U.S. patent application number 14/345147 was filed with the patent office on 2015-02-12 for methods for increasing production of 3-methyl-2-butenol using fusion proteins.
This patent application is currently assigned to The Regents of the University of California. The applicant listed for this patent is Howard Chou, Jay D. Keasling. Invention is credited to Howard Chou, Jay D. Keasling.
Application Number | 20150044747 14/345147 |
Document ID | / |
Family ID | 47883967 |
Filed Date | 2015-02-12 |
United States Patent
Application |
20150044747 |
Kind Code |
A1 |
Chou; Howard ; et
al. |
February 12, 2015 |
METHODS FOR INCREASING PRODUCTION OF 3-METHYL-2-BUTENOL USING
FUSION PROTEINS
Abstract
The invention relates, in part, to nucleic acid constructs,
genetically modified host cells and methods employing such
constructs and host cells to increase the production of
3-methyl-2-butenol from IPP. Thus, in some aspects, the invention
provides a genetically modified host cell transformed with a
nucleic acid construct encoding a fusion protein comprising a
phosphatase capable of catalyzing the dephosphorylation of
dimethylallyl diphosphate (DMAPP) linked to an IPP isomerase
capable of converting IPP to DMAPP, wherein the nucleic acid
construct is operably linked to a promoter. In some embodiments,
the genetically modified host cell 5 further comprises a nucleic
acid encoding a reductase that is capable of converting
3-methyl-2-butenol to 3-methyl-butanol. In some embodiments, the
reductase is encoded by a nucleic acid construct introduced into
the cell. In some embodiments, the IPP isomerase is a Type I
isomerase. In some embodiments, the IPP isomerase is a Type II
isomerase. In some embodiments, the host cell is selected from a
group of taxonimcal classes consisting of 20 Escherichia,
Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas,
Klebsiella, Proteus, Salmonella, Serratia, Shigella, Rhizobia,
Vitreoscilla, Synechococcus, Synechocystis, and Paracoccus
taxonomical classes. In some embodiments, the host cell is an
Escherichia coli cell. In some embodiments, the host cell is a
fungal cell, such as a yeast cell. In some embodiments, the yeast
cell is a Saccharomyces sp. cell. In some embodiments, the host
cell is an algal, insect or mammalian cell line. In some
embodiments, the phosphatase is nudB from E. coli. In some
embodiments, the IPP isomerase is encoded by an idi gene from E.
coli or idil gene from Saccharomyces cerevisiae.
Inventors: |
Chou; Howard; (Berkeley,
CA) ; Keasling; Jay D.; (Berkeley, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Chou; Howard
Keasling; Jay D. |
Berkeley
Berkeley |
CA
CA |
US
US |
|
|
Assignee: |
The Regents of the University of
California
Oakland
CA
|
Family ID: |
47883967 |
Appl. No.: |
14/345147 |
Filed: |
September 13, 2012 |
PCT Filed: |
September 13, 2012 |
PCT NO: |
PCT/US2012/055165 |
371 Date: |
October 7, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61534816 |
Sep 14, 2011 |
|
|
|
Current U.S.
Class: |
435/160 ;
435/252.2; 435/252.3; 435/252.31; 435/252.33; 435/252.34;
435/254.11; 435/254.2; 435/254.21; 435/257.2; 435/325; 435/348 |
Current CPC
Class: |
C12Y 503/03002 20130101;
C12N 9/90 20130101; C12N 9/16 20130101; Y02E 50/10 20130101; C12N
15/62 20130101; C12P 7/16 20130101 |
Class at
Publication: |
435/160 ;
435/252.33; 435/252.31; 435/252.34; 435/252.3; 435/257.2;
435/254.21; 435/252.2; 435/254.11; 435/254.2; 435/348; 435/325 |
International
Class: |
C12P 7/16 20060101
C12P007/16; C12N 9/16 20060101 C12N009/16; C12N 9/90 20060101
C12N009/90 |
Goverment Interests
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED
RESEARCH AND DEVELOPMENT
[0002] The invention described and claimed herein was made
utilizing funds supplied by the U.S. Department of Energy under
Contract No. DE-AC02-05CH11231. The government has certain rights
in this invention.
Claims
1. A genetically modified host cell transformed with a nucleic acid
construct encoding a fusion protein comprising a phosphatase
capable of catalyzing the dephosphorylation of dimethylallyl
diphosphate (DMAPP) linked to an IPP isomerase capable of
converting IPP to DMAPP, wherein the nucleic acid construct is
operably linked to a promoter.
2. The genetically modified host cell of claim 1, wherein the
genetically modified host cell further comprises a nucleic acid
encoding a reductase that is capable of converting
3-methyl-2-butenol to 3-methyl-butanol.
3. The genetically modified host cell of claim 2, wherein the
reductase is encoded by a nucleic acid construct introduced into
the cell.
4. The genetically modified host cell of claim 1, wherein the IPP
isomerase is a Type I isomerase.
5. The genetically modified host cell of claim 4, wherein the
isomerase is the idi gene from E. coli or idil gene from
Saccharomyces cerevisiae.
6. The genetically modified host cell of claim 1, wherein the
phosphatase is a member of the Nudix superfamily.
7. The genetically modified host cell of claim 6, wherein the
phosphatase is nudB from E. coli.
8. The genetically modified host cell of claim 1, wherein the host
cell is a prokaryotic cell selected from the from the Escherichia,
Enterobacter, Azotobacter, Erwinia, Bacillus, Pseudomonas,
Klebsielia, Proteus, Salmonella, Serratia, Shigella, Rhizobia,
Vitreoscilla, Synechococcus, Synechocystis, or Paracoccus
taxonomical classes.
9. The genetically modified host cell of claim 8, wherein the
prokaryotic cell is an Escherichia coli cell.
10. The genetically modified host cell of claim 1, wherein the host
cell is a fungal cell.
11. The genetically modified host cell of claim 10, wherein the
fungal cell is a yeast cell.
12. The genetically modified host cell of claim 11, wherein the
yeast cell is a Saccharomyces sp. cell.
13. The genetically modified host cell of claim 1, wherein the host
cell is an algal, insect or mammalian cell line.
14. A method of enhancing production of a 3-methyl-2-butenol in a
genetically modified host cell of claim 1, the method comprising
culturing the host cell under conditions such that the culturing
results in the expression of the fusion protein and production of
3-methyl-2-butenol.
15. The method of claim 14, further comprising recovering
3-methyl-2-butenol produced by the cells.
16. The method of claim 1, wherein the genetically modified host
cell comprises a nucleic acid encoding a reductase such that
expression of the reductase converts 3-methyl-2-butenol to 3-methyl
butanol.
17. The method of claim 16, wherein the reductase is encoded by a
nucleic acid construct introduced into the cell.
18. The method of claim 16, further comprising recovering
3-methyl-2-butenol or 3-methyl butanol produced by the cells.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. provisional
application No. 61/534,816, filed Sep. 14, 2011, which application
is herein incorporated by reference for all purposes.
BACKGROUND OF THE INVENTION
[0003] Petroleum derived fuels have been the primary source of
energy for over a hundred years. Petroleum is formed over millions
of years in nature and is a non-renewable source of energy. A
significant amount of research in biofuels has been ongoing for
decades. Within this field, ethanol has been studied intensively as
a gasoline substitute. However, the efficiency of ethanol as a fuel
remains debatable. (Pimentel, Natural Resources Research (2005)
14:65; Farrell et al., Science (2006), 311:506).
[0004] The alcohol 3-methyl-butanol has been demonstrated to be a
potential biofuel in both spark-ignition and homogenous charge
compression ignition (HCCI) engines. The compound can be
synthesized from the isoprenoid pathway by converting the
isoprenoid intermediate isoprenoid precursors isopentyl
pyrophosphate (IPP) to dimethylallyl diphosphate (DMAPP), DMAPP to
3-methyl-2-butenol, and 3-methyl-2-butenol to 3-methyl-butanol
(FIG. 1). The enzymes required for performing each individual step
are: a phosphatase to convert IPP to 3-methyl-3-butenol, a
phosphatase to convert DMAPP to 3-methyl-2-butenol, and a reductase
to convert 3-methyl-2-butenol to 3-methyl-butanol. The enzymes can
be expressed to obtain all of these three 5-carbon alcohols (see,
e.g., U.S. Pat. No. 7,985,567, which is incorporated by reference).
The conversion of IPP to DMAPP requires expression of an IPP
isomerase.
[0005] The present invention relates to compositions and methods
for expressing IPP isomerase as a fusion protein linked to a
phosphatase to increase the production of 3-methyl-2-butenol from
IPP and thus provides a method for increasing the production of
3-methyl 2-butanol for biofuel production.
BRIEF SUMMARY OF THE INVENTION
[0006] The invention relates, in part, to nucleic acid constructs,
genetically modified host cells and methods employing such
constructs and host cells to increase the production of
3-methyl-2-butenol from IPP.
[0007] Thus, in some aspects, the invention provides a genetically
modified host cell transformed with a nucleic acid construct
encoding a fusion protein comprising a phosphatase capable of
catalyzing the dephosphorylation of dimethylallyl diphosphate
(DMAPP) linked to an IPP isomerase capable of converting IPP to
DMAPP, wherein the nucleic acid construct is operably linked to a
promoter. In some embodiments, the genetically modified host cell
further comprises a nucleic acid encoding a reductase that is
capable of converting 3-methyl-2-butenol to 3-methyl-butanol. In
some embodiments, the reductase is encoded by a nucleic acid
construct introduced into the cell. In some embodiments, the IPP
isomerase is a Type I isomerase. In some embodiments, the IPP
isomerase is a Type II isomerase. In some embodiments, the host
cell is selected from a group of taxonimcal classes consisting of
Escherichia, Enterobacter, Azotobacter, Erwinia, Bacillus,
Pseudomonas, Klebsielia, Proteus, Salmonella, Serratia, Shigella,
Rhizobia, Vitreoscilla, Synechococcus, Synechocystis, and
Paracoccus taxonomical classes. In some embodiments, the host cell
is an Escherichia coli cell. In some embodiments, the host cell is
a fungal cell, such as a yeast cell. In some embodiments, the yeast
cell is a Saccharomyces sp. cell. In some embodiments, the host
cell is an algal, insect or mammalian cell line. In some
embodiments, the phosphatase is nudB from E. coli. In some
embodiments, the IPP isomerase is encoded by an idi gene from E.
coli or idil gene from Saccharomyces cerevisiae.
[0008] In a further aspect, the invention provides a method of
producing 3-methyl-2-butenol in a genetically modified host cell of
as described herein, wherein the genetically modified host cell
comprises a nucleic acid construct encoding a fusion protein
comprising a phosphatase capable of catalyzing the
dephosphorylation of dimethylallyl diphosphate (DMAPP) linked to an
IPP isomerase capable of converting IPP to DMAPP, the method
comprising culturing the host cell under conditions such that the
culturing results in the expression of the fusion protein and
production of 3-methyl-2-butenol. In some embodiments, the method
further comprises recovering 3-methyl-2-butenol produced by the
cells. In some embodiments, the genetically modified host cell
comprises a nucleic acid encoding a reductase such that expression
of the reductase converts 3-methyl-2-butenol to 3-methyl butanol.
In some embodiments, such a method further comprises recovering
3-methyl-2-butenol or 3-methyl butanol produced by the cells.
[0009] In an additional aspect, the invention provides a nucleic
acid encoding a fusion construct comprising a phosphatase capable
of catalyzing the dephosphorylation of dimethylallyl diphosphate
(DMAPP) linked to an IPP isomerase capable of converting IPP to
DMAPP. In some embodiments, the nucleic acid construct is operably
linked to a promoter. In some embodiments, the nucleic acid
construct is contained within an expression vector that is capable
of replicating in a host cell. In some embodiments, the phosphatase
is nudB from E. coli. In some embodiments, the IPP isomerase is
encoded by an idi gene from E. coli or idil from Saccharomyces
cerevisiae.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] FIG. 1 provides a schematic depicting the synthesis of
3-methyl-butanol from the isoprenoid pathway by converting the
isoprenoid intermediate IPP to DMAPP, DMAPP to 3-methyl-2-butenol,
and 3-methyl-2-butenol to 3-methyl-butanol.
[0011] FIG. 2 provides data showing that independent expression of
a heterologous IPP isomerase reduces the production of
3-methyl-3-butenol.
[0012] FIG. 3 provides data showing that fusion proteins in which a
phosphatase is fused of an isopentyl diphosphate isomerase (IDI)
increases production of 3-methyl-3-butenol in the presence of IDI,
and leads to production of 3-methyl-2-butenol.
DETAILED DESCRIPTION OF THE INVENTION
[0013] Before the invention is described in detail, it is to be
understood that, unless otherwise indicated, this invention is not
limited to particular sequences, expression vectors, enzymes, host
microorganisms, or processes, as such may vary. It is also to be
understood that the terminology used herein is for purposes of
describing particular embodiments only, and is not intended to be
limiting.
[0014] In order to more fully appreciate the invention the
following definitions are provided.
[0015] As used in the specification and the appended claims, the
singular forms "a," "an," and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to an "expression vector" includes a single expression
vector as well as a plurality of expression vectors, either the
same (e.g., the same operon) or different; reference to "cell"
includes a single cell as well as a plurality of cells; and the
like.
[0016] The terms "optional" or "optionally" as used herein mean
that the subsequently described feature or structure may or may not
be present, or that the subsequently described event or
circumstance may or may not occur, and that the description
includes instances where a particular feature or structure is
present and instances where the feature or structure is absent, or
instances where the event or circumstance occurs and instances
where it does not.
[0017] The terms "host cell" and "host microorganism" are used
interchangeably herein to refer to a living biological cell that
can be transformed via insertion of an expression vector. Thus, a
host organism or cell as described herein may be a prokaryotic
organism (e.g., an organism of the kingdom Eubacteria) or a
eukaryotic cell. As will be appreciated by one of ordinary skill in
the art, a prokaryotic cell lacks a membrane-bound nucleus, while a
eukaryotic cell has a membrane-bound nucleus.
[0018] The term "heterologous DNA" as used herein refers to a
polymer of nucleic acids wherein at least one of the following is
true: (a) the sequence of nucleic acids is foreign to (i.e., not
naturally found in) a given host microorganism; (b) the sequence
may be naturally found in a given host microorganism, but in an
unnatural (e.g., greater than expected) amount; or (c) the sequence
of nucleic acids comprises two or more subsequences that are not
found in the same relationship to each other in nature. For
example, regarding instance (c), a heterologous nucleic acid
sequence that is recombinantly produced will have two or more
sequences from unrelated genes arranged to make a new functional
nucleic acid. Specifically, the present invention describes the
introduction of an expression vector into a host microorganism,
wherein the expression vector contains a nucleic acid sequence
coding for an enzyme that is not normally found in a host
microorganism. With reference to the host microorganism's genome,
then, the nucleic acid sequence that codes for the enzyme is
heterologous.
[0019] In the present invention, the terms "isopenty pyrophosate
(IPP) isomerase", "IPP isomerase", "isopentenyl diphosphate
isomerase, and "IDI" are used interchangeably to refer to an enzyme
that catalyzes the interconversion of isopentenyl diphosphate (IPP)
and dimethyl allyl diphosphate (DMAPP) (e.g., converting IPP into
DMAPP and/or converting DMAPP into IPP). Standard methods such as
those described herein and in the examples are used to assess
whether a polypeptide has IPP isomerase activity by measuring the
ability of the polypeptide to interconvert IPP and DMAPP in vitro,
in a cell extract, or in vivo. Examples of IPP isomerase
polypeptides and nucleic acids and methods of measuring IPP
isomerase activity include, but are not limited to, those described
in WO 2009/076676, U.S. Patent Application Publication No.
2009/0203102, WO 2010/003007, U.S. Patent Application Publication.
No. 2010/0048964, WO 2009/132220, and U.S. Patent Application No.
2010/0003716. In the present invention an IPP isomerase capable of
converting to IPP to DMAPP is not limited to converting IPP to
DMAPP, but may also convert DMAPP to IPP.
[0020] In the present invention, a suitable phosphatase enzyme has
an enzymatic activity for cleaving a pyrophosphate from IPP or
cleaving a single phosphate multiple times from IPP. In some
embodiments, phosphatases that are members of the Nudix hydrolase
superfamily or haloacid dehalogenase (HAD) superfamily are
employed. In the present invention, a phosphatase that capable of
catalyzing the dephosphorylation of dimethylallyl diphosphate
(DMAPP) to 3-methyl-2-butenol is not limited to converting DMAPP to
3-methyl-2-butenol, but may also catalyze the conversion of IPP to
3-methyl-3-butenol.
[0021] The term "mevalonate pathway" is used herein to refer to the
pathway that converts acetyl-CoA to isopentenyl pyrophosphate
through a mevalonate intermediate.
[0022] The terms "expression vector" or "vector" refer to a
compound and/or composition that transduces, transforms, or infects
a host microorganism, thereby causing the cell to express nucleic
acids and/or proteins other than those native to the cell, or in a
manner not native to the cell. An "expression vector" contains a
sequence of nucleic acids (ordinarily RNA or DNA) to be expressed
by the host microorganism. Optionally, the expression vector also
comprises materials to aid in achieving entry of the nucleic acid
into the host microorganism, such as a virus, liposome, protein
coating, or the like. The expression vectors contemplated for use
in the present invention include those into which a nucleic acid
sequence can be inserted, along with any preferred or required
operational elements. Further, the expression vector must be one
that can be transferred into a host microorganism and replicated
therein. Preferred expression vectors are plasmids, particularly
those with restriction sites that have been well documented and
that contain the operational elements preferred or required for
transcription of the nucleic acid sequence. Such plasmids, as well
as other expression vectors, are well known to those of ordinary
skill in the art.
[0023] The term "transduce" as used herein refers to the transfer
of a sequence of nucleic acids into a host microorganism or cell.
Only when the sequence of nucleic acids becomes stably replicated
by the cell does the host microorganism or cell become
"transformed." As will be appreciated by those of ordinary skill in
the art, "transformation" may take place either by incorporation of
the sequence of nucleic acids into the cellular genome, i.e.,
chromosomal integration, or by extrachromosomal integration. In
contrast, an expression vector, e.g., a virus, is "infective" when
it transduces a host microorganism, replicates, and (without the
benefit of any complementary virus or vector) spreads progeny
expression vectors, e.g., viruses, of the same type as the original
transducing expression vector to other microorganisms, wherein the
progeny expression vectors possess the same ability to
reproduce.
[0024] The terms "isolated" or "biologically pure" refer to
material that is substantially or essentially free of components
that normally accompany it in its native state.
[0025] As used herein, the terms "nucleic acid sequence," "sequence
of nucleic acids," and variations thereof shall be generic to
polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to
polyribonucleotides (containing D-ribose), to any other type of
polynucleotide that is an N-glycoside of a purine or pyrimidine
base, and to other polymers containing nonnucleotidic backbones,
provided that the polymers contain nucleobases in a configuration
that allows for base pairing and base stacking, as found in DNA and
RNA. Thus, these terms include known types of nucleic acid sequence
modifications, for example, substitution of one or more of the
naturally occurring nucleotides with an analog; internucleotide
modifications, such as, for example, those with uncharged linkages
(e.g., methyl phosphonates, phosphotriesters, phosphoramidates,
carbamates, etc.), with negatively charged linkages (e.g.,
phosphorothioates, phosphorodithioates, etc.), and with positively
charged linkages (e.g., aminoalklyphosphoramidates,
aminoalkylphosphotriesters); those containing pendant moieties,
such as, for example, proteins (including nucleases, toxins,
antibodies, signal peptides, poly-L-lysine, etc.); those with
intercalators (e.g., acridine, psoralen, etc.); and those
containing chelators (e.g., metals, radioactive metals, boron,
oxidative metals, etc.). As used herein, the symbols for
nucleotides and polynucleotides are those recommended by the
IUPAC-IUB Commission of Biochemical Nomenclature (Biochem. 9:4022,
1970).
[0026] The term "operably linked" refers to a functional linkage
between a nucleic acid expression control sequence (such as a
promoter) and a second nucleic acid sequence, wherein the
expression control sequence directs transcription of the nucleic
acid corresponding to the second sequence.
[0027] "Alga," "algal," and "microalgae" or the like, refers to
plants belonging to the subphylum Algae of the phylum Thallophyta.
The algae are unicellular, photosynthetic, oxygenic algae and are
non-parasitis plants without roots, stems, or leaves; they contain
chlorophyll and have a great variety in size, from microscopic to
large seaweeds. Green algae, belonging to
Eukaryota--Viridiplantae--Chlorophyta--Chlorophyceae, can be used
in the invention. However, algae useful in the invention may also
be blue-green, red, or brown.
Introduction
[0028] The present invention provides methods for increasing
production of 3-methyl-2-butenol in a de novo synthetic pathway, in
a genetically modified host cell, using isopentenyl disphosphate
(IPP) as a substrate. IPP can be derived from the non-mevalonate as
well as mevalonate pathways. The invention provides genetically
modified cells that have been modified to be capable of expression
a fusion protein that comprises an IPP isomerase fused to a
phosphatase.
[0029] In a further aspect, the invention also thus provides a
nucleic acid encoding a fusion protein comprising a phosphatase
fused to an IPP isomerase and genetically modified host cells
containing the nucleic acid such that expression of the fusion
protein results in increased levels of 3-methyl-2-butenol.
[0030] The invention employs routine techniques in the field of
recombinant nucleic acid technology. Basic texts disclosing the
general methods of use in this invention include Sambrook &
Russell, Molecular Cloning, A Laboratory Manual (3rd Ed, 2001);
Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990);
and Current Protocols in Molecular Biology (Ausubel et al., eds.,
1994-2009, Wiley Interscience).
Enzymes Present in Fusion Constructs
Phosphatases
[0031] A phosphatase, or homologous enzyme thereof, that is capable
of catalyzing the dephosphorylation of IPP is employed in a fusion
construct of the invention. A homologous enzyme is an enzyme that
has a polypeptide sequence that is at least 70%, 75%, 80%, 85%,
90%, 95% or 99% identical to any one of the phosphatase enzymes
described in this specification or in an incorporated reference.
The homologous enzyme retains amino acids residues that are
recognized as conserved for the enzyme and that are necessary for
phosphatase activity. The homologous enzyme may have non-conserved
amino acid residues replaced or found to be of a different amino
acid, or amino acid(s) inserted or deleted, but which does not
affect or has insignificant effect on the enzymatic activity of the
homologous enzyme. The homologous enzyme has an enzymatic activity
that is identical or essentially identical to the enzymatic
activity any one of the enzymes described in this specification or
in an incorporated reference. The homologous enzyme may be found in
nature or be an engineered mutant thereof.
[0032] In the present invention, a suitable phosphatase enzyme has
an enzymatic activity for cleaving a pyrophosphate from IPP or
cleaving a single phosphate multiple times from IPP. Example of
suitable phosphatase enzymes include broad specificity
phosphatases, such as PhoE (YhfR) of a Bacillus sp., e.g., PhoE
(YhfR) of Bacillus stearothermophilus (such as strains NGB101 and
10; Ridgen et al., Protein Sci. 2001, 10:1835-1846, which is
incorporated in its entirety by reference), Bacillus halodurans
(Takami et al., Nucleic Acids Res. (2000) 28:4317-4331, which is
incorporated in its entirety by reference) or Bacillus subtilus
(Kunst et al., Nature (1997), 390:249-256; Pearson et al., J.
Bacteriol. (2000) 182:4121-4123; which are incorporated in their
entireties by reference). The amino acid sequences are disclosed in
Rigden et al. (Protein Sci. (2001) 10:1835-1846), which are
incorporated in their entireties by reference. In some embodiments,
the suitable phosphatase is about 190 to 210, or about 192 to 209,
amino acids in length. A homologous enzyme comprises the conserved
amino acid residues and sequences identified in U.S. Pat. No.
7,985,567 and in Rigden et al. (Protein Sci. (2001) 10:1835-1846).
In some embodiments, a conserved amino acid sequence is RHG; RHGE;
RHGE(T or S); RHGE(T or S)(W or G)N; or RHGX.sub.4N (where X is any
amino acid). In some embodiments, a conserved amino acid sequence
is RHGEX.sub.3NX.sub.42RX.sub.23EX.sub.56-67H (where X is any amino
acid). In some embodiments, a conserved amino acid sequence is
RHGEX.sub.3NX.sub.5QG (where X is any amino acid). In some
embodiments, a conserved amino acid sequence is
RHGX.sub.4NX.sub.7-9DX.sub.2LX.sub.3G (where X is any amino acid).
Further conserved amino acid sequences of the phosphatase are shown
in FIG. 1 of Rigden et al. (Protein Sci. (2001) 10:1835-1846).
[0033] Two exemplary enzyme superfamilies with members able to
catalyze the hydrolysis of phosphoester bonds are Nudix (Mildvan et
al, Arch. Biochem. Biophysics (2005) 433:129) and haloacid
dehalogenase (HAD) (Allen and Dunaway-Mariano, Trends Biochem. Sci.
(2004) 29:495). (see Table 1). Another superfamily able to
hydrolyze phosphoester bonds is the cofactor-dependent
phosphoglycerate mutase (Rigden et al., J. Mol. Biol. (2003)
324:411). Other protein families able to dephosphorylate IPP and
DMAPP can be used with the current invention.
[0034] In some embodiments suitable phosphatases are members of the
Nudix hydrolase superfamily from, but not limited to, Escherichia
sp., Bacillus sp., Pseudomonas sp., Lactococcus sp., Caulobacter
sp., Agrobacterium sp., Synechocytis sp., Streptomyces sp.,
Saccharomyces sp., human, and mouse. An exemplar nucleic acid
sequence of Nudix hydrolase family is found at GenBank accession
No. NP.sub.--009669. In some embodiments the Nudix superfamily
recognizes the general substrate motif nucleoside diphosphate
linked to another moiety. In some embodiments the Nudix enzymes
have a conserved 23-amino acid catalytic motif (Nudix box),
consisting of the consensus sequence
GX.sub.5EX.sub.5[UA]XREX.sub.2EEXGU, where U is an aliphatic,
hydrophobic residue and X is any amino acid (McLennan, A. G., Cell
Mol. Life. Sci. (2006) 63:123). There also exist individuals in the
superfamily with slightly altered consensus residues. Examples of
Nudix hydrolases from E. coli are listed in Table 1, but are not
intended to limit the scope of the present invention.
[0035] In some embodiments suitable phosphatases are members of the
halocid dehalogenase (HAD) superfamily from, but not limited to,
Escherichia sp., Bacillus sp., Pseudomonas sp., Lactococcus sp.,
Caulobacter sp., Agrobacterium sp., Synechocytis sp., Streptomyces
sp., Saccharomyces sp., human, and mouse. HADs have 10-30% sequence
similarity can be identified from three short conserved sequence
motifs that include a conserved aspartic acid, a serine/threonine,
a lysine, and a nucleophile, such as an aspartic acid or serine.
The consensus sequence for the amino acid sequence motifs are
disclosed in FIG. 2 of Koonin and Tatusov, J. Mol. Biol. (1994)
244:125; which are incorporated in their entireties by reference)
and Supplementary FIG. 1 of Kuznetsova, et al., (J. Biol. Chem.
(2006) 281:36149; which is incorporated in their entireties by
reference). Examples of HADs from E. coli are listed in Table 1,
but are not meant to limit the scope of the present invention.
TABLE-US-00001 TABLE 1 Superfamily Organism Name HAD E. coli YniC
(HAD1) E. coli YfbT (HAD2) E. coli YieH (HAD3) E. coli YihX (HAD4)
E. coli YjjG (HAD5) E. coli YqaB (HAD6) E. coli YigB (HAD7) E. coli
YlrG (HAD8) E. coli SerB (HAD9) E. coli Gph (HAD10) E. coli YcjU
(HAD11) E. coli YbiV (HAD12) E. coli YidA (HAD13) E. coli YbhA
(HAD14) E. coli YbjI (HAD15) E. coli YigL (HAD16) E. coli OtsB
(HAD17) E. coli Cof (HAD18) E. coli YedP (HAD19) E. coli YaeD
(HAD20) E. coli HisB (HAD21) E. coli YrbI (HAD22) Nudix E. coli
NudA (MutT) E. coli NudB E. coli NudC E. coli NudD (Gmm) E. coli
NudE E. coli NudF E. coli NudG E. coli NudH (RppH) E. coli NudI
(YfaO) E. coli NudJ (YmfB) E. coli NudK (YffH) E. coli NudL
(YeaB)
Isomerases
[0036] An IPP isomerase, or homologous enzyme thereof, that is
capable of catalyzing the conversion of IPP to DMAPP is employed in
a fusion construct of the invention. A homologous enzyme is an
enzyme that has a polypeptide sequence that is at least 70%, 75%,
80%, 85%, 90%, 95% or 99% identical to any one of the IPP isomerase
enzymes described in this specification or in an incorporated
reference. The homologous enzyme retains amino acids residues that
are recognized as conserved for the enzyme and that are necessary
for IPP isomerase activity. The homologous enzyme may have
non-conserved amino acid residues replaced or found to be of a
different amino acid, or amino acid(s) inserted or deleted, but
which does not affect or has insignificant effect on the enzymatic
activity of the homologous enzyme. The homologous enzyme has an
enzymatic activity that is identical or essentially identical to
the enzymatic activity any one of the enzymes described in this
specification or in an incorporated reference. The homologous
enzyme may be found in nature or be an engineered mutant thereof.
The structures of various IPP isomerase has been determined. The
enzymes are well characterized with respect to the catalytic site
and residues important for activity (see, e.g., Zhen et al., J.
Mol. Biol. 366:1447-1458, 2007; Zhang et al., J. Mol. Biol.
366:1437-1446, 2007; Street, et al., Biochemistry 33 (14):
4212-4217, 1994; Wouters, et al., J. Biol. Chem. 278 (14):
11903-11908, 2003; Bonanno, et al., Proc. Natl. Acad Sci USA 98:
12896-12901, 2001).
[0037] An IPP isomerase encoded by a construct of the invention
catalyzes the interconversion of IPP and DMAPP. IPP isomerase
enzymes are classified under the E.C. number 5.3.3.2. IPP
isomerases are also referred to as isopentenyl-diphosphate
delta-isomerases, isopentenylpyrophosphate delta-isomerases,
isopentenylpyrophosphate isomerases, and methylbutenylpyrophosphate
isomerases. Any enzyme with IPP isomerase activity can be used in
the fusion protein with an enzyme with phosphatase activity with
any flexible peptide linker. An enzyme with IPP isomerase activity
can be either Type I or Type II. Type I are commonly found in
Eukaryota and Eubacteria, such as (but not limited to) Escherichia
coli, Saccharomyces cerevisiae, Homo sapiens, Salmonella enterica,
Arabidopsis thaliana, Bacillus subtilis, Rhodobacter capsulatus,
Citrobacter rodentium, Klebsiella pneumoniae, Enterobacter
asburiae, Pichia pastoris. Type I IPP isomerases utilize a divalent
metal (typically Mn.sup.2+, Mg.sup.2+, or Ca.sup.2+). in a
protonation-deprotonation reaction. Type II IPP isomerases are
commonly found in Archaea and some bacteria, such as (but not
limited to) Synechocystis sp., Methanothermobacter
thermautotrophicus, Sulfolobus shibatae, Streptomyces sp.,
Staphylococcus aureus. Type II enzymes employ reduced flavin and
metal cofactors (e.g., Mn.sup.2+, Mg.sup.2+, or Ca.sup.2+).
[0038] Examples of Type I IPP isomerases that can be used in the
invention, include, but are not limited to, the sequences
identified by the following accession numbers: Escherichia coli
(NP.sub.--417365), Saccharomyces cerevisiae (NP.sub.--015208), Homo
sapiens (NP.sub.--004499), Mus musculus (NP.sub.--663335),
Salmonella enterica (NP.sub.--806649), Arabidopsis thaliana
(NP.sub.--197148), Bacillus subtilis (NP.sub.--390168),
Caenorhabditis elegans (NP.sub.--498766), Streptomyces coelicolor
(NP.sub.--630823). In some embodiments, the Type I isomerase is
from bacteria or a fungus, such as a yeast.
[0039] Examples of Type II IPP isomerases that can be used in the
invention, include, but are not limited to, the sequences
identified by the following accession numbers: Synechocystis sp.
(NP.sub.--441701), Methanothermobacter thermautotrophicus
(NP.sub.--275191), Sulfolobus solfataricus (NP.sub.--341634), and
Staphylococcus aureus (NP.sub.--375459).
[0040] Additional examples of IPP isomerases suitable for use in
the invention include those shown in in the sequence alignment FIG.
3 of Bonanno et al. Proc. Natl. Acad. Sci. USA 98: 12896-12901,
2001.
[0041] In some embodiments, an IPP isomerase for use in the
invention, e.g., encoded by an idi gene such as an E. coli or
Saccharomyces idil gene, require one Mn.sup.2+ or Mg.sup.2+ ion in
its active site to fold into an active conformation and also
contains a sequence related to the Nudix motif, a highly conserved
23-residue block (GX.sub.5EX.sub.7REUXEEXGU, where X is any residue
and U=I, L or V), that functions as a metal binding and catalytic
site. In some embodiments, an IPP isomerase protein comprised by a
fusion protein of the invention contains a similar conserved motif
Gly-X.sub.3-Ala-X2-Arg-Arg/Lys-.phi.-X.sub.2-Glu-Leu-Gly-.phi.
(see, e.g., Bonanno et al. Proc. Natl. Acad. Sci. USA 98:
12896-12901, 2001). The metal binding site is present within the
active site and plays structural and catalytical roles. As
explained above, IPP isomerases are well represented in several
bacteria, archaebacteria and eukaryotes, including fungi, mammals
and plants. Despite sequence variations (mainly at the N-terminus),
the core structure is highly conserved.
Constructs
[0042] The nucleic acid constructs of the present invention
comprise fusion proteins encoding a phosphatase and an IPP
isomerase. The nucleic acids encoding the fusion protein is
operably linked to a promoter and optionally, additional control
sequences, such that the subject fusion protein is expressed in a
host cell cultured under suitable conditions. The promoters and
control sequences employed in generating a nucleic acid construct
encoding a fusion protein of the invention are specific for each
host cell species. In some embodiments, expression vectors comprise
the nucleic acid constructs. Methods for designing and making
nucleic acid constructs and expression vectors are well known to
those skilled in the art.
[0043] Sequences of nucleic acids encoding the subject enzymes are
prepared by any suitable method known to those of ordinary skill in
the art, including, for example, direct chemical synthesis or
cloning. For example, in direct chemical synthesis,
oligonucleotides of up to about 40 bases are individually
synthesized, then joined (e.g., by enzymatic or chemical ligation
methods, or polymerase-mediated methods) to form essentially any
desired continuous sequence. Further, commercial services are
available that can supply synthetic genes of the desired
sequence.
[0044] In addition, the desired sequences may be isolated from
natural sources using well known cloning methodology, e.g.,
employing PCR to amplify the desired sequences and join the
amplified regions, e.g., using overlap extension to obtain a gene
encoding an isomerase/phosphatase fusion protein of the
invention.
[0045] The iosmerase and phosphate sequence in the recombinant
fusion protein are typically joined via a linker domain. Such an
amino acid linker sequence is incorporated into the fusion protein
using standard techniques well known in the art. Suitable peptide
linker sequences may be chosen based on the following factors: (1)
their ability to adopt a flexible extended conformation; (2) their
inability to adopt a secondary structure that could interact with
functional epitopes on the first and second polypeptides; and (3)
the lack of hydrophobic or charged residues that might react with
the polypeptide functional epitopes. Typical peptide linker
sequences contain Gly, Ser, Val, Ala, and Thr residues and are well
known in the art. The linker sequence may generally be from 1 to
about 50 amino acids in length, e.g., 3, 4, 6, or 10 amino acids in
length, but can be 100 or 200 amino acids in length. Useful linkers
include glycine-serine polymers including, for example, (GGGGS)n,
(GS)n, (GSGGS)n, and (GGGS)n, where n is an integer of at least
one; glycine-alanine polymers; alanine-serine polymers; and other
flexible linkers. Linker sequences may not be required when the
first and second polypeptides have non-essential N-terminal amino
acid regions that can be used to separate the functional domains
and prevent steric interference. In some embodiments, proline
residues are incorporated into the linker to prevent the formation
of significant secondary structural elements by the linker.
[0046] The nucleic acid sequence encoding the desired fusion
construct comprising the isomerase and phosphatase enzyme can be
incorporated into an expression vector. The invention is not
limited with respect to the process by which the nucleic acid
sequence is incorporated into the expression vector. Those of
ordinary skill in the art are familiar with the necessary steps for
incorporating a nucleic acid sequence into an expression vector. A
typical expression vector contains the desired nucleic acid
sequence preceded by one or more regulatory regions, along with a
ribosome binding site, e.g., a nucleotide sequence that is 3-9
nucleotides in length and located 3-11 nucleotides upstream of the
initiation codon in E. coli. See Shine et al. (1975) Nature 254:34
and Steitz, in Biological Regulation and Development: Gene
Expression (ed. R. F. Goldberger), vol. 1, p. 349, 1979, Plenum
Publishing, N.Y.
[0047] Regulatory regions include, for example, those regions that
contain a promoter and an operator. A promoter is operably linked
to the desired nucleic acid sequence, thereby initiating
transcription of the nucleic acid sequence via an RNA polymerase
enzyme. An operator is a sequence of nucleic acids adjacent to the
promoter, which contains a protein-binding domain where a repressor
protein can bind. In the absence of a repressor protein,
transcription initiates through the promoter. When present, the
repressor protein specific to the protein-binding domain of the
operator binds to the operator, thereby inhibiting transcription.
In this way, control of transcription is accomplished, based upon
the particular regulatory regions used and the presence or absence
of the corresponding repressor protein. Examples include lactose
promoters (Lad repressor protein changes conformation when
contacted with lactose, thereby preventing the LacI repressor
protein from binding to the operator) and tryptophan promoters
(when complexed with tryptophan, TrpR repressor protein has a
conformation that binds the operator; in the absence of tryptophan,
the TrpR repressor protein has a conformation that does not bind to
the operator). Another example is the tac promoter. (See deBoer et
al. (1983) Proc. Natl. Acad. Sci. USA, 80:21-25.) As will be
appreciated by those of ordinary skill in the art, these and other
expression vectors may be used in the present invention, and the
invention is not limited in this respect.
[0048] Although any suitable expression vector may be used to
incorporate the desired sequences, readily available expression
vectors include, without limitation: plasmids, such as pSC101,
pBR322, pBBR1MCS-3, pUR, pEX, pMR100, pCR4, pBAD24, pUC19;
bacteriophages, such as M13 phage and .lamda. phage. Of course,
such expression vectors may only be suitable for particular host
cells. One of ordinary skill in the art, however, can readily
determine through routine experimentation whether any particular
expression vector is suited for any given host cell. For example,
the expression vector can be introduced into the host cell, which
is then monitored for viability and expression of the sequences
contained in the vector. In addition, reference may be made to the
relevant texts and literature, which describe expression vectors
and their suitability to any particular host cell.
[0049] The expression vectors of the invention must be introduced
or transferred into the host cell. Such methods for transferring
the expression vectors into host cells are well known to those of
ordinary skill in the art. For example, one method for transforming
E. coli with an expression vector involves a calcium chloride
treatment wherein the expression vector is introduced via a calcium
precipitate. Other salts, e.g., calcium phosphate, may also be used
following a similar procedure. In addition, electroporation (i.e.,
the application of current to increase the permeability of cells to
nucleic acid sequences) may be used to transfect the host
microorganism. Also, microinjection of the nucleic acid sequencers)
provides the ability to transfect host microorganisms. Other means,
such as lipid complexes, liposomes, and dendrimers, may also be
employed. Those of ordinary skill in the art can transfect a host
cell with a desired sequence using these or other methods.
[0050] For identifying a transfected host cell, a variety of
methods are available. For example, a culture of potentially
transfected host cells may be separated, using a suitable dilution,
into individual cells and thereafter individually grown and tested
for expression of the desired nucleic acid sequence. In addition,
when plasmids are used, an often-used practice involves the
selection of cells based upon antimicrobial resistance that has
been conferred by genes intentionally contained within the
expression vector, such as the amp, gpt, neo, and hyg genes.
[0051] The host cell is transformed with at least one expression
vector. When only a single expression vector is used (without the
addition of an intermediate), the vector will contain all of the
nucleic acid sequences necessary.
[0052] Once the host cell has been transformed with the expression
vector, the host cell is allowed to grow. For microbial hosts, this
process entails culturing the cells in a suitable medium. It is
important that the culture medium contain an excess carbon source,
such as a sugar (e.g., glucose) when an intermediate is not
introduced. In this way, cellular production of acetyl-CoA, a
starting material for IPP and DMAPP synthesis is ensured. When
added, the intermediate is present in an excess amount in the
culture medium.
[0053] As the host cell grows and/or multiplies, expression of the
fusion protein comprising the phosphatase and isomerase is
effected. Once expressed, the enzyme activities comprised by the
fusion proteins catalyze the steps necessary for converting IPP to
DMAPP and converting IPP/and/or DMAPP into 3-methyl-3 butenol and
3-methyl-2-butenol. In some embodiments, the host cells further
comprise an enzyme encoding a reductase to convert 3-methyl-2
butenol into 3-methyl butanol. If an intermediate has been
introduced, the expressed enzymes catalyze those steps necessary to
convert the intermediate into the respective IPP and/or DMAPP. Any
means for recovering the 5-carbon alcohol, e.g., 3-methyl-2-butenol
or 3-methyl butanol from the host cell may be used. For example,
the host cell may be harvested and subjected to hypotonic
conditions, thereby lysing the cells. The lysate may then be
centrifuged and the supernatant subjected to high performance
liquid chromatography (HPLC) or gas chromatography (GC).
Host Cells
[0054] The host cells of the present invention are genetically
modified in that a nucleic acid encoding a fusion protein
comprising an IPP isomerase and phosphatase is introduced into the
cell. In some embodiments, the IPP isomerase and/or phosphatase may
be from the same species as the host cell. In other embodiments,
the IPP isomerase and/or phosphatase may be from a different
species. The suitable host cell is one capable of expressing a
nucleic acid construct encoding an enzyme capable of catalyzing the
isomerization of IPP to DMAPP and the dephosphorylation of IPP
and/or DMAPP. Such a host cell may also be capable of reducing
3-methyl-2-butanol into 3-methyl butanol. In some embodiments, the
host cell naturally produces IPP and/or DMAPP, and optionally may
comprises heterologous nucleic acid constructs capable of
expressing one or more genes for producing IPP and/or DMAPP. The
gene may be heterogous to the host cell or the gene may be native
to the host cell but is operatively linked to a heterologous
promoter and one or more control regions which result in a higher
expression of the gene in the host cell. In other embodiments, the
host cell does not naturally produce IPP and/or DMAPP, and
comprises heterologous nucleic acid constructs capable of
expressing one or more genes for producing IPP and/or DMAPP.
[0055] The phosphatase enzyme capable of catalyzing the
dephosphorylation of IPP and/or DMAPP can be native or heterologous
to the host cell. Similarly, the IPP isomerase capable of
converting IPP to DMAPPs can be native or heterologous to the host
cell.
[0056] The host cells produce the DMAPP that is converted by the
isomerase into IPP and/or DMAPP that is dephosphorylated into
3-methyl-3-buten-1-ol and/or 3-methyl-2-buten-1-ol, respectively.
The host cell comprises the genes encoding enzymes in the pathway
from which the IPP and/or DMAPP are synthesized from acetyl-CoA.
Optionally, the host cell may comprise a gene encoding the enzyme
that reduces 3-methyl-2-buten-1-ol into 3-methyl-butan-1-ol. These
genes can either be native to the host cell or are heterologous to
the host cell and introduced all or in part into the host cell
either by integration into the host cell chromosome(s) or an
expression vector, or both. In embodiments in which the host cell
is modified to express a reductase to convert 3-methyl-2-butenol
into 3-methyl-butanol, suitable reducatase genes are described in
U.S. Pat. No. 7,985,567, which is incorporated by reference.
[0057] The host cells may comprise systems for synthesizing IPP
and/or DMAPP. Such systems are taught in U.S. Pat. Nos. 7,172,886
and 7,183,089, and U.S. Pat. Application Pub. No. 2003/0148479,
2006/0079476, 2007/0077616, 2007/0092931, and 2007/0099261, which
are incorporated in their entireties by reference. Such methods
include producing an IPP and/or DMAPP in a genetically modified
host cell, such as E. coli.
[0058] The host cells may express pyrophosphases which hydrolyze
the isoprenyl diphosphate intermediates to the corresponding
primary alcohols (Song, Appl. Biochem. Biotechnol. 2006, 128:149,
which is incorporated in its entirety by reference). The host cells
may be knocked out for or lack expression of any terpene cyclases
which catalyze the formation of terpenes from diphosphate
intermediates.
[0059] IPP and DMAPP are generated in vivo via either the
mevalonate pathway or the non-mevalonate pathway (also known as the
DXP pathway), which is described in Reiling et al., Biotechnol.
Bioeng. 87(2):200-212 (2004), which is incorporated in its entirety
by reference.
[0060] In some embodiments, a host cell may naturally be capable of
hydrogenating the double bond of 3-methyl-2-butenol. Such a host
cell may not be modified in order to be able to produce
3-methyl-butanol from 3-methyl-2-butenol or the gene encoding the
enzyme for catalyzing this reaction can be modified so that
expression of the enzyme is increased. A host cell that may not
require modification is Saccharomyces cerevisiae. Gramatica et al.
(Experientia 38, 1982) have shown that S. cerevisiae is capable of
reducing geraniol to R-(+)-citronellol. Gramatica et al. (J Org.
Chem. 50, 1985) have shown that S. cerevisiae is capable of
hydrogenating the double bonds in .alpha.- or
.beta.-methyl-.alpha.,.beta.-unsaturated aldehydes (including
alcohols and acetals). Yeast can catalyze the conversion of
3-methyl-2-butenol to isopentanol (see, e.g., U.S. Pat. No.
7,985,567).
[0061] Any prokaryotic or eukaryotic host cell may be used in the
present method so long as it remains viable after being transformed
with a sequence of nucleic acids. Generally, although not
necessarily, the host microorganism is bacterial. Examples of
bacterial host cells include, without limitation, those species
assigned to the Escherichia, Enterobacter, Azotobacter, Erwinia,
Bacillus, Pseudomonas, Klebsielia, Proteus, Salmonella, Serratia,
Shigella, Rhizobia, Vitreoscilla, Synechococcus, and Paracoccus
taxonomical classes. In some embodiments, the microorganism is a
cyanobacteria. In some embodiments the bacterial host is
Synechocystis sp. Preferably, the host cell is not adversely
affected by the transduction of the necessary nucleic acid
sequences, the subsequent expression of the proteins (i.e.,
enzymes), or the resulting intermediates required for carrying out
the steps associated with the mevalonate pathway. For example, it
is preferred that minimal "cross-talk" (i.e., interference) occur
between the host cell's own metabolic processes and those processes
involved with the mevalonate pathway.
[0062] Suitable eukaryotic cells include, but are not limited to,
algal, fungal, insect or mammalian cells. In some embodiments,
suitable fungal cells are yeast cells, such as yeast cells of the
Saccharomyces genus. In some embodiments the eukaryotic cell is a
green algae. In some embodiments the eukaryotic cell is
Chlamydomonas reinhardtii, Scenedesmus obliquus, Chlorella vulgaris
or Dunaliella salina.
[0063] The host cell can further be modified to comprise endogenous
solvent efflux system such as AcrAB-TolC (Ramos et al., Annu Rev
Microbiol 2002, 56:743, which is incorporated in its entirety by
reference) to pump the 5-carbon alcohol produced by the host cell
out of the cell. When the host cell is capable of pumping the
produced 5-carbon alcohol out of the cell, the 5-carbon alcohol can
be recovered by removal of the supernatant in which the host cell
is being cultured.
[0064] The toxicity of the branched-CS alcohols will not be
problematic for the viability of host cells during fermentation.
The minimum inhibitory concentration (MIC) of the alcohols is
approximately 1% (w/v) for E. coli. The branched-CS alcohols begin
to phase separate at this concentration from the growth medium.
Isolation of 5-Carbon Alcohols Produced
[0065] The present invention provides for an isolated 5-carbon
alcohol produced from the method of the present invention.
Isolating the 5-carbon alcohol involves the separating at least
part or all of the host cells, and parts thereof, from which the
5-carbon alcohol was produced, from the isolated 5-carbon alcohol.
The isolated 5-carbon alcohol may be free or essentially free of
impurities formed from at least part or all of the host cells, and
parts thereof. The isolated 5-carbon alcohol is essentially free of
these impurities when the amount and properties of the impurities
do not interfere in the use of the 5-carbon alcohol as a fuel, such
as a fuel in a combustion reaction. These host cells are
specifically cells that do not in nature produce the 5-carbon
alcohol. The impurities are no more than 5%, 1%, 0.5%, 0.1%, 0.05%,
or 0.01% by weight of a composition comprising one or more of the
5-carbon alcohols.
[0066] The present invention also provides for a combustible
composition comprising an isolated 5-carbon alcohol and cellular
components, wherein the cellular components do not substantially
interfere in the combustion of the composition. The cellular
components include whole cells or parts thereof. The cellular
components are derived from host cells which produced the 5-carbon
alcohol was derived.
[0067] The 5-carbon alcohol of the present invention are useful as
fuels as chemical source of energy that can be used as an
alternative to petroleum derived fuels, ethanol and the like.
[0068] It is to be understood that, while the invention has been
described in conjunction with the preferred specific embodiments
thereof, the foregoing description is intended to illustrate and
not limit the scope of the invention. Other aspects, advantages,
and modifications within the scope of the invention will be
apparent to those skilled in the art to which the invention
pertains.
[0069] All patents, patent applications, accession numbers, and
publications mentioned herein are hereby incorporated by reference
in their entireties.
[0070] The invention having been described, the following examples
are offered to illustrate the subject invention by way of
illustration, not by way of limitation.
EXAMPLES
[0071] The following examples are provided by way of illustration
only and not by way of limitation. Those of skill in the art will
readily recognize a variety of non-critical parameters that could
be changed or modified to yield essentially similar results.
Example 1
Expression of Fusion Proteins in E. coli
[0072] FIG. 2 provides data showing that expression of IPP
isomerase can reduce the production of 3-methyl-3-butenol such that
little or no 3-methyl-2-butenol is observed. This example
demonstrates that fusion proteins comprising a phosphatase fused to
an IPP isomerase results in enhanced production of
3-methyl-2-butenol.
Materials and Methods
Strains and Media
[0073] All solvents, standards, and antibiotics (e.g. tetracycline,
chloramphenicol, ampicillin) were purchased from Sigma-Aldrich (St.
Louis, Mo.) unless otherwise indicated. 3-methyl-3-butenol,
3-methyl-2-butenol and 3-methyl-butanol were purchased from Tokyo
Chemical Industry (Portland, Oreg.). Phusion polymerase was
purchased from Finnzymes (Lafayette, Colo.). All restriction
enzymes were purchased from Fermentas (Glen Burnie, Md.). All
primers were ordered from Integrated DNA Technologies (Coralville,
Iowa).
Construction of Fusion Proteins.
[0074] The fusion protein comprises of an IPP isomerase and a
phosphatase (e.g. such as a phosphatase described in U.S. Pat. No.
7,985,567) fused by a short peptide linker. In the present example,
two versions of the fusion protein was made--one fungal and one
bacterial. The fungal fusion protein was made by amplifying idil
from S. cerevisiae and nudB from E. coli, and fusing the two genes
with a 45-nucleotide linker
(5'-GGAGGCGGTAGTGGTGGTGGAACCGGTGGAGGCAGTGGTGGAGGC-3') using SOEing
PCR and standard cloning protocols. The bacterial fusion protein
was made by amplifying idi from E. coli and nudB from E. coli, and
fusing the two genes with a 57-nucleotide linker
(5'-GGTGGCGGAAGTGGAGGCGGTAGTGGTGGTGGAACCGGTGGAGGCAGTGGTGG AGGC-3')
using SOEing PCR and standard cloning protocols. The fusion
proteins were cloned into pTrc99A or pTrc99A-nemA, and co-expressed
with pMevT and pMevB (see, e.g., U.S. Pat. No. 7,985,567).
[0075] For the IPP isomerases, idil was amplified from S.
cerevisiae genomic DNA using the primers
5'-GGCCCATGGCTGCCGACAACAATAGTATGC-3' and
5'-GGCGAATTCTTATAGCATTCTATGAATTTGCCTGTC-3', and idi was amplified
from E. coli genomic DNA using the primers
5'-GGCCCATGGAAACGGAACACGTCATTTT-3' and
5'-GGCGAATTCTTATTTAAGCTGGGTAAATGCAG-3'. The isomerases were
inserted into the NcoI-EcoRI sites (underlined in the primer
sequences) of pTrc99A to construct pTrc99A-idil and pTrc99A-idi.
nudB was amplified from E. coli genomic DNA using the primers
primers 5'-GGCCCATGGAGGATAAAGTGTATAAGCG-3' and
5'-GGCGAATTCTCAGGCAGCGTTAATTACAAACT-3', and the gene was inserted
into the NcoI-EcoRI sites (underlined in the primer sequences) of
pTrc99A to construct pTrc99A-nudB. The reductase nemA from E. coli
(see, U.S. Pat. No. 7,985,567) was amplified using the primers
5'-GGCGGATCCGGAGGACAGCTAAATGTCATCTGAAAAACTGTA-3' and
5'-GGCTCTAGATTACAACGTCGGGTAATCGG-3', and inserted into the
BamHI-XbaI sites (underlined in the primer sequences) of pTrc99A to
construct pTrc99A-nemA.
[0076] To construct the fungal fusion protein, idil was amplified
from pTrc99A-idil using the primers
5'-GGCGAATTCTAGCTTTCCCCGTCTACAATTTCTTCAAGATGACTGCCGACAACAAT-3' and
5'-TCCACCGGTTCCACCACCACTACCGCCTCCTTTAAGCTGGGTAAATGC-3', nudB was
amplified from pTrc99A-nudB using the primers
5'-GGTGGTGGAACCGGTGGAGGCAGTGGTGGAGGCATGGAGGATAAAGTGTAT-3' and
5'-GGCGGTACCTCAGGCAGCGTTAATTACAAACT-3', and the PCR products from
those two reactions were used for SOEing PCR using the primers
5'-GGCGAATTCTAGCTTTCCCCGTCTACAATTTCTTCAAGATGACTGCCGACAACAAT-3' and
5'-GGCGGTACCTCAGGCAGCGTTAATTACAAACT-3'. To construct the bacterial
fusion protein, idi was amplified from pTrc99A-idi using the
primers
5'-GGCGAATTCATAAATCGAACACGTTTAGGAAGGAGCGCAACGATGCAAACGGAACACGTC-3'
and
5'-ACCGGTTCCACCACCACTACCGCCTCCACTTCCGCCACCTTTAAGCTGGGTAAATGC-3',
nudB was amplified from pTrc99A-nudB using the primers
5'-AGTGGTGGTGGAACCGGTGGAGGCAGTGGTGGAGGCATGGAGGATAAAGTG-3' and
5'-GGCGGTACCTCAGGCAGCGTTAATTACAAACT-3', and the PCR products from
those two reactions were used for SOEing PCR using the primers
5'-GGCGAATTCATAAATCGAACACGTTTAGGAAGGAGCGCAACGATGCAAACGGAACACGTC-3'
and 5'-GGCGGTACCTCAGGCAGCGTTAATTACAAACT-3'. The part of each primer
that is associated with the nucleotide linker is in italics. The
fungal and bacterial fusion proteins were inserted into the
EcoRI-KpnI sites (underlined in the primer sequences) of pTrc99A
and pTrc99A-nemA.
Quantification of Alcohol Production.
[0077] Overnight cultures were inoculated into EZ-Rich Defined
Medium with 0.2% glucose and grown for 4 hours at 37.degree. C.
Afterwards, the cultures were induced with 0.1 mM IPTG and grown at
30.degree. C. for 18-20 hours shaking at 200 r.p.m. 700 .mu.l of
sample was analyzed by mixing it with 700 .mu.l of extraction
solvent (80:20 chloroform:methanol spiked with 50 mg l.sup.-1 of
butanol internal standard). The samples were vortexed for 15
minutes and centrifuged for 1 minute at 12000 r.p.m. 450 .mu.l of
the organic layer was removed from each sample and transferred to a
clean GC vial for analysis.
[0078] The GC-FID data were collected using a Tr-Wax column (0.25
mm.times.30 m, 0.25 .mu.m film thickness; Thermo Electron) on a
Focus GC with TriPlus autosampler (Thermo Electron). The carrier
was set at constant pressure for 300 kPa, and the inlet temperature
was set to 200.degree. C. The oven program was as follows:
40.degree. C. (1.50 min hold); 40-110.degree. C. (15.degree. C.
min.sup.-1). Samples were normalized using the butanol internal
standard and quantified using authentic standards.
[0079] The expression systems comprising the phosphatase/isomerase
fusion proteins exhibited increased production of
3-methyl-2-butenol from 3-methyl-3 butenol compared to the other
constructs. The bacterial variant recovered 50% of production,
whereas the fungal variant recovered 60% of production (compared to
production in the absence of an isomerase), and produced
significant levels of 3-methyl-2-butenol. In this experiment, the
fungal variant produced 3-methyl-3-butenol and 3-methyl-2-butenol
in a 2:1 ratio. Expression of a reductase able to catalyze the
reduction of 3-methyl-2-butenol led to the production of
3-methyl-butanol. The ratio of alcohols produced with the fungal
variant of the fusion protein is 2:1:1
3-methyl-3-butenol:3-methyl-2-butenol:3-methyl-butanol.
Approximately half of the 3-methyl-2-butenol is converted to
3-methyl-butanol.
[0080] While the present invention has been described with
reference to the specific embodiments thereof, it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adapt a particular situation,
material, composition of matter, process, process step or steps, to
the objective, spirit and scope of the present invention. All such
modifications are intended to be within the scope of the claims
appended hereto.
Sequence CWU 1
1
3514PRTArtificial Sequencesynthetic phosphatase conserved amino
acid sequence 1Arg His Gly Glu1 25PRTArtificial Sequencesynthetic
phosphatase conserved amino acid sequence 2Arg His Gly Glu Xaa1 5
37PRTArtificial Sequencesynthetic phosphatase conserved amino acid
sequence 3Arg His Gly Glu Xaa Xaa Asn1 5 48PRTArtificial
Sequencesynthetic phosphatase conserved amino acid sequence 4Arg
His Gly Xaa Xaa Xaa Xaa Asn1 5 5143PRTArtificial Sequencesynthetic
phosphatase conserved amino acid sequence 5Arg His Gly Glu Xaa Xaa
Xaa Asn Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5 10 15 Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 20 25 30 Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 35 40 45
Xaa Xaa Arg Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50
55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa
Xaa65 70 75 80 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 85 90 95 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 100 105 110 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 115 120 125 Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa His 130 135 140 615PRTArtificial
Sequencesynthetic phosphatase conserved amino acid sequence 6Arg
His Gly Glu Xaa Xaa Xaa Asn Xaa Xaa Xaa Xaa Xaa Gln Gly1 5 10 15
725PRTArtificial Sequencesynthetic phosphatase conserved amino acid
sequence 7Arg His Gly Xaa Xaa Xaa Xaa Asn Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa1 5 10 15 Xaa Asp Xaa Xaa Leu Xaa Xaa Xaa Gly 20 25
823PRTArtificial Sequencesynthetic catalytic motif (Nudix box)
conserved 23-amino acid consensus sequence 8Gly Xaa Xaa Xaa Xaa Xaa
Glu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Arg Glu1 5 10 15 Xaa Xaa Glu Glu
Xaa Gly Xaa 20 923PRTArtificial Sequencesynthetic conserved
23-residue block sequence metal binding and catalytic site related
to Nudix motif 9Gly Xaa Xaa Xaa Xaa Xaa Glu Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Arg Glu1 5 10 15 Xaa Xaa Glu Glu Xaa Gly Xaa 20
1016PRTArtificial Sequencesynthetic IPP isomerase metal binding
site conserved motif 10Gly Xaa Xaa Xaa Ala Xaa Xaa Arg Xaa Xaa Xaa
Xaa Glu Leu Gly Xaa1 5 10 15 115PRTArtificial Sequencesynthetic
glycine-serine polymer flexible linker 11Gly Gly Gly Gly Ser1 5
125PRTArtificial Sequencesynthetic glycine-serine polymer flexible
linker 12Gly Ser Gly Gly Ser1 5 134PRTArtificial Sequencesynthetic
glycine-serine polymer flexible linker 13Gly Gly Gly Ser1
1445DNAArtificial Sequencesynthetic IPP isomerase and phosphatase
fungal fusion protein 45-nucleotide linker 14ggaggcggta gtggtggtgg
aaccggtgga ggcagtggtg gaggc 451557DNAArtificial Sequencesynthetic
E. coli idi and nudB bacterial fusion protein 57-nucleotide linker
and phosphatase fungal fusion protein 45-nucleotide linker
15ggtggcggaa gtggaggcgg tagtggtggt ggaaccggtg gaggcagtgg tggaggc
571630DNAArtificial Sequencesynthetic S. cerevisiae IPP isomerase
idi1 amplification primer 16ggcccatggc tgccgacaac aatagtatgc
301736DNAArtificial Sequencesynthetic S. cerevisiae IPP isomerase
idi1 amplification primer 17ggcgaattct tatagcattc tatgaatttg cctgtc
361828DNAArtificial Sequencesynthetic E. coli isomerase idi
amplification primer 18ggcccatgga aacggaacac gtcatttt
281932DNAArtificial Sequencesynthetic E. coli isomerase idi
amplification primer 19ggcgaattct tatttaagct gggtaaatgc ag
322028DNAArtificial Sequencesynthetic E. coli nudB amplification
primer 20ggcccatgga ggataaagtg tataagcg 282132DNAArtificial
Sequencesynthetic E. coli nudB amplification primer 21ggcgaattct
caggcagcgt taattacaaa ct 322242DNAArtificial Sequencesynthetic E.
coli reductase nemA amplification primer 22ggcggatccg gaggacagct
aaatgtcatc tgaaaaactg ta 422329DNAArtificial Sequencesynthetic E.
coli reductase nemA amplification primer 23ggctctagat tacaacgtcg
ggtaatcgg 292456DNAArtificial Sequencesynthetic pTrc99A-idi1 idi1
amplification primer 24ggcgaattct agctttcccc gtctacaatt tcttcaagat
gactgccgac aacaat 562548DNAArtificial Sequencesynthetic
pTrc99A-idi1 idi1 amplification primer 25tccaccggtt ccaccaccac
taccgcctcc tttaagctgg gtaaatgc 482651DNAArtificial
Sequencesynthetic pTrc99A-nudB nudB amplification primer
26ggtggtggaa ccggtggagg cagtggtgga ggcatggagg ataaagtgta t
512732DNAArtificial Sequencesynthetic pTrc99A-nudB nudB
amplification primer 27ggcggtacct caggcagcgt taattacaaa ct
322856DNAArtificial Sequencesynthetic idi1 and nudB SOEing PCR
primer 28ggcgaattct agctttcccc gtctacaatt tcttcaagat gactgccgac
aacaat 562932DNAArtificial Sequencesynthetic idi1 and nudB SOEing
PCR primer 29ggcggtacct caggcagcgt taattacaaa ct
323060DNAArtificial Sequencesynthetic pTrc99A-idi idi amplification
primer 30ggcgaattca taaatcgaac acgtttagga aggagcgcaa cgatgcaaac
ggaacacgtc 603157DNAArtificial Sequencesynthetic pTrc99A-idi idi
amplification primer 31accggttcca ccaccactac cgcctccact tccgccacct
ttaagctggg taaatgc 573251DNAArtificial Sequencesynthetic
pTrc99A-nudB nudB amplification primer 32agtggtggtg gaaccggtgg
aggcagtggt ggaggcatgg aggataaagt g 513332DNAArtificial
Sequencesynthetic pTrc99A-nudB nudB amplification primer
33ggcggtacct caggcagcgt taattacaaa ct 323460DNAArtificial
Sequencesynthetic idi and nudB SOEing PCR primer 34ggcgaattca
taaatcgaac acgtttagga aggagcgcaa cgatgcaaac ggaacacgtc
603532DNAArtificial Sequencesynthetic idi and nudB SOEing PCR
primer 35ggcggtacct caggcagcgt taattacaaa ct 32
* * * * *