U.S. patent application number 14/330860 was filed with the patent office on 2015-01-15 for plants comprising events pp009-401, pp009-415, and pp009-469, compositions, sequences, and methods for detection thereof.
The applicant listed for this patent is OMS Investments, Inc.. Invention is credited to Robert W. HARRIMAN, Lisa LEE, David M. STALKER, Rebecca TORISKY.
Application Number | 20150020233 14/330860 |
Document ID | / |
Family ID | 52278277 |
Filed Date | 2015-01-15 |
United States Patent
Application |
20150020233 |
Kind Code |
A1 |
HARRIMAN; Robert W. ; et
al. |
January 15, 2015 |
PLANTS COMPRISING EVENTS PP009-401, PP009-415, AND PP009-469,
COMPOSITIONS, SEQUENCES, AND METHODS FOR DETECTION THEREOF
Abstract
The invention provides glyphosate tolerant transgenic turfgrass
plants, plant material, and seeds that have a specific
transformation event. Also provided are assays for detecting the
presence of the event. The invention also provides sequences for a
variant EPSPS gene and a GAO2X gene, cassettes, and plants
comprising the variant EPSPS gene and a GAO2X gene.
Inventors: |
HARRIMAN; Robert W.;
(Delaware, OH) ; LEE; Lisa; (Marysville, OH)
; STALKER; David M.; (St. Louis, MO) ; TORISKY;
Rebecca; (Marysville, OH) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
OMS Investments, Inc. |
Los Angeles |
CA |
US |
|
|
Family ID: |
52278277 |
Appl. No.: |
14/330860 |
Filed: |
July 14, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61845794 |
Jul 12, 2013 |
|
|
|
61985238 |
Apr 28, 2014 |
|
|
|
Current U.S.
Class: |
800/260 ;
435/193; 435/320.1; 435/418; 435/6.11; 504/206; 506/16; 536/23.2;
536/24.3; 536/24.33; 800/300 |
Current CPC
Class: |
C12Q 2600/13 20130101;
C12N 15/8297 20130101; C12N 9/0071 20130101; C12Q 1/6895 20130101;
C12Y 114/11013 20130101; C12N 9/1092 20130101; C12Y 205/01019
20130101; C12Q 2600/156 20130101; A01N 57/20 20130101; C12N 15/8275
20130101; A01H 5/12 20130101 |
Class at
Publication: |
800/260 ;
800/300; 435/418; 435/6.11; 536/24.3; 506/16; 536/24.33; 536/23.2;
435/320.1; 504/206; 435/193 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12N 9/10 20060101 C12N009/10; C12Q 1/68 20060101
C12Q001/68; A01N 57/20 20060101 A01N057/20; A01H 1/02 20060101
A01H001/02; A01H 1/04 20060101 A01H001/04 |
Claims
1. Seed of Kentucky bluegrass comprising event Pp009-401, event
Pp009-415, or event Pp009-469, a representative sample of seed
comprising event Pp009-401, event Pp009-415, and event Pp009-469
having been deposited under ATCC Accession Nos. PTA-120354,
PTA-120353, and PTA-120355, respectively.
2. A Kentucky bluegrass plant, or part thereof, produced from the
seed of claim 1.
3. The part of claim 2, wherein said part is a cell, pollen, ovule,
seed, root, or leaf.
4. Progeny of the Kentucky bluegrass plant of claim 2, wherein said
progeny comprise event Pp009-401, event Pp009-415, or event
Pp009-469.
5. A method for producing Kentucky bluegrass plant or seed
comprising crossing a Kentucky bluegrass plant comprising event
Pp009-401, event Pp009-415, or event Pp009-469 with a plant lacking
event Pp009-401, event Pp009-415, or event Pp009-469, and planting
seed obtained from said cross, wherein said seed comprises event
Pp009-401, event Pp009-415, or event Pp009-469.
6. The method of claim 5, further comprising selecting progeny
plants tolerant to glyphosate.
7. The method of claim 6, further comprising backcrossing said
progeny plants with a Kentucky bluegrass plant comprising event
Pp009-401, event Pp009-415, or event Pp009-469.
8. A plant or seed obtained from the method of claim 7, wherein
said plant or seed comprises event Pp009-401, event Pp009-415, or
event Pp009-469.
9. Kentucky bluegrass genomic DNA comprising event Pp009-401, event
Pp009-415, or event Pp009-469.
10. A Kentucky bluegrass plant, cell, plant part, or seed
comprising the genomic DNA of claim 9.
11. The Kentucky bluegrass plant, cell, plant part, or seed of
claim 10, wherein said genomic DNA comprises SEQ ID NO: 7.
12. The Kentucky bluegrass plant, cell, plant part, or seed of
claim 10, wherein said genomic DNA comprises SEQ ID NO: 8.
13. The Kentucky bluegrass plant, cell, plant part, or seed of
claim 10, wherein said genomic DNA comprises SEQ ID NO: 9.
14. A method for detecting the presence of the genomic DNA of claim
11, comprising (1) amplifying a nucleic acid obtained from a
Kentucky bluegrass plant, plant cell, or plant material using a
primer pair of SEQ ID NO: 1 and SEQ ID NO: 2; or (2) hybridizing a
nucleic acid obtained from a Kentucky bluegrass plant, plant cell,
or plant material using a probe comprising SEQ ID NO: 1 and SEQ ID
NO: 2.
15. A method for detecting the presence of the genomic DNA of claim
12, comprising (1) amplifying a nucleic acid obtained from a
Kentucky bluegrass plant, plant cell, or plant material using a
primer pair of SEQ ID NO: 3 and SEQ ID NO: 4; or (2) hybridizing a
nucleic acid obtained from a Kentucky bluegrass plant, plant cell,
or plant material using a probe comprising SEQ ID NO: 3 and SEQ ID
NO: 4.
16. A method for detecting the presence of the genomic DNA of claim
13, comprising (1) amplifying a nucleic acid obtained from a
Kentucky bluegrass plant, plant cell, or plant material using a
primer pair of SEQ ID NO: 5 and SEQ ID NO: 6; or (2) hybridizing a
nucleic acid obtained from a Kentucky bluegrass plant, plant cell,
or plant material using a probe comprising SEQ ID NO: 5 and SEQ ID
NO: 6.
17. A kit comprising the primer pair or probe of claim 14.
18. A kit comprising the primer pair or probe of claim 15.
19. A kit comprising the primer pair or probe of claim 16.
20. The kit of any one of claims 17-19, wherein said primer pair or
probe is attached to a solid support.
21. The kit of claim 20, wherein said solid support is a bead,
fiber, plate, or multi-well plate.
22. The kit of claim 20, wherein said primer pair or probe is
arranged in an array.
23. The kit of any one of claims 17-19, wherein said kit further
comprises a buffer or solution.
24. The kit of any one of claims 17-19, wherein said primer pair or
probe is labeled.
25. The kit of claim 24, wherein said label is a florescent
molecule, a radioactive isotope, ligand, chemifluorescent,
chemiluminescent agent, or enzyme.
26. A method for producing Kentucky bluegrass plant or seed
comprising selfing or crossing a Kentucky bluegrass plant
comprising event Pp009-401, event Pp009-415, or event Pp009-469
with a plant lacking event Pp009-401, event Pp009-415, or event
Pp009-469, and planting seed obtained from said cross.
27. An isolated nucleic acid comprising the nucleotide sequence of
SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
28. An isolated nucleic acid comprising the nucleotide sequence of
SEQ ID NO: 10.
29. An isolated nucleic acid comprising the nucleotide sequence of
SEQ ID NO: 11.
30. An isolated nucleic acid comprising the nucleotide sequence of
SEQ ID NO: 12.
31. An isolated nucleic acid comprising the nucleotide sequence of
SEQ ID NO: 13.
32. An isolated cassette comprising the nucleotide sequence of SEQ
ID NO: 10 or SEQ ID NO: 11.
33. An isolated cassette comprising the nucleotide sequence of SEQ
ID NO: 10.
34. An isolated cassette comprising the nucleotide sequence of SEQ
ID NO: 11.
35. An isolated plasmid comprising the nucleotide sequence of SEQ
ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
36. An isolated plasmid comprising the nucleotide sequence of SEQ
ID NO: 10.
37. An isolated plasmid comprising the nucleotide sequence of SEQ
ID NO: 11.
38. An isolated plasmid comprising the nucleotide sequence of SEQ
ID NO: 12.
39. An isolated plasmid comprising the nucleotide sequence of SEQ
ID NO: 13.
40. An isolated cell comprising the nucleotide sequence of SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
41. An isolated cell comprising the nucleotide sequence of SEQ ID
NO: 10.
42. An isolated cell comprising the nucleotide sequence of SEQ ID
NO: 11.
43. An isolated cell comprising the nucleotide sequence of SEQ ID
NO: 12.
44. An isolated cell comprising the nucleotide sequence of SEQ ID
NO: 13.
45. The cell of any one of claims 41-44, wherein said cell is a
bacterial cell or a plant cell.
46. A Kentucky bluegrass plant, cell, plant part, or seed
comprising the nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11,
SEQ ID NO: 12, or SEQ ID NO: 13.
47. A seed of Kentucky bluegrass comprising the nucleotide sequence
of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO:
13.
48. A Kentucky bluegrass plant, or part thereof, produced from the
seed of claim 47.
49. The part of claim 48, wherein said part is a cell, bulb, tuber,
crown, stem, tiller, cuttings including un-rooted cuttings, rooted
cuttings, and callus cuttings or callus-generated plantlets; apical
meristems, pollen, ovule, flower, shoot, stolon, progagule, seed,
runner, corm, rhizome, root, or leaf.
50. A method for producing Kentucky bluegrass plant or seed
comprising growing the seed of claim 47.
51. A method for controlling weeds in a field comprising growing
the seed of claim 47 and treating the field with an effective
amount of an herbicide comprising glyphosate.
52. A lawn comprising the plant of claim 46.
53. A method for producing a Kentucky bluegrass plant that
tolerates application of glyphosate comprising sexually crossing a
first parental Kentucky bluegrass comprising the nucleic acid of
SEQ ID NO: 10 or 12 and a second parental plant that lacks the
nucleic acid of SEQ ID NO: 10 or 12 or that lacks glyphosate
tolerance, thereby producing a plurality of progeny plants.
54. A method for producing a Kentucky bluegrass plant that
tolerates application of glyphosate comprising: (a) sexually
crossing a first parental Kentucky bluegrass the nucleic acid of
SEQ ID NO: 10 or 12 and a second parental plant that lacks the
nucleic acid of SEQ ID NO: 10 or 12 or that lacks glyphosate
tolerance, thereby producing a plurality of progeny plants; and (b)
selecting a progeny plant that tolerates application of
glyphosate.
55. The method of claim 54, wherein said method further comprises
back-crossing the progeny plant to the second parental Kentucky
bluegrass plant and selecting for glyphosate tolerant progeny to
produce a true-breeding Kentucky bluegrass variety that tolerates
application of glyphosate.
56. A turfgrass stand, lawn, sports field, or golf course
comprising a Kentucky bluegrass plant comprising the nucleic acid
of SEQ ID NO: 10 or 12.
57. A method of controlling weeds in a turfgrass stand of Kentucky
bluegrass the nucleic acid of SEQ ID NO: 10 or 12 comprising the
step of applying a glyphosate containing herbicide formulation to
the turfgrass stand.
58. A plant cell comprising the nucleotide sequence of SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
59. A plant cell comprising the event Pp009-401, event Pp009-415,
or event Pp009-469.
60. A plant comprising the event Pp009-401, event Pp009-415, or
event Pp009-469.
61. A plant comprising the nucleotide sequence of SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
62. A transgenic plant comprising the nucleotide sequence of SEQ ID
NO: 10.
63. A transgenic plant comprising the nucleotide sequence of SEQ ID
NO: 11.
64. A transgenic plant comprising the nucleotide sequence of SEQ ID
NO: 12.
65. A transgenic plant comprising the nucleotide sequence of SEQ ID
NO: 13.
66. The plant of any one of claims 61-65, wherein said plant is a
grass, grain crop, an agricultural crop, ornamental flower, legume,
fruit, vegetable, herb, ornamental flower, perennial plant, or
tree.
67. The plant of claim 66, wherein said plant is a root vegetable
or vine vegetable.
68. The plant of claim 66, wherein said plant is a grass.
69. The plant of claim 66, wherein said grass is Bahia grass, bent
grass, Bermuda grass, Blue grama grass, Buffalo grass, centipedes
grasses, fescue grass, optionally needle-leaved Fescue grass, tall
Fescue, or broad-leaved Fescue grass, Kentucky bluegrass, rygrass
optionally annual ryegrass or perennial ryegrass, seashore
paspalum, St. Augustine grass, or Zoysia grass.
70. The plant of claim 66, wherein said plant is a grain crop.
71. The plant of claim 66, wherein said grain crop is barley,
sorghum, millet, rice, canola, corn, oats, wheat, barley, or
hops.
72. The plant of claim 66, wherein said plant is soybean.
73. The plant of claim 66, wherein said plant is an ornamental
flower.
74. The plant of claim 66, wherein said flower is an annual or
perennial ornamental flower.
75. The plant of claim 74, wherein said ornamental flower is a
geranium, petunia, or daffodil.
76. The plant of claim 66, wherein said plant is a legume.
77. The plant of claim 76, wherein said legume is alfalfa, clover,
peas, beans, lentils, lupins, mesquite, carob, soybeans, peanuts,
or tamarind.
78. The plant of claim 66, wherein said plant is a fruit.
79. The plant of claim 78, wherein said fruit is a grape,
raspberry, blueberry, strawberry, blackberry, watermelon, apple,
cherry, pear, orange, lemon, or pumpkin.
80. The plant of claim 66, wherein said plant is a vegetable.
81. The plant of claim 80, wherein said vegetable is asparagus,
Brussels sprouts, cabbage, carrots, celery, chard, collard greens,
endive, tomatoes, beans, peas, broccoli, cauliflower, bell pepper,
eggplant, kale, lettuce, okra, onion, radish, spinach, peppers,
broccoli, cucumber, zucchini, eggplant, beet, squash, beans,
potato, or onion.
82. The plant of claim 66, wherein said plant is a herb.
83. The plant of claim 82, wherein said herb is anise, basil,
caraway, cilantro, chamomile, dill, fennel, lavender, lemon grass,
marjoram, oregano, parsley, rosemary, sage, thyme, or mint.
84. The plant of claim 66, wherein said plant is a root vegetable
or a vine vegetable.
85. The plant of claim 84, wherein said root vegetable is a turnip,
potato, carrot, or beet.
86. The plant of claim 84, wherein said vine vegetable is a
cucumber, pumpkin, squash, melon, or zucchini.
87. The plant of claim 66, wherein said plant is an agricultural
crop.
88. The plant of claim 87, wherein said agricultural crop is
cotton, corn, sugar cane, wheat, soybean, tobacco, or citrus.
89. The plant of claim 66, wherein said plant is an ornamental
plant.
90. The plant of claim 89, wherein said ornamental plant is a
geranium, petunia, impatien, verbena, dahlia, pansy, vinca,
ipomoea, lantana, salvia, snapdragon, scaevola, torenia, lobelia,
dipladenia, calibrachoa, asters, agerantum, phlox, penstemon,
gaillardia, zinnia, coleus, osteospermum, gerbera, begonia,
angelonia, dianthus, calendula, campanula, celosia, portulaca,
viola, or mum.
91. The plant of claim 89, wherein said ornamental plant is a
variety of the vinca genus.
92. The plant of claim 89, wherein said ornamental plant is a
variety of the helianthus annuus genus.
93. The plant of claim 89, wherein said ornamental plant is a
variety of the impatients hawkeri genus.
94. The plant of claim 89, wherein said ornamental plant is a
variety of the lantana genus.
95. The plant of claim 89, wherein said ornamental plant is a
variety of the mandevilla hydrida genus.
96. The plant of claim 89, wherein said ornamental plant is a
variety of the pelargonium interspecific genus.
97. The plant of claim 89, wherein said ornamental plant is a
variety of the pentas lanceolata genus.
98. The plant of claim 89, wherein said ornamental plant is a
variety of the petunia pendula genus.
99. The plant of claim 89, wherein said ornamental plant is a
variety of the rudbeckia genus.
100. The plant of claim 89, wherein said ornamental plant is a
variety of the tagetes erecta genus.
101. The plant of claim 89, wherein said ornamental plant is a
variety of the viola cornuta genus.
102. The plant of claim 89, wherein said ornamental plant is a
variety of the viola wittrockiana genus.
103. The plant of claim 89, wherein said ornamental plant is a
variety of the zinnia genus.
104. A plant, or part thereof, from the plant of any one of claims
60-103.
105. The part of claim 104, wherein said part is a cell, bulb,
tuber, crown, stem, tiller, cuttings including un-rooted cuttings,
rooted cutting, and callus cutting or callus-generated plantlet;
apical meristem, pollen, ovule, flower, shoot, stolon, progagule,
seed, runner, corm, rhizome, root, or leaf.
106. A method for controlling weeds in a field comprising growing
the seed of claim 105 and treating the field with an effective
amount of an herbicide comprising glyphosate.
107. An isolated DNA molecule with at least 80% homology to the
nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3,
SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO:
8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or
SEQ ID NO: 13.
108. The DNA molecule of claim 107, wherein said DNA molecule has
80%, 81%, 82%, 83%, 84%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or 99% to said nucleic acid sequence.
109. An expression vector comprising the DNA molecule of claim 107
or 108.
110. A host cell comprising the expression vector of claim 109.
111. An isolated polypeptide encoded by the DNA molecule of claim
107 or 108.
112. A kit comprising the DNA molecule of claim 107 or 108.
113. A method of producing a polypeptide comprising expressing an
expression vector in a host cell and harvesting the polypeptide.
Description
CROSS-REFERENCE TO RELATED PATENT APPLICATIONS
[0001] This International Patent Application claims priority to
U.S. Provisional Patent Application No. 61/845,794, filed Jul. 12,
2013 and U.S. Provisional Patent Application No. 61/985,238, filed
Apr. 28, 2014, the disclosures of both of which are herein
incorporated by reference.
FIELD OF THE INVENTION
[0002] The invention relates to the field of plant molecular
biology. More specifically, the invention relates to Kentucky
bluegrass plant events Pp009-401, Pp009-415 and Pp009-469, plants,
seeds, and plant material comprising these events, and methods for
detecting the presence of the events. Turfgrasses comprising events
Pp009-401, Pp009-415, and/or Pp009-469 possess desirable
characteristics including glyphosate tolerance and enhanced
turfgrass quality. The invention also relates to plants, seeds, and
plant material comprising a variant enzyme
5-enolpyruvyl-3-phosphoshikimate synthase (EPSPS) transgene and
methods for detecting the presence of the variant EPSPS transgene.
Plants comprising the variant EPSPS transgene possess glyphosate
tolerance.
BACKGROUND OF THE INVENTION
[0003] Kentucky bluegrass (Poa pratensis L.) is an important turf
species in many areas of the world. Kentucky bluegrass is used on
consumer lawns, sport fields, on golf courses and various managed
turfgrass areas. The control of weeds in Kentucky bluegrass is
particularly problematic. Annual grasses, such as crabgrass,
foxtail, dallisgrass, and goosegrass must be controlled by use of a
variety of herbicides including bensulide, dithiopyr, oxadiazon,
fenoxapropand prodiamine applied at specific rates, environmental
conditions, and seasons. Results vary even when applied by
experts.
[0004] N-phosphonomethylglycine, also known as glyphosate, is a
well-known herbicide that has activity on a broad spectrum of plant
species. Glyphosate is the active ingredient of Roundup.RTM.
(Monsanto Co.), an herbicide having a desirably short half-life in
the environment. When applied to a plant surface, glyphosate moves
systemically through the plant. Glyphosate is phytotoxic due to its
inhibition of the shikimic acid pathway, which provides a precursor
for the synthesis of aromatic amino acids. Glyphosate inhibits the
enzyme 5-enolpyruvyl-3-phosphoshikimate synthase (EPSPS) found in
plants.
[0005] Glyphosate tolerance is a desirable phenotype in various
plants. Glyphosate tolerance can be achieved by the expression of
bacterial EPSPS variants and plant EPSPS variants that have lower
affinity for glyphosate and therefore retain their catalytic
activity in the presence of glyphosate. (See, e.g., U.S. Pat. Nos.
5,633,435; 5,094,945; 4,535,060; and 6,040,497).
[0006] Plants comprising events that confer glyphosate tolerance
are known in the art. For example, U.S. Pat. No. 7,569,747,
incorporated by reference herein in its entirety, relates to
bentgrass event ASR-368, glyphosate tolerant plants comprising
ASR-368, and methods for detecting ASR-368. There is a need,
however, for other grasses tolerant to glyphosate.
SUMMARY OF VARIOUS EMBODIMENTS OF THE INVENTION
[0007] The invention provides for glyphosate tolerant turf grasses
(e.g., Kentucky bluegrass), methods of making glyphosate tolerant
turf grasses, and methods of controlling weeds in a field
comprising glyphosate tolerant turf grasses by treating the field
with an effective amount of an herbicide comprising glyphosate. The
invention also provides for turf grasses that have enhanced
turfgrass quality (e.g., require less mowing, have a darker green
color, and generate a thicker, fuller stand).
[0008] The invention provides Kentucky bluegrass transgenic events
designated Pp009-401, Pp009-415, and Pp009-469. Representative
seeds comprising events Pp009-401, Pp009-415, and Pp009-469 have
been deposited with American Type Culture Collection (ATCC) as
Accession Nos. PTA-120354, PTA-120353, and PTA-120355,
respectively. In one aspect, the invention includes plants grown
from, or obtainable from, seeds comprising events Pp009-401,
Pp009-415, or Pp009-469. The invention also includes progeny
plants, seeds, or regenerable parts of plants comprising events
Pp009-401, Pp009-415, or Pp009-469. In a particular aspect, plant
parts, such as bulb, tuber, crown, stem, tiller, cuttings including
un-rooted cuttings, rooted cuttings, and callus cuttings or
callus-generated plantlets; apical meristems, pollen, ovule,
flowers, shoots, stolons, progagules, seeds, runners, corms,
rhizomes, roots, and leaves may comprise events Pp009-401,
Pp009-415 and Pp009-469. In another aspect, the invention provides
for a Kentucky bluegrass plant, cell, plant part, or seed
comprising event Pp009-401, event Pp009-415, or event
Pp009-469.
[0009] In another aspect, the invention provides for DNA comprising
the transgene/genomic junction regions contained in the genome of
events Pp009-401, Pp009-415, or Pp009-469. In another aspect, the
invention provides for genomic DNA comprising events Pp009-401,
Pp009-415, or Pp009-469. In a particular aspect, the invention
provides for an isolated DNA molecule comprising SEQ ID NO: 1, SEQ
ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6,
SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:
11, SEQ ID NO: 12, SEQ ID NO: 13, the complements thereof, or
combinations thereof. In another aspect, the invention provides for
a plant, plant cell, plant part, or seed comprising the DNA
molecule of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, the
complements thereof, or combinations thereof.
[0010] In another aspect, the invention provides for a plant, plant
cell, plant part, or seed comprising a DNA molecule with at least
80%, 81%, 82%, 83%, 84%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or 99% homology to the nucleic acid
sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, the
complements thereof, or combinations thereof.
[0011] In a further aspect, a DNA molecule may have at least about
80%, 81%, 82%, 83%, 84%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or 99% homology to the nucleic acid
sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4,
SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
In a further aspect, a kit may comprise a DNA molecule with at
least about 80%, 81%, 82%, 83%, 84%, 86%, 87%, 88%, 89%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to the nucleic
acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID
NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ
ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID
NO: 13.
[0012] The invention also provides an expression vector comprising
a nucleotide encoding a DNA molecule with at least 80%, 81%, 82%,
83%, 84%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, or 99% homology to the nucleic acid sequence of SEQ ID
NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ
ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.
[0013] In another aspect, the invention provides for an host cell
comprising a DNA molecule with at least 80%, 81%, 82%, 83%, 84%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
99% homology to the nucleic acid sequence of SEQ ID NO: 1, SEQ ID
NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ
ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11,
SEQ ID NO: 12, or SEQ ID NO: 13.
[0014] The invention further provides for methods of expressing a
DNA molecule with at least 80%, 81%, 82%, 83%, 84%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology
to the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID
NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ
ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, or SEQ ID NO: 13 in a host cell and collecting the expressed
polypeptide.
[0015] The invention also provides for a polypeptide encoded by a
DNA molecule may have at least about 80%, 81%, 82%, 83%, 84%, 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
homology to the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO:
2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID
NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11,
SEQ ID NO: 12, or SEQ ID NO: 13.
[0016] In one aspect, the invention provides for a method of
detecting the transgene/genomic junction region of events
Pp009-401, Pp009-415, or Pp009-469 in a plant. In another aspect,
the invention provides for a method of detecting genomic DNA
comprising events Pp009-401, Pp009-415, or Pp009-469 in a plant.
These methods may involve the use of primers or probes specific for
the transgene/genomic junction of events Pp009-401, Pp009-415, or
Pp009-469. In a particular aspect, the invention provides for a
method of detection comprising amplifying DNA from a plant, plant
cell, plant part, or seed using the primers described herein. In an
alternative aspect, the invention provides for a method of
detection comprising hybridizing DNA from a plant, plant cell,
plant part, or seed with the probes described herein.
[0017] In another aspect, the invention provides for compositions
and methods for detecting the presence of a transgene/genomic
junction region from Kentucky bluegrass plant event Pp009-401. DNA
molecules are provided that comprise the transgene/genomic junction
DNA molecule comprising SEQ ID NO: 2, or complements thereof,
wherein the junction molecule spans the insertion site that
comprises a heterologous DNA inserted into the Kentucky bluegrass
genome and the genomic DNA from the Kentucky bluegrass cell
flanking the insertion site in Kentucky bluegrass event Pp009-401.
A Kentucky bluegrass plant Pp009-401 and seed comprising these
molecules is another aspect of this invention.
[0018] In another aspect, the invention provides for compositions
and methods for detecting the presence of a transgene/genomic
junction region from Kentucky bluegrass plant event Pp009-415. DNA
molecules are provided that comprise the transgene/genomic junction
DNA molecule comprising SEQ ID NO: 4, or complements thereof,
wherein the junction molecule spans the insertion site that
comprises a heterologous DNA inserted into the Kentucky bluegrass
genome and the genomic DNA from the Kentucky bluegrass cell
flanking the insertion site in Kentucky bluegrass event Pp009-415.
A Kentucky bluegrass plant Pp009-415 and seed comprising these
molecules is another aspect of this invention.
[0019] In another aspect, the invention provides for compositions
and methods for detecting the presence of a transgene/genomic
junction region from Kentucky bluegrass plant event Pp009-469. DNA
molecules are provided that comprise the transgene/genomic junction
DNA molecule comprising SEQ ID NO: 6, or complements thereof,
wherein the junction molecule spans the insertion site that
comprises a heterologous DNA inserted into the Kentucky bluegrass
genome and the genomic DNA from the Kentucky bluegrass cell
flanking the insertion site in Kentucky bluegrass event Pp009-469.
A Kentucky bluegrass plant Pp009-469 and seed comprising these
molecules is another aspect of this invention.
[0020] In another aspect, the invention provides for two DNA
molecules (primers) that, when used together in a DNA amplification
method, produce an amplicon diagnostic for Kentucky bluegrass event
Pp009-401. In one aspect, the primers are derived from SEQ ID NO:
7. In another aspect, the first DNA molecule comprises at least 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, or more contiguous or homologous polynucleotides of any portion
of the transgene region of the DNA molecule of SEQ ID NO: 7, or the
complement thereof, and the second DNA molecule is of similar
length and comprises any portion of a 5' flanking Kentucky
bluegrass genomic DNA region of SEQ ID NO: 7, or the complement
thereof. In a particular aspect, the DNA primers comprise SEQ ID
NO: 1 and SEQ ID NO: 2. In alternative aspect, the invention
provides for a DNA probe that, when used in a DNA hybridization
method, detects Kentucky bluegrass event Pp009-401. In another
aspect, the DNA probe comprises at least 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or more
nucleotides that hybridize to any portion of the transgene region
and any portion of the flanking genomic DNA region of the DNA
molecule of SEQ ID NO: 7. In a particular aspect, the DNA probe
comprises SEQ ID NO: 2.
[0021] In another aspect, the invention provides for two DNA
molecules (primers) that, when used together in a DNA amplification
method, produce an amplicon diagnostic for Kentucky bluegrass event
Pp009-415. In one aspect, the primers are derived from SEQ ID NO:
8. In another aspect, the first DNA molecule comprises at least 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, or more contiguous or homologous polynucleotides of any portion
of the transgene region of the DNA molecule of SEQ ID NO: 8, or the
complement thereof, and the second DNA molecule is of similar
length and comprises any portion of a 5' flanking Kentucky
bluegrass genomic DNA region of SEQ ID NO: 8, or the complement
thereof. In a particular aspect, the DNA primers comprise SEQ ID
NO: 3 and SEQ ID NO: 4. In alternative aspect, the invention
provides for a DNA probe that, when used in a DNA hybridization
method, detects Kentucky bluegrass event Pp009-415. In another
aspect, the DNA probe comprises at least 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or more
nucleotides that hybridize to any portion of the transgene region
and any portion of the flanking genomic DNA region of the DNA
molecule of SEQ ID NO: 8. In a particular aspect, the DNA probe
comprises SEQ ID NO: 4.
[0022] In another aspect, the invention provides for two DNA
molecules (primers) that, when used together in a DNA amplification
method, produce an amplicon diagnostic for Kentucky bluegrass event
Pp009-469. In one aspect, the primers are derived from SEQ ID NO:
9. In another aspect, the first DNA molecule comprises at least 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, or more contiguous or homologous polynucleotides of any portion
of the transgene region of the DNA molecule of SEQ ID NO: 9, or the
complement thereof, and the second DNA molecule is of similar
length and comprises any portion of a 5' flanking Kentucky
bluegrass genomic DNA region of SEQ ID NO: 9, or the complement
thereof. In a particular aspect, the DNA primers comprise SEQ ID
NO: 5 and SEQ ID NO: 6. In alternative aspect, the invention
provides for a DNA probe that, when used in a DNA hybridization
method, detects Kentucky bluegrass event Pp009-469. In another
aspect, the DNA probe comprises at least 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or more
nucleotides that hybridize to any portion of the transgene region
and any portion of the flanking genomic DNA region of the DNA
molecule of SEQ ID NO: 9. In a particular aspect, the DNA probe
comprises SEQ ID NO: 6.
[0023] In another aspect, the invention provides for methods of
detecting the presence of DNA corresponding specifically to the
Kentucky bluegrass event Pp009-401, Pp009-415, or Pp009-469 DNA in
a sample. These methods comprise: (a) contacting a DNA sample with
a primer pair that, when used in a nucleic acid amplification
reaction with genomic DNA from Kentucky bluegrass event Pp009-401,
Pp009-415, or Pp009-469 produces an amplicon diagnostic for
Kentucky bluegrass event Pp009-401, Pp009-415, or Pp009-469; (b)
performing a nucleic acid amplification reaction, thereby producing
the amplicon; and (c) detecting the amplicon.
[0024] In another aspect, the invention provides for methods of
detecting the presence of DNA corresponding specifically to the
Kentucky bluegrass event Pp009-401, Pp009-415, and Pp009-469 DNA in
a sample. These methods comprise: (a) contacting a DNA sample with
a probe that hybridizes under stringent hybridization conditions
with genomic DNA from Kentucky bluegrass event Pp009-401,
Pp009-415, or Pp009-469; (b) subjecting the sample and probe to
stringent hybridization conditions; and (c) detecting hybridization
of the probe to the Pp009-401, Pp009-415, or Pp009-469 DNA.
[0025] In another aspect, the invention provides for methods of
producing a Kentucky bluegrass plant that tolerates application of
glyphosate comprising sexually crossing a first parental Kentucky
bluegrass event Pp009-401, Pp009-415, or Pp009-469 and a second
parental plant (e.g., Kentucky bluegrass) that lacks Pp009-401,
Pp009-415, or Pp009-469 (or that lacks glyphosate tolerance),
thereby producing a plurality of progeny plants.
[0026] In another aspect, the invention provides for methods of
producing a Kentucky bluegrass plant that tolerates application of
glyphosate comprising: (a) sexually crossing a first parental
Kentucky bluegrass event Pp009-401, Pp009-415, or Pp009-469 and a
second parental plant (e.g., Kentucky bluegrass) that lacks
Pp009-401, Pp009-415, or Pp009-469 (or that lacks glyphosate
tolerance), thereby producing a plurality of progeny plants; and
(b) selecting a progeny plant that tolerates application of
glyphosate. Such methods may optionally comprise the further step
of back-crossing the progeny plant to the second parental Kentucky
bluegrass plant and selecting for glyphosate tolerant progeny to
produce a true-breeding Kentucky bluegrass variety that tolerates
application of glyphosate.
[0027] In another aspect, the invention provides for a turfgrass
stand, lawn, sports field, or golf course comprising event
Pp009-401, Pp009-415 and/or Pp009-469. In another aspect, the
invention provides for a method of controlling weeds in a turfgrass
stand of Kentucky bluegrass Pp009-401, Pp009-415 and/or Pp009-469
comprising the step of applying a glyphosate containing herbicide
formulation to the turfgrass stand.
[0028] In another embodiment, the invention provides for methods of
producing a Kentucky bluegrass plant that tolerates application of
glyphosate comprising sexually crossing a first parental Kentucky
bluegrass comprising the nucleic acid of SEQ ID NO: 10 or 12 and a
second parental plant (e.g., Kentucky bluegrass) that lacks the
nucleic acid of SEQ ID NO: 10 or 12 (or that lacks glyphosate
tolerance), thereby producing a plurality of progeny plants.
[0029] In another embodiment, the invention provides for methods of
producing a Kentucky bluegrass plant that tolerates application of
glyphosate comprising: (a) sexually crossing a first parental
Kentucky bluegrass the nucleic acid of SEQ ID NO: 10 or 12 and a
second parental plant (e.g., Kentucky bluegrass) that lacks the
nucleic acid of SEQ ID NO: 10 or 12 (or that lacks glyphosate
tolerance), thereby producing a plurality of progeny plants; and
(b) selecting a progeny plant that tolerates application of
glyphosate. Such methods may optionally comprise the further step
of back-crossing the progeny plant to the second parental Kentucky
bluegrass plant and selecting for glyphosate tolerant progeny to
produce a true-breeding Kentucky bluegrass variety that tolerates
application of glyphosate.
[0030] In another embodiment, the invention provides for a
turfgrass stand, lawn, sports field, or golf course comprising the
nucleic acid of SEQ ID NO: 10 or 12. In another embodiment, the
invention provides for a method of controlling weeds in a turfgrass
stand of Kentucky bluegrass the nucleic acid of SEQ ID NO: 10 or 12
comprising the step of applying a glyphosate containing herbicide
formulation to the turfgrass stand.
[0031] In one embodiment, a method for detecting the presence of
the genomic DNA of claim 11, may comprise (1) amplifying a nucleic
acid obtained from a Kentucky bluegrass plant, plant cell, or plant
material using a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2; or
(2) hybridizing a nucleic acid obtained from a Kentucky bluegrass
plant, plant cell, or plant material using a probe comprising SEQ
ID NO: 1 and SEQ ID NO: 2.
[0032] In one embodiment, a method for detecting the presence of
the genomic DNA of claim 12, may comprise (1) amplifying a nucleic
acid obtained from a Kentucky bluegrass plant, plant cell, or plant
material using a primer pair of SEQ ID NO: 3 and SEQ ID NO: 4; or
(2) hybridizing a nucleic acid obtained from a Kentucky bluegrass
plant, plant cell, or plant material using a probe comprising SEQ
ID NO: 3 and SEQ ID NO: 4.
[0033] In one embodiment, a method for detecting the presence of
the genomic DNA of claim 13, may comprise (1) amplifying a nucleic
acid obtained from a Kentucky bluegrass plant, plant cell, or plant
material using a primer pair of SEQ ID NO: 5 and SEQ ID NO: 6; or
(2) hybridizing a nucleic acid obtained from a Kentucky bluegrass
plant, plant cell, or plant material using a probe comprising SEQ
ID NO: 5 and SEQ ID NO: 6.
[0034] In one embodiment, a kit may comprise the primer pair or
probe of SEQ ID NO: 1 and SEQ ID NO: 2. In one embodiment, a kit
may comprise the primer pair or probe of SEQ ID NO: 3 and SEQ ID
NO: 4. In one embodiment, a kit may comprise the primer pair or
probe of SEQ ID NO: 5 and SEQ ID NO: 6. In another embodiment, the
primer pair or probe may be attached to a solid support. In another
embodiment, the solid support may be a bead, fiber, plate, or
multi-well plate. In another embodiment, the primer pair or probe
may be arranged in an array. In another embodiment, the kit may
further comprise a buffer or solution. In another embodiment, the
primer pair or probe may be labeled. In another embodiment, the
label may be a florescent molecule, a radioactive isotope, ligand,
chemifluorescent, chemiluminescent agent, or enzyme.
[0035] In another embodiment, the method for producing Kentucky
bluegrass plant or seed may comprise selfing or crossing a Kentucky
bluegrass plant comprising event Pp009-401, event Pp009-415, or
event Pp009-469 with a plant lacking event Pp009-401, event
Pp009-415, or event Pp009-469, and planting seed obtained from said
cross.
[0036] In one embodiment, an isolated nucleic acid may comprise the
nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
or SEQ ID NO: 13. In another embodiment, an isolated nucleic acid
may comprise the nucleotide sequence of SEQ ID NO: 10. In another
embodiment, an isolated nucleic acid may comprise the nucleotide
sequence of SEQ ID NO: 11. In another embodiment, an isolated
nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 12.
In another embodiment, an isolated nucleic acid may comprise the
nucleotide sequence of SEQ ID NO: 13.
[0037] In one embodiment, an isolated cassette may comprise the
nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 11. In another
embodiment, an isolated cassette may comprise the nucleotide
sequence of SEQ ID NO: 10. In another embodiment, an isolated
cassette may comprise the nucleotide sequence of SEQ ID NO: 11.
[0038] In one embodiment, an isolated plasmid may comprise the
nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
or SEQ ID NO: 13. In another embodiment, an isolated plasmid may
comprise the nucleotide sequence of SEQ ID NO: 10.
[0039] In another embodiment, an isolated plasmid may comprise the
nucleotide sequence of SEQ ID NO: 11. In another embodiment, an
isolated plasmid may comprise the nucleotide sequence of SEQ ID NO:
12. In another embodiment, an isolated plasmid may comprise the
nucleotide sequence of SEQ ID NO: 13.
[0040] In one embodiment, an isolated cell may comprise the
nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
or SEQ ID NO: 13. In another embodiment, an isolated cell may
comprise the nucleotide sequence of SEQ ID NO: 10. In another
embodiment, an isolated cell may comprise the nucleotide sequence
of SEQ ID NO: 11. In another embodiment, an isolated cell may
comprise the nucleotide sequence of SEQ ID NO: 12. In another
embodiment, an isolated cell may comprise the nucleotide sequence
of SEQ ID NO: 13. In another embodiment, the cell may be a
bacterial cell or a plant cell.
[0041] In one embodiment, a Kentucky bluegrass plant, cell, plant
part, or seed may comprise the nucleotide sequence of SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In another
embodiment, a seed of Kentucky bluegrass may comprise the
nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
or SEQ ID NO: 13. In another embodiment, a Kentucky bluegrass
plant, or part thereof, may produced from a seed comprising the
nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
or SEQ ID NO: 13. In another emboidment, the part may be a cell,
bulb, tuber, crown, stem, tiller, cuttings including un-rooted
cuttings, rooted cuttings, and callus cuttings or callus-generated
plantlets; apical meristems, pollen, ovule, flower, shoot, stolon,
progagule, seed, runner, corm, rhizome, root, or leaf.
[0042] In one embodiment, a method for producing Kentucky bluegrass
plant or seed may comprise growing the seed comprising the
nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
or SEQ ID NO: 13.
[0043] In one embodiment, the method for controlling weeds in a
field may comprise growing the seed comprising the nucleotide
sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID
NO: 13 and treating the field with an effective amount of an
herbicide comprising glyphosate.
[0044] In one embodiment, a lawn may comprise a plant comprising
the nucleotide sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, or SEQ ID NO: 13.
[0045] In one embodiment, a method for producing a Kentucky
bluegrass plant that tolerates application of glyphosate may
comprise sexually crossing a first parental Kentucky bluegrass
comprising the nucleic acid of SEQ ID NO: 10 or 12 and a second
parental plant that lacks the nucleic acid of SEQ ID NO: 10 or 12
or that lacks glyphosate tolerance, thereby producing a plurality
of progeny plants.
[0046] In one embodiment, a method for producing a Kentucky
bluegrass plant that tolerates application of glyphosate may
comprise: (a) sexually crossing a first parental Kentucky bluegrass
the nucleic acid of SEQ ID NO: 10 or 12 and a second parental plant
that lacks the nucleic acid of SEQ ID NO: 10 or 12 or that lacks
glyphosate tolerance, thereby producing a plurality of progeny
plants; and (b) selecting a progeny plant that tolerates
application of glyphosate. In another embodiment, the method may
further comprise back-crossing the progeny plant to the second
parental Kentucky bluegrass plant and selecting for glyphosate
tolerant progeny to produce a true-breeding Kentucky bluegrass
variety that tolerates application of glyphosate.
[0047] In one embodiment, a turfgrass stand, lawn, sports field, or
golf course may comprise a Kentucky bluegrass plant comprising the
nucleic acid of SEQ ID NO: 10 or 12.
[0048] In one embodiment, a method of controlling weeds in a
turfgrass stand of Kentucky bluegrass the nucleic acid of SEQ ID
NO: 10 or 12 may comprise the step of applying a glyphosate
containing herbicide formulation to the turfgrass stand.
[0049] In one embodiment, a plant cell may comprise the nucleotide
sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID
NO: 13.
[0050] In one embodiment, a plant cell may comprise the event
Pp009-401, event Pp009-415, or event Pp009-469.
[0051] In one embodiment, a plant may comprise the event Pp009-401,
event Pp009-415, or event Pp009-469.
[0052] In one embodiment, a plant may comprise the nucleotide
sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID
NO: 13.
[0053] In one embodiment, a transgenic plant may comprise the
nucleotide sequence of SEQ ID NO: 10. In one embodiment, a
transgenic plant may comprise the nucleotide sequence of SEQ ID NO:
11. In one embodiment, a transgenic plant may comprise the
nucleotide sequence of SEQ ID NO: 12. In one embodiment, a
transgenic plant may comprise the nucleotide sequence of SEQ ID NO:
13.
[0054] In one embodiment, the plant may be a grass, grain crop, an
agricultural crop, ornamental flower, legume, fruit, vegetable,
herb, ornamental flower, perennial plant, or tree.
[0055] In one embodiment, the plant may be a grass. In another
embodiment, the grass may be Bahia grass, bent grass, Bermuda
grass, Blue grama grass, Buffalo grass, centipedes grasses, fescue
grass, optionally needle-leaved Fescue grass, tall Fescue, or
broad-leaved Fescue grass, Kentucky bluegrass, rygrass optionally
annual ryegrass or perennial ryegrass, seashore paspalum, St.
Augustine grass, or Zoysia grass.
[0056] In another embodiment, the plant may be a grain crop. In
another embodiment, the grain crop may be barley, sorghum, millet,
rice, canola, corn, oats, wheat, barley, or hops. In a further
embodiment, the plant may be soybean.
[0057] In one embodiment, the plant may be an ornamental flower. In
another embodiment, the flower may be an annual or perennial
ornamental flower. In another embodiment, the ornamental flower may
be a geranium, petunia, or daffodil.
[0058] In one embodiment, the plant may be a legume. In one
embodiment, the legume may be alfalfa, clover, peas, beans,
lentils, lupins, mesquite, carob, soybeans, peanuts, or
tamarind.
[0059] In one embodiment, the plant may be a fruit. In another
embodiment, the fruit may be a grape, raspberry, blueberry,
strawberry, blackberry, watermelon, apple, cherry, pear, orange,
lemon, or pumpkin.
[0060] In one embodiment, the plant may be a vegetable. In another
embodiment, the vegetable may be asparagus, Brussels sprouts,
cabbage, carrots, celery, chard, collard greens, endive, tomatoes,
beans, peas, broccoli, cauliflower, bell pepper, eggplant, kale,
lettuce, okra, onion, radish, spinach, peppers, broccoli, cucumber,
zucchini, eggplant, beet, squash, beans, potato, or onion.
[0061] In one embodiment, the plant may be a herb. In another
embodiment, the herb may be anise, basil, caraway, cilantro,
chamomile, dill, fennel, lavender, lemon grass, marjoram, oregano,
parsley, rosemary, sage, thyme, or mint.
[0062] In one embodiment, the plant may be a root vegetable or a
vine vegetable. In another embodiment, the root vegetable may be a
turnip, potato, carrot, or beet. In another embodiment, the vine
vegetable may be a cucumber, pumpkin, squash, melon, or
zucchini.
[0063] In one embodiment, the plant may be an agricultural crop. In
another embodiment, the agricultural crop may be cotton, corn,
sugar cane, wheat, soybean, tobacco, or citrus.
[0064] In one embodiment, the plant may be an ornamental plant. In
another embodiment, the ornamental plant may be a geranium,
petunia, impatien, verbena, dahlia, pansy, vinca, ipomoea, lantana,
salvia, snapdragon, scaevola, torenia, lobelia, dipladenia,
calibrachoa, asters, agerantum, phlox, penstemon, gaillardia,
zinnia, coleus, osteospermum, gerbera, begonia, angelonia,
dianthus, calendula, campanula, celosia, portulaca, viola, or mum.
In another embodiment, the ornamental plant may be a variety of the
vinca genus. In another embodiment, the ornamental plant may be a
variety of the helianthus annuus genus. In another embodiment, the
ornamental plant may be a variety of the impatients hawkeri genus.
In another embodiment, the ornamental plant may be a variety of the
lantana genus. In another embodiment, the ornamental plant may be a
variety of the mandevilla hydrida genus. In another embodiment, the
ornamental plant may be a variety of the pelargonium interspecific
genus. In another embodiment, the ornamental plant may be a variety
of the pentas lanceolata genus. In another embodiment, the
ornamental plant may be a variety of the petunia pendula genus. In
another embodiment, the ornamental plant may be a variety of the
rudbeckia genus. In another embodiment, the ornamental plant may be
a variety of the tagetes erecta genus. In another embodiment, the
ornamental plant may be a variety of the viola cornuta genus. In
another embodiment, the ornamental plant may be a variety of the
viola wittrockiana genus. In another embodiment, the ornamental
plant may be a variety of the zinnia genus.
[0065] In one embodiment, a plant, or part thereof, may be from a
plant comprising the nucleic acid sequence of SEQ ID NO: 10, 11,
12, or 13. In another embodiment, the part may be a cell, bulb,
tuber, crown, stem, tiller, cuttings including un-rooted cuttings,
rooted cutting, and callus cutting or callus-generated plantlet;
apical meristem, pollen, ovule, flower, shoot, stolon, progagule,
seed, runner, corm, rhizome, root, or leaf.
[0066] In one embodiment, a method for controlling weeds in a field
may comprise growing a seed from a plant comprising the nucleic
acid sequence of SEQ ID NO: 12 or SEQ ID NO: 12 and SEQ ID NO: 13
and treating the field with an effective amount of an herbicide
comprising glyphosate.
[0067] The foregoing and other aspects of the invention will become
more apparent from the following detailed description and
accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0068] FIG. 1 depicts a plasmid map of pSCO761.
[0069] FIG. 2 depicts the Pp009-401 transgene/genomic/chromosomal
flanking DNA sequence (SEQ ID NO: 7). The single underlined
sequence represents the native DNA primer 401 UBB1 Dil 3-1 priming
site. The double underlined sequence represents the pSCO761
junction primer 401 UBB1 Dil 5-2 priming site. The italicized
sequence represents the pSCO761 transgene homology. The primers
span a sequence of 720 bases in length (i.e, the primers produce an
amplicon of 720 bp).
[0070] FIG. 3 depicts Pp009-415 transgene/genomic/chromosomal
flanking DNA sequence (SEQ ID NO: 8). The single underlined
sequence represents the native DNA primer 415 GOB1 Dil 3-1 priming
site. The double underlined sequence represents the pSCO761
junction primer 415 GOB1 Dil 5-2 priming site. The italicized
sequence represents the pSCO761 transgene homology. The primers
span a sequence of 719 bases in length (i.e, the primers produce an
amplicon of 719 bp).
[0071] FIG. 4 depicts Pp009-469 transgene/genomic/chromosomal
flanking DNA sequence (SEQ ID NO: 9) The single underlined sequence
represents the native DNA primer 469 GOB1 Dil 3-1 priming site. The
double underlined sequence represents the pSCO761 junction primer
469 GOB1 Dil 5-5 priming site. The italicized sequence represents
the pSCO761 transgene homology. The primers span a sequence of 410
bases in length (i.e, the primers produce an amplicon of 410
bp).
[0072] FIG. 5 depicts the 401 UBB1 Dil 3-1 primer sequence (SEQ ID
NO: 1) and 401 UBB1 Dil 5-2 primer sequence (SEQ ID NO: 2). These
primers are useful in detecting event Pp009-401.
[0073] FIG. 6 depicts the 415 GOB1 Dil 3-1 primer sequence (SEQ ID
NO: 3) and 415 GOB1 Dil 5-2 primer sequence (SEQ ID NO: 4). These
primers are useful in detecting event Pp009-415.
[0074] FIG. 7 depicts the 469 GOB1 Dil 3-1 primer sequence (SEQ ID
NO: 5) and 469 GOB1 Dil 5-5 primer sequence (SEQ ID NO: 6). These
primers are useful in detecting event p009-469.
[0075] FIG. 8 is a photograph of an electrophoresis gel showing PCR
bands from reactions using primers disclosed herein.
[0076] FIG. 9 depicts the sequence of the EPSPS cassette comprising
a RUBQ promoter (bold), rice actin intron (italicized), EPSPS
coding sequence (underline), and ZmADH 3' UTR (SMALL CAPS). The
EPSPS cassette comprises heterologous DNA sequences.
[0077] FIG. 10 depicts the sequence of the GA2OX cassette
comprising a GOS2 promoter (bold), GA2OX coding sequence
(underline), and SpH 3' UTR (SMALL CAPS). The GA2OX cassette
comprises heterologous DNA sequences.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION
[0078] The invention provides Kentucky bluegrass plant events
Pp009-401, Pp009-415 and Pp009-469, turfgrasses, plants, seeds, and
plant material comprising these events, and methods for detecting
the presence of the events. Plants (e.g., turfgrasses) may comprise
events Pp009-401, Pp009-415, and/or Pp009-469 possess desirable
characteristics including glyphosate tolerance and enhanced
turfgrass quality. The invention also provides plants, bulb, tuber,
crown, stem, tiller, cuttings including un-rooted cuttings, rooted
cuttings, and callus cuttings or callus-generated plantlets; apical
meristems, pollen, ovule, flowers, shoots, stolons, progagules,
seeds, runners, corms, rhizomes, roots, leaves, and plant material
comprising a variant enzyme 5-enolpyruvyl-3-phosphoshikimate
synthase (EPSPS) transgene and methods for detecting the presence
of the variant EPSPS transgene. Plants comprising the variant EPSPS
transgene possess glyphosate tolerance. The invention also provides
plants, bulb, tuber, crown, stem, tiller, cuttings including
un-rooted cuttings, rooted cuttings, and callus cuttings or
callus-generated plantlets; apical meristems, pollen, ovule,
flowers, shoots, stolons, progagules, seeds, runners, corms,
rhizomes, roots, leaves, and plant material comprising a
gibberellic acid 2-oxidase (GA2OX) transgene and variant EPSPS
transgene and methods for detecting the presence of the GA2OX
transgene or variant EPSPS transgene. Plants comprising the variant
GA2OX transgene may exhibit shorter stature, darker green color,
thicker/more density, shorter stolons, better nurtrient use
efficiency, better water use efficiency. The invention also
provides plants, bulb, tuber, crown, stem, tiller, cuttings
including un-rooted cuttings, rooted cuttings, and callus cuttings
or callus-generated plantlets; apical meristems, pollen, ovule,
flowers, shoots, stolons, progagules, seeds, runners, corms,
rhizomes, roots, leaves, and plant material comprising a variant
enzyme 5-enolpyruvyl-3-phosphoshikimate synthase (EPSPS) transgene
and a gibberellic acid 2-oxidase (GA2OX) transgene and methods for
detecting the presence of the EPSPS and/or GA2OX transgenes.
DEFINITIONS
[0079] Unless otherwise indicated, all terms used herein have the
same meaning as they would to one skilled in the art.
[0080] "Conservative substitution," as used herein, refers broadly
to the substitution of an amino acid by another amino acid of the
same class, in which the classes are defined as follows: Nonpolar:
A, V, L, I, P, M, F, W Uncharged polar: G, S, T, C, Y, N, Q Acidic:
D, E Basic: K, R, H.
[0081] "Specific," for (a target sequence), as used herein, refers
broadly to a probe or primer hybridizes under standard stringent
hybridization conditions only to the target sequence in a sample
comprising the target sequence.
[0082] "Sequence identity," with regard to nucleotide sequences
(DNA or RNA), as used herein, refers broadly to the number of
positions with identical nucleotides divided by the number of
nucleotides in the shorter of the two sequences. The alignment of
the two nucleotide sequences is performed by the Wilbur and Lipmann
algorithm (Wilbur and Lipmann, 1983, Proc. Nat. Acad. Sci. USA
80:726) using a window-size of 20 nucleotides, a word length of 4
nucleotides, and a gap penalty of 4. Computer-assisted analysis and
interpretation of sequence data, including sequence alignment as
described above, can, e.g., be conveniently performed using the
sequence analysis software package of the Genetics Computer Group
(GCG, University of Wisconsin Biotechnology center).
[0083] "Solid support," "support," and "substrate," as used herein,
refers broadly to any material that provides a solid or semi-solid
structure with which another material can be attached.
[0084] "Variant," as used herein, refers broadly to means a
nucleotide sequence that codes for the amino acid sequence differs
from the base sequence from which it is derived in that one or more
amino acids within the encoded sequence are substituted for other
amino acids.
Event
[0085] An "event" is a genetic locus that, as a result of genetic
engineering, carries a transgene of interest. An "event" is
produced by transformation of plant cells with heterologous DNA,
i.e, a nucleic acid construct that includes a transgene of
interest, regeneration of a population of plants resulting from the
insertion of the transgene into the genome of the plant, and
selection of a particular plant characterized by insertion into a
particular genome location. An "event" refers to the original
transformant and progeny of the transformant that includes the
heterologous DNA. An "event" also refers to progeny produced by a
sexual outcross between the transformant and another event that
include the heterologous DNA. Even after repeated back-crossing to
a recurrent parent, the inserted DNA and flanking genomic DNA from
the transformed parent is present in the progeny of the cross at
the same chromosomal location. An "event" also refers to DNA from
the original transformant comprising the inserted DNA and flanking
genomic sequence immediately adjacent to the inserted DNA, that
would be expected to be transferred to a progeny that receives the
inserted DNA including the transgene of interest as the result of a
sexual cross of one parental line that includes the inserted DNA
(e.g., the original transformant and progeny resulting from
selfing) and a parental line that does not contain the inserted
DNA.
[0086] The transformation of a plant with heterologous DNA, or by
back-crossing with plants obtained by such transformation,
typically results in a population of transformants comprising a
multitude of separate events. Individual events from this group of
events are selected based on various criteria such as expression
and stability of the transgene(s) and its compatibility with
optimal agronomic characteristics of the plant comprising it. As
described herein, event Pp009-401, event Pp009-415, and event
Pp009-469 were selected based on such characteristics including
glyphosate tolerance and enhanced turfgrass quality.
[0087] The heterologous (or foreign) DNA can be characterized by
the particular location in which it is incorporated into the plant
genome. The foreign DNA can be detected by identifying regions or
sequences that flank the foreign DNA. These flanking/junction
regions or sequences are different from the introduced DNA, and are
preferably DNA from the plant genome which is located either
immediately upstream of and contiguous with, or immediately
downstream of and contiguous with the foreign DNA.
Events Pp009-401, Pp009-415, and Pp009-469
[0088] The invention relates to Kentucky bluegrass transgenic
events designated Pp009-401, Pp009-415, and Pp009-469, and plants,
cells, plant parts, and seeds comprising these events. The events
involve the transformation of two expression cassettes depicted in
FIG. 1. The first cassette includes a
5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene from
Arabidopsis, and the second cassette includes a gibberellic acid
2-oxidase gene from spinach. Plants comprising these events are
glyphosate tolerant and possess enhanced turfgrass qualities (e.g.,
require less mowing, have a darker green color, and generate a
thicker, fuller stand). The events described herein may be in the
original transformant and progeny of the transformant that include
the heterologous DNA.
[0089] Plants comprising Pp009-401, Pp009-415, or Pp009-469 may be
produced by growing seeds comprising these events. For example,
plants may be grown from seeds comprising events Pp009-401,
Pp009-415, and Pp009-469 having been deposited with American Type
Culture Collection (ATCC) as Accession Nos. PTA-120354, PTA-120353,
and PTA-120355, respectively. Plants comprising the events may also
be obtained by propagation of and/or breeding of plants comprising
the events (e.g., a plant grown from a seed deposited with the
ATCC). Plant parts, such as bulb, tuber, crown, stem, tiller,
cuttings including un-rooted cuttings, rooted cuttings, and callus
cuttings or callus-generated plantlets; apical meristems, pollen,
ovule, flowers, shoots, stolons, progagules, seeds, runners, corms,
rhizomes, roots, or leaves may that comprise events Pp009-401,
Pp009-415 or Pp009-469 are also encompassed herein.
[0090] Progeny comprising the events may be produced by a sexual
outcross between a parental plant comprising Pp009-401, Pp009-415,
or Pp009-469 (e.g., original transformant, plant grown from seed
comprising event), and itself or another parental plant that lacks
Pp009-401, Pp009-415, or Pp009-469, respectively. The other plant
may also lack glyphosate tolerance. The other plant may, however,
comprise other events and/or desirable characteristics.
[0091] In one embodiment, the invention provides for a method of
producing a turfgrass (e.g., Kentucky bluegrass) plant or seed
comprising crossing a Kentucky bluegrass plant comprising event
Pp009-401, event Pp009-415, or event Pp009-469 with a plant lacking
event Pp009-401, event Pp009-415, or event Pp009-469 (or by selfing
with a plant comprising event Pp009-401, event Pp009-415, or event
Pp009-469), and planting seed obtained from the cross or selfing,
wherein the seed comprises event Pp009-401, event Pp009-415, or
event Pp009-469. The plant lacking the event can be a Kentucky
bluegrass (Poa pratensis L.) plant or other plant species that can
breed with Kentucky blue grass (e.g., P. interior, P. arachnifera).
The method may also involve selecting progeny plants tolerant to
glyphosate. The method may further include backcrossing (or
selfing) the progeny plants with a Kentucky bluegrass plant
comprising event Pp009-401, event Pp009-415, or event Pp009-469.
The backcrossing or selfing step may be performed more than once.
Plants and seeds (comprising event Pp009-401, event Pp009-415, or
event Pp009-469) obtained from any of these methods are encompassed
herein.
[0092] In another embodiment, a glyphosate tolerant, enhanced
turfgrass quality Kentucky bluegrass plant can be bred by first
sexually crossing a parental Kentucky bluegrass plant, or other
sexually compatible Kentucky bluegrass plant, grown from the
transgenic Kentucky bluegrass plant derived from transformation
with the plant expression cassettes contained in pSCO761 (FIG. 1)
that tolerates application of glyphosate herbicide, and a second
parental Kentucky bluegrass plant that lacks the tolerance to
glyphosate herbicide, thereby producing a plurality of first
progeny plants; and then selecting a first progeny plant that is
tolerant to application of glyphosate herbicide (i.e, first
glyphosate herbicide tolerant plant); and selfing or crossing the
first progeny plant, thereby producing a plurality of second
progeny plants; and then selecting from the second progeny plants,
a glyphosate herbicide tolerant plant (i.e, second glyphosate
herbicide tolerant plant). These steps can further include the
back-crossing or crossing of the first glyphosate tolerant progeny
plant or the second glyphosate tolerant progeny plant to the second
parental Kentucky bluegrass plant or sexually compatible species or
a third parental Kentucky bluegrass plant or sexually compatible
species, thereby producing a Kentucky bluegrass plant that
tolerates the application of glyphosate herbicide. Plants and seeds
(comprising events Pp009-401, event Pp009-415, or event Pp009-469)
obtained from any of these methods are encompassed herein.
[0093] It is also to be understood that two different transgenic
plants can also be mated to produce offspring that contain two
independently segregating added, exogenous genes. Selfing of
appropriate progeny can produce plants that are homozygous for both
added, exogenous genes. Back-crossing to a parental plant and
out-crossing with a non-transgenic plant are also contemplated, as
is vegetative propagation. Descriptions of other breeding methods
that are commonly used for different traits and crops can be found
in one of several references (e.g., Fehr, in Breeding Methods for
Cultivar Development, Wilcox J. ed., American Society of Agronomy,
Madison Wis. (1987)).
EPSPS Variant Nucleic Acid
[0094] The nucleic acid comprising SEQ ID NO: 12 is a cDNA and
encodes a variant of the enzyme 5-enolpyruvyl-3-phosphoshikimate
synthase (EPSPS):
TABLE-US-00001 (SEQ ID NO: 12)
CCCAGGTGTCCCGCATCTGCAACGGCGTGCAGAACCCATCCCTCATCT
CCAACCTCTCCAAGTCCTCCCAGCGCAAGTCCCCACTCTCCGTGTCCC
TCAAGACCCAGCAACACCCACGCGCCTACCCAATCTCCAGCTCCTGGG
GCCTCAAGAAGTCCGGCATGACCCTCATCGGCTCCGAGCTGCGCCCAC
TCAAGGTGATGTCCTCCGTGTCCACCGCCGAGAAGGCCTCCGAGATCG
TGCTCCAGCCAATCCGCGAGATTTCCGGCCTCATCAAGCTCCCAGGCT
CCAAGTCCCTCTCCAACCGCATCCTCCTGCTCGCCGCTCTCTCCGAGG
GCACCACCGTGGTGGACAACCTGCTCAACTCCGACGACATCAACTACA
TGCTCGACGCCCTCAAGCGCCTCGGCCTCAACGTGGAGACCGACTCCG
AGAACAACCGCGCCGTGGTGGAGGGCTGCGGCGGCATCTTCCCAGCCT
CCATCGATTCCAAGTCCGACATCGAGCTGTACCTCGGCAACTCCGGCA
CCTGCATGAGGTCACTCACGGCGGCGGTCACCGCGGCTGGCGGCAACG
CCTCCTACGTGCTCGACGGCGTGCCAAGGATGCGCGAGCGCCCAATCG
GCGACCTCGTGGTGGGCCTCAAGCAACTCGGCGCCGACGTGGAGTGCA
CCCTCGGCACCAACTGCCCACCAGTGCGCGTGAACGCCAACGGCGGCC
TCCCAGGCGGCAAGGTGAAGCTCTCCGGCTCCATCTCCTCCCAGTACC
TCACCGCCCTGCTCATGTCCGCCCCACTCGCCCTCGGCGACGTGGAGA
TCGAGATCGTGGACAAGCTCATCTCCGTGCCATACGTGGAGATGACCC
TCAAGCTCATGGAGCGCTTCGGCGTGTCCGTGGAGCACTCCGACAGCT
GGGACCGCTTCTTCGTGAAGGGCGGCCAGAAGTACAAGTCCCCAGGCA
ACGCCTACGTGGAGGGCGACGCCTCCTCCGCCTCCTACTTCCTCGCTG
GCGCTGCCATCACCGGCGAGACCGTGACCGTGGAGGGGTGCGGCACCA
CCAGCCTCCAAGGCGACGTGAAGTTCGCCGAGGTGCTCGAGAAGATGG
GCTGCAAGGTGTCCTGGACCGAGAACTCCGTGACCGTGACCGGCCCAC
CAAGGGACGCCTTCGGCATGAGGCACCTCCGCGCCATCGACGTGAACA
TGAACAAGATGCCAGACGTGGCCATGACCCTCGCCGTGGTGGCCCTCT
TCGCCGACGGCCCAACCACCATCAGGGACGTGGCCAGCTGGCGCGTGA
AGGAGACCGAGCGCATGATCGCCATCTGCACCGAGCTGAGAAAGCTCG
GCGCCACCGTCGAGGAGGGCTCCGACTACTGCGTGATCACCCCACCAA
AGAAGGTCAAGACCGCCGAGATCGACACCTACGACGACCACCGCATGG
CGATGGCCTTCTCCCTCGCCGCCTGCGCCGACGTGCCGATCACCATCA
ACGACCCAGGCTGCACCCGCAAGACCTTCCCAGACTACTTCCAGGTGC
TCGAGCGCATCACCAAGCACT
[0095] This EPSPS variant has a lower affinity for glyphosate and
thus can retain catalytic activity in the presence of glyphosate.
The first cassette is a nucleic acid comprising SEQ ID NO: 10 is a
transgene expression cassette comprising the variant EPSPS (SEQ ID
NO: 12) that confers glyphosate resistance and enhanced turfgrass
characteristics. The first cassette includes the rice ubiquitin
promoter (P-Os.UBQ, also referred to as P-rUBQ) and rice actin 1
intron (I-Os.Act1, also referred to as ract intron), operably
connected to a glyphosate tolerant
5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) variant and
operably connected to a Zea mays alcohol dehydrogenase
transcriptional terminator.
Gibberellic Acid 2-Oxidase (GA2OX) Nucleic Acid
[0096] The nucleic acid comprising SEQ ID NO: 13 is a cDNA and
encodes gibberellic acid 2-oxidase (GA2OX):
TABLE-US-00002 (SEQ ID NO: 13)
ATGGCCTCCACCAAGGTGGTCGAGCACCTCAAGGAGAACGTCCTCTGG
AAGCAGGCCATCATGGACCGCAACGCCAACATCTCCGACCCACCGTTC
GAGGAGACCTACAAGAACCTCCTGCTCAAGCACAACATCACCCCGCTC
AACCACCACCACGACCACGCGACCACCACGGCGACCATCGAGGTGAGG
GATCTCCCACTCATCGACCTCTCCAGGCTCGTGGCCACCGCCGCCAAG
GAGCGCGAGAACTGCAAGAGGGATATCGCCAACGCCTCCCGCGAGTGG
GGCTTCTTCCAGGTGGTGAACCACGGCATCCCGCATAGGATGCTCGAG
GAGATGAACAAGGAGCAGGTCAAGGTGTTCCGCGAGCCGTTCAACAAG
AAGAAGGGCGACAACTGCATGAACCTCAGGCTCTCCCCAGGCTCCTAC
AGGTGGGGCTCCCCGACCCCGAACTGCCTCTCCCAGCTCTCCTGGTCC
GAGGCCTTCCACATCCCGATGAACGACATCTGCTCCAACGCCCCGAGG
AACATTGCCAACGGCAACCCGAACATCTCCAACCTCTGCTCCACCGTG
AAGCAGTTCGCCACCACCGTGTCCGAGCTGGCCAACAAGCTCGCCAAC
ATCCTCGTCGAGAAGCTCGGCCATGACGAGCTGACCTTCATCGAGGAG
AAGTGCTCCCCGAACACGTGCTACCTCAGGATGAACCGCTACCCGCCG
CTGCCCAAAGTACTCCCACGTGCTCGGCCTCATGCCACATACGACTCC
GACTTCCTCACCATCCTCTACCAGGACCAGGTGGGCGGCCTCCAGCTC
GTGAAGGACGGCCGCTGGATTTCCGTGAAGCCGAACCCAGAGGCCCTC
ATCGTGAACATCGGCGACCTCTTCCAGGCCTGGTCTAACGGCGTGTAC
AAGTCCGTGGTGCATAGGGTGGTGGCCAACCCGAGGTTCGAGAGGTTC
TCTACCGCCTACTTCCTCTGCCCGTCCGGCGACGCCGTGATCCAGTCC
TACCGCGAGCCGTCTATGTACCGCAAGTTCAGCTTCGGCGAGTACAGG
CAGCAGGTCCAGCAGGACGTGCGCGAGTTCGGCCACAAGATCGGCCTC
TCCCGCTTCCTCATCTGCAAC
[0097] The second transgene expression cassette is a nucleic acid
construct that comprises the Os.GOS2 promoter, operably connected
to gibberellic acid 2-oxidase and operably connected to a Solanum
pennellii histone H1 gene transcriptional terminator. Expression of
this nucleic acid leads to enhanced turfgrass quality in
grasses.
Kentucky Bluegrass Comprising Variant EPSPS or GA2OX and Variant
EPSPS Transgenes
[0098] The invention provides Kentucky bluegrass comprising the
nucleic acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, and/or SEQ ID NO: 13. The Kentucky bluegrass may be transformed
with the two expression cassettes depicted in FIGS. 9 and 10. The
first cassette includes a variant
5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) variant from
Arabidopsis (SEQ ID NO: 9) [FIG. 9], and the second cassette
includes a gibberellic acid 2-oxidase gene from spinach (SEQ ID NO:
10) [FIG. 10]. The sequences described herein may be in the
original transformant and progeny of the transformant that include
the heterologous DNA. The Kentucky bluegrass may be transformed
with the nucleic acid sequence of SEQ ID NO: 12. The Kentucky
bluegrass transformed with the nucleic acid of SEQ ID NO: 12 then
may be transformed with the nucleic acid of SEQ ID NO: 13. The
Kentucky bluegrass may comprise the nucleic acid sequence of SEQ ID
NO: 12. The Kentucky bluegrass may comprise the nucleic acid
sequence of SEQ ID NO: 12 and SEQ ID NO: 13. Plants comprising
these sequences are glyphosate tolerant and possess enhanced
turfgrass qualities (e.g., require less mowing, have a darker green
color, and generate a thicker, fuller stand).
[0099] Kentucky bluegrass comprising the nucleic acid sequences of
SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13
may be produced by growing seeds comprising these nucleic acids.
Kentucky bluegrass comprising the sequences may also be obtained by
propagation of and/or breeding of Kentucky bluegrass comprising the
sequences (e.g., a plant grown from a seed comprising the nucleic
acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
and/or SEQ ID NO: 13). Plant parts, such as bulb, tuber, crown,
stem, tiller, cuttings including un-rooted cuttings, rooted
cuttings, and callus cuttings or callus-generated plantlets; apical
meristems, pollen, ovule, flowers, shoots, stolons, progagules,
seeds, runners, corms, rhizomes, roots, or leaves that comprise the
nucleic acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, and/or SEQ ID NO: 13 are also encompassed herein.
[0100] Progeny comprising the sequences may be produced by a sexual
outcross between a parental Kentucky bluegrass plant comprising the
nucleic acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, and/or SEQ ID NO: 13 (e.g., original transformant, plant grown
from seed comprising the nucleic acid sequences of SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13), and itself or
another parental Kentucky bluegrass plant that lacks the nucleic
acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
and/or SEQ ID NO: 13, respectively. The other Kentucky bluegrass
plant may also lack glyphosate tolerance. The other plant may,
however, comprise other sequences, events, and/or desirable
characteristics.
[0101] In one embodiment, the invention provides for a method of
producing a turfgrass (e.g., Kentucky bluegrass) plant or seed
comprising crossing a Kentucky bluegrass plant comprising the
nucleic acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, and/or SEQ ID NO: 13 with a plant lacking the nucleic acid
sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or
SEQ ID NO: 13, and planting seed obtained from the cross or
selfing, wherein the seed comprises the nucleic acid sequences of
SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13.
The plant lacking the sequences described herein can be a Kentucky
bluegrass (Poa pratensis L.) plant or other plant species that can
breed with Kentucky blue grass (e.g., P. interior, P. arachnifera).
The method may also involve selecting progeny Kentucky bluegrass
plants tolerant to glyphosate. The method may further include
backcrossing (or selfing) the progeny plants with a Kentucky
bluegrass plant comprising the nucleic acid sequences of SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13. The
backcrossing or selfing step may be performed more than once.
Plants and seeds (comprising the nucleic acid sequences of SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13)
obtained from any of these methods are encompassed herein.
[0102] In another embodiment, a glyphosate tolerant, enhanced
turfgrass quality Kentucky bluegrass plant can be bred by first
sexually crossing a parental Kentucky bluegrass plant, or other
sexually compatible Kentucky bluegrass plant, grown from the
transgenic Kentucky bluegrass plant derived from transformation
with the plant expression cassettes contained in the pSCO761
plasmid (FIG. 1) that tolerates application of glyphosate
herbicide, and a second parental Kentucky bluegrass plant that
lacks the tolerance to glyphosate herbicide, thereby producing a
plurality of first progeny plants; and then selecting a first
progeny plant that is tolerant to application of glyphosate
herbicide (i.e, first glyphosate herbicide tolerant plant); and
selfing or crossing the first progeny plant, thereby producing a
plurality of second progeny plants; and then selecting from the
second progeny plants, a glyphosate herbicide tolerant plant (i.e,
second glyphosate herbicide tolerant plant). These steps can
further include the back-crossing or crossing of the first
glyphosate tolerant progeny plant or the second glyphosate tolerant
progeny plant to the second parental Kentucky bluegrass plant or
sexually compatible species or a third parental Kentucky bluegrass
plant or sexually compatible species, thereby producing a Kentucky
bluegrass plant that tolerates the application of glyphosate
herbicide. Plants and seeds (comprising the nucleic acid sequences
of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO:
13) obtained from any of these methods are encompassed herein.
[0103] It is also to be understood that two different transgenic
plants can also be mated to produce offspring that contain two
independently segregating added, exogenous genes. Selfing of
appropriate progeny can produce plants that are homozygous for both
added, exogenous genes. Back-crossing to a parental plant and
out-crossing with a non-transgenic plant are also contemplated, as
is vegetative propagation. Descriptions of other breeding methods
that are commonly used for different traits and crops can be found
in one of several references (e.g., Fehr, in Breeding Methods for
Cultivar Development, Wilcox J. ed., American Society of Agronomy,
Madison Wis. (1987)).
Grasses Comprising EPSPS or GA2OX and variant EPSPS Transgenes
[0104] The invention provides grasses comprising the nucleic acid
sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or
SEQ ID NO: 13. Grasses may be transformed with the two expression
cassettes depicted in FIGS. 9 and 10. The first cassette includes a
variant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene
from Arabidopsis (SEQ ID NO: 9) [FIG. 9], and the second cassette
includes a gibberellic acid 2-oxidase gene from spinach (SEQ ID NO:
10) [FIG. 10]. Grasses comprising these sequences are glyphosate
tolerant and possess enhanced turfgrass qualities (e.g., require
less mowing, have a darker green color, and generate a thicker,
fuller stand). The grass may be transformed with the nucleic acid
sequence of SEQ ID NO: 12. The grass transformed with the nucleic
acid of SEQ ID NO: 12 then may be transformed with the nucleic acid
of SEQ ID NO: 13. The grass may comprise the nucleic acid sequence
of SEQ ID NO: 12. The grass may comprise the nucleic acid sequence
of SEQ ID NO: 12 and SEQ ID NO: 13. The sequences described herein
may be in the original transformant and progeny of the transformant
that include the heterologous DNA.
[0105] Grasses comprising the nucleic acid sequences of SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13 may be
produced by growing seeds comprising these nucleic acids. Grasses
comprising the sequences may also be obtained by propagation of
and/or breeding of grasses comprising the sequences (e.g., a grass
grown from a seed comprising the nucleic acid sequences of SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13). Grass
parts, such as bulb, stem, tiller, cuttings including un-rooted
cuttings, rooted cuttings, and callus cuttings or callus-generated
plantlets; apical meristems, pollen, ovule, flowers, shoots,
stolons, progagules, seeds, runners, rhizomes, roots, or leaves,
that comprise the nucleic acid sequences of SEQ ID NO: 10, SEQ ID
NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13 are also encompassed
herein.
[0106] Progeny comprising the sequences may be produced by a sexual
outcross between a parental grass comprising the nucleic acid
sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or
SEQ ID NO: 13 (e.g., original transformant, grass grown from seed
comprising the nucleic acid sequences of SEQ ID NO: 10, SEQ ID NO:
11, SEQ ID NO: 12, and/or SEQ ID NO: 13), and itself or another
parental plant that lacks the nucleic acid sequences of SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13,
respectively. The other grass may also lack glyphosate tolerance.
The other grass may, however, comprise other sequences, events,
and/or desirable characteristics.
[0107] In one embodiment, the invention provides for a method of
producing a grass (e.g., Kentucky bluegrass) plant or seed
comprising crossing a grass comprising the nucleic acid sequences
of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO:
13 with a grass lacking the nucleic acid sequences of SEQ ID NO:
10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO: 13, and
planting seed obtained from the cross or selfing, wherein the seed
comprises the nucleic acid sequences of SEQ ID NO: 10, SEQ ID NO:
11, SEQ ID NO: 12, and/or SEQ ID NO: 13. The grass lacking the
sequences described herein can be a Kentucky bluegrass (Poa
pratensis L.) plant or other plant species that can breed with
Kentucky blue grass (e.g., P. interior, P. arachnifera). The grass
transformed with the expression cassettes depicted in FIG. 9 may be
Bahia grass, bent grass, Bermuda grass, Blue grama grass, Buffalo
grass, centipedes grasses, fescue grass, optionally needle-leaved
Fescue grass or broad-leaved Fescue grass, Kentucky bluegrass,
rygrass optionally annual ryegrass or perennial reygrass, seashore
paspalum, St. Augustine grass, or Zoysia grass.
[0108] The method may also involve selecting progeny grass tolerant
to glyphosate. The method may further include backcrossing (or
selfing) the progeny grass with a grass plant comprising the
nucleic acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, and/or SEQ ID NO: 13. The backcrossing or selfing step may be
performed more than once. Grass plants and seeds (comprising the
nucleic acid sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, and/or SEQ ID NO: 13) obtained from any of these methods are
encompassed herein.
[0109] In another embodiment, a glyphosate tolerant, enhanced grass
can be bred by first sexually crossing a parental grass, or other
sexually compatible grass, grown from the transgenic grass derived
from transformation with the plant expression cassettes contained
in the pSCO761 plasmid (FIG. 1) that tolerates application of
glyphosate herbicide, and a second parental grass that lacks the
tolerance to glyphosate herbicide, thereby producing a plurality of
first progeny grasses; and then selecting a first progeny grass
that is tolerant to application of glyphosate herbicide (i.e, first
glyphosate herbicide tolerant plant); and selfing or crossing the
first progeny grass, thereby producing a plurality of second
progeny grasses; and then selecting from the second progeny
grasses, a glyphosate herbicide tolerant grass (i.e, second
glyphosate herbicide tolerant grass). These steps can further
include the back-crossing or crossing of the first glyphosate
tolerant progeny grass or the second glyphosate tolerant progeny
grass to the second parental grass or sexually compatible species
or a third parental grass or sexually compatible species, thereby
producing a grass that tolerates the application of glyphosate
herbicide. Grasses and seeds (comprising the nucleic acid sequences
of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or SEQ ID NO:
13) obtained from any of these methods are encompassed herein.
[0110] It is also to be understood that two different transgenic
grasses can also be mated to produce offspring that contain two
independently segregating added, exogenous genes. Selfing of
appropriate progeny can produce grasses that are homozygous for
both added, exogenous genes. Back-crossing to a parental grass and
out-crossing with a non-transgenic grass are also contemplated, as
is vegetative propagation. Descriptions of other breeding methods
that are commonly used for different traits and crops can be found
in one of several references (e.g., Fehr, in Breeding Methods for
Cultivar Development, Wilcox J. ed., American Society of Agronomy,
Madison Wis. (1987)).
Plants Comprising Variant EPSPS or GA2OX Transgene and Variant
EPSPS
[0111] The invention provides to plants comprising the nucleic acid
sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, and/or
SEQ ID NO: 13. Plants may be transformed with the two expression
cassettes depicted in FIGS. 9 and 10. The first cassette includes a
variant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene
from Arabidopsis (SEQ ID NO: 9) [FIG. 9], and the second cassette
includes a gibberellic acid 2-oxidase gene from spinach (SEQ ID NO:
10) [FIG. 10]. The plants may comprise the EPSPS gene comprising
the sequence of SEQ ID NO: 12. Plants comprising the EPSPS sequence
are glyphosate tolerant. The plants may be transformed with the
nucleic acid sequence of SEQ ID NO: 12. The plants transformed with
the nucleic acid of SEQ ID NO: 12 then may be transformed with the
nucleic acid of SEQ ID NO: 13. The plants may comprise the nucleic
acid sequence of SEQ ID NO: 12. The plants may comprise the nucleic
acid sequence of SEQ ID NO: 12 and SEQ ID NO: 13. Plants comprising
the variant GA2OX transgene may exhibit shorter stature, darker
green color, thicker/more density, shorter stolons, better nutrient
use efficiency, better water use efficiency. The sequences
described herein may be in the original transformant and progeny of
the transformant that include the heterologous DNA.
[0112] The invention provides for plants comprising the nucleic
acid molecules comprising SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, or SEQ ID NO: 13 including but not limited to flowers,
vegetables, fruits, herbs, grass, trees, or perennial plant parts
(e.g., bulb, tuber, crown, stem, tiller, cuttings including
un-rooted cuttings, rooted cuttings, and callus cuttings or
callus-generated plantlets; apical meristems, pollen, ovule,
flowers, shoots, stolons, progagules, seeds, runners, corms,
rhizomes, roots, leaves). Plant life that may comprise the nucleic
acid molecules comprising SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, or SEQ ID NO: 13 include but are not limited to plants, plant
cuttings, young plants or seeds from ornamental plants including
but not limited to geranium, petunia, impatiens, verbena, dahlia,
pansy, vinca, ipomoea, lantana, salvia, snapdragon, scaevola,
torenia, lobelia, dipladenia, calibrachoa, asters, agerantum,
phlox, penstemon, gaillardia, zinnia, coleus, osteospermum,
gerbera, begonia, angelonia, dianthus, calendula, campanula,
celosia, portulaca, viola, mums; vegetables such as tomatoes,
peppers, broccoli, cucumber, zucchini, raddish, eggplant, cabbage,
lettuce, spinach, beet, carrots, spinach, squash, radish, beans,
potato, onion; herbs such as basil, rosemary, dill, cilantro,
coriander, thyme, oregano, mint; fruits such as, blueberry,
blackberry, raspberry, watermelon, apple, cherry, pear, orange,
lemon, and pumpkin; turfgrasses such as bluegrass, St.
Augustinegrass, bermudagrass, bentgrass, bahiagrass,
centipedegrass, tall fescue, buffalograss, zoysiagrass, ryegrass,
fine fescue; and agricultural crops such as corn, sugar cane,
wheat, soybean, tobacco, or citrus. Without being limited to
varieties enumerated herein, the varieties of ornamental plants of
the present invention comprising the nucleic acid molecules
comprising SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID
NO: 13 may be varieties of the vinca genus; plants of the cleome
genus; plants of the helianthus annuus genus; plants of the
impatients hawkeri genus; plants of the lantana genus; plants of
the mandevilla hydrida genus; plants of the pelargonium
interspecific genus Calliope; plants of the pentas lanceolata
genus; plants of the petunia pendula genus; plants of the rudbeckia
genus, plants of the viola cornuta genus; plants of the viola
wittrockiana genus; and plants of the zinnia genus.
[0113] The invention provides for plants comprising the nucleic
acid molecules comprising the event Pp009-401, Pp009-415, or
Pp009-469 including but not limited to flowers, vegetables, fruits,
herbs, grass, trees, or perennial plant parts (e.g., bulb, tuber,
crown, stem, tiller, cuttings including un-rooted cuttings, rooted
cuttings, and callus cuttings or callus-generated plantlets; apical
meristems, pollen, ovule, flowers, shoots, stolons, progagules,
seeds, runners, corms, rhizomes, roots, or leaves). Plant life that
may comprise the nucleic acid molecules comprising the event
Pp009-401, Pp009-415, or Pp009-469 include but are not limited to
plants, plant cuttings, young plants or seeds from ornamental
plants including but not limited to geranium, petunia, impatiens,
verbena, dahlia, pansy, vinca, ipomoea, lantana, salvia,
snapdragon, scaevola, torenia, lobelia, dipladenia, calibrachoa,
asters, agerantum, phlox, penstemon, gaillardia, zinnia, coleus,
osteospermum, gerbera, begonia, angelonia, dianthus, calendula,
campanula, celosia, portulaca, viola, mums; vegetables such as
tomatoes, peppers, broccoli, cucumber, zucchini, raddish, eggplant,
cabbage, lettuce, spinach, beet, carrots, spinach, squash, radish,
beans, potato, onion; herbs such as basil, rosemary, dill,
cilantro, coriander, thyme, oregano, mint; fruits such as,
blueberry, blackberry, raspberry, watermelon, apple, cherry, pear,
orange, lemon, and pumpkin; turfgrasses such as bluegrass, St.
Augustinegrass, bermudagrass, bentgrass, bahiagrass,
centipedegrass, tall fescue, buffalograss, zoysiagrass, ryegrass,
fine fescue; and agricultural crops such as corn, sugar cane,
wheat, soybean, tobacco, or citrus. Without being limited to
varieties enumerated herein, the varieties of ornamental plants of
the present invention comprising the nucleic acid molecules
comprising the event Pp009-401, Pp009-415, or Pp009-469 may be
varieties of the vinca genus, such as Cora Cascade Polka Dot, Cora
Cascade peach blush, Cora Cascade apricot, Exp. Cora Cascade
apricot, Exp. Cora Cascade blush splash, Exp. Cora Cascade shell
pink, Exp. Cora Cascade strawberry, Cora Cascade cherry, Exp. Cora
Cascade cherry, Cora Cascade magenta, Cora Cascade lilac, Exp. Cora
Cascade violet, Exp. Nirvana Cascade white, Exp. Nirvana Cascade
polka dot, Nirvana Cascade pink blush, Nirvana Cascade.RTM. pink
splash, Nirvana Cascade.RTM. burgundy, or Nirvana Cascade lavender
eye; plants of the cleome genus, such as Sparkler F1 blush,
Sparkler F1 rose, Sparkler F1 white, Sparkler.RTM. lavender; plants
of the helianthus annuus genus, such as Exp. Yellow Dark Ct
Indeterminant, or Exp. Yellow Dark Ct Indeterminant; plants of the
impatients hawkeri genus Exp. NGI red, Exp. NGI red, Divine scarlet
red, Exp. NGI orange, Divine orange bronze leaf, Exp. NGI salmon,
Exp. New Guinea Impatiens salmon, Exp. New Guinea Impatiens salmon,
Exp. NGI bicolor orange, Exp. NGI white, Exp. NGI white, Exp. New
Guinea Impatiens pink, Divine pink, Exp. NGI violet, Divine violet,
Exp. NGI lavender, or Divine lavender; plants of the lantana genus,
such as Exp. Bandana white, Bandana.RTM. primrose, Bandana.RTM.
peach, Bandana.RTM. rose upgrade, Exp. Bandana red, Exp. Bandana
cherry, Bandana.RTM. orange sunrise, Bandana.RTM. trailing gold, or
Exp. Bandana trailing red; plants of the mandevilla hydrida genus
Exp. R10 dark pink, R10 pink, Exp. R10 pink, R10 deep red, Exp. R10
red, or Exp. R10 white; plants of the pelargonium interspecific
genus Calliope exp. It pk, Calliope exp. Coral (bicolor), Exp.
Calliope hot rose, Exp. Calliope rose splash, Exp. Calliope
burgundy, Calliope exp. lay, Exp. Calliope lavender rose, Calliope
exp. ro, Calliope exp. Scarlet, Calliope Scarlet Fire "Cope
Scarfir", Exp. Calliope hot scarlet, Calliope Dark Red"Ameri
Trared", Exp. Calliope burgundy, Exp. Calliope violet, Exp.
Calliope burgundy, Calliope exp. ro w/Eye, Exp. Caliente.RTM.
lavender rose, Caliente Pink "Cante Pinka", Caliente exp. Dp.Pk,
Exp. Caliente.RTM. salmon, Caliente Coral "Cante Coras", Caliente
Orange "Cante Oran", Caliente exp. Vio, Caliente exp. Vio, Caliente
exp. ro sp, Exp. Caliente.RTM. rose coral, or Caliente exp. pkbl;
plants of the pentas lanceolata genus, such as Exp. Trailing white,
Exp. Trailing white, Exp. Trailing white, Exp. Trailing pink
bicolor, Exp. Trailing pink bicolor, Exp. Trailing deep pink, Exp.
Trailing rose, Exp. Trailing rose, Exp. Trailing cherry, or Exp.
Trailing red; plants of the petunia pendula genus, such as Plush
white, Ramblin' white, Exp. Ramblin yellow, Plush red, Ramblin'
red, Plush blue, or Ramblin' nu blue; plants of the rudbeckia
genus, such as Tiger eye gold F1; plants of the tagetes erecta
genus, such as Perfection.RTM. yellow, Perfection.RTM. F1 gold,
Perfection.RTM. F1 orange, Exp. Perfection Vanilla White, Asian Cut
flower, Gold, Asian Cut flower, or Orange, plants of the viola
cornuta genus, such as Endurio yellow with violet wing, or Exp.
Endurio yellow with violet wing; plants of the viola wittrockiana
genus, such as Exp Colossus Yellow/Blotch VI042, Mammoth
Blue-ti-ful, Exp. WonderFall White, Exp. WonderFall Yellow, Exp.
WonderFall Yellow Blotch, WonderdFall Yellow with Red Wing
trailing, Exp. WonderFall Blue Blotch, WonderFall Blue Picotee
Shades, Exp. WonderFall Purple; and plants of the zinnia genus,
such as ZOWIE!.RTM. YELLOW FLAME, Uproar.RTM. Rose, Uproar.TM.
White 1695-1-T1, Uproar.TM. Deep Yellow 1695-17-T1, Uproar.TM.
Orange 1695-8-T1, Uproar.TM. Scarlet 1695-10-T2.
[0114] The invention provides for the transformation of plants with
any one of the nucleic acid sequence of SEQ ID NO: 10, 11, 12, or
13. The transformed plant comprising the nucleic acid sequence of
SEQ ID NO: 9, 10, 11, 12, or 13 may be a grass, grain crop, crop,
ornamental flower, legume, fruit, vegetable, herb, perennial plant,
or tree.
[0115] The transformed plant comprising the nucleic acid sequence
of SEQ ID NO: 9, 10, 11, 12, or 13 may be a root vegetable or vine
vegetable.
[0116] The transformed grass comprising the nucleic acid sequence
of SEQ ID NO: 9, 10, 11, 12, or 13 may be Bahia grass, bent grass,
Bermuda grass, Blue grama grass, Buffalo grass, centipedes grasses,
fescue grass, optionally needle-leaved Fescue grass, tall Fescue,
or broad-leaved Fescue grass, Kentucky bluegrass, rygrass
optionally annual ryegrass or perennial ryegrass, seashore
paspalum, St. Augustine grass, or Zoysia grass.
[0117] The transformed grain crop comprising the nucleic acid
sequence of SEQ ID NO: 9, 10, 11, 12, or 13 may be is barley,
sorghum, millet, rice, canola, corn, oats, wheat, barley, or
hops.
[0118] The transformed plant comprising the nucleic acid sequence
of SEQ ID NO: 9, 10, 11, 12, or 13 may be soybean.
[0119] The transformed ornamental flower comprising the nucleic
acid sequence of SEQ ID NO: 10, 11, 12, or 13 may be an annual or
perennial ornamental flower. The ornamental flower may be a
geranium, petunia, or daffodil.
[0120] The transformed legume comprising the nucleic acid sequence
of SEQ ID NO: 10, 11, 12, or 13 may be alfalfa, clover, peas,
beans, lentils, lupins, mesquite, carob, soybeans, peanuts, or
tamarind.
[0121] The transformed fruit comprising the nucleic acid sequence
of SEQ ID NO: 10, 11, 12, or 13 may be grape, raspberry, blueberry,
strawberry, blackberry, watermelon, apple, cherry, pear, orange,
lemon, or pumpkin.
[0122] The transformed vegetable comprising the nucleic acid
sequence of SEQ ID NO: 10, 11, 12, or 13 may be asparagus, Brussels
sprouts, cabbage, carrots, celery, chard, collard greens, endive,
tomatoes, beans, peas, broccoli, cauliflower, bell pepper,
eggplant, kale, lettuce, okra, onion, radish, spinach, peppers,
broccoli, cucumber, zucchini, eggplant, beet, squash, beans,
potato, or onion.
[0123] The transformed herb comprising the nucleic acid sequence of
SEQ ID NO: 10, 11, 12, or 13 may be anise, basil, caraway,
cilantro, chamomile, dill, fennel, lavender, lemon grass, marjoram,
oregano, parsley, rosemary, sage, thyme, or mint.
[0124] The transformed root vegetable comprising the nucleic acid
sequence of SEQ ID NO: 10, 11, 12, or 13 may be turnip, potato,
carrot, or beet.
[0125] The transformed vine vegetable comprising the nucleic acid
sequence of SEQ ID NO: 10, 11, 12, or 13 may be cucumber, pumpkins,
squash, melon, or zucchini.
[0126] The transformed agricultural crop comprising the nucleic
acid sequence of SEQ ID NO: 10, 11, 12, or 13 may be cotton, corn,
sugar cane, wheat, soybean, tobacco, or citrus.
[0127] The transformed ornamental plant comprising the nucleic acid
molecules comprising SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
or SEQ ID NO: 13 include but not limited to geranium, petunia,
impatiens, verbena, dahlia, pansy, vinca, ipomoea, lantana, salvia,
snapdragon, scaevola, torenia, lobelia, dipladenia, calibrachoa,
asters, agerantum, phlox, penstemon, gaillardia, zinnia, coleus,
osteospermum, gerbera, begonia, angelonia, dianthus, calendula,
campanula, celosia, portulaca, viola, or mums.
[0128] The varieties of ornamental plants of the present invention
comprising the nucleic acid molecules comprising SEQ ID NO: 10, SEQ
ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13 may be varieties of the
vinca genus; plants of the cleome genus; plants of the helianthus
annuus genus; plants of the lantana genus; plants of the
pelargonium interspecific genus Calliope; plants of the pentas
lanceolata genus; plants of the rudbeckia genus, plants of the
viola cornuta genus; plants of the viola wittrockiana genus; and
plants of the zinnia genus.
[0129] The invention provides plants comprising the nucleic acid
sequence of SEQ ID NO: 12 and plants, cells, plant parts, and seeds
comprising this sequence. Plants comprising these sequences are
glyphosate tolerant. The sequences described herein may be in the
original transformant and progeny of the transformant that include
the heterologous DNA. The plants transformed with the nucleic acid
sequence of SEQ ID NO: 12 may be a grass, grain crop, crop,
ornamental flower, legume, fruit bush, vegetable, root vegetable,
herb, or a vine vegetable.
[0130] Plants comprising nucleic acid sequence of SEQ ID NO: 12 may
be produced by growing seeds comprising these nucleic acids. Plants
comprising the sequences may also be obtained by propagation of
and/or breeding of plants comprising the sequences (e.g., a plant
grown from a seed comprising nucleic acid sequence of SEQ ID NO:
12). Plant parts, such as bulb, tuber, crown, stem, tiller,
cuttings including un-rooted cuttings, rooted cuttings, and callus
cuttings or callus-generated plantlets; apical meristems, pollen,
ovule, flowers, shoots, stolons, progagules, seeds, runners, corms,
rhizomes, roots, or leaves, that comprise nucleic acid sequence of
SEQ ID NO: 12 are also encompassed herein.
[0131] Progeny comprising the sequences may be produced by a sexual
outcross between a parental plant comprising nucleic acid sequence
of SEQ ID NO: 12 (e.g., original transformant, plant grown from
seed comprising nucleic acid sequence of SEQ ID NO: 12), and itself
or another parental plant that lacks nucleic acid sequence of SEQ
ID NO: 12, respectively. The other plant may also lack glyphosate
tolerance. The other plant may, however, comprise other events
and/or desirable characteristics.
[0132] In one embodiment, the invention provides for a method of
producing a plant or seed comprising crossing a plant comprising
the nucleic acid sequence of SEQ ID NO: 12 with a plant lacking the
nucleic acid sequences of SEQ ID NO: 12, and planting seed obtained
from the cross or selfing, wherein the seed comprises the nucleic
acid sequence of SEQ ID NO: 12. The plant lacking the sequences can
be a plant species. The method may also involve selecting progeny
plants tolerant to glyphosate. The method may further include
backcrossing (or selfing) the progeny plants with a plant
comprising the nucleic acid sequence of SEQ ID NO: 12. The
backcrossing or selfing step may be performed more than once.
Plants and seeds (comprising the nucleic acid sequence of SEQ ID
NO: 12) obtained from any of these methods are encompassed
herein.
[0133] In another embodiment, a glyphosate tolerant, plant can be
bred by first sexually crossing a parental plant, or other sexually
compatible plant, grown from the transgenic plant derived from
transformation with the plant expression cassettes contained in the
pSCO761 plasmid (FIG. 1) that tolerates application of glyphosate
herbicide, and a second parental plant that lacks the tolerance to
glyphosate herbicide, thereby producing a plurality of first
progeny plants; and then selecting a first progeny plant that is
tolerant to application of glyphosate herbicide (i.e, first
glyphosate herbicide tolerant plant); and selfing or crossing the
first progeny plant, thereby producing a plurality of second
progeny plants; and then selecting from the second progeny plants,
a glyphosate herbicide tolerant plant (i.e, second glyphosate
herbicide tolerant plant). These steps can further include the
back-crossing or crossing of the first glyphosate tolerant progeny
plant or the second glyphosate tolerant progeny plant to the second
parental plant or sexually compatible species or a third parental
plant or sexually compatible species, thereby producing a plant
that tolerates the application of glyphosate herbicide. Plants and
seeds (comprising the nucleic acid sequences of SEQ ID NO: 12)
obtained from any of these methods are encompassed herein.
[0134] It is also to be understood that two different transgenic
plants can also be mated to produce offspring that contain two
independently segregating added, exogenous genes. Selfing of
appropriate progeny can produce plants that are homozygous for both
added, exogenous genes. Back-crossing to a parental plant and
out-crossing with a non-transgenic plant are also contemplated, as
is vegetative propagation. Descriptions of other breeding methods
that are commonly used for different traits and crops can be found
in one of several references (e.g., Fehr, in Breeding Methods for
Cultivar Development, Wilcox J. ed., American Society of Agronomy,
Madison Wis. (1987)).
Plant Cells Comprising Elite Events
[0135] DNA molecules comprising event Pp009-401, event Pp009-415,
or event Pp009-469 are provided herein. In a particular embodiment,
the invention provides for DNA molecules comprising SEQ ID NO: 1,
SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO:
6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID
NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or complements thereof, or
combinations thereof. Plants, plant cells, plant parts, and seeds
comprising this DNA is also encompassed herein.
[0136] Nucleic acid molecules comprising the junction regions for
event Pp009-401, event Pp009-415, or event Pp009-469 are also
provided herein. In a particular embodiment, the invention provides
for nucleic acid molecules comprising SEQ ID NO: 2, SEQ ID NO: 4,
SEQ ID NO: 6, or complements thereof. Plants, plant cells, plant
parts, and seeds comprising these nucleic acid molecules are also
encompassed herein.
[0137] Nucleic acid molecules comprising the nucleotide sequences
of SEQ ID NO: 10, 11, 12, and 13 are provided herein. In one
embodiment, the invention provides for nucleic acid molecules
comprising SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO:
13, or complements thereof. Plants, plant cells, plant parts, and
seeds comprising these nucleic acid molecules are also encompassed
herein.
Primers and Probes
[0138] Primers and probes useful in the detection of event
Pp009-401, event Pp009-415, and/or event Pp009-469, and methods of
detecting these events are provided herein.
[0139] Primers and probes useful in the detection of nucleic acid
molecules comprising SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
SEQ ID NO: 13, and methods of detecting these events are provided
herein.
[0140] A "primer" is a nucleic acid capable of priming the
synthesis of a nascent nucleic acid in a template-dependent
process, such as polymerase chain reaction (PCR). A primer anneals
to a complementary target DNA strand by nucleic acid hybridization
to form a hybrid between the primer and the target DNA strand, and
is then extended along the target DNA strand by a polymerase, e.g.,
a DNA polymerase. Typically, primers are oligonucleotides from 10
to 30 nucleotides (e.g., 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides), but longer
sequences may be employed. A "probe" can be used as a primer, but
is designed to bind to target DNA or RNA and need not be used in an
amplification reaction. Probes, like primers, may range from 10 to
30 nucleotides (e.g., 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, or 29 nucleotides), but longer
sequences may be employed.
[0141] Primers and probes are selected to be of sufficient length
to specifically hybridize to a target sequence under stringent
conditions. Preferably, the probes and primers have complete
sequence similarity or complementarity with the target sequence,
although primers and probes differing from the target sequence
(e.g., by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches) that retain
the ability to hybridize to target sequences are encompassed
herein.
[0142] Regarding the amplification of a target nucleic acid
sequence (e.g. by PCR) using a particular amplification primer
pair, "stringent conditions" are conditions that permit the primer
pair to hybridize only to the target nucleic acid sequence to which
a primer having the corresponding wild-type sequence (or its
complement) would bind and preferably to produce a unique
amplification product, the amplicon, in a DNA thermal amplification
reaction. Specificity may be determined by the presence of positive
and negative controls. For example, an analysis for event
Pp009-401, Pp009-415 or Pp009-469 plant tissue sample may include a
positive tissue control from event Pp009-401, Pp009-415 or
Pp009-469, respectively, a negative control from a Kentucky
bluegrass plant that is not event Pp009-401, Pp009-415 or
Pp009-469, respectively, and a negative control that contains no
Kentucky bluegrass DNA. In another example, when performing a PCR
to identify the presence of event Pp009-401, event Pp009-415, or
event Pp009-469, in unknown samples, a control is included of a set
of primers with which a fragment within a "housekeeping gene" of
the plant species of the event can be amplified. Housekeeping genes
are genes expressed in most cell types and that are concerned with
basic metabolic activities common to all cells. Preferably, the
fragment amplified from the housekeeping gene is a fragment larger
than the amplified integration fragment. Depending on the samples
to be analyzed, other controls can be included.
[0143] Regarding the amplification of a target nucleic acid
sequence (e.g. by PCR) using a particular amplification primer
pair, "stringent conditions" are conditions that permit the primer
pair to hybridize only to the target nucleic acid sequence to which
a primer having the corresponding wild-type sequence (or its
complement) would bind and preferably to produce a unique
amplification product, the amplicon, in a DNA thermal amplification
reaction. Specificity may be determined by the presence of positive
and negative controls. For example, an analysis for plant tissue
sample comprising nucleic acid molecules comprising SEQ ID NO: 10,
SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13 may include a
positive tissue control from nucleic acid molecules comprising SEQ
ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13,
respectively, a negative control from a plant that is does not
comprise nucleic acid molecules comprising SEQ ID NO: 10, SEQ ID
NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, respectively, and a negative
control that contains none of the plant DNA. In another example,
when performing a PCR to identify the presence of nucleic acid
molecules comprising SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12,
SEQ ID NO: 13, in unknown samples, a control is included of a set
of primers with which a fragment within a "housekeeping gene" of
the plant species of the event can be amplified. Housekeeping genes
are genes expressed in most cell types and that are concerned with
basic metabolic activities common to all cells. Preferably, the
fragment amplified from the housekeeping gene is a fragment larger
than the amplified integration fragment. Depending on the samples
to be analyzed, other controls can be included.
[0144] Regarding the hybridization of a target sequence and a
probe, the probe will specifically hybridize to the complement of
the target nucleic acid sequence under standard stringency
conditions. Standard stringency conditions as used herein refers to
the conditions for hybridization described herein or to the
conventional hybridizing conditions as described by Sambrook, et
al. (2001) Molecular Cloning: A Laboratory Manual, Third Edition,
Cold Spring Harbor Laboratory Press, NY, which for instance can
comprise the following steps: (1) immobilizing plant genomic DNA
fragments on a filter, (2) prehybridizing the filter for 1 to 2
hours at 42.degree. C. in 50% formamide, 5.times.SSPE,
2.times.Denhardt's reagent and 0.1% SDS, or for 1 to 2 hours at
68.degree. C. in 6.times.SSC, 2.times.Denhardt's reagent and 0.1%
SDS, (3) adding the hybridization probe which has been labeled, (4)
incubating for 16 to 24 hours, (5) washing the filter for 20
minutes at room temperature in 1.times.SSC, 0.1% SDS, (6) washing
the filter three times for 20 minutes each at 68.degree. C. in
0.2.times.SSC, 0.1% SDS, and (7) exposing the filter for 24 to 48
hours to X-ray film at -70.degree. C. with an intensifying
screen.
[0145] Contacting nucleic acid of a biological sample, with the
probe, under conditions which allow hybridization of the probe with
its corresponding fragment in the nucleic acid, results in the
formation of a nucleic acid/probe hybrid. The formation of this
hybrid can be detected (e.g. labeling of the nucleic acid or
probe), whereby the formation of this hybrid indicates the presence
of event Pp009-401, Pp009-415 or Pp009-469. The formation of this
hybrid can be detected (e.g. labeling of the nucleic acid or
probe), whereby the formation of this hybrid indicates the presence
of nucleic acid molecules comprising SEQ ID NO: 10, SEQ ID NO: 11,
SEQ ID NO: 12, SEQ ID NO: 13. Such identification methods based on
hybridization with a specific probe (either on a solid phase
carrier or in solution) have been described in the art. The target
nucleic acid target or the probe may be labeled with a conventional
detectable label or reporter molecule, e.g., a florescent molecule,
a radioactive isotope, ligand, chemifluorescent, chemiluminescent
agent, or enzyme.
[0146] Techniques for the manipulation of nucleic acids, such as,
for example, for generating mutations in sequences, subcloning,
labeling probes, sequencing, hybridization are well described in
the scientific and patent literature. See, e.g., Sambrook, et al.
(2001) (Eds.) Molecular Cloning: A Laboratory Manual (3.sup.rd Ed.)
Cold Spring Harbor Laboratory; Ausubel, et al. (2011) Ed., Current
Protocols in Molecular Biology, John Wiley & Sons, Inc., New
York; Tijssen (1993) [Ed.] Laboratory Techniques in Biochemistry
and Molecular Biology: Hybridization With Nucleic Acid Probes, Part
I, Theory and Nucleic Acid Preparation, Elsevier, NY.
[0147] The invention provides for a primer pair for detecting the
transgene/junction regions of event Pp009-401, event Pp009-415, or
event Pp009-469. These primer pairs are used to produce an
amplicons diagnostic for the events. In one aspect, any primer pair
derived from SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 that, in a
DNA amplification reaction produces an amplicon diagnostic for
Kentucky bluegrass event Pp009-401, Pp009-415 and Pp009-469,
respectively, is encompassed herein. In another aspect, any
isolated DNA polynucleotide primer or primer pair comprising at
least 11 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, or 29) contiguous nucleotides of SEQ ID NO: 7, SEQ
ID NO: 8 and SEQ ID NO: 9, or its complement, useful in a DNA
amplification method to produce an amplicon diagnostic for Kentucky
bluegrass event Pp009-401, Pp009-415 and Pp009-469, respectively,
is an aspect of the invention. In a particular aspect, Pp009-401,
Pp009-415 and Pp009-469 event primer pairs that will produce a
diagnostic amplicon for Kentucky bluegrass Pp009-401, Pp009-415 and
Pp009-469, respectively, include, but are not limited to, a primer
pair comprising Pp009-401 event primer 1 (SEQ ID NO: 1) and
Pp009-401 event primer 2 (SEQ ID NO: 2); Pp009-415 event primer 1
(SEQ ID NO: 3) and Pp009-415 event primer 2 (SEQ ID NO: 4); and
Pp009-469 event primer 1 (SEQ ID NO: 5) and Pp009-469 event primer
2 (SEQ ID NO: 6). In another aspect, amplicons diagnostic for
Pp009-401, Pp009-415 and Pp009-469 comprise at least one junction
sequence comprising SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9,
respectively.
[0148] The invention also provides for probes specific for the
transgene/junction regions of event Pp009-401, event Pp009-415, or
event Pp009-469. The probes are DNA molecules that hybridize
specifically to a region within the 5' flanking region of the event
and a region of the foreign/transgene DNA contiguous therewith.
Exemplary probes include, but are not limited to DNA molecules
comprising SEQ ID NO: 2 (event Pp009-401), SEQ ID NO: 4 (event
Pp009-415), and SEQ ID NO: 6 (event Pp009-469). In another aspect,
the probe comprises a sequence of between 50 bp and 500 bp,
preferably of 100 to 350 bp which is at least 80%, 85%, 90%, 95%,
97%, 98%, 99%, or 100% identical to an event junction nucleotide
sequence (e.g., nucleic acid molecule comprising SEQ ID NOs: 2, 4,
6, 7, 8, 9, or the complement thereof). In a particular embodiment,
the probe comprises or specifically hybridizes to one or more of
the nucleic acid molecules set forth in SEQ ID NOs: 2, 4, 6, 7, 8
or 9, complements thereof, or fragments thereof, under standard
stringency conditions.
[0149] In another aspect, the probe comprises a sequence of between
50 bp and 500 bp, preferably of 100 to 350 bp which is at least
80%, 85%, 90%, 91% 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%
identical to the nucleotide sequence comprising SEQ ID NO: 10, SEQ
ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13. In a particular
embodiment, the probe comprises or specifically hybridizes to one
or more of the nucleic acid molecules comprising SEQ ID NO: 10, SEQ
ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, complements thereof, or
fragments thereof, under standard stringency conditions.
[0150] The present invention also encompasses variants of the
nucleic acids described herein. The variant nucleic acids may
encode amino acid substitutions that may be regarded as
"conservative" where an amino acid is replaced with a different
amino acid with broadly similar properties. Non-conservative
substitutions are where amino acids are replaced with amino acids
of a different type.
[0151] As is well known to those skilled in the art, altering the
primary structure of a peptide by a conservative substitution may
not significantly alter the activity of that peptide because the
side-chain of the amino acid which is inserted into the sequence
may be able to form similar bonds and contacts as the side chain of
the amino acid which has been substituted out. This is so even when
the substitution is in a region which is critical in determining
the peptide's conformation. This substitution may be accomplished
by changing the codon in the underlying nucleic acid.
[0152] Non-conservative substitutions are possible provided that
these do not interrupt with the function of the encoded EPSPS
enzyme or GA2OX protein. Broadly speaking, fewer non-conservative
substitutions will be possible without altering the biological
activity of the polypeptides.
[0153] Determination of the effect of any substitution (and,
indeed, of any amino acid deletion or insertion) is wholly within
the routine capabilities of the skilled person, who can readily
determine whether a variant polypeptide retains the function of the
encoded EPSPS enzyme or GA2OX protein. For example, when
determining whether a variant of the polypeptide falls within the
scope of the invention, the skilled person will determine whether
the variant retains the activity of the encoded EPSPS enzyme or
GA2OX protein activity at least 90%, 95%, 96%, 97%, 98%, 99% or
100% of the non-variant polypeptide. Activity may be measured by,
for example, any standard measure such as the number of bases of a
template sequence which can be replicated in a given time
period.
[0154] Using the standard genetic code, further nucleic acids
encoding the polypeptides may readily be conceived and manufactured
by the skilled person. The nucleic acid may be DNA or RNA and,
where it is a DNA molecule, it may for example comprise a cDNA or
genomic DNA.
[0155] The invention encompasses variant nucleic acids encoding the
polypeptide of the invention. The term "variant" in relation to a
nucleic acid sequences means any substitution of, variation of,
modification of, replacement of deletion of, or addition of one or
more nucleic acid(s) from or to a polynucleotide sequence providing
the resultant polypeptide sequence encoded by the polynucleotide
exhibits at least the same properties as the polypeptide encoded by
the basic sequence. The term therefore includes allelic variants
and also includes a polynucleotide which substantially hybridizes
to the polynucleotide sequence of the present invention. Such
hybridization may occur at or between low and high stringency
conditions. In general terms, low stringency conditions can be
defined a hybridization in which the washing step takes place in a
0.330-0.825 M NaCl buffer solution at a temperature of about
40-48.degree. C. below the calculated or actual melting temperature
of the probe sequence (for example, about ambient laboratory
temperature to about 55.degree. C.), while high stringency
conditions involve a wash in a 0.0165-0.0330 M NaCl buffer solution
at a temperature of about 5-10.degree. C. below the calculated or
actual melting temperature of the probe (for example, about
65.degree. C.). The buffer solution may, for example, be SSC buffer
(0.15M NaCl and 0.015M tri-sodium citrate), with the low stringency
wash taking place in 3.times.SSC buffer and the high stringency
wash taking place in 0.1.times.SSC buffer. Steps involved in
hybridization of nucleic acid sequences have been described for
example in Sambrook, et al. (2001) (Eds.) Molecular Cloning: A
Laboratory Manual [3.sup.rd Ed.] Cold Spring Harbor Laboratory, and
by Hayrnes, et al. (1985) in Nucleic Acid Hybridization, a
Practical Approach (IRL Press, DC).
[0156] Variant nucleic acids of the invention may be
codon-optimized for expression in a particular host cell.
Techniques for the manipulation of nucleic acids, such as, for
example, for generating mutations in sequences, subcloning,
labeling probes, sequencing, hybridization are well described in
the scientific and patent literature. See, e.g., Sambrook, et al.
(2001) (Eds.) Molecular Cloning: A Laboratory Manual (3.sup.rd Ed.)
Cold Spring Harbor Laboratory; Ausubel, et al. (2011) Ed., Current
Protocols in Molecular Biology, John Wiley & Sons, Inc., New
York; Tijssen (1993) [Ed.] Laboratory Techniques in Biochemistry
and Molecular Biology: Hybridization With Nucleic Acid Probes, Part
I, Theory and Nucleic Acid Preparation, Elsevier, NY.
[0157] Sequence identity between nucleotide and amino acid
sequences can be determined by comparing an alignment of the
sequences. When an equivalent position in the compared sequences is
occupied by the same amino acid or base, then the molecules are
identical at that position. Scoring an alignment as a percentage of
identity is a function of the number of identical amino acids or
bases at positions shared by the compared sequences. When comparing
sequences, optimal alignments may require gaps to be introduced
into one or more of the sequences to take into consideration
possible insertions and deletions in the sequences. Sequence
comparison methods may employ gap penalties so that, for the same
number of identical molecules in sequences being compared, a
sequence alignment with as few gaps as possible, reflecting higher
relatedness between the two compared sequences, will achieve a
higher score than one with many gaps. Calculation of maximum
percent identity involves the production of an optimal alignment,
taking into consideration gap penalties.
[0158] In addition to the BLASTP computer program mentioned above,
further suitable computer programs for carrying out sequence
comparisons are widely available in the commercial and public
sector. Examples include the MatGat program (Campanella, et al.,
2003, BMC Bioinformatics 4: 29), the Gap program (Needleman &
Wunsch, 1970, J. Mol. Biol. 48: 443-453) and the FASTA program
(Altschul et al., 1990, J. Mol. Biol. 215: 403-410). MatGAT v2.03
is freely available and has also been submitted for public
distribution to the Indiana University Biology Archive (IUBIO
Archive). Gap and FASTA are available as part of the Accelrys GCG
Package Version 11.1 (Accelrys, Cambridge, UK), formerly known as
the GCG Wisconsin Package. The FASTA program can alternatively be
accessed publicly from the European Bioinformatics Institute and
the University of Virginia. FASTA may be used to search a sequence
database with a given sequence or to compare two given sequences.
Typically, default parameters set by the computer programs should
be used when comparing sequences. The default parameters may change
depending on the type and length of sequences being compared. A
sequence comparison using the MatGAT program may use default
parameters of Scoring Matrix=Blosum50, First Gap=16, Extending
Gap=4 for DNA, and Scoring Matrix=Blosum50, First Gap=12, Extending
Gap=2 for protein. A comparison using the FASTA program may use
default parameters of Ktup=2, Scoring matrix=Blosum50, gap=-10 and
ext=-2. Sequence identity can be determined using the MatGAT
program v2.03 using default parameters as noted above.
[0159] Primers and probes based on the flanking genomic DNA and
insert sequences disclosed herein can be used to confirm (and, if
necessary, to correct) the disclosed DNA sequences by conventional
methods, e.g., by re-cloning and sequencing such DNA molecules
isolated from Kentucky bluegrass Pp009-401, Pp009-415, and
Pp009-469, the seed of which is deposited with the ATCC having
accession number PTA-120354, PTA-120353, and PTA-120355,
respectively.
[0160] As used herein, "amplified DNA" or "amplicon" refers to the
product of polynucleic acid amplification of a target polynucleic
acid molecule that is part of a polynucleic acid template. For
example, to determine whether a Kentucky bluegrass plant resulting
from a sexual cross contains transgenic event genomic DNA from the
Kentucky bluegrass event Pp009-401, Pp009-415 or Pp009-469, DNA
extracted from a Kentucky bluegrass plant tissue sample may be
subjected to polynucleic acid amplification method using a primer
pair described herein (e.g., primer pair that includes a primer
derived from flanking DNA in the genome of the Pp009-401, Pp009-415
or Pp009-469 plant adjacent to the insertion site of the inserted
heterologous DNA (transgenic DNA), and a second primer derived from
the inserted heterologous DNA to produce an amplicon diagnostic for
the presence of the Pp009-401, Pp009-415 or Pp009-469 event DNA).
The amplicon is of a length and has a polynucleotide sequence that
is also diagnostic for the event. The amplicon may range in length
from the combined length of the primer pairs plus one nucleotide
base pair, preferably plus about fifty nucleotide base pairs, more
preferably plus about two hundred-fifty nucleotide base pairs, and
even more preferably plus about four hundred-fifty nucleotide base
pairs or more. In one aspect, the amplicon diagnostic for Pp009-401
is between 500-1000 base pairs (e.g., 720 base pairs). In another
aspect, the amplicon diagnostic for Pp009-415 is between 500-1000
base pairs (e.g., 719 base pairs). In another aspect, the amplicon
diagnostic for Pp009-469 is between 300-600 base pairs (e.g., 410
base pairs). The use of the term "amplicon" specifically excludes
primer dimers that may be formed in the DNA thermal amplification
reaction.
[0161] A member of a primer pair derived from the plant genomic
sequence of Pp009-401, Pp009-415 and Pp009-469 may be located a
distance from the inserted DNA molecule, this distance can range
from one nucleotide base pair up to about twenty thousand
nucleotide base pairs. Alternatively, a primer pair can be derived
from flanking genomic sequence on both sides of the inserted
heterologous DNA so as to produce an amplicon that includes the
entire insert polynucleotide sequence (e.g., a primer pair that
amplifies an inserted DNA molecule comprising the MluI expression
cassette of pSCO761 DNA fragment that was transformed into Kentucky
bluegrass, about 7,142 nucleotide base pairs, FIG. 2-4, for
Pp009-401, Pp009-415 and Pp009-469, respectively).
[0162] Polynucleic acid amplification can be accomplished by any of
the various polynucleic acid amplification methods known in the
art, including the polymerase chain reaction (PCR) and are
described, for example, in U.S. Pat. Nos. 4,683,195 and 4,683,202
and in PCR Protocols: A Guide to Methods and Applications, ed.
Innis, et al. Academic Press, San Diego, 1990. PCR amplification
methods have been developed to amplify up to 22 kb of genomic DNA
and up to 42 kb of bacteriophage DNA (Cheng, et al. Proc. Natl.
Acad. Sci. USA 91:5695-5699, 1994). These methods as well as other
methods known in the art of DNA amplification may be used in the
practice of the invention. Exemplary amplification conditions are
illustrated in Table 1. It is understood that these conditions may
be modified by those skilled in the art to produce an amplicon
diagnostic for event Pp009-401, Pp009-415 or Pp009-469. Further, it
is understood that these conditions may be modified by those
skilled in the art to produce an amplicon diagnostic for the
nucleic acid sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO:
12, or SEQ ID NO: 13.
[0163] The sequence of the heterologous DNA insert or flanking
genomic DNA from Kentucky bluegrass event Pp009-401, Pp009-415 and
Pp009-469 can be verified by amplifying such DNA molecules from the
event using primers derived from the sequences provided herein
followed by standard DNA sequencing of the PCR amplicon or of the
cloned DNA. DNA detection kits that are based on DNA amplification
methods contain DNA primers that specifically amplify a diagnostic
amplicon. The kit may provide an agarose gel based detection method
or any number of methods of detecting the amplicon known in the
art.
[0164] The amplicon produced by these methods may be detected by a
plurality of techniques. For example, Genetic Bit Analysis
(Nikiforov, et al. Nucleic Acid Res. 22:4167-4175, 1994) is a
method where a DNA oligonucleotide is designed that overlaps both
the adjacent flanking genomic DNA sequence and the inserted DNA
sequence. The oligonucleotide is immobilized in wells of a
microtiter plate. Following PCR of the region of interest (using
one primer in the inserted sequence and one in the adjacent
flanking genomic sequence), a single-stranded PCR product can be
hybridized to the immobilized oligonucleotide and serve as a
template for a single base extension reaction using a DNA
polymerase and labeled dideoxynucleotide triphosphate (ddNTPs)
specific for the expected next base. Readout may be fluorescent or
ELISA-based. A signal indicates presence of the insert/flanking
sequence due to successful amplification, hybridization, and single
base extension.
[0165] In pyrosequencing (Winge, Innov. Pharma. Tech. 00:18-24,
2000), an oligonucleotide is designed that overlaps the adjacent
genomic DNA and insert DNA junction. The oligonucleotide is
hybridized to single-stranded PCR product from the region of
interest (one primer in the inserted sequence and one in the
flanking genomic sequence) and incubated in the presence of a DNA
polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5'
phosphosulfate and luciferin. Deoxyribonucleotides (DNTPs) are
added individually and the incorporation results in a light signal
that is measured. A light signal indicates the presence of the
transgene insert/flanking sequence due to successful amplification,
hybridization, and single or multi-base extension.
[0166] Fluorescence Polarization (Chen, et al. Genome Res.
9:492-498, 1999) is a method that can be used to detect the
amplicon of the present invention. Using this method an
oligonucleotide is designed that overlaps the genomic flanking and
inserted DNA junction. The oligonucleotide is hybridized to
single-stranded PCR product from the region of interest (one primer
in the inserted DNA and one in the flanking genomic DNA sequence)
and incubated in the presence of a DNA polymerase and a
fluorescent-labeled ddNTP. Single base extension results in
incorporation of the ddNTP. Incorporation can be measured as a
change in polarization using a fluorometer. A change in
polarization indicates the presence of the transgene
insert/flanking sequence due to successful amplification,
hybridization, and single base extension.
[0167] Taqman.RTM. (Applied Biosystems, Foster City, Calif.) is
another method of detecting and quantifying the presence of a DNA
sequence. Briefly, a FRET oligonucleotide probe is designed which
overlaps the genomic flanking and insert DNA junction. The FRET
probe and PCR primers (one primer in the insert DNA sequence and
one in the flanking genomic sequence) are cycled in the presence of
a thermostable polymerase and dNTPs. Hybridization of the FRET
probe results in cleavage and release of the fluorescent moiety
away from the quenching moiety on the FRET probe. A fluorescent
signal indicates the presence of the flanking/transgene insert
sequence due to successful amplification and hybridization.
[0168] Molecular Beacons (Tyagi, et al. Nature Biotech. 14:303-308,
1996) may also be used. Briefly, a FRET oligonucleotide probe is
designed that overlaps the flanking genomic and insert DNA
junction. The unique structure of the FRET probe results in it
containing secondary structure that keeps the fluorescent and
quenching moieties in close proximity. The FRET probe and PCR
primers (one primer in the insert DNA sequence and one in the
flanking genomic sequence) are cycled in the presence of a
thermostable polymerase and dNTPs. Following successful PCR
amplification, hybridization of the FRET probe to the target
sequence results in the removal of the probe secondary structure
and spatial separation of the fluorescent and quenching moieties. A
fluorescent signal results. A fluorescent signal indicates the
presence of the flanking/transgene insert sequence due to
successful amplification and hybridization.
[0169] In another embodiment, the invention provides for a marker
nucleic acid molecule that comprises the nucleic acid sequence of
SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 complements
thereof, or fragments thereof. The marker nucleic acid molecule may
share 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 97%, 98%, 99%, or
100% sequence identity with the nucleic acid sequence set forth in
SEQ ID NO: 1-13, complements thereof, or fragments of either. The
marker nucleic acid molecules may be used as markers in plant
breeding methods to identify the progeny of genetic crosses similar
to the methods described for simple sequence repeat DNA marker
analysis, in "DNA markers: Protocols, applications, and overviews:
(1997) 173-185, Cregan, et al. eds., Wiley-Liss NY. The
hybridization of the probe to the target DNA molecule can be
detected by any number of methods known to those skilled in the
art, including fluorescent tags, radioactive tags, antibody based
tags, and chemiluminescent tags.
Kits
[0170] Kits comprising any of the products (e.g., nucleic acid
molecules, primers, probes, markers) described herein are also
provided. In one aspect, the kit comprises any primer pair derived
from SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 that, in a DNA
amplification reaction produces an amplicon diagnostic for Kentucky
bluegrass event Pp009-401, Pp009-415 and Pp009-469, respectively. A
kit may comprise any primer pair derived from the nucleotide
sequence of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID
NO: 13. In another aspect, the kit comprises any primer pair
derived from any of the genetic elements of pSCO761 diagnostic for
Pp009-401, Pp009-415 or Pp009-469. In another aspect, the kit
comprises any primer pair derived from SEQ ID NO: 10, SEQ ID NO:
11, SEQ ID NO: 12, or SEQ ID NO: 13. In another aspect, the kit
comprises any isolated DNA polynucleotide primer or primer pair
comprising at least 11 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, or 29) contiguous nucleotides of
SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9, or its complement,
useful in a DNA amplification method to produce an amplicon
diagnostic for Kentucky bluegrass event Pp009-401, Pp009-415 and
Pp009-469, respectively. In a particular aspect, the kit comprises
one or more of the following primer pairs: Pp009-401 event primer 1
(SEQ ID NO: 1) and Pp009-401 event primer 2 (SEQ ID NO: 2);
Pp009-415 event primer 1 (SEQ ID NO: 3) and Pp009-415 event primer
2 (SEQ ID NO: 4); and Pp009-469 event primer 1 (SEQ ID NO: 5) and
Pp009-469 event primer 2 (SEQ ID NO: 6).
[0171] In another aspect, the kit comprises a DNA specific for the
transgene/junction regions of event Pp009-401, event Pp009-415,
and/or event Pp009-469. In a particular aspect, the kit comprises a
DNA molecule comprising SEQ ID NO: 2 (event Pp009-401), SEQ ID NO:
4 (event Pp009-415), SEQ ID NO: 6 (event Pp009-469), or
combinations thereof. In another aspect, the kit comprises a DNA
probe that specifically hybridizes to a nucleic acid molecule set
forth in SEQ ID NOs: 7, 8, 9, 10, 11, 12, 13, complements thereof,
fragments thereof, or combinations thereof, under standard
stringency conditions.
[0172] Kits comprising any of the products (e.g., nucleic acid
molecules, primers, probes, markers) described herein may include a
solid support. The nucleic acid molecules, including but not
limited to probes and primers, may be attached to a substrate. The
nucleic acid molecules may be directly attached to the substrate or
attached via a linker. The substrate includes but is not limited to
smooth supports (e.g., metal, glass, plastic, silicon, and ceramic
surfaces) as well as textured and porous materials. Substrate
materials include, but are not limited to acrylics, carbon (e.g.,
graphite, carbon-fiber), cellulose (e.g., cellulose acetate),
ceramics, controlled-pore glass, cross-linked polysaccharides
(e.g., agarose or SEPHAROSE.RTM. (crosslinked, beaded-form of
agarose), gels, glass (e.g., modified or functionalized glass),
graphite, inorganic glasses, inorganic polymers, latex, mica,
nanomaterials (e.g., highly oriented pyrolitic graphite (HOPG)
nanosheets), nitrocellulose, NYLON.RTM. (aliphatic polyamides),
optical fiber bundles, organic polymers, paper, plastics,
polacryloylmorpholide, poly(4-methylbutene), poly(ethylene
terephthalate), poly(vinyl butyrate), polybutylene,
polydimethylsiloxane (PDMS), polyethylene, polyformaldehyde,
polymethacrylate, polypropylene, polysaccharides, polystyrene,
polyurethanes, polyvinylidene difluoride (PVDF), quartz, rayon,
resins, rubbers, semiconductor material, silica, silicon (e.g.,
surface-oxidized silicon), sulfide, and TEFLON.RTM.
(Polytetrafluoroethylene (PTFE)).
[0173] Substrates need not be flat and can include any type of
shape including spherical shapes (e.g., beads) or cylindrical
shapes (e.g., fibers). The nucleic acid molecules, including but
not limited to probes and primers, may be attached to any portion
of the solid support (e.g., may be attached to an interior portion
of a porous solid support material).
[0174] Substrates may be patterned, where a pattern (e.g., stripes,
swirls, lines, triangles, rectangles, circles, arcs, checks,
plaids, diagonals, arrows, squares, or cross-hatches) is etched,
printed, embedded, or layered onto a substrate. For example, the
probes and primers described herein may be arranged in an array on
a solid support (e.g., attached to the support in a pattern). The
substrate can be substantially flat or planar. Alternatively, the
surface can be rounded or contoured. Exemplary contours that can be
included on a surface are wells, depressions, pillars, ridges, and
channels.
[0175] The nucleic acid molecules, including but not limited to
probes and primers, may be attached to a substrate through a stable
chemical or physical interaction. The attachment may be through a
covalent bond. However, attachments need not be covalent or
permanent. For example, the materials may be attached to a
substrate through a "spacer molecule" or "linker group." Such
spacer molecules are molecules that have a first portion that
attaches to the nucleic acid molecule and a second portion that
attaches to the substrate. Thus, when attached to the substrate,
the spacer molecule separates the substrate and the nucleic acid,
but is attached to both. Methods of attaching nucleic acids to a
substrate are well known in the art, and include but are not
limited to chemical coupling.
[0176] Kits comprising any of the products (e.g., nucleic acid
molecules, primers, probes, markers) described herein may be in a
buffer or solution. For example, the probes and primers may be
provided suspended in a buffer. The probes and primers described
herein may be lyophilized.
[0177] The sequences discloses herein, probes and primers, may be
labeled. The label may be a chemiluminescent label, paramagnetic
label, an MRI contrast agent, fluorescent label, bioluminescent
label, or radioactive label.
Areas Comprising the Events
[0178] Kentucky bluegrass events Pp009-401, Pp009-415 and Pp009-469
are tolerant to glyphosate herbicide and possess enhanced turfgrass
quality. Grasses comprising these events are useful in a turfgrass
stand. As such, the invention provides for turfgrass stands
comprising Kentucky bluegrass event Pp009-401, Pp009-415 and/or
Pp009-469. The turfgrass stand may be cultivated in private and
public areas. In a particular aspect, the turfgrass stand
comprising Pp009-401, Pp009-415 and/or Pp009-469 is grown or
located on a sports field (e.g., golf course), home lawn or public
ground. In another aspect, the invention provides for a turfgrass
stand wherein at least 50%, 75%, 90%, or more of the turfgrass
stand comprises Kentucky bluegrass event Pp009-401, Pp009-415
and/or Pp009-469.
[0179] Turfgrass stands comprising events Pp009-401, Pp009-415
and/or Pp009-469 can be effectively managed for weed control by the
application of a glyphosate containing herbicide. As such, the
invention provides for methods of controlling weeds in a turfgrass
stand comprising applying an effective amount of glyphosate to a
turfgrass stand comprising events Pp009-401, Pp009-415 and/or
Pp009-469.
Variant EPSPS DNA Molecules, Vectors, and Host Cells
[0180] Another aspect of the invention pertains to nucleic acid
molecules that encode the variant EPSPS. The nucleic acids may be
present in whole cells, in a cell lysate, or in a partially
purified or substantially pure form. A nucleic acid may be isolated
by purification away from other cellular components or other
contaminants (e.g., other cellular nucleic acids or proteins) by
standard techniques, including alkaline/SDS treatment, CsCl
banding, column chromatography, agarose gel electrophoresis and
others well known in the art. A nucleic acid of the invention may
be, for example, DNA or RNA and may or may not contain intronic
sequences. The nucleic acid may be a cDNA molecule. Exemplary
nucleic acids may be a DNA molecule with at least about 80%, 81%,
82%, 83%, 84%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, or 99% homology to the nucleic acid sequence of SEQ
ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5,
SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO:
10, SEQ ID NO: 11,
[0181] SEQ ID NO: 12, or SEQ ID NO: 13. Nucleic acids of the
invention may be obtained using standard molecular biology
techniques. See Ausubel, et al. (2011) Current Protocols in
Molecular Biology John Wiley & Sons, Inc.
[0182] Expression vectors, either as individual expression vectors
or as libraries of expression vectors, comprising the
ligand-binding region encoding sequences may be introduced into a
genome or into the cytoplasm or a nucleus of a cell and expressed
by a variety of conventional techniques, well described in the
scientific and patent literature. See, e.g., Sambrook, et al.
(2001) [Eds.] Molecular Cloning: A Laboratory Manual (3.sup.rd Ed.)
Cold Spring Harbor Laboratory; Ausubel, et al. (2011) [Ed.] Current
Protocols in Molecular Biology John Wiley & Sons, Inc.;
Knablein (2006) "Plant-based Expression of Biopharmaceuticals."
Encylopedia of Molecular Cell Biology and Molecular Medicine; and
Lindbo BMC Biotechnology 2007, 7:52.
[0183] The nucleic acids can be expressed in expression cassettes,
vectors or viruses which are stably or transiently expressed in
cells (e.g., episomal expression systems). Selection markers can be
incorporated into expression cassettes and vectors to confer a
selectable phenotype on transformed cells and sequences. For
example, selection markers can code for episomal maintenance and
replication such that integration into the host genome is not
required. For example, the marker may encode antibiotic resistance
(e.g., chloramphenicol, kanamycin, G418, bleomycin, hygromycin) or
herbicide resistance (e.g., chlorosulfurone or Basta) to permit
selection of those cells transformed with the desired DNA
sequences. See, e.g., Ausubel, et al. (2011) [Ed.] Current
Protocols in Molecular Biology John Wiley & Sons, Inc.; Walker
& Papley (2009) Molecular Biology and Biotechnology [5.sup.th
Ed.] Royal Society of Chemistry; and Twyman, et al. (2003)
"Molecular farming in plants: host systems and expression
technology." TRENDS in Biotechology 21(12): 570-578. Because
selectable marker genes conferring resistance to substrates like
neomycin or hygromycin can only be utilized in tissue culture,
chemoresistance genes are also used as selectable markers in vitro
and in vivo.
[0184] To enable cellular expression of the polynucleotides of the
present invention, a nucleic acid construct according to the
present invention may be used, which includes at least a coding
region of one of the above nucleic acid sequences, and further
includes at least one cis acting regulatory element. Preferably,
the promoter utilized by the nucleic acid construct of the present
invention is active in the specific cell population transformed.
Examples of cell type-specific and/or tissue-specific promoters are
well-known in the art. See Kole, et al. (2012) [Ed.] Handbook of
Bioenergy Crop Plants CRC Press; Fernandez & Hoeffler (1999)
Gene Expression Systems: Using Nature for the Art of Expression
Academic Press. The nucleic acid construct of the present invention
can further include an enhancer, which can be adjacent or distant
to the promoter sequence and can function in up regulating the
transcription therefrom.
[0185] The nucleic acid construct of the present invention
preferably further includes an appropriate selectable marker and/or
an origin of replication. Preferably, the nucleic acid construct
utilized is a shuttle vector, which can propagate both in E. coli
(wherein the construct comprises an appropriate selectable marker
and origin of replication) and be compatible for propagation in
cells, or integration in a gene and a tissue of choice. The
construct according to the present invention can be, for example, a
plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus, for
example tobacco mosaic virus (TMV), potato virus X, or cowpea
mosaic virus, or an artificial chromosome.
[0186] Examples of suitable constructs include, but are not limited
to, pcDNA3, pcDNA3.1 (+/-), pGL3, PzeoSV2 (+/-), pDisplay,
pEF/myc/cyto, pCMV/myc/cyto each of which is commercially available
from Life Technologies (Carlsbad, Calif.) Examples of retroviral
vector and packaging systems are those sold by Clontech (San Diego,
Calif.), including Retro-X vectors pLNCX and pLXSN, which permit
cloning into multiple cloning sites and the transgene is
transcribed from CMV promoter. Vectors derived from Mo-MuLV are
also included such as pBabe, where the transgene will be
transcribed from the 5' LTR promoter. Many plant expression vectors
are based on Ti plasmid of Agrobacterium tumefaciens.
[0187] The recombinant expression vectors of the invention comprise
a nucleic acid of the invention in a form suitable for expression
of the nucleic acid in a host cell, which means that the
recombinant expression vectors include one or more regulatory
sequences, selected on the basis of the host cells to be used for
expression, that is operatively-linked to the nucleic acid sequence
to be expressed. Within a recombinant expression vector,
"operably-linked" is intended to mean that the nucleotide sequence
of interest is linked to the regulatory sequence(s) in a manner
that allows for expression of the nucleotide sequence (e.g., in an
in vitro transcription/translation system or in a host cell when
the vector is introduced into the host cell).
[0188] A host cell can be any prokaryotic or eukaryotic cell. For
example, protein of the invention can be produced in bacterial
cells such as E. coli, insect cells, yeast, plant or mammalian
cells (e.g., Chinese hamster ovary cells (CHO), COS, HEK293 cells).
Other suitable host cells are known to those skilled in the art.
Alternatively, polypeptides of the present invention can be
produced in insect cells using baculovirus expression vectors.
Baculovirus vectors available for expression of proteins in
cultured insect cells (e.g., SF9 cells) include the pAc series
(Smith, et al. (1983) Mol. Cell. Biol. 3: 2156-2165) and the pVL
series (Lucklow and Summers (1989) Virology 170: 31-39).
[0189] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" are
intended to refer to a variety of art-recognized techniques for
introducing foreign nucleic acid (e.g., DNA) into a host cell,
including calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting
host cells can be found in Sambrook, et al. (2001) [Eds.] Molecular
Cloning: A Laboratory Manual (3.sup.rd Ed.) Cold Spring Harbor
Laboratory.
[0190] Any of the well-known procedures for introducing foreign
nucleotide sequences into host cells may be used. These include the
use of calcium phosphate transfection, polybrene, protoplast
fusion, electroporation, liposomes, microinjection, plasma vectors,
viral vectors and any of the other well known methods for
introducing cloned genomic DNA, cDNA, synthetic DNA or other
foreign genetic material into a host cell. See, e.g., Sambrook, et
al. (2001) (Eds.) Molecular Cloning: A Laboratory Manual (3.sup.rd
Ed.) Cold Spring Harbor Laboratory and Walker & Papley (2009)
Molecular Biology and Biotechnology [5.sup.th Ed.] Royal Society of
Chemistry.
[0191] A host cell of the invention, such as a prokaryotic or
eukaryotic host cell in culture, can be used to produce (i.e.,
express) protein of the invention. Accordingly, the invention
further provides methods for producing proteins of the invention
using the host cells of the invention. In one embodiment, the
method comprises culturing the host cell of the present invention
(into which a recombinant expression vector encoding protein of the
invention has been introduced) in a suitable medium such that the
protein of the invention is produced. In another embodiment, the
method further comprises isolating protein of the invention from
the medium or the host cell.
[0192] After the expression vector is introduced into the cells,
the transfected cells are cultured under conditions favoring
expression of the receptor, fragment, or variant of interest, which
is then recovered from the culture using standard techniques.
Examples of such techniques are well known in the art. See, e.g.,
WO 00/06593.
Seed Deposit Information
[0193] Reference seed comprising events Pp009-401, Pp009-415, and
Pp009-469 were deposited at the ATCC (ATCC Patent Depository, 10801
University Blvd., Manassas, Va. 20110) on May 17, 2013, under the
Budapest Treaty, as ATCC accession numbers PTA-120354, PTA-120353,
and PTA-120355, respectively, and the viability thereof was
confirmed on Jun. 5, 2013. All restrictions on the availability to
the public of the deposited material will be irrevocably removed
upon the granting of a patent on the present application.
Expression of Transgenes in Plants
[0194] The invention also provides for methods of producing plants
comprising a nucleic acid molecule of the nucleotide sequence of
SEQ ID NOs: 1-13 by plant transgenesis, a first stage comprising
the integration, into plant cells of a nucleic acid molecule of the
nucleotide sequence of SEQ ID NOs: 1-13, the second stage
comprising the regeneration of the plant from the transformed cells
according to the invention. The transformation may be obtained by
any appropriate means known in the art. By using nucleic acid
molecules encoding EPSPS it is possible to produce plants by means
of recombinant DNA techniques (for example by an antisense, a
ribozyme or a cosuppression approach) exhibiting glyphosate
resistance. Therefore in another embodiment of the invention the
plant cells of the invention are further characterized by
glyphosate resistance as compared to corresponding cells from
wild-type plants.
[0195] A plurality of techniques is available by which DNA can be
inserted into a plant host cell. These techniques include the
transformation of plant cells by T-DNA using Agrobacterium
tumefaciens or Agrobacterium rhizogenes as a transforming agent,
the fusion of protoplasts, injection, electroporation of DNA,
insertion of DNA by the biolistic approach and other
possibilities.
[0196] The use of the Agrobacteria-mediated transformation of plant
cells has been extensively investigated and sufficiently described
in EP 120 516; Hoekema, In: The Binary Plant Vector System,
Offsetdrukkerij Kanters B. V., Alblasserdam (1985), Chapter V;
Fraley et al, Crit. Rev. Plant Sci. 4 (1993), 1-46 and An, et al.
EMBO J. 4 (1985), 277-287. Regarding the transformation of potatoes
see for instance Rocha-Sosa et al. (EMBO J. 8 (1989), 29-33).
[0197] The transformation of monocotyledonous plants by means of
Agrobacterium-based vectors has also been described (Chan, et al.
Plant Mol. Biol. 22 (1993), 491-506; Hiei, et al. Plant J. 6 (1994)
271-282; Deng et al, Science in China 33 (1990), 28-34; Wilmink et
al, Plant Cell Reports 11 (1992), 76-80; May, et al. Bio/Technology
13 (1995), 486-492; Conner and Dormisse, Int. J. Plant Sci. 153
(1992), 550-555; Ritchie et al. Transgenic Res. 2 (1993), 252-265).
An alternative system for transforming monocotyledonous plants is
the transformation by the biolistic approach (Wan and Lemaux, Plant
Physiol. 104 (1994), 37-48; Vasil, et al. Bio/Technology 11 (1993),
1553-1558; Ritala, et al. Plant Mol. Biol. 24 (1994) 317-325;
Spencer, et al. Theor. Appl. Genet. 79 (1990), 625-631), protoplast
transformation, electroporation of partially permeabilized cells,
insertion of DNA via glass fibers. The transformation of maize in
particular has been repeatedly described in the literature (see for
instance WO 95/06128, EP 0 513 849, EP 0 465 875, EP 29 24 35;
Fromm et al, Biotechnology 8, (1990), 833-844; Gordon-Kamm, et al.
Plant Cell 2, (1990), 603-618; Koziel, et al. Biotechnology 11
(1993), 194-200; Moroc, et al. Theor. Appl. Genet. 80, (1990),
721-726).
[0198] The successful transformation of other types of cereals has
also been described for instance of barley (Wan and Lemaux, supra;
Ritala, et al. supra, Krens, et al. Nature 296 (1982), 72-74) and
wheat (Nehra, et al. Plant J. 5 (1994), 285-297).
[0199] One series of methods consists in bombarding cells or
protoplasts with particles to which DNA sequences are attached.
Nucleic acids comprising the sequence of SEQ ID NOs: 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, or 13 may be carried by the same particles
or by different bombardments. Another method utilizes a chimeric
gene inserted into an Agrobacterium rhizogenes Ri or Agrobacterium
tumefaciens Ti plasmid. Other methods may be used, such as
microinjection or electroporation. Persons skilled in the art will
choose the appropriate method according to the nature of the plant,
in particular its monocotyledonous or dicotyledonous character.
[0200] The nucleic acid molecule of the nucleotide sequence of SEQ
ID NO: 1-13 may be expressed in a host cell. The host cells may be
cells of microorganisms, including but not limited to bacterial
cells (e.g., E. coli) and yeast cells. The preparation of such host
cells for the production of recombinant EPSPS can be carried out by
methods known to those skilled in the art.
[0201] An overview of different expression systems is for instance
contained in Methods in Enzymology 153 (1987), 385-516, in Bitter
et al. (Methods in Enzymology 153 (1987), 516-544) and in Sawers et
al. (Applied Microbiology and Biotechnology 46 (1996), 1-9),
Billman-Jacobe (Current Opinion in Biotechnology 7 (1996), 500-4),
Hockney (Trends in Biotechnology 12 (1994), 456-463), Griffiths et
al, Methods in Molecular Biology 75 (1997), 427-440). An overview
of yeast expression systems is for instance given by Hensing et al.
(Antonie van Leuwenhoek 67 (1995), 261-279), Bussineau et al.
(Developments in Biological Standardization 83 (1994), 13-19),
Gellissen et al. (Antonie van Leuwenhoek 62 (1992), 79-93, Fleer
(Current Opinion in Biotechnology 3 (1992), 486-496), Vedvick
(Current Opinion in Biotechnology 2 (1991), 742-745) and Buckholz
(Bio/Technology 9 (1991), 1067-1072).
[0202] The transformation of the host cell with DNA encoding an
EPSPS can be carried out by standard methods, as for instance
described in Sambrook, et al. (2001) Molec. Cloning: Lab. Manual
[3.sup.rd Ed] Cold Spring Harbor Laboratory Press. See, also,
Burke, et al. (2000) Methods in Yeast Genetics Cold Spring Harbor
Laboratory Press. The host cell is cultured in nutrient media
meeting the requirements of the particular host cell used, in
particular in respect of the pH value, temperature, salt
concentration, aeration, antibiotics, vitamins, or trace
elements.
[0203] The invention also provides to transgenic plant cells
transformed by a nucleic acid molecule of the nucleotide sequence
of SEQ ID NO: 1-13 or a vector of the invention or descended from
such cells, the nucleic acid molecule which encodes the protein
that has the biological activity of an EPSPS being under the
control of regulatory elements permitting the transcription of a
translatable mRNA in plant cells.
[0204] Generally, any promoter active in plant cells is suitable to
express the nucleic acid molecules in plant cells. The promoter can
be so chosen that the expression in the plants of the invention
occurs constitutively or only in a particular tissue, at a
particular time of plant development or at a time determined by
external influences. The promoter may be homologous or heterologous
to the plant.
[0205] Suitable promoters are for instance the promoter of 35S RNA
of the Cauliflower Mosaic Virus (See, e.g., U.S. Pat. No.
5,352,605) and the ubiquitin-promoter (See, e.g., U.S. Pat. No.
5,614,399) which lend themselves to constitutive expression, the
patatin gene promoter B33 (Rocha-Sosa, et al. EMBO J. 8 (1989),
23-29) which lends itself to a tuber-specific expression in
potatoes or a promoter ensuring expression in photosynthetically
active tissues only, for instance the ST-LS1 promoter (Stockhaus,
et al. Proc. Natl. Acad. Sci. USA 84 (1987), 7943-7947; Stockhaus,
et al. EMBO, J. 8 (1989) 2445-2451), the Ca/b-promoter (see for
instance U.S. Pat. No. 5,656,496, U.S. Pat. No. 5,639,952, Bansal,
et al. Proc. Natl. Acad. Sci. USA 89 (1992), 3654-3658) and the
Rubisco SSU promoter (see for instance U.S. Pat. No. 5,034,322;
U.S. Pat. No. 4,962,028) or the glutelin promoter from wheat which
lends itself to endosperm-specific expression (HMW promoter)
(Anderson, Theoretical and Applied Genetics 96, (1998), 568-576,
Thomas, Plant Cell 2 (12), (1990), 1171-1180), the glutelin
promoter from rice (Takaiwa, Plant Mol. Biol. 30(6) (1996),
1207-1221, Yoshihara, FEBS Lett. 383 (1996), 213-218, Yoshihara,
Plant and Cell Physiology 37 (1996), 107-111), the shrunken
promoter from maize (Maas, EMBO J. 8 (11) (1990), 3447-3452, Werr,
Mol. Gen. Genet. 202(3) (1986), 471-475, Werr, Mol. Gen. Genet.
212(2), (1988), 342-350), the USP promoter, the phaseolin promoter
(Sengupta-Gopalan, Proc. Natl. Acad. Sci. USA 82 (1985), 3320-3324,
Bustos, Plant Cell 1 (9) (1989), 839-853) or promoters of zein
genes from maize (Pedersen, et al. Cell 29 (1982), 1015-1026;
Quatroccio, et al. Plant Mol. Biol. 15 (1990), 81-93). However,
promoters which are only activated at a point in time determined by
external influences can also be used (see for instance WO
93/07279). In this connection, promoters of heat shock proteins
which permit simple induction may be of particular interest.
Moreover, seed-specific promoters such as the USP promoter from
Vicia faba which ensures a seed-specific expression in Vicia faba
and other plants may be used (Fiedler, et al. Plant Mol. Biol. 22
(1993), 669-679; Baumlein, et al. Mol. Gen. Genet. 225 (1991),
459-467). Moreover, fruit-specific promoters, such as described in
WO 91/01373 may be used. Shoot-preferred promoters may be used.
[0206] Moreover, a termination sequence may be present, which
serves to terminate transcription correctly and to add a
poly-A-tail to the transcript, which is believed to have a function
in the stabilization of the transcripts. Such elements are
described in the literature (see for instance Gielen, et al. EMBO
J. 8 (1989), 23-29) and can be replaced at will.
[0207] Such cells can be distinguished from naturally occurring
plant cells inter alia by the fact that they contain a nucleic acid
molecule of the invention which does not naturally occur in these
cells. For example, a person skill in the art can screen for
transformants by treating the plants with an herbicide comprising
glyphosate. Moreover, such transgenic plant cells of the invention
can be distinguished from naturally occurring plant cells in that
they contain at least one copy of the nucleic acid molecule of the
invention stably integrated in their genome (e.g., the plants are
tolerant to glyphosate).
[0208] Moreover, the plant cells of the invention can preferably be
distinguished from naturally occurring plant cells by at least one
of the following features: If the inserted nucleic acid molecule of
the invention is heterologous to the plant cell, then the
transgenic plant cells are found to have transcripts of the
inserted nucleic acid molecules of the invention. The latter can be
detected for instance by Northern blot analysis. The plants cells
of the invention preferably contain a protein encoded by an
inserted nucleic acid molecule of the invention. This can be shown
for instance by immunological methods, in particular by Western
blot analysis.
[0209] The present invention also provides the plants obtainable by
regeneration of the transgenic plant cells of the invention.
Furthermore, also plants containing the above-described transformed
plant cells are described herein. Transgenic plant cells can be
regenerated to whole plants according to methods known to a person
skilled in the art.
TABLE-US-00003 TABLE 1 Sequences Sequence Identifier Nucleic Acid
Type 1 401 UBB1 Dil 3-1 primer for transgene/ genomic junction 2
401 UBB1 Dil 5-2 primer for genomic DNA sequence flanking the 5'
end 3 415 GOB 1 Dil 3-1 primer for transgene/ genomic junction 4
415 GOB 1 Dil 5-2 primer for genomic DNA sequence flanking the 5'
end 5 469 GOB 1 Dil 3-1 primer for transgene/ genomic junction 6
469 GOB 1 Dil 5-5 primer for genomic DNA sequence flanking the 5'
end 7 Pp009-401 Event transgene/genomic/chromosomal flanking DNA
sequence 8 Pp009-415 Event transgene/genomic/chromosomal flanking
DNA sequence 9 Pp009-469 Event transgene/genomic/chromosomal
flanking DNA sequence 10 EPSPS cassette transgene cassette 11 GAO2X
cassette transgene cassette 12 variant EPSPS transgene transgene
(cDNA) 13 GAO2X transgene transgene (cDNA)
[0210] All publications (e.g., Non-Patent Literature), patents,
patent application publications, and patent applications mentioned
in this specification are indicative of the level of skill of those
skilled in the art to which this invention pertains. All such
publications (e.g., Non-Patent Literature), patents, patent
application publications, and patent applications are herein
incorporated by reference to the same extent as if each individual
publication, patent, patent application publication, or patent
application was specifically and individually indicated to be
incorporated by reference.
[0211] The following examples show various embodiments of the
invention. It should be appreciated by those of skill in the art
that modifications can be made without departing from the spirit
and scope of the invention.
EXAMPLES
Example 1
Events Pp009-401, Pp009-415, and Pp009-469
[0212] The transgenic Kentucky bluegrass events Pp009-401,
Pp009-415, and Pp009-469 were generated by microprojectile
bombardment of Kentucky bluegrass callus material using a linear
DNA fragment derived from pSCO761 (FIG. 1), the transgene insert of
the invention. This DNA fragment contains two transgene expression
cassettes that confer glyphosate and enhanced turfgrass
characteristics. The first cassette includes the rice ubiquitin
promoter (P-Os.UBQ, also referred to as P-rUBQ) and rice actin 1
intron (I-Os.Act 1, also referred to as ract intron) (see U.S. Pat.
No. 5,641,876, incorporated by reference herein), operably
connected to a glyphosate tolerant
5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) from
Arabidopsis and operably connected to a Zea mays alcohol
dehydrogenase transcriptional terminator. The second transgene
expression cassette includes the Os.GOS2 promoter, operably
connected to gibberellic acid 2-oxidase from spinach (Lee, et al.
Plant Physiology, May 2005, Vol. 138, pp. 243-254, incorporated by
reference herein in its entirety) and operably connected to a
Solanum pennellii histone H1 gene transcriptional terminator.
[0213] Post-bombardment, glyphosate-tolerant transgenic calli were
selected on media containing 0.5 mM glyphosate and plants were
subsequently regenerated on media containing 0.1 mM glyphosate.
Transgenic events were produced and events Pp009-401, Pp009-415 and
Pp009-469 were selected from this population based on a superior
combination of characteristics, including glyphosate tolerance and
enhanced turfgrass quality.
Example 2
Tolerance to Glyphosate Vegetative Injury
[0214] Kentucky bluegrass events Pp009-401, Pp009-415, and
Pp009-469 were tested for tolerance to glyphosate vegetative
injury. Kentucky bluegrass plants comprising events Pp009-401,
Pp009-415, and Pp009-469 showed no damage to Roundup.RTM. Pro
(glyphosate containing herbicide formulation) sprayed in a booth at
3.0 lbs acid equivalence or an amount equivalent to 128 ounces
Roundup.RTM. Pro per acre. The standard recommended rate is 1.25 to
2.5% Roundup.RTM. Pro or amount equivalent to 32 to 64 ounces
Roundup.RTM. Pro per acre. Therefore, treating a turfgrass stand
comprising Kentucky bluegrass Pp009-401, Pp009-415, and/or
Pp009-469, with a glyphosate containing herbicide, is useful for
controlling weeds and other unwanted plants in the turfgrass
stand.
Example 3
DNA Sequences of the Genomic Regions Adjacent to the Transgene
[0215] The DNA sequences of the genomic regions adjacent to the
transgene insert were determined by isolation of the DNA molecules
using Clontech's Universal Genome Walker.TM. Kit (Clontech
Laboratories Inc, Mountain View, Calif.) (part no 638904) to clone
plant genomic sequences that flank a bombardment-mediated inserted
copy of pSCO761. Genomic DNA (3 .mu.g) of Kentucky bluegrass
Pp009-401, Pp009-415, and Pp009-469 were digested completely with
blunt-cutter enzyme BsaBI, selected for the apparent lack of
internal sites within the pSCO761 cassette. After verifying an
effective digestion, DNA was then purified using the Promega
Wizard.RTM. SV gel/PCR cleanup kit (Promega Corporation, Cat no
A9281), which collects DNA on a binding membrane on a spin column.
DNA was then eluted with nuclease-free water (20 .mu.L). A 4-.mu.L
sample of purified DNA digest was then ligated overnight at
16.degree. C. to a short (50 bases long) double-stranded,
blunt-ended adaptor, which contains sequence for binding two nested
oligomers (AP1 and AP2) included in the Geomewalker.TM. kit. To
each 8-.mu.L ligation reaction 65 .mu.L water and 7.2 .mu.L
10.times.TE was added. This finished "Genomewalker library" was
used as a template for two successive PCR reactions, the first
using the outermost linker primer (AP1), and the outermost
"flanking" primers designed from pSCO761.
[0216] Two sets of nested oligonucleotides had been designed that
primed in reverse at a location within 100 bp of either end of the
pSCO761 cassette, allowing PCR amplification of a flanking sequence
adjacent to either the GOS2 promoter at one end, or the RUBQ
promoter at the other end. They have been designated PRU761 fl-1
PRU761 fl-2, PGO761 fl-1, and PGO761 fl-2. This first PCR reaction
(PCR1) is done as a set of two per transgenic line, using each of
the transgene-specific primers (PRU761 fl-1 and PGO761 fl-1) in
combination with Genomewalker.TM. primer AP1. Since the nearest
genomic BsaBI site to insertion sites of pSCO761 are unknown, PCR
conditions are designed to amplify long sequences, up to 6 kb. A
kit containing a Taq polymerase optimized for long-distance PCR
(Advantage 2 PCR kit) (Clontech Laboratories Inc, Mountain View,
Calif.) (part no 639206) was used.
[0217] Two PCR programs were designed, based on recommendations by
the kit. The first PCR reaction used a program named FLANK1:
95.degree. C.-2', (94.degree. C.-25'', 64.degree. C.-6').times.7,
(94.degree. C.-25'', 60.degree. C.-6').times.30, 72.degree. C.-10'.
After the PCR1 run was complete, an aliquot of the reaction was
diluted 1/50 in sterile water for use as a template for PCR2. This
next PCR reaction enriches for sequence flanking the transgene, by
priming the products of PCR 1 with nested primers specific to
either the Genomewalker.TM. linker (AP2) or the transgene (PGO761
fl-2 or PRU761 fl-2). To each reaction 1 .mu.L diluted PCR1
template and 1 .mu.L 10 mM transgene-specific nested primer 2 was
added; the diluted PCR1 reaction using PGO761 fl-1/AP1 was the
template for PGO761 fl-2/AP2, and the diluted PCR1 reaction using
PRU761 fl-1/AP 1 was the template for PRU761 fl-2/AP2. The 2.sup.nd
PCR reaction used a program named FLANK2: 95.degree. C.-2',
(94.degree. C.-25'', 64.degree. C.-25'', 68.degree. C.-6').times.5,
(94.degree. C.-25'', 60.degree. C.-25'', 68.degree.
C.-6').times.21, 72.degree. C.-10'.
[0218] The completed PCR2 reactions are resolved by electrophoresis
on a preparative agarose gel. Intensely-staining bands were each
excised separately using a clean scalpel blade, for
cloning/sequencing. Each band was given a designation based on the
transgenic line, the primer sets used, the restriction endonuclease
that generated the library, and finally the order of band recovery,
if multiple bands were produced. A 0.80-kb fragment generated from
the Pp009-401 BsaBI library using the PRU761 primer set (priming
P-RUBQ in reverse) was named 401-UB-B-1. Likewise, a 0.80-kb
fragment generated from Pp009-415 BsaBI library using the PGO761
primer set (priming P-GOS2 in reverse) was named 415-GO-B-1. A
1.0-kb fragment generated from the Pp009-469 BsaBI library using
the PGO761 primer set was named 469-GO-B-1. Fragments in excised
gel slices were extracted using the Wizard.RTM.SV-gel/PCR cleanup
kit (Promega Corp, Madison Wis.)(Part no A9281), according to the
instructions by the manufacturer. The gel slice is dissolved in a
special binding buffer included with the kit, and collecting the
DNA by passage through a spin column with a binding membrane. DNA
was eluted from the membrane with 24 .mu.L sterile water, and
cloned into a vector designed for cloning and sequencing PCR
fragments (TOPO.RTM. TA Cloning kit, Invitrogen, by Life
Technologies.TM.)(Part no K4575-01). Each cloning reaction used 4
.mu.L extracted fragment in a 6-.mu.L reaction volume with 1 .mu.L
each TOPO vector (pCR.TM. 4-TOPO.RTM.), and salt solution provided
in the kit. Reactions were incubated for at least 5' at room
temperature, and 1 .mu.L each was then used to transform aliquots
of E. coli (One Shot.RTM. TOP10) competent cells provided with the
kit. Cells were incubated on ice for 30', then heat shocked at
43.degree. C. for 30'', then incubated for 1 H with shaking at
37.degree. C. before plating on LB agar medium containing 50 mg/L
carbenicillin, and culturing overnight at 37.degree. C. Viable
colonies were then screened for the presence of expected-sized
insert by colony PCR amplification using primers (T3 TOPO long and
T7 TOPO long) designed to the T3 and T7 sequences of the TOPO
vector cloning site. Clones showing inserts of expected size were
sent to Cornell University's Biotechnology Resource Center for
bidirectional sequencing from the T3 and T7 sites, using T3 TOPO
long and T7 TOPO long to prime the sequencing reactions.
[0219] Sequence data generated from these fragments was analyzed,
and mapped for the BsaBI cloning site to the Genomewalker linker at
one end, and for pSCO761 sequence (either P-RUBQ or P-GOS2)
junction at the other. DNA sequence between the junction and the
BsaBI cloning site was then verified to be unlike pSCO761 by
comparing against the complete sequence of the MluI cassette of
pSCO761 using L-ALIGN software (Sequence identity to pSCO761 would
indicate a tandem repeat). If the sequence was dissimilar to
pSCO761, it was postulated to be host plant genomic sequence
flanking a pSCO761 insertion site, and was subjected to BLAST
searches using NCBI and TIGR monocot transcript databases. Any
strong "hits" to either a cloned cDNA or a non-coding sequence from
a genomic library was also noted as part of the record for that
fragment. The DNA sequence of the genomic/transgene region DNA
molecule is illustrated in FIGS. 2, 3 and 4 for Pp009-401,
Pp009-415, and Pp009-469, respectively.
Example 4
Presence of the Transgene/Genomic DNA in a Kentucky Bluegrass
[0220] The presence of the transgene/genomic DNA in a Kentucky
bluegrass sample was verified by using PCR to generate a
transgene/genomic junction region amplicon using alternate primers
to those originally used to clone the Genomewalker library
fragment. For Pp009-401, the transgene/genomic junction region
amplicon is produced using one primer (SEQ ID NO: 1), designed to
an area within the genomic DNA sequence flanking the 5' end of the
insert paired with a second primer (SEQ ID NO: 2) associated within
the rice ubiquitin promoter of the inserted transgene DNA. For
Pp009-415, the transgene/genomic junction region amplicon is
produced using one primer (SEQ ID NO: 3), designed to an area
within the genomic DNA sequence flanking the 5' end of the insert
paired with a second primer (SEQ ID NO: 4) associated within the
GOS2 promoter of the inserted transgene DNA. For Pp009-469, the
transgene/genomic junction region amplicon is produced using one
primer (SEQ ID NO: 5), designed to an area within the genomic DNA
sequence flanking the 5' end of the insert paired with a second
primer (SEQ ID NO: 6) associated within the RUBQ promoter of the
inserted transgene DNA. The junction amplicons were produced from
about 10 ng of leaf genomic DNA as a template, 10 pmol of each
primer, and the GoTaq.RTM. Flexi DNA Polymerase system (Promega
Corp, Madison Wis.)(Part no M8295) in a 50 .mu.l reaction volume.
The amplification of the reactions was performed under the
following cycling conditions: 95.degree. C.-2', (94.degree.
C.-45'', 65.degree. C.-45'', 72.degree. C.-1').times.40, 72.degree.
C.-10'.
[0221] Kentucky bluegrass genomic DNA flanking sequence of the
transgenic insertion was determined for event Pp009-401, Pp009-415
and Pp009-469 by sequencing the Genome Walker.TM.-derived
amplification products and alignment to known transgene sequence. A
5' region of the transgene insertion site was sequenced, this
region comprises a transgene/genomic DNA sequence of 770 nucleotide
base pairs (bps) (SEQ ID NO: 7) for Pp009-401, 832 nucleotide base
pairs (bps) (SEQ ID NO: 8) for Pp009-415, 516 nucleotide base pairs
(bps) (SEQ ID NO: 9) for Pp009-469.
[0222] The junction sequences, SEQ ID NO: 1 and SEQ ID NO: 2 (FIG.
5), SEQ ID NO: 3 and SEQ ID NO: 4 (FIG. 6), SEQ ID NO: 5 and SEQ ID
NO: 6 (FIG. 7) are novel DNA sequences from event Pp009-401,
Pp009-415 and Pp009-469, respectively, and are diagnostic for
Kentucky bluegrass plant event Pp009-401, Pp009-415, and Pp009-469,
respectively, and its progeny. The junction sequences in SEQ ID NO:
1 and SEQ ID NO: 2 comprise polynucleotides on each side of an
insertion site of a transgene sequence fragment and Kentucky
bluegrass genomic DNA. The sequence SEQ ID NO: 1 is found at
nucleotide position 15-43 of SEQ ID NO: 7, the 5' region of the
transgene insertion site for PP009-401. The sequence SEQ ID NO: 3
is found at nucleotide position 32-56 of SEQ ID NO: 8, the 5'
region of the transgene insertion site for PP009-415. The sequence
SEQ ID NO: 5 is found at nucleotide position 76-106 of SEQ ID NO:
9, the 5' region of the transgene insertion site for Pp009-469.
Example 5
Specificity of the Cloned Transgene/Genomic Flanking Sequences
[0223] The specificity of the cloned transgene/genomic flanking
sequences SEQ ID Nos. 7, 8, and 9 to transgenic lines Pp009-401,
Pp0090-415 and Pp009-469 respectively, was tested by a series of
PCR reactions using primer pairs Seq ID NO: 1 and 2 (designed to
Pp009-401 cloned fragment Seq ID NO: 7), Seq ID NO: 3 and 4
(designed to Pp009-415 cloned fragment Seq ID NO:8), and Seq ID NO:
5 and 6 (designed to Pp009-469 cloned fragment Seq ID NO 9),
against templates of genomic DNA of non-transgenic Kentucky
Bluegrass, Pp009-401, Pp009-415, and Pp009-469.
[0224] The PCR reactions, done in sets of 5 for each primer pair,
included the following templates in separate reactions: SEQ ID NO:
1 and 2 were used against 1-.mu.L templates of 10 ng non-transgenc
Kentucky Bluegrass cv Abbey from tissue culture, 10 ng Pp009-401,
10 ng Pp009-415, 10 ng Pp009-469, and 1 ng Pp009-401 plus 49.5 ng
ea Pp009-415 and Pp009-469 genomic DNA. SEQ ID NO: 3 and 4 were
used against 1-.mu.L templates of 10 ng non-transgenic Kentucky
Bluegrass cv Abbey from tissue culture, 10 ng Pp009-401, 10 ng
Pp009-415, 10 ng Pp009-469, and 1 ng Pp009-415 plus 49.5 ng ea
Pp009-401 and Pp009-469 genomic DNA. SEQ ID NO: 5 and 6 were used
against 1-.mu.L templates of 10 ng non-transgenic Kentucky
Bluegrass cv Abbey from tissue culture, 10 ng Pp009-401, 10 ng
Pp009-415, 10 ng Pp009-469, and 1 ng Pp009-469 plus 49.5 ng ea
Pp009-401 and Pp009-415 genomic DNA. The PCR conditions used can be
found on Table 2. The PCR reactions used the GoTaq.RTM. Flexi DNA
Polymerase system (Promega Corp, Madison Wis.) (part no M8295) in a
50 .mu.l reaction volume. The colorless 5.times. GoTaq.RTM. Flexi
buffer (lacking loading dye) was used. The PCR program was
95.degree. C.-2', (94.degree. C.-45'', 65.degree. C.-45'',
72.degree. C.-1').times.40, 72.degree. C.-10'. After the PCR run, a
combination DNA-visualizing agent and loading dye (EZ Vision.TM.
Three 6.times. Dye and Buffer) (Amresco Inc, Solon, Ohio) (part No
N313) was added to each PCR reaction to 1.times.. Samples of each
PCR reaction (15 .mu.L) were then resolved on a 1.3% agarose/TBE
gel by electrophoresis, alongside DNA molecular weight markers
(Bench Top 100 bp Ladder) (Promega Corp) (Part No G8291), loaded in
lanes in between each set.
TABLE-US-00004 TABLE 2 PCR conditions for amplification of
diagnostic flanking sequences PCR reagents, GoTaq .RTM. Flexi DNA
Polymerase source (Promega Corp, Part No M8295) PCR reaction
volume: 50 .mu.L Template DNA: 10 ng MgCl2: 1.5 mM Polymerase: 1.25
U dNTPs 200 .mu.M ea PCR buffer Green or Colorless GoTaq .RTM.
Flexi Buffer, to 1 X PCR program: 95.degree. C. - 2', (94.degree.
C. - 45'', 65.degree. C. - 45'', 72.degree. C. - 1') X 40,
72.degree. C. - 10'
[0225] The results are shown in FIG. 8. As expected, the PCR
reactions using the primer pair designed to Seq ID NO: 7 (from
Pp009-401) amplify a band of expected size (720 bp) from Pp009-401
template, both 10 ng DNA alone, and 1 ng DNA+99 ng mixed DNA of
Pp009-401 and 415; and fail to amplify a similar band from either
control Abbey, Pp009-415, or Pp009-469 (10 ng ea). Likewise, the
PCR reactions using the primer pair designed to SEQ ID NO: 8 (from
Pp009-415) amplify a band of expected size (719 bp) from Pp009-415
template, both 10 ng DNA alone, and 1 ng DNA+99 ng mixed DNA of
Pp009-401 and 469; and fail to amplify a similar band from either
control Abbey, Pp009-401, or Pp009-469 (10 ng ea). Likewise, the
PCR reactions using the primer pair designed to SEQ ID NO: 9 (from
Pp009-469) amplify a band of expected size (410 bp) from Pp009-469
template, both 10 ng DNA alone, and 1 ng DNA+99 ng mixed DNA of
Pp009-401 and 415; and fail to amplify a similar band from either
control Abbey, Pp009-401, or Pp009-415 (10 ng ea). These results
indicate the transgene/genomic flanking sequences represented in
SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9 are unique to their
respective transgenic lines.
[0226] All publications, patents and patent applications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety.
Sequence CWU 1
1
13129DNAArtificial SequencePrimer 1gttctgaaaa actgtgcacg tccaagagg
29225DNAArtificial SequencePrimer 2cggccgcggt accatagaat acaga
25325DNAArtificial SequencePrimer 3ccacacaagc aaacgtcaca aactg
25427DNAArtificial SequencePrimer 4gcggccgcgg taccacgatt tgcggac
27531DNAArtificial SequenceChemically Synthesized 5caaactagaa
ctgcagccac ccgtaaattt g 31627DNAArtificial SequenceChemically
Synthesized 6tagacttgag aaacacgacg agtcgct 277770DNAArtificial
SequencePp009-401 Event 7gtatccacac atacgttctg aaaaactgtg
cacgtccaag aggtttcttt caatacagag 60gactgtagtc attatcagct cggaaagctt
tctccgcttc ttcatccctc cacctcttct 120gctcttttta gatgatgtac
ggttttgaag cttgtcaacc ttttgtaccc gtgtagaaaa 180ttttgagttt
tcccatgtac tcttctcttt aagaaggcac ggcggcttcc acgaagatgg
240tggaacaata cggcaaatcc catatggttc tgctgttggc cgtatactct
caatatattt 300tagagtgtct ttaaattcct gatccacgta gagaatatac
cataagattg ggctatttag 360taaaacaaca gagatagata aaacgtgata
cggcagttag caaagacgga aggtacctcc 420tcagtaggat agtagacagg
agcttcgtca agaacaggcc tccgtgcacc agctggattc 480caatttgcag
taacctgcat ggtgtgaaaa cacataagac aacaagagac cagcttcatg
540gaagtaggaa acacaggaat tcagcagacg aatgtgaacc ttttgacagt
cactgcagcc 600tgcacatcct cgaataactc cttttggtaa tttctgtctg
cgcttcgctg gacttacagc 660ctgccaaaag aacattttca tatagtggaa
agcattaaaa tcacagtcat ctgtattcta 720tggtaccgcg gccgcaagct
tgtcgacctg atgattattt tgttgatcat 7708832DNAArtificial
SequencePp009-415 8gtatcatggt atgggatcac tagatatttt tccacacaag
caaacgtcac aaactgccgt 60ggttcgcatt catccaccaa acacacacac atcatccact
gtgctaagca ggcagccaag 120ctgctgaatg gatgaacagg gatcatgccc
gcgtactcca gatcggacag attgatttgg 180tggcctgttg cggtgcagct
gctcgcttgc gtccgtgcgc ggtctgggca gatcaaaaca 240gggctaggtg
gatggctggc tcggctgtcg gctgggcgca ccggcgcagc gaccaaaacg
300gaggactgga ggaggtgggg acgccctcgc ggacgagcgg agcagaggac
cttggcgcgt 360ggactcccag ccagaccccc ggtgaggcga ggagctgttg
gacgttactc gggagcgagc 420agagcagcga tgctgccgcc gtcggcagcg
gagctagggg agcagggaaa gcgccggtga 480ggagcgggtc ggcagacaac
tcaaacgaga agagggagag aggaagaaag gcggcggcgc 540tcagaactca
gatgcgagag gcggggcgac ctgctagtgg acgcggtggt ctgccagcag
600cgcggcgagg cgaggaagtg agggagggca atggcgtggg gaggcgacac
gcacgtgaga 660ctgtgagaga cggcggcgtt cgctcgcgtt tgggaggaag
gcagctaaca attgatcttg 720tccgtccgca aatcgtggta ccgcggccgc
aagctttcta gaatccgaaa agtttctgca 780ccgttttcac cccctaacta
acaatatagg gaacgtgtgc taatataaaa tg 8329516DNAArtificial
SequencePp009-469 9tcatcatcgc agcagatgat ggcccaggac ccaggtttcg
cgctttgaac tgtgacgctg 60tgcaagtttg gttgtcaaac tagaactgca gccacccgta
aatttgcaag cagcggcaat 120catgaggtgt gcgacttcag tgtgtcccag
ctatcgcgtg tctattgaat ggcgagacct 180gattcatttt ttaagcatca
tggtcctgcc taacttagta ctaatagact gagaatcggg 240ttgtttgttt
tccgaatatg tggaaatttt gtggatcaag gagtagctct tttgagttcc
300tttgaagttt ggttgattca ggcatctgcg cgtgagagaa caaatgcggc
ttgtcatgtc 360acactcacac cacggacgaa ccaggacaag cagccctcag
cccctctatc ccaaccacgg 420cctcgccggt gatggaccgg gagagtgaga
tgctctttag cgactcgtcg tgtttctcaa 480gtctagatcc gccgccgccg
gtaaccaccc cgcccc 516103456DNAArtificial SequenceEPSPS Cassette
10acgcgtggta ccgcggccgc aagcttgtcg acctgatgat tattttgttg atcatgattt
60tcttttggct atttgatttt ttgaaagata tttttttccc tgggaagaca cctatgggac
120gaagatatta tgttatatat atatatatat atatatcaca tcagtctctg
cacaaagtgc 180atcctgggct gcttcaatta taaagcccca ttcaccacat
ttgctagata gtcgaaaagc 240accatcaata ttgagcttca ggtatttttg
gttgtgttgt ggttggattg attctaatat 300ataccaaatc aatataattc
actaccaaaa tataccatag ccatcacaac tttattaatt 360ttggtagctt
aagatggtat atataataac caattaacaa ctgattctaa ttttactacg
420gcccagtatc taccaataca aaacaacgag tatgttttct tccgtcgtaa
tcgtacacag 480tacaaaaaaa cctggccagc ctttcttggg ctggggctct
ctttcgaaag gtcacaaaac 540gtacacggca gtaacgccgc ttcgctgcgt
gttaacggcc accaaccccg ccgtgagcaa 600acggcatcag ctttccacct
cctcgatatc tccgcggcgc cgtctggacc cgcccccttt 660ccgttccttt
ctttccttct cgcgtttgcg tggtggggac ggactcccca aaccgcctct
720ccctctcttt atttgtctat attctcactg ggccccaccc accgcacccc
tgggcccact 780cacgagtccc cccctcccca cctataaata ccccaccccc
tcctcgcctc ttcctccatc 840aatcgaatcc ccaaaatcgc agagaaaaaa
aaatctcccc tcgaagcgaa gcgtcgaatc 900gccttctcaa gtctagatcc
gccgccgccg gtaaccaccc cgcccctctc ctctttcttt 960ctccgttttt
tttttccgtc tcggtctcga tctttggcct tggtagtttg ggtgggcgag
1020aggcggcttc gtgcgcgccc agatcggtgc gcgggagggg cgggatctcg
cggctggggc 1080tctcgccggc gtggatccgg cccggatctc gcggggaatg
gggctctcgg atgtagatct 1140gcgatccgcc gttgttgggg gagatgatgg
ggggtttaaa atttccgcca tgctaaacaa 1200gatcaggaag aggggaaaag
ggcactatgg tttatatttt tatatatttc tgctgcttcg 1260tcaggcttag
atgtgctaga tctttctttc ttctttttgt gggtagaatt tgaatccctc
1320agcattgttc atcggtagtt tttcttttca tgatttgtga caaatgcagc
ctcgtgcgga 1380gcttttttgt aggtagaagg gatccatggc ccaggtgtcc
cgcatctgca acggcgtgca 1440gaacccatcc ctcatctcca acctctccaa
gtcctcccag cgcaagtccc cactctccgt 1500gtccctcaag acccagcaac
acccacgcgc ctacccaatc tccagctcct ggggcctcaa 1560gaagtccggc
atgaccctca tcggctccga gctgcgccca ctcaaggtga tgtcctccgt
1620gtccaccgcc gagaaggcct ccgagatcgt gctccagcca atccgcgaga
tttccggcct 1680catcaagctc ccaggctcca agtccctctc caaccgcatc
ctcctgctcg ccgctctctc 1740cgagggcacc accgtggtgg acaacctgct
caactccgac gacatcaact acatgctcga 1800cgccctcaag cgcctcggcc
tcaacgtgga gaccgactcc gagaacaacc gcgccgtggt 1860ggagggctgc
ggcggcatct tcccagcctc catcgattcc aagtccgaca tcgagctgta
1920cctcggcaac tccggcacct gcatgaggtc actcacggcg gcggtcaccg
cggctggcgg 1980caacgcctcc tacgtgctcg acggcgtgcc aaggatgcgc
gagcgcccaa tcggcgacct 2040cgtggtgggc ctcaagcaac tcggcgccga
cgtggagtgc accctcggca ccaactgccc 2100accagtgcgc gtgaacgcca
acggcggcct cccaggcggc aaggtgaagc tctccggctc 2160catctcctcc
cagtacctca ccgccctgct catgtccgcc ccactcgccc tcggcgacgt
2220ggagatcgag atcgtggaca agctcatctc cgtgccatac gtggagatga
ccctcaagct 2280catggagcgc ttcggcgtgt ccgtggagca ctccgacagc
tgggaccgct tcttcgtgaa 2340gggcggccag aagtacaagt ccccaggcaa
cgcctacgtg gagggcgacg cctcctccgc 2400ctcctacttc ctcgctggcg
ctgccatcac cggcgagacc gtgaccgtgg aggggtgcgg 2460caccaccagc
ctccaaggcg acgtgaagtt cgccgaggtg ctcgagaaga tgggctgcaa
2520ggtgtcctgg accgagaact ccgtgaccgt gaccggccca ccaagggacg
ccttcggcat 2580gaggcacctc cgcgccatcg acgtgaacat gaacaagatg
ccagacgtgg ccatgaccct 2640cgccgtggtg gccctcttcg ccgacggccc
aaccaccatc agggacgtgg ccagctggcg 2700cgtgaaggag accgagcgca
tgatcgccat ctgcaccgag ctgagaaagc tcggcgccac 2760cgtcgaggag
ggctccgact actgcgtgat caccccacca aagaaggtca agaccgccga
2820gatcgacacc tacgacgacc accgcatggc gatggccttc tccctcgccg
cctgcgccga 2880cgtgccgatc accatcaacg acccaggctg cacccgcaag
accttcccag actacttcca 2940ggtgctcgag cgcatcacca agcactgagc
tcgaattcag cttcattgca agctagctcc 3000tcctgcaggg caggcatgtc
gcacagcaaa tgggcatgaa aagttgaagg cgctccagtc 3060ctccagcttg
tgtagtacac agtagcaata aaacgttagt gtttgtcctg tgcccatcct
3120gtattattct gttccagggt ttcaccttta tcgtcagtgt gtggtcaggt
ttcaaccctt 3180ctcagaacaa ccccctccca gaaaaaaaac aaaggaagaa
gtttgtgtcc aggtttcaga 3240atcccctgtc tgtaattacc attttgcatg
acaataatga gatactgtag atattaataa 3300tgttccagac cttcaaggcc
tccctccctc gcaaattgca gatttacttg aggtatcatt 3360cggtattcac
aaaatgtaac gtaaatagta gtgattaaca ctcgattacc agcgataggc
3420agtttgaata agacggcccg gggcggccgc cccggg 3456113685DNAArtificial
SequenceGAO2X Cassette 11acgcgtggta ccgcggccgc aagctttcta
gaatccgaaa agtttctgca ccgttttcac 60cccctaacta acaatatagg gaacgtgtgc
taaatataaa atgagacctt atatatgtag 120cgctgataac tagaactatg
caagaaaaac tcatccacct actttagtgg caatcgggct 180aaataaaaaa
gagtcgctac actagtttcg ttttccttag taattaagtg ggaaaatgaa
240atcattattg cttagaatat acgttcacat ctctgtcatg aagttaaatt
attcgaggta 300gccataattg tcatcaaact cttcttgaat aaaaaaatct
ttctagctga actcaatggg 360taaagagaga gatttttttt aaaaaaatag
aatgaagata ttctgaacgt attggcaaag 420atttaaacat ataattatat
aattttatag tttgtgcatt cgtcatatcg cacatcatta 480aggacatgtc
ttactccatc ccaattttta tttagtaatt aaagacaatt gacttatttt
540tattatttat cttttttcga ttagatgcaa ggtacttacg cacacacttt
gtgctcatgt 600gcatgtgtga gtgcacctcc tcaatacacg ttcaactagc
aacacatctc taatatcact 660cgcctattta atacatttag gtagcaatat
ctgaattcaa gcactccacc atcaccagac 720cacttttaat aatatctaaa
atacaaaaaa taattttaca gaatagcatg aaaagtatga 780aacgaactat
ttaggttttt cacatacaaa aaaaaaaaga attttgctcg tgcgcgagcg
840ccaatctccc atattgggca cacaggcaac aacagagtgg ctgcccacag
aacaacccac 900aaaaaacgat gatctaacgg aggacagcaa gtccgcaaca
accttttaac agcaggcttt 960gcggccagga gagaggagga gaggcaaaga
aaaccaagca tcctcctcct cccatctata 1020aattcctccc cccttttccc
ctctctatat aggaggcatc caagccaaga agagggagag 1080caccaaggac
acgcgactag cagaagccga gcgaccgcct tcttcgatcc atatcttccg
1140gtcgagttct tggtcgatct cttccctcct ccacctcctc ctcacagggt
atgtgccctt 1200cggttgttct tggatttatt gttctaggtt gtgtagtacg
ggcgttgatg ttaggaaagg 1260ggatctgtat ctgtgatgat tcctgttctt
ggatttggga tagaggggtt cttgatgttg 1320catgttatcg gttcggtttg
attagtagta tggttttcaa tcgtctggag agctctatgg 1380aaatgaaatg
gtttagggta cggaatcttg cgattttgtg agtacctttt gtttgaggta
1440aaatcagagc accggtgatt ttgcttggtg taataaaagt acggttgttt
ggtcctcgat 1500tctggtagtg atgcttctcg atttgacgaa gctatccttt
gtttattccc tattgaacaa 1560aaataatcca actttgaaga cggtcccgtt
gatgagattg aatgattgat tcttaagcct 1620gtccaaaatt tcgcagctgg
cttgtttaga tacagtagtc cccatcacga aattcatgga 1680aacagttata
atcctcagga acaggggatt ccctgttctt ccgatttgct ttagtcccag
1740aatttttttt cccaaatatc ttaaaaagtc actttctggt tcagttcaat
gaattgattg 1800ctacaaataa tgcttttata gcgttatcct agctgtagtt
cagttaatag gtaatacccc 1860tatagtttag tcaggagaag aacttatccg
atttctgatc tccattttta attatatgaa 1920atgaactgta gcataagcag
tattcatttg gattattttt tttattagct ctcacccctt 1980cattattctg
agctgaaagt ctggcatgaa ctgtcctcaa ttttgttttc aaattcacat
2040cgattatcta tcgattatcc tcttgtatct acctgtagaa gtttcttttt
ggttattcct 2100tgactgcttg attacagaaa gaaatttatg aagctgtaat
cgggatagtt atactgcttg 2160ttcttatgat tcatttcctt tgtgcagttc
ttggtgtagc ttgccacttt caccagcaaa 2220gtttcggatc catggcctcc
accaaggtgg tcgagcacct caaggagaac gtcctctgga 2280agcaggccat
catggaccgc aacgccaaca tctccgaccc accgttcgag gagacctaca
2340agaacctcct gctcaagcac aacatcaccc cgctcaccac caccacgacc
acgacgacca 2400ccacggcgac catcgaggtg agggatctcc cactcatcga
cctctccagg ctcgtggcca 2460ccgccgccaa ggagcgcgag aactgcaaga
gggatatcgc caacgcctcc cgcgagtggg 2520gcttcttcca ggtggtgaac
cacggcatcc cgcataggat gctcgaggag atgaacaagg 2580agcaggtcaa
ggtgttccgc gagccgttca acaagaagaa gggcgacaac tgcatgaacc
2640tcaggctctc cccaggctcc tacaggtggg gctccccgac cccgaactgc
ctctcccagc 2700tctcctggtc cgaggccttc cacatcccga tgaacgacat
ctgctccaac gccccgagga 2760acattgccaa cggcaacccg aacatctcca
acctctgctc caccgtgaag cagttcgcca 2820ccaccgtgtc cgagctggcc
aacaagctcg ccaacatcct cgtcgagaag ctcggccatg 2880acgagctgac
cttcatcgag gagaagtgct ccccgaacac gtgctacctc aggatgaacc
2940gctacccgcc gtgcccaaag tactcccacg tgctcggcct catgccacat
accgactccg 3000acttcctcac catcctctac caggaccagg tgggcggcct
ccagctcgtg aaggacggcc 3060gctggatttc cgtgaagccg aacccagagg
ccctcatcgt gaacatcggc gacctcttcc 3120aggcctggtc taacggcgtg
tacaagtccg tggtgcatag ggtggtggcc aacccgaggt 3180tcgagaggtt
ctctaccgcc tacttcctct gcccgtccgg cgacgccgtg atccagtcct
3240accgcgagcc gtctatgtac cgcaagttca gcttcggcga gtacaggcag
caggtccagc 3300aggacgtgcg cgagttcggc cacaagatcg gcctctcccg
cttcctcatc tgcaagagct 3360cgaattcgca tggcgtggga taatacagac
tgtatatagg aggaataatg gtttgctgct 3420tgtagctctg taaataggaa
aatgaagctc agcttttact ttcagtcatc tagttcggta 3480gtgtaggtcg
ggtttgctga agtttggtta atgaaggctc tgtgtctctg caaattaagg
3540cgttgttctg tcaataatca tcttttttct gcaacatgct ttctttcaaa
tttgccgagt 3600tacttttgta atgatcatta atggcattgt ataatcattg
attggtcgac gataatcaat 3660tgcctgtatc acaaattcaa gactt
3685121557DNAArtificial SequenceEPSPS variant 12cccaggtgtc
ccgcatctgc aacggcgtgc agaacccatc cctcatctcc aacctctcca 60agtcctccca
gcgcaagtcc ccactctccg tgtccctcaa gacccagcaa cacccacgcg
120cctacccaat ctccagctcc tggggcctca agaagtccgg catgaccctc
atcggctccg 180agctgcgccc actcaaggtg atgtcctccg tgtccaccgc
cgagaaggcc tccgagatcg 240tgctccagcc aatccgcgag atttccggcc
tcatcaagct cccaggctcc aagtccctct 300ccaaccgcat cctcctgctc
gccgctctct ccgagggcac caccgtggtg gacaacctgc 360tcaactccga
cgacatcaac tacatgctcg acgccctcaa gcgcctcggc ctcaacgtgg
420agaccgactc cgagaacaac cgcgccgtgg tggagggctg cggcggcatc
ttcccagcct 480ccatcgattc caagtccgac atcgagctgt acctcggcaa
ctccggcacc tgcatgaggt 540cactcacggc ggcggtcacc gcggctggcg
gcaacgcctc ctacgtgctc gacggcgtgc 600caaggatgcg cgagcgccca
atcggcgacc tcgtggtggg cctcaagcaa ctcggcgccg 660acgtggagtg
caccctcggc accaactgcc caccagtgcg cgtgaacgcc aacggcggcc
720tcccaggcgg caaggtgaag ctctccggct ccatctcctc ccagtacctc
accgccctgc 780tcatgtccgc cccactcgcc ctcggcgacg tggagatcga
gatcgtggac aagctcatct 840ccgtgccata cgtggagatg accctcaagc
tcatggagcg cttcggcgtg tccgtggagc 900actccgacag ctgggaccgc
ttcttcgtga agggcggcca gaagtacaag tccccaggca 960acgcctacgt
ggagggcgac gcctcctccg cctcctactt cctcgctggc gctgccatca
1020ccggcgagac cgtgaccgtg gaggggtgcg gcaccaccag cctccaaggc
gacgtgaagt 1080tcgccgaggt gctcgagaag atgggctgca aggtgtcctg
gaccgagaac tccgtgaccg 1140tgaccggccc accaagggac gccttcggca
tgaggcacct ccgcgccatc gacgtgaaca 1200tgaacaagat gccagacgtg
gccatgaccc tcgccgtggt ggccctcttc gccgacggcc 1260caaccaccat
cagggacgtg gccagctggc gcgtgaagga gaccgagcgc atgatcgcca
1320tctgcaccga gctgagaaag ctcggcgcca ccgtcgagga gggctccgac
tactgcgtga 1380tcaccccacc aaagaaggtc aagaccgccg agatcgacac
ctacgacgac caccgcatgg 1440cgatggcctt ctccctcgcc gcctgcgccg
acgtgccgat caccatcaac gacccaggct 1500gcacccgcaa gaccttccca
gactacttcc aggtgctcga gcgcatcacc aagcact 1557131125DNAArtificial
SequenceGAO2X transgene 13atggcctcca ccaaggtggt cgagcacctc
aaggagaacg tcctctggaa gcaggccatc 60atggaccgca acgccaacat ctccgaccca
ccgttcgagg agacctacaa gaacctcctg 120ctcaagcaca acatcacccc
gctcaccacc accacgacca cgacgaccac cacggcgacc 180atcgaggtga
gggatctccc actcatcgac ctctccaggc tcgtggccac cgccgccaag
240gagcgcgaga actgcaagag ggatatcgcc aacgcctccc gcgagtgggg
cttcttccag 300gtggtgaacc acggcatccc gcataggatg ctcgaggaga
tgaacaagga gcaggtcaag 360gtgttccgcg agccgttcaa caagaagaag
ggcgacaact gcatgaacct caggctctcc 420ccaggctcct acaggtgggg
ctccccgacc ccgaactgcc tctcccagct ctcctggtcc 480gaggccttcc
acatcccgat gaacgacatc tgctccaacg ccccgaggaa cattgccaac
540ggcaacccga acatctccaa cctctgctcc accgtgaagc agttcgccac
caccgtgtcc 600gagctggcca acaagctcgc caacatcctc gtcgagaagc
tcggccatga cgagctgacc 660ttcatcgagg agaagtgctc cccgaacacg
tgctacctca ggatgaaccg ctacccgccg 720tgcccaaagt actcccacgt
gctcggcctc atgccacata ccgactccga cttcctcacc 780atcctctacc
aggaccaggt gggcggcctc cagctcgtga aggacggccg ctggatttcc
840gtgaagccga acccagaggc cctcatcgtg aacatcggcg acctcttcca
ggcctggtct 900aacggcgtgt acaagtccgt ggtgcatagg gtggtggcca
acccgaggtt cgagaggttc 960tctaccgcct acttcctctg cccgtccggc
gacgccgtga tccagtccta ccgcgagccg 1020tctatgtacc gcaagttcag
cttcggcgag tacaggcagc aggtccagca ggacgtgcgc 1080gagttcggcc
acaagatcgg cctctcccgc ttcctcatct gcaac 1125
* * * * *