Gln Asn Leu 225 230 235 240 Tyr Gln Leu Glu Gly Asn Lys Arg Ile
Thr Cys Arg Asn Gly Gln Trp 245 250 255 Ser Glu Pro Pro Lys Cys Leu
His Pro Cys Val Ile Ser Arg Glu Ile 260 265
270 Met Glu Asn Tyr Asn Ile Ala Leu Arg Trp Thr Ala Lys Gln Lys Leu
275 280 285 Tyr Leu Arg Thr Gly Glu Ser Ala Glu Phe Val Cys Lys Arg
Gly Tyr 290 295 300 Arg Leu Ser Ser Arg Ser His Thr Leu Arg Thr Thr
Cys Trp Asp Gly 305 310 315 320 Lys Leu Glu Tyr Pro Thr Cys Ala Lys
Arg 325 330 51246DNAHomo sapiens 5atgttgttac taatcaatgt cattctgacc
ttgtgggttt cctgtgctaa tggacaagtg 60aaaccttgtg attttccaga cattaaacat
ggaggtctat ttcatgagaa tatgcgtaga 120ccatactttc cagtagctgt
aggaaaatat tactcctatt actgtgatga acattttgag 180actccgtcag
gaagttactg ggattacatt cattgcacac aaaatgggtg gtcaccagca
240gtaccatgtc tcagaaaatg ttattttcct tatttggaaa atggatataa
tcaaaattat 300ggaagaaagt ttgtacaggg taactctaca gaagttgcct
gccatcctgg ctacggtctt 360ccaaaagtcc gtcagaccac agttacatgt
acggagaatg gctggtctcc tactcccaga 420tgcatccgag acagaacatg
ctcaaaatca gatatagaaa ttgaaaatgg attcatttct 480gaatcttcct
ctatttatat tttaaataaa gaaatacaat ataaatgtaa accaggatat
540gcaacagcag atggaaattc ttcaggatca attacatgtt tgcgaaatgg
atggtcagca 600caaccaattt gcattaattc ttcagaaaag tgtggacctc
ctccacctat tagcaatggt 660gataccacct cctttctact aaaagtgtat
gtgccacagt caagagtcga gtaccaatgc 720cagtcctact atgaacttca
gggttctaat tatgtaacat gtagtaatgg agagtggtcg 780gcaccaccta
gatgcataca tccatgtata ataactgaag aaaacatgaa taaaaataac
840ataaagttaa aaggaagaag tgacagaaaa tattatgcaa aaacagggga
taccattgaa 900tttatgtgta aattgggata taatgcaaat acatcaattc
tatcatttca agcagtgtgt 960cgggaaggga tagtggaata ccccagatgc
gaataaggca gcattgttac cctaaatgta 1020tgtccaactt ccacttttcc
acttctcact cttatggtct caaagcttgc aaagatagct 1080tctgatattg
ttgtaatttc tactttattt caaagaaaat taatataata gtttcaattt
1140gcaacttaat atattctcaa aaatatatta aaacaaacta aattattgct
tatgcttgta 1200ctaaaataat aaaaactact cttataaaaa aaaaaaaaaa aaaaaa
12466331PRTHomo sapiens 6Met Leu Leu Leu Ile Asn Val Ile Leu Thr
Leu Trp Val Ser Cys Ala 1 5 10 15 Asn Gly Gln Val Lys Pro Cys Asp
Phe Pro Asp Ile Lys His Gly Gly 20 25 30 Leu Phe His Glu Asn Met
Arg Arg Pro Tyr Phe Pro Val Ala Val Gly 35 40 45 Lys Tyr Tyr Ser
Tyr Tyr Cys Asp Glu His Phe Glu Thr Pro Ser Gly 50 55 60 Ser Tyr
Trp Asp Tyr Ile His Cys Thr Gln Asn Gly Trp Ser Pro Ala 65 70 75 80
Val Pro Cys Leu Arg Lys Cys Tyr Phe Pro Tyr Leu Glu Asn Gly Tyr 85
90 95 Asn Gln Asn Tyr Gly Arg Lys Phe Val Gln Gly Asn Ser Thr Glu
Val 100 105 110 Ala Cys His Pro Gly Tyr Gly Leu Pro Lys Val Arg Gln
Thr Thr Val 115 120 125 Thr Cys Thr Glu Asn Gly Trp Ser Pro Thr Pro
Arg Cys Ile Arg Asp 130 135 140 Arg Thr Cys Ser Lys Ser Asp Ile Glu
Ile Glu Asn Gly Phe Ile Ser 145 150 155 160 Glu Ser Ser Ser Ile Tyr
Ile Leu Asn Lys Glu Ile Gln Tyr Lys Cys 165 170 175 Lys Pro Gly Tyr
Ala Thr Ala Asp Gly Asn Ser Ser Gly Ser Ile Thr 180 185 190 Cys Leu
Arg Asn Gly Trp Ser Ala Gln Pro Ile Cys Ile Asn Ser Ser 195 200 205
Glu Lys Cys Gly Pro Pro Pro Pro Ile Ser Asn Gly Asp Thr Thr Ser 210
215 220 Phe Leu Leu Lys Val Tyr Val Pro Gln Ser Arg Val Glu Tyr Gln
Cys 225 230 235 240 Gln Ser Tyr Tyr Glu Leu Gln Gly Ser Asn Tyr Val
Thr Cys Ser Asn 245 250 255 Gly Glu Trp Ser Ala Pro Pro Arg Cys Ile
His Pro Cys Ile Ile Thr 260 265 270 Glu Glu Asn Met Asn Lys Asn Asn
Ile Lys Leu Lys Gly Arg Ser Asp 275 280 285 Arg Lys Tyr Tyr Ala Lys
Thr Gly Asp Thr Ile Glu Phe Met Cys Lys 290 295 300 Leu Gly Tyr Asn
Ala Asn Thr Ser Ile Leu Ser Phe Gln Ala Val Cys 305 310 315 320 Arg
Glu Gly Ile Val Glu Tyr Pro Arg Cys Glu 325 330
717DNAArtificialSynthetic CFHL1ex6.F, CFHR1 ex6 forward primer
7agtcggtttg gacagtg 17818DNAArtificialSynthetic CFHL1ex6R, CFHR1
ex6 reverse primer 8gcacaagttg gatactcc 18920DNAArtificialSynthetic
CFHL1ex6. F2, CFHR1 (ex6) forward primer 9catagtcggt ttggacagtg
201019DNAArtificialSynthetic CFHL3ex3.F, CFHR3 ex3 forward primer
10tcattgctat gtccttagg 191117DNAArtificialSynthetic CFHL3ex3.R,
CFHR3 ex3 reverse primer 11tctgagactg tcgtccg
171217DNAArtificialSynthetic CFHL3ex3seq.F, CFHR3 ex3 seq forward
primer 12ttttggatgt ttatgcg 171316DNAArtificialSynthetic
CFHL3ex3seq.R, CFHR3 ex3 seq reverse primer 13aaataggtcc gttggc
161420DNAArtificialSynthetic PCR primer CFH ex22 forward
14ggtttggata gtgttttgag 201517DNAArtificialSynthetic PCR primer CFH
ex22 reverse 15accgttagtt ttccagg 171617DNAArtificialSynthetic PCR
primer CFHR2 ex4 forward 16tgtgttcatt cagtgag
171717DNAArtificialSynthetic PCR primer CFHR2 ex4 reverse
17atagacattt ggtaggc 171820DNAArtificialSynthetic PCR primer CFHR4
ex3 forward 18ctacaatggg actttcttag 201919DNAArtificialSynthetic
PCR primer CFHR4 ex3 reverse 19ttcacactca taggaggac
192016DNAArtificialSynthetic PCR primer CFHR5 ex2 forward
20aacccttttt cccaag 162119DNAArtificialSynthetic PCR primer CFHR5
ex2 reverse 21cacatccttc tctattcac 192217DNAArtificialSynthetic PCR
primer CFH ex22 reverse 22atgttgttcg caatgtg
172323DNAArtificialSynthetic PCR primer IVS 5' to CFHR3 forward
23cacgctattt gaaagacaaa ctt 232422DNAArtificialSynthetic PCR primer
IVS 5' to CFHR3 reverse 24aagcaaccct gctctacaat gt
222520DNAArtificialSynthetic PCR primer IVS 5' to CFHR3 forward
25ggaaccacat gggtcaaatg 202627DNAArtificialSynthetic PCR primer IVS
5' to CFHR3 reverse 26gcacaacaaa taaaactagc aaatcat
272723DNAArtificialSynthetic PCR primer IVS 5' to CFHR3 forward
27attgctgcaa tctcagaaga aaa 232822DNAArtificialSynthetic PCR primer
IVS 5' to CFHR3 reverse 28tcaaaacgaa caaacaaaca gg
222921DNAArtificialSynthetic PCR primer CFHR3 (ex2) forward
29tgcgtagacc atactttcca g 213033DNAArtificialSynthetic PCR primer
CFHR3 (ex2) reverse 30ctctctttaa tcttttaaag ttttatacat gtg
333123DNAArtificialSynthetic PCR primer CFHR1 (ex2) forward
31taaagtgctg tgtttgtatt tgc 233223DNAArtificialSynthetic PCR primer
CFHR1 (ex2) reverse 32gtgattattt tgttaccaac agc
233323DNAArtificialSynthetic PCR primer CFHR2 forward 33tccttttcta
gttcattaac ata 233421DNAArtificialSynthetic PCR primer CFHR2
reverse 34agtgatatga cacatgctga c 213524DNAArtificialSynthetic PCR
primer CFHR2 forward 35ctacagacta actttcaata attt
243624DNAArtificialSynthetic PCR primer CFHR2 reverse 36gatactttta
cattttctta tgat 243725DNAArtificialSynthetic PCR primer CFHR2
forward 37acatagttat atgatcgttt tgagt 253823DNAArtificialSynthetic
PCR primer CFHR2 reverse 38acagagaaag aacttactaa ttg
233922DNAArtificialSynthetic PCR primer CFHR4 forward 39agtattaaat
tgttcagtcc ag 224023DNAArtificialSynthetic PCR primer CFHR4 reverse
40aaactagtgt aagaatgtat gat 234123DNAArtificialSynthetic PCR primer
CFHR4 forward 41taagttgaaa gagatctaaa cac
234225DNAArtificialSynthetic PCR primer CFHR4 reverse 42actgtatgta
agattatgaa agtat 25
* * * * *
References