U.S. patent application number 14/454854 was filed with the patent office on 2015-01-29 for method and kit for detection of cancer, and therapeutic agent for cancer.
This patent application is currently assigned to Sapporo Medical University. The applicant listed for this patent is Sapporo Medical University. Invention is credited to Kohzoh Imai, Yasuhisa Shinomura, Hiromu Suzuki, Takashi Tokino, Minoru Toyota.
Application Number | 20150031033 14/454854 |
Document ID | / |
Family ID | 41264558 |
Filed Date | 2015-01-29 |
United States Patent
Application |
20150031033 |
Kind Code |
A1 |
Suzuki; Hiromu ; et
al. |
January 29, 2015 |
METHOD AND KIT FOR DETECTION OF CANCER, AND THERAPEUTIC AGENT FOR
CANCER
Abstract
The object aims to comprehensively analyze miRNA that undergoes
epigenetic silencing in cancer to identify miRNA associated with
cancer, elucidate the role of the identified miRNA in cancer, and
develop a novel method for detecting cancer and a novel therapeutic
agent for cancer both of which relate to the miRNA. Disclosed is a
method for detecting cancer in a subject, which comprises detecting
methylated CpG in a CpG island located in a promoter region of a
microRNA 34b gene and/or a microRNA 34c gene in a biological sample
collected from the subject. Also disclosed is a therapeutic agent
for cancer, which comprises a nucleic acid encoding a BTG4 gene or
BTG4, or comprises a nucleic acid encoding a miR-34b gene and/or an
miR-34c gene or miR-34b and/or miR-34c.
Inventors: |
Suzuki; Hiromu;
(Sapporo-shi, JP) ; Toyota; Minoru; (Sapporo-shi,
JP) ; Imai; Kohzoh; (Sapporo-shi, JP) ;
Shinomura; Yasuhisa; (Sapporo-shi, JP) ; Tokino;
Takashi; (Sapporo-shi, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Sapporo Medical University |
Sapporo-shi |
|
JP |
|
|
Assignee: |
Sapporo Medical University
Sapporo-shi
JP
|
Family ID: |
41264558 |
Appl. No.: |
14/454854 |
Filed: |
August 8, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12991335 |
Feb 9, 2011 |
8841268 |
|
|
PCT/JP2009/002007 |
May 7, 2009 |
|
|
|
14454854 |
|
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12N 2320/10 20130101;
C12Q 2600/154 20130101; C12N 15/113 20130101; A61K 31/711 20130101;
C12N 2330/10 20130101; C12Q 1/6886 20130101; A61K 31/7105 20130101;
C12Q 2600/118 20130101; A61P 43/00 20180101; C07K 14/47 20130101;
C12Q 2600/178 20130101; A61P 35/00 20180101; C12N 2310/141
20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Foreign Application Data
Date |
Code |
Application Number |
May 7, 2008 |
JP |
2008-121671 |
Claims
1. Method of detecting a cancer in a subject, comprising: detecting
a methylated CpG in a CpG island in a promoter region of
microRNA34b gene and/or microRNA34c gene in a biological sample
obtained from the subject.
2. The method according to claim 1, wherein the cancer is detected
according to a criteria that the methylated CpG in the CpG island
in the promoter region of microRNA34b and/or microRNA34c gene in
the biological sample obtained from the subject is at least more
than 10% of all CpGs in the CpG island in the promoter region of
microRNA34b gene and/or microRNA34c gene in said biological sample
obtained from the subject.
3. The method according to claim 1, wherein the CpG island in the
promoter region of microRNA34b gene and/or microRNA34c gene is a
DNA region having a nucleotide sequence that is identical to or
substantially identical to the nucleotide sequence of SEQ ID
NO:5.
4. The method according to claim 1, wherein the cancer is
colorectal cancer, gastric cancer, pancreatic cancer or breast
cancer.
5. The method according to claim 1, wherein the biological sample
is one or more selected from a group consisting of serum, stool,
colon tissue, gastric lavage fluid, pancreatic juice and bile.
6. The method according to claim 1, wherein the methylated CpG is
detected using one or more procedures selected from the group
consisting of methylation-specific PCR, bisulfite sequencing,
pyro-sequencing, COBRA, and MethyLight.
7. The method according to claim 6, wherein the methylated CpG is
detected using a sense primer comprising successive 15 to 40
nucleotides of a nucleotide sequence that is identical to or
substantially identical to the nucleotide sequence of SEQ ID NO:5,
and an antisense primer comprising successive 15 to 40 nucleotides
of a nucleotide sequence that is complementary to a nucleotide
sequence that is identical to or substantially identical to the
nucleotide sequence of SEQ ID NO:5.
8. The method according to claim 6, wherein the methylated CpG is
detected using an oligonucleotide having a nucleotide sequence of
any one of SEQ ID NO:10, 11, 13, 14, 15, 17, 18, 19 and 20.
9. A kit for detecting cancer, for predicting the stage of cancer,
for predicting a risk of carcinogenesis, and/or for predicting a
risk of recurrence, comprising: (i) a sense primer comprising
successive 15 to 40 nucleotides of a nucleotide sequence that is
identical to or substantially identical to the nucleotide sequence
of SEQ ID NO:5, and an antisense primer comprising successive 15 to
40 nucleotides of a nucleotide sequence that is complementary to a
nucleotide sequence that is identical to or substantially identical
to the nucleotide sequence of SEQ ID NO:5; or (ii) an
oligonucleotide having a nucleotide sequence of any one of SEQ ID
NOs:10, 11, 13, 14, 15, 17, 18, 19 and 20.
10. (canceled)
11. A kit for cancer detection for detecting a cancer by the method
according to claim 1, comprising: (i) a sense primer comprising
successive 15 to 40 nucleotides of a nucleotide sequence that is
identical to or substantially identical to the nucleotide sequence
of SEQ ID NO:5, and an antisense primer comprising successive 15 to
40 nucleotides of a nucleotide sequence that is complementary to a
nucleotide sequence that is identical to or substantially identical
to the nucleotide sequence of SEQ ID NO:5: or (ii) an
oligonucleotide having a nucleotide sequence of any one of SEQ ID
NOs:10, 11, 13, 14, 15, 17, 18, 19 and 20.
12-20. (canceled)
21. The method according to claim 1, wherein the method is
practiced using the kit according to claim 9.
Description
RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 12/991,335, filed Nov. 5, 2010, which is a national stage
filing under 35 U.S.C. .sctn.371 of international application
PCT/JP2009/002007, filed May 7, 2009, the disclosures of which are
incorporated by reference herein in their entireties.
FIELD OF THE INVENTION
[0002] The present invention is directed to methods of detecting
cancer and kits for detecting cancer, as well as therapeutic agents
for cancer.
BACKGROUND ARTS
[0003] MicroRNA (hereinbelow may be referred to as miRNA) is a
short non-coding RNA of 21 to 22 bases. A precursor, primary miRNA,
is processed by Drosha to produce a pre-miRNA, which is further
processed by RISC complex comprising DICER to produce a mature
miRNA. It then interferes with mRNA-to-protein translation of
numerous target genes that are homologous to itself, suppressively
controlling expression of various genes (FIG. 1).
[0004] Recently, since the involvement of miRNA in cancer was
suggested, intensive studies focused on the relation between cancer
and miRNA have been made, beginning to reveal the critical role of
miRNA in cancer to control the expression of oncogenes and tumor
suppressor genes. It has been shown that expression of many miRNAs
is decreased in tumor tissue compared to in normal tissue (see,
non-patent references 1 and 2). It is also reported that certain
type of miRNA whose expression is decreased in tumor cell functions
in a manner like a tumor suppressor gene by suppressing expression
of oncogenes (see, non-patent reference 3). On the other hand,
there has been reports suggesting, for those miRNAs that are
overexpressed in tumor tissue, that oncogenes induce their
expression, and that they function in an oncogene-like manner being
involved in tumor formation (see, non-patent references 4 and
5).
[0005] Besides, studies have also been made to approach to the
relation between miRNA and cancer from the aspect that miRNA
functions as the target for tumor suppressor genes and oncogenes.
For instance, an oncogene product Myc targets miR17-92, a miRNA
cluster gene which is highly expressed in B cell lymphoma, and
induces its expression (see, non-patent references 4 and 5). On the
other hand, a tumor suppressor gene product p53 directly targets
miRNA genes of miR-34 family consisting of miR-34a, miR-34b and
miR-34c, and it has been shown that p53 is bound to p53-binding
site located in the promoter region of miR-34a gene and miR-34b/c
gene, thereby controlling the expression of each miRNA of miR-34
family (see, non-patent reference 6). Furthermore, each miRNA of
miR-34 has been shown to have an effect of suppressing cell
proliferation and inducing G1 arrest (see, non-patent references 6
and 7).
[0006] As described above, intensive studies have been made on the
involvement of miRNA in cancer, and from their results it has been
considered that miRNA analysis in cancer is important in order not
only to elucidate the mechanism of carcinogenesis but also to
obtain a basic knowledge for developing novel methods for diagnosis
and treatment of cancer.
[0007] Meanwhile, inactivation of tumor suppressor gene is
considered to be one factor of cancer development and/or
progression, and a widely known mechanism of it is epigenetic
suppression of gene expression (silencing). Particularly, cytosine
methylation of a CpG (DNA methylation) in the region of
transcription initiation of a gene is a phenomenon observed in
almost any cancer. Many of the known tumor suppressor genes are
reported to be silenced by DNA methylation. Recent discoveries of a
series of genes that are specifically DNA-methylated in cancer
imply that DNA methylation in cancer is as important as mutation
and deletion as mechanism of genetic abnormalities associated with
cancer development and/or progression. In the context of the
aforementioned involvement of miRNA in cancer, studies have
gradually been made on the relation between the silencing of miRNA
by methylation and cancer (see, non-patent references 8 and 9).
[0008] Nevertheless, although there are hundreds of miRNAs, only a
few among them have been implicated in specific cancer for their
DNA methylation, and, many miRNAs are not even described for the
specific function of their own. Therefore, most of miRNAs are yet
to be analyzed in detail about their involvement in the epigenetic
control of gene expression in cancer, and a large part thereof is
still unclear. [0009] [Non-patent reference 1] Lu J. et al.,
Nature, 435: 834-838, 2005 [0010] [Non-patent reference 2] Thomson
J. M. et al., Genes & Development, 20: 2202-2207, 2006 [0011]
[Non-patent reference 3] Johnson S. M. et al., Cell, 120: 635-647,
2005 [0012] [Non-patent reference 4] He L. et al., Nature, 435:
823-833, 2005 [0013] [Non-patent reference 5] O'Donnell K. A. et
al., Nature, 435: 839-843, 2005 [0014] [Non-patent reference 6] He
L. et al., Nature, 447: 1130-1134, 2007 [0015] [Non-patent
reference 7] Corney D. C. et al., Cancer Research, 67: 8433-8438,
2007 [0016] [Non-patent reference 8] Lujambio A. et al., Cancer
Research, 67: 1424-1429, 2007 [0017] [Non-patent reference 9]
Lujambio A. et al., Cell Cycle, 15: 1455-1459, 2007
DISCLOSURE OF THE INVENTION
Problems to be Solved by the Invention
[0018] Accordingly, the object of the present invention is to
identify a miRNA that is related to cancer, to elucidate its role
in cancer, and to provide a novel method of detecting cancer and a
therapeutic agent for cancer associated with said miRNA, by
performing a global analysis of miRNAs that undergo epigenetic
silencing in cancer.
Means to Solve the Problem
[0019] The inventors therefore made an intensive investigation to
achieve the object above, and identified for the first time miR-34b
and miR-34c as miRNAs whose expression are decreased under the
control by epigenetic gene silencing in tumor cell-specific manner,
and discovered that DNA methylation of CpG island in the promoter
region of their genes is scarcely observed in normal tissue, but is
at high level in tumor tissue. From these findings, the inventors
discovered that the detection of cancer in a subject is enabled by
detecting methylated CpG in the CpG island in the promoter regions
of miR-34b gene and/or miR-34c gene in a biological sample obtained
from the subject, thereby completed the invention. The inventors
further carried on the investigation based on these findings, and
thus discovered that miR-34b and miR-34c target oncogenes,
cell-cycle regulatory genes, etc., and suppress their expression.
The inventors further discovered that the CpG island in the
promoter region of miR-34b gene and/or miR-34c gene also functions
as the promoter for BTG4 gene, which is transcribed in opposite
direction to miR-34b and miR-34c, and discovered for the first time
that the expression of BTG4 gene is decreased by epigenetic
silencing in cancer cell, and that its gene product BTG4 has an
ability of suppressing cell proliferation, thereby completed the
cancer therapeutic agent of the invention.
[0020] Thus, the present invention is directed to a method of
detecting a cancer in a subject, the method comprising:
[0021] detecting a methylated CpG in a CpG island in a promoter
region of microRNA34b gene and/or microRNA34c gene in a biological
sample obtained from the subject.
[0022] The present invention is also directed to said method
wherein the cancer is detected according to a criteria that the
methylated CpG in CpG island in the promoter region of microRNA34b
and/or microRNA34c gene in the biological sample obtained from the
subject are at least more than 10% of all CpGs in the CpG island in
the promoter region of microRNA34b gene and/or microRNA34c gene in
said biological sample obtained from the subject.
[0023] The present invention is further directed to said method
wherein the CpG island in the promoter region of microRNA34b gene
and/or microRNA34c gene is a DNA region having a nucleotide
sequence that is identical to or substantially identical to the
nucleotide sequence of SEQ ID NO:5.
[0024] The present invention is also directed to said method
wherein the cancer is colorectal cancer, gastric cancer, pancreatic
cancer or breast cancer.
[0025] Further, the present invention is also directed to said
method wherein the biological sample is one or more selected from a
group consisting of serum, stool, colon tissue, gastric lavage
fluid, pancreatic juice and bile.
[0026] The invention is also directed to said method wherein the
methylated CpG is detected using one or more procedures selected
from the group consisting of methylation-specific PCR, bisulfite
sequencing, pyro-sequencing, COBRA, and MethyLight.
[0027] Furthermore, the present invention is directed to said
method wherein the methylated CpG is detected using a sense primer
comprising successive 15 to 40 nucleotides of a nucleotide sequence
that is identical to or substantially identical to the nucleotide
sequence of SEQ ID NO:5, and an antisense primer comprising
successive 15 to 40 nucleotides of a nucleotide sequence that is
complementary to a nucleotide sequence that is identical to or
substantially identical to the nucleotide sequence of SEQ ID
NO:5.
[0028] The present invention is further directed to said method
wherein the methylated CpG is detected using an oligonucleotide
having a nucleotide sequence of any one of SEQ ID NOs:10, 11, 13,
14, 15, 17, 18, 19 and 20.
[0029] Moreover, the present invention is directed to a kit for
cancer detection comprising a sense primer comprising successive 15
to 40 nucleotides of a nucleotide sequence that is identical to or
substantially identical to the nucleotide sequence of SEQ ID NO:5,
and an antisense primer comprising successive 15 to 40 nucleotides
of a nucleotide sequence that is complementary to a nucleotide
sequence that is identical to or substantially identical to the
nucleotide sequence of SEQ ID NO:5.
[0030] The present invention is also directed to a kit for cancer
detection comprising an oligonucleotide having a nucleotide
sequence of any one of SEQ ID NOs:10, 11, 13, 14, 15, 17, 18, 19
and 20.
[0031] The present invention is further directed to a kit for
cancer detection for detecting a cancer by any one of foregoing
methods, the kit comprising a sense primer comprising successive 15
to 40 nucleotides of a nucleotide sequence that is identical to or
substantially identical to the nucleotide sequence of SEQ ID NO:5,
and an antisense primer comprising successive 15 to 40 nucleotides
of a nucleotide sequence that is complementary to a nucleotide
sequence that is identical to or substantially identical to the
nucleotide sequence of SEQ ID NO:5.
[0032] Furthermore, the present invention is directed to a kit for
cancer detection for detecting a cancer by any one of foregoing
methods, the kit comprising an oligonucleotide having a nucleotide
sequence of any one of SEQ ID NOs:10, 11, 13, 14, 15, 17, 18, 19
and 20.
[0033] The invention is also directed to a cancer therapeutic agent
comprising a nucleic acid encoding BTG4 gene.
[0034] The invention is further directed to said cancer therapeutic
agent wherein the nucleic acid encoding BTG4 gene is a nucleic acid
encoding a protein having an amino acid sequence that is identical
to or substantially identical to an amino acid sequence of SEQ ID
NO:21.
[0035] Furthermore, the present invention is directed to a cancer
therapeutic agent comprising BTG4.
[0036] The present invention is also directed to said cancer
therapeutic agent wherein BTG4 is a protein having an amino acid
sequence that is identical to or substantially identical to an
amino acid sequence of SEQ ID NO:21.
[0037] Moreover, the present invention is directed to a cancer
therapeutic agent comprising a nucleic acid encoding microRNA34b
gene and/or microRNA34c gene.
[0038] The present invention is also directed to said cancer
therapeutic agent wherein the nucleic acid encoding microRNA34b
gene is encoding a polynucleotide sequence that is identical to or
substantially identical to a polynucleotide sequence of SEQ ID
NO:1, and the nucleic acid encoding microRNA34c gene is encoding a
polynucleotide sequence that is identical to or substantially
identical to a polynucleotide sequence of SEQ ID NO:3.
[0039] The present invention is further directed to a cancer
therapeutic agent comprising microRNA34b and/or microRNA34c.
[0040] Furthermore, the present invention is directed to said
cancer therapeutic agent wherein microRNA34b has a polynucleotide
sequence that is identical to or substantially identical to a
polynucleotide sequence of SEQ ID NO:2, and microRNA34c has a
polynucleotide sequence that is identical to or substantially
identical to a polynucleotide sequence of SEQ ID NO:4.
The Effects Exhibited by the Invention
[0041] The method of detecting cancer according to the present
invention is based on the detection of a methylated CpG in a CpG
island in a promoter region of miR-34b and/or miR-34c gene in a
biological sample obtained from a subject. While the expression of
miR-34b and/or miR-34c gene is kept high in normal tissue, it is
decreased in tumor tissue-specific manner. The present invention,
which detects the methylated CpG in the CpG island in the promoter
region that directly control the expression of miR-34b and miR-34c,
therefore permit an extremely accurate detection of cancer.
Furthermore, the biological sample used for detection can be a
tissue or tumor tissue obtained from the subject, such as colon
tissue or colorectal tumor tissue, gastric tissue or gastric tumor
tissue, as well as serum, stool, gastric lavage fluid, pancreatic
juice and bile, which are relatively readily available and thereby
facilitates cancer detection using the method of the present
invention. Furthermore, the method according to the present
invention can be carried out using methods such as
methylation-specific PCR, bisulfite sequencing, pyro-sequencing,
COBRA, MethyLight, and thus able to generate a detection result
with high accuracy at high detection sensitivity in short time
using extremely small amount of biological sample, thereby
decreasing the subject's burden, and also contributes to early
finding of cancer, predicting the stage of cancer, predicting a
risk of recurrence of cancer, predicting a risk of
carcinogenesis.
[0042] Also, similarly, the kit for cancer detection according to
the present invention permits an easy detection of cancer with
favorable accuracy, based on the fact that the target of detection,
i.e., a methylated CpG in a CpG island in a promoter region of
miR-34b and/or miR-34c gene, is specifically increased in tumor
tissue but scarcely observed in normal tissue, and it is suitable
for detecting cancer at extremely early stages, for monitoring
recurrence of cancer, for detecting a risk of carcinogenesis, and
for predicting the stage of cancer. In addition, the method and kit
of the present invention are also useful in combination with other
examination methods such as endoscopy, the combination would permit
obtaining even more accurate examination result.
[0043] Furthermore, the therapeutic agent of the present invention
comprises BTG4 or a nucleic acid encoding BTG4 gene, or miR-34b
and/or miR-34c or a nucleic acid encoding miR-34b gene and/or
miR-34c gene. The therapeutic agent of the present invention
therefore is capable of suppressing proliferation of cancer cells
through introducing BTG4 or miR-34b and/or miR-34c into a cancer
cell, or expressing BTG4 gene or miR-34b and/or miR-34c gene in a
cancer cell, providing an outstanding therapeutic effect.
Furthermore, the expression of BTG4 or BTG4 gene, or miR-34b and/or
miR-34c or miR-34b gene and/or miR-34c gene contained in the
therapeutic agent of the present invention is being suppressed in
tumor tissue while they are highly expressed in normal tissue. The
therapeutic agent of the present invention therefore permits the
tumor cell-specific recovery of the expression of gene or gene
product that are being deactivated due to epigenetic abnormalities,
while it causes no toxic effects on normal tissue, but exhibiting
specific effect in target tumor tissue in needs of the treatment,
with little side effect and high safety. It also serves for
developing more effective therapy with less side effect.
The Best Mode for Performing the Present Invention
[0044] The present invention is described in detail
hereinbelow.
[0045] Unless otherwise stated herein, scientific and technical
terms used in the context of the present invention have the
meanings that are normally understood by a person with ordinary
skill in the art. In general, terms and techniques used in the
context of cell and tissue culture, molecular biology, immunology,
microbiology, genetics and protein and nucleic chemistry are well
known and normally used in the art. Also, unless otherwise stated,
the methods and techniques of the present invention are carried out
according to routine procedures that are well known in the art, as
described in various general and more specialized references cited
and discussed herein. Such references include, for example,
Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed.,
Cold Spring Harbor Laboratory Press (1989) and Sambrook et al.,
Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor
Press (2001); Ausubel et al., Current Protocols in Molecular
Biology, Greene Publishing Associates (1992, and supplementary of
2000); Ausubel et al., Short Protocols in Molecular Biology: A
Compendium of Methods from Current Protocols in Molecular
Biology--4.sup.th Ed., Wiley & Sons (1999); Harlow and Lane,
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory
Press (1990); and Harlow and Lane, Using Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory Press (1999).
[0046] The terms as well as experimental procedures and techniques
described herein in the context of analytical chemistry, synthetic
organic chemistry, and pharmaceutical chemistry and medicinal
chemistry are well known and normally used in the art. Standard
techniques are used in chemical synthesis, chemical analysis,
production, formulation and delivery of an agent, and treatment of
a subject.
[0047] The term "subject" in the present invention means any
individual of an organism, preferably a vertebrate, more preferably
a mammal, still more preferably a human individual. In the present
invention, the subject may be healthy or having some diseases,
although where treatment for cancer is contemplated, a subject,
e.g., a rodent such as mouse, rat, gerbil, guinea pig; a Felidae
animal such as cat, puma, tiger; a Cervidae animal such as deer and
elk; and a rabbit, dog, mink, sheep, goat, bovine, equine, monkey,
human, etc., having or being experimentally made to have the
disease is preferred.
[0048] Herein, unless otherwise stated, name of a protein is
described in alphabets (or alphabets and digits), a gene encoding
the protein is described by adding "gene" after said description in
alphabets (or alphabets and digits) or by underlining said
description in alphabets (or alphabets and digits). Therefore,
unless otherwise stated, a simple description of "BTG4", for
instance, means the protein itself of BTG4 (B cell translocation
gene 4), whereas the description of "BTG4 gene" or "BTG4"
(underlined) means a gene that encodes BTG4.
[0049] Also, with respect to the description of a microRNA (miRNA),
when the miRNA itself is meant, its name is described, whereas when
a DNA encoding it is meant, "gene" is added after the name, or the
name is underlined. Therefore, unless otherwise stated, by
"microRNA34b" or "miR-34b", miRNA itself of microRNA34b is meant,
whereas by "microRNA34b gene" or "miR-34b gene" a DNA that encodes
miRNA34b is meant, and by "miRNA-34b" (underlined), a DNA that
encodes miRNA34b is meant too.
[0050] In the present invention, a method of detecting cancer in a
subject is provided, the method comprising:
[0051] detecting a methylated CpG in a CpG island in a promoter
region of miR-34b gene and/or miR-34c gene in a biological sample
obtained from the subject.
[0052] As used herein, microRNA34b (also as described as miRNA-34b
herein) and microRNA34c (also as described as miRNA-34c herein) are
miRNAs derived from single precursor RNA transcribed from
chromosome 11q23.1 in human. Examples of miRNA-34b include those
encoded by a DNA sequence that is identical to or substantially
identical to a DNA sequence of SEQ ID NO:1 (precursor miRNA-34b),
and a matured type of miRNA-34b includes those having an RNA
nucleotide sequence that is identical to or substantially identical
to a nucleotide sequence of: UAGGCAGUGUCAUUAGCUGAUUG (SEQ ID NO:2)
(miRNA accession number MI0000742).
[0053] Examples of miRNA-34c include those encoded by a DNA
sequence that is identical to or substantially identical to a DNA
sequence of SEQ ID NO:3 (precursor miRNA-34c), and a matured type
of miRNA-34c includes those having an RNA sequence that is
identical to or substantially identical to a nucleotide sequence
of: AGGCAGUGUAGUUAGCUGAUUGC (SEQ ID NO:4) (miRNA accession number
MI0000743).
[0054] Here, a DNA sequence that is substantially identical to a
DNA sequence of SEQ ID NO:1 or 3 can be, for example, a nucleotide
sequence having a homology of about 70% or more, preferably about
80% or more, more preferably about 90% or more, still more
preferably about 95% or more, most preferably about 98% and more to
a DNA nucleotide sequence of SEQ ID NO:1 or 3. Furthermore, in the
present invention, as precursor miRNA-34b that are encompassed by
miRNA-34b and encoded by the DNA sequence that is substantially
identical to the DNA sequence of SEQ ID NO:1, preferably used are
those which maintain the functions of the miRNA encoded by the
nucleotide sequence of SEQ ID NO:1 at substantially equal level.
Similarly, in the present invention, as precursor miRNA-34c that
are encompassed by miRNA-34c and encoded by a DNA sequence that is
substantially identical to the DNA sequence of SEQ ID NO:3,
preferably used are those which maintain the functions of the miRNA
encoded by the nucleotide sequence of SEQ ID NO:3 at substantially
equal level.
[0055] Also, similarly, a nucleotide sequence that is substantially
identical to the DNA sequence of SEQ ID NO:2 or 4 can be, for
example, a nucleotide sequence having a homology of about 70% or
more, preferably about 80% or more, more preferably about 90% or
more, still more preferably about 95% or more, most preferably
about 98% and more to the DNA sequence of SEQ ID NO:2 or 4.
Furthermore, in the present invention, as those encompassed by
miRNA-34b and have an RNA nucleotide sequence that is substantially
identical to the nucleotide sequence of SEQ ID NO:2, preferably
used are those which maintain the functions of a miRNA consisting
of the nucleotide sequence of SEQ ID NO:2, i.e., for example, the
suppressor function to the expression of oncogenes such as MET gene
and MYB gene, at substantially equal level. Similarly, in the
present invention, as those encompassed by miRNA-34c and have an
RNA nucleotide sequence that is substantially identical to the
nucleotide sequence of SEQ ID NO:4, preferably used are those which
maintain the functions of a miRNA consisting of the nucleotide
sequence of SEQ ID NO:4, i.e., for example, the suppressor function
to the expression of oncogenes such as MET gene and MYB gene, at
substantially equal level.
[0056] Furthermore, an miR-34b gene used in the present invention
includes, for example, a DNA comprising a nucleotide sequence of
SEQ ID NO:1, or a DNA comprising a nucleotide sequence that
specifically hybridizes to the nucleotide sequence of SEQ ID NO:1
under a stringent condition and encoding a miRNA having
substantially equal properties to a miRNA comprising the nucleotide
sequence of SEQ ID NO:2. Here, as a DNA comprising a nucleotide
sequence that specifically hybridizes to the nucleotide sequence of
SEQ ID NO:1 under a stringent condition, a DNA comprising a
nucleotide sequence having homology of about 60% or more,
preferably about 70% or more, more preferably about 80% or more,
still more preferably about 90% or more, particularly preferably
about 95% or more, most preferably about 98% or more, to a
nucleotide sequence that is complementary to the nucleotide
sequence of SEQ ID NO:1 may be used.
[0057] Similarly, an miR-34c gene used in the present invention
includes, for example, a DNA comprising a nucleotide sequence of
SEQ ID NO:3, or a DNA comprising a nucleotide sequence that
specifically hybridizes to the nucleotide sequence of SEQ ID NO:3
under a stringent condition and encoding a miRNA having
substantially equal properties to the miRNA comprising the
nucleotide sequence of SEQ ID NO:4. Here, as a DNA comprising a
nucleotide sequence that specifically hybridizes to the nucleotide
sequence of SEQ ID NO:3 under a stringent conditions, for example,
a DNA comprising a nucleotide sequence having homology of about 60%
or more, preferably about 70% or more, more preferably about 80% or
more, still more preferably about 90% or more, particularly
preferably about 95% or more, most preferably about 98% or more, to
a nucleotide sequence that is complementary to the nucleotide
sequence of SEQ ID NO:3 may be used.
[0058] A "stringent condition" herein are normally a condition of
42 degree Centigrade, 2.times.SSC and 0.1% SDS, preferably a
condition of 65 degree Centigrade, 0.1.times.SSC and 0.1% SDS.
[0059] Although the nucleotide sequence of miR-34b gene and/or
miR-34c gene may differ not only between different species but also
even within the same species, due to polymorphism, isoforms, etc.,
a gene having different nucleotide sequence is still encompassed by
miR-34b gene or miR-34c gene as long as it encodes miR-34b or
miR-34c.
[0060] In the present invention, the promoter region of miR-34b
and/or miR-34c gene is meant to refer to the region of 1000 bps in
full length, from the 5' end of miR-34b gene to its 1000 bps
upstream on chromosome, for example, in human, the region from the
5' end of miR-34b gene to 867 bps upstream thereof, particularly
preferably the region from the 5' end of miR-34b gene to 756 bps
upstream thereof.
[0061] In the present invention, a CpG island is a DNA region rich
in CpGs (i.e., where a cytosine is on 5' side and a guanine is on
3' side, being adjacent and bound to each other by phosphodiester
bond), wherein the CG content is 50% or more, and the ratio of
existing CpG is 60% or more of the expected amount.
[0062] A CpG island in a promoter region of miR-34b and/or miR-34c
gene can be used for the detection of cancer according to method of
the present invention without limitation as long as it corresponds
to the CpG island in the promoter region as described above, and
includes, for example, in the case of human, a region of 987 bps in
full length, from 748 bps upstream of the 5' end of miR-34b gene to
230 bps downstream of the 5' end of miR-34b gene. An exemplary
nucleotide sequence includes those of SEQ ID NO:5 or having
substantially identical nucleotide sequence thereto.
[0063] Among the CpG islands in the promoter region of human
miR-34b and/or miR-34c gene described above, a region of 262 bps in
full length from 111th to 372th nucleotide, for example, is
preferred in the method of cancer detection according to the
present invention. An example includes a region of 262 bps in full
length from 111th to 372th nucleotide of the nucleotide sequence of
SEQ ID NO:5 (the region consisting of the nucleotide sequence of
SEQ ID NO:6) or a region having a nucleotide sequence that is
substantially identical to it. More preferred is a region of 223
bps in full length from 144th to 366th nucleotide, and an example
includes a region of 223 bps in full length from 144th to 366th
nucleotide of the nucleotide sequence of SEQ ID NO:5 (the region
consisting of the nucleotide sequence of SEQ ID NO:7) or a region
having a nucleotide sequence that is substantially identical to it.
Most preferred is a region of 134 bps in full length from 214th to
347th nucleotide, and an example includes a region of 134 bps in
full length from 214th to 347th nucleotide of the nucleotide
sequence of SEQ ID NO:5 (the region consisting of the nucleotide
sequence of SEQ ID NO:8) or a region having a nucleotide sequence
that is substantially identical to it.
[0064] Here, a nucleotide sequence that is substantially identical
to a nucleotide sequence of SEQ ID NO:5, 6, 7 or 8 may include, for
example, a nucleotide sequence having homology of about 70% or
more, preferably about 80% or more, more preferably about 90% or
more, still more preferably about 95% or more, most preferably
about 98% or more, to the nucleotide sequence of SEQ ID NO:5, 6, 7
or 8.
[0065] Furthermore, the inventors have discovered that the promoter
region of miR-34b gene and/or miR-34c gene overlaps the promoter
region of BTG4 (B cell translocation gene 4) gene which is encoded
in opposite direction (antisense direction) to miR-34b gene and/or
miR-34c gene on the same chromosome (FIGS. 3B, 7 and 8A), and that
the CpG island located on the promoter region of miR-34b gene
and/or miR-34c gene has a promoter effect not only on miR-34b gene
and/or miR-34c gene but also on BTG4 gene (FIGS. 8A and B).
[0066] Accordingly, the method, provided by the present invention,
of detecting cancer in a subject comprising:
[0067] detecting a methylated CpG in a CpG island in a promoter
region of miR-34b gene and/or miR-34c gene in a biological sample
obtained from the subject can namely be described in other words as
a method of detecting cancer in a subject comprising:
[0068] detecting a methylated CpG in a CpG island in a promoter
region of BTG4 gene in a biological sample obtained from the
subject.
[0069] In the method of the present invention, "detecting a
methylated CpG" means detecting methylated cytosine in a DNA
nucleotide sequence (i.e., DNA methylation).
[0070] The method of the invention may, as long as the method
"comprises detecting a methylated CpG in a CpG island in a promoter
region of microRNA34b and/or microRNA34c gene in a biological
sample obtained from the subject", be carried out without any
limitation in terms of the measure by which it is determined that
cancer is present in the subject, and employ any criteria for
detecting cancer that is appropriately selected according to
individual situation and types of cancer. Nevertheless, because the
ratio of methylated CpGs in a CpG island is low in normal tissue
and high in tumor tissue, it is preferred to determine that cancer
is present in the subject based on the criteria that the methylated
CpGs in the CpG island in the biological sample obtained from the
subject are quantitatively greater compared to the methylated CpGs
in the CpG island in a biological sample obtained from a healthy
subject from the same species as said subject, or compared to the
methylated CpGs in the CpG island in a biological sample of the
control normal tissue obtained from the same individual as said
subject.
[0071] Moreover, according to the study by the inventors, it is
discovered that the methylated CpGs in a CpG island in a promoter
region of miR-34b gene and/or miR-34c gene share no more than 5 to
6% of total CpGs in the sample when the biological sample obtained
from the subject is a normal tissue, whereas they are well over
this when the biological sample obtained from the subject is a
tumor tissue, being often more than 50%. However, when a biopsy
specimen is used as the biological sample, which often contains an
admixture of tumor and normal tissue, the high value of the tumor
part is averaged with the low value of the normal tissue part, and
the ratio of methylated CpGs in total CpGs in the sample tends to
be expressed low even when cancer is actually present. Accordingly,
in more suitable embodiments, the method of the present invention
may detect cancer and determine the presence of cancer according to
the criteria that the methylated CpGs in the CpG island in the
promoter region of miR-34b and/or miR-34c gene in the biological
sample obtained from the subject is at least more than 8%,
preferably at least 10%, more preferably at least 20%, still more
preferably at least 30% of total CpGs in the CpG island in said
region in said biological sample obtained from the subject (i.e.,
total alleles in said sample).
[0072] In the method of the present invention, the detection of
methylated CpGs may be carried out by any means without limitation,
although it is preferred to use a known method for detecting DNA
methylation (a methylated cytosine) such as methylation-specific
PCR, bisulfite sequencing, pyro-sequencing, COBRA, and MethyLight,
and any one of those methods may be used alone or in combination of
two or more. Among foregoing methods, MethyLight is particularly
preferably used for its ability of detecting methylation from a
small amount of specimen with high sensitivity. Pyro-sequencing is
also particularly preferably used when quantitative detection of
methylation is aimed.
[0073] Methylation-specific PCR utilizes the difference in
sensitivity to the cytosine-to-uracil conversion in the presence or
absence of methylation, generating primers specific to methylated
allele and unmethylated allele, amplifying and detecting them by
PCR for detection. The obtained PCR product is subjected to
electrophoresis on an agarose gel, stained with ethidium bromide,
then the presence of methylation is determined by the presence of
bands (see, Methods Mol Med. 2005; 113: 279-91, and Suzuki, H.,
Toyota, M. and K. Imai, "Bisulfite PCR: Shin Idenshi Kogaku
Handbook", 4th edition, Muramatsu, M. and T. Yamamoto eds.,
Yodo-sha, pp 99-106, 2003).
[0074] Bisulfite sequencing utilizes bisulfite-treated DNAs to
amplifies methylated and unmethylated alleles at the same time, and
obtained PCR products are cloned into e.g., TOPO-cloning vector
(Invitrogen), and then the presence or absence of methylation is
detected by sequencing. It has an advantage that the methylation of
all CpG sequences within the amplified region can be determined,
although it may not be suitable for manifold analysis due to its
requirement for heavy work for analysis (see, Methods. 2002 Jun.;
27(2): 101-7, and Suzuki, H., Toyota, M. and K. Imai, "Bisulfite
PCR: Shin Idenshi Kogaku Handbook", 4th edition, Muramatsu, M. and
T. Yamamoto eds., Yodo-sha, pp 99-106, 2003).
[0075] Pyro-sequencing uses bisulfite-treated DNAs to amplify
methylated and unmethylated alleles at the same time, then analyzes
obtained PCR products by pyro-sequencing. The ratio of methylation
is detected as the polymorphism of cytosine and thymine, calculated
as [fluorescent intensity of cytosine/the sum of fluorescent
intensities of cytosine and thymine]. It is useful as a
quantitative and high-throughput methylation analysis (see, Nat
Protoc. 2007; 2(9):2265-75).
[0076] COBRA method uses bisulfite-treated DNAs to amplify
methylated and unmethylated alleles at the same time, and obtained
PCR products are digested with restricted enzymes, then subjected
to electrophoresis on an agarose gel, stained with ethidium
bromide, and the presence or absence of methylation is determined
according to the presence or absence of the bands cleaved by
restriction enzymes (see, Methods Mol Biol. 2002; 200:71-85, and
Suzuki, H., Toyota, M. and K. Imai, "Bisulfite PCR: Shin Idenshi
Kogaku Handbook", 4th edition, Muramatsu, M. and T. Yamamoto eds.,
Yodo-sha, pp 99-106, 2003).
[0077] MethyLight method detects methylated alleles using
methylation-specific PCR combined with TaqMan PCR. It is capable of
highly sensitive detection of methylation, and is useful in
detection of methylation from small amount of specimen (see,
Methods. 2001 Dec.; 25(4):456-62).
[0078] When using methylation-specific PCR, bisulfite sequencing,
pyro-sequencing, COBRA and MethyLight, an unmethylated cytosine is
specifically converted to an uracil whereas a methylated cytosine
is not converted to an uracil due to bisulfite treatment.
Accordingly, among the CpG islands in the promoter region of the
miR-34b gene and/or miR-34c gene, the region of SEQ ID NO:6, 7 or 8
is converted to SEQ ID NO:9, 12 or 16, respectively, due to
bisulfite treatment.
[0079] Accordingly, when the method of the present invention is
practiced by bisulfite sequencing using, for example, the region
described in SEQ ID NO:6 as the CpG island in the promoter region
of miR-34b gene and/or miR-34c gene, the sample is treated with
bisulfite to convert the sequence of SEQ ID NO:6 in the sample to a
sequence of SEQ ID NO:9, and the methylated CpGs in this
bisulfite-treated sequence can be detected by performing sequencing
using:
TABLE-US-00001 a forward primer: (SEQ ID NO: 10)
5'-GTTTTAAGAATTTGGGTTTTTATTTTTTAG-3' and a reverse primer: (SEQ ID
NO: 11) 5'-CAAACTTCAATTCCCAACCCCAAAC-3'.
[0080] Alternatively, when the method of the present invention is
practiced by pyro-sequencing using, for example, the region
described in SEQ ID NO:7 as the CpG island in the promoter region
of miR-34b gene and/or miR-34c gene, the sample is treated with
bisulfite to convert the sequence of SEQ ID NO:7 in the sample to a
sequence of SEQ ID NO:12, and the methylated CpGs in this
bisulfite-treated sequence can be detected by performing PCR
using:
TABLE-US-00002 a forward primer: (SEQ ID NO: 13)
5'-TTAGTTTTTAGTTTTAAATTTTAGAGTTGG-3' and a reverse primer: (SEQ ID
NO: 14) 5'-TCTCCCTTAAAAACCCTTCAAAAACC-3', and further sequencing
using: a sequencing primer: (SEQ ID NO: 15)
5'-TAATYGTTTTTGGAATTT-3'.
[0081] When DNA methylation analysis is performed by
pyro-sequencing using foregoing primers, the antisense chain
obtained by treating the sequence of SEQ ID NO:7 with bisulfite (a
nucleotide sequence of SEQ ID NO:12) is amplified for the analysis.
Because bisulfite treatment unties the double-strand of a DNA into
single-strands before converting cytosines into uracils, the DNA
after the treatment no longer has a complementarity, and the PCR
products based on the sense chain and antisense chain after the
treatment are partly different in their sequences. This is a
phenomenon due to the chemical characteristics of bisulfite
treatment, and the analytical result should theoretically be
identical using either chain for performing PCR. A PCR primer is
normally designed based on the nucleotide sequence of the sense
chain of a gene. However, when there are any difficulties in PCR
amplification or sequencing due to some reasons such as the
presence of many repeat sequences, such technical difficulties may
to be removed by designing primers based on the nucleotide sequence
of the antisense chain, and pyro-sequencing above is one example of
such case (see, Working Example 7).
[0082] Accordingly, in the example of pyro-sequencing above, the
aforementioned forward primer (sense primer: SEQ ID NO:13) consists
of a sequence on the antisense side to the nucleotide sequence of
the CpG island in the promoter region of miR-34b gene and/or
miR-34c gene described in SEQ ID NO:7. Similarly, the
aforementioned reverse primer (antisense primer: SEQ ID NO:14)
consists of a sequence on the sense side to the nucleotide sequence
of the CpG island in the promoter region of miR-34b gene and/or
miR-34c gene described in SEQ ID NO:7. Moreover, the aforementioned
sequencing primer (SEQ ID NO:15) consists of a sequence on the
antisense side to the nucleotide sequence of the CpG island in the
promoter region of miR-34b gene and/or miR-34c gene described in
SEQ ID NO:7.
[0083] Furthermore, when the method of the present invention is
practiced by methylation-specific PCR using, for example, the
region described in SEQ ID NO:8 as the CpG island in the promoter
region of miR-34b gene and/or miR-34c gene, the sample is treated
with bisulfite to convert the sequence of SEQ ID NO:8 in the sample
to a sequence of SEQ ID NO:16, and the methylated CpGs in this
bisulfite-treated sequence can be detected based on the presence or
absence of a methylation-specific band or unmethylation-specific
band, by performing the methylation-specific reaction using:
TABLE-US-00003 a forward primer: (SEQ ID NO: 17)
5'-ATTCGTTTCGTTTCGCGTTCGTTTC-3' and a reverse primer: (SEQ ID NO:
18) 5'-CTAAAACTAACTCTCTCGACCCCG-3',
and further performing unmethylation-specific reaction using:
TABLE-US-00004 a forward primer: (SEQ ID NO: 19)
5'-TTTTTATTTGTTTTGTTTTGTGTTTGTTTTG-3' and a reverse primer: (SEQ ID
NO: 20) 5'-CCTAAAACTAACTCTCTCAACCCCA-3'.
[0084] In the present invention, the detection of methylated CpGs
above can also be carried out using a pair of primer that is
specific to the nucleotide sequence of the CpG island in the
promoter region of miR-34b gene and/or miR-34c gene, for example, a
sense primer comprising a part of a nucleotide sequence that is
identical to or substantially identical to a nucleotide sequence of
SEQ ID NO:5, 6, 7 or 8, and an antisense primer comprising a part
of a nucleotide sequence that is complementary to a nucleotide
sequence that is identical to or substantially identical to a
nucleotide sequence of SEQ ID NO:5, 6, 7 or 8. Here, the nucleotide
sequence that is substantially identical to the nucleotide sequence
of SEQ ID NO:5, 6, 7 or 8 includes, for example, a nucleotide
sequence having a homology of about 70% or more, preferably about
80% or more, more preferably about 90% or more, still more
preferably about 95% or more, most preferably about 98% or more, to
the nucleotide sequence of SEQ ID NO:5, 6, 7 or 8. The nucleotide
length of said primer is, for example, 15 to 40 nucleotides,
preferably 17 to 35 nucleotides.
[0085] Accordingly, in a preferred embodiment, the detection of
methylated CpG above according to the present invention is
performed using: a pair of primers specific to the nucleotide
sequence of the CpG island in the promoter region of miR-34b gene
and/or miR-34c gene, for example, a sense primer comprising
successive 15 to 40 nucleotides of a nucleotide sequence that is
identical to or substantially identical to a nucleotide sequence of
SEQ ID NO:5, and an antisense primer comprising successive 15 to 40
nucleotides of a nucleotide sequence that is complementary to a
nucleotide sequence that is identical to or substantially identical
to a nucleotide sequence of SEQ ID NO:5, more preferably using a
sense primer comprising successive 15 to 40 nucleotides of a
nucleotide sequence that is identical to or substantially identical
to a nucleotide sequence of SEQ ID NO:6, and an antisense primer
comprising successive 15 to 40 nucleotides of a nucleotide sequence
that is complementary to a nucleotide sequence that is identical to
or substantially identical to a nucleotide sequence of SEQ ID NO:6,
still more preferably using a sense primer comprising successive 15
to 40 nucleotides of a nucleotide sequence that is identical to or
substantially identical to a nucleotide sequence of SEQ ID NO:7,
and an antisense primer comprising successive 15 to 40 nucleotides
of a nucleotide sequence that is complementary to a nucleotide
sequence that is identical to or substantially identical to a
nucleotide sequence of SEQ ID NO:7, and particularly preferably
using a sense primer comprising successive 15 to 40 nucleotides of
a nucleotide sequence that is identical to or substantially
identical to a nucleotide sequence of SEQ ID NO:8, and an antisense
primer comprising successive 15 to 40 nucleotides of a nucleotide
sequence that is complementary to a nucleotide sequence that is
identical to or substantially identical to a nucleotide sequence of
SEQ ID NO:8.
[0086] Furthermore, in the present invention, when the sample is
treated with bisulfite, a DNA region within the sample having a
nucleotide sequence of SEQ ID NO:6, 7 or 8 is converted to a region
having a nucleotide sequence of SEQ ID NO:9, 12 or 16,
respectively. Therefore, the detection of methylated CpGs above
according to the present invention can be performed using,
preferably, a sense primer comprising successive 15 to 40
nucleotides of a nucleotide sequence that is identical to or
substantially identical to a nucleotide sequence of SEQ ID NO:9,
and an antisense primer comprising successive 15 to 40 nucleotides
of a nucleotide sequence that is complementary to a nucleotide
sequence that is identical to or substantially identical to a
nucleotide sequence of SEQ ID NO:9, more preferably using a sense
primer comprising successive 15 to 40 nucleotides of a nucleotide
sequence that is identical to or substantially identical to a
nucleotide sequence of SEQ ID NO:12, and an antisense primer
comprising successive 15 to 40 nucleotides of a nucleotide sequence
that is complementary to a nucleotide sequence that is identical to
or substantially identical to a nucleotide sequence of SEQ ID
NO:12, and particularly preferably using a sense primer comprising
successive 15 to 40 nucleotides of a nucleotide sequence that is
identical to or substantially identical to a nucleotide sequence of
SEQ ID NO:16, and an antisense primer comprising successive 15 to
40 nucleotides of a nucleotide sequence that is complementary to a
nucleotide sequence that is identical to or substantially identical
to a nucleotide sequence of SEQ ID NO:16.
[0087] Examples of particularly preferable combination of primers
used in the method of the present invention include:
[0088] a combination in which the sense primer is an
oligonucleotide having a nucleotide sequence of SEQ ID NO:10, and
the antisense primer is an oligonucleotide having a nucleotide
sequence of SEQ ID NO:11;
[0089] a combination in which the sense primer is an
oligonucleotide having a nucleotide sequence of SEQ ID NO:13, and
the antisense primer is an oligonucleotide having a nucleotide
sequence of SEQ ID NO:14;
[0090] a combination in which the sense primer is an
oligonucleotide having a nucleotide sequence of SEQ ID NO:17, and
the antisense primer is an oligonucleotide having a nucleotide
sequence of SEQ ID NO:18; and a combination in which the sense
primer is an oligonucleotide having a nucleotide sequence of SEQ ID
NO:19, and the antisense primer is an oligonucleotide having a
nucleotide sequence of SEQ ID NO:20.
[0091] Any one of the oligonucleotides having sequences of SEQ ID
NOs:10, 11, 13, 14, 15, 17, 18, 19 and 20 may preferably be used
for practicing the present invention, and in preferred embodiment,
for practicing the method of the present invention by
methylation-specific PCR, bisulfite sequencing and pyro-sequencing,
COBRA and MethyLight methods. For instance, an analysis by
bisulfite sequencing is carried out preferably using a combination
of PCR primers of the oligonucleotides having nucleotide sequences
of SEQ ID NOs:10 and 11; an analysis by pyro-sequence is carried
out preferably using a combination of PCR primers of the
oligonucleotides having nucleotide sequences of SEQ ID NOs:13 and
14. Also, an oligonucleotide having a nucleotide sequence of SEQ ID
NO:15 is preferably used as a sequencing primer for
pyro-sequencing. An analysis by methylation-specific PCR is carried
out preferably using a combination of PCR primers of the
oligonucleotides having nucleotide sequences of SEQ ID NOs:17 and
18 for methylation-specific reaction, and a combination of PCR
primers of the oligonucleotides having nucleotide sequences of SEQ
ID NOs:19 and 20 for unmethylation-specific reaction.
[0092] Furthermore, according to the present invention, a kit for
cancer detection is provided, the kit comprising a pair of
oligonucleotides which is a pair of primers that are specific to
nucleotide sequences of a CpG island in a promoter region of miR-34
gene and/or miR-34c gene as reagents for detecting or quantitating
the methylated CpGs in a biological sample collected from a
subject.
[0093] The primers comprised in the kit for cancer detection and
used for detecting or quantitating methylated CpGs include, for
example, a sense primer comprising a part of a nucleotide sequence
that is identical to or substantially identical to a nucleotide
sequence of SEQ ID NO:5, 6, 7 or 8, and an antisense primer
comprising a part of a nucleotide sequence that is complementary to
a nucleotide sequence that is identical to or substantially
identical to the nucleotide sequence of SEQ ID NO:5, 6, 7 or 8,
respectively. Here, the nucleotide sequence that is substantially
identical to the nucleotide sequence of SEQ ID NO:5, 6, 7 or 8
includes, for example, a nucleotide sequence having a homology of
about 70% or more, preferably about 80% or more, more preferably
about 90% or more, still more preferably about 95% or more, most
preferably about 98% or more, to the nucleotide sequence of SEQ ID
NO:5, 6, 7 or 8. The nucleotide length of said primer is, for
example, 15 to 40 nucleotides, preferably 17 to 35 nucleotides.
[0094] Accordingly, in a preferred embodiment, the oligonucleotides
contained in the kit of the present invention and used as the
reagent for detecting or quantitating methylated CpGs are, for
example, a sense primer comprising successive 15 to 40 nucleotides
of a nucleotide sequence that is identical to or substantially
identical to a nucleotide sequence of SEQ ID NO:5 and an antisense
primer comprising successive 15 to 40 nucleotides of a nucleotide
sequence that is complementary to a nucleotide sequence that is
identical to or substantially identical to a nucleotide sequence of
SEQ ID NO:5, preferably a sense primer comprising successive 15 to
40 nucleotides of a nucleotide sequence that is identical to or
substantially identical to a nucleotide sequence of SEQ ID NO:6 and
an antisense primer comprising successive 15 to 40 nucleotides of a
nucleotide sequence that is complementary to a nucleotide sequence
that is identical to or substantially identical to a nucleotide
sequence of SEQ ID NO:6, more preferably a sense primer comprising
successive 15 to 40 nucleotides of a nucleotide sequence that is
identical to or substantially identical to a nucleotide sequence of
SEQ ID NO:7 and an antisense primer comprising successive 15 to 40
nucleotides of a nucleotide sequence that is complementary to a
nucleotide sequence that is identical to or substantially identical
to a nucleotide sequence of SEQ ID NO:7, and particularly
preferably a sense primer comprising successive 15 to 40
nucleotides of a nucleotide sequence that is identical to or
substantially identical to a nucleotide sequence of SEQ ID NO:8 and
an antisense primer comprising successive 15 to 40 nucleotides of a
nucleotide sequence that is complementary to a nucleotide sequence
that is identical to or substantially identical to a nucleotide
sequence of SEQ ID NO:8.
[0095] The kit of the present invention for cancer detection is
suitable for detecting methylated CpGs in a CpG island in a
promoter region of miR-34b gene and/or miR-34c gene, and the method
of detecting cancer according to the present invention can
therefore be practiced using said kit.
[0096] Accordingly, the aforementioned primers can preferably be
used for practicing the method of the present invention using such
as methylation-specific PCR, bisulfite sequencing and
pyro-sequencing, COBRA and MethyLight methods as above. When using
these methods which involve bisulfite treatment of the sample, a
DNA region having a nucleotide sequence of SEQ ID NO:6, 7 or 8 in
the sample is converted, for example to a region having a
nucleotide sequence of SEQ ID NO:9, 12 or 16, respectively.
Therefore, in the kit of the present invention, examples of the
oligonucleotides used as the reagents for detecting or quantitating
methylated CpGs include, preferably, a sense primer comprising
successive 15 to 40 nucleotides of a nucleotide sequence that is
identical to or substantially identical to a nucleotide sequence of
SEQ ID NO:9 and an antisense primer comprising successive 15 to 40
nucleotides of a nucleotide sequence that is complementary to a
nucleotide sequence that is identical to or substantially identical
to a nucleotide sequence of SEQ ID NO:9, more preferably a sense
primer comprising successive 15 to 40 nucleotides of a nucleotide
sequence that is identical to or substantially identical to a
nucleotide sequence of SEQ ID NO:12 and an antisense primer
comprising successive 15 to 40 nucleotides of a nucleotide sequence
that is complementary to a nucleotide sequence that is identical to
or substantially identical to a nucleotide sequence of SEQ ID
NO:12, and particularly preferably a sense primer comprising
successive 15 to 40 nucleotides of a nucleotide sequence that is
identical to or substantially identical to a nucleotide sequence of
SEQ ID NO:16 and an antisense primer comprising successive 15 to 40
nucleotides of a nucleotide sequence that is complementary to a
nucleotide sequence that is identical to or substantially identical
to a nucleotide sequence of SEQ ID NO:16.
[0097] Moreover, according to the invention, a kit for cancer
detection is provided, the kit comprising one or more
oligonucleotides having a nucleotide sequence of any one of SEQ ID
NOs:10, 11, 13, 14, 15, 17, 18, 19 and 20 as reagents for detecting
or quantitating methylated CpGs in a biological sample collected
from a subject, and such kit can be used for practicing the method
of the present invention.
[0098] Further, examples of particularly preferred combination of
oligonucleotide contained in the kit of the invention include: the
combination of an oligonucleotide having a nucleotide sequence of
SEQ ID NO:10 and an oligonucleotide having a nucleotide sequence of
SEQ ID NO:11; a combination of an oligonucleotide having a
nucleotide sequence of SEQ ID NO:13 and an oligonucleotide having a
nucleotide sequence of SEQ ID NO:14, or a combination of an
oligonucleotide having a nucleotide sequence of SEQ ID NO:13, an
oligonucleotide having a nucleotide sequence of SEQ ID NO:14 and an
oligonucleotide having a nucleotide sequence of SEQ ID NO:15; a
combination of an oligonucleotide having a nucleotide sequence of
SEQ ID NO:17 and an oligonucleotide having a nucleotide sequence of
SEQ ID NO:18; and a combination of an oligonucleotide having a
nucleotide sequence of SEQ ID NO:19 and an oligonucleotide having a
nucleotide sequence of SEQ ID NO:20.
[0099] The foregoing oligonucleotides can be used for practicing
the method of the present invention by methylation-specific PCR,
bisulfite sequencing and pyro-sequencing, COBRA and MethyLight
methods as described above. Therefore, when the kit of the
invention is aimed for an analysis by bisulfite sequencing, for
example, it preferably comprises a combination of PCR primers of
the oligonucleotides having nucleotide sequences of SEQ ID NOs:10
and 11, when the kit is aimed for an analysis by pyro-sequencing,
it preferably comprises a combination of PCR primers of the
oligonucleotides having nucleotide sequences of SEQ ID NOs:13 and
14. Also, the kit may comprise an oligonucleotide having a
nucleotide sequence of SEQ ID NO:15 as a sequencing primer for
pyro-sequencing. When the kit is aimed for an analysis by
methylation-specific PCR, it is preferred that the kit comprises a
combination of PCR primers of the oligonucleotides having
nucleotide sequences of SEQ ID NOs:17 and 18 for
methylation-specific reaction and a combination of PCR primers of
the oligonucleotides having nucleotide sequences of SEQ ID NOs:19
and 20 for unmethylation-specific reaction.
[0100] The kit of the present invention for cancer detection may be
in any form, as long as it comprises one or more of aforementioned
oligonucleotides or primers, and may appropriately comprise
reagents, apparatuses, instruction, etc., and may comprise one or
more of solutions and apparatuses used for DNA extraction from a
biological sample such as tissue or cells (e.g., buffers for
tissue- or cell-lysis, phenol/chloroform, ethanol, etc.), reagents
necessary for PCR (e.g., H.sub.2O, buffer, MgCl.sub.2, dNTP
mixture, Taq polymerase, etc.), reagents necessary for quantitation
of PCR-amplified fragments (e.g., RI, fluorescent dye, etc.).
[0101] Also, in the present invention, a cancer refers to a
malignant tumor and encompasses those which are generally included
within the concept of cancer.
[0102] Moreover, a colorectal cancer encompasses those which are
generally included in the concept of colorectal cancer, including
malignant tumors generated from epithelial mucosa of large
intestine, as well as colon adenoma. A gastric cancer encompasses
those which are generally included within the concept of gastric
cancer, including malignant tumors generated from epithelial mucosa
of stomach. Further, a pancreatic cancer encompasses those which
are generally included within the concept of pancreatic cancer.
[0103] Furthermore, a breast cancer encompasses those which are
generally included within the concept of breast cancer, meaning
malignant tumors generated on mammary gland, fat layer and skin,
including invasive breast cancer, non-invasive breast cancer, and
those classified as Paget's disease.
[0104] In the present invention, as a "biological sample obtained
from the subject", for example, blood, serum, ascites, urine,
stool, gastric lavage fluid, pancreatic juice, bile, or digestive
tract tissue (stomach, small intestine, large intestine, pancreas,
etc.), tissue which constitutes a breast such as mammary gland, fat
layer or skin, secretion secreted from mammary gland, lavage fluid
secreted from mammary gland (ductal fluid) may be utilized without
specific limitation as long as detection of cancer is possible. The
expression levels of miR-34b gene and/or miR-34c gene are generally
high in any normal tissue and tend to be markedly decreased in
tumor tissue. Therefore, biological sample obtained from the
subject may appropriately be selected according to the object. For
instance, when the object is to detect a colorectal cancer, the
biological sample is preferably serum, stool or tissue of large
intestine; when the object is to detect a gastric cancer, the
sample is preferably serum, gastric lavage fluid or stomach tissue;
when the object is to detect a pancreatic cancer, the sample is
preferably serum, pancreatic juice or pancreatic tissue; when the
object is to detect a breast cancer, the sample is preferably
serum, tissues such as mammary gland, fat layer or skin which
constitutes breast, secretion secreted from mammary gland, lavage
fluid secreted from mammary gland (ductal fluid); and when the
object is to detect a bile duct cancer or gallbladder cancer, the
sample is preferably serum, bile, bile duct tumor tissue or
gallbladder tumor tissue.
[0105] Also, the biological sample that can be used in the method
of the present invention may be collected by any means, for
example, it may be collected by surgery, may be collected by
paracentesis needle for tissue collection, or may be collected as
pancreatic juice, bile, or gastric lavage fluid, secretion secreted
from mammary gland or lavage fluid secreted from mammary gland
(ductal fluid).
[0106] In practicing the method of the present invention, although
it is possible to directly carry out the detection of methylated
CpGs without any preliminary treatments, such as DNA extraction, to
the biological sample obtained from the subject, it is preferred to
extract DNA in the biological sample before detecting methylated
CpGs by aforementioned method, e.g., methylation-specific PCR,
bisulfite sequencing, pyro-sequencing, COBRA or MethyLight. Methods
of extracting DNA from biological sample are well known in the art,
and may be performed using, for example, phenol/chloroform,
ethanol, or commercially available DNA extraction reagents.
[0107] Furthermore, the inventors have discovered that miR-34b
and/or miR-34c exhibit a high expression level in normal tissue
while their expression is markedly suppressed in tumor tissue, and
that they suppress oncogenes such as MYB gene and MET gene and
cell-cycle regulatory genes such as CDK4 gene. Accordingly, since
miR-34b and/or miR-34c are considered to be effective for
suppressing proliferation or metastasis of cancer cells, the
present invention also provides a therapeutic agent for cancer
comprising miR-34b and/or miR-34c, as well as a therapeutic agent
for cancer comprising a nucleic acid encoding miR-34b gene and/or
miR-34c gene.
[0108] Here, as mentioned above, miR-34b includes specifically an
RNA encoded by a DNA sequence that is identical to or substantially
identical to a DNA sequence of SEQ ID NO:1 (precursor miRNA-34b),
as well as an RNA having a RNA nucleotide sequence that is
identical to or substantially identical to an RNA sequence of SEQ
ID NO:2 (matured type miRNA-34b), and miR-34c includes specifically
an RNA encoded by a DNA sequence that is identical to or
substantially identical to a DNA sequence of SEQ ID NO:3 (precursor
miRNA-34c), as well as an RNA having a RNA nucleotide sequence that
is identical to or substantially identical to an RNA sequence of
SEQ ID NO:4 (matured type miRNA-34c).
[0109] Also, a nucleic acid encoding miR-34b gene includes, for
example, a DNA comprising a nucleotide sequence of SEQ ID NO:1 or a
DNA comprising a nucleotide sequence that hybridizes to the
nucleotide sequence of SEQ ID NO:1 under a stringent condition and
encoding a miRNA having substantially equal properties to a miRNA
comprising a nucleotide sequence of SEQ ID NO:2. Similarly, a
nucleic acid encoding miR-34c gene includes, for example, a DNA
comprising a nucleotide sequence of SEQ ID NO:3 or a DNA comprising
a nucleotide sequence that hybridizes to the nucleotide sequence of
SEQ ID NO:3 under a stringent condition and encoding an miRNA
having substantially equal properties to a miRNA comprising the
nucleotide sequence of SEQ ID NO:4. Here, as a DNA comprising a
nucleotide sequence that specifically hybridizes to the nucleotide
sequence of SEQ ID NO:1 or 3 under a stringent condition, a DNA
comprising a nucleotide sequence having homology of about 60% or
more, preferably about 70% or more, more preferably about 80% or
more, still more preferably about 90% or more, particularly
preferably about 95% or more, most preferably about 98% or more, to
a nucleotide sequence that is complementary to the nucleotide
sequence of SEQ ID NO:1 or 3 may be used, for example.
[0110] In addition, the inventors have discovered that the CpG
island present in the promoter region of miR-34b gene and/or
miR-34c gene has an activity as the promoter of BTG4 (B cell
translocation gene 4) gene which is encoded in opposite direction
(antisense direction) to miR-34b gene and/or miR-34c gene on the
same chromosome, and that BTG4 has a function of suppressing cell
proliferation, and that its expression level is high in normal
tissues but markedly suppressed in cancer cells. Accordingly, since
BTG4 is considered to be capable of suppressing proliferation or
metastasis of tumor cells, a therapeutic agent for cancer
comprising BTG4 as well as a therapeutic agent for cancer
comprising nucleic acid encoding BTG4 gene are provided according
to the present invention.
[0111] Here, BTG4 used in the present invention is a protein called
as B cell translocation gene 4 (also known as PC3B or MGC33003)
(accession number NM.sub.--017589), and includes, for example, a
protein comprising an amino acid sequence that is identical to or
substantially identical to an amino acid sequence of SEQ ID NO:21.
Here, an example of an amino acid sequence that is substantially
identical to an amino acid sequence of SEQ ID NO:21 includes an
amino acid sequence having homology of about 70% or more,
preferably about 80% or more, more preferably about 90% or more,
still more preferably about 95% or more, most preferably about 98%
or more to an amino acid sequence of SEQ ID NO:21. Also, in the
present invention, among the polypeptides in which the amino acid
sequence encompassed by BTG4 has a substantially identical amino
acid sequence to the polypeptide of SEQ ID NO:21, preferably used
are those which maintain, as functions of BTG4, the properties and
functions of the protein consisting of an amino acid sequence of
SEQ ID NO:21 (e.g., cancer cell proliferation suppressing effect)
at equal level to a protein substantially consisting of an amino
acid sequence.
[0112] Further, the nucleic acid encoding BTG4 gene used in the
present invention includes, for example, a nucleic acid encoding a
protein having an amino acid sequence that is identical to or
substantially identical to an amino acid sequence of SEQ ID NO:21,
as well as a DNA comprising a nucleotide sequence of SEQ ID NO:22,
or a DNA comprising a nucleotide sequence that specifically
hybridizes to a nucleotide sequence of SEQ ID NO:22 under a
stringent condition and encodes a protein having a substantially
equal properties to the protein consisting of the amino acid
sequence of SEQ ID NO:21 (e.g., cancer cell proliferation
suppressing effect, etc.). Here, as a DNA comprising a nucleotide
sequence that specifically hybridizes to a nucleotide sequence of
SEQ ID NO:22 under a stringent condition, a DNA comprising a
nucleotide sequence having homology of about 60% or more,
preferably about 70% or more, more preferably about 80% or more,
still more preferably about 90% or more, particularly preferably
about 95% or more, most preferably about 98% or more to a
nucleotide sequence that is complementary to a nucleotide sequence
of SEQ ID NO:22, for example, may be used.
[0113] Although the nucleotide sequence of BTG4 gene may differ not
only between different species but also even within the same
species, due to polymorphism, isoforms, etc., a gene having
different nucleotide sequence is still encompassed by BTG4 gene as
long as it encodes BTG4.
[0114] The above-mentioned cancer therapeutic agent according to
the present invention may be used for any cancer, although it is
particularly preferably used for colorectal cancer, gastric cancer,
pancreatic cancer and breast cancer as mentioned above.
[0115] The cancer therapeutic agent of the present invention may be
provided as a therapeutic agent for cancer being formulated in
combination with pharmaceutically acceptable carriers (e.g.,
excipient, binder, disintegrant, lubricant, stabilizer, antiseptic,
pH adjusting agent, flavoring agent, diluent, solvent for
injection, etc.). The therapeutic agent of the present invention
may also comprise tag or nanocapsule that enable specific delivery
to target tissue. The therapeutic agent of the present invention
may comprise any one of miR-34b, a nucleic acid encoding miR-34b,
miR-34c, a nucleic acid encoding miR-34c, BTG4 and a nucleic acid
encoding BTG4 gene alone or in combination of two or more.
[0116] Furthermore, the therapeutic agent of the present invention
may further comprise other pharmaceutically active ingredient such
as a known anticancer agent effective in the therapy of cancer
(e.g., fluorouracil, tamoxifen, anastrozole, aclarubicin,
doxorubicin, tegafur, cyclophosphamide, irinotecan, cytarabine,
paclitaxel, docetaxel, epirubicin, carboplatin, cisplatin,
thiotepa, or a pharmaceutically acceptable salt thereof), or may be
used in combination with such active ingredient.
[0117] The route of administration of the therapeutic of the
present invention includes, for example, oral administration,
parenteral administration (such as intravenous administration,
intraarterial administration, subcutaneous administration,
intramuscular administration, intraperitoneal administration,
topical administration), and examples of the dosage form include
spray, capsules, tablets, granules, syrup, emulsion, suppository,
injection and suspension. Specifically, in the case of topical
administration, the diseased area is exposed by surgery, and the
therapeutic agent of the present invention can directly be
administered to the tumor tissue by means of injection, etc. In the
case of non-topical administration, the administration may be
carried out through tumor feeding vessels. Preferred route of
administration is topical administration.
[0118] In particular, the therapeutic agent of the present
invention comprising a nucleic acid encoding miR-34b, a nucleic
acid encoding miR-34c or a nucleic acid encoding BTG4 gene may be
used as a gene therapy agent aimed to introduce and express miR-34b
gene, miR-34c gene or BTG4 gene, respectively, in a cancer
cell.
[0119] The cancer therapeutic agent of the present invention used
as a gene therapy agent may be parenterally administered to a
subject by HVJ liposome method, a method in which the nucleotide
sequence of said gene is directly administered by injection,
calcium phosphate method, DEAE-dextran method, electroporation
method, a method using gene gun, method of administration by
lipofection, a method using appropriate expression vector (e.g.,
and adenovirus vector, adeno-associated virus vector, herpes virus
vector, vaccinia virus vector, retrovirus vector, etc.).
[0120] Although the dosage and frequency of administration of the
cancer therapeutic agent of the present invention vary depending on
the effect to be achieved, the method of administration, the
duration of the therapy, the age, body weight or gender of the
subject, when miR-34b and/or miR-34c or BTG4 is used, the dosage
may appropriately be chosen normally in the range of 100 .mu.g to
100 mg, preferably 1 to 20 mg, per 1 day for an adult in the case
of human, and when a nucleic acid encoding miR-34b, a nucleic acid
encoding miR-34c or a nucleic acid encoding BTG4, or an expression
vector comprising one of these is used, the dosage may
appropriately be chosen normally in the range of 0.01 mg/kg to 1
g/kg, preferably 0.1 mg/kg to 500 mg/kg per day for an adult in the
case of human, and the frequency of administration may
appropriately be chosen from once to several times a day. The
dosage, however, may vary depending on various conditions, and is
therefore not limited to the range above.
[0121] Furthermore, according to the present invention, use of
miR-34b, a nucleotide encoding miR-34b gene, miR-34c, a nucleotide
encoding miR-34c gene, BTG4, or a nucleotide encoding BTG4 gene, in
particular use in production of a therapeutic agent according to
the present invention and use as a therapeutic agent according to
the invention are provided.
[0122] Furthermore, according to the present invention, a method of
cancer treatment comprising administrating miR-34b, a nucleotide
encoding miR-34b gene, miR-34c, a nucleotide encoding miR-34c gene,
BTG4, or a nucleotide encoding BTG4 gene is provided. The effective
dosage, method for administration and dosage form in this case may
be pursuant to the description above.
WORKING EXAMPLES
[0123] The present invention is illustrated in more detail using
following working examples, although the scope of the present
invention is not limited by these examples.
Working Example 1
Expression Analysis of miRNAs
[0124] In order to identify miRNAs that undergo epigenetic
silencing in a cancer cell, miRNA was collected from a cancer cell
line HCT116 cell, a HCT116 cell treated with DNA methyltransferase
inhibitor 5-aza-2'-deoxycytidine (DAC) (2 .mu.M, 72 hours), and a
HCT116 cell in which two DNA methyltransferase genes DNMT1 and
DNMT3B genes have been knocked out (hereinafter may also be
referred to as DKO2 cell; it is known that DNA methylation has
almost been lost throughout the genome in this cell) using mirVana
miRNA isolation kit (Ambion) or Trizol (Invitrogen), and the
expression levels of 157 miRNAs were compared by delta/delta CT
method using TaqMan miRNA Assay System (Applied Biosystems) and ABI
7900 real-time PCR analyzer (Applied Biosystems). U6 snRNA were
used as an internal control.
[0125] The expression level of each miRNA was converted to the
ratio of the expression level of each miRNA to that of U6 snRNA
(i.e., the expression level of each miRNA/the expression level of
U6 snRNA) and analyzed. As shown in FIG. 2 (in FIG. 2, for each
miRNA, the top bar indicates HCT116 cell (HCT116), the second bar
indicates the HCT116 cell with DAC treatment (HCT116+DAC), the
third bar indicates the HCT116 cell in which DNA methyltransferase
genes are knocked out (DNMT knockout)), it has been revealed that
the treatment with DNA methyltransferase inhibitor and the knockout
of DNA methyltransferase genes induced the expression of 37 miRNAs
(hsa-miR-34b, hsa-miR-34c, hsa-miR-105, hsa-miR-124a, hsa-miR-124b,
hsa-miR-127, hsa-miR-129, hsa-miR-134, hsa-miR-137, hsa-miR-138,
hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-146, hsa-miR-150,
hsa-miR-154, hsa-miR-154*, hsa-miR-155, hsa-miR-184, hsa-miR-187,
hsa-miR-199a, hsa-miR-205, hsa-miR-296, hsa-miR-299, hsa-miR-302a,
hsa-miR-302b, hsa-miR-302c, hsa-miR-302d, hsa-miR-323, hsa-miR-337,
hsa-miR-338, hsa-miR-367, hsa-miR-368, hsa-miR-370, hsa-miR-371,
hsa-miR-372, hsa-miR-373 and hsa-miR-373*).
[0126] Among these 37 miRNAs identified as above, it has been known
that, for miR-34b and miR-34c, a single precursor RNA transcribed
from chromosome 11q23 is processed to generate each mature miRNA.
It is understood that although the expression levels of miRNA34b
and miR-34c are both extremely low in the HCT116 cell (HCT116), the
treatment with DNA methyltransferase inhibitor (HCT116+DAC)
restores their expression, and they are observed to be highly
expressed in the DKO2 cell (DKO2). Almost similar patterns of
induction were shown in miR-34b and miR-34c (FIG. 3A).
Working Example 2
Expression Analysis of miR-34b and miR-34c in Colorectal Cancer
Cell Lines
[0127] Furthermore, in order to examine whether the induction of
expression of miR-34b and miR-34c (hereinafter may also be referred
to as miR-34b/c) is observed in colorectal cancer cell lines other
than HCT116 cell, for 9 colorectal cancer cell lines (CaCO2,
Colo320, DLD1, HCT116, HT29, LoVo, RKO, SW48 and SW480) and the
same 9 colorectal cancer cell lines with DAC treatment, miRNA was
collected using mirVana miRNA isolation kit (Ambion) or Trizol
(Invitrogen), and the expression levels of miR-34 b/c were analyzed
by delta/delta CT methods using TaqMan miRNA Assay System (Applied
Biosystems) and ABI 7900 real-time PCR analyzer (Applied
Biosystems). DKO2 cell was used as a control, and U6 snRNA was used
as an internal control.
[0128] The expression level of miRNA was converted to the ratio of
the expression level of each miRNA to that of U6 snRNA (i.e., the
expression level of each miRNA/the expression level of U6 snRNA)
and analyzed. As shown in FIG. 4 (indicated as an average and
standard deviation of three repeated experiments), it was revealed
that DAC treatment (DAC+) induces the expression of miR-34b (FIG.
4A) and miR-34c (FIG. 4B) in all said 9 colorectal cancer cell
lines. It is therefore suggested that the expression of miR-34b/c
genes may be suppressed through the epigenetic silencing by DNA
methylation.
Working Example 3
Analysis of miR-34b/c Gene as a p53 Target
[0129] Because miR-34b gene and miR-34c gene overlap intron 1 and
exon 1 of a non-coding RNA BC021376, this BC021376 is considered to
be a candidate precursor RNA of miR-34b/c. Furthermore, there is a
binding sequence for p53, a tumor suppressor gene product,
immediately close to the transcription initiation site of BC021736.
Also, there is another gene B-cell translocation gene 4 (BTG4)
being encoded in antisense direction to miR-34b/c, and a CpG island
being located close to BTG4 exon 1 and miR-34 b/c (FIG. 3B).
[0130] Thus, firstly, a HCT116 cell or p53-knockout HCT116 cell was
treated either with DAC alone (2 .mu.M, 72 hours), with DAC (2
.mu.M, 72 hours) and then further with adriamycin (ADR: 0.5
.mu.g/ml, 24 hours) which is known to induce p53, or with
adriamycin alone (0.5 .mu.g/ml, 24 hours), and their miR-34b/c
expression levels were analyzed by delta/delta CT method using
TaqMan miRNA Assay System (Applied Biosystems) and ABI 7900
real-time PCR analyzer (Applied Biosystems). U6 snRNA was used as
an internal control.
[0131] As shown in FIG. 5A (indicated by the average and standard
deviation of three repeated experiments), an induction of miR-34b/c
expression was observed in the HCT116 cell treated either with DAC
at low concentration or with ADR, whereas miR-34b/c expression was
synergistically increased when treated with both DAC and ADR.
[0132] Furthermore, as shown in FIG. 5B (indicated by the average
and standard deviation of three repeated experiments), in the
HCT116 cell in which p53 gene has been knocked out, miR-34b/c
expression was induced when the cell was treated with DAC, but not
at all when the cell was treated with ADR. When the cell was
treated with both DAC and ADR, the miR-34b/c expression was induced
only at a similar level to the case when the cell was treated with
DAC alone.
[0133] Then, similarly, a HCT116 cell or a HCT116 cell in which p53
gene has been knocked out was treated either with DAC alone (2
.mu.M, 72 hours), with DAC (2 .mu.M, 72 hours) and then further
with ADR (0.5 .mu.g/ml, 24 hours), or with ADR alone (0.5 .mu.g/ml,
24 hours), and the induction of p53 expression was analyzed at
protein level by western-blotting using an anti-p53 antibody. The
expression of .beta.-actin was confirmed as control, and the
expression of p21 gene which is known as a representative target of
p53 was similarly confirmed.
[0134] The results, as shown in FIG. 5C, indicated that in the
HCT116 cell (WT) p53 expression was induced by ADR treatment but
not by DAC treatment, and that the expression of p21 gene, a p53
target, was also induced in similar pattern to that of p53. On the
other hand, in the HCT116 cell in which p53 has been knocked out
(p53KO), neither p53 nor p21 was changed at all by either
treatment.
[0135] Then, a p53 binding sequence (SEQ ID NO:23), which is
located in a region close to miR-34b/c gene, was inserted into
pGL3-promoter (Promega), a luciferase vector with SV40 promoter, to
generate a vector (pGL3-promoter-p53RE) (FIG. 6A). This
pGL3-promoter-p53RE was co-transfected into a HCT116 cell with
p53-expressing vector, then 48 hours after transfection, luciferase
activity was measured, showing an increased activity (FIG. 6B).
[0136] These results confirmed that miR-34b/c gene is a target of
p53 gene and its expression is controlled by both p53 and
epigenetic gene silencing.
Working Example 4
Promoter Analysis of miR-34b/c Gene
[0137] There is a CpG island located near miRNA-34b/c gene (FIG.
7). Because the fourth lysine of histone H3 (H3-K4) is
trimethylated in general at the RNA transcription initiation site,
the trimethylation of H3-K4 is known to be an index of
transcription initiation site. Thus, in order to investigate
whether the CpG island near miR-34b/c gene is the transcription
initiation site of miR-34b/c gene, we analyzed the H3-K4
trimethylation within the area to 4.5 kb upstream of miRNA-34b/c
for a HCT116 cell, a HCT116 cell with DAC treatment (2 .mu.M, 72
hours) and a DKO2 cell, by chromatin immunoprecipitation using
Chromatin Immunoprecipitation kit (Upstate). Specifically, cells
were fixed in formalin and dissolved in an elution buffer. DNA was
homogenized by a homogenizer and then subjected to
immunoprecipitation with H3-K4 antibody. Precipitated DNA was
detected by PCR. The results, as shown in FIG. 7, show H3-K4
trimethylation consistent with the CpG island in the sequence near
miR-34b/c gene as shown in the horizontal axis (see, FIG. 7, top
panel: the schematic diagram of the sequence near miR-34b/c gene),
suggesting the presence of transcription initiation site of
miR-34b/c gene near this CpG island.
[0138] This CpG island near miR-34b/c is encoding a miR-34b/c gene
in telomere-ward direction, and also encoding another gene, B-cell
translocation gene 4 (BTG4) gene, in centromere-ward direction. An
analysis using a promoter region predicting program (WWW Promoter
Scan, http://www-bimas.cit.nih.gov/molbio/proscan/) suggested that
this CpG island has promoter activity in both direction. This CpG
island region was thus cloned, and the miR-34b/c-ward sequence of
SEQ ID NO:24 and the BTG4-ward sequence of SEQ ID NO:25 were
inserted into a luciferase vector pGL3-Basic (Promega) to produce
pGL3miR-34b vector and pGL3-BTG4 vector, respectively, which were
introduced into colorectal cancer cell lines HCT116 and DLD1 cell,
and the promoter activity of each sequence was measured 48 hours
after transfection. The results, as shown in FIG. 8B, indicate that
luciferase activity was increased in both cell, transfected either
with pGL3-miR34b or pGL3-BTG4, compared to the case when the cells
were transfected with pGL3-Basic, a luciferase vector without a
promoter used as negative control, confirming that the CpG island
near miR-34b/c gene has promoter activity in both miR-34b/c gene
direction and BTG4 gene direction.
Working Example 5
DNA Methylation Analysis by Methylation-Specific PCR (MSP)
[0139] DNA methylation of a CpG island in a promoter region of
miR-34b/c gene was analyzed by methylation-specific PCR (MSP)
method for 9 colorectal cancer cell lines (CaCO2, Colo320, DLD1,
HCT116, HT29, LoVo, RKO, SW48 and SW480) as well as DKO2 cell and
human normal colon tissue. Specifically, bisulfite treatment was
performed using EpiTect Bisulfite Kits (Qiagen), and the
methylation was detected thereafter with methylation specific
primers:
TABLE-US-00005 (SEQ ID NO: 17) 5'-ATTCGTTTCGTTTCGCGTTCGTTTC-3' and
(SEQ ID NO: 18) 5'-CTAAAACTAACTCTCTCGACCCCG-3',
and unmethylation was detected with unmethylation specific
primers:
TABLE-US-00006 (SEQ ID NO: 19)
5'-TTTTTATTTGTTTTGTTTTGTGTTTGTTTTG-3' and (SEQ ID NO: 20)
5'-CCTAAAACTAACTCTCTCAACCCCA-3'.
The primers were designed to specifically amplify the part of the
CpG island indicated with heavy line in FIG. 8A (the region
consisting of the nucleotide sequence of SEQ ID NO:8).
[0140] As a result, as shown in FIG. 9A, definite bands were
detected from the specific amplification of methylated site (M) but
vanishingly little from the specific amplification of unmethylated
site (U) in all 9 colorectal cancer cell lines, confirming a
high-level DNA methylation in the CpG island in the promoter region
of miR-34b/c gene. On the other hand, in DKO2 cell in which DNMT
gene has been knocked out and in normal colon tissue,
methylation-specific bands were hardly detected (M) but
unmethylation-specific bands were strongly detected (U), confirming
that the CpG island in the promoter region of miR-34b/c gene was
methylated very little (FIG. 9A).
[0141] Then, 126 clinical samples of colorectal cancer were
obtained as frozen tissues by surgery. Of those 97 were provided
with information about age (average age=65.3 years old) and 102
cases were provided with information about gender (male 67 cases
and female 35 cases). DNA was extracted and the methylation of the
CpG island in the promoter region of miR-34b/c gene was analyzed as
above by methylation-specific PCR (MSP).
[0142] The result shows that the DNA methylation of the CpG island
was detected in many samples in tumor colon tissue (T), but none or
very slightly if any in control non-tumor colon tissue (N), as
shown in 7 samples (CRC1 to CRC7) in FIG. 9B. Further, as shown in
FIG. 9C, in 114 among said 126 cases (90%), DNA methylation was
detected in the CpG island in the promoter region of miR-34b/c
gene.
[0143] These results suggested that the CpG island in the promoter
region of miR-34b/c gene is specifically methylated in colorectal
cancer cell and tissue.
Working Example 6
DNA Methylation Analysis by Bisulfite Sequencing
[0144] The methylation of the CpG island in the promoter region of
miR-34b/c was analyzed for colorectal cancer cell lines HCT116 cell
(HCT116) and DKO2 cell (DKO2), normal human colon tissue (normal
colon), human colon tumor tissue (Tumor#1 and Tumor#2) (frozen
tissue obtained by surgery, same tissue as used in Working Example
5) by bisulfite sequencing. Specifically, DNA was bisulfite-treated
using EpiTect Bisulfite Kits (Qiagen), before PCR amplification of
the interested region using primers for bisulfite sequencing:
TABLE-US-00007 (SEQ ID NO: 10) 5'-GTTTTAAGAATTTGGGTTTTTATTTTTTAG-3'
and (SEQ ID NO: 11) 5'-CAAACTTCAATTCCCAACCCCAAAC-3'.
Amplified PCR products were then cloned with TOPO TA Cloning Kit
(Invitrogen), and their nucleotide sequences were analyzed by ABI
3130.times. sequencer (Applied Biosystems). Primers were designed
to specifically amplify the heavy-lined part indicated as
"bisulfite seq" in the CpG island in FIG. 8A (the region consisting
of a nucleotide sequence of SEQ ID NO:6).
[0145] As a result, as shown in FIG. 10 (in FIG. 10 the horizontal
axis indicates the number of CpG sequences and the vertical axis
indicates the number of clones analyzed), among 22 CpGs located in
the area of about 200 bps, all CpGs were highly methylated in
colorectal cancer cell line HCT116 cell (HCT116), whereas the
methylation was almost completely lost in all sites in DKO2 cell
(DKO2) which is a HCT116 cell in which DNMT gene has been knocked
out, the result being completely consistent with the result of the
analysis by MSP method in Working Example 5 above. Furthermore, in
colon tumor tissue (Tumor#1 and Tumor#2) almost all CpGs were
highly methylated, whereas in normal colorectal tissue (normal
colon) only a few CpGs were slightly methylated. The level of
methylation in colon tumor tissue was lower than that in the HCT116
cell, showing a mixed pattern of methylation with unmethylation,
which is considered to be due to the mixed presence of cancer and
non-cancer cells within tissue.
Working Example 7
DNA Methylation Analysis by Pyro-Sequencing
[0146] DNA methylation of the CpG island in the promoter region of
miR-34b/c was quantitatively analyzed for colorectal cancer cell
line HCT116 cell and DNMT gene-knockout DKO2 cell, human normal
colon tissue (normal colon), human colon tumor tissue (Tumor#1
(same tissue as Working Example 6 above)) by pyro-sequencing.
Specifically, DNA was bisulfite-treated using EpiTect Bisulfite
Kits (Qiagen) before PCR amplification of the interested region
using primers for pyro-sequencing:
TABLE-US-00008 (SEQ ID NO: 13) 5'-TTAGTTTTTAGTTTTAAATTTTAGAGTTGG-3'
and (SEQ ID NO: 14) 5'-TCTCCCTTAAAAACCCTTCAAAAACC-3',
followed by sequence analysis using Pyro Gold reagent (Biotage) and
the primer for sequencing (5'-TAATYGTTTTTGGAATTT-3' (SEQ ID
NO:15)). Primers were designed to specifically amplify the
heavy-lined part indicated as "pyro seq" in the CpG island in FIG.
8A (the region consisting of a nucleotide sequence of SEQ ID
NO:7).
[0147] Besides, this example of pyro-sequencing is aimed to perform
an analysis by specifically amplifying a region having a nucleotide
sequence of SEQ ID NO:7. However, when the primers used were
designed based on the sense chain of the bisulfite-treated DNA of
the region having a nucleotide sequence of SEQ ID NO:7, sequencing
reaction was difficult due to the presence of many repeat
sequences, etc. Thus, the analysis of DNA methylation of the region
of interest of SEQ ID NO:7 was achieved using primers that were
designed based on the sequence of the antisense chain of the
bisulfite-treated DNA of the region having the nucleotide sequence
of SEQ ID NO:7 (a sequence having a nucleotide sequence of SEQ ID
NO:12).
[0148] The result, as shown in FIG. 11 (in FIG. 11, the horizontal
axis indicates nucleotide sequence, the vertical axis indicates
fluorescent intensity, i.e., methylation intensity), was consistent
with the results of analyses by MSP and bisulfite-sequencing.
[0149] Furthermore, 17 samples of normal colon tissue (normal
colon), 10 samples of colon tumor tissue (tumor (U)) that was
determined as methylation-negative in MSP analysis in Working
Example 5, 101 samples of colon tumor tissue (tumor (M)) that was
determined as methylation-positive in MSP analysis in Working
Example 5, and 9 colorectal cancer cell lines (CaCO2, Colo320,
DLD1, HCT116, HT29, LoVo, RKO, SW48 and SW480) (cell lines) were
analyzed by pyro-sequencing as above. The results are shown in FIG.
12.
[0150] In the graph of FIG. 12, each one dot indicates one sample,
and the vertical axis indicates the level of methylation. As
understood from FIG. 12, the results were similar to those obtained
by MSP and bisulfite sequencing, confirming that pyro-sequencing is
capable of being used for a high-throughput and quantitative
analysis of DNA methylation.
[0151] Moreover, 16 gastric cancer cell lines (MKN1, MKN7, MKN74,
SH101, SNU1, SNU638, JRST, KatoIII, AZ521, MKN28, MKN45, NUGC3,
NUGC4, AGS, NCI-N87, SNU16), 9 pancreatic cancer cell lines
(BxPC-3, Capan2, CFPAC, KLM-1, KP1-NL, MIAPaCa, Panc-1, PK-8,
PK-9), 9 breast cancer cell lines (MCF7, MDA-MB-231, MDA-MB-435S,
MDA-MB-436, MDA-MB-468, T-47D, SK-BR-3, MDA-MB-453, ZR-75-1) were
analyzed for DNA methylation of the CpG island in the promoter
region of miR-34b/c using pyro-sequencing as above, methylation was
observed in 15 of the gastric cancer cell lines (MKN1, MKN7, MKN74,
SH101, SNU1, SNU638, JRST, KatoIII, AZ521, MKN28, MKN45, NUGC3,
NUGC4, AGS, NCI-N87) (94%), 5 of the pancreatic cancer cell lines
(BxPC-3, KLM-1, MIAPaCa, PK-8, PK-9) (56%), and 7 of the breast
cancer cell lines (MCF7, MDA-MB-231, MDA-MB-435S, MDA-MB-468,
T-47D, MDA-MB-453, ZR-75-1) (78%).
[0152] These results shows that DNA methylation of the CpG island
in the promoter region of miR-34b/c was detected at high level in
colorectal cancer cell and colon tumor tissue but hardly detected
in normal tissue, revealing that the CpG island in the promoter
region of miR-34b/c is specifically methylated in colorectal
cancer, and suggesting that miR-34b/c gene undergoes silencing in
colorectal cancer-specific manner. Also, the CpG island in the
promoter region of miR-34b/c was methylated not only in colorectal
cancer but also in gastric cancer, pancreatic cancer and breast
cancer, suggesting that miR-34b/c gene may be being silenced.
Working Example 8
Functional Analysis of miR-34b/c
[0153] Based on the suggestion that miR-34b/c gene undergoes
silencing in tumor cell-specific manner, we investigated on the
possibility that miR-34b/c gene functions as tumor suppressor gene
that suppresses expression of oncogene product. Firstly, in order
to search for a gene whose expression is decreased by miR-34b/c
expression, control miRNA (control miRNA (Ambion)), miR-34b
(miR-34b precursor (Ambion)) and miR-34c (miR-34c precursor
(Ambion)) were introduced into a HCT116 cell by electroporation,
and after 48 hours RNA was extracted and subjected to microarray
analysis. Also, for an intact HCT116 cell (mock) and a HCT116 cell
treated with DNA methyltransferase inhibitor DAC (2 .mu.M, 72
hours) (DAC), RNA extraction and microarray analysis were similarly
carried out.
[0154] The results are shown in FIG. 13A. A comparison of the
expression patterns of control miRNA (miRNA-control), miR-34b
(miR-34b) and miR-34c (miR-34c) shows a group of genes whose
expression was decreased by expressing miR-34b/c as indicated by a
large case arc in top of FIG. 13A, which were considered to
correspond to the target genes for miR-34b/c. Furthermore, a
comparison between an intact HCT116 cell (mock) and a HCT116 cell
with DAC treatment (DAC) and an analysis of genes that showed any
difference revealed that the expression of many of the genes whose
expression is decreased by expressing miR-34b/c was also decreased
by DAC treatment. This is considered to be due to an increase in
endogenous miR-34b/c expression by DAC treatment.
[0155] Then, in order to verify the microarray results, the
expression of representative oncogenes MET (hepatocyte growth
factor receptor) gene and MTB (v-myb myeloblastosis viral oncogene
homolog) gene, cell-cycle associated genes CDK4 (cyclin-dependent
kinase 4) gene and CCNE2 (Cyclin E2) gene, as well as SFRS2
(splicing factor, arginine/serine-rich 2) gene were analyzed by
introducing control miRNA (control miRNA (Ambion)), miR-34b
(miR-34b precursor (Ambion)) and miR-34c (miR-34c precursor
(Ambion)) into HCT116 cells by electroporation, extracting RNA
after 48 hours, analyzing by real-time RT-PCR using TaqMan Gene
Expression Assay (Applied Biosystems). Also, RNA was extracted from
an intact HCT116 cell (mock) and a HCT116 cell treated with DNA
methyltransferase inhibitor DAC (2 .mu.M, 72 hours) (DAC) and
similarly analyzed. The result, as shown in FIG. 13B, indicates
that mRNA expression levels of all of the foregoing genes were
decreased by expressing miR-34b/c, as well as by treating with
DAC.
[0156] Furthermore, for foregoing genes, changes in protein level
were verified by western-blot analysis using an anti-MET antibody
(MET), anti-CDK4 antibody (CDK4), anti-SFRS2 antibody (SFRS2), and
anti-actin antibody as control (actin), as shown in FIG. 13C. It
was shown that the expression levels of all of the aforementioned
proteins (MET, CDK4 and SFRS2) were decreased by expressing
miR-34b/c as well as by treating with DAC. It has been known that
the effect of miRNA to inhibit the translation of RNA to a protein
is more potent than its effect to degrade RNA. The result above
also indicates a more marked decrease in protein level than in RNA
level.
[0157] These results suggested that the oncogenes MET gene and MYB
gene, cell-cycle associated genes CDK4 gene and Cyclin E2 gene, as
well as SFRS2 gene are target genes for miR-34b/c. Furthermore,
since the CpG island in the promoter region of miR-34b/c may
undergo the silencing by specific methylation in tumor cell,
resulting in suppression of miR-34b/c expression and increase in
the expression of its target genes, miR-34b/c can be considered as
a tumor suppressive miRNA, which functions in tumor-suppressive
manner.
[0158] Numerous tumor suppressor genes and oncogenes have been
identified so far whose transcription is suppressed by DNA
methylation. Expression of these genes is restored by DNA
methyltransferase inhibitor such as decitabine, drawing attention
to DNA methyltransferase inhibitor as an effective cancer
therapeutic. Current study by the inventors demonstrated a
mechanism that DNA methyltransferase inhibitor restores the
expression of miRNA that has a tumor suppressing effect, resulting
in suppression of oncogene product expression, exhibiting a
anti-cancer effect.
Working Example 9
Functional Analysis of BTG4
[0159] As shown in Working Example 4 above, the CpG island near
miR-34b/c gene possesses a promoter activity in both directions,
suggesting that BTG4 gene, which is transcribed in opposite
direction to miR-34b/c, may also undergo a silencing in tumor cell.
We therefore made an analysis on BTG4.
[0160] Firstly, BTG4 expression in 9 colorectal cancer cell lines
(CaCO2, Colo320, DLD1, HCT116, HT29, LoVo, RKO, SW48 and SW480),
DKO2 cell and human normal colon tissue, as well as BTG4 expression
in the foregoing colorectal cancer cells treated with DAC (2 .mu.M,
72 hours) were examined by RT-PCR using:
TABLE-US-00009 a forward primer: (SEQ ID NO: 26)
5'-GTTTCTCTTTCTGATCTAGCAGGA-3' and a reverse primer: (SEQ ID NO:
27) 5'-TCAGAGTGCCAGTGACTTCTGTA-3'.
The results are shown in FIG. 14A.
[0161] As shown in the results in FIG. 14A, mRNA expression of BTG4
gene has been lost or at an extremely low level in all 9 colorectal
cancer cell lines, but tends to markedly increased (restored) by
DAC treatment. BTG4 gene was also expressed at a high level in the
DKO2 cell. Thus, it is suggested that, in colorectal cancer cell,
BTG4 gene is silenced and its expression is suppressed by DNA
methylation of the CpG island in the promoter region of
miR-34b/c.
[0162] The ability of BTG4 to propagating cells was then analyzed
by colony-formation assay. A BTG4-expressing vector or control
vector was introduced into colorectal cancer cell lines DLD1 cell
and HCT116 cell. Transgenic cells were selected with the agent
G418. The cells were fixed with methanol 10 to 14 days after gene
transfer, stained with Giemsa staining, and colonies were counted.
The results are shown in FIGS. 14B and 14C. FIG. 14C is a graphed
result of FIG. 14B, indicating averages and standard deviations of
three experimental results.
[0163] As understood by the results in FIGS. 14B and 14C, in the
colorectal cancer cell transferred with the BTG4-expressing vector
(BTG4), colony-forming ability has been decreased compared to the
cell transferred with the control vector (vector). Thus, BTG4 was
shown to have an effect to suppress tumor growth, implying a
potential function of BTG4 gene as tumor suppressor gene.
[0164] Accordingly, the DNA methylation of the CpG island in the
promoter region of miR-34b/c has been implicated in controlling not
only transcription of miR-34b/c but also that of BTG4, showing a
strong involvement in cellular canceration.
Working Example 10
DNA Methylation of miR-34b/c in Cases of Gastric Cancer
[0165] In the examples above, in colorectal cancer, it was
suggested that the CpG island in the promoter region of miR-34b/c
is specifically methylated in colorectal cancer cell and tissue. We
further analyzed on DNA methylation of the same site in cases of
gastric cancer.
[0166] For the cases of multiple gastric cancer, single gastric
cancer and non-cancer, gastric vestibule mucosa was collected and
DNA was extracted. DNA methylation of the CpG island in the
promoter region of miR-34b/c was quantitatively analyzed by
pyro-sequencing as in Working Example 7.
[0167] As shown in FIG. 15, DNA methylation level of miR-34b/c
observed in background mucosa of gastric vestibule was 33.8% in
average in the multiple gastric cancer cases (15 samples), 21.3% in
average in the single gastric cancer cases (39 cases), and 22.3% in
average in the non-cancer cases (46 samples). Thus, DNA methylation
of miR-34b/c was observed in the multiple gastric cancer cases at
significantly higher level compared to in the single gastric cancer
and non-cancer cases, suggesting that it may be possible to detect
a multiple gastric cancer case based on the level of DNA
methylation of miR-34b/c in mucosa of gastric vestibule.
[0168] A similar experiment was carried out for mucosa of gastric
corpus. As shown in FIG. 16, DNA methylation level of miR-34b/c
observed in mucosa of gastric corpus was 21.6% in average in the
multiple gastric cancer cases (15 samples), 19.1% in average in the
single gastric cancer cases (39 cases) and 17.2% in average in the
non-cancer cases (46 samples). Thus, DNA methylation of miR-34b/c
was observed in the multiple gastric cancer cases at significantly
higher level compared to in the single gastric cancer and
non-cancer cases (p=0.045), suggesting that it may be possible to
detect a multiple gastric cancer case based on the level of DNA
methylation of miR-34b/c in mucosa of gastric corpus.
[0169] Furthermore, the average of DNA methylation levels of
miR-34b/c in gastric vestibule and gastric corpus was, as shown in
FIG. 17, 27.7% in average in the multiple gastric cancer cases,
19.9% in average in the single gastric cancer cases, and 19.6% in
average in non-cancer cases. Thus, DNA methylation of miR-34b/c was
observed in the multiple gastric cancer cases at significantly
higher level compared to in the single gastric cancer and
non-cancer cases (p<0.0001), suggesting that a multiple gastric
cancer case may be detected at higher accuracy by employing the
mean value of DNA methylation levels of miR-34b/c in mucosae of
gastric vestibule and gastric corpus.
[0170] Also, these results reveals that the level of miR-34b/c DNA
methylation shows a high value in multiple gastric cancer cases,
suggesting the possibility that the detection of the level of
miR-34b/c DNA methylation in gastric mucosa may be useful for
predicting recurrence of gastric cancer. Furthermore, because a
high level methylation is detected in some of the single cancer and
non-cancer cases, it is suggested that a risk of carcinogenesis may
be predicted based on the level of DNA methylation of
miR-34b/c.
Working Example 11
DNA Methylation of miR-34b/c in Colorectal Cancer Cases
[0171] In the examples above, it was suggested that the CpG island
in the promoter region of miR-34b/c is specifically methylated in
colorectal cancer cell and tissue. We further analyzed the relation
between DNA methylation of this site and the staging of colorectal
cancer.
[0172] For colorectal adenoma (Adenoma) cases (12 samples),
invasive cancer (Cancer) cases (18 samples), and severe atypical
adenoma-intramucosal carcinoma (Sev-m) cases (5 samples), colon
tissue (colonic biopsy) was collected, DNA was extracted, and DNA
methylation of the CpG island in the promoter region of miR-34b/c
was quantitatively analyzed by pyro-sequencing as in Working
Example 7.
[0173] The result, as shown in FIG. 18, demonstrated that the level
of DNA methylation of miR-34b/c in colonic biopsy tissue was at
22.9% in average in the colorectal adenoma (Adenoma) cases, 41.9%
in average in the invasive cancer (Cancer) cases, and 34.8% in
average in the severe atypical adenoma-intramucosal carcinoma
(Sev-m) cases. Thus, DNA methylation of miR-34b/c was observed in
invasive cancer cases at a significantly higher level compared to
in colorectal adenoma cases (p=0.0011), suggesting that the staging
of colorectal cancer can be predicted, and invasive cancer cases
can be detected, based on the level of DNA methylation of miR-34b/c
in colonic biopsy tissue.
[0174] Moreover, because it is often difficult to determine by
magnified endoscopy examination whether a case revealing a type-IV
Pit is a carcinoma or adenoma, we classified the cases with a
type-IV Pit into 4b case (revealing a type-V Pit within the same
lesion and being associated with a severe atypism,
intra-adenomatous carcinoma or cancer) or IVb case (revealing a
simple moderate adenoma), and then carried out a similar experiment
as above to investigate DNA methylation level of miR-34b/c. The
results, as shown in FIG. 19, were 44.5% in average in 4b cases (10
samples) and 22.4% in average in IVb cases (6 samples). Thus, even
among type-IV Pit cases which cannot be distinguished by endoscopy,
cases that are associated with cancer (4b) show a significantly
higher level of DNA methylation for miR-34b/c compared to the cases
that are not associated with cancer (IVb) (p=0.0028), suggesting
the possibility that a risk of carcinogenesis can be predicted at
high accuracy even in a case which is difficult to be diagnosed by
endoscopy.
[0175] These results revealed that the level of DNA methylation of
miR-34b/c is particularly high in the cases of invasive cancer
among colorectal cancer, indicating that the prediction of the
stage of colorectal cancer and the prediction of a risk of
carcinogenesis can be enabled by detecting the level of DNA
methylation of miR-34b/c using colonic (biopsy) tissue as
sample.
[0176] As described above, the inventors have newly identified
miR-34b/c as a miRNA that undergoes an epigenetic silencing by DNA
methylation in a colorectal cancer cell. The inventors have further
discovered for the first time, from detailed analysis of DNA
methylation of the CpG island near miR-34b/c gene located in the
chromosome 11q23.1, that said CpG island is the promoter of
miR-34b/c gene and is directly involved in inactivation of
miR-34b/c gene by being specifically methylated in various cancers
such as colorectal cancer, gastric cancer, pancreatic cancer and
breast cancer. The inventors have also revealed that a tumor
suppressor gene product p53 induces the expression of miR-34b/c
gene, and that miR-34b/c gene suppresses expression of cell-cycle
regulatory genes such as Cyclin E2 gene and CDK4 gene as well as
oncogenes such as MET gene and MYB gene, demonstrating that p53
functions as tumor suppressor gene product by indirectly
controlling expression of oncogenes through miR-34b/c. Moreover,
the inventors has discovered that the CpG island in the promoter
region of miR-34b/c possesses a promoter activity for BTG4 gene,
which is transcribed in opposite direction to miR-34b/c gene, and
that BTG4 gene is also silenced by methylation of said CpG island
in colorectal cancer cell. It has further been shown that BTG4
exhibits a suppressing effect on cancer cell proliferation, and
thus BTG4 gene may function as a tumor suppressor gene.
[0177] These results demonstrated that, by the method of the
present invention, or by using the kit of the present invention, a
cancer, particularly colorectal cancer, gastric cancer, pancreatic
cancer and breast cancer in a subject can easily and accurately be
detected using a biological sample obtained from the subject. It is
also suggested that the method of the present invention or the kit
of the present invention is extremely useful not only for detecting
a cancer, but also for predicting the stage of a cancer, for
predicting a risk of carcinogenesis, and for predicting a risk of
recurrence. The aforementioned CpG island directly controls the
expression of two genes miR-34b/c gene and BTG4 gene whose
expression is decreased in tumor tissue-specific manner in cancer
cell as described above. Therefore, the method of the present
invention, which detects a cancer based on the methylation of this
region, is considered to be highly accurate.
[0178] Moreover, since the cancer therapeutic agent of the present
invention increases the expression of miR-34b/c or BTG4 that
functions like a tumor suppressor gene product in cancers such as
colorectal cancer, gastric cancer, pancreatic cancer and breast
cancer, it has been suggested to be capable of effectively
suppressing the proliferation of cancer cells.
INDUSTRIAL APPLICABILITY
[0179] The expression of miR-34b/c gene is specifically suppressed
in cancers such as colorectal cancer, gastric cancer, pancreatic
cancer and breast cancer. According to the present invention, a
method of detecting a cancer comprising detecting DNA methylation
in a CpG island in a promoter region of miR-34b/c gene, and a kit
for detecting a cancer based on such method can be provided.
Accordingly, the present invention would greatly contribute to
diagnosing, treating and researching cancers such as colorectal
cancer, gastric cancer, pancreatic cancer and breast cancer.
[0180] Also, since expression of miR-34b and/or miR-34c is
specifically decreased in a cancer cell and they have a suppressing
effect on oncogene expression, a therapeutic agent for cancer
comprising miR-34b and/or miR-34c or a nucleic acid encoding
miR-34b and/or miR-34c gene can be provided. Such cancer
therapeutic agent can be expected to be applied for a
pharmaceutical product which exhibits a high therapeutic effect.
Furthermore, since the expression of BTG4 is specifically decreased
in cancer cell, and it has a suppressing effect on cell
proliferation, a therapeutic agent for cancer comprising BTG4 or a
nucleic acid encoding BTG4 gene can be provided. Such cancer
therapeutic agent can be expected to be applied for a
pharmaceutical product which exhibits a high therapeutic
effect.
BRIEF DESCRIPTION OF THE DRAWINGS
[0181] FIG. 1 is a schematic diagram showing functions of a
microRNA.
[0182] FIG. 2 is a diagram showing the results of an analysis of 37
miRNA in a colorectal cancer cell line HCT116 (HCT116), a HCT116
cell treated with DNA methyltransferase inhibitor (HCT116+DAC), and
a HCT116 cell in which DNA methyltransferase gene has been knocked
out (DNMT knockout).
[0183] FIG. 3A is a diagram showing the expression level of
hsa-miR-34b and hsa-miR-34c in a colorectal cancer cell line HCT116
(HCT116), a HCT116 cell treated with DNA methyltransferase
inhibitor (HCT116+DAC), and a HCT116 cell in which DNA
methyltransferase gene has been knocked out (DKO2).
[0184] FIG. 3B is a schematic diagram showing the sequence near
miR-34b/c gene in chromosome 11q23.1.
[0185] FIG. 4A is a diagram showing the expression level of miR-34b
in 9 colorectal cancer cell lines (CaCo2, Colo320, DLD1, HCT116,
HT29, LoVo, RKO, SW48, SW480), and said cell lines treated with
DAC, as well as a HCT116 cell in which DNA methyltransferase has
been knocked out (DKO2) as control.
[0186] FIG. 4B is a diagram showing the expression level of miR-34c
in 9 colorectal cancer cell lines (CaCo2, Colo320, DLD1, HCT116,
HT29, LoVo, RKO, SW48, SW480), and said cell lines treated with
DAC, as well as a HCT116 cell in which DNA methyltransferase has
been knocked out (DKO2) as control.
[0187] FIG. 5A is a diagram showing the expression levels of
miR-34b and miR-34c, in a HCT116 cell without treatment, with DAC
treatment, with ADR treatment, and with both DAC treatment and ADR
treatment.
[0188] FIG. 5B is a diagram showing the expression levels of
miR-34b and miR-34c, in p53 gene-knockout HCT116 cell without
treatment, with DAC treatment, with ADR treatment, and with both
DAC treatment and ADR treatment.
[0189] FIG. 5C is a diagram showing the protein expression levels
of p53, p21 and .beta.-actin, in a HCT116 cell (WT) and in p53
gene-knockout HCT116 cell (p53KO), each without treatment, with DAC
treatment, with ADR treatment, and with both DAC treatment and ADR
treatment.
[0190] FIG. 6A is a schematic diagram showing a vector
pGL3-promoter-p53RE in which a p53-binding sequence that is located
near miR-34b/c has been inserted into pGL3-promoter, a luciferase
vector with SV40 promoter.
[0191] FIG. 6B is a diagram showing luciferase activity of
pGL3-promoter-p53RE, being introduced into a HCT116 cell either
concurrently with a control expression vector, or concurrently with
p53-expressing vector.
[0192] FIG. 7 is a diagram showing a schematic diagram showing the
sequence near miR-34b/c gene (top), and a graph showing the
relation between the sequence near miR-34b/c gene and the
trimethylation of the fourth lysine of histone H3 (H3-K4)
(bottom).
[0193] FIG. 8A is a schematic diagram showing the CpG island near
miR-34b/c gene.
[0194] FIG. 8B is a schematic diagram showing the results of
measuring luciferase activity of colorectal cancer cell lines
HCT116 and DLD1 transferred with a control luciferase vector
(pGL3-Basic) or a luciferase vector in which the promoter region
near miR-34b/c gene has been inserted (pGL3-miR-34b/c or
pGL3-BTG4).
[0195] FIG. 9A is a diagram showing the results of an analysis by
methylation-specific PCR of DNA methylation of the CpG island near
miR-34b/c gene in colorectal cancer cell lines (CaCo2, Colo320,
DLD1, HCT116, HT29, LoVo, RKO, SW48, SW480) and in a HCT116 cell in
which DNA methyltransferase has been knocked out (DKO2).
[0196] FIG. 9B is a diagram showing the result of an analysis by
methylation-specific PCR of DNA methylation of the CpG island near
miR-34b/c gene in tumor tissue (T) and non-tumor tissue (T) of 7
clinical samples of colorectal cancer.
[0197] FIG. 9C is a diagram showing the result of an analysis of
DNA methylation of the CpG island near miR-34b/c gene in 126
clinical samples of colorectal cancer.
[0198] FIG. 10 is a diagram showing the result of an analysis by
bisulfite sequencing of DNA methylation of the CpG island near
miR-34b/c gene in a HCT116 cell (HCT116), DKO2 cell (DKO2), normal
colon tissue (normal colon), and 2 colon tumor tissue samples
(Tumor#1 and Tumor#2).
[0199] FIG. 11 is a diagram showing the result of an analysis by
pyro-sequencing of DNA methylation of the CpG island near miR-34b/c
gene in a HCT116 cell (HCT116), DKO2 cell (DKO2), normal colon
tissue (normal colon), and colon tumor tissue (Tumor#1).
[0200] FIG. 12 is a diagram showing the result of an analysis by
pyro-sequencing of DNA methylation of the CpG island near miR-34b/c
gene in normal colon tissue (n=17) (normal colon), in colon tumor
tissue determined to be methylation-negative by MSP (n=10)
(tumor(U)), in colon tumor tissue determined to be
methylation-positive by MSP (n=101) (tumor(M)), and in colorectal
cancer cell lines (n=9)(cell lines).
[0201] FIG. 13A is a diagram showing the result of a microarray
analysis for a HCT116 cell transferred with a control miRNA
(miR-control), miR-34b (miR-34b) or miR-34c (miR-34c), or a HCT116
cell without treatment (mock), or a HCT116 cell with DAC treatment
(DAC).
[0202] FIG. 13B is a diagram showing the result of a realtime PCR
analysis of the expression of oncogenes MET gene and MYB gene,
cell-cycle genes CDK4 gene and CCNE2 gene, and SFRS2 gene for a
HCT116 cell transferred with a control miRNA (miR-control), miR-34b
(miR-34b) or miR-34c (miR-34c), or a HCT116 cell without treatment
(mock), or a HCT116 cell with DAC treatment (DAC).
[0203] FIG. 13C is a diagram showing the result of an western-blot
analysis of protein expression of a oncogene product MET, a
cell-cycle gene product CDK4, and SFRS2 for a HCT116 cell
transferred with control miRNA (miR-control), miR-34b (miR-34b) or
miR-34c (miR-34c), or a HCT116 cell without treatment (mock), or a
HCT116 cell with DAC treatment (DAC).
[0204] FIG. 14A is a diagram showing the expression level of BTG4
gene in 9 colorectal cancer cell lines (CaCo2, Colo320, DLD1,
HCT116, HT29, LoVo, RKO, SW48, SW480) and said cell lines treated
with DAC, as well as in DKO2 cell (DKO2) and normal colon tissue
(normal colon).
[0205] FIG. 14B is a diagram showing the results of a
colony-formation assay in a DLD1 cell or HCT116 cell transferred
with a control vector (vector) or BTG4-expressing vector
(BTG4).
[0206] FIG. 14C is a graph showing the results of a
colony-formation assay in a DLD1 cell or HCT116 cell transferred
with a control vector (vector) or BTG4-expressing vector
(BTG4).
[0207] FIG. 15 is a diagram showing the result of a pyro-sequencing
analysis of DNA methylation of the CpG island near miR-34b/c gene
in gastric vestibule mucosa in multiple cases of gastric cancer,
single cases of gastric cancer, or non-cancer cases.
[0208] FIG. 16 is a diagram showing the result of a pyro-sequencing
analysis of DNA methylation of the CpG island near miR-34b/c gene
in gastric corpus mucosa in multiple cases of gastric cancer,
single cases of gastric cancer, or non-cancer cases.
[0209] FIG. 17 is a diagram showing the averages of the results of
a pyro-sequencing analysis of DNA methylation of the CpG island
near miR-34b/c gene in gastric vestibule mucosa and gastric corpus
mucosa in multiple cases of gastric cancer, single cases of gastric
cancer, or non-cancer cases.
[0210] FIG. 18 is a diagram showing the results of a
pyro-sequencing analysis of DNA methylation of the CpG island near
miR-34b/c gene in biopsy tissue collected from the cases of
colorectal cancer (Adenoma: up to moderate adenoma, Cancer:
(invasive) cancer at or deeper than sm, Sev-m: severe atypical
adenoma-intramucosal carcinoma) cases.
[0211] FIG. 19 is a diagram showing the results of a
pyro-sequencing analysis of DNA methylation of the CpG island near
miR-34b/c gene in DNA samples collected from colorectal cancer
cases with type-IV Pit, wherein the cases are classified into 4b
cases (cases revealing type-V Pit within the same lesion, and being
associated with severe atypism, intra-adenomatous carcinoma or
cancer) and IVb cases (revealing simple moderate adenoma).
Sequence CWU 1
1
27184DNAhuman 1gtgctcggtt tgtaggcagt gtcattagct gattgtactg
tggtggttac aatcactaac 60tccactgcca tcaaaacaag gcac 84223RNAhuman
2uaggcagugu cauuagcuga uug 23377DNAhuman 3agtctagtta ctaggcagtg
tagttagctg attgctaata gtaccaatca ctaaccacac 60ggccaggtaa aaagatt
77423RNAhuman 4aggcagugua guuagcugau ugc 235978DNAhuman 5cgctttccca
gggcggaatg gtcacggaaa ctgggtaggc tgggggcctt cttggggaat 60gagggagtgg
aggagctctt tgtccctcct gctagatcag aaagagaaac gtctcaagaa
120tctgggcctc catcttctag gcgtctccct tggaggccct tcagggaccg
cccacagcgc 180tttctctcag cctcctcccc ccccccatcc cctcccccac
ccgccccgtc tcgcgcccgc 240cccgcccctc ggcccgcggg gttccaagga
cggttggtcg cccccgccac agtcactcgg 300ccgctcagag cggcggggcg
cacggggtcg agagagccag ctctagggtt tggggctggg 360aactgaagcc
tggcgtgaag gaagtgggag cccgggccga ggaggcgaag gggaaaggaa
420aagcgagggg aacctgagcg ggagggccct gagaggagcg ggaggctgcg
ggaaggggag 480gcctggcact cctgggggtc atgggggtcg gggcgcggct
cccggcctgg gagggcgcgg 540gtcctccccg gcagcgccgc ccgctggccc
agctacgcgt gttgtgcgct gcgaggccgg 600cgggggtccc gctgggcccg
ggggtgtcct cgggggccgc ttgcgcccag ccatggtagg 660gcgtcccccg
gtgaaatggg gtccgaggcg ggccccgacc ccgcgtcggc gctgcggacc
720gtccgggagc tgcagccgcg ggtgcccggt gctcggtttg taggcagtgt
cattagctga 780ttgtactgtg gtggttacaa tcactaactc cactgccatc
aaaacaaggc acagcatcac 840cgccgcccgg ccgggaagaa gacgccggct
cgggcagccc gcagccttcg agagaagatg 900cctgagaagc gcggcgtcgg
cgtgggtcct gcgcagcctg ccccgcgagc gcccgctgca 960agtgcgagga aacccgcg
9786262DNAhuman 6gtctcaagaa tctgggcctc catcttctag gcgtctccct
tggaggccct tcagggaccg 60cccacagcgc tttctctcag cctcctcccc ccccccatcc
cctcccccac ccgccccgtc 120tcgcgcccgc cccgcccctc ggcccgcggg
gttccaagga cggttggtcg cccccgccac 180agtcactcgg ccgctcagag
cggcggggcg cacggggtcg agagagccag ctctagggtt 240tggggctggg
aactgaagcc tg 2627223DNAhuman 7tctcccttgg aggcccttca gggaccgccc
acagcgcttt ctctcagcct cctccccccc 60cccatcccct cccccacccg ccccgtctcg
cgcccgcccc gcccctcggc ccgcggggtt 120ccaaggacgg ttggtcgccc
ccgccacagt cactcggccg ctcagagcgg cggggcgcac 180ggggtcgaga
gagccagctc tagggtttgg ggctgggaac tga 2238134DNAhuman 8cccccacccg
ccccgtctcg cgcccgcccc gcccctcggc ccgcggggtt ccaaggacgg 60ttggtcgccc
ccgccacagt cactcggccg ctcagagcgg cggggcgcac ggggtcgaga
120gagccagctc tagg 1349262DNAArtificialbisulfated 9gttttaagaa
tttgggtttt tattttttag gcgttttttt tggaggtttt ttagggatcg 60tttatagcgt
ttttttttag tttttttttt ttttttattt ttttttttat tcgtttcgtt
120tcgcgttcgt ttcgtttttc ggttcgcggg gttttaagga cggttggtcg
ttttcgttat 180agttattcgg tcgtttagag cggcggggcg tacggggtcg
agagagttag ttttagggtt 240tggggttggg aattgaagtt tg 2621030DNAhuman
10gttttaagaa tttgggtttt tattttttag 301125DNAhuman 11caaacttcaa
ttcccaaccc caaac 2512223DNAhuman 12ttagttttta gttttaaatt ttagagttgg
ttttttcgat ttcgtgcgtt tcgtcgtttt 60gagcggtcga gtgattgtgg cgggggcgat
taatcgtttt tggaatttcg cgggtcgagg 120ggcggggcgg gcgcgagacg
gggcgggtgg gggaggggat gggggggggg aggaggttga 180gagaaagcgt
tgtgggcggt ttttgaaggg tttttaaggg aga 2231330DNAhuman 13ttagttttta
gttttaaatt ttagagttgg 301426DNAhuman 14tctcccttaa aaacccttca aaaacc
261518DNAhuman 15taatygtttt tggaattt 1816134DNAhuman 16tttttattcg
tttcgtttcg cgttcgtttc gtttttcggt tcgcggggtt ttaaggacgg 60ttggtcgttt
tcgttatagt tattcggtcg tttagagcgg cggggcgtac ggggtcgaga
120gagttagttt tagg 1341725DNAhuman 17attcgtttcg tttcgcgttc gtttc
251824DNAhuman 18ctaaaactaa ctctctcgac cccg 241931DNAhuman
19tttttatttg ttttgttttg tgtttgtttt g 312025DNAhuman 20cctaaaacta
actctctcaa cccca 2521223PRThuman 21Met Arg Asp Glu Ile Ala Thr Thr
Val Phe Phe Val Thr Arg Leu Val 1 5 10 15 Lys Lys His Asp Lys Leu
Ser Lys Gln Gln Ile Glu Asp Phe Ala Glu 20 25 30 Lys Leu Met Thr
Ile Leu Phe Glu Thr Tyr Arg Ser His Trp His Ser 35 40 45 Asp Cys
Pro Ser Lys Gly Gln Ala Phe Arg Cys Ile Arg Ile Asn Asn 50 55 60
Asn Gln Asn Lys Asp Pro Ile Leu Glu Arg Ala Cys Val Glu Ser Asn 65
70 75 80 Val Asp Phe Ser His Leu Gly Leu Pro Lys Glu Met Thr Ile
Trp Val 85 90 95 Asp Pro Phe Glu Val Cys Cys Arg Tyr Gly Glu Lys
Asn His Pro Phe 100 105 110 Thr Val Ala Ser Phe Lys Gly Arg Trp Glu
Glu Trp Glu Leu Tyr Gln 115 120 125 Gln Ile Ser Tyr Ala Val Ser Arg
Ala Ser Ser Asp Val Ser Ser Gly 130 135 140 Thr Ser Cys Asp Glu Glu
Ser Cys Ser Lys Glu Pro Arg Val Ile Pro 145 150 155 160 Lys Val Ser
Asn Pro Lys Ser Ile Tyr Gln Val Glu Asn Leu Lys Gln 165 170 175 Pro
Phe Gln Ser Trp Leu Gln Ile Pro Arg Lys Lys Asn Val Val Asp 180 185
190 Gly Arg Val Gly Leu Leu Gly Asn Thr Tyr His Gly Ser Gln Lys His
195 200 205 Pro Lys Cys Tyr Arg Pro Ala Met His Arg Leu Asp Arg Ile
Leu 210 215 220 22672DNAhuman 22atgagagatg aaattgcaac aacagttttc
tttgtcacaa gattggtgaa aaaacatgat 60aaactaagta aacagcaaat agaagacttt
gcagaaaagc tgatgacgat cttgtttgaa 120acatacagaa gtcactggca
ctctgattgc ccttctaaag ggcaagcctt caggtgcatc 180aggataaaca
acaatcagaa taaagatccc attctagaaa gggcatgtgt ggaaagtaat
240gtagattttt ctcacctggg acttccgaag gagatgacca tatgggtaga
tccctttgaa 300gtatgctgta ggtatggtga gaaaaaccat ccatttacag
ttgcttcttt taaaggcaga 360tgggaggaat gggaactata tcaacaaatc
agttatgccg ttagtagagc ctcatcagac 420gtttcctctg gcacttcctg
cgatgaagaa agttgtagca aggaacctcg tgtcattcct 480aaagtcagca
atccgaagag tatttatcag gttgaaaact tgaaacagcc ctttcaatct
540tggttacaaa tcccccgcaa aaagaatgtg gtggacggcc gtgttggcct
cctgggaaac 600acttaccatg gctcgcagaa gcatcctaag tgttacaggc
ctgctatgca ccggctggac 660agaattttat aa 6722320DNAhuman 23aggcatgcct
agacatgaac 2024317DNAhuman 24ccaacagagc acagaggtgc agatgagact
ctccaagcca tcctcccata tgtcagaggc 60tacccaagcc cacctccatt tggaaaattc
aaacctataa tttgaggtac ctgggaagcc 120gctttcccag ggcggaatgg
tcacggaaac tgggtaggct gggggccttc ttggggaatg 180agggagtgga
ggagctcttt gtccctcctg ctagatcaga aagagaaacg tctcaagaat
240ctgggcctcc atcttctagg cgtctccctt ggaggccctt cagggaccgc
ccacagcgct 300ttctctcagc ctcctcc 31725413DNAhuman 25gcacaacacg
cgtagctggg ccagcgggcg gcgctgccgg ggaggacccg cgccctccca 60ggccgggagc
cgcgccccga cccccatgac ccccaggagt gccaggcctc cccttcccgc
120agcctcccgc tcctctcagg gccctcccgc tcaggttccc ctcgcttttc
ctttcccctt 180cgcctcctcg gcccgggctc ccacttcctt cacgccaggc
ttcagttccc agccccaaac 240cctagagctg gctctctcga ccccgtgcgc
cccgccgctc tgagcggccg agtgactgtg 300gcgggggcga ccaaccgtcc
ttggaacccc gcgggccgag gggcggggcg ggcgcgagac 360ggggcgggtg
ggggagggga tggggggggg gaggaggctg agagaaagcg ctg 4132624DNAhuman
26gtttctcttt ctgatctagc agga 242723DNAhuman 27tcagagtgcc agtgacttct
gta 23
* * * * *
References