RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy

Abstract

The current invention provides an improved oligonucleotide and its use for treating, ameliorating, preventing and/or delaying DMD or BMD.

Description

CROSS REFERENCE

[0001] This application is a continuation of international Patent Application No. PCT/NL2013/050045, filed Jan. 28, 2013, which claims the benefit of EP 12152934.1 filed Jan. 27, 2012, and U.S. Provisional Application Nos. 61/591,354 filed Jan. 27, 2012 and 61/612,467 filed Mar. 19, 2012, all of which are incorporated by reference in their entirety.

FIELD

[0002] The invention relates to the field of human genetics, more specifically neuromuscular disorders. The invention in particular relates to the use of an oligonucleotide with improved characteristics enhancing clinical applicability as further defined herein.

BACKGROUND OF THE INVENTION

[0003] Neuromuscular diseases are characterized by impaired functioning of the muscles due to either muscle or nerve pathology (myopathies and neuropathies). The myopathies include genetic muscular dystrophies that are characterized by progressive weakness and degeneration of skeletal, heart and/or smooth muscle. Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common childhood forms of muscular dystrophy. DMD is a severe, lethal neuromuscular disorder resulting in a dependency on wheelchair support before the age of 12 and patients often die before the age of thirty due to respiratory- or heart failure. It is caused by reading frame-shifting deletions (.about.67%) or duplications (.about.7%) of one or more exons, or by point mutations (.about.25%) in the 2.24 Mb DMD gene, resulting in the absence of functional dystrophin. BMD is also caused by mutations in the DMD gene, but these maintain the open reading frame, yield semi-functional dystrophin proteins, and result in a typically much milder phenotype and longer lifespan. During the last decade, specific modification of splicing in order to restore the disrupted reading frame of the transcript has emerged as a promising therapy for DMD (van Ommen et al., 2008; Yokota et al., 2007; van Deutekom et al., 2007; Goemans et al., 2011; Cirak et al., 2011). Using highly sequence-specific antisense oligonucleotides (AONs) which bind to the exon flanking or containing the mutation and which interfere with its splicing signals, the skipping of that exon can be induced during the processing of the DMD pre-mRNA. Despite the resulting truncated transcript, the open reading frame is restored and a protein is introduced which is similar to those found in BMD patients. AON-induced exon skipping provides a mutation-specific, and thus personalized, therapeutic approach for DMD patients. Several oligonucleotides are currently being developed for skipping most relevant exons of the dystrophin pre-mRNA such as exons 2, 8, 9, 17, 29, 43, 44, 45, 46, 47, 48, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60-63, 71-78 as described in WO 02/024906, WO2004/083446, WO2006/112705, WO2007/135105, WO 2009/139630, WO 2010/050801 or WO 2010/050802.

[0004] As the majority of the mutations cluster around exons 45 to 55, the skipping of one specific exon may be therapeutic for many patients with different mutations. The skipping of exon 51 applies to the largest subset of patients (.about.13%), including those with deletions of exons 45 to 50, 48 to 50, 50, or 52. The AONs applied are chemically modified to resist endonucleases, exonucleases and RNaseH, and to promote RNA binding and duplex stability. Two different AON chemistries are currently being developed for exon 51 skipping in DMD: 2'-O-methyl phosphorothioate RNA AONs (2OMePS, GSK2402968/PRO051) and phosphorodiamidate morpholino oligomers (PMO, AVI-4658) (Goemans et al., 2011; Cirak et al., 2011). In two independent phase I/II studies, both were shown to specifically induce exon 51 skipping and at least partly restore dystrophin expression at the muscle fiber membranes after systemic administration. Although AONs are typically not well taken up by healthy muscle fibers, the dystrophin deficiency in DMD, resulting in damaged and thus more permeable fiber membranes, actually promotes uptake. In studies in the dystrophin-deficient mdx mouse model, 2'-O-methyl phosphorothioate RNA oligonucleotides have demonstrated an up to 10 times higher uptake in different muscle groups when compared to that in wild type mice (Heemskerk et al., 2010). Although the recent phase I/II results with both 2'-O-methyl phosphorothioate RNA and phosphorodiamidate morpholino AONs in DMD patients confirm this enhanced uptake in dystrophic muscle, the different chemical modifications seemed to result in a differential uptake by and distribution through muscle. The levels of novel dystrophin in both studies after 3 months of treatment were promising but still moderate and challenges the field to investigate next generation oligochemistry.

[0005] The particular characteristics of a chosen chemistry at least in part affects the delivery of an AON to the target transcript: administration route, biostability, biodistribution, intra-tissue distribution, and cellular uptake and trafficking. In addition, further optimization of oligonucleotide chemistry is conceived to enhance binding affinity and stability, enhance activity, improve safety, and/or to reduce cost of goods by reducing length or improving synthesis and/or purification procedures. Multiple chemical modifications have become generally and/or commercially available to the research community (such as 2'-O-methyl RNA and 5-substituted pyrimidines and 2,6-diaminopurines), whereas most others still present significant synthetic effort to obtain. Especially preliminary encouraging results have been obtained using 2'-O-methyl phosphorothioate RNA containing modifications on the pyrimidine and purine bases as identified herein.

[0006] In conclusion, to enhance the therapeutic applicability of AONs for DMD, there is a need for AONs with further improved characteristics.

DESCRIPTION OF THE INVENTION

Oligonucleotide

[0007] In a first aspect, the invention provides an oligonucleotide comprising a 2'-O-methyl RNA monomer and a phosphorothioatc backbone or consisting of 2'-O-methyl RNA monomers linked by phosphorothioate backbones, and comprising a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy. Therefore, the invention provides an oligonucleotide comprising a 2'-O-methyl RNA monomer, a phosphorothioate backbone and a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.

[0008] Accordingly the invention also provides an oligonucleotide consisting of 2'-O-methyl RNA monomers and a phosphorothioate backbone and comprises a 5-methylpyrimidine and/or a 2,6-diaminopurine base preferably for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.

[0009] It is clear for the skilled person that "an RNA monomer" as present in an oligonucleotide of the invention may also be identified as being "an RNA nucleotide residue". Both terms may be used interchangeably throughout the application.

[0010] Within the context of the invention, "a" in each of the following expressions means "at least one": a 2'-O-methyl RNA monomer, a 2'-O-methyl RNA nucleotide residue, a 2'-O-methyl phosphorothioate RNA monomer, a 5-methylpyrimidine base, a 2,6-diaminopurine base.

[0011] Within the context of the invention, it is clear for the skilled person that "an oligonucleotide comprising a 2'-O-methyl RNA monomer, a phosphorothioate backbone" could be replaced by "an oligonucleotide comprising a 2'-O-methyl RNA monomer linked by phosphorothioate backbones". The same holds for "an oligonucleotide consisting of 2'-O-methyl RNA monomers and a phosphorothioate backbone" that could be replaced by "an oligonucleotide consisting of 2'-O-methyl RNA monomer linked by phosphorothioate backbones".

[0012] In the context of the invention, the expression "for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy" could be replaced by the expression "for use in the treatment of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy."

[0013] Preferably, an oligonucleotide is an oligonucleotide with less than 34 nucleotides. Said oligonucleotide may have 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Such oligonucleotide may also be identified as an oligonucleotide having from 10 to 33 nucleotides.

[0014] Accordingly, an oligonucleotide of the invention comprises a 2'-O-methyl RNA monomer and a phosphorothioate backbone and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides).

[0015] Accordingly, an oligonucleotide of the invention consists of 2'-O-methyl RNA monomers linked by phosphorothioate backbone and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides)

[0016] Accordingly, an oligonucleotide of the invention comprises a 2'-O-methyl RNA monomer, a phosphorothioate backbone, comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) and a 5-methylpyrimidine and/or a 2,6-diaminopurine base.

[0017] Accordingly, an oligonucleotide of the invention consists of 2'-O-methyl RNA monomers linked by phosphorothioate backbone, and comprises less than 34 nucleotides (i.e. it comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) and a 5-methylpyrimidine and/or a 2,6-diaminopurine base.

[0018] Each of these oligonucleotides is for use or may be for use as a medicament for treating Duchenne Muscular Dystrophy or Becker Muscular Dystrophy.

[0019] An oligonucleotide of the invention comprises or consists of a 2'-O-methyl phosphorothioate RNA monomer. Such oligonucleotide comprises a 2'-O-methyl RNA monomer connected through or linked by a phosphorothioate backbone or consists of 2'-O-methyl phosphorothioate RNA. Preferably, such oligonucleotide consists of a 2'-O-methyl phosphorothioate RNA. Such chemistry is known to the skilled person. Throughout the application, an oligonucleotide comprising a 2'-O-methyl RNA monomer and a phosphorothioate backbone may be replaced by an oligonucleotide comprising a 2'-O-methyl phosphorothioate RNA. Throughout the application, an oligonucleotide consisting of 2'-O-methyl RNA monomers linked by or connected through phosphorothioate backbones may be replaced by an oligonucleotide consisting of 2'-O-methyl phosphorothioatc RNA.

[0020] In the context of the invention, "backbone" is used to identify the linkage between two sugar units or modified versions of a sugar unit or moiety as later defined herein (i.e. internucleoside linkage). Throughout the description, the words "backbone", "internucleoside linkage" and "linkage" may be used interchangeably. Thus, an oligonucleotide having 10 nucleotides contains 9 backbones, linking the 10 sugar units or modified versions of a sugar unit or moiety as later defined herein together. At least one of the backbones of the oligonucleotide according to the invention consists of a phosphorothioate moiety, linking two sugar units or modified versions of a sugar unit or moiety as later defined herein. Thus, at least one phosphodiester backbones present in RNA is replaced by phosphorothioate moiety. A naturally occurring internucleoside linkage or backbone is the 3' to 5' phosphodiester linkage.

[0021] In addition, an oligonucleotide of the invention may comprise a base modification that increases binding affinity to target strands, increases melting temperature of the resulting duplex of said oligonucleotide with its target, and/or decreases immunostimulatory effects, and/or increases biostability, and/or improves biodistribution and/or intra-tissue distribution, and/or cellular uptake and trafficking. In a more preferred embodiment, an oligonucleotide of the invention comprises a 5-methylpyrimidine and/or a 2,6-diaminopurine base. A 5-methylpyrimidine base is selected from a 5-methylcytosine and/or a 5-methyluracil and/or a thymine, in which thymine is identical to 5-methyluracil.

[0022] Accordingly, the expression "comprises a 5-methylcytosine and/or a 5-methyluracil and/or a 2,6-diaminopurine base" in the context of the modified oligonucleotide of the invention may be replaced by "comprises a base modification selected from the group consisting of: a 5-methylcytosine, a 5-methyluracil and a 2,6-diaminopurine base".

[0023] Where an oligonucleotide of the invention has two or more such base modifications, said base modifications may be identical, for example all such modified bases in the oligonucleotide are 5-methylcytosine, or said base modifications may be combinations of different base modifications, for example the oligonucleotide may have one or more 5-methylcytosines and one or more 5-methyluracils. `Thymine` and `5-methyluracil` may be interchanged throughout the document. In analogy, 2,6-diaminopurine is identical to 2-aminoadenine and these terms may be interchanged throughout the document. The use of 2,6-diaminopurine has been disclosed in another context in U.S. Pat. No. 7,745,420.

[0024] The term "base modification" or "modified base" as identified herein refers to the modification of an existing base (i.e. pyrimidine or purine base) or to the de novo synthesis of a base. This de novo synthesized base could be qualified as "modified" by comparison to an existing base. An oligonucleotide of the invention comprising a 5-methylcytosine and/or a 5-methyluracil and/or a 2,6-diaminopurine base means that at least one of the cytosine nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group, i.e. a 5-substituted cytosine, and/or that at least one of the uracil nucleobases of said oligonucleotide has been modified by substitution of the proton at the 5-position of the pyrimidine ring with a methyl group (i.e. a 5-methyluracil), and/or that at least one of the adenine nucleobases of said oligonucleotide has been modified by substitution of the proton at the 2-position with an amino group (i.e. a 2,6-diaminopurine), respectively. Within the context of the invention, the expression "the substitution of a proton with a methyl group in position 5 of the pyrimidine ring" may be replaced by the expression "the substitution of a pyrimidine with a 5-methylpyrimidine," with pyrimidine referring to only uracil, only cytosine or both. Likewise, within the context of the invention, the expression "the substitution of a proton with an amino group in position 2 of adenine" may be replaced by the expression "the substitution of an adenine with a 2,6-diaminopurine." If said oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines, uracils, and/or adenines, at least one, 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines, uracils and/or adenines respectively have been modified this way. Preferably all cytosines, uracils and/or adenines have been modified this way or substituted by 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine, respectively. No need to say that this aspect of the invention could only be applied to oligonucleotides comprising at least one cytosine, uracil, or adenine, respectively, in their sequence. An oligonucleotide comprising at least one 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine may be called a modified oligonucleotide by reference to its non-modified counterpart comprising no 5-methylcytosine, no 5-methyluracil and no 2,6-diaminopurine. A non-modified counterpart may also be identified as being an oligonucleotide comprising unmodified cytosines, unmodified uraciles and unmodified adenines. Preferred non-modified sequences are represented by one of the following base or nucleotide sequences comprising or consisting of SEQ ID NO:91, 93-170.

[0025] We discovered that the presence of a 5-methylcytosine, 5-methyluracil and/or a 2,6-diaminopurine in an oligonucleotide of the invention has a positive effect on at least one of the parameters of said oligonucleotides. In this context, parameters may include: binding affinity and/or kinetics, exon skipping activity, biostability, (intra-tissue) distribution, cellular uptake and/or trafficking, and/or immunogenicity of said oligonucleotide, as explained below. Said positive effect may be correlated with the number or percentage of base modifications incorporated. For the parameter of exon skipping activity, we found for some oligonucleotides that modification of nucleobases is not needed per se to obtain relatively high levels of exon skipping. This may be related to the specific role (and strength) of the specifically targeted sequence within the exon in its splicing process.

[0026] Binding affinity and kinetics depend on the AON's thermodynamic properties. These are at least in part determined by the melting temperature of said oligonucleotide (Tm; calculated with e.g. the oligonucleotide properties calculator (http://www.unc.edu/.about.cail/biotool/oligo/index.html or http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/) for single stranded RNA using the basic Tm and the nearest neighbor model), and/or the free energy of the oligonucleotide-target exon complex (using RNA structure version 4.5 or RNA mfold version 3.5). If a Tm is increased, the exon skipping activity typically increases, but when a Tm is too high, the AON is expected to become less sequence-specific. An acceptable Tm and free energy depend on the sequence of the oligonucleotide. Therefore, it is difficult to give preferred ranges for each of these parameters.

[0027] Exon skipping activity is preferably measured by analysing total RNA isolated from AON-treated muscle cell cultures or muscle tissue by reverse transcriptase polymerase chain reaction (RT-PCR) using DMD gene-specific primers flanking the targeted exon as described (Aartsma-Rus et al., 2003). RT-PCR products are analyzed on 1-2% agarose gels or with the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). The ratio of shorter transcript fragments, representing transcripts in which the targeted exon is skipped, to the total of transcript products is assessed (calculated as percentage of exon skipping induced by an AON). Shorter fragments may also be sequenced to determine the correctness and specificity of the targeted exon skipping. An increase in percentage of exon skipping may be detected for a modified oligonucleotide of the invention (i.e. an oligonucleotide comprising a 2'-O-methyl RNA monomer, a phosphorothioate backbone and a 5-methylpyrimidine and/or a 2,6-diaminopurine base) compared to its non-modified counterpart (i.e. an oligonucleotide comprising a 2'-O-methyl RNA monomer, a phosphorothioate backbone and not comprising any 5-methylpyrimidine and any 2,6-diaminopurine base). Said increase is preferably a detectable increase assessed as explained above using RT-PCR. Said increase is preferably an increase of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times higher, or even 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times higher or more.

[0028] Biodistribution and biostability are preferably at least in part determined by a validated hybridization ligation assay adapted from Yu et al., 2002. In an embodiment, plasma or homogenized tissue samples are incubated with a specific capture oligonucleotide probe. After separation, a DTG-labeled oligonucleotide is ligated to the complex and detection followed using an anti-DIG antibody-linked peroxidase. Non-compartmental pharmacokinetic analysis is performed using WINNONLIN software package (model 200, version 5.2, Pharsight, Mountainview, Calif.). Levels of AON (ug) per mL plasma or mg tissue are monitored over time to assess area under the curve (AUC), peak concentration (C.sub.max), time to peak concentration (T.sub.max), terminal half life and absorption lag time (t.sub.lag). Such a preferred assay has been disclosed in the experimental part.

[0029] AONs may stimulate an innate immune response by activating the Toll-like receptors (TLR), including TLR9 and TLR7 (Krieg et al., 1995). The activation of TLR9 typically occurs due to the presence of non-methylated CG sequences present in oligodeoxynucleotides (ODNs), by mimicking bacterial DNA which activates the innate immune system through TLR9-mediated cytokine release. The 2'-O-methyl modification is however suggested to markedly reduce such possible effect. TLR7 has been described to recognize uracil repeats in RNA (Diebold et al., 2006).

[0030] Activation of TLR9 and TLR7 result in a set of coordinated immune responses that include innate immunity (macrophages, dendritic cells (DC), and NK cells)(Krieg et al., 1995; Krieg, 2000). Several chemo- and cytokines, such as IP-10, TNF.alpha., IL-6, MCP-1 and IFN.alpha. (Wagner, 1999; Popovic et al., 2006) have been implicated in this process. The inflammatory cytokines attract additional defensive cells from the blood, such as T and B cells. The levels of these cytokines can be investigated by in vitro testing. In short, human whole blood is incubated with increasing concentrations of AONs after which the levels of the cytokines are determined by standard commercially available ELISA kits. Such a preferred assay has been described in the experimental part. A decrease in immunogenicity preferably corresponds to a detectable decrease of concentration of at least one of the cytokines mentioned above by comparison to the concentration of corresponding cytokine in an assay in a cell treated with an oligonucleotide comprising at least one 5-methylcytosine compared to a cell treated with a corresponding oligonucleotide having no 5-methylcytosines.

[0031] Accordingly, a preferred oligonucleotide of the invention has an improved parameter, such as an acceptable or a decreased immunogenicity and/or a better biodistribution and/or acceptable or improved RNA binding kinetics and/or thermodynamic properties by comparison to a corresponding oligonucleotide consisting of a 2'O-methyl phosphorothioate RNA without a 5-methylcytosine, a 5-methyluracil and a 2,6-diaminopurine (i.e. so called non-modified oligonucleotide). Said non-modified oligonucleotide may also be identified as being an oligonucleotide comprising unmodified cytosines, unmodified uraciles and unmodified adenines. Each of these parameters could be assessed using assays known to the skilled person or preferably as disclosed herein.

[0032] Below other chemistries and modifications of the oligonucleotide of the invention are defined. These additional chemistries and modifications may be present in combination with the chemistry already defined for said oligonucleotide, i.e. the presence of a 5-methylcytosine, a 5-methyluracil and/or a 2,6-diaminopurine, and the oligonucleotide comprising or consisting of a 2'-O-methyl phosphorothioate RNA.

[0033] A preferred oligonucleotide of the invention comprises or consists of an RNA molecule or a modified RNA molecule. In a preferred embodiment, an oligonucleotide is single stranded. The skilled person will understand that it is however possible that a single stranded oligonucleotide may form an internal double stranded structure. However, this oligonucleotide is still named a single stranded oligonucleotide in the context of this invention.

[0034] In addition to the modifications described above, the oligonucleotide of the invention may comprise further modifications such as different types of nucleic acid monomers or nucleotides as described below. Different types of nucleic acid monomers may be used to generate an oligonucleotide of the invention. Said oligonucleotide may have at least one backbone, and/or sugar modification and/or at least one base modification compared to an RNA-based oligonucleotide.

[0035] A base modification includes a modified version of the natural purine and pyrimidine bases (e.g. adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine, orotic acid, agmatidine, lysidine, 2-thiopyrimidine (e.g. 2-thiouracil, 2-thiothymine), G-clamp and its derivatives, 5-substituted pyrimidine (e.g. 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or derivatives thereof; N.sup.2-cyclopentylguanine (cPent-G), N.sup.2-cyclopentyl-2-aminopurine (cPent-AP), and N.sup.2-propyl-2-aminopurine (Pr-AP), pseudouracil or derivatives thereof; and degenerate or universal bases, like 2,6-difluorotoluene or absent bases like abasic sites (e.g. 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen has been replaced with nitrogen (azaribose)). Examples of derivatives of Super A, Super G and Super T can be found in U.S. Pat. No. 6,683,173 (Epoch Biosciences), which is incorporated here entirely by reference. cPent-G, cPent-AP and Pr-AP were shown to reduce immunostimulatory effects when incorporated in siRNA (Peacock H. et al. J. Am. Chem. Soc. 2011, 133, 9200).

[0036] A pseudouracil is a naturally occurring isomerized version of uracil, with a C-glycoside rather than the regular N-glycoside as in uridine. Pseudouridine-containing synthetic mRNA may have an improved safety profile compared to uridine-containing mRNA (WO 2009127230, incorporated here in its entirety by reference).

[0037] In an embodiment, an oligonucleotide of the invention comprises an abasic site or an abasic monomer. Within the context of the invention, such monomer may be called an abasic site or an abasic monomer. An abasic monomer or abasic site is a monomer or building block that lacks a nucleobase by comparison to a corresponding monomer comprising a nucleobase. Within the invention, an abasic monomer is thus a building block part of an oligonucleotide but lacking a nucleobase. Such abasic monomer may be present or linked or attached or conjugated to a free terminus of an oligonucleotide.

[0038] In a more preferred embodiment, an oligonucleotide of the invention comprises 1-20 or more abasic monomers. Therefore, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more abasic monomers may be present in an oligonucleotide of the invention.

[0039] An abasic monomer may be of any type known and conceivable by the skilled person, non-limiting examples of which are depicted below:

##STR00001##

[0040] Herein, R.sub.1 and R.sub.2 are independently H, an oligonucleotide or other abasic site(s), provided that not both R.sub.1 and R.sub.2 are H and R.sub.1 and R.sub.2 are not both an oligonucleotide. An abasic monomer(s) can be attached to either or both termini of the oligonucleotide as specified before. It should be noted that an oligonucleotide attached to one or two an abasic site(s) or abasic monomer(s) may comprise less than 10 nucleotides. In this respect, the oligonucleotide according to the invention may comprise at least 10 nucleotides, optionally including one or more abasic sites or abasic monomers at one or both termini.

[0041] Depending on its length an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 base modifications. It is also encompassed by the invention to introduce more than one distinct base modification in said oligonucleotide.

[0042] A sugar modification includes a modified version of the ribosyl moiety, such as 2'-O-modified RNA such as 2'-O-alkyl or 2'-O-(substituted)alkyl e.g. 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-allyl, 2'-O-(3-amino)propyl, 2'-O-(3-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. 2011, 21, 6285) e.g. 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM); 2'-O-alkoxycarbonyl e.g. 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME); 2'-halo e.g. 2'-F, FANA (2'-Farabinosyl nucleic acid); carbasugar, sulfa and sulfosugar and azasugar modifications; 3'-O-alkyl e.g. 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl; 4'-carboxy e.g. 4'-carboxythymidine (Hari et al.); and their derivatives.

[0043] Other sugar modification includes "bridged" or "bicylic" nucleic acid (BNA), e.g. locked nucleic acid (LNA), xylo-LNA, .alpha.-L-LNA, .beta.-D-LNA, cEt (2'-O,4'-C constrained ethyl) LNA, cMOEt (2'-O,4'-C constrained methoxyethyl) LNA, ethylene-bridged nucleic acid (ENA), tricyclo DNA (tcDNA, tc-PS-DNA e.g. US patent application 20120149756); 3'-S-phosphorothiolate DNA (e.g. Org. Biol. Chem. 2013, 11, 966); doubly constrained nucleic acid (tri-NA, e.g. Hanessian et al.); unlocked nucleic acid (UNA); cyclohexenyl nucleic acid (CeNA), altriol nucleic acid (ANA), hexitol nucleic acid (HNA), fluorinated HNA (F-HNA), pyranosyl-RNA (p-RNA), 3'-deoxypyranosyl-DNA (p-DNA); molpholino (as e.g. in PMO, PPMO, PMOPlus, PMO-X); and their derivatives. Depending on its length, an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 sugar modifications. It is also encompassed by the invention to introduce more than one distinct sugar modification in said oligonucleotide. In an embodiment, an oligonucleotide as defined herein comprises or consists of an LNA or a derivative thereof. BNA derivatives are for example described in WO 2011/097641, which is incorporated in its entirety by reference. In a more preferred embodiment, an oligonucleotide of the invention is fully 2'-O-methyl modified. Examples of PMO-X are described in WO2011150408, which is incorporated here in its entirety by reference.

[0044] A backbone modification includes a modified version of the phosphodiester present in RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, and their derivatives. Another modification includes phosphoramidite, phosphoramidate, N3'.fwdarw.P5' phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, sulfonate, triazole, oxalyl, carbamate, methyleneimino (MMI), 3'-S-phosphorothiolate (Org. Biol. Chem. 2013, 11, 966) and thioacetamido nucleic acid (TANA); and their derivatives. Depending on its length, an oligonucleotide of the invention may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 backbone modifications. It is also encompassed by the invention to introduce more than one distinct backbone modification in said oligonucleotide.

[0045] In a preferred embodiment, an oligonucleotide of the invention comprises at least one phosphorothioate modification. In a more preferred embodiment, an oligonucleotide of the invention is fully phosphorothioate modified.

[0046] Other chemical modifications of an oligonucleotide of the invention include peptide-base nucleic acid (PNA), boron-cluster modified PNA, pyrrolidine-based oxy-peptide nucleic acid (POPNA), glycol- or glycerol-based nucleic acid (GNA), threose-based nucleic acid (TNA), acyclic threoninol-based nucleic acid (aTNA), morpholino-based oligonucleotide (PMO, PPMO, PMO-X), cationic morpholino-based oligomers (PMOPlus), oligonucleotides with integrated bases and backbones (ONIBs), pyrrolidine-amide oligonucleotides (POMs); and their derivatives.

[0047] In another embodiment, an oligonucleotide comprises a peptide nucleic acid and/or a morpholino phosphorodiamidate or a derivative thereof.

[0048] In another embodiment, an oligonucleotide comprises a monothiophosphate moiety at the 5' position of the 5' terminal residue and/or a monothiophosphate moiety at the 3' position of the 3' terminal residue. These monothiophosphate groups have been shown to improve oligonucleotide stability (e.g. US patent application 20120148664--miRagen).

[0049] With the advent of nucleic acid mimicking technology it has become possible to generate molecules that have a similar, preferably the same hybridization characteristics in kind not necessarily in amount as nucleic acid itself. Such functional equivalents are of course also suitable for use in the invention.

[0050] The skilled person will understand that not each sugar, base, and/or backbone may be modified the same way. Several distinct modified sugars, bases and/or backbones may be combined into one single oligonucleotide of the invention.

[0051] A person skilled in the art will also recognize that there are many synthetic derivatives of oligonucleotides. A backbone modification includes a modified version of the phosphodiester present in RNA, such as phosphorothioate (PS), chirally pure phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, phosphorothioate prodrug, H-phosphonate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, and their derivatives. Another modification includes phosphoramidite, phosphoramidate, N3'.fwdarw.P5' phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylenesulfoxide, sulfonate, and thioacetamido nucleic acid (TANA); and their derivatives.

[0052] Preferably, said oligonucleotide comprises RNA, as RNA/RNA duplexes are very stable. It is preferred that an RNA oligonucleotide comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases, exonucleases, and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, increased activity, reduced toxicity, increased intracellular transport, tissue-specificity, etc. In addition, the mRNA complexed with the oligonucleotide of the invention is preferably not susceptible to RNaseH cleavage. Preferred modifications have been identified above.

[0053] Accordingly, the invention provides an oligonucleotide comprising a 2'-O-methyl phosphorothioate RNA monomer or consisting of 2'-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine and/or a 2,6-diaminopurine base. Most preferably, this oligonucleotide consists of 2'-O-methyl RNA monomers connected through a phosphorothioate backbone and all of its cytosines and/or all of its uracils and/or all of its adenines, independently, have been substituted by 5-methylcytosine, 5-methyluracil and/or 2,6-diaminopurine, respectively. Preferred modified and non-modified oligonucleotides encompassed by the invention and disclosed herein comprises or consists of one of a base or nucleotide sequence selected from one of SEQ ID NO: 14-90 as identified in table 1. The expression "oligonucleotide represented by a nucleotide or base sequence selected from SEQ ID NO:14-90" could be replaced by the expression "oligonucleotide represented by a nucleotide or base sequence selected from one of SEQ ID NO:14-90" or by the expression "oligonucleotide represented by a nucleotide or base sequence selected from the list of SEQ ID NO:14-90". The same holds for other groups of SEQ ID NO referred herein.

[0054] Preferred non-modified oligonucleotides are derived from one of SEQ ID NO:14-90 and encompassed by the present invention and disclosed herein comprises or consists of one of a base or nucleotide sequences selected from SEQ ID NO: 91, 93-170.

[0055] Modified oligonucleotides are preferably derived from one of SEQ ID NO:14-90 and encompassed by the present invention and disclosed herein comprises or consists of one of a base or nucleotide sequences selected from SEQ ID NO: 92, 171-213, 215.

[0056] Please note that two SEQ ID NO present in the sequence listing are identical: SEQ ID NO:91 is identical with SEQ ID NO: 132. SEQ ID NO: 92 is identical with SEQ ID NO:199.

[0057] The sequence representing each of these oligonucleotides is disclosed in Tables 1-3 and in the sequence listing. Later on in the description, most preferred oligonucleotides are described in more detail.

[0058] Thus, an oligonucleotide of the invention may have:

[0059] At least one and preferably all cytosines substituted with 5-methylcytosines,

[0060] At least one and preferably all cytosines substituted with 5-methylcytosines and at least one and preferably all uracils substituted with 5-methyluracils,

[0061] At least one and preferably all cytosines substituted with 5-methylcytosines and at least one and preferably all adenines substituted with 2,6-diaminopurines,

[0062] At least one and preferably all cytosines substituted with 5-methylcytosines and at least one and preferably all uracils substituted with 5-methyluracils and at least one and preferably all adenines substituted with 2,6-diaminopurines,

[0063] At least one and preferably all uracils substituted with 5-methyluracils,

[0064] At least one and preferably all uracils substituted with 5-methyluracils and at least one and preferably all adenines substituted with 2,6-diaminopurines, or

[0065] At least one and preferably all adenines substituted with 2,6-diaminopurines.

[0066] However, an oligonucleotide may also have at least one or at least two or at least half or all its cytosines substituted with 5-methylcytosines. If a non-modified oligonucleotide of the invention preferably based on SEQ ID NO:14-90 has x cytosines, x being an integer ranged from 1 to 33, a corresponding modified oligonucleotide of the invention may have 1, 2, 3, . . . (x-2), (x-1), x 5-methylcytosines.

[0067] If x is 3 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2 or 3.

[0068] If x is 4 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3 or 4.

[0069] If x is 5 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4 or 5.

[0070] If x is 6 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5 or 6.

[0071] If x is 7 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5, 6 or 7.

[0072] If x is 8 in such a non-modified oligonucleotide, the number of 5-methylcytosines in a corresponding modified oligonucleotide is 1, 2, 3, 4, 5, 6, 7, or 8.

[0073] The same holds for uracils substituted with 5-methyluracils and adenines substituted with 2,6-diaminopurines.

[0074] Preferably, an oligonucleotide of the invention is for use as a medicament for DMD, more preferably said oligonucleotide is for use in therapeutic RNA modulation. Therefore, an oligonucleotide is an antisense oligonucleotide (AON). An antisense oligonucleotide is an oligonucleotide which is reverse complementary to a specific sequence of the DMD or dystrophin pre-mRNA derived from the coding sense strand of a DNA of an individual. This oligonucleotide binds to and/or targets and/or hybridizes and/or is able to bind to and/or is able to target and/or is able to hybridize said sequence of said pre-mRNA. The objective of RNA modulation for DMD is to skip one or more specific exons in the DMD or dystrophin pre-mRNA in order to restore the open reading frame of the transcript and to induce the expression of a shorter but (more) functional dystrophin protein, with the ultimate goal to be able to interfere with the course of the disease

[0075] In a preferred embodiment, an oligonucleotide of the invention is thus used for inducing exon-skipping in the DMD or dystrophin pre-mRNA in a cell, in an organ, in a tissue and/or in an individual. Exon-skipping results in a mature DMD or dystrophin mRNA that does not contain a skipped exon and thus, when said exon codes for amino acids, can lead to the expression of a shorter protein product. The skipping of an exon is preferably induced by the binding of an AON to specific exon-internal sequences comprising splicing regulatory elements, the splice sites and/or intronic branchpoint sequences.

[0076] As defined herein a DMD pre-mRNA preferably means a pre-mRNA of a DMD gene coding for a dystrophin protein. A mutated DMD pre-mRNA corresponds to a pre-mRNA of a BMD or DMD patient with a mutation when compared to a wild type DMD pre-mRNA of a non-affected person, resulting in (reduced levels of) an aberrant protein (BMD), or the absence of functional dystrophin (DMD). A DMD pre-mRNA is also named a dystrophin pre-mRNA. A DMD gene may also be named a dystrophin gene. Dystrophin and DMD may be used interchangeably throughout the application.

[0077] A patient is preferably intended to mean a patient having DMD or BMD as later defined herein or a patient susceptible to develop DMD or BMD due to his or her genetic background. In the case of a DMD patient, an oligonucleotide used will preferably correct one mutation as present in the DMD gene of said patient and create a protein that will look like a BMD protein: said protein will preferably be a functional or semi-functional dystrophin as later defined herein. In the case of a BMD patient, an oligonucleotide as used will preferably correct one mutation as present in the BMD gene of said patient and create a dystrophin which will be more functional than the dystrophin which was originally present in said BMD patient. As defined herein, a functional dystrophin is preferably a wild type dystrophin corresponding to a protein having the amino acid sequence as identified in SEQ ID NO: 1. As defined herein, a semi-functional dystrophin is preferably a BMD-like dystrophin corresponding to a protein having an acting binding domain in its N terminal part (first 240 amino acids at the N terminus), a cysteine-rich domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at the C terminus) each of these domains being present in a wild type dystrophin as known to the skilled person. The amino acids indicated herein correspond to amino acids of the wild type dystrophin being represented by SEQ ID NO:1. In other words, a functional or a semi-functional dystrophin is a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin. "At least to some extent" preferably means at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of a corresponding activity of a wild type functional dystrophin. In this context, an activity of a functional dystrophin is preferably binding to actin and to the dystrophin-associated glycoprotein complex (DGC or DAPC) (Ehmsen J et al, 2002).

[0078] Binding of dystrophin to actin and to the DGC or DAPC complex may be visualized by either co-immunoprecipitation using total protein extracts or immunofluorescence analysis of cross-sections using various antibodies reacting with the different members of the complex, from a control (non-DMD) biopsy of one from a muscle suspected to be dystrophic, pre- and/or post-treatment, as known to the skilled person.

[0079] Individuals or patients suffering from Duchenne muscular dystrophy typically have a mutation in the gene encoding dystrophin (the DMD or dystrophin gene) that prevents synthesis of the complete protein, i.e a premature stop codon prevents the synthesis of the C-terminus. In Becker muscular dystrophy the dystrophin gene also comprises a mutation compared to the wild type but the mutation does typically not result in a premature stop codon and the C-terminus is typically synthesized. As a result a functional or semi-functional dystrophin protein is synthesized that has at least the same activity in kind as the wild type protein, although not necessarily the same amount of activity. The genome of a BMD patient typically encodes a dystrophin protein comprising the N terminal part (first 240 amino acids at the N terminus), a cysteine-rich domain (amino acid 3361 till 3685) and a C-terminal domain (last 325 amino acids at the C-terminus) but in the majority of cases its central rod shaped domain is shorter than the one of a wild type dystrophin (Monaco et al., 1988). Antisense oligonucleotide-induced exon skipping for the treatment of DMD is typically directed to overcome a premature stop in the pre-mRNA by skipping an exon, preferably in the central rod-domain shaped domain, to correct the open reading frame and allow synthesis of remainder of the dystrophin protein including the C-terminus, albeit that the protein is somewhat smaller as a result of a smaller rod domain. In a preferred embodiment, an individual having DMD and being treated by an oligonucleotide as defined herein will be provided a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin. More preferably, if said individual is a Duchenne patient or is suspected to be a Duchenne patient, a functional or a semi-functional dystrophin is a dystrophin of an individual having BMD: typically said dystrophin is able to interact with both actin and the DGC or DAPC, but its central rod shaped domain may be shorter than the one of a wild type dystrophin (Monaco et al., 1988). The central rod domain of wild type dystrophin comprises 24 spectrin-like repeats. For example, a central rod shaped domain of a dystrophin as provided herein may comprise 5 to 23, 10 to 22 or 12 to 18 spectrin-like repeats as long as it can bind to actin and to DGC.

[0080] Alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual using an oligonucleotide of the invention may be assessed by any of the following assays: prolongation of time to loss of walking, improvement of muscle strength, improvement of the ability to lift weight, improvement of the time taken to rise from the floor, improvement in the nine-metre walking time, improvement in the time taken for four-stairs climbing, improvement of the leg function grade, improvement of the pulmonary function, improvement of cardiac function, improvement of the quality of life. Each of these assays is known to the skilled person. As an example, the publication of Manzur et al (2008) gives an extensive explanation of each of these assays. For each of these assays, as soon as a detectable improvement or prolongation of a parameter measured in an assay has been found, it will preferably mean that one or more symptoms of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy has been alleviated in an individual using an oligonucleotide of the invention. Detectable improvement or prolongation is preferably a statistically significant improvement or prolongation as described in Hodgetts et al. (2006). Alternatively, the alleviation of one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy may be assessed by measuring an improvement of a muscle fiber function, integrity and/or survival. In a preferred method, one or more symptom(s) of a DMD or a BMD patient is/are alleviated and/or one or more characteristic(s) of one or more muscle cells from a DMD or a BMD patient is/are improved. Such symptoms or characteristics may be assessed at the cellular, tissue level or on the patient self.

[0081] An alleviation of one or more characteristics of a muscle cell from a patient may be assessed by any of the following assays on a myogenic cell or muscle cell from a patient: reduced calcium uptake by muscle cells, decreased collagen synthesis, altered morphology, altered lipid biosynthesis, decreased oxidative stress, and/or improved muscle fiber function, integrity, and/or survival. These parameters are usually assessed using immunofluorescence and/or histochemical analyses of cross sections of muscle biopsies.

[0082] The improvement of muscle fiber function, integrity and/or survival may be assessed using at least one of the following assays: a detectable decrease of creatine kinase in blood, a detectable decrease of necrosis of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic, and/or a detectable increase of the homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic. Each of these assays is known to the skilled person.

[0083] Creatine kinase may be detected in blood as described in Hodgetts et al. (2006). A detectable decrease in creatine kinase may mean a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the concentration of creatine kinase in a same DMD or BMD patient before treatment.

[0084] A detectable decrease of necrosis of muscle fibers is preferably assessed in a muscle biopsy, more preferably as described in Hodgetts et al. (2006), using biopsy cross-sections. A detectable decrease of necrosis may be a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the area wherein necrosis has been identified using biopsy cross-sections. The decrease is measured by comparison to the necrosis as assessed in a same DMD or BMD patient before treatment.

[0085] A detectable increase of the homogeneity of the diameter of a muscle fiber is preferably assessed in a muscle biopsy cross-section, more preferably as described in Hodgetts et al. (2006). The increase is measured by comparison to the homogeneity of the diameter of a muscle fiber in a same DMD or BMD patient before treatment

[0086] Preferably, an oligonucleotide of the invention provides said individual with a functional or a semi-functional dystrophin protein (typically in the case of DMD) and is able to, for at least in part decrease the production of an aberrant dystrophin protein in said individual (typically in the case of BMD).

[0087] Decreasing the production of an aberrant dystrophin mRNA, or aberrant dystrophin protein, preferably means that 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the initial amount of aberrant dystrophin mRNA, or aberrant dystrophin protein, is still detectable by RT PCR (mRNA) or immunofluorescence or western blot analysis (protein). An aberrant dystrophin mRNA or protein is also referred to herein as a less functional (compared to a wild type functional dystrophin protein as earlier defined herein) or a non-functional dystrophin mRNA or protein. A non functional dystrophin protein is preferably a dystrophin protein which is not able to bind actin and/or members of the DCC protein complex. A non-functional dystrophin protein or dystrophin mRNA does typically not have, or does not encode a dystrophin protein with an intact C-terminus of the protein. The detection of a functional or semi-functional dystrophin mRNA or protein may be done as for an aberrant dystrophin mRNA or protein.

[0088] Once a DMD patient is provided with a functional or a semi-functional dystrophin protein, at least part of the cause of DMD is taken away. Hence, it would then be expected that the symptoms of DMD are at least partly alleviated. The enhanced skipping frequency also increases the level of functional or a semi-functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.

[0089] Exons contain one or more specific sequences comprising splicing regulatory elements which have shown to be effective targets for antisense oligonucleotides (Aartsma-Rus et al, 2010). One embodiment therefore provides an oligonucleotide for providing said individual with a functional or semi-functional dystrophin protein wherein said oligonucleotide comprises a sequence which is specifically binding, targeting and/or hybridizing with and/or blocking these splicing regulatory elements in a dystrophin pre-mRNA exon. Such oligonucleotide is also able to bind and/or target and/or hybridize with and/or block these splicing regulatory elements in a dystrophin pre-mRNA. In addition, since an exon will only be included into the resulting mRNA when both the splice sites are recognized by the spliceosome complex, splice sites are other targets for an oligonucleotide of the invention. One embodiment therefore provides an oligonucleotide for providing said individual with a functional or semi-functional dystrophin protein wherein said oligonucleotide comprises a sequence which is specifically binding and/or targeting and/or hybridizing with, and/or blocking one of or both the splice sites of an exon of a dystrophin pre-mRNA. Such oligonucleotide is also able to bind and/or target, hybridize with and/or block one or both of these splice sites of an exon of a dystrophin pre-mRNA. Usually a splice site of an exon comprises 1, 2, 3, or more nucleotides present in said exon and 1, 2, 3, or more nucleotides present in an adjacent or neighboring intron. In one embodiment an oligonucleotide is used which is solely binding to and/or targeting and/or hybridizing with an intron region of a dystrophin pre-mRNA. Such oligonucleotide is able to bind and/or able to target and/or able to hybridize with said intron region. This is however not necessary: it is also possible to use an oligonucleotide which targets and/or binds and/or hybridizes with and/or is able to target and/or is able to binds and/or is able to hybridizes with an intron-specific sequence as well as exon-specific sequence. Of course, an oligonucleotide is not necessarily binding to and/or targeting and/or hybridizing with the entire sequence of a dystrophin exon or intron. Such oligonucleotide is also not necessary able to bind to and/or able to target and/or able to hybridize with the entire sequence of a dystrophin exon or intron. Oligonucleotides which are specifically binding, targeting and/or hybridizing with and/or which are specifically able to bind and/or able to target and/or able to hybridize part of such exon or intron are preferred. An oligonucleotide is used, said oligonucleotide is preferably reverse complementary to, and/or binds to, and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with at least part of a dystrophin exon and/or intron, said part having at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.

[0090] Splicing of a dystrophin pre-mRNA occurs via two sequential transesterification reactions involving an intronic branch point and a splice site of an adjacent intron. Hence, an oligonucleotide is used for exon skipping, wherein said oligonucleotide comprises a sequence which is binding to and/or targeting and/or hybridizing with or is able to bind to and/or is able to target and/or is able to hybridize with such branch point and/or splice site. Preferably said splice site and/or branch point is present in a dystrophin pre-mRNA.

[0091] Since splice sites contain consensus sequences, the use of an oligonucleotide part or a functional equivalent thereof comprising a sequence which is capable of binding to and/or able to bind to and/or able to target and/or able to hybridize and/or binds to and/or target and/or hybridizes with a splice site involves the risk of promiscuous hybridization. Hybridization of said oligonucleotide to other splice sites than the sites of the exon to be skipped could easily interfere with the accuracy of the splicing process. To overcome these and other potential problems related to the use of an oligonucleotide which is binding and/or hybridizing and/or targeting and/or is able to bind to and/or is able to target and/or is able to hybridize a splice site, most preferred embodiment provides an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, wherein said oligonucleotide or a functional equivalent thereof, binding to and/or hybridizing with and/or targeting and/or is able to bind to and/or is able to hybridize and/or is able to target a specific part of a dystrophin pre-mRNA exon. Exons contain coding sequences which are typically more specific that the non-coding intron sequences. Preferably, said oligonucleotide binding to and/or hybridizing with and/or targeting and/or able to bind to and/or able to hybridize with and/or able to target a specific part of a dystrophin pre-mRNA exon is capable of specifically blocking, interfering and/or inhibiting a splicing regulatory sequence and/or structure of the anticipated exon(s) in said dystrophin pre-mRNA. Interfering with such splicing regulatory sequence and/or structure has the advantage that such elements are located within the exon. The risk for sequence-related off-target effects is therefore limited. By providing an oligonucleotide for the interior of the exon to be skipped, it is possible to mask the exon from the splicing apparatus. The failure of the splicing apparatus to recognize the exon to be skipped thus leads to exclusion of the exon from the final mRNA. This embodiment does not interfere directly with the enzymatic process of the splicing machinery (the joining of the exons). It is thought that this allows the method to be more specific and/or reliable. It has been found that an oligonucleotide capable of binding to and/or able to bind to and/or able to target and/or able to hybridize and/or binding to and/or hybridizing with and/or targeting an exon at any point may be able to induce the skipping of said exon.

[0092] Within the context of the invention, an oligonucleotide of the invention may comprise a functional equivalent or an equivalent of an oligonucleotide. A functional equivalent or an equivalent of an oligonucleotide preferably means an oligonucleotide as defined herein wherein one or more nucleotides have been substituted and wherein an activity of said functional equivalent or equivalent is retained to at least some extent. Preferably, an activity of said oligonucleotide comprising a functional equivalent or equivalent of an oligonucleotide is providing a functional or a semi-functional dystrophin protein. Said activity of said oligonucleotide comprising a functional equivalent or an equivalent of an oligonucleotide is therefore preferably assessed by quantifying the amount of a functional or a semi-functional dystrophin protein. A functional or semi-functional dystrophin is herein preferably defined as being a dystrophin able to bind actin and members of the DCC (or DAPC) protein complex. The assessment of said activity of said functional equivalent of an oligonucleotide is preferably done by RT-PCR and sequencing (on RNA level; for detection of specific exon skipping), or by immunofluorescence and Western blot analyses (on protein level: for detection of protein restoration). Said activity is preferably retained to at least some extent when it represents at least 50%, or at least 60%, or at least 70% or at least 80% or at least 90% or at least 95% or more of corresponding activity of said oligonucleotide the functional equivalent or equivalent derives from. Throughout this application, when the word oligonucleotide is used it may be replaced by a functional equivalent thereof or an equivalent thereof as defined herein. In an embodiment, an equivalent or a functional equivalent of an oligonucleotide of the invention comprises a modification. Throughout this application, when the word oligonucleotide is used it may be replaced by an antisense oligonucleotide as defined herein unless otherwise indicated.

[0093] Hence, the use of an oligonucleotide or a functional equivalent thereof, or an equivalent thereof comprising a 2'-O-methyl phosphorothioate RNA monomer or consisting of 2'-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine (i.e. a 5-methylcytosine and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and being represented by a nucleotide sequence comprising or consisting of a sequence which is reverse complementary to, and/or binds to and/or targets and/or hybridizes and/or is able to bind to and/or is able to target and/or is able to hybridize with a dystrophin pre-mRNA exon is assumed to have a positive effect on at least one of the parameters of said oligonucleotide, as has already been defined herein, when compared to their counterparts which do not comprise any 5-methylcytosine, 5-methyluracil and 2,6-diaminopurine (i.e. so called non-modified oligonucleotide) as indicated earlier herein, and is therefore assumed to exhibit an improved therapeutic result in a DMD or a BMD cell of a patient and/or in a DMD or a BMD patient. Such a therapeutic result may be characterized by: [0094] alleviating one or more symptom(s) of DMD or BMD and/or [0095] alleviating one or more characteristics of a muscle cell from a patient and/or [0096] providing said individual with a functional or semi-functional dystrophin protein and/or [0097] at least in part decreasing the production of an aberrant dystrophin protein in said individual. Each of these features has already been defined herein.

[0098] Preferably, an oligonucleotide is represented by a nucleotide sequence which comprises or consists of a sequence which is binding to and/or targeting and/or being reverse complementary to and/or is hybridizing with and/or which is able to bind to and/or is able to target and/or is able to hybridize with and/or is reverse complementary to at least a part of dystrophin pre-mRNA exons 44 to 55, said oligonucleotide having a length of at least 10 nucleotides. However, the length of said oligonucleotide may be at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Throughout the invention, said sequence representing the oligonucleotide may also be called a base or a nucleotide sequence.

[0099] Preferably, an oligonucleotide of the invention is represented by a nucleotide sequence or a base sequence comprising or consisting of a sequence that is capable of binding to, and/or targeting and/or being reverse complementary to and/or hybridizing with and/or being able to bind to and/or being able to hybridize with and/or being able to target a part of an exon of dystrophin pre-mRNA. Said binding or targeted part may be at least 50% of the length of the oligonucleotide of the invention, or at least 60%, or at least 70%, or at least 80%, or at least 90% or at least 95%, or 98% and up to 100%. An oligonucleotide may be represented by a nucleotide or a base sequence, said nucleotide or base sequence comprising a sequence that binds and/or targets and/or is reverse complementary to and/or hybridizes with and/or is able to bind to and/or is able to hybridize with and/or is able to target at least a part of an exon selected from the group consisting of exons 44 to 55 of dystrophin pre-mRNA as defined herein and additional flanking sequences. In a more preferred embodiment, the length of said binding or targeted part of said oligonucleotide is of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Several types of flanking sequences may be used. Preferably, flanking sequences are used to modify the binding of a protein to said oligonucleotide, or to modify a thermodynamic property of said oligonucleotide, more preferably to modify target RNA binding affinity. In another preferred embodiment, additional flanking sequences are reverse complementary to sequences of the dystrophin pre-mRNA which are not present in said exon. Such flanking sequences are preferably capable of binding to and/or targeting sequences comprising or consisting of the branchpoint and/or the splice site acceptor or donor consensus sequences of said exon. In a preferred embodiment, such flanking sequences are capable of binding to and/or targeting sequences comprising or consisting of sequences of an intron of the dystrophin pre-mRNA which is adjacent to said exon.

[0100] One preferred embodiment provides an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, said oligonucleotide or a functional equivalent thereof or an equivalent thereof, being represented by a sequence or a base sequence which comprises: [0101] a sequence which binds, is able to bind, targets, hybridizes or is reverse complementary to a region of a dystrophin pre-mRNA exon that is hybridized to another part of a dystrophin pre-mRNA exon (closed structure), and a sequence which binds and/or targets and/or hybridizes and/or is reverse complementary to and/or is able to bind and/or is able to target and/or is able to hybridize with a region of a dystrophin pre-mRNA exon that is not hybridized in said dystrophin pre-mRNA (open structure).

[0102] For this embodiment, reference is made to the WO 2004/083446 patent application. RNA molecules exhibit strong secondary structures, mostly due to base pairing of complementary or partly complementary stretches within the same RNA. It has long since been thought that structures in the RNA play a role in the function of the RNA. Without being bound by theory, it is believed that the secondary structure of the RNA of an exon plays a role in structuring the splicing process. Through its structure, an exon is recognized as a part that needs to be included in the mRNA. In an embodiment, an oligonucleotide is capable of interfering with the structure of the exon and therefore capable of interfering with the splicing apparatus of said exon, masking the exon from the splicing apparatus and thereby inducing the skipping of said exon. It has been found that many oligonucleotides indeed comprise this capacity, some more efficient than others. Without being bound by theory it is thought that the overlap with an open structure improves the invasion efficiency of the oligonucleotide (i.e. increases the efficiency with which the oligonucleotide can enter the structure), whereas the overlap with the closed structure subsequently increases the efficiency of interfering with the secondary structure of the RNA of the exon. It is found that the length of the partial reverse complementarity to both the closed and the open structure is not extremely restricted. We have observed high efficiencies with compounds comprising oligonucleotides with variable lengths of reverse complementarity in either structure. The term (reverse) complementarity is used herein to refer to a stretch of nucleic acids that can hybridise to another stretch of nucleic acids under physiological conditions. Hybridization conditions are later defined herein. It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. For instance, when designing an antisense oligonucleotide, one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may to some extent be allowed, if under the circumstances in the cell, the stretch of nucleotides is capable of hybridizing to the complementary part.

[0103] In a preferred embodiment a reverse complementary part of an antisense oligonucleotide (either to said open or to said closed structure) comprises at least 3, and more preferably at least 4 consecutive nucleotides. The reverse complementary regions are preferably designed such that, when combined, they are specific for an exon in a pre-mRNA. Such specificity may be created with various lengths of reverse complementary regions as this depends on the actual sequences in other (pre-)mRNA in the system. The risk that also one or more other pre-mRNA will be able to hybridise to an oligonucleotide decreases with increasing size of said oligonucleotide. It is clear that an antisense oligonucleotide comprising mismatches in the region of reverse complementarity but that retain the capacity to hybridise to the targeted region(s) in the pre-mRNA, can be used in the present invention. However, preferably at least the reverse complementary parts do not comprise such mismatches as these typically have a higher efficiency and a higher specificity than oligonucleotide having such mismatches in one or more reverse complementary regions. It is thought that higher hybridisation strengths, (i.e. increasing number of interactions with the opposing strand) are favourable in increasing the efficiency of the process of interfering with the splicing machinery of the system. Preferably, the reverse complementarity is from 90 to 100%. In general this allows for 1 or 2 mismatch(es) in an oligonucleotide of 20 nucleotides or 1 to 4 mismatches in an oligonucleotide of 40 nucleotides. Therefore, we may have 1, 2, 3, 4, 5 mismatches in an oligonucleotide of 10 to 50 nucleotides. Preferably, 0, 1 or 2 mismatches are present in an oligonucleotide of 10 to 50 nucleotides.

[0104] The structure (i.e. open and closed structures) is best analyzed in the context of the pre-mRNA wherein the exon resides. Such structure may be analyzed in the actual RNA. However, it is currently possible to predict the secondary structure of an RNA molecule (at lowest energy costs) quite well using structure-modeling programs. Non-limiting examples of a suitable program are RNA structure version 4.5 or RNA mfold version 3.5 (Zuker et al., 2003). A person skilled in the art will be able to predict, with suitable reproducibility, a likely structure of an exon, given a nucleotide sequence. Best predictions are obtained when providing such modeling programs with both said exon and flanking intron sequences. It is typically not necessary to model the structure of the entire pre-mRNA.

[0105] The open and closed structure to which the oligonucleotide of an oligonucleotide is directed, are preferably adjacent to one another. It is thought that in this way the annealing of the oligonucleotide to the open structure induces opening of the closed structure whereupon annealing progresses into this closed structure. Through this action the previously closed structure assumes a different conformation. However, when potential (cryptic) splice acceptor and/or donor sequences are present within the targeted exon, occasionally a new exon inclusion signal or splicing regulatory sequence, element, structure, or signal is generated defining a different (neo) exon, i.e. with a different 5' end, a different 3' end, or both. This type of activity is within the scope of the present invention as the targeted exon is excluded from the mRNA. The presence of a new exon, containing part of the targeted exon, in the mRNA does not alter the fact that the targeted exon, as such, is excluded. The inclusion of a neo-exon can be seen as a side effect which occurs only occasionally. There are two possibilities when exon skipping is used to restore (part of) an open reading frame of dystrophin that is disrupted as a result of a mutation. One is that the neo-exon is functional in the restoration of the reading frame, whereas in the other case the reading frame is not restored. When selecting a compound comprising an oligonucleotide for restoring dystrophin reading frames by means of exon-skipping it is of course clear that under these conditions only those compounds comprising those oligonucleotide are selected that indeed result in exon-skipping that restores the dystrophin open reading frame, with or without a neo-exon.

[0106] Further provided is an oligonucleotide for providing said individual with a functional or a semi-functional dystrophin protein, wherein said oligonucleotide or a functional equivalent thereof or an equivalent thereof comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and is represented by a nucleotide or a base sequence comprising a sequence that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with a binding site for a serine-arginine (SR) protein in RNA of an exon of a dystrophin pre-mRNA. In WO 2006/112705 patent application we have disclosed the presence of a correlation between the effectivity of an exon-internal antisense oligonucleotide in inducing exon skipping and the presence of a (for example by ESEfinder) predicted SR binding site in the target pre-mRNA site of said AON. Therefore, in one embodiment an oligonucleotide is generated comprising determining a (putative) binding site for an SR (Ser-Arg) protein in RNA of a dystrophin exon and producing a corresponding compound comprising oligonucleotide that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind and/or is able to target and/or is able to hybridize with said RNA and that at least partly overlaps said (putative) binding site. The term "at least partly overlaps" is defined herein as to comprise an overlap of only a single nucleotide of an SR binding site as well as multiple nucleotides of said binding site as well as a complete overlap of said binding site. This embodiment preferably further comprises determining from a secondary structure of said RNA, a region that is hybridized to another part of said RNA (closed structure) and a region that is not hybridized in said structure (open structure), and subsequently generating an oligonucleotide that at least partly overlaps said (putative) binding site and that overlaps at least part of said closed structure and overlaps at least part of said open structure. In this way we increase the chance of obtaining an oligonucleotide that is capable of interfering with the exon inclusion from the pre-mRNA into mRNA. It is possible that a first selected SR-binding region does not have the requested open-closed structure in which case another (second) SR protein binding site is selected which is then subsequently tested for the presence of an open-closed structure. This process is continued until a sequence is identified which contains an SR protein binding site as well as a(n) (partly overlapping) open-closed structure. This sequence is then used to design an oligonucleotide which is reverse complementary to said sequence.

[0107] Such a method for generating an antisense oligonucleotide is also performed by reversing the described order, i.e. first generating an oligonucleotide comprising determining, from a secondary structure of RNA from a dystrophin exon, a region that assumes a structure that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide, of which at least a part of said oligonucleotide is reverse complementary to said closed structure and of which at least another part of said oligonucleotide is reverse complementary to said open structure. This is then followed by determining whether an SR protein binding site at least overlaps with said open/closed structure. In this way the method of WO 2004/083446 is improved. In yet another embodiment the selections are performed simultaneously.

[0108] Without wishing to be bound by any theory it is currently thought that use of an oligonucleotide directed to or targeting an SR protein binding site results in (at least partly) impairing the binding of an SR protein to the binding site of an SR protein which results in disrupted or impaired splicing.

[0109] Preferably, an open/closed structure and an SR protein binding site partly overlap and even more preferred an open/closed structure completely overlaps an SR protein binding site or an SR protein binding site completely overlaps an open/closed structure. This allows for an improved disruption of exon inclusion.

[0110] Besides consensus splice site and branchpoint intronic sequences, many (if not all) exons contain splicing regulatory sequences such as but not limited to exonic splicing enhancer (ESE) sequences to facilitate the recognition of genuine splice sites by the spliceosome (Cartegni et al., 2002; and Cartegni et al., 2003). A subgroup of splicing factors, called the SR proteins, can bind to these ESEs and recruit other splicing factors, such as U1 and U2AF to (weakly defined) splice sites. The binding sites of the four most abundant SR proteins (SF2/ASF, SC35, SRp40 and SRp55) have been analyzed in detail and these results are implemented in ESEfinder, a web source that predicts potential binding sites for these SR proteins (Cartegni et al., 2002; and Cartegni et al., 2003). There is a correlation between the effectiveness of an oligonucleotide and the presence/absence of an SF2/ASF, SC35 and SRp40 binding site in the site targeted by said oligonucleotide. In a preferred embodiment, the invention thus provides an oligonucleotide as described above, which is reverse complementary to and/or targets and/or binds to and/or hybridizes with and/or is able to target and/or is able to bind and/or is able to hybridize with a binding site for a SR protein. Preferably, said SR protein is SF2/ASF or SC35 or SRp40.

[0111] In one embodiment a DMD patient is provided with a functional or a semi-functional dystrophin protein by using an oligonucleotide or a functional equivalent thereof or an equivalent thereof comprising a 2'-O-methyl phosphorothioate RNA monomer or consisting of 2'-O-methyl phosphorothioate RNA and comprising a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and being capable of specifically binding or targeting and/or being able to bind and/or being able to target and/or being able to hybridize a regulatory RNA sequence which is required for the correct splicing of a dystrophin exon in a transcript. Several cis-acting RNA sequences are required for the correct splicing of exons in a transcript. In particular, elements such as an exonic splicing enhancer (ESE), an exon recognition sequence (ERS), and/or an exonic splicing silencer (ESS) are identified to regulate specific and efficient splicing of constitutive and alternative exons. Using a sequence-specific antisense oligonucleotide or a base-specific antisense oligonucleotide (AON) that binds to and/or targets and/or is reverse complementary to and/or hybridizes with and/or is able to bind and/or is able to hybridize with and/or is able to target the elements, their regulatory function is disturbed so that the exon is skipped, as shown for DMD. Hence, in one preferred embodiment, an oligonucleotide or a functional equivalent thereof or an equivalent thereof is used which is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with an exonic splicing enhancer (ESE), an exon recognition sequence (ERS), and/or an exonic splicing silencer (ESS).

[0112] In a preferred embodiment, an oligonucleotide of the invention comprises or consists of a sequence or a base sequence that is reverse complementary to and/or binds to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with at least a part of dystrophin pre-mRNA exon 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55, said part having at least 10 nucleotides. However, said part may also have at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or, 33 nucleotides. For the dystrophin exons identified above, we provide the stretch of nucleotides (SEQ ID NO: 2 to 13 identified below) of said exon to which an oligonucleotide binds to and/or is reverse complementary to and/or targets and/or hybridizes with and/or is able to bind to and/or is able to target and/or is able to hybridize with.

TABLE-US-00001 (SEQ ID NO: 2) 5'-GCGAUUUGACAGAUCUGUUGAGAAAUGGCGGCGUUUUCAUUAUGAUAU AAAGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAA GACACAAAUUCCUGAGAAUUGGGAACAUGCUAAAUACAAAUGGUAUCU UAAG-3' for skipping of exon 44; (SEQ ID NO: 3) 5'-GAACUCCAGGAUGGCAUUGGGCAGCGGCAAACUGUUGUCAGAACAUUG AAUGCAACUGGGGAAGAAAUAAUUCAGCAAUCCUCAAAAACAGAUGCC AGUAUUCUACAGGAAAAAUUGGGAAGCCUGAAUCUGCGGUGGCAGGAG GUCUGCAAACAGCUGUCAGACAGAAAAAAGAG-3' for skipping of exon 45: (SEQ ID NO: 4) 5'-GCUAGAAGAACAAAAGAAUAUCUUGUCAGAAUUUCAAAGAGAUUUAAA UGAAUUUGUUUUAUGGUUGGAGGAAGCAGAUAACAUUGCUAGUAUCCC ACUUGAACCUGGAAAAGAGCAGCAACUAAAAGAAAAGCUUGAGCAAGU CAAG-3' for skipping of exon 46; (SEQ ID NO: 5) 5'-UUACUGGUGGAAGAGUUGCCCCUGCGCCAGGGAAUUCUCAAACAAUUA AAUGAAACUGGAGGACCCGUGCUUGUAAGUGCUCCCAUAAGCCCAGAA GAGCAAGAUAAACUUGAAAAUAAGCUCAAGCAGACAAAUCUCCAGUGG AUAAAG-3' for skipping of exon 47 (SEQ ID NO: 6) 5'-GUUUCCAGAGCUUUACCUGAGAAACAAGGAGAAAUUGAAGCUCAAAUA AAAGACCUUGGGCAGCUUGAAAAAAAGCUUGAAGACCUUGAAGAGCAG UUAAAUCAUCUGCUGCUGUGGUUAUCUCCUAUUAGGAAUCAGUUGGAA AUUUAUAACCAACCAAACCAAGAAGGACCAUUUGACGUUCAG-3' for skipping of exon 48 (SEQ ID NO: 7) 5'-GAAACUGAAAUAGCAGUUCAAGCUAAACAACCGGAUGUGGAAGAGAUU UUGUCUAAAGGGCAGCAUUUGUACAAGGAAAAACCAGCCACUCAGCCA GUGAAG-3' for skipping of exon 49 (SEQ ID NO: 8) 5'-AGGAAGUUAGAAGAUCUGAGCUCUGAGUGGAAGGCGGUAAACCGUUUA CUUCAAGAGCUGAGGGCAAAGCAGCCUGACCUAGCUCCUGGACUGACCA CUAUUGGAGCCU-3' for skipping of exon 50; (SEQ ID NO: 9) 5'-CUCCUACUCAGACUGUUACUCUGGUGACACAACCUGUGGUUACUAAGG AAACUGCCAUCUCCAAACUAGAAAUGCCAUCUUCCUUGAUGUUGGAGG UACCUGCUCUGGCAGAUUUCAACCGGGCUUGGACAGAACUUACCGACUG GCUUUCUCUGCUUGAUCAAGUUAUAAAAUCACAGAGGGUGAUGGUGGG UGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAGAAG-3' for skipping of exon 51; (SEQ TD NO: 10) 5'-GCAACAAUGCAGGAUUUGGAACAGAGGCGUCCCCAGUUGGAAGAACUC AUUACCGCUGCCCAAAAUUUGAAAAACAAGACCAGCAAUCAAGAGGCU AGAACAAUCAUUACGGAUCGAA-3' for skipping of exon 52; (SEQ ID NO: 11) 5'-UUGAAAGAAUUCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCAGA ACCGGAGGCAACAGUUGAAUGAAAUGUUAAAGGAUUCAACACAAUGGC UGGAAGCUAAGGAAGAAGCUGAGCAGGUCUUAGGACAGGCCAGAGCCA AGCUUGAGUCAUGGAAGGAGGGUCCCUAUACAGUAGAUGCAAUCCAAA AGAAAAUCACAGAAACCAAG-3' for skipping of exon 53; (SEQ ID NO: 12) 5'-CAGUUGGCCAAAGACCUCCGCCAGUGGCAGACAAAUGUAGAUGUGGCA AAUGACUUGGCCCUGAAACUUCUCCGGGAUUAUUCUGCAGAUGAUACC AGAAAAGUCCACAUGAUAACAGAGAAUAUCAAUGCCUCUUGGAGAAGC AUUCAUAAAAG-3' for skipping of exon 54; (SEQ ID NO: 13) 5'-GGUGAGUGAGCGAGAGGCUGCUUUGGAAGAAACUCAUAGAUUACUGCA ACAGUUCCCCCUGGACCUGGAAAAGUUUCUUGCCUGGCUUACAGAAGCU GAAACAACUGCCAAUGUCCUACAGGAUGCUACCCGUAAGGAAAGGCUCC UAGAAGACUCCAAGGGAGUAAAAGAGCUGAUGAAACAAUGGCAA-3' for skipping of exon 55.

[0113] Therefore, a preferred oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and binds to and/or is reverse complementary to and/or targets and/or hybridizes with and/or is able to bind and/or is able to target and/or is able to hybridize with a continuous stretch of at least 10 and up to 33 nucleotides within one of the following exon nucleotide sequences selected from SEQ ID NO: 2 to 13.

[0114] Preferred oligonucleotides are also defined as follows: [0115] comprise a 2'-O-methyl phosphorothioate RNA monomer or consist of 2'-O-methyl phosphorothioate RNA and [0116] bind to and/or are reverse complementary to and/or target and/or hybridize with and/or is able to bind to and/or is able to target and/or is able to hybridize with a continuous stretch of at least 10 and up to 33 nucleotides within one of the following exon nucleotide sequences selected from SEQ ID NO: 2 to 13 as identified above.

[0117] More preferably, such oligonucleotides comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

[0118] More preferred oligonucleotides comprise a 2'-O-methyl phosphorothioate RNA monomer or consist of 2'-O-methyl phosphorothioate RNA and more preferably comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base and are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 14-90 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 14-90. SEQ ID NO:14-90 are identified in Table 1. In this context, "a 5-methylpyrimidine" means at least one 5-methylpyrimidine. Accordingly "at least one 5-methylpyrimindine" means at least one 5-methylcytosine and/or at least one 5-methyluracile.

[0119] Accordingly, preferred non-modified oligonucleotides are preferably derived from one of the nucleotide or base sequences SEQ ID NO:14-90 with X.dbd.C, Y.dbd.U, Z=A), and/or are represented by SEQ ID NO:91, 93, 94-170. Each of these non-modified oligonucleotides comprises no 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and no 2,6-diaminopurine. Please note that SEQ ID NO:91 is identical with SEQ ID NO: 132.

[0120] Accordingly, preferred modified oligonucleotides are derived from one of the nucleotide or base sequences SEQ ID NO:14-90 and comprise at least one 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or at least one 2,6-diaminopurine (i.e. at least one X is m.sup.5C.dbd.X.sub.1 and/or at least one Y is m.sup.5U.dbd.Y.sub.1 and/or at least one Z is a.sup.2A=Z.sub.1). Please note that SEQ ID NO: 92 is identical with SEQ ID NO: 199. More preferred modified oligonucleotides are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215, 217, 218, 219. Even more preferred modified oligonucleotides (all X=m.sup.5C.dbd.X.sub.1 and/or all Y=m.sup.5U.dbd.Y.sub.1 and/or all Z=a.sup.2A=Z.sub.1) are derived from the most preferred nucleotide or base sequences (SEQ ID NO:15, 21, 31, 40, 52, and 57) and are represented by SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-215, 217, 218, 219. The most preferred modified oligonucleotides are disclosed in Table 3.

[0121] Within the context of the invention, a fragment of SEQ ID NO:14-90, or a fragment of SEQ ID NO:91-219, preferably means a nucleotide or a base sequence comprising or consisting of at least 10 contiguous nucleotides from said SEQ ID NO:14-90 or from said SEQ ID NO:91-219.

[0122] Such more preferred oligonucleotides are also defined as follows: [0123] comprise a 2'-O-methyl phosphorothioate RNA monomer or consist of 2'-O-methyl phosphorothioate RNA and [0124] are represented by a nucleotide or base sequence comprising or consisting of SEQ ID NO: 14-90, 91, 93-170 or by a nucleotide or base sequence comprising or consisting of a fragment of SEQ ID NO: 14-90, 91, 93-170.

[0125] More preferably, such oligonucleotides comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

[0126] Even more preferred oligonucleotides comprise a 2'-O-methyl phosphorothioate RNA monomer or consist of 2'-O-methyl phosphorothioate RNA and more preferably comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 14-90, 92, 171-215, 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO:14-90, 92, 171-215, 217, 218, 219 and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Preferred sequences (i.e. preferred nucleotide or base sequences) among SEQ ID NO:14-90, 92, and 171-215, 217, 218, 219 include SEQ ID NO: 15, 21, 31, 40, 43, 52, 57, 59, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 more preferably SEQ ID NO: 40, 43, 52, 57, 59, 208, 207, 200, 210, 206, 171, 173, 199, 213, 185, 187.

[0127] Such even more preferred oligonucleotides are also defined as follows: [0128] comprise a 2'-O-methyl phosphorothioate RNA monomer or consist of 2'-O-methyl phosphorothioate RNA and are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 14-90, 91, 93-170, 216 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 14-90, 91, 93-170 and have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. More preferably, such oligonucleotides comprise a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

[0129] Even more preferably, such modified oligonucleotides are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 92, 171-213, 215, 217, 218, 219 and have a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Even more preferred modified oligonucleotides are derived from the most preferred nucleotide or base sequences (SEQ ID NO:15, 21, 31, 40, 52, and 57) and are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of. SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219 and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0130] Preferred oligonucleotides for inducing the skipping of exon 44 from the dystrophin pre-mRNA are as follows below.

[0131] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 14 and has a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:14 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:14.

[0132] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:14 is represented by SEQ ID NO:94 and a preferred fragment of SEQ ID NO:94 is represented by SEQ ID NO:143.

[0133] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 94 and has a length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:94 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:94.

[0134] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:14 comprises SEQ ID NO: 63 and a preferred fragment of SEQ ID NO:94 comprises SEQ ID NO: 143, and each of said preferred fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0135] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0136] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 15 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:15 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:15.

[0137] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:15 is represented by SEQ ID NO:95.

[0138] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 95 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:95 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:95.

[0139] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:15 comprises SEQ ID NO: 64 and a preferred fragment of SEQ ID NO:95 comprises SEQ ID NO:144 and each of said fragments has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0140] Such preferred oligonucleotide is also defined as follows: [0141] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0142] is represented by a nucleotide or base sequence comprising or consisting of SEQ ID NO: 15 or 95 or 64 or 144 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide or base sequence comprising or consisting of a fragment of SEQ ID NO: 15 or 95 or 64 or 144, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:15 or 95 or 64 or 144.

[0143] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

[0144] More preferably, an oligonucleotide: [0145] consists of 2'-O-methyl phosphorothioate RNA, [0146] all its cytosines have been replaced by 5-methylcytosines, [0147] such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 15 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:15 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:15. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0148] More preferably, an oligonucleotide: [0149] consists of 2'-O-methyl phosphorothioate RNA, [0150] all its uraciles have been replaced by 5-methyluraciles, [0151] such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 204 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:204 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:204. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0152] More preferably, an oligonucleotide: [0153] consists of 2'-O-methyl phosphorothioate RNA, [0154] all its cytosines have been replaced by 5-methylcytosines, [0155] such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 208 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:208 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:208. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0156] More preferably, an oligonucleotide: [0157] consists of 2'-O-methyl phosphorothioate RNA, [0158] all its uraciles have been replaced by 5-methyluraciles and all its cytosines have been replaced by 5-methylcytosines, [0159] such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 205 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:205 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:205. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0160] More preferably, an oligonucleotide: [0161] consists of 2'-O-methyl phosphorothioate RNA, [0162] all its adenines have been replaced by 2,6-diaminopurines, [0163] such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 207 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:207 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:207. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0164] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or base sequence comprising SEQ ID NO: 16 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:16 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:16.

[0165] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:16 is represented by SEQ ID NO:96.

[0166] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 96 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:96 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:96.

[0167] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0168] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0169] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 17 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:17 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:17.

[0170] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:17 is represented by SEQ ID NO:97 and a preferred fragment of SEQ ID NO:97 is represented by SEQ ID NO:145.

[0171] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 97 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:97 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:97.

[0172] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:17 comprises SEQ ID NO: 65 and a preferred fragment of SEQ ID NO: 97 comprises SEQ ID NO: 145, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0173] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base.

[0174] Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0175] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 18 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:18 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:18.

[0176] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:18 is represented by SEQ ID NO:98 and a preferred fragment of SEQ ID NO:98 is represented by SEQ ID NO:146.

[0177] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:18 comprises SEQ ID NO: 66 and a preferred fragment of SEQ ID NO: 98 comprises SEQ ID NO: 146, each of said fragments has a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0178] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 98 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:98 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:98.

[0179] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0180] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 19 and has a length of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:19 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:19.

[0181] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:19 is represented by SEQ ID NO:99.

[0182] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 99 and has a length of 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:99 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:99.

[0183] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0184] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0185] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 20 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:20 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:20.

[0186] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:20 is represented by SEQ ID NO:100 and a preferred fragment of SEQ ID NO:100 is represented by SEQ ID NO:147, 148 or 149.

[0187] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 100 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:100 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:100.

[0188] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 67 and a preferred fragment of SEQ ID NO:100 comprises SEQ ID NO:147, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 68 and another preferred fragment of SEQ ID NO:100 comprises SEQ ID NO: 148, each of said fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:20 comprises SEQ ID NO: 69 and another preferred fragment of SEQ ID NO:100 comprises SEQ ID NO: 149, each of said fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0189] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0190] Preferred oligonucleotides for inducing the skipping of exon 45 from the dystrophin pre-mRNA are as follows below.

[0191] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:21 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:21.

[0192] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:21 is represented by SEQ ID NO:101 and a preferred fragment of SEQ ID NO:101 is represented by SEQ ID NO:150, 151 or 152.

[0193] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 101 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:101 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:101.

[0194] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 70 and a preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:150, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 71 and another preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:151, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:21 comprises SEQ ID NO: 72 and a preferred fragment of SEQ ID NO:101 comprises SEQ ID NO:152, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0195] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0196] Such preferred oligonucleotide is also defined as follows: [0197] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0198] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 21 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 21, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:21.

[0199] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

[0200] More preferably, an oligonucleotide: [0201] consists of 2'-O-methyl phosphorothioate RNA, [0202] all its cytosines have been replaced by 5-methylcytosines, [0203] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:21 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:21.

[0204] Accordingly, said oligonucleotide is particularly represented by a nucleotide or a base sequence comprising SEQ ID NO: 200 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:200 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:200.

[0205] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0206] More preferably, an oligonucleotide: [0207] consists of 2'-O-methyl phosphorothioate RNA, [0208] all its uraciles have been replaced by 5-methyluraciles and all its cytosines have been replaced by 5-methylcytosines, [0209] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 or SEQ ID NO:209 in particular, and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:21 or 209 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 21 or 209. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0210] More preferably, an oligonucleotide: [0211] consists of 2'-O-methyl phosphorothioate RNA, [0212] all its adenines have been replaced by 2,6-diaminopurines, [0213] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 21 or SEQ ID NO: 210 in particular, and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:21 or 210 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:21 or 210. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0214] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 22 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:22 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:22.

[0215] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:22 is represented by SEQ ID NO:102.

[0216] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 102 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:102 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:102.

[0217] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0218] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified.

[0219] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 23 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:23 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:23.

[0220] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:23 is represented by SEQ ID NO:103.

[0221] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 103 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:103 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:103.

[0222] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0223] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0224] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 24 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:24 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:24.

[0225] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:24 is represented by SEQ ID NO:104.

[0226] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or base sequence comprising SEQ ID NO: 104 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:104 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:104.

[0227] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0228] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0229] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 25 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:25 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:25.

[0230] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:25 is represented by SEQ ID NO:105.

[0231] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 105 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:105 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:105.

[0232] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0233] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0234] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioatc RNA monomer or consists of 2'-O-methyl phosphorothioatc RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 26 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:26 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:26.

[0235] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:26 is represented by SEQ ID NO:106.

[0236] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 106 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:106 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:106.

[0237] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0238] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0239] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 27 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:27 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:27.

[0240] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:27 is represented by SEQ ID NO:107.

[0241] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioatc RNA monomer or consists of 2'-O-methyl phosphorothioatc RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 107 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:107 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:107.

[0242] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0243] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base.

[0244] Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0245] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 28 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:28 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:28.

[0246] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:28 is represented by SEQ ID NO:108. Each of SEQ ID NO:28 and SEQ ID NO:108 identified in table 1 comprises an hypoxanthine base at position 7.

[0247] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 108 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:108 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:108.

[0248] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0249] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0250] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 29 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:29 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:29.

[0251] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:29 is represented by SEQ ID NO:109.

[0252] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 109 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:109 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ NO:109.

[0253] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0254] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0255] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 30 and has a length of 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:30 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:30.

[0256] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:30 is represented by SEQ ID NO:110.

[0257] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 110 and has a length 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:110 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:110.

[0258] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0259] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0260] Preferred oligonucleotides for inducing the skipping of exon 51 from the dystrophin pre-mRNA are as follows below.

[0261] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 31 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:31 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:31.

[0262] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:31 is represented by SEQ ID NO:111 and a preferred fragment of SEQ ID NO:111 is represented by SEQ ID NO:153 or 154.

[0263] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 111 and has a length 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:111 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:111.

[0264] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:31 comprises SEQ ID NO: 73 and a preferred fragment of SEQ ID NO: 111 comprises SEQ ID NO: 153, and each of said fragments has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:31 comprises SEQ ID NO: 74 and another preferred fragment of SEQ ID NO: 111 comprises SEQ ID NO: 154, and each of said fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0265] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0266] Such preferred oligonucleotide is also defined as follows: [0267] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0268] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 31 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 31, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:31.

[0269] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

[0270] More preferably, an oligonucleotide: [0271] consists of 2'-O-methyl phosphorothioate RNA, [0272] all its cytosines have been replaced by 5-methylcytosines, [0273] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 31 or SEQ ID NO: 215 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:31 or SEQ ID NO:215 comprising or consisting of at least 10 contiguous nucleotides of SEQ ID NO:31 or of SEQ ID NO: 215. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0274] More preferably, an oligonucleotide: [0275] consists of 2'-O-methyl phosphorothioate RNA, [0276] all its uraciles have been replaced by 5-methyluraciles, [0277] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 202 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:202 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:202. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0278] More preferably, an oligonucleotide: [0279] consists of 2'-O-methyl phosphorothioate RNA, [0280] all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0281] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 203 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:203 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:203. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0282] More preferably, an oligonucleotide: [0283] consists of 2'-O-methyl phosphorothioate RNA, [0284] all its adenines have been replaced by 2,6-diaminopurines, [0285] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 206 and has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:206 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:206. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0286] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 32 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:32 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:32.

[0287] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:32 is represented by SEQ ID NO:112.

[0288] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 112 and has a length 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:112 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:112.

[0289] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0290] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0291] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 33 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:33 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:33.

[0292] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:33 is represented by SEQ ID NO:113.

[0293] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 113 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:113 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:113.

[0294] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0295] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0296] In another embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 34 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:34 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:34.

[0297] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:34 is represented by SEQ ID NO:114.

[0298] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consist of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide sequence comprising SEQ ID NO: 114 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:114 comprising or consisting of at least 10 contiguous nucleotides of SEQ ID NO:114.

[0299] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0300] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO: 34 comprises or consists of SEQ ID NO: 93 (PS1116: 5'-CAACAUCAAGGAAGAUGGCAUUUCU-3').

[0301] Such preferred oligonucleotide is also defined as follows: [0302] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0303] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 34 or 93 or 114 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 34 or 93 or 114, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:34 or 93 or 114.

[0304] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

[0305] More preferably, an oligonucleotide: [0306] consists of 2'-O-methyl phosphorothioatc RNA, [0307] all its cytosines have been replaced by 5-methylcytosines, [0308] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 34 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:34 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:34. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0309] More preferably, an oligonucleotide: [0310] consists of 2'-O-methyl phosphorothioate RNA, [0311] all its adenines have been replaced by 2,6-diaminopurines [0312] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 34 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:34 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:34. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0313] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 35 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:35 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:35.

[0314] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:35 is represented by SEQ ID NO:115.

[0315] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 115 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:115 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:115.

[0316] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0317] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0318] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 36 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:36 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:36.

[0319] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:36 is represented by SEQ ID NO:116 and a preferred fragment of SEQ ID NO:116 is represented by SEQ ID NO:155 or 156 or 157.

[0320] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 116 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:116 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:116.

[0321] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 75 or a preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 155, and each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 76 or another preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 156, and each of said fragments has a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:36 comprises SEQ ID NO: 77 or another preferred fragment of SEQ ID NO: 116 comprises SEQ ID NO: 157, and each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0322] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0323] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 37 and has a length of 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:37 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:37.

[0324] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:37 is represented by SEQ ID NO:117.

[0325] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 117 and has a length 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:117 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:117.

[0326] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0327] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0328] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 38 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:38 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:38.

[0329] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:38 is represented by SEQ ID NO:118.

[0330] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 118 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:118 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:118.

[0331] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0332] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0333] Preferred oligonucleotides for inducing the skipping of exon 52 from the dystrophin pre-mRNA are as follows below.

[0334] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 39 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:39 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:39.

[0335] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:39 is represented by SEQ ID NO:119.

[0336] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 119 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:119 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:119.

[0337] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0338] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0339] More preferably, an oligonucleotide: [0340] consists of 2'-O-methyl phosphorothioate RNA, [0341] all its cytosines have been replaced by 5-methylcytosines, [0342] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 201 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:201 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:201. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0343] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 40 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:40 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:40. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0344] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:40 is represented by SEQ ID NO:120 and a preferred fragment of SEQ ID NO:120 is represented by SEQ ID NO:158 or 159 or 160.

[0345] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 120 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:120 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:120.

[0346] A preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 78 and a preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:158, and each fragment has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 79 and another preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:159, and each fragment has a length of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:40 comprises SEQ ID NO: 80 and another preferred fragment of SEQ ID NO:120 comprises SEQ ID NO:160, and each fragment has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0347] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Such preferred oligonucleotide is also defined as follows: [0348] comprises a 2'-O-methyl phosphorothioatc RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0349] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 40 or 120 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 40 or 120, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:40 or 120.

[0350] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

[0351] More preferably, an oligonucleotide: [0352] consists of 2'-O-methyl phosphorothioate RNA, [0353] all its cytosines have been replaced by 5-methylcytosines, [0354] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 40 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:40 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:40. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 171 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:171 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:171. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 4 cytosines of SEQ ID NO:40 are modified as represented in SEQ ID NO:171. It is encompassed that 1, 2 or 3 of these cytosines are modified.

[0355] More preferably, an oligonucleotide: [0356] consists of 2'-O-methyl phosphorothioate RNA, [0357] all its uraciles have been replaced by 5-methyluraciles, [0358] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO:172 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:172 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:172. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 7 uraciles of SEQ ID NO:40 are modified as represented in SEQ ID NO:172. It is encompassed that 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

[0359] More preferably, an oligonucleotide: [0360] consists of 2'-O-methyl phosphorothioate RNA, [0361] all its adenines have been replaced by 2,6-diaminopurines, [0362] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 173 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:173 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:173. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 adenines of SEQ ID NO:40 are modified as represented in SEQ ID NO:173. It is encompassed that 1, 2, 3 or 4 of these adenines are modified.

[0363] More preferably, an oligonucleotide: [0364] consists of 2'-O-methyl phosphorothioate RNA, [0365] all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0366] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 174 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:174 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:174. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 174 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:174 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:174. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 4 cytosines and not all the 7 uraciles of SEQ ID NO:40 are modified as represented in SEQ ID NO:174. It is encompassed that 1, 2 or 3 of these cytosines and-or 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

[0367] More preferably, an oligonucleotide: [0368] consists of 2'-O-methyl phosphorothioate RNA, [0369] all its cytosines have been replaced by 5-methylcytosines and all its adenines have been replaced by 2,6-diaminopurines, [0370] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 175 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:175 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:175. Accordingly, said oligonucleotide is represented by a nucleotide sequence comprising SEQ ID NO: 175 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:175 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:175. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides It is also encompassed that not all the 4 cytosines and not all the 5 adenines of SEQ ID NO:40 are modified as represented in SEQ ID NO:175. It is encompassed that 1, 2 or 3 of these cytosines and-or 1, 2, 3 or 4 of these adenines are modified.

[0371] More preferably, an oligonucleotide: [0372] consists of 2'-O-methyl phosphorothioate RNA, [0373] all its adenines have been replaced by 2,6-diaminopurines and all its uraciles have been replaced by 5-methyluraciles, [0374] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 176 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:176 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:176. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 adenines and not all the 7 uraciles of SEQ ID NO: 40 are modified as represented in SEQ ID NO:176. It is encompassed that 1, 2, 3 or 4 of these adenines and-or 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

[0375] More preferably, an oligonucleotide: [0376] consists of 2'-O-methyl phosphorothioate RNA, [0377] all its adenines have been replaced by 2,6-diaminopurines, all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0378] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 177 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:177 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:177. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 4 cytosines and not all the 7 uraciles and not all the 5 adenines of SEQ ID NO:40 are modified as represented in SEQ ID NO:177. It is encompassed that 1, 2 or 3 of these cytosines and-or 1, 2, 3, 4, 5 or 6 of these uraciles and-or 1, 2, 3 or 4 of these adenines are modified.

[0379] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide sequence or a base comprising SEQ ID NO: 41 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:41 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:41.

[0380] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:41 is represented by SEQ ID NO:121.

[0381] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 121 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:121 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:121.

[0382] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0383] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0384] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 42 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:42 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:42.

[0385] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:42 is represented by SEQ ID NO:122.

[0386] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 122 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:122 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:122.

[0387] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0388] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0389] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 43 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:43 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:43.

[0390] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0391] Such preferred oligonucleotide is also defined as follows: [0392] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0393] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 43 or 123 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 43 or 123, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:43 or 123. Accordingly a non-modified oligonucleotide derived from SEQ ID NO:43 is represented by SEQ ID NO:123 and a preferred fragment of SEQ ID NO:123 is represented by SEQ ID NO: 161.

[0394] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 123 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:123 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:123.

[0395] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein. Even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0396] More preferably, an oligonucleotide: [0397] consists of 2'-O-methyl phosphorothioate RNA, [0398] all its cytosines have been replaced by 5-methylcytosines, [0399] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 43 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:43 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:43. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 178 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:178 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:178. It is also encompassed that not all the 6 cytosines of SEQ ID NO:43 are modified as represented in SEQ ID NO:178. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines are modified.

[0400] A preferred fragment of SEQ ID NO:43 comprises SEQ ID NO: 81 and a preferred fragment of SEQ ID NO:123 comprises SEQ ID NO:161, each of said fragments has a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0401] More preferably, an oligonucleotide: [0402] consists of 2'-O-methyl phosphorothioate RNA, [0403] all its uraciles have been replaced by 5-methyluraciles, [0404] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO:179 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:179 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:179. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 11 uraciles of SEQ ID NO:43 are modified as represented in SEQ ID NO:179. It is encompassed that 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these uraciles are modified.

[0405] More preferably, an oligonucleotide: [0406] consists of 2'-O-methyl phosphorothioate RNA, [0407] all its adenines have been replaced by 2,6-diaminopurines, [0408] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 180 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:180 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:180. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 2 adenines of SEQ ID NO:43 are modified as represented in SEQ ID NO:180. It is encompassed that 1 of these adenines are modified.

[0409] More preferably, an oligonucleotide: [0410] consists of 2'-O-methyl phosphorothioate RNA, [0411] all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0412] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 181 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:181 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:181. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 181 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:181 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:181. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 cytosines and not all the 11 uraciles of SEQ ID NO: 43 are modified as represented in SEQ ID NO:181. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines and-or 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these uraciles are modified.

[0413] More preferably, an oligonucleotide: [0414] consists of 2'-O-methyl phosphorothioate RNA, [0415] all its cytosines have been replaced by 5-methylcytosines and all its adenines have been replaced by 2,6-diaminopurines, [0416] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 182 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:182 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:182. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 182 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:182 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:182. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 cytosines and not all the 2 adenines of SEQ ID NO:43 are modified as represented in SEQ ID NO:182. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines and-or 1 of these adenines are modified.

[0417] More preferably, an oligonucleotide: [0418] consists of 2'-O-methyl phosphorothioate RNA, [0419] all its adenines have been replaced by 2,6-diaminopurines and all its uraciles have been replaced by 5-methyluraciles, [0420] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 183 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:183 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:183. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 2 adenines and not all the 11 uraciles of SEQ ID NO:43 are modified as represented in SEQ ID NO:183. It is encompassed that 1 of these adenines and/or 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these uraciles are modified.

[0421] More preferably, an oligonucleotide: [0422] consists of 2'-O-methyl phosphorothioate RNA, [0423] all its adenines have been replaced by 2,6-diaminopurines, all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0424] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 184 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:184 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:184. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 cytosines and not all the 11 uraciles and not all the 2 adenines of SEQ ID NO:43 are modified as represented in SEQ ID NO:184. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines and-or 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 of these uraciles and-or 1 of these adenines are modified.

[0425] Preferred oligonucleotides for inducing the skipping of exon 53 from the dystrophin pre-mRNA are as follows below.

[0426] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 44 and has a length of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:44 comprising or consisting of at least 10 contiguous or bases nucleotides of SEQ ID NO:44.

[0427] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:44 is represented by SEQ ID NO:124.

[0428] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 124 and has a length 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:124 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:124.

[0429] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0430] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0431] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 45 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:45 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:45.

[0432] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:45 is represented by SEQ ID NO:125.

[0433] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 125 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:125 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:125.

[0434] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0435] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0436] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 46 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:46 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:46.

[0437] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:46 is represented by SEQ ID NO:126.

[0438] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 126 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:126 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:126.

[0439] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0440] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0441] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 47 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:47 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:47.

[0442] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:47 is represented by SEQ ID NO:127.

[0443] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 127 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:127 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:127.

[0444] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0445] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0446] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 48 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:48 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:48.

[0447] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:48 is represented by SEQ ID NO:128.

[0448] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 128 and has a length 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:128 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:128.

[0449] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0450] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0451] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 49 and has a length of 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:49 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:49.

[0452] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:49 is represented by SEQ ID NO:129.

[0453] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 129 and has a length 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:129 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:129.

[0454] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0455] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0456] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 50 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:50 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:50.

[0457] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:50 is represented by SEQ ID NO:130.

[0458] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 130 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:130 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:130.

[0459] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0460] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0461] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 51 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:51 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:51.

[0462] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:51 is represented by SEQ ID NO:131.

[0463] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 131 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:131 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:131.

[0464] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0465] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0466] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 52 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:52 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:52.

[0467] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:52 is represented by SEQ ID NO: 91 and a preferred fragment of SEQ ID NO:91 is represented by SEQ ID NO:162, 163 or 164. SEQ ID NO: 91 is identical with SEQ ID NO: 132.

[0468] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 91 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:191 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:91.

[0469] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0470] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0471] Such preferred oligonucleotide is also defined as follows: [0472] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0473] is represented by a nucleotide or base sequence comprising or consisting of SEQ ID NO: 52 or 91 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 52 or 91, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:52 or 91.

[0474] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein.

[0475] More preferably, an oligonucleotide: [0476] consists of 2'-O-methyl phosphorothioate RNA, [0477] all its cytosines have been replaced by 5-methylcytosines, [0478] such oligonucleotide is represented by a nucleotide or base sequence comprising SEQ ID NO: 52 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:52 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:52. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0479] A preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 82 and a preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:162, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 83 and another preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:163, each of said fragments has a length of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:52 comprises SEQ ID NO: 84 and another preferred fragment of SEQ ID NO:91 comprises SEQ ID NO:164, each of said fragments has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. A most preferred fragment of SEQ ID NO: 52 comprises or consists of SEQ ID NO: 91 (PS229L: 5'-GUUGCCUCCGGUUCUGAAGGUGUUC-3'). Another most preferred fragment of SEQ ID NO: 52 comprises or consists of SEQ ID NO: 92 (PS524: 5'-GUUGXXUXXGGUUXUGAAGGUGUUX-3'; wherein X is 5-methylcytosine).

[0480] Such preferred oligonucleotide is also defined as follows: [0481] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0482] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 82, 83, 84, 91 or 92 or 162 or 163 or 164 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 82, 83, 84, 91 or 92, or 162 or 163 or 164, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:82, 83, 84, 91, or 92 or 162, 163 or 164.

[0483] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

[0484] More preferably, an oligonucleotide: [0485] consists of 2'-O-methyl phosphorothioate RNA, [0486] all its cytosines have been replaced by 5-methylcytosines, [0487] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 82, 83, 84 or 92 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:82, 83, 84, or 92 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:82, 83, 84, or 92. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. SEQ ID NO: 92 is identical with SEQ ID NO: 199. It is also encompassed that not all the 6 cytosines of SEQ ID NO:52 are modified as represented in SEQ ID NO:92. It is encompassed that 1, 2, 3, 4 or 5 of these cytosines are modified.

[0488] More preferably, an oligonucleotide: [0489] consists of 2'-O-methyl phosphorothioate RNA, [0490] two of its cytosines have been replaced by 5-methylcytosines, [0491] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 218 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:218 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:218. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0492] More preferably, an oligonucleotide: [0493] consists of 2'-O-methyl phosphorothioate RNA, [0494] three of its cytosines have been replaced by 5-methylcytosines, [0495] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 219 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:219 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:219. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0496] More preferably, an oligonucleotide: [0497] consists of 2'-O-methyl phosphorothioate RNA, [0498] four of its cytosines have been replaced by 5-methylcytosines, [0499] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 217 and has a length of 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:217 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:217. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0500] More preferably, an oligonucleotide: [0501] consists of 2'-O-methyl phosphorothioate RNA, [0502] all its uraciles have been replaced by 5-methyluraciles, [0503] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 211 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:211 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:211. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 211 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:211 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:211. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 9 uraciles of SEQ ID NO:52 are modified as represented in SEQ ID NO:211. It is encompassed that 1, 2, 3, 4, 5, 6, 7, or 8 of these uraciles are modified.

[0504] More preferably, an oligonucleotide: [0505] consists of 2'-O-methyl phosphorothioate RNA, [0506] all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0507] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 212 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:212 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:212. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 212 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:212 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:212. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 cytosines and not all the 9 uraciles of SEQ ID NO:52 are modified as represented in SEQ ID NO:212. It is encompassed that 1, 2, 3, 4, or 5 of these cytosines and/or 1, 2, 3, 4, 5, 6, 7, or 8 of these uraciles are modified.

[0508] More preferably, an oligonucleotide: [0509] consists of 2'-O-methyl phosphorothioate RNA, [0510] all its adenines have been replaced by 2,6-diaminopurines, [0511] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 213 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:213 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:213. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 2 adenines of SEQ ID NO:52 are modified as represented in SEQ ID NO:213. It is encompassed that 1 of these adenines are modified.

[0512] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 53 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:53 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:53.

[0513] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:53 is represented by SEQ ID NO:133.

[0514] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 133 and has a length 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:133 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:133.

[0515] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0516] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0517] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 54 and has a length of 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:54 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:54.

[0518] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:54 is represented by SEQ ID NO:134.

[0519] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 134 and has a length 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:134 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:134.

[0520] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0521] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0522] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioatc RNA monomer or consists of 2'-O-methyl phosphorothioatc RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 55 and has a length of 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:55 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:55.

[0523] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:55 is represented by SEQ ID NO:135.

[0524] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 135 and has a length 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:135 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:135.

[0525] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0526] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0527] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 56 and has a length of 33, 34 or 35 nucleotides or by a fragment of SEQ ID NO:56 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:56.

[0528] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:56 is represented by SEQ ID NO:136.

[0529] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioatc RNA monomer or consists of 2'-O-methyl phosphorothioatc RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 136 and has a length 33, 34 or 35 nucleotides, or by a fragment of SEQ ID NO:136 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:136.

[0530] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0531] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0532] Preferred oligonucleotides for inducing the skipping of exon 55 from the dystrophin pre-mRNA are as follows below.

[0533] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 57 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:57 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:57. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

Such preferred oligonucleotide is also defined as follows: [0534] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0535] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 57 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 57, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:57. [0536] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:57 is represented by SEQ ID NO:137 and a preferred fragment of SEQ ID NO:137 is represented by SEQ ID NO:165 or 166.

[0537] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 137 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:137 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:137.

[0538] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein. Even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0539] More preferably, an oligonucleotide: [0540] consists of 2'-O-methyl phosphorothioate RNA, [0541] all its cytosines have been replaced by 5-methylcytosines, [0542] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 57 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:57 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:57.

[0543] Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 185 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:185 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:185. It is also encompassed that not all the 8 cytosines of SEQ ID NO:57 are modified as represented in SEQ ID NO:185. It is encompassed that 1, 2, 3, 4, 5, 6, or 7 of these cytosines are modified.

[0544] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0545] A preferred fragment of SEQ ID NO:57 comprises SEQ ID NO: 85 and a preferred fragment of SEQ ID NO:137 comprises SEQ ID NO: 165, each of said fragments has a length of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:57 comprises SEQ ID NO: 86 and another preferred fragment of SEQ ID NO:137 comprises SEQ ID NO: 166, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0546] More preferably, an oligonucleotide: [0547] consists of 2'-O-methyl phosphorothioate RNA, [0548] all its uraciles have been replaced by 5-methyluraciles, [0549] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO:186 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:186 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:186. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 7 uraciles of SEQ ID NO:57 are modified as represented in SEQ ID NO:186. It is encompassed that 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

[0550] More preferably, an oligonucleotide: [0551] consists of 2'-O-methyl phosphorothioate RNA, [0552] all its adenines have been replaced by 2,6-diaminopurines, [0553] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 187 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:187 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:187. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 adenines of SEQ ID NO:57 are modified as represented in SEQ ID NO:187. It is encompassed that 1, 2, 3 or 4 of these adenines are modified.

[0554] More preferably, an oligonucleotide: [0555] consists of 2'-O-methyl phosphorothioate RNA, [0556] all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0557] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 188 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:188 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:188. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 188 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:188 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:188. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 8 cytosines and not all the 7 uraciles of SEQ ID NO:57 are modified as represented in SEQ ID NO:188. It is encompassed that 1, 2, 3, 4, 5, 6 or 7 of these cytosines and-or 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

[0558] More preferably, an oligonucleotide: [0559] consists of 2'-O-methyl phosphorothioate RNA, [0560] all its cytosines have been replaced by 5-methylcytosines and all its adenines have been replaced by 2,6-diaminopurines, [0561] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 189 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:189 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:189. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 189 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:189 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:189. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides It is also encompassed that not all the 8 cytosines and not all the 5 adenines of SEQ ID NO:57 are modified as represented in SEQ ID NO:189. It is encompassed that 1, 2, 3, 4, 5, 6 or 7 of these cytosines and-or 1, 2, 3 or 4 of these adenines are modified.

[0562] More preferably, an oligonucleotide: [0563] consists of 2'-O-methyl phosphorothioate RNA, [0564] all its adenines have been replaced by 2,6-diaminopurines and all its uraciles have been replaced by 5-methyluraciles, [0565] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 190 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:190 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:190. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 adenines and not all the 7 uraciles of SEQ ID NO:57 are modified as represented in SEQ ID NO:190. It is encompassed that 1, 2, 3 or 4 of these adenines and-or 1, 2, 3, 4, 5 or 6 of these uraciles are modified.

[0566] More preferably, an oligonucleotide: [0567] consists of 2'-O-methyl phosphorothioate RNA, [0568] all its adenines have been replaced by 2,6-diaminopurines, all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0569] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 191 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:191 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:191. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 8 cytosines and not all the 7 uraciles and not all the 5 adenines of SEQ ID NO:57 are modified as represented in SEQ ID NO:191. It is encompassed that 1, 2, 3, 4, 5, 6 or 7 of these cytosines and-or 1, 2, 3, 4, 5 or 6 of these uraciles and-or 1, 2, 3 or 4 of these adenines are modified.

[0570] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 58 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:58 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:58.

[0571] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:58 is represented by SEQ ID NO:138.

[0572] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 138 and has a length 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:138 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:138.

[0573] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0574] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0575] Such preferred oligonucleotide is also defined as follows: [0576] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0577] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 58 or 138 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a nucleotide or a base sequence comprising or consisting of a fragment of SEQ ID NO: 58 or 138, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:58 or 138.

[0578] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein

[0579] More preferably, an oligonucleotide: [0580] consists of 2'-O-methyl phosphorothioate RNA, [0581] all its cytosines have been replaced by 5-methylcytosines, [0582] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 58 and has a length of 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:58 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:58. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0583] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 59 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:59 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:59. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0584] Such preferred oligonucleotide is also defined as follows: [0585] comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and [0586] is represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 59 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 59, said fragment comprising or consisting of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 contiguous nucleotides or bases of SEQ ID NO:59. [0587] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:59 is represented by SEQ ID NO:139 and a preferred fragment of SEQ ID NO:139 is represented by SEQ ID NO: 167 or 168 or 169 or 170.

[0588] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and is represented by a nucleotide or a base sequence comprising SEQ ID NO: 139 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:139 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:139.

[0589] More preferably, such oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base as earlier defined herein. Even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0590] More preferably, an oligonucleotide: [0591] consists of 2'-O-methyl phosphorothioate RNA, [0592] all its cytosines have been replaced by 5-methylcytosines, [0593] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 59 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:59 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:59.

[0594] Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 192 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:192 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:192. It is also encompassed that not all the 5 cytosines of SEQ ID NO:59 are modified as represented in SEQ ID NO:192. It is encompassed that 1, 2, 3 or 4 of these cytosines are modified.

[0595] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0596] A preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 87 and a preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:167, each of said fragments has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 88 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:168, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 89 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:169, each of said fragments has a length of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. Another preferred fragment of SEQ ID NO:59 comprises SEQ ID NO: 90 and another preferred fragment of SEQ ID NO:139 comprises SEQ ID NO:170, each of said fragments has a length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0597] More preferably, an oligonucleotide: [0598] consists of 2'-O-methyl phosphorothioate RNA, [0599] all its uraciles have been replaced by 5-methyluraciles, [0600] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO:193 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:193 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:193. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 uraciles of SEQ ID NO:59 are modified as represented in SEQ ID NO:193. It is encompassed that 1, 2, 3, 4 or 5 of these uraciles are modified.

[0601] More preferably, an oligonucleotide: [0602] consists of 2'-O-methyl phosphorothioate RNA, [0603] all its adenines have been replaced by 2,6-diaminopurines, [0604] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 194 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:194 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:194. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 adenines of SEQ ID NO:59 are modified as represented in SEQ ID NO:194. It is encompassed that 1, 2, 3, 4 or 5 of these adenines are modified.

[0605] More preferably, an oligonucleotide: [0606] consists of 2'-O-methyl phosphorothioate RNA, [0607] all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0608] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 195 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:195 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:195. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 195 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:195 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:195. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 cytosines and not all the 6 uraciles of SEQ ID NO:59 are modified as represented in SEQ ID NO:195. It is encompassed that 1, 2, 3 or 4 of these cytosines and-or 1, 2, 3, 4 or 5 of these uraciles are modified.

[0609] More preferably, an oligonucleotide: [0610] consists of 2'-O-methyl phosphorothioate RNA, [0611] all its cytosines have been replaced by 5-methylcytosines and all its adenines have been replaced by 2,6-diaminopurines, [0612] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 196 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:196 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:196. Accordingly, said oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 196 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:196 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:196. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides It is also encompassed that not all the 5 cytosines and not all the 6 adenines of SEQ ID NO:59 are modified as represented in SEQ ID NO:196. It is encompassed that 1, 2, 3 or 4 of these cytosines and/or 1, 2, 3, 4 or 5 of these adenines are modified.

[0613] More preferably, an oligonucleotide: [0614] consists of 2'-O-methyl phosphorothioate RNA, [0615] all its adenines have been replaced by 2,6-diaminopurines and all its uraciles have been replaced by 5-methyluraciles, [0616] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 197 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:197 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:197. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 6 adenines and not all the 6 uraciles of SEQ ID NO:59 are modified as represented in SEQ ID NO:197. It is encompassed that 1, 2, 3, 4 or 5 of these adenines and/or 1, 2, 3, 4 or 5 of these uraciles are modified.

[0617] More preferably, an oligonucleotide: [0618] consists of 2'-O-methyl phosphorothioate RNA, [0619] all its adenines have been replaced by 2,6-diaminopurines, all its cytosines have been replaced by 5-methylcytosines and all its uraciles have been replaced by 5-methyluraciles, [0620] such oligonucleotide is represented by a nucleotide or a base sequence comprising SEQ ID NO: 198 and has a length of 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:198 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:198. Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides. It is also encompassed that not all the 5 cytosines and not all the 6 uraciles and not all the 6 adenines of SEQ ID NO:59 are modified as represented in SEQ ID NO:198. It is encompassed that 1, 2, 3 or 4 of these cytosines and/or 1, 2, 3, 4 or 5 of these uraciles and/or 1, 2, 3, 4 or 5 of these adenines are modified.

[0621] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 60 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, or by a fragment of SEQ ID NO:60 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:60.

[0622] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:60 is represented by SEQ ID NO:140.

[0623] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 140 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides, or by a fragment of SEQ ID NO:140 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:140.

[0624] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0625] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0626] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 61 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:61 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:61.

[0627] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:61 is represented by SEQ ID NO:141.

[0628] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 141 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:141 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:141.

[0629] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0630] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

[0631] In a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA and more preferably comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base, is represented by a nucleotide or a base sequence comprising SEQ ID NO: 62 and has a length of 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides or by a fragment of SEQ ID NO:62 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:62.

[0632] Accordingly a non-modified oligonucleotide derived from SEQ ID NO:62 is represented by SEQ ID NO:142.

[0633] Accordingly, in a preferred embodiment, an oligonucleotide comprises a 2'-O-methyl phosphorothioate RNA monomer or consists of 2'-O-methyl phosphorothioate RNA is represented by a nucleotide or a base sequence comprising SEQ ID NO: 142 and has a length 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides or by a fragment of SEQ ID NO:142 comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO:142.

[0634] Such fragment has preferably a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

[0635] Accordingly, more preferably, said oligonucleotide comprises a 5-methylpyrimidine (i.e. a 5-methylcytosine, and/or a 5-methyluracil) and/or a 2,6-diaminopurine base. Accordingly, even more preferably, said oligonucleotide has all its cytosines and/or all its uracil and/or all its adenines that have been substituted or modified as defined herein.

Composition

[0636] In a second aspect, there is provided a composition comprising an oligonucleotide as described in the previous section entitled "Oligonucleotide". This composition preferably comprises or consists of an oligonucleotide as described above.

[0637] In a preferred embodiment, said composition is for use as a medicament. Said composition is therefore a pharmaceutical composition. A pharmaceutical composition usually comprises a pharmaceutically accepted carrier, diluent and/or excipient. In a preferred embodiment, a composition of the current invention comprises a compound as defined herein and optionally further comprises a pharmaceutically acceptable formulation, filler, preservative, solubilizer, carrier, diluent, excipient, salt, adjuvant and/or solvent. Such pharmaceutically acceptable carrier, filler, preservative, solubilizer, diluent, salt, adjuvant, solvent and/or excipient may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, Md.: Lippincott Williams & Wilkins, 2000. The compound as described in the invention may possess at least one ionizable group. An ionizable group may be a base or acid, and may be charged or neutral. An ionizable group may be present as ion pair with an appropriate counterion that carries opposite charge(s). Examples of cationic counterions are sodium, potassium, cesium, Tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium, and tetraalkylammonium. Examples of anionic counterions are chloride, bromide, iodide, lactate, mesylate, acetate, trifluoroacetate, dichloroacetate, and citrate. Examples of counterions have been described [e.g. Kumar, 2008, which is incorporated here in its entirety by reference].

[0638] In a preferred embodiment, a composition comprises the oligonucleotide of the invention and sodium as counterion. Said oligonucleotide present in said composition may also be named as an oligonucleotide in its sodium form.

[0639] In another preferred embodiment, a composition comprises the oligonucleotide of the invention and calcium and/or magnesium as counterion. Said oligonucleotide present in said composition may also be named as an oligonucleotide in its calcium or magnesium or mixed calcium/magnesium form.

[0640] Such type of composition comprising an oligonucleotide of the invention and a counterion may be obtained through either formulating the counterion salt of the oligonucleotide or by adding appropriate amounts of said salt to an oligonucleotide. A positive effect of calcium salts present in composition comprising an oligonucleotide with respect to immunostimulatory effects of said oligonucleotides has been described (e.g. patent application WO 2012021985 (Replicor), incorporated here in its entirety by reference).

[0641] A pharmaceutical composition may comprise an aid in enhancing the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics and cellular uptake of said compound, in particular an excipient capable of forming complexes, nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or pluronics, polymersomes, colloids, microbubbles, vesicles, micelles, lipoplexes, and/or liposomes. Examples of nanoparticles include polymeric nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar particles, protein nanoparticles and peptide nanoparticles.

[0642] A preferred composition comprises at least one excipient that may further aid in enhancing the targeting and/or delivery of said composition and/or said oligonucleotide to a tissue and/or a cell and/or into a tissue and/or a cell. A preferred tissue or cell is a muscle tissue or cell.

[0643] Many of these excipients are known in the art (e.g. see Bruno, 2011) and may be categorized as a first type of excipient. Examples of first type of excipients include polymers (e.g. polyethyleneimine (PEI), poly-2-hydroxypropylcneimine (pHP), polypropyleneimine (PPI), dextran derivatives, butylcyanoacrylate (PBCA), hexylcyanoacrylate (PHCA), poly(lactic-co-glycolic acid) (PLGA), polyamines (e.g. spermine, spermidine, putrescine, cadaverine), chitosan, poly(amido amines) (PAMAM), poly(ester amine), polyvinyl ether, polyvinyl pyrrolidone (PVP), polyethylene glycol (PEG) cyclodextrins, hyaluronic acid, colominic acid, and derivatives thereof), dendrimers (e.g. poly(amidoamine)), lipids {e.g. 1,2-dioleoyl-3-dimethylammonium propane (DODAP), dioleoyldimethylammonium chloride (DODAC), phosphatidylcholine derivatives [e.g 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)], lyso-phosphatidylcholine derivaties [e.g. 1-stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-LysoPC)], sphingomyeline, 2-{3-[Bis-(3-amino-propyl)-amino]-propylamino}-N-ditetracedyl carbamoyl methylacetamide (RPR209120), phosphoglycerol derivatives [e.g. 1,2-dipalmitoyl-sn-glycero-3-phosphoglycerol, sodium salt (DPPG-Na), phosphaticid acid derivatives [1,2-distearoyl-sn-glycero-3-phosphaticid acid, sodium salt (DSPA), phosphatidylethanolamine derivatives [e.g. dioleoyl-L-R-phosphatidylethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE),], N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), 1,3-di-oleoyloxy-2-(6-carboxy-spermyl)-propylamid (DOSPER), (1,2-dimyristyolxypropyl-3-dimethylhydroxy ethyl ammonium (DMRIE), (N1-cholesteryloxycarbonyl-3,7-diazanonane-1,9-diamine (CDAN), dimethyldioctadecylammonium bromide (DDAB), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), (b-L-Arginyl-2,3-L-diaminopropionic acid-N-palmityl-N-olelyl-amide trihydrochloride (AtuFECT01), 1,N,N-dimethyl-3-aminopropane derivatives [e.g. 1,2-distearoyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-Dilinoleyloxy-N,N-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl[1,3]-dioxolane (DLin-K-DMA), phosphatidylserine derivatives [1,2-dioleyl-sn-glycero-3-phospho-L-serine, sodium salt (DOPS)], cholesterol}proteins (e.g. albumin, gelatins, atellocollagen), and peptides (e.g. protamine, PepFects, NickFects, polyarginine, polylysine, CADY, MPG).

[0644] Another preferred composition may comprise at least one excipient categorized as a second type of excipient. A second type of excipient may comprise or contain a conjugate group as described herein to enhance targeting and/or delivery of the composition and/or of the oligonucleotide of the invention to a tissue and/or cell and/or into a tissue and/or cell, as for example muscle tissue or cell. Both types of excipients may be combined together into one single composition as identified herein.

[0645] The skilled person may select, combine and/or adapt one or more of the above or other alternative excipients and delivery systems to formulate and deliver a compound for use in the present invention.

[0646] Such a pharmaceutical composition of the invention may be administered in an effective concentration at set times to an animal, preferably a mammal. More preferred mammal is a human being. An oligonucleotide or a composition as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing a disease or condition as identified herein, and may be administered directly in vivo, ex vivo or in vitro. Administration may be via topical, systemic and/or parenteral routes, for example intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, urogenital, intradermal, dermal, enteral, intravitreal, intracavernous, intracerebral, intrathecal, epidural or oral route.

[0647] Preferably, such a pharmaceutical composition of the invention may be encapsulated in the form of an emulsion, suspension, pill, tablet, capsule or soft-gel for oral delivery, or in the form of aerosol or dry powder for delivery to the respiratory tract and lungs.

[0648] In an embodiment an oligonucleotide of the invention may be used together with another compound already known to be used for the treatment of said disease. Such other compounds may be used for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival and/or improve, increase or restore cardiac function. Examples are, but not limited to, a steroid, preferably a (gluco)corticosteroid, an ACE inhibitor (preferably perindopril), an angiotensin II type 1 receptor blocker (preferably losartan), a tumor necrosis factor-alpha (TNF.alpha.) inhibitor, a TGF.beta. inhibitor (preferably decorin), human recombinant biglycan, a source of mIGF-1, a myostatin inhibitor, mannose-6-phosphate, an antioxidant, an ion channel inhibitor, a protease inhibitor, a phosphodiesterase inhibitor (preferably a PDE5 inhibitor, such as sildenafil or tadalafil), a histone deacetylase inhibitor (HDAC inhibitor, androgen receptor modulator, creatine, creatine phosphate, and/or L-arginine. Such combined use may be a sequential use: each component is administered in a distinct composition. Alternatively each compound may be used together in a single composition.

Use

[0649] In a further aspect, there is provided the use of a composition or an oligonucleotide as described in the previous sections for use as a medicament or part of therapy, or applications in which said oligonucleotide exerts its activity intracellularly.

[0650] Preferably, an oligonucleotide or composition of the invention is for use as a medicament or part of a therapy for preventing, delaying, curing, ameliorating and/or treating DMD or BMD.

Method

[0651] In a further aspect, there is provided a method for preventing, treating, curing, ameliorating and/or delaying a condition or disease as defined in the previous section in an individual, in a cell, tissue or organ of said individual. The method comprising administering an oligonucleotide or a composition of the invention to said individual or a subject in the need thereof.

[0652] The method according to the invention wherein an oligonucleotide or a composition as defined herein may be suitable for administration to a cell, tissue and/or an organ in vivo of individuals affected by any of the herein defined diseases, and may be administered in vivo, ex vivo or in vitro. An individual or a subject in need is preferably a mammal, more preferably a human being.

[0653] In a further aspect, there is provided a method for diagnosis wherein the oligonucleotide of the invention is provided with a radioactive label or fluorescent label.

[0654] In an embodiment, in a method of the invention, a concentration of an oligonucleotide or composition is ranged from 0.01 nM to 1 .mu.M. More preferably, the concentration used is from 0.05 to 500 nM, or from 0.1 to 500 nM, or from 0.02 to 500 nM, or from 0.05 to 500 nM, even more preferably from 1 to 200 nM.

[0655] Dose ranges of an oligonucleotide or composition according to the invention are preferably designed on the basis of rising dose studies in clinical trials (in vivo use) for which rigorous protocol requirements exist. An oligonucleotide as defined herein may be used at a dose which is ranged from 0.01 to 200 mg/kg or 0.05 to 100 mg/kg or 0.1 to 50 mg/kg or 0.1 to 20 mg/kg, preferably from 0.5 to 10 mg/kg.

[0656] The ranges of concentration or dose of oligonucleotide or composition as given above are preferred concentrations or doses for in vitro or ex vivo uses. The skilled person will understand that depending on the identity of the oligonucleotide used, the target cell to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration or dose of oligonucleotide used may further vary and may need to be optimised any further.

[0657] In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb "to consist" may be replaced by "to consist essentially of" meaning that an oligonucleotide or a composition as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

[0658] Each embodiment as identified herein may be combined together unless otherwise indicated. All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

DEFINITIONS

[0659] Throughout the application, the word "binds", "targets", "hybridizes" could be used interchangeably when used in the context of an antisense oligonucleotide which is reverse complementary to a part of a pre-mRNA as identified herein.

[0660] In addition, throughout the application, the expression "able to bind", "able to target", "able to hybridize" could be used interchangeably when used in the context of an antisense oligonucleotide which is reverse complementary to a part of a pre-mRNA as identified herein and for which conditions could be found wherein said oligonucleotide could bind, target or hybridize with said part of said pre-mRNA.

[0661] As used herein, "hybridization" refers to the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases). For example, the natural base adenine is nucleobase complementary to the natural nucleobases thymine and uracil which pair through the formation of hydrogen bonds. The natural base guanine is nucleobase complementary to the natural bases cytosine and 5-methylcytosine. Hybridization can occur under varying circumstances.

[0662] As used herein, "specifically hybridizes" refers to the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an anti sense oligonucleotide specifically hybridizes to more than one target site.

[0663] In the context of the invention, "hybridizes" is used under physiological conditions in a cell, preferably a muscular cell unless otherwise indicated.

[0664] As used herein, "nucleoside" refers to a compound comprising a heterocyclic base moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA), abasic nucleosides, modified nucleosides, and sugar-modified nucleosides. Nucleosides may be modified with any of a variety of substituents.

[0665] As used herein, "sugar moiety" means a natural (furanosyl), a modified sugar moiety or a sugar surrogate.

[0666] As used herein, "modified sugar moiety" means a chemically-modified furanosyl sugar or a non-furanosyl sugar moiety. Also, embraced by this term are furanosyl sugar analogs and derivatives including tricyclic sugars, bicyclic sugars, tetrahydropyrans, morpholinos, 2'-modified sugars, 4'-modified sugars, 5'-modified sugars, and 4'-substituted sugars.

[0667] As used herein, "sugar-modified nucleoside" means a nucleoside comprising a modified sugar moiety.

[0668] As used herein the term "sugar surrogate" refers to a structure that is capable of replacing the furanose ring of a naturally occurring nucleoside. In certain embodiments, sugar surrogates are non-furanose (or 4'-substituted furanose) rings or ring systems or open systems. Such structures include simple changes relative to the natural furanose ring, such as a six membered ring or may be more complicated as is the case with the non-ring system used in peptide nucleic acid. Sugar surrogates includes without limitation morpholinos and cyclohexenyls and cyclohexitols. In most nucleosides having a sugar surrogate group the heterocyclic base moiety is generally maintained to permit hybridization.

[0669] As used herein, "nucleotide" refers to a nucleoside further comprising a modified or unmodified phosphate linking group or a non-phosphate internucleoside linkage.

[0670] As used herein, "linked nucleosides" may or may not be linked by phosphate linkages and thus includes "linked nucleotides".

[0671] As used herein, "nucleobase" refers to the heterocyclic base portion of a nucleoside. Nucleobases may be naturally occurring or may be modified and therefore include, but are not limited to adenine, cytosine, guanine, uracil, thymine and analogues thereof such as 5-methylcytosine. In certain embodiments, a nucleobase may comprise any atom or group of atoms capable of hydrogen bonding to a base of another nucleic acid.

[0672] As used herein, "modified nucleoside" refers to a nucleoside comprising at least one modification compared to naturally occurring RNA or DNA nucleosides. Such modification may be at the sugar moiety and/or at the nucleobases.

[0673] As used herein, "T.sub.m" means melting temperature which is the temperature at which the two strands of a duplex nucleic acid separate. T.sub.m is often used as a measure of duplex stability or the binding affinity of an antisense compound toward a complementary RNA molecule.

[0674] As used herein, "2'-modified" or "2'-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2'-substituents, such as allyl, amino, azido, thio, O-allyl, O--C.sub.1-C.sub.10 alkyl, --OCF.sub.3, O--(CH.sub.2).sub.2--O--CH.sub.3, 2'-O(CH.sub.2).sub.2SCH.sub.3, O--(CH.sub.2).sub.2--O--N(R.sub.m)(R.sub.n), or O--CH.sub.2--C(.dbd.O)--N(R.sub.m)(R.sub.n), wherein each R.sub.m and R.sub.n is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl. 2'-modified nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.

[0675] As used herein, "2'-OMe" or "2'-OCH.sub.3" or "2'-O-methyl" each refers to a nucleoside comprising a sugar comprising an --OCH.sub.3 group at the 2' position of the sugar ring.

[0676] As used herein, "MOE" or "2'-MOE" or "2'-OCH.sub.2CH.sub.2OCH.sub.3" or "2'-O-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a --OCH.sub.2CH.sub.2OCH.sub.3 group at the 2' position of the sugar ring.

[0677] As used herein, the term "adenine analogue" means a chemically-modified purine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with either a thymine or uracil of a complementary strand of RNA or DNA.

[0678] As used herein, the term "uracil analogue" means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with either a adenine of a complementary strand of RNA or DNA.

[0679] As used herein, the term "thymine analogue" means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with an adenine of a complementary strand of RNA or DNA.

[0680] As used herein, the term "cytosine analogue" means a chemically-modified pyrimidine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with a guanine of a complementary strand of RNA or DNA. For example, cytosine analogue can be a 5-methylcytosine.

[0681] As used herein, the term "guanine analogue" means a chemically-modified purine nucleobase that, when incorporated into an oligomer, is capable with forming a Watson-Crick base pair with a cytosine of a complementary strand of RNA or DNA.

[0682] As used herein, the term "guanosine" refers to a nucleoside or sugar-modified nucleoside comprising a guanine or guanine analog nucleobase.

[0683] As used herein, the term "uridine" refers to a nucleoside or sugar-modified nucleoside comprising a uracil or uracil analog nucleobase.

[0684] As used herein, the term "thymidine" refers to a nucleoside or sugar-modified nucleoside comprising a thymine or thymine analog nucleobase.

[0685] As used herein, the term "cytidine" refers to a nucleoside or sugar-modified nucleoside comprising a cytosine or cytosine analog nucleobase.

[0686] As used herein, the term "adenosine" refers to a nucleoside or sugar-modified nucleoside comprising an adenine or adenine analog nucleobase.

[0687] As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA).

[0688] As used herein "oligonucleoside" refers to an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.

[0689] As used herein, "modified oligonucleotide" or "chemically-modified oligonucleotide" refers to an oligonucleotide comprising at least one modified sugar, a modified nucleobase and/or a modified internucleoside linkage or backbone.

[0690] As used herein, "internucleoside linkage" or "backbone" refers to a covalent linkage between adjacent nucleosides.

[0691] As used herein "naturally occurring internucleoside linkage" refers to a 3' to 5' phosphodiester linkage.

[0692] As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a naturally occurring internucleoside linkage.

[0693] As used herein, "oligomeric compound" refers to a polymeric structure comprising two or more sub-structures. In certain embodiments, an oligomeric compound is an oligonucleotide. In certain embodiments, an oligomeric compound is a single-stranded oligonucleotide. In certain embodiments, an oligomeric compound is a double-stranded duplex comprising two oligonucleotides. In certain embodiments, an oligomeric compound is a single-stranded or double-stranded oligonucleotide comprising one or more conjugate groups and/or terminal groups.

[0694] As used herein, "conjugate" refers to an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional linking moiety or linking group to the parent compound such as an oligomeric compound. In certain embodiments, conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. In certain embodiments, conjugates are terminal groups. In certain embodiments, conjugates are attached to a 3' or 5' terminal nucleoside or to an internal nucleosides of an oligonucleotide.

[0695] As used herein, "conjugate linking group" refers to any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound. Linking groups or bifunctional linking moieties such as those known in the art are amenable to the present invention.

[0696] As used herein, "antisense compound" refers to an oligomeric compound, at least a portion of which is at least partially complementary to a target nucleic acid to which it hybridizes and modulates the activity, processing or expression of said target nucleic acid.

[0697] As used herein, "expression" refers to the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, splicing, post-transcriptional modification, and translation.

[0698] As used herein, "antisense oligonucleotide" refers to an antisense compound that is an oligonucleotide.

[0699] As used herein, "antisense activity" refers to any detectable and/or measurable activity attributable to the hybridization of an anti sense compound to its target nucleic acid. In certain embodiments, such activity may be an increase or decrease in an amount of a nucleic acid or protein. In certain embodiments, such activity may be a change in the ratio of splice variants of a nucleic acid or protein. Detection and/or measuring of antisense activity may be direct or indirect. In certain embodiments, antisense activity is assessed by observing a phenotypic change in a cell or animal.

[0700] As used herein, "target nucleic acid" refers to any nucleic acid molecule the expression, amount, or activity of which is capable of being modulated by an antisense compound. In certain embodiments, the target nucleic acid is DNA or RNA. In certain embodiments, the target RNA is mRNA, pre-mRNA, non-coding RNA, pri-microRNA, pre-microRNA, mature microRNA, promoter-directed RNA, or natural antisense transcripts. For example, the target nucleic acid can be a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In certain embodiments, target nucleic acid is a viral or bacterial nucleic acid.

[0701] As used herein, "target mRNA" refers to a pre-selected RNA molecule that encodes a protein.

[0702] As used herein, "targeting" or "targeted to" refers to the association of an antisense compound to a particular target nucleic acid molecule or a particular region of nucleotides within a target nucleic acid molecule. An anti sense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.

[0703] As used herein, "target site" refers to a region of a target nucleic acid that is bound by an antisense compound. In certain embodiments, a target site is at least partially within the 3' untranslated region of an RNA molecule. In certain embodiments, a target site is at least partially within the 5' untranslated region of an RNA molecule. In certain embodiments, a target site is at least partially within the coding region of an RNA molecule. In certain embodiments, a target site is at least partially within an exon of an RNA molecule. In certain embodiments, a target site is at least partially within an intron of an RNA molecule. In certain embodiments, a target site is at least partially within a microRNA target site of an RNA molecule. In certain embodiments, a target site is at least partially within a repeat region of an RNA molecule.

[0704] As used herein, "target protein" refers to a protein, the expression of which is modulated by an antisense compound. In certain embodiments, a target protein is encoded by a target nucleic acid. In certain embodiments, expression of a target protein is otherwise influenced by a target nucleic acid.

[0705] As used herein, "complementarily" in reference to nucleobases refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.

[0706] As used herein, "non-complementary" in reference to nucleobases refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

[0707] As used herein, "complementary" in reference to linked nucleosides, oligonucleotides, or nucleic acids, refers to the capacity of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid through nucleobase complementarity. In certain embodiments, an antisense compound and its target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can bond with each other to allow stable association between the anti sense compound and the target. One skilled in the art recognizes that the inclusion of mismatches is possible without eliminating the ability of the oligomeric compounds to remain in association. Therefore, described herein are antisense compounds that may comprise up to about 20% nucleotides that are mismatched (i.e., are not nucleobase complementary to the corresponding nucleotides of the target). Preferably the antisense compounds contain no more than about 15%, more preferably not more than about 10%, most preferably not more than 5% or no mismatches. The remaining nucleotides are nucleobase complementary or otherwise do not disrupt hybridization (e.g., universal bases). One of ordinary skill in the art would recognize the compounds provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a target nucleic acid.

[0708] As used herein, "modulation" refers to a perturbation of amount or quality of a function or activity when compared to the function or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include perturbing splice site selection of pre-mRNA processing, resulting in a change in the amount of a particular splice-variant present compared to conditions that were not perturbed. As a further example, modulation includes perturbing translation of a protein.

[0709] As used herein, "motif" refers to a pattern of modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.

[0710] As used herein, "nucleoside motif" refers to a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.

[0711] As used herein, "linkage motif" refers to a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.

[0712] As used herein, "the same modifications" refer to modifications relative to naturally occurring molecules that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have "the same modification," even though the DNA nucleoside is unmodified.

[0713] As used herein, "type of modification" in reference to a nucleoside or a nucleoside of a "type" refers to the modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.

[0714] As used herein, "separate regions" refers to a portion of an oligomeric compound wherein the nucleosides and internucleoside linkages within the region all comprise the same modifications; and the nucleosides and/or the internucleoside linkages of any neighboring portions include at least one different modification.

[0715] As used herein, "pharmaceutically acceptable salts" refers to salts of active compounds that retain the desired biological activity of the active compound and do not impart undesired toxicological effects thereto.

[0716] As used herein, "cap structure" or "terminal cap moiety" refers to chemical modifications incorporated at either terminus of an anti sense compound.

[0717] As used herein, the term "independently" means that each occurrence of a repetitive variable within a claimed oligonucleotide is selected independent of one another. For example, each repetitive variable can be selected so that (i) each of the repetitive variables are the same, (ii) two or more are the same, or (iii) each of the repetitive variables can be different.

General Chemistry Definitions

[0718] As used herein, "alkyl" refers to a saturated straight or branched hydrocarbon substituent or radical, typically containing up to twenty four carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to 24 carbon atoms, more typically from 1 to 12 carbon atoms (C.sub.1-C.sub.12 alkyl) with from 1 to 6 carbon atoms (C.sub.1-C.sub.6 alkyl) being more preferred. The term "lower alkyl" as used herein includes from 1 to 6 carbon atoms (C.sub.1-C.sub.6 alkyl). Alkyl groups as used herein may optionally include one or more further substituent groups.

[0719] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain radical or substituent, typically containing up to twenty four carbon atoms, and having at least one carbon-carbon double bond. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadienyl and the like. Alkenyl groups typically include from 2 to 24 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.

[0720] As used herein, "alkynyl" refers to a straight or branched hydrocarbon radical or substituent, typically containing up to twenty four carbon atoms, and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to 24 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.

[0721] As used herein, "aminoalkyl" refers to an amino substituted alkyl radical or substituent. This term is meant to include C.sub.1-C.sub.12 alkyl groups having an amino substituent at any position and wherein the aminoalkyl group is attached to the parent molecule via its alkyl moiety. The alkyl and/or amino portions of the aminoalkyl group can be further substituted with substituent groups.

[0722] As used herein, "aliphatic" refers to a straight or branched hydrocarbon radical or substituent, typically containing up to twenty four carbon atoms, wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to 24 carbon atoms, more typically from 1 to 12 carbon atoms with from 1 to 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.

[0723] As used herein, "alicyclic" or "alicyclyl" refers to a cyclic radical or substituent, wherein the ring system is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclic moieties include rings having from 5 to 9 carbon atoms in the ring. Alicyclic groups as used herein may optionally include further substituent groups.

[0724] As used herein, "alkoxy" refers to a radical or substituent comprising an alkyl group and an oxygen atom, wherein the alkoxy group is attached to a parent molecule via its oxygen atom. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.

[0725] As used herein, "halo", "halide" and "halogen" refer to an atom, radical or substituent selected from fluorine, chlorine, bromine and iodine.

[0726] As used herein, "aryl" and "aromatic" refer to a radical or substituent comprising a mono- or polycyclic carbocyclic ring system having one or more aromatic rings. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from 5 to 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.

[0727] As used herein, "aralkyl" and "arylalkyl" refer to a radical or substituent comprising an alkyl group and an aryl group, wherein the aralkyl or arylalkyl group is attached to a parent molecule via its alkyl moiety. Examples include, but are not limited to, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical or substituent.

[0728] As used herein, "heterocyclyl" refers to a radical or substituent comprising a mono- or polycyclic ring system that includes at least one heteroatom and is unsaturated, partially saturated or fully saturated, thereby including heteroaryl groups. Heterocyclyl is also meant to include fused ring system moieties wherein one or more of the fused rings contain at least one heteroatom and the other rings can contain one or more heteroatoms or optionally contain no heteroatoms. A heterocyclic group typically includes at least one atom selected from sulfur, nitrogen or oxygen. Examples of heterocyclic groups include [1,3]dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as used herein may optionally include further substituent groups.

[0729] As used herein, "heteroaryl" and "heteroaromatic" refer to a radical or substituent comprising a mono- or polycyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatom. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl, and the like. Heteroaryl radicals or substituents can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or a heteroatom. Heteroaryl groups as used herein may optionally include further substituent groups.

[0730] As used herein, "heteroarylalkyl" refers to a radical or substituent comprising a heteroaryl group as previously defined and an alkyl moiety, wherein the heteroarylalkyl group is attached to a parent molecule via its alkyl moiety. Examples include, but are not limited to, pyridinylmethyl, pyrimidinylethyl, napthyridinylpropyl and the like. Heteroarylalkyl groups as used herein may optionally include further substituent groups on one or both of the heteroaryl or alkyl portions.

[0731] As used herein, "mono or polycyclic" refers to any ring systems, such as a single ring or a polycyclic system having rings that are fused or linked, and is meant to be inclusive of single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic and heteroarylalkyl. Such mono and polycyclic structures can contain rings that have a uniform or varying degree of saturation, including fully saturated, partially saturated or fully unsaturated rings. Each ring can comprise ring atoms selected from C, N, O and S to give rise to heterocyclic rings as well as rings comprising only C ring atoms. Heterocyclic and all-carbon rings can be present in a mixed motif, such as for example benzimidazole wherein one ring of the fused ring system has only carbon ring atoms and the other ring has two nitrogen atoms. The mono or polycyclic structures can be further substituted with substituent groups such as for example phthalimide which has two oxo groups (.dbd.O) attached to one of the rings. In another aspect, mono or polycyclic structures can be attached to a parent molecule directly through a ring atom, through a substituent group or a bifunctional linking moiety. As used herein, "acyl" refers to a radical or substituent comprising a carbonyl moiety (C.dbd.O or --C(O)--) and a further substituent X, wherein the acyl group is attached to a parent molecule via its carbonyl moiety. As such, an acyl group is formally obtained by removal of a hydroxyl group from an organic acid and has the general formula --C(O)--X, wherein X is typically aliphatic, alicyclic or aromatic. The term "acyl" is also meant to include heteroacyl radicals or substituents with general formula --Y(O).sub.n--X, wherein X is as defined above and Y(O).sub.n is typically sulfonyl, sulfinyl or phosphate. Examples of acyl groups include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.

[0732] As used herein, "substituent" and "substituent group" include groups that are typically added to other substituents or parent compounds to enhance desired properties or give desired effects. Substituent groups can be protected or unprotected and can be attached to one available site or to many available sites in a parent compound. Substituent groups may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound. Herein, "hydrocarbyl" refers to any group comprising C, O and H. Included are straight, branched and cyclic groups having any degree of saturation.

[0733] Such hydrocarbyl groups can include one or more heteroatoms selected from N, O and S and can be further substituted with one or more substituent groups.

[0734] Unless otherwise indicated, the term substituted or "optionally substituted" refers to the optional presence of any of the following substituents: halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (--C(O)R.sub.aa), carboxyl (--C(O)O--R.sub.aa), aliphatic groups, alicyclic groups, alkoxy, substituted oxo (--O--R.sub.aa), aryl, aralkyl, heterocyclic, heteroaryl, heteroarylalkyl, amino (--NR.sub.bbR.sub.cc), imino (.dbd.NR.sub.bb), amido (--C(O)NR.sub.bbR.sub.cc or --N(R.sub.bb)C(O)R.sub.aa), azido (--N.sub.3), nitro (--NO.sub.2), cyano (--CN), carbamido (--OC(O)NR.sub.bbR.sub.cc or --N(R.sub.bb)C(O)OR.sub.aa), ureido (--N(R.sub.bb)C(O)NR.sub.bbR.sub.cc), thioureido (--N(R.sub.bb)C(S)NR.sub.bbR.sub.cc), guanidinyl (--N(R.sub.bb)C(.dbd.NR.sub.bb)NR.sub.bbR.sub.cc), amidinyl (--C(.dbd.NR.sub.bb)NR.sub.bbR.sub.cc or --N(R.sub.bb)C(NR.sub.bb)R.sub.aa), thiol (--SR.sub.bb), sulfinyl (--S(O)R.sub.bb), sulfonyl (--S(O).sub.2R.sub.bb), sulfonamidyl (--S(O).sub.2NR.sub.bbR.sub.cc or --N(R.sub.bb)S(O).sub.2R.sub.bb) and conjugate groups. Herein, each R.sub.aa, R.sub.bb and R.sub.cc is, independently, H, an optionally linked chemical functional group or a further substituent group, preferably but without limitation chosen from the group consisting of H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.

[0735] In this context, "recursive substituent" means that a substituent may recite another instance of itself. Because of the recursive nature of such substituents, theoretically, a large number may be present in any given claim. One of ordinary skill in the art of medicinal chemistry and organic chemistry understands that the total number of such substituents is reasonably limited by the desired properties of the compound intended. Such properties include, by way of example and not limitation, physical properties such as molecular weight, solubility or log P, application properties such as activity against the intended target and practical properties such as ease of synthesis. Recursive substituents are an intended aspect of the invention. One of ordinary skill in the art of medicinal and organic chemistry understands the versatility of such substituents. To the degree that recursive substituents are present in a claim of the invention, the total number will be determined as set forth above.

[0736] The terms "stable compound" and "stable structure" as used herein are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contemplated herein.

[0737] As used herein, a zero (0) in a range indicating number of a particular unit means that the unit may be absent. For example, an oligomeric compound comprising 0-2 regions of a particular motif means that the oligomeric compound may comprise one or two such regions having the particular motif, or the oligomeric compound may not have any regions having the particular motif. In instances where an internal portion of a molecule is absent, the portions flanking the absent portion are bound directly to one another. Likewise, the term "none" as used herein, indicates that a certain feature is not present.

[0738] As used herein, "analogue" or "derivative" means either a compound or moiety similar in structure but different in respect to elemental composition from the parent compound regardless of how the compound is made. For example, an analogue or derivative compound does not need to be made from the parent compound as a chemical starting material.

[0739] The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

LEGENDS TO THE FIGURES

[0740] FIGS. 1A-1C

[0741] Comparison of AONs with or without cytosine to 5-methylcytosine substitution in differentiated healthy muscle cells in vitro after transfection with (A) PS229L/PS524, SEQ ID NO:52 (corresponding to SEQ ID NO: 91 for the non-modified sequence, corresponding to SEQ ID NO: 92 wherein all cytosines are modified) or (B) PS220/PS339 (SEQ ID NO:21, corresponding to SEQ ID NO:101 for the non-modified sequence, corresponding to SEQ ID NO:200 wherein all cytosines are modified) or (C)PS524/PS1317/PS1318/PS1319, SEQ ID NO:52 (corresponding to SEQ ID NO: 92 (PS524) wherein all 6 cytosines are modified, to SEQ ID NO: 217 (PS1317) wherein 4 of the 6 cytosines are modified, to SEQ ID NO: 218 (PS1318) wherein 2 of the 6 cytosines are modified and to SEQ ID NO:219 (PS1319) wherein 3 of the 6 cytosines are modified SEQ ID NO:217). Average skipping percentages were calculated from triplo (n=3) (A,B) or duplo (n=2) (C) transfections per concentration. Solid lines refer to AONs with 5-methylcytosines, dotted lines to AONs with non-substituted cytosines (A,B).

[0742] FIGS. 2A-2B

[0743] Summary of the pharmacokinetic study in wild type (control) and mdx mice, comparing plasma and muscle tissue profiles of AONs with 5-methylcytosines (PS524, SEQ ID NO:52 (i.e. corresponding to SEQ ID NO: 92 wherein all cytosines are modified) and PS652, SEQ ID NO:57 (i.e. corresponding to SEQ ID NO: 185 wherein all cytosines are modified) and AONs with unmodified (non-methylated) cytosines (PS229L, SEQ ID NO:52 corresponding to SEQ ID NO: 91 for the non-modified sequence, and PS531, SEQ ID NO:57 corresponding to SEQ ID NO: 137 for the non-modified sequence). (A) Pharmacokinetic tissue analysis of: 1) the ratio between the average levels of AON in muscle in mdx mice versus control mice after one single sc injection; 2) the levels of the AONs (.mu.g/g) in several mdx muscles (dia=diaphragm, gastroc=gastrocnemius, quadr=quadriceps, tric=triceps) at 14 days; 3) the relative muscle/kidney and muscle/liver levels at day 14, and 4) the estimated half-life of the different AONs in triceps. B) Pharmacokinetic plasma analysis of 1) Tmax (time at which Cmaxwas reached, only two time points of analysis included (15 or 60 min), 2) Cmax (highest plasma concentration reached), 3) AUC (area under curve; indicative for bioavailability) an 4) Cl (plasma clearance at 24 h.

[0744] FIGS. 3A-3H

[0745] Analysis of cytokine levels in human whole blood upon incubation with 0, 10, 25, or 50 .mu.g/ml of AONs with unmodified cytosines PS232 (SEQ ID NO: 39, corresponding to SEQ ID NO: 119 for the non-modified sequence) and PS534 (SEQ ID NO:59, corresponding to SEQ ID NO: 139 for the non-modified sequence) (black bars) or AONs with 5-methylcytosines PS648 (SEQ ID NO: 39, corresponding to SEQ ID NO: 201 wherein all cytosines are modified) and PS653 (SEQ ID NO:59, to SEQ ID NO: 192 wherein all cytosines are modified) (grey bars). The levels of TNF.alpha. (A, B), MCP-1 (D, E), IP-10 (E, F), and IL6 (G, H) were determined using commercially available ELISA kits. Each experiment was repeated four times (n=4). Data is shown for the most pronounced response of each cytokine.

[0746] FIGS. 4A-4B

[0747] Activity comparisons of AONs with 5-methylcytosines and/or 5-methyluracils with corresponding AONs without these base modifications, (A) Transfection of 200 nM, in duplo, into differentiated healthy muscle cells in vitro. Activity was expressed as average percentage exon 51 (PS43, non-modified sequence represented by SEQ ID NO: 111, PS559 corresponding to SEQ ID NO: 202, wherein all uraciles are modified, PS1106 corresponding to SEQ ID NO:203, wherein all cytosines and all uraciles are modified. All sequences are derived from SEQ ID NO: 31), exon 44 (PS188, non-modified sequence represented by SEQ ID NO: 95, PS785, corresponding to SEQ ID NO: 204, wherein all uraciles are modified, PS1107: corresponding to SEQ ID NO:205, wherein all cytosines and all uraciles are modified. All sequences are derived from SEQ ID NO 15); or exon 52 (PS235, non-modified sequence represented by SEQ ID NO: 120, PS786: corresponding to SEQ ID NO: 172, wherein all uraciles are modified. All sequences are derived from SEQ ID NO 40) skipping (n=2). AON sequences (5' to 3') and base modifications (bold, underlined nucleotides) are shown in the table underneath. (B) Intramuscular injection of 20 .mu.g of PS49 (non-modified sequence, SEQ ID NO: 216) or PS959 (modified sequence wherein all uracils are modified, SEQ ID NO:214) in the gastrocnemius muscles of mdx mice. Activity was expressed as average percentage murine exon 23 skipping (n=4). AON sequences (5' to 3') and base modifications (bold, underlined nucleotides) are shown in the table underneath.

[0748] FIGS. 5A-5C

[0749] Activity comparisons of AONs with 2,6-diaminopurines with corresponding AONs without this base modification. (A), Transfection of 200 nM, in duplo, into differentiated healthy muscle cells in vitro. Activity was expressed as average percentage exon 51 (PS43, non-modified sequence represented by SEQ ID NO: 111, PS403, corresponding to SEQ ID NO: 206, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 31), exon 52 (PS235, non-modified sequence represented by SEQ ID NO: 120, PS897: corresponding to SEQ ID NO: 173, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 40), or exon 44 (PS188, non-modified sequence represented by SEQ ID NO: 95, PS733: corresponding to SEQ ID NO: 207, wherein all adenines have been modified. All sequences are derived from SEQ ID NO: 15) skipping (n=2). AON sequences (5' to 3') and base modifications (bold, underlined nucleotides) are shown in the table underneath. (B) and (C) The effect of substituting all unmodified adenines (PS188; SEQ ID NO: 95) with 2,6-diaminopurines (PS733; SEQ ID NO:207) on in vitro safety. As markers for activation of the alternative complement pathway, split factors C3a (B) and Bb (C) were measured in monkey plasma.

EXAMPLES

TABLE-US-00002 [0750] TABLE 1 General structures of AONs. X = C or m.sup.5C, Y = U or m.sup.5U, Z = A or a.sup.2A; 1 = inosine (hypoxanthine base), X.sub.1 = m.sup.5C, Y.sub.1 = m.sup.5U, Z.sub.1 = a.sup.2A DMD SEQ Exon AON Sequence (5'.fwdarw.3') ID NO 44 GXXZYYYXYXZZXZGZYXY 14 GCCAUUUCUCAACAGAUCU 94 44 YXZGXYYXYGYYZGXXZXYG 15 UCAGCUUCUGUUAGCCACUG 95 Y.sub.1CAGCY.sub.1Y.sub.1CY.sub.1GY.sub.1Y.sub.1AGCCACY.sub.1G 204 UX.sub.1AGX.sub.1UUX.sub.1UGUUAGX.sub.1X.sub.1AX.sub.1UG 208 Y.sub.1X.sub.1AGX.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1GY.sub.1Y.sub.1AGX.sub- .1X.sub.1AX.sub.1Y.sub.1G 205 UCZ.sub.1GCUUCUGUUZ.sub.1GCCZ.sub.1CUG 207 44 YYYGYZYYYZGXZYGYYXXX 16 UUUGUAUUUAGCAUGUUCCC 96 44 ZYYXYXZGGZZYYYGYGYXYYYX 17 AUUCUCAGGAAUUUGUGUCUUUC 97 44 XXZYYYGYZYYYZGXZYGYYXXX 18 CCAUUUGUAUUUAGCAUGUUCCC 98 44 YXYXZGGZZYYYGYGYXYYYX 19 UCUCAGGAAUUUGUGUCUUUC 99 44 GXXZYYYXYXZZXZGZYXYGYXZ 20 GCCAUUUCUCAACAGAUCUGUCA 100 45 YYYGXXGXYGXXXZZYGXXZYXXYG 21 UUUGCCGCUGCCCAAUGCCAUCCUG 101 UUUGX.sub.1X.sub.1GX.sub.1UGX.sub.1X.sub.1X.sub.1AAUGX.sub.1X.sub.1AUX.su- b.1X.sub.1UG 200 Y.sub.1Y.sub.1Y.sub.1GX.sub.1X.sub.1GX.sub.1Y.sub.1GX.sub.1X.sub.1X.sub.1- AAY.sub.1GX.sub.1X.sub.1AY.sub.1X.sub.1X.sub.1Y.sub.1G 209 UUUGCCGCUGCCCZ.sub.1Z.sub.1UGCCZ.sub.1UCCUG 210 45 YYGXXGXYGXXXZZYGXXZYXXYG 22 UUGCCGCUGCCCAAUGCCAUCCUG 102 45 YYGXXGXYGXXXZZYGXXZYXXYGG 23 UUGCCGCUGCCCAAUGCCAUCCUGG 103 45 YGXXGXYGXXXZZYGXXZYXXYG 24 UGCCGCUGCCCAAUGCCAUCCUG 104 45 YGXXGXYGXXXZZYGXXZYXXYGG 25 UGCCGCUGCCCAAUGCCAUCCUGG 105 45 GXXGXYGXXXZZYGXXZYXXYG 26 GCCGCUGCCCAAUGCCAUCCUG 106 45 XXGXYGXXXZZYGXXZYXXYGG 27 CCGCUGCCCAAUGCCAUCCUGG 107 45 YYYGXXIXYGXXXZZYGXXZYXXYG 28 UUUGCCICUGCCCAAUGCCAUCCUG 108 45 XZGYYYGXXGXYGXXXZZYGXXZYX 29 CAGUUUGCCGCUGCCCAAUGCCAUC 109 45 XZGYYYGXXGXYGXXXZZYGXXZYXXYGGZ 30 CAGUUUGCCGCUGCCCAAUGCCAUCCUGGA 110 51 YXZZGGZZGZYGGXZYYYXY 31 UCAAGGAAGAUGGCAUUUCU 111 Y.sub.1CAAGGAAGAY.sub.1GGCAY.sub.1Y.sub.1Y.sub.1CY.sub.1 202 Y.sub.1X.sub.1AAGGAAGAY.sub.1GGX.sub.1AY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.- 1 203 UCZ.sub.1Z.sub.1GGZ.sub.1Z.sub.1GZ.sub.1UGGCZ.sub.1UUUCU 206 UX.sub.1AAGGAAGAUGGX.sub.1AUUUX.sub.1U 215 51 YGGXZYYYXYZGYYYGG 32 UGGCAUUUCUAGUUUGG 112 51 XZYXZZGGZZGZYGGXZYYYXY 33 CAUCAAGGAAGAUGGCAUUUCU 113 51 XZZXZYXZZGGZZGZYGGXZYYYXY 34 CAACAUCAAGGAAGAUGGCAUUUCU 114 51 XXYXYGYGZYYYYZYZZXYYGZY 35 CCUCUGUGAUUUUAUAACUUGAU 115 51 XXZGZGXZGGYZXXYXXZZXZYX 36 CCAGAGCAGGUACCUCCAACAUC 116 51 ZXZYXZZGGZZGZYGGXZYYYXYZGYYYGG 37 ACAUCAAGGAAGAUGGCAUUUCUAGUUUGG 117 51 ZXZYXZZGGZZGZYGGXZYYYXYZG 38 ACAUCAAGGAAGAUGGCAUUUCUAG 118 52 XYXYYGZYYGXYGGYXYYGYYYYYX 39 CUCUUGAUUGCUGGUCUUGUUUUUC 119 X.sub.1UX.sub.1UUGAUUGX.sub.1UGGUX.sub.1UUGUUUUUX.sub.1 201 52 GGYZZYGZGYYXYYXXZZXYGG 40 GGUAAUGAGUUCUUCCAACUGG 120 GGUAAUGAGUUX.sub.1UUX.sub.1X.sub.1AAX.sub.1UGG 171 GGY.sub.1AAY.sub.1GAGY.sub.1Y.sub.1CY.sub.1Y.sub.1CCAACY.sub.1GG 172 GGUZ.sub.1Z.sub.1UGZ.sub.1GUUCUUCCZ.sub.1Z.sub.1CUGG 173 GGY.sub.1AAY.sub.1GAGY.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1AAX- .sub.1Y.sub.1GG 174 GGUZ.sub.1Z.sub.1UGZ.sub.1GUUX.sub.1UUX.sub.1X.sub.1Z.sub.1Z.sub.1X.sub.1- UGG 175 GGY.sub.1Z.sub.1Z.sub.1Y.sub.1GZ.sub.1GY.sub.1Y.sub.1CY.sub.1Y.sub.1CCZ.s- ub.1Z.sub.1CY.sub.1GG 176 GGY.sub.1Z.sub.1Z.sub.1Y.sub.1GZ.sub.1GY.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.- 1X.sub.1X.sub.1Z.sub.1Z.sub.1X.sub.1Y.sub.1GG 177 52 YXYYGZYYGXYGGYXYYGYYYYYXZ 41 UCUUGAUUGCUGGUCUUGUUUUUCA 121 52 YYXXZZXYGGGGZXGXXYXYGYYXX 42 UUCCAACUGGGGACGCCUCUGUUCC 122 52 YGYYXYZGXXYXYYGZYYGXYGGYX 43 UGUUCUAGCCUCUUGAUUGCUGGUC 123 UGUUX.sub.1UAGX.sub.1UX.sub.1UUGAUUGX.sub.1UGGUX.sub.1 178 Y.sub.1GY.sub.1Y.sub.1CY.sub.1AGCCY.sub.1CY.sub.1Y.sub.1GAY.sub.1Y.sub.1G- CY.sub.1GGY.sub.1C 179 UGUUCUZ.sub.1GCCUCUUGZ.sub.1UUGCUGGUC 180 Y.sub.1GY.sub.1Y.sub.1X.sub.1Y.sub.1AGX.sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1- Y.sub.1GAY.sub.1Y.sub.1GX.sub.1Y.sub.1GGY.sub.1X.sub.1 181 UGUUX.sub.1UZ.sub.1GX.sub.1X.sub.1UX.sub.1UUGZ.sub.1UUGX.sub.1UGGUX.sub.1 182 Y.sub.1GY.sub.1Y.sub.1CY.sub.1Z.sub.1GCCY.sub.1CY.sub.1Y.sub.1GZ.sub.1Y.s- ub.1Y.sub.1GCY.sub.1GGY.sub.1C 183 Y.sub.1GY.sub.1Y.sub.1X.sub.1Y.sub.1Z.sub.1GX.sub.1X.sub.1Y.sub.1X.sub.1Y- .sub.1Y.sub.1GZ.sub.1Y.sub.1Y.sub.1GX.sub.1Y.sub.1GGY.sub.1X.sub.1 184 53 XYGYYGXXYXXGGYYXYG 44 CUGUUGCCUCCGGUUCUG 124 53 XZZXYGYYGXXYXXGGYYXYGZ 45 CAACUGUUGCCUCCGGUUCUGA 125 53 XZZXYGYYGXXYXXGGYYXYGZZ 46 CAACUGUUGCCUCCGGUUCUGAA 126 53 XZZXYGYYGXXYXXGGYYXYGZZG 47 CAACUGUUGCCUCCGGUUCUGAAG 127 53 XYGYYGXXYXXGGYYXYGZZGG 48 CUGUUGCCUCCGGUUCUGAAGG 128 53 XYGYYGXXYXXGGYYXYGZZGGY 49 CUGUUGCCUCCGGUUCUGAAGGU 129 53 XYGYYGXXYXXGGYYXYGZZGGYG 50 CUGUUGCCUCCGGUUCUGAAGGUG 130 53 XYGYYGXXYXXGGYYXYGZZGGYGY 51 CUGUUGCCUCCGGUUCUGAAGGUGU 131 53 GYYGXXYXXGGYYXYGZZGGYGYYX 52 GUUGCCUCCGGUUCUGAAGGUGUUC 91 GUUGX.sub.1X.sub.1UX.sub.1X.sub.1GGUUX.sub.1UGAAGGUGUUX.sub.1 92 GUUGX.sub.1X.sub.1UCCGGUUX.sub.1UGAAGGUGUUX.sub.1 217 GUUGX.sub.1X.sub.1UCCGGUUCUGAAGGUGUUC 218 GUUGCX.sub.1UCCGGUUX.sub.1UGAAGGUGUUX.sub.1 219 G Y.sub.1 Y.sub.1GCC Y.sub.1CCGG Y.sub.1 Y.sub.1C Y.sub.1GAAGG Y.sub.1GY.sub.1 Y.sub.1C 211 G Y.sub.1 Y.sub.1GX.sub.1X.sub.1 Y.sub.1X.sub.1X.sub.1GG Y.sub.1 Y.sub.1X.sub.1 Y.sub.1GAAGG Y.sub.1GY.sub.1 Y.sub.1X.sub.1 212 GUUGCCUCCGGUUCUGZ.sub.1Z.sub.1GGUGUUC 213 53 GXXYXXGGYYXYGZZGGYGYYXYYG 53 GCCUCCGGUUCUGAAGGUGUUCUUG 133 53 YYGXXYXXGGYYXYGZZGGYGYYXYYGYZX 54 UUGCCUCCGGUUCUGAAGGUGUUCUUGUAC 134 53 XYGYYGXXYXXGGYYXYGZZGGYGYYXYYG 55 CUGUUGCCUCCGGUUCUGAAGGUGUUCUUG 135 53 XZZXYGYYGXXYXXGGYYXYGZZGGYGYYXYYG 56 CAACUGUUGCCUCCGGUUCUGAAGGUGUUCUUG 136 55 GZGYYYXYYXXZZZGXZGXXYXYX 57 GAGUUUCUUCCAAAGCAGCCUCUC 137 GAGUUUX.sub.1UUX.sub.1X.sub.1AAAGX.sub.1AGX.sub.1X.sub.1UX.sub.1UX.sub.1 185 GAGY.sub.1Y.sub.1Y.sub.1CY.sub.1Y.sub.1CCAAAGCAGCCY.sub.1CY.sub.1C 186 GZ.sub.1GUUUCUUCCZ.sub.1Z.sub.1Z.sub.1GCZ.sub.1GCCUCUC 187 GAGY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1AAAGX.sub.1AGX- .sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1X.sub.1 188 GZ.sub.1GUUUX.sub.1UUX.sub.1X.sub.1Z.sub.1Z.sub.1Z.sub.1GX.sub.1Z.sub.1GX- .sub.1X.sub.1UX.sub.1UX.sub.1 189 GZ.sub.1GY.sub.1Y.sub.1Y.sub.1CY.sub.1Y.sub.1CCZ.sub.1Z.sub.1Z.sub.1GCZ.s- ub.1GCCY.sub.1CY.sub.1C 190 GZ.sub.1GY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1Z.sub.1Z- .sub.1Z.sub.1GX.sub.1Z.sub.1GX.sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1X.sub.1 191 55 YZYGZGYYYXYYXXZZZGXZGXXYX 58 UAUGAGUUUCUUCCAAAGCAGCCUC 138 55 ZGXZYXXYGYZGGZXZYYGGXZGY 59 AGCAUCCUGUAGGACAUUGGCAGU 139 AGX.sub.1AUX.sub.1X.sub.1UGUAGGAX.sub.1AUUGGX.sub.1AGU 192 AGCAY.sub.1CCY.sub.1GY.sub.1AGGACAY.sub.1Y.sub.1GGCAGY.sub.1 193 Z.sub.1GCZ.sub.1UCCUGUZ.sub.1GGZ.sub.1CZ.sub.1UUGGCZ.sub.1GU 194 AGX.sub.1AY.sub.1X.sub.1X.sub.1Y.sub.1GY.sub.1AGGAX.sub.1AY.sub.1Y.sub.1G- GX.sub.1AGY.sub.1 195 Z.sub.1GX.sub.1Z.sub.1UX.sub.1X.sub.1UGUZ.sub.1GGZ.sub.1X.sub.1Z.sub.1UUG- GX.sub.1Z.sub.1GU 196 Z.sub.1GCZ.sub.1Y.sub.1CCY.sub.1GY.sub.1Z.sub.1GGZ.sub.1CZ.sub.1Y.sub.1Y.- sub.1GGCZ.sub.1GY.sub.1 197 Z.sub.1GX.sub.1Z.sub.1Y.sub.1X.sub.1X.sub.1Y.sub.1GY.sub.1Z.sub.1GGZ.sub.- 1X.sub.1Z.sub.1Y.sub.1Y.sub.1GGX.sub.1Z.sub.1GY.sub.1 198 55 XZYXXYGYZGGZXZYYGGXZGYYG 60 CAUCCUGUAGGACAUUGGCAGUUG 140 55 YXXYGYZGGZXZYYGGXZGYYGYY 61 UCCUGUAGGACAUUGGCAGUUGUU 141 55 XYGYZGGZXZYYGGXZGYYGYYYX 62 CUGUAGGACAUUGGCAGUUGUUUC 142

TABLE-US-00003 TABLE 2 General structures of AONs. X = C or m.sup.5C, Y = U or m.sup.5U, Z = A or a.sup.2A; I = inosine (hypoxanthine base), X.sub.1 = m.sup.5C, Y.sub.1 = m.sup.5U, Z.sub.1 = a.sup.2A DMD Exon AON Sequence (5'.fwdarw.3') SEQ ID NO 44 ZYYYXYXZZXZGZ 63 AUUUCUCAACAGA 143 44 ZGXYYXYGYYZGXXZ 64 AGCUUCUGUUAGCCA 144 44 ZYYXYXZGGZZ 65 AUUCUCAGGAA 145 44 ZYYYGYZYYYZGXZ 66 AUUUGUAUUUAGCA 146 44 ZYYYXYXZZXZGZYXYGYXZ 67 AUUUCUCAACAGAUCUGUCA 147 44 ZYYYXYXZZXZGZ 68 AUUUCUCAACAGA 148 44 ZXZGZYXYGYXZ 69 ACAGAUCUGUCA 149 45 YYYGXXGXYGXXXZZYGXXZ 70 UUUGCCGCUGCCCAAUGCCA 150 45 XGXYGXXXZZYGXXZYXXYG 71 CGCUGCCCAAUGCCAUCCUG 151 45 GXXGXYGXXXZZYGXXZYXX 72 GCCGCUGCCCAAUGCCAUCC 152 51 ZZGGZZGZYGGXZ 73 AAGGAAGAUGGCA 153 51 ZGGZZGZYGGXZ 74 AGGAAGAUGGCA 154 51 ZGZGXZGGYZ 75 AGAGCAGGUA 155 51 ZGXZGGYZXXYXXZ 76 AGCAGGUACCUCCA 156 51 ZXXYXXZZXZ 77 ACCUCCAACA 157 52 ZZYGZGYYXYYXXZZ 78 AAUGAGUUCUUCCAA 158 52 ZYGZGYYXYYXXZ 79 AUGAGUUCUUCCA 159 52 ZGYYXYYXXZ 80 AGUUCUUCCA 160 52 ZGXXYXYYGZ 81 AGCCUCUUGA 161 53 GYYGXXYXXGGYYXYGZZGG 82 GUUGCCUCCGGUUCUGAAGG 162 53 XYXXGGYYXYGZZGGYGYYX 83 CUCCGGUUCUGAAGGUGUUC 163 53 XXYXXGGYYXYGZZGGY 84 CCUCCGGUUCUGAAGGU 164 55 ZGYYYXYYXXZZZGXZ 85 AGUUUCUUCCAAAGCA 165 55 ZGYYYXYYXXZ 86 AGUUUCUUCCA 166 55 ZGXZYXXYGYZGGZXZYYGGXZ 87 AGCAUCCUGUAGGACAUUGGCA 167 55 ZGXZYXXYGYZ 88 AGCAUCCUGUA 168 55 ZYXXYGYZGGZ 89 AUCCUGUAGGA 169 55 ZGGZXZYYGGXZ 90 AGGACAUUGGCA 170

TABLE-US-00004 TABLE 3 Most preferred AONs General structures of AONs. X = C or m.sup.5C, Y = U or m.sup.5U, Z = A or a.sup.2A; I = inosine (hypoxanthine base), X.sub.1 = m.sup.5C, Y.sub.1 = m.sup.5U, Z.sub.1 = a.sup.2A DMD SEQ Exon AON Sequence (5'.fwdarw.3') ID NO 44 YXZGXYYXYGYYZGXXZXYG 15 UCAGCUUCUGUUAGCCACUG 95 PS188 FIG. 4, 5 Y.sub.1CAGCY.sub.1Y.sub.1CY.sub.1GY.sub.1Y.sub.1AGCCACY.sub.1G 204 PS785 FIG. 4 UX.sub.1AGX.sub.1UUX.sub.1UGUUAGX.sub.1X.sub.1AX.sub.1UG 208 PS658 Y.sub.1X.sub.1AGX.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1GY.sub.1Y.sub.1AGX.sub- .1X.sub.1AX.sub.1Y.sub.1G 205 PS1107 FIG. 4 UCZ.sub.1GCUUCUGUUZ.sub.1GCCZ.sub.1CUG 207 PS733 FIG. 5 45 YYYGXXGXYGXXXZZYGXXZYXXYG 21 UUUGCCGCUGCCCAAUGCCAUCCUG 101 PS220 FIG. 1b UUUGX.sub.1X.sub.1GX.sub.1UGX.sub.1X.sub.1X.sub.1AAUGX.sub.1X.sub.1AUX.su- b.1X.sub.1UG 200 PS399 FIG. 1b Y.sub.1Y.sub.1Y.sub.1GX.sub.1X.sub.1GX.sub.1Y.sub.1GX.sub.1X.sub.1X.sub.1- AAY.sub.1GX.sub.1X.sub.1AY.sub.1X.sub.1X.sub.1Y.sub.1G 209 PS1108 UUUGCCGCUGCCCZ.sub.1Z.sub.1UGCCZ.sub.1UCCUG 210 PS1229 YYYGXXIXYGXXXZZYGXXZYXXYG 28 UUUGCCICUGCCCAAUGCCAUCCUG 108 PS305 51 YXZZGGZZGZYGGXZYYYXY 31 UCAAGGAAGAUGGCAUUUCU 111 PS43 FIG. 4, 5 Y.sub.1CAAGGAAGAY.sub.1GGCAY.sub.1Y.sub.1Y.sub.1CY.sub.1 202 PS559 FIG. 4 Y.sub.1X.sub.1AAGGAAGAY.sub.1GGX.sub.1AY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.- 1 203 PS1106 FIG. 4 UCZ.sub.1Z.sub.1GGZ.sub.1Z.sub.1GZ.sub.1UGGCZ.sub.1UUUCU 206 PS403 FIG. 5 UX.sub.1AAGGAAGAUGGX.sub.1AUUUX.sub.1U 215 PS401 52 GGYZZYGZGYYXYYXXZZXYGG 40 GGUAAUGAGUUCUUCCAACUGG 120 PS235 FIG. 4, 5 GGUAAUGAGUUX.sub.1UUX.sub.1X.sub.1AAX.sub.1UGG 171 PS650 GGY.sub.1AAY.sub.1GAGY.sub.1Y.sub.1CY.sub.1Y.sub.1CCAACY.sub.1GG 172 PS786 FIG. 4 GGUZ.sub.1Z.sub.1UGZ.sub.1GUUCUUCCZ.sub.1Z.sub.1CUGG 173 PS897 FIG. 5 GGY.sub.1AAY.sub.1GAGY.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1AAX- .sub.1Y.sub.1GG 174 PS1110 53 GYYGXXYXXGGYYXYGZZGGYGYYX 52 GUUGCCUCCGGUUCUGAAGGUGUUC 91 PS229L FIG. 1a, 2 GUUGX.sub.1X.sub.1UX.sub.1X.sub.1GGUUX.sub.1UGAAGGUGUUX.sub.1 92 PS524 FIG. 1a, c, 2 GUUGX.sub.1X.sub.1UCCGGUUX.sub.1UGAAGGUGUUX.sub.1 217 PS1317 FIG. 1c GUUGX.sub.1X.sub.1UCCGGUUCUGAAGGUGUUC 218 PS1318 FIG. 1c GUUGCX.sub.1UCCGGUUX.sub.1UGAAGGUGUUX.sub.1 219 PS1319 FIG. 1c G Y.sub.1 Y.sub.1GCC Y.sub.1CCGG Y.sub.1 Y.sub.1C Y.sub.1GAAGG Y.sub.1G Y.sub.1 Y.sub.1C 211 G Y.sub.1 Y.sub.1GX.sub.1X.sub.1 Y.sub.1X.sub.1X.sub.1GG Y.sub.1 Y.sub.1X.sub.1 Y.sub.1GAAGG Y.sub.1G Y.sub.1 Y.sub.1X.sub.1 212 PS1109 GUUGCCUCCGGUUCUG Z.sub.1 Z.sub.1GGUGUUC 213 55 GZGYYYXYYXXZZZGXZGXXYXYX 57 GAGUUUCUUCCAAAGCAGCCUCUC 137 PS531 FIG. 2 GAGUUUX.sub.1UUX.sub.1X.sub.1AAAGX.sub.1AGX.sub.1X.sub.1UX.sub.1UX.sub.1 185 PS652 FIG. 2 GAGY.sub.1Y.sub.1Y.sub.1CY.sub.1Y.sub.1CCAAAGCAGCCY.sub.1CY.sub.1C 186 GZ.sub.1GUUUCUUCCZ.sub.1Z.sub.1Z.sub.1GCZ.sub.1GCCUCUC 187 GAGY.sub.1Y.sub.1Y.sub.1X.sub.1Y.sub.1Y.sub.1X.sub.1X.sub.1AAAGX.sub.1AGX- .sub.1X.sub.1Y.sub.1X.sub.1Y.sub.1X.sub.1 188 PS1112

[0751] Preferred non modified oligonucleotides (X.dbd.C, Y.dbd.U, Z=A) are more preferably derived from each of the oligonucleotide basis sequence (SEQ ID NO:14-90) and are represented by a nucleotide or base sequence SEQ ID NO:91, 93-170

[0752] Preferred modified oligonucleotides derived from one of the nucleotide or base sequences SEQ ID NO:14-90 and comprising at least one X is m.sup.5C and/or at least one Y is m.sup.5U and/or at least one Z is a.sup.2A are represented by a nucleotide or a base sequence comprising or consisting of SEQ ID NO: 92, 171-213, 215, 217, 218, 219. Even more preferred modified oligonucleotides (all X=m.sup.5C.dbd.X.sub.1 and/or all Y=m.sup.5U Y.sub.1 and/or all Z=a.sup.2A=Z.sub.1) are derived from the most preferred nucleotide or base sequences (SEQ ID NO:15, 21, 31, 40, 52, and 57) and are represented by SEQ ID NO: 92, 171-174, 185-188, 199, 200, 202-213, 215, 217, 218, 219. The most preferred modified oligonucleotides are disclosed in Table 3.

Example 1

Material and Methods

AONs

[0753] All oligonucleotides (PS220/PS399, based on SEQ ID NO:21 corresponding to SEQ ID NO:101 for the non-modified sequence (PS220) and to SEQ ID NO:200 wherein all cytosines are modified (PS399); PS229L/PS524/PS1317/PS1318/PS1319, based on SEQ ID NO:52 corresponding to SEQ ID NO:91 for the non-modified sequence (PS229L), to SEQ ID NO:92 (PS524) wherein all 6 cytosines are modified, to SEQ ID NO: 217 (PS1317) wherein 4 of the 6 cytosines are modified, to SEQ ID NO: 218 (PS1318) wherein 2 of the 6 cytosines are modified and to SEQ ID NO:219 (PS1319) wherein 3 of the 6 cytosines are modified; PS232/PS648, based on SEQ ID NO: 39 corresponding to SEQ ID NO:119 for the non-modified sequence (PS232) and to SEQ ID NO:201 wherein all cytosines are modified (PS648); PS531/PS652, based on SEQ ID NO:57 corresponding to SEQ ID NO:137 for the non-modified sequence (PS531) and to SEQ ID NO:185 wherein all cytosines are modified (PS652); PS534/PS653, based on SEQ ID NO:59 corresponding to SEQ ID NO:139 for the non-modified sequence (PS534) and to SEQ ID NO:192 wherein all cytosines are modified (PS653)) were 2'-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/AKTA Oligopilot), through standard phosphoramidite protocols, or obtained from commercial suppliers, in 40 nmol-4.5 mmol synthesis scale. Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH.sub.4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS399 (ChemGenes, 1 .mu.mol synthesis scale, used as received), PS1317, PS1318, and PS1319 (ChemGenes, 200 nmol synthesis scale, used as received), PS229L, PS232, PS524, and PS648 (EuroGentec, 40=01 synthesis scale, used as received), PS229L (Prosensa, 5.9 g obtained material, purity 81%), PS524 (Avecia, 4.5 mmol synthesis scale, purity 93%), PS534 (Prosensa, 2 .mu.mol synthesis scale, purity 86%), PS653 (Prosensa, 40 nmol synthesis scale, purity 77%), PS531 (Avecia, 4.6 g obtained material, purity 85%), PS652 (Avecia, 2.4 g obtained material, purity 84% and 3.8 g obtained material, purity 82%). For the in vitro transfection experiments described herein, 50 .mu.M working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0). For the whole blood cytokine release assays in this example, the concentrations of the stock solutions (prepared in DNase/RNase-free distilled water (Invitrogen)) varied: PS232 (8.75 mg/mL), PS534 (7.02 mg/mL), PS648 (8.55 mg/mL), PS653 (8.12 mg/mL).

Transfection and RT-PCR Analysis

[0754] Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a triplo AON concentration series of 0-100-200-400 nM (FIG. 1a, PS229L/PS524, SEQ ID NO:91/92) or 0-50-100-200-400-800 nM (FIG. 1b, PS220/PS399, SEQ ID NO: 101/200) or with an in duplo concentration of 400 nM (FIG. 1c, PS524/PS1317/PS1318/PS1319, SEQ ID NO:92/217/218/219), according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 .mu.l per .mu.g AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transfection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 47 (PS220/PS399) or exon 55 (PS229L/PS524/PS1317/PS1318/PS1319) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 .mu.l of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 45 (PS220/PS399) or 53 (PS229L/PS524/PS1317/PS1318/PS1319). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described (Aartsma-Rus et al., 2003). RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed by "Agilent 2100 Bioanalyzer" software and Excel 2007. The ratio of the smaller transcript product (containing the exon 45(PS220/PS399) or 53 skip (PS229L/PS524/PS1317/PS1318/PS1319)) to the total amount of transcript products was assessed (representing the exon 45 or 53 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.

Pharmacokinetic Study in Wild Type and Mdx Mice

[0755] Mdx (C57Bl/10ScSn-Dmd.sub.mdx/J) and wild-type (C57Bl/10ScSnJ) mice at 5 weeks of age were obtained from Jackson Laboratory (Maine USA). The AONs (PS229L/PS524 corresponding to SEQ ID NO: 91/92, PS531/PS652 corresponding to SEQ ID NO: 137/185) were administered in physiological saline at a dose of 100 mg/kg by subcutaneous injections three times per week for two weeks. To determine the plasma profile of the AONs, plasma samples were taken from 2 animals per time-point (per AON group) at the following times for the animals: 15 min, 1 h, 2 h, 6 h and 24 hours after dosing. To obtain plasma, venous whole blood was collected into Li-Heparin tubes, centrifuged and kept at -80.degree. C. until analysis. For distribution analysis 7 organs (heart, kidney cortex, liver, diaphragm, gastrocnemius, quadriceps & triceps) were harvested upon sacrifice of the animals. The tissues were snap frozen and stored at -80.degree. C. until analysis.

AON Hybridisation Assay

[0756] To determine the concentration of the AONs (PS229L/PS524 corresponding to SEQ ID NO: 91/92, PS531/PS652 corresponding to SEQ ID NO: 137/185) in plasma and tissue an AON hybridization assay was used, which is based on the assay described by Yu et al., 2002. For the tissue distribution analysis, tissues were homogenized, using a MagNaLyzer (Roche) to a concentration of 60 mg/ml in protK buffer (100 mmol/l Tris-HCl pH8.5, 200 mmol/l NaCl, 5 mmol/l EDTA, 0.2% SDS) containing 2 mg/ml proteinase K, followed by a 2 hours incubation (liver) or 4 hours incubation (all other organs) in a rotating hybridization oven at 55.degree. C. and then stored -20.degree. C. until use. All tissue homogenates and calibration curves were diluted (fit to criteria of the assay) in 60 times diluted pooled mdx control tissue homogenate (kidney, liver, several muscle groups). A template probe specific for each AON (5' gaatagacg-anti-AON-biotin 3', DNA phosphate oligonucleotide) and a ligation probe (p-cgtctattc-DIG DNA phosphate oligonucleotide) were used in the hybridization assay. The homogenates were incubated for 1 h at 37.degree. C. with template probe (50 nmol/l) and the hybridized samples were transferred to streptavidin coated 96-well plates and incubated for 30 min at 37.degree. C. Subsequently, the plate was washed 4 times and the digoxigenin-labeled ligation (2 nmol/l) was added and incubated for 30 min at ambient temperature. The DIG-label was detected using an anti-DIG-POD (1:7,500-1:30,000; Roche Diagnostics), which was visualized with a 3,3',5,5'-tetramethylbenzidine substrate (Sigma Aldrich, the Netherlands), and the reaction was stopped using an acidic solution (Sigma Aldrich). The absorption was measured at 450 nm using a BioTek Synergy HT plate reader (Beun de Ronde, Abcoude, The Netherlands). Plasma samples were analyzed according to the same protocol, using 100 times diluted pooled mdx plasma.

Whole Blood Cytokine Release Assay

[0757] For the detection of possible cytokine stimulation induced by selected AONs (PS232/PS648 corresponding to SEQ ID NO: 119/201 and PS534/PS653 corresponding to SEQ ID NO: 139/192) whole blood (anticoagulant CPD) from healthy human volunteers was used. Varying AON concentrations (ranging from 0 to 50 .mu.g/ml, in a dilution of approximately 1:0.01 (v/v)) were added to the blood and the samples were incubated for 4 hours at 37.degree. C. under 5% CO.sub.2 atmosphere. After incubation, the samples were centrifuged at 3200.times.g for 15 minutes at 4.degree. C. and plasma supernatants were collected and stored at -20.degree. C. until cytokine quantification. MCP-1, IL-6, TNF-.alpha., and IP-10 concentrations were determined by sandwich ELISA (human MCP-1, IL-6, TNF-.alpha., IP-10 ELISA kits (R&D Systems). The experiments with human whole blood were repeated three to four times. FIG. 3 is based on one experiment only, but considered representative.

Results

[0758] The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all cytosines with 5-methylcytosines (m5C) was tested in cultured, differentiated, healthy muscle cells in vitro. In FIGS. 1a and 1b two examples are shown. When comparing PS229L and PS524 (=PS229L-m5C) (i.e. non-modified sequence SEQ ID NO: 91 compared with the modified sequence SEQ ID NO: 92 wherein all cytosines have been modified) in a dose-response transfection experiment using 0-100-200-400 nM, PS524 was clearly more efficient than PS229L at 200 and 400 nM (1.9-fold higher exon 53 skipping levels) (FIG. 1a). Similarly, when comparing PS220 and PS399 (=PS220-m5C) (i.e. non-modified sequence SEQ ID NO: 101 compared with the modified sequence SEQ ID NO: 200 wherein all cytosines have been modified) in a dose-response transfection experiment using 0-50-100-200-400-800 nM, PS399 was clearly more efficient than PS220, especially at lower concentrations (up to 10-fold higher exon 45 skipping levels at 50 nM) (FIG. 1b). These results demonstrate that the presence of 5-methylcytosines has a positive effect on the activity of the AONs. In PS524 (SEQ ID NO:92) all 6 cytosines are substituted with 5-methylcytosines (m5C) which had a positive effect on the exon skipping activity when compared to the non-modified counterpart oligonucleotide PS229L (SEQ ID NO:91) (FIG. 1a). To test whether such positive effect may be correlated with the number or percentage of base modifications incorporated, PS1317, PS1318, and PS1319, with respectively 4, 2, and 3 of the 6 cytosines substituted with 5-methylcytosines (m5C), were tested and directly compared to PS524 in cultured, differentiated, healthy muscle cells in vitro. PS1317, PS1318, and PS1319 were all effective in inducing exon 53 skipping (47%, 37%, and 45% respectively) (FIG. 1c). When compared to the levels obtained with PS524 however (64%), these results indeed suggest that reducing the number of 5-methylcytosines (m5C), from 6 to 4, 3, or 2 5-methylcytosines, leads to a reduced positive effect on exon skipping activity of the AON.

[0759] To investigate whether 5-methylcytosines affect bio-stability, -distribution, and/or -availability, a pharamacokinetic study was performed both in wild type (control) and mdx mice. The mdx mouse model for DMD has a natural nonsense mutation in exon 23 and is therefore dystrophin-deficient. The lack of dystrophin at the membranes increases the permeability of the muscle fibers for relatively small molecules as AONs, and has indeed been demonstrated to enhance 2'-O-methyl phosphorothioate RNA AON uptake by muscle up to 10-fold (Heemskerk et al., 2010). The mice were injected subcutaneously with 100 mg/kg of either 5-methylcytosine-containing AONs (PS524, PS652 corresponding to SEQ ID NO: 92, 185) or their counterparts with unmodified cytosines (PS229L, PS531 corresponding to SEQ ID NO: 91, 137), three times per week for two weeks. At different time-points (day 1, 7, 14) after the last injection, the mice were sacrificed and different muscle groups (heart, diaphragm, gastrocnemius, quadriceps, and triceps) and liver and kidney were isolated to determine AON concentrations therein (FIG. 2A). As anticipated, for all compounds the concentrations in mdx muscles (average of all samples) was higher than those in control mice. The ratio mdx to control AON levels appeared relatively higher for the AONs with 5-methylcytosines. More specifically, in the mdx mice, the levels of PS524 and PS652 were 2- to 3-fold higher than that of PS229L and PS531. (FIG. 2A). When monitoring the levels of AON in kidney and liver (known toxicity organs), the ratios between muscle tissue and toxicity tissues remained similar, or were even favorable for PS524. These results suggest that AONs with 5-methylcytosine are taken up better by or more stable in muscle than AONs with unmodified cytosines. Indeed the half life in muscle was longer for PS524 (>20 days) and PS652 (25 days) when compared to PS229L (7 days) and PS531 (10 days). In plasma, the Cmaxvalues of the AONs injected were similar, which confirms that the mice received equal doses (FIG. 2B). Remarkably, the AUC values (as indicator for bioavailability) were 1.5 to 2.3-fold higher for the 5-methylcytosine containing AONs. This was associated with a lower clearance which supports their higher muscle tissue levels. The results from this pharmacokinetic study thus demonstrate that the presence of 5-methylcytosines has a positive effect on the bio-stability, -distribution, and/or -availability of the AONs, while the muscle/toxicity organ ratios were similar to those with the AONs with unmodified cytosines.

[0760] The in vitro safety profile of AONs with 5-methylcytosines (PS648, PS653 corresponding to SEQ ID NO: 201, 192) was compared to that of AONs with unmodified cytosines (PS232, PS534, corresponding to SEQ ID NO: 119, 139). AONs may stimulate an innate immune response by activating the Toll-like receptors (including TLR7, TLR8, TLR9), which results in set of coordinated immune responses that include innate immunity. Several chemo- and cytokines, such as IP-10, TNF.alpha., TL-6 and MCP-1 play a role in this process, and were therefore monitored in human whole blood incubated with 0 to 50 .mu.g/ml of each AON (using commercially available ELISA kits). PS232 and PS534 both have unmodified cytosines and induced the release of TNF-.alpha. (FIG. 3A, B), MCP-1 (FIG. 3C, D), IP-10 (FIG. 3E, F), and IL-6 (FIG. 3G, H) at increasing doses. In contrast, both PS648 and PS653 (with 5-methylcytosines) did not have any effect on TNF-.alpha., IP-10 and IL-6. PS653, not PS648, seemed to induce a minor release of MCP-1 only. In conclusion, the presence of 5-methylcytosines improved the safety profile of these AONs in vitro.

Example 2

Material and Methods

AONs

[0761] All oligonucleotides (PS43/PS559/PS1106, all based on SEQ ID NO:31, and corresponding to SEQ ID NO: 111 (PS43) non modified sequence, SEQ ID NO: 202 (PS559) wherein all uraciles have been modified, and SEQ ID NO: 203 (PS1106) wherein all uraciles and all cytosines have been modified; PS188/PS785/PS1107, all based on SEQ ID NO:15, and corresponding to SEQ ID NO: 95 (PS188) non-modified sequence, SEQ ID NO: 204 (PS785) wherein all uraciles have been modified, and SEQ ID NO: 205 (PS1107) wherein all uraciles and all cytosines have been modified; PS235/PS786, both based on SEQ ID NO:40, and corresponding to SEQ ID NO: 120 (PS235) non-modified sequence and SEQ ID NO: 172 (PS786) wherein all uraciles have been modified), and PS49 (SEQ ID NO:216) non-modified sequence and PS959 (SEQ ID NO:214) wherein all cytosines have been modified, were 2'-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/AKTA Oligopilot) through standard phosphoramidite protocols, or obtained from commercial suppliers, in 200 nmol-286.1 g scale. Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by conc. NH.sub.4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS188 (Girindus, 286.1 g obtained product, purity 93%), PS785, PS786, PS1106, and PS1107 (ChemGenes, 200 nmol synthesis scale, used as received), PS43 (Prosensa, 1 .mu.mol synthesis scale, purity 90%), PS559 (ChemGenes, 1 .mu.mol synthesis scale, used as received), PS235 (Prosensa, 1.92 mmol synthesis scale, purity 91%). For the in vitro transfection experiments described herein, 50 .mu.M working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0).

Transfection and RT-PCR Analysis

[0762] Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a fixed AON concentration of 200 nM, according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 .mu.l per .mu.g AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transfection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 53 (PS43/PS559/PS1106, SEQ ID NO: 111, 202, 203), exon 46 (PS188/PS785/PS1107 SEQ ID NO: 95, 204, 205) or exon 54 (PS235/PS786, SEQ ID NO: 120, 172) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 .mu.l of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 51 (PS43/PS559/PS1106), exon 44 (PS188/PS785/PS1107) or exon 52 (PS235/PS786). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described [Aartsma-Rus et al., Hum Mol Genet 2003; 12(8):907-14]. RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed by "Agilent 2100 Bioanalyzer" software and Excel 2007. The ratio of the smaller transcript product (containing the exon 51 (PS43/PS559/PS1106), exon 44 (PS188/PS785/PS1107), or exon 52 skip (PS235/PS786) to the total amount of transcript products was assessed (representing the exon 51, 44, or 52 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.

In Vivo Administration and RT-PCR

[0763] The experiments with the mdx mouse model (C57Bl/10ScSn-mdx/J; Charles River Laboratories) were approved by the local LUMC Animal Ethics Committee (DEC number 11145). Two mdx mice per group were anaesthetized using isoflurane and then injected intramuscularly in both gastrocnemius muscles, with 20 ug PS49 (SEQ ID NO: 216) or PS959 (SEQ ID NO:214), diluted in sterile saline to a total volume of 50 .mu.l per injection, on two consecutive days. Animals were sacrificed 1 week after the last injection by cervical dislocation and muscles were isolated and snap frozen in magnalyzer greenbead tubes (Roche). Six-hundred .mu.l Tripure (Roche) was added to the tubes and muscles were homogenized using the bulletblender machine, 3.times.1 min speed 10. The lysate was transferred to a clean tube to which 120 .mu.l of chloroform was added. Samples were vigorously shaken en incubated on ice for 5 minutes, then centrifuged for 15 minutes at maximum speed at 4.degree. C. The supernatant was transferred to another tube and 1 volume of isopropanol was added. Samples were mixed and incubated at 4 degrees for at least 30 minutes. Then samples were centrifuged for 15 minutes at maximum speed at 4.degree. C., washed with 70% ethanol followed by a second centrifugation step of 10 minutes at maximum speed at 4.degree. C. RNA pellets were airdried and solved in DEPC treated water. cDNA was generated using 400 ng total RNA with random hexamer primers using Transcriptor reverse transcriptase (RT) (Roche Diagnostics) according to the manufacturer's instructions. PCRs were performed by 30 cycles of 94 degrees for 30 s, 60 degrees for 30 s and 72 degrees for 30 s in a 50 .mu.l reaction using 1.5 .mu.l cDNA as template using primers specific for mouse exon 22 and exon 24. PCR products were visualized on 2% agarose gels quantified the Agilent 2100 Bioanalyzer (Agilent, Santa Clara, Calif., USA).

Results

[0764] The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified cytosines with 5-methylcytosines and substituting all unmodified uracils with 5-methyluracils (as in PS1106, PS1107, SEQ ID NO: 203, 205), and of only substituting all unmodified uracils with 5-methyluracils (as in PS559, PS785, PS786, SEQ ID NO: 202, 204, 172), was first tested at a fixed 200 nM AON concentration in cultured, differentiated, healthy muscle cells in vitro (FIG. 4A). The AONs with 5-methyluracils (PS559, PS785, and PS786) increased the exon skipping efficiencies 1.3- to 3-fold when compared to their counterparts with unmodified uracils. When also replacing the unmodified cytosines by 5-methylcytosines, the skipping levels were further increased (PS1106 versus PS559, SEQ ID NO: 203 versus 202) or similar (PS1107 versus PS785, SEQ ID NO: 205 versus 204). The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified uracils (as in PS49; SEQ ID NO:216) with 5-methyluracils (as in PS959; SEQ ID NO:214) was then also tested in muscle of the mdx mouse model. PS959 with all 5-methyluracils increased the exon 23 skipping efficiencies approximately 3-fold when compared to PS49 with unmodified uracils (n=4 per AON) (FIG. 4B). These results demonstrate that not only 5-methylcytosines may have a positive effect on exon skipping activity (as also shown in FIG. 1) but also, 5-methyluracils, both in vitro and in vivo. In addition the combined use of these 5-methylpyrimidines may even further increase activity.

Example 3

Material and Methods

AONs

[0765] All oligonucleotides (PS43/PS403, based on SEQ ID NO:31, and corresponding to SEQ ID NO: 111 (PS43) for the non-modified and SEQ ID NO: 206 (PS403) for the sequence wherein all adenines have been modified; PS188/PS733, based on SEQ ID NO:15, and corresponding to SEQ ID NO: 95 (PS188) for the non-modified and SEQ ID NO: 207 (PS733) for the sequence wherein all adenines have been modified; PS235/PS897, based on SEQ ID NO:40, and corresponding to SEQ ID NO: 120 (PS235) for the non-modified and SEQ ID NO: 173 (PS897) for the sequence wherein all adenines have been modified) were 2'-O-methyl phosphorothioate RNA, and synthesized using an OP-10 synthesizer (GE/AKTA Oligopilot) through standard phosphoramidite protocols, or obtained from commercial suppliers, in 200 nmol-151 g scale. Prosensa-synthesized oligonucleotides were cleaved and deprotected in a two step sequence (DIEA followed by cone. NH.sub.4OH treatment), purified by HPLC and dissolved in water and an excess of NaCl was added to exchange ions. After evaporation, compounds were redissolved in water, desalted by FPLC or ultrafiltration and lyophilized. Mass spectrometry confirmed the identity of all compounds, and purity (determined by UPLC) was found acceptable for all compounds (>75-80%); compounds obtained from commercial sources were used as received: PS188 (Girindus, 151 g obtained, purity 92%), PS733 (TriLink or ChemGenes, 200 nmol/1 mg synthesis scale, used as received, PS43 (Prosensa, 10 .mu.mol synthesis scale, purity 86%), PS403 (ChemGenes, 1 .mu.mol synthesis scale, used as received), PS235 (Prosensa, 1.92 mmol synthesis scale, purity 91%), PS897 (ChemGenes, 200 nmol synthesis scale, used as received). For the in vitro transfection experiments described herein, 50 .mu.M working solutions of the AONs were prepared in 20 mM phosphate buffer (pH 7.0). For the in vitro complement activation assays described herein, 3 mg/mL stock solutions of PS188 and PS733 were prepared in 20 mM phosphate buffer (pH 7.0).

Transfection and RT-PCR Analysis

[0766] Differentiated human healthy control muscle cells (myotubes) were transfected in 6-wells plates with a fixed AON concentration of 200 nM, according to non-GLP standard operating procedures. For transfection polyethylenimine (ExGen500, Fermentas) was used (2 .mu.l per .mu.g AON, in 0.15M NaCl). Aforementioned transfection procedures were adapted from previously reported material and methods (Aartsma-Rus et al., 2003). At 24 hrs after transfection, RNA was isolated and analyzed by RT-PCR. Briefly, to generate dystrophin-specific cDNA, a DMD gene specific reverse primer in exon 53 (PS43/PS403, SEQ ID NO: 111/206), exon 46 (PS188/PS733, SEQ ID NO: 95/207) or exon 54 (PS235/PS897, SEQ ID NO: 120/173) was used in the reverse transcriptase (RT) reaction on 1000 ng input RNA. The PCR analysis was subsequently done on 3 .mu.l of dystrophin cDNA for each sample, and included a first and nested PCR using DMD gene specific primers in exons flanking exon 51 (PS43/PS403), exon 44 (PS188/PS733) or exon 52 (PS235/PS897). The RNA isolation and RT-PCR analysis were performed according to non-GLP standard operating procedures as described [Aartsma-Rus et al., Hum Mol Genet 2003; 12(8):907-14]. RT-PCR products were analyzed by gel electrophoresis (2% agarose gels). The resulting RT-PCR fragments were quantified through DNA Lab-on-a-Chip analysis (Agilent). The data was processed by "Agilent 2100 Bioanalyzer" software and Excel 2007. The ratio of the smaller transcript product (containing the exon 51 (PS43/PS403), exon 44 (PS188/PS733), or exon 52 skip (PS235/PS897) to the total amount of transcript products was assessed (representing the exon 51, 44, or 52 skipping efficiencies in percentages) and directly compared to that in non-transfected cells.

Complement Activation Assay

[0767] Antisense oligonucleotides may activate the alternative complement pathway, which contains several split factors, such as C3a and factor Bb (the latter is unique to the alternative pathway). The ability of AONs to possibly activate the complement pathway was assessed in plasma from Cynomolgus monkeys (LiHe plasma, CIT, France). Increasing concentrations (from 0 to 300 .mu.g/mL) of PS188 (SEQ ID NO: 95) and PS733 (PS207), in a dilution of 1:10 (v/v)), were added to the plasma and incubated at 37.degree. C. for 30 min. The reaction was terminated by transferring the samples to ice and making dilutions in ice-cold diluent. Bb and C3a concentrations were determined by ELISA (Quidel, San Diego, Calif.).

Results

[0768] The effect on AON activity (i.e. inducing exon skipping efficiency) of substituting all unmodified adenines with 2,6-diaminopurines was tested at a fixed AON concentration (200 nM) in cultured, differentiated, healthy muscle cells in vitro. In FIG. 5A examples for three different AON sequences are shown. The AONs with 2,6-diaminopurines (PS403, PS897, and PS733, SEQ ID NO: 206, 207, 173) increased the exon skipping efficiencies 2- to 4-fold when compared to their counterparts with unmodified adenines (compared to SEQ ID NO: 111, 95, 120). There seemed to be a correlation with the number of 2,6-diaminopurines in each AON.

[0769] The effect of substituting all unmodified adenines (as in PS188; SEQ ID NO: 95) with 2,6-diaminopurines (as in PS733; SEQ ID NO:207) on in vitro safety, i.e. possible activation of the alternative complement pathway, was tested in monkey plasma. Whereas PS188 induced relatively high levels of both split factors Bb and C3 a, the 2,6-diaminopurines in PS733 completely abolished the effect on the alternative pathway, showing no increase in either Bb or C3a levels (FIG. 5B). Thus the presence of 2,6-diaminopurines seemed to improve the safety profile of PS188 in vitro.

[0770] These results demonstrate the positive effect of 2,6-diaminopurines on the exon skipping activity and safety of AONs.

LIST OF REFERENCES

[0771] van Ommen, van Deutekom, Aartsma-Rus, Curr Opin Mol Ther. 2008; 10(2):140-9. [0772] Yokota, Duddy, Partidge, Acta Myol. 2007; 26(3):179-84. [0773] van Deutekom et al., N Engl J Med. 2007; 357(26):2677-86. [0774] Goemans et al., N Engl J Med. 2011; 364(16):1513-22. [0775] Cirak et al., Lancet 2011; 378: 595-605. [0776] Heemskerk et al., Mol Ther 2010; 18(6):1210-7. [0777] Aartsma-Rus et al., Hum Mol Gen 2003; 12(8):907-14. [0778] Yu R Z., Anal Biochem 2002; 304: 19-25. [0779] Krieg A M. et al., Nature 1995; 374: 546-549. [0780] Diebold S. S., et. al., Eur J Immunol. 2006; December; 36(12):3256-67. [0781] Krieg, A. M., Curr. Opin. Immunol. 2000; 12: 35-43. [0782] Wagner, H., Adv. Immunol. 1999; 73: 329-368. [0783] Popovic P J. et al. J of Immunol 2006; 177: 8701-8707. [0784] Peacock H et al. J. Am. Chem. Soc. 2011, 133, 9200 [0785] Arai K et al. Bioorg. Med. Chem. 2011, 21, 6285 [0786] Ehmsen J. et al, J. Cell Sci. 2002, 115 (Pt14): 2801-2803. [0787] Monaco A. P., et al., Genomics 1988; 2: 90-95. [0788] Manzur A. Y. et al., Wiley publishers, 2008. The Cochrane collaboration. [0789] Hodgetts S., et al, Neuromuscular Disorders 2006; 16: 591-602. [0790] Aartsma-Rus et al, Oligonucleotides 2010, 20(2): 69-77 [0791] Zuker M., et al, Nucleic Acids Res. 2003; 31(13):3406-15. [0792] Cartegni L, et al, Nat Rev Genet 2002; 3(4):285-98. [0793] Cartegni L, et al, Nucleic Acids Res 2003; 31(13):3568-71 [0794] Remington: The Science and Practice of Pharmacy, 20th Edition. [0795] Baltimore, Md.: Lippincott Williams & Wilkins, 2000 [0796] Kumar L, Pharm. Technol. 2008, 3, 128 [0797] Bruno, K., Advanced Drug Delivery Reviews 2011; 63: 1210. [0798] Hari et al. Org. Biomol. Chem. 2012, 10, 9639); [0799] Hanessian et al. Angew. Chem. Intl Ed. 2012, 45, 11242

Sequence CWU 1

1

21913685PRTHomo sapiens 1Met Leu Trp Trp Glu Glu Val Glu Asp Cys Tyr Glu Arg Glu Asp Val 1 5 10 15 Gln Lys Lys Thr Phe Thr Lys Trp Val Asn Ala Gln Phe Ser Lys Phe 20 25 30 Gly Lys Gln His Ile Glu Asn Leu Phe Ser Asp Leu Gln Asp Gly Arg 35 40 45 Arg Leu Leu Asp Leu Leu Glu Gly Leu Thr Gly Gln Lys Leu Pro Lys 50 55 60 Glu Lys Gly Ser Thr Arg Val His Ala Leu Asn Asn Val Asn Lys Ala 65 70 75 80 Leu Arg Val Leu Gln Asn Asn Asn Val Asp Leu Val Asn Ile Gly Ser 85 90 95 Thr Asp Ile Val Asp Gly Asn His Lys Leu Thr Leu Gly Leu Ile Trp 100 105 110 Asn Ile Ile Leu His Trp Gln Val Lys Asn Val Met Lys Asn Ile Met 115 120 125 Ala Gly Leu Gln Gln Thr Asn Ser Glu Lys Ile Leu Leu Ser Trp Val 130 135 140 Arg Gln Ser Thr Arg Asn Tyr Pro Gln Val Asn Val Ile Asn Phe Thr 145 150 155 160 Thr Ser Trp Ser Asp Gly Leu Ala Leu Asn Ala Leu Ile His Ser His 165 170 175 Arg Pro Asp Leu Phe Asp Trp Asn Ser Val Val Cys Gln Gln Ser Ala 180 185 190 Thr Gln Arg Leu Glu His Ala Phe Asn Ile Ala Arg Tyr Gln Leu Gly 195 200 205 Ile Glu Lys Leu Leu Asp Pro Glu Asp Val Asp Thr Thr Tyr Pro Asp 210 215 220 Lys Lys Ser Ile Leu Met Tyr Ile Thr Ser Leu Phe Gln Val Leu Pro 225 230 235 240 Gln Gln Val Ser Ile Glu Ala Ile Gln Glu Val Glu Met Leu Pro Arg 245 250 255 Pro Pro Lys Val Thr Lys Glu Glu His Phe Gln Leu His His Gln Met 260 265 270 His Tyr Ser Gln Gln Ile Thr Val Ser Leu Ala Gln Gly Tyr Glu Arg 275 280 285 Thr Ser Ser Pro Lys Pro Arg Phe Lys Ser Tyr Ala Tyr Thr Gln Ala 290 295 300 Ala Tyr Val Thr Thr Ser Asp Pro Thr Arg Ser Pro Phe Pro Ser Gln 305 310 315 320 His Leu Glu Ala Pro Glu Asp Lys Ser Phe Gly Ser Ser Leu Met Glu 325 330 335 Ser Glu Val Asn Leu Asp Arg Tyr Gln Thr Ala Leu Glu Glu Val Leu 340 345 350 Ser Trp Leu Leu Ser Ala Glu Asp Thr Leu Gln Ala Gln Gly Glu Ile 355 360 365 Ser Asn Asp Val Glu Val Val Lys Asp Gln Phe His Thr His Glu Gly 370 375 380 Tyr Met Met Asp Leu Thr Ala His Gln Gly Arg Val Gly Asn Ile Leu 385 390 395 400 Gln Leu Gly Ser Lys Leu Ile Gly Thr Gly Lys Leu Ser Glu Asp Glu 405 410 415 Glu Thr Glu Val Gln Glu Gln Met Asn Leu Leu Asn Ser Arg Trp Glu 420 425 430 Cys Leu Arg Val Ala Ser Met Glu Lys Gln Ser Asn Leu His Arg Val 435 440 445 Leu Met Asp Leu Gln Asn Gln Lys Leu Lys Glu Leu Asn Asp Trp Leu 450 455 460 Thr Lys Thr Glu Glu Arg Thr Arg Lys Met Glu Glu Glu Pro Leu Gly 465 470 475 480 Pro Asp Leu Glu Asp Leu Lys Arg Gln Val Gln Gln His Lys Val Leu 485 490 495 Gln Glu Asp Leu Glu Gln Glu Gln Val Arg Val Asn Ser Leu Thr His 500 505 510 Met Val Val Val Val Asp Glu Ser Ser Gly Asp His Ala Thr Ala Ala 515 520 525 Leu Glu Glu Gln Leu Lys Val Leu Gly Asp Arg Trp Ala Asn Ile Cys 530 535 540 Arg Trp Thr Glu Asp Arg Trp Val Leu Leu Gln Asp Ile Leu Leu Lys 545 550 555 560 Trp Gln Arg Leu Thr Glu Glu Gln Cys Leu Phe Ser Ala Trp Leu Ser 565 570 575 Glu Lys Glu Asp Ala Val Asn Lys Ile His Thr Thr Gly Phe Lys Asp 580 585 590 Gln Asn Glu Met Leu Ser Ser Leu Gln Lys Leu Ala Val Leu Lys Ala 595 600 605 Asp Leu Glu Lys Lys Lys Gln Ser Met Gly Lys Leu Tyr Ser Leu Lys 610 615 620 Gln Asp Leu Leu Ser Thr Leu Lys Asn Lys Ser Val Thr Gln Lys Thr 625 630 635 640 Glu Ala Trp Leu Asp Asn Phe Ala Arg Cys Trp Asp Asn Leu Val Gln 645 650 655 Lys Leu Glu Lys Ser Thr Ala Gln Ile Ser Gln Ala Val Thr Thr Thr 660 665 670 Gln Pro Ser Leu Thr Gln Thr Thr Val Met Glu Thr Val Thr Thr Val 675 680 685 Thr Thr Arg Glu Gln Ile Leu Val Lys His Ala Gln Glu Glu Leu Pro 690 695 700 Pro Pro Pro Pro Gln Lys Lys Arg Gln Ile Thr Val Asp Ser Glu Ile 705 710 715 720 Arg Lys Arg Leu Asp Val Asp Ile Thr Glu Leu His Ser Trp Ile Thr 725 730 735 Arg Ser Glu Ala Val Leu Gln Ser Pro Glu Phe Ala Ile Phe Arg Lys 740 745 750 Glu Gly Asn Phe Ser Asp Leu Lys Glu Lys Val Asn Ala Ile Glu Arg 755 760 765 Glu Lys Ala Glu Lys Phe Arg Lys Leu Gln Asp Ala Ser Arg Ser Ala 770 775 780 Gln Ala Leu Val Glu Gln Met Val Asn Glu Gly Val Asn Ala Asp Ser 785 790 795 800 Ile Lys Gln Ala Ser Glu Gln Leu Asn Ser Arg Trp Ile Glu Phe Cys 805 810 815 Gln Leu Leu Ser Glu Arg Leu Asn Trp Leu Glu Tyr Gln Asn Asn Ile 820 825 830 Ile Ala Phe Tyr Asn Gln Leu Gln Gln Leu Glu Gln Met Thr Thr Thr 835 840 845 Ala Glu Asn Trp Leu Lys Ile Gln Pro Thr Thr Pro Ser Glu Pro Thr 850 855 860 Ala Ile Lys Ser Gln Leu Lys Ile Cys Lys Asp Glu Val Asn Arg Leu 865 870 875 880 Ser Gly Leu Gln Pro Gln Ile Glu Arg Leu Lys Ile Gln Ser Ile Ala 885 890 895 Leu Lys Glu Lys Gly Gln Gly Pro Met Phe Leu Asp Ala Asp Phe Val 900 905 910 Ala Phe Thr Asn His Phe Lys Gln Val Phe Ser Asp Val Gln Ala Arg 915 920 925 Glu Lys Glu Leu Gln Thr Ile Phe Asp Thr Leu Pro Pro Met Arg Tyr 930 935 940 Gln Glu Thr Met Ser Ala Ile Arg Thr Trp Val Gln Gln Ser Glu Thr 945 950 955 960 Lys Leu Ser Ile Pro Gln Leu Ser Val Thr Asp Tyr Glu Ile Met Glu 965 970 975 Gln Arg Leu Gly Glu Leu Gln Ala Leu Gln Ser Ser Leu Gln Glu Gln 980 985 990 Gln Ser Gly Leu Tyr Tyr Leu Ser Thr Thr Val Lys Glu Met Ser Lys 995 1000 1005 Lys Ala Pro Ser Glu Ile Ser Arg Lys Tyr Gln Ser Glu Phe Glu 1010 1015 1020 Glu Ile Glu Gly Arg Trp Lys Lys Leu Ser Ser Gln Leu Val Glu 1025 1030 1035 His Cys Gln Lys Leu Glu Glu Gln Met Asn Lys Leu Arg Lys Ile 1040 1045 1050 Gln Asn His Ile Gln Thr Leu Lys Lys Trp Met Ala Glu Val Asp 1055 1060 1065 Val Phe Leu Lys Glu Glu Trp Pro Ala Leu Gly Asp Ser Glu Ile 1070 1075 1080 Leu Lys Lys Gln Leu Lys Gln Cys Arg Leu Leu Val Ser Asp Ile 1085 1090 1095 Gln Thr Ile Gln Pro Ser Leu Asn Ser Val Asn Glu Gly Gly Gln 1100 1105 1110 Lys Ile Lys Asn Glu Ala Glu Pro Glu Phe Ala Ser Arg Leu Glu 1115 1120 1125 Thr Glu Leu Lys Glu Leu Asn Thr Gln Trp Asp His Met Cys Gln 1130 1135 1140 Gln Val Tyr Ala Arg Lys Glu Ala Leu Lys Gly Gly Leu Glu Lys 1145 1150 1155 Thr Val Ser Leu Gln Lys Asp Leu Ser Glu Met His Glu Trp Met 1160 1165 1170 Thr Gln Ala Glu Glu Glu Tyr Leu Glu Arg Asp Phe Glu Tyr Lys 1175 1180 1185 Thr Pro Asp Glu Leu Gln Lys Ala Val Glu Glu Met Lys Arg Ala 1190 1195 1200 Lys Glu Glu Ala Gln Gln Lys Glu Ala Lys Val Lys Leu Leu Thr 1205 1210 1215 Glu Ser Val Asn Ser Val Ile Ala Gln Ala Pro Pro Val Ala Gln 1220 1225 1230 Glu Ala Leu Lys Lys Glu Leu Glu Thr Leu Thr Thr Asn Tyr Gln 1235 1240 1245 Trp Leu Cys Thr Arg Leu Asn Gly Lys Cys Lys Thr Leu Glu Glu 1250 1255 1260 Val Trp Ala Cys Trp His Glu Leu Leu Ser Tyr Leu Glu Lys Ala 1265 1270 1275 Asn Lys Trp Leu Asn Glu Val Glu Phe Lys Leu Lys Thr Thr Glu 1280 1285 1290 Asn Ile Pro Gly Gly Ala Glu Glu Ile Ser Glu Val Leu Asp Ser 1295 1300 1305 Leu Glu Asn Leu Met Arg His Ser Glu Asp Asn Pro Asn Gln Ile 1310 1315 1320 Arg Ile Leu Ala Gln Thr Leu Thr Asp Gly Gly Val Met Asp Glu 1325 1330 1335 Leu Ile Asn Glu Glu Leu Glu Thr Phe Asn Ser Arg Trp Arg Glu 1340 1345 1350 Leu His Glu Glu Ala Val Arg Arg Gln Lys Leu Leu Glu Gln Ser 1355 1360 1365 Ile Gln Ser Ala Gln Glu Thr Glu Lys Ser Leu His Leu Ile Gln 1370 1375 1380 Glu Ser Leu Thr Phe Ile Asp Lys Gln Leu Ala Ala Tyr Ile Ala 1385 1390 1395 Asp Lys Val Asp Ala Ala Gln Met Pro Gln Glu Ala Gln Lys Ile 1400 1405 1410 Gln Ser Asp Leu Thr Ser His Glu Ile Ser Leu Glu Glu Met Lys 1415 1420 1425 Lys His Asn Gln Gly Lys Glu Ala Ala Gln Arg Val Leu Ser Gln 1430 1435 1440 Ile Asp Val Ala Gln Lys Lys Leu Gln Asp Val Ser Met Lys Phe 1445 1450 1455 Arg Leu Phe Gln Lys Pro Ala Asn Phe Glu Gln Arg Leu Gln Glu 1460 1465 1470 Ser Lys Met Ile Leu Asp Glu Val Lys Met His Leu Pro Ala Leu 1475 1480 1485 Glu Thr Lys Ser Val Glu Gln Glu Val Val Gln Ser Gln Leu Asn 1490 1495 1500 His Cys Val Asn Leu Tyr Lys Ser Leu Ser Glu Val Lys Ser Glu 1505 1510 1515 Val Glu Met Val Ile Lys Thr Gly Arg Gln Ile Val Gln Lys Lys 1520 1525 1530 Gln Thr Glu Asn Pro Lys Glu Leu Asp Glu Arg Val Thr Ala Leu 1535 1540 1545 Lys Leu His Tyr Asn Glu Leu Gly Ala Lys Val Thr Glu Arg Lys 1550 1555 1560 Gln Gln Leu Glu Lys Cys Leu Lys Leu Ser Arg Lys Met Arg Lys 1565 1570 1575 Glu Met Asn Val Leu Thr Glu Trp Leu Ala Ala Thr Asp Met Glu 1580 1585 1590 Leu Thr Lys Arg Ser Ala Val Glu Gly Met Pro Ser Asn Leu Asp 1595 1600 1605 Ser Glu Val Ala Trp Gly Lys Ala Thr Gln Lys Glu Ile Glu Lys 1610 1615 1620 Gln Lys Val His Leu Lys Ser Ile Thr Glu Val Gly Glu Ala Leu 1625 1630 1635 Lys Thr Val Leu Gly Lys Lys Glu Thr Leu Val Glu Asp Lys Leu 1640 1645 1650 Ser Leu Leu Asn Ser Asn Trp Ile Ala Val Thr Ser Arg Ala Glu 1655 1660 1665 Glu Trp Leu Asn Leu Leu Leu Glu Tyr Gln Lys His Met Glu Thr 1670 1675 1680 Phe Asp Gln Asn Val Asp His Ile Thr Lys Trp Ile Ile Gln Ala 1685 1690 1695 Asp Thr Leu Leu Asp Glu Ser Glu Lys Lys Lys Pro Gln Gln Lys 1700 1705 1710 Glu Asp Val Leu Lys Arg Leu Lys Ala Glu Leu Asn Asp Ile Arg 1715 1720 1725 Pro Lys Val Asp Ser Thr Arg Asp Gln Ala Ala Asn Leu Met Ala 1730 1735 1740 Asn Arg Gly Asp His Cys Arg Lys Leu Val Glu Pro Gln Ile Ser 1745 1750 1755 Glu Leu Asn His Arg Phe Ala Ala Ile Ser His Arg Ile Lys Thr 1760 1765 1770 Gly Lys Ala Ser Ile Pro Leu Lys Glu Leu Glu Gln Phe Asn Ser 1775 1780 1785 Asp Ile Gln Lys Leu Leu Glu Pro Leu Glu Ala Glu Ile Gln Gln 1790 1795 1800 Gly Val Asn Leu Lys Glu Glu Asp Phe Asn Lys Asp Met Asn Glu 1805 1810 1815 Asp Asn Glu Gly Thr Val Lys Glu Leu Leu Gln Arg Gly Asp Asn 1820 1825 1830 Leu Gln Gln Arg Ile Thr Asp Glu Arg Lys Arg Glu Glu Ile Lys 1835 1840 1845 Ile Lys Gln Gln Leu Leu Gln Thr Lys His Asn Ala Leu Lys Asp 1850 1855 1860 Leu Arg Ser Gln Arg Arg Lys Lys Ala Leu Glu Ile Ser His Gln 1865 1870 1875 Trp Tyr Gln Tyr Lys Arg Gln Ala Asp Asp Leu Leu Lys Cys Leu 1880 1885 1890 Asp Asp Ile Glu Lys Lys Leu Ala Ser Leu Pro Glu Pro Arg Asp 1895 1900 1905 Glu Arg Lys Ile Lys Glu Ile Asp Arg Glu Leu Gln Lys Lys Lys 1910 1915 1920 Glu Glu Leu Asn Ala Val Arg Arg Gln Ala Glu Gly Leu Ser Glu 1925 1930 1935 Asp Gly Ala Ala Met Ala Val Glu Pro Thr Gln Ile Gln Leu Ser 1940 1945 1950 Lys Arg Trp Arg Glu Ile Glu Ser Lys Phe Ala Gln Phe Arg Arg 1955 1960 1965 Leu Asn Phe Ala Gln Ile His Thr Val Arg Glu Glu Thr Met Met 1970 1975 1980 Val Met Thr Glu Asp Met Pro Leu Glu Ile Ser Tyr Val Pro Ser 1985 1990 1995 Thr Tyr Leu Thr Glu Ile Thr His Val Ser Gln Ala Leu Leu Glu 2000 2005 2010 Val Glu Gln Leu Leu Asn Ala Pro Asp Leu Cys Ala Lys Asp Phe 2015 2020 2025 Glu Asp Leu Phe Lys Gln Glu Glu Ser Leu Lys Asn Ile Lys Asp 2030 2035 2040 Ser Leu Gln Gln Ser Ser Gly Arg Ile Asp Ile Ile His Ser Lys 2045 2050 2055 Lys Thr Ala Ala Leu Gln Ser Ala Thr Pro Val Glu Arg Val Lys 2060 2065 2070 Leu Gln Glu Ala Leu Ser Gln Leu Asp Phe Gln Trp Glu Lys Val 2075 2080 2085 Asn Lys Met Tyr Lys Asp Arg Gln Gly Arg Phe Asp Arg Ser Val 2090 2095 2100 Glu Lys Trp Arg Arg Phe His Tyr Asp Ile Lys Ile Phe Asn Gln 2105 2110 2115 Trp Leu Thr Glu Ala Glu Gln Phe Leu Arg Lys Thr Gln Ile Pro 2120 2125 2130 Glu Asn Trp Glu His Ala Lys Tyr Lys Trp Tyr Leu Lys Glu Leu 2135 2140 2145 Gln Asp Gly Ile Gly Gln Arg Gln Thr Val Val Arg Thr Leu Asn 2150 2155 2160 Ala Thr Gly Glu Glu Ile Ile Gln Gln Ser Ser Lys Thr Asp Ala 2165 2170 2175 Ser Ile Leu Gln Glu Lys Leu Gly Ser Leu Asn Leu Arg Trp Gln 2180 2185 2190 Glu Val Cys Lys Gln Leu Ser Asp Arg Lys Lys Arg Leu Glu Glu 2195 2200 2205 Gln Lys Asn Ile Leu Ser Glu Phe Gln Arg Asp Leu Asn Glu Phe 2210 2215 2220 Val Leu Trp Leu Glu Glu Ala Asp Asn Ile Ala Ser Ile Pro Leu 2225 2230 2235 Glu Pro Gly Lys Glu Gln Gln

Leu Lys Glu Lys Leu Glu Gln Val 2240 2245 2250 Lys Leu Leu Val Glu Glu Leu Pro Leu Arg Gln Gly Ile Leu Lys 2255 2260 2265 Gln Leu Asn Glu Thr Gly Gly Pro Val Leu Val Ser Ala Pro Ile 2270 2275 2280 Ser Pro Glu Glu Gln Asp Lys Leu Glu Asn Lys Leu Lys Gln Thr 2285 2290 2295 Asn Leu Gln Trp Ile Lys Val Ser Arg Ala Leu Pro Glu Lys Gln 2300 2305 2310 Gly Glu Ile Glu Ala Gln Ile Lys Asp Leu Gly Gln Leu Glu Lys 2315 2320 2325 Lys Leu Glu Asp Leu Glu Glu Gln Leu Asn His Leu Leu Leu Trp 2330 2335 2340 Leu Ser Pro Ile Arg Asn Gln Leu Glu Ile Tyr Asn Gln Pro Asn 2345 2350 2355 Gln Glu Gly Pro Phe Asp Val Gln Glu Thr Glu Ile Ala Val Gln 2360 2365 2370 Ala Lys Gln Pro Asp Val Glu Glu Ile Leu Ser Lys Gly Gln His 2375 2380 2385 Leu Tyr Lys Glu Lys Pro Ala Thr Gln Pro Val Lys Arg Lys Leu 2390 2395 2400 Glu Asp Leu Ser Ser Glu Trp Lys Ala Val Asn Arg Leu Leu Gln 2405 2410 2415 Glu Leu Arg Ala Lys Gln Pro Asp Leu Ala Pro Gly Leu Thr Thr 2420 2425 2430 Ile Gly Ala Ser Pro Thr Gln Thr Val Thr Leu Val Thr Gln Pro 2435 2440 2445 Val Val Thr Lys Glu Thr Ala Ile Ser Lys Leu Glu Met Pro Ser 2450 2455 2460 Ser Leu Met Leu Glu Val Pro Ala Leu Ala Asp Phe Asn Arg Ala 2465 2470 2475 Trp Thr Glu Leu Thr Asp Trp Leu Ser Leu Leu Asp Gln Val Ile 2480 2485 2490 Lys Ser Gln Arg Val Met Val Gly Asp Leu Glu Asp Ile Asn Glu 2495 2500 2505 Met Ile Ile Lys Gln Lys Ala Thr Met Gln Asp Leu Glu Gln Arg 2510 2515 2520 Arg Pro Gln Leu Glu Glu Leu Ile Thr Ala Ala Gln Asn Leu Lys 2525 2530 2535 Asn Lys Thr Ser Asn Gln Glu Ala Arg Thr Ile Ile Thr Asp Arg 2540 2545 2550 Ile Glu Arg Ile Gln Asn Gln Trp Asp Glu Val Gln Glu His Leu 2555 2560 2565 Gln Asn Arg Arg Gln Gln Leu Asn Glu Met Leu Lys Asp Ser Thr 2570 2575 2580 Gln Trp Leu Glu Ala Lys Glu Glu Ala Glu Gln Val Leu Gly Gln 2585 2590 2595 Ala Arg Ala Lys Leu Glu Ser Trp Lys Glu Gly Pro Tyr Thr Val 2600 2605 2610 Asp Ala Ile Gln Lys Lys Ile Thr Glu Thr Lys Gln Leu Ala Lys 2615 2620 2625 Asp Leu Arg Gln Trp Gln Thr Asn Val Asp Val Ala Asn Asp Leu 2630 2635 2640 Ala Leu Lys Leu Leu Arg Asp Tyr Ser Ala Asp Asp Thr Arg Lys 2645 2650 2655 Val His Met Ile Thr Glu Asn Ile Asn Ala Ser Trp Arg Ser Ile 2660 2665 2670 His Lys Arg Val Ser Glu Arg Glu Ala Ala Leu Glu Glu Thr His 2675 2680 2685 Arg Leu Leu Gln Gln Phe Pro Leu Asp Leu Glu Lys Phe Leu Ala 2690 2695 2700 Trp Leu Thr Glu Ala Glu Thr Thr Ala Asn Val Leu Gln Asp Ala 2705 2710 2715 Thr Arg Lys Glu Arg Leu Leu Glu Asp Ser Lys Gly Val Lys Glu 2720 2725 2730 Leu Met Lys Gln Trp Gln Asp Leu Gln Gly Glu Ile Glu Ala His 2735 2740 2745 Thr Asp Val Tyr His Asn Leu Asp Glu Asn Ser Gln Lys Ile Leu 2750 2755 2760 Arg Ser Leu Glu Gly Ser Asp Asp Ala Val Leu Leu Gln Arg Arg 2765 2770 2775 Leu Asp Asn Met Asn Phe Lys Trp Ser Glu Leu Arg Lys Lys Ser 2780 2785 2790 Leu Asn Ile Arg Ser His Leu Glu Ala Ser Ser Asp Gln Trp Lys 2795 2800 2805 Arg Leu His Leu Ser Leu Gln Glu Leu Leu Val Trp Leu Gln Leu 2810 2815 2820 Lys Asp Asp Glu Leu Ser Arg Gln Ala Pro Ile Gly Gly Asp Phe 2825 2830 2835 Pro Ala Val Gln Lys Gln Asn Asp Val His Arg Ala Phe Lys Arg 2840 2845 2850 Glu Leu Lys Thr Lys Glu Pro Val Ile Met Ser Thr Leu Glu Thr 2855 2860 2865 Val Arg Ile Phe Leu Thr Glu Gln Pro Leu Glu Gly Leu Glu Lys 2870 2875 2880 Leu Tyr Gln Glu Pro Arg Glu Leu Pro Pro Glu Glu Arg Ala Gln 2885 2890 2895 Asn Val Thr Arg Leu Leu Arg Lys Gln Ala Glu Glu Val Asn Thr 2900 2905 2910 Glu Trp Glu Lys Leu Asn Leu His Ser Ala Asp Trp Gln Arg Lys 2915 2920 2925 Ile Asp Glu Thr Leu Glu Arg Leu Gln Glu Leu Gln Glu Ala Thr 2930 2935 2940 Asp Glu Leu Asp Leu Lys Leu Arg Gln Ala Glu Val Ile Lys Gly 2945 2950 2955 Ser Trp Gln Pro Val Gly Asp Leu Leu Ile Asp Ser Leu Gln Asp 2960 2965 2970 His Leu Glu Lys Val Lys Ala Leu Arg Gly Glu Ile Ala Pro Leu 2975 2980 2985 Lys Glu Asn Val Ser His Val Asn Asp Leu Ala Arg Gln Leu Thr 2990 2995 3000 Thr Leu Gly Ile Gln Leu Ser Pro Tyr Asn Leu Ser Thr Leu Glu 3005 3010 3015 Asp Leu Asn Thr Arg Trp Lys Leu Leu Gln Val Ala Val Glu Asp 3020 3025 3030 Arg Val Arg Gln Leu His Glu Ala His Arg Asp Phe Gly Pro Ala 3035 3040 3045 Ser Gln His Phe Leu Ser Thr Ser Val Gln Gly Pro Trp Glu Arg 3050 3055 3060 Ala Ile Ser Pro Asn Lys Val Pro Tyr Tyr Ile Asn His Glu Thr 3065 3070 3075 Gln Thr Thr Cys Trp Asp His Pro Lys Met Thr Glu Leu Tyr Gln 3080 3085 3090 Ser Leu Ala Asp Leu Asn Asn Val Arg Phe Ser Ala Tyr Arg Thr 3095 3100 3105 Ala Met Lys Leu Arg Arg Leu Gln Lys Ala Leu Cys Leu Asp Leu 3110 3115 3120 Leu Ser Leu Ser Ala Ala Cys Asp Ala Leu Asp Gln His Asn Leu 3125 3130 3135 Lys Gln Asn Asp Gln Pro Met Asp Ile Leu Gln Ile Ile Asn Cys 3140 3145 3150 Leu Thr Thr Ile Tyr Asp Arg Leu Glu Gln Glu His Asn Asn Leu 3155 3160 3165 Val Asn Val Pro Leu Cys Val Asp Met Cys Leu Asn Trp Leu Leu 3170 3175 3180 Asn Val Tyr Asp Thr Gly Arg Thr Gly Arg Ile Arg Val Leu Ser 3185 3190 3195 Phe Lys Thr Gly Ile Ile Ser Leu Cys Lys Ala His Leu Glu Asp 3200 3205 3210 Lys Tyr Arg Tyr Leu Phe Lys Gln Val Ala Ser Ser Thr Gly Phe 3215 3220 3225 Cys Asp Gln Arg Arg Leu Gly Leu Leu Leu His Asp Ser Ile Gln 3230 3235 3240 Ile Pro Arg Gln Leu Gly Glu Val Ala Ser Phe Gly Gly Ser Asn 3245 3250 3255 Ile Glu Pro Ser Val Arg Ser Cys Phe Gln Phe Ala Asn Asn Lys 3260 3265 3270 Pro Glu Ile Glu Ala Ala Leu Phe Leu Asp Trp Met Arg Leu Glu 3275 3280 3285 Pro Gln Ser Met Val Trp Leu Pro Val Leu His Arg Val Ala Ala 3290 3295 3300 Ala Glu Thr Ala Lys His Gln Ala Lys Cys Asn Ile Cys Lys Glu 3305 3310 3315 Cys Pro Ile Ile Gly Phe Arg Tyr Arg Ser Leu Lys His Phe Asn 3320 3325 3330 Tyr Asp Ile Cys Gln Ser Cys Phe Phe Ser Gly Arg Val Ala Lys 3335 3340 3345 Gly His Lys Met His Tyr Pro Met Val Glu Tyr Cys Thr Pro Thr 3350 3355 3360 Thr Ser Gly Glu Asp Val Arg Asp Phe Ala Lys Val Leu Lys Asn 3365 3370 3375 Lys Phe Arg Thr Lys Arg Tyr Phe Ala Lys His Pro Arg Met Gly 3380 3385 3390 Tyr Leu Pro Val Gln Thr Val Leu Glu Gly Asp Asn Met Glu Thr 3395 3400 3405 Pro Val Thr Leu Ile Asn Phe Trp Pro Val Asp Ser Ala Pro Ala 3410 3415 3420 Ser Ser Pro Gln Leu Ser His Asp Asp Thr His Ser Arg Ile Glu 3425 3430 3435 His Tyr Ala Ser Arg Leu Ala Glu Met Glu Asn Ser Asn Gly Ser 3440 3445 3450 Tyr Leu Asn Asp Ser Ile Ser Pro Asn Glu Ser Ile Asp Asp Glu 3455 3460 3465 His Leu Leu Ile Gln His Tyr Cys Gln Ser Leu Asn Gln Asp Ser 3470 3475 3480 Pro Leu Ser Gln Pro Arg Ser Pro Ala Gln Ile Leu Ile Ser Leu 3485 3490 3495 Glu Ser Glu Glu Arg Gly Glu Leu Glu Arg Ile Leu Ala Asp Leu 3500 3505 3510 Glu Glu Glu Asn Arg Asn Leu Gln Ala Glu Tyr Asp Arg Leu Lys 3515 3520 3525 Gln Gln His Glu His Lys Gly Leu Ser Pro Leu Pro Ser Pro Pro 3530 3535 3540 Glu Met Met Pro Thr Ser Pro Gln Ser Pro Arg Asp Ala Glu Leu 3545 3550 3555 Ile Ala Glu Ala Lys Leu Leu Arg Gln His Lys Gly Arg Leu Glu 3560 3565 3570 Ala Arg Met Gln Ile Leu Glu Asp His Asn Lys Gln Leu Glu Ser 3575 3580 3585 Gln Leu His Arg Leu Arg Gln Leu Leu Glu Gln Pro Gln Ala Glu 3590 3595 3600 Ala Lys Val Asn Gly Thr Thr Val Ser Ser Pro Ser Thr Ser Leu 3605 3610 3615 Gln Arg Ser Asp Ser Ser Gln Pro Met Leu Leu Arg Val Val Gly 3620 3625 3630 Ser Gln Thr Ser Asp Ser Met Gly Glu Glu Asp Leu Leu Ser Pro 3635 3640 3645 Pro Gln Asp Thr Ser Thr Gly Leu Glu Glu Val Met Glu Gln Leu 3650 3655 3660 Asn Asn Ser Phe Pro Ser Ser Arg Gly Arg Asn Thr Pro Gly Lys 3665 3670 3675 Pro Met Arg Glu Asp Thr Met 3680 3685 2148RNAHomo sapiens 2gcgauuugac agaucuguug agaaauggcg gcguuuucau uaugauauaa agauauuuaa 60ucaguggcua acagaagcug aacaguuucu cagaaagaca caaauuccug agaauuggga 120acaugcuaaa uacaaauggu aucuuaag 1483176RNAHomo sapiens 3gaacuccagg auggcauugg gcagcggcaa acuguuguca gaacauugaa ugcaacuggg 60gaagaaauaa uucagcaauc cucaaaaaca gaugccagua uucuacagga aaaauuggga 120agccugaauc ugcgguggca ggaggucugc aaacagcugu cagacagaaa aaagag 1764148RNAHomo sapiens 4gcuagaagaa caaaagaaua ucuugucaga auuucaaaga gauuuaaaug aauuuguuuu 60augguuggag gaagcagaua acauugcuag uaucccacuu gaaccuggaa aagagcagca 120acuaaaagaa aagcuugagc aagucaag 1485150RNAHomo sapiens 5uuacuggugg aagaguugcc ccugcgccag ggaauucuca aacaauuaaa ugaaacugga 60ggacccgugc uuguaagugc ucccauaagc ccagaagagc aagauaaacu ugaaaauaag 120cucaagcaga caaaucucca guggauaaag 1506186RNAHomo sapiens 6guuuccagag cuuuaccuga gaaacaagga gaaauugaag cucaaauaaa agaccuuggg 60cagcuugaaa aaaagcuuga agaccuugaa gagcaguuaa aucaucugcu gcugugguua 120ucuccuauua ggaaucaguu ggaaauuuau aaccaaccaa accaagaagg accauuugac 180guucag 1867102RNAHomo sapiens 7gaaacugaaa uagcaguuca agcuaaacaa ccggaugugg aagagauuuu gucuaaaggg 60cagcauuugu acaaggaaaa accagccacu cagccaguga ag 1028109RNAHomo sapiens 8aggaaguuag aagaucugag cucugagugg aaggcgguaa accguuuacu ucaagagcug 60agggcaaagc agccugaccu agcuccugga cugaccacua uuggagccu 1099233RNAHomo sapiens 9cuccuacuca gacuguuacu cuggugacac aaccuguggu uacuaaggaa acugccaucu 60ccaaacuaga aaugccaucu uccuugaugu uggagguacc ugcucuggca gauuucaacc 120gggcuuggac agaacuuacc gacuggcuuu cucugcuuga ucaaguuaua aaaucacaga 180gggugauggu gggugaccuu gaggauauca acgagaugau caucaagcag aag 23310118RNAHomo sapiens 10gcaacaaugc aggauuugga acagaggcgu ccccaguugg aagaacucau uaccgcugcc 60caaaauuuga aaaacaagac cagcaaucaa gaggcuagaa caaucauuac ggaucgaa 11811212RNAHomo sapiens 11uugaaagaau ucagaaucag ugggaugaag uacaagaaca ccuucagaac cggaggcaac 60aguugaauga aauguuaaag gauucaacac aauggcugga agcuaaggaa gaagcugagc 120aggucuuagg acaggccaga gccaagcuug agucauggaa ggaggguccc uauacaguag 180augcaaucca aaagaaaauc acagaaacca ag 21212155RNAHomo sapiens 12caguuggcca aagaccuccg ccaguggcag acaaauguag auguggcaaa ugacuuggcc 60cugaaacuuc uccgggauua uucugcagau gauaccagaa aaguccacau gauaacagag 120aauaucaaug ccucuuggag aagcauucau aaaag 15513190RNAHomo sapiens 13ggugagugag cgagaggcug cuuuggaaga aacucauaga uuacugcaac aguucccccu 60ggaccuggaa aaguuucuug ccuggcuuac agaagcugaa acaacugcca auguccuaca 120ggaugcuacc cguaaggaaa ggcuccuaga agacuccaag ggaguaaaag agcugaugaa 180acaauggcaa 1901419RNAArtificialOligonucleotide 14gnnnnnnnnn nnnngnnnn 191520RNAArtificialOligonucleotide 15nnngnnnnng nnngnnnnng 201620RNAartificialoligonucleotide 16nnngnnnnnn gnnngnnnnn 201723RNAArtificialOligonucleotide 17nnnnnnnggn nnnngngnnn nnn 231823RNAArtificialOligonucleotide 18nnnnnngnnn nnngnnngnn nnn 231921RNAArtificialOligonucleotide 19nnnnnggnnn nngngnnnnn n 212023RNAArtificialOligonucleotide 20gnnnnnnnnn nnnngnnnng nnn 232125RNAArtificialOligonucleotide 21nnngnngnng nnnnnngnnn nnnng 252224RNAArtificialOligonucleotide 22nngnngnngn nnnnngnnnn nnng 242325RNAArtificialOligonucleotide 23nngnngnngn nnnnngnnnn nnngg 252423RNAArtificialOligonucleotide 24ngnngnngnn nnnngnnnnn nng 232524RNAArtificialOligonucleotide 25ngnngnngnn nnnngnnnnn nngg 242622RNAArtificialOligonucleotide 26gnngnngnnn nnngnnnnnn ng 222722RNAArtificialOligonucleotide 27nngnngnnnn nngnnnnnnn gg 222825RNAArtificialOligonucleotide 28nnngnnnnng nnnnnngnnn nnnng 252925RNAArtificialOligonucleotide 29nngnnngnng nngnnnnnng nnnnn 253030RNAArtificialOligonucleotide 30nngnnngnng nngnnnnnng nnnnnnnggn 303120RNAArtificialOligonucleotide 31nnnnggnngn nggnnnnnnn 203217RNAArtificialOligonucleotide 32nggnnnnnnn ngnnngg 173322RNAArtificialOligonucleotide 33nnnnnnggnn gnnggnnnnn nn 223425RNAArtificialOligonucleotide 34nnnnnnnnng gnngnnggnn nnnnn 253523RNAArtificialOligonucleotide 35nnnnngngnn nnnnnnnnnn gnn 233623RNAArtificialOligonucleotide 36nnngngnngg nnnnnnnnnn nnn 233730RNAArtificialOligonucleotide 37nnnnnnnggn ngnnggnnnn nnnngnnngg 303825RNAArtificialOligonucleotide 38nnnnnnnggn ngnnggnnnn nnnng 253925RNAArtificialOligonucleotide 39nnnnngnnng nnggnnnngn nnnnn 254022RNAArtificialOligonucleotide 40ggnnnngngn nnnnnnnnnn gg 224125RNAArtificialOligonucleotide 41nnnngnnngn nggnnnngnn nnnnn 254225RNAArtificialOligonucleotide 42nnnnnnnngg ggnngnnnnn gnnnn 254325RNAArtificialOligonucleotide 43ngnnnnngnn nnnngnnngn nggnn

254418RNAArtificialOligonucleotide 44nngnngnnnn nggnnnng 184522RNAArtificialOligonucleotide 45nnnnngnngn nnnnggnnnn gn 224623RNAArtificialOligonucleotide 46nnnnngnngn nnnnggnnnn gnn 234724RNAArtificialOligonucleotide 47nnnnngnngn nnnnggnnnn gnng 244822RNAArtificialOligonucleotide 48nngnngnnnn nggnnnngnn gg 224923RNAArtificialOligonucleotide 49nngnngnnnn nggnnnngnn ggn 235024RNAArtificialOligonucleotide 50nngnngnnnn nggnnnngnn ggng 245125RNAArtificialOligonucleotide 51nngnngnnnn nggnnnngnn ggngn 255225RNAArtificialOligonucleotide 52gnngnnnnng gnnnngnngg ngnnn 255325RNAArtificialOligonucleotide 53gnnnnnggnn nngnnggngn nnnng 255430RNAArtificialOligonucleotide 54nngnnnnngg nnnngnnggn gnnnnngnnn 305530RNAArtificialOligonucleotide 55nngnngnnnn nggnnnngnn ggngnnnnng 305633RNAArtificialOligonucleotide 56nnnnngnngn nnnnggnnnn gnnggngnnn nng 335724RNAArtificialOligonucleotide 57gngnnnnnnn nnnngnngnn nnnn 245825RNAArtificialOligonucleotide 58nnngngnnnn nnnnnnngnn gnnnn 255924RNAArtificialOligonucleotide 59ngnnnnnngn nggnnnnngg nngn 246024RNAArtificialOligonucleotide 60nnnnnngnng gnnnnnggnn gnng 246124RNAArtificialOligonucleotide 61nnnngnnggn nnnnggnngn ngnn 246224RNAArtificialOligonucleotide 62nngnnggnnn nnggnngnng nnnn 246313RNAArtificialOligonucleotide 63nnnnnnnnnn ngn 136415RNAArtificialOligonucleotide 64ngnnnnngnn ngnnn 156511RNAArtificialOligonucleotide 65nnnnnnnggn n 116614RNAArtificialOligonucleotide 66nnnngnnnnn ngnn 146720RNAArtificialOligonucleotide 67nnnnnnnnnn ngnnnngnnn 206813RNAArtificialOligonucleotide 68nnnnnnnnnn ngn 136912RNAArtificialOligonucleotide 69nnngnnnngn nn 127020RNAArtificialOligonucleotide 70nnngnngnng nnnnnngnnn 207120RNAArtificialOligonucleotide 71ngnngnnnnn ngnnnnnnng 207220RNAArtificialOligonucleotide 72gnngnngnnn nnngnnnnnn 207313RNAArtificialOligonucleotide 73nnggnngnng gnn 137412RNAArtificialOligonucleotide 74nggnngnngg nn 127510RNAArtificialOligonucleotide 75ngngnnggnn 107614RNAArtificialOligonucleotide 76ngnnggnnnn nnnn 147710RNAArtificialOligonucleotide 77nnnnnnnnnn 107815RNAArtificialOligonucleotide 78nnngngnnnn nnnnn 157913RNAArtificialOligonucleotide 79nngngnnnnn nnn 138010RNAArtificialOligonucleotide 80ngnnnnnnnn 108110RNAArtificialOligonucleotide 81ngnnnnnngn 108220RNAArtificialOligonucleotide 82gnngnnnnng gnnnngnngg 208320RNAArtificialOligonucleotide 83nnnnggnnnn gnnggngnnn 208417RNAArtificialOligonucleotide 84nnnnnggnnn ngnnggn 178516RNAArtificialOligonucleotide 85ngnnnnnnnn nnngnn 168611RNAArtificialOligonucleotide 86ngnnnnnnnn n 118722RNAArtificialOligonucleotide 87ngnnnnnngn nggnnnnngg nn 228811RNAArtificialOligonucleotide 88ngnnnnnngn n 118911RNAArtificialOligonucleotide 89nnnnngnngg n 119012RNAArtificialOligonucleotide 90nggnnnnngg nn 129125RNAArtificialOligonucleotide 91guugccuccg guucugaagg uguuc 259225RNAArtificialOligonucleotide 92guugnnunng guunugaagg uguun 259325RNAArtificialOligonucleotide 93caacaucaag gaagauggca uuucu 259419RNAArtificialOligonucleotide 94gccauuucuc aacagaucu 199520RNAArtificialOligonucleotide 95ucagcuucug uuagccacug 209620RNAArtificialOligonucleotide 96uuuguauuua gcauguuccc 209723RNAArtificialOligonucleotide 97auucucagga auuugugucu uuc 239823RNAArtificialOligonucleotide 98ccauuuguau uuagcauguu ccc 239921RNAArtificialOligonucleotide 99ucucaggaau uugugucuuu c 2110023RNAArtificialOligonucleotide 100gccauuucuc aacagaucug uca 2310125RNAArtificialOligonucleotide 101uuugccgcug cccaaugcca uccug 2510224RNAArtificialOligonucleotide 102uugccgcugc ccaaugccau ccug 2410325RNAArtificialOligonucleotide 103uugccgcugc ccaaugccau ccugg 2510423RNAArtificialOligonucleotide 104ugccgcugcc caaugccauc cug 2310524RNAArtificialOligonucleotide 105ugccgcugcc caaugccauc cugg 2410622RNAArtificialOligonucleotide 106gccgcugccc aaugccaucc ug 2210722RNAArtificialOligonucleotide 107ccgcugccca augccauccu gg 2210825RNAArtificialOligonucleotide 108uuugccncug cccaaugcca uccug 2510925RNAArtificialOligonucleotide 109caguuugccg cugcccaaug ccauc 2511030RNAArtificialOligonucleotide 110caguuugccg cugcccaaug ccauccugga 3011120RNAArtificialOligonucleotide 111ucaaggaaga uggcauuucu 2011217RNAArtificialOligonucleotide 112uggcauuucu aguuugg 1711322RNAArtificialOligonucleotide 113caucaaggaa gauggcauuu cu 2211425RNAArtificialOligonucleotide 114caacaucaag gaagauggca uuucu 2511523RNAArtificialOligonucleotide 115ccucugugau uuuauaacuu gau 2311623RNAArtificialOligonucleotide 116ccagagcagg uaccuccaac auc 2311730RNAArtificialOligonucleotide 117acaucaagga agauggcauu ucuaguuugg 3011825RNAArtificialOligonucleotide 118acaucaagga agauggcauu ucuag 2511925RNAArtificialOligonucleotide 119cucuugauug cuggucuugu uuuuc 2512022RNAArtificialOligonucleotide 120gguaaugagu ucuuccaacu gg 2212125RNAArtificialOligonucleotide 121ucuugauugc uggucuuguu uuuca 2512225RNAArtificialOligonucleotide 122uuccaacugg ggacgccucu guucc 2512325RNAArtificialOligonucleotide 123uguucuagcc ucuugauugc ugguc 2512418RNAArtificialOligonucleotide 124cuguugccuc cgguucug 1812522RNAArtificialOligonucleotide 125caacuguugc cuccgguucu ga 2212623RNAArtificialOligonucleotide 126caacuguugc cuccgguucu gaa 2312724RNAArtificialOligonucleotide 127caacuguugc cuccgguucu gaag 2412822RNAArtificialOligonucleotide 128cuguugccuc cgguucugaa gg 2212923RNAArtificialOligonucleotide 129cuguugccuc cgguucugaa ggu 2313024RNAArtificialOligonucleotide 130cuguugccuc cgguucugaa ggug 2413125RNAArtificialOligonucleotide 131cuguugccuc cgguucugaa ggugu 2513225RNAArtificialOligonucleotide 132guugccuccg guucugaagg uguuc 2513325RNAArtificialOligonucleotide 133gccuccgguu cugaaggugu ucuug 2513430RNAArtificialOligonucleotide 134uugccuccgg uucugaaggu guucuuguac 3013530RNAArtificialOligonucleotide 135cuguugccuc cgguucugaa gguguucuug 3013633RNAArtificialOligonucleotide 136caacuguugc cuccgguucu gaagguguuc uug 3313724RNAArtificialOligonucleotide 137gaguuucuuc caaagcagcc ucuc 2413825RNAArtificialOligonucleotide 138uaugaguuuc uuccaaagca gccuc 2513924RNAArtificialOligonucleotide 139agcauccugu aggacauugg cagu 2414024RNAArtificialOligonucleotide 140cauccuguag gacauuggca guug 2414124RNAArtificialOligonucleotide 141uccuguagga cauuggcagu uguu 2414224RNAArtificialOligonucleotide 142cuguaggaca uuggcaguug uuuc 2414313RNAArtificialOligonucleotide 143auuucucaac aga 1314415RNAArtificialOligonucleotide 144agcuucuguu agcca 1514511RNAArtificialOligonucleotide 145auucucagga a 1114614RNAArtificialOligonucleotide 146auuuguauuu agca 1414720RNAArtificialOligonucleotide 147auuucucaac agaucuguca 2014813RNAArtificialOligonucleotide 148auuucucaac aga 1314912RNAArtificialOligonucleotide 149acagaucugu ca 1215020RNAArtificialOligonucleotide 150uuugccgcug cccaaugcca 2015120RNAArtificialOligonucleotide 151cgcugcccaa ugccauccug 2015220RNAArtificialOligonucleotide 152gccgcugccc aaugccaucc 2015313RNAArtificialOligonucleotide 153aaggaagaug gca 1315412RNAArtificialOligonucleotide 154aggaagaugg ca 1215510RNAArtificialOligonucleotide 155agagcaggua 1015614RNAArtificialOligonucleotide 156agcagguacc ucca 1415710RNAArtificialOligonucleotide 157accuccaaca 1015815RNAArtificialOligonucleotide 158aaugaguucu uccaa 1515913RNAArtificialOligonucleotide 159augaguucuu cca 1316010RNAArtificialOligonucleotide 160aguucuucca 1016110RNAArtificialOligonucleotide 161agccucuuga 1016220RNAArtificialOligonucleotide 162guugccuccg guucugaagg 2016320RNAArtificialOligonucleotide 163cuccgguucu gaagguguuc 2016417RNAArtificialOligonucleotide 164ccuccgguuc ugaaggu 1716516RNAArtificialOligonucleotide 165aguuucuucc aaagca 1616611RNAArtificialOligonucleotide 166aguuucuucc a 1116722RNAArtificialOligonucleotide 167agcauccugu aggacauugg ca 2216811RNAArtificialOligonucleotide 168agcauccugu a 1116911RNAArtificialOligonucleotide 169auccuguagg a 1117012RNAArtificialOligonucleotide 170aggacauugg ca 1217122RNAArtificialOligonucleotide 171gguaaugagu unuunnaanu gg 2217222RNAArtificialOligonucleotide 172ggnaangagn ncnnccaacn gg 2217322RNAArtificialOligonucleotide 173ggunnugngu ucuuccnncu gg 2217422RNAArtificialOligonucleotide 174ggnaangagn nnnnnnaann gg 2217522RNAArtificialOligonucleotide 175ggunnugngu unuunnnnnu gg 2217622RNAArtificialOligonucleotide 176ggnnnngngn ncnnccnncn gg 2217722RNAArtificialOligonucleotide 177ggnnnngngn nnnnnnnnnn gg 2217825RNAArtificialOligonucleotide 178uguunuagnn unuugauugn uggun 2517925RNAArtificialOligonucleotide 179ngnncnagcc ncnnganngc nggnc 2518025RNAArtificialOligonucleotide 180uguucungcc ucuugnuugc ugguc 2518125RNAArtificialOligonucleotide 181ngnnnnagnn nnnnganngn nggnn 2518225RNAArtificialOligonucleotide 182uguunungnn unuugnuugn uggun 2518325RNAArtificialOligonucleotide 183ngnncnngcc ncnngnnngc nggnc 2518425RNAArtificialOligonucleotide 184ngnnnnngnn nnnngnnngn nggnn 2518524RNAArtificialOligonucleotide 185gaguuunuun naaagnagnn unun 2418624RNAArtificialOligonucleotide 186gagnnncnnc caaagcagcc ncnc 2418724RNAArtificialOligonucleotide 187gnguuucuuc cnnngcngcc ucuc 2418824RNAArtificialOligonucleotide 188gagnnnnnnn naaagnagnn nnnn 2418924RNAArtificialOligonucleotide 189gnguuunuun nnnngnngnn unun 2419024RNAArtificialOligonucleotide 190gngnnncnnc cnnngcngcc ncnc 2419124RNAArtificialOligonucleotide 191gngnnnnnnn nnnngnngnn nnnn 2419224RNAArtificialOligonucleotide 192agnaunnugu agganauugg nagu 2419324RNAArtificialOligonucleotide 193agcanccngn aggacanngg cagn 2419424RNAArtificialOligonucleotide 194ngcnuccugu nggncnuugg cngu 2419524RNAArtificialOligonucleotide 195agnannnngn aggananngg nagn 2419624RNAArtificialOligonucleotide 196ngnnunnugu nggnnnuugg nngu 2419724RNAArtificialOligonucleotide 197ngcnnccngn nggncnnngg cngn 2419824RNAArtificialOligonucleotide 198ngnnnnnngn nggnnnnngg nngn 2419925RNAArtificialOligonucleotide 199guugnnunng guunugaagg uguun 2520025RNAArtificialOligonucleotide 200uuugnngnug nnnaaugnna unnug 2520125RNAArtificialOligonucleotide 201nunuugauug nuggunuugu uuuun 2520220RNAArtificialOligonucleotide 202ncaaggaaga nggcannncn 2020320RNAArtificialOligonucleotide 203nnaaggaaga nggnannnnn 2020420RNAArtificialOligonucleotide 204ncagcnncng nnagccacng 2020520RNAArtificialOligonucleotide 205nnagnnnnng nnagnnanng 2020620RNAArtificialOligonucleotide 206ucnnggnngn uggcnuuucu 2020720RNAArtificialOligonucleotide 207ucngcuucug uungccncug 2020820RNAArtificialOligonucleotide 208unagnuunug uuagnnanug 2020925RNAArtificialOligonucleotide 209nnngnngnng nnnaangnna nnnng 2521025RNAArtificialOligonucleotide 210uuugccgcug cccnnugccn uccug 2521125RNAArtificialOligonucleotide

211gnngccnccg gnncngaagg ngnnc 2521225RNAArtificialOligonucleotide 212gnngnnnnng gnnnngaagg ngnnn 2521325RNAArtificialOligonucleotide 213guugccuccg guucugnngg uguuc 2521420RNAArtificialOligonucleotide 214ggccaaaccn cggcnnaccn 2021520RNAArtificialOligonucleotide 215unaaggaaga uggnauuunu 2021620RNAArtificialOligonucleotide 216ggccaaaccu cggcuuaccu 2021725RNAArtificialOligonucleotide 217guugnnuccg guunugaagg uguun 2521825RNAArtificialOligonucleotide 218guugnnuccg guucugaagg uguuc 2521925RNAArtificialOligonucleotide 219guugcnuccg guunugaagg uguun 25

Claims

1. An oligonucleotide comprising a 2'-O-methyl RNA monomer and a phosphorothioate backbone and comprising a 5-methyluracil and/or a 5-methylcytosine and/or a 2,6-diaminopurine base, said oligonucleotide being able to induce skipping of an exon of the dystrophin pre-mRNA.

2. An oligonucleotide according to claim 1, wherein said oligonucleotide comprises a 5-methylcytosine and/or a 5-methyluracil base.

3. An oligonucleotide according to claim 1, wherein said oligonucleotide comprises a 2,6-diaminopurine base.

4. An oligonucleotide according to claim 1, wherein said oligonucleotide has an improved parameter by comparison to a corresponding oligonucleotide comprising a 2'-O-methyl RNA monomer and a phosphorothioate backbone without a 5-methylcytosine, and a 5-methyluracil and a 2,6-diaminopurine wherein said improved parameter is selected from the group consisting of: increased binding affinity, longer half-life, increased exon skipping activity, increased biostability, wider (intratissue) distribution, increased cellular uptake, increased trafficking, and/or lower immunogenicity.

5. An oligonucleotide according to claim 1, wherein the length of said oligonucleotide is less than 34 nucleotides.

6. An oligonucleotide according to claim 1, wherein said oligonucleotide is reverse complementary to and/or binds to and/or targets and/or hybridizes with at least a part of a dystrophin exon and/or non-exon region.

7. An oligonucleotide according to claim 1, wherein said oligonucleotide comprises or consists of a sequence which is reverse complementary to and/or binds to and/or targets and/or hybridizes at least a part of dystrophin pre-mRNA exons 44 to 55, said oligonucleotide part having from 10 to 33 nucleotides.

8. An oligonucleotide according to claim 7, wherein said oligonucleotide comprises a 2'-O-methyl RNA monomer and a phosphorothioate backbone, said oligonucleotide is represented by a nucleotide or a base sequence comprising or consisting of one of SEQ ID NO: 52, 14-51, 53-90 or by a nucleotide sequence comprising or consisting of a fragment of one of SEQ ID NO: 52, 14-51, 53-90 and said oligonucleotide comprises a 5-methyluracil and/or a 5-methylcytosine and/or a 2,6-diaminopurine base.

9. An oligonucleotide according to claim 8, wherein said oligonucleotide is represented by a nucleotide or a base sequence comprising or consisting of one of SEQ ID NO: 52, 15, 21, 31, 40, 57, or by a nucleotide or a base sequence comprising or consisting of a fragment of one of SEQ ID NO: 52, 15, 21, 31, 40, 57.

10. An oligonucleotide according to claim 8, wherein said oligonucleotide is represented by a nucleotide or a base sequence comprising or consisting of one of SEQ ID NO:92, 171-215, 217, 218, 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of one of SEQ ID NO: 92, 171-215, 217, 218, 219.

11. An oligonucleotide according to claim 10, wherein said oligonucleotide is represented by a nucleotide or a base sequence comprising or consisting of one of SEQ ID NO:92, 171, 173, 185, 187, 200, 206, 207, 208, 210, 213, 217, 218 or 219 or by a nucleotide or a base sequence comprising or consisting of a fragment of one of SEQ ID NO: 92, 171, 173, 185, 187, 200, 206, 207, 208, 210, 213, 217, 218 or 219 said fragment comprising or consisting of at least 10 contiguous nucleotides or bases of SEQ ID NO: 92, 171, 173, 185, 187, 200, 206, 207, 208, 210, 213, 217, 218 or 219 and such fragment having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 nucleotides.

12. A composition comprising an oligonucleotide as defined in claim 1.

13. A composition according to claim 12, comprising at least one excipient that may enhance the targeting and/or delivery of said composition and/or said oligonucleotide to a tissue and/or cell and/or into a tissue and/or cell.

14. A method for preventing, treating, and/or delaying Duchenne Muscular Dystrophy or Becker Muscular Dystrophy by administering an oligonucleotide as defined in claim 1 to a subject in the need thereof.

15. A method for preventing, treating, and/or delaying Duchenne Muscular Dystrophy or Becker Muscular Dystrophy by administering a composition as defined in claim 12 to a subject in the need thereof.