Membrane Bioreactor For Increased Production Of Isoprene Gas

Abstract

The invention provides improved methods for the production of isoprene from biological materials.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. patent application Ser. No. 12/976,572, filed on Dec. 22, 2010, which claims priority to U.S. Provisional Patent Application No. 61/289,352, filed on Dec. 22, 2009, the disclosures of which are herein incorporated by reference in their entirety.

FIELD OF THE INVENTION

[0002] This disclosure relates to improved methods for the production of isoprene.

BACKGROUND OF THE INVENTION

[0003] Isoprene (2-methyl-1,3-butadiene) is an important organic compound used in a wide array of applications. For instance, isoprene is employed as an intermediate or a starting material in the synthesis of numerous chemical compositions and polymers. Isoprene is also an important biological material that is synthesized naturally by many plants and animals, including humans.

[0004] The isoprene used in industrial applications is typically produced as a by-product of the thermal cracking of petroleum or naphtha or is otherwise extracted from petrochemical streams. This is a relatively expensive, energy-intensive process. With the worldwide demand for petrochemical based products constantly increasing, the cost of isoprene is expected to rise to much higher levels in the long-term and its availability is limited in any case. There is concern that future supplies of isoprene from petrochemical-based sources will be inadequate to meet projected needs and that prices will rise to unprecedented levels. Accordingly, there is a need to procure a source of isoprene from a low cost, renewable source which is environmentally friendly.

[0005] Several recent advancements have been made in the production of isoprene from renewable sources (see, for example, International Patent Application Publication No. WO 2009/076676 A2). Such methods produce isoprene at rates, titers, and purity that may be sufficient to meet the demands of a robust commercial process, however process improvements to reduce the operational costs associated with the production of isoprene derived from biological sources, and to increase yields of isoprene are needed.

[0006] All patents, patent applications, publications, documents, nucleotide and protein sequence database accession numbers, the sequences to which they refer, and articles cited herein are all incorporated herein by reference in their entireties.

BRIEF SUMMARY OF THE INVENTION

[0007] Disclosed herein are improved methods for the production of isoprene from biological materials, comprising the operation of a membrane bioreactor in conjunction with a bioreactor culturing isoprene-producing cells.

[0008] In one aspect, provided herein are improved methods of producing isoprene, the methods comprising: (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide under suitable culture conditions for the production of isoprene, wherein the cells either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity of isoprene greater than about 500 mg/L.sub.broth/hr of isoprene; (b) removing a portion of the culture; (c) filtering the removed portion of the culture to produce a permeate and a retentate; (d) returning the retentate to the culture; and (e) producing isoprene; wherein the cultured cells undergoing steps (b), (c), and (d) either (i) produce isoprene at a higher titer, or (ii) have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), and (d).

[0009] In another aspect, provided herein are improved methods of producing isoprene, the methods comprising: (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide under suitable culture conditions for the production of isoprene, wherein the cells either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity of isoprene greater than about 500 mg/L.sub.broth/hr of isoprene; (b) removing a portion of the culture; (c) filtering the removed portion of the culture to produce a permeate and a retentate; (d) returning the retentate to the culture; (e) producing isoprene; and (1) recovering the isoprene; wherein the cultured cells undergoing steps (b), (c), and (d) either (i) produce isoprene at a higher titer, or (ii) have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), and (d). In some aspects, the filtering is by tangential flow filtration.

[0010] In some aspects, the cells produce isoprene at a titer of greater than about 40 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 50 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 60 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 70 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 80 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 90 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 100 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 110 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 120 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 130 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 140 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 150 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 160 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 170 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 180 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 190 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 100 g/L. In some aspects, the cells produce isoprene at a titer between about 60 g/L and about 100 g/L. In some aspects, the cells produce isoprene at a titer between about 60 g/L and about 120 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 80 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 180 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 120 g/L and about 200 g/L. In some aspects, the cells have an average volumetric productivity of greater than about 500 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 1.000 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 1.500 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 2,000 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity between about 500 mg/L.sub.broth/hr and about 2,000 mg/L.sub.broth/hr of isoprene.

[0011] In some aspects, the method further comprises a step of recycling the permeate back into the same cell culture or into another cell culture, wherein the cells cultured in the presence of recycled permeate have greater average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the cells have about two times the average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the cells have about three times the average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the portion of the culture is removed continuously. In some aspects, the portion of the culture is removed discontinuously.

[0012] In some aspects, the isoprene synthase polypeptide is a plant isoprene synthase polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding an IDI polypeptide. In some aspects, the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding an IDI polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding a DXP pathway polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding a DXS polypeptide. In some aspects, the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding a DXS polypeptide. In some aspects, the cells further comprise one or more nucleic acids encoding an IDI polypeptide and a DXS polypeptide or a DXP pathway polypeptide. In some aspects, one nucleic acid encodes the isoprene synthase polypeptide. IDI polypeptide, and DXS polypeptide or a DXP pathway polypeptide. In some aspects, one plasmid encodes the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding an MVA pathway polypeptide. In some aspects, the MVA pathway polypeptide is a mevalonate kinase (MVK) polypeptide. In some aspects, the MVK polypeptide is a polypeptide from the genus Methanosarcina. In some aspects, the Methanosarcina is Methanosarcina mazei.

[0013] In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from the genus Pueraria. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from Pueraria montana. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from the genus Populus. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from Populus alba. In some aspects, the cells further comprise a heterologous nucleic acid encoding an MVA pathway polypeptide. In some aspects, the MVA pathway polypeptide is a mevalonate kinase (MVK). In some aspects, the MVK is from the genus Methanosarcina. In some aspects, the MVK is from Methanosarcina mazei. In some aspects, the cells are bacterial cells. In some aspects, the cells are gram-positive bacterial cells. In some aspects, the cells are Bacillus cells. In some aspects, the cells are Bacillus subtilis cells. In some aspects, the cells are gram-negative bacterial cells. In some aspects, the cells are Escherichia or Pantoea cells. In some aspects, the cells are Escherichia coli or Pantoea citrea cells. In some aspects, the cells are fungal cells. In some aspects, the cells are Trichoderma cells. In some aspects, the cells are Trichoderma reesei cells. In some aspects, the cells are yeast cells. In some aspects, the cells are Yarrowia cells. In some aspects, the cells are Yarrowia lipolytica cells.

[0014] In some aspects, the cells comprise (i) an integrated nucleic acid encoding the lower MVA pathway from S. cerevisiae comprising a glucose isomerase promoter and a nucleic acid encoding mevalonate kinase (MVK); a nucleic acid encoding phosphomevalonate kinase (PMK); a nucleic acid encoding diphosphomevalonate decarboxylase (MVD); and a nucleic acid encoding isopentenyl diphosphate isomerase (IDI); (ii) a nucleic acid encoding P. alba isoprene synthase; (iii) a nucleic acid encoding M. mazei mevalonate kinase; and (iv) a nucleic acid encoding the upper MVA pathway from Enterococcus faecalis, comprising a nucleic acid encoding an acetoacetyl-Coenzyme A synthase (thiolase) polypeptide; a nucleic acid encoding a 3-hydroxy-3-methylglutaryl-Coenzyme A synthase polypeptide; and a nucleic acid encoding a 3-hydroxy-3-methylglutaryl-Coenzyme A reductase polypeptide.

[0015] In another aspect, provided herein are improved methods of producing isoprene, the methods comprising: (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide in a fermentor containing growth medium under suitable culture conditions for the production of isoprene, wherein the cells either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity of isoprene greater than about 500 mg/L.sub.broth/hr of isoprene; (b) removing a portion of the cell culture from the fermentor; (c) transferring the removed portion of the cell culture to a filter; (d) filtering the removed portion of the cell culture to form: (i) a permeate comprising spent growth medium; and (ii) a retentate comprising cells and other culture solids; (e) returning the retentate to the fermentor; (f) collecting the permeate; and (g) producing isoprene; wherein the cultured cells undergoing steps (b), (c), (d) and (e) either (i) produce isoprene at a higher titer, or (ii) have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), (d), and (e).

[0016] In another aspect, provided herein are improved methods of producing isoprene, the methods comprising: (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide in a fermentor containing growth medium under suitable culture conditions for the production of isoprene, wherein the cells either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity of isoprene greater than about 500 mg/L.sub.broth/hr of isoprene; (b) removing a portion of the cell culture from the fermentor; (c) transferring the removed portion of the cell culture to a filter; (d) filtering the removed portion of the cell culture to form: (i) a permeate comprising spent growth medium; and (ii) a retentate comprising cells and other culture solids; (e) returning the retentate to the fermentor; (f) collecting the permeate; (g) producing isoprene; and (h) recovering the isoprene; wherein the cultured cells undergoing steps (b), (c), (d) and (e) either (i) produce isoprene at a higher titer, or (ii) have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), (d), and (e).

[0017] In some aspects, the fermentor and the filter are connected by a circulation loop and a circulation pump. In some aspects, the permeate is collected from the filter by a permeate collection outlet and a permeate pump and stored in a permeate collection tank. In some aspects, the permeate collection tank further comprises a vent to relieve pressure within the tank. In some aspects, the circulation pump and the permeate pump are peristaltic pumps. In some aspects, the filter is a microfilter. In some aspects, the filter is an ultrafilter. In some aspects, the microfilter is a tangential flow filter. In some aspects, the tangential flow filter has a filter pore size between about 0.005 .mu.m and about 100 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.05 .mu.m and about 10 .mu.m. In some aspects, the ultrafilter is a tangential flow filter. In some aspects, the tangential flow filter has a nominal molecular weight cutoff (NMWC) greater than about 100,000. In some aspects, the tangential flow filter has a NMWC greater than about 250,000. In some aspects, the tangential flow filter is a GE Healthcare Xampler.TM. Ultrafiltration Cartridge having a 500,000 nominal molecular weight cutoff (NMWC) and comprising a hollow fiber membrane.

[0018] In some aspects, the method further comprises the steps of (i) monitoring the inlet pressure of the filter with an inlet pressure gauge (P.sub.in); (ii) monitoring the outlet pressure of the filter with an outlet pressure gauge (P.sub.out); (iii) monitoring the pressure in the permeate collection outlet with a permeate pressure gauge (P.sub.perm); and (iv) determining the transmembrane pressure (TMP) across the filter. In some aspects, the method further comprises the step of maintaining positive TMP across the filter. In some aspects, the fermentor further comprises an isoprene collection outlet connected to an isoprene storage tank.

[0019] In some aspects, the cells produce isoprene at a titer of greater than about 40 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 50 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 60 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 70 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 80 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 90 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 100 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 110 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 120 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 130 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 140 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 150 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 160 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 170 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 180 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 190 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 100 g/L. In some aspects, the cells produce isoprene at a titer between about 60 g/L and about 100 g/L. In some aspects, the cells produce isoprene at a titer between about 60 g/L and about 120 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 80 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 180 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 120 g/L and about 200 g/L. In some aspects, the cells have an average volumetric productivity of greater than about 500 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 1.000 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 1,500 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 2.000 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity between about 500 mg/L.sub.broth/hr and about 2,000 mg/L.sub.broth/hr of isoprene.

[0020] In some aspects, the method further comprises the steps of sterilizing the collected permeate and recycling it back into the same fermentor or into another fermentor, wherein the cells cultured in the presence of recycled permeate have greater average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the cells have about two times the average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the cells have about three times the average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the portion of the culture is removed continuously. In some aspects, the portion of the culture is removed discontinuously.

[0021] In some aspects, the isoprene synthase polypeptide is a plant isoprene synthase polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding an IDI polypeptide. In some aspects, the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding an IDI polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding a DXS polypeptide. In some aspects, the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding a DXS polypeptide. In some aspects, the cells further comprise one or more nucleic acids encoding an IDI polypeptide and a DXS polypeptide. In some aspects, one nucleic acid encodes the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide. In some aspects, one plasmid encodes the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding an MVA pathway polypeptide. In some aspects, the MVA pathway polypeptide is a mevalonate kinase (MVK) polypeptide. In some aspects, the MVK polypeptide is from the genus Methanosarcina. In some aspects, the MVK is from Methanosarcina mazei. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from the genus Pueraria. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from Pueraria montana. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from the genus Populus. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from Populus alba. In some aspects, the cells further comprise a heterologous nucleic acid encoding an MVA pathway polypeptide. In some aspects, the MVA pathway polypeptide is a mevalonate kinase (MVK) polypeptide. In some aspects, the MVK polypeptide is from the genus Methanosarcina. In some aspects, the MVK polypeptide is from Methanosarcina mazei. In some aspects, the cells are bacterial cells.

[0022] In some aspects, the cells are gram-positive bacterial cells. In some aspects, the cells are Bacillus cells. In some aspects, the cells are Bacillus subtilis cells. In some aspects, the cells are gram-negative bacterial cells. In some aspects, the cells are Escherichia or Pantoea cells. In some aspects, the cells are Escherichia coli or Pantoea citrea cells. In some aspects, the cells are fungal cells. In some aspects, the cells are Trichoderma cells. In some aspects, the cells are Trichoderma reesei cells. In some aspects, the cells are yeast cells. In some aspects, the cells are Yarrowia cells. In some aspects, the cells are Yarrowia lipolytica cells.

[0023] In some aspects, the cells comprise (i) an integrated nucleic acid encoding the lower MVA pathway from S. cerevisiae comprising a glucose isomerase promoter and a nucleic acid encoding mevalonate kinase (MVK); a nucleic acid encoding phosphomevalonate kinase (PMK); a nucleic acid encoding diphosphomevalonate decarboxylase (MVD); and a nucleic acid encoding isopentenyl diphosphate isomerase (IDI); (ii) a nucleic acid encoding P. alba isoprene synthase; (iii) a nucleic acid encoding M. mazei mevalonate kinase; and (iv) a nucleic acid encoding the upper MVA pathway from Enterococcus faecalis, comprising a nucleic acid encoding an acetoacetyl-Coenzyme A synthase (thiolase) polypeptide; a nucleic acid encoding a 3-hydroxy-3-methylglutaryl-Coenzyme A synthase polypeptide; and a nucleic acid encoding a 3-hydroxy-3-methylglutaryl-Coenzyme A reductase polypeptide.

BRIEF DESCRIPTION OF THE DRAWINGS

[0024] FIG. 1A shows the MVA and DXP metabolic pathways for isoprene (based on F. Bouvier et al., Progress in Lipid Res. 44:357-429, 2005). The following description includes alternative names for each polypeptide in the pathways and a reference that discloses an assay for measuring the activity of the indicated polypeptide (each of these references are each hereby incorporated herein by reference in their entireties). Mevalonate Pathway: AACT; Acetyl-CoA acetyltransferase, MvaE, EC 2.3.1.9. Assay: J. Bacteriol. 184:2116-2122, 2002; HMGS; Hydroxymethylglutaryl-CoA synthase. MvaS, EC 2.3.3.10. Assay: J. Bacteriol. 184:4065-4070, 2002; HMGR; 3-Hydroxy-3-methylglutaryl-CoA reductase, MvaE, EC 1.1.1.34. Assay: J. Bacteriol. 184:2116-2122, 2002; MVK; Mevalonate kinase, ERG12. EC 2.7.1.36. Assay: Curr Genet 19:9-14, 1991. PMK; Phosphomevalonate kinase. ERG8, EC 2.7.4.2, Assay: Mol. Cell. Biol. S11:620-631, 1991; DPMDC; Diphosphomevalonate decarboxylase. MVD1. EC 4.1.1.33. Assay: Biochemistry 33:13355-13362, 1994; IDI; Isopentenyl-diphosphate delta-isomerase, IDI1, EC 5.3.3.2, Assay: J. Biol. Chem. 264:19169-19175, 1989. DXP Pathway: DXS; 1-Deoxyxylulose-5-phosphate synthase, dxs, EC 2.2.1.7. Assay: PNAS 94:12857-62, 1997; DXR; 1-Deoxy-D-xylulose 5-phosphate reductoisomerase, dxr, EC 2.2.1.7. Assay: Eur. J. Biochem. 269:4446-4457, 2002; MCT; 4-Diphosphocytidyl-2C-methyl-D-erythritol synthase, IspD, EC 2.7.7.60. Assay: PNAS 97: 6451-6456, 2000; CMK; 4-Diphosphocytidyl-2-C-methyl-D-erythritol kinase. IspE, EC 2.7.1.148. Assay: PNAS 97:1062-1067, 2000; MCS; 2C-Methyl-D-erythritol 2,4-cyclodiphosphate synthase, IspF, EC 4.6.1.12. Assay: PNAS 96:11758-11763, 1999; HDS; 1-Hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase, ispG, EC 1.17.4.3. Assay: J. Org. Chem. 70:9168-9174, 2005; HDR; 1-Hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase. IspH, EC 1.17.1.2. Assay: JACS 126:12847-12855, 2004.

[0025] FIG. 1B illustrates the classical and modified MVA pathways. 1, acetyl-CoA acetyltransferase (AACT); 2. HMG-CoA synthase (HMGS); 3, HMG-CoA reductase (HMGR); 4, mevalonate kinase (MVK); 5, phosphomevalonate kinase (PMK); 6, diphosphomevalonate decarboxylase (MVD or DPMDC); 7, isopentenyl diphosphate isomerase (IDI); 8, phosphomevalonate decarboxylase (PMDC); 9, isopentenyl phosphate kinase (IPK). The classical MVA pathway proceeds from reaction 1 through reaction 7 via reactions 5 and 6, while a modified MVA pathway goes through reactions 8 and 9. P and PP in the structural formula are phosphate and pyrophosphate, respectively. This figure was taken from Koga and Morii. Microbiology and Mol. Biology Reviews 71:97-120, 2007, which is incorporated herein by reference in its entirety, particular with respect to nucleic acids and polypeptides of the modified MVA pathway. The modified MVA pathway is present, for example, in some archaeal organisms, such as Methanosarcina mazei.

[0026] FIG. 2 is a map of plasmid pET24 P. alba HGS.

[0027] FIG. 3A-B are the nucleotide sequence of plasmid pET24 P. alba HGS (SEQ ID NO:1).

[0028] FIG. 4 is a schematic diagram showing restriction sites used for endonuclease digestion to construct plasmid EWL230 and compatible cohesive ends between BspHI and NcoI sites.

[0029] FIG. 5 is a map of plasmid EWL230.

[0030] FIGS. 6A-B are the nucleotide sequence of plasmid EWL230 (SEQ ID NO:2).

[0031] FIG. 7 is a schematic diagram showing restriction sites used for endonuclease digestion to construct plasmid EWL244 and compatible cohesive ends between NsiI and PstI sites.

[0032] FIG. 8 is a map of plasmid EWL244.

[0033] FIGS. 9A-B are the nucleotide sequence of plasmid EWL244 (SEQ ID NO:3).

[0034] FIG. 10A is a map of the M. mazei archaeal Lower Pathway operon.

[0035] FIGS. 10B-C are the nucleotide sequence of the M. mazei archaeal Lower Pathway operon (SEQ ID NO:4).

[0036] FIG. 11A is a map of MCM376-MVK from M. mazei archaeal Lower in pET200D.

[0037] FIGS. 11B-C are the nucleotide sequence of MCM376-MVK from M. mazei archaeal Lower in pET200D (SEQ ID NO:5).

[0038] FIG. 12 is a map of plasmid pBBRCMPGI1.5-pgl.

[0039] FIGS. 13A-B are the nucleotide sequence of plasmid pBBRCMPGI1.5-pgl (SEQ ID NO:6).

[0040] FIGS. 14A-F are graphs of isoprene production by E. coli strain expressing M. mazei mevalonate kinase, P. alba isoprene synthase, and pgl (RHM11608-2), and grown in fed-batch culture at the 15-L scale. FIG. 14A shows the time course of optical density within the 15-L bioreactor fed with glucose. FIG. 14B shows the time course of isoprene titer within the 15-L bioreactor fed with glucose. The titer is defined as the amount of isoprene produced per liter of fermentation broth. Method for calculating isoprene: cumulative isoprene produced in 59 hrs, g/Fermentor volume at 59 hrs. L [=]g/L broth. FIG. 14C also shows the time course of isoprene titer within the 15-L bioreactor fed with glucose. Method for calculating isoprene: .intg.(Instantaneous isoprene production rate, g/L/hr) dt from t=0 to 59 hours [=]g/L broth. FIG. 14D shows the time course of total isoprene produced from the 15-L bioreactor fed with glucose. FIG. 14E shows volumetric productivity within the 15-L bioreactor fed with glucose. FIG. 14F shows carbon dioxide evolution rate (CER), or metabolic activity profile, within the 15-L bioreactor fed with glucose.

[0041] FIGS. 15A-B are graphs showing analysis of off-gas from fermentation in 15 L bioreactors. Sample A is strain RM111608-2 sampled at 64.8 hours. Sample B is strain EWL256 was E. coli BL21 (DE3), pCL upper, cmR-gi1.2-yKKDyI, pTrcAlba-mMVK sampled at 34.5 hours. Hydrogen is detected above the baseline (0.95.times.10.sup.-8 torr) for both samples.

[0042] FIG. 16A shows an exemplary isoprene recovery unit.

[0043] FIG. 16B shows an exemplary isoprene desorption/condensation setup.

[0044] FIG. 17 shows a GC/FID chromatogram of an isoprene product. The material was determined to be 99.7% pure.

[0045] FIG. 18A-C show the GC/FID chromatograms of an isoprene sample before (A) and after treatment with alumina (B) or silica (C). The isoprene peak is not shown in these chromatograms.

[0046] FIG. 19A shows a map of plasmid pDW34, encoding a truncated version of P. alba isoprene synthase (MEA variant) under the control of the PTrc promoter and M. mazei MVK.

[0047] FIG. 19B-D shows the complete nucleotide sequence of plasmid pDW34 (SEQ ID NO:7).

[0048] FIG. 20 shows the chromosomal organization of E. coli K12 strain MG1655 around the pgl locus. The region deleted in E. coli BL21 (DE3) compared to E. coli K12 MG655 and restored in strains CMP215 and CMP258 is shown in brackets. The predicted ORF of the ybgS gene is circled. A forward arrow (.fwdarw.) indicates the annealing site of the galMF primer (SEQ ID NO:8). A reverse arrow (.rarw.) indicates the annealing site of the galMR primer (SEQ ID NO:9).

[0049] FIG. 21 shows a diagram of an MBR system used in 15-L scale fermentation to make isoprene gas and to collect permeate containing spent media. A broth circulation loop delivers fermentor broth to a tangential flow membrane filter. The membrane, a GE Healthcare Xampler.TM. Ultrafiltration Cartridge 500,000 NMWC, 1 mm fiber inner diameter, 60 cm long, 850 sq cm area, hollow fiber membrane, was chosen based on its suitability for high cell density E. coli broth. The hold-up volume of the broth circulation loop, including the membrane, was roughly 250 mL. The part of the apparatus comprising the loop components, but excluding the circulation pump, was autoclaved before use. The circulation and permeate pumps were peristaltic tubing pumps. A pressure gauge was used to measure P.sub.in, the inlet pressure of the membrane, to ensure the pressure tolerance of the membrane (roughly 2 bar) was not exceeded. TMP, defined in the diagram, is a rough measure of the force that drives permeation. A positive TMP was needed to collect permeate.

[0050] FIG. 22 shows the operational parameters of an MBR during a 15-L scale run. P.sub.in and TMP were manipulated mainly by changing circulation pump rate, e.g. a reduction in P.sub.in of around 20% was achieved at 50 h by lowering circulation pump rate by around 20%. TMP was steady at about 0.2 bar during permeation. Due to flow dynamics within the membrane cartridge, TMP was never zero, even when the permeate rate was zero. The permeate rate was controlled by adjusting permeate pump rate. Around 8 kg of permeate was collected in this example.

[0051] FIG. 23 shows a plot of optical density (OD) in reactor broth in a 15-L scale fermentation for an MBR fermentation and a non-MBR control. The OD during MBR operation rose from 195 to 305, whereas the OD of the non-MBR control declined from 195 to 175 during the same period. OD was measured by the 550-nm absorbance of a broth sample. Higher OD indicates a higher concentration of cells, cell debris, and other suspended solids. The fermentation method is described in Example 4.

[0052] FIG. 24 shows a plot of isoprene specific productivity in a 15-L scale run for an MBR fermentation and a non-MBR control. The MBR did not change the specific productivity of cells compared to that of a non-MBR control. The specific productivity is the rate of isoprene production on a cell mass basis. The similarity between the MBR and the non-MBR control runs suggests the MBR operation did not significantly alter cell physiology. The fermentation method is described in Example 4. Specific productivity was calculated using equations in Example 4.

[0053] FIG. 25 shows a plot of isoprene gas titer in a 15-L scale run for an MBR fermentation and a non-MBR control. The MBR increased titer by around 16% compared to a non-MBR control. A higher titer means more isoprene is produced per reactor volume, which leads to a lower production cost. The fermentation method is described in Example 4.

[0054] FIG. 26 shows a plot of total isoprene gas production in a 15-L scale run for an MBR fermentation and a non-MBR control. The MBR increased total production of isoprene gas by around 17% compared to a non-MBR control over the same fermentation time. The fermentation method is described in Example 4. The equations used to calculate total isoprene production are described in Example 4.

[0055] FIG. 27 shows a plot of volumetric productivity of isoprene in a 15-L scale run for an MBR fermentation and a non-MBR control. The volumetric productivity was higher during operation of the MBR compared to that of the non-MBR control during the same period. A higher volumetric productivity means a higher rate of isoprene production on a volume basis, which leads to lower production cost. The fermentation method is described in Example 4. Volumetric productivity was calculated using equations in Example 4.

[0056] FIG. 28 shows a plot of bioreactor broth weights in 15-L scale run fermentor runs. To maintain reactor weight, a membrane permeate was extracted in the MBR run, while whole broth (draw-off) was removed in the non-MBR control run. In this example, around 8 kg of permeate was collected in the MBR run, and around 7 kg of draw-off, in the non-MBR control. The fermentation method is described in Example 4.

[0057] FIG. 29 shows a plot of the increase in specific productivity of isoprene gas in a fed-batch culture by supplementing with spent media: More than a three-fold increase in isoprene specific productivity was achieved by supplementing the culture medium with 30% by weight of spent media (clarified broth supernatant), despite around 25% lesser growth. A higher specific productivity means that more isoprene is produced per cell mass per time. The result suggests that MBR permeate, which contains spent media, can be used to enhance specific productivity of cells, thereby reducing production cost. The experimental method is described in Example 5.

DETAILED DESCRIPTION OF THE INVENTION

[0058] A membrane bioreactor (MBR) can enhance fermentative production of isoprene gas by combining fermentation with recycling of select broth components that would otherwise be discarded. An MBR includes a liquid fermentation bioreactor culturing isoprene-producing cells operated in conjunction with a membrane filter, such as a crossflow filter or a tangential flow filter. The MBR filters fermentation broth and returns the non-permeating component (filter "retentate") to the reactor, effectively increasing reactor concentration of cells, cell debris, and other broth solids, while maintaining specific productivity of the cells. This substantially improves titer, total production, and volumetric productivity of isoprene, leading to lower capital and operating costs.

[0059] The liquid filtrate ("permeate") is not returned to the reactor and thus provides a beneficial reduction in reactor volume, similar to collecting a broth draw-off. However, unlike a broth draw-off, the collected permeate is a clarified liquid that can be easily sterilized by filtration after storage in an ordinary vessel. Thus, the permeate can be readily reused as a nutrient and/or water recycle source, further reducing operating costs. A permeate, which contains soluble "spent medium," may be added to the same or another fermentation to enhance isoprene production.

[0060] The MBR is a potentially scalable and advantageous mode of the methods of producing isoprene from renewable resources described elsewhere (see. e.g., International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007. US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716). Besides providing a significantly higher isoprene titer than otherwise possible and increasing volumetric productivity, the MBR produces a clarified permeate which may be used as a nutrient and as a water source, thereby reducing raw material consumption and improving process sustainability.

[0061] Accordingly, in one aspect, provided herein are improved methods of producing isoprene comprising: (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide under suitable culture conditions for the production of isoprene, wherein the cells either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity of isoprene greater than about 500 mg/L.sub.broth/hr of isoprene; (b) removing a portion of the culture; (c) filtering the removed portion of the culture to produce a permeate and a retentate; (d) returning the retentate to the culture; (e) producing isoprene; and optionally (f) recovering the isoprene; wherein the cultured cells undergoing steps (b), (c), and (d) either (i) produce isoprene at a higher titer, or (ii) have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), and (d).

[0062] In another aspect, provided herein are improved methods of producing isoprene comprising: (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide in a fermentor containing growth medium under suitable culture conditions for the production of isoprene, wherein the cells either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity of isoprene greater than about 500 mg/L.sub.broth/hr of isoprene; (b) removing a portion of the cell culture from the fermentor; (c) transferring the removed portion of the cell culture to a filter; (d) filtering the removed portion of the cell culture to form: (i) a permeate comprising spent growth medium; and (ii) a retentate comprising cells and other culture solids; (e) returning the retentate to the fermentor; (f) collecting the permeate; (g) producing isoprene; and (h) recovering the isoprene; wherein the cultured cells undergoing steps (b), (c), (d) and (e) either (i) produce isoprene at a higher titer, or (ii) have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), (d), and (e).

General Techniques

[0063] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984); "Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press. Inc.); "Current Protocols in Molecular Biology" (F. M. Ausubel et al., eds., 1987, and periodic updates); "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994). Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York. N.Y. 1994), and March, Advanced Organic Chemistry Reactions. Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992), provide one skilled in the art with a general guide to many of the terms used in the present application.

[0064] Genetically engineered cell cultures in bioreactors have produced isoprene more efficiently, in larger quantities, in higher purities and/or with unique impurity profiles, e.g., as described in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964. WO 2009/132220, and US Publ. No. 2010/0003716.

DEFINITIONS

[0065] The term "isoprene" refers to 2-methyl-1,3-butadiene (CAS#78-79-5). Isoprene can be the direct and final volatile C5 hydrocarbon product from the elimination of pyrophosphate from 3,3-dimethylallyl pyrophosphate (DMAPP). In some cases, it may not involve the linking or polymerization of an IPP molecule(s) to a DMAPP molecule(s). The term "isoprene" is not generally intended to be limited to its method of production unless indicated otherwise herein.

[0066] As used herein, "biologically produced isoprene" or "bioisoprene" is isoprene produced by any biological means, such as produced by genetically engineered cell cultures, natural microbials, plants or animals. A bioisoprene composition usually contains fewer hydrocarbon impurities than isoprene produced from petrochemical sources and often requires minimal treatment in order to be of polymerization grade. A bioisoprene composition also has a different impurity profile from a petrochemically produced isoprene composition.

[0067] As used herein, the term "permeate" refers to filtrate (i.e., spent growth medium) produced by filtering the contents of a fermentor or bioreactor containing growth medium and cells (i.e., containing cultured cells), for example, by crossflow filtration. The cells can be any of the exemplary isoprene-producing cells or cell types described herein, including, for example, those that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide, and/or an MVA pathway polypeptide operably linked to a promoter.

[0068] As used herein, the term "retentate" refers to solids retained on a filter (i.e., cells, debris and other culture solids) after filtering the contents of a fermentor or bioreactor containing growth medium and cells (i.e., containing cultured cells), for example, by crossflow filtration. The cells can be any of the exemplary isoprene-producing cells or cell types described herein, including, for example, those that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide, and/or an MVA pathway polypeptide operably linked to a promoter.

[0069] As used herein, the terms "polypeptide" and "polypeptides" include polypeptides, proteins, peptides, fragments of polypeptides, and fusion polypeptides.

[0070] As used herein, an "isolated polypeptide" is not part of a library of polypeptides, such as a library of 2, 5, 10, 20, 50 or more different polypeptides and is separated from at least one component with which it occurs in nature. An isolated polypeptide can be obtained, for example, by expression of a recombinant nucleic acid encoding the polypeptide. An isolated polypeptide can be a non-naturally occurring polypeptide.

[0071] By "heterologous polypeptide" is meant a polypeptide whose amino acid sequence is not identical to that of another polypeptide naturally expressed in the same host cell. In particular, a heterologous polypeptide is not identical to a wild-type polypeptide that is found in the same host cell in nature.

[0072] As used herein, a "nucleic acid" refers to two or more deoxyribonucleotides and/or ribonucleotides covalently joined together in either single or double-stranded form.

[0073] By "recombinant nucleic acid" is meant a nucleic acid of interest that is free of one or more nucleic acids (e.g., genes) which, in the genome occurring in nature of the organism from which the nucleic acid of interest is derived, flank the nucleic acid of interest. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA, a genomic DNA fragment, or a cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In some cases a recombinant nucleic acid is a nucleic acid that encodes a non-naturally occurring polypeptide.

[0074] By "heterologous nucleic acid" is meant a nucleic acid whose nucleic acid sequence is not identical to that of another nucleic acid naturally found in the same host cell. In particular, a heterologous nucleic acid is not identical to a wild-type nucleic acid that is found in the same host cell in nature.

[0075] As used herein, a "vector" means a construct that is capable of delivering, and desirably expressing one or more nucleic acids of interest in a host cell. Examples of vectors include, but are not limited to, plasmids, viral vectors, DNA or RNA expression vectors, cosmids, and phage vectors.

[0076] As used herein, an "expression control sequence" means a nucleic acid sequence that directs transcription of a nucleic acid of interest. An expression control sequence can be a promoter, such as a constitutive or an inducible promoter, or an enhancer. An "inducible promoter" is a promoter that is active under environmental or developmental regulation. The expression control sequence is operably linked to the nucleic acid segment to be transcribed.

[0077] The term "selective marker" or "selectable marker" refers to a nucleic acid capable of expression in a host cell that allows for ease of selection of those host cells containing an introduced nucleic acid or vector. Examples of selectable markers include, but are not limited to, antibiotic resistance nucleic acids (e.g., kanamycin, ampicillin, carbenicillin, gentamicin, hygromycin, phleomycin, bleomycin, neomycin, or chloramphenicol) and/or nucleic acids that confer a metabolic advantage, such as a nutritional advantage on the host cell. Exemplary nutritional selective markers include those markers known in the art as amdS, argB, and pyr4.

[0078] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although any methods and materials similar or equivalent to those described herein find use in the practice of the present invention, the preferred methods and materials are described herein. Accordingly, the terms defined immediately below are more fully described by reference to the Specification as a whole. All documents cited are, in relevant part, incorporated herein by reference in their entirety. However, the citation of any document is not to be construed as an admission that it is prior art with respect to the present invention.

[0079] As used herein, the singular terms "a," "an," and "the" include the plural reference unless the context clearly indicates otherwise.

[0080] It is intended that every maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this specification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

Methods for the Increased Production of Bioisoprene

[0081] Provided herein are improved methods of producing isoprene. In some aspects, the improved methods comprise (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase under culture conditions suitable for the production of isoprene, wherein the cells either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity greater than about 500 mg L.sub.broth/hr of isoprene; (b) removing a portion of the culture; (c) filtering the removed portion of the culture to produce a permeate and a retentate; (d) returning the retentate to the culture; (e) producing isoprene; and optionally (f) recovering the isoprene; wherein the cultured cells undergoing steps (b), (c), and (d) either (i) produce isoprene at a higher titer, or (ii) have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), and (d). In some aspects, the cells are cultured in a fermentor, bioreactor, or other vessel suitable for commercial scale cell culture. In some aspects, the fermentor, bioreactor, or cell culture vessel is stainless steel, glass or copper. In some aspects, the fermentor, bioreactor, or cell culture vessel further comprises an isoprene collection outlet connected to an isoprene storage tank. In some aspects, the isoprene collection outlet further comprises a valve to control the flow of isoprene through the isoprene collection outlet.

[0082] In some aspects, the improved methods comprise (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase in a fermentor containing growth medium under culture conditions suitable for the production of isoprene, wherein the cells either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity greater than about 500 mg/L.sub.broth/hr of isoprene; (b) removing a portion of the cell culture from the fermentor; (c) transferring the removed portion of the cell culture to a filter; (d) filtering the removed portion of the cell culture to form: (i) a permeate comprising spent growth medium; and (ii) a retentate comprising cells and other culture solids; (e) returning the retentate to the fermentor; (f) collecting the permeate; (g) producing isoprene; and optionally (h) recovering the isoprene; wherein the cultured cells undergoing steps (b), (c), (d) and (e) either (i) produce isoprene at a higher titer, or (ii) have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), (d) and (e). In some aspects, the cells are cultured in a fermentor, bioreactor, or other vessel suitable for commercial scale cell culture. In some aspects, the fermentor, bioreactor, or cell culture vessel is stainless steel, glass or copper. In some aspects, the fermentor, bioreactor, or cell culture vessel further comprises an isoprene collection outlet connected to an isoprene storage tank. In some aspects, the isoprene collection outlet further comprises a valve to control the flow of isoprene through the isoprene collection outlet. In some aspects, the isoprene collection outlet comprises any suitable flexible tubing or rigid tubing described herein.

[0083] In some aspects, the fermentor, bioreactor, or cell culture vessel is connected to the filter by a circulation loop and a circulation pump. In some aspects, the circulation loop further comprises one or more valves to control the flow of material (i.e., of a portion of the cell culture or of the retentate) through the circulation loop. Generally, any type of pump having the ability to precisely regulate or control flow rate and pressure can be used with the methods described herein. In some aspects, the circulation pump comprises a positive displacement pump, such as a peristaltic pump, a reciprocating pump, or a rotary pump. In some aspects, the circulation pump is a peristaltic pump. In some aspects, the circulation pump is a velocity pump, such as a centrifugal pump, a radial flow pump, an axial flow pump, a mixed flow pump, or a gravity pump. In some aspects, the circulation pump is a centrifugal pump.

[0084] In some aspects, the circulation loop comprises flexible tubing. In some aspects, the flexible tubing is polyvinyl chloride (PVC), polyurethane (e.g., Superthane.RTM.), silicone (e.g., Silcon.RTM.), thermoplastic rubber (TPR; e.g., Suprene.RTM.), fluoropolymer, polyethylene, polypropylene (e.g., Prolite.RTM.), latex or metal tubing. In some aspects, the PVC tubing is braid reinforced (e.g., Nylobrade.RTM.), steel wire reinforced (e.g., Vardex.RTM.), or spiral reinforced (e.g., Newflex.RTM.). In some aspects, the polyurethane tubing is braid-reinforced (e.g., Urebrade.RTM. Pneumatic). In some aspects, the silicone tubing is braid reinforced (e.g., Silbrade.RTM.), platinum-cured medical grade tubing (e.g., Silcon.RTM. Med-X), or polyester and wire reinforced (e.g., Silvac.RTM.). In some aspects, the fluoropolymer tubing is polytetrafluoroethylene (PTFE; e.g., CONTEF.TM.), fluorinated ethylene propylene (FEP; e.g., Coiltef.TM.), perfluoroalkoxy (PFA; e.g., Coiltef.TM.), ethylene tetrafluoroethylene (ETFE), ethylene chloro-trifluoroethylene (ECTFE), polyvinylidene fluoride (PVDF) polyetherimide (PEI), or polyetheretherketone (PEEK). In some aspects, the polyethylene tubing is linear low density polyethylene tubing (LLDPE; e.g., Zeliter.TM.).

[0085] In some aspects, the circulation loop comprises rigid tubing or pipe. In some aspects, the rigid tubing is metal. In some aspects, the metal is carbon steel, stainless steel, galvanized steel, copper, brass, or any other suitable metal or alloy. In some aspects, the rigid tubing is plastic. In some aspects, the plastic is polyvinyl chloride (PVC), chlorinated polyvinyl chloride (CPVC), fiber reinforced plastic (FRP), reinforced polymer mortar (RPMP), polypropylene (PP), polyethylene (PE), cross-linked high density polyethylene (PEX), polybutylene (PB), high density polyurethane, acrylonitrile butadiene styrene (ABS), or any other suitable material.

[0086] In some aspects, the permeate is collected from the filter by a permeate collection outlet and a permeate pump and stored in a permeate collection tank. In some aspects, the permeate collection outlet further comprises a valve to control the flow of permeate through the permeate collection outlet. In some aspects, the permeate collection outlet comprises any suitable flexible tubing or rigid tubing described herein. In some aspects, the permeate collection outlet further comprises a permeate pressure gauge to monitor the pressure in the permeate collection outlet (P.sub.perm). Generally, any type of pump having the ability to precisely regulate or control flow rate and pressure can be used with the methods described herein. In some aspects, the permeate pump comprises a positive displacement pump, such as a peristaltic pump, a reciprocating pump, or a rotary pump. In some aspects, the permeate pump is a peristaltic pump. In some aspects, the permeate pump is a velocity pump, such as a centrifugal pump, a radial flow pump, an axial flow pump, a mixed flow pump, or a gravity pump. In some aspects, the permeate pump is a centrifugal pump. In some aspects, the permeate collection tank further comprises a vent to relieve pressure within the tank.

[0087] In some aspects, the improved method further comprises a step of recycling the permeate back into the same cell culture or into another culture. Recycling the permeate can allow for increased production of isoprene over a period of time, for example, more isoprene made per L.sub.broth per hour. Accordingly, in one aspect, the cells cultured in the presence of recycled permeate have greater average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the cells have about two times the average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the cells have about three times the average specific productivity of isoprene than the same cells cultured in the absence of recycled permeate. In some aspects, the permeate is sterilized before being recycled back into the same cell culture or into another cell culture. In some aspects, the permeate is sterilized by filtration. In some aspects, the permeate is sterilized by autoclaving. In some aspects, the permeate is sterilized by ultraviolet or gamma irradiation. In some aspects, the permeate is not sterilized before being recycled back into the same cell culture or into another cell culture.

[0088] One advantage of this system described herein is that a minimal amount of the desired product (i.e., isoprene) is lost through the recycling or discarding of the permeate. In one aspect, at least about 50% of the isoprene that is produced in the fermentor before the circulation commences is recoverable after the circulation has been completed and thus is not lost in the recycling or discarding of permeate. In another aspect, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, at least about 99.6%, at least about 99.7%, at least about 99.8%, or at least about 99.9% of the isoprene produced in the fermentor is recoverable and not lost in the permeate.

[0089] In some aspects, the circulation loop further comprises an inlet pressure gauge to monitor the inlet pressure (P.sub.in) of the filter. In some aspects, the circulation loop further comprises an outlet gauge to monitor the outlet pressure (P.sub.out) of the filter. In some aspects, the circulation loop further comprises an inlet pressure gauge to monitor the inlet pressure (P.sub.in) of the filter and an outlet gauge to monitor the outlet pressure (P.sub.out) of the filter. In some aspects, the improved method further comprises the steps of: (i) monitoring the inlet pressure of the filter with an inlet pressure gauge (P.sub.in); (ii) monitoring the outlet pressure of the filter with an outlet pressure gauge (P.sub.out); and (iii) monitoring the pressure in the permeate collection outlet with a permeate pressure gauge (P.sub.perm) to determine the transmembrane pressure across the filter.

[0090] In some aspects, the filtering is by microfiltration. In some aspects, the microfiltering is by crossflow filtration. In some aspects, the filtering is by ultrafiltration. In some aspects, the ultrafiltering is by crossflow filtration. In crossflow filtration, the solution to be filtered is passed tangentially across the filter membrane at positive transmembrane pressure (TMP) relative to the permeate side. A proportion of the material which is smaller than the membrane pore size passes through the membrane as filtrate (i.e., permeate), while the rest of the solution remains on the feed side of the membrane as retentate. With crossflow filtration, the tangential motion of the bulk of the fluid across the membrane causes trapped particles or solids left on the filter surface to be rubbed off, so a crossflow filter can operate continuously at relatively high solids loads without fouling. In addition, the retentate remains in the form of a mobile slurry, suitable for returning to the fermentor via the circulation loop. In some aspects, the filtering is by centrifugation or spin-filtration. In some aspects, the filtering is by vortex-flow filtration. In some aspects, the filtering is by hydrocyclone. In any of the aspects described herein, the filtration is by microfiltration. In any of the aspects described herein, the filtration is by ultrafiltration.

[0091] In some aspects, the filtering is by microfiltration. In some aspects, the microfiltration is crossflow filtration. In some aspects, the crossflow filtration is tangential flow filtration. In some aspects, the tangential flow filter comprises a membrane configuration selected from the group consisting of a hollow fiber membrane, a spiral wound membrane, a tubular membrane, or a plate-frame membrane. In some aspects, the tangential flow filter comprises a hollow fiber membrane. In some aspects, the hollow fiber membrane, the spiral wound membrane, the tubular membrane, or the plate-frame membrane comprises a polyethersulfone (PES) membrane, a polysulfone (PS) membrane, a polyvinylidene difluoride (PVDF) membrane, a polyarylsulfone membrane, a polyamide membrane, a polypropylene membrane, a polyethylene membrane, a polytetrafluoroethylene (PTFE) membrane, a cellulose acetate membrane, a polyacrylonitrile membrane, a vinyl copolymer membrane, a cellulose membrane, a regenerated cellulose membrane, a polycarbonate membrane, a ceramic membrane, a steel membrane, or a stainless steel membrane.

[0092] The pore size of a microfiltration membrane, such as a tangential flow membrane, can vary depending on the membrane material and application. Any of the membrane configurations and membrane types described herein can have filter pore sizes in various ranges.

[0093] In some aspects, the tangential flow filter has a filter pore size suitable for use with any of the exemplary isoprene-producing cells or cell types described herein, including, for example, those that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide and/or an MVA pathway polypeptide operably linked to a promoter. In some aspects, the tangential flow filter has a filter pore size between about 0.005 .mu.m and about 100 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.005 .mu.m and about 50 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.005 .mu.m and about 10 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.005 .mu.m and about 5 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.005 .mu.m and about 2 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.005 .mu.m and about 1 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.05 .mu.m and about 100 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.05 .mu.m and about 50 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.05 .mu.m and about 10 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.05 .mu.m and about 5 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.05 .mu.m and about 2 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.05 .mu.m and about 1 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.5 .mu.m and about 100 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.5 .mu.m and about 50 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.5 .mu.m and about 10 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.5 .mu.m and about 5 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.5 .mu.m and about 2 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.5 .mu.m and 1 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 1 .mu.m and about 10 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 1 .mu.m and about 50 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 1 .mu.m and about 100 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 5 .mu.m and about 10 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 5 .mu.m and about 50 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 5 .mu.m and about 100 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.05 .mu.m and about 0.5 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.5 .mu.m and about 1 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 1 .mu.m and about 5 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 5 microns and about 10 microns. In some aspects, the tangential flow filter has a filter pore size between about 10 microns and about 50 microns. In some aspects, the tangential flow filter has a filter pore size between about 10 microns and about 100 microns.

[0094] In some aspects, the filtering is by ultrafiltration. In some aspects, the ultrafiltration is crossflow filtration. In some aspects, the crossflow filtration is tangential flow filtration. In some aspects, the tangential flow filter comprises a membrane configuration selected from the group consisting of a hollow fiber membrane, a spiral wound membrane, a tubular membrane, or a plate-frame membrane. In some aspects, the tangential flow filter comprises a hollow fiber membrane. In some aspects, the hollow fiber membrane, the spiral wound membrane, the tubular membrane, or the plate-frame membrane comprises a polyethersulfone (PES) membrane, a polysulfone (PS) membrane, a polyvinylidene difluoride (PVDF) membrane, a polyarylsulfone membrane, a polyamide membrane, a polypropylene membrane, a polyethylene membrane, a polytetrafluoroethylene (PTFE) membrane, a cellulose acetate membrane, a polyacrylonitrile membrane, a vinyl copolymer membrane, a cellulose membrane, a regenerated cellulose membrane, a polycarbonate membrane, a ceramic membrane, a steel membrane, or a stainless steel membrane.

[0095] The nominal molecular weight cutoff (NMWC) of an ultrafiltration membrane, such as a tangential flow membrane, can vary depending on the membrane material and application. Any of the membrane configurations and membrane types described herein can have NMWCs in various ranges.

[0096] In some aspects, the tangential flow filter has a nominal molecular weight cutoff (NMWC) suitable for use with any of the exemplary isoprene-producing cells or cell types described herein, including, for example, those that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide, DXP pathway polypeptide and/or an MVA pathway polypeptide operably linked to a promoter. In some aspects the tangential flow filter has an NMWC between 1000 and 750,000. In some aspects, the tangential flow filter has an NMWC greater than 1000. In some aspects, the tangential flow filter has an NMWC greater than 5000. In some aspects, the tangential flow filter has an NMWC greater than 10,000. In some aspects, the tangential flow filter has an NMWC greater than 15,000. In some aspects, the tangential flow filter has an NMWC greater than 20,000. In some aspects, the tangential flow filter has an NMWC greater than 25,000. In some aspects, the tangential flow filter has an NMWC greater than 50,000. In some aspects, the tangential flow filter has an NMWC greater than 75,000. In some aspects, the tangential flow filter has an NMWC greater than 100,000. In some aspects, the tangential flow filter has an NMWC greater than 150,000. In some aspects, the tangential flow filter has an NMWC greater than 200,000. In some aspects, the tangential flow filter has an NMWC greater than 250,000. In some aspects, the tangential flow filter has an NMWC greater than 300,000. In some aspects, the tangential flow filter has an NMWC greater than 350,000. In some aspects, the tangential flow filter has an NMWC greater than 400,000. In some aspects, the tangential flow filter has an NMWC greater than 450,000. In some aspects, the tangential flow filter has an NMWC greater than 500,000. In some aspects, the tangential flow filter has an NMWC greater than 600,000. In some aspects, the tangential flow filter has an NMWC greater than 750,000.

[0097] In some aspects, the tangential flow filter is a GE Healthcare Xampler.TM. Ultrafiltration Cartridge (GE Healthcare Bio-Sciences, Corp., Piscataway. NJ) having a 500,000 nominal molecular weight cutoff (NMWC), comprising a hollow fiber membrane having a 1 mm inner diameter. In some aspects, the tangential flow filter is an OPTISEP.RTM. 3000 filter module (NCSRT, Inc., Apex, N.C.), an OPTISEP.RTM.7000 filter module, or an OPTISEP.RTM. 11000 filter module using a filter having a molecular weight cutoff suitable for use with any of the exemplary isoprene-producing cells or cell types described herein, including, for example, those that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide, and/or an MVA pathway polypeptide operably linked to a promoter.

[0098] In some aspects, the filter is a tangential flow filter has a nominal molecular weight cutoff (NMWC) suitable for use with any of the exemplary isoprene-producing cells or cell types described herein, including, for example, those that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide, a DXP pathway polypeptide and/or an MVA pathway polypeptide operably linked to a promoter. In some aspects the tangential flow filter has an NMWC between 1000 and 750,000. In some aspects the tangential flow filter has an NMWC between 10,000 and 750,000. In some aspects the tangential flow filter has an NMWC between 100,000 and 750,000. In some aspects the tangential flow filter has an NMWC between 250,000 and 750,000. In some aspects, the tangential flow filter has an NMWC greater than 1000. In some aspects, the tangential flow filter has an NMWC greater than 5000. In some aspects, the tangential flow filter has an NMWC greater than 10,000. In some aspects, the tangential flow filter has an NMWC greater than 15,000. In some aspects, the tangential flow filter has an NMWC greater than 20,000. In some aspects, the tangential flow filter has an NMWC greater than 25,000. In some aspects, the tangential flow filter has an NMWC greater than 50,000. In some aspects, the tangential flow filter has an NMWC greater than 75,000. In some aspects, the tangential flow filter has an NMWC greater than 100,000. In some aspects, the tangential flow filter has an NMWC greater than 150,000. In some aspects, the tangential flow filter has an NMWC greater than 200,000. In some aspects, the tangential flow filter has an NMWC greater than 250,000. In some aspects, the tangential flow filter has an NMWC greater than 300,000. In some aspects, the tangential flow filter has an NMWC greater than 350,000. In some aspects, the tangential flow filter has an NMWC greater than 400,000. In some aspects, the tangential flow filter has an NMWC greater than 450,000. In some aspects, the tangential flow filter has an NMWC greater than 500,000. In some aspects, the tangential flow filter has an NMWC greater than 600,000. In some aspects, the tangential flow filter has an NMWC greater than 750,000.

[0099] In some aspects, the fermentor, bioreactor, or cell culture vessel lacks a circulation loop and a circulation pump, and the filtering is by a submerged membrane bioreactor. In some aspects, the submerged membrane bioreactor comprises a filtration module immersed in the cell culture within the fermentor, bioreactor, or cell culture vessel. In some aspects, the filtration module comprises a filter and a permeate side in fluid contact with the cell culture only through the filter. In some aspects, the filter comprises a comprises a polyethersulfone (PES) membrane, a polysulfone (PS) membrane, a polyvinylidene difluoride (PVDF) membrane, a polyarylsulfone membrane, a polyamide membrane, a polypropylene membrane, a polyethylene membrane, a polytetrafluoroethylene (PTFE) membrane, a cellulose acetate membrane, a polyacrylonitrile membrane, a vinyl copolymer membrane, a cellulose membrane, a regenerated cellulose membrane, a polycarbonate membrane, a ceramic membrane, a steel membrane, or a stainless steel membrane.

[0100] In some aspects, the filter in the submerged membrane bioreactor is an ultrafilter having a nominal molecular weight cutoff (NMWC) suitable for use with any of the exemplary isoprene-producing cells or cell types described herein, including, for example, those that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide and/or an MVA pathway polypeptide operably linked to a promoter. In some aspects the filter has an NMWC between 1000 and 750,000. In some aspects, the filter has an NMWC greater than 1000. In some aspects, the filter has an NMWC greater than 5000. In some aspects, the filter has an NMWC greater than 10,000. In some aspects, the filter has an NMWC greater than 15,000. In some aspects, the filter has an NMWC greater than 20,000. In some aspects, the filter has an NMWC greater than 25,000. In some aspects, the filter has an NMWC greater than 50,000. In some aspects, the filter has an NMWC greater than 75,000. In some aspects, the filter has an NMWC greater than 100,000. In some aspects, the filter has an NMWC greater than 150,000. In some aspects, the filter has an NMWC greater than 200,000. In some aspects, the filter has an NMWC greater than 250,000. In some aspects, the filter has an NMWC greater than 300,000. In some aspects, the filter has an NMWC greater than 350,000. In some aspects, the filter has an NMWC greater than 400,000. In some aspects, the filter has an NMWC greater than 450,000. In some aspects, the filter has an NMWC greater than 500,000. In some aspects, the filter has an NMWC greater than 600,000. In some aspects, the filter has an NMWC greater than 750,000.

[0101] In some aspects, the filter in the submerged membrane bioreactor is a microfilter having a filter pore size suitable for use with any of the exemplary isoprene-producing cells or cell types described herein, including, for example, those that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide, a DXP pathway polypeptide and/or an MVA pathway polypeptide operably linked to a promoter. In some aspects, the filter has a filter pore size between about 0.005 .mu.m and about 100 .mu.m. In some aspects, the filter has a filter pore size between about 0.005 .mu.m and about 50 .mu.min. In some aspects, the filter has a filter pore size between about 0.005 .mu.m and about 10 .mu.m. In some aspects, the filter has a filter pore size between about 0.005 .mu.m and about 5 .mu.m. In some aspects, the filter has a filter pore size between about 0.005 .mu.m and about 2 .mu.m. In some aspects, the filter has a filter pore size between about 0.005 .mu.m and about 1 .mu.m. In some aspects, the filter has a filter pore size between about 0.05 .mu.m and about 100 .mu.m. In some aspects, the filter has a filter pore size between about 0.05 .mu.m and about 50 .mu.m. In some aspects, the filter has a filter pore size between about 0.05 .mu.m and about 10 .mu.m. In some aspects, the filter has a filter pore size between about 0.05 .mu.m and about 5 .mu.m. In some aspects, the filter has a filter pore size between about 0.05 .mu.m and about 2 .mu.m. In some aspects, the filter has a filter pore size between about 0.05 .mu.m and about 1 .mu.m. In some aspects, the filter has a filter pore size between about 0.5 .mu.m and about 100 .mu.m. In some aspects, the filter has a filter pore size between about 0.5 .mu.m and about 50 .mu.m. In some aspects, the filter has a filter pore size between about 0.5 .mu.m and about 10 .mu.m. In some aspects, the filter has a filter pore size between about 0.5 .mu.m and about 5 .mu.m. In some aspects, the tangential flow filter has a filter pore size between about 0.5 .mu.m and about 2 .mu.m. In some aspects, the filter has a filter pore size between about 0.5 .mu.m and 1 .mu.m. In some aspects, the filter has a filter pore size between about 1 .mu.m and about 10 .mu.m. In some aspects, the filter has a filter pore size between about 1 .mu.m and about 50 .mu.m. In some aspects, the filter has a filter pore size between about 1 .mu.m and about 100 .mu.m. In some aspects, the filter has a filter pore size between about 5 .mu.m and about 10 .mu.m. In some aspects, the filter has a filter pore size between about 5 .mu.m and about 50 .mu.m. In some aspects, the filter has a filter pore size between about 5 .mu.m and about 100 .mu.m. In some aspects, the filter has a filter pore size between about 0.05 .mu.m and about 0.5 .mu.m. In some aspects, the filter has a filter pore size between about 0.5 .mu.m and about 1 .mu.m. In some aspects, the filter has a filter pore size between about 1 .mu.m and about 5 .mu.m. In some aspects, the filter has a filter pore size between about 5 microns and about 10 microns. In some aspects, the filter has a filter pore size between about 10 microns and about 50 microns. In some aspects, the filter has a filter pore size between about 10 microns and about 100 microns.

[0102] In some aspects, the filtration module further comprises a permeate collection outlet and a permeate pump. In some aspects, the filtration module further comprises a permeate collection tank. In some aspects, the permeate pump comprises a positive displacement pump, such as a peristaltic pump, a reciprocating pump, or a rotary pump. In some aspects, the permeate pump is a peristaltic pump. In some aspects, the permeate pump is a velocity pump, such as a centrifugal pump, a radial flow pump, an axial flow pump, a mixed flow pump, or a gravity pump. In some aspects, the permeate pump is a centrifugal pump. In some aspects, the permeate collection tank further comprises a vent to relieve pressure within the tank.

[0103] In some aspects, the improved method further comprises the step of maintaining a positive transmembrane pressure, calculated as follows: TMP=([P.sub.in+P.sub.out]/2)-P.sub.perm). In some aspects, the improved method further comprises the step of cleaning the filter by inverting the TMP (i.e., making the TMP negative). Inverting the TMP causes the permeate to flow back into the solution to be filtered, thereby lifting any solids fouling the filter off the surface of the membrane and improving flow through the filter and the circulation loop. Inverting the TMP usually requires pressurizing the permeate side of the membrane. Inverting the TMP is more commonly applied to ceramic and steel membrane filters, which are less susceptible to damage due to their intrinsic strength. Pressurization of the permeate may be achieved by connecting the permeate line to compressed air or water, among other methods. See, for example, Danisco application WO 2009/035700 for exemplary teachings on specific ways to invert TMP in a spiral-wound polymeric membrane

[0104] In some aspects, the residence time within the filtration unit is 25 seconds and the glucose concentration within the fermentation broth is between 3 and 25 g/L. In some aspects, the residence time within the filtration unit is 10 seconds and the glucose concentration within the fermentation broth is between 1 and 3 g/L. In some aspects, the residence time within the filtration unit is between 5 and 60 seconds and the glucose concentration within the fermentation broth is between 0.2 and 25 g/L.

[0105] In some aspects, removal of a portion of the culture first begins when the culture reaches a target volume. In some aspects, the target volume is determined empirically. In some aspects, the target volume is 1/2 (one-half), 1/3 (one-third), 1/4 (one-quarter), 1/5 (one-fifth), 1/6 (one-sixth), 1/7 (one-seventh), 1/8 (one-eighth), 1/9 (one ninth), 1/10 (one tenth), or less of the total volume of the fermentor, bioreactor, or cell culture vessel. In some aspects, the target volume is the working capacity of the fermentor, bioreactor, or cell culture vessel being used to culture the cells. In some aspects, removal of a portion of the culture first begins at 5 hours, 10 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours, or more after the start of cell culture (i.e., after the start of fermentation).

[0106] Continuous operation of the circulation loop costs energy (pumping against pressure) and adds stress to the cells. Thus, the option of delaying or suspending filtration, i.e. harvesting spent media at particular times during the fermentation or at intervals instead of continuously, may provide economic benefit as well as potentially improve fermentation outcome. In some aspects, the portion of the culture is removed continuously from the fermentor, bioreactor, or cell culture vessel. In some aspects, the portion of the culture is continuously removed at a rate of 1 ml/minute, 5 ml/minute, 10 ml/minute, 15 ml/minute, 20 ml/minute, 25 ml/minute, 30 ml/minute, 35 ml/minute, 40 ml/minute, 45 ml/minute, 50 ml/minute, 100 ml/minute, 250 ml/minute, 500 ml/minute, 1000 ml/minute or more. In some aspects, the portion of the culture is continuously removed at a rate of 1 ml/15 minutes, 5 ml/15 minutes, 10 ml/15 minutes, 15 ml/15 minutes, 20 ml/15 minutes, 25 ml/15 minutes, 30 ml/15 minutes, 35 ml/15 minutes, 40 ml/15 minutes, 45 ml/15 minutes, 50 ml/15 minutes, 100 ml/15 minutes, 250 ml/15 minutes, 500 ml/15 minutes, 1000 ml/15 minutes or more. In some aspects, the portion of the culture is continuously removed at a rate of 1 ml/30 minutes, 5 ml/30 minutes, 10 ml/30 minutes, 15 ml/30 minutes, 20 ml/30 minutes, 25 ml/30 minutes, 30 ml/30 minutes, 35 ml/30 minutes, 40 ml/30 minutes, 45 ml/30 minutes, 50 ml/30 minutes, 100 ml/30 minutes, 250 ml/30 minutes, 500 ml/30 minutes, 1000 ml/30 minutes or more. In some aspects, the portion of the culture is continuously removed at a rate of 1 ml/60 minutes, 5 ml/60 minutes, 10 ml/60 minutes, 15 ml/60 minutes, 20 ml/60 minutes, 25 ml/60 minutes, 30 ml/60 minutes, 35 ml/60 minutes, 40 ml/60 minutes, 45 ml/60 minutes, 50 ml/60 minutes, 100 ml/60 minutes, 250 ml/60 minutes, 500 ml/60 minutes, 1000 ml/60 minutes or more. In some aspects, the portion of the culture is continuously removed at a rate of 1 g/minute, 2 g/minute, 3 g/minute, 4 g/minute, 5 g/minute, 6 g/minute, 7 g/minute, 8 g/minute, 9 g/minute, 10 g/minute, 20 g/minute, 30 g/minute, 40 g/minute, 50 g/minute, 60 g/minute, 70 g/minute, 80 g/minute, 90 g/minute, 100 g/minute or more. In some aspects, the portion of the culture is continuously removed at a rate of 1 g/l 5 minutes, 2 g/15 minutes, 3 g/15 minutes, 4 g/15 minutes, 5 g/15 minutes, 6 g/15 minutes, 7 g/15 minutes, 8 g/15 minutes, 9 g/15 minutes, 10 g/15 minutes, 20 g/15 minutes, 30 g/15 minutes, 40 g/15 minutes 50 g/15 minutes, 60 g/15 minutes, 70 g/15 minutes, 80 g/15 minutes, 90 g/15 minutes, 100 g/15 minutes or more. In some aspects, the portion of the culture is continuously removed at a rate of 1 g/30 minutes, 2 g/30 minutes, 3 g/30 minutes, 4 g/30 minutes, 5 g/30 minutes, 6 g/30 minutes, 7 g/30 minutes, 8 g/30 minutes, 9 g/30 minutes, 10 g/30 minutes, 20 g/30 minutes, 30 g/30 minutes 40 g/30 minutes, 50 g/30 minutes, 60 g/30 minutes, 70 g/30 minutes, 80 g/30 minutes, 90 g/30 minutes, 100 g/30 minutes or more. In some aspects, the portion of the culture is continuously removed at a rate of 1 g/60 minutes, 2 g/60 minutes, 3 g/60 minutes, 4 g/60 minutes, 5 g/60 minutes, 6 g/60 minutes, 7 g/60 minutes, 8 g/60 minutes, 9 g/60 minutes, 10 g/60 minutes, 20 g/60 minutes, 30 g/60 minutes, 40 g/60 minutes, 50 g/60 minutes, 60 g/60 minutes, 70 g/60 minutes, 80 g/60 minutes, 90 g/60 minutes, 100 g/60 minutes or more. In some aspects, the portion of the culture is continuously removed at a rate of 0.2 kg/minute, 0.4 kg/minute, 0.6 kg/minute, 0.8 kg/minute, 1.0 kg/minute, 1.2 kg/minute, 1.4 kg/minute, 1.6 kg/minute, 1.8 kg/minute, 2.0 kg/minute, 3.0 kg/minute, 4.0 kg/minute, 5.0 kg/minute or more. In some aspects, the portion of the culture is continuously removed at a rate of 0.2 kg/15 minutes, 0.4 kg/15 minutes, 0.6 kg/15 minutes, 0.8 kg/15 minutes, 1.0 kg/15 minutes, 1.2 kg/15 minutes, 1.4 kg/15 minutes, 1.6 kg/15 minutes, 1.8 kg/15 minutes, 2.0 kg/15 minutes, 3.0 kg/15 minutes, 4.0 kg/15 minutes, 5.0 kg/15 minutes or more. In some aspects, the portion of the culture is continuously removed at a rate of 0.2 kg/30 minutes, 0.4 kg/30 minutes, 0.6 kg/30 minutes, 0.8 kg/30 minutes, 1.0 kg/30 minutes, 1.2 kg/30 minutes, 1.4 kg/30 minutes, 1.6 kg/30 minutes, 1.8 kg/30 minutes, 2.0 kg/30 minutes, 3.0 kg/30 minutes, 4.0 kg/30 minutes, 5.0 kg/30 minutes or more. In some aspects, the portion of the culture is continuously removed at a rate of 0.2 kg/60 minutes, 0.4 kg/60 minutes, 0.6 kg/60 minutes, 0.8 kg/60 minutes, 1.0 kg/60 minutes, 1.2 kg/60 minutes, 1.4 kg/60 minutes, 1.6 kg/60 minutes, 1.8 kg/60 minutes, 2.0 kg/60 minutes, 3.0 kg/60 minutes, 4.0 kg/60 minutes, 5.0 kg/60 minutes or more.

[0107] In some aspects, the portion of the culture is removed discontinuously from the fermentor, bioreactor, or cell culture vessel, at a desired time interval. In some aspects, a portion of the culture is removed from the fermentor, bioreactor, or cell culture vessel, every 5 minutes, every 10 minutes, every 15 minutes, every 20 minutes, every 25 minutes, every 30 minutes, every 35 minutes, every 40 minutes, every 45 minutes, every 50 minutes, every 55 minutes, every 60 minutes, or more. In some aspects, 1 ml, 5 ml, 10 ml, 15 ml, 20 ml, 25 ml, 30 ml, 35 ml, 40 ml, 45 ml, 50 ml, 75 ml, 100 ml, 125 ml, 150 ml, 175 ml, 200 ml, 225 ml, 250 ml, or more is removed from the culture at each interval. In some aspects, 0.2 kg, 0.4 kg, 0.6 kg, 0.8 kg, 1.0 kg, 1.2 kg, 1.4 kg, 1.6 kg, 1.8 kg, 2.0 kg, or more is removed from the culture at each interval.

[0108] In some aspects, the cells cultured in any of the improved methods described herein are any of the isoprene-producing cells described herein that comprise one or more heterologous nucleic acids encoding an isoprene synthase polypeptide, a DXS polypeptide, an IDI polypeptide, a DXP pathway polypeptide and/or an MVA pathway polypeptide operably linked to a promoter. In some aspects, the cells comprising a heterologous nucleic acid encoding an isoprene synthase either (i) produce isoprene at a titer greater than 40 g/L or (ii) have an average volumetric productivity greater than about 500 mg/L.sub.broth/hr of isoprene.

[0109] In some aspects, the DXP pathway polypeptide is selected from the group consisting of DXS (1-deoxy-D-xylulose-5-phosphate synthase), DXR (1-deoxy-D-xylulose-5-phosphate reductoisomerase), MCT (4-diphosphocytidyl-2C-methyl-D-erythritol synthase). CMK (4-diphosphocytidyl-2-C-methyl-D-erythritol kinase), MCS (2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase). HDS (1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase), HDR (1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase), and IDI polypeptides.

[0110] In some aspects, the MVA pathway polypeptide is an upper MVA pathway polypeptide.

[0111] In some aspects, the upper MVA pathway polypeptide is selected from the group consisting of: (i) an acetoacetyl-Coenzyme A synthase (thiolase) polypeptide; (ii) a 3-hydroxy-3-methylglutaryl-Coenzyme A synthase polypeptide; and (iii) a 3-hydroxy-3-methylglutaryl-Coenzyme A reductase polypeptide. In some aspects, the upper MVA pathway polypeptide is from the genus Enterococcus. In some aspects, the upper MVA pathway polypeptide is from Enterococcus faecalis. In some aspects, the upper MVA pathway polypeptide comprises an acetoacetyl-Coenzyme A synthase (thiolase) polypeptide, a 3-hydroxy-3-methylglutaryl-Coenzyme A reductase polypeptide and a 3-hydroxy-3-methylglutaryl-Coenzyme A synthase polypeptide from Enterococcus faecalis.

[0112] In some aspects, the MVA pathway polypeptide is a lower MVA pathway polypeptide. In some aspects, the lower MVA pathway polypeptide is selected from the group consisting of: (i) mevalonate kinase (MVK); (ii) phosphomevalonate kinase (PMK); (iii) diphosphomevalonate decarboxylase (MVD); and (iv) isopentenyl diphosphate isomerase (IDI). In some aspects, the lower MVA pathway polypeptide is from the genus Methanosarcina. In some aspects, the lower MVA pathway polypeptide is from Methanosarcina mazei. In some aspects, the lower MVA pathway polypeptide comprises an MVK polypeptide from Methanosarcina mazei. In some aspects, the lower MVA pathway polypeptide comprises an MVK polypeptide, a PMK polypeptide, an MVD polypeptide, and an IDI polypeptide from Saccharomyces cerevisiae. In some aspects, the lower MVA polypeptide comprises an MVK polypeptide from Methanosarcina mazei and an MVK polypeptide, a PMK polypeptide, an MVD polypeptide, and an IDI polypeptide from Saccharomyces cerevisiae.

[0113] In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from the genus Pueraria. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from Pueraria montana. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from the genus Populus. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from Populus alba.

[0114] In some aspects, the upper MVA pathway polypeptide comprises an acetoacetyl-Coenzyme A synthase (thiolase) polypeptide, a 3-hydroxy-3-methylglutaryl-Coenzyme A reductase polypeptide and a 3-hydroxy-3-methylglutaryl-Coenzyme A synthase polypeptide from Enterococcus faecalis; the lower MVA polypeptide comprises an MVK polypeptide from Methanosarcina mazei and an MVK polypeptide, a PMK polypeptide, an MVD polypeptide, and an IDI polypeptide from Saccharomyces cerevisiae; and the isoprene synthase polypeptide is from Populus alba.

[0115] In some aspects, the cells produce isoprene at a titer of greater than about 40 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 50 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 60 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 70 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 80 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 90 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 100 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 110 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 120 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 130 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 140 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 150 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 160 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 170 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 180 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 190 g/L. In some aspects, the cells produce isoprene at a titer of greater than about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 100 g/L. In some aspects, the cells produce isoprene at a titer between about 60 g/L and about 100 g/L. In some aspects, the cells produce isoprene at a titer between about 60 g/L and about 120 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 40 g/L and about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 80 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 150 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 180 g/L. In some aspects, the cells produce isoprene at a titer between about 100 g/L and about 200 g/L. In some aspects, the cells produce isoprene at a titer between about 120 g/L and about 200 g/L. In some aspects, the cells have an average volumetric productivity of greater than about 500 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 1.000 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 1,500 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity greater than about 2.000 mg/L.sub.broth/hr of isoprene. In some aspects, the cells have an average volumetric productivity between about 500 mg/L.sub.broth/hr and about 2,000 mg/L.sub.broth/hr of isoprene.

[0116] In some aspects, the isoprene synthase polypeptide is a plant isoprene synthase polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding an IDI polypeptide. In some aspects, the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding an IDI polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding a DXS polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding a DXP pathway polypeptide. In some aspects, the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding a DXS polypeptide. In some aspects, the cells further comprise one or more nucleic acids encoding an IDI polypeptide and a DXS polypeptide or a DXP pathway polypeptide. In some aspects, one nucleic acid encodes the isoprene synthase polypeptide, IDI polypeptide, and DXS polypeptide or a DXP pathway polypeptide. In some aspects, one plasmid encodes the isoprene synthase polypeptide. IDI polypeptide, and DXS polypeptide or a DXP pathway polypeptide. In some aspects, the cells further comprise a heterologous nucleic acid encoding an MVA pathway polypeptide. In some aspects, the cells further comprise a chromosomal copy of an endogenous nucleic acid encoding an MVA pathway polypeptide. In some aspects, the MVA pathway polypeptide is a mevalonate kinase (MVK). In some aspects, the MVK is a polypeptide from the genus Methanosarcina. In some aspects, the MVK is a polypeptide from Methanosarcina mazei.

[0117] In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from the genus Pueraria. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from Pueraria montana. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from the genus Populus. In some aspects, the isoprene synthase polypeptide is a naturally-occurring polypeptide from Populus alba. In some aspects, the cells further comprise a heterologous nucleic acid encoding an MVA pathway polypeptide. In some aspects, the MVA pathway polypeptide is a mevalonate kinase (MVK). In some aspects, the MVK is a polypeptide from the genus Methanosarcina. In some aspects, the MVK is a polypeptide from Methanosarcina mazei. In some aspects, the cells are bacterial cells. In some aspects, the cells are gram-positive bacterial cells. In some aspects, the cells are Bacillus cells. In some aspects, the cells are Bacillus subtilis cells. In some aspects, the cells are gram-negative bacterial cells. In some aspects, the cells are Escherichia or Pantoea cells. In some aspects, the cells are Escherichia coli or Pantoea citrea cells. In some aspects, the cells are fungal cells. In some aspects, the cells are Trichoderma cells. In some aspects, the cells are Trichoderma reesei cells. In some aspects, the cells are yeast cells. In some aspects, the cells are Yarrowia cells. In some aspects, the cells are Yarrowia lipolytica cells.

Exemplary Methods for Isolating Nucleic Acids

[0118] Isoprene synthase, DXS, IDI, DXP pathway polypeptides. MVA pathway polypeptides. PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids can be isolated using standard methods. Methods of obtaining desired nucleic acids from a source organism of interest (such as a bacterial genome) are common and well known in the art of molecular biology (see, for example, WO 2004/033646 and references cited therein). Standard methods of isolating nucleic acids, including PCR amplification of known sequences, synthesis of nucleic acids, screening of genomic libraries, screening of cosmid libraries are described in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716).

Exemplary Promoters and Vectors

[0119] Any of the isoprene synthase, DXS, DXP pathway polypeptides, IDI, MVA pathway polypeptides, PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids described herein can be included in one or more vectors. Accordingly, also described herein are vectors with one more nucleic acids encoding any of the isoprene synthase, DXS, IDI, DXP pathway polypeptides, MVA pathway polypeptides, PGL, hydrogenase, hydrogenase maturation and/or transcription factor polypeptides that are described herein. In some aspects, the vector contains a nucleic acid under the control of an expression control sequence. In some aspects, the expression control sequence is a native expression control sequence. In some aspects, the expression control sequence is a non-native expression control sequence. In some aspects, the vector contains a selective marker or selectable marker. In some aspects, an isoprene synthase. DXS, IDI, DXP pathway, MVA pathway, PGL, hydrogenase, hydrogenase maturation, or transcription regulatory nucleic acid integrates into a chromosome of the cells without a selectable marker.

[0120] Suitable vectors are those which are compatible with the host cell employed. Suitable vectors can be derived, for example, from a bacterium, a virus (such as bacteriophage T7 or a M-13 derived phage), a cosmid, a yeast, or a plant. Suitable vectors can be maintained in low, medium, or high copy number in the host cell. Protocols for obtaining and using such vectors are known to those in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989). Suitable vectors compatible with the cells and methods described herein are described in International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716).

[0121] Promoters are well known in the art. Any promoter that functions in the host cell can be used for expression of an isoprene synthase. DXS, DXP pathway. IDI, MVA pathway, PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acid in the host cell. Initiation control regions or promoters, which are useful to drive expression of isoprene synthase, DXS, DXP pathway, IDI, MVA pathway. PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids in various host cells are numerous and familiar to those skilled in the art (see, for example, WO 2004/033646 and references cited therein). Virtually any promoter capable of driving these nucleic acids can be used including a glucose isomerase promoter (see, for example, U.S. Pat. No. 7,132,527 and references cited therein). Suitable promoters compatible with the cells and methods described herein are described in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716).

[0122] In some aspects, the expression vector also includes a termination sequence. Termination control regions may also be derived from various genes native to the host cell. In some aspects, the termination sequence and the promoter sequence are derived from the same source. Suitable termination sequences compatible with the cells and methods described herein are described in International Publication No. WO 2009/076676 A2 and U.S. patent application Ser. No. 12/335,071, both of which are incorporated herein by reference.

[0123] An isoprene synthase, DXS, DXP pathway, IDI, MVA pathway. PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acid can be incorporated into a vector, such as an expression vector, using standard techniques (Sambrook et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, 1982). Suitable techniques compatible with the cells and methods described herein are described in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716).

[0124] In some aspects, it may be desirable to over-express isoprene synthase, DXP pathway polypeptides, IDI, MVA pathway polypeptides, PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids at levels far higher than currently found in naturally-occurring cells. In some aspects, it may be desirable to under-express (e.g., mutate, inactivate, or delete) isoprene synthase. DXP pathway polypeptides. IDI, MVA pathway polypeptides, PGL, hydrogenase, hydrogenase maturation, or transcription factor polypeptide-encoding nucleic acids at levels far below that those currently found in naturally-occurring cells. Suitable methods for over- or under-expressing the isoprene synthase. DXP pathway polypeptides, IDI, MVA pathway polypeptides. PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids compatible with cells and methods described herein are described in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716).

Exemplary Source Organisms

[0125] Isoprene synthase, DXP pathway. IDI, MVA pathway, PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids (and their encoded polypeptides) can be obtained from any organism that naturally contains isoprene synthase, DXP pathway, IDI, MVA pathway, PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids. As noted above, isoprene is formed naturally by a variety of organisms, such as bacteria, yeast, plants, and animals. Organisms contain the MVA pathway. DXP pathway, or both the MVA and DXP pathways for producing isoprene (FIGS. 1A and 1B). Thus, DXP pathway nucleic acids can be obtained, e.g., from any organism that contains the DXP pathway or contains both the MVA and DXP pathways. IDI and isoprene synthase nucleic acids can be obtained, e.g., from any organism that contains the MVA pathway. DXP pathway, or both the MVA and DXP pathways. MVA pathway nucleic acids can be obtained. e.g., from any organism that contains the MVA pathway or contains both the MVA and DXP pathways. Hydrogenase nucleic acids can be obtained, e.g., from any organism that oxidizes hydrogen or reduces hydrogen ions. Fermentation side product genes can be obtained or identified, e.g., from any organism that undergoes oxygen-limited or anaerobic respiration, such as glycolysis.

[0126] The nucleic acid sequence of the isoprene synthase, DXP pathway. IDI, MVA pathway, PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids can be isolated from a bacterium, fungus, plant, algae, or cyanobacterium. Exemplary source organisms include, for example, yeasts, such as species of Saccharomyces (e.g., S. cerevisiae) or species of Yarrowia (e.g., Yarrowia lipolytica), other fungi, such as species of Trichoderma (e.g., T. reesei), bacteria, such as species of Bacillus (e.g., B. subtilis), species of Escherichia (e.g., E. coli), species of Methanosarcina (e.g., Methanosarcina mazei) or species of Pantoea (e.g., P. citrea), plants, such as kudzu or poplar (e.g., Populus alba x tremula CAC35696) or aspen (e.g., Populus tremuloides). Exemplary host organisms are described in U.S. Provisional Patent Application No. 61/187,959, International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716.

Exemplary Host Cells

[0127] A variety of host cells can be used to express isoprene synthase. DXS, IDI, DXP pathway polypeptides, MVA pathway polypeptides, hydrogenase, hydrogenase maturation and/or transcription factor polypeptides and to co-produce isoprene and hydrogen in the methods described herein. Exemplary host cells include cells from any of the organisms listed in the prior section under the heading "Exemplary Source Organisms." The host cell may be a cell that naturally produces isoprene or a cell that does not naturally produce isoprene. In some aspects, the host cell naturally produces isoprene using the DXP pathway, and an isoprene synthase. DXS, and/or IDI nucleic acid is added to enhance production of isoprene using this pathway. In some aspects, the host cell naturally produces isoprene using the MVA pathway, and an isoprene synthase and/or one or more MVA pathway nucleic acids are added to enhance production of isoprene using this pathway. In some aspects, the host cell naturally produces isoprene using the DXP pathway and one or more MVA pathway nucleic acids are added to produce isoprene using part or all of the MVA pathway as well as the DXP pathway. In some aspects, the host cell naturally produces isoprene using both the DXP and MVA pathways and one or more isoprene synthase. DXS, IDI, or MVA pathway nucleic acids are added to enhance production of isoprene by one or both of these pathways.

[0128] Various types of host cells suitable for use with the methods described herein, including cells that naturally produce isoprene using both the DXP and MVA pathways, are discussed in International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716. Non-limiting host cells include; Escherichia coli (E. coli), Panteoa citrea, Bacillus subtilis, Yarrowia lipolytica, and Trichoderma reesei.

Exemplary Transformation Methods

[0129] Isoprene synthase, DXS, IDI, MVA pathway, PGL, hydrogenase, hydrogenase maturation and/or transcription factor nucleic acids or vectors containing them can be inserted into a host cell (e.g., a plant cell, a fungal cell, a yeast cell, or a bacterial cell described herein) using standard techniques for introduction of a DNA construct or vector into a host cell, such as transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipofection mediated or DEAE-Dextrin mediated transfection or transfection using a recombinant phage virus), incubation with calcium phosphate DNA precipitate, high velocity bombardment with DNA-coated microprojectiles, and protoplast fusion. General transformation techniques are known in the art (see. e.g., Current Protocols in Molecular Biology (F. M. Ausubel et al. (eds.) Chapter 9, 1987; Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd ed., Cold Spring Harbor, 1989; and Campbell el al., Curr. Genet. 16:53-56, 1989). The introduced nucleic acids may be integrated into chromosomal DNA or maintained as extrachromosomal replicating sequences. Transformants can be selected by any method known in the art. Suitable methods for selecting transformants are described in U.S. Provisional Patent Application No. 61/187,959, International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102). WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716.

Exemplary Cell Culture Media

[0130] By "cells in culture" is meant two or more cells in a solution (e.g., a cell growth medium) that allows the cells to undergo one or more cell divisions. "Cells in culture" do not include plant cells that are part of a living, multicellular plant containing cells that have differentiated into plant tissues. In various aspects, the cell culture includes at least or about 10, 20, 50, 100, 200, 500, 1,000, 5,000, 10,000 or more cells.

[0131] Any carbon source can be used to cultivate the host cells. The term "carbon source" refers to one or more carbon-containing compounds capable of being metabolized by a host cell or organism. For example, the cell medium used to cultivate the host cells may include any carbon source suitable for maintaining the viability or growing the host cells.

[0132] Various carbon sources suitable for culturing isoprene producing cells according to the methods described herein are described in International Application Publication WO 2009/076676 A2 and in U.S. patent application Ser. No. 12/335,071, both of which are incorporated herein by reference in their entireties.

[0133] In some aspects, cells are cultured in a standard medium containing physiological salts and nutrients (see, e.g., Pourquie, J. et al., Biochemistry and Genetics of Cellulose Degradation, eds. Aubert et al., Academic Press, pp. 71-86, 1988 and Ilmen et al., Appl. Environ. Microbiol. 63:1298-1306, 1997). Exemplary growth media are common commercially prepared media such as Luria Bertani (LB) broth, Sabouraud Dextrose (SD) broth, or Yeast medium (YM) broth. Other defined or synthetic growth media may also be used, and the appropriate medium for growth of particular host cells are known by someone skilled in the art of microbiology or fermentation science.

[0134] In addition to an appropriate carbon source, the cell medium desirably contains suitable minerals, salts, cofactors, buffers, and other components known to those skilled in the art suitable for the growth of the cultures or the enhancement of isoprene production (see, for example, WO 2004/033646 and references cited therein and WO 96/35796 and references cited therein). In some aspects where an isoprene synthase, DXS, IDI, and/or MVA pathway nucleic acid is under the control of an inducible promoter, the inducing agent (e.g., a sugar, metal salt or antimicrobial), is desirably added to the medium at a concentration effective to induce expression of an isoprene synthase, DXS, IDI, DXP pathway polypeptides and/or MVA pathway polypeptides. In some aspects, cell medium has an antibiotic (such as kanamycin) that corresponds to the antibiotic resistance nucleic acid (such as a kanamycin resistance nucleic acid) on a vector that has one or more isoprene synthase, DXS, IDI, DXP pathway nucleic acids or MVA pathway nucleic acids.

Exemplary Cell Culture Conditions

[0135] Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art. Exemplary techniques may be found in Manual of Methods for General Bacteriology Gerhardt et al., eds.), American Society for Microbiology, Washington, D.C. (1994) or Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass. In some aspects, the cells are cultured in a culture medium under conditions permitting the expression of one or more isoprene synthase, DXS, IDI, DXP pathway polypeptides or MVA pathway polypeptides encoded by a nucleic acid inserted into the host cells.

[0136] Standard cell culture conditions are suitable for culturing the cells (see, for example, WO 2004/033646 and references cited therein). Cells are grown and maintained at an appropriate temperature, gas mixture, and pH (such as at about 20.degree. C. to about 37.degree. C., at about 6% to about 84% CO.sub.2, and at a pH between about 5 to about 9). In some aspects, cells are grown at 35.degree. C. in an appropriate cell medium. In some aspects, e.g., cultures are cultured at approximately 28.degree. C. in appropriate medium in shake cultures or fermentors until the desired amount of isoprene and hydrogen co-production is achieved. In some aspects, the pH ranges for fermentation are between about pH 5.0 to about pH 9.0 (such as about pH 6.0 to about pH 8.0 or about 6.5 to about 7.0). Reactions may be performed under aerobic, anoxic, or anaerobic conditions based on the requirements of the host cells.

[0137] Standard culture conditions and modes of fermentation, such as batch, fed-batch, or continuous fermentation, are described in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716. Batch and Fed-Batch fermentations are common and well known in the art and examples may be found in Brock, Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc.

[0138] In some aspects, a constitutive or leaky promoter (such as a Trc promoter) is used and a compound (such as IPTG) is not added to induce expression of the isoprene synthase, DXS, IDI, DXP pathway nucleic acid(s) or MVA pathway nucleic acid(s) operably linked to the promoter. In some aspects, a compound (such as IPTG) is added to induce expression of the isoprene synthase. DXS, IDI, DXP pathway nucleic acid(s) or MVA pathway nucleic acid(s) operably linked to the promoter.

Exemplary Isoprene Synthase Polypeptides and Nucleic Acids

[0139] In some aspects, the E. coli cells comprise a heterologous nucleic acid encoding an isoprene synthase polypeptide. In some aspects, the isoprene synthase polypeptide or nucleic acid is from the family Fabaceae, such as the Faboideae subfamily. In some aspects, the isoprene synthase polypeptide or nucleic acid is a polypeptide or nucleic acid from Pueraria montana (kudzu) (Sharkey et al., Plant Physiology 137: 700-712, 2005), Pueraria lobata, poplar (such as Populus alba, Populus nigra, Populus trichocarpa, or Populus alba x tremula (CAC35696) Miller et al., Planta 213:483-487, 2001) aspen (such as Populus tremuloides) Silver et al., JBC 270(22): 13010-1316, 1995), or English Oak (Quercus robur) (Zimmer et al., WO 98/02550). In some aspects, the isoprene synthase polypeptide or nucleic acid is a naturally-occurring isoprene synthase polypeptide or nucleic acid. In some aspects, the isoprene synthase polypeptide or nucleic acid is not a naturally-occurring isoprene synthase polypeptide or nucleic acid. Exemplary isoprene synthase polypeptides and nucleic acids and methods of measuring isoprene synthase activity are described in more detail in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102). WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716.

Exemplary DXP Pathway Polypeptides and Nucleic Acids

[0140] Exemplary DXP pathways polypeptides include, but are not limited to any of the following polypeptides: DXS polypeptides, DXR polypeptides, MCT polypeptides, CMK polypeptides. MCS polypeptides. HDS polypeptides. HDR polypeptides, IDI polypeptides, and polypeptides (e.g., fusion polypeptides) having an activity of one, two, or more of the DXP pathway polypeptides. In particular. DXP pathway polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of a DXP pathway polypeptide. Exemplary DXP pathway nucleic acids include nucleic acids that encode a polypeptide, fragment of a polypeptide, peptide, or fusion polypeptide that has at least one activity of a DXP pathway polypeptide. Exemplary DXP pathway polypeptides and nucleic acids include naturally-occurring polypeptides and nucleic acids from any of the source organisms described herein as well as mutant polypeptides and nucleic acids of any of the source organisms described herein.

[0141] Exemplary DXS polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of a DXS polypeptide. Standard methods (such as those described herein) can be used to determine whether a polypeptide has DXS polypeptide activity by measuring the ability of the polypeptide to convert pyruvate and D-glyceraldehyde-3-phosphate into 1-deoxy-D-xylulose-5-phosphate in vitro, in a cell extract, or in vivo. Exemplary DXS polypeptides and nucleic acids and methods of measuring DXS activity are described in more detail in International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716.

[0142] In particular, DXS polypeptides convert pyruvate and D-glyceraldehyde 3-phosphate into 1-deoxy-d-xylulose 5-phosphate (DXP). Standard methods can be used to determine whether a polypeptide has DXS polypeptide activity by measuring the ability of the polypeptide to convert pyruvate and D-glyceraldehyde 3-phosphate in vitro, in a cell extract, or in vivo.

[0143] DXR polypeptides convert 1-deoxy-d-xylulose 5-phosphate (DXP) into 2-C-methyl-D-erythritol 4-phosphate (MEP). Standard methods can be used to determine whether a polypeptide has DXR polypeptide activity by measuring the ability of the polypeptide to convert DXP in vitro, in a cell extract, or in vivo.

[0144] MCT polypeptides convert 2-C-methyl-D-erythritol 4-phosphate (MEP) into 4-(cytidine 5'-diphospho)-2-methyl-D-erythritol (CDP-ME). Standard methods can be used to determine whether a polypeptide has MCT polypeptide activity by measuring the ability of the polypeptide to convert MEP in vitro, in a cell extract, or in vivo.

[0145] CMK polypeptides convert 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (CDP-ME) into 2-phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (CDP-MEP). Standard methods can be used to determine whether a polypeptide has CMK polypeptide activity by measuring the ability of the polypeptide to convert CDP-ME in vitro, in a cell extract, or in vivo.

[0146] MCS polypeptides convert 2-phospho-4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (CDP-MEP) into 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (ME-CPP or cMEPP). Standard methods can be used to determine whether a polypeptide has MCS polypeptide activity by measuring the ability of the polypeptide to convert CDP-MEP in vitro, in a cell extract, or in vivo.

[0147] HDS polypeptides convert 2-C-methyl-D-erythritol 2,4-cyclodiphosphate (ME-CPP or cMEPP) into (E)-4-hydroxy-3-methylbut-2-en-1-yl diphosphate (HMBPP or HDMAPP). Standard methods can be used to determine whether a polypeptide has HDS polypeptide activity by measuring the ability of the polypeptide to convert ME-CPP or cMEPP in vitro, in a cell extract, or in vivo.

[0148] HDR polypeptides convert (E)-4-hydroxy-3-methylbut-2-en-1-yl diphosphate (HMBPP or HDMAPP) into isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). Standard methods can be used to determine whether a polypeptide has HDR polypeptide activity by measuring the ability of the polypeptide to convert HMBPP or HDMAPP in vitro, in a cell extract, or in vivo.

[0149] IDI polypeptides convert isopentenyl diphosphate into dimethylallyl disphosphate. Standard methods can be used to determine whether a polypeptide has IDI polypeptide activity by measuring the ability of the polypeptide to convert isopentenyl diphosphate in vitro, in a cell extract, or in vivo.

Exemplary IDI Polypeptides and Nucleic Acids

[0150] Isopentenyl diphosphate isomerase polypeptides (isopentenyl-diphosphate delta-isomerase or IDI) catalyses the interconversion of isopentenyl diphosphate (IPP) and dimethyl allyl diphosphate (DMAPP) (e.g., converting IPP into DMAPP and/or converting DMAPP into IPP). Exemplary IDI polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an IDI polypeptide. Standard methods (such as those described herein) can be used to determine whether a polypeptide has IDI polypeptide activity by measuring the ability of the polypeptide to interconvert IPP and DMAPP in vitro, in a cell extract, or in vivo. Exemplary IDI polypeptides and nucleic acids and methods of measuring IDI activity are described in more detail in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102). WO 2010/003007. US Publ. No. 2010/0048964. WO 2009/132220, and US Publ. No. 2010/0003716.

Exemplary MVA Pathway Polypeptides and Nucleic Acids

[0151] Exemplary MVA pathway polypeptides include acetyl-CoA acetyltransferase (AA-CoA thiolase) polypeptides, 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase) polypeptides, 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) polypeptides, mevalonate kinase (MVK) polypeptides, phosphomevalonate kinase (PMK) polypeptides, diphosphomevalonate decarboxylase (MVD) polypeptides, phosphomevalonate decarboxylase (PMDC) polypeptides, isopentenyl phosphate kinase (IPK) polypeptides, IDI polypeptides, and polypeptides (e.g., fusion polypeptides) having an activity of two or more MVA pathway polypeptides. In particular. MVA pathway polypeptides include polypeptides, fragments of polypeptides, peptides, and fusions polypeptides that have at least one activity of an MVA pathway polypeptide. Exemplary MVA pathway polypeptides and nucleic acids and methods of measuring IDI activity are described in more detail in International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716.

[0152] In some aspects, the cells contain the upper MVA pathway, which includes AA-CoA thiolase. HMG-CoA synthase, and HMG-CoA reductase nucleic acids. In some aspects, the cells contain the lower MVA pathway, which includes MVK, PMK, MVD, and IDI nucleic acids. In some aspects, the cells contain an entire MVA pathway that includes AA-CoA thiolase, H-IMG-CoA synthase, HMG-CoA reductase, MVK, PMK, MVD, and IDI nucleic acids. In some aspects, the cells contain an entire MVA pathway that includes AA-CoA thiolase, HMG-CoA synthase, HMG-CoA reductase, MVK, PMDC, IPK, and IDI nucleic acids.

[0153] The improved methods described herein can also be used to produce isoprene and a co-product, such as hydrogen. Exemplary hydrogenase polypeptides and nucleic acids, polypeptides and nucleic acids for genes related to production of fermentation side products, and polypeptides and nucleic acids for genes relating to hydrogen reuptake can also be used with the compositions and methods described in. Such polypeptides and nucleic acids are described in U.S. Provisional Patent Application No. 61/141,652, U.S. Provisional Patent Application No. 61/187,934, US Publ. No. 2010/0196988. WO 2010/078457. International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716.

Isoprene Compositions Produced from Renewable Resources

[0154] Isoprene compositions produced from renewable resources (e.g. bioisoprene) are distinguished from petro-isoprene compositions in that bioisoprene is produced with other bio-byproducts (compounds derived from the biological sources and/or associated the biological processes that are obtained together with bioisoprene) that are not present or present in much lower levels in petro-isoprene compositions, such as alcohols, aldehydes, ketone and the like. The bio-byproducts may include, but are not limited to, ethanol, acetone, methanol, acetaldehyde, methacrolein, methyl vinyl ketone, 2-methyl-2-vinyloxirane, cis- and trans-3-methyl-1,3-pentadiene, a C5 prenyl alcohol (such as 3-methyl-3-buten-1-ol or 3-methyl-2-buten-1-ol), 2-heptanone, 6-methyl-5-hepten-2-one, 2,4,5-trimethylpyridine, 2,3,5-trimethylpyrazine, citronellal, methanethiol, methyl acetate, 1-propanol, diacetyl, 2-butanone, 2-methyl-3-buten-2-ol, ethyl acetate, 2-methyl-1-propanol, 3-methyl-1-butanal, 3-methyl-2-butanone, 1-butanol, 2-pentanone, 3-methyl-1-butanol, ethyl isobutyrate, 3-methyl-2-butenal, butyl acetate, 3-methylbutyl acetate, 3-methyl-3-buten-1-yl acetate, 3-methyl-2-buten-1-yl acetate, 3-hexen-1-ol, 3-hexen-1-yl acetate, limonene, geraniol (trans-3,7-dimethyl-2,6-octadien-1-ol), citronellol (3,7-dimethyl-6-octen-1-ol), (E)-3,7-dimethyl-1,3,6-octatriene, (Z)-3,7-dimethyl-1,3,6-octatriene, 2,3-cycloheptenopyridine, or a linear isoprene polymer (such as a linear isoprene dimer or a linear isoprene trimer derived from the polymerization of multiple isoprene units). Products derived from bioisoprene contain one or more of the bio-byproducts or compounds derived from any of the by-products. In addition, products derived from bioisoprene may contain compounds formed from these by-products during subsequent chemical conversion. Examples of such compounds include those derived from Diels-Alder cycloaddition of dienophiles to isoprene, or the oxidation of isoprene.

[0155] Isoprene compositions produced from renewable resources including particular byproducts or impurities are described in more detail in U.S. Provisional Patent Application No. 61/187,959, U.S. application Ser. No. 12/818,090, PCT/US10/039088, International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102). WO 2010/003007. US Publ. No. 2010/0048964. WO 2009/132220, and US Publ. No. 2010/0003716.

Exemplary Purification Methods

[0156] In some aspects, any of the methods described herein further include a step of recovering the isoprene. Additional examples of efficient methods for the production and recovery of isoprene are described in U.S. Provisional Patent Application Ser. Nos. 61/187,959 and 61/187,934, International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716. Additional examples of efficient methods for the production and recovery of isoprene and a coproduct, such as hydrogen, are described in U.S. Provisional Patent Application Nos. 61/141,652, 61/187,934, and 61/187,959, and International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007. US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716. In addition, recovery may be achieved by absorption stripping as described in U.S. application Ser. No. 12/969,440.

Other Techniques

[0157] Isoprene production in cells by the methods described herein can be increased by decoupling isoprene production from cell growth, as described in U.S. Provisional Patent Application Ser. No. 61/187,959. U.S. patent application Ser. No. 12/496,573. International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102). WO 2010/003007, US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716. The safety of methods of producing isoprene in cells by the methods described herein can be improved by producing isoprene within safe operating ranges, as described in U.S. Provisional Patent Application Ser. No. 61/187,959, U.S. patent application Ser. No. 12/496,573, International Publication No. WO 2009/076676, U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102). WO 2010/003007. US Publ. No. 2010/0048964, WO 2009/132220, and US Publ. No. 2010/0003716. Cell viability at high isoprene titers, such as those achieved by the improved methods of producing isoprene described herein, can be improved as described in U.S. Provisional Patent Application Ser. No. 61/187,959, International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102). WO 2010/003007. US Publ. No. 2010/0048964. WO 2009/132220, and US Publ. No. 2010/0003716.

[0158] Additional examples of efficient methods for the production and recovery of isoprene are described in U.S. Provisional Patent Application Ser. No. 61/187,959, International Publication No. WO 2009/076676. U.S. patent application Ser. No. 12/335,071 (US Publ. No. 2009/0203102), WO 2010/003007. US Publ. No. 2010/0048964, WO 2009/132220, US Publ. No. 2010/0003716 and U.S. application Ser. No. 12/969,440. Additional examples of efficient methods for the production and recovery of isoprene and a coproduct, such as hydrogen, are described in U.S. Provisional Patent Application No. 61/141,652, U.S. Provisional Patent Application No. 61/187,934, US Publ. No. 2010/0196977, and WO 2010/078457.

[0159] The invention can be further understood by reference to the following examples, which are provided by way of illustration and are not meant to be limiting.

EXAMPLES

Example 1

Construction of E. coli strains expressing the S. cerevisiae gi1.2KKDyI operon, P. alba isoprene synthase, M. mazei mevalonate kinase, pCL Upper MVA (E. faecalis mvaE and mvaS) and ybhE (pgl)

[0160] (i) Construction of strain EWL201 (BL21, Cm-GI1.2-KKDyI)

[0161] E. coli BL21 (Novagen brand, EMD Biosciences, Inc.) was a recipient strain, transduced with MCM331 P1 lysate (lysate prepared according to the method described in Ausubel, et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc.). MCM331 cells contain chromosomal construct gi1.2KKDyI encoding S. cerevisiae mevalonate kinase, mevalonate phosphate kinase, mevalonate pyrophosphate decarboxylase, and IPP isomerase (i.e., the gi1.2-KKDyI operon from S. cerevisiae). Transductants were selected for by spreading cells onto L Agar and 20 .mu.g/.mu.l chloramphenicol. The plates were incubated overnight at 30.degree. C. Analysis of transductants showed no colonies on control plates (water+cells control plate for reversion and water and P1 lysate control plate for lysate contamination.

[0162] Four transductants were picked and used to inoculate 5 mL L Broth and 20 .mu.g/.mu.l chloramphenicol. The cultures were grown overnight at 30.degree. C. with shaking at 200 rpm. To make genomic DNA preps of each transductant for PCR analysis, 1.5 mL of overnight cell culture were centrifuged. The cell pellet was resuspended with 400 .mu.l Resuspension Buffer (20 mM Tris, 1 mM EDTA, 50 mM NaCl, pH 7.5) and 4 .mu.l RNase, DNase-free (Roche) was added. The tubes were incubated at 37.degree. C. for 30 minutes followed by the addition of 4 .mu.l 10% SDS and 4 .mu.l of 10 mg/ml Proteinase K stock solution (Sigma-Aldrich). The tubes were incubated at 37.degree. C. for 1 hour. The cell lysate was transferred into 2 ml Phase Lock Light Gel tubes (Eppendorf) and 200 .mu.l each of saturated phenol pH 7.9 (Ambion Inc.) and chloroform were added. The tubes were mixed well and microcentrifuged for 5 minutes. A second extraction was done with 400 .mu.l chloroform and the aqueous layer was transferred to a new eppendorf tube. The genomic DNA was precipitated by the addition of 1 ml of 100% ethanol and centrifugation for 5 minutes. The genomic DNA pellet was washed with 1 ml 70% ethanol. The ethanol was removed and the genomic DNA pellet was allowed to air dry briefly. The genomic DNA pellet was resuspended with 200 id TE.

[0163] Using Pfu Ultra II DNA polymerase (Stratagene) and 200 ng/.mu.l of genomic DNA as template, 2 different sets of PCR reaction tubes were prepared according to manufacturer's protocol. For set 1, primers MCM130 and GB Cm-Rev (Table 1) were used to ensure transductants were successfully integrated into the attTn7 locus. PCR parameters for set 1 were 95.degree. C. for 2 minutes (first cycle only), 95.degree. C. for 25 seconds, 55.degree. C. for 25 seconds, 72.degree. C. for 25 seconds (repeat steps 2-4 for 28 cycles), 72.degree. C. for 1 minute. For set 2, primers MVD For and MVD Rev (Table 1) were used to ensure that the gi1.2-KKDyI operon integrated properly. PCR parameters for set 2 were 95.degree. C. for 2 minutes (first cycle only), 95.degree. C. for 25 seconds, 55.degree. C. for 25 seconds, 72.degree. C. for 10 seconds (repeat steps 2-4 for 28 cycles), 72.degree. C. for 1 minute. Analysis of PCR amplicons on a 1.2% E-gel (Invitrogen Corp.) showed that all 4 transductant clones were correct. One was picked and designated as strain EWL201.

(ii) Construction of Strain EWL204 (BL21, Loopout-GI1.2-KKDyI)

[0164] The chloramphenicol marker was looped out of strain EWL201 using plasmid pCP20 as described by Datsenko and Wanner (2000) (Datsenko et al., Proc Natl. Acad. Sci USA 97:6640-6645, 2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. (Datsenko et al., PNAS 97:6640-6645, 2000). EWL201 cells were grown in L Broth to midlog phase and then washed three times in ice-cold, sterile water. An aliquot of 50 .mu.g/.mu.l of cell suspension was mixed with 1 .mu.l of pCP20 and the cell suspension mixture was electroporated in a 2 mm cuvette (Invitrogen Corp.) at 2.5 Volts and 25 .mu.Fd using a Gene Pulser Electroporator (Bio-Rad Inc.). 1 ml of LB was immediately added to the cells, then transferred to a 14 ml polypropylene tube (Sarstedt) with a metal cap. Cells were allowed to recover by growing for 1 hour at 30.degree. C. Transformants were selected on L Agar and 20 .mu.g/.mu.l chloramphenicol and 50 .mu.g/.mu.l carbenicillin and incubated at 30.degree. C. overnight. The next day, a single clone was grown in 10 ml L Broth and 50 .mu.g/.mu.l carbenicillin at 30.degree. C. until early log phase. The temperature of the growing culture was then shifted to 42.degree. C. for 2 hours. Serial dilutions were made, the cells were then spread onto LA plates (no antibiotic selection), and incubated overnight at 30.degree. C. The next day, 20 colonies were picked and patched onto L Agar (no antibiotics) and LA and 20 .mu.g/.mu.l chloramphenicol plates. Plates were then incubated overnight at 30.degree. C. Cells able to grow on LA plates, but not LA and 20 .mu.g/.mu.l chloramphenicol plates, were deemed to have the chloramphenicol marker looped out (picked one and designated as strain EWL204).

(iii) Construction of Plasmid pEWL230 (pTrc P. alba)

[0165] Generation of a synthetic gene encoding Populus alba isoprene synthase (P. alba HGS) was outsourced to DNA2.0 Inc. (Menlo Park, Calif.) based on their codon optimization method for E. coli expression. The synthetic gene was custom cloned into plasmid pET24a (Novagen brand, EMD Biosciences, Inc.) and delivered lyophilized (FIGS. 2, 3A-B; SEQ ID NO:1).

[0166] A PCR reaction was performed to amplify the P. alba isoprene synthase (P. alba HGS) gene using pET24 P. alba HGS as the template, primers MCM182 and MCM 192, and Herculase II Fusion DNA polymerase (Stratagene) according to manufacturer's protocol. PCR conditions were as follows: 95.degree. C. for 2 minutes (first cycle only), 95.degree. C. for 25 seconds, 55.degree. C. for 20 seconds, 72.degree. C. for 1 minute, repeat for 25 cycles, with final extension at 72.degree. C. for 3 minutes. The P. alba isoprene synthase PCR product was purified using QIAquick PCR Purification Kit (Qiagen Inc.).

[0167] P. alba isoprene synthase PCR product was then digested in a 20 .mu.l reaction containing 1 .mu.l BspHI endonuclease (New England Biolabs) with 2 .mu.l 10.times.NEB Buffer 4. The reaction was incubated for 2 hours at 37.degree. C. The digested PCR fragment was then purified using the QIAquick PCR Purification Kit. A secondary restriction digest was performed in a 20 .mu.l reaction containing 1 .mu.l PstI endonuclease (Roche) with 2 .mu.l 10.times. Buffer H. The reaction was incubated for 2 hours at 37.degree. C. The digested PCR fragment was then purified using the QIAquick PCR Purification Kit. Plasmid pTrcHis2B (Invitrogen Corp.) was digested in a 20 .mu.l reaction containing 1 .mu.l NcoI endonuclease (Roche), 1 .mu.l PstI endonuclease, and 2 .mu.l 10.times. Buffer H. The reaction was incubated for 2 hours at 37.degree. C. The digested pTrcHis2B vector was gel purified using a 1.2% E-gel (Invitrogen Corp.) and extracted using the QIAquick Gel Extraction Kit (Qiagen) (FIG. 4). Using the compatible cohesive ends of BspHI and NcoI sites, a 20 .mu.l ligation reaction was prepared containing 5 .mu.l P. alba isoprene synthase insert, 2 .mu.l pTrc vector, 1 .mu.l T4 DNA ligase (New England Biolabs), 2 .mu.l 10.times. ligase buffer, and 10 .mu.l ddH.sub.2O. The ligation mixture was incubated at room temperature for 40 minutes. The ligation mixture was desalted by floating a 0.025 .mu.m nitrocellulose membrane filter (Millipore) in a petri dish of ddH.sub.2O and applying the ligation mixture gently on top of the nitrocellulose membrane filter for 30 minutes at room temperature. MCM446 cells (see Section II) were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. An aliquot of 50 .mu.l of cell suspension was mixed with 5 .mu.l of desalted pTrc P. alba HGS ligation mix. The cell suspension mixture was electroporated in a 2 mm cuvette at 2.5 Volts and 25 .mu.Fd using a Gene Pulser Electroporator. 1 ml of LB is immediately added to the cells, then transferred to a 14 ml polypropylene tube (Sarstedt) with a metal cap. Cells were allowed to recover by growing for 2 hours at 30.degree. C. Transformants were selected on L Agar and 50 .mu.g/.mu.l carbenicillin and 10 mM mevalonic acid and incubated at 30.degree. C. The next day, 6 transformants were picked and grown in 5 ml L Broth and 50 .mu.g/.mu.l carbenicillin tubes overnight at 30.degree. C. Plasmid preps were performed on the overnight cultures using QIAquick Spin Miniprep Kit (Qiagen). Due to the use of BL21 cells for propagating plasmids, a modification of washing the spin columns with PB Buffer 5.times. and PE Buffer 3.times. was incorporated to the standard manufacturer's protocol for achieving high quality plasmid DNA. Plasmids were digested with PstI in a 20 .mu.l reaction to ensure the correct sized linear fragment. All 6 plasmids were the correct size and shipped to Quintara Biosciences (Berkeley, Calif.) for sequencing with primers MCM65, MCM66, EL1000 (Table 1). DNA sequencing results showed all 6 plasmids were correct. One plasmid was picked designated as plasmid EWL230 (FIGS. 5, 6A-B; SEQ ID NO:2).

iv) Construction of Plasmid pEWL244 (pTrc P. alba-mMVK)

[0168] A PCR reaction was performed to amplify the Methanosarcina mazei (M. mazei) MVK gene using MCM376 as the template (see section (v) below), primers MCM65 and MCM77 (see Table 1), and Pfu Ultra II Fusion DNA polymerase (Stratagene) according to manufacturer's protocol. PCR conditions were as follows: 95.degree. C. for 2 minutes (first cycle only), 95.degree. C. for 25 seconds, 55.degree. C. for 25 seconds, 72.degree. C. for 18 seconds, repeat for 28 cycles, with final extension at 72.degree. C. for 1 minute. The M. mazei MVK PCR product was purified using QIAquick PCR Purification Kit (Qiagen Inc.).

[0169] The M. mazei MVK PCR product was then digested in a 40 .mu.l reaction containing 8 .mu.l PCR product, 2 .mu.l PmneI endonuclease (New England Biolabs), 4 .mu.l 10.times.NEB Buffer 4, 4 .mu.l 10.times.NEB BSA, and 22 .mu.l of ddH.sub.2O. The reaction was incubated for 3 hours at 37.degree. C. The digested PCR fragment was then purified using the QIAquick PCR Purification Kit. A secondary restriction digest was performed in a 47 .mu.l reaction containing 2 .mu.l NsiI endonuclease (Roche), 4.7 .mu.l 10.times. Buffer H, and 40 .mu.l of PmeI digested M. mazei MVK fragment. The reaction was incubated for 3 hours at 37.degree. C. The digested PCR fragment was then gel purified using a 1.2% E-gel and extracted using the QIAquick Gel Extraction Kit. Plasmid EWL230 was digested in a 40 .mu.l reaction containing 10 .mu.l plasmid, 2 .mu.l PmeI endonuclease, 4 .mu.l 10.times.NEB Buffer 4, 4 .mu.l 10.times.NEB BSA, and 20 .mu.l of ddH.sub.2O. The reaction was incubated for 3 hours at 37.degree. C. The digested PCR fragment was then purified using the QIAquick PCR Purification Kit. A secondary restriction digest was performed in a 47 .mu.l reaction containing 2 .mu.l PstI endonuclease, 4.7 .mu.l 10.times. Buffer H, and 40 .mu.l of PmeI digested EWL230 linear fragment. The reaction was incubated for 3 hours at 37.degree. C. The digested PCR fragment was then gel purified using a 1.2% E-gel and extracted using the QIAquick Gel Extraction Kit (FIG. 7). Using the compatible cohesive ends of NsiI and PstI sites, a 20 .mu.l ligation reaction was prepared containing 8 .mu.l M. mazei MVK insert, 3 .mu.l EWL230 .mu.plasmid, 1 .mu.l T4 DNA ligase, 2 .mu.l 10.times. ligase buffer, and 6 .mu.l ddH.sub.2O. The ligation mixture was incubated overnight at 16.degree. C. The next day, the ligation mixture was desalted by floating a 0.025 .mu.m nitrocellulose membrane filter in a petri dish of ddH.sub.2O and applying the ligation mixture gently on top of the nitrocellulose membrane filter for 30 minutes at room temperature. MCM446 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. An aliquot of 50 .mu.l of cell suspension was mixed with 5 .mu.l of desalted pTrc P. alba-mMVK ligation mix. The cell suspension mixture was electroporated in a 2 mm cuvette at 2.5 Volts and 25 .mu.Fd using a Gene Pulser Electroporator. 1 ml of LB is immediately added to the cells, then the cells are transferred to a 14 ml polypropylene tube with a metal cap. Cells were allowed to recover by growing for 2 hour at 30.degree. C. Transformants were selected on LA and 50 .mu.g/.mu.l carbenicillin and 5 mM mevalonic acid plates and incubated at 30.degree. C. The next day, 6 transformants were picked and grown in 5 ml LB and 50 .mu.g/.mu.l carbenicillin tubes overnight at 30.degree. C. Plasmid preps were performed on the overnight cultures using QIAquick Spin Miniprep Kit. Due to the use of BL21 cells for propagating plasmids, a modification of washing the spin columns with PB Buffer 5.times. and PE Buffer 3.times. was incorporated to the standard manufacturer's protocol for achieving high quality plasmid DNA. Plasmids were digested with PstI in a 20 .mu.l reaction to ensure the correct sized linear fragment. Three of the 6 plasmids were the correct size and shipped to Quintara Biosciences for sequencing with primers MCM65, MCM66, EL1000, EL1003, and EL1006 (Table 1). DNA sequencing results showed all 3 plasmids were correct. One was picked and designated as plasmid EWL244 (FIGS. 8 and 9A-B; SEQ ID NO:3).

v) Construction of Plasmid MCM376-MVK from M. mazei Archaeal Lower in pET200D.

[0170] The MVK ORF from the M. mazei archaeal Lower Pathway operon (FIGS. 10A-C; SEQ ID NO:4) was PCR amplified using primers MCM161 and MCM162 (Table 1) using the Invitrogen Platinum 1-HiFi PCR mix. 45 .mu.L of PCR mix was combined with 1 .mu.L template, 1 .mu.L, of each primer at 10 .mu.M, and 2 .mu.L water. The reaction was cycled as follows: 94.degree. C. for 2:00 minutes; 30 cycles of 94.degree. C. for 0:30 minutes, 55.degree. C. for 0:30 minutes and 68.degree. C. for 1:15 minutes; and then 72.degree. C. for 7:00 minutes, and 4.degree. C. until cool. 3 .mu.L of this PCR reaction was ligated to Invitrogen pET200D plasmid according to the manufacturer's protocol. 3 .mu.L of this ligation was introduced into Invitrogen TOP 10 cells, and transformants were selected on LA/kan50. A plasmid from a transformant was isolated and the insert sequenced, resulting in MCM376 (FIGS. 11A-C).

vi) Construction of Strain EWL251 (BL21 (DE3), Cm-GI1.2-KKDyI, pTrc P. alba-mMVK)

[0171] MCM331 cells (which contain chromosomal construct gi 1.2KKDyI encoding S. cerevisiae mevalonate kinase, mevalonate phosphate kinase, mevalonate pyrophosphate decarboxylase, and IPP isomerase) were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 .mu.l of cell suspension with 1 .mu.l of plasmid EWL244. The cell suspension mixture was electroporated in a 2 mm cuvette at 2.5 Volts and 25 .mu.Fd using a Gene Pulser Electroporator. 1 ml of LB is immediately added to the cells, and then the cells were transferred to a 14 ml polypropylene tube with a metal cap. Cells were allowed to recover by growing for 2 hours at 30.degree. C. Transformants were selected on LA and 50 .mu.g/.mu.l carbenicillin and 5 mM mevalonic acid plates and incubated at 37.degree. C. One colony was selected and designated as strain EWL251.

vii) Construction of Strain EWL256 (BL21 (DE3), Cm-GI1.2-KKDyI, pTrc P. alba-mMVK, pCL Upper MVA)

[0172] EWL251 cells were grown in LB to midlog phase and then washed three times in ice-cold, sterile water. Mixed 50 .mu.l of cell suspension with 1 .mu.l of plasmid MCMS2 (comprising pCL PutcUpperPathway (also known as "pCL, Upper MVA"), encoding E. faecalis mvaE and mvaS). Plasmid pCL Ptrc Upper Pathway was constructed as described in Example 8 of International Publication No. WO 2009/076676 A2 and U.S. patent application Ser. No. 12/335,071, both of which are incorporated herein by reference in their entireties. The cell suspension mixture was electroporated in a 2 mm cuvette at 2.5 Volts and 25 .mu.Fd using a Gene Pulser Electroporator. 1 ml of LB was immediately added to the cells. Cells were then transferred to a 14 ml polypropylene tube with a metal cap. Cells were allowed to recover by growing for 2 hours at 30.degree. C. Transformants were selected on LA and 50 .mu.g/.mu.l carbenicillin and 50 .mu.g/.mu.l spectinomycin plates and incubated at 37.degree. C. One colony was picked and designated as strain EWL256.

TABLE-US-00001 TABLE 1 Primer Sequences Primer name Primer sequence MCM130 ACCAATTGCACCCGGCAGA (SEQ ID NO: 10) GB Cm GCTAAAGCGCATGCTCCAGAC (SEQ ID NO: 11) Rev MVD GACTGGCCTCAGATGAAAGC (SEQ ID NO: 12) For MVD CAAACATGTGGCATGGAAAG (SEQ ID NO: 13) Rev MCM182 GGGCCCGTTTAAACTTTAACTAGACTCTGCAG TTAGCGTTCAAACGGCAGAA (SEQ ID NO: 14) MCM192 CGCATGCATGTCATGAGATGTAGCGTGTCCACCGAAAA (SEQ ID NO: 15) MCM65 ACAATTTCACACAGGAAACAGC (SEQ ID NO: 16) MCM66 CCAGGCAAATTCTGTTTTATCAG (SEQ ID NO: 17) EL1000 GCACTGTCTTTCCGTCTGCTGC (SEQ ID NO: 18) MCM165 GCGAACGATGCATAAAGGAGGTAAAAAAACATGGTATCC TGTTCTGCGCCGGGTAAGATTTACCTG (SEQ ID NO: 19) MCM177 GGGCCCGTTTAAACTTTAACTAGACTTTAATCTACTTTCA GACCTTGC (SEQ ID NO: 20) EL1003 GATAGTAACGGCTGCGCTGCTACC (SEQ ID NO: 21) EL1006 GACAGCTTATCATCGACTGCACG (SEQ ID NO: 22) MCM161 CACCATGGTATCCTGTTCTGCG (SEQ ID NO: 23) MCM162 TTAATCTACTTTCAGACCTTGC (SEQ ID NO: 24)

viii) Construction of Strain RM111608-2 (Cm-GI1.2-KKDyI, pTrc P. alba-mMVK, pCL Upper MVA, pBBRCMPGI1.5-Pgl)

[0173] The BL21 strain of E. coli producing isoprene (EWL256) was constructed with constitutive expression of the ybhE gene (encoding E. coli 6-phosphogluconolactonase) on a replicating plasmid pBBRIMCS5 (Gentamycin) (obtained from Dr. K. Peterson, Louisiana State University).

[0174] FRT-based recombination cassettes, and plasmids for Red/ET-mediated integration and antibiotic marker loopout were obtained from Gene Bridges GmbH (Germany). Procedures using these materials were carried out according to Gene Bridges protocols. Primers Pgl-F (SEQ ID NO:25) and PglGI1.5-R (SEQ ID NO:26) were used to amplify the resistance cassette from the FRT-gb2-Cm-FRT template using Stratagene Herculase II Fusion kit according to the manufacturer's protocol. The PCR reaction (50 .mu.L final volume) contained: 5 .mu.L buffer, 1 .mu.L template DNA (FRT-gb2-Cm-F from Gene Bridges), 10 pmols of each primer, and 1.5 .mu.L 25 mM dNTP mix, made to 50 .mu.L with dH.sub.2O. The reaction was cycled as follows: 1.times.2 minutes, 95.degree. C. then 30 cycles of (30 seconds at 95.degree. C.; 30 seconds at 63.degree. C.; 3 minutes at 72.degree. C.).

[0175] The resulting PCR product was purified using the QIAquick.RTM. PCR Purification Kit (Qiagen) and electroporated into electrocompetent MG1655 cells harboring the pRed-ET recombinase-containing plasmid as follows. MG 1655 cells were prepared for electroporation by growing in 5 mLs of L broth to and OD.sub.600.about.0.6 at 30.degree. C. The cells were induced for recombinase expression by the addition of 4% arabinose and allowed to grow for 30 minutes at 30.degree. C. followed by 30 minutes of growth at 37.degree. C. An aliquot of 1.5 mLs of the cells was washed 3-4 times in ice cold dH.sub.2O. The final cell pellet was resuspended in 40 .mu.L of ice cold dH.sub.2O and 2-5 .mu.L of the PCR product was added. The electroporation was carried out in 1-mm gap cuvettes, at 1.3 kV in a Gene Pulser Electroporator (Bio-Rad Inc.). Cells were recovered for 1-2 hours at 30.degree. C. and plated on L agar containing chloramphenicol (5 .mu.g/mL). Five transformants were analyzed by PCR and sequencing using primers flanking the integration site (2 primer sets: pgl and 49 rev and 3'EcoRV-pglstop; Bottom Pgb2 and Top GB's CMP (946)). A correct transformant was selected and this strain was designated MG1655 GI1.5-pgl::CMP.

[0176] The chromosomal DNA of MG1655 GI1.5-pgl::CMP was used as template to generate a PCR fragment containing the FRT-CM P-FRT-GI 1.5-ybhE construct. This construct was cloned into pBBR1MCS5 (Gentamycin) as follows. The fragment, here on referred to as CMP-GI1.5-pgl, was amplified using the 5' primer Pglconfirm-F (SEQ ID NO:27) and 3' primer 3' EcoRV-pglstop (SEQ ID NO:28). The resulting fragment was cloned using the Invitrogen TOPO-Blunt cloning kit into the plasmid vector pCR-Blunt II-TOPO as suggested from the manufacturer. The NsiI fragment harboring the CMP-GI1.5-pgl fragment was cloned into the PstI site of pBBR1 MCS5 (Gentamycin). A 20 .mu.l ligation reaction was prepared containing 5 .mu.l CMP-GI1.5-pgl insert, 2 .mu.l pBBR1MCS5 (Gentamycin) vector, 1 .mu.l T4 DNA ligase (New England Biolabs), 2 .mu.l 10.times. ligase buffer, and 10 .mu.l ddH.sub.2O. The ligation mixture was incubated at room temperature for 40 minutes then 2-4 .mu.L were electroporated into electrocompetent Top10 cells (Invitrogen) using the parameters disclosed above. Transformants were selected on L agar containing 10 .mu.g/ml chloramphenicol and 5 .mu.g/ml Gentamycin. The sequence of the selected clone was determined using a number of the primers described above as well as with the in-house T3 and Reverse primers provided by Sequetech, CA. This plasmid was designated pBBRCMPGI 1.5-pgl (FIGS. 12, 13A-B and SEQ ID NO:6).

[0177] Plasmid pBBRCMPGI1.5-pgl was electroporated into EWL256, as described herein and transformants were plated on L agar containing Chloramphenicol (10 .mu.g/mL). Gentamycin (5 .mu.g/mL), spectinomycin (50 .mu.g/mL), and carbenicillin (50 .mu.g/mL). One transformant was selected and designated strain RM11608-2.

TABLE-US-00002 Primers: Pgl-F (SEQ ID NO: 25) 5'-ACCGCCAAAAGCGACTAATTTTAGCTGTTACAGTCAGTTGAATTAAC CCTCACTAAAGGGCGGCCGC-3' PglGI1.5-R (SEQ ID NO: 26) 5'-GCTGGCGATATAAACTGTTTGCTTCATGAATGCTCCTTTGGGTTACC TCCGGGAAACGCGGTTGATTTGTTTAGTGGTTGAATTATTTGCTCAGGAT GTGGCATAGTCAAGGGCGTGACGGCTCGCTAATACGACTCACTATAGGGC TCGAG-3' 3' EcoRV-pglstop: (SEQ ID NO: 28) 5'-CTT GAT ATC TTA GTG TGC GTT AAC CAC CAC pgl +49 rev: (SEQ ID NO: 29) CGTGAATTTGCTGGCTCTCAG Bottom Pgb2: (SEQ ID NO: 30) GGTTTAGTTCCTCACCTTGTC Top GB's CMP (946): (SEQ ID NO: 31) ACTGAAACGTTTTCATCGCTC Pglconfirm-F (SEQ ID NO: 27) 5'-ACCGCCAAAAGCGACTAATTTTAGCT-3'

Example 2

Improvement of Isoprene Production by Constitutive Expression of vbhE (Pgl) in E. coli

[0178] This example shows production of isoprene in a strain constitutively expressing E. coli vbhE (pgl) compared to a control strain expressing ybhE at wild-type levels (i.e., EWL256). The gene ybhE (pgl) encodes E. coli 6-phosphogluconolactonase that suppresses posttranslational gluconylation of heterologously expressed proteins and improves product solubility and yield while also improving biomass yield and flux through the pentose phosphate pathway (Aon et al., Applied and Environmental Microbiology 74(4):950-958, 2008).

i) Small Scale Analysis

[0179] Media Recipe (per liter fermentation media): K.sub.2HPO.sub.4 13.6 g. KH.sub.2PO.sub.4 13.6 g. MgSO.sub.4*7H.sub.2O 2 g, citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, (NH.sub.4).sub.2SO.sub.4 3.2 g, yeast extract 1 g, 1000.times. Trace Metals Solution 1 ml. All of the components were added together and dissolved in diH.sub.2O. The pH was adjusted to 6.8 with ammonium hydroxide (30%) and brought to volume. Media was filter-sterilized with a 0.22 micron filter. Glucose 5.0 g and antibiotics were added after sterilization and pH adjustment.

1000.times. Trace Metal Solution (per liter fermentation media): Citric Acid*H.sub.2O 40 g, MnSO.sub.4*H.sub.2O 30 g, NaCl 10 g, FeSO.sub.4*7H.sub.2O 1 g. CoCl.sub.6*H.sub.2O 1 g, ZnSO.sub.4 7H.sub.2O 1 g, CuSO.sub.4*5H.sub.2O 100 mg, H.sub.3BO.sub.3 100 mg. NaMoO.sub.4*2H.sub.2O 100 mg. Each component is dissolved one at a time in diH.sub.2O. The pH is adjusted to 3.0 with HCl/NaOH, and then the solution is brought to volume and filter-sterilized with a 0.22 micron filter.

(a) Experimental Procedure

[0180] Isoprene production was analyzed by growing the strains in a Cellerator.TM. from MicroReactor Technologies, Inc. The working volume in each of the 24 wells was 4.5 mL. The temperature was maintained at 30.degree. C., the pH setpoint was 7.0, the oxygen flow setpoint was 20 seem and the agitation rate was 800 rpm. An inoculum of E. coli strain taken from a frozen vial was streaked onto an LB broth agar plate (with antibiotics) and incubated at 30.degree. C. A single colony was inoculated into media with antibiotics and grown overnight. The bacteria were diluted into 4.5 mL of media with antibiotics to reach an optical density of 0.05 measured at 550 nm.

[0181] Off-gas analysis of isoprene was performed using a gas chromatograph-mass spectrometer (GC-MS) (Agilent) headspace assay. Sample preparation was as follows: 100 .mu.L of whole broth was placed in a sealed GC vial and incubated at 30.degree. C. for a fixed time of 30 minutes. Following a heat kill step, consisting of incubation at 70.degree. C. for 5 minutes, the sample was loaded on the GC.

[0182] Optical density (OD) at a wavelength of 550 nm was obtained using a microplate reader (Spectramax) during the course of the run. Specific productivity was obtained by dividing the isoprene concentration (.mu.g/L) by the OD reading and the time (hour).

[0183] The two strains EWL256 and RM111608-2 were assessed at 200 and 400 .mu.M IPTG induction levels. Samples were analyzed for isoprene production and cell growth (OID550) at 1, 2.5, 4.75, and 8 hours post-induction. Samples were done in duplicate.

(b) Results

[0184] The example demonstrated that at 2 different concentrations of IPTG the strain expressing the ybhE (pgl) had a dramatic 2-3 fold increase in specific productivity of isoprene compared to the control strain.

ii) Isoprene Fermentation from E. coli Expressing Cm-GI1.2-KKDyI, M. mazei Mevalonate Kinase, P. alba Isoprene Synthase, and ybhE (Pgl) (RM111608-2) and Grown in Fed-Batch Culture at the 15-L Scale

[0185] Medium Recipe (per liter fermentation medium): KZ1-HPO.sub.4 7.5 g. MgSO.sub.4*7H.sub.2O 2 g. citric acid monohydrate 2 g, ferric ammonium citrate 0.3 g, yeast extract 0.5 g, 1000.times. Modified Trace Metal Solution 1 ml. All of the components were added together and dissolved in diH.sub.2O. This solution was autoclaved. The pH was adjusted to 7.0 with ammonium hydroxide (30%) and q.s. to volume. Glucose 10 g, thiamine*HCl 0.1 g. and antibiotics were added after sterilization and pH adjustment.

[0186] 1000.times. Modified trace Metal Solution: Citric Acids*H.sub.2O 40 g, MnSO.sub.4*1H.sub.2O 30 g, NaCl 10 g, FeSO.sub.4*7H.sub.2O 1 g. CoCl.sub.2*6H.sub.2O 1 g, ZnSO.sub.4*7H.sub.2O 1 g, CuSO.sub.4*5H.sub.2O 100 mg, H.sub.3BO.sub.3 100 mg, NaMoO.sub.4*2H.sub.2O 100 mg. Each component is dissolved one at a time in Di H.sub.2O, pH to 3.0 with HCl/NaOH, then q.s. to volume and filter sterilized with a 0.22 micron filter

[0187] Fermentation was performed in a 15-L bioreactor with BL21 (DE3) E. coli cells containing the upper mevalonic acid (MVA) pathway (pCL Upper), the integrated lower MVA pathway (gi 1.2KKDyI), high expression of mevalonate kinase from M. mazei and isoprene synthase from P. alba (pTrcAlba-mMVK), and high expression of E. coli pgl (pBBR-pgl). This example was carried out to monitor isoprene formation from glucose at the desired fermentation pH 7.0 and temperature 34.degree. C. A frozen vial of the E. coli strain was thawed and inoculated into tryptone-yeast extract medium. After the inoculum grew to OD 1.0, measured at 550 nm, 500 mL was used to inoculate a 15-L bioreactor bringing the initial volume to 5-L.

[0188] Glucose was fed at an exponential rate until cells reached the stationary phase. After this time the glucose feed was decreased to meet metabolic demands. The total amount of glucose delivered to the bioreactor during the 40 hour (59 hour) fermentation was 3.1 kg (4.2 kg at 59 hour). Induction was achieved by adding IPTG. The IPTG concentration was brought to 110 .mu.M when the optical density at 550 nm (OD.sub.550) reached a value of 4. The IPTG concentration was raised to 192 .mu.M when OD.sub.550 reached 150. The OD.sub.550 profile within the bioreactor over time is shown in FIG. 14A. The isoprene level in the off gas from the bioreactor was determined using a Hiden mass spectrometer. The isoprene titer increased over the course of the fermentation to a maximum value of 33.2 g/L at 40 hours (48.6 g/L at 59 hours) (FIG. 14B). The isoprene titer increased over the course of the fermentation to a maximum value of 40.0 g/L at 40 hours (60.5 g/L at 59 hours) (FIG. 14C). The total amount of isoprene produced during the 40-hour (59-hour) fermentation was 281.3 g (451.0 g at 59 hours) and the time course of production is shown in FIG. 14D. The time course of volumetric productivity is shown in FIG. 14E and shows that an average rate of 1.0 g/L/hr was maintained between 0 and 40 hours (1.4 g/L/hour between 19 and 59 hour). The metabolic activity profile, as measured by CER, is shown in FIG. 14F. The molar yield of utilized carbon that went into producing isoprene during fermentation was 19.6% at 40 hours (23.6% at 59 hours). The weight percent yield of isoprene from glucose was 8.9% at 40 hours (10.7% at 59 hours).

Example 3

Recovery of Isoprene Produced from Renewable Resources

[0189] Isoprene was recovered from a set of four 15-L scale fermentations in a two-step operation involving stripping of isoprene from the fermentation off-gas stream by adsorption to activated carbon, followed by off-line steam desorption and condensation to give liquid bioisoprene (FIGS. 16A and 16B). The total amount of isoprene produced by the four fermentors was 1150 g (16.9 mol), of which 953 g (14 mol, 83%) was adsorbed by the carbon filters. Following the steam desorption/condensation step, the amount of liquid isoprene recovered was 810 g, corresponding to an overall recovery yield of 70%. The recovered isoprene was analyzed for the presence of impurities.

Analysis and Impurity Profile of Isoprene Liquid Produced from Renewable Resources

[0190] Recovered bioisoprene liquid was analyzed by GC/MS and gas chromatography/flame ionization detection (GC/FID) to determine the nature and levels of impurities. The product was determined to be >99.5% pure and contained several dominant impurities in addition to many minor components. The GC/FID chromatogram is depicted in FIG. 17, and the typical levels of impurities are shown in Table 2. The impurity profile was similar to other bioisoprene batches produced on this scale.

TABLE-US-00003 TABLE 2 Summary of the nature and levels of impurities seen in several batches of isoprene produced from renewable resources. Retention Time (min) Compound GC/MS GC/FID Conc. Range Ethanol 1.59 11.89 <50 ppm Acetone 1.624 12.673 <100 ppm Methacrolein 1.851 15.369 <200 ppm Methyl vinyl ketone 1.923 16.333 <20 ppm Ethyl acetate 2.037 17.145 100 to 800 ppm 3-Methyl-1,3- 2.27 18.875 50 to 500 ppm pentadiene Methyl vinyl oxirane 2.548 19.931 <100 ppm Isoprenol 2.962 21.583 <500 ppm 3-methyl-1-butanol 2.99 21.783 <50 ppm 3-hexen-1-ol 4.019 24.819 <100 ppm Isopentenyl acetate 4.466 25.733 200 to 1000 ppm 3-hexen-1-yl acetate 5.339 27.223 <400 ppm limonene 5.715 27.971 <500 ppm Other cyclics 5.50-6.50 27.5-28.0 <200 ppm

Purification of Isoprene Produced from Renewable Resources by Treatment with Adsorbents

[0191] Adsorbents are widely used by industry for the removal of trace impurities from hydrocarbon feedstocks. Suitable adsorbents include zeolite, alumina and silica-based materials. Isoprene can be substantially purified by passage over silica gel, and to a lesser extent with alumina. FIG. 18 shows the GC/FID chromatograms of an isoprene sample before (A) and after treatment with alumina (B) or silica (C). The Selexsorb.TM. adsorbent products from BASF is one of the adsorbents of choice for the removal of polar impurities from isoprene produced from renewable resources. Specifically, the Selexsorb CD and CDX products are preferred given their proven utility for removal of polar impurities from isoprene and butadiene feedstocks.

Example 4

Increased Production of Isoprene Gas Using a Membrane Bioreactor System

[0192] I. Construction of E. coli Strain CM P234

[0193] P1 transduction enables movement of up to 100 kb of DNA between bacterial strains (Thomason et al. 2007). A 17,257 bp deletion in E. coli BL21 (DE3) was replaced by moving a piece of the bacterial chromosome from E. coli K12 MG 1655 to E. coli BL21 (DE3) using P1 transduction.

[0194] Two strategies were used employing different selectable markers to identify colonies containing the recombined bacterial chromosome. First, we inserted an antibiotic marker in a gene close to the 17,257 bp sequence to be transferred, whose deletion was not likely to be detrimental to the strain. A strain containing that antibiotic marker will likely have the 17,257 bp piece of bacterial chromosome transduced at the same time as the marker. In this case, we inserted a gene encoding kanamycin resistance ("kan.sup.R") into the vbgS gene, encoding a 126 amino acid protein of unknown function. Second, since it is known that a number of genes involved in utilization of galactose are close to pgl in the 17,257 bp piece to be transduced into E. coli BL21 (DE3), colonies transduced with a P1 lysate obtained from E. coli K12 MG1655 (which contains the 17,257 bp sequence deleted in E. coli BL21 (DE3)) and isolated in M9 medium (6 g/L Na.sub.2HPO.sub.4, 3 g/L KH.sub.2PO.sub.4, 0.5 g/L NaCl, 0.5 g/L NH.sub.4Cl, 0.1 mM CaCl.sub.2, 2 mM MgSO.sub.4) containing 0.4% (w/v) galactose will likely contain the 17,257 bp piece of bacterial chromosome.

[0195] Primers MCM120 (SEQ ID NO:32) and MCM224 (SEQ ID NO:33) were used to amplify the chloramphenicol resistance ("Cm.sup.R") cassette from the GeneBridges FRT-gb2-Cm-FRT template using the Stratagene Herculase.TM. II Fusion kit (Agilent Technologies, Stratagene Products Division, La Jolla, Calif.) according to the manufacturer's protocol. Four 50 .mu.L PCR reactions were cycled as follows: 95.degree. C./2 minutes; 30 cycles of 95.degree. C./20 seconds, 55.degree. C./20 seconds, 72.degree. C./1 minute; and 72.degree. C./3 minutes. Reactions were then cooled to 4.degree. C. The four reactions were pooled, loaded onto a Qiagen PCR column according to the manufacturer's protocol and eluted with 60 .mu.L elution buffer ("EB") at 55.degree. C.

[0196] Plasmid pRedET-carbenicillin.sup.R (GeneBridges, Heidelberg, Germany) was electroporated into E. coli BL21 (DE3) strain MCM446 (Cm.sup.R, gi1.6mKKDyI A1-3) using standard procedures. Transformants were recovered by shaking for one hour in SOC medium at 30.degree. C. and then selected on LB+50 .mu.g/mL carbenicillin ("LB/carb50") plates at 30.degree. C. overnight. A carbenicillin-resistant colony was frozen as strain MCM508.

[0197] Strain MCM508 was grown from a fresh streak in 5 mL LB/carb50 at 30.degree. C. to an OD.sub.600 of .about.0.5. At that point, 40 mM L-arabinose was added, and the culture was incubated at 37.degree. C. for 1.5 hours. Cells were then harvested by centrifugation, electroporated with 3 .mu.L of purified amplicons as described above, and then recovered in 500 .mu.L SOC medium at 37.degree. C. for 1.5-3 hours. Transformants were selected on LB+10 .mu.g/mL kanamycin (LB/kan10) plates at 37.degree. C.

[0198] Recombination of the amplicon at the target locus was confirmed by PCR with primers GB-DW (SEQ ID NO:34) and MCM208 (SEQ ID NO:35). The resulting amplicons were sequenced to identify four clones having the sequences listed below. Four carbenicillin-sensitive clones were frozen as strains MCM518-MCM521.

[0199] Strains MCM518-MCM521 were re-streaked onto LB/kan10) and grown overnight at 37.degree. C. Colonies of strains MCM518-MCM521 were picked, cultured in LB/kan10 at 37.degree. C. and electrotransformed with plasmid pCP20, which encodes the yeast Flp recombinase, chloramphenicol and ampicillin resistance genes and confers temperature sensitive replication on host cells (Cherepanov, P. P. et al., Gene 158(1):9-14 (1995)). Cells were recovered in 500 .mu.L SOC medium by shaking at 30.degree. C. for 1 hour. Transformants were selected on LB/carb50 plates at 30.degree. C. overnight. The following morning a colony from each plate was grown at 30.degree. C. in LB/carb50 medium until visibly turbid. The culture was then shifted to 37.degree. C. for at least 3 hours. Cells were streaked from that culture onto LB plates and grown overnight at 37.degree. C.

[0200] The following day colonies were patched to LB, LB/carb50 and LB/kan10. Clones that were sensitive to both carbenicillin and kanamycin (i.e., which could not grow on carb50 and kan10) were cultured in liquid LB and frozen as strains MCM528-MCM531.

TABLE-US-00004 TABLE 3 E. coli strains Strain Description Parent MCM508 BL21 gi1.6-mKKDyI + predet.-carb MCM446 MCM518 BL21 neo-PL.6-mKKDyI, clone 10 MCM508 MCM519 BL21 neo-PL.0-mKKDyI, clone 11 MCM508 MCM520 BL21 neo-PL.0-mKKDyI (bad RBS in MCM508 front of mMVK), clone 13 MCM521 BL21 neo-PL.2-mKKDyI, clone 15 MCM508 MCM528 BL21 PL.6-mKKDyI, neo.sup.R looped out MCM518 MCM529 BL21 PL.0-mKKDyI, neo.sup.R looped out MCM519 MCM530 BL21 PL.0-mKKDyI (bad RBS in MCM520 front of mMVK), neo.sup.R looped out MCM531 BL21 PL.2-mKKDyI, neo.sup.R looped out MCM521

TABLE-US-00005 TABLE 4 Primer sequences Primer name Sequence(5' .fwdarw. 3') MCM120 aaagtagccgaagatgacggtttgtcacatggagttggcaggat gtttgattaaaagcAATTAACCCTCACTAAAGGGCGG (SEQ ID NO: 32) MCM224 taaatcttacccggcgcagaacaggataccatgtttttttacct cctttgcaccttcatggtggtcagtgcgtcctgctgatgtgctc agtatcaccgccagtggtatttaNgtcaacaccgccagagata atttatcaccgcagatggttatctgtatgttttttatatgaatt taatacgactcactatagggctcg (SEQ ID NO: 33) GB-DW aaagaccgaccaagcgacgtctga (SEQ ID NO: 34) MCM208 GCTCTGAATAGTGATAGAGTCA (SEQ ID NO: 35)

[0201] The assemblies integrated into the chromosomes of strains MCM518-MCM521 include new P.sub.L promoters derived from bacteriophage lambda (.lamda.) and the very beginning of the mMVK ORF, with sequences from the Gene Bridges FRT-gb2-Cm-FRT cassette integrated upstream of the promoter/mMVK assembly, as well as the remainder of the mMVK ORF followed by the rest of the lower MVA pathway integron from strain MCM508.

[0202] Promoter/mMVK sequence integrated into MCM518 (SEQ ID NO:36):

TABLE-US-00006 aaagaccgaccaagcgacgtctgagagctccctggcgaattcggtaccaa taaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgc ggaagttcctattctctagaaagtataggaacttcctcgagccctatagt gagtcgtattaaattcatataaaaaacatacagataaccatctgcggtga taaattatctctggcggtgttgacataaataccactggcggtgatactga gcacatcagcaggacgcactgaccaccatgaaggtgcaaaggaggtaaaa aaacatggtatcctgttctgcgccgggtaagatttacctgttcggtgaac acgccgtagtttatggcgaaactgcaattgcgtgtgcggtggaactgcgt acccgtgttcgcgcggaactcaatgactctatcactattcagagc

[0203] Promoter/mMVK sequence integrated into MCM519 (SEQ ID NO:37):

TABLE-US-00007 aaagaccgaccaagcgacgtctgagagctccctggcgaattcggtaccaa taaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgc ggaagttcctattctctagaaagtataggaacttcctcgagccctatagt gagtcgtattaaattcatataaaaaacatacagataaccatctgcggtga taaattatctctggcggtgttgacctaaataccactggcggtgatactga gcacatcagcaggacgcactgaccaccatgaaggtgcaaaggaggtaaaa aaacatggtatcctgttctgcgccgggtaagatttacctgttcggtgaac acgccgtagtttatggcgaaactgcaattgcgtgtgcggtggaactgcgt acccgtgttcgcgcggaactcaatgactctatcactattcagagc

[0204] Promoter/mMVK sequence integrated into MCM520 (SEQ ID NO:38):

TABLE-US-00008 aaagaccgaccaagcgacgtctgagagctccctggcgaattcggtaccaa taaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgc ggaagttcctattctctagaaagtataggaacttcctcgagccctatagt gagtcgtattaaattcatataaaaaacatacagataaccatctgcggtga taaattatctctggcggtgttgacctaaataccactggcggtgatactga gcacatcagcaggacgcactgaccaccatgaaggtgcaaaggtaaaaaaa catggtatcctgttctgcgccgggtaagatttacctgttcggtgaacacg ccgtagtttatggcgaaactgcaattgcgtgtgcggtggaactgcgtacc cgtgttcgcgcggaactcaatgactctatcactattcagagc

[0205] Promoter/mMVK sequence integrated into MCM521 (SEQ ID NO:39):

TABLE-US-00009 aaagaccgaccaagcgacgtctgagagctccctggcgaattcggtaccaa taaaagagctttattttcatgatctgtgtgttggtttttgtgtgcggcgc ggaagttcctattctctagaaagtataggaacttcctcgagccctatagt gagtcgtattaaattcatataaaaaacatacagataaccatctgcggtga taaattatctctggcggtgttgacgtaaataccactggcggtgatactga gcacatcagcaggacgcactgaccaccatgaaggtgcaaaggaggtaaaa aaacatggtatcctgttctgcgccgggtaagatttacctgttcggtgaac acgccgtagtttatggcgaaactgcaattgcgtgtgcggtggaactgcgt acccgtgttcgcgcggaactcaatgactctatcactattcagagc

[0206] Next, E. coli strain DW199, an isoprene-producing E. coli strain harboring the truncated version of P. alba isoprene synthase (the MEA variant) under control of the PTrc promoter, was constructed.

[0207] The plasmid harboring truncated P. alba isoprene synthase (IspS) was constructed by Quikchange.TM. (Agilent Technologies, Stratagene Products Division, La Jolla, Calif.) PCR mutagenesis from the template pEWL244 (also referred to as pTrc-P. alba(MEA)-mMVK (the construction of which is described in Example 10 of U.S. patent application Ser. No. 12/335,071, which is incorporated herein by reference in its entirety). The PCR reaction contained the following components: 1 .mu.l pEWL244 (encoding pTrc P. alba-mMVK), 5 .mu.l 10.mu. PfuUltra High Fidelity buffer, 1 .mu.l 100 mM dNTPs, 1 .mu.l 50 .mu.M QC EWL244 MEA F primer (SEQ ID NO: 40), 1 .mu.l 50 .mu.M QC EWL244 MEA R primer (SEQ ID NO:41), 2 .mu.l DMSO, 1 .mu.l PfuUltra High Fidelity polymerase (Agilent Technologies, Stratagene Products Division, La Jolla, Calif.), and 39 .mu.l diH.sub.2O. The PCR reaction was cycled as follows: 95.degree. C./1 minute; and 18 cycles of 95.degree. C./30 seconds, 55.degree. C./1 minute, 68.degree. C./7.3 minutes. The reaction was then cooled to 4.degree. C.

[0208] The PCR product was visualized by gel electrophoresis using an E-gel (Invitrogen, Carlsbad, Calif.), and then treated with 1 .mu.l DpnI restriction endonuclease (Roche. South San Francisco, Calif.) for three hours at 37.degree. C. Ten .mu.l of the PCR product were then de-salted using a microdialysis membrane (MilliPore, Billerica, Mass.) and transformed into electrocompetent E. coli strain MCM531 (prepared as described above) using standard molecular biology techniques. Cells were recovered in one ml of LB medium for 1.5 hours at 30.degree. C., plated onto LB-agar plates containing 50 .mu.g/ml carbenicillin and 5 mM mevalonic acid, and then incubated overnight at 37.degree. C. The next day, positive colonies (of strain DW 195, see below) were selected for growth, plasmid purification (Qiagen, Valencia, Calif.), confirmed by DNA sequencing (Quintara Biosciences. Berkeley, Calif.) with the primers listed below. The final plasmid, pDW34 (FIG. 19A-D; SEQ ID NO: 156), was confirmed to carry the open reading frame that encodes the truncated version of P. alba IspS.

[0209] Strain DW199 was generated by transformation of pDW34 and MCM82 (the construction of which is described in Example 8 of U.S. patent application Ser. No. 12/335,071, which is incorporated herein by reference in its entirety) into electrocompetent MCM531 (prepared as described above). Cells were recovered in 1 ml of LB medium for 1 hour at 37.degree. C., plated on LB agar plates containing 50 .mu.g/ml spectinomycin and 50 .mu.g/ml carbenicillin, and then incubated overnight at 37.degree. C. The next day, antibiotic resistant colonies of strain DW 199 were chosen for further study.

TABLE-US-00010 TABLE 5 Primers Primer Name Sequence(5' .fwdarw. 3') QC EWL244 gaggaataaaccatggaagctcgtcgttct MEA F (SEQ ID NO: 40) QC EWL244 agaacgacgagcttccatggtttattcctc MEA R (SEQ ID NO: 41) EL-1006 gacagcttatcatcgactgcacg (SEQ ID NO: 42) EL-1000 gcactgtctttccgtctgctgc (SEQ ID NO: 43) A-rev ctcgtacaggctcaggatag (SEQ ID NO: 44) A-rev-2 ttacgtcccaacgctcaact (SEQ ID NO: 45) QB1493 cttcggcaacgcatggaaat (SEQ ID NO: 46) MCM208 gctctgaatagtgatagagtca (SEQ ID NO: 35) MCM66 ccaggcaaattctgttttatcag (SEQ ID NO: 47) (aka pTrc Reverse)

TABLE-US-00011 TABLE 6 Strains Strain Background Plasmid Resistance Genotype DW195 MCM531 pDW34 Carb BL21 (Novagen) PL.2mKKDyI, pTrc-P. alba(MEA)-mMVK DW199 MCM531 pDW34 Carb/Spec BL21 (Novagen) MCM82 PL.2mKKDyI, pTrc-P. alba(MEA)-mMVK, pCL pTrc-Upper

[0210] This example describes the construction of E. coli strains CMP215, CMP258, and CMP234, all of which are derived from BL21 transduced with P1 phage containing E. coli MG1655 genomic DNA and selected for recombination of a 17.257 bp piece present in MG 1655 but absent in BL21 and BL21 (DE3).

[0211] A P1 lysate was made of strain JW0736, in which the ybgS gene was replaced with a kanamycin resistance gene ("Kan.sup.R")(i.e., ybgS::Kan.sup.R mutation) from the Keio collection (Baba et al. 2006). That lysate was used to infect strain MCM531 (described above), producing strain CMP215. The genotype of CMP215 was confirmed by PCR using primers galM R (5'-GTC AGG CTG GAA TAC TCT TCG-3': SEQ ID NO:9) and galM F (5'-GAC GCT TITC GCC AAG TCA GG-3'; SEQ ID NO:8). Those primers anneal to the galM gene, as shown on FIG. 20, but only produce a PCR product from E. coli BL21 (DE3) chromosomal DNA having the 17,257 bp deletion.

[0212] Integration of the 17,257 bp fragment following P1 transduction was verified by PCR with the following protocol. One bacterial colony was stirred in 30 .mu.l H.sub.2O and heated to 95.degree. C. for 5 minutes. The resulting solution was spun down and 2 .mu.l of the supernatant used as template in the following PCR reaction: 2 .mu.l colony in H.sub.2O, 5 .mu.l Herculase.RTM. Buffer, 1 .mu.l 100 mM dNTPs, 1 .mu.l 10 .mu.M Forward primer, 1 .mu.l 10 .mu.M Reverse primer, 0.5 .mu.l of Herculase.RTM. Enhanced DNA Polymerase (Agilent Technologies, Stratagene Products Division, La Jolla, Calif.), and 39.5 .mu.l diH.sub.2O. The PCR reaction was cycled in a PCR Express Thermal Cycler (Thermo Hybaid, Franklin, Mass.) as follows: 95.degree. C./2 minutes; 30 cycles of 95.degree. C./30 seconds, 52.degree. C./30 seconds, 72.degree. C./60 seconds; and 72 C/17 minutes. The reaction was then cooled to 4.degree. C. The annealing temperature of 52.degree. C. was 3.degree. C. lower than the lower T.sup.m of the primer pair. The size of the resulting PCR fragment was determined on a pre-cast 0.8% E-gel.RTM. (Invitrogen. Carlsbad, Calif.), using DNA Molecular Weight Marker X (75-12,216 bp)(Roche Diagnostics, Mannheim, Germany) as size marker. Successful transduction was also confirmed by the ability of strain CMP215 to grow on galactose.

[0213] Alternatively, a lysate of E. coli MG 1655 was used to transduce strain MCM531 (described above). A colony selected on M9 medium supplemented with 0.4% (w/v) galactose was named CMP258. Presence of the 17,257 bp region containing pgl was confirmed by PCR using primers galM R (SEQ ID NO:9) and galM F (SEQ ID NO:8), essentially as described above.

[0214] Strain CMP215 was cotransformed by electroporation with plasmids pCLPtrcUpperPathway expressing mvaE and mvaS (prepared as described in Example 8 of U.S. patent application Ser. No. 12/335,071, which is incorporated herein by reference in its entirety) and pDW34 (containing a truncated P. alba isoprene synthase and M. mazei mevalonate kinase, as described above). Transformants were selected on LB agar plates including 50 .mu.g/ml carbenicillin+50 .mu.g/ml spectinomycin. One colony was picked and named CMP234.

[0215] II. Fermentation Using an MBR Increases Isoprene Production

[0216] Increased production of isoprene: 15 L fed-batch fermentation with E. coli strain CMP234 in a membrane bioreactor system. E. coli BL21 (DE3) strain CMP234 (constructed as described above) overexpresses M. mazei mevalonate kinase and P. alba isoprene synthase and contains an integrated copy of 6-phosphogluconolactonase (PGL) derived from E. coli K12 strain MG 1655. Isoprene was produced by CMP234 cells grown in fed-batch culture at 15-L scale in a membrane bioreactor (MBR) in minimal medium.

[0217] Medium Recipe (Per L):

[0218] 7.5 g K.sub.2HPO.sub.4, 2 g MgSO.sub.4*7H.sub.2O, 2 g citric acid monohydrate, 0.3 g ferric ammonium citrate, 0.5 g yeast extract, and 1 mL 1000.times. Modified Trace Metal Solution (recipe below) were dissolved together in distilled, deionized water (diH.sub.2O) and heat-sterilized at 123.degree. C. for 20 minutes. The pH was adjusted to 7.0 with 28% ammonium hydroxide brought up to final volume with sterile water. 10 g glucose, 8 mL Vitamin Solution (recipe below) and appropriate antibiotics were added after sterilization and pH adjustment.

[0219] 1000.times. Modified Trace Metal Solution (Per L):

[0220] 40 g Citric Acid*H.sub.2O z, 30 g MnSO.sub.4*H.sub.2O, 10 g NaCl, 1 g FeSO.sub.4*7H.sub.2O, 1 g CoCl.sub.2*6H.sub.2O, 1 g ZnSO.sub.4*7H.sub.2O, 100 mg CuSO.sub.4*5H.sub.2O, 100 mg H.sub.3BO.sub.3, and 100 mg NaMoO.sub.4*2H.sub.2O were dissolved one at a time in diH.sub.2O. The pH was adjusted to 3.0 with HCl/NaOH, and the solution was brought up to final volume and sterilized using a 0.22-.mu.m filter.

[0221] Vitamin Solution (Per L):

[0222] 1 g Thiamine hydrochloride, 1 g D-(+)-biotin, 1 g nicotinic acid, 4.8 g D-pantothenic acid, and 4.0 g pyridoxine hydrochloride were dissolved one at a time in diH.sub.2O. The pH was adjusted to 3.0 with HCl/NaOH, and the solution was brought up to final volume and sterilized using a 0.22-.mu.m filter.

[0223] Macro Salt Solution (Per L):

[0224] 296 g MgSO.sub.4*7O, 296 g citric acid monohydrate, and 49.6 g ferric ammonium citrate were dissolved together in water, brought up to final volume, and sterilized using a 0.22 .mu.m filter.

[0225] Glucose Feed Solution (Per Kg):

[0226] 0.57 kg Glucose, 0.38 kg diH.sub.2O, 7.5 g K.sub.2HPO.sub.4, and 10 g 100% Foamblast were mixed together and autoclaved. 5.6 mL, Macro Salt Solution, 0.8 mL 1000.times. Modified Trace Metal Solution, and 6.7 mL Vitamin Solution were added after the solution had cooled to 25.degree. C.

[0227] Fermentation was performed in a 15-L bioreactor with E. coli BL21 cells expressing the upper mevalonic acid (MVA) pathway (pCL Upper), the integrated lower MVA pathway (PL.2 mKKDyI), mevalonate kinase from M. mazei and truncated isoprene synthase from P. alba (pTrcAlba (MEA) mMVK (pDW34)), and containing a restored chromosomal pgl gene (t ybgS::Kan) (strain name CMP234).

[0228] This example was carried out to monitor isoprene formation from glucose at the desired fermentation pH 7.0 and temperature 34.degree. C. in an MBR, using a separate "non-MBR" membrane-free reactor as a control. A frozen vial of E. coli BL21 strain CMP234 was thawed and inoculated into tryptone-yeast extract medium for each reactor. After the inoculum grew to optical density 1.0, measured at 550 nm (OD), 500 mL was used to inoculate a 15-L reactor and bring the initial tank volume to 5 L.

[0229] FIG. 21 shows a membrane bioreactor including a tangential flow filter set up with a 15-L bioreactor growing E. coli strain CMP234. FIG. 22 shows the operational parameters of an MBR during a 15-L scale fermentation run.

[0230] The feed solution was added at an exponential rate until a top feed rate of 6.4 g/minute was reached. Glucose was then fed to meet metabolic demands at rates less than or equal to 6.4 g/minute. The total amount of glucose delivered to the MBR reactor during the 88 h fermentation was 9.2 kg, compared to 8.4 kg of glucose delivered to the non-MBR control reactor. Induction of protein expression was achieved by adding isopropyl-beta-D-1-thiogalactopyranoside (IPTG). The IPTG concentration was brought to 110 .mu.M when the OD reached 5 and raised to 200 .mu.M when the OD reached 100.

[0231] Clarified fermentation broth (permeate) was removed using the MBR (FIG. 21) starting at 30 hours of fermentation in amounts necessary to maintain reactor weight at 9.7 kg (FIG. 28; 7.8 kg permeate removed in 88 hours of fermentation). Whole broth including cells was removed starting at 30 hours of fermentation from the non-MBR control reactor in amounts necessary to maintain reactor weight at 9.7 kg (FIG. 28; 6.6 kg whole broth removed in 88 hours of fermentation). OD profiles within the MBR and non-MBR reactors over time are shown in FIG. 23.

[0232] The isoprene level in reactor off-gas was determined using a Hiden mass spectrometer. Isoprene titer increased during fermentation to 100.5 g/L at 88 hours in the MBR and to 84.3 g/L in the non-MBR control (FIG. 25). Total isoprene produced during the 88 hour fermentation was 843.9 g in the MBR, compared to 721.0 g in the non-MBR control. The time course of production is shown in FIG. 26. The time course of specific productivity shows very similar profiles for both reactors: the MBR did not seem to dramatically alter cell physiology (FIG. 24). The molar yield of isoprene from glucose carbon during fermentation was 20.1% at 88 hours in the MBR, compared to 18.8% at 88 hours in the non-MBR control. The weight-% yield of isoprene from glucose was 9.3% at 88 hours in the MBR, compared to 8.7% at 88 hours in the non-MBR control.

[0233] Isoprene evolution rate, isoprene titer, total isoprene, volumetric productivity, and specific productivity were calculated according to the equations below.

HGER = Airflow OffgasN 2 Supply N 2 OffgasHG ( 60 min / h ) ( 100 % 24.14 ) 1.05` Ferm Wt ##EQU00001## Isoprene Titer = 68.117 .intg. ( HGER ) t ##EQU00001.2## Total Isoprene = .intg. ( Airflow HG .mu.g / L 60 min / h 1 g / 1000000 .mu.g ) t ##EQU00001.3## VolProd = t ( Isoprene Titer ) .apprxeq. ( Isoprene Titer ) n + 1 - ( Isoprene Titer ) n - 1 ( t ) n + 1 - ( t ) n - 1 ##EQU00001.4## SpProd = VolProd 1000 mg / g 2.7 OD ##EQU00001.5##

where

[0234] HGER=total isoprene evolution rate per vol. broth[=] mol/L/h

[0235] Airflow=air flow rate into reactor [=] std L/min

[0236] Offgas N2=nitrogen conc. in reactor off-gas [=] mol %

[0237] Supply N2=nitrogen conc. in air entering reactor [=] mol %

[0238] Offgas HG=isoprene conc. in reactor off-gas [=] mol %

[0239] 24.14=ideal gas conversion at 1 atm, 21.1.degree. C. [=] L/mol

[0240] 1.05=broth density [=] kg/L

[0241] Ferm Wt=reactor broth wt [=] kg

[0242] Isoprene Titer=isoprene produced on a broth volume basis [=] g/L

[0243] t=time [=] h

[0244] n=time interval designation [=] unitless

[0245] 68.117=isoprene molecular wt [=] g/mol

[0246] Total Isoprene=total isoprene produced [=] g

[0247] HG .mu.g/L=isoprene conc. in reactor off-gas [=] g/L

[0248] Vol Prod=isoprene volumetric productivity [=] g/L/h

[0249] Sp Prod=isoprene specific productivity [=] mg isopr/g cell/h

[0250] OD=optical density of broth at 550 nm [=] abs. unit

[0251] 2.7=empirical conversion of OD to cell conc. [=] abs. unit.circle-w/dot.L/g cell

and where integrals may be estimated by the trapezoidal rule.

Example 5

Recycled Permeate from an MBR Improves Isoprene Specific Productivity

[0252] Recycling Permeate from MBR.

[0253] Medium from 15-L scale fermentations of the isoprene producing E. coli strain DW202 (strain DW199 (produced as described above)+pBBR gi1.5-pgl (produced as described above)), carrying the MVA pathway (upper MVA pathway from E. faecalis and integrated lower MVA pathway from S. cerevisiae, plus MVK from M. mazei) and isoprene synthase (from P. alba), was isolated from the bioreactors 38 hours after inoculation. 15-L scale fermentations were performed as described above. Cell mass was quickly removed by centrifugation. The remaining medium (analogous to permeate) was ultracentrifuged at 50,000 rpm for 30 minutes at 4.degree. C. to ensure that all solids were removed. The resulting clarified, spent medium was diluted into fresh TM3 minimal medium at concentrations ranging from 0 to 30%.

[0254] The E. coli strain MCM597 (E. coli BL21 (DE3) pLysS expressing a truncated version of P. alba isoprene synthase (the MEA variant). E. coli DXS and S. cerevisiae IDI (prepared as described in Example 7 of U.S. patent application Ser. No. 12/335,071, which is hereby incorporated herein by reference in its entirety) was grown overnight and inoculated in the medium. Protein expression in strain MCM597 was induced with 200 .mu.M IPTG and the induced strain was grown at 30.degree. C. in a microfermentor. Culture growth (i.e., cell mass) was followed by measuring optical density at 600 nm using a plate reader. Isoprene production was followed by GC analysis of 100 .mu.L headspace samples taken at 4 hours after inoculation. Specific productivity was calculated as the isoprene production divided by the optical density.

[0255] A greater than three-fold increase in isoprene specific productivity was achieved by supplementing the culture medium with 30% (w/w) of spent media (i.e., permeate), despite about 25% less growth (FIG. 29). A higher specific productivity means that more isoprene is produced per cell mass per time. The result suggests that MBR permeate containing spent medium can be used to enhance specific productivity of isoprene-producing cells, thereby reducing production costs.

[0256] The headings provided herein are not limitations of the various aspects or aspects of the invention which can be had by reference to the specification as a whole.

[0257] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 47 <210> SEQ ID NO 1 <211> LENGTH: 6957 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600 tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660 actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720 gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780 aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840 agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900 cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960 aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020 tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080 tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140 taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200 ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260 tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320 tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380 cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440 cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500 gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560 gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620 agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680 aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740 agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800 cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860 accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920 aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980 ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040 cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100 gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160 tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220 agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280 tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340 caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400 ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460 gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520 gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580 gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640 aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700 ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760 acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820 ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880 tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940 tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000 cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060 gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120 ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180 catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240 ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300 gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360 gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420 ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480 atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540 cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600 tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660 ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720 aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780 atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840 cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900 gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960 tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020 agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080 gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140 ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200 catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260 tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320 tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380 gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440 ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500 tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560 catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620 cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680 tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740 ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800 ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860 cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920 gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980 aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040 ttttgtttaa ctttaagaag gagatataca tatgcgttgt agcgtgtcca ccgaaaatgt 5100 gtctttcacc gaaactgaaa ccgaagctcg tcgttctgcg aactacgaac ctaacagctg 5160 ggactatgat tacctgctgt cctccgacac ggacgagtcc atcgaagtat acaaagacaa 5220 agcgaaaaag ctggaagccg aagttcgtcg cgagattaat aacgaaaaag cagaatttct 5280 gaccctgctg gaactgattg acaacgtcca gcgcctgggc ctgggttacc gtttcgagtc 5340 tgatatccgt ggtgcgctgg atcgcttcgt ttcctccggc ggcttcgatg cggtaaccaa 5400 gacttccctg cacggtacgg cactgtcttt ccgtctgctg cgtcaacacg gttttgaggt 5460 ttctcaggaa gcgttcagcg gcttcaaaga ccaaaacggc aacttcctgg agaacctgaa 5520 ggaagatatc aaagctatcc tgagcctgta cgaggccagc ttcctggctc tggaaggcga 5580 aaacatcctg gacgaggcga aggttttcgc aatctctcat ctgaaagaac tgtctgaaga 5640 aaagatcggt aaagagctgg cagaacaggt gaaccatgca ctggaactgc cactgcatcg 5700 ccgtactcag cgtctggaag cagtatggtc tatcgaggcc taccgtaaaa aggaggacgc 5760 gaatcaggtt ctgctggagc tggcaattct ggattacaac atgatccagt ctgtatacca 5820 gcgtgatctg cgtgaaacgt cccgttggtg gcgtcgtgtg ggtctggcga ccaaactgca 5880 ctttgctcgt gaccgcctga ttgagagctt ctactgggcc gtgggtgtag cattcgaacc 5940 gcaatactcc gactgccgta actccgtcgc aaaaatgttt tctttcgtaa ccattatcga 6000 cgatatctac gatgtatacg gcaccctgga cgaactggag ctgtttactg atgcagttga 6060 gcgttgggac gtaaacgcca tcaacgacct gccggattac atgaaactgt gctttctggc 6120 tctgtataac actattaacg aaatcgccta cgacaacctg aaagataaag gtgagaacat 6180 cctgccgtat ctgaccaaag cctgggctga cctgtgcaac gctttcctgc aagaagccaa 6240 gtggctgtac aacaaatcta ctccgacctt tgacgactac ttcggcaacg catggaaatc 6300 ctcttctggc ccgctgcaac tggtgttcgc ttacttcgct gtcgtgcaga acattaaaaa 6360 ggaagagatc gaaaacctgc aaaaatacca tgacaccatc tctcgtcctt cccatatctt 6420 ccgtctgtgc aatgacctgg ctagcgcgtc tgcggaaatt gcgcgtggtg aaaccgcaaa 6480 tagcgtttct tgttacatgc gcactaaagg tatctccgaa gaactggcta ccgaaagcgt 6540 gatgaatctg atcgatgaaa cctggaaaaa gatgaacaag gaaaaactgg gtggtagcct 6600 gttcgcgaaa ccgttcgtgg aaaccgcgat caacctggca cgtcaatctc actgcactta 6660 tcataacggc gacgcgcata cctctccgga tgagctgacc cgcaaacgcg ttctgtctgt 6720 aatcactgaa ccgattctgc cgtttgaacg ctaaggatcc gaattcgagc tccgtcgaca 6780 agcttgcggc cgcactcgag caccaccacc accaccactg agatccggct gctaacaaag 6840 cccgaaagga agctgagttg gctgctgcca ccgctgagca ataactagca taaccccttg 6900 gggcctctaa acgggtcttg aggggttttt tgctgaaagg aggaactata tccggat 6957 <210> SEQ ID NO 2 <211> LENGTH: 6068 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 2 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240 taacaatttc acacaggaaa cagcgccgct gagaaaaagc gaagcggcac tgctctttaa 300 caatttatca gacaatctgt gtgggcactc gaccggaatt atcgattaac tttattatta 360 aaaattaaag aggtatatat taatgtatcg attaaataag gaggaataaa ccatgagatg 420 tagcgtgtcc accgaaaatg tgtctttcac cgaaactgaa accgaagctc gtcgttctgc 480 gaactacgaa cctaacagct gggactatga ttacctgctg tcctccgaca cggacgagtc 540 catcgaagta tacaaagaca aagcgaaaaa gctggaagcc gaagttcgtc gcgagattaa 600 taacgaaaaa gcagaatttc tgaccctgct ggaactgatt gacaacgtcc agcgcctggg 660 cctgggttac cgtttcgagt ctgatatccg tggtgcgctg gatcgcttcg tttcctccgg 720 cggcttcgat gcggtaacca agacttccct gcacggtacg gcactgtctt tccgtctgct 780 gcgtcaacac ggttttgagg tttctcagga agcgttcagc ggcttcaaag accaaaacgg 840 caacttcctg gagaacctga aggaagatat caaagctatc ctgagcctgt acgaggccag 900 cttcctggct ctggaaggcg aaaacatcct ggacgaggcg aaggttttcg caatctctca 960 tctgaaagaa ctgtctgaag aaaagatcgg taaagagctg gcagaacagg tgaaccatgc 1020 actggaactg ccactgcatc gccgtactca gcgtctggaa gcagtatggt ctatcgaggc 1080 ctaccgtaaa aaggaggacg cgaatcaggt tctgctggag ctggcaattc tggattacaa 1140 catgatccag tctgtatacc agcgtgatct gcgtgaaacg tcccgttggt ggcgtcgtgt 1200 gggtctggcg accaaactgc actttgctcg tgaccgcctg attgagagct tctactgggc 1260 cgtgggtgta gcattcgaac cgcaatactc cgactgccgt aactccgtcg caaaaatgtt 1320 ttctttcgta accattatcg acgatatcta cgatgtatac ggcaccctgg acgaactgga 1380 gctgtttact gatgcagttg agcgttggga cgtaaacgcc atcaacgacc tgccggatta 1440 catgaaactg tgctttctgg ctctgtataa cactattaac gaaatcgcct acgacaacct 1500 gaaagataaa ggtgagaaca tcctgccgta tctgaccaaa gcctgggctg acctgtgcaa 1560 cgctttcctg caagaagcca agtggctgta caacaaatct actccgacct ttgacgacta 1620 cttcggcaac gcatggaaat cctcttctgg cccgctgcaa ctggtgttcg cttacttcgc 1680 tgtcgtgcag aacattaaaa aggaagagat cgaaaacctg caaaaatacc atgacaccat 1740 ctctcgtcct tcccatatct tccgtctgtg caatgacctg gctagcgcgt ctgcggaaat 1800 tgcgcgtggt gaaaccgcaa atagcgtttc ttgttacatg cgcactaaag gtatctccga 1860 agaactggct accgaaagcg tgatgaatct gatcgatgaa acctggaaaa agatgaacaa 1920 ggaaaaactg ggtggtagcc tgttcgcgaa accgttcgtg gaaaccgcga tcaacctggc 1980 acgtcaatct cactgcactt atcataacgg cgacgcgcat acctctccgg atgagctgac 2040 ccgcaaacgc gttctgtctg taatcactga accgattctg ccgtttgaac gctaactgca 2100 gctggtacca tatgggaatt cgaagctttc tagaacaaaa actcatctca gaagaggatc 2160 tgaatagcgc cgtcgaccat catcatcatc atcattgagt ttaaacggtc tccagcttgg 2220 ctgttttggc ggatgagaga agattttcag cctgatacag attaaatcag aacgcagaag 2280 cggtctgata aaacagaatt tgcctggcgg cagtagcgcg gtggtcccac ctgaccccat 2340 gccgaactca gaagtgaaac gccgtagcgc cgatggtagt gtggggtctc cccatgcgag 2400 agtagggaac tgccaggcat caaataaaac gaaaggctca gtcgaaagac tgggcctttc 2460 gttttatctg ttgtttgtcg gtgaacgctc tcctgagtag gacaaatccg ccgggagcgg 2520 atttgaacgt tgcgaagcaa cggcccggag ggtggcgggc aggacgcccg ccataaactg 2580 ccaggcatca aattaagcag aaggccatcc tgacggatgg cctttttgcg tttctacaaa 2640 ctctttttgt ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc 2700 ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt 2760 cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct 2820 ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga 2880 tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag 2940 cacttttaaa gttctgctat gtggcgcggt attatcccgt gttgacgccg ggcaagagca 3000 actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga 3060 aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag 3120 tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc 3180 ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa 3240 tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt 3300 gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg 3360 gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt 3420 tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg cagcactggg 3480 gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat 3540 ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact 3600 gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa 3660 aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt 3720 ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt 3780 ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg 3840 tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca 3900 gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt 3960 agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga 4020 taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc 4080 gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact 4140 gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga 4200 caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg 4260 aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt 4320 tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt 4380 acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga 4440 ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac 4500 gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcctgatgc ggtattttct 4560 ccttacgcat ctgtgcggta tttcacaccg catatggtgc actctcagta caatctgctc 4620 tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg ggtcatggct 4680 gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca 4740 tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg 4800 tcatcaccga aacgcgcgag gcagcagatc aattcgcgcg cgaaggcgaa gcggcatgca 4860 tttacgttga caccatcgaa tggtgcaaaa cctttcgcgg tatggcatga tagcgcccgg 4920 aagagagtca attcagggtg gtgaatgtga aaccagtaac gttatacgat gtcgcagagt 4980 atgccggtgt ctcttatcag accgtttccc gcgtggtgaa ccaggccagc cacgtttctg 5040 cgaaaacgcg ggaaaaagtg gaagcggcga tggcggagct gaattacatt cccaaccgcg 5100 tggcacaaca actggcgggc aaacagtcgt tgctgattgg cgttgccacc tccagtctgg 5160 ccctgcacgc gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat caactgggtg 5220 ccagcgtggt ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa gcggcggtgc 5280 acaatcttct cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg gatgaccagg 5340 atgccattgc tgtggaagct gcctgcacta atgttccggc gttatttctt gatgtctctg 5400 accagacacc catcaacagt attattttct cccatgaaga cggtacgcga ctgggcgtgg 5460 agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg 5520 tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc 5580 cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa 5640 tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg 5700 gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg 5760 gatacgacga taccgaagac agctcatgtt atatcccgcc gtcaaccacc atcaaacagg 5820 attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg 5880 cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc 5940 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 6000 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagcgcgaa 6060 ttgatctg 6068 <210> SEQ ID NO 3 <211> LENGTH: 6906 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 3 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240 taacaatttc acacaggaaa cagcgccgct gagaaaaagc gaagcggcac tgctctttaa 300 caatttatca gacaatctgt gtgggcactc gaccggaatt atcgattaac tttattatta 360 aaaattaaag aggtatatat taatgtatcg attaaataag gaggaataaa ccatgagatg 420 tagcgtgtcc accgaaaatg tgtctttcac cgaaactgaa accgaagctc gtcgttctgc 480 gaactacgaa cctaacagct gggactatga ttacctgctg tcctccgaca cggacgagtc 540 catcgaagta tacaaagaca aagcgaaaaa gctggaagcc gaagttcgtc gcgagattaa 600 taacgaaaaa gcagaatttc tgaccctgct ggaactgatt gacaacgtcc agcgcctggg 660 cctgggttac cgtttcgagt ctgatatccg tggtgcgctg gatcgcttcg tttcctccgg 720 cggcttcgat gcggtaacca agacttccct gcacggtacg gcactgtctt tccgtctgct 780 gcgtcaacac ggttttgagg tttctcagga agcgttcagc ggcttcaaag accaaaacgg 840 caacttcctg gagaacctga aggaagatat caaagctatc ctgagcctgt acgaggccag 900 cttcctggct ctggaaggcg aaaacatcct ggacgaggcg aaggttttcg caatctctca 960 tctgaaagaa ctgtctgaag aaaagatcgg taaagagctg gcagaacagg tgaaccatgc 1020 actggaactg ccactgcatc gccgtactca gcgtctggaa gcagtatggt ctatcgaggc 1080 ctaccgtaaa aaggaggacg cgaatcaggt tctgctggag ctggcaattc tggattacaa 1140 catgatccag tctgtatacc agcgtgatct gcgtgaaacg tcccgttggt ggcgtcgtgt 1200 gggtctggcg accaaactgc actttgctcg tgaccgcctg attgagagct tctactgggc 1260 cgtgggtgta gcattcgaac cgcaatactc cgactgccgt aactccgtcg caaaaatgtt 1320 ttctttcgta accattatcg acgatatcta cgatgtatac ggcaccctgg acgaactgga 1380 gctgtttact gatgcagttg agcgttggga cgtaaacgcc atcaacgacc tgccggatta 1440 catgaaactg tgctttctgg ctctgtataa cactattaac gaaatcgcct acgacaacct 1500 gaaagataaa ggtgagaaca tcctgccgta tctgaccaaa gcctgggctg acctgtgcaa 1560 cgctttcctg caagaagcca agtggctgta caacaaatct actccgacct ttgacgacta 1620 cttcggcaac gcatggaaat cctcttctgg cccgctgcaa ctggtgttcg cttacttcgc 1680 tgtcgtgcag aacattaaaa aggaagagat cgaaaacctg caaaaatacc atgacaccat 1740 ctctcgtcct tcccatatct tccgtctgtg caatgacctg gctagcgcgt ctgcggaaat 1800 tgcgcgtggt gaaaccgcaa atagcgtttc ttgttacatg cgcactaaag gtatctccga 1860 agaactggct accgaaagcg tgatgaatct gatcgatgaa acctggaaaa agatgaacaa 1920 ggaaaaactg ggtggtagcc tgttcgcgaa accgttcgtg gaaaccgcga tcaacctggc 1980 acgtcaatct cactgcactt atcataacgg cgacgcgcat acctctccgg atgagctgac 2040 ccgcaaacgc gttctgtctg taatcactga accgattctg ccgtttgaac gctaactgca 2100 taaaggaggt aaaaaaacat ggtatcctgt tctgcgccgg gtaagattta cctgttcggt 2160 gaacacgccg tagtttatgg cgaaactgca attgcgtgtg cggtggaact gcgtacccgt 2220 gttcgcgcgg aactcaatga ctctatcact attcagagcc agatcggccg caccggtctg 2280 gatttcgaaa agcaccctta tgtgtctgcg gtaattgaga aaatgcgcaa atctattcct 2340 attaacggtg ttttcttgac cgtcgattcc gacatcccgg tgggctccgg tctgggtagc 2400 agcgcagccg ttactatcgc gtctattggt gcgctgaacg agctgttcgg ctttggcctc 2460 agcctgcaag aaatcgctaa actgggccac gaaatcgaaa ttaaagtaca gggtgccgcg 2520 tccccaaccg atacgtatgt ttctaccttc ggcggcgtgg ttaccatccc ggaacgtcgc 2580 aaactgaaaa ctccggactg cggcattgtg attggcgata ccggcgtttt ctcctccacc 2640 aaagagttag tagctaacgt acgtcagctg cgcgaaagct acccggattt gatcgaaccg 2700 ctgatgacct ctattggcaa aatctctcgt atcggcgaac aactggttct gtctggcgac 2760 tacgcatcca tcggccgcct gatgaacgtc aaccagggtc tcctggacgc cctgggcgtt 2820 aacatcttag aactgagcca gctgatctat tccgctcgtg cggcaggtgc gtttggcgct 2880 aaaatcacgg gcgctggcgg cggtggctgt atggttgcgc tgaccgctcc ggaaaaatgc 2940 aaccaagtgg cagaagcggt agcaggcgct ggcggtaaag tgactatcac taaaccgacc 3000 gagcaaggtc tgaaagtaga ttaaagtcta gttaaagttt aaacggtctc cagcttggct 3060 gttttggcgg atgagagaag attttcagcc tgatacagat taaatcagaa cgcagaagcg 3120 gtctgataaa acagaatttg cctggcggca gtagcgcggt ggtcccacct gaccccatgc 3180 cgaactcaga agtgaaacgc cgtagcgccg atggtagtgt ggggtctccc catgcgagag 3240 tagggaactg ccaggcatca aataaaacga aaggctcagt cgaaagactg ggcctttcgt 3300 tttatctgtt gtttgtcggt gaacgctctc ctgagtagga caaatccgcc gggagcggat 3360 ttgaacgttg cgaagcaacg gcccggaggg tggcgggcag gacgcccgcc ataaactgcc 3420 aggcatcaaa ttaagcagaa ggccatcctg acggatggcc tttttgcgtt tctacaaact 3480 ctttttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 3540 gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 3600 cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 3660 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 3720 tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 3780 cttttaaagt tctgctatgt ggcgcggtat tatcccgtgt tgacgccggg caagagcaac 3840 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 3900 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 3960 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 4020 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 4080 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 4140 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 4200 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 4260 ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc 4320 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 4380 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 4440 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 4500 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 4560 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 4620 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 4680 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 4740 taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 4800 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 4860 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 4920 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 4980 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 5040 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 5100 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 5160 tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 5220 ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta tcccctgatt 5280 ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc agccgaacga 5340 ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg tattttctcc 5400 ttacgcatct gtgcggtatt tcacaccgca tatggtgcac tctcagtaca atctgctctg 5460 atgccgcata gttaagccag tatacactcc gctatcgcta cgtgactggg tcatggctgc 5520 gccccgacac ccgccaacac ccgctgacgc gccctgacgg gcttgtctgc tcccggcatc 5580 cgcttacaga caagctgtga ccgtctccgg gagctgcatg tgtcagaggt tttcaccgtc 5640 atcaccgaaa cgcgcgaggc agcagatcaa ttcgcgcgcg aaggcgaagc ggcatgcatt 5700 tacgttgaca ccatcgaatg gtgcaaaacc tttcgcggta tggcatgata gcgcccggaa 5760 gagagtcaat tcagggtggt gaatgtgaaa ccagtaacgt tatacgatgt cgcagagtat 5820 gccggtgtct cttatcagac cgtttcccgc gtggtgaacc aggccagcca cgtttctgcg 5880 aaaacgcggg aaaaagtgga agcggcgatg gcggagctga attacattcc caaccgcgtg 5940 gcacaacaac tggcgggcaa acagtcgttg ctgattggcg ttgccacctc cagtctggcc 6000 ctgcacgcgc cgtcgcaaat tgtcgcggcg attaaatctc gcgccgatca actgggtgcc 6060 agcgtggtgg tgtcgatggt agaacgaagc ggcgtcgaag cctgtaaagc ggcggtgcac 6120 aatcttctcg cgcaacgcgt cagtgggctg atcattaact atccgctgga tgaccaggat 6180 gccattgctg tggaagctgc ctgcactaat gttccggcgt tatttcttga tgtctctgac 6240 cagacaccca tcaacagtat tattttctcc catgaagacg gtacgcgact gggcgtggag 6300 catctggtcg cattgggtca ccagcaaatc gcgctgttag cgggcccatt aagttctgtc 6360 tcggcgcgtc tgcgtctggc tggctggcat aaatatctca ctcgcaatca aattcagccg 6420 atagcggaac gggaaggcga ctggagtgcc atgtccggtt ttcaacaaac catgcaaatg 6480 ctgaatgagg gcatcgttcc cactgcgatg ctggttgcca acgatcagat ggcgctgggc 6540 gcaatgcgcg ccattaccga gtccgggctg cgcgttggtg cggatatctc ggtagtggga 6600 tacgacgata ccgaagacag ctcatgttat atcccgccgt caaccaccat caaacaggat 6660 tttcgcctgc tggggcaaac cagcgtggac cgcttgctgc aactctctca gggccaggcg 6720 gtgaagggca atcagctgtt gcccgtctca ctggtgaaaa gaaaaaccac cctggcgccc 6780 aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag 6840 gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt agcgcgaatt 6900 gatctg 6906 <210> SEQ ID NO 4 <211> LENGTH: 3913 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 4 gcggccgcgc ccttgacgat gccacatcct gagcaaataa ttcaaccact aattgtgagc 60 ggataacaca aggaggaaac agccatggta tcctgttctg cgccgggtaa gatttacctg 120 ttcggtgaac acgccgtagt ttatggcgaa actgcaattg cgtgtgcggt ggaactgcgt 180 acccgtgttc gcgcggaact caatgactct atcactattc agagccagat cggccgcacc 240 ggtctggatt tcgaaaagca cccttatgtg tctgcggtaa ttgagaaaat gcgcaaatct 300 attcctatta acggtgtttt cttgaccgtc gattccgaca tcccggtggg ctccggtctg 360 ggtagcagcg cagccgttac tatcgcgtct attggtgcgc tgaacgagct gttcggcttt 420 ggcctcagcc tgcaagaaat cgctaaactg ggccacgaaa tcgaaattaa agtacagggt 480 gccgcgtccc caaccgatac gtatgtttct accttcggcg gcgtggttac catcccggaa 540 cgtcgcaaac tgaaaactcc ggactgcggc attgtgattg gcgataccgg cgttttctcc 600 tccaccaaag agttagtagc taacgtacgt cagctgcgcg aaagctaccc ggatttgatc 660 gaaccgctga tgacctctat tggcaaaatc tctcgtatcg gcgaacaact ggttctgtct 720 ggcgactacg catccatcgg ccgcctgatg aacgtcaacc agggtctcct ggacgccctg 780 ggcgttaaca tcttagaact gagccagctg atctattccg ctcgtgcggc aggtgcgttt 840 ggcgctaaaa tcacgggcgc tggcggcggt ggctgtatgg ttgcgctgac cgctccggaa 900 aaatgcaacc aagtggcaga agcggtagca ggcgctggcg gtaaagtgac tatcactaaa 960 ccgaccgagc aaggtctgaa agtagattaa gccttgactt aatagctgct tatttcgccc 1020 ttatggtacc tagtaggagg aaaaaaacat ggaaatgcgt caaccggctg tcgcaggtca 1080 attctaccca ctgcgttgcg agaacctgga aaacgaactg aaacgctgct tcgaaggcct 1140 ggagatccgc gaacaagaag tgctgggcgc agtctgtccg cacgccggtt atatgtactc 1200 tggcaaagtt gcggcgcacg tctatgccac tctgccggaa gctgatacct acgtaatctt 1260 cggcccgaac cacaccggct acggtagccc tgtctctgtg agccgtgaaa cttggaagac 1320 cccgttgggc aatatcgatg ttgacctgga actggcggac ggcttcctgg gttccatcgt 1380 agatgcggat gaactcggtc acaaatacga acactctatc gaagttcagc tgccgtttct 1440 gcaataccgt tttgaacgcg atttcaaaat tctgccaatc tgcatgggta tgcaagacga 1500 agaaaccgcg gtcgaagtag gtaacctgct ggcggatctg atcagcgagt ccggtaaacg 1560 tgctgtgatc atcgcaagct ctgatttcac ccactatgag acggctgaac gtgccaaaga 1620 aatcgattcc gaagttattg attctatcct gaactttgac atctctggca tgtacgatcg 1680 cctgtatcgc cgtaacgcct ctgtttgcgg ttacggcccg atcaccgcta tgctgacggc 1740 aagcaaaaag ctgggcggct ctcgtgcgac tttgctgaaa tacgcaaaca gcggtgacgt 1800 gtccggtgat aaagacgctg tggtgggcta cgccgccatc atcgttgagt aagctgatta 1860 aaggttgaac agataggatt tcgtcatgga tcctacaagg aggaaaaaaa catgaatgct 1920 tctaatgaac cggtgattct gaaactgggt ggctctgcta ttaccgacaa aggtgcctac 1980 gaaggcgtag ttaaggaagc tgatttgctg cgcatcgcac aggaagttag cggtttccgt 2040 ggcaagatga tcgtggttca tggtgctggt agcttcggcc atacgtacgc gaagaaatac 2100 ggcctggacc gtaccttcga cccagagggc gcaattgtta ctcatgaatc tgttaaaaag 2160 ctcgcctcca aagttgtagg tgctctgaat agcttcggcg tgcgtgctat cgcggtgcat 2220 cctatggact gcgcagtatg ccgtaacggt cgtatcgaaa cgatgtatct ggactccatc 2280 aagttaatgc tggaaaaagg tctggtgccg gttctgcacg gcgacgtcgc aatggatatt 2340 gaactgggca cttgtatcct gtccggtgat caaatcgttc cttacctggc caaagaactg 2400 ggtatctccc gcctcggcct gggcagcgca gaggatggtg tgctggatat ggagggcaaa 2460 cctgtaccgg aaatcacccc agaaactttc gaagagttcc gccactgcat cggtggttct 2520 ggttctactg atgtaaccgg tggcatgctg ggcaaagtgc tggaacttct ggaattgagc 2580 aaaaattctt ccattactag ctacattttc aacgctggta aagcagacaa catctaccgc 2640 tttctgaatg gtgagtccat cggcactcgc atcagcccgg acaagcgtgt ttaagctagt 2700 tattaaccta aatgctctaa accagttatg agctctacaa ggaggaaaaa aacatgatta 2760 acactaccag ccgccgcaaa attgaacacc tgaaactctg cgcagaatcc ccggttgaag 2820 cgcgtcaggt atctgccggc tttgaagacg ttactctgat ccaccgcgct ttaccggagc 2880 tgaacatgga tgaactggac ctcagcgttg atttcctggg taaacgcatc aaagcgccgt 2940 tcctgattgc gtctatcacg ggtggtcacc cagataccat cccggttaac gctgcgctgg 3000 cagctgctgc tgaggagctg ggtgttggca tcggcgttgg ctctcagcgc gcggccattg 3060 atgatccgag ccaggaagac agcttccgtg tagtgcgtga tgaagcccca gatgcgtttg 3120 tttatggcaa cgtcggcgca gcacagatcc gtcagtatgg tgttgaaggt gttgaaaaac 3180 tgatcgaaat gattgacgca gatgccttgg caatccacct gaactttctg caagaagcgg 3240 tccaaccgga aggtgaccgc gacgcgaccg gttgcctgga catgattacc gaaatttgct 3300 ctcagattaa aactccggta atcgtgaaag aaaccggtgc aggcattagc cgtgaagatg 3360 cgattctgtt ccagaaagct ggcgtgagcg caatcgacgt tggcggcgcg ggcggcacct 3420 cctgggctgg cgtcgaggtc taccgtgcta aagaaagccg tgactctgtt agcgagcgtt 3480 taggtgagct gttttgggat ttcggcattc cgacggtagc ttctctgatt gaatcccgcg 3540 tttccttgcc gctgatcgca accggcggta tccgtaacgg tctggacatt gctaaaagca 3600 ttgctctcgg cgcaagcgct gccagcgccg ctctgccgtt cgttggtccg tccctggagg 3660 gcaaagaatc cgttgtacgt gtgctgagct gcatgctgga agaatttaaa gcagcaatgt 3720 ttttgtgcgg ttgcggcaac atcaaagacc tgcacaactc tccagtagtg gtaactggtt 3780 ggacccgcga atacctggag cagcgcggtt ttaacgttaa ggacctctcc ctgccgggca 3840 acgctctgta agcttcaacg cgtctacaaa taaaaaaggc acgtcagatg acgtgccttt 3900 tttcttgtct aga 3913 <210> SEQ ID NO 5 <211> LENGTH: 6647 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 5 aagggcgagc tcaacgatcc ggctgctaac aaagcccgaa aggaagctga gttggctgct 60 gccaccgctg agcaataact agcataaccc cttggggcct ctaaacgggt cttgaggagt 120 tttttgctga aaggaggaac tatatccgga tatcccgcaa gaggcccggc agtaccggca 180 taaccaagcc tatgcctaca gcatccaggg tgacggtgcc gaggatgacg atgagcgcat 240 tgttagattt catacacggt gcctgactgc gttagcaatt taactgtgat aaactaccgc 300 attaaagctt atcgatgata agctgtcaaa catgagaatt aattcttgaa gacgaaaggg 360 cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc 420 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 480 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 540 aaggaagagt atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtgga 600 gaggctattc ggctatgact gggcacaact gacaatcggc tgctctgatg ccgccgtgtt 660 ccggctgtca gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct 720 gaatgaactg caggacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg 780 cgcagctgtg ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt 840 gccggggcag gatctcctgt catctcacct tgctcctgcc gagaaagtat ccatcatggc 900 tgatgcaatg cggcggctgc atacgcttga tccggctacc tgcccattcg accaccaagc 960 gaaacatcgc atcgagcggg cacgtactcg gatggaagcc ggtcttgtcg atcaggatga 1020 tctggacgaa gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg 1080 catgcccgac ggcgaggatc tcgtcgtgac acatggcgat gcctgcttgc cgaatatcat 1140 ggtggaaaat ggccgctttt ctggattcat cgactgtggc cggctgggtg tggcggaccg 1200 ctatcaggac atagcgttgg ctacccgtga tattgctgaa gagcttggcg gcgaatgggc 1260 tgaccgcttc ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca tcgccttcta 1320 tcgccttctt gacgagttct tctgagcggg actctggggt tcgaaatgac cgaccaagcg 1380 acgcctaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 1440 tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt 1500 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt 1560 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 1620 cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca 1680 gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca 1740 agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg 1800 ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg 1860 cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 1920 acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga 1980 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc 2040 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg 2100 agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg 2160 cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt 2220 tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc 2280 gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcctgatgc 2340 ggtattttct ccttacgcat ctgtgcggta tttcacaccg caatggtgca ctctcagtac 2400 aatctgctct gatgccgcat agttaagcca gtatacactc cgctatcgct acgtgactgg 2460 gtcatggctg cgccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg 2520 ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg 2580 ttttcaccgt catcaccgaa acgcgcgagg cagctgcggt aaagctcatc agcgtggtcg 2640 tgaagcgatt cacagatgtc tgcctgttca tccgcgtcca gctcgttgag tttctccaga 2700 agcgttaatg tctggcttct gataaagcgg gccatgttaa gggcggtttt ttcctgtttg 2760 gtcactgatg cctccgtgta agggggattt ctgttcatgg gggtaatgat accgatgaaa 2820 cgagagagga tgctcacgat acgggttact gatgatgaac atgcccggtt actggaacgt 2880 tgtgagggta aacaactggc ggtatggatg cggcgggacc agagaaaaat cactcagggt 2940 caatgccagc gcttcgttaa tacagatgta ggtgttccac agggtagcca gcagcatcct 3000 gcgatgcaga tccggaacat aatggtgcag ggcgctgact tccgcgtttc cagactttac 3060 gaaacacgga aaccgaagac cattcatgtt gttgctcagg tcgcagacgt tttgcagcag 3120 cagtcgcttc acgttcgctc gcgtatcggt gattcattct gctaaccagt aaggcaaccc 3180 cgccagccta gccgggtcct caacgacagg agcacgatca tgcgcacccg tggccaggac 3240 ccaacgctgc ccgagatgcg ccgcgtgcgg ctgctggaga tggcggacgc gatggatatg 3300 ttctgccaag ggttggtttg cgcattcaca gttctccgca agaattgatt ggctccaatt 3360 cttggagtgg tgaatccgtt agcgaggtgc cgccggcttc cattcaggtc gaggtggccc 3420 ggctccatgc accgcgacgc aacgcgggga ggcagacaag gtatagggcg gcgcctacaa 3480 tccatgccaa cccgttccat gtgctcgccg aggcggcata aatcgccgtg acgatcagcg 3540 gtccaatgat cgaagttagg ctggtaagag ccgcgagcga tccttgaagc tgtccctgat 3600 ggtcgtcatc tacctgcctg gacagcatgg cctgcaacgc gggcatcccg atgccgccgg 3660 aagcgagaag aatcataatg gggaaggcca tccagcctcg cgtcgcgaac gccagcaaga 3720 cgtagcccag cgcgtcggcc gccatgccgg cgataatggc ctgcttctcg ccgaaacgtt 3780 tggtggcggg accagtgacg aaggcttgag cgagggcgtg caagattccg aataccgcaa 3840 gcgacaggcc gatcatcgtc gcgctccagc gaaagcggtc ctcgccgaaa atgacccaga 3900 gcgctgccgg cacctgtcct acgagttgca tgataaagaa gacagtcata agtgcggcga 3960 cgatagtcat gccccgcgcc caccggaagg agctgactgg gttgaaggct ctcaagggca 4020 tcggtcgaga tcccggtgcc taatgagtga gctaacttac attaattgcg ttgcgctcac 4080 tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 4140 cggggagagg cggtttgcgt attgggcgcc agggtggttt ttcttttcac cagtgagacg 4200 ggcaacagct gattgccctt caccgcctgg ccctgagaga gttgcagcaa gcggtccacg 4260 ctggtttgcc ccagcaggcg aaaatcctgt ttgatggtgg ttaacggcgg gatataacat 4320 gagctgtctt cggtatcgtc gtatcccact accgagatat ccgcaccaac gcgcagcccg 4380 gactcggtaa tggcgcgcat tgcgcccagc gccatctgat cgttggcaac cagcatcgca 4440 gtgggaacga tgccctcatt cagcatttgc atggtttgtt gaaaaccgga catggcactc 4500 cagtcgcctt cccgttccgc tatcggctga atttgattgc gagtgagata tttatgccag 4560 ccagccagac gcagacgcgc cgagacagaa cttaatgggc ccgctaacag cgcgatttgc 4620 tggtgaccca atgcgaccag atgctccacg cccagtcgcg taccgtcttc atgggagaaa 4680 ataatactgt tgatgggtgt ctggtcagag acatcaagaa ataacgccgg aacattagtg 4740 caggcagctt ccacagcaat ggcatcctgg tcatccagcg gatagttaat gatcagccca 4800 ctgacgcgtt gcgcgagaag attgtgcacc gccgctttac aggcttcgac gccgcttcgt 4860 tctaccatcg acaccaccac gctggcaccc agttgatcgg cgcgagattt aatcgccgcg 4920 acaatttgcg acggcgcgtg cagggccaga ctggaggtgg caacgccaat cagcaacgac 4980 tgtttgcccg ccagttgttg tgccacgcgg ttgggaatgt aattcagctc cgccatcgcc 5040 gcttccactt tttcccgcgt tttcgcagaa acgtggctgg cctggttcac cacgcgggaa 5100 acggtctgat aagagacacc ggcatactct gcgacatcgt ataacgttac tggtttcaca 5160 ttcaccaccc tgaattgact ctcttccggg cgctatcatg ccataccgcg aaaggttttg 5220 cgccattcga tggtgtccgg gatctcgacg ctctccctta tgcgactcct gcattaggaa 5280 gcagcccagt agtaggttga ggccgttgag caccgccgcc gcaaggaatg gtgcatgcaa 5340 ggagatggcg cccaacagtc ccccggccac ggggcctgcc accataccca cgccgaaaca 5400 agcgctcatg agcccgaagt ggcgagcccg atcttcccca tcggtgatgt cggcgatata 5460 ggcgccagca accgcacctg tggcgccggt gatgccggcc acgatgcgtc cggcgtagag 5520 gatcgagatc tcgatcccgc gaaattaata cgactcacta taggggaatt gtgagcggat 5580 aacaattccc ctctagaaat aattttgttt aactttaaga aggagatata catatgcggg 5640 gttctcatca tcatcatcat catggtatgg ctagcatgac tggtggacag caaatgggtc 5700 gggatctgta cgacgatgac gataaggatc atcccttcac catggtatcc tgttctgcgc 5760 cgggtaagat ttacctgttc ggtgaacacg ccgtagttta tggcgaaact gcaattgcgt 5820 gtgcggtgga actgcgtacc cgtgttcgcg cggaactcaa tgactctatc actattcaga 5880 gccagatcgg ccgcaccggt ctggatttcg aaaagcaccc ttatgtgtct gcggtaattg 5940 agaaaatgcg caaatctatt cctattaacg gtgttttctt gaccgtcgat tccgacatcc 6000 cggtgggctc cggtctgggt agcagcgcag ccgttactat cgcgtctatt ggtgcgctga 6060 acgagctgtt cggctttggc ctcagcctgc aagaaatcgc taaactgggc cacgaaatcg 6120 aaattaaagt acagggtgcc gcgtccccaa ccgatacgta tgtttctacc ttcggcggcg 6180 tggttaccat cccggaacgt cgcaaactga aaactccgga ctgcggcatt gtgattggcg 6240 ataccggcgt tttctcctcc accaaagagt tagtagctaa cgtacgtcag ctgcgcgaaa 6300 gctacccgga tttgatcgaa ccgctgatga cctctattgg caaaatctct cgtatcggcg 6360 aacaactggt tctgtctggc gactacgcat ccatcggccg cctgatgaac gtcaaccagg 6420 gtctcctgga cgccctgggc gttaacatct tagaactgag ccagctgatc tattccgctc 6480 gtgcggcagg tgcgtttggc gctaaaatca cgggcgctgg cggcggtggc tgtatggttg 6540 cgctgaccgc tccggaaaaa tgcaaccaag tggcagaagc ggtagcaggc gctggcggta 6600 aagtgactat cactaaaccg accgagcaag gtctgaaagt agattaa 6647 <210> SEQ ID NO 6 <211> LENGTH: 7519 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 6 ctcgggccgt ctcttgggct tgatcggcct tcttgcgcat ctcacgcgct cctgcggcgg 60 cctgtagggc aggctcatac ccctgccgaa ccgcttttgt cagccggtcg gccacggctt 120 ccggcgtctc aacgcgcttt gagattccca gcttttcggc caatccctgc ggtgcatagg 180 cgcgtggctc gaccgcttgc gggctgatgg tgacgtggcc cactggtggc cgctccaggg 240 cctcgtagaa cgcctgaatg cgcgtgtgac gtgccttgct gccctcgatg ccccgttgca 300 gccctagatc ggccacagcg gccgcaaacg tggtctggtc gcgggtcatc tgcgctttgt 360 tgccgatgaa ctccttggcc gacagcctgc cgtcctgcgt cagcggcacc acgaacgcgg 420 tcatgtgcgg gctggtttcg tcacggtgga tgctggccgt cacgatgcga tccgccccgt 480 acttgtccgc cagccacttg tgcgccttct cgaagaacgc cgcctgctgt tcttggctgg 540 ccgacttcca ccattccggg ctggccgtca tgacgtactc gaccgccaac acagcgtcct 600 tgcgccgctt ctctggcagc aactcgcgca gtcggcccat cgcttcatcg gtgctgctgg 660 ccgcccagtg ctcgttctct ggcgtcctgc tggcgtcagc gttgggcgtc tcgcgctcgc 720 ggtaggcgtg cttgagactg gccgccacgt tgcccatttt cgccagcttc ttgcatcgca 780 tgatcgcgta tgccgccatg cctgcccctc ccttttggtg tccaaccggc tcgacggggg 840 cagcgcaagg cggtgcctcc ggcgggccac tcaatgcttg agtatactca ctagactttg 900 cttcgcaaag tcgtgaccgc ctacggcggc tgcggcgccc tacgggcttg ctctccgggc 960 ttcgccctgc gcggtcgctg cgctcccttg ccagcccgtg gatatgtgga cgatggccgc 1020 gagcggccac cggctggctc gcttcgctcg gcccgtggac aaccctgctg gacaagctga 1080 tggacaggct gcgcctgccc acgagcttga ccacagggat tgcccaccgg ctacccagcc 1140 ttcgaccaca tacccaccgg ctccaactgc gcggcctgcg gccttgcccc atcaattttt 1200 ttaattttct ctggggaaaa gcctccggcc tgcggcctgc gcgcttcgct tgccggttgg 1260 acaccaagtg gaaggcgggt caaggctcgc gcagcgaccg cgcagcggct tggccttgac 1320 gcgcctggaa cgacccaagc ctatgcgagt gggggcagtc gaaggcgaag cccgcccgcc 1380 tgccccccga gcctcacggc ggcgagtgcg ggggttccaa gggggcagcg ccaccttggg 1440 caaggccgaa ggccgcgcag tcgatcaaca agccccggag gggccacttt ttgccggagg 1500 gggagccgcg ccgaaggcgt gggggaaccc cgcaggggtg cccttctttg ggcaccaaag 1560 aactagatat agggcgaaat gcgaaagact taaaaatcaa caacttaaaa aaggggggta 1620 cgcaacagct cattgcggca ccccccgcaa tagctcattg cgtaggttaa agaaaatctg 1680 taattgactg ccacttttac gcaacgcata attgttgtcg cgctgccgaa aagttgcagc 1740 tgattgcgca tggtgccgca accgtgcggc accctaccgc atggagataa gcatggccac 1800 gcagtccaga gaaatcggca ttcaagccaa gaacaagccc ggtcactggg tgcaaacgga 1860 acgcaaagcg catgaggcgt gggccgggct tattgcgagg aaacccacgg cggcaatgct 1920 gctgcatcac ctcgtggcgc agatgggcca ccagaacgcc gtggtggtca gccagaagac 1980 actttccaag ctcatcggac gttctttgcg gacggtccaa tacgcagtca aggacttggt 2040 ggccgagcgc tggatctccg tcgtgaagct caacggcccc ggcaccgtgt cggcctacgt 2100 ggtcaatgac cgcgtggcgt ggggccagcc ccgcgaccag ttgcgcctgt cggtgttcag 2160 tgccgccgtg gtggttgatc acgacgacca ggacgaatcg ctgttggggc atggcgacct 2220 gcgccgcatc ccgaccctgt atccgggcga gcagcaacta ccgaccggcc ccggcgagga 2280 gccgcccagc cagcccggca ttccgggcat ggaaccagac ctgccagcct tgaccgaaac 2340 ggaggaatgg gaacggcgcg ggcagcagcg cctgccgatg cccgatgagc cgtgttttct 2400 ggacgatggc gagccgttgg agccgccgac acgggtcacg ctgccgcgcc ggtagcactt 2460 gggttgcgca gcaacccgta agtgcgctgt tccagactat cggctgtagc cgcctcgccg 2520 ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc atggagccgg gccacctcga 2580 cctgaatgga agccggcggc acctcgctaa cggattcacc gtttttatca ggctctggga 2640 ggcagaataa atgatcatat cgtcaattat tacctccacg gggagagcct gagcaaactg 2700 gcctcaggca tttgagaagc acacggtcac actgcttccg gtagtcaata aaccggtaaa 2760 ccagcaatag acataagcgg ctatttaacg accctgccct gaaccgacga ccgggtcgaa 2820 tttgctttcg aatttctgcc attcatccgc ttattatcac ttattcaggc gtagcaccag 2880 gcgtttaagg gcaccaataa ctgccttaaa aaaattacgc cccgccctgc cactcatcgc 2940 agtcggccta ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattttaaca 3000 aaatattaac gcttacaatt tccattcgcc attcaggctg cgcaactgtt gggaagggcg 3060 atcggtgcgg gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg 3120 attaagttgg gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtga 3180 gcgcgcgtaa tacgactcac tatagggcga attggagctc caccgcggtg gcggccgctc 3240 tagaactagt ggatcccccg ggctgcatgc tcgagcggcc gccagtgtga tggatatctg 3300 cagaattcgc ccttcttgat atcttagtgt gcgttaacca ccacccacat tggtccctgc 3360 ccgaccgcat agcggccttt ttcatgcagt agcccctgct cgccaacaat ttcgtatacc 3420 gagatgtggt gagatttttg cccggcggca atcagatact tgccgctgtg atcaacattg 3480 aagccgcgcg gctgggtttc cgttggctgg aagccttctt tactcaacac gctgccatct 3540 tccgaaacgc tgaaaacggt aatcaggctg gcggtacggt cgcaggcgta taaatggcga 3600 ccatccgggg tgatatgaat atcagccgcc caacgggtgt cggagaagtt ttccggcatc 3660 atatccagcg tctggacaca ttcgatatta ccgtgcggat ctttcagttc ccagacatcc 3720 actgagctgt ttaactcatt gacgcaatac gcatattgtt cgtttggatg gaataccata 3780 tgacgcgggc cggccccttc aacggtggtc acttccgcag ggtcctgcgc cacgagatga 3840 ccatcatcgc tgaccgtaaa caggcaaatg cgatcctgct ttaatgccgg aacccacagc 3900 gtacggttgt ccggtgagat attggcggaa tggcaaccgt ccagcccctc gaccacatcg 3960 acgacgccca ctggcaggcc atcttccaga cgcgttacgc tcacgttacc cgcattgtaa 4020 gaacctacaa agacaaactg cccctggtga tcggtggaaa tatgcgtcgg actacccggc 4080 agcgcagact ctgcggcaaa ggtcagtgcg ccatcgtccg gggcgatacg atacgccagg 4140 acgcgaaact cagggcgaac accaacatag agataacgtt tgtccgggct gaccaccatc 4200 ggctgcacct gccccggcac atcgacaacc tgtgtcagcg tcagtgcgcc ttcatgattc 4260 agattccaga cgtgaatttg ctggctctca gggctggcga tataaactgt ttgcttcatg 4320 aatgctcctt tgggttacct ccgggaaacg cggttgattt gtttagtggt tgaattattt 4380 gctcaggatg tggcatagtc aagggcgtga cggctcgcta atacaactca ctatagggct 4440 cgaggaagtt cctatacttt ctagagaata ggaacttccg cgccgcacac aaaaaccaac 4500 acacagatca tgaaaataaa gctcttttat tggtaccgaa ttcgccaggg agctctcaga 4560 cgtcgcttgg tcggtcttta ttcgaacccc agagtcccgc ttacgccccg ccctgccact 4620 catcgcagta ctgttgtaat tcattaagca ttctgccgac atggaagcca tcacaaacgg 4680 catgatgaac ctgaatcgcc agcggcatca gcaccttgtc gccttgcgta taatatttgc 4740 ccatggtgaa aacgggggcg aagaagttgt ccatattggc cacgtttaaa tcaaaactgg 4800 tgaaactcac ccagggattg gctgagacga aaaacatatt ctcaataaac cctttaggga 4860 aataggccag gttttcaccg taacacgcca catcttgcga atatatgtgt agaaactgcc 4920 ggaaatcgtc gtggtattca ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa 4980 cggtgtaaca agggtgaaca ctatcccata tcaccagctc accgtctttc attgccatac 5040 ggaattccgg atgagcattc atcaggcggg caagaatgtg aataaaggcc ggataaaact 5100 tgtgcttatt tttctttacg gtctttaaaa aggccgtaat atccagctga acggtctggt 5160 tataggtaca ttgagcaact gactgaaatg cctcaaaatg ttctttacga tgccattggg 5220 atatatcaac ggtggtatat ccagtgattt ttttctccat ggtttagttc ctcaccttgt 5280 cgtattatac tatgccgata tactatgccg atgattaatt gtcaacacgt gctgctgcag 5340 gtcgaaaggc ccggagatga ggaagaggag aacagcgcgg cagacgtgcg cttttgaagc 5400 gtgcagaatg ccgggcctcc ggaggacctt cgggcgcccg ccccgcccct gagcccgccc 5460 ctgagcccgc ccccggaccc accccttccc agcctctgag cccagaaagc gaaggagcaa 5520 agctgctatt ggccgctgcc ccaaaggcct acccgcttcc attgctcagc ggtgctgtcc 5580 atctgcacga gactagtgag acgtgctact tccatttgtc acgtcctgca cgacgcgagc 5640 tgcggggcgg gggggaactt cctgactagg ggaggagtgg aaggtggcgc gaaggggcca 5700 ccaaagaacg gagccggttg gcgcctaccg gtggatgtgg aatgtgtgcg aggccagagg 5760 ccacttgtgt agcgccaagt gcccagcggg gctgctaaag cgcatgctcc agactgcctt 5820 gggaaaagcg cctcccctac ccggtagaat gaagttccta tactttctag agaataggaa 5880 cttcgcggcc gccctttagt gagggttaat tcaactgact gtaacagcta aaattagtcg 5940 cttttggcgg taagggcgaa ttccagcaca ctggcggccg ttactagtgg atccgagctc 6000 ggtaccaagc ttgatgcagg aattcgatat caagcttatc gataccgtcg acctcgaggg 6060 ggggcccggt acccagcttt tgttcccttt agtgagggtt aattgcgcgc ttggcgtaat 6120 catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 6180 gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 6240 ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 6300 gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgcatgcat aaaaactgtt 6360 gtaattcatt aagcattctg ccgacatgga agccatcaca aacggcatga tgaacctgaa 6420 tcgccagcgg catcagcacc ttgtcgcctt gcgtataata tttgcccatg gacgcacacc 6480 gtggaaacgg atgaaggcac gaacccagtt gacataagcc tgttcggttc gtaaactgta 6540 atgcaagtag cgtatgcgct cacgcaactg gtccagaacc ttgaccgaac gcagcggtgg 6600 taacggcgca gtggcggttt tcatggcttg ttatgactgt ttttttgtac agtctatgcc 6660 tcgggcatcc aagcagcaag cgcgttacgc cgtgggtcga tgtttgatgt tatggagcag 6720 caacgatgtt acgcagcagc aacgatgtta cgcagcaggg cagtcgccct aaaacaaagt 6780 taggtggctc aagtatgggc atcattcgca catgtaggct cggccctgac caagtcaaat 6840 ccatgcgggc tgctcttgat cttttcggtc gtgagttcgg agacgtagcc acctactccc 6900 aacatcagcc ggactccgat tacctcggga acttgctccg tagtaagaca ttcatcgcgc 6960 ttgctgcctt cgaccaagaa gcggttgttg gcgctctcgc ggcttacgtt ctgcccaggt 7020 ttgagcagcc gcgtagtgag atctatatct atgatctcgc agtctccggc gagcaccgga 7080 ggcagggcat tgccaccgcg ctcatcaatc tcctcaagca tgaggccaac gcgcttggtg 7140 cttatgtgat ctacgtgcaa gcagattacg gtgacgatcc cgcagtggct ctctatacaa 7200 agttgggcat acgggaagaa gtgatgcact ttgatatcga cccaagtacc gccacctaac 7260 aattcgttca agccgagatc ggcttcccgg ccgcggagtt gttcggtaaa ttgtcacaac 7320 gccgccaggt ggcacttttc ggggaaatgt gcgcgcccgc gttcctgctg gcgctgggcc 7380 tgtttctggc gctggacttc ccgctgttcc gtcagcagct tttcgcccac ggccttgatg 7440 atcgcggcgg ccttggcctg catatcccga ttcaacggcc ccagggcgtc cagaacgggc 7500 ttcaggcgct cccgaaggt 7519 <210> SEQ ID NO 7 <211> LENGTH: 6858 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 7 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240 taacaatttc acacaggaaa cagcgccgct gagaaaaagc gaagcggcac tgctctttaa 300 caatttatca gacaatctgt gtgggcactc gaccggaatt atcgattaac tttattatta 360 aaaattaaag aggtatatat taatgtatcg attaaataag gaggaataaa ccatggaagc 420 tcgtcgttct gcgaactacg aacctaacag ctgggactat gattacctgc tgtcctccga 480 cacggacgag tccatcgaag tatacaaaga caaagcgaaa aagctggaag ccgaagttcg 540 tcgcgagatt aataacgaaa aagcagaatt tctgaccctg ctggaactga ttgacaacgt 600 ccagcgcctg ggcctgggtt accgtttcga gtctgatatc cgtggtgcgc tggatcgctt 660 cgtttcctcc ggcggcttcg atgcggtaac caagacttcc ctgcacggta cggcactgtc 720 tttccgtctg ctgcgtcaac acggttttga ggtttctcag gaagcgttca gcggcttcaa 780 agaccaaaac ggcaacttcc tggagaacct gaaggaagat atcaaagcta tcctgagcct 840 gtacgaggcc agcttcctgg ctctggaagg cgaaaacatc ctggacgagg cgaaggtttt 900 cgcaatctct catctgaaag aactgtctga agaaaagatc ggtaaagagc tggcagaaca 960 ggtgaaccat gcactggaac tgccactgca tcgccgtact cagcgtctgg aagcagtatg 1020 gtctatcgag gcctaccgta aaaaggagga cgcgaatcag gttctgctgg agctggcaat 1080 tctggattac aacatgatcc agtctgtata ccagcgtgat ctgcgtgaaa cgtcccgttg 1140 gtggcgtcgt gtgggtctgg cgaccaaact gcactttgct cgtgaccgcc tgattgagag 1200 cttctactgg gccgtgggtg tagcattcga accgcaatac tccgactgcc gtaactccgt 1260 cgcaaaaatg ttttctttcg taaccattat cgacgatatc tacgatgtat acggcaccct 1320 ggacgaactg gagctgttta ctgatgcagt tgagcgttgg gacgtaaacg ccatcaacga 1380 cctgccggat tacatgaaac tgtgctttct ggctctgtat aacactatta acgaaatcgc 1440 ctacgacaac ctgaaagata aaggtgagaa catcctgccg tatctgacca aagcctgggc 1500 tgacctgtgc aacgctttcc tgcaagaagc caagtggctg tacaacaaat ctactccgac 1560 ctttgacgac tacttcggca acgcatggaa atcctcttct ggcccgctgc aactggtgtt 1620 cgcttacttc gctgtcgtgc agaacattaa aaaggaagag atcgaaaacc tgcaaaaata 1680 ccatgacacc atctctcgtc cttcccatat cttccgtctg tgcaatgacc tggctagcgc 1740 gtctgcggaa attgcgcgtg gtgaaaccgc aaatagcgtt tcttgttaca tgcgcactaa 1800 aggtatctcc gaagaactgg ctaccgaaag cgtgatgaat ctgatcgatg aaacctggaa 1860 aaagatgaac aaggaaaaac tgggtggtag cctgttcgcg aaaccgttcg tggaaaccgc 1920 gatcaacctg gcacgtcaat ctcactgcac ttatcataac ggcgacgcgc atacctctcc 1980 ggatgagctg acccgcaaac gcgttctgtc tgtaatcact gaaccgattc tgccgtttga 2040 acgctaactg cataaaggag gtaaaaaaac atggtatcct gttctgcgcc gggtaagatt 2100 tacctgttcg gtgaacacgc cgtagtttat ggcgaaactg caattgcgtg tgcggtggaa 2160 ctgcgtaccc gtgttcgcgc ggaactcaat gactctatca ctattcagag ccagatcggc 2220 cgcaccggtc tggatttcga aaagcaccct tatgtgtctg cggtaattga gaaaatgcgc 2280 aaatctattc ctattaacgg tgttttcttg accgtcgatt ccgacatccc ggtgggctcc 2340 ggtctgggta gcagcgcagc cgttactatc gcgtctattg gtgcgctgaa cgagctgttc 2400 ggctttggcc tcagcctgca agaaatcgct aaactgggcc acgaaatcga aattaaagta 2460 cagggtgccg cgtccccaac cgatacgtat gtttctacct tcggcggcgt ggttaccatc 2520 ccggaacgtc gcaaactgaa aactccggac tgcggcattg tgattggcga taccggcgtt 2580 ttctcctcca ccaaagagtt agtagctaac gtacgtcagc tgcgcgaaag ctacccggat 2640 ttgatcgaac cgctgatgac ctctattggc aaaatctctc gtatcggcga acaactggtt 2700 ctgtctggcg actacgcatc catcggccgc ctgatgaacg tcaaccaggg tctcctggac 2760 gccctgggcg ttaacatctt agaactgagc cagctgatct attccgctcg tgcggcaggt 2820 gcgtttggcg ctaaaatcac gggcgctggc ggcggtggct gtatggttgc gctgaccgct 2880 ccggaaaaat gcaaccaagt ggcagaagcg gtagcaggcg ctggcggtaa agtgactatc 2940 actaaaccga ccgagcaagg tctgaaagta gattaaagtc tagttaaagt ttaaacggtc 3000 tccagcttgg ctgttttggc ggatgagaga agattttcag cctgatacag attaaatcag 3060 aacgcagaag cggtctgata aaacagaatt tgcctggcgg cagtagcgcg gtggtcccac 3120 ctgaccccat gccgaactca gaagtgaaac gccgtagcgc cgatggtagt gtggggtctc 3180 cccatgcgag agtagggaac tgccaggcat caaataaaac gaaaggctca gtcgaaagac 3240 tgggcctttc gttttatctg ttgtttgtcg gtgaacgctc tcctgagtag gacaaatccg 3300 ccgggagcgg atttgaacgt tgcgaagcaa cggcccggag ggtggcgggc aggacgcccg 3360 ccataaactg ccaggcatca aattaagcag aaggccatcc tgacggatgg cctttttgcg 3420 tttctacaaa ctctttttgt ttatttttct aaatacattc aaatatgtat ccgctcatga 3480 gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac 3540 atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc 3600 cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca 3660 tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc 3720 caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt gttgacgccg 3780 ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac 3840 cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca 3900 taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg 3960 agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac 4020 cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg 4080 caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat 4140 taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg 4200 ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg 4260 cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc 4320 aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc 4380 attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 4440 tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt 4500 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt 4560 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 4620 cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca 4680 gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca 4740 agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg 4800 ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg 4860 cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 4920 acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga 4980 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc 5040 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg 5100 agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg 5160 cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt 5220 tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc 5280 gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcctgatgc 5340 ggtattttct ccttacgcat ctgtgcggta tttcacaccg catatggtgc actctcagta 5400 caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 5460 ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 5520 gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 5580 gttttcaccg tcatcaccga aacgcgcgag gcagcagatc aattcgcgcg cgaaggcgaa 5640 gcggcatgca tttacgttga caccatcgaa tggtgcaaaa cctttcgcgg tatggcatga 5700 tagcgcccgg aagagagtca attcagggtg gtgaatgtga aaccagtaac gttatacgat 5760 gtcgcagagt atgccggtgt ctcttatcag accgtttccc gcgtggtgaa ccaggccagc 5820 cacgtttctg cgaaaacgcg ggaaaaagtg gaagcggcga tggcggagct gaattacatt 5880 cccaaccgcg tggcacaaca actggcgggc aaacagtcgt tgctgattgg cgttgccacc 5940 tccagtctgg ccctgcacgc gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat 6000 caactgggtg ccagcgtggt ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa 6060 gcggcggtgc acaatcttct cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg 6120 gatgaccagg atgccattgc tgtggaagct gcctgcacta atgttccggc gttatttctt 6180 gatgtctctg accagacacc catcaacagt attattttct cccatgaaga cggtacgcga 6240 ctgggcgtgg agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca 6300 ttaagttctg tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat 6360 caaattcagc cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa 6420 accatgcaaa tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag 6480 atggcgctgg gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc 6540 tcggtagtgg gatacgacga taccgaagac agctcatgtt atatcccgcc gtcaaccacc 6600 atcaaacagg attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct 6660 cagggccagg cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc 6720 accctggcgc ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 6780 ctggcacgac aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag 6840 ttagcgcgaa ttgatctg 6858 <210> SEQ ID NO 8 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 8 gacgctttcg ccaagtcagg 20 <210> SEQ ID NO 9 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 9 gtcaggctgg aatactcttc g 21 <210> SEQ ID NO 10 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 10 accaattgca cccggcaga 19 <210> SEQ ID NO 11 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 11 gctaaagcgc atgctccaga c 21 <210> SEQ ID NO 12 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 12 gactggcctc agatgaaagc 20 <210> SEQ ID NO 13 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 13 caaacatgtg gcatggaaag 20 <210> SEQ ID NO 14 <211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 14 gggcccgttt aaactttaac tagactctgc agttagcgtt caaacggcag aa 52 <210> SEQ ID NO 15 <211> LENGTH: 38 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 15 cgcatgcatg tcatgagatg tagcgtgtcc accgaaaa 38 <210> SEQ ID NO 16 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 16 acaatttcac acaggaaaca gc 22 <210> SEQ ID NO 17 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 17 ccaggcaaat tctgttttat cag 23 <210> SEQ ID NO 18 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 18 gcactgtctt tccgtctgct gc 22 <210> SEQ ID NO 19 <211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 19 gcgaacgatg cataaaggag gtaaaaaaac atggtatcct gttctgcgcc gggtaagatt 60 tacctg 66 <210> SEQ ID NO 20 <211> LENGTH: 48 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 20 gggcccgttt aaactttaac tagactttaa tctactttca gaccttgc 48 <210> SEQ ID NO 21 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 21 gatagtaacg gctgcgctgc tacc 24 <210> SEQ ID NO 22 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 22 gacagcttat catcgactgc acg 23 <210> SEQ ID NO 23 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 23 caccatggta tcctgttctg cg 22 <210> SEQ ID NO 24 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 24 ttaatctact ttcagacctt gc 22 <210> SEQ ID NO 25 <211> LENGTH: 67 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 25 accgccaaaa gcgactaatt ttagctgtta cagtcagttg aattaaccct cactaaaggg 60 cggccgc 67 <210> SEQ ID NO 26 <211> LENGTH: 152 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 26 gctggcgata taaactgttt gcttcatgaa tgctcctttg ggttacctcc gggaaacgcg 60 gttgatttgt ttagtggttg aattatttgc tcaggatgtg gcatagtcaa gggcgtgacg 120 gctcgctaat acgactcact atagggctcg ag 152 <210> SEQ ID NO 27 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 27 accgccaaaa gcgactaatt ttagct 26 <210> SEQ ID NO 28 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 28 cttgatatct tagtgtgcgt taaccaccac 30 <210> SEQ ID NO 29 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 29 cgtgaatttg ctggctctca g 21 <210> SEQ ID NO 30 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 30 ggtttagttc ctcaccttgt c 21 <210> SEQ ID NO 31 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 31 actgaaacgt tttcatcgct c 21 <210> SEQ ID NO 32 <211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 32 aaagtagccg aagatgacgg tttgtcacat ggagttggca ggatgtttga ttaaaagcaa 60 ttaaccctca ctaaagggcg g 81 <210> SEQ ID NO 33 <211> LENGTH: 199 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: 112 <223> OTHER INFORMATION: n = A,T,C or G <400> SEQUENCE: 33 taaatcttac ccggcgcaga acaggatacc atgttttttt acctcctttg caccttcatg 60 gtggtcagtg cgtcctgctg atgtgctcag tatcaccgcc agtggtattt angtcaacac 120 cgccagagat aatttatcac cgcagatggt tatctgtatg ttttttatat gaatttaata 180 cgactcacta tagggctcg 199 <210> SEQ ID NO 34 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 34 aaagaccgac caagcgacgt ctga 24 <210> SEQ ID NO 35 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 35 gctctgaata gtgatagagt ca 22 <210> SEQ ID NO 36 <211> LENGTH: 445 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 36 aaagaccgac caagcgacgt ctgagagctc cctggcgaat tcggtaccaa taaaagagct 60 ttattttcat gatctgtgtg ttggtttttg tgtgcggcgc ggaagttcct attctctaga 120 aagtatagga acttcctcga gccctatagt gagtcgtatt aaattcatat aaaaaacata 180 cagataacca tctgcggtga taaattatct ctggcggtgt tgacataaat accactggcg 240 gtgatactga gcacatcagc aggacgcact gaccaccatg aaggtgcaaa ggaggtaaaa 300 aaacatggta tcctgttctg cgccgggtaa gatttacctg ttcggtgaac acgccgtagt 360 ttatggcgaa actgcaattg cgtgtgcggt ggaactgcgt acccgtgttc gcgcggaact 420 caatgactct atcactattc agagc 445 <210> SEQ ID NO 37 <211> LENGTH: 445 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 37 aaagaccgac caagcgacgt ctgagagctc cctggcgaat tcggtaccaa taaaagagct 60 ttattttcat gatctgtgtg ttggtttttg tgtgcggcgc ggaagttcct attctctaga 120 aagtatagga acttcctcga gccctatagt gagtcgtatt aaattcatat aaaaaacata 180 cagataacca tctgcggtga taaattatct ctggcggtgt tgacctaaat accactggcg 240 gtgatactga gcacatcagc aggacgcact gaccaccatg aaggtgcaaa ggaggtaaaa 300 aaacatggta tcctgttctg cgccgggtaa gatttacctg ttcggtgaac acgccgtagt 360 ttatggcgaa actgcaattg cgtgtgcggt ggaactgcgt acccgtgttc gcgcggaact 420 caatgactct atcactattc agagc 445 <210> SEQ ID NO 38 <211> LENGTH: 442 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 38 aaagaccgac caagcgacgt ctgagagctc cctggcgaat tcggtaccaa taaaagagct 60 ttattttcat gatctgtgtg ttggtttttg tgtgcggcgc ggaagttcct attctctaga 120 aagtatagga acttcctcga gccctatagt gagtcgtatt aaattcatat aaaaaacata 180 cagataacca tctgcggtga taaattatct ctggcggtgt tgacctaaat accactggcg 240 gtgatactga gcacatcagc aggacgcact gaccaccatg aaggtgcaaa ggtaaaaaaa 300 catggtatcc tgttctgcgc cgggtaagat ttacctgttc ggtgaacacg ccgtagttta 360 tggcgaaact gcaattgcgt gtgcggtgga actgcgtacc cgtgttcgcg cggaactcaa 420 tgactctatc actattcaga gc 442 <210> SEQ ID NO 39 <211> LENGTH: 445 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 39 aaagaccgac caagcgacgt ctgagagctc cctggcgaat tcggtaccaa taaaagagct 60 ttattttcat gatctgtgtg ttggtttttg tgtgcggcgc ggaagttcct attctctaga 120 aagtatagga acttcctcga gccctatagt gagtcgtatt aaattcatat aaaaaacata 180 cagataacca tctgcggtga taaattatct ctggcggtgt tgacgtaaat accactggcg 240 gtgatactga gcacatcagc aggacgcact gaccaccatg aaggtgcaaa ggaggtaaaa 300 aaacatggta tcctgttctg cgccgggtaa gatttacctg ttcggtgaac acgccgtagt 360 ttatggcgaa actgcaattg cgtgtgcggt ggaactgcgt acccgtgttc gcgcggaact 420 caatgactct atcactattc agagc 445 <210> SEQ ID NO 40 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 40 gaggaataaa ccatggaagc tcgtcgttct 30 <210> SEQ ID NO 41 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 41 agaacgacga gcttccatgg tttattcctc 30 <210> SEQ ID NO 42 <400> SEQUENCE: 42 000 <210> SEQ ID NO 43 <400> SEQUENCE: 43 000 <210> SEQ ID NO 44 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 44 ctcgtacagg ctcaggatag 20 <210> SEQ ID NO 45 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 45 ttacgtccca acgctcaact 20 <210> SEQ ID NO 46 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 46 cttcggcaac gcatggaaat 20 <210> SEQ ID NO 47 <400> SEQUENCE: 47 000

1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 47 <210> SEQ ID NO 1 <211> LENGTH: 6957 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600 tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660 actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720 gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780 aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840 agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900 cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960 aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020 tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080 tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140 taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200 ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260 tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320 tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380 cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440 cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500 gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560 gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620 agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680 aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740 agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800 cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860 accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920 aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980 ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040 cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100 gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160 tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220 agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280 tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340 caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400 ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460 gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520 gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580 gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640 aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700 ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760 acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820 ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880 tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940 tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000 cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060 gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120 ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180 catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240 ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300 gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360 gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420 ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480 atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540 cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600 tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660 ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720 aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780 atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840 cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900 gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960 tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020 agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080 gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140 ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200 catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260 tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320 tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380 gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440 ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500 tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560 catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620 cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680 tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740 ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800 ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860 cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920 gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980 aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040 ttttgtttaa ctttaagaag gagatataca tatgcgttgt agcgtgtcca ccgaaaatgt 5100 gtctttcacc gaaactgaaa ccgaagctcg tcgttctgcg aactacgaac ctaacagctg 5160 ggactatgat tacctgctgt cctccgacac ggacgagtcc atcgaagtat acaaagacaa 5220 agcgaaaaag ctggaagccg aagttcgtcg cgagattaat aacgaaaaag cagaatttct 5280 gaccctgctg gaactgattg acaacgtcca gcgcctgggc ctgggttacc gtttcgagtc 5340 tgatatccgt ggtgcgctgg atcgcttcgt ttcctccggc ggcttcgatg cggtaaccaa 5400 gacttccctg cacggtacgg cactgtcttt ccgtctgctg cgtcaacacg gttttgaggt 5460 ttctcaggaa gcgttcagcg gcttcaaaga ccaaaacggc aacttcctgg agaacctgaa 5520 ggaagatatc aaagctatcc tgagcctgta cgaggccagc ttcctggctc tggaaggcga 5580 aaacatcctg gacgaggcga aggttttcgc aatctctcat ctgaaagaac tgtctgaaga 5640 aaagatcggt aaagagctgg cagaacaggt gaaccatgca ctggaactgc cactgcatcg 5700 ccgtactcag cgtctggaag cagtatggtc tatcgaggcc taccgtaaaa aggaggacgc 5760 gaatcaggtt ctgctggagc tggcaattct ggattacaac atgatccagt ctgtatacca 5820 gcgtgatctg cgtgaaacgt cccgttggtg gcgtcgtgtg ggtctggcga ccaaactgca 5880 ctttgctcgt gaccgcctga ttgagagctt ctactgggcc gtgggtgtag cattcgaacc 5940 gcaatactcc gactgccgta actccgtcgc aaaaatgttt tctttcgtaa ccattatcga 6000 cgatatctac gatgtatacg gcaccctgga cgaactggag ctgtttactg atgcagttga 6060 gcgttgggac gtaaacgcca tcaacgacct gccggattac atgaaactgt gctttctggc 6120 tctgtataac actattaacg aaatcgccta cgacaacctg aaagataaag gtgagaacat 6180 cctgccgtat ctgaccaaag cctgggctga cctgtgcaac gctttcctgc aagaagccaa 6240 gtggctgtac aacaaatcta ctccgacctt tgacgactac ttcggcaacg catggaaatc 6300 ctcttctggc ccgctgcaac tggtgttcgc ttacttcgct gtcgtgcaga acattaaaaa 6360 ggaagagatc gaaaacctgc aaaaatacca tgacaccatc tctcgtcctt cccatatctt 6420 ccgtctgtgc aatgacctgg ctagcgcgtc tgcggaaatt gcgcgtggtg aaaccgcaaa 6480 tagcgtttct tgttacatgc gcactaaagg tatctccgaa gaactggcta ccgaaagcgt 6540 gatgaatctg atcgatgaaa cctggaaaaa gatgaacaag gaaaaactgg gtggtagcct 6600 gttcgcgaaa ccgttcgtgg aaaccgcgat caacctggca cgtcaatctc actgcactta 6660 tcataacggc gacgcgcata cctctccgga tgagctgacc cgcaaacgcg ttctgtctgt 6720 aatcactgaa ccgattctgc cgtttgaacg ctaaggatcc gaattcgagc tccgtcgaca 6780 agcttgcggc cgcactcgag caccaccacc accaccactg agatccggct gctaacaaag 6840 cccgaaagga agctgagttg gctgctgcca ccgctgagca ataactagca taaccccttg 6900 gggcctctaa acgggtcttg aggggttttt tgctgaaagg aggaactata tccggat 6957 <210> SEQ ID NO 2 <211> LENGTH: 6068

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 2 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240 taacaatttc acacaggaaa cagcgccgct gagaaaaagc gaagcggcac tgctctttaa 300 caatttatca gacaatctgt gtgggcactc gaccggaatt atcgattaac tttattatta 360 aaaattaaag aggtatatat taatgtatcg attaaataag gaggaataaa ccatgagatg 420 tagcgtgtcc accgaaaatg tgtctttcac cgaaactgaa accgaagctc gtcgttctgc 480 gaactacgaa cctaacagct gggactatga ttacctgctg tcctccgaca cggacgagtc 540 catcgaagta tacaaagaca aagcgaaaaa gctggaagcc gaagttcgtc gcgagattaa 600 taacgaaaaa gcagaatttc tgaccctgct ggaactgatt gacaacgtcc agcgcctggg 660 cctgggttac cgtttcgagt ctgatatccg tggtgcgctg gatcgcttcg tttcctccgg 720 cggcttcgat gcggtaacca agacttccct gcacggtacg gcactgtctt tccgtctgct 780 gcgtcaacac ggttttgagg tttctcagga agcgttcagc ggcttcaaag accaaaacgg 840 caacttcctg gagaacctga aggaagatat caaagctatc ctgagcctgt acgaggccag 900 cttcctggct ctggaaggcg aaaacatcct ggacgaggcg aaggttttcg caatctctca 960 tctgaaagaa ctgtctgaag aaaagatcgg taaagagctg gcagaacagg tgaaccatgc 1020 actggaactg ccactgcatc gccgtactca gcgtctggaa gcagtatggt ctatcgaggc 1080 ctaccgtaaa aaggaggacg cgaatcaggt tctgctggag ctggcaattc tggattacaa 1140 catgatccag tctgtatacc agcgtgatct gcgtgaaacg tcccgttggt ggcgtcgtgt 1200 gggtctggcg accaaactgc actttgctcg tgaccgcctg attgagagct tctactgggc 1260 cgtgggtgta gcattcgaac cgcaatactc cgactgccgt aactccgtcg caaaaatgtt 1320 ttctttcgta accattatcg acgatatcta cgatgtatac ggcaccctgg acgaactgga 1380 gctgtttact gatgcagttg agcgttggga cgtaaacgcc atcaacgacc tgccggatta 1440 catgaaactg tgctttctgg ctctgtataa cactattaac gaaatcgcct acgacaacct 1500 gaaagataaa ggtgagaaca tcctgccgta tctgaccaaa gcctgggctg acctgtgcaa 1560 cgctttcctg caagaagcca agtggctgta caacaaatct actccgacct ttgacgacta 1620 cttcggcaac gcatggaaat cctcttctgg cccgctgcaa ctggtgttcg cttacttcgc 1680 tgtcgtgcag aacattaaaa aggaagagat cgaaaacctg caaaaatacc atgacaccat 1740 ctctcgtcct tcccatatct tccgtctgtg caatgacctg gctagcgcgt ctgcggaaat 1800 tgcgcgtggt gaaaccgcaa atagcgtttc ttgttacatg cgcactaaag gtatctccga 1860 agaactggct accgaaagcg tgatgaatct gatcgatgaa acctggaaaa agatgaacaa 1920 ggaaaaactg ggtggtagcc tgttcgcgaa accgttcgtg gaaaccgcga tcaacctggc 1980 acgtcaatct cactgcactt atcataacgg cgacgcgcat acctctccgg atgagctgac 2040 ccgcaaacgc gttctgtctg taatcactga accgattctg ccgtttgaac gctaactgca 2100 gctggtacca tatgggaatt cgaagctttc tagaacaaaa actcatctca gaagaggatc 2160 tgaatagcgc cgtcgaccat catcatcatc atcattgagt ttaaacggtc tccagcttgg 2220 ctgttttggc ggatgagaga agattttcag cctgatacag attaaatcag aacgcagaag 2280 cggtctgata aaacagaatt tgcctggcgg cagtagcgcg gtggtcccac ctgaccccat 2340 gccgaactca gaagtgaaac gccgtagcgc cgatggtagt gtggggtctc cccatgcgag 2400 agtagggaac tgccaggcat caaataaaac gaaaggctca gtcgaaagac tgggcctttc 2460 gttttatctg ttgtttgtcg gtgaacgctc tcctgagtag gacaaatccg ccgggagcgg 2520 atttgaacgt tgcgaagcaa cggcccggag ggtggcgggc aggacgcccg ccataaactg 2580 ccaggcatca aattaagcag aaggccatcc tgacggatgg cctttttgcg tttctacaaa 2640 ctctttttgt ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc 2700 ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt 2760 cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct 2820 ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga 2880 tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag 2940 cacttttaaa gttctgctat gtggcgcggt attatcccgt gttgacgccg ggcaagagca 3000 actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga 3060 aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag 3120 tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc 3180 ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa 3240 tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt 3300 gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg 3360 gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt 3420 tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg cagcactggg 3480 gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat 3540 ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact 3600 gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa 3660 aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt 3720 ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt 3780 ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg 3840 tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca 3900 gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt 3960 agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga 4020 taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc 4080 gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact 4140 gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga 4200 caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg 4260 aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt 4320 tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt 4380 acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga 4440 ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac 4500 gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcctgatgc ggtattttct 4560 ccttacgcat ctgtgcggta tttcacaccg catatggtgc actctcagta caatctgctc 4620 tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg ggtcatggct 4680 gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca 4740 tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg 4800 tcatcaccga aacgcgcgag gcagcagatc aattcgcgcg cgaaggcgaa gcggcatgca 4860 tttacgttga caccatcgaa tggtgcaaaa cctttcgcgg tatggcatga tagcgcccgg 4920 aagagagtca attcagggtg gtgaatgtga aaccagtaac gttatacgat gtcgcagagt 4980 atgccggtgt ctcttatcag accgtttccc gcgtggtgaa ccaggccagc cacgtttctg 5040 cgaaaacgcg ggaaaaagtg gaagcggcga tggcggagct gaattacatt cccaaccgcg 5100 tggcacaaca actggcgggc aaacagtcgt tgctgattgg cgttgccacc tccagtctgg 5160 ccctgcacgc gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat caactgggtg 5220 ccagcgtggt ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa gcggcggtgc 5280 acaatcttct cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg gatgaccagg 5340 atgccattgc tgtggaagct gcctgcacta atgttccggc gttatttctt gatgtctctg 5400 accagacacc catcaacagt attattttct cccatgaaga cggtacgcga ctgggcgtgg 5460 agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg 5520 tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc 5580 cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa 5640 tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg 5700 gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg 5760 gatacgacga taccgaagac agctcatgtt atatcccgcc gtcaaccacc atcaaacagg 5820 attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg 5880 cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc 5940 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac 6000 aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagcgcgaa 6060 ttgatctg 6068 <210> SEQ ID NO 3 <211> LENGTH: 6906 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 3 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240 taacaatttc acacaggaaa cagcgccgct gagaaaaagc gaagcggcac tgctctttaa 300 caatttatca gacaatctgt gtgggcactc gaccggaatt atcgattaac tttattatta 360 aaaattaaag aggtatatat taatgtatcg attaaataag gaggaataaa ccatgagatg 420 tagcgtgtcc accgaaaatg tgtctttcac cgaaactgaa accgaagctc gtcgttctgc 480 gaactacgaa cctaacagct gggactatga ttacctgctg tcctccgaca cggacgagtc 540 catcgaagta tacaaagaca aagcgaaaaa gctggaagcc gaagttcgtc gcgagattaa 600 taacgaaaaa gcagaatttc tgaccctgct ggaactgatt gacaacgtcc agcgcctggg 660 cctgggttac cgtttcgagt ctgatatccg tggtgcgctg gatcgcttcg tttcctccgg 720 cggcttcgat gcggtaacca agacttccct gcacggtacg gcactgtctt tccgtctgct 780 gcgtcaacac ggttttgagg tttctcagga agcgttcagc ggcttcaaag accaaaacgg 840 caacttcctg gagaacctga aggaagatat caaagctatc ctgagcctgt acgaggccag 900

cttcctggct ctggaaggcg aaaacatcct ggacgaggcg aaggttttcg caatctctca 960 tctgaaagaa ctgtctgaag aaaagatcgg taaagagctg gcagaacagg tgaaccatgc 1020 actggaactg ccactgcatc gccgtactca gcgtctggaa gcagtatggt ctatcgaggc 1080 ctaccgtaaa aaggaggacg cgaatcaggt tctgctggag ctggcaattc tggattacaa 1140 catgatccag tctgtatacc agcgtgatct gcgtgaaacg tcccgttggt ggcgtcgtgt 1200 gggtctggcg accaaactgc actttgctcg tgaccgcctg attgagagct tctactgggc 1260 cgtgggtgta gcattcgaac cgcaatactc cgactgccgt aactccgtcg caaaaatgtt 1320 ttctttcgta accattatcg acgatatcta cgatgtatac ggcaccctgg acgaactgga 1380 gctgtttact gatgcagttg agcgttggga cgtaaacgcc atcaacgacc tgccggatta 1440 catgaaactg tgctttctgg ctctgtataa cactattaac gaaatcgcct acgacaacct 1500 gaaagataaa ggtgagaaca tcctgccgta tctgaccaaa gcctgggctg acctgtgcaa 1560 cgctttcctg caagaagcca agtggctgta caacaaatct actccgacct ttgacgacta 1620 cttcggcaac gcatggaaat cctcttctgg cccgctgcaa ctggtgttcg cttacttcgc 1680 tgtcgtgcag aacattaaaa aggaagagat cgaaaacctg caaaaatacc atgacaccat 1740 ctctcgtcct tcccatatct tccgtctgtg caatgacctg gctagcgcgt ctgcggaaat 1800 tgcgcgtggt gaaaccgcaa atagcgtttc ttgttacatg cgcactaaag gtatctccga 1860 agaactggct accgaaagcg tgatgaatct gatcgatgaa acctggaaaa agatgaacaa 1920 ggaaaaactg ggtggtagcc tgttcgcgaa accgttcgtg gaaaccgcga tcaacctggc 1980 acgtcaatct cactgcactt atcataacgg cgacgcgcat acctctccgg atgagctgac 2040 ccgcaaacgc gttctgtctg taatcactga accgattctg ccgtttgaac gctaactgca 2100 taaaggaggt aaaaaaacat ggtatcctgt tctgcgccgg gtaagattta cctgttcggt 2160 gaacacgccg tagtttatgg cgaaactgca attgcgtgtg cggtggaact gcgtacccgt 2220 gttcgcgcgg aactcaatga ctctatcact attcagagcc agatcggccg caccggtctg 2280 gatttcgaaa agcaccctta tgtgtctgcg gtaattgaga aaatgcgcaa atctattcct 2340 attaacggtg ttttcttgac cgtcgattcc gacatcccgg tgggctccgg tctgggtagc 2400 agcgcagccg ttactatcgc gtctattggt gcgctgaacg agctgttcgg ctttggcctc 2460 agcctgcaag aaatcgctaa actgggccac gaaatcgaaa ttaaagtaca gggtgccgcg 2520 tccccaaccg atacgtatgt ttctaccttc ggcggcgtgg ttaccatccc ggaacgtcgc 2580 aaactgaaaa ctccggactg cggcattgtg attggcgata ccggcgtttt ctcctccacc 2640 aaagagttag tagctaacgt acgtcagctg cgcgaaagct acccggattt gatcgaaccg 2700 ctgatgacct ctattggcaa aatctctcgt atcggcgaac aactggttct gtctggcgac 2760 tacgcatcca tcggccgcct gatgaacgtc aaccagggtc tcctggacgc cctgggcgtt 2820 aacatcttag aactgagcca gctgatctat tccgctcgtg cggcaggtgc gtttggcgct 2880 aaaatcacgg gcgctggcgg cggtggctgt atggttgcgc tgaccgctcc ggaaaaatgc 2940 aaccaagtgg cagaagcggt agcaggcgct ggcggtaaag tgactatcac taaaccgacc 3000 gagcaaggtc tgaaagtaga ttaaagtcta gttaaagttt aaacggtctc cagcttggct 3060 gttttggcgg atgagagaag attttcagcc tgatacagat taaatcagaa cgcagaagcg 3120 gtctgataaa acagaatttg cctggcggca gtagcgcggt ggtcccacct gaccccatgc 3180 cgaactcaga agtgaaacgc cgtagcgccg atggtagtgt ggggtctccc catgcgagag 3240 tagggaactg ccaggcatca aataaaacga aaggctcagt cgaaagactg ggcctttcgt 3300 tttatctgtt gtttgtcggt gaacgctctc ctgagtagga caaatccgcc gggagcggat 3360 ttgaacgttg cgaagcaacg gcccggaggg tggcgggcag gacgcccgcc ataaactgcc 3420 aggcatcaaa ttaagcagaa ggccatcctg acggatggcc tttttgcgtt tctacaaact 3480 ctttttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 3540 gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 3600 cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 3660 tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 3720 tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 3780 cttttaaagt tctgctatgt ggcgcggtat tatcccgtgt tgacgccggg caagagcaac 3840 tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 3900 agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 3960 ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 4020 ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 4080 aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 4140 gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 4200 tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 4260 ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg tatcattgca gcactggggc 4320 cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 4380 atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 4440 cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 4500 ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 4560 cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 4620 ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 4680 tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 4740 taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 4800 caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 4860 agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 4920 gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 4980 gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 5040 ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 5100 acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 5160 tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 5220 ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta tcccctgatt 5280 ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc agccgaacga 5340 ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg tattttctcc 5400 ttacgcatct gtgcggtatt tcacaccgca tatggtgcac tctcagtaca atctgctctg 5460 atgccgcata gttaagccag tatacactcc gctatcgcta cgtgactggg tcatggctgc 5520 gccccgacac ccgccaacac ccgctgacgc gccctgacgg gcttgtctgc tcccggcatc 5580 cgcttacaga caagctgtga ccgtctccgg gagctgcatg tgtcagaggt tttcaccgtc 5640 atcaccgaaa cgcgcgaggc agcagatcaa ttcgcgcgcg aaggcgaagc ggcatgcatt 5700 tacgttgaca ccatcgaatg gtgcaaaacc tttcgcggta tggcatgata gcgcccggaa 5760 gagagtcaat tcagggtggt gaatgtgaaa ccagtaacgt tatacgatgt cgcagagtat 5820 gccggtgtct cttatcagac cgtttcccgc gtggtgaacc aggccagcca cgtttctgcg 5880 aaaacgcggg aaaaagtgga agcggcgatg gcggagctga attacattcc caaccgcgtg 5940 gcacaacaac tggcgggcaa acagtcgttg ctgattggcg ttgccacctc cagtctggcc 6000 ctgcacgcgc cgtcgcaaat tgtcgcggcg attaaatctc gcgccgatca actgggtgcc 6060 agcgtggtgg tgtcgatggt agaacgaagc ggcgtcgaag cctgtaaagc ggcggtgcac 6120 aatcttctcg cgcaacgcgt cagtgggctg atcattaact atccgctgga tgaccaggat 6180 gccattgctg tggaagctgc ctgcactaat gttccggcgt tatttcttga tgtctctgac 6240 cagacaccca tcaacagtat tattttctcc catgaagacg gtacgcgact gggcgtggag 6300 catctggtcg cattgggtca ccagcaaatc gcgctgttag cgggcccatt aagttctgtc 6360 tcggcgcgtc tgcgtctggc tggctggcat aaatatctca ctcgcaatca aattcagccg 6420 atagcggaac gggaaggcga ctggagtgcc atgtccggtt ttcaacaaac catgcaaatg 6480 ctgaatgagg gcatcgttcc cactgcgatg ctggttgcca acgatcagat ggcgctgggc 6540 gcaatgcgcg ccattaccga gtccgggctg cgcgttggtg cggatatctc ggtagtggga 6600 tacgacgata ccgaagacag ctcatgttat atcccgccgt caaccaccat caaacaggat 6660 tttcgcctgc tggggcaaac cagcgtggac cgcttgctgc aactctctca gggccaggcg 6720 gtgaagggca atcagctgtt gcccgtctca ctggtgaaaa gaaaaaccac cctggcgccc 6780 aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag 6840 gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt agcgcgaatt 6900 gatctg 6906 <210> SEQ ID NO 4 <211> LENGTH: 3913 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 4 gcggccgcgc ccttgacgat gccacatcct gagcaaataa ttcaaccact aattgtgagc 60 ggataacaca aggaggaaac agccatggta tcctgttctg cgccgggtaa gatttacctg 120 ttcggtgaac acgccgtagt ttatggcgaa actgcaattg cgtgtgcggt ggaactgcgt 180 acccgtgttc gcgcggaact caatgactct atcactattc agagccagat cggccgcacc 240 ggtctggatt tcgaaaagca cccttatgtg tctgcggtaa ttgagaaaat gcgcaaatct 300 attcctatta acggtgtttt cttgaccgtc gattccgaca tcccggtggg ctccggtctg 360 ggtagcagcg cagccgttac tatcgcgtct attggtgcgc tgaacgagct gttcggcttt 420 ggcctcagcc tgcaagaaat cgctaaactg ggccacgaaa tcgaaattaa agtacagggt 480 gccgcgtccc caaccgatac gtatgtttct accttcggcg gcgtggttac catcccggaa 540 cgtcgcaaac tgaaaactcc ggactgcggc attgtgattg gcgataccgg cgttttctcc 600 tccaccaaag agttagtagc taacgtacgt cagctgcgcg aaagctaccc ggatttgatc 660 gaaccgctga tgacctctat tggcaaaatc tctcgtatcg gcgaacaact ggttctgtct 720 ggcgactacg catccatcgg ccgcctgatg aacgtcaacc agggtctcct ggacgccctg 780 ggcgttaaca tcttagaact gagccagctg atctattccg ctcgtgcggc aggtgcgttt 840 ggcgctaaaa tcacgggcgc tggcggcggt ggctgtatgg ttgcgctgac cgctccggaa 900 aaatgcaacc aagtggcaga agcggtagca ggcgctggcg gtaaagtgac tatcactaaa 960 ccgaccgagc aaggtctgaa agtagattaa gccttgactt aatagctgct tatttcgccc 1020 ttatggtacc tagtaggagg aaaaaaacat ggaaatgcgt caaccggctg tcgcaggtca 1080 attctaccca ctgcgttgcg agaacctgga aaacgaactg aaacgctgct tcgaaggcct 1140 ggagatccgc gaacaagaag tgctgggcgc agtctgtccg cacgccggtt atatgtactc 1200

tggcaaagtt gcggcgcacg tctatgccac tctgccggaa gctgatacct acgtaatctt 1260 cggcccgaac cacaccggct acggtagccc tgtctctgtg agccgtgaaa cttggaagac 1320 cccgttgggc aatatcgatg ttgacctgga actggcggac ggcttcctgg gttccatcgt 1380 agatgcggat gaactcggtc acaaatacga acactctatc gaagttcagc tgccgtttct 1440 gcaataccgt tttgaacgcg atttcaaaat tctgccaatc tgcatgggta tgcaagacga 1500 agaaaccgcg gtcgaagtag gtaacctgct ggcggatctg atcagcgagt ccggtaaacg 1560 tgctgtgatc atcgcaagct ctgatttcac ccactatgag acggctgaac gtgccaaaga 1620 aatcgattcc gaagttattg attctatcct gaactttgac atctctggca tgtacgatcg 1680 cctgtatcgc cgtaacgcct ctgtttgcgg ttacggcccg atcaccgcta tgctgacggc 1740 aagcaaaaag ctgggcggct ctcgtgcgac tttgctgaaa tacgcaaaca gcggtgacgt 1800 gtccggtgat aaagacgctg tggtgggcta cgccgccatc atcgttgagt aagctgatta 1860 aaggttgaac agataggatt tcgtcatgga tcctacaagg aggaaaaaaa catgaatgct 1920 tctaatgaac cggtgattct gaaactgggt ggctctgcta ttaccgacaa aggtgcctac 1980 gaaggcgtag ttaaggaagc tgatttgctg cgcatcgcac aggaagttag cggtttccgt 2040 ggcaagatga tcgtggttca tggtgctggt agcttcggcc atacgtacgc gaagaaatac 2100 ggcctggacc gtaccttcga cccagagggc gcaattgtta ctcatgaatc tgttaaaaag 2160 ctcgcctcca aagttgtagg tgctctgaat agcttcggcg tgcgtgctat cgcggtgcat 2220 cctatggact gcgcagtatg ccgtaacggt cgtatcgaaa cgatgtatct ggactccatc 2280 aagttaatgc tggaaaaagg tctggtgccg gttctgcacg gcgacgtcgc aatggatatt 2340 gaactgggca cttgtatcct gtccggtgat caaatcgttc cttacctggc caaagaactg 2400 ggtatctccc gcctcggcct gggcagcgca gaggatggtg tgctggatat ggagggcaaa 2460 cctgtaccgg aaatcacccc agaaactttc gaagagttcc gccactgcat cggtggttct 2520 ggttctactg atgtaaccgg tggcatgctg ggcaaagtgc tggaacttct ggaattgagc 2580 aaaaattctt ccattactag ctacattttc aacgctggta aagcagacaa catctaccgc 2640 tttctgaatg gtgagtccat cggcactcgc atcagcccgg acaagcgtgt ttaagctagt 2700 tattaaccta aatgctctaa accagttatg agctctacaa ggaggaaaaa aacatgatta 2760 acactaccag ccgccgcaaa attgaacacc tgaaactctg cgcagaatcc ccggttgaag 2820 cgcgtcaggt atctgccggc tttgaagacg ttactctgat ccaccgcgct ttaccggagc 2880 tgaacatgga tgaactggac ctcagcgttg atttcctggg taaacgcatc aaagcgccgt 2940 tcctgattgc gtctatcacg ggtggtcacc cagataccat cccggttaac gctgcgctgg 3000 cagctgctgc tgaggagctg ggtgttggca tcggcgttgg ctctcagcgc gcggccattg 3060 atgatccgag ccaggaagac agcttccgtg tagtgcgtga tgaagcccca gatgcgtttg 3120 tttatggcaa cgtcggcgca gcacagatcc gtcagtatgg tgttgaaggt gttgaaaaac 3180 tgatcgaaat gattgacgca gatgccttgg caatccacct gaactttctg caagaagcgg 3240 tccaaccgga aggtgaccgc gacgcgaccg gttgcctgga catgattacc gaaatttgct 3300 ctcagattaa aactccggta atcgtgaaag aaaccggtgc aggcattagc cgtgaagatg 3360 cgattctgtt ccagaaagct ggcgtgagcg caatcgacgt tggcggcgcg ggcggcacct 3420 cctgggctgg cgtcgaggtc taccgtgcta aagaaagccg tgactctgtt agcgagcgtt 3480 taggtgagct gttttgggat ttcggcattc cgacggtagc ttctctgatt gaatcccgcg 3540 tttccttgcc gctgatcgca accggcggta tccgtaacgg tctggacatt gctaaaagca 3600 ttgctctcgg cgcaagcgct gccagcgccg ctctgccgtt cgttggtccg tccctggagg 3660 gcaaagaatc cgttgtacgt gtgctgagct gcatgctgga agaatttaaa gcagcaatgt 3720 ttttgtgcgg ttgcggcaac atcaaagacc tgcacaactc tccagtagtg gtaactggtt 3780 ggacccgcga atacctggag cagcgcggtt ttaacgttaa ggacctctcc ctgccgggca 3840 acgctctgta agcttcaacg cgtctacaaa taaaaaaggc acgtcagatg acgtgccttt 3900 tttcttgtct aga 3913 <210> SEQ ID NO 5 <211> LENGTH: 6647 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 5 aagggcgagc tcaacgatcc ggctgctaac aaagcccgaa aggaagctga gttggctgct 60 gccaccgctg agcaataact agcataaccc cttggggcct ctaaacgggt cttgaggagt 120 tttttgctga aaggaggaac tatatccgga tatcccgcaa gaggcccggc agtaccggca 180 taaccaagcc tatgcctaca gcatccaggg tgacggtgcc gaggatgacg atgagcgcat 240 tgttagattt catacacggt gcctgactgc gttagcaatt taactgtgat aaactaccgc 300 attaaagctt atcgatgata agctgtcaaa catgagaatt aattcttgaa gacgaaaggg 360 cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc 420 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca 480 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa 540 aaggaagagt atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtgga 600 gaggctattc ggctatgact gggcacaact gacaatcggc tgctctgatg ccgccgtgtt 660 ccggctgtca gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct 720 gaatgaactg caggacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg 780 cgcagctgtg ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt 840 gccggggcag gatctcctgt catctcacct tgctcctgcc gagaaagtat ccatcatggc 900 tgatgcaatg cggcggctgc atacgcttga tccggctacc tgcccattcg accaccaagc 960 gaaacatcgc atcgagcggg cacgtactcg gatggaagcc ggtcttgtcg atcaggatga 1020 tctggacgaa gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg 1080 catgcccgac ggcgaggatc tcgtcgtgac acatggcgat gcctgcttgc cgaatatcat 1140 ggtggaaaat ggccgctttt ctggattcat cgactgtggc cggctgggtg tggcggaccg 1200 ctatcaggac atagcgttgg ctacccgtga tattgctgaa gagcttggcg gcgaatgggc 1260 tgaccgcttc ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca tcgccttcta 1320 tcgccttctt gacgagttct tctgagcggg actctggggt tcgaaatgac cgaccaagcg 1380 acgcctaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 1440 tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt 1500 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt 1560 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 1620 cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca 1680 gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca 1740 agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg 1800 ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg 1860 cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 1920 acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga 1980 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc 2040 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg 2100 agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg 2160 cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt 2220 tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc 2280 gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcctgatgc 2340 ggtattttct ccttacgcat ctgtgcggta tttcacaccg caatggtgca ctctcagtac 2400 aatctgctct gatgccgcat agttaagcca gtatacactc cgctatcgct acgtgactgg 2460 gtcatggctg cgccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg 2520 ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg 2580 ttttcaccgt catcaccgaa acgcgcgagg cagctgcggt aaagctcatc agcgtggtcg 2640 tgaagcgatt cacagatgtc tgcctgttca tccgcgtcca gctcgttgag tttctccaga 2700 agcgttaatg tctggcttct gataaagcgg gccatgttaa gggcggtttt ttcctgtttg 2760 gtcactgatg cctccgtgta agggggattt ctgttcatgg gggtaatgat accgatgaaa 2820 cgagagagga tgctcacgat acgggttact gatgatgaac atgcccggtt actggaacgt 2880 tgtgagggta aacaactggc ggtatggatg cggcgggacc agagaaaaat cactcagggt 2940 caatgccagc gcttcgttaa tacagatgta ggtgttccac agggtagcca gcagcatcct 3000 gcgatgcaga tccggaacat aatggtgcag ggcgctgact tccgcgtttc cagactttac 3060 gaaacacgga aaccgaagac cattcatgtt gttgctcagg tcgcagacgt tttgcagcag 3120 cagtcgcttc acgttcgctc gcgtatcggt gattcattct gctaaccagt aaggcaaccc 3180 cgccagccta gccgggtcct caacgacagg agcacgatca tgcgcacccg tggccaggac 3240 ccaacgctgc ccgagatgcg ccgcgtgcgg ctgctggaga tggcggacgc gatggatatg 3300 ttctgccaag ggttggtttg cgcattcaca gttctccgca agaattgatt ggctccaatt 3360 cttggagtgg tgaatccgtt agcgaggtgc cgccggcttc cattcaggtc gaggtggccc 3420 ggctccatgc accgcgacgc aacgcgggga ggcagacaag gtatagggcg gcgcctacaa 3480 tccatgccaa cccgttccat gtgctcgccg aggcggcata aatcgccgtg acgatcagcg 3540 gtccaatgat cgaagttagg ctggtaagag ccgcgagcga tccttgaagc tgtccctgat 3600 ggtcgtcatc tacctgcctg gacagcatgg cctgcaacgc gggcatcccg atgccgccgg 3660 aagcgagaag aatcataatg gggaaggcca tccagcctcg cgtcgcgaac gccagcaaga 3720 cgtagcccag cgcgtcggcc gccatgccgg cgataatggc ctgcttctcg ccgaaacgtt 3780 tggtggcggg accagtgacg aaggcttgag cgagggcgtg caagattccg aataccgcaa 3840 gcgacaggcc gatcatcgtc gcgctccagc gaaagcggtc ctcgccgaaa atgacccaga 3900 gcgctgccgg cacctgtcct acgagttgca tgataaagaa gacagtcata agtgcggcga 3960 cgatagtcat gccccgcgcc caccggaagg agctgactgg gttgaaggct ctcaagggca 4020 tcggtcgaga tcccggtgcc taatgagtga gctaacttac attaattgcg ttgcgctcac 4080 tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 4140 cggggagagg cggtttgcgt attgggcgcc agggtggttt ttcttttcac cagtgagacg 4200 ggcaacagct gattgccctt caccgcctgg ccctgagaga gttgcagcaa gcggtccacg 4260 ctggtttgcc ccagcaggcg aaaatcctgt ttgatggtgg ttaacggcgg gatataacat 4320 gagctgtctt cggtatcgtc gtatcccact accgagatat ccgcaccaac gcgcagcccg 4380 gactcggtaa tggcgcgcat tgcgcccagc gccatctgat cgttggcaac cagcatcgca 4440

gtgggaacga tgccctcatt cagcatttgc atggtttgtt gaaaaccgga catggcactc 4500 cagtcgcctt cccgttccgc tatcggctga atttgattgc gagtgagata tttatgccag 4560 ccagccagac gcagacgcgc cgagacagaa cttaatgggc ccgctaacag cgcgatttgc 4620 tggtgaccca atgcgaccag atgctccacg cccagtcgcg taccgtcttc atgggagaaa 4680 ataatactgt tgatgggtgt ctggtcagag acatcaagaa ataacgccgg aacattagtg 4740 caggcagctt ccacagcaat ggcatcctgg tcatccagcg gatagttaat gatcagccca 4800 ctgacgcgtt gcgcgagaag attgtgcacc gccgctttac aggcttcgac gccgcttcgt 4860 tctaccatcg acaccaccac gctggcaccc agttgatcgg cgcgagattt aatcgccgcg 4920 acaatttgcg acggcgcgtg cagggccaga ctggaggtgg caacgccaat cagcaacgac 4980 tgtttgcccg ccagttgttg tgccacgcgg ttgggaatgt aattcagctc cgccatcgcc 5040 gcttccactt tttcccgcgt tttcgcagaa acgtggctgg cctggttcac cacgcgggaa 5100 acggtctgat aagagacacc ggcatactct gcgacatcgt ataacgttac tggtttcaca 5160 ttcaccaccc tgaattgact ctcttccggg cgctatcatg ccataccgcg aaaggttttg 5220 cgccattcga tggtgtccgg gatctcgacg ctctccctta tgcgactcct gcattaggaa 5280 gcagcccagt agtaggttga ggccgttgag caccgccgcc gcaaggaatg gtgcatgcaa 5340 ggagatggcg cccaacagtc ccccggccac ggggcctgcc accataccca cgccgaaaca 5400 agcgctcatg agcccgaagt ggcgagcccg atcttcccca tcggtgatgt cggcgatata 5460 ggcgccagca accgcacctg tggcgccggt gatgccggcc acgatgcgtc cggcgtagag 5520 gatcgagatc tcgatcccgc gaaattaata cgactcacta taggggaatt gtgagcggat 5580 aacaattccc ctctagaaat aattttgttt aactttaaga aggagatata catatgcggg 5640 gttctcatca tcatcatcat catggtatgg ctagcatgac tggtggacag caaatgggtc 5700 gggatctgta cgacgatgac gataaggatc atcccttcac catggtatcc tgttctgcgc 5760 cgggtaagat ttacctgttc ggtgaacacg ccgtagttta tggcgaaact gcaattgcgt 5820 gtgcggtgga actgcgtacc cgtgttcgcg cggaactcaa tgactctatc actattcaga 5880 gccagatcgg ccgcaccggt ctggatttcg aaaagcaccc ttatgtgtct gcggtaattg 5940 agaaaatgcg caaatctatt cctattaacg gtgttttctt gaccgtcgat tccgacatcc 6000 cggtgggctc cggtctgggt agcagcgcag ccgttactat cgcgtctatt ggtgcgctga 6060 acgagctgtt cggctttggc ctcagcctgc aagaaatcgc taaactgggc cacgaaatcg 6120 aaattaaagt acagggtgcc gcgtccccaa ccgatacgta tgtttctacc ttcggcggcg 6180 tggttaccat cccggaacgt cgcaaactga aaactccgga ctgcggcatt gtgattggcg 6240 ataccggcgt tttctcctcc accaaagagt tagtagctaa cgtacgtcag ctgcgcgaaa 6300 gctacccgga tttgatcgaa ccgctgatga cctctattgg caaaatctct cgtatcggcg 6360 aacaactggt tctgtctggc gactacgcat ccatcggccg cctgatgaac gtcaaccagg 6420 gtctcctgga cgccctgggc gttaacatct tagaactgag ccagctgatc tattccgctc 6480 gtgcggcagg tgcgtttggc gctaaaatca cgggcgctgg cggcggtggc tgtatggttg 6540 cgctgaccgc tccggaaaaa tgcaaccaag tggcagaagc ggtagcaggc gctggcggta 6600 aagtgactat cactaaaccg accgagcaag gtctgaaagt agattaa 6647 <210> SEQ ID NO 6 <211> LENGTH: 7519 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 6 ctcgggccgt ctcttgggct tgatcggcct tcttgcgcat ctcacgcgct cctgcggcgg 60 cctgtagggc aggctcatac ccctgccgaa ccgcttttgt cagccggtcg gccacggctt 120 ccggcgtctc aacgcgcttt gagattccca gcttttcggc caatccctgc ggtgcatagg 180 cgcgtggctc gaccgcttgc gggctgatgg tgacgtggcc cactggtggc cgctccaggg 240 cctcgtagaa cgcctgaatg cgcgtgtgac gtgccttgct gccctcgatg ccccgttgca 300 gccctagatc ggccacagcg gccgcaaacg tggtctggtc gcgggtcatc tgcgctttgt 360 tgccgatgaa ctccttggcc gacagcctgc cgtcctgcgt cagcggcacc acgaacgcgg 420 tcatgtgcgg gctggtttcg tcacggtgga tgctggccgt cacgatgcga tccgccccgt 480 acttgtccgc cagccacttg tgcgccttct cgaagaacgc cgcctgctgt tcttggctgg 540 ccgacttcca ccattccggg ctggccgtca tgacgtactc gaccgccaac acagcgtcct 600 tgcgccgctt ctctggcagc aactcgcgca gtcggcccat cgcttcatcg gtgctgctgg 660 ccgcccagtg ctcgttctct ggcgtcctgc tggcgtcagc gttgggcgtc tcgcgctcgc 720 ggtaggcgtg cttgagactg gccgccacgt tgcccatttt cgccagcttc ttgcatcgca 780 tgatcgcgta tgccgccatg cctgcccctc ccttttggtg tccaaccggc tcgacggggg 840 cagcgcaagg cggtgcctcc ggcgggccac tcaatgcttg agtatactca ctagactttg 900 cttcgcaaag tcgtgaccgc ctacggcggc tgcggcgccc tacgggcttg ctctccgggc 960 ttcgccctgc gcggtcgctg cgctcccttg ccagcccgtg gatatgtgga cgatggccgc 1020 gagcggccac cggctggctc gcttcgctcg gcccgtggac aaccctgctg gacaagctga 1080 tggacaggct gcgcctgccc acgagcttga ccacagggat tgcccaccgg ctacccagcc 1140 ttcgaccaca tacccaccgg ctccaactgc gcggcctgcg gccttgcccc atcaattttt 1200 ttaattttct ctggggaaaa gcctccggcc tgcggcctgc gcgcttcgct tgccggttgg 1260 acaccaagtg gaaggcgggt caaggctcgc gcagcgaccg cgcagcggct tggccttgac 1320 gcgcctggaa cgacccaagc ctatgcgagt gggggcagtc gaaggcgaag cccgcccgcc 1380 tgccccccga gcctcacggc ggcgagtgcg ggggttccaa gggggcagcg ccaccttggg 1440 caaggccgaa ggccgcgcag tcgatcaaca agccccggag gggccacttt ttgccggagg 1500 gggagccgcg ccgaaggcgt gggggaaccc cgcaggggtg cccttctttg ggcaccaaag 1560 aactagatat agggcgaaat gcgaaagact taaaaatcaa caacttaaaa aaggggggta 1620 cgcaacagct cattgcggca ccccccgcaa tagctcattg cgtaggttaa agaaaatctg 1680 taattgactg ccacttttac gcaacgcata attgttgtcg cgctgccgaa aagttgcagc 1740 tgattgcgca tggtgccgca accgtgcggc accctaccgc atggagataa gcatggccac 1800 gcagtccaga gaaatcggca ttcaagccaa gaacaagccc ggtcactggg tgcaaacgga 1860 acgcaaagcg catgaggcgt gggccgggct tattgcgagg aaacccacgg cggcaatgct 1920 gctgcatcac ctcgtggcgc agatgggcca ccagaacgcc gtggtggtca gccagaagac 1980 actttccaag ctcatcggac gttctttgcg gacggtccaa tacgcagtca aggacttggt 2040 ggccgagcgc tggatctccg tcgtgaagct caacggcccc ggcaccgtgt cggcctacgt 2100 ggtcaatgac cgcgtggcgt ggggccagcc ccgcgaccag ttgcgcctgt cggtgttcag 2160 tgccgccgtg gtggttgatc acgacgacca ggacgaatcg ctgttggggc atggcgacct 2220 gcgccgcatc ccgaccctgt atccgggcga gcagcaacta ccgaccggcc ccggcgagga 2280 gccgcccagc cagcccggca ttccgggcat ggaaccagac ctgccagcct tgaccgaaac 2340 ggaggaatgg gaacggcgcg ggcagcagcg cctgccgatg cccgatgagc cgtgttttct 2400 ggacgatggc gagccgttgg agccgccgac acgggtcacg ctgccgcgcc ggtagcactt 2460 gggttgcgca gcaacccgta agtgcgctgt tccagactat cggctgtagc cgcctcgccg 2520 ccctatacct tgtctgcctc cccgcgttgc gtcgcggtgc atggagccgg gccacctcga 2580 cctgaatgga agccggcggc acctcgctaa cggattcacc gtttttatca ggctctggga 2640 ggcagaataa atgatcatat cgtcaattat tacctccacg gggagagcct gagcaaactg 2700 gcctcaggca tttgagaagc acacggtcac actgcttccg gtagtcaata aaccggtaaa 2760 ccagcaatag acataagcgg ctatttaacg accctgccct gaaccgacga ccgggtcgaa 2820 tttgctttcg aatttctgcc attcatccgc ttattatcac ttattcaggc gtagcaccag 2880 gcgtttaagg gcaccaataa ctgccttaaa aaaattacgc cccgccctgc cactcatcgc 2940 agtcggccta ttggttaaaa aatgagctga tttaacaaaa atttaacgcg aattttaaca 3000 aaatattaac gcttacaatt tccattcgcc attcaggctg cgcaactgtt gggaagggcg 3060 atcggtgcgg gcctcttcgc tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg 3120 attaagttgg gtaacgccag ggttttccca gtcacgacgt tgtaaaacga cggccagtga 3180 gcgcgcgtaa tacgactcac tatagggcga attggagctc caccgcggtg gcggccgctc 3240 tagaactagt ggatcccccg ggctgcatgc tcgagcggcc gccagtgtga tggatatctg 3300 cagaattcgc ccttcttgat atcttagtgt gcgttaacca ccacccacat tggtccctgc 3360 ccgaccgcat agcggccttt ttcatgcagt agcccctgct cgccaacaat ttcgtatacc 3420 gagatgtggt gagatttttg cccggcggca atcagatact tgccgctgtg atcaacattg 3480 aagccgcgcg gctgggtttc cgttggctgg aagccttctt tactcaacac gctgccatct 3540 tccgaaacgc tgaaaacggt aatcaggctg gcggtacggt cgcaggcgta taaatggcga 3600 ccatccgggg tgatatgaat atcagccgcc caacgggtgt cggagaagtt ttccggcatc 3660 atatccagcg tctggacaca ttcgatatta ccgtgcggat ctttcagttc ccagacatcc 3720 actgagctgt ttaactcatt gacgcaatac gcatattgtt cgtttggatg gaataccata 3780 tgacgcgggc cggccccttc aacggtggtc acttccgcag ggtcctgcgc cacgagatga 3840 ccatcatcgc tgaccgtaaa caggcaaatg cgatcctgct ttaatgccgg aacccacagc 3900 gtacggttgt ccggtgagat attggcggaa tggcaaccgt ccagcccctc gaccacatcg 3960 acgacgccca ctggcaggcc atcttccaga cgcgttacgc tcacgttacc cgcattgtaa 4020 gaacctacaa agacaaactg cccctggtga tcggtggaaa tatgcgtcgg actacccggc 4080 agcgcagact ctgcggcaaa ggtcagtgcg ccatcgtccg gggcgatacg atacgccagg 4140 acgcgaaact cagggcgaac accaacatag agataacgtt tgtccgggct gaccaccatc 4200 ggctgcacct gccccggcac atcgacaacc tgtgtcagcg tcagtgcgcc ttcatgattc 4260 agattccaga cgtgaatttg ctggctctca gggctggcga tataaactgt ttgcttcatg 4320 aatgctcctt tgggttacct ccgggaaacg cggttgattt gtttagtggt tgaattattt 4380 gctcaggatg tggcatagtc aagggcgtga cggctcgcta atacaactca ctatagggct 4440 cgaggaagtt cctatacttt ctagagaata ggaacttccg cgccgcacac aaaaaccaac 4500 acacagatca tgaaaataaa gctcttttat tggtaccgaa ttcgccaggg agctctcaga 4560 cgtcgcttgg tcggtcttta ttcgaacccc agagtcccgc ttacgccccg ccctgccact 4620 catcgcagta ctgttgtaat tcattaagca ttctgccgac atggaagcca tcacaaacgg 4680 catgatgaac ctgaatcgcc agcggcatca gcaccttgtc gccttgcgta taatatttgc 4740 ccatggtgaa aacgggggcg aagaagttgt ccatattggc cacgtttaaa tcaaaactgg 4800 tgaaactcac ccagggattg gctgagacga aaaacatatt ctcaataaac cctttaggga 4860 aataggccag gttttcaccg taacacgcca catcttgcga atatatgtgt agaaactgcc 4920 ggaaatcgtc gtggtattca ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa 4980 cggtgtaaca agggtgaaca ctatcccata tcaccagctc accgtctttc attgccatac 5040

ggaattccgg atgagcattc atcaggcggg caagaatgtg aataaaggcc ggataaaact 5100 tgtgcttatt tttctttacg gtctttaaaa aggccgtaat atccagctga acggtctggt 5160 tataggtaca ttgagcaact gactgaaatg cctcaaaatg ttctttacga tgccattggg 5220 atatatcaac ggtggtatat ccagtgattt ttttctccat ggtttagttc ctcaccttgt 5280 cgtattatac tatgccgata tactatgccg atgattaatt gtcaacacgt gctgctgcag 5340 gtcgaaaggc ccggagatga ggaagaggag aacagcgcgg cagacgtgcg cttttgaagc 5400 gtgcagaatg ccgggcctcc ggaggacctt cgggcgcccg ccccgcccct gagcccgccc 5460 ctgagcccgc ccccggaccc accccttccc agcctctgag cccagaaagc gaaggagcaa 5520 agctgctatt ggccgctgcc ccaaaggcct acccgcttcc attgctcagc ggtgctgtcc 5580 atctgcacga gactagtgag acgtgctact tccatttgtc acgtcctgca cgacgcgagc 5640 tgcggggcgg gggggaactt cctgactagg ggaggagtgg aaggtggcgc gaaggggcca 5700 ccaaagaacg gagccggttg gcgcctaccg gtggatgtgg aatgtgtgcg aggccagagg 5760 ccacttgtgt agcgccaagt gcccagcggg gctgctaaag cgcatgctcc agactgcctt 5820 gggaaaagcg cctcccctac ccggtagaat gaagttccta tactttctag agaataggaa 5880 cttcgcggcc gccctttagt gagggttaat tcaactgact gtaacagcta aaattagtcg 5940 cttttggcgg taagggcgaa ttccagcaca ctggcggccg ttactagtgg atccgagctc 6000 ggtaccaagc ttgatgcagg aattcgatat caagcttatc gataccgtcg acctcgaggg 6060 ggggcccggt acccagcttt tgttcccttt agtgagggtt aattgcgcgc ttggcgtaat 6120 catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 6180 gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 6240 ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 6300 gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgcatgcat aaaaactgtt 6360 gtaattcatt aagcattctg ccgacatgga agccatcaca aacggcatga tgaacctgaa 6420 tcgccagcgg catcagcacc ttgtcgcctt gcgtataata tttgcccatg gacgcacacc 6480 gtggaaacgg atgaaggcac gaacccagtt gacataagcc tgttcggttc gtaaactgta 6540 atgcaagtag cgtatgcgct cacgcaactg gtccagaacc ttgaccgaac gcagcggtgg 6600 taacggcgca gtggcggttt tcatggcttg ttatgactgt ttttttgtac agtctatgcc 6660 tcgggcatcc aagcagcaag cgcgttacgc cgtgggtcga tgtttgatgt tatggagcag 6720 caacgatgtt acgcagcagc aacgatgtta cgcagcaggg cagtcgccct aaaacaaagt 6780 taggtggctc aagtatgggc atcattcgca catgtaggct cggccctgac caagtcaaat 6840 ccatgcgggc tgctcttgat cttttcggtc gtgagttcgg agacgtagcc acctactccc 6900 aacatcagcc ggactccgat tacctcggga acttgctccg tagtaagaca ttcatcgcgc 6960 ttgctgcctt cgaccaagaa gcggttgttg gcgctctcgc ggcttacgtt ctgcccaggt 7020 ttgagcagcc gcgtagtgag atctatatct atgatctcgc agtctccggc gagcaccgga 7080 ggcagggcat tgccaccgcg ctcatcaatc tcctcaagca tgaggccaac gcgcttggtg 7140 cttatgtgat ctacgtgcaa gcagattacg gtgacgatcc cgcagtggct ctctatacaa 7200 agttgggcat acgggaagaa gtgatgcact ttgatatcga cccaagtacc gccacctaac 7260 aattcgttca agccgagatc ggcttcccgg ccgcggagtt gttcggtaaa ttgtcacaac 7320 gccgccaggt ggcacttttc ggggaaatgt gcgcgcccgc gttcctgctg gcgctgggcc 7380 tgtttctggc gctggacttc ccgctgttcc gtcagcagct tttcgcccac ggccttgatg 7440 atcgcggcgg ccttggcctg catatcccga ttcaacggcc ccagggcgtc cagaacgggc 7500 ttcaggcgct cccgaaggt 7519 <210> SEQ ID NO 7 <211> LENGTH: 6858 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 7 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240 taacaatttc acacaggaaa cagcgccgct gagaaaaagc gaagcggcac tgctctttaa 300 caatttatca gacaatctgt gtgggcactc gaccggaatt atcgattaac tttattatta 360 aaaattaaag aggtatatat taatgtatcg attaaataag gaggaataaa ccatggaagc 420 tcgtcgttct gcgaactacg aacctaacag ctgggactat gattacctgc tgtcctccga 480 cacggacgag tccatcgaag tatacaaaga caaagcgaaa aagctggaag ccgaagttcg 540 tcgcgagatt aataacgaaa aagcagaatt tctgaccctg ctggaactga ttgacaacgt 600 ccagcgcctg ggcctgggtt accgtttcga gtctgatatc cgtggtgcgc tggatcgctt 660 cgtttcctcc ggcggcttcg atgcggtaac caagacttcc ctgcacggta cggcactgtc 720 tttccgtctg ctgcgtcaac acggttttga ggtttctcag gaagcgttca gcggcttcaa 780 agaccaaaac ggcaacttcc tggagaacct gaaggaagat atcaaagcta tcctgagcct 840 gtacgaggcc agcttcctgg ctctggaagg cgaaaacatc ctggacgagg cgaaggtttt 900 cgcaatctct catctgaaag aactgtctga agaaaagatc ggtaaagagc tggcagaaca 960 ggtgaaccat gcactggaac tgccactgca tcgccgtact cagcgtctgg aagcagtatg 1020 gtctatcgag gcctaccgta aaaaggagga cgcgaatcag gttctgctgg agctggcaat 1080 tctggattac aacatgatcc agtctgtata ccagcgtgat ctgcgtgaaa cgtcccgttg 1140 gtggcgtcgt gtgggtctgg cgaccaaact gcactttgct cgtgaccgcc tgattgagag 1200 cttctactgg gccgtgggtg tagcattcga accgcaatac tccgactgcc gtaactccgt 1260 cgcaaaaatg ttttctttcg taaccattat cgacgatatc tacgatgtat acggcaccct 1320 ggacgaactg gagctgttta ctgatgcagt tgagcgttgg gacgtaaacg ccatcaacga 1380 cctgccggat tacatgaaac tgtgctttct ggctctgtat aacactatta acgaaatcgc 1440 ctacgacaac ctgaaagata aaggtgagaa catcctgccg tatctgacca aagcctgggc 1500 tgacctgtgc aacgctttcc tgcaagaagc caagtggctg tacaacaaat ctactccgac 1560 ctttgacgac tacttcggca acgcatggaa atcctcttct ggcccgctgc aactggtgtt 1620 cgcttacttc gctgtcgtgc agaacattaa aaaggaagag atcgaaaacc tgcaaaaata 1680 ccatgacacc atctctcgtc cttcccatat cttccgtctg tgcaatgacc tggctagcgc 1740 gtctgcggaa attgcgcgtg gtgaaaccgc aaatagcgtt tcttgttaca tgcgcactaa 1800 aggtatctcc gaagaactgg ctaccgaaag cgtgatgaat ctgatcgatg aaacctggaa 1860 aaagatgaac aaggaaaaac tgggtggtag cctgttcgcg aaaccgttcg tggaaaccgc 1920 gatcaacctg gcacgtcaat ctcactgcac ttatcataac ggcgacgcgc atacctctcc 1980 ggatgagctg acccgcaaac gcgttctgtc tgtaatcact gaaccgattc tgccgtttga 2040 acgctaactg cataaaggag gtaaaaaaac atggtatcct gttctgcgcc gggtaagatt 2100 tacctgttcg gtgaacacgc cgtagtttat ggcgaaactg caattgcgtg tgcggtggaa 2160 ctgcgtaccc gtgttcgcgc ggaactcaat gactctatca ctattcagag ccagatcggc 2220 cgcaccggtc tggatttcga aaagcaccct tatgtgtctg cggtaattga gaaaatgcgc 2280 aaatctattc ctattaacgg tgttttcttg accgtcgatt ccgacatccc ggtgggctcc 2340 ggtctgggta gcagcgcagc cgttactatc gcgtctattg gtgcgctgaa cgagctgttc 2400 ggctttggcc tcagcctgca agaaatcgct aaactgggcc acgaaatcga aattaaagta 2460 cagggtgccg cgtccccaac cgatacgtat gtttctacct tcggcggcgt ggttaccatc 2520 ccggaacgtc gcaaactgaa aactccggac tgcggcattg tgattggcga taccggcgtt 2580 ttctcctcca ccaaagagtt agtagctaac gtacgtcagc tgcgcgaaag ctacccggat 2640 ttgatcgaac cgctgatgac ctctattggc aaaatctctc gtatcggcga acaactggtt 2700 ctgtctggcg actacgcatc catcggccgc ctgatgaacg tcaaccaggg tctcctggac 2760 gccctgggcg ttaacatctt agaactgagc cagctgatct attccgctcg tgcggcaggt 2820 gcgtttggcg ctaaaatcac gggcgctggc ggcggtggct gtatggttgc gctgaccgct 2880 ccggaaaaat gcaaccaagt ggcagaagcg gtagcaggcg ctggcggtaa agtgactatc 2940 actaaaccga ccgagcaagg tctgaaagta gattaaagtc tagttaaagt ttaaacggtc 3000 tccagcttgg ctgttttggc ggatgagaga agattttcag cctgatacag attaaatcag 3060 aacgcagaag cggtctgata aaacagaatt tgcctggcgg cagtagcgcg gtggtcccac 3120 ctgaccccat gccgaactca gaagtgaaac gccgtagcgc cgatggtagt gtggggtctc 3180 cccatgcgag agtagggaac tgccaggcat caaataaaac gaaaggctca gtcgaaagac 3240 tgggcctttc gttttatctg ttgtttgtcg gtgaacgctc tcctgagtag gacaaatccg 3300 ccgggagcgg atttgaacgt tgcgaagcaa cggcccggag ggtggcgggc aggacgcccg 3360 ccataaactg ccaggcatca aattaagcag aaggccatcc tgacggatgg cctttttgcg 3420 tttctacaaa ctctttttgt ttatttttct aaatacattc aaatatgtat ccgctcatga 3480 gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac 3540 atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc 3600 cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca 3660 tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc 3720 caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt gttgacgccg 3780 ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac 3840 cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca 3900 taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg 3960 agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac 4020 cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg 4080 caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat 4140 taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg 4200 ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg 4260 cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc 4320 aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc 4380 attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 4440 tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt 4500 aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt 4560 gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag 4620 cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta actggcttca 4680

gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca 4740 agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg 4800 ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg 4860 cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct 4920 acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga 4980 gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc 5040 ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg 5100 agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg 5160 cggccttttt acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt 5220 tatcccctga ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc 5280 gcagccgaac gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcctgatgc 5340 ggtattttct ccttacgcat ctgtgcggta tttcacaccg catatggtgc actctcagta 5400 caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 5460 ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 5520 gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 5580 gttttcaccg tcatcaccga aacgcgcgag gcagcagatc aattcgcgcg cgaaggcgaa 5640 gcggcatgca tttacgttga caccatcgaa tggtgcaaaa cctttcgcgg tatggcatga 5700 tagcgcccgg aagagagtca attcagggtg gtgaatgtga aaccagtaac gttatacgat 5760 gtcgcagagt atgccggtgt ctcttatcag accgtttccc gcgtggtgaa ccaggccagc 5820 cacgtttctg cgaaaacgcg ggaaaaagtg gaagcggcga tggcggagct gaattacatt 5880 cccaaccgcg tggcacaaca actggcgggc aaacagtcgt tgctgattgg cgttgccacc 5940 tccagtctgg ccctgcacgc gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat 6000 caactgggtg ccagcgtggt ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa 6060 gcggcggtgc acaatcttct cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg 6120 gatgaccagg atgccattgc tgtggaagct gcctgcacta atgttccggc gttatttctt 6180 gatgtctctg accagacacc catcaacagt attattttct cccatgaaga cggtacgcga 6240 ctgggcgtgg agcatctggt cgcattgggt caccagcaaa tcgcgctgtt agcgggccca 6300 ttaagttctg tctcggcgcg tctgcgtctg gctggctggc ataaatatct cactcgcaat 6360 caaattcagc cgatagcgga acgggaaggc gactggagtg ccatgtccgg ttttcaacaa 6420 accatgcaaa tgctgaatga gggcatcgtt cccactgcga tgctggttgc caacgatcag 6480 atggcgctgg gcgcaatgcg cgccattacc gagtccgggc tgcgcgttgg tgcggatatc 6540 tcggtagtgg gatacgacga taccgaagac agctcatgtt atatcccgcc gtcaaccacc 6600 atcaaacagg attttcgcct gctggggcaa accagcgtgg accgcttgct gcaactctct 6660 cagggccagg cggtgaaggg caatcagctg ttgcccgtct cactggtgaa aagaaaaacc 6720 accctggcgc ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 6780 ctggcacgac aggtttcccg actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag 6840 ttagcgcgaa ttgatctg 6858 <210> SEQ ID NO 8 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 8 gacgctttcg ccaagtcagg 20 <210> SEQ ID NO 9 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 9 gtcaggctgg aatactcttc g 21 <210> SEQ ID NO 10 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 10 accaattgca cccggcaga 19 <210> SEQ ID NO 11 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 11 gctaaagcgc atgctccaga c 21 <210> SEQ ID NO 12 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 12 gactggcctc agatgaaagc 20 <210> SEQ ID NO 13 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 13 caaacatgtg gcatggaaag 20 <210> SEQ ID NO 14 <211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 14 gggcccgttt aaactttaac tagactctgc agttagcgtt caaacggcag aa 52 <210> SEQ ID NO 15 <211> LENGTH: 38 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 15 cgcatgcatg tcatgagatg tagcgtgtcc accgaaaa 38 <210> SEQ ID NO 16 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 16 acaatttcac acaggaaaca gc 22 <210> SEQ ID NO 17 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 17 ccaggcaaat tctgttttat cag 23 <210> SEQ ID NO 18 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 18 gcactgtctt tccgtctgct gc 22 <210> SEQ ID NO 19 <211> LENGTH: 66 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 19 gcgaacgatg cataaaggag gtaaaaaaac atggtatcct gttctgcgcc gggtaagatt 60 tacctg 66 <210> SEQ ID NO 20 <211> LENGTH: 48 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 20 gggcccgttt aaactttaac tagactttaa tctactttca gaccttgc 48 <210> SEQ ID NO 21 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 21 gatagtaacg gctgcgctgc tacc 24 <210> SEQ ID NO 22 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct

<400> SEQUENCE: 22 gacagcttat catcgactgc acg 23 <210> SEQ ID NO 23 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 23 caccatggta tcctgttctg cg 22 <210> SEQ ID NO 24 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 24 ttaatctact ttcagacctt gc 22 <210> SEQ ID NO 25 <211> LENGTH: 67 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 25 accgccaaaa gcgactaatt ttagctgtta cagtcagttg aattaaccct cactaaaggg 60 cggccgc 67 <210> SEQ ID NO 26 <211> LENGTH: 152 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 26 gctggcgata taaactgttt gcttcatgaa tgctcctttg ggttacctcc gggaaacgcg 60 gttgatttgt ttagtggttg aattatttgc tcaggatgtg gcatagtcaa gggcgtgacg 120 gctcgctaat acgactcact atagggctcg ag 152 <210> SEQ ID NO 27 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 27 accgccaaaa gcgactaatt ttagct 26 <210> SEQ ID NO 28 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 28 cttgatatct tagtgtgcgt taaccaccac 30 <210> SEQ ID NO 29 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 29 cgtgaatttg ctggctctca g 21 <210> SEQ ID NO 30 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 30 ggtttagttc ctcaccttgt c 21 <210> SEQ ID NO 31 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 31 actgaaacgt tttcatcgct c 21 <210> SEQ ID NO 32 <211> LENGTH: 81 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 32 aaagtagccg aagatgacgg tttgtcacat ggagttggca ggatgtttga ttaaaagcaa 60 ttaaccctca ctaaagggcg g 81 <210> SEQ ID NO 33 <211> LENGTH: 199 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: 112 <223> OTHER INFORMATION: n = A,T,C or G <400> SEQUENCE: 33 taaatcttac ccggcgcaga acaggatacc atgttttttt acctcctttg caccttcatg 60 gtggtcagtg cgtcctgctg atgtgctcag tatcaccgcc agtggtattt angtcaacac 120 cgccagagat aatttatcac cgcagatggt tatctgtatg ttttttatat gaatttaata 180 cgactcacta tagggctcg 199 <210> SEQ ID NO 34 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 34 aaagaccgac caagcgacgt ctga 24 <210> SEQ ID NO 35 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 35 gctctgaata gtgatagagt ca 22 <210> SEQ ID NO 36 <211> LENGTH: 445 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 36 aaagaccgac caagcgacgt ctgagagctc cctggcgaat tcggtaccaa taaaagagct 60 ttattttcat gatctgtgtg ttggtttttg tgtgcggcgc ggaagttcct attctctaga 120 aagtatagga acttcctcga gccctatagt gagtcgtatt aaattcatat aaaaaacata 180 cagataacca tctgcggtga taaattatct ctggcggtgt tgacataaat accactggcg 240 gtgatactga gcacatcagc aggacgcact gaccaccatg aaggtgcaaa ggaggtaaaa 300 aaacatggta tcctgttctg cgccgggtaa gatttacctg ttcggtgaac acgccgtagt 360 ttatggcgaa actgcaattg cgtgtgcggt ggaactgcgt acccgtgttc gcgcggaact 420 caatgactct atcactattc agagc 445 <210> SEQ ID NO 37 <211> LENGTH: 445 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 37 aaagaccgac caagcgacgt ctgagagctc cctggcgaat tcggtaccaa taaaagagct 60 ttattttcat gatctgtgtg ttggtttttg tgtgcggcgc ggaagttcct attctctaga 120 aagtatagga acttcctcga gccctatagt gagtcgtatt aaattcatat aaaaaacata 180 cagataacca tctgcggtga taaattatct ctggcggtgt tgacctaaat accactggcg 240 gtgatactga gcacatcagc aggacgcact gaccaccatg aaggtgcaaa ggaggtaaaa 300 aaacatggta tcctgttctg cgccgggtaa gatttacctg ttcggtgaac acgccgtagt 360 ttatggcgaa actgcaattg cgtgtgcggt ggaactgcgt acccgtgttc gcgcggaact 420 caatgactct atcactattc agagc 445 <210> SEQ ID NO 38 <211> LENGTH: 442 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 38 aaagaccgac caagcgacgt ctgagagctc cctggcgaat tcggtaccaa taaaagagct 60 ttattttcat gatctgtgtg ttggtttttg tgtgcggcgc ggaagttcct attctctaga 120 aagtatagga acttcctcga gccctatagt gagtcgtatt aaattcatat aaaaaacata 180 cagataacca tctgcggtga taaattatct ctggcggtgt tgacctaaat accactggcg 240 gtgatactga gcacatcagc aggacgcact gaccaccatg aaggtgcaaa ggtaaaaaaa 300

catggtatcc tgttctgcgc cgggtaagat ttacctgttc ggtgaacacg ccgtagttta 360 tggcgaaact gcaattgcgt gtgcggtgga actgcgtacc cgtgttcgcg cggaactcaa 420 tgactctatc actattcaga gc 442 <210> SEQ ID NO 39 <211> LENGTH: 445 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 39 aaagaccgac caagcgacgt ctgagagctc cctggcgaat tcggtaccaa taaaagagct 60 ttattttcat gatctgtgtg ttggtttttg tgtgcggcgc ggaagttcct attctctaga 120 aagtatagga acttcctcga gccctatagt gagtcgtatt aaattcatat aaaaaacata 180 cagataacca tctgcggtga taaattatct ctggcggtgt tgacgtaaat accactggcg 240 gtgatactga gcacatcagc aggacgcact gaccaccatg aaggtgcaaa ggaggtaaaa 300 aaacatggta tcctgttctg cgccgggtaa gatttacctg ttcggtgaac acgccgtagt 360 ttatggcgaa actgcaattg cgtgtgcggt ggaactgcgt acccgtgttc gcgcggaact 420 caatgactct atcactattc agagc 445 <210> SEQ ID NO 40 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 40 gaggaataaa ccatggaagc tcgtcgttct 30 <210> SEQ ID NO 41 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 41 agaacgacga gcttccatgg tttattcctc 30 <210> SEQ ID NO 42 <400> SEQUENCE: 42 000 <210> SEQ ID NO 43 <400> SEQUENCE: 43 000 <210> SEQ ID NO 44 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 44 ctcgtacagg ctcaggatag 20 <210> SEQ ID NO 45 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 45 ttacgtccca acgctcaact 20 <210> SEQ ID NO 46 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 46 cttcggcaac gcatggaaat 20 <210> SEQ ID NO 47 <400> SEQUENCE: 47 000

Claims

1-124. (canceled)

125. A method of producing isoprene, the method comprising: (a) culturing cells comprising a heterologous nucleic acid encoding an isoprene synthase polypeptide under suitable culture conditions for the production of isoprene; (b) removing a portion of the culture; (c) filtering the removed portion of the culture to produce a permeate and a retentate; (d) returning the retentate to the culture; and (e) producing isoprene; wherein the cultured cells undergoing steps (b), (c), and (d) either produce isoprene at a higher titer, or have greater average volumetric productivity of isoprene than the same cells cultured without undergoing steps (b), (c), and (d).