U.S. patent application number 14/337408 was filed with the patent office on 2015-01-29 for method for predicting and detecting tumor metastasis.
The applicant listed for this patent is The United States of America,as represented by the Secretary,Department of Health Human Services, The United States of America,as represented by the Secretary,Department of Health Human Services. Invention is credited to Niamh X. Cawley, Terence K. Lee, Yoke Peng Loh, Saravana Radha Krishna Murthy.
Application Number | 20150031744 14/337408 |
Document ID | / |
Family ID | 41479095 |
Filed Date | 2015-01-29 |
United States Patent
Application |
20150031744 |
Kind Code |
A1 |
Loh; Yoke Peng ; et
al. |
January 29, 2015 |
METHOD FOR PREDICTING AND DETECTING TUMOR METASTASIS
Abstract
The invention provides a method of determining the prognosis of
cancer in a subject. The method comprises (a) obtaining a sample
from the subject, (b) analyzing the sample for the expression level
of a carboxypeptidase E (CPE) splice variant, and (c) correlating
the expression level in the sample with the prognosis of cancer in
the subject. The invention further provides a method of diagnosing
cancer, methods of treatment, kits for detecting mRNA expression of
a CPE-.DELTA.N, and inhibitors of CPE-.DELTA.N and compositions
thereof.
Inventors: |
Loh; Yoke Peng; (Bethesda,
MD) ; Cawley; Niamh X.; (Bethesda, MD) ;
Murthy; Saravana Radha Krishna; (Rockville, MD) ;
Lee; Terence K.; (Hong Kong, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The United States of America,as represented by the
Secretary,Department of Health Human Services |
Bethesda |
MD |
US |
|
|
Family ID: |
41479095 |
Appl. No.: |
14/337408 |
Filed: |
July 22, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13006603 |
Jan 14, 2011 |
8816059 |
|
|
14337408 |
|
|
|
|
PCT/US09/50460 |
Jul 14, 2009 |
|
|
|
13006603 |
|
|
|
|
61080508 |
Jul 14, 2008 |
|
|
|
61161568 |
Mar 19, 2009 |
|
|
|
Current U.S.
Class: |
514/44A ;
435/6.12; 435/7.6; 506/9; 536/23.1 |
Current CPC
Class: |
C12N 15/1137 20130101;
C12Q 2600/156 20130101; C12Q 2600/158 20130101; G01N 2333/948
20130101; C12Q 2600/118 20130101; G01N 2800/7028 20130101; C12Q
1/6886 20130101; C12Q 2600/112 20130101; G01N 33/573 20130101; G01N
2800/52 20130101; A61K 45/06 20130101; C12Q 2600/136 20130101 |
Class at
Publication: |
514/44.A ;
435/6.12; 506/9; 435/7.6; 536/23.1 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; A61K 45/06 20060101 A61K045/06; G01N 33/573 20060101
G01N033/573; C12N 15/113 20060101 C12N015/113 |
Claims
1. A method of determining the prognosis of cancer in a subject,
the method comprising (a) obtaining a sample from the subject, (b)
analyzing the sample for an expression level of a carboxypeptidase
E (CPE) splice variant that lacks the N terminus (CPE-.DELTA.N),
and (c) correlating the expression level of CPE-.DELTA.N in the
sample to the prognosis of cancer in the subject.
2. The method of claim 1, wherein the prognosis is that the cancer
is a metastatic lesion.
3. The method of claim 1, wherein the prognosis is that the cancer
is likely to metastasize.
4. The method of claim 1, wherein the prognosis is that the cancer
is not a metastatic lesion.
5. The method of claim 1, wherein the prognosis is that the cancer
is not likely to metastasize.
6. The method of claim 1, further comprising determining a
treatment course for the subject in accordance with the
prognosis.
7. A method of diagnosing cancer in a subject, the method
comprising (a) obtaining a sample from the subject, (b) analyzing
the sample for an expression level of a carboxypeptidase E (CPE)
splice variant that lacks the N terminus (CPE-.DELTA.N), and (c)
correlating the expression level of CPE-.DELTA.N in the sample to a
diagnosis of cancer in the subject.
8. The method of claim 7, wherein the diagnosis is that the subject
has cancer.
9. The method of claim 8, wherein the diagnosis is that the cancer
is benign or malignant.
10. The method of claim 8, wherein the diagnosis is that the cancer
is metastatic.
11. The method of claim 7, further comprising determining a
treatment course for the subject in accordance with the
diagnosis.
12. The method of claim 1, wherein the sample is selected from the
group consisting of tissue, blood, and a combination thereof.
13. The method of claim 12, wherein the sample is tissue, and the
tissue is selected from the group consisting of nerve, adrenal,
thyroid, liver, lung, colorectal, breast, head and neck, skin,
pancreatic, ovarian, cervical, paraganglioma, pheochromocytoma,
melanoma, esophagus, cervical, brain, and stomach cancer.
14. The method of claim 13, wherein the tissue is selected from the
group consisting of tumor, tissue surrounding the tumor, and a
combination thereof.
15. The method of claim 1, wherein the expression level of
CPE-.DELTA.N is determined using copy number of CPE-.DELTA.N
mRNA.
16. The method of claim 15, wherein the sample is a
pheochromocytoma/paraganglioma (PHEO/PGL).
17. The method of claim 16, wherein a copy number of CPE-.DELTA.N
mRNA of less than about 200,000 is correlated to a prognosis of the
PHEO/PGL tumor as benign and of about 1 million or greater is
correlated to a prognosis of the PHEO/PGL tumor as metastatic.
18. The method of claim 15, wherein the sample is a differentiated
thyroid carcinoma (DTC).
19. The method of claim 18, wherein a copy number of CPE-.DELTA.N
mRNA of less than about 200,000 is correlated to a prognosis of the
DTC tumor as benign, of between about 200,000 to about 600,000 is
correlated to a prognosis of no metastasis of the DTC tumor, of
about 600,000 to about 1 million is correlated to a prognosis of
likely metastasis of the DTC tumor, and of about greater than 1
million is correlated to a prognosis of the DTC tumor as
metastatic.
20. A method of treating cancer in a subject, comprising
administering an effective amount of an inhibitor of a
carboxypeptidase E (CPE) splice variant that lacks the N terminus
(CPE-.DELTA.N) to a subject to treat a cancer in the subject.
21. The method of claim 20, wherein the inhibitor comprises a
nucleic acid complementary to a DNA or mRNA of CPE-.DELTA.N.
22. The method of claim 20, wherein the method further comprises
administering a chemotherapeutic agent to the subject.
23. The method of claim 20, wherein the cancer is selected from the
group consisting of nerve, adrenal, thyroid, liver, lung,
colorectal, breast, head and neck, skin, pancreatic, ovarian,
cervical, paraganglioma, pheochromocytoma, melanoma, esophagus,
cervical, brain, and stomach cancer.
24. The method of claim 1, wherein CPE-.DELTA.N polypeptide
comprises SEQ ID NO: 2.
25. The method of claim 1, wherein CPE-.DELTA.N polypeptide is
encoded by a nucleic acid comprising SEQ ID NO: 1.
26. A composition comprising an inhibitor of a carboxypeptidase E
(CPE) splice variant that lacks the N terminus (CPE-.DELTA.N) and a
pharmaceutically acceptable carrier.
27. The composition of claim 26, wherein the inhibitor comprises a
nucleic acid complementary to the DNA or mRNA of the CPE splice
variant.
28. The composition of claim 27, wherein the inhibitor is selected
from the group consisting of siRNA, cDNA, and antisense.
29. The composition of claim 26, wherein the inhibitor comprises a
nucleic acid sequence selected from the group consisting of SEQ ID
NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27.
30. An isolated nucleic acid comprising a nucleic acid sequence
selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 26,
and SEQ ID NO: 27.
31. A kit for detecting mRNA expression of a carboxypeptidase E
(CPE) splice variant that lacks the N terminus (CPE-.DELTA.N) or
polypeptide levels of CPE-.DELTA.N comprising one or more primers
or probes that detect CPE-.DELTA.N mRNA or CPE-.DELTA.N
polypeptide.
32. The kit of claim 31, wherein the one or more primers do not
amplify wild-type CPE mRNA.
33. The kit of claim 31, wherein the one or more primers include
SEQ ID NO: 5 and SEQ ID NO: 6.
34. The kit of claim 31, wherein the one or more probes do not
specifically bind wild-type CPE mRNA or wild-type CPE
polypeptide.
35. The kit of claim 31, wherein the one or more probes are
antibodies.
36. A method of detecting expression of a carboxypeptidase E (CPE)
splice variant that lacks the N terminus (CPE-.DELTA.N) or
polypeptide levels of CPE-.DELTA.N in a sample comprising (a)
obtaining a sample from the subject, and (b) contacting the sample
with one or more primers or probes that detect CPE-.DELTA.N mRNA or
CPE-.DELTA.N polypeptide, thereby detecting expression of
CPE-.DELTA.N mRNA or CPE-.DELTA.N polypeptide levels.
37. The method of claim 36, wherein the one or more probes do not
specifically bind wild-type CPE mRNA or wild-type CPE
polypeptide.
38. The method of claim 36, wherein the one or more probes are
antibodies.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This patent application is a divisional of U.S. patent
application Ser. No. 13/006,603, filed Jan. 14, 2011, which is a
continuation-in-part of International Patent Application No.
PCT/US09/50460, filed on Jul. 14, 2009, which claims the benefit of
U.S. Provisional Patent Application No. 61/080,508, filed Jul. 14,
2008, and U.S. Provisional Patent Application No. 61/161,568, filed
Mar. 19, 2009, which are each incorporated by reference.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] Incorporated by reference in its entirety herein is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith and identified as follows: One 17,000 Byte
ASCII (Text) file named "708201ST25.TXT," created on Jul. 9,
2014.
BACKGROUND OF THE INVENTION
[0003] Detecting cancer prior to metastasis greatly increases the
efficacy of treatment and the chances of a subject's long-term
survival. Although biomarkers have been reported as useful in
identifying aggressive tumor types and predicting prognosis (He,
Hum. Pathol., 35: 1196-209 (2004); and Brouwers, Ann. N.Y. Acad.
Sci., 1073: 541-56 (2006)), each biomarker is specific for a
particular type of cancer. In addition, due to a lack of
reliability, several markers typically are required to determine
the prognosis and course of therapy.
[0004] There exists a desire in the art for a universal biomarker
that can determine the prognosis for a number of different
cancers.
BRIEF SUMMARY OF THE INVENTION
[0005] The invention provides a method of determining the prognosis
of cancer in a subject. The method comprises (a) obtaining a sample
from the subject, (b) analyzing the sample for an expression level
of a carboxypeptidase E (CPE) splice variant that lacks the N
terminus (CPE-.DELTA.N), and (c) correlating the expression level
of CPE-.DELTA.N in the sample with the prognosis of cancer in the
subject.
[0006] The invention provides a method of diagnosing cancer in a
subject, the method comprising (a) obtaining a sample from the
subject, (b) analyzing the sample for an expression level of a
carboxypeptidase E (CPE) splice variant that lacks the N terminus
(CPE-.DELTA.N), and (c) correlating the expression level of
CPE-.DELTA.N in the sample to a diagnosis of cancer in the
subject.
[0007] The invention also provides a method of treating a cancer in
a subject by administering an effective amount of an inhibitor of
CPE-.DELTA.N.
[0008] The invention additionally provides a composition comprising
an inhibitor of CPE-.DELTA.N and a pharmaceutically acceptable
carrier. In particular, the invention provides a nucleic acid
comprising a nucleic acid sequence selected from the group
consisting of SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27.
[0009] The invention provides a kit for detecting mRNA expression
of CPE-.DELTA.N comprising one or more primers that detect
CPE-.DELTA.N mRNA.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0010] FIGS. 1A-E are bar graphs depicting expression levels of
hCPE-.DELTA.N and NEDD9 (Neural precursor cell expressed,
developmentally down-regulated gene 9) for HCC (A), prostate (B),
breast (C), colon (D), and head and neck (H&N) (E) cancer cell
lines, corrected for actin levels and expressed as mean.+-.SEM in
arbitrary units (n=3 separate experiments). The HCC cell lines
represented are H2P (1), H2M (2), MHCC97L (3), MHCC97H (4), and
MHCCLM3 (5). The prostate cancer cell lines represented are LNCAP
(6), PC-3 (7), and DU145 (8). The breast cancer cell lines
represented are MCF-7 (9), T47D (10), and MDA-MB-231 (11). The
colorectal cell lines represented are SW480 (12), HT-116 (13), and
HT-29 (14). The H&N cancer cell lines represented are TU167
(15), TU159 (16), and MDA-1986 (17). * indicates highly metastatic
or aggressive cell lines.
[0011] FIGS. 2A-B are bar graphs depicting the fold increase of
proliferation (A) or invasion (B) in MHCCLM3 cells transfected with
CPE-.DELTA.N or empty vector (EV). The data demonstrate increased
proliferation (1.92.+-.0.05 fold, SEM, n=3, p<0.0001) and
invasion (2.72.+-.0.15 fold, SEM, n=5, p=0.0013) in cells
transfected with CPE-.DELTA.N versus EV.
[0012] FIG. 3A is a bar graph depicting the CPE expression level
(as a percent of control). Data is from Western blots of
CPE-.DELTA.N performed on highly metastatic tumor cell lines from
breast (MDA-MB-231), prostate (DU145), head and neck (MDA1986),
colorectal (HT-29), and liver (MHCCLM3) cancers transfected with
si-scr (control) or si-CPE-.DELTA.N (which suppresses CPE-.DELTA.N
and CPE mRNA expression). In particular, the bar graph shows the
percent of .about.40 kD CPE-.DELTA.N in si-CPE-.DELTA.N treated
cells relative to si-scr treated cells (made equal to 100%). Mean
values.+-.SEM (n=3) are shown.
[0013] FIG. 3B is a bar graph depicting the number of colonies with
>50 cells in si-scr treated cells and si-CPE-.DELTA.N treated
cells. Mean values SEM (n=3) are shown.
[0014] FIG. 3C is a bar graph depicting the percent invasion of
si-CPE-.DELTA.N treated cells relative to the si-scr treated cells
(made equal to 100%). Mean values.+-.SEM (n=3) are shown.
[0015] FIG. 4A is a bar graph depicting the ratio of hCPE-.DELTA.N
mRNA levels in tumor (T) versus surrounding non-tumor tissue (N) in
HCC clinical samples for HCC patients that (i) were disease-free
(Non-Recurrence; n=49) or (ii) had a recurrence of either
intrahepatic or extrahepatic metastases one year after surgical
resection (Recurrence; n=50). Mean.+-.SEM (p<0.001) are
shown.
[0016] FIG. 4B is a bar graph depicting the ratio of hCPE-.DELTA.N
protein levels in tumor (T) versus surrounding non-tumor tissue (N)
in HCC clinical samples for HCC patients that (i) were disease-free
(Non-Recurrence; n=34) or (ii) had a recurrence of either
intrahepatic or extrahepatic metastases one year after surgical
resection (Recurrence; n=46). The intensity of the CPE-.DELTA.N
band from the Western blots was quantified by densitometry and
expressed in arbitrary units after correction for the actin level
in the sample. Mean.+-.SEM (p<0.001) are shown.
[0017] FIG. 5A is a growth curve for wild-type Neuro2A cells
transfected with empty vector (EV) and clones stably expressing CPE
(clones 3, 6, and 17). Each value represents means of replicates of
3.+-.SEM. Experiments were repeated four times.
[0018] FIG. 5B is a diagram showing mouse wild-type (WT) and mouse
CPE-.DELTA.N mRNA and protein.
[0019] FIG. 6 is a diagram showing human WT and human CPE-.DELTA.N
mRNA and protein.
[0020] FIGS. 7A-E are bar graphs depicting fold differences in
expression of hCPE-.DELTA.N mRNA in tumor cell lines relative to
primary tumor cells with lowest hCPE-.DELTA.N mRNA expression
(first gray bar in each graph) made equal to 1. Highly metastatic
cell lines: white bars, low metastatic cell lines: gray bars. The
tumor cell lines represented are HCC (A), prostate (B), breast (C),
colon (D), and head and neck (E).
DETAILED DESCRIPTION OF THE INVENTION
[0021] The inventors identified a splice variant isoform of the
prohormone processing enzyme, carboxypeptidase E (CPE), which
promotes growth and metastasis of several types of human
epithelial-derived tumor cells. The splice variant isoform of CPE
(CPE-.DELTA.N) lacks the N-terminus (see FIG. 5B). In humans, the
CPE-.DELTA.N polypeptide comprises the amino acid sequence of SEQ
ID NO: 2 and is encoded by the nucleic acid sequence of SEQ ID NO:
1. In mice, the CPE-.DELTA.N polypeptide comprises the amino acid
sequence of SEQ ID NO: 4 and is encoded by the nucleic acid
sequence of SEQ ID NO: 3.
[0022] The invention provides a method of determining the prognosis
of cancer in a subject. The invention provides a method of
determining the prognosis of cancer in a subject. The method
comprises (a) obtaining a sample from the subject, (b) analyzing
the sample for an expression level of CPE-.DELTA.N, and (c)
correlating the expression level of CPE-.DELTA.N in the sample with
the prognosis of cancer in the subject.
[0023] The invention further provides a method of diagnosing cancer
in a subject. The method comprises (a) obtaining a sample from the
subject, (b) analyzing the sample for an expression level of
CPE-.DELTA.N (e.g., RNA or protein), and (c) correlating the
expression level of CPE-.DELTA.N in the sample with a diagnosis of
cancer in the subject.
[0024] The sample to be analyzed can be any suitable tissue or
fluid obtained from the subject. For example, the tissue can be
tumor tissue, tissue adjacent to and/or surrounding the tumor,
tissue from a location that is not adjacent to a primary tumor but
that is suspected of harboring metastasized tumor, or blood.
[0025] The sample can be obtained by any suitable method. For
example, sample tissue can be obtained via surgery, biopsy,
resected tissue specimen, or arterial or venous blood
withdrawal.
[0026] Preferably, the inventive methods further comprise the step
of obtaining a sample from surrounding non-tumor tissue (N) for the
purpose of comparison. In particular, the methods comprise (a)
obtaining a sample from a tumor (T) and a sample from surrounding
non-tumor tissue (N), (b) analyzing the tumor (T) sample for an
expression level of CPE-.DELTA.N (e.g., RNA or protein) relative to
an expression level of CPE-.DELTA.N in the surrounding non-tumor
tissue sample (N), and (c) correlating the expression level of
CPE-.DELTA.N in tumor/non-tumor (T/N) with the prognosis of cancer
in the subject.
[0027] The subject can be any mammal (e.g., mouse, rat, rabbit,
hamster, guinea pig, cat, dog, pig, goat, cow, horse, primate, or
human). Preferably, the subject is a human of any age and sex.
[0028] Without wishing to be bound by any particular theory, it is
believed that CPE-.DELTA.N promotes growth and metastasis of a
variety of human cancer cells by up-regulating the expression of
the metastasis gene, NEDD9 (see, e.g., Kim, Cell, 125: 1269-81
(2006)). Additionally, it is believed that CPE-.DELTA.N activates
gene expression by epigenetic mechanisms by interacting with
histone deacetylase and transcription factor SATB1. In this regard,
CPE-.DELTA.N can serve as a biomarker to reliably predict future
metastasis of a variety of cancers based on the level of
CPE-.DELTA.N in the resected primary tumor.
[0029] Examples of cancers that can be detected utilizing the
inventive method include nerve, adrenal, thyroid, liver (such as
hepatocellular carcinoma (HCC)), prostate, lung, colorectal (e.g.,
colon, rectal), breast, head and neck, skin, pancreatic, ovarian,
cervical, pheochromocytoma (PHEO)/paraganglioma (PGL) (e.g., PGL,
PHEO), melanoma, esophagus, cervical, brain, and stomach cancer.
The inventive method is particularly useful in detecting thyroid,
PHEO/PGL, liver, prostate, colorectal, breast, and head and neck
cancers.
[0030] The expression level of CPE-.DELTA.N can be determined by
detecting and, optionally, quantifying the levels of mRNA and/or
protein of CPE-.DELTA.N (referred to herein as "biomarker" or
"biomarkers") in the sample.
[0031] Methods for detecting and quantifying such biomarkers are
well within the art. In particular, suitable techniques for
determining the presence and level of expression of the biomarkers
in cells are within the skill in the art. According to one such
method, total cellular RNA can be purified from cells by
homogenization in the presence of nucleic acid extraction buffer,
followed by centrifugation. Nucleic acids are precipitated, and DNA
is removed by treatment with DNase and precipitation. The RNA
molecules are then separated by gel electrophoresis on agarose gels
according to standard techniques, and transferred to nitrocellulose
filters by, e.g., the so-called "Northern" blotting technique. The
RNA is then immobilized on the filters by heating. Detection and
quantification of specific RNA is accomplished using appropriately
labeled DNA or RNA probes complementary to the RNA in question.
See, for example, Molecular Cloning: A Laboratory Manual, J.
Sambrook et al., eds., 2nd edition, Cold Spring Harbor Laboratory
Press, 1989, Chapter 7, the entire disclosure of which is
incorporated herein by reference.
[0032] Methods for the preparation of labeled DNA and RNA probes,
and the conditions for hybridization thereof to target nucleotide
sequences, are described in Molecular Cloning: A Laboratory Manual,
J. Sambrook et al., eds., 2nd edition, Cold Spring Harbor
Laboratory Press, 1989, Chapters 10 and 11, the entire disclosures
of which are incorporated herein by reference. For example, the
nucleic acid probe can be labeled with, e.g., a radionuclide such
as .sup.3H, .sup.32P, .sup.33P, .sup.14C, or .sup.35S; a heavy
metal; or a ligand capable of functioning as a specific binding
pair member for a labeled ligand (e.g., biotin, avidin, or an
antibody), a fluorescent molecule, a chemiluminescent molecule, an
enzyme, or the like.
[0033] Probes can be labeled to high specific activity by either
the nick translation method of Rigby et al., J. Mol. Biol., 113:
237-251 (1977), or by the random priming method of Fienberg, Anal.
Biochem., 132: 6-13 (1983), the entire disclosures of which are
herein incorporated by reference. The latter can be a method for
synthesizing .sup.32P-labeled probes of high specific activity from
RNA templates. For example, by replacing preexisting nucleotides
with highly radioactive nucleotides according to the nick
translation method, it is possible to prepare .sup.32P-labeled
nucleic acid probes with a specific activity well in excess of
10.sup.8 cpm/microgram. Autoradiographic detection of hybridization
then can be performed by exposing hybridized filters to
photographic film. Densitometric scanning of the photographic films
exposed by the hybridized filters provides an accurate measurement
of biomarker levels. Using another approach, biomarker levels can
be quantified by computerized imaging systems, such as the
Molecular Dynamics 400-B 2D Phosphorimager (Amersham Biosciences,
Piscataway, N.J., USA).
[0034] Where radionuclide labeling of DNA or RNA probes is not
practical, the random-primer method can be used to incorporate an
analogue, for example, the dTTP analogue
5-(N--(N-biotinyl-epsilon-aminocaproyl)-3-aminoallyl)deoxyuridine
triphosphate, into the probe molecule. The biotinylated probe
oligonucleotide can be detected by reaction with biotin-binding
proteins, such as avidin, streptavidin, and antibodies (e.g.,
anti-biotin antibodies) coupled to fluorescent dyes or enzymes that
produce color reactions.
[0035] In addition to Northern and other RNA blotting hybridization
techniques, determining the levels of RNA transcript can be
accomplished using the technique of in situ hybridization. This
technique requires fewer cells than the Northern blotting
technique, and involves depositing whole cells onto a microscope
cover slip and probing the nucleic acid content of the cell with a
solution containing radioactive or otherwise labeled nucleic acid
(e.g., cDNA or RNA) probes. This technique is particularly
well-suited for analyzing tissue biopsy samples from subjects. The
practice of the in situ hybridization technique is described in
more detail in U.S. Pat. No. 5,427,916, the entire disclosure of
which is incorporated herein by reference. The inventive method
encompasses automated quantification of CPE-.DELTA.N (e.g., in
formalin-fixed slides).
[0036] The relative number of RNA transcripts in cells also can be
determined by reverse transcription of RNA transcripts, followed by
amplification of the reverse-transcribed transcripts by polymerase
chain reaction (RT-PCR). The levels of RNA transcripts can be
quantified in comparison with an internal standard, for example,
the level of mRNA from a standard gene present in the same sample.
Suitable genes for use as an internal standard include, for
example, myosin or glyceraldehyde-3-phosphate dehydrogenase
(G3PDH). The methods for quantitative RT-PCR and variations thereof
are within the skill in the art.
[0037] Any suitable primers can be used for the quantitative
RT-PCR. Preferably, the primers are specific to CPE-.DELTA.N and do
not amplify wild-type CPE. It is within the skill in the art to
generate primers specific to CPE-.DELTA.N (see FIGS. 5B and 6 for a
comparison of wild-type CPE and CPE-.DELTA.N). Primers can be of
any suitable length, but preferably are between 9 and 70 (e.g., 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, as well as ranges of the values
described herein) nucleotides.
[0038] In one embodiment, the invention provides a pair of primers
specific to human CPE-.DELTA.N, such as fwd:
5'-ATGGCCGGGCATGAGGCGGC-3' (SEQ ID NO: 5) and rev:
5'-GCTGCGCCCCACCGTGTAAA-3' (SEQ ID NO: 6). The primers also can
have greater or fewer nucleotides. In particular, a maximum length
primer pair specific to human CPE-.DELTA.N is fwd:
5'-GAGCGCAGCGATGGCCGGGCATGAGGCGGCGCCGGCGGC-3' (SEQ ID NO: 7) and
rev: 5'-GGCCCTCGAAGCTGCGCCCCACCGTGTAAATCCTGCTGAT-3' (SEQ ID NO: 8),
and a minimal length primer pair specific to human CPE-.DELTA.N is
fwd: 5'-CGGGCATGA-3' (SEQ ID NO: 9) and rev: 5'-CCCCACCGT-3' (SEQ
ID NO: 10). Primer pairs of intermediate lengths (e.g., between the
minimal and maximum length primer pairs) also are encompassed by
the invention.
[0039] In another embodiment, the invention provides a pair of
primers specific to mouse CPE-.DELTA.N, such as fwd:
5'-GACAAAAGAGGCCAGCAAGA-3' (SEQ ID NO: 17) and rev:
5'-CAGGTTCACCCGGCTCAT-3' (SEQ ID NO: 18). The primers also can have
greater or fewer nucleotides. In particular, a maximum length
primer pair specific to mouse CPE-.DELTA.N is fwd:
5'-CAGACAAAAGAGGCCAGCAAGAGGACGGCA-3' (SEQ ID NO: 19) and rev:
5'-ATTCAGGTTCACCCGGCTCATGGACCCCG-3' (SEQ ID NO: 20), and a minimal
length primer pair specific to mouse CPE-.DELTA.N is fwd:
5'-AGGCCAGCAA-3' (SEQ ID NO: 21) and rev: 5'-GTTCACCCGG-3' (SEQ ID
NO: 22). However, primer pairs of intermediate lengths (e.g.,
between the minimal and maximum length primer pairs) also are
encompassed by the invention.
[0040] A tissue microarray can be utilized to detect biomarker
expression. In the tissue microarray technique, a hollow needle is
used to remove tissue cores as small as 0.6 mm in diameter from
regions of interest in paraffin-embedded tissues such as clinical
biopsies or tumor samples. These tissue cores are then inserted in
a recipient paraffin block in a precisely spaced, array pattern.
Sections from this block are cut using a microtome, mounted on a
microscope slide and then analyzed by any method of standard
histological analysis. Each microarray block can be cut into
100-500 sections, which can be subjected to independent tests.
Tests commonly employed in tissue microarray include
immunohistochemistry and fluorescent in situ hybridization.
[0041] In some instances, it may be desirable to use microchip
technology to detect biomarker expression. The microchip can be
fabricated by techniques known in the art. For example, probe
oligonucleotides of an appropriate length, e.g., 40 nucleotides,
are 5'-amine modified at position C6 and printed using commercially
available microarray systems, e.g., the GENEMACHINE OmniGrid 100
Microarrayer and Amersham CODELINK activated slides. Labeled cDNA
oligomer corresponding to the target RNAs is prepared by reverse
transcribing the target RNA with labeled primer. Following first
strand synthesis, the RNA/DNA hybrids are denatured to degrade the
RNA templates. The labeled target cDNAs thus prepared are then
hybridized to the microarray chip under hybridizing conditions,
e.g., 6 times SSPE/30% formamide at 25.degree. C. for 18 hours,
followed by washing in 0.75 times TNT at 37.degree. C. for 40
minutes. At positions on the array, where the immobilized probe DNA
recognizes a complementary target cDNA in the sample, hybridization
occurs. The labeled target cDNA marks the exact position on the
array where binding occurs, thereby allowing automatic detection
and quantification. The output consists of a list of hybridization
events, which indicate the relative abundance of specific cDNA
sequences, and therefore the relative abundance of the
corresponding complementary biomarker, in the subject sample.
According to one embodiment, the labeled cDNA oligomer is a
biotin-labeled cDNA prepared from a biotin-labeled primer. The
microarray is then processed by direct detection of the
biotin-containing transcripts using, e.g., Streptavidin-Alexa647
conjugate, and scanned utilizing conventional scanning methods.
Image intensities of each spot on the array are proportional to the
abundance of the corresponding biomarker in the subject sample.
[0042] The use of the array has one or more advantages for mRNA
expression detection. First, the global expression of several
hundred genes can be identified in a single sample at one time.
Second, through careful design of the oligonucleotide probes, the
expression of both mature and precursor molecules can be
identified. Third, in comparison with Northern blot analysis, the
chip requires a small amount of RNA and provides reproducible
results using 2.5 .mu.g of total RNA.
[0043] Protein in a sample can be detected using a variety of
methods, such as protein immunostaining, immunoprecipitation,
protein microarray, radio-immunoassay, and Western blot, all of
which are well known in the art. Immunostaining is a general term
in biochemistry that applies to any use of an antibody-based method
to detect a specific protein in a sample. Similarly,
immunoprecipitation is the technique of precipitating an antigen
out of solution using an antibody specific to that antigen. This
process can be used to enrich a given protein to some degree of
purity. A Western blot is a method by which protein may be detected
in a given sample of tissue homogenate or extract. It uses gel
electrophoresis to separate denatured proteins by mass. The
proteins are then transferred out of the gel and onto a membrane
(typically nitrocellulose), where they are "probed" using
antibodies specific to the protein. As a result, researchers can
examine the amount of protein in a given sample and compare levels
between several groups.
[0044] The expression level of CPE-.DELTA.N can be correlated to a
prognosis by comparing the biomarker expression level in the sample
to biomarker expression in surrounding non-tumor tissue or to a
standard. The standard with which the sample is compared can be a
normalized standard and/or can be a sample taken at an earlier time
from the same subject. That is, the sample can be compared to a
sample taken from the same subject prior to treatment or the
subject after treatment has commenced (i.e., the subject at an
earlier time). In this way, the efficacy of treatment also can be
determined.
[0045] The prognosis of the cancer in a subject can be determined
in the inventive method. The cancer can be from a primary tumor
and/or a metastatic lesion. In this regard, the prognosis can be
that the cancer in the subject is or is not likely to metastasize
or already has metastasized. The prognosis can be that the cancer
in the subject is or is not a metastatic lesion. The prognosis also
can include combinations of the above.
[0046] The diagnosis of cancer in a subject can be determined in
the inventive method. Cancer cells are circulating in the blood
even before a tumor is formed. After the tumor is formed, the tumor
continually sheds cancer cells, which circulate in the blood. The
expression level of CPE-.DELTA.N in the sample can be used to
determine whether a subject has cancer. For example, if the
expression level of CPE-.DELTA.N in a sample is >2 (e.g., 2.5,
3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, or greater)
times than that of a control sample (e.g., a sample from a subject
without cancer), the diagnosis is that the subject has cancer.
[0047] Additionally, the expression level of CPE-.DELTA.N in a
sample (e.g., blood sample) can be used to diagnose a suspected
cancer as metastatic or having an increased risk of recurrence and
future metastases. Even if a clinician diagnoses a cancer as benign
based on the pathology of the primary tumor and the absence of
visible metastases, a patient with increased expression of
CPE-.DELTA.N mRNA in the tumor has an increased risk of recurrence
and future metastases (e.g., within 2, 3, 4, 5, 6, 7, 8, 9, or 10
years from resection of the primary tumor) based on the expression
level of CPE-.DELTA.N mRNA in the tumor. A patient with an
increased expression of CPE-.DELTA.N mRNA should be closely
monitored for recurrence and metastases.
[0048] In one embodiment, the prognosis of cancer is based on the
ratio of CPE-.DELTA.N mRNA in tumor (T) versus non-tumor (NT)
tissue. In particular, subjects with CPE-.DELTA.N (e.g., mRNA or
protein) T/NT ratios of .ltoreq.2 are much less likely than
subjects with CPE-.DELTA.N T/NT ratios of >2 (e.g., 2.5, 3, 3.5,
4, 4.5, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, or greater) to have
metastatic cancer or a recurrence of cancer (e.g., metastatic
cancer).
[0049] In another embodiment, the prognosis and/or diagnosis of
cancer is based on the copy number of CPE-.DELTA.N mRNA in tumor
tissue. The copy number can be determined by any suitable method
(e.g., quantitative RT-PCR).
[0050] When the cancer is pheochromocytoma (PHEO)/paraganglioma
(PGL), CPE-.DELTA.N mRNA copy numbers in tumor tissue of about
200,000 or less (e.g., 150,000 or less, 100,000 or less, or 50,000
or less) correlate to a prognosis that the tumor is benign.
Patients in this group have a low risk of recurrence or metastasis
(e.g., within 2, 3, 4, 5, 6, 7, 8, 9, or 10 years from resection of
the primary tumor). In contrast, CPE-.DELTA.N mRNA copy numbers in
tumor tissue of about 1 million or greater (e.g., 2 million or
greater, 3 million or greater, 4 million or greater, 5 million or
greater, 6 million or greater, 7 million or greater, 8 million or
greater, 9 million or greater, 10 million or greater, 15 million or
greater, or 20 million or greater) correlate with a prognosis that
the tumor is metastatic.
[0051] When the cancer is differentiated thyroid carcinoma (DTC),
CPE-.DELTA.N mRNA copy numbers in tumor tissue of about 200,000 or
less (e.g., 150,000 or less, 100,000 or less, or 50,000 or less)
correlate to a prognosis that the tumor is benign. CPE-.DELTA.N
mRNA copy numbers in tumor tissue of about 200,000 to about 600,000
(e.g., 250,000, 300,000, 350,000, 400,000, 450,000, 500,000,
550,000 or ranges of any of the values described herein) correlate
to a low risk of recurrence or metastasis (e.g., within 2, 3, 4, 5,
6, 7, 8, 9, or 10 years from resection of the primary tumor).
CPE-.DELTA.N mRNA copy numbers in tumor tissue of about 600,000 to
about 1 million (e.g., 650,000, 700,000, 750,00, 800,000, 850,000,
900,000, 950,000, or ranges of any of the values described herein)
correlate to an increased risk of recurrence or metastasis (e.g.,
within 2, 3, 4, 5, 6, 7, 8, 9, or 10 years from resection of the
primary tumor). CPE-.DELTA.N mRNA copy numbers in tumor tissue of
about 1 million or greater (e.g., 2 million or greater, 3 million
or greater, 4 million or greater, 5 million or greater, 6 million
or greater, 7 million or greater, 8 million or greater, 9 million
or greater, 10 million or greater, or 15 million or greater)
correlate with a prognosis that the tumor is metastatic.
[0052] The invention also provides a kit to measure CPE-.DELTA.N
mRNA and protein (e.g., from tissue biopsies and resected primary
tumor tissues) for diagnostic or assay purposes. For example, the
kit can comprise one or more primer pairs that detect CPE-.DELTA.N
mRNA levels and/or one or more probes that detect CPE-.DELTA.N
protein levels. Preferably, the primers and probes can
differentiate between CPE-.DELTA.N and wild-type CPE. The kits can
be used to determine metastasis in a subject, to predict future
recurrence/metastasis, and/or to monitor tumor progression in a
subject (e.g., to determine efficacy of a cancer treatment).
[0053] The invention further provides a method of treatment for the
subject that is accordance with the determined prognosis. The
treatment can be any suitable treatment. Suitable treatments
include chemotherapy, radiation, surgery, suppression of
CPE-.DELTA.N, NEDD9 inhibition, and combinations thereof. Methods
of chemotherapy, radiation, and surgical intervention are well
within the art and can be determined on a case-by-case basis
depending on the location, type, and stage of the cancer.
[0054] In one embodiment, the treatment includes suppression of
CPE-.DELTA.N. In this regard, an effective amount of an inhibitor
of CPE-.DELTA.N is administered to the subject. Desirably, the
inhibitor prevents metastasis or slows the progression of
metastasis (e.g., by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%,
40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or
100%).
[0055] The inhibitor can be administered at any time following a
prognosis determination. The inhibitor can be administered alone or
in combination with other treatments. For instance, the inhibitor
can be administered prior to surgical resection of a tumor. The
inhibitor also can be administered following surgical resection of
a tumor. One skilled in the art can readily determine an effective
amount of the inhibitor composition to be administered to a given
subject, by taking into account factors such as the size and weight
of the subject, the extent of disease penetration, the age, health,
and sex of the subject, the route of administration, and whether
the administration is regional or systemic.
[0056] One skilled in the art also can readily determine an
appropriate dosage regimen for administering a composition that
alters biomarker levels or gene expression to a given subject. For
example, the composition can be administered to the subject once
(e.g. as a single injection or deposition). Alternatively, the
composition can be administered multiple times on any suitable
schedule, e.g., once or twice daily, monthly, bimonthly, or
biannually. The administration of the treatment to a subject can be
for a period ranging from days, weeks, months, or years. In certain
embodiments, the treatment continues throughout the life of the
subject. Where a dosage regimen comprises multiple administrations,
it is understood that the effective amount of the composition
administered to the subject can comprise the total amount of
composition administered over the entire dosage regimen.
[0057] The inhibitor can be any suitable entity that
suppresses/inhibits expression or transcriptional activity of
CPE-.DELTA.N. For example, the inhibitor can comprise a nucleic
acid that is complementary to DNA or RNA (i.e., mRNA or tRNA) of
CPE-.DELTA.N that binds to and inhibits expression of CPE-.DELTA.N.
Alternatively, the treatment can include the administration of a
NEDD9 inhibitor comprising a nucleic acid that is complementary to
the NEDD9 DNA or RNA (i.e., mRNA or tRNA).
[0058] In this regard, the invention further provides a composition
comprising an inhibitor of CPE-.DELTA.N and/or a NEDD9 inhibitor
and a pharmaceutically acceptable carrier.
[0059] Suitable compositions for inhibiting the expression of
genes, such as the gene encoding CPE-.DELTA.N and/or NEDD9, include
double-stranded RNA (such as short- or small-interfering RNA or
"siRNA"), antisense nucleic acids, and enzymatic RNA molecules such
as ribozymes. These components can be targeted to a given biomarker
gene product and can destroy or induce the destruction of the
target biomarker gene product.
[0060] For example, expression of a given gene can be inhibited by
inducing RNA interference of the gene with an isolated
double-stranded RNA ("dsRNA") molecule which has at least 90%, for
example, at least 95%, at least 98%, at least 99%, or 100%,
sequence homology with at least a portion of the gene product. In a
preferred embodiment, the dsRNA molecule is a "short or small
interfering RNA" or "siRNA" (e.g., shRNA).
[0061] siRNA useful in the inventive methods comprise short
double-stranded RNA from about 17 nucleotides to about 29
nucleotides in length, and preferably from about 19 to about 25
nucleotides in length. The siRNA comprise a sense RNA strand and a
complementary antisense RNA strand annealed together by standard
Watson-Crick base-pairing interactions (hereinafter "base-paired").
The sense strand comprises a nucleic acid sequence which is
substantially identical to a nucleic acid sequence contained within
the target gene product.
[0062] As used herein, an siRNA "substantially identical" to a
target sequence contained within the target nucleic sequence is a
nucleic acid sequence that is identical to the target sequence or
differs from the target sequence by at most one or two nucleotides.
The sense and antisense strands of the siRNA can comprise two
complementary, single-stranded RNA molecules, or can comprise a
single molecule in which two complementary portions are base-paired
and are covalently linked by a single-stranded "hairpin" area
(shRNA).
[0063] The siRNA also can be altered RNA that differs from
naturally-occurring RNA by the addition, deletion, substitution,
and/or alteration of one or more nucleotides. Such alterations can
include the addition of non-nucleotide material, such as to the
end(s) of the siRNA or to one or more internal nucleotides of the
siRNA, or modifications that make the siRNA resistant to nuclease
digestion, or the substitution of one or more nucleotides in the
siRNA with deoxyribonucleotides.
[0064] One or both strands of the siRNA also can comprise a 3'
overhang. As used herein, a "3' overhang" refers to at least one
unpaired nucleotide extending from the 3'-end of a duplexed RNA
strand. Thus, in one embodiment, the siRNA comprises at least one
3' overhang of from 1 to about 6 nucleotides (which includes
ribonucleotides or deoxyribonucleotides) in length, preferably from
1 to about 5 nucleotides in length, more preferably from 1 to about
4 nucleotides in length, and most preferably from about 2 to about
4 nucleotides in length. In a preferred embodiment, the 3' overhang
is present on both strands of the siRNA, and is 2 nucleotides in
length. For example, each strand of the siRNA can comprise 3'
overhangs of dithymidylic acid ("TT") or diuridylic acid
("uu").
[0065] The siRNA can be produced chemically or biologically, or can
be expressed from a recombinant plasmid or viral vector (e.g.,
lentiviral, adenoviral, or retroviral vector), as described above
for the isolated gene product. Exemplary methods for producing and
testing dsRNA or siRNA molecules are described in U.S. Patent
Application Publication No. 2002/0173478 and U.S. Pat. No.
7,148,342, the entire disclosures of which are incorporated herein
by reference. Examples of shRNA include SEQ ID NOs: 25-27.
[0066] Expression of a given gene also can be inhibited by an
antisense nucleic acid. As used herein, an "antisense nucleic acid"
refers to a nucleic acid molecule that binds to target RNA by means
of RNA-RNA or RNA-DNA or RNA-peptide nucleic acid interactions,
which alter the activity of the target RNA. Antisense nucleic acids
suitable for use in the inventive methods are single-stranded
nucleic acids (e.g., RNA, DNA, RNA-DNA chimeras, and
peptide-nucleic acids (PNA)) that generally comprise a nucleic acid
sequence complementary to a contiguous nucleic acid sequence in a
gene product. Preferably, the antisense nucleic acid comprises a
nucleic acid sequence that is 50-100% complementary, more
preferably 75-100% complementary, and most preferably 95-100%
complementary, to a contiguous nucleic acid sequence in a gene
product.
[0067] Antisense nucleic acids can also contain modifications to
the nucleic acid backbone or to the sugar and base moieties (or
their equivalent) to enhance target specificity, nuclease
resistance, delivery, or other properties related to efficacy of
the molecule. Such modifications include cholesterol moieties,
duplex intercalators such as acridine, or the inclusion of one or
more nuclease-resistant groups.
[0068] Antisense nucleic acids can be produced chemically or
biologically, or can be expressed from a recombinant plasmid or
viral vector, as described above for the isolated gene products.
Exemplary methods for producing and testing are within the skill in
the art, as disclosed in, for example, Stein, Science, 261: 1004
(1993), and U.S. Pat. No. 5,849,902, the entire disclosures of
which are incorporated herein by reference.
[0069] Expression of a given gene also can be inhibited by an
enzymatic nucleic acid. As used herein, an "enzymatic nucleic acid"
refers to a nucleic acid comprising a substrate binding region that
has complementarity to a contiguous nucleic acid sequence of a gene
product, and which is able to specifically cleave the gene product.
Preferably, the enzymatic nucleic acid substrate binding region is
50-100% complementary, more preferably 75-100% complementary, and
most preferably 95-100% complementary, to a contiguous nucleic acid
sequence in a biomarker gene product. The enzymatic nucleic acids
also can comprise modifications at the base, sugar, and/or
phosphate groups. An exemplary enzymatic nucleic acid for use in
the inventive methods is a ribozyme.
[0070] The enzymatic nucleic acids can be produced chemically or
biologically, or can be expressed from a recombinant plasmid or
viral vector, as described above for the isolated gene products.
Exemplary methods for producing and testing dsRNA or siRNA
molecules are described in Werner, Nucl. Acids Res., 23: 2092-96
(1995); Hammann, Antisense and Nucleic Acid Drug Dev., 9: 25-31
(1999); and U.S. Pat. No. 4,987,071, the entire disclosures of
which are incorporated herein by reference.
[0071] The inventive compositions can be administered to a subject
by any means suitable for directly or indirectly delivering these
compositions to the subject (e.g., the lungs, stomach, and/or blood
vessels of the subject). For example, the compositions can be
administered by methods suitable to transfect cells of the subject
with these compositions. Preferably, the cells are transfected with
a plasmid or viral vector comprising sequences encoding at least
one biomarker gene product or biomarker gene expression inhibiting
product.
[0072] Transfection methods for eukaryotic cells are well known in
the art, and include, e.g., direct injection of the nucleic acid
into the nucleus or pronucleus of a cell, electroporation, liposome
transfer or transfer mediated by lipophilic materials,
receptor-mediated nucleic acid delivery, bioballistic or particle
acceleration, calcium phosphate precipitation, and transfection
mediated by viral vectors.
[0073] For example, cells can be transfected with a liposomal
transfer composition, e.g., DOTAP
(N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium
methylsulfate, Boehringer-Mannheim) or an equivalent, such as
LIPOFECTIN.TM. Reagent (Invitrogen Corporation). The amount of
nucleic acid used is not critical to the practice of the invention;
acceptable results may be achieved with 0.1-100 micrograms of
nucleic acid/10.sup.5 cells. For example, a ratio of about 0.5
micrograms of plasmid vector in 3 micrograms of DOTAP per 10.sup.5
cells can be used.
[0074] The composition also can be administered to a subject by any
suitable enteral or parenteral administration route. Suitable
enteral administration routes include, e.g., oral or intranasal
delivery. Suitable parenteral administration routes include, e.g.,
intravascular administration (e.g., intravenous bolus injection,
intravenous infusion, intra-arterial bolus injection,
intra-arterial infusion, and catheter instillation into the
vasculature); subcutaneous injection or deposition, including
subcutaneous infusion (such as by osmotic pumps); direct
application to the tissue of interest (i.e., lung, liver tissue,
etc.), for example by a catheter or other placement device (e.g.,
an implant comprising a porous, non-porous, or gelatinous
material); intramuscular injection; and inhalation.
[0075] The composition can be administered to the subject either as
naked RNA, in combination with a delivery reagent, or as a nucleic
acid (e.g., a recombinant plasmid or viral vector) comprising
sequences that express the biomarker gene product or expression
inhibiting composition. Suitable delivery reagents include, e.g.,
the Mirus Transit TKO lipophilic reagent, LIPOFECTIN.TM. Reagent
(Invitrogen Corporation), LIPOFECTAMINE.TM. (Invitrogen
Corporation), CELLFECTIN (Invitrogen Corporation), polycations
(e.g., polylysine), and liposomes.
[0076] Recombinant plasmids and viral vectors comprising sequences
that express the biomarker or biomarker gene expression inhibiting
compositions, and techniques for delivering such plasmids and
vectors to a tissue, are discussed above.
[0077] In a preferred embodiment, liposomes are used to deliver a
gene expression-inhibiting composition (or nucleic acids comprising
sequences encoding them) to a subject. Liposomes can also increase
the blood half-life of the gene products or nucleic acids.
[0078] Liposomes suitable for use in the invention can be formed
from standard vesicle-forming lipids, which generally include
neutral or negatively charged phospholipids and a sterol, such as
cholesterol. The selection of lipids is generally guided by
consideration of factors such as the desired liposome size and
half-life of the liposomes in the blood stream. A variety of
methods are known for preparing liposomes, for example, as
described in Szoka, Ann. Rev. Biophys. Bioeng., 9: 467 (1980); and
U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the
entire disclosures of which are incorporated herein by
reference.
[0079] The liposomes can comprise a ligand molecule that targets
the liposome to lungs (i.e., small airways and/or large airways).
Ligands which bind to receptors prevalent in the lungs, such as
monoclonal antibodies that bind small airway epithelial cells, are
preferred.
[0080] The composition of the invention typically includes a
pharmaceutically acceptable carrier. The pharmaceutically
acceptable carrier can be any suitable pharmaceutically acceptable
carrier, such as one or more compatible solid or liquid fillers,
diluents, other excipients, or encapsulating substances which are
suitable for administration into a human or veterinary patient. The
pharmaceutically acceptable carrier can be an organic or inorganic
ingredient, natural or synthetic, with which the active ingredient
is combined to facilitate the application of the active ingredient.
The pharmaceutically acceptable carrier desirably is co-mingled
with one or more of the active components, and with each other, in
a manner so as not to substantially impair the desired
pharmaceutical efficacy of the active components. Pharmaceutically
acceptable carriers desirably are capable of administration to a
patient without the production of undesirable physiological effects
such as nausea, dizziness, rash, or gastric upset. It is, for
example, desirable for the pharmaceutically acceptable carrier not
to be immunogenic when administered to a human patient for
therapeutic purposes.
[0081] The pharmaceutical composition optionally can contain
suitable buffering agents, including, for example, acetic acid in a
salt, citric acid in a salt, boric acid in a salt, and phosphoric
acid in a salt. The pharmaceutical composition also optionally can
contain suitable preservatives, such as benzalkonium chloride,
chlorobutanol, parabens, and thimerosal.
[0082] The pharmaceutical composition conveniently can be presented
in unit dosage form and can be prepared by any of the methods well
known in the art of pharmacy. Such methods include the step of
bringing the active agent into association with a carrier that
constitutes one or more accessory ingredients. In general, the
composition is prepared by uniformly and intimately bringing the
active component(s) into association with a liquid carrier, a
finely divided solid carrier, or both, and then, if necessary,
shaping the product.
[0083] A composition suitable for parenteral administration
conveniently comprises a sterile aqueous preparation of the
inventive composition, which is preferably isotonic with the blood
of the recipient. This aqueous preparation can be formulated
according to known methods using suitable dispersing or wetting
agents and suspending agents. The sterile injectable preparation
also can be a sterile injectable solution or suspension in a
non-toxic parenterally-acceptable diluent or solvent, for example,
as a solution in 1,3-butane diol. Among the acceptable vehicles and
solvents that can be employed are water, Ringer's solution, and
isotonic sodium chloride solution. In addition, sterile, fixed oils
are conventionally employed as a solvent or suspending medium. For
this purpose any bland fixed oil can be employed, including
synthetic mono- or di-glycerides. In addition, fatty acids such as
oleic acid can be used in the preparation of injectables. Carrier
formulations suitable for oral, subcutaneous, intravenous,
intramuscular, etc. administrations can be found in Remington's
Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., which is
incorporated herein by reference thereto.
[0084] The composition of the invention can be in the form of a
time-released, delayed release, or sustained release delivery
system. The inventive composition can be used in conjunction with
other therapeutic agents or therapies. Such an approach can avoid
repeated administrations of the inventive composition, thereby
increasing convenience to the subject and the physician, and may be
particularly suitable for certain compositions of the
invention.
[0085] Many types of release delivery systems are available and
known to those of ordinary skill in the art. They include polymer
base systems such as poly(lactide-glycolide), copolyoxalates,
polycaprolactones, polyesteramides, polyorthoesters,
polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the
foregoing polymers containing drugs are described in, for example,
U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer
systems that are lipids including sterols such as cholesterol,
cholesterol esters, and fatty acids or neutral fats such as mono-,
di-, and tri-glycerides; hydrogel release systems; sylastic
systems; peptide based systems; wax coatings; compressed tablets
using conventional binders and excipients; partially fused
implants; and the like. Specific examples include, but are not
limited to: (a) erosional systems in which the active component is
contained in a form within a matrix such as those described in U.S.
Pat. Nos. 4,452,775, 4,667,014, 4,748,034, and 5,239,660 and (b)
diffusional systems in which an active component permeates at a
controlled rate from a polymer such as described in U.S. Pat. Nos.
3,832,253 and 3,854,480. In addition, pump-based hardware delivery
systems can be used, some of which are adapted for
implantation.
[0086] The following examples further illustrate the invention but,
of course, should not be construed as in any way limiting its
scope.
Example 1
[0087] This example demonstrates the identification of the CPE
splice variant isoform that is a biomarker for cancer
metastasis.
[0088] Cell Lines.
[0089] Three lines of human oral squamous cell carcinoma Tu167,
Tu159, and MDA1986 (Myers et al., Clin. Cancer Res., 8: 293-298
(2002)) established from freshly resected human tumors were
obtained from the laboratory of Dr. Gary L. Clayman, The University
of Texas M.D. Anderson Cancer Center. Human HCC cell lines MHCC97L,
MHCC97H, and MHCCLM3 (Li et al., World J. Gastroenterol., 7:
630-636 (2001)) were obtained from Liver Cancer Institute, Fudan
University (Shanghai, China). H2P and H2M (Hu et al., Oncogene, 23:
298-302 (2004)) were obtained from Dr. X. Y. Guan from the
Department of Clinical Oncology, University of Hong Kong. Human
prostate adenocarcinoma cell lines (PC3, LNCaP, and DU145), human
colon cancer cell lines (HT116, HT29, and SW480), human breast
cancer cell lines (MDA-MB-231, T47D, and MCF-7), and Neuro2A cells
were obtained from ATCC (Manassas, Va., USA).
[0090] Patient Samples.
[0091] HCC samples used for Western blotting were obtained with
informed consent from 80 patients undergoing hepatectomy for HCC
from 2002 to 2005 in the Department of Surgery at the University of
Hong Kong (Hong Kong, China). Forty-six of the patients developed
recurrence or extrahepatic metastasis within 6 months of surgery,
while the other 34 remained disease-free during that time. HCC
samples used for RT-PCR and inmmunohistochemistry were obtained
with informed consent from 99 patients who underwent surgical
resection for HCC from 2000 to 2005 in the Department of Surgery in
the University of Hong Kong. Colon cancer samples used for RT-PCR
were obtained from 68 patients who underwent surgical resection in
2006 in the Department of Surgery at the University of Hong Kong.
Tissue specimens for tissue microarray (TMA) were obtained from 31
patients who underwent surgical operation for colon cancer between
1999 and 2005 at the University of Hong Kong and subsequently
developed extra-colonic metastases to liver. Matched pairs of
primary and metastatic colon cancer samples were obtained for the
TMA.
[0092] For prediction of metastasis, CPE-.DELTA.N mRNA from
resected primary tumor (T) and surrounding normal tissue (N) from a
subset of 37 HCC patients, which showed recurrence or were
disease-free, were determined by quantitative RT-PCR (qRT-PCR). A
threshold T/N value of 2 was established, above which indicated
tumor recurrence within a year. Thereafter 62 and 80 different HCC
patients were used in a blinded study as the test groups to measure
CPE-.DELTA.N mRNA by qRT-PCR and protein by Western blot,
respectively, to predict those patients who would remain
disease-free and those patients who would show a recurrence within
2 years (for qRT-PCR) or 6 months (for Western blots) after surgery
based on their T/N ratio. A blinded clinical study also was
conducted in 68 patients with colon cancer to determine which
patients would remain disease-free or would exhibit
metastasis/recurrence based on their CPE-.DELTA.N mRNA T/N ratios
in the resected tumor and surrounding tissues.
[0093] Growth and Proliferation of Neuro2A Clones.
[0094] Neuro2A cells were stably transfected with the expression
vector, pcDNA3.1/CPE, and selected with 800 .mu.g/ml G418.
Individual colonies were picked and screened for the overexpression
of CPE from which three clones (clones 3, 6, and 17) were selected
(N2A/CPE cells). Neuro2A cells transfected with the pcDNA3.1 empty
vector were batch selected with 800 .mu.g/ml G418 and used as
control wild-type (WT) Neuro2A cells (WT cells). Cells were plated
in 10 cm plates at a density of 6.times.10.sup.5 cells/dish in
replicates of 3. Each 10 cm dish contained 6 coverslips.
Proliferation was assessed over a period of 4 days with a MTT
assay, as described in McGirr et al., Endocrinology, 146: 4514
(2005). Briefly, one coverslip was removed from each dish every day
and placed into a E-well plate containing 500 .mu.l media. Twenty
.mu.l of 2.5 .mu.g/ml thiazolyl blue was added to each well, and
cells were incubated for 4 hours at 37.degree. C. Media were
removed, and metabolized MTT was dissolved in 200 .mu.l of
acidified isopropanol. Absorbance for duplicate 90 .mu.l samples
was read at 590 nm in a plate reader.
[0095] Bioinformatics.
[0096] A non-redundant nucleotide sequence database search was
carried out with human and mouse CPE nucleotide sequence as queries
(NM.sub.--001873.2 and NM.sub.--013494.3, respectively). Potential
spliced variants (Genbank accession number AK090962 and BY270449)
were screened based on difference in nucleotide sequence between
the query and the subject sequences. Specific primers at the splice
junctions were designed to amplify these variants by PCR in Neuro2A
cells and MHCC97 cells for mouse and human splice variants,
respectively.
[0097] Semi-Quantitative PCR of WT-CPE and CPE-.DELTA.N Transcripts
in Neuro2A Clones and HCC Cells.
[0098] RNA was extracted from Neuro2A clones, MHCC97L and MHCC97H,
using the RNEASY.TM. Mini Kit (Qiagen, CA, USA). First strand cDNA
was synthesized with 1 .mu.g of total RNA from MHCC97L and MHCC97H
cells using Transcriptor First strand cDNA synthesis kit (Roche
Applied Science, Germany). Semi-quantitative polymerase chain
reaction was performed to quantify CPE-.DELTA.N transcripts using
TAKARA.TM. Taq polymerase (TaKaRa Bio Inc., Shiga, Japan). 18S RNA
was used as a housekeeping gene for normalization. Primer sequences
specific for human .DELTA.N-splice variant CPE-.DELTA.N RNA were
fwd: 5'-ATGGCCGGGCATGAGGCGGC-3' (SEQ ID NO: 5) and rev:
5'-GCTGCGCCCCACCGTGTAAA-3' (SEQ ID NO: 6). Primer sequences
specific for mouse .DELTA.N-splice variant CPE-.DELTA.N RNA in
Neuro2A cells were fwd: 5'-GACAAAAGAGGCCAGCAAGA-3' (SEQ ID NO: 17)
and rev: 5'-CAGGTTCACCCGGCTCAT-3' (SEQ ID NO: 18) and for mouse WT
CPE RNA were fwd: 5-TGCTGCTGGCGCTGTGT-3' (SEQ ID NO: 21) and rev:
5'-CAGGTTCACCCGGCTCAT-3' (SEQ ID NO: 22). The primers for mouse WT
CPE are specific for WT and do not prime the CPE-.DELTA.N
transcript. Primer sequences for amplifying 18S RNA were fwd:
5'-CTCTTAGCTGAGTGTCCCGC-3' (SEQ ID NO: 23) and rev:
5'-CTGATCGTCTTCGAACCTCC-3' (SEQ ID NO: 24). 0.25 .mu.g of cDNA from
MHCC97L and MHCC97H cells were used for every reaction. PCR cycling
was at 94.degree. C. for 15 seconds, annealing at 65.degree. C. for
30 seconds, extension at 72.degree. C. for 30 seconds and a final
extension at 72.degree. C. for 10 minutes. Same conditions were
optimized and used for all 3 sets of primers. 16 .mu.l of each
sample were removed every 5 cycles from 24 to 35 cycles in each
reaction to amplify CPE-.DELTA.N and 18S fragments. Amplified PCR
products were separated on 1.5% agarose gels with Tris-borate EDTA
buffer and stained with ethidium bromide. Gels were captured as
digital images and the corresponding bands quantified by
densitometry (ImageJ, NIH).
[0099] Verification of the Specificity of CPE-.DELTA.N Specific
Primers.
[0100] To verify the specificity of the CPE-.DELTA.N primers, the
ability of the CPE-.DELTA.N primers to prime and amplify WT CPE
transcript obtained from a tissue enriched in CPE was assayed.
Normal human adrenal medulla where CPE is expressed in abundance
was utilized. First strand cDNA was synthesized from 100 ng of
total RNA from this tissue using the Transcriptor First strand cDNA
synthesis kit (Roche Applied Science, Germany). The
semi-quantitative polymerase chain reaction was performed with
TAKARA.TM. Taq polymerase (TaKaRa Bio Inc., Shiga, Japan) with 35
PCR cycles at 94.degree. C. for 15 seconds, annealing at 65.degree.
C. for 30 seconds, extension at 72.degree. C. for 30 seconds, and a
final extension at 72.degree. C. for 10 minutes. The PCR was
carried out with both generic CPE primers (fwd:
5'-CCATCTCCGTGGAAGGAATA-3' (SEQ ID NO: 11) and rev:
5'-CCTGGAGCTGAGGCTGTAAG-3' (SEQ ID NO: 12)) and CPE-.DELTA.N
specific primers (fwd: 5'-ATGGCCGGGCATGAGGCGGC-3' (SEQ ID NO: 5),
rev: 5'-GCTGCGCCCCACCGTGTAAA-3' (SEQ ID NO: 6)). The correctly
sized product was amplified using the generic primers, but no
product was amplified with the CPE-.DELTA.N specific primers, which
indicated that the CPE-.DELTA.N primers are specific for
CPE-.DELTA.N cDNA.
[0101] Verification of Lack of CPE WT in HCC Cells and Human HCC
Tumors.
[0102] Since primers that specifically amplified the human WT CPE
mRNA were not identified, an alternative method was used to
determine if MHCC97H cells contain WT CPE. A standard curve was
generated, so that the amount of template in an unknown sample in
terms of copy number could be determined. A complete clone of hCPE
cDNA was excised from its plasmid and purified, and its
concentration was determined spectophotometrically. Serial
dilutions of the cDNA were made and used as templates for qRT-PCR.
The PCR was carried out in triplicate for each sample from eight
different concentrations. Generic CPE primers were used, and the
crossing point was determined from the qRT-PCR program, averaged
for each point, plotted as a function of the starting template
concentration, and expressed as template copy number. The mRNA copy
numbers in the MHCC97H cells or HCC tumor tissue were compared
using the set of generic primers (fwd: 5'-CCATCTCCGTGGAAGGAATA-3'
(SEQ ID NO: 11) and rev: 5'-CCTGGAGCTGAGGCTGTAAG-3'(SEQ ID NO: 12))
that amplifies both WT and CPE-.DELTA.N cDNA and using primers
specific for hCPE-.DELTA.N (fwd: 5'-ATGGCCGGGCATGAGGCGGC-3' (SEQ ID
NO: 5) and rev: 5'-GCTGCGCCCCACCGTGTAAA-3'(SEQ ID NO: 6)).
Conditions for the qRT-PCR for CPE using both sets of primers were
as follows: initial denaturation for 3 minutes at 95.degree. C.,
followed by 45 cycles of 15 seconds at 95.degree. C., 15 seconds at
62.degree. C., and 5 seconds at 72.degree. C. The PCR reaction was
followed by a melting curve program (65.degree. C.-95.degree. C.)
with a heating rate of 0.1.degree. C. per second, a continuous
fluorescence measurement, and a cooling program at 40.degree. C.
Negative controls consisting of no-template (water) reaction
mixtures were run with all reactions. PCR products also were run on
agarose gels to confirm the formation of a single product of the
predicted size. The copy numbers in the HCC cells and the human
tumor samples using either the generic primers or the CPE-.DELTA.N
specific primers were identical, indicating that MHCC97H cells and
HCC tumors lacked WT CPE. Additionally, Western blots of MHCC97H
cells and human HCC samples using AtT-20 cells as a positive
control showed no WT CPE band.
[0103] Microarray Hybridization and Data Analysis of Neuro2A
Cells.
[0104] Neuro2A clonal cells expressing CPE and the WT cells
transfected with vector alone were used for microarray studies. All
GeneChips were processed at the London Regional Genomics Centre
(Robarts Research Institute, London, Ontario, Canada). RNA was
extracted from clone 17, and the WT cells and the quality of the
RNA was assessed using the Agilent 2100 Bioanalyzer (Agilent
Technologies Inc., Palo Alto, Calif., USA) and the RNA 6000 Nano
kit (Caliper Life Sciences, Mountain View, Calif., USA). All
procedures, including cRNA synthesis, labeling, and hybridization
to Affymetrix Mouse Genome 2.0 GeneChips, were performed as
described in the Affymetrix Technical Analysis Manual (Affymetrix,
Santa Clara, Calif., USA). GeneChips were scanned with the
Affymetrix GeneChip Scanner 3000 (Affymetrix, Santa Clara, Calif.,
USA). Probe signal intensities for genes were generated using GCOS
1.4 (Affymetrix Inc., Santa Clara, Calif., USA) using default
values for the statistical expression algorithm parameters and a
target signal of 150 for all probe sets and a normalization value
of 1. Gene level data was generated using the RMA preprocessor in
GeneSpring GX 7.3.1 (Agilent Technologies Inc., Palo Alto, Calif.,
USA). Data from 4 different microarrays were transformed
(measurements less than 0.01 set to 0.01) and normalized per chip
to the 50th percentile and per gene to the WT Neuro2A cells. Genes
were grouped according to function in development and considered
significantly changed using Venn analysis to screen at least 2-fold
changes, followed by a one-way ANOVA with a p value cutoff of
0.05.
[0105] Western blot for CPE-.DELTA.N and NEDD9 in Cell Lines and
Clinical Specimens.
[0106] Proteins from clinical specimens were prepared using urea
buffer (8 M urea, 10 mM Tris, pH 7). Briefly, frozen tissue blocks
were homogenized, and cells were placed on ice for 15 minutes and
then centrifuged at 13,000.times.g for 5 minutes at 4.degree. C.
The protein supernatant was collected, and its concentration was
determined. Proteins from human cancer cell lines were prepared
using cell lysis buffer (Cell Signaling Technology, Beverly, Mass.,
USA) or, for Neuro2A cells, with M-per mammalian protein extraction
reagent (Pierce, Rockford, Ill., USA) supplemented with Complete
Inhibitor Cocktail (Roche, Indianapolis, Ind., USA) to prevent
protein degradation. The cell lysate was collected and centrifuged
at 15,000.times.g for 10 minutes at 4.degree. C. The protein
concentrations from supernatants of the cell lysates were
determined. Twenty .mu.g of protein were denatured, run on 4-20% or
12% SDS-PAGE gels, and transferred onto nitrocellulose membrane or
PVDF membrane (Millipore, Billerica, Mass., USA) using the standard
protocol. After blocking with 5% nonfat milk at room temperature
for 1 hour, CPE-.DELTA.N on the membrane was detected using a CPE
monoclonal antibody directed against amino acid residues 49-200 of
the human WT CPE sequence (R&D Systems, Inc., Minneapolis,
Minn.) at 1:4000 dilution. NEDD9 was detected with mouse anti-human
HEF1 generated using the N-terminal 82-398 residues of the NEDD9
protein (clone 14A11 at 1:1000 dilution, Rockland Immunochemicals,
Gilbertsville, Pa., USA) and rabbit polyclonal C-terminal antibody
from Professor Mirimoto (Japan) (Sasaki et al., Stroke, 36: 2457
(2005)). Following primary antibody binding, the membrane was
incubated with horseradish peroxidase-conjugated anti-mouse or
rabbit antibody (Amersham) and then visualized by enhanced
chemiluminescence plus according to the manufacturer's protocol.
The intensity of the bands was quantified by densitometry and
expressed as arbitrary unites (AU). The expression of CPE-.DELTA.N
and NEDD9 levels of each cell line was corrected for their actin
level and expressed as the mean.+-.SEM of AU from three separate
experiments.
[0107] Lentiviral Based CPE-.DELTA.N Suppression in Tumor Cell
Lines.
[0108] Lentiviral based shRNAs against human CPE, which also
suppress CPE-.DELTA.N mRNA expression
(CCGGCCAGTACCTATGCAACGAATACTCGAGTATTCGTTGCATAGGTACTGGTTTTT G (SEQ
ID NO: 25);
CCGGCTCCAGGCTATCTGGCAATAACTCGAGTTATTGCCAGATAGCCTGGAGTTTTT G (SEQ ID
NO: 26); and
CCGGGATAGGATAGTGTACGTGAATCTCGAGATTCACGTACACTATCCTATCTTTTT G (SEQ ID
NO: 27)) and scramble control were obtained from DFCI-Broad RNAi
Consortium in a pLKO.puro vector. VSV.G-pseudotyped lentiviral
particles were generated by calcium phosphate cotransfection of
293T cells, and viral supernatants were collected after 48 hours.
Lentiviral supernatants were used to transduce (i) MHCCLM3, (ii)
HT29, (iii) MDA-MB-231, (iv) DU145, and (v) MDA1986 cells. At 2
days post-transduction, cells were selected by puromycin at a
concentration of 2 .mu.g/ml.
[0109] Immunofluorescence of CPE-.DELTA.N in HCC Tumor Cells.
[0110] MHCCLM3 cells transfected with either si-scrambled or
si-CPE-.DELTA.N (which down-regulates CPE-.DELTA.N mRNA expression)
were cultured on chamber slides, permeabilized with 0.1% Triton
X-100, and fixed with 4% paraformaldehyde in PBS. The cells were
incubated with monoclonal antibodies against CPE (1:100) (R&D
Systems, Inc., Minneapolis, Minn., USA). The secondary antibody was
TRITC-conjugated goat anti-mouse IgG (Molecular Probes). The slide
was subsequently stained with fluorescein phalloidin (Molecular
Probes) in 1% BSA (dilution factor, 1:50) at 37.degree. C. for 1
hour and counterstained by DAPI (AppliChem GmbH). All images were
visualized by confocal microscopy and photographs were taken at
600.times. magnification.
[0111] Colony Formation Assay.
[0112] Growth analysis of cells was performed by the colony
formation assay described Ng et al., Cancer Res., 60: 6581-6584
(2000). Eighty percent confluent cells were trypsinized, and
single-cell suspensions were obtained. Four hundred viable cells
were seeded per well in 6-well plates. Ten days later, cells were
fixed with 70% ethanol and stained with 10% (v/v) Giemsa (MERCK,
Damstadt, Germany). Colonies consisting of more than 50 cells were
counted. Each experiment was done in triplicate, and the mean
values.+-.SEM were determined.
[0113] Matrigel Invasion Assay.
[0114] Invasion assay was carried out as described in Lee et al.,
Cancer Res., 66: 9948-9956 (2006). Conditioned medium from cells
transfected with si-scramble or si-CPE-.DELTA.N was placed in the
lower chambers as chemo-attractants. After 22 hours in culture, the
cells were removed from the upper surface of the filter by scraping
with a cotton swab. The cells that invaded through the Matrigel and
were adherent to the bottom of the membrane were stained with
crystal violet solution. The cell-associated dye was eluted with
10% acetic acid, and its absorbance at 595 nm determined. Each
experiment was done in triplicate, and the mean values.+-.SEM were
determined.
[0115] Generation of Luciferase-Expressing Cells.
[0116] For luciferase labeling of MHCCLM3 cells, lentiviral vector
containing the sequence of the firefly luciferase gene was
constructed and transfected into the cells (see, e.g., Lee et al.,
Cancer Res., 67: 8800 (2007)). Stable transfectants were generated
from a pool of >20 positive clones, which were selected by
blasticidin at a concentration of 2 .mu.g/ml.
[0117] Bioluminescent Imaging of Live Animals Bearing Tumors.
[0118] Animal care and euthanasia were conducted with full approval
by the Committee on the Use of Live Animals in Teaching and
Research of the University of Hong Kong. Approximately
1.times.10.sup.6 MHCCLM3 cells stably expressing firefly luciferase
were transfected with either si-scramble or si-CPE-.DELTA.N and
injected subcutaneously into the right flank of four-week-old male
BALB/c-nu/nu mice with a 30-gauge hypodermic needle (see, e.g., Fu
et al., Proc. Natl. Acad. Sci. U.S.A., 88: 9345 (1991)). The mice
were imaged on day 0 and day 30 after cell inoculation. Mice were
anesthetized with ketamine-xylazine mix (4:1). Imaging was done
using an Xenogen IVIS.TM. 100 cooled CCD camera (Caliper Life
Sciences, Hopkinton, Mass., USA). The mice were injected with 200
.mu.L of 15 mg/ml D-luciferin i.p. for 15 minutes before imaging,
after which they were placed in a light-tight chamber. A gray-scale
reference image was obtained followed by the acquisition of a
bioluminescent image. The acquisition time ranged from 3 seconds to
1 minute.
[0119] Metastatic Orthotopic Nude Mouse Model.
[0120] Approximately 1.times.10.sup.6 MHCCLM3 cells (in 0.2 ml
culture medium) transfected with either si-scramble or
si-CPE-.DELTA.N were injected subcutaneously into the right flank
of nude mice, which were then observed daily for signs of tumor
development. Once the subcutaneous tumor reached 1 to 1.5 cm in
diameter, the tumor was removed and cut into about 1 to 2 mm cubes,
which were implanted into the left liver lobe of the nude mice
(see, e.g., Livak et al., Methods, 25: 402 (2001)). The mice were
imaged on day 0 and day 35 after tumor inoculation. Mice were
anesthetized with ketamine-xylazine mix (4:1). Imaging was
performed using a Xenogen IVIS 100 cooled CCD camera (Xenogen) and
metastasis to the lung and intestines was tracked. After imaging,
metastasis to these tissues was confirmed by inspection and imaging
of the dissected tissues.
[0121] Histopathology.
[0122] To confirm that metastasis to the lungs occurred, the animal
was autopsied as soon as the original signal was recorded. Lungs
were examined and imaged with the Xenogen camera to confirm the
bioluminescence of this tissue and then fixed by intrabranchial
perfusion of 10% neutralized formalin solution. Paraffin-embedded
sections (4 .mu.m) were cut and stained with H&E.
[0123] Quantitative RT-PCR of CPE-.DELTA.N in Cell Lines and
Clinical Specimens.
[0124] RNA was extracted from both cancer cells (as described
above) and each patient's tumor and surrounding non-tumor tissue
using trizol (Invitrogen, CA, USA). Complementary DNA amplified
from 0.2 .mu.g mRNA in the tissues was subjected to real-time
quantitative PCR for CPE-.DELTA.N expression using a Fast SYBR.TM.
Green Master Mix PCR kit (Applied Biosystems, Foster City, Calif.,
USA) under the following cycling conditions: 95.degree. C. for 5
mins, followed by 40 cycles of 95.degree. C. for 15 second,
62.degree. C. for 60 seconds. Reactions were performed using an ABI
PRISM 7900 Sequence Detector (Applied Biosystems). Fluorescence
signals were analyzed using SDS 1.9.1 software (Applied
Biosystems). 18S was used as the endogenous normalization control.
Primer sequences for CPE-.DELTA.N RNA were fwd:
5'-ATGGCCGGGCATGAGGCGGC-3' (SEQ ID NO: 5), rev:
5'-GCTGCGCCCCACCGTGTAAA-3' (SEQ ID NO: 6); 18S-fwd:
5'-CTCTTAGCTGAGTGTCCCGC-3' (SEQ ID NO: 23); and 18S-rev:
5'-CTGATCGTCTTCGAACCTCC-3' (SEQ ID NO: 24). All PCRs were performed
in duplicate and were averaged to obtain the data point for each
specimen. The relative amount of CPE-.DELTA.N mRNA was normalized
to an internal control, 18S, and relative to a calibrator (see,
e.g., Livak et al., Methods, 25: 402 (2001)):
2.sup.-.DELTA..DELTA.CT, where
.DELTA..DELTA.C.sub.T=[C.sub.T(CPE)-C.sub.T(18S)]test-[C.sub.T(CPE)-C.sub-
.T(18S)]calibrator. The threshold value (C.sub.T) was defined as
the fractional cycle number at which the amount of amplified target
reached a fixed threshold. The C.sub.T value correlated with the
input target mRNA levels, and a lower C.sub.T value indicated a
higher starting copy number. One of the samples was designated as
the calibrator to compare the relative amount of target in
different samples and used to adjust for the plate-to-plate
variation in amplification efficiency. The relative expression
level of CPE of each patient was evaluated as the relative fold
change in log 2 scale.
[0125] Construction of Tissue Microarray (TMA).
[0126] Tissue microarrays were constructed with 0.6 mm diameter
cores using a MTA-1 tissue arrayer (Beecher Instruments, Sun
Prairie, Wis.) (see, e.g., Kononen, Nat. Med., 4: 844-847 (1998)).
The final array contained 31 pairs of primary and matched
metastatic colorectal to liver cancer samples. Five .mu.m sections
were cut and immunostained as described below. Regions of interest
were selected from hematoxylin and eosin stained sections after
review by two pathologists.
[0127] Immunostaining and Quantification of CPE in Human Tissue
Sections.
[0128] HCC tumor tissue and surrounding non-tumor tissue were
formalin-fixed and paraffin-embedded. Four .mu.m sections were cut,
dewaxed in xylene and graded alcohols, hydrated, and washed in PBS.
After pretreatment in a microwave oven (12 minutes in sodium
citrate buffer (pH 6)), the endogenous peroxidase was inhibited by
0.3% H.sub.2O.sub.2 for 30 min, and the sections were incubated
with 10% normal goat serum for 30 minutes. Mouse monoclonal
anti-carboxypeptiase E (1:100) (R&D Systems, Inc., Minneapolis,
Minn.) was applied overnight in a humidity chamber at 4.degree. C.
A standard avidin-biotin peroxidase technique (DAKO, Carpinteria,
Calif.) was applied. Briefly, biotinylated goat anti-mouse
immunoglobulin and avidin-biotin peroxidase complex were applied
for 30 minutes each with 15-minute washes in PBS. The reaction was
finally developed with the Dako Liquid DAB+ Substrate Chromogen
System (Dako, Glostrup, Denmark). Slides were imaged on a
SCANSCOPE.TM. CS imager (Aperio, Vista, Calif., USA), generating
0.43 .mu.m/pixel whole slide images. These images were compiled and
analyzed using the SPECTRUM.TM. software (Aperio, Vista, Calif.,
USA) with a pixel count algorithm (see, e.g., Brennan et al., Clin.
Cancer Res., 14: 2681 (2008)). Quantified expression of tumor
tissue minus adjacent normal tissue was compared for patients with
and without recurrence.
[0129] Results.
[0130] In order to investigate the possible role of CPE, wild-type
(WT) CPE cDNA was stably transfected into a clone of the mouse
neuroblastoma cell line, Neuro2A, with low CPE expression. The
isolated clones proliferated faster than Neuro2A cells transfected
with empty vector (see FIG. 5A).
[0131] This result prompted an exhaustive non-redundant nucleotide
sequence database search that uncovered a splice variant isoform of
CPE that lacks the N-terminus (CPE-.DELTA.N) (see FIG. 5B). PCR
identified two different CPE transcripts expressed in the stably
transfected Neuro2A clones: WT and CPE-.DELTA.N (see FIG. 5B). This
finding suggested that CPE-.DELTA.N is responsible for the enhanced
proliferation of Neuro2A cells.
[0132] To identify genes up-regulated in the CPE-transfected
Neuro2A clones that promote proliferation, gene microarray analysis
of a Neuro2A clone stably overexpressing CPE versus WT Neuro2A
cells transfected with empty vector was performed. The analysis
showed, among changes in other mRNAs, a 6-fold higher expression of
NEDD9 in the CPE-transfected Neuro2A clone. NEDD9 has been shown to
be expressed during embryonic development, and expression of NEDD9
is down-regulated in adult mice (see, e.g., Kumar et al., Biochem.
Biophys. Res. Commun., 185: 1155 (1992); and Aquino et al., Gene
Expression Patterns, 8: 217 (2008)). NEDD9 has been implicated in
cancer development (see, e.g., Merrill et al., Dev. Dyn., 231: 564
(2004); and O'Neill et al., Cancer. Res., 67: 8975 (2007)) and
recently was identified as a metastasis promoting gene in melanomas
(see, e.g., Kim et al., Cell, 125: 1269-81 (2006)). NEDD9 promoted
growth and enhanced invasion in vitro and metastasis in vivo of
normal and transformed melanocytes by interacting with focal
adhesion kinase (FAK) (see, e.g., Kim, Cell, 125: 1269-81 (2006);
and McLean et al., Nat. Rev. Cancer, 5: 505 (2005)). NEDD9 is
highly expressed in human melanomas and governs the metastatic
potential of these tumors.
[0133] These findings led to the hypothesis that CPE-.DELTA.N
promotes growth and metastasis of tumor cells by up-regulating
NEDD9 gene expression. This hypothesis was tested on human HCC
cells. Semi-quantitative RT-PCR showed that high metastatic MHCC97H
cells had elevated levels of CPE-.DELTA.N mRNA compared to low
metastatic cells (MHCC97L) (see FIG. 6). Moreover, WT CPE mRNA or
protein was not expressed in these epithelial-derived MHCC97 cells,
unlike neuroendocrine tumors, which express both WT and
CPE-.DELTA.N. Quantitative RT-PCR showed that CPE-.DELTA.N mRNA was
8.5-fold higher in MHCC97H versus MHCC97L cells (see FIGS.
7A-E).
[0134] The translation product derived from the human CPE-.DELTA.N
splice variant transcript (see FIG. 6) in HCC cells has an apparent
molecular mass of .about.40 kD. Other highly metastatic human tumor
cell lines of epithelial origin derived from HCC, colon, breast,
prostate, and head and neck tumors also had elevated expression of
CPE-.DELTA.N mRNA (see FIGS. 7A-E) and the .about.40 kD
CPE-.DELTA.N protein, as well as NEDD9 protein, compared to matched
tumor lines with low metastatic potential (see FIGS. 1A-E). The
forms of NEDD9 that increased with metastatic potential in these
cells were primarily a 70 kD N-terminal domain that contains the
FAK binding domain involved in metastasis (see, e.g., O'Neill et
al., Mol. Cell Biol., 15: 5094 (2001)) and a 35 kD C-terminal
cleavage product.
[0135] To verify that CPE-.DELTA.N regulates NEDD9 gene expression,
low metastatic MHCC97L cells were transfected with the CPE-.DELTA.N
cDNA. A concomitant increase in CPE-.DELTA.N and NEDD9 protein was
observed. Furthermore, MHCC97L cells transfected with CPE-.DELTA.N
showed increased proliferation and invasion compared to cells
transfected with empty vector, thereby demonstrating a role of
CPE-.DELTA.N in growth promotion and invasion of tumor cells (see
FIGS. 2A-B).
[0136] Conversely, siRNA-mediated down-regulation of CPE-.DELTA.N
in the highly metastatic MHCCLM3 cells resulted in a decrease in
NEDD9 expression in each of the 3 clones stably transfected with 3
different si-RNA sequences. Immunofluorescence microscopy of
MHCCLM3 cells transduced with scrambled-si (si-scr) RNA revealed
immunoreactive CPE-.DELTA.N primarily in the nucleus versus
cytoplasm. In MHCCLM3 cells down-regulated in expression of
CPE-.DELTA.N by si-CPE-.DELTA.N, CPE-.DELTA.N immunofluorescence
was barely detectable. These results indicate that CPE-.DELTA.N
that lacks a signal peptide is expressed in the cytoplasm and can
be translocated into the nucleus to modulate gene expression.
[0137] To demonstrate that CPE-.DELTA.N mediates growth and cell
invasion in multiple types of human tumors, highly metastatic cell
lines from breast (MDA-MB-23), prostate (DU145), head and neck (MDA
1986), colon (HT29), and liver (MHCC97M3) were down-regulated in
CPE-.DELTA.N expression using si-RNA (SEQ ID NO: 26) (see FIG. 3A).
Suppression of CPE-.DELTA.N expression in these tumor cell lines
led to 56-85% inhibition of growth (FIG. 3B) and 70-85% inhibition
of invasion (see FIG. 3B).
[0138] In addition to the in vitro assays, in vivo animal studies
were performed in two models. Nude mice were subcutaneously
injected with MHCCLM3 cells transduced with either si-CPE-.DELTA.N
(SEQ ID NO: 26) or si-scr (see, e.g., Lee et al., Clin. Cancer
Res., 11: 8458 (2005)). Thirty days after cell inoculation, control
mice injected with the si-scr MHCCLM3 cells had liver tumors with
16.2-fold higher intensity (which reflects increased volume) when
compared to mice injected with si-CPE-.DELTA.N cells.
[0139] Using a metastatic orthotopic nude mouse model (see, e.g.,
Lee et al., Cancer Res., 67: 8800 (2007)), MHCCLM3 cells transduced
with either si-scr or si-CPE-.DELTA.N were injected subcutaneously
into the right flank of the mice. When the subcutaneous tumor was
.about.1.5 cm in diameter, the tumor was removed, cut into 1-2 mm
cubes, and implanted into the liver of nude mice (see, e.g., Lee et
al., Cancer Res., 67: 8800 (2007)). Thirty-five days
post-implantation, mice with the si-scr MHCCLM3-derived tumors
showed 13.9-fold higher intensity (reflecting increased volume) and
developed intrahepatic metastasis and extrahepatic metastasis to
lung and intestine (see, e.g., Li et al., Clin. Cancer Res., 12:
7140 (2006)), while mice inoculated with si-CPE-.DELTA.N
MHCCLM3-derived tumors had smaller tumors and failed to demonstrate
metastasis.
[0140] To determine if CPE-.DELTA.N is a useful marker for
predicting future recurrence and metastasis, quantitative RT-PCR
and Western blot analysis were performed on primary tumors from HCC
patients to measure CPE-.DELTA.N mRNA and protein levels,
respectively. RT-PCR verified that only CPE-.DELTA.N mRNA, and not
WT CPE mRNA, was expressed in primary HCC tumors. CPE-.DELTA.N was
quantified by qRT-PCR in the primary tumor (T) versus surrounding
non-tumor (N) tissue, and its ratio determined. Forty-four of 49
(89.8%) HCC patients, who were disease-free two years after
surgery, had CPE-.DELTA.N mRNA TIN ratios of .ltoreq.2. In
contrast, 46 of 50 (92%) of patients with extra- or intra-hepatic
metastasis/recurrence had a T/N ratio>2 (see FIG. 4A and Table
1).
TABLE-US-00001 TABLE 1 Clinical significance of CPE in HCC tissues.
Clinicopathological CPE Expression Variables n T/NT .ltoreq. 2 T/NT
> 2 p value TNM (UICC) classification Early Stage (I-II) 39 26
13 <0.002*+ Late Stage (III-IV) 57 20 37 Recurrence in the first
year Yes 50 4 46 <0.001* No 49 44 5 *statistically significant;
+incomplete data
[0141] The survival analysis of disease-free survival of 99 HCC
patients showed shorter survival times (p<0.0001) when
CPE-.DELTA.N mRNA T/N were >2 (high) in the primary tumor
compared to patients with T/N .ltoreq.2 (low). The mean survival
was 17.44 months and 82.75 months for the high group versus the low
group.
[0142] In 68 colorectal cancer patients, the level of CPE-.DELTA.N
was determined at the time of surgery. Twenty-nine of 31 (93.5%)
patients that were disease-free had a CPE-.DELTA.N mRNA T/N ratio
of whereas .ltoreq.2 of 37 (86.5%) patients that had lymph node or
distant metastasis had a CPE-.DELTA.N mRNA T/N ratio of >2 (see
Table 2).
TABLE-US-00002 TABLE 2 Clinical significance of CPE in colorectal
cancer. Clinicopathological CPE Expression Variables n T/NT
.ltoreq. 2 T/NT > 2 p value TNM (UICC) classification Early
Stage (I-II) 29 28 1 <0.001* Late Stage (III-IV) 39 6 33 Lymph
node and distant metastases Yes 37 11 26 <0.001* No 31 26 5
*statistically significant
[0143] Additionally, Western blots showed higher CPE-.DELTA.N
levels in patients with recurrence compared to the disease-free
group. Quantitative analysis of the T/N ratios of the CPE-.DELTA.N
band from Western blots from 80 patients revealed that 28 of 34
(82.3%) patients with primary HCC who were disease-free after
surgery had tumor CPE-.DELTA.N levels with T/N .ltoreq.2 (see FIG.
4B). However, 35 of 46 (76%) patients who developed intra-hepatic
recurrence or extra-hepatic metastasis within 6 months had primary
tumor CPE-.DELTA.N levels of T/N>2.
[0144] Immunohistochemistry (IHC) of CPE-.DELTA.N in HCC tumors
from patients revealed immunostaining primarily in the nuclei of
tumor cells in patients who subsequently developed recurrence that
was absent in the cell nuclei of patients who remained
disease-free. Staining was primarily in the cytoplasm of tumor
cells in patients who remained disease-free. The intensity of
immunostaining as determined by image analysis (0.402.+-.0.032 SEM
versus 0.279.+-.0.036 SEM) was statistically different (p<0.02)
between the groups.
[0145] Analysis of primary colorectal cancer cells that had
metastasized to the liver also revealed increased numbers of
CPE-.DELTA.N positive cells in the metastatic tissue, and, similar
to the HCC cells, staining was observed primarily in the nuclei of
these metastatic colorectal cells.
[0146] These retrospective studies demonstrate that measurement of
CPE-.DELTA.N mRNA and protein levels in resected tumors is a
powerful prognostic tool for predicting recurrence/metastasis in
cancer (e.g., HCC) patients. In particular, measurement of
CPE-.DELTA.N mRNA levels in resected primary tumors versus
surrounding non-tumor tissues from HCC and PHEO/PGL patients by
qRT-PCR has proven to be a very reliable tool for predicting future
metastasis/recurrence with high prognostic significance
(p<0.0001).
[0147] The data resulting from these in vitro and in vivo assays
demonstrate that CPE-.DELTA.N functions to govern growth, invasion,
and metastasis in multiple types of cancer cells, including liver,
breast, colorectal, and head and neck cancers, by up-regulating the
metastasis gene NEDD9, which has been shown to promote growth and
metastasis of melanoma cells. The results from CPE-.DELTA.N
analysis of clinical resected primary and metastatic tumors from
colorectal cancer and HCC patients demonstrate that CPE-.DELTA.N
can serve as a biomarker for metastasis and a reliable predictor of
impending metastasis within 6 months of diagnosis of HCC based on
CPE-AN levels in the resected primary HCC tumor.
[0148] CPE-.DELTA.N is translocated into the nucleus and has a
domain homologous to histone deacetylase (HDAC) interacting
proteins (human CPE-.DELTA.N amino acids 111 to 196 with a
consensus of 60%). The results of co-immunoprecipitation studies
indicated that CPE-.DELTA.N interacts with HDAC1/2, which are known
to modulate gene transcription through histone deacetylation and
mediate human tumorigenesis. When HCC97L cells stably expressing
CPE-.DELTA.N were treated with the HDAC inhibitors, depsipeptide
and TSA, expression of NEDD9 in the HCC cells was suppressed while
there was no effect on CPE-.DELTA.N expression. Based on these
results, CPE-.DELTA.N appears to upregulate NEDD9 gene expression
through its interaction with HDAC1/2 to induce tumor cell
proliferation and migration.
Example 2
[0149] This example demonstrates that the expression level of
CPE-.DELTA.N is correlated with metastasis.
[0150] Paragangliomas (PGLs) are catecholamine-producing
neuroendocrine tumors that derive from sympathetic tissue in
adrenal (also known as pheochromocytomas (PHEOs)) and extra-adrenal
locations or from parasympathetic tissue of the head and neck.
Despite improved diagnostic techniques there is generally a 3-year
delay between the initial symptoms and final diagnosis of PGL.
Advances in genetic testing have led to the recognition of the high
prevalence of PGLs in certain familial syndromes. The accumulation
of evidence now indicates that the hereditary basis of PGLs
accounts for 24% of patients with the tumor, with no obvious
initial evidence of a syndrome or family history. Germline
mutations in five genes have been associated with familial
syndromes: the von Hippel-Lindau gene (VHL), which causes von
Hippel-Lindau syndrome; the RET gene leading to multiple endocrine
neoplasia type 2 (MEN2); the neurofibromatosis type 1 gene (NF1),
which is associated with von Recklinghausen's disease; and the
genes encoding the B and D subunits of mitochondrial succinate
dehydrogenase (SDHB and SDHD), which are associated with familial
PGLs and PHEOs. PHEOs are not always present and usually are not
the first clinical manifestation of syndromes due to mutations of
VHL, RET, and NF1 genes. PHEOs in these three syndromes usually are
associated with other benign or malignant neoplasms.
[0151] Prevalence of metastasis is much higher for patients with
specific mutations such as those causing some form of PGL (e.g.,
SDHB). SDHB/SDHD patients develop PHEOs, head and neck tumors, and
abdominal PGLs. There are three genes involved in the pathogenesis
of familial PGL syndrome described to date: those encoding the B, C
and D subunits of mitochondrial complex II enzyme succinate
dehydrogenase (SDHB, SDHC, and SDHD). SDHD/C-associated tumors are
predominantly benign; however, SDHB mutations predispose to
malignant PGL with poor prognosis. Up to 70% of abdominal and
thoracic PGLs in patients carrying a SDHB mutation were reported to
develop into metastatic disease. Currently, there is no marker
available that would either predict malignant behavior or diagnose
malignancy of these tumors. Furthermore, the diagnosis of
SDHB-related PGL may be delayed by lack of typical symptoms and
signs of catecholamine excess.
[0152] To determine the copy numbers of CPE-.DELTA.N mRNA in
resected tumors from patients, mRNA was extracted from frozen
resected tumor tissues from patients using the SV Total RNA
Isolation System (Promega, USA) according to manufacture's
instructions. 0.2 .mu.g of total mRNA was converted to cDNA using
the First Strand cDNA Synthesis Kit for RT-PCR (Roche Applied
Sciences, Germany). 0.25 .mu.g of the first strand cDNA was used to
determine the CPE-.DELTA.N mRNA copy number in the samples by
absolute quantification obtained from a standard curve generated
for every assay. The standard curve was generated using defined
concentrations of full-length CPE-WT cDNA cloned in pcDNA3.1 His
vector (Invitrogen, USA). The CPE-WT cDNA sequence was cleaved from
pcDNA3.1 CPE-WT cDNA by XhoI and BamHI restriction enzymes, and the
digest run on a 1.5% agarose gel. The CPE-WT cDNA, which runs at
about 1500 bp, was cut from the gel, and the DNA extracted. The
cDNA concentrations were determined spectrophotometrically, and the
microgram value was converted to copy number using standard methods
(e.g., a software program which converts weight to copy number,
such as that described in U.S. Provisional Patent Application
61/161,568).
[0153] 1 .mu.g of cDNA was serially diluted (1:10.sup.2,
1:10.sup.3, 1:10.sup.4, 1:10.sup.5, 1:10.sup.6, and 1:10.sup.7) to
generate the standard curve using the real time PCR setting with
generic primers (SEQ ID NOs: 11 and 12) as crossing point values.
Each point on the standard curve was averaged from triplicate
determinations. Exact mRNA copy numbers of the patient samples were
determined by running the cDNA sample in triplicates and averaged.
The average crossing points of the sample were read from the
standard curve generated by the real time PCR, and the copy number
was determined.
[0154] Based on the mRNA copy numbers in SDHB/SDHD tumors, the
metastatic state of 9 tumors was assigned in a blinded analysis
(see Table 3).
TABLE-US-00003 TABLE 3 Determination of CPE-.DELTA.N mRNA copy
number in SDHB/D tumors. Follow-up (years of Sample Geno- Copy
follow-up or time to Number State.sup.1 type Number
recurrence/metastasis) S55 Benign.sup.2 SDHD 167,550 Disease
free.sup.4 (4 yrs) S85 Benign.sup.2 SDHD 187,809 Disease free (2
yrs) S73 Benign.sup.3 SDHB 200,000 Disease free (2.5 yrs) S82
Benign.sup.3 SDHB 200,714 Disease free (2.4 yrs) S31 Benign SDHB
11,894,562 Metastatic (2 yrs) S18 Metastatic SDHB 5,583,686
Metastatic S22 Metastatic SDHB 10,937,462 Metastatic S95-A-1
Metastatic SDHB 6,181,873 Metastatic M20 Metastatic SDHB 11,057,100
Metastatic .sup.1Diagnosis at the time of surgery .sup.2Benign
adrenal .sup.3Benign extra-adrenal .sup.4Disease free refers to no
clinical symptoms or signs of disease with negative imaging and
biochemical data.
[0155] Four of the SDHB patients diagnosed with metastatic tumors
based on the pathology of the tumor and lymph node invasion had
copy numbers within the range of 5-11 million copies.
[0156] In the group of three SDHB patients diagnosed with benign
tumors, two had copy numbers of about 200,000. Interestingly, one
of these patients had a copy number of almost 12 million. This
patient was recalled, and it was found that he had developed
recurrence and metastasis.
[0157] The two SDHD patients with benign tumors showed CPE-.DELTA.N
mRNA copy numbers of about 180,000.
[0158] Patients with CPE-.DELTA.N mRNA copy numbers of
180,000-200,000 that had tumors diagnosed as benign showed no
recurrence between 2-5 years after surgery.
[0159] These analyses demonstrate the accuracy (100%) of this
method of assaying CPE-.DELTA.N biomarker in diagnosing and
predicting future metastasis in SDHB/SDHD patients.
[0160] To further test the method, a group of MEN2 patients were
examined in a blinded study. Most MEN2 patients develop bilateral
adrenal tumors. Extra-adrenal localization and malignant disease
are very rare in this group of patients. Four MEN2 patients were
diagnosed with benign tumors at the time of surgery (see Table 4).
Of those, three had CPE-.DELTA.N mRNA copy numbers in the
170,000-200,000 range consistent with the numbers found in SDHD/B
with benign tumors. Two patients had copy numbers of 6.7-14.8
million. The patients showed symptoms of recurrence.
TABLE-US-00004 TABLE 4 Determination of CPE-.DELTA.N mRNA copy
number in MEN2 tumors. Follow-up (years of Sample Geno- Copy
follow-up or time to Number State.sup.1 type Number
recurrence/metastasis) M05 Benign.sup.2 MEN2 14,825,680 Recurrent
(8 yrs) M06 Recurrent.sup.3 MEN2 6,750,151 Recurrent (4 yrs) M12
Benign.sup.2 MEN2 194,801 Disease free.sup.4 (6.5 yrs) M13
Benign.sup.2 MEN2 190,139 Disease free (6 yrs) M15 Benign.sup.2
MEN2 168,984 No information .sup.1Diagnosis at the time of surgery
.sup.2Benign adrenal .sup.3Recurrent in contralateral adrenal
surgical bed .sup.4Disease free refers to no clinical symptoms or
signs of disease with negative imaging and biochemical data.
[0161] A group of eight patients with PHEO/PGL that had no
hereditary basis for the disease also were studied. This group has
been termed "sporadic" cases. Of the eight cases diagnosed as
having a benign tumor at time of surgery, four of them had
CPE-.DELTA.N mRNA copy numbers in the 130,000-185,000 range and
have not shown any recurrence 2-5 years post surgery (Table 5).
[0162] In contrast, there were four patients that had CPE-.DELTA.N
mRNA copy numbers of 4.3-7.2 million. One patient has since
developed thyroid cancer, and another showed capsular and vascular
invasion, indicating that the primary tumors of these patients were
not typical benign tumors. Another patient had an unusually large
(8 cm) adrenal tumor, while one had surgery only a year ago, and it
is too early to know if he will show recurrence later.
Nevertheless, the high CPE-.DELTA.N mRNA copy number in these
patients certainly warrants close follow-up.
TABLE-US-00005 TABLE 5 Determination of CPE-.DELTA.N mRNA copy
number in sporadic PHEO/PGL tumors. Sample Geno- Copy Number
State.sup.1 type Number Follow-up S39 Benign SPORADIC 175,080 S45
Benign SPORADIC 6,181,873 Thyroid cancer S48 Benign SPORADIC
184,761 S49 Benign SPORADIC 181,713 S67 Benign SPORADIC 135,279 S71
Benign SPORADIC 6,451,057 Large tumor (8 cm) S75 Benign SPORADIC
4,357,402 S76 Benign SPORADIC 7,228,701 Capsular and vascular
invasion .sup.1At the time of surgery
[0163] These results from 22 patients in different categories
(SDHB/D, MEN2, and sporadic) clearly demonstrate that the
measurement of CPE-.DELTA.N mRNA copy numbers can be used as a
prognostic tool in diagnosing and predicting recurrence/metastasis
of PHEOs/PGLs. Tumors with CPE-.DELTA.N mRNA copy numbers of less
than 200,000 clearly are benign. In contrast, tumors with
CPE-.DELTA.N mRNA copy numbers of 1-12 million or greater are
malignant, or patients with these tumors have a high probability of
showing recurrence and future metastasis.
Example 3
[0164] This example demonstrates that the expression level of
CPE-.DELTA.N is correlated with metastasis.
[0165] Differentiated thyroid carcinoma (DTC) is a malignancy of
epithelial origin that is on the rise in the U.S. The vast majority
of patients who have low risk disease do not develop distant
metastases and have excellent survival. However, the minority of
patients who have high-risk disease develop distant metastases and
experience reduced survival.
[0166] Some prognostic indicators are helpful in predicting which
patients are more likely to develop distant metastases. Examples of
prognostic indicators that can be assessed at the time of
thyroidectomy are age at diagnosis, tumor size, and soft tissue
invasion. Other prognostic indicators include BRAF mutations,
cyclin D expression, galectin-3 expression, p53 expression, tumor
vascularity, post-operative serum thyroglobulin levels, and the
presence of variant types of differentiated thyroid cancer such as
the tall cell variant. However, the performance of these prognostic
indicators is imperfect. Distant metastases clearly portend a worse
prognosis, but the presence of such disease frequently is not
discovered until imaging studies are performed at various follow-up
visits after the initial thyroidectomy.
[0167] An area of particular interest with respect to thyroid
cancer prognosis is potential gender differences. Differentiated
thyroid cancer has a higher incidence and prevalence in females
than males. There is disagreement as to whether there is truly a
different biologic behavior of thyroid carcinoma between genders,
or whether thyroid cancer is simply detected at a later, less
treatment-responsive stage in males. Certainly the role of estrogen
as a modulator of apoptosis in thyroid cancer cells has been
investigated, but although the findings from such studies could
potentially explain the increased incidence of thyroid cancer in
women, the findings do not provide on explanation for the better
prognosis of thyroid cancer in females.
[0168] There is, therefore, a need for an accurate prognostic
indicator that can be readily assessed at the time of initial
surgery.
[0169] The use of CPE-.DELTA.N mRNA copy number as biomarker for
metastasis for DTC was evaluated in a blinded study. The
CPE-.DELTA.N mRNA copy numbers from resected DTC from different
categories (papillary carcinoma and hurthle cell carcinoma) were
determined using the methods described in Example 2 (see Table
6).
TABLE-US-00006 TABLE 6 Determination of CPE-.DELTA.N mRNA copy
number in DTC tumors. Sample Copy Number State* Description Number
Follow-up 12-T Metastasis Papillary 11,097,674 Died from Carcinoma
the cancer 39-T Metastasis Papillary 14,279,070 Carcinoma 39N
Normal Surrounding non 3,260 tumor tissue 219-T-2 No Metastasis
Papillary 563,118 Carcinoma 219-N-1 Normal Surrounding non 162,888
tumor tissue 296T-1 No Metastasis Papillary 235,311 No Carcinoma
recurrence after 2 yrs 296N-2 Normal Surrounding non 6,530 tumor
tissue 189T No Metastasis Papillary 6,114 Carcinoma 189-N-1 Normal
Surrounding non 7,950 tumor tissue 333T No Metastasis Papillary
7,025 Carcinoma 650T-1 No Metastasis Hurthle cell 223,347 carcinoma
246-1-T No Metastasis Hurthle cell 602,598 carcinoma *At the time
of surgery
[0170] CPE-.DELTA.N mRNA copy numbers of metastatic tumors from two
patients were 11 million and 14 million (see Table 6). CPE-.DELTA.N
mRNA copy numbers in tumors that did not show metastasis ranged
from 6,000-600,000. Where there was patient follow up data
available, the patient with 11 million copies died of the cancer,
whereas a patient with 235,000 copies did not show recurrence in 2
years.
[0171] From the eight patient samples for DTC, it can be concluded
that CPE-.DELTA.N mRNA copy numbers of 250,000 or less fall into a
very low risk group with values typically found in normal tissue
and benign tumors. This is similar to PGLs (see Example 2).
[0172] In contrast, CPE-.DELTA.N mRNA copy numbers of greater than
1 million indicates a metastatic tumor. Patients having
non-malignant tumors with CPE-.DELTA.N mRNA copy numbers between
400,000-1 million (e.g., 500,000, 600,000, 700,000, 800,000,
900,000, or ranges of the values described herein) could
potentially develop recurrence or metastasis and should be
carefully monitored.
[0173] All references, including publications, patent applications,
and patents, cited herein are hereby incorporated by reference to
the same extent as if each reference were individually and
specifically indicated to be incorporated by reference and were set
forth in its entirety herein.
[0174] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. The terms "comprising,"
"having," "including," and "containing" are to be construed as
open-ended terms (i.e., meaning "including, but not limited to,")
unless otherwise noted. Recitation of ranges of values herein are
merely intended to serve as a shorthand method of referring
individually to each separate value falling within the range,
unless otherwise indicated herein, and each separate value is
incorporated into the specification as if it were individually
recited herein. All methods described herein can be performed in
any suitable order unless otherwise indicated herein or otherwise
clearly contradicted by context. The use of any and all examples,
or exemplary language (e.g., "such as") provided herein, is
intended merely to better illuminate the invention and does not
pose a limitation on the scope of the invention unless otherwise
claimed. No language in the specification should be construed as
indicating any non-claimed element as essential to the practice of
the invention.
[0175] Preferred embodiments of this invention are described
herein, including the best mode known to the inventors for carrying
out the invention. Variations of those preferred embodiments may
become apparent to those of ordinary skill in the art upon reading
the foregoing description. The inventors expect skilled artisans to
employ such variations as appropriate, and the inventors intend for
the invention to be practiced otherwise than as specifically
described herein. Accordingly, this invention includes all
modifications and equivalents of the subject matter recited in the
claims appended hereto as permitted by applicable law. Moreover,
any combination of the above-described elements in all possible
variations thereof is encompassed by the invention unless otherwise
indicated herein or otherwise clearly contradicted by context.
Sequence CWU 1
1
2712191DNAHomo sapiens 1agtgcgcggg ctgacactca ttcagccggg gaaggtgagg
cgagtagagg ctggtgcgga 60acttgccgcc cccagcagcg ccggcgggct aagcccaggg
ccgggcagac aaaagaggcc 120gcccgcgtag gaaggcacgg ccggcggcgg
cggagcgcag cgatggccgg gcatgaggcg 180gcgccggcgg ctgcagcaag
aggacggcat ctccttcgag taccaccgct accccgagct 240gcgcgaggcg
ctcgtgtccg tgtggctgca gtgcaccgcc atcagcagga tttacacggt
300ggggcgcagc ttcgagggcc gggagctcct ggtcatcgag ctgtccgaca
accctggcgt 360ccatgagcct ggtgagcctg aatttaaata cattgggaat
atgcatggga atgaggctgt 420tggacgagaa ctgctcattt tcttggccca
gtacctatgc aacgaatacc agaaggggaa 480cgagacaatt gtcaacctga
tccacagtac ccgcattcac atcatgcctt ccctgaaccc 540agatggcttt
gagaaggcag cgtctcagcc tggtgaactc aaggactggt ttgtgggtcg
600aagcaatgcc cagggaatag atctgaaccg gaactttcca gacctggata
ggatagtgta 660cgtgaatgag aaagaaggtg gtccaaataa tcatctgttg
aaaaatatga agaaaattgt 720ggatcaaaac acaaagcttg ctcctgagac
caaggctgtc attcattgga ttatggatat 780tccttttgtg ctttctgcca
atctccatgg aggagacctt gtggccaatt atccatatga 840tgagacgcgg
agtggtagtg ctcacgaata cagctcctcc ccagatgacg ccattttcca
900aagcttggcc cgggcatact ctcctttcaa cccggccatg tctgacccca
atcggccacc 960atgtcgcaag aatgatgatg acagcagctt tgtagatgga
accaccaacg gtggtgcttg 1020gtacagcgta cctggaggga tgcaagactt
caattacctt agcagcaact gttttgagat 1080caccgtggag cttagctgtg
agaagttccc acctgaagag actctgaaga cctactggga 1140ggataacaaa
aactccctca ttagctacct tgagcagata caccgaggag ttaaaggatt
1200tgtccgagac cttcaaggta acccaattgc gaatgccacc atctccgtgg
aaggaataga 1260ccacgatgtt acatccgcaa aggatggtga ttactggaga
ttgcttatac ctggaaacta 1320taaacttaca gcctcagctc caggctatct
ggcaataaca aagaaagtgg cagttcctta 1380cagccctgct gctggggttg
attttgaact ggagtcattt tctgaaagga aagaagagga 1440gaaggaagaa
ttgatggaat ggtggaaaat gatgtcagaa actttaaatt tttaaaaagg
1500cttctagtta gctgctttaa atctatctat ataatgtagt atgatgtaat
gtggtctttt 1560ttttagattt tgtgcagtta atacttaaca ttgatttatt
ttttaatcat ttaaatatta 1620atcaactttc cttaaaataa atagcctctt
aggtaaaaat ataagaactt gatatatttc 1680attctcttat atagtattca
ttttcctacc tatattacac aaaaaagtat agaaaagatt 1740taagtaattt
tgccatccta ggcttaaatg caatattcct ggtattattt acaatgcaga
1800attttttgag taattctagc tttcaaaaat tagtgaagtt cttttactgt
aattggtgac 1860aatgtcacat aatgaatgct attgaaaagg ttaacagata
cagctcggag ttgtgagcac 1920tctactgcaa gacttaaata gttcagtata
aattgtcgtt tttttcttgt gctgactaac 1980tataagcatg atcttgttaa
tgcatttttg atgggaagaa aaggtacatg tttacaaaga 2040ggttttatga
aaagaataaa aattgacttc ttgcttgtac atataggagc aatactatta
2100tattatgtag tccgttaaca ctacttaaaa gtttagggtt ttctcttggt
tgtagagtgg 2160cccagaattg cattctgaat gaataaaggt t 21912440PRTHomo
sapiens 2Met Arg Arg Arg Arg Arg Leu Gln Gln Glu Asp Gly Ile Ser
Phe Glu 1 5 10 15 Tyr His Arg Tyr Pro Glu Leu Arg Glu Ala Leu Val
Ser Val Trp Leu 20 25 30 Gln Cys Thr Ala Ile Ser Arg Ile Tyr Thr
Val Gly Arg Ser Phe Glu 35 40 45 Gly Arg Glu Leu Leu Val Ile Glu
Leu Ser Asp Asn Pro Gly Val His 50 55 60 Glu Pro Gly Glu Pro Glu
Phe Lys Tyr Ile Gly Asn Met His Gly Asn 65 70 75 80 Glu Ala Val Gly
Arg Glu Leu Leu Ile Phe Leu Ala Gln Tyr Leu Cys 85 90 95 Asn Glu
Tyr Gln Lys Gly Asn Glu Thr Ile Val Asn Leu Ile His Ser 100 105 110
Thr Arg Ile His Ile Met Pro Ser Leu Asn Pro Asp Gly Phe Glu Lys 115
120 125 Ala Ala Ser Gln Pro Gly Glu Leu Lys Asp Trp Phe Val Gly Arg
Ser 130 135 140 Asn Ala Gln Gly Ile Asp Leu Asn Arg Asn Phe Pro Asp
Leu Asp Arg 145 150 155 160 Ile Val Tyr Val Asn Glu Lys Glu Gly Gly
Pro Asn Asn His Leu Leu 165 170 175 Lys Asn Met Lys Lys Ile Val Asp
Gln Asn Thr Lys Leu Ala Pro Glu 180 185 190 Thr Lys Ala Val Ile His
Trp Ile Met Asp Ile Pro Phe Val Leu Ser 195 200 205 Ala Asn Leu His
Gly Gly Asp Leu Val Ala Asn Tyr Pro Tyr Asp Glu 210 215 220 Thr Arg
Ser Gly Ser Ala His Glu Tyr Ser Ser Ser Pro Asp Asp Ala 225 230 235
240 Ile Phe Gln Ser Leu Ala Arg Ala Tyr Ser Ser Phe Asn Pro Ala Met
245 250 255 Ser Asp Pro Asn Arg Pro Pro Cys Arg Lys Asn Asp Asp Asp
Ser Ser 260 265 270 Phe Val Asp Gly Thr Thr Asn Gly Gly Ala Trp Tyr
Ser Val Pro Gly 275 280 285 Gly Met Gln Asp Phe Asn Tyr Leu Ser Ser
Asn Cys Phe Glu Ile Thr 290 295 300 Val Glu Leu Ser Cys Glu Lys Phe
Pro Pro Glu Glu Thr Leu Lys Thr 305 310 315 320 Tyr Trp Glu Asp Asn
Lys Asn Ser Leu Ile Ser Tyr Leu Glu Gln Ile 325 330 335 His Arg Gly
Val Lys Gly Phe Val Arg Asp Leu Gln Gly Asn Pro Ile 340 345 350 Ala
Asn Ala Thr Ile Ser Val Glu Gly Ile Asp His Asp Val Thr Ser 355 360
365 Ala Lys Asp Gly Asp Tyr Trp Arg Leu Leu Ile Pro Gly Asn Tyr Lys
370 375 380 Leu Thr Ala Ser Ala Pro Gly Tyr Leu Ala Ile Thr Lys Lys
Val Ala 385 390 395 400 Val Pro Tyr Ser Pro Ala Ala Gly Val Asp Phe
Glu Leu Glu Ser Phe 405 410 415 Ser Glu Arg Lys Glu Glu Glu Lys Glu
Glu Leu Met Glu Trp Trp Lys 420 425 430 Met Met Ser Glu Thr Leu Asn
Phe 435 440 3 1949DNAMus musculus 3gtgaggcgag aggaggctgg tgctgagctc
gccaactcca cccgggcccg ggcagacaaa 60agaggccagc aagaggacgg catctccttc
gagtaccacc gctatccaga gctgcgcgag 120gcgctggtgt ccgtatggct
gcagtgcacc gccatcagca gaatctacac agtggggcgc 180agcttcgagg
gccgggagct cctggtcatc gagctgtctg acaaccccgg ggtccatgag
240ccgggtgaac ctgaatttaa atacattggg aacatgcatg gtaatgaggc
ggttggacgg 300gaactgctta ttttcttggc ccagtacctg tgtaacgagt
accagaaagg caatgagaca 360attgtcaacc tgatccacag cacccgaatt
catatcatgc cctccttgaa ccccgacggc 420tttgagaaag ccgcatcgca
gcccggcgag ctgaaggact ggtttgtggg ccgcagcaac 480gcccagggaa
tagatctgaa ccgtaacttc ccagacctgg acaggatcgt gtatgttaat
540gagaaagaag gcggtcctaa caatcacctg ctgaagaatc tgaagaaaat
tgtggaccaa 600aattcaaagc ttgcccccga gaccaaggct gtcattcact
ggatcatgga cattccattt 660gtgctttctg ccaatctgca cggaggagac
cttgtggcta attacccata tgatgagaca 720cggagcggta ctgctcacga
atacagttcc tgccctgatg acgcaatttt ccaaagcttg 780gctcgcgcgt
actcttcttt caacccagtc atgtctgacc ccaatcgacc tccctgtcgc
840aagaatgacg atgacagcag ctttgtagat ggaacgacca atggtggtgc
atggtacagc 900gtccccggtg gaatgcaaga cttcaattac ctgagcagca
actgcttcga gatcactgtg 960gagcttagct gtgagaagtt cccaccggaa
gagactctca aaagctactg ggaagataac 1020aaaaactccc tcatcagcta
cctggagcag atacaccgag gtgttaaagg gtttgtccgt 1080gaccttcagg
gtaacccgat tgccaacgca accatctctg tggacgggat agaccatgat
1140gtcacctcgg ctaaggatgg ggattactgg cgattgcttg ctcctggaaa
ctataaactt 1200acagcctccg ctcctggcta cctggcaatc acaaagaaag
tggcagttcc ttttagccct 1260gctgttgggg tggactttga gcttgagtct
ttctctgaaa ggaaggagga ggagaaggaa 1320gaattgatgg agtggtggaa
aatgatgtca gaaactttga atttttaaga aaggcttcta 1380actaattgct
ttaatctatc tatagactgt agtaagatgc aatgtggctc ttttctttta
1440ggttgtgtgc agttgatatt taacattgat ttatttttga tcatttaagt
aatagttagt 1500aatcacgtaa atacacccgg acagaaatat aatgtctgga
tctacttcat tcttacatca 1560acattcactt taaaatctat cgaagctctt
ttaacgtaat gggtgacaat gtcacatgac 1620agatgccatg aagaagtcaa
ccgatatagc ttggatctgt gaaccctgta ctgcgagaat 1680cacatagttc
catataagtt gtccttagtc tcttgtgctg attcactgta taagcatgat
1740cctggtaatg cactttggat gggaagaaaa tgtacgtgct tttcagaggg
gctctgaaca 1800gaatgaaaac ctagttcttg cgtgtacttt gaagaatgga
attgtattag tcagcctgtt 1860aatgccactt cagagtttgg ggttttgtct
tgattgtaga ttggcccaga attgcattct 1920gatgaataaa ggcaaaaaaa
aaaaaaaaa 19494364PRTMus musculus 4Met His Gly Asn Glu Ala Val Gly
Arg Glu Leu Leu Ile Phe Leu Ala 1 5 10 15 Gln Tyr Leu Cys Asn Glu
Tyr Gln Lys Gly Asn Glu Thr Ile Val Asn 20 25 30 Leu Ile His Ser
Thr Arg Ile His Ile Met Pro Ser Leu Asn Pro Asp 35 40 45 Gly Phe
Glu Lys Ala Ala Ser Gln Pro Gly Glu Leu Lys Asp Trp Phe 50 55 60
Val Gly Arg Ser Asn Ala Gln Gly Ile Asp Leu Asn Arg Asn Phe Pro 65
70 75 80 Asp Leu Asp Arg Ile Val Tyr Val Asn Glu Lys Glu Gly Gly
Pro Asn 85 90 95 Asn His Leu Leu Lys Asn Leu Lys Lys Ile Val Asp
Gln Asn Ser Lys 100 105 110 Leu Ala Pro Glu Thr Lys Ala Val Ile His
Trp Ile Met Asp Ile Pro 115 120 125 Phe Val Leu Ser Ala Asn Leu His
Gly Gly Asp Leu Val Ala Asn Tyr 130 135 140 Pro Tyr Asp Glu Thr Arg
Ser Gly Thr Ala His Glu Tyr Ser Ser Cys 145 150 155 160 Pro Asp Asp
Ala Ile Phe Gln Ser Leu Ala Arg Ala Tyr Ser Ser Phe 165 170 175 Asn
Pro Val Met Ser Asp Pro Asn Arg Pro Pro Cys Arg Lys Asn Asp 180 185
190 Asp Asp Ser Ser Phe Val Asp Gly Thr Thr Asn Gly Gly Ala Trp Tyr
195 200 205 Ser Val Pro Gly Gly Met Gln Asp Phe Asn Tyr Leu Ser Ser
Asn Cys 210 215 220 Phe Glu Ile Thr Val Glu Leu Ser Cys Glu Lys Phe
Pro Pro Glu Glu 225 230 235 240 Thr Leu Lys Ser Tyr Trp Glu Asp Asn
Lys Asn Ser Leu Ile Ser Tyr 245 250 255 Leu Glu Gln Ile His Arg Gly
Val Lys Gly Phe Val Arg Asp Leu Gln 260 265 270 Gly Asn Pro Ile Ala
Asn Ala Thr Ile Ser Val Asp Gly Ile Asp His 275 280 285 Asp Val Thr
Ser Ala Lys Asp Gly Asp Tyr Trp Arg Leu Leu Ala Pro 290 295 300 Gly
Asn Tyr Lys Leu Thr Ala Ser Ala Pro Gly Tyr Leu Ala Ile Thr 305 310
315 320 Lys Lys Val Ala Val Pro Phe Ser Pro Ala Val Gly Val Asp Phe
Glu 325 330 335 Leu Glu Ser Phe Ser Glu Arg Lys Glu Glu Glu Lys Glu
Glu Leu Met 340 345 350 Glu Trp Trp Lys Met Met Ser Glu Thr Leu Asn
Phe 355 360 520DNAHomo sapiens 5atggccgggc atgaggcggc 20620DNAHomo
sapiens 6gctgcgcccc accgtgtaaa 20739DNAHomo sapiens 7gagcgcagcg
atggccgggc atgaggcggc gccggcggc 39840DNAHomo sapiens 8ggccctcgaa
gctgcgcccc accgtgtaaa tcctgctgat 4099DNAHomo sapiens 9cgggcatga 9
109DNAHomo sapiens 10ccccaccgt 9 1120DNAHomo sapiens 11ccatctccgt
ggaaggaata 201220DNAHomo sapiens 12cctggagctg aggctgtaag
201340DNAHomo sapiens 13gcgaatgcca ccatctccgt ggaaggaata gaccacgatg
401440DNAHomo sapiens 14tgccagatag cctggagctg aggctgtaag tttatagttt
401510DNAHomo sapiens 15tccgtggaag 101610DNAHomo sapiens
16tccgtggaag 101720DNAMus musculus 17gacaaaagag gccagcaaga
201818DNAMus musculus 18caggttcacc cggctcat 181930DNAMus musculus
19cagacaaaag aggccagcaa gaggacggca 302029DNAMus musculus
20attcaggttc acccggctca tggaccccg 292110DNAMus musculus
21aggccagcaa 102210DNAMus musculus 22gttcacccgg 102320DNAArtificial
SequenceSynthetic 23ctcttagctg agtgtcccgc 202420DNAArtificial
SequenceSynthetic 24ctgatcgtct tcgaacctcc 202558DNAHomo sapiens
25ccggccagta cctatgcaac gaatactcga gtattcgttg cataggtact ggtttttg
582658DNAHomo sapiens 26ccggctccag gctatctggc aataactcga gttattgcca
gatagcctgg agtttttg 582758DNAHomo sapiens 27ccgggatagg atagtgtacg
tgaatctcga gattcacgta cactatccta tctttttg 58
* * * * *