U.S. patent application number 14/320054 was filed with the patent office on 2015-01-22 for identification and use of compounds that affect the fidelity of eukaryotic translation initiation codon selection.
The applicant listed for this patent is The Johns Hopkins University. Invention is credited to Jon R. Lorsch, Timothy Brian Neary, Julie Ellen Takacs.
Application Number | 20150025044 14/320054 |
Document ID | / |
Family ID | 44647710 |
Filed Date | 2015-01-22 |
United States Patent
Application |
20150025044 |
Kind Code |
A1 |
Lorsch; Jon R. ; et
al. |
January 22, 2015 |
IDENTIFICATION AND USE OF COMPOUNDS THAT AFFECT THE FIDELITY OF
EUKARYOTIC TRANSLATION INITIATION CODON SELECTION
Abstract
A screening method for identifying compounds that alter the
fidelity with which the initiation codon in mRNAs is recognized by
the translational apparatus in eukaryotes is disclosed. This
screening method was used to identify compounds having such
activity. Methods of altering the fidelity of initiation codon
selection are also disclosed. Methods of treating disorders
characterized by single nucleotide mutations in initiation codons
using compounds identified by the screening method, as well as
methods of treating fungal and parasitic infections and
hyperproliferative disorders using compounds identified by the
screening method are also disclosed.
Inventors: |
Lorsch; Jon R.; (Towson,
MD) ; Takacs; Julie Ellen; (Baltimore, MD) ;
Neary; Timothy Brian; (Baldwin, MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The Johns Hopkins University |
Baltimore |
MD |
US |
|
|
Family ID: |
44647710 |
Appl. No.: |
14/320054 |
Filed: |
June 30, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13051610 |
Mar 18, 2011 |
8828976 |
|
|
14320054 |
|
|
|
|
61315240 |
Mar 18, 2010 |
|
|
|
Current U.S.
Class: |
514/150 ; 435/8;
514/297; 514/307; 514/315 |
Current CPC
Class: |
C07D 219/10 20130101;
A61P 7/00 20180101; C12Q 1/66 20130101; C07D 217/26 20130101; A61K
31/47 20130101; A61K 31/655 20130101; A61P 31/10 20180101; C07D
211/94 20130101; A61P 7/06 20180101; A61P 33/00 20180101; A61P 3/00
20180101; C07C 245/10 20130101; C12Q 1/025 20130101; A61P 35/00
20180101; A61K 31/45 20130101; G01N 2500/10 20130101; A61K 31/473
20130101; G01N 33/5008 20130101 |
Class at
Publication: |
514/150 ; 435/8;
514/307; 514/297; 514/315 |
International
Class: |
C12Q 1/66 20060101
C12Q001/66; C07C 245/10 20060101 C07C245/10; C07D 211/94 20060101
C07D211/94; C07D 217/26 20060101 C07D217/26; C07D 219/10 20060101
C07D219/10 |
Goverment Interests
[0003] This invention was made with United States Government
support under R21 DK078633 awarded by the National Institutes of
Health. The United States Government has certain rights in the
invention.
Claims
1. A method for identifying an active compound affecting fidelity
of eukaryotic translation initiation codon selection comprising:
introducing a compound to eukaryotic cells in culture, wherein the
cells comprise a DNA sequence encoding a first reporter protein,
and the mRNA from the first reporter protein has an initiation
codon that is a near-cognate of AUG; measuring an amount of the
first reporter protein; determining a change in the amount of first
reporter protein by comparing the amount of the first reporter
protein to a baseline amount of the first reporter protein measured
in the absence of the compound; and selecting the compound as the
active compound for affecting fidelity of eukaryotic translation
initiation codon of the near-cognate of AUG initiation codons when
the change in the amount of the first reporter protein meets or
exceeds a predetermined threshold.
2. The method of claim 1, wherein the predetermined threshold is an
increase or decrease of 50%.
3. The method of claim 1, further comprising measuring the baseline
amount of the first reporter protein.
4. The method of claim 1, further comprising counter-screening the
active compound to determine non-specific activity and eliminating
the compound as the active compound if it exhibits non-specific
activity.
5. The method of claim 4, wherein the counter-screening comprises
measuring a second amount of the first reporter protein wherein the
second amount of the first reporter protein is an amount produced
by introducing the compound to eukaryotic cell in culture, wherein
the cells comprise a DNA sequence encoding the first reporter
protein, and the mRNA from the first reporter protein has an AUG
initiation codon.
6. The method of claim 1, wherein the cells are yeast cells.
7. The method of claim 1, wherein the cells are mammalian
cells.
8. The method of claim 1, wherein the first reporter protein is a
luciferase protein.
9. The method of claim 8, wherein the luciferase protein is a
firefly luciferase protein.
10. The method of claim 1, wherein the cells further comprise a DNA
sequence encoding a second reporter protein, and the mRNA from the
second reporter protein has an AUG initiation codon; the method
further comprising measuring the amount of the second reporter
protein.
11. The method of claim 10, further comprising measuring the ratio
between the amount of first reporter protein and the amount of the
second reporter protein.
12. The method of claim 10, where the second reporter protein is a
luciferase protein.
13. The method of claim 10, wherein the second reporter protein is
selected from the group consisting of a luciferase protein, a
fluorescent protein, or a colorimetric protein.
14. The method of claim 10, wherein the first reporter protein is a
firefly luciferase protein and the second reporter is a Renilla
luciferase protein.
15. The method of claim 10, wherein the first and/or the second
reporter protein is quantified by a method selected from the group
consisting of colorimetric, luminescence, fluorescence, absorbance,
immunogenically, level of cell growth in a selected media, and
measuring protein expression.
16. A method of treating a disorder treatable by a compound
affecting fidelity of eukaryotic translation initiation codon
selection comprising administrating a therapeutically effective
amount of an active compound selected by the method of claim 1 to a
subject in need thereof.
17. The method of claim 16, wherein the disorder is selected from
the group consisting of a genetic disorder, a fungal infection, a
parasitic infection, or a hyperproliferative disorder.
18. The method of claim 17, wherein the disorder is a genetic
disorder characterized by a single nucleotide mutation in the
initiation codon selected from the group consisting of
beta-thalassemia, alpha-thalassemia, hemoglobin H disease,
phenylketonuria, congenital adrenal hyperplasia, Smith-Lemli-Opitz
Syndrome, and Refsum disease.
19. The method of claim 17, wherein the disorder is a fungal
infection.
20. The method of claim 17, wherein the disorder is a
hyperproliferative disorder.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation of U.S. patent
application Ser. No. 13/051,610, filed Mar. 18, 2011, which claims
priority to U.S. Provisional Application No. 61/315,240 filed Mar.
18, 2010, the entire contents of which are hereby incorporated by
reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Mar. 17, 2011, is named 22431922.txt and is 2,193 bytes in
size.
BACKGROUND
[0004] 1. Field of the Invention
[0005] The present invention relates to compounds that affect the
fidelity of eukaryotic translation initiation codon selection and
screening methods for identifying such compounds.
[0006] 2. Background of the Invention
[0007] Translation of mRNA into functional protein is energetically
expensive and must be highly accurate. The initiation phase of
protein synthesis establishes the reading frame of translation and
commits the cellular machinery to begin the elongation phase. For
most mRNAs, the start codon is an AUG. It has been shown that
codons that vary from AUG in one position (near-cognates) can be
used up to .about.8% as efficiently as AUG codons as start sites in
S. cerevisiae (Zitomer et al., Mol. Cell Biol., vol. 4, no. 7, pp.
1191-1197, 1984; Clements et al., Mol. Cell Biol., vol. 8, no. 10,
pp. 4533-4536, 1988; Donahue et al., Mol. Cell Biol., vol. 8, no.
7, pp. 2955-2963, 1988; Kolitz et al., RNA, vol. 15, no. 1, pp.
138-152, 2009). Translation initiation at non-AUG codons has been
shown to occur naturally in both translation using a non-AUG start
codon (Anaganti et al. 2009). In yeast, two tRNA synthetase genes,
GRS1 and ALA1, use non-AUG start codons for normal expression (UUG
and ACG, respectively) (Chang and Wang 2004; Tang et al. 2004).
Additionally, using ribosomal profiling Ingolia et al. (2009)
identified 143 actively translated upstream open reading frames
(uORFs) that appear to have non-AUG start codons in yeast.
Interestingly, translation from these small uORFs is increased upon
amino acid starvation, although neither the reason for this effect
nor its mechanism is yet understood (Ingolia et al. 2009).
[0008] Recent studies using a reconstituted S. cerevisiae
translation initiation system have elucidated core events involved
in start codon selection. Briefly, the 40S subunit with eukaryotic
initiation factor (eIF) 1, eIF1A, the ternary complex (TC: eIF2,
initiator methionyl-tRNA and GTP) and eIF5 (the GTPase activating
protein (GAP) for eIF2) is loaded onto the 5' end of the mRNA and
scans to locate the start codon. In vivo, eIF4F, eIF4B and eIF3 are
involved in loading of this 43S ribosomal pre-initiation complex
(PIC) onto the 5' end of the mRNA and subsequent scanning of the
message. After the initiator tRNA anti-codon base pairs with the
mRNA start codon, eIF1 is released from the complex. Loss of eIF1
in turn allows inorganic phosphate to be released from eIF2,
converting the factor into its GDP-bound form. The release of eIF1
also produces a conformational change in the complex that is
thought to prevent further scanning. At this stage, the large
ribosomal subunit joins the small ribosomal complex with the help
of eIF1A and eIF5B, producing an 80S initiation complex that can
enter the elongation phase of the cycle (for reviews of the
mechanism of eukaryotic translation initiation see (Lorsch et al.,
J. Biol. Chem., vol. 285, no. 21203-21207, 2010; Sonenberg et al.,
Cell, vol. 136, no. 4, pp. 731-745, 2009; (Jackson et al., Nat.
Rev. Mol. Cell. Biol., vol. 11, no. 2, pp. 113-127, 2010).
[0009] Although many steps involved in locating the start codon
have been elucidated, the mechanistic details of this process are
still a mystery. Many components of the translation machinery are
known to impact the fidelity of start codon selection. Mutations in
eIF1 (Yoon et al., Mol. Cell. Biol., vol. 12, no. 1, pp. 248-260,
1992), 1A (Fekete et al., EMBO J., vol. 24, no. 20, pp. 3588-3601,
2005; Saini et al., Genes Dev., vol. 24, no. 1, pp. 97-110, 2010),
eIF2 (Donahue et al., Cell, vol. 54, no. 5, pp. 621-632, 1988;
Castilho-Valavicius et al., Genetics, vol. 124, no. 3, pp. 483-495,
1988), eIF5 (Huang et al., Genes Dev., vol. 11, no. 18, pp.
2396-2413, 1997), eIF3 (Valasek et al., Mol. Cell. Biol., vol. 24,
no. 21, pp. 9437-9455; 2004) and eIF4G (He et al., Mol. Cell.
Biol., vol. 23, no. 15, pp. 5431-5445, 2003) are known to decrease
the fidelity of start codon selection in vivo (Sui.sup.-
phenotype), and have been important tools to study the steps
involved in translation initiation. While mechanistically very
different, the selection of the start codon in the P-site during
translation initiation can be related to selection of tRNA in the
A-site during elongation; both processes are dependent on matching
codon:anti-codon base pairing, which triggers downstream events
(Kolitz et al., RNA, vol. 15, no. 1, pp. 138-152, 2009; Cigan et
al., Science, vol. 242, no. 4875, pp. 93-97, 1988; Ogle et al.,
Science, vol. 292, no. 5518, pp. 897-902, 2001). Small molecules
such as the aminoglycoside family of antibiotics have been crucial
tools to probe the mechanism of tRNA selection in the ribosomal
A-site during the elongation phase of translation (Rodnina et al.,
Annu. Rev. Biochem., vol. 70, pp. 415-435, 2001; Ogle et al., Cell,
vol. 111, no. 5, pp. 721-732, 2002; Ogle et al., Annu. Rev.
Biochem., vol. 74, pp. 129-177, 2005). Although mutations in
eukaryotic initiation factors have been studied, no chemical
modulators of start codon selection exist to help elucidate the
mechanism of this complicated process. Compounds that increase or
decrease misreading during initiation could provide unique insight
to how AUG is selected during initiation.
SUMMARY
[0010] Embodiments of the invention include methods of altering the
fidelity of eukaryotic translation initiation codon selection by
administering to a cell a compound of Formula I-V:
##STR00001##
where n is an integer from 1 to 4; R.sup.1 is H, halogen, alkyl,
NO.sub.2OR.sup.3, N(R.sup.4).sub.2, or SR.sup.5; R.sup.2 is H or
alkyl; R.sup.3 is H or alkyl, and R.sup.4 is H or alkyl and R.sup.5
is H or alkyl;
##STR00002##
where X.sup.1 is Br, or I; R.sup.6 is H, halogen, alkyl, NO.sub.2,
OR.sup.3, N(R.sup.4).sub.2, or SR.sup.5; R.sup.3 is H or alkyl, and
R.sup.4 is H or alkyl and R.sup.5 is H or alkyl;
##STR00003##
where X.sup.2 is F, Cl, Br, or I; R.sup.7 is H or alkyl;
##STR00004##
where X.sup.3 is F, Cl, Br, or I; R.sup.8 is H or alkyl; R.sup.9 is
H or alkyl;
##STR00005##
where R.sup.10 is H or alkyl and R.sup.11 is H or alkyl; and
pharmaceutically acceptable salts thereof.
[0011] Some embodiments include methods of altering the fidelity of
eukaryotic translation initiation codon selection by administering
to a cell a compound of Formula (I) or (II).
[0012] In some embodiments, the compound may be one of the
compounds shown below.
##STR00006##
[0013] In some embodiments, the compound may be one of the
compounds shown below.
##STR00007##
[0014] Embodiments of the invention include methods for screening a
test compound by introducing the test compound to eukaryotic cells
in a culture where the cells have a DNA sequence encoding a first
reporter protein, and where the mRNA from the first reporter
protein has an initiation codon that is a near-cognate of AUG. Then
measuring the change in the amount of reporter protein. In some
embodiments the cells also have a DNA sequence encoding a second
reporter protein, where the mRNA from the second reporter protein
has an AUG initiation codon.
[0015] In embodiments, the step of measuring the amount of reporter
protein also includes measuring the ratio between the amount of
first reporter protein and the second reporter protein.
[0016] In some embodiments, the eukaryotic cells are yeast cells.
In some embodiments, the eukaryotic cells are mammalian cells.
[0017] In some embodiments, the first reporter protein is a
luciferase protein. In some embodiments, the first reporter protein
is a firefly luciferase protein.
[0018] In some embodiments having a second reporter protein, the
second reporter protein is a luciferase protein. In some
embodiments, the second reporter protein is a Renilla luciferase
protein.
[0019] In some embodiments, the cells have a first and second
reporter protein and the first reporter protein is a firefly
luciferase protein and the second reporter is a Renilla luciferase
protein.
[0020] Embodiments of the invention include methods of treating a
disorder comprising administering to a subject in need of treatment
an effective amount of a compound of formula I-V, shown below.
##STR00008##
where n is an integer from 1 to 4; R.sup.1 is H, halogen, alkyl,
NO.sub.2OR.sup.3, N(R.sup.4).sub.2, or SR.sup.5; R.sup.2 is H or
alkyl; R.sup.3 is H or alkyl, and R.sup.4 is H or alkyl and R.sup.5
is H or alkyl;
##STR00009##
where X.sup.1 is Br, or I; R.sup.6 is H, halogen, alkyl, NO.sub.2,
OR.sup.3, N(R.sup.4).sub.2, or SR.sup.5; R.sup.3 is H or alkyl, and
R.sup.4 is H or alkyl and R.sup.5 is H or alkyl;
##STR00010##
where X.sup.2 is F, Cl, Br, or I; R.sup.7 is H or alkyl;
##STR00011##
where X.sup.3 is F, Cl, Br, or I; R.sup.8 is H or alkyl; R.sup.9 is
H or alkyl; and
##STR00012##
or pharmaceutically acceptable salt thereof. The disorder is: a
disorder characterized by a non-AUG initiation codon, a fungal
infection, a parasitic infection, or a hyperproliferative
disorder.
[0021] In some treatment methods, the compound is a compound of
Formula (I) or (II).
[0022] In some treatment methods, the compound is one of the
compounds shown below.
##STR00013##
[0023] In some treatment methods, the compound is one of the
compounds shown below.
##STR00014##
[0024] In some embodiments where the disorder is a genetic disorder
characterized by a single nucleotide mutation in the initiation
codon, the disorder may be, for example, beta-thalassemia,
alpha-thalassemia, hemoglobin H disease, phenylketonuria,
congenital adrenal hyperplasia, Smith-Lemli-Opitz Syndrome, Refsum
disease, Laron syndrome (LS) or growth hormone (GH) insensitivity
syndrome (GHIS), cerebral adrenoleukodystrophy (ALD) and
adrenomyeloneuropathy (AMN), Ataxia, Combined factor V-factor VIII
deficiency (F5F8D), melanoma, Rhmod syndrome, glycogen storage
disease type V (McArdle's disease), Autosomal dominant
neurohypophyseal diabetes insipidus (ADNDI), Norrie disease (ND),
Leukocyte adhesion deficiency (LAD), Niemann Pick disease (NPD),
mucopolysaccharidosis type I (MPS) or Hurler/Scheie syndrome
(IH/S), Tay-Sachs disease, or hyperphenylalaninemia.
[0025] In some embodiments, the disorder is a fungal infection. In
some embodiments, the disorder is a parasitic infection. In some
embodiments, the disorder is a hyperproliferative disorder.
[0026] In some embodiments, the presently disclosed screening
method uses a dual luciferase assay in which renilla and firefly
luciferase are expressed from the same plasmid, but as separate
messages. Renilla (Rluc) luciferase mRNA, with an AUG start codon,
acts as an internal control for expression of firefly (Fluc)
luciferase mRNA, with the near cognate codon UUG. Screening of over
50,000 compounds identified compounds that increase expression from
UUG relative to AUG.
[0027] Certain aspects of the presently disclosed subject matter
having been stated hereinabove, which are addressed in whole or in
part by the presently disclosed subject matter, other aspects will
become evident as the description proceeds when taken in connection
with the accompanying Examples and Drawings as best described
herein below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] FIG. 1 is a model of eukaryotic translation initiation,
excluding mRNA cap and poly(A) tail associated factors (Mitchell et
al., J. Biol. Chem., vol. 283, no. 41, pp. 27345-27349, 2008). eIF2
delivers the Met-tRNAi to the 40S subunit, and converts GTP to GDP
in response to identification of the start codon. eIF5 is the GAP
for eIF2. The N and C termini of eIF1 and eIF1A have been shown to
be critical in monitoring the identification of the start
codon.
[0029] FIG. 2 is an overview of the dual luciferase assay and
screen. FIG. 2A shows a schematic of the coding region of the
plasmid used for the dual luciferase assay. P, promoter; T,
terminator. The ADH promoter and HIS terminator were used to
produce renilla luciferase mRNA, and the GPD promoter and CYC
terminator were used for firefly luciferase mRNA. FIG. 2B shows a
flow-chart for identifying compounds that alter the fidelity of
start codon recognition.
[0030] FIG. 3 shows an evaluation of the dual luciferase assay
under screening conditions. FIG. 3A shows increasing volumes of
yeast (strain BY4741) culture expressing FlucUUG (circles) and
RlucAUG (squares) from plasmid pFuugRaug were added to lysis
buffer, and the resulting luciferase activities measured. Points
are fit to a straight line with R>0.99 for both renilla and
firefly luciferase activities. FIG. 3B shows the effect of DMSO on
the Fluc/Rluc ratio for AUG/AUG (white bars) and UUG/AUG (filled
bars). BY4741 with pFuugRaug or pFaugRaug were grown with 3% DMSO
under screening conditions. The effect of DMSO on the ratio was
controlled for by normalization with the DMSO-only control during
the screening analysis.
[0031] FIG. 4 shows an evaluation of the dual luciferase assay
under screening conditions. FIG. 4A shows BY4741 transformed with
pFuugRaug grown with various concentrations of cycloheximide and
the luciferase activities measured after four hours (circles are
FlucUUG, squares are RlucAUG). FIG. 4B shows BY4741 with pFuugRaug,
as above, as well as with pFaugRaug, grown with cycloheximide and
the UUG/AUG (squares) and AUG/AUG (circles) ratios were measured.
The Fluc/Rluc ratio of the solvent-only control was used to
normalize the treated samples so that both ratios (UUG/AUG and
AUG/AUG) equal 1 in the absence of drug.
[0032] FIG. 5 shows the data set used to calculate the Z' factor.
The FlucUUG/FlucAUG ratios were measured using a wild type
(TD76-8D, closed circles) and a Sui.sup.- strain (301-4D, open
squares).
[0033] FIG. 6 shows the effect of compound NSC 218351 on expression
of firefly luciferase in a pre-lysis experiment. Points are
averages of twelve independent experiments for in vivo ratios, and
prelysis points are from one experiment.
[0034] FIG. 7 shows the effects of NSC218351 in the dual luciferase
assay. FIG. 7A shows BY4741 expressing Fluc with either an AUG or
UUG start codon treated with various concentrations of NSC218351,
and normalized to the internal Rluc control with an AUG start
codon. The Fluc/Rluc ratio from each sample was then normalized to
the appropriate DMSO-only control, so that each ratio equals 1 in
the absence of compound (normalized FlucUUG, circles; normalized
FlucAUG, squares). Points are the averages of at least 7
independent experiments.+-.standard error. FIG. 7B shows raw
luciferase activity values with increasing concentrations of
NSC218351. Symbols indicate luciferase values from pFuugRaug
plasmid, and luciferase values from pFaugRaug counter-screening
plasmid (Fluc, squares; Rluc, circles). Luciferase activities are
normalized to the DMSO control values in each experiment, and the
normalized values of at least 6 independent experiments are
averaged (.+-.average deviation).
[0035] FIG. 8 shows the effects of NSC92218 in the dual luciferase
assay. FIG. 8A shows BY4741 expressing Fluc with either an AUG or
UUG start codon treated with various concentrations of NSC92218,
and normalized to the internal Rluc control with an AUG start
codon. The Fluc/Rluc ratio from each sample was then normalized to
the appropriate DMSO-only control, so that each ratio equals 1 in
the absence of compound (normalized FlucUUG, circles; normalized
FlucAUG, squares). Points are the averages of at least 7
independent experiments.+-.standard error. FIG. 8B shows raw
luciferase activity values with increasing concentrations of
NSC92218. Symbols indicate luciferase values from pFuugRaug
plasmid, and luciferase values from pFaugRaug counter-screening
plasmid (Fluc, squares; Rluc, circles). Luciferase activities are
normalized to the DMSO control values in each experiment, and the
normalized values of at least 6 independent experiments are
averaged (.+-.average deviation).
[0036] FIG. 9 shows Fluc expression from different near-cognate
start codons. FIG. 9A shows Fluc expression from reporters with
different near-cognate start codons in cells treated with NSC218351
(the black X is AUG). FIG. 9B shows Fluc expression from reporters
with different near-cognate start codons in cells treated with
NSC92218 (the black X is AUG).
[0037] FIG. 10 shows the effect of Sui.sup.- mutants on all
near-cognate start codons in the dual luciferase assay. The
FlucXXX/FlucAUG ratio was measured for several Sui.sup.- mutants,
where XXX is the start codon that varies from AUG by one base pair.
This ratio was normalized to the same ratio in the wild type
control [(Fxxx/Faug).sub.Sui.sub.-/(Fxxx/Faug).sub.wt] to
illustrate the magnitude of the effect of the Sui.sup.- mutations
on initiation at each codon relative to a wild type strain.
[0038] FIG. 11 shows relative levels of Fluc/Rluc mRNA measured
using RT-q-PCR, from strain BY4741 expressing FlucUUG and RlucAUG
treated with 2 .mu.M NSC92218 or 50 .mu.M NSC218351. The Rluc mRNA
levels were used to normalize the Fluc mRNA levels, and the
Fluc/Rluc ratio of the DMSO sample was used to normalize the
samples treated with compounds. Data are the averages of duplicate
samples.
[0039] FIG. 12 shows normalized Fluc(AUG) (squares) and Fluc(UUG)
(circles) expression in WT yeast (BY4741; closed symbols) and a
strain deficient in drug efflux pumps (YRP1: snq2.DELTA.,
pdr5.DELTA., erg6.DELTA.; open symbols) treated with compounds
NSC218351 (FIG. 12A) and NSC92218 (FIG. 12B). Points for YRP1 are
averages of data from 3 separate transformants.+-.average
deviation.
[0040] FIG. 13 shows analogs of NSC218351 that were tested at
various concentrations in the dual luciferase assay to measure
their effects on initiation at UUG and AUG codons.
[0041] FIG. 14 shows analogs of NSC92218 that were tested at
various concentrations in the dual luciferase assay to measure
their effects on initiation at UUG and AUG codons,
[0042] FIG. 15 shows a schematic of the reporter for measuring how
compounds increase translation of a luciferase reporter fused to
the small, endogenous uORF from PRE2 beginning with a UUG codon. As
a control, the uORF was fused out of frame from the luciferase
coding region.
[0043] FIG. 16 shows BY4741 expressing the reporter from FIG. 14
treated with NSC218351 (FIG. 16A) or NSC92218 (FIG. 16B), and Fluc
activity was measured. Closed squares are the in-frame reporters,
and open squares are the out-of-frame controls. Fluc activity with
DMSO alone was used to normalize the activity with compound. Points
are averages of 2 independent experiments.+-.average deviation.
[0044] FIG. 17 shows growth of Sui.sup.- mutant eIF1 D83G with
compound NSC 218351, DMSO, or analog quinaldic acid in SC-His
media. Doubling times were quantified for two experiments by
plotting Log.sub.2(OD.sub.600) vs. time. The slope of the line
between -2.5<Log.sub.2(OD.sub.600)<2 equals 1/doubling
time.
[0045] FIG. 18 shows that both compounds increase the growth of
Sui.sup.- strain sui1-1 (eIF1 D83G) on media lacking histidine.
Compound or solvent soaked paper strips were placed on agar plates.
Yeast were spotted onto the plate as 4 rows increasingly distant
from the paper strip and grown for 4 days on SC-His and 2 days on
SC. Two rows from one representative experiment are shown (the 50
mM isoquinoline data are from a separate experiment). The results
were consistent in all rows and in three independent
experiments.
[0046] FIG. 19 shows the effect of NSC218351 and NSC92218 on start
site selection in strains of yeast with altered levels of eIFs 1,
1A and 5. FIG. 19A shows the FlucUUG/RlucAUG expression ratio and
FIG. 19B shows the FlucAUG/RlucAUG expression ratio, in the
presence of DMSO (white bars) or compounds (NSC218351, grey bars;
NSC92218, black bars), measured in strain H3984 (hc eIF1) and
compared to wild type (BY4741), and haplo-insufficient diploids for
eIFs 1 (+/sui1.DELTA.), 1A (+/tif1.DELTA.) and 5 (+/tif5.DELTA.)
and compared to diploid wild type BY4743 (+/+). H3984 data are an
average of 2 independent experiments. Error bars represent average
deviation. The concentration of NSC218351 was 60 .mu.M, and
NSC92218 was 3.8 .mu.M. Haplo-insufficiency results are averages of
data from 2 separate transformants. The concentration of NSC218351
was 33 .mu.M, and NSC92218 was 7 .mu.M. FlucAUG/RlucAUG expression
ratio with DMSO alone was used to normalize the Fluc/Rluc ratio for
both FlucAUG and FlucUUG for each strain (normalized
FlucAUG/RlucAUG with DMSO alone is 1 for each strain).
[0047] FIG. 20 shows the concentration dependence of the effect of
NSC218351 (FIG. 20A) and NSC92218 (FIG. 20B) on Fluc expression
from UUG (squares) and AUG (circles) in hc eIF1 (closed symbols)
and wild type (open symbols). Data, from 2 independent experiments,
were analyzed.
DETAILED DESCRIPTION
[0048] The presently disclosed subject matter now will be described
more fully hereinafter with reference to the accompanying Drawings,
in which some, but not all embodiments of the inventions are shown.
The presently disclosed subject matter may be embodied in many
different forms and should not be construed as limited to the
embodiments set forth herein; rather, these embodiments are
provided so that this disclosure will satisfy applicable legal
requirements. Indeed, many modifications and other embodiments of
the presently disclosed subject matter set forth herein will come
to mind to one skilled in the art to which the presently disclosed
subject matter pertains having the benefit of the teachings
presented in the foregoing descriptions and the associated
Drawings. Therefore, it is to be understood that the presently
disclosed subject matter is not to be limited to the specific
embodiments disclosed and that modifications and other embodiments
are intended to be included within the scope of the appended
claims.
DEFINITIONS
[0049] Although specific terms are employed herein, they are used
in a generic and descriptive sense only and not for purposes of
limitation. Unless otherwise defined, all technical and scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which this presently described
subject matter belongs.
[0050] Following long-standing patent law convention, the terms
"a," "an," and "the" refer to "one or more" when used in this
application, including the claims. Thus, for example, reference to
"a subject" includes a plurality of subjects, unless the context
clearly is to the contrary (e.g., a plurality of subjects), and so
forth.
[0051] Throughout this specification and the claims, the terms
"comprise," "comprises," and "comprising" are used in a
non-exclusive sense, except where the context requires otherwise.
Likewise, the term "include" and its grammatical variants are
intended to be non-limiting, such that recitation of items in a
list is not to the exclusion of other like items that can be
substituted or added to the listed items.
[0052] For the purposes of this specification and appended claims,
unless otherwise indicated, all numbers expressing amounts, sizes,
dimensions, proportions, shapes, formulations, parameters,
percentages, parameters, quantities, characteristics, and other
numerical values used in the specification and claims, are to be
understood as being modified in all instances by the term "about"
even though the term "about" may not expressly appear with the
value, amount or range. Accordingly, unless indicated to the
contrary, the numerical parameters set forth in the following
specification and attached claims are not and need not be exact,
but may be approximate and/or larger or smaller as desired,
reflecting tolerances, conversion factors, rounding off,
measurement error and the like, and other factors known to those of
skill in the art depending on the desired properties sought to be
obtained by the presently disclosed subject matter. For example,
the term "about," when referring to a value can be meant to
encompass variations of, in some embodiments, .+-.100% in some
embodiments .+-.50%, in some embodiments+20%, in some
embodiments+10%, in some embodiments .+-.5%, in some embodiments
.+-.1%, in some embodiments .+-.0.5%, and in some embodiments
.+-.0.1% from the specified amount, as such variations are
appropriate to perform the disclosed methods or employ the
disclosed compositions.
[0053] Further, the term "about" when used in connection with one
or more numbers or numerical ranges, should be understood to refer
to all such numbers, including all numbers in a range and modifies
that range by extending the boundaries above and below the
numerical values set forth. The recitation of numerical ranges by
endpoints includes all numbers, e.g., whole integers, including
fractions thereof, subsumed within that range (for example, the
recitation of 1 to 5 includes 1, 2, 3, 4, and 5, as well as
fractions thereof, e.g., 1.5, 2.25, 3.75, 4.1, and the like) and
any range within that range.
[0054] By "control" is meant a standard or reference condition.
[0055] By "disease" or "disorder" is meant any condition that
damages or interferes with the normal function of a cell, tissue,
organ or subject.
[0056] By "effective amount" is meant the amount of an agent
required to ameliorate the symptoms of a disease relative to an
untreated subject. The effective amount of an active therapeutic
agent for the treatment of a disease or injury varies depending
upon the manner of administration, the age, body weight, and
general health of the subject. Ultimately, the attending clinician
will decide the appropriate amount and dosage regimen.
[0057] By "modifies" is meant alters. An agent that modifies a
cell, substrate, or cellular environment produces a biochemical
alteration in a component (e.g., polypeptide, nucleotide, or
molecular component) of the cell, substrate, or cellular
environment.
[0058] As used herein, the terms "prevent," "preventing,"
"prevention," "prophylactic treatment" and the like refer to
reducing the probability of developing a disorder or condition in a
subject, who does not have, but is at risk of or susceptible to
developing a disorder or condition.
[0059] As used herein, a "prodrug" is a pharmacologically inactive
compound that is converted into a pharmacologically active agent by
a metabolic transformation.
[0060] By "subject" is meant a mammal, including, but not limited
to, a human or non-human mammal, such as a rodent, bovine, equine,
canine, ovine, or feline.
[0061] As used herein, the terms "treat," treating," "treatment,"
"therapeutic" and the like refer to reducing or ameliorating a
disorder and/or symptoms associated therewith. It will be
appreciated that, although not precluded, treating a disorder or
condition does not require that the disorder, condition or symptoms
associated therewith be completely eliminated.
Chemical Terminology
[0062] While the following terms in relation to compounds found
throughout this application are believed to be well understood by
one of ordinary skill in the art, the following definitions are set
forth to facilitate explanation of the presently disclosed subject
matter. These definitions are intended to supplement and
illustrate, not preclude, the definitions that would be apparent to
one of ordinary skill in the art upon review of the present
disclosure.
[0063] When the term "independently selected" is used, the
substituents being referred to (e.g., R groups, such as groups
R.sub.1, R.sub.2, and the like, or variables, such as "m" and "n"),
can be identical or different. For example, both R.sub.1 and
R.sub.2 can be substituted alkyls, or R.sub.1 can be hydrogen and
R.sub.2 can be a substituted alkyl, and the like. Where multiple R
groups are labeled with the same variable, e.g. where there are two
or more R.sup.1 groups in a molecule, each may be the same or
different from other similarly labeled groups.
[0064] A named "R" or group will generally have the structure that
is recognized in the art as corresponding to a group having that
name, unless specified otherwise herein. For the purposes of
illustration, certain representative "R" groups as set forth above
are defined below.
[0065] As used herein the term "alkyl" refers to C.sub.1-20
inclusive, linear (i.e., "straight-chain"), branched, or cyclic,
saturated or at least partially and in some cases fully unsaturated
(i.e., alkenyl and alkynyl) hydrocarbon chains, including for
example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl,
tert-butyl, pentyl, hexyl, octyl, ethenyl, propenyl, butenyl,
pentenyl, hexenyl, octenyl, butadienyl, propynyl, butynyl,
pentynyl, hexynyl, heptynyl, and allenyl groups. "Branched" refers
to an alkyl group in which a lower alkyl group, such as methyl,
ethyl or propyl, is attached to a linear alkyl chain. In exemplary
embodiments, alkyl is limited to lower alkyl. "Lower alkyl" refers
to an alkyl group having 1 to about 8 carbon atoms (i.e., a
C.sub.1-8 alkyl), e.g., 1, 2, 3, 4, 5, 6, 7, or 8 carbon atoms.
"Higher alkyl" refers to an alkyl group having about 10 to about 20
carbon atoms, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
carbon atoms. In certain embodiments, "alkyl" refers, in
particular, to C.sub.1-8 straight-chain alkyls. There can be
optionally inserted along the alkyl chain one or more oxygen,
sulfur or substituted or unsubstituted nitrogen atoms, wherein the
nitrogen substituent is hydrogen, lower alkyl (also referred to
herein as "alkylaminoalkyl"), or aryl.
[0066] The terms "halo", "halide", or "halogen" as used herein
refer to fluoro, chloro, bromo, and iodo groups.
[0067] The term "nitro" refers to the --NO.sub.2 group.
[0068] Throughout the specification and claims, a given chemical
formula or name shall encompass all tautomers, congeners, and
optical- and stereoisomers, as well as racemic mixtures where such
isomers and mixtures exist.
DESCRIPTION
[0069] Selection of the AUG start codon in eukaryotic translation
initiation is a complex process (FIG. 1). The mechanisms underlying
AUG recognition are not well understood, and the in vivo fidelity
has not been well established. An in vivo dual luciferase assay can
be used to measure the fidelity of initiation from near-cognate
start codons in Saccharomyces cerevisiae (S. cerevisiae). The dual
luciferase assay can be adapted to screen for compounds that alter
the fidelity of translation initiation. Such compounds potentially
may be powerful tools to investigate the mechanism of start codon
selection in vivo and in in vitro systems including the
reconstituted S. cerevisiae translation initiation system, and also
would provide leads for drug development to treat diseases caused
by altered translation initiation. Also, the dual luciferase assay
and the reconstituted translation initiation system can be used to
study the role of the consensus sequence surrounding initiation
codons in yeast.
[0070] Many of the molecular steps leading to the selection of the
AUG start codon in eukaryotic translation initiation have been
elucidated using in vitro and in vivo systems, but the process is
still not fully understood. Studies of tRNA selection during the
elongation phase of prokaryotic translation have benefited from the
use of small molecules. No such chemical tools exist, however, to
probe start codon recognition in eukaryotic translation initiation
and no compounds are currently known that modulate, e.g., alter,
the fidelity of recognition of the translation initiation codon in
eukaryotes. In fact, only a few compounds are known at all that
specifically target any aspect of the process of protein synthesis
in eukaryotes.
[0071] Compounds capable of modulating the fidelity of recognition
of the translation initiation codon in eukaryotes would be useful
for studying the mechanism of translation and could potentially be
developed into drugs to treat a variety of diseases. For example,
variants of many genetic diseases are known that are caused by
mutations of the initiation codon. Compounds that reduce the
fidelity of initiation codon recognition could ameliorate these
diseases by allowing synthesis of the protein from the mutant
mRNAs. In addition, compounds that alter the fidelity of initiation
codon recognition might have antiproliferation properties because
rapidly dividing cells, e.g., cancers, require high levels of
protein synthesis and might be selectively sensitive to increased
production of miscoded proteins. Finally, compounds that
selectively target yeast, but not mammalian translation, could
serve as antifungal agents and compounds that selectively or
preferentially affect parasitic organisms rather than their
mammalian hosts could have antiparasitic activities.
Assay
[0072] Embodiments of the invention include methods of screening a
test compound by introducing a test compound to eukaryotic cells in
a culture wherein the cells comprise a DNA sequence encoding a
first reporter protein. The mRNA from the first reporter protein
has an initiation codon that is a near-cognate of AUG. Measuring
the change in the amount of reporter protein allows the effects of
the compounds on recognition of the initiation codon to be
assessed.
[0073] As used herein, a "near-cognate" of AUG is a codon that
differs from AUG by only one base (e.g. UUG, GUG, CUG, AUA, AUC,
AUU, ACG, AAG, AGG). Near-cognates may be prepared, for example, by
site-directed mutagenesis or other means of changing a single
nucleotide in a nucleotide sequence.
[0074] In some embodiments, the DNA sequence is contained in a
plasmid or vector within the cells. In other embodiments, the DNA
sequence is integrated into the cell's genomic DNA. Often, a
plasmid or vector containing the DNA sequence is inserted into an
existing cell by transformation or transfection using standard
procedures. After insertion, the plasmid or vector may integrate
into the genomic DNA in the cells.
[0075] In principal, any type of eukaryotic cell type may be used,
so long as the cells don't interfere with expression of the
reporter protein. In some embodiments, the cells are yeast cells,
such as, for example, Saccharomyces cerevisiae. In some
embodiments, the cells are mammalian cells, such as, for example,
mouse cells, rat cells, or human cells, or cells of any mammalian
subject described herein.
[0076] Any protein that can be quantified may be used as the
reporter protein. In some embodiments, the reporter protein is a
protein that is not native to the cells used in the assay. In some
embodiments, the reporter protein is a light emitting protein, such
as, for example, a luciferase enzyme, such as, for example firefly
luciferase or Renilla luciferase, or fluorescent protein, such as,
for example, green fluorescent protein, enhanced green fluorescent
protein, blue fluorescent protein, cyan fluorescent protein, yellow
fluorescent protein, red fluorescent protein, and variants thereof.
In some embodiments, the reporter protein may be colorimetric, such
as, for example LacZ. In some embodiments, the first reporter
protein is a firefly luciferase protein.
[0077] The amount of reporter protein may be measured by any means
of quantifying protein expression. In some embodiments, where the
reporter protein emits light, the amount of protein may be
quantified by measuring the amount of luminescence or fluorescence.
In some embodiments, using colorimetric reporter proteins, the
amount of protein may be quantified by measuring absorbance at a
frequency or range of frequencies. In other embodiments, the
reporter protein may be quantified immunogenically, for example by
Western blotting or ELISA. In some embodiments the amount of
expression may be quantified by the level of growth of the cells
allowed on or in selective media, for example, medium lacking
histidine.
[0078] Active compounds are determined by an increase or decrease
in the amount of the reporter protein. Compounds that increase the
amount of reporter protein decrease the fidelity of eukaryotic
translation initiation codon selection by increasing the use of
non-AUG initiation codons. Compounds that decrease the amount of
reporter protein increase the fidelity of eukaryotic translation
initiation codon selection by decreasing the use of non-AUG
initiation codons.
[0079] In some embodiments, additional experiments may be used to
normalize the results. For example, in some embodiments an internal
control may be used to normalize the measurements by the number of
cells, which reduces the variation between different experiments
and allows for more accurate comparisons. Other methods may also be
used to normalize the measurements based on the number of cells,
such as, for example, measuring the number of cells by optical
density.
[0080] In some embodiments, counterscreens or secondary assays may
be used to exclude compounds having non-specific activity. For
example, the counterscreen and secondary assays described below may
be used.
[0081] The threshold for active compounds may be set arbitrarily,
so long as the change in reporter protein expression is measurable,
reproducible, and statistically significant. For example, active
compounds may be identified as those that cause an increase or
decrease of at least, for example, 1.5 fold, 2 fold, 2.5 fold or
more. A 1.5 fold increase means that the amount of protein
expressed in the presence of compound is 1.5 times the amount of
protein expressed in the absence of compound. In other words the
amount of reporter protein expression increases by 50% upon
administration of the compound.
[0082] The number of cells in the culture should be sufficient to
give a detectable level of expression of the reporter protein, and
may be readily optimized by one of ordinary skill in the art.
Likewise, the amount of compound used in the assay should be high
enough to produce a detectable difference in expression of the
reporter protein, if the compound is an active compound. Compounds
that are toxic to the cells at the initial concentration may be
measured at lower, non-toxic concentrations.
[0083] In some embodiments, the cell includes a DNA sequence
encoding a second reporter protein, where the mRNA from the second
reporter protein has an AUG initiation codon.
[0084] As above, the DNA sequence may be part of a plasmid, or may
be integrated into the genomic DNA of the cell.
[0085] Any protein that may be quantified may be used as the second
reporter protein, so long as it is different from the first
reporter protein and the two proteins may be quantified
individually. In some embodiments, the second reporter protein may
be a luciferase protein, fluorescent protein or colorimetric
protein. In some embodiments, the second reporter protein is a
Renilla luciferase protein.
[0086] In some embodiments, the first reporter protein is a firefly
luciferase, and the second reporter protein is a Renilla luciferase
protein. The two luciferase proteins may be independently
quantified by measuring light emission because Renilla luciferase
cannot use the firefly luciferase substrate, and firefly luciferase
requires magnesium ions to produce light emission as described in
U.S. Pat. No. 6,171,809 incorporated by reference in its entirety.
To quantify the two proteins individually, for example, firefly
luciferase substrate and magnesium ions may be added to sample
containing the two luciferase enzymes. The amount of light emission
is produced only by firefly luciferase and may be quantified.
Renilla luciferase substrate and EDTA may then be added to the
sample containing the two luciferase enzymes. Because the magnesium
ions are sequestered by EDTA, any light emission is produced only
by Renilla luciferase, and may be quantified.
[0087] In some embodiments, the measuring step includes measuring
the ratio between the amount of the first reporter protein and the
amount of the second reporter protein. The ratio allows the
screening assay to be normalized to the amount of cells in each
assay. Thus, comparisons may be made between different screening
experiments without the need for additional normalization
procedures, such as cell counting or optical density
measurements.
[0088] In some embodiments, the method further includes a
counterscreen. The counterscreen may eliminate false positives for
example, or compounds that act by a mechanism other than altering
the fidelity of eukaryotic translation initiation codon selection.
The counterscreen may include, for example, performing a separate
assay using the same first reporter protein having an AUG
initiation codon.
[0089] In some embodiments, the counterscreen includes an assay
using the same first reporter protein and second reporter protein
used in the initial screen, but where both reporter proteins have
an AUG initiation codon.
[0090] Any cells or reporter proteins discussed previously may be
used in the counterscreen. In some embodiments, in the
counterscreen, the first reporter protein is firefly luciferase,
and the second reporter protein is Renilla luciferase.
[0091] Additional assays may be used to confirm the activity of the
compound as a compound that alters the fidelity of eukaryotic
translation initiation codon selection. For example, a cell growth
assay using a cell line with a single-nucleotide mutation in the
initiation codon for a protein essential for growth may be used. An
active compound that decreases the fidelity of translation
initiation codon selection allows the use of non-AUG initiation
codons. Therefore, an essential gene may be expressed, allowing the
cells to grow. For example, cells with a single-nucleotide mutation
in the HIS4 protein can not grow on media lacking histidine.
However, an active compound may allow sufficient HIS4 protein to be
expressed, allowing the mutated cells to grow on media lacking
histidine.
[0092] Other assays may be used, such as, for example, RT-PCR, to
show that the compounds do not affect mRNA abundance. Other assays
may be used to confirm that mRNA stability is not altered. For
example, the effect of the compounds with these reporters may be
tested in strains in which nonsense-mediated decay is inoperative,
such as, for example, upf1.DELTA..
Methods
[0093] Embodiments include methods of altering the fidelity of
eukaryotic translation initiation codon selection by administering
to a cell a compound of Formula I-V:
##STR00015##
where n is an integer from 1 to 4; R.sup.1 is H, halogen, alkyl,
NO.sub.2OR.sup.3, N(R.sup.4).sub.2, or SR.sup.5; R.sup.2 is H or
alkyl; R.sup.3 is H or alkyl, and R.sup.4 is H or alkyl and R.sup.5
is H or alkyl;
##STR00016##
where X.sup.1 is Br, or I; R.sup.6 is H, halogen, alkyl, NO.sub.2,
OR.sup.3, N(R.sup.4).sub.2, or SR.sup.5; R.sup.3 is H or alkyl, and
R.sup.4 is H or alkyl and R.sup.5 is H or alkyl;
##STR00017##
where X.sup.2 is F, Cl, Br, or I; R.sup.7 is H or alkyl;
##STR00018##
where X.sup.3 is F, Cl, Br, or I; R.sup.8 is H or alkyl; R.sup.9 is
H or alkyl;
##STR00019##
where R.sup.10 is H or alkyl and R.sup.11 is H or alkyl; and
pharmaceutically acceptable salts thereof.
[0094] In some embodiments, the compound is one shown below.
##STR00020##
[0095] Altering the fidelity of eukaryotic translation initiation
codon selection results in an increase or decrease in the amount of
near-cognate (non-AUG) initiation codons used in protein
translation. A compound that increases fidelity decreases the use
of near-cognate (non-AUG) initiation codons for protein
translation. A compound that decreases fidelity increases the use
of near-cognate (non-AUG) initiation codons in protein translation.
A sufficient amount of compound is administered to the cells to
produce the desired change in fidelity.
[0096] In some embodiments, a compound may alter the fidelity of
initiation codon selection on any mRNA expressed in the cell. In
other words, a compound may have general activity. Alternatively,
in some embodiments, a compound may alter the fidelity of
initiation codon selection only on mRNAs expressed from a specific
gene or specific group of genes. In other words, a compound may
have specific activity. To achieve specific activity, a compound
may alter the fidelity of initiation codon selection on mRNAs
expressed from a specific gene or specific group of genes at a
lower concentration than on mRNAs expressed from other genes.
[0097] The cells may be present in any medium, such as for example,
in vitro (i.e. in culture medium), within a host (if a parasite),
or in vivo (if a subject).
Methods of Treatment
[0098] The terms "treat" or "treating," and grammatical derivatives
thereof, as used herein refer to any type of treatment that imparts
a benefit to a subject afflicted with a disease or illness,
including improvement in the condition of the subject (e.g., in one
or more symptoms), delay in the progression of the condition,
prevention or delay of the onset of the disease or illness, e.g.,
prophylactic treatment, enhancement of normal physiological
functionality, and the like.
[0099] A "therapeutically effective amount" as provided herein
refers to an amount of the presently disclosed compounds and/or
compositions necessary to provide the desired therapeutic effect,
e.g., an amount that is effective to prevent, alleviate, or
ameliorate symptoms of disease or prolong the survival of the
subject being treated. As would be appreciated by one of ordinary
skill in the art upon review of the present disclosure, the exact
amount required will vary from subject to subject, depending on
age, general condition of the subject, the severity of the
condition being treated, the particular compound and/or composition
administered, and the like. An appropriate "therapeutically
effective amount" in any individual case can be determined by one
of ordinary skill in the art by reference to the pertinent texts
and literature and/or by using routine experimentation.
[0100] Embodiments include methods of treating a disorder by
administering to a subject in need of treatment an effective amount
of a compound selected from the group consisting of
##STR00021##
where n is an integer from 1 to 4; R.sup.1 is H, halogen, alkyl,
NO.sub.2OR.sup.3, N(R.sup.4).sub.2, or SR.sup.5; R.sup.2 is H or
alkyl; R.sup.3 is H or alkyl, and R.sup.4 is H or alkyl and R.sup.5
is H or alkyl;
##STR00022##
where X.sup.1 is Br, or I; R.sup.6 is H, halogen, alkyl, NO.sub.2,
OR.sup.3, N(R.sup.4).sub.2, or SR.sup.5; R.sup.3 is H or alkyl, and
R.sup.4 is H or alkyl and R.sup.5 is H or alkyl;
##STR00023##
where X.sup.2 is F, Cl, Br, or I; R is H or alkyl;
##STR00024##
where X.sup.3 is F, Cl, Br, or I; R.sup.8 is H or alkyl; R.sup.9 is
H or alkyl; and
##STR00025##
or pharmaceutically acceptable salt thereof
[0101] In some embodiments, the disorder is: a disorder
characterized by a non-AUG initiation codon, a fungal infection, a
parasitic infection, or a hyperproliferative disorder. Disorders
characterized by a non-AUG initiation codon may be, for example, a
genetic disorder caused by a mutation in the initiation codon of a
protein; use of non-AUG start codons in hyperproliferating cells to
express different isoforms of oncoproteins; or use of non-AUG start
codons in viruses to express viral proteins. As used herein, a
`disorder` is any condition that damages or interferes with the
normal function of a cell, tissue, organ or subject, i.e. a
disorder not present in wild-type cells, tissues, organs or
subjects.
[0102] A number of known genetic disorders are characterized by a
single nucleotide mutation in the initiation codon. Examples
include, beta-thalassemia, alpha-thalassemia, hemoglobin H disease,
phenylketonuria, congenital adrenal hyperplasia, Smith-Lemli-Opitz
Syndrome, Refsum disease, Laron syndrome (LS) or growth hormone
(GH) insensitivity syndrome (GHIS), cerebral adrenoleukodystrophy
(ALD), adrenomyeloneuropathy (AMN), Ataxia, Combined factor
V-factor VIII deficiency (F5F8D), melanoma, Rhmod syndrome,
glycogen storage disease type V (McArdle's disease), Autosomal
dominant neurohypophyseal diabetes insipidus (ADNDI), Norrie
disease (ND), Leukocyte adhesion deficiency (LAD), Niemann Pick
disease (NPD), mucopolysaccharidosis type I (MPS) or Hurler/Scheie
syndrome (IH/S), Tay-Sachs disease, or hyperphenylalaninemia. In
these disorders, administration of a compound that decreases the
fidelity of eukaryotic translation initiation codon selection may
allow sufficient protein to be produced to ameliorate the symptoms
of the genetic disorder.
[0103] In some embodiments, the disorder may be a fungal infection
or parasite infection, where the compounds are specific to fungal
or parasitic protein translation. In such instances, the compounds
act selectively, e.g. more effectively, predominately or only
against the fungi cells, or parasite cells, and not against the
host cells. Examples of eukaryotic parasites include, for example,
Plasmodium (malaria), Trypanosomes, Leishmania, Giardia, Nematodes,
Trematodes, Cestoidea, and Amoeba.
[0104] In other embodiments, the compound may be used against other
organisms, such as insects, or mammals for pest or rodent
control.
[0105] In other embodiments, the disorder may be a virus within
mammalian cells, where the compound inhibits production of viral
proteins that use non-AUG start codons (where the compound
increases fidelity), or produces mis-translated viral proteins by
increasing use of non-AUG start codons (where the compound
decreases fidelity). The compounds may also act against a virus by
disrupting the balance of translation from cognate and near-cognate
codons required for maintaining the proper balance of viral gene
products.
[0106] In some embodiments, the disorder may be a
hyperproliferative disorder. High amounts of protein are produced
in rapidly proliferating cells. Administration of a compound that
decreases the fidelity of eukaryotic translation initiation codon
selection may produce increased levels of protein mistranslation.
In addition, the compounds may alter the balance of expression of
short and long isoforms of oncoproteins and proteins involved in
growth control generated by initiation of translation at
alternative cognate and near-cognate initiation codons. Examples of
oncoproteins and proteins involved in growth control with isoforms
generated from alternative initiation codons include c-myc, VEGF,
JunD, ornithine decarboxylase and C/EBP (Blackwood et al., Mol.
Biol. Cell, vol. 5, pp. 597-609, 1994; Cencig et al., Oncogene,
vol. 23, pp. 267-77, 2004; Bastide et al., Nucleic Acids Ress, vol.
36, pp. 2434-2445, 2008; Touriol et al., Biol. Cell, vol. 95, pp.
169-178, 2003; Ivanov et al., Proc. Natl. Acad. Sci. U.S.A., vol.
105, pp. 10079-10084, 2008; Short et al., J. Biol. Chem., vol. 277,
pp. 32697-32705, 2002).
[0107] In some embodiments, the administered compound is one of the
compounds shown below.
##STR00026##
[0108] The presently disclosed compound(s) can be administered
therapeutically to achieve a therapeutic benefit or
prophylactically to achieve a prophylactic benefit. By therapeutic
benefit is meant eradication or amelioration of the underlying
disorder being treated and/or eradication or amelioration of one or
more of the symptoms associated with the underlying disorder such
that the patient reports an improvement in feeling or condition,
notwithstanding that the patient can still be afflicted with the
underlying disorder. For example, administration of a compound to a
patient suffering from a condition provides therapeutic benefit not
only when the underlying condition is eradicated or ameliorated,
but also when the patient reports a decrease in the severity or
duration of the symptoms associated with the condition. Therapeutic
benefit also includes halting or slowing the progression of the
disease, regardless of whether improvement is realized by the
patient.
[0109] For prophylactic administration, the presently disclosed
compound(s) and compositions can be administered to a subject at
risk of developing a particular condition, e.g., heart failure, or
at risk to the toxic side effects of cardiac glycosides.
Alternatively, prophylactic administration can be applied to avoid
the onset of symptoms in a patient diagnosed with the underlying
disorder.
[0110] The amount of compound administered will depend upon a
variety of factors, including, for example, the particular
indication being treated, the mode of administration, whether the
desired benefit is prophylactic or therapeutic, the severity of the
indication being treated and the age and weight of the patient, the
bioavailability of the particular active compound, and the like.
Determination of an effective dosage is well within the
capabilities of those skilled in the art.
[0111] Effective dosages can be estimated initially from in vitro
assays. For example, an initial dosage for use in animals can be
formulated to achieve a circulating blood or serum concentration of
active compound that is at or above an IC50 of the particular
compound as measured in an in vitro assay known in the art.
Calculating dosages to achieve such circulating blood or serum
concentrations taking into account the bioavailability of the
particular compound is well within the capabilities of skilled
artisans. For guidance, see Fingl & Woodbury, "General
Principles," In: Goodman and Gilman's The Pharmaceutical Basis of
Therapeutics, Chapter 1, pp. 1-46, latest edition, Pagamonon Press,
and the references cited therein.
[0112] Initial dosages also can be estimated from in vivo data,
such as animal models. Animal models useful for testing the
efficacy of compounds to treat or prevent the various diseases
described above are well-known in the art. Dosage amounts will
depend on, among other factors, the activity of the compound, its
bioavailability, the mode of administration and various factors
discussed above. Dosage amount and interval can be adjusted
individually to provide levels of the compound(s) sufficient to
maintain a therapeutic or prophylactic effect. Skilled artisans
will be able to optimize effective local dosages without undue
experimentation.
[0113] The presently disclosed compound(s) and compositions can be
administered once per day, a few or several times per day, or even
multiple times per day, depending upon, among other things, the
indication being treated and the judgment of the prescribing
physician.
[0114] Preferably, the presently disclosed compound(s) and
compositions will provide therapeutic or prophylactic benefit
without causing substantial toxicity. Toxicity of the compound(s)
and compositions can be determined using standard pharmaceutical
procedures. The dose ratio between toxic and therapeutic (or
prophylactic) effect is the therapeutic index. Compounds(s) and
compositions that exhibit high therapeutic indices are
preferred.
Subject
[0115] The subject treated by the presently disclosed methods in
their many embodiments is desirably a human subject, although it is
to be understood that the methods described herein are effective
with respect to all vertebrate species, which are intended to be
included in the term "subject." Accordingly, a "subject" can
include a human subject for medical purposes, such as for the
treatment of an existing condition or disease or the prophylactic
treatment for preventing the onset of a condition or disease, or an
animal subject for medical, veterinary purposes, or developmental
purposes. Suitable animal subjects include mammals including, but
not limited to, primates, e.g., humans, monkeys, apes, and the
like; bovines, e.g., cattle, oxen, and the like; ovines, e.g.,
sheep and the like; caprines, e.g., goats and the like; porcines,
e.g., pigs, hogs, and the like; equines, e.g., horses, donkeys,
zebras, and the like; felines, including wild and domestic cats;
canines, including dogs; lagomorphs, including rabbits, hares, and
the like; and rodents, including mice, rats, and the like. In some
embodiments, the subject is a human including, but not limited to,
fetal, neonatal, infant, juvenile, and adult subjects. Further, a
"subject" can include a patient afflicted with or suspected of
being afflicted with a condition or disease. Thus, the terms
"subject" and "patient" are used interchangeably herein. The
subject also can refer to a cell or tissue sample.
Compounds
[0116] In all embodiments, active compounds may be present as
pharmaceutically acceptable salts or other derivatives, such as
ether derivatives, ester derivatives, acid derivatives, and aqueous
solubility altering derivatives of the active compound. Derivatives
include all individual enantiomers, diastereomers, racemates, and
other isomers of the compounds. Derivatives also include all
polymorphs and solvates, such as hydrates and those formed with
organic solvents, of the compounds. Such isomers, polymorphs, and
solvates may be prepared by methods known in the art, such as by
regiospecific and/or enantioselective synthesis and resolution.
[0117] The ability to prepare salts depends on the acidity of
basicity of the compounds. Suitable salts of the compounds include,
but are not limited to, acid addition salts, such as those made
with hydrochloric, hydrobromic, hydroiodic, perchloric, sulfuric,
nitric, phosphoric, acetic, propionic, glycolic, lactic pyruvic,
malonic, succinic, maleic, fumaric, malic, tartaric, citric,
benzoic, carbonic cinnamic, mandelic, methanesulfonic,
ethanesulfonic, hydroxyethanesulfonic, benezenesulfonic, p-toluene
sulfonic, cyclohexanesulfamic, salicyclic, p-aminosalicylic,
2-phenoxybenzoic, and 2-acetoxybenzoic acid; salts made with
saccharin; alkali metal salts, such as sodium and potassium salts;
alkaline earth metal salts, such as calcium and magnesium salts;
and salts formed with organic or inorganic ligands, such as
quaternary ammonium salts.
[0118] Additional suitable salts include, but are not limited to,
acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate,
bitartrate, borate, bromide, calcium edetate, camsylate, carbonate,
chloride, clavulanate, citrate, dihydrochloride, edetate,
edisylate, estolate, esylate, fumarate, gluceptate, gluconate,
glutamate, glycollylarsanilate, hexylresorcinate, hydrabamine,
hydrobromide, hydrochloride, hydroxynaphthoate, iodide,
isothionate, lactate, lactobionate, laurate, malate, maleate,
mandelate, mesylate, methylbromide, methylnitrate, methylsulfate,
mucate, napsylate, nitrate, N-methylglucamine ammonium salt,
oleate, pamoate (embonate), palmitate, pantothenate,
phosphate/diphosphate, polygalacturonate, salicylate, stearate,
sulfate, subacetate, succinate, tannate, tartrate, teoclate,
tosylate, triethiodide and valerate salts of the compounds.
Pharmaceutical Compositions
[0119] Pharmaceutical compositions may include one or more active
agent, i.e. a compound according to the invention, and may further
contain other suitable substances and excipients, including but not
limited to physiologically acceptable buffering agents, stabilizers
(e.g. antioxidants), flavoring agents, agents to effect the
solubilization of the compound, and the like.
[0120] In other embodiments, the pharmaceutical composition may be
in any suitable form such as a solution, a suspension, an emulsion,
an infusion device, or a delivery device for implantation or it may
be presented as a dry powder to be reconstituted with water or
another suitable vehicle before use. The composition may include
suitable parenterally acceptable carriers and/or excipients.
[0121] In other embodiments, the pharmaceutical compositions may
comprise an effective amount of an active agent in a
physiologically-acceptable carrier. The carrier may take a wide
variety of forms depending on the form of preparation desired for a
particular route of administration. Suitable carriers and their
formulation are described, for example, in Remington's
Pharmaceutical Sciences by E. W. Martin.
[0122] In some embodiments, the active agent may be contained in
any appropriate amount in any suitable carrier substance, and is
generally present in an amount of 1-95% by weight of the total
weight of the composition. The composition may be provided in a
dosage form that is suitable for parenteral (e.g., subcutaneously,
intravenously, intramuscularly, or intraperitoneally) or oral
administration route. The pharmaceutical compositions may be
formulated according to conventional pharmaceutical practice (see,
e.g., Remington: The Science and Practice of Pharmacy (20th ed.),
ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and
Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J.
C. Boylan, 1988-1999, Marcel Dekker, New York).
[0123] In some embodiments, the pharmaceutical compositions may be
in a form suitable for administration by sterile injection. In one
example, to prepare such a composition, the compositions(s) are
dissolved or suspended in a parenterally acceptable liquid vehicle.
Among acceptable vehicles and solvents that may be employed are
water, water adjusted to a suitable pH by addition of an
appropriate amount of hydrochloric acid, sodium hydroxide or a
suitable buffer, 1,3-butanediol, Ringer's solution, and isotonic
sodium chloride solution and dextrose solution. The aqueous
formulation may also contain one or more preservatives (e.g.,
methyl, ethyl or n-propyl p-hydroxybenzoate). For parenteral
formulations, the carrier will usually comprise sterile water,
though other ingredients, for example, ingredients that aid
solubility or for preservation, may be included. Injectable
solutions may also be prepared in which case appropriate
stabilizing agents may be employed.
[0124] Formulations suitable for parenteral administration usually
comprise a sterile aqueous preparation of the inhibitor, which may
be isotonic with the blood of the recipient (e.g., physiological
saline solution). Such formulations may include suspending agents
and thickening agents and liposomes or other microparticulate
systems which are designed to target the compound to blood
components or one or more organs. The formulations may be presented
in unit-dose or multi-dose form.
[0125] Parenteral administration may comprise any suitable form of
systemic delivery or localized delivery. Administration may for
example be intravenous, intra-arterial, intrathecal, intramuscular,
subcutaneous, intramuscular, intra-abdominal (e.g.,
intraperitoneal), etc., and may be effected by infusion pumps
(external or implantable) or any other suitable means appropriate
to the desired administration modality.
[0126] In some embodiments, the pharmaceutical compositions may be
in a form suitable for oral administration. In compositions in oral
dosage form, any of the usual pharmaceutical media may be employed.
Thus, for liquid oral preparations, such as, for example,
suspensions, elixirs and solutions, suitable carriers and additives
include water, glycols, oils, alcohols, flavoring agents,
preservatives, coloring agents and the like. For solid oral
preparations such as, for example, powders, capsules and tablets,
suitable carriers and additives include starches, sugars, diluents,
granulating agents, lubricants, binders, disintegrating agents and
the like. If desired, tablets may be sugar coated or enteric coated
by standard techniques.
[0127] Compositions suitable for oral administration may be
presented as discrete units such as capsules, cachets, tablets, or
lozenges, each containing a predetermined amount of the active
ingredient as a powder or granules. Optionally, a suspension in an
aqueous liquor or a non-aqueous liquid may be employed, such as a
syrup, an elixir, an emulsion, or a draught. Formulations for oral
use include tablets containing active ingredient(s) in a mixture
with pharmaceutically acceptable excipients. Such formulations are
known to the skilled artisan. Excipients may be, for example, inert
diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol,
microcrystalline cellulose, starches including potato starch,
calcium carbonate, sodium chloride, lactose, calcium phosphate,
calcium sulfate, or sodium phosphate); granulating and
disintegrating agents (e.g., cellulose derivatives including
microcrystalline cellulose, starches including potato starch,
croscarmellose sodium, alginates, or alginic acid); binding agents
(e.g., sucrose, glucose, sorbitol, acacia, alginic acid, sodium
alginate, gelatin, starch, pregelatinized starch, microcrystalline
cellulose, magnesium aluminum silicate, carboxymethylcellulose
sodium, methylcellulose, hydroxypropyl methylcellulose,
ethylcellulose, polyvinylpyrrolidone, or polyethylene glycol); and
lubricating agents, glidants, and antiadhesives (e.g., magnesium
stearate, zinc stearate, stearic acid, silicas, hydrogenated
vegetable oils, or talc). Other pharmaceutically acceptable
excipients can be colorants, flavoring agents, plasticizers,
humectants, buffering agents, and the like.
[0128] A syrup may be made by adding the compound to a concentrated
aqueous solution of a sugar, for example sucrose, to which may also
be added any accessory ingredient(s). Such accessory ingredient(s)
may include flavorings, suitable preservative, agents to retard
crystallization of the sugar, and agents to increase the solubility
of any other ingredient, such as a polyhydroxy alcohol, for example
glycerol or sorbitol.
[0129] In some embodiments, the pharmaceutical composition may be
in a form of nasal or other mucosal spray formulations (e.g.
inhalable forms). These formulations can include purified aqueous
solutions of the active compounds with preservative agents and
isotonic agents. Such formulations can be adjusted to a pH and
isotonic state compatible with the nasal or other mucous membranes.
Alternatively, they can be in the form of finely divided solid
powders suspended in a gas carrier. Such formulations may be
delivered by any suitable means or method, e.g., by nebulizer,
atomizer, metered dose inhaler, or the like.
[0130] In some embodiments, the pharmaceutical composition may be
in a form suitable for rectal administration. These formulations
may be presented as a suppository with a suitable carrier such as
cocoa butter, hydrogenated fats, or hydrogenated fatty carboxylic
acids.
[0131] In some embodiments, the pharmaceutical composition may be
in a form suitable for transdermal administration. These
formulations may be prepared, for example, by incorporating the
active compound in a thixotropic or gelatinous carrier such as a
cellulosic medium, e.g., methyl cellulose or hydroxyethyl
cellulose, with the resulting formulation then being packed in a
transdermal device adapted to be secured in dermal contact with the
skin of a wearer.
[0132] In addition to the aforementioned ingredients,
pharmaceutical compositions of the invention may further include
one or more accessory ingredient(s) selected from encapsulants,
diluents, buffers, flavoring agents, binders, disintegrants,
surface active agents, thickeners, lubricants, preservatives
(including antioxidants), and the like.
[0133] In some embodiments, pharmaceutical compositions may be
formulated for immediate release, sustained release, delayed-onset
release or any other release profile known to one skilled in the
art.
[0134] In some embodiments, the pharmaceutical composition may be
formulated to release the active compound substantially immediately
upon administration or at any predetermined time or time period
after administration. The latter types of compositions are
generally known as controlled release formulations, which include
(i) formulations that create a substantially constant concentration
of the drug within the body over an extended period of time; (ii)
formulations that after a predetermined lag time create a
substantially constant concentration of the drug within the body
over an extended period of time; (iii) formulations that sustain
action during a predetermined time period by maintaining a
relatively constant, effective level in the body with concomitant
minimization of undesirable side effects associated with
fluctuations in the plasma level of the active substance (sawtooth
kinetic pattern); (iv) formulations that localize action by, e.g.,
spatial placement of a controlled release composition adjacent to
or in the central nervous system or cerebrospinal fluid; (v)
formulations that allow for convenient dosing, such that doses are
administered, for example, once every one or two weeks; and (vi)
formulations that target the site of a pathology. For some
applications, controlled release formulations obviate the need for
frequent dosing to sustain activity at a medically advantageous
level.
[0135] Any of a number of strategies can be pursued in order to
obtain controlled release in which the rate of release outweighs
the rate of metabolism of the compound in question. In one example,
controlled release is obtained by appropriate selection of various
formulation parameters and ingredients, including, e.g., various
types of controlled release compositions and coatings. Thus, the
inhibitor is formulated with appropriate excipients into a
pharmaceutical composition that, upon administration, releases the
inhibitor in a controlled manner. Examples include single or
multiple unit tablet or capsule compositions, oil solutions,
suspensions, emulsions, microcapsules, microspheres, molecular
complexes, nanoparticles, patches, and liposomes.
[0136] In some embodiments, the pharmaceutical composition may
comprise a "vectorized" form, such as by encapsulation of the
inhibitor in a liposome or other encapsulate medium, or by fixation
of the inhibitor, e.g., by covalent bonding, chelation, or
associative coordination, on a suitable biomolecule, such as those
selected from proteins, lipoproteins, glycoproteins, and
polysaccharides.
[0137] In some embodiments, the pharmaceutical composition can be
incorporated into microspheres, microcapsules, nanoparticles,
liposomes, or the like for controlled release. Furthermore, the
composition may include suspending, solubilizing, stabilizing,
pH-adjusting agents, tonicity adjusting agents, and/or dispersing,
agents. Alternatively, the inhibitor may be incorporated in
biocompatible carriers, implants, or infusion devices.
[0138] Materials for use in the preparation of microspheres and/or
microcapsules are, e.g., biodegradable/bioerodible polymers such as
polygalactin, poly-(isobutyl cyanoacrylate),
poly(2-hydroxyethyl-L-glutamine) and, poly(lactic acid).
Biocompatible carriers that may be used when formulating a
controlled release parenteral formulation are carbohydrates (e.g.,
dextrans), proteins (e.g., albumin), lipoproteins, or antibodies.
Materials for use in implants can be non-biodegradable (e.g.,
polydimethyl siloxane) or biodegradable (e.g., poly(caprolactone),
poly(lactic acid), poly(glycolic acid) or poly(ortho esters) or
combinations thereof).
[0139] Unless the context clearly indicates otherwise,
pharmaceutical compositions of all embodiments can comprise various
pharmaceutically acceptable salts, or other derivatives described
previously.
[0140] The formulation and preparation of such compositions are
well known to those skilled in the art of pharmaceutical
formulation. Formulations can be found in Remington: The Science
and Practice of Pharmacy.
[0141] The pharmaceutical compositions may be provided in unit
dosage forms (e.g., in single-dose ampules), or in vials containing
several doses and in which a suitable preservative may be added. A
composition of the invention may be in any suitable form such as a
solution, a suspension, an emulsion, an infusion device, or a
delivery device for implantation or it may be presented as a dry
powder to be reconstituted with water or another suitable vehicle
before use. The composition may include suitable parenterally
acceptable carriers and/or excipients.
[0142] Further, in some embodiments, compounds disclosed herein may
be prepared as prodrugs. The term "prodrug" refers to a therapeutic
agent that has been chemically derivatized such that, upon
administration to a subject, the derivative is metabolized to yield
the biologically-active therapeutic agent. Accordingly, upon
administration to a recipient, a prodrug is capable of providing
(directly or indirectly) a compound of the presently disclosed
subject matter or an inhibitorily active metabolite or residue
thereof. Prodrugs can increase the bioavailability of the presently
disclosed compounds when such compounds are administered to a
subject (e.g., by allowing an orally administered compound to be
more readily absorbed into the blood) or can enhance delivery of
the parent compound to a biological compartment (e.g., the brain or
lymphatic system) relative to a metabolite species.
[0143] The presently disclosed active compounds or prodrugs thereof
can be formulated in the pharmaceutical compositions per se, or in
the form of a hydrate, solvate, N-oxide or pharmaceutically
acceptable salt, as is known in the art. Typically, such salts are
more soluble in aqueous solutions than the corresponding free acids
and bases, but salts having lower solubility than the corresponding
free acids and bases also can be formed.
Dosage
[0144] The administration of a compound may be by any suitable
means that results in a concentration of the compound that,
combined with other components, is effective in preventing,
diagnosing, prognosing, ameliorating, reducing, or stabilizing a
deficit or disorder.
[0145] Generally, the amount of administered agent of the invention
will be empirically determined in accordance with information and
protocols known in the art. Often the relevant amount will be such
that the concentration of compound in the blood stream of the
patient is about equal to or larger than the IC.sub.50 or K.sub.i
of the compound. Typically agents are administered in the range of
about 10 to 1000 .mu.g/kg of the recipient. Other additives may be
included, such as stabilizers, bactericides, and anti-fungals.
These additives are present in conventional amounts.
[0146] The amount of the compound/agent to be administered varies
depending upon the manner of administration, the age and body
weight of the subject/patient, and with the subject's symptoms and
condition. A compound is generally administered at a dosage that
best achieves medical goals with the fewest corresponding side
effects.
Kits
[0147] The pharmaceutical compositions can, if desired, be
presented in a pack or dispenser device (individually or
collectively referred to as "a kit"), which can contain one or more
unit dosage forms containing the active compound(s) and
compositions. The kit can, for example, comprise metal or plastic
foil, such as a blister pack. The kit can be accompanied by
instructions for administration.
[0148] From the foregoing description, it will be apparent that
variations and modifications may be made to the invention described
herein to adopt it to various usages and conditions. Such
embodiments are also within the scope of the following claims.
[0149] The recitation of a listing of elements in any definition of
a variable herein includes definitions of that variable as any
single element or combination (or subcombination) of listed
elements. The recitation of an embodiment herein includes that
embodiment as any single embodiment or in combination with any
other embodiments or portions thereof.
[0150] The above disclosure generally describes exemplary
embodiments of the present invention. The examples disclosed below
are provided to illustrate the invention but not to limit its
scope. Other variants of the invention will be readily apparent to
one of ordinary skill in the art and are encompassed by the
appended claims. All publications, databases, patents and patent
applications disclosed herein are hereby incorporated by reference
in their entirety.
EXAMPLES
[0151] The following Examples have been included to provide
guidance to one of ordinary skill in the art for practicing
representative embodiments of the presently disclosed subject
matter. In light of the present disclosure and the general level of
skill in the art, those of skill can appreciate that the following
Examples are intended to be exemplary only and that numerous
changes, modifications, and alterations can be employed without
departing from the scope of the presently disclosed subject matter.
The following Examples are offered by way of illustration and not
by way of limitation.
Strains and Plasmids
TABLE-US-00001 [0152] TABLE 1 Genotypes of strains used in this
study. Strain Genotype Source BY4741 MATa his3.DELTA.1 leu2.DELTA.0
met15.DELTA.0 ura 3.DELTA.0 Open Biosystems YRP1 YPH499; MATa
snq2.DELTA.pdr5.DELTA.erg6.DELTA. (Kung et al. 2005) upf1.DELTA.
MATa his3 leu2 met15 ura3 upfl: (Baker and Parker KanMX6 2006)
TD76-8D MATa his4-303(ATT) ura3-52 leu2-3 Thomas Donahue 301-4D
MATa leu2-3 leu2-112 ura3-52 his4- (Yoon and Donahue 303(ATT)
sui1-1 1992) 117-1AR7 MATa his4-303(ATT) ura3-52 inol-13 (Donahue
et al. 1988) sui3-2 H1894 MATa ura3-52 leu2-3 leu2-112
trpl-.DELTA.63 (Kawagishi- gcn2A Kobayashi et al. 1997) H3984 MATa
ura3-52 leu2-3 trpl .DELTA.63 his4- (Cheung et al. 2007) (JCY149)
303(ATT) sui1-.DELTA.':hisG [p4389 His-SUI1 LEU2 2 micron] BY4743
MATa/.DELTA. his3.DELTA.37/his3.DELTA.1 leu2.DELTA.0/leu2.DELTA.0
Open Biosystems LYS2/lys2.DELTA.0 met15.DELTA.0/MET15 ura3.DELTA.0/
ura3.DELTA.0 YNL244C MATa/.DELTA. his3.DELTA.37/his3.DELTA.1
leu2.DELTA.0/leu2.DELTA.0 Open Biosystems (+/sui1.DELTA.)
LYS2/lys2.DELTA.0 met15.DELTA.0/MET15 ura3.DELTA.0/ ura3.DELTA.0
+/sui1 .DELTA. YMR260C MATa/.alpha. his3.DELTA.38/his3.DELTA.1
leu2.DELTA.0/leu2.DELTA.0 Open Biosystems (+/tif11.DELTA.)
LYS2/lys2.DELTA.0 met15.DELTA.0/MET15 ura3.DELTA.0/ ura3.DELTA.0
+/tif11.DELTA. YPR041W MATa/.alpha. his3.DELTA.38/his3.DELTA.1
leu2.DELTA.0/leu2.DELTA.0 Open Biosystems (+/tif5.DELTA.)
LYS2/lys2.DELTA.0 met15.DELTA.0/MET15 ura3.DELTA.0/ ura3.DELTA.0
+/tif5.DELTA. JCY145 MATa ura3-52 leu2-3 leu2-112 trp1.DELTA.63
(Cheung et al. 2007) his4-303(AUU) sui1.DELTA.::hisG pCFB03 (sc
LEU2 His-SUI1) JCY653 MATa ura3-52 leu2-3 leu2-112 trp1.DELTA.63
(Nanda et al. 2009) his4-303(AUU) sui1.DELTA.::hisG pCFB03 (sc LEU2
His-SUI1-G107S) JCY189 MATa ura3-52 leu2-3 leu2-112 trp1.DELTA.63
(Cheung et al. 2007) his4-303(AUU) sui1.DELTA.::hisG pCFB129 (sc
LEU2 His-SUI1-ISQLG93- 97ASQAA) H3582 MATa ura3-52 trp1.DELTA.63
leu2-3 leu2-112 (Fekete et al. 2005) his4-301 (ACG)
tif11.DELTA.p3392 (sc TIF11, URA3) ASY36 MATa ura3-52 trp1.DELTA.63
leu2-3 leu2-112 (Saini et al.) his4-301 (ACG) tif11.DELTA.pAS36 (hc
tif11- .DELTA.107-153, URA3) ASY113 MATa ura3-52 trp1.DELTA.63
leu2-3 leu2-112 This study his4-301 (ACG) tif11.DELTA.pAS113 (hc
tif11- .DELTA.124-153, URA3)
[0153] To construct the uORF-luciferase fusion reporters, the PRE2
uORF was fused to the firefly luciferase coding region with a PDR5
3'UTR as Not1/Spe1 fragments in pRS313. The (Spe1)-Fluc-3'UTR
fusion was cloned by PCR with oNTI226
(GCAactagtGGAAGACGCCAAAAACATAAAG (SEQ ID NO: 1)) and oNTI227
(GCTttaattaaTTACACGGCGATCTTTCCG (SEQ ID NO: 2)) on pGL3 basic and
PCR with oNTI228 (GCAttaatTAATAGAATTTTGAATTTGGTTAAGAAAAG (SEQ ID
NO: 3)) and oNTI229 (GCTgggcccATCAGAGCTGGTAAATTCAAG (SEQ ID NO: 4))
from yeast genomic DNA. A 3-way Spe1/Pac1/Apa1 ligation fused Fluc
with the PDR5 3'UTR in the pRS313 background. The in-frame PRE2
uORF plasmid (pNTI33) was made by PCR with primer oNTI248
(GCAactagtTCTATTCAATTTAATAGTAAATTTGTTATT (SEQ ID NO: 5)), and the
out-of-frame plasmid (pNTI32) was made using the primer oNTI249
(GCAactagtATCTATTCAATTTAATAGTAAATTTGTTAT (SEQ ID NO: 6)), in
combination with oNTI247 (GCTgeggccgeGTTACTATCAAGATGTATCAAACAATG
(SEQ ID NO: 7)), and subcloned into the Fluc-PDR5 3'UTR plasmid as
a Not1/Spe1 fragment.
[0154] TIF11 mutant alleles were constructed by fusion PCR using
p3390, containing WT TIF11 as template, as described previously
(Olsen et al. 2003). The fusion PCR products were inserted between
the EcoRI and SalI sites of YCplac111 (Sc) or YCplac181 (hc), and
the subcloned fragments of all mutant constructs were confirmed by
DNA sequencing. Yeast strains harboring the mutant constructs were
constructed from strains H3582 (his4-301) (Fekete et al. 2005) by
plasmid shuffling.
Chemicals
[0155] After initial characterization of NSC218351 from the NCI DTP
library, additional material was purchased from Sigma Aldrich for
further studies. It behaved identically to the compound in the
library. NSC92218 could not be obtained commercially and thus came
only from the NCI DTP. Identity and purity of NSC92218 were
confirmed by mass spectrometry at the University of Illinois at
Urbana Champaign facility. One species with an exact ionized mass
of 287.1 was detected by LR ESI, and HR Q-tof gave the possible
atomic composition of C.sub.9H.sub.8N.sub.2OI or
C.sub.7H.sub.9N.sub.2ONaI. The expected atomic mass, 286.1, and
composition C.sub.9H.sub.8N.sub.2OI exactly matched NSC92218.
Cycloheximide was obtained from Sigma Aldrich.
Example 1
Screening Protocols
[0156] In this study, a high throughput screen in S. cerevisiae was
set up using a dual luciferase reporter to find compounds that
alter the fidelity of start codon selection in vivo. Approximately
55,000 compounds were screened, and structurally related molecules
were identified that increase the use of non-AUG codons as
initiation sites, thus chemically inducing Sui.sup.- phenotypes.
Data indicate that these compounds act within the cell and that
they increase initiation at a natural uORF with a near-cognate
start codon as well as on the luciferase reporter mRNA. The
compounds can also increase growth on medium lacking histidine of a
Sui.sup.- strain of yeast (sui1-1) in which the AUG start codon of
the HIS4 gene has been changed to a near-cognate codon such that
initiation must occur at a non-AUG (his4-303). This effect
demonstrates the feasibility of chemically ameliorating a genetic
defect caused by mutation of an initiation codon.
[0157] A dual luciferase assay was previously used to measure the
efficiency of translation in yeast and was used to measure
translation from near-cognate start codons in wild type and
Sui.sup.- mutant yeast strains that exhibit defects in fidelity of
start site selection (Cheung et al., Genes Dev., vol. 21, no. 10,
pp. 1217-1230, 2007; Kolitz et al., RNA, vol. 15, no. 1, pp.
138-152, 2009). In the assay, Renilla luciferase (Rluc) and firefly
luciferase (Fluc) genes are expressed from a single plasmid, each
under the control of a separate constitutive promoter and
terminator, allowing transcription of the two genes as separate
mRNAs. The Fluc mRNA has a non-AUG start codon (FIG. 2A). The Rluc
mRNA has an AUG start codon and acts as an internal control for
effects on global gene expression and cell growth (as well as
pipetting errors or differences in lysis efficiency), enabling
detection of effects specific to initiation on the Fluc mRNA. In
both WT and Sui.sup.- strains, Fluc activity is detectable when the
AUG start codon is changed to near-cognate codons that differ from
AUG by only one base (UUG, GUG, CUG, AUA, AUC, AUU, ACG), except
AAG and AGG. UUG is used .about.5% as well as AUG in wild type
yeast (Kolitz et al., RNA, vol. 15, no. 1, pp. 138-152, 2009), and
almost as well as AUG in some Sui.sup.- strains (Cheung et al.,
Genes Dev., vol. 21, no. 10, pp. 1217-1230, 2007). UUG was chosen
as the near cognate start site in the screen, allowing easy
identification of compounds that either increase expression
(chemically reproducing a Sui.sup.- phenotype, decreasing fidelity)
or decrease expression (enhancing fidelity) of UUG relative to AUG
in the dual luciferase assay.
[0158] The scheme for identifying compounds that altered the
fidelity of translation initiation is shown in FIG. 2B. If a
compound appeared to be toxic in the primary screen (both
luciferase values near background levels), it was screened again at
lower concentrations. Compounds that altered the UUG/AUG ratio by
greater than 1.5-fold were rescreened. If the UUG/AUG ratio change
was reproducible, the compounds were counter-screened using the
dual luciferase assay in which both reporters had AUG start codons.
The counter-screen is very powerful, eliminating any compounds that
have effects unrelated to the fidelity of start codon recognition.
For example, a compound that alters the activity of one of the
luciferase enzymes or that generally affects translation of the
Fluc mRNA will show an effect in the counter-screen assay as well
as the primary screen, whereas compounds that specifically affect
initiation from non-AUG codons will not. Compounds that produced
similar effects in both the initial screen and the counter-screen
(for example, increased both UUG/AUG and AUG/AUG) were not pursued
further. For the few compounds that passed the counter-screen, the
luciferase ratios, both UUG/AUG and AUG/AUG, were measured at
various concentrations of each drug to demonstrate concentration
dependence. The compounds were then tested in secondary assays.
Dual Luciferase Assay
[0159] The dual luciferase assay was carried out as in Kolitz et
al. (RNA, vol. 15, no. 1, pp. 138-152, 2009), with the following
modifications to screening conditions: An over-night culture of
wild type yeast (BY4741 transformed with pFuugRaug) were diluted to
an OD.sub.600 of approximately 0.2 in SC-Ura, and 50 .mu.L were
aliquoted to each well of a 96 well plate. BY4741 expressing the
RaugFaug plasmid was included in the 1.sup.st and last column as an
additional control. Compounds to be tested were supplied from the
NCI DTP library in 96 well format at 1 mM in DMSO. DMSO was
included in all control wells. 1.5 .mu.L of compound (or DMSO) was
added to each well of the yeast plate, followed by incubation at
30.degree. C. for 4 hours while shaking. To measure luciferase
activity, 1 .mu.L of culture was added directly to 50 .mu.L of
1.lamda. Passive Lysis Buffer (Promega), incubated 40-60 minutes at
room temperature, then luciferase activity measured using a Turner
Modulus Microplate Reader (Kolitz et al., RNA, vol. 15, no. 1, pp.
138-152, 2009). The same protocol was used when testing the other
libraries, with the appropriate solvent controls. The Fuug/Raug
ratio of each sample with drug was compared to the average
Fuug/Raug ratio of the solvent only controls on the same plate.
[0160] Every row contains DMSO-only controls for each strain. For
each compound-treated sample, the ratio of
[Fluc(UUG)/Rluc(AUG)]/[Fluc(AUG)/Rluc(AUG)] is calculated using the
DMSO-only Fluc(AUG)/Rluc(AUG) control from that row (there is one
for each row in a plate). This ratio is the Fluc(UUG)/Fluc(AUG)
ratio normalized to Rluc(AUG) activity in each sample. This
normalization helps to control for any overall change in the
observation of active luciferase enzymes that is not caused by
addition of drug between the drug-containing (Fluc(UUG)) and
DMSO-only (Fluc(AUG)) wells. Potential changes include pipetting
inaccuracies, differences in lysis efficiencies or global effects
on gene expression due to differences in cell densities during
growth. The internal Rluc control also helps screen out compounds
that affect gene expression or cell growth globally rather than
having specific effects on translation from non-AUG codons.
Screening Assay Validation and Controls
[0161] To demonstrate that the dual luciferase assay could be
adapted to a high throughput screen, the activities of each
reporter were characterized and the ratio of Fluc to Rluc
calculated under screening conditions. For screening, yeast were
grown in 96 well plates, then added to Passive Lysis Buffer
(Promega) in a luciferase reading plate, and the activity of both
reporters measured. Luciferase detection is linear over at least
3-orders of magnitude (FIG. 3A), indicating that an increase or
decrease in expression of either reporter should be detectable.
When the cells were grown under screening conditions in the
presence of cycloheximide, an inhibitor of translation elongation,
the raw luciferase values dropped to .about.25% of the control
values (FIG. 4A); cycloheximide also caused a change in both
ratios, Fluc.sub.UUG/Rluc.sub.AUG and Fluc.sub.AUG/Rluc.sub.AUG
(FIG. 4B), possibly because of differences in half-lives of the two
proteins. The Fluc protein has a half life of 1.5 hrs in yeast, but
the half life of Rluc has not been measured (McNabb et al.,
Eukaryot. Cell, vol. 4, no. 9, pp. 1539-1549, 2005). Since
cycloheximide altered the Fluc.sub.UUG/Rluc.sub.AUG ratio, general
translation inhibitors can be identified in the primary screen.
However, such compounds will fail the counter screen because the
Fluc.sub.AUG/Rluc.sub.AUG ratio is also altered (FIG. 4B,
circles).
[0162] The compounds were dissolved in DMSO. Addition of DMSO alone
to growth media resulted in a slight change in the
Fluc.sub.UUG/Rluc.sub.AUG ratio (FIG. 3B). DMSO controls were
included in the screen and were used to correct for the effect of
DMSO on the Fluc.sub.UUG/Rluc.sub.AUG and Fluc.sub.AUG/Rluc.sub.AUG
ratios.
[0163] Unfortunately, no compound that alters the fidelity of start
codon recognition is currently known, and thus a positive control
was not available to include in the screen. However, the Sui.sup.-
mutant strains, which decrease the fidelity of start codon
recognition by up to 20-fold, can serve as proxy positive controls
to evaluate the quality of the assay. The UUG/AUG ratio of the
sui1-1 mutant (eIF1 D83G, which increases translation from UUG
almost to the level of AUG) (Cheung et al., Genes Dev., vol. 21,
no. 10, pp. 1217-1230, 2007; Donahue et al., Mol. Cell. Biol., vol.
8, no. 7, pp. 2955-2963, 1988) compared to the UUG/AUG wild type
ratio gives a Z'-factor of 0.68 (FIG. 5). The Z'-factor was
calculated using the formula
Z'=1-(3.sigma..sub.c++3.sigma..sub.c-)/(|.mu..sub.c+-.mu..sub.c-|)
where c+ is the FlucUUG/AUG ratio from the sui1-1 strain (301-4D)
and c- is the same ratio from the wild type strain (TD76-8D).
.sigma. represents standard deviation, and .mu. represents average
(Zhang et al., J. Biomol. Screen., vol. 4, no. 2, pp. 67-73, 1999).
The Z' factor is a statistical characterization to evaluate the
quality of a screening assay. According to these parameters, the
dual luciferase assay is well suited to identify compounds that
change the fidelity of translation initiation.
Counterscreening
[0164] Changes in the Fluc(UUG)/Rluc(AUG) ratio could be caused by
a compound altering the use of UUG as a start codon (the desired
target) or a variety of other effects such as changes in
transcription of one gene, changes in mRNA or protein half-life, or
inhibition or activation of one of the luciferase enzymes. To
eliminate compounds that do not target the fidelity of start codon
recognition, we use the same dual luciferase assay but with a
plasmid in which both firefly and renilla luciferase mRNAs have AUG
start codons. Compounds that specifically increase use of
near-cognate codons as start sites will not produce an effect in
this Fluc(AUG)/Rluc(AUG) assay, whereas compounds that alter other
process will not be specific for the Fluc(UUG)/Rluc(AUG) system and
will still produce effects with the Fluc(AUG)/Rluc(AUG) reporter.
Compounds that are not specific for effects on Fluc(UUG) expression
will not be pursued further. This counter-screen is extremely
powerful and eliminated 99.8% of the initial hits (.about.1,000)
from the 50,000 molecules we screened from the DTP library.
Pre-Lysis Experiments
[0165] Additionally, a "prelysis" experiment, where the compound is
added to yeast lysates, eliminates compounds that specifically
inhibit the luciferase enzymes. Yeast were grown for four hours
with compound or DMSO. The ratio of firefly luciferase with
compound was compared to that with DMSO only, each firefly value
was normalized to internal RlucAUG control. A decrease in the ratio
indicates increased expression of firefly luciferase. In prelysis
samples, the yeast were grown without compound, and compound was
added to the lysate before measuring luciferase activity to control
for inhibition of luciferase enzymes.
Hit Validation
Concentration Dependence
[0166] When a hit was identified, rescreening and counter screening
assays were done using 300 .mu.M to 10 nM of the compound, i.e.,
the identified "hit," to measure concentration dependence.
uORF Luciferase Assay
[0167] BY4741 was transformed with pNTI33 or pNTI32. Transformants
were incubated with compound and luciferase activity measured as
described for the dual luciferase assay. The solvent-only firefly
luciferase activity was used for normalization.
[0168] To further validate the effects of compounds that pass the
primary and counterscreens, an additional reporter assay was
performed. The assay uses a 5'-upstream open reading frame (uORF)
that begins with a UUG codon and was shown in yeast to be
translated, especially under amino acid starvation conditions
(Castilho-Valavicius et al., Genetics, vol. 124, pp. 483-495,
1990). This uORF was fused both in-frame and out-of-frame to the
firefly luciferase gene and the effect of the compounds on
initiation on this physiologically relevant near-cognate start
codon assessed. Active compounds increase expression of the
in-frame fusion, but not the out-of-frame fusion, to a similar or
greater extent than they do with the original luciferase reporter
with a UUG start codon. This indicates the compounds can enhance
use of UUG codons in multiple sequence contexts.
RT-q-PCR
[0169] With both luciferase-based reporters, RT-q-PCR was used to
provide further evidence that the compounds do not affect mRNA
abundance. The effect of the compounds with these reporters was
tested in strains in which nonsense-mediated decay is inoperative
(upf1.DELTA.) to further confirm that mRNA stability is not
altered.
Growth Assays
[0170] An additional reporter assay utilizes a yeast strain in
which the AUG start codon of the HIS4 gene has been changed to AUU
(his4-303) (Huang et al., Genes Dev., vol. 11, pp. 2396-2413,
1997). This strain is a histidine auxotroph and cannot grow on
medium lacking histidine. However, Sui.sup.- mutations allow
initiation from the AUU start site or, more commonly, a UUG three
codons downstream from it, restoring expression of His4p and thus
growth on His.sup.- medium (Castilho-Valavicius et al., Genetics,
vol. 124, pp. 483-495, 1990; Huang et al., Genes Dev., vol. 11, pp.
2396-2413, 1997; Yoon et al., Mol. Cell. Biol., vol. 12, pp.
248-260, 1992). Observing an alteration of the Sui.sup.- phenotype
is a more sensitive assay than rescuing growth of a wild type
strain. If a compound enhances translation from UUG, growth of
these mutants should be better with compound than without on
His.sup.- media. Likewise, if the compound increases the fidelity
of initiation, then growth should be compromised.
[0171] Yeast with the his4-303 allele from an over-night culture
were washed with water and diluted to an OD.sub.600 between 0.1-1.
Strips of sterile Whatman paper were soaked with compound or
solvent and placed on an agar plate of the appropriate media. The
yeast culture was spotted onto the plate at various distances from
the paper strips. The plates were incubated at 30.degree. C.
Diffusion creates a gradient of compound, which tends to enhance
growth only in a certain range because of off-setting toxicity at
high concentrations.
In Vitro Transcription Assays
[0172] An in vitro translation system was also used. This assay
uses yeast extracts to translate in vitro transcribed mRNAs
encoding renilla luciferase with an AUG or UUG start codon (Wu et
al., Methods Enzymol., vol. 429, pp. 203-225, 2007).
Example 2
Active Compounds
[0173] Approximately 55,000 compounds from four libraries were
screened. The main source of compounds was the National Cancer
Institute (NCI) Developmental Therapeutics Program (DTP) library.
Of the >200,000 compounds in this library, 49,840 were screened.
Three smaller libraries were also screened: 1) .about.2500
compounds that have passed phase I clinical trials (gift of Dr. Jun
Liu, Johns Hopkins University School of Medicine); 2) .about.2500
natural products (Dr. Jerry Pelletier); 3) .about.500 microbial
growth media extracts (gift of Dr. Scott Strobel, Yale University).
With the liberal cut-off of a .gtoreq.1.5-fold change in the
Fluc.sub.UUG/Rluc.sub.AUG ratio, approximately 2% of the compounds
screened passed the primary screen, but 2 compounds, both from the
NCI DTP library, passed the counter-screen. The structures of these
two compounds, isoquinoline-1-carboxylic acid (NSC218351) and
7-amino-5-iodo-8-quinolinol hydrochloride (NSC92218), are shown
below. NSC218351 is commercially available through Sigma Aldrich.
NSC92218 is not commercially available, and was supplied by the NCI
for further studies. High resolution mass spectrometry confirmed
the purity and atomic composition of this compound.
##STR00027##
Pre-Lysis Experiments
[0174] FIG. 6 demonstrates the effect of compound NSC 218351 on
expression of firefly luciferase in the pre-lysis experiment.
Points are averages of twelve independent experiments for in vivo
ratios, and prelysis points are from one experiment;
Concentration Dependence
[0175] NSC218351 increased the Fluc.sub.UUG/Rluc.sub.AUG ratio
1.8-fold (FIG. 7A). The raw Fluc.sub.UUG value increased slightly
as the Rluc.sub.AUG value decreased (FIG. 7B). At high
concentrations all values decreased, suggesting a general effect on
translation and/or toxicity. The Fluc.sub.AUG/Rluc.sub.AUG ratio
does not change in the presence of compound (FIG. 7A, squares),
even when both raw values decreased at high concentrations of
compound (FIG. 7B).
[0176] NSC92218 affected the dual luciferase assay in a similar
manner to NSC218351. The Fluc.sub.UUG/Rluc.sub.AUG ratio increased
1.8-fold, while the Fluc.sub.AUG/Rluc.sub.AUG ratio did not change
(FIG. 8A, compare circles to squares). The raw FlucUUG value did
not change, or increases slightly, at concentrations that decreased
the other luciferase values (FIG. 8B).
[0177] The compounds increased initiation at most near-cognate
codons, indicating that their effects are not limited to UUG codons
(FIGS. 9A and 9B). AAG and AGG are not used detectably as Fluc
initiation codons in yeast (Kolitz et al., RNA, vol. 15, no. 1, pp.
138-152, 2009) and were thus not tested. The one exception is that
NSC218351 did not increase initiation at AUU codons. Interestingly,
AUU is generally the near cognate codon whose use as an alternative
start site is increased the least by Sui.sup.- mutants (FIG. 10).
Efficiency of use of near cognate codons as initiation sites was
measured with the dual luciferase assay in several Sui.sup.- mutant
strains. Translation from each alternative start codon in the
Sui.sup.- strain was normalized to translation from that codon in a
wild type strain. Sui.sup.- mutations increase the use of near
cognates up to 18-fold (GUG in eIF1 D83G strain). However, in each
mutant strain, translation from AUU is increased the least.
Although it is not understood why AUU behaves anomalously, it is
interesting that NSC218351 mimics this aspect of the behavior of
the Sui.sup.- mutations in initiation factors.
RT-PCR
[0178] RNA was purified from yeast (grown with 50 .mu.M NSC218351
or 2 .mu.M NSC92218) using acid phenol extraction (Fazzio et al.,
Mol. Cell Biol., vol. 21, no. 19, pp. 6450-6460, 2001), and DNase
treated (DNase I, Roche). The iScript cDNA kit (BioRad) was used to
make the cDNA, and the SYBR green protocol was used for the qPCR
reactions in a BioRad CFX96 Real-time PCR detection system.
[0179] At high concentrations, the compounds slow yeast growth;
however, the Fluc.sub.UUG/Rluc.sub.AUG ratio increases at
concentrations of compounds that do not affect growth of wild type
yeast (50 .mu.M NSC218351 and 2 .mu.M NSC92218, FIGS. 8A and 9A).
To demonstrate that the compounds were not affecting mRNA levels at
these concentrations, RT-q-PCR (reverse-transcription, quantitative
PCR) was used to measure relative levels of the luciferase mRNAs.
The levels of the reporter messages did not change significantly
(FIG. 11), indicating that the compounds do not affect synthesis or
degradation of these mRNAs.
Non-Sense Mediated Decay
[0180] As an additional test for effects on mRNA stability, the
compounds in the dual luciferase assay were tested with a strain
deficient for non-sense mediated decay (NMD), upf1.DELTA. (He et
al., Mol. Cell Biol., vol. 23, no. 15, pp. 5431-5445, 1993).
Premature termination can target a message for NMD. If a message
lacks the appropriate start codon, use of an upstream or out of
frame codon for initiation can lead to premature termination, and
potentially NMD (Amrani et al., Nat. Rev. Mol. Cell Biol., vol. 7,
no. 6, pp. 415-425, 2006. Expression from the UUG codon in Fluc
mRNA was not changed in the upf1.DELTA. strain relative to the WT
strain (in the absence of compound), indicating that NMD does not
influence expression of this reporter when it lacks an AUG start
codon (Kolitz et al., RNA, vol. 15, no. 1, pp. 138-152, 2009). If
the compounds were inhibiting the NMD pathway, no effect would be
expected in the assay in a strain where NMD was already blocked.
Using the dual luciferase assay, the effects of the compounds on
the UUG/AUG ratio were still observed in the upf1.DELTA. strain
(data not shown).
[0181] These results, in combination with the RT-q-PCR experiments
and the fact that no effect is seen on the
Fluc.sub.AUG/Rluc.sub.AUG expression ratio, indicate that the
compounds increase expression of the reporter from non-AUG start
codons at the translational level.
Time Dependence
[0182] Based on the measured activities of Sui.sup.- mutants
(Cheung et al., Genes Dev., vol. 21, no. 10, pp. 1217-1230, 2007)
(FIG. 10), yeast cells are viable even when translation from near
cognate start codons is increased almost 20-fold relative to WT
cells. To investigate if .about.2 fold is the maximal effect of the
compounds on expression from the Fluc reporter a determination of
whether time of incubation with compound altered the UUG/AUG
expression ratio was conducted. Under screening conditions, yeast
was grown with compounds for 4 hours. The UUG/AUG and AUG/AUG
ratios from 1 to 8 hours of growth with compound were monitored. At
1 hour, no effect of either compound was observed. Approximately
20% of the maximal effect was achieved at 2 hours. The maximal
effect is reached at 4 hours, and further incubation did not result
in an additional decrease in the fidelity of start site selection
(data not shown).
Other Yeast Strains
[0183] Another factor possibly contributing to the magnitude of the
UUG/AUG ratio change is bioavailability of the molecules. A wild
type strain was used in the screen, which may restrict some
compounds from entering the cells effectively. Therefore, a strain
deficient in efflux pumps (YRP1: snq2.DELTA., pdr5.DELTA.,
erg6.DELTA.) was tested to see if the magnitudes of the effects of
the compounds or their effective concentrations would change if
efflux from the cells decreased (Kung et al., Proc. Natl. Acad.
Sci. U.S.A., vol. 102, no. 10, pp. 3587-3592, 2005). The minimal
effective concentration for both compounds is lower in the YRP1
strain than the WT (FIGS. 12A and 12B), suggesting that the
compounds act inside of the cell rather than affecting translation
by binding to its surface or by altering some other external
property. Interestingly, the magnitudes of the UUG/AUG ratio
decreased, rather than increased, in the YRP1 strain. A potential
explanation for this phenomenon is that the toxic concentrations of
the compounds are lowered in the YRP1 strain because of the loss of
the efflux pumps, and the leftward shift of the toxicity curve is
greater than the shift of the efficacy curve. If this were true it
would suggest that the targets of the compounds that produce
toxicity are different than those that alter the UUG/AUG initiation
ratio. Alternatively, the differences in the effects of the
compounds on the UUG/AUG expression ratio could be due to
differences in genetic backgrounds of the wild type strain used in
the screen (BY4741) and the YRP1 strain.
Structure-Activity Analysis
[0184] Two active compounds were identified in different sections
of the NCI DTP library, but bear resemblance in structure and
activity. Both compounds increase the UUG/AUG ratio by 1.8-fold,
but the minimal concentration required to achieve this effect is
4-fold higher for NSC218351 than for NSC92218 (60 .mu.M and 15
.mu.M, respectively). Little information is available about the
biological activity of either of these compounds. Studies indicate
that compounds related to NSC92218 have anti-fungal activity
through an unknown mechanism (Gershon et al., J. Pharm. Sci., vol.
80, no. 6, pp. 542-544, 1991). NSC218351 and derivatives have been
implicated in inhibition of protein kinases (Lu et al., Biol. Chem.
Hoppe Seyler, vol. 377, no. 6, pp. 373-384, 1996).
[0185] To learn about the important chemical features of these
compounds, about 20 analogs of each were obtained and tested in the
dual luciferase assay. Changing some functional groups of NSC218351
(moving or removing the N or acid group, eliminating aromaticity or
removing one of the rings) resulted in a loss of the effect on
start codon recognition (FIG. 13 and Table 1). Some analogs did
change the UUG/AUG expression ratio, but these compounds have
similar effects on the AUG/AUG expression ratio indicating that
they are not specifically altering the fidelity of translation
initiation (compare columns UUG/AUG to AUG/AUG).
TABLE-US-00002 TABLE 1 Analogs of NSC218351 tested in the dual
luciferase assay. Compound number refers to FIG. 13. Primary screen
(UUG/AUG) and counter screen (AUG/AUG) effects are listed, as well
as concentration. Concentration Cpd # Name (NSC#) UUG/AUG AUG/AUG
(.mu.M)* 1 Quinaldic acid (4882) 1.00 0.71 120 2
3-isoquinolinecarboxylic 1.07 1.11 60 acid (53385) 3 Isoquinoline
0.77 0.88 120 4 1,2,3,4-tetrahyrdo-1- 0.98 0.92 75 isoquinoline
carboxylic acid 5 2-Picolinic acid 0.92 0.95 60 6
1-Aminoisoquinoline 1.16 1.11 75 7 1-Chloroisoquinoline 1.03 0.97
60 8 1-Naphthoic acid 1.52 1.48 60 9 1,5-Isoquinolinediol (65585)
0.98 0.94 60 10 1,3-isoquinolinediol (72173) 0.91 1.05 60 11
2-Hydroxy-1-naphthoic acid 0.94 1.13 60 12
1-isoquinolinecarbonitrile 0.78 0.71 120 (203335) 13 Methyl 3- 0.94
0.78 120 isoquinolinecarboxylate 14 1-Morpholin-4-yl- 0.92 0.90 60
isoquinoline (72173) 15 4-chloro-1- 0.96 0.95 60
phthalazinecarboxylic acid 16 Ethyl 1,4- 1.03 0.75 75
dihydroxyisoquinoline-3- carboxylate (28791) 17
1-phenylisoquinoline-3- 0.94 0.89 75 carboxylic acid hydrochloride
(10181) 18 Fusaric acid (19870) 1.25 1.13 24 *A range of
concentrations was tested for each compound, but only one is
listed.
[0186] Fewer close analogs of NSC92218 were available, but changing
--I to --Cl, or removing the amine and --I resulted in a loss of
the effect (FIG. 14 and Table 2). These data indicate that the
activities of NSC92218 and NSC218351 in altering the fidelity of
start codon recognition are specific and are not possessed by many
structurally similar molecules.
TABLE-US-00003 TABLE 2 Analogs of NSC92218 tested in the dual
luciferase assay. Compound number refers to FIG. 14. Primary screen
(UUG/AUG) and counter screen (AUG/AUG) effects are listed, as well
as concentration. UUG/ AUG/ Concentration Cpd # Name (NSC#) AUG AUG
(.mu.M)* 1 7-amino-5-chloroquinolin-8-ol 0.94 0.81 8 2
quinolin-8-ol (2039) 0.81 0.99 8 3 5-chloroquinolin-8-ol 1.35 1.40
60 4 5,7-dichloroquinolin-8-ol 1.69 1.27 8 (3904) 5
5,7-diiodoquinolin-8-ol (8704) 1.08 1.45 8 6
7-bromo-5-chloroquinolin-8-ol 6.03 5.21 60 7
5-chloro-7-iodoquinolin-8-ol 2.02 1.67 8 (3531) 8
5-aminoquinolin-8-ol 1.09 1.14 60 9 5,7-dibromoquinolin-8-ol 2.10
1.72 1.6 (1810) 10 quinolin-8-amine (7933) 0.96 0.93 8 11
7-chloroquinolin-8-amine 1.00 1.08 8 (13569) 12
5-chloroquinolin-8-amine 1.01 1.05 8 (13700) 13
quinoline-8-carboxylic acid 1.05 1.05 8 (6505) 14
5,7,8-trichloroquinolin-6-ol 0.89 0.88 8 (13207) 15
5,7,8-trichloro-6- 1.01 0.93 8 methoxyquinoline (13211) 16
8-hydroxy-7-iodoquinoline-5- 0.96 1.05 8 sulfonic acid (3784) 17
8-hydroxyquinoline-5- 0.94 0.96 8 sulfonic acid (13139) 18
5-nitrosoquinolin-8-ol (3852) 1.00 0.99 8 19
5-chloro-6-methoxyquinolin- 0.94 0.99 8 8-amine (1184) *A range of
concentrations was tested for each compound, but only one is
listed. **JL indicates a gift of Dr. Jun Liu, Johns Hopkins
University.
Secondary Assays
[0187] Ribosomal profiling identified over 100 small upstream open
readings frames (uORFs) that appear to be translated from non-AUG
start codons in S. cerevisiae (Ingolia et al., Science, vol. 324,
no. 5924, pp. 218-223, 2009). uORFs are coding regions that are
sometimes used to regulate the translation of a downstream ORF
encoding a protein (Meijer et al., Biochem. J., vol. 367(Pt. 1),
pp. 1-11, 2002). To demonstrate that the compounds have a general
effect on the fidelity of start codon recognition, rather than a
specific one on the use of the start codon in Fluc mRNA, an uORF
identified by Ingolia and colleagues from PRE2 mRNA was fused to
the firefly luciferase coding sequence. This construct was used to
assess the effect of the compounds on translation mediated by the
non-AUG start codon of the uORFs. The PRE2 uORF has an UUG start
codon, with the consensus sequence (-3)AAA(-1) directly upstream of
UUG (FIG. 15). In the control reporter, the luciferase coding
region is out-of-frame from the start codon of the uORF. In wild
type yeast, NSC218351 and NSC92218 increase expression of the
reporter approximately 1.5-fold and 2-fold, respectively (FIGS. 16A
and 16B), similar to their effects in the dual luciferase assay.
The out-of-frame controls are not well translated, and incubation
with either compound does not improve luciferase signal. RT-q-PCR
showed that the compounds do not increase mRNA levels of these
reporters (data not shown), indicating that the increase in
luciferase signal is due to a decrease in the fidelity of start
codon selection.
Yeast Growth Assays Using Sui.sup.- Phenotype
[0188] NSC 218351 enhances the growth of the eIF1 Sui.sup.- strains
on His.sup.- plates. In His.sup.- culture, the doubling time of
eIF1 D83G was decreased from 8 hrs to 7.35 hrs (FIG. 17). While
small, the effects are reproducible. No effects on growth of
Sui.sup.- strains with mutations in other initiation factors
(eIF1A, eIF2, and eIF5) have been detected.
[0189] Chemically increasing use of near-cognate codons as start
codons mimics the Sui.sup.- phenotype. Sui.sup.- mutations were
originally identified in a screen that requires translation
initiation at a non-AUG start codon in a mutant of the HIS4 gene
(his4-303 allele) for growth on SC-His media (Donahue et al., Mol.
Cell. Biol., vol. 8, no. 7, pp. 2955-2963, 1988). Compounds that
increase the use of non-AUG start codons to a small degree should
further increase growth of Sui.sup.- strains with the his4-303
allele on SC-His media, chemically enhancing the Su.sup.-
phenotype. To test this, a paper strip saturated with compound was
placed onto a plate of media (SC or SC-His). Yeast with the
his4-303 allele was spotted on the plate at various distances from
the compound- or solvent-containing strips. DMSO alone does not
affect growth of the Sui.sup.- strain (sui1-1) on complete media
(SC) or selective media (SC-His) (FIG. 18). Close to the compound
source, 10 mM NSC92218 prevented growth and 50 mM NSC218351 slowed
growth (FIG. 18, column 1 and 5). In the presence of 50 mM
NSC218351 on the paper strip, growth of sui1-1 on selective media
was inhibited close to the drug source, but was enhanced relative
to the DMSO farther from the source (FIG. 18, compare columns 1, 3
and 4). With 12.5 mM NSC218351, growth of the sui1-1 strain is
enhanced in the column closest to the compound source on SC-His
(column 1). In columns 2 and 3, 10 mM NSC92218 enhanced growth of
the sui1-1 strain on SC-His, especially when normalized for the
inhibitory effect on growth on the SC plate (columns 2 vs. 6). With
2.5 mM NCS92218, growth enhancement occurred in column 1 on SC-His
relative to the inhibitory effect on SC (columns 1 vs. 5). Thus
both compounds enhance the phenotype of a Sui.sup.- strain of yeast
at discrete distances from the compound source on SC-His media. The
analog isoquinoline (FIG. 13, compound 3) did not cause any
enhancement of growth in this assay, further indicating specificity
of the effects produced by NSC218351 and NSC92218.
Role of Start Codon Context
[0190] In addition to identifying compounds that alter the fidelity
of start codon recognition, this screen has the potential to
identify compounds that affect recognition of the consensus
sequence elements flanking start codons in yeast. The yeast
consensus sequence is AAAA directly upstream of the initiation
codon (Hamilton et al., Nucleic Acids Res., vol. 15, no. 8, pp.
3581-2593, 1987; Shabalina et al., Nucleic Acids Res., vol. 32, no.
5, pp. 1774-1782, 2004). In mammals, the consensus sequence is
GCC(A/G)CC.sub.AUGG (SEQ ID NO: 8), and can have up to a 20-fold
effect on use of the codon as a start site (Kozak M., Cell, vol.
44, no. 2, pp. 283-292, 1986; Kozak M., Nucleic Acids Res., vol.
15, no. 20, pp. 8125-8148, 1987). In yeast the consensus sequence
generally has a small or no effect on initiation from AUG start
codons (Cigan et al., Mol. Cell Biol., vol. 8, no. 7, pp.
2964-2975, 1988; Donahue et al., Mol. Cell. Biol., vol. 8, no. 7,
pp. 2955-2963, 1988), but it does have a strong effect on use of
non-AUG start codons (Zitomer et al., Mol. Cell. Biol., vol. 4, no.
7, pp. 1191-1197, 1984; Chen et al., J. Biol. Chem. vol. 283, no.
6, pp. 3173-3180, 2008). If the firefly reporter with a UUG start
codon lacks the consensus sequence (GCTC instead of AAAA), the mRNA
is not detectably translated. Since non-AUG codons are more
sensitive to this sequence than are AUG codons, the screen might
identify compounds that diminish or enhance the influence of the
flanking region. Such an effect has not previously been noted in
yeast, by genetic mutation or chemical treatment.
[0191] In the reporters used for the screen, both the AUG and UUG
start codons had AAAA directly upstream (positions -4 to -1).
Although the sequence GCTC does not detectably promote translation
from a UUG start codon, changing the -3 position to an A in this
context (GATC) restores 18% of the signal observed with AAAA (data
not shown). Changing any other single upstream position to A does
not allow detectable translation from UUG. The Fluc reporter with
this minimal stimulatory flanking sequence, GATC, was used to test
whether the compounds increase the influence of the sequence
upstream of the start codon. The effects of the compounds on
Fluc-UUG expression was unchanged when the full (AAAA) upstream
sequence was replaced with the minimal version (GATC; data not
shown), indicating that the compounds' abilities to increase use of
UUG as an initiation codon are not altered by changing the strength
of the sequence context around the start codon, and that upstream
bases at the -1, -2 and -4 positions are not required for the
activity of the compounds.
In Vitro Transcription Assays
[0192] An in vitro translation system was also used. This assay
uses yeast extracts to translate in vitro transcribed mRNAs
encoding Renilla luciferase with an AUG or UUG start codon.
[0193] No significant effects have been observed in the in vitro
translation system; this assay, however, is not very sensitive.
When a strong Sui.sup.- protein, e.g., eIF5 G31R, was added to wild
type extracts, no effect on the fidelity of translation initiation
in the in vitro system was observed. eIF1 G107R mutant, which
increases translation from UUG in vivo approximately five-fold from
wt, increases translation greater than two-fold when added to wild
type lysates in the in vitro translation assay. Based on the effect
of these Sui.sup.- mutants, it seems unlikely that the in vivo
effect of NSC 218351 (<two-fold) would be detectable in the in
vitro translation system.
Toxicity to Yeast and Mammalian Cells
[0194] NSC218351 was not toxic to yeast cells. Growth was reduced
at 300 .mu.M, but at working concentrations (10-100 .mu.M) toxicity
is not a concern. Mammalian cells have not been tested.
Mechanism of Action
[0195] Genetic approaches enabled testing for synthetic effects,
either enhancement or suppression, of the compounds with particular
yeast genes. eIF1, eIF1A and eIF5 play crucial roles in start codon
selection (Mitchell et al., J. Biol. Chem., vol. 283, no. 41, pp.
27345-27349, 2008). To examine the importance of these factors on
the effects of the compounds, translation from the UUG start codon
of Fluc using the dual luciferase assay in diploid strains
haplo-insufficient was measured for these factors (Open Biosystems)
(deletion of any one of these factors in haploids is lethal)
(Winzeler et al., Science, vol. 285, no. 5429, pp. 901-906, 1999).
Western analysis demonstrated that the level of each protein in the
halpo-insufficient dipoids strains decreased .about.2-fold relative
to the level in the diploid wild type strain, as expected (data not
shown). Haplo-insufficiency of eIF1A (+/tif11.DELTA.) or eIF5
(+/tif5.DELTA.) did not have an effect on translation from UUG
(FlucUUG/RIucAUG), but eIF1 haplo-insufficiency (+/sui1.DELTA.)
increased use of UUG .about.2 fold (FIG. 19A, white bars),
consistent with its role as a master switch that controls the
response to start codon recognition (Lorsch et al., J. Biol. Chem.,
vol. 285, no. 21203-21207, 2010). In all of these strains, the
compounds still increased the UUG/AUG ratio .about.2 fold (FIG.
19A, gray and black bars). This indicates that the effects of eIF1
haplo-insuffciency and the presence of either compound on start
codon selection are additive, and that a haplo-insufficiency of
eIF1A or eIF5 does not alter the effect of the compounds. The
FlucAUG/RlucAUG ratio was not altered in any of these strains or
conditions (FIG. 19B), indicating that the effects of the compounds
in these strains are specific to translation from a near cognate
start codon and that haploinsufficiency of eIF1 reduces the
fidelity of start codon recognition rather than generally affecting
Fluc expression or activity.
[0196] Although a deficiency in eIF1 decreases the fidelity of
translation initiation, over-expression of eIF1 does not increase
the fidelity of start site selection in WT yeast (Cheung et al.,
Genes Dev., vol. 21, no. 10, 1217-1230, 2007) (FIG. 19A, compare
white bars of BY4741 and hc eIF1). However, over-expression of eIF1
has been shown to suppress the Sui.sup.- phenotypes of a number of
mutations in eIF1 and other factors (eIF1A, eIF5, eIF3, eIF2f.beta.
and eIF4G) (Cheung et al., Genes Dev., vol. 21, no. 10, 1217-1230,
2007; Saini et al., Genes Dev., vol. 24, no. 1, pp. 97-110; 2010;
Valasek et al., Mol. Cell. Biol., vol. 24, no. 21, pp. 9437-9455,
2004; He et al., Mol. Cell. Biol., vol. 23, no. 15, pp. 5431-5445,
2003). Interestingly, over-expression of eIF1 also suppressed the
effects of both compounds on the fidelity of start codon
recognition. The effect of NSC218351 was completely suppressed in a
strain over-expressing eIF1 (FIG. 19A, compare gray bars of BY4741
and hc eIF1; FIG. 20A, compare open and closed squares), and the
effect of NSC92218 was reduced by .about.50% relative to the effect
in wild type cells (FIG. 19A, compare black bars of BY4741 and hc
eIF1; FIG. 20B, compare open and closed squares). Because
over-expression of eIF1 alone does not increase the fidelity of
start codon selection, this suppression is specific to the
Sui.sup.- phenotype, whether mutationally or chemically induced,
and provides evidence that the compounds affect the fidelity of
translation initiation by altering the function of the 40S
ribosomal subunit or one of the initiation factors that participate
in start codon selection
Example 3
Additional Compounds
[0197] Additional compounds identified by the described screening
method are shown below.
##STR00028##
[0198] According to the invention a dual luciferase assay has been
adapted into a high-throughput screen to identify compounds that
alter the fidelity of start codon recognition in yeast. These
structurally related compounds passing the primary screen and the
counterscreen increase translation from near-cognate start codons
.about.2-fold in the dual luciferase assay (at 60 .mu.M NSC218351
and 15 .mu.M NSC92218) and in the uORF-Fluc assay, and enhance the
Sui.sup.- phenotypes conferred by the sui1-1 D83G eIF1 mutation and
by haploinsufficiency of WT eIF1. Thus the compounds decrease the
fidelity of start codon selection in three separate in vivo assays.
Additionally, the increased use of UUG as a site of initiation
caused by NSC218351 and NSC92218 is suppressed, completely and
partially, respectively, by over-expression of eIF 1, providing
strong evidence that the compounds act in a mechanistically similar
manner to Sui.sup.- mutations in initiation factors.
[0199] eIF1 is a key controller of start codon selection (Mitchell
and Lorsch 2008). It binds tightly to the 43S PIC and is important
for maintaining a scanning competent conformation of the ribosome.
Upon start codon recognition, eIF1 is released from the PIC,
causing a reversion to the closed, scanning arrested state of the
ribosome and triggering release of P.sub.i from eIF2 (Lorsch and
Dever 2010). Most Sui.sup.- mutations in eIF1 act by decreasing the
factor's affinity for the PIC and thus increasing the rate of eIF1
release at non-AUG codons. Over-expression of these eIF1 mutants
can partially suppress the Sui.sup.- phenotype (Cheung et al.
2007). Suppression of the effects of NSC218351 and NSC92218 by hc
eIF1 is consistent with the idea that they act by altering eIF1
affinity for the PIC. However, effects of either compound on the
affinity of eIF1 for the 40S subunit (+/-eIF1A) or on the rate of
release of the factor upon start codon recognition by the PIC (data
not shown) were not detected. These data suggest that the compounds
act on another step in the pathway and that eIF1 over-expression
can suppress the effect on this step. This is consistent with the
fact that hc eIF1 can also suppress the Sui.sup.- phenotypes of
mutations in eIF1A, eIF5, eIF3, eIF4G, and eIF2 (Cheung et al.,
Genes Dev., vol. 21, no. 10, pp. 1217-1230, 2007; Saini et al.,
Genes Dev., vol. 24, no. 1, pp. 97-110, 2010; Valasek et al., Mol.
Cell. Biol., vol. 24, no. 21, pp. 9437-9455, 2004; He et al., Mol.
Cell. Biol., vol. 23, no. 15, pp. 5431-5445, 2003).
[0200] In addition to providing new insight into the complicated
mechanism of start codon selection, the compounds identified in
this screen could serve as leads for the development of new drugs
targeting translation initiation. For example, modulators of the
fidelity of start codon recognition could be used to treat variants
of genetic diseases that are caused by mutations of the start codon
or region surrounding the start codon. A compound that functions
analogously in translation termination has shown promise for
clinical use. The compound, PTC124, specifically increases
read-through of nonsense codons in vivo, and is currently in
clinical trials to treat cystic fibrosis, Duchenne myscular
dystrophy and hemophilia (Welch et al., Nature, vol. 447, no. 7140,
pp. 87-91, 2007). In addition to treating genetic diseases,
compounds that reduce the fidelity of start codon recognition might
be developed into anticancer agents, as rapidly reproducing cells
could be less tolerant of mis-translation than are quiescent cells.
Alternatively, if the effects of the compounds identified here are
specific to yeast, they might be developed into novel anti-fungal
agents.
[0201] This is the first screen to find compounds that alter the
fidelity of start codon selection in eukaryotes. The compounds
identified bear striking resemblance to each other, yet the ability
to decrease the fidelity of start codon selection appears to be
quite specific.
[0202] All publications, patent applications, patents, and other
references mentioned in the specification are indicative of the
level of those skilled in the art to which the presently disclosed
subject matter pertains. All publications, patent applications,
patents, and other references are herein incorporated by reference
to the same extent as if each individual publication, patent
application, patent, and other reference was specifically and
individually indicated to be incorporated by reference. It will be
understood that, although a number of patent applications, patents,
and other references are referred to herein, such reference does
not constitute an admission that any of these documents forms part
of the common general knowledge in the art.
[0203] Although the foregoing subject matter has been described in
some detail by way of illustration and example for purposes of
clarity of understanding, it will be understood by those skilled in
the art that certain changes and modifications can be practiced
within the scope of the appended claims.
Sequence CWU 1
1
8131DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1gcaactagtg gaagacgcca aaaacataaa g
31230DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2gctttaatta attacacggc gatctttccg
30338DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 3gcattaatta atagaatttt gaatttggtt aagaaaag
38430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4gctgggccca tcagagctgg taaattcaag
30539DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5gcaactagtt ctattcaatt taatagtaaa tttgttatt
39639DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 6gcaactagta tctattcaat ttaatagtaa atttgttat
39738DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7gctgcggccg cgttactatc aagatgtatc aaacaatg
38810RNAArtificial SequenceDescription of Artificial Sequence
Synthetic consensus sequence 8gccrccaugg 10
* * * * *