U.S. patent application number 14/276577 was filed with the patent office on 2015-01-15 for polymorphisms in the human gene for the multidrug resistance-associated protein 1 (mrp-1) and their use in diagnostic and therapeutic applications.
The applicant listed for this patent is Transgenomic, Inc.. Invention is credited to Ulrich Brinkmann, Sven Hoffmeyer, Esther Mornhinweg.
Application Number | 20150018229 14/276577 |
Document ID | / |
Family ID | 8176294 |
Filed Date | 2015-01-15 |
United States Patent
Application |
20150018229 |
Kind Code |
A1 |
Brinkmann; Ulrich ; et
al. |
January 15, 2015 |
POLYMORPHISMS IN THE HUMAN GENE FOR THE MULTIDRUG
RESISTANCE-ASSOCIATED PROTEIN 1 (MRP-1) AND THEIR USE IN DIAGNOSTIC
AND THERAPEUTIC APPLICATIONS
Abstract
The present invention relates to a polymorphic MRP-1
polynucleotide, genes or vectors comprising the polynucleotides and
a host cell genetically engineered with the polynucleotide or gene.
Also provided are methods for producing molecular variant
polypeptides, cells capable of expressing a molecular variant
polypeptide and a polypeptide encoded by the polynucleotide or the
gene or obtainable by the method or cells produced herein. Also
provided is an antibody to the polypeptide, a transgenic animal,
and a solid support comprising one or a plurality of the provided
polynucleotides, genes, vectors, polypeptides, antibodies or host
cells. Furthermore, methods of identifying a polymorphism,
identifying and obtaining a pro-drug or drug or an inhibitor are
also provided. In addition, the invention relates to methods for
producing a pharmaceutical composition, diagnosing a disease and
detection of the polynucleotide. Furthermore, provided herein are
uses of the polynucleotides, genes, vectors, polypeptides or
antibodies herein.
Inventors: |
Brinkmann; Ulrich;
(Weilheim, DE) ; Hoffmeyer; Sven; (Eberfing,
DE) ; Mornhinweg; Esther; (Weilheim, DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Transgenomic, Inc. |
Omaha |
NE |
US |
|
|
Family ID: |
8176294 |
Appl. No.: |
14/276577 |
Filed: |
May 13, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13711281 |
Dec 11, 2012 |
|
|
|
14276577 |
|
|
|
|
13273856 |
Oct 14, 2011 |
|
|
|
13711281 |
|
|
|
|
11901238 |
Sep 13, 2007 |
8039211 |
|
|
13273856 |
|
|
|
|
10627253 |
Jul 24, 2003 |
|
|
|
11901238 |
|
|
|
|
PCT/EP02/00796 |
Jan 25, 2002 |
|
|
|
10627253 |
|
|
|
|
Current U.S.
Class: |
506/9 ;
435/252.3; 435/252.31; 435/252.33; 435/320.1; 435/69.1; 506/17;
530/350; 536/23.5 |
Current CPC
Class: |
C07K 14/47 20130101;
C12Q 2600/158 20130101; C12Q 2600/156 20130101; G01N 2333/705
20130101; G01N 2500/04 20130101; G01N 2800/44 20130101; C12Q
2600/106 20130101; A61P 35/00 20180101; G01N 33/6893 20130101; C12Q
1/6883 20130101 |
Class at
Publication: |
506/9 ; 536/23.5;
435/320.1; 435/69.1; 530/350; 506/17; 435/252.3; 435/252.33;
435/252.31 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07K 14/47 20060101 C07K014/47 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 26, 2001 |
EP |
01101651.6 |
Claims
1. A polynucleotide comprising a polynucleotide selected from the
group consisting of: (a) a polynucleotide having the nucleic acid
sequence of SEQ ID NO: 75, 76, 81, 82, 87, 88, 93, 94, 99, 100,
105, 106, 111, 112, 117, 118, 123, 124, 129, 130, 135, 136, 141,
142, 147, 148, 153, 154, 159, 160, 165, 166, 171, 172, 177, 178,
183, 184, 189, 190, 195, 196, 201, 202, 207, 208, 213, 214, 219,
220, 225, 226, 231, 232, 237, 238, 243, 244, 249, 250, 255, 256,
261, 262, 267, 268, 273, 274, 279, 280, 285, 286, 291, 292, 297,
298, 303, 304, 309, 310, 315, 316, 321, 322, 329, 330, 333, 334,
337, 338, 341, 342, 345, 346, 349, 350, 353, 354, 357, 358, 361,
362, 365, 366, 369, 370, 373, 374, 377, 378, 381, 382, 385, 386,
389, 390, 393, 394, 397 or 398; (b) a polynucleotide encoding a
polypeptide having the amino acid sequence of SEQ ID NO: 324, 326,
328, 401 or 403; (c) a polynucleotide capable of hybridizing to a
MRP-1 gene, wherein said polynucleotide is having a substitution or
deletion of at least one nucleotide at a position corresponding to
position 124667 of the MRP-1 gene (Accession No: AC026452), 1884,
1720 to 1723, 1163, 926, 437, 381, 233, 189, 440 or 1625 of the
MRP-1 gene (Accession No: U07050), 39508 of the MRP-1 gene (GI No:
7209451), 79, 88 or 249 of the MRP-1 gene (Accession No: AF022830),
95 or 259 of the MRP-1 gene (Accession No: AF022831), 57998, 57853
or 53282 of the MRP-1 gene (GI No: 7209451), 1377.10, 137667, 38646
or 137647 of the MRP-1 gene (Accession No: AC026452), 27159, 27258,
34206 to 34207, 34218, 34215, 55156 or 55472 of the MRP-1 gene
(Accession No: AC003026), 14008, 17970, 18195, 21133, 18067, 17900
of the MRP-1 gene (Accession No: U91318), or 150727 or 33551 of the
MRP-1 gene (Accession No: AC025277), 174 of the MRP-1 gene
(Accession No: AF022828), 248 or 258 of the MRP-1 gene (Accession
No: AF022829), 51798 or 50892 of the MRP-1 gene (Accession No: GI
3582311), 37971 of the MRP-1 gene (Accession No: GI 7363401),
55296, 55132, 55114, 55112 or 20097 to 20099 of the MRP-1 gene
(Accession No: GI 2815549), 109 to 122, 76 to 78, 73 to 78, 70 to
78, 67 to 78 or 58 to 78 of the MRP-1 gene (Accession No: GI
4826837), 60357, 61786 or 39541 of the MRP-1 gene (Accession No: GI
7209451) or a insertion of at least one nucleotide at a position
corresponding to position 55156/55157 of the MRP-1 gene (Accession
No: AC003026) or 437/438 or 926/927 of the MRP-1 gene (Accession
No: U07050) or 76437/76438 of the MRP-1 gene (Accession No: GI
7209451); (d) a polynucleotide capable of hybridizing to a MRP-1
gene, wherein said polynucleotide is having at a position
corresponding to position 124667 of the MRP-1 gene (Accession No:
AC026452) a C, at a position corresponding to position 1884 of the
MRP-1 gene (Accession No: U07050) an A, at a position corresponding
to position 1720 to 1723 of the MRP-1 gene (Accession No: U07050) a
deletion, at a position corresponding to position 1163 of the MRP-1
gene (Accession No: U07050) a T, at a position corresponding to
position 926/927 of the MRP-1 gene (Accession No: U07050) a
insertion, at a position corresponding to position 437/438 of the
MRP-1 gene (Accession No: U07050) a insertion, at a position
corresponding to position 381 of the MRP-1 gene (Accession No:
U07050) a G, at a position corresponding to position 233 of the
MRP-1 gene (Accession No: U07050) an A, at a position corresponding
to position 189 of the MRP-1 gene (Accession No: U07050) an A, at a
position corresponding to position 39508 of the MRP-1 gene (GI No:
7209451) an A, at a position corresponding to position 174 of the
MRP-1 gene (Accession No: AF022828) a T, at a position
corresponding to position 248 of the MRP-1 gene (Accession No:
AF022829) an A, at a position corresponding to position 258 of the
MRP-1 gene (Accession No: AF022829) a G, at a position
corresponding to position 79 of the MRP-1 gene (Accession No:
AF022830) an A, at a position corresponding to position 88 of the
MRP-1 gene (Accession No: AF022830) a C, at a position
corresponding to position 249 of the MRP-1 gene (Accession No:
AF022830) a G, at a position corresponding to position 95 of the
MRP-1 gene (Accession No: AF022831) a C, at a position
corresponding to position 259 of the MRP-1 gene (Accession No:
AF022831) a G, at a position corresponding to position 57998 of the
MRP-1 gene (GI No: 7209451) a T, at a position corresponding to
position 57853 of the MRP-1 gene (GI No: 7209451) a T, at a
position corresponding to position 53282 of the MRP-1 gene (GI No:
7209451) a G, at a position corresponding to position 137710 of the
MRP-1 gene (Accession No: AC026452) a G, at a position
corresponding to position 137667 of the MRP-1 gene (Accession No:
AC026452) a T, at a position corresponding to position 137647 of
the MRP-1 gene (Accession No: AC026452) a T, at a position
corresponding to position 27159 of the MRP-1 gene (Accession No:
AC003026) a C, at a position corresponding to position 27258 of the
MRP-1 gene (Accession No: AC003026) an A, at a position
corresponding to position 34206 to 34207 of the MRP-1 gene
(Accession No: AC003026) a deletion, at a position corresponding to
position 34215 of the MRP-1 gene (Accession No: AC003026) a C, at a
position corresponding to position 55156/55157 of the MRP-1 gene
(Accession No: AC003026) a insertion, at a position corresponding
to position 55472 of the MRP-1 gene (Accession No: AC003026) a C,
at a position corresponding to position 14008 of the MRP-1 gene
(Accession No: U91318) an A, at a position corresponding to
position 150727 of the MRP-1 gene (Accession No: AC025277) an A, at
a position corresponding to position 17970 of the MRP-1 gene
(Accession No: U91318) a deletion, at a position corresponding to
position 18195 of the MRP-1 gene (Accession No: U91318) an A, at a
position corresponding to position 21133 of the MRP-1 gene
(Accession No: U91318) an A, at a position corresponding to
position 34218 of the MRP-1 gene (Accession No: AC003026) an A, at
a position corresponding to position 18067 of the MRP-1 gene
(Accession No: U91318) a T, at a position corresponding to position
440 of the MRP-1 gene (Accession No: U07050) a T, at a position
corresponding to position 1625 of the MRP-1 gene (Accession No:
U07050) an A, at a position corresponding to position 17900 of the
MRP-1 gene (Accession No: U91318) a T, at a position corresponding
to position 38646 of the MRP-1 gene (Accession No: AC026452) a C,
at a position corresponding to position 33551 of the MRP-1 gene
(Accession No: AC025277) an A, at a position corresponding to
position 51798 of the MRP-1 gene (Accession No: 3582311) an G, at a
position corresponding to position 37971 of the MRP-1 gene
(Accession No: 7363401) an A, at a position corresponding to
position 50892 of the MRP-1 gene (Accession No: 358231.1) an A, at
a position corresponding to position 55296 of the MRP-1 gene
(Accession No: 2815549) an A, at a position corresponding to
position 55132 of the MRP-1 gene (Accession No: 2815549) an A, at a
position corresponding to position 55114 of the MRP-1 gene
(Accession No: 2815549) an G, at a position corresponding to
position 55112 of the MRP-1 gene (Accession No: 2815549) an G, at a
position corresponding to position 109 to 122 of the MRP-1 gene
(Accession No: 4826837) deletions, at a position corresponding to
position 76 to 78 of the MRP-1 gene (Accession No: 4826837)
deletions, at a position corresponding to position 73 to 78 of the
MRP-1 gene (Accession No: 4826837) deletions, at a position
corresponding to position 70 to 78 of the MRP-1 gene (Accession No:
4826837) deletions, at a position corresponding to position 67 to
78 of the MRP-1 gene (Accession No: 4826837) deletions, at a
position corresponding to position 58 to 78 of the MRP-1 gene
(Accession No: 4826837) deletions, at a position corresponding to
position 20097 to 20099 of the MRP-1 gene (Accession No: 2815549)
deletions, at a position corresponding to position 60357 of the
MRP-1 gene (Accession No: 7209451) a T, at a position corresponding
to position 61786 of the MRP-1 gene (Accession No: 7209451) an A,
at a position corresponding to position 76437/76438 of the MRP-1
gene (Accession No: 7209451) an insertion or at a position
corresponding to position 39541 of the MRP-1 gene (Accession No:
7209451) an A; (e) a polynucleotide encoding an MRP-1 polypeptide
or fragment thereof, wherein said polypeptide comprises an amino
acid substitution at position 329, 433 or 723 of the MRP-1
polypeptide (Accession No: P33527) or 73 or 989 of the MRP-1
polypeptide (Accession No: GI 2828206); and (f) a polynucleotide
encoding an MRP-1 polypeptide or fragment thereof, wherein said
polypeptide comprises an amino acid substitution of Phe to Cys at
position 329, Arg to Ser at position 433 or Arg to Gln at position
723 of the MRP-1 polypeptide (Accession No: P33527) or Thr to Ile
at position 73 or Ala to Thr at position 989 of the MRP-1
polypeptide (Accession No: GI 2828206).
2. The polynucleotide of claim 1, wherein said polynucleotide is
associated with a disease selected from the group consisting of
cancer diseases and multidrug resistance related diseases.
3-5. (canceled)
6. A vector comprising a polynucleotide of claim 1.
7. (canceled)
8. A host cell genetically engineered with the polynucleotide of
claim 1.
9. A method for producing a molecular variant MRP-1 polypeptide or
fragment thereof comprising (a) culturing the host cell of claim 8;
and (b) recovering said protein or fragment from the culture.
10. (canceled)
11. A polypeptide or fragment thereof encoded by a polynucleotide
comprising a polynucleotide selected from the group consisting of:
(a) a polynucleotide having the nucleic acid sequence of SEQ ID NO:
75, 76, 81, 82, 87, 88, 93, 94, 99, 100, 105, 106, 111, 112, 117,
118, 123, 124, 129, 130, 135, 136, 141, 142, 147, 148, 153, 154,
159, 160, 165, 166, 171, 172, 177, 178, 183, 184, 189, 190, 195,
196, 201, 202, 207, 208, 213, 214, 219, 220, 225, 226, 231, 232,
237, 238, 243, 244, 249, 250, 255, 256, 261, 262, 267, 268, 273,
274, 279, 280, 285, 286, 291, 292, 297, 298, 303, 304, 309, 310,
315, 316, 321, 322, 329, 330, 333, 334, 337, 338, 341, 342, 345,
346, 349, 350, 353, 354, 357, 358, 361, 362, 365, 366, 369, 370,
373, 374, 377, 378, 381, 382, 385, 386, 389, 390, 393, 394, 397 or
398; (b) a polynucleotide encoding a polypeptide having the amino
acid sequence of SEQ ID NO: 324, 326, 328, 401 or 403; (c) a
polynucleotide capable of hybridizing to a MRP-1 gene, wherein said
polynucleotide is having a substitution or deletion of at least one
nucleotide at a position corresponding to position 124667 of the
MRP-1 gene (Accession No: AC026452), 1884, 1720 to 1723, 1163, 926,
437, 381, 233, 189, 440 or 1625 of the MRP-1 gene (Accession No:
U07050), 39508 of the MRP-1 gene (GI No: 7209451), 79, 88 or 249 of
the MRP-1 gene (Accession No: AF022830), 95 or 259 of the MRP-1
gene (Accession No: AF022831), 57998, 57853 or 53282 of the MRP-1
gene (GI No: 7209451), 1377.10, 137667, 38646 or 137647 of the
MRP-1 gene (Accession No: AC026452), 27159, 27258, 34206 to 34207,
34218, 34215, 55156 or 55472 of the MRP-1 gene (Accession No:
AC003026), 14008, 17970, 18195, 21133, 18067, 17900 of the MRP-1
gene (Accession No: U91318), or 150727 or 33551 of the MRP-1 gene
(Accession No: AC025277), 174 of the MRP-1 gene (Accession No:
AF022828), 248 or 258 of the MRP-1 gene (Accession No: AF022829),
51798 or 50892 of the MRP-1 gene (Accession No: GI 3582311), 37971
of the MRP-1 gene (Accession No: GI 7363401), 55296, 55132, 55114,
55112 or 20097 to 20099 of the MRP-1 gene (Accession No: GI
2815549), 109 to 122, 76 to 78, 73 to 78, 70 to 78, 67 to 78 or 58
to 78 of the MRP-1 gene (Accession No: GI 4826837), 60357, 61786 or
39541 of the MRP-1 gene (Accession No: GI 7209451) or a insertion
of at least one nucleotide at a position corresponding to position
55156/55157 of the MRP-1 gene (Accession No: AC003026) or 437/438
or 926/927 of the MRP-1 gene (Accession No: U07050) or 76437/76438
of the MRP-1 gene (Accession No: GI 7209451); (d) a polynucleotide
capable of hybridizing to a MRP-1 gene, wherein said polynucleotide
is having at a position corresponding to position 124667 of the
MRP-1 gene (Accession No: AC026452) a C, at a position
corresponding to position 1884 of the MRP-1 gene (Accession No:
U07050) an A, at a position corresponding to position 1720 to 1723
of the MRP-1 gene (Accession No: U07050) a deletion, at a position
corresponding to position 1163 of the MRP-1 gene (Accession No:
U07050) a T, at a position corresponding to position 926/927 of the
MRP-1 gene (Accession No: U07050) insertion, at a position
corresponding to position 437/438 of the MRP-1 gene (Accession No:
U07050) a insertion, at a position corresponding to position 381 of
the MRP-1 gene (Accession No: U07050) a G, at a position
corresponding to position 233 of the MRP-1 gene (Accession No:
U07050) an A, at a position corresponding to position 189 of the
MRP-1 gene (Accession No: U07050) an A, at a position corresponding
to position 39508 of the MRP-1 gene (GI No: 7209451) an A, at a
position corresponding to position 174 of the MRP-1 gene (Accession
No: AF022828) a T, at a position corresponding to position 248 of
the MRP-1 gene (Accession No: AF022829) an A, at a position
corresponding to position 258 of the MRP-1 gene (Accession No:
AF022829) a G, at a position corresponding to position 79 of the
MRP-1 gene (Accession No: AF022830) an A, at a position
corresponding to position 88 of the MRP-1 gene (Accession No:
AF022830) a C, at a position corresponding to position 249 of the
MRP-1 gene (Accession No: AF022830) a G, at a position
corresponding to position 95 of the MRP-1 gene (Accession No:
AF022831) a C, at a position corresponding to position 259 of the
MRP-1 gene (Accession No: AF022831) a G, at a position
corresponding to position 57998 of the MRP-1 gene (GI No: 7209451)
a T, at a position corresponding to position 57853 of the MRP-1
gene (GI No: 7209451) a T, at a position corresponding to position
53282 of the MRP-1 gene (GI No: 7209451) a G, at a position
corresponding to position 137710 of the MRP-1 gene (Accession No:
AC026452) a G, at a position corresponding to position 137667 of
the MRP-1 gene (Accession No: AC026452) a T, at a position
corresponding to position 137647 of the MRP-1 gene (Accession No:
AC026452) a T, at a position corresponding to position 27159 of the
MRP-1 gene (Accession No: AC003026) a C, at a position
corresponding to position 27258 of the MRP-1 gene (Accession No:
AC003026) an A, at a position corresponding to position 34206 to
34207 of the MRP-1 gene (Accession No: AC003026) a deletion, at a
position corresponding to position 34215 of the MRP-1 gene
(Accession No: AC003026) a C, at a position corresponding to
position 55156/55157 of the MRP-1 gene (Accession No: AC003026) a
insertion, at a position corresponding to position 55472 of the
MRP-1 gene (Accession No: AC003026) a C, at a position
corresponding to position 14008 of the MRP-1 gene (Accession No:
U91318) an A, at a position corresponding to position 150727 of the
MRP-1 gene (Accession No: AC025277) an A, at a position
corresponding to position 17970 of the MRP-1 gene (Accession No:
U91318) a deletion, at a position corresponding to position 18195
of the MRP-1 gene (Accession No: U91318) an A, at a position
corresponding to position 21133 of the MRP-1 gene (Accession No:
U91318) an A, at a position corresponding to position 34218 of the
MRP-1 gene (Accession No: AC003026) an A, at a position
corresponding to position 18067 of the MRP-1 gene (Accession No:
U91318) a T, at a position corresponding to position 440 of the
MRP-1 gene (Accession No: U07050) a T, at a position corresponding
to position 1625 of the MRP-1 gene (Accession No: U07050) an A, at
a position corresponding to position 17900 of the MRP-1 gene
(Accession No: U91318) a T, at a position corresponding to position
38646 of the MRP-1 gene (Accession No: AC026452) a C, at a position
corresponding to position 33551 of the MRP-1 gene (Accession No:
AC025277) an A, at a position corresponding to position 51798 of
the MRP-1 gene (Accession No: 3582311) an G, at a position
corresponding to position 37971 of the MRP-1 gene (Accession No:
7363401) an A, at a position corresponding to position 50892 of the
MRP-1 gene (Accession No: 358231.1) an A, at a position
corresponding to position 55296 of the MRP-1 ene Accession No:
2815549 an A, at a position corresponding to position 55132 of the
MRP-1 gene (Accession No: 2815549) an A, at a position
corresponding to position 55114 of the MRP-1 gene (Accession No:
2815549) an G, at a position corresponding to position 55112 of the
MRP-1 gene (Accession No: 2815549) an G, at a position
corresponding to position 109 to 122 of the MRP-1 gene (Accession
No: 4826837) deletions, at a position corresponding to position 76
to 78 of the MRP-1 gene (Accession No: 4826837) deletions, at a
position corresponding to position 73 to 78 of the MRP-1 gene
(Accession No: 48268371 deletions, at a position corresponding to
position 70 to 78 of the MRP-1 gene (Accession No: 4826837)
deletions, at a position corresponding to position 67 to 78 of the
MRP-1 gene (Accession No: 4826837) deletions, at a position
corresponding to position 58 to 78 of the MRP-1 gene (Accession No:
4826837) deletions, at a position corresponding to position 20097
to 20099 of the MRP-1 gene (Accession No: 2815549) deletions, at a
position corresponding to position 60357 of the MRP-1 gene
(Accession No: 7209451) a T, at a position corresponding to
position 61786 of the MRP-1 gene (Accession No: 7209451) an A, at a
position corresponding to position 76437/76438 of the MRP-1 gene
(Accession No: 7209451) an insertion or at a position corresponding
to position 39541 of the MRP-1 gene (Accession No: 7209451) an A;
(e) a polynucleotide encoding an MRP-1 polypeptide or fragment
thereof, wherein said polypeptide comprises an amino acid
substitution at position 329, 433 or 723 of the MRP-1 polypeptide
(Accession No: P33527) or 73 or 989 of the MRP-1 polypeptide
(Accession No: GI 2828206); and (f) a polynucleotide encoding an
MRP-1 polypeptide or fragment thereof, wherein said polypeptide
comprises an amino acid substitution of Phe to Cys at position 329,
Arg to Ser at position 433 or Arg to Gln at position 723 of the
MRP-1 polypeptide (Accession No: P33527) or Thr to Ile at position
73 or Ala to Thr at position 989 of the MRP-1 polypeptide
(Accession No: GI 2828206).
12-16. (canceled)
17. A solid support comprising one or a plurality of the
polynucleotide of claim 1.
18-28. (canceled)
29. A method of diagnosing a disorder related to the presence of a
molecular variant of a MRP-1 gene or susceptibility to such a
disorder comprising determining the presence of a polynucleotide
comprising a polynucleotide selected from the group consisting of:
(a) a polynucleotide having the nucleic acid sequence of SEQ ID NO:
75, 76, 81, 82, 87, 88, 93, 94, 99, 100, 105, 106, 111, 112, 117,
118, 123, 124, 129, 130, 135, 136, 141, 142, 147, 148, 153, 154,
159, 160, 165, 166, 171, 172, 177, 178, 183, 184, 189, 190, 195,
196, 201, 202, 207, 208, 213, 214, 219, 220, 225, 226, 231, 232,
237, 238, 243, 244, 249, 250, 255, 256, 261, 262, 267, 268, 273,
274, 279, 280, 285, 286, 291, 292, 297, 298, 303, 304, 309, 310,
315, 316, 321, 322, 329, 330, 333, 334, 337, 338, 341, 342, 345,
346, 349, 350, 353, 354, 357, 358, 361, 362, 365, 366, 369, 370,
373, 374, 377, 378, 381, 382, 385, 386, 389, 390, 393, 394, 397 or
398; (b) a polynucleotide encoding a polypeptide having the amino
acid sequence of SEQ ID NO: 324, 326, 328, 401 or 403; (c) a
polynucleotide capable of hybridizing to a MRP-1 gene, wherein said
polynucleotide is having a substitution or deletion of at least one
nucleotide at a position corresponding to position 124667 of the
MRP-1 gene (Accession No: AC026452), 1884, 1720 to 1723, 1163, 926,
437, 381, 233, 189, 440 or 1625 of the MRP-1 gene (Accession No:
U07050), 39508 of the MRP-1 gene (GI No: 7209451), 79, 88 or 249 of
the MRP-1 gene (Accession No: AF022830), 95 or 259 of the MRP-1
gene (Accession No: AF022831), 57998, 57853 or 53282 of the MRP-1
gene (GI No: 7209451), 1377.10, 137667, 38646 or 137647 of the
MRP-1 gene (Accession No: AC026452), 27159, 27258, 34206 to 34207,
34218, 34215, 55156 or 55472 of the MRP-1 gene (Accession No:
AC003026), 14008, 17970, 18195, 21133, 18067, 17900 of the MRP-1
gene (Accession No: U91318), or 150727 or 33551 of the MRP-1 gene
(Accession No: AC025277), 174 of the MRP-1 gene (Accession No:
AF022828), 248 or 258 of the MRP-1 gene (Accession No: AF022829),
51798 or 50892 of the MRP-1 gene (Accession No: GI 3582311), 37971
of the MRP-1 gene (Accession No: GI 7363401), 55296, 55132, 55114,
55112 or 20097 to 20099 of the MRP-1 gene (Accession No: GI
2815549), 109 to 122, 76 to 78, 73 to 78, 70 to 78, 67 to 78 or 58
to 78 of the MRP-1 gene (Accession No: GI 4826837), 60357, 61786 or
39541 of the MRP-1 gene (Accession No: GI 7209451) or a insertion
of at least one nucleotide at a position corresponding to position
55156/55157 of the MRP-1 gene (Accession No: AC003026) or 437/438
or 926/927 of the MRP-1 gene (Accession No: U07050) or 76437/76438
of the MRP-1 gene (Accession No: GI 7209451); (d) a polynucleotide
capable of hybridizing to a MRP-1 gene, wherein said polynucleotide
is having at a position corresponding to position 124667 of the
MRP-1 gene (Accession No: AC026452) a C, at a position
corresponding to position 1884 of the MRP-1 gene (Accession No:
U07050) an A, at a position corresponding to position 1720 to 1723
of the MRP-1 gene (Accession No: U07050) a deletion, at a position
corresponding to position 1163 of the MRP-1 gene (Accession No:
U07050) a T, at a position corresponding to position 926/927 of the
MRP-1 gene (Accession No: U07050) a insertion, at a position
corresponding to position 437/438 of the MRP-1 gene (Accession No:
U07050) a insertion, at a position corresponding to position 381 of
the MRP-1 gene (Accession No: U07050) a G, at a position
corresponding to position 233 of the MRP-1 gene (Accession No:
U07050) an A, at a position corresponding to position 189 of the
MRP-1 gene (Accession No: U07050) an A, at a position corresponding
to position 39508 of the MRP-1 gene (GI No: 7209451) an A, at a
position corresponding to position 174 of the MRP-1 gene (Accession
No: AF022828) a T, at a position corresponding to position 248 of
the MRP-1 gene (Accession No: AF022829) an A, at a position
corresponding to position 258 of the MRP-1 gene (Accession No:
AF022829) a G, at a position corresponding to position 79 of the
MRP-1 gene (Accession No: AF022830) an A, at a position
corresponding to position 88 of the MRP-1 gene (Accession No:
AF022830) a C, at a position corresponding to position 249 of the
MRP-1 gene (Accession No: AF022830) a G, at a position
corresponding to position 95 of the MRP-1 gene (Accession No:
AF022831) a C, at a position corresponding to position 259 of the
MRP-1 gene (Accession No: AF022831) a G, at a position
corresponding to position 57998 of the MRP-1 gene (GI No: 7209451)
a T, at a position corresponding to position 57853 of the MRP-1
gene (GI No: 7209451) a T, at a position corresponding to position
53282 of the MRP-1 gene (GI No: 7209451) a G, at a position
corresponding to position 137710 of the MRP-1 gene (Accession No:
AC026452) a G, at a position corresponding to position 137667 of
the MRP-1 gene (Accession No: AC026452) a T, at a position
corresponding to position 137647 of the MRP-1 gene (Accession No:
AC026452) a T, at a position corresponding to position 27159 of the
MRP-1 gene (Accession No: AC003026) a C, at a position
corresponding to position 27258 of the MRP-1 gene (Accession No:
AC003026) an A, at a position corresponding to position 34206 to
34207 of the MRP-1 gene (Accession No: AC003026) a deletion, at a
position corresponding to position 34215 of the MRP-1 gene
(Accession No: AC003026) a C, at a position corresponding to
position 55156/55157 of the MRP-1 gene (Accession No: AC003026) a
insertion, at a position corresponding to position 55472 of the
MRP-1 gene (Accession No: AC003026) a C, at a position
corresponding to position 14008 of the MRP-1 gene (Accession No:
U91318) an A, at a position corresponding to position 150727 of the
MRP-1 gene (Accession No: AC025277) an A, at a position
corresponding to position 17970 of the MRP-1 gene (Accession No:
U91318) a deletion, at a position corresponding to position 18195
of the MRP-1 gene (Accession No: U91318) an A, at a position
corresponding to position 21133 of the MRP-1 gene (Accession No:
U91318) an A, at a position corresponding to position 34218 of the
MRP-1 gene (Accession No: AC003026) an A, at a position
corresponding to position 18067 of the MRP-1 gene (Accession No:
U91318) a T, at a position corresponding to position 440 of the
MRP-1 gene (Accession No: U07050) a T, at a position corresponding
to position 1625 of the MRP-1 gene (Accession No: U07050) an A, at
a position corresponding to position 17900 of the MRP-1 gene
(Accession No: U91318) a T, at a position corresponding to position
38646 of the MRP-1 gene (Accession No: AC026452) a C, at a position
corresponding to position 33551 of the MRP-1 gene (Accession No:
AC025277) an A, at a position corresponding to position 51798 of
the MRP-1 gene (Accession No: 3582311) an G, at a position
corresponding to position 37971 of the MRP-1 gene (Accession No:
7363401) an A, at a position corresponding to position 50892 of the
MRP-1 gene (Accession No: 358231.1) an A, at a position
corresponding to position 55296 of the MRP-1 gene (Accession No:
2815549) an A, at a position corresponding to position 55132 of the
MRP-1 gene Accession No: 2815549 an A, at a position corresponding
to position 55114 of the MRP-1 gene (Accession No: 2815549) an G,
at a position corresponding to position 55112 of the MRP-1 gene
(Accession No: 2815549) an G, at a position corresponding to
position 109 to 122 of the MRP-1 gene (Accession No: 4826837)
deletions, at a position corresponding to position 76 to 78 of the
MRP-1 gene (Accession No: 4826837) deletions, at a position
corresponding to position 73 to 78 of the MRP-1 gene (Accession No:
4826837) deletions, at a position corresponding to position 70 to
78 of the MRP-1 gene (Accession No: 4826837) deletions, at a
position corresponding to position 67 to 78 of the MRP-1 gene
(Accession No: 4826837) deletions, at a position corresponding to
position 58 to 78 of the MRP-1 gene (Accession No: 4826837)
deletions, at a position corresponding to position 20097 to 20099
of the MRP-1 gene (Accession No: 2815549) deletions, at a position
corresponding to position 60357 of the MRP-1 gene (Accession No:
7209451) a T, at a position corresponding to position 61786 of the
MRP-1 gene (Accession No: 7209451) an A, at a position
corresponding to position 76437/76438 of the MRP-1 gene Accession
No: 7209451 an insertion or at a position corresponding to position
39541 of the MRP-1 gene (Accession No: 7209451) an A; (e) a
polynucleotide encoding an MRP-1 polypeptide or fragment thereof,
wherein said polypeptide comprises an amino acid substitution at
position 329, 433 or 723 of the MRP-1 polypeptide (Accession No:
P33527) or 73 or 989 of the MRP-1 polypeptide (Accession No: GI
2828206); and (f) a polynucleotide encoding an MRP-1 polypeptide or
fragment thereof, wherein said polypeptide comprises an amino acid
substitution of Phe to Cys at position 329, Arg to Ser at position
433 or Arg to Gln at position 723 of the MRP-1 polypeptide
(Accession No: P33527) or Thr to Ile at position 73 or Ala to Thr
at position 989 of the MRP-1 polypeptide (Accession No: GI
2828206); or a polypeptide encoded by the polynucleotide in a
sample from a subject.
30-31. (canceled)
32. The method of claim 29, wherein said disorder is a cancer
disease or a disease related to multidrug resistance.
33. (canceled)
34. A method of detection of the polynucleotide of claim 1 in a
sample comprising the steps of (a) contacting a solid support
comprising one or a plurality of the polynucleotide of claim 1 with
the sample under conditions allowing interaction of the
polynucleotide of claim 1 with the immobilized targets on a solid
support and; (b) determining the binding of said polynucleotide or
said gene to said immobilized targets on a solid support.
35. An in vitro method for diagnosing a disease comprising the
steps of (a) contacting a solid support comprising one or a
plurality of a polynucleotide with a sample under conditions
allowing interaction of the polynucleotide with the immobilized
targets on a solid support and; (b) determining the binding of said
polynucleotide or said gene to said immobilized targets on a solid
support, wherein binding of said polynucleotide or gene to said
immobilized targets on said solid support is indicative for the
presence or the absence of said disease or a prevalence for said
disease; wherein the polynucleotide comprises a polynucleotide
selected from the group consisting of: (a) a polynucleotide having
the nucleic acid sequence of SEQ ID NO: 75, 76, 81, 82, 87, 88, 93,
94, 99, 100, 105, 106, 111, 112, 117, 118, 123, 124, 129, 130, 135,
136, 141, 142, 147, 148, 153, 154, 159, 160, 165, 166, 171, 172,
177, 178, 183, 184, 189, 190, 195, 196, 201, 202, 207, 208, 213,
214, 219, 220, 225, 226, 231, 232, 237, 238, 243, 244, 249, 250,
255, 256, 261, 262, 267, 268, 273, 274, 279, 280, 285, 286, 291,
292, 297, 298, 303, 304, 309, 310, 315, 316, 321, 322, 329, 330,
333, 334, 337, 338, 341, 342, 345, 346, 349, 350, 353, 354, 357,
358, 361, 362, 365, 366, 369, 370, 373, 374, 377, 378, 381, 382,
385, 386, 389, 390, 393, 394, 397 or 398; (b) a polynucleotide
encoding a polypeptide having the amino acid sequence of SEQ ID NO:
324, 326, 328, 401 or 403; (c) a polynucleotide capable of
hybridizing to a MRP-1 gene, wherein said polynucleotide is having
a substitution or deletion of at least one nucleotide at a position
corresponding to position 124667 of the MRP-1 gene (Accession No:
AC026452), 1884, 1720 to 1723, 1163, 926, 437, 381, 233, 189, 440
or 1625 of the MRP-1 gene (Accession No: U07050), 39508 of the
MRP-1 gene (GI No: 7209451), 79, 88 or 249 of the MRP-1 gene
(Accession No: AF022830), 95 or 259 of the MRP-1 gene (Accession
No: AF022831), 57998, 57853 or 53282 of the MRP-1 gene (GI No:
7209451), 1377.10, 137667, 38646 or 137647 of the MRP-1 gene
(Accession No: AC026452), 27159, 27258, 34206 to 34207, 34218,
34215, 55156 or 55472 of the MRP-1 gene (Accession No: AC003026),
14008, 17970, 18195, 21133, 18067, 17900 of the MRP-1 gene
(Accession No: U91318), or 150727 or 33551 of the MRP-1 gene
(Accession No: AC025277), 174 of the MRP-1 gene (Accession No:
AF022828), 248 or 258 of the MRP-1 gene (Accession No: AF022829),
51798 or 50892 of the MRP-1 gene (Accession No: GI 3582311), 37971
of the MRP-1 gene (Accession No: GI 7363401), 55296, 55132, 55114,
55112 or 20097 to 20099 of the MRP-1 gene (Accession No: GI
2815549), 109 to 122, 76 to 78, 73 to 78, 70 to 78, 67 to 78 or 58
to 78 of the MRP-1 gene (Accession No: GI 4826837), 60357, 61786 or
39541 of the MRP-1 gene (Accession No: GI 7209451) or a insertion
of at least one nucleotide at a position corresponding to position
55156/55157 of the MRP-1 gene (Accession No: AC003026) or 437/438
or 926/927 of the MRP-1 gene (Accession No: U07050) or 76437/76438
of the MRP-1 gene (Accession No: GI 7209451); (d) a polynucleotide
capable of hybridizing to a MRP-1 gene, wherein said polynucleotide
is having at a position corresponding to position 124667 of the
MRP-1 gene (Accession No: AC026452) a C, at a position
corresponding to position 1884 of the MRP-1 gene (Accession No:
U07050) an A, at a position corresponding to position 1720 to 1723
of the MRP-1 gene Accession No: U07050 a deletion, at a position
corresponding to position 1163 of the MRP-1 gene (Accession No:
U07050) a T, at a position corresponding to position 926/927 of the
MRP-1 gene (Accession No: U07050) a insertion, at a position
corresponding to position 437/438 of the MRP-1 gene (Accession No:
U07050) a insertion, at a position corresponding to position 381 of
the MRP-1 gene (Accession No: U07050) a G, at a position
corresponding to position 233 of the MRP-1 gene (Accession No:
U07050) an A, at a position corresponding to position 189 of the
MRP-1 gene (Accession No: U07050) an A, at a position corresponding
to position 39508 of the MRP-1 gene (GI No: 7209451) an A, at a
position corresponding to position 174 of the MRP-1 gene (Accession
No: AF022828) a T, at a position corresponding to position 248 of
the MRP-1 gene (Accession No: AF022829) an A, at a position
corresponding to position 258 of the MRP-1 gene (Accession No:
AF022829) a G, at a position corresponding to position 79 of the
MRP-1 gene (Accession No: AF022830) an A, at a position
corresponding to position 88 of the MRP-1 gene (Accession No:
AF022830) a C, at a position corresponding to position 249 of the
MRP-1 gene (Accession No: AF022830) a G, at a position
corresponding to position 95 of the MRP-1 gene (Accession No:
AF022831) a C, at a position corresponding to position 259 of the
MRP-1 gene (Accession No: AF022831) a G, at a position
corresponding to position 57998 of the MRP-1 gene (GI No: 7209451)
a T, at a position corresponding to position 57853 of the MRP-1
gene (GI No: 7209451) a T, at a position corresponding to position
53282 of the MRP-1 gene (GI No: 7209451) a G, at a position
corresponding to position 137710 of the MRP-1 gene (Accession No:
AC026452) a G, at a position corresponding to position 137667 of
the MRP-1 gene (Accession No: AC026452) a T, at a position
corresponding to position 137647 of the MRP-1 gene (Accession No:
AC026452) a T, at a position corresponding to position 27159 of the
MRP-1 gene (Accession No: AC003026) a C, at a position
corresponding to position 27258 of the MRP-1 gene (Accession No:
AC003026) an A, at a position corresponding to position 34206 to
34207 of the MRP-1 gene (Accession No: AC003026) a deletion, at a
position corresponding to position 34215 of the MRP-1 gene
(Accession No: AC003026) a C, at a position corresponding to
position 55156/55157 of the MRP-1 gene (Accession No: AC003026) a
insertion, at a position corresponding to position 55472 of the
MRP-1 gene (Accession No: AC003026) a C, at a position
corresponding to position 14008 of the MRP-1 gene (Accession No:
U91318) an A, at a position corresponding to position 150727 of the
MRP-1 gene (Accession No: AC025277) an A, at a position
corresponding to position 17970 of the MRP-1 gene (Accession No:
U91318) a deletion, at a position corresponding to position 18195
of the MRP-1 gene Accession No: U91318 an A, at a position
corresponding to position 21133 of the MRP-1 gene (Accession No:
U91318) an A, at a position corresponding to position 34218 of the
MRP-1 gene (Accession No: AC003026) an A, at a position
corresponding to position 18067 of the MRP-1 gene (Accession No:
U91318) a T, at a position corresponding to position 440 of the
MRP-1 gene (Accession No: U07050) a T, at a position corresponding
to position 1625 of the MRP-1 gene (Accession No: U07050) an A, at
a position corresponding to position 17900 of the MRP-1 gene
(Accession No: U91318) a T, at a position corresponding to position
38646 of the MRP-1 gene (Accession No: AC026452) a C, at a position
corresponding to position 33551 of the MRP-1 gene (Accession No:
AC025277) an A, at a position corresponding to position 51798 of
the MRP-1 gene (Accession No: 3582311) an G, at a position
corresponding to position 37971 of the MRP-1 gene (Accession No:
7363401) an A, at a position corresponding to position 50892 of the
MRP-1 gene (Accession No: 358231.1) an A, at a position
corresponding to position 55296 of the MRP-1 gene (Accession No:
2815549) an A, at a position corresponding to position 55132 of the
MRP-1 gene (Accession No: 2815549) an A, at a position
corresponding to position 55114 of the MRP-1 gene (Accession No:
2815549) an G, at a position corresponding to position 55112 of the
MRP-1 gene (Accession No: 2815549) an G, at a position
corresponding to position 109 to 122 of the MRP-1 gene (Accession
No: 4826837) deletions, at a position corresponding to position 76
to 78 of the MRP-1 gene (Accession No: 4826837) deletions, at a
position corresponding to position 73 to 78 of the MRP-1 gene
(Accession No: 4826837) deletions, at a position corresponding to
position 70 to 78 of the MRP-1 gene (Accession No: 4826837)
deletions, at a position corresponding to position 67 to 78 of the
MRP-1 gene (Accession No: 4826837) deletions, at a position
corresponding to position 58 to 78 of the MRP-1 gene (Accession No:
4826837) deletions, at a position corresponding to position 20097
to 20099 of the MRP-1 gene (Accession No: 28155491 deletions, at a
position corresponding to position 60357 of the MRP-1 gene
(Accession No: 7209451) a T, at a position corresponding to
position 61786 of the MRP-1 gene (Accession No: 7209451) an A, at a
position corresponding to position 76437/76438 of the MRP-1 gene
(Accession No: 7209451) an insertion or at a position corresponding
to position 39541 of the MRP-1 gene (Accession No: 7209451) an A;
(e) a polynucleotide encoding an MRP-1 polypeptide or fragment
thereof, wherein said polypeptide comprises an amino acid
substitution at position 329, 433 or 723 of the MRP-1 polypeptide
(Accession No: P33527) or 73 or 989 of the MRP-1 polypeptide
(Accession No: GI 2828206); and (f) a polynucleotide encoding an
MRP-1 polypeptide or fragment thereof, wherein said polypeptide
comprises an amino acid substitution of Phe to Cys at position 329,
Arg to Ser at position 433 or Arg to Gln at position 723 of the
MRP-1 polypeptide (Accession No: P33527) or Thr to Ile at position
73 or Ala to Thr at position 989 of the MRP-1 polypeptide
(Accession No: GI 2828206).
36. A diagnostic composition comprising the polynucleotide of claim
1.
37-41. (canceled)
42. A diagnostic kit for detection of a single nucleotide
polymorphism comprising the polynucleotide of claim 1 or the solid
support comprising one or a plurality of the polynucleotide of
claim 1.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 13/711,281, filed Dec. 11, 2012, which, in turn, is a
continuation of U.S. application Ser. No. 13/273,856, filed Oct.
14, 2011, which is a continuation of U.S. application Ser. No.
11/901,238, filed Sep. 13, 2007, the entire contents of which are
expressly incorporated herein by reference. U.S. application Ser.
No. 11/901,238 is a continuation of U.S. application Ser. No.
10/627,253, filed Jul. 24, 2003, now abandoned, which is a
continuation of International Application PCT/EP02/00796, filed
Jan. 25, 2002, which in turn, claims priority to EP Application No.
01101651.6, filed Jan. 26, 2001.
[0002] The present invention relates to a polymorphic MRP-1
polynucleotide. Moreover, the invention relates to genes or vectors
comprising the polynucleotides of the invention and to a host cell
genetically engineered with the polynucleotide or gene of the
invention. Further, the invention relates to methods for producing
molecular variant polypeptides or fragments thereof, methods for
producing cells capable of expressing a molecular variant
polypeptide and to a polypeptide or fragment thereof encoded by the
polynucleotide or the gene of the invention or which is obtainable
by the method or from the cells produced by the method of the
invention. Furthermore, the invention relates to an antibody which
binds specifically the polypeptide of the invention. Moreover, the
invention relates to a transgenic non-human animal. The invention
also relates to a solid support comprising one or a plurality of
the above mentioned polynucleotides, genes, vectors, polypeptides,
antibodies or host cells. Furthermore, methods of identifying a
polymorphism, identifying and obtaining a pro-drug or drug or an
inhibitor are also encompassed by the present-invention. In
addition, the invention relates to methods for producing of a
pharmaceutical composition and to methods of diagnosing a disease.
Further, the invention relates to a method of detection of the
polynucleotide of the invention. Furthermore, comprised by the
present invention are a diagnostic and a pharmaceutical
composition. Even more, the invention relates to uses of the
polynucleotides, genes, vectors, polypeptides or antibodies of the
invention. Finally, the invention relates to a diagnostic kit.
[0003] The human multidrug resistance-associated protein (MRP)
family, a subfamily of the ATP-binding cassette (ABC) protein
superfamily, currently contains seven members. ABC proteins are
composed of transmembrane domains (TMD's), and nucleotide binding
domains (NBD's, or ATP-binding cassettes). The ability of several
of these membrane proteins to transport a wide range of anticancer
drugs out of cells and their expression in many tumor types, make
them to possible candidates involved in unexplained cases of drug
resistance (Borst et al. 2000, J Natl Cancer Inst 92 (16):
1295-1302; Borst et al. 1999, Biochimica et Biophysica Acta 1461:
347-357; Klein et al. 1999, Biochimica et Biophysica Acta 1461:
237-262).
[0004] One member of the human MRP family is MRP-1. The gene spans
at least 200 kb and contains 31 exons. Several alternatively
spliced variants of the MRP-1 mRNA could be characterized. The
MRP-1 gene, encodes an integral membrane protein of 190 kDa whose
function is the energy dependent export of substances from the
inside of cells, and from membranes, to the outside. In contrast to
P-glycoprotein that is invariably located in the apical membrane of
epithelial cells, MRP-1 is located basolaterally and, therefore,
tends to pump drugs into the body. The protein is present in many
normal tissues and occurs mainly in lung, testis and muscle and
very low in liver. The MRP-1 protein is located in plasma membranes
in different tissues, like kidney and liver (Grant et al. 1997,
Genomics 45: 368-378; Klein et al. 1999, Biochimica et Biophysica
Acta 1461, 237-262; Cole and Deeley 1998, BioEssays 20: 931-940;
Borst et al. 1999, Biochimica et Biophysica Acta 1461: 347-357). In
addition it could be shown, that beside P-glycoprotein likewise
MRP-1 is expressed in the epithelia of the choroid plexus (CP), in
which the blood-cerebrospinal-fluid (CSF) drug permeability barrier
is localized. The function of this blood-brain barrier is to
isolate the brain from circulating drugs, toxins and xenobiotics.
MRP-1 contributes to the basolateral broad-specificity
drug-permeation barrier in CP (Rao et al. 1999, Proc. Natl. Acad.
Sci. USA 96: 3900-3905).
[0005] In contrast to P-glycoprotein and to other members of the
MRP family (MRP-4 and MRP-5), e.g. MRP-2 and MRP-1 possesses an
additional N-terminal transmembrane domain (TMD0). Thus, these
proteins contain two characteristic hydrophilic, cytosolic
ATP-binding domains (NBD's) and 3 hydrophobic transmembrane
domains, which include totally 17 transmembrane segments. This is
designated as TMD0(TMD-ABC)2 arrangement (Klein et al. 1999,
Biochimica et Biophysica Acta 1461: 237-262). The NBD's are
characterized by two sequence motifs, designated "Walker A" and
"Walker B". Mutational analysis of a number of ABC proteins
indicates that these two regions are critical for ATPase function
(Walker et al. 1982, EMBO J. 1: 945-951; Schneider et al. 1998,
FEMS Microbiol. Rev. 22: 1-20). Within the Walker A motif there
exists a conserved lysine residue (GX.sub.4GKS/T), which is
essential in both nucleotide binding domains for full transport
function. This is consistent with the role of this consensus
sequence as the amino acid acceptor site of the phosphoryl moiety
of the nucleotide. In addition, ABC transporters possess a
characteristic conserved "active transport family" signature (or
"C") motif encompassing 14 amino acids (LSSGGQX.sub.3RHydXHydA)
(SEQ ID NO: 406). This region is located between the Walker A and B
motifs. A possible significance of this motif referring to the
binding and hydrolysis of nucleotide could be deduced from the
observation, that it is highly conserved in NBD1, but not in NBD2
of the MRP-related proteins. This is in contrast to observations,
which point to a invariant nature of this motif in NBD1 and NBD2 in
P-glycoproteins (Cole and Deeley 1998 Bio Essays 20: 931-940).
[0006] MRP-1 and the other members of the MRP family all contain a
highly conserved "deletion" of 13 amino acids located between the
Walker A and B motifs in NBD1, which alters the spacing between the
two Walker motifs in the first nucleotide binding domain. Recent
studies have shown, that this deletion affects the folding and
activity of this domain (Hipfner et al. 1999, J. Biol. Chem. 274
(22): 15420-6). In contrast to the NBD's, the transmembrane domains
of the ABC transporters are highly divergent. This sequence
divergence is consistent with the notion that the transmembrane
domains are important determinants of the different substrate
specificities of various ABC transporters (Ueda et al. 1997, Semin.
Cancer Biol. 8 (3): 151-159; Hrycyna et al. 1998, J. Biol. Chem.:
273 (27): 16631-4). The study of post-translational modification of
the MRP-1 protein by limited proteolysis and site-directed
mutagenesis revealed, that the protein is glycosylated at Asn 19
and Asn 23 in the NH2-terminal transmembrane domain and at Asn 1006
in the COOH-proximal transmembrane domain (Hipfner et al. 1997, J.
Biol. Chem. 272 (38): 23623-30). Interestingly, recent studies of
deletion mutants of MRP-1, by the removal of the full TMD0 region,
indicated that this region is neither required for the transport
function of MRP-1 nor for its proper routing to the lateral plasma
membrane compartment (Bakos et al. 1998, J. Biol. Chem. 273:
32167-32175).
[0007] The members of the MRP family transport anionic drugs, like
methotrexate, neutral drugs conjugated to acidic ligands, such as
glutathione (GSH), glucuronate, or sulfate. While for MRP-2 the
major physiologic function is the transport of bilirubin
glucuronides and other organic anions from liver into bile, for
MRP-1 it is the transport of the cysteinyl leukotriene LTC.sub.4.
This is an important chemical mediator of inflammatory responses in
receptor-mediated signal transduction pathways that control
vascular permeability and smooth muscle contraction. So far no
major physiologic function is known for the other members of the
MRP family. MRP-1, -2 and -3 can additionally cause resistance to
neutral organic drugs that are not known to be conjugated to acidic
ligands by transporting these drugs together with free GSH (Borst
et al. 2000, J Natl Cancer Inst 92 (16): 1295-1302; Hipfner et al.
19999, Biochimica et Biophysica Acta 1461: 359-376). Although
MRP-1, MRP-2 and MRP-3 have many common substrates, the three
transport proteins may differ in their relative affinities for
individual compounds. LTC.sub.4 remains the highest affinity
substrate known for MRP-1. In addition to the cysteinyl leukotriene
LTC.sub.4 many of the identified endogenous MRP-1 substrates, like
glutathione disulfide (GSSG) or bilirubin glucuronides are well
characterized MRP-2 substrates (Heijn et al. 1997, Biochim,
Biophys, Acta 13261; 12-22; Jedlitschky et al. 1997, Biochem. J.
327; 305-310). Beside LTC.sub.4 the preferred substrates of MRP-1
are organic anions, like drugs conjugated to glutathione (GSH),
glucuronate, or sulfate. MRP-1 transports for example substrates,
such as methotrexate (MTX) or arsenite (H.sub.3AsO.sub.3). Likewise
a variety of other GSH-conjugated xenobiotics, including conjugates
of the activated forms of the potent carcinogen aflatoxin B1 can be
actively transported by MRP-1, suggesting a protective role of
MRP-1 in chemical carcinogenesis (Loe at al. 1997, Mo. Pharmacol.
51 (6): 1034-41). In contrast to that, P-Glycoprotein has a low
affinity for such negatively charged compounds.
[0008] Glutathione conjugation by GSTs and transport of glutathione
S-conjugates out of cells into the extracellular space by MRP-1
have been shown to work as a system in the detoxification of many
xenobiotics among them many anticancer drugs (Zhang et al., 1998,
Int J One 12: 871-882). Because of that, the degree of expression
and the functionality of the MRP-1 gene product can affect the
therapeutic effectiveness of such agents. This is of particular
importance in cancer therapy where high MRP-1, as well as P-gp
expression and activity correlate with the resistance of cancer
cells against chemotherapeutic drugs (Gottesman et al. 1996, Curr.
Biol. 6: 610-617; Nooter and Stoter 1996, Path. Res. Pract. 192:
768-780).
[0009] Utilization of chemotherapy for the treatment of tumors can
be limited by its hematological toxicity. Transduction of
hematopoietic progenitors with the multidrug resistance 1 (MDR-1)
or with the MRP-1 gene should provide protection from toxic effects
of chemotherapeutic agents. The interest in the use of MRP-1 as an
alternative to MDR-1 for bone marrow protection lies in its
different modulation.
[0010] Because MRP-1 expression is not reversed by agents, that
decrease MDR-1 tumor resistance, these reversal agents can be used
without reversing bone marrow (BM) protection of the MRP-1
transduced hematopoietic cells. These transduced cells have shown
increased resistance to doxorubicin, vincristine and etoposide. In
mice, a retrovirus-mediated MRP-1 gene transfer into hematopoietic
cells leads to a protection from chemotherapy-induced leukopenia
(Machiels et al. 1999, Hum Gene Ther 10 (5): 801-11; D'Hondt et al.
1997, Hum Gene Ther 8 (15): 1745-51).
[0011] For understanding the physiological mechanisms of action of
MRP-1, such as mechanisms by which MRP-1 transports compounds and
mediates multidrug resistance, mrp-1 knockout models in vitro, as
well as in vivo have been generated (Wijnholds et al. 1997, Nat Med
3: 1275-1279). Because both the human and murine MRP-1 have an 88%
amino acid identity and both can induce multidrug resistance when
their respective cDNA's are transfected into drug-sensitive cells,
it is conceivable that results from knockout studies can be
transferred to humans (Stride et al. 1997, Mol Pharmacol 52:
344-353). A total block of the murine mrp-1 has been found to be
compatible with life, suggesting that MRP-1 inhibitors can be
safely used for treating cancer patients. The studies with mrp-1
knockout mice have given detailed insights in the MRP-1 transport
characteristics, so that this protein catalyzes both the export of
certain glutathione-S-conjugates and a cotransport of GSH and drugs
or endogenous metabolites (Rappa et al. 1999, Biochem Pharmacol 58:
557-562).
[0012] Different forms of multidrug resistance (MDR) have been
characterized. The classical MDR is defined by overexpression of
P-glycoprotein, while the non-Pgp MDR phenotype has typically no
expression of P-glycoprotein, but is caused by an overexpression of
MRP-1. Such an overexpression has been observed so far in
multidrug-resistant cell lines derived from many different tissue
and tumor types, including both small cell and large cell lung
cancer, carcinomas of the colon, breast, bladder, prostate, thyroid
and cervix, glioma, neuroblastoma, fibrosarcoma, and various forms
of leukemia (Hipfner et al. 1999, Biochimica et Biophysica Acta
1461: 359-376). Furthermore a cell line from renal cell carcinoma
(RCC) could be established, which show resistance to adriamycin and
epirubicin, in addition the cells demonstrated cross-resistance to
cisplatin and 5-fluororubicin. Beside elevated MDR-1, GST-pi and
topoisomerase II mRNA levels, likewise the mRNA content for MRP-1
was higher than in a control cell line (Yu et al. 2000, Urol. Res.
28 (2): 86-92).
[0013] Multidrug resistance caused by MRP-1 and P-gp is
characterized by an ATP-dependent reduction in drug accumulation.
In respect to the drug resistance profiles of transfected cells,
which overexpress P-gp or MRP-1 it could be shown that the
substrate specificity of MRP-1 and P-glycoprotein is similar.
[0014] MRP-1 transfected mammalian cells are resistant to
anthracyclines, such as doxorubicin and daunorubicin, to vinca
alkaloids, such as vincristine and to the etoposide VP-16. The
transfected cells accumulate lower levels of these drugs than do
control cells (Zhu et al. 1997, Oncol. Res. 9: 229-236). In
addition resistance to the vinca alkaloid vinblastine, to
colchicine and to the taxane paclitaxel have been observed, but to
a rather lower extent in MRP-1 transfected cells than in P-gp
overexpressing cells. The basis of this differential sensitivity is
still unknown. MRP-1 also confers resistance to certain antimonial
and arsenical oxyanions (Cole et al. 1994, Cancer Res. 54:
5902-10).
[0015] Considerable interest exists in elucidating the potential
involvement of MRP-1 in clinical MDR. For the analysis of the MRP-1
expression levels and its localization within both normal and
malignant tissues, a number of different MRP-1 antibodies have been
used in immunoassays (Flens et al. 1994, Cancer Res. 54 (17):
4557-63; Hipfner et al. 1994, Cancer Res. 54 (22): 5788-92). The
expression of the MRP1 protein and/or mRNA has been detected in
almost every tumor type examined. In the following some examples of
the tumor types, which were analyzed: solid tumors, such as lung
tumors, neuroblastoma, melanoma, retinoblastoma, breast and
prostate cancer, as well as hematological malignancies (Takebayashi
et al. 1998, Cancer 82 (4): 661-666; Campling et al. 1997, Clin.
Cancer Res. 3 (1): 115-22; Sullivan et al. 1998, Clin. Cancer Res.
4 (6): 1393-1403; Filipits et al. 1997, Leukemia 11 (7): 1073-7).
Among the common tumor types, expression of high levels of MRP1 is
particularly frequent in the major histologic forms of non-small
cell lung cancer. These studies suggest that MRP1 may be involved
in multidrug resistance of some tumor types or subgroups of
patients, but up to now no comprehensive picture of the general
relevance of this protein to clinical multidrug resistance has
defined (Hipfner et al. 1999, Biochimica et Biophysica Acta 1461:
359-376).
[0016] Nevertheless several studies have detected MRP-1 expression
levels to be of prognostic significance. In, childhood
neuroblastoma it could be shown, that the amplification of the
N-myc oncogene is a powerful indicator of poor response to
chemotherapy and poor outcome. The analysis of neuroblastoma tumor
samples revealed significantly higher MRP-1 mRNA levels in tumors
with N-myc amplification, than in tumors without such an
amplification. In addition a correlation between levels of MRP-1
mRNA and a reduced survival rate independent of the N-myc
amplification could be found (Norris et al. 1996, N. Engl. J. Med.
334 (4): 231-8).
[0017] The potential role of drug transporters in clinical
multidrug resistance has lead to a search for strategies, which
allow either an inhibition of these drug pumps, or a reduction of
the expression in cancer patients. In respect to MRP's the attempts
to find inhibitors have concentrated to MRP-1 and MRP-2. Examples
of potent competitive inhibitors are high affinity substrates, such
as leukotriene C4, S-decylglutathione and the leukotriene D4
antagonist MK571. Other inhibitors are organic acids, such as
probenecid and benzobromarone, which were originally developed to
inhibit transport of uric acid (Borst et al. 2000, J Natl Cancer
Inst 92 (16): 1295-1302). Furthermore experiments using polarized
cell lines and ovarian carcinoma cells, both stably expressing
MRP-1 cDNA have revealed, that V-104 (a pipecolinate derivative)
partially inhibits daunorubicin transport by MRP-1. In addition
this agent reverses etoposide resistance of MRP-1 expressing
ovarian cancer cells (Evers et al. 2000, Br. J. Cancer 83 (3):
366-74). Another promising strategy for overcoming MRP-1 induced
multidrug resistance is to use antisense oligonucleotides against
this drug transporter. In MRP-1 transfected HeLa cells the
treatment with an antisense oligonucleotide, targeted to the coding
region of the MRP-1 mRNA results in a greater than 90% reduction of
the MRP-1 mRNA level. Under these conditions an increased
sensitivity to doxorubicin was observed (Stewart et al. 1996,
Biochem. Pharmacol. 51 (4): 461-9). The findings concerning these
two strategies have potential implications for the treatment of
drug-resistant tumors.
[0018] Thus, means and methods for diagnosing and treating a
variety of diseases and disorders based on dysfunctions or
dysregulations of drug transport, were not available yet but are
nevertheless highly desirable. Thus, the technical problem
underlying the present invention is to comply with the above
specified needs.
[0019] The solution to this technical problem is achieved by
providing the embodiments characterized in the claims.
[0020] Accordingly, the present invention relates to a
polynucleotide comprising a polynucleotide selected from the group
consisting of: [0021] (a) a polynucleotide having the nucleic acid
sequence of SEQ ID NO: 75, 76, 81, 82, 87, 88, 93, 94, 99, 100,
105, 106, 111, 112, 117, 118, 123, 124, 129, 130, 135, 136, 141,
142, 147, 148, 153, 154, 159, 160, 165, 166, 171, 172, 177, 178,
183, 184, 189, 190, 195, 196, 201, 202, 207, 208, 213, 214, 219,
220, 225, 226, 231, 232, 237, 238, 243, 244, 249, 250, 255, 256,
261, 262, 267, 268, 273, 274, 279, 280, 285, 286, 291, 292, 297,
298, 303, 304, 309, 310, 315, 316, 321, 322, 329, 330, 333, 334,
337, 338, 341, 342, 345, 346, 349, 350, 353, 354, 357, 358, 361,
362, 365, 366, 369, 370, 373, 374, 377, 378, 381, 382, 385, 386,
389, 390, 393, 394, 397 or 398; [0022] (b) a polynucleotide
encoding a polypeptide having the amino acid sequence of SEQ ID NO:
324, 326, 328, 401 or 403; [0023] (c) a polynucleotide capable of
hybridizing to a MRP-1 gene, wherein said polynucleotide is having
a substitution or deletion of at least one nucleotide at a position
corresponding to position 124667 of the MRP-1 gene (Accession No:
AC026452), 1884, 1720 to 1723, 1163, 926, 437, 381, 233, 189, 440
or 1625 of the MRP-1 gene (Accession No: U07050), 39508 of the
MRP-1 gene (GI No: 7209451), 79, 88 or 249 of the MRP-1 gene
(Accession No: AF022830), 95 or 259 of the MRP-1 gene (Accession
No: AF022831), 57998, 57853 or 53282 of the MRP-1 gene (GI No:
7209451), 137710, 137667, 38646 or 137647 of the MRP-1 gene
(Accession No: AC026452), 27159, 27258, 34206 to 34207, 34218,
34215, 55156 or 55472 of the MRP-1 gene (Accession No: AC003026),
14008, 17970, 18195, 21133, 18067, 17900 of the MRP-1 gene
(Accession No: U91318), or 150727 or 33551 of the MRP-1 gene
(Accession No: AC025277), 174 of the MRP-1 gene (Accession No:
AF022828), 248 or 258 of the MRP-1 gene (Accession No: AF022829),
51798 or 50892 of the MRP-1 gene (Accession No: GI 3582311), 37971
of the MRP-1 gene (Accession No: GI 7363401), 55296, 55132, 55114,
55112 or 20097 to 20099 of the MRP-1 gene (Accession No: GI
2815549), 109 to 122, 76 to 78, 73 to 78, 70 to 78, 67 to 78 or 58
to 78 of the MRP-1 gene (Accession No: GI 4826837), 60357, 61786 or
39541 of the MRP-1 gene (Accession No: GI 7209451) or a insertion
of at least one nucleotide at a position corresponding to position
55156/55157 of the MRP-1 gene (Accession No: AC003026), 437/438 or
926/927 of the MRP-1 gene (Accession No: U07050) or 76437/76438 of
the MRP-1 gene (Accession No: GI 7209451); [0024] (d) a
polynucleotide capable of hybridizing to a MRP-1 gene, wherein said
polynucleotide is having at a position corresponding to position
124667 of the MRP-1 gene (Accession No: AC026452) a C, at a
position corresponding to position 1884 of the MRP-1 gene
(Accession No: U07050) an A, at a position corresponding to
position 1720 to 1723 of the MRP-1 gene (Accession No: U07050) a
deletion, at a position corresponding to position 1163 of the MRP-1
gene (Accession No: U07050) a T, at a position corresponding to
position 926/927 of the MRP-1 gene (Accession No: U07050) a
insertion, at a position corresponding to position 437/438 of the
MRP-1 gene (Accession No: U07050) a insertion, at a position
corresponding to position 381 of the MRP-1 gene (Accession No:
007050) a G, at a position corresponding to position 233 of the
MRP-1 gene (Accession No: U07050) an A, at a position corresponding
to position 189 of the MRP-1 gene (Accession No: U07050) an A, at a
position corresponding to position 39508 of the MRP-1 gene (GI No:
7209451) an A, at a position corresponding to position 174 of the
MRP-1 gene (Accession No: AF022828) a T, at a position
corresponding to position 248 of the MRP-1 gene (Accession No:
AF022829) an A, at a position corresponding to position 258 of the
MRP-1 gene (Accession No: AF022829) a G, at a position
corresponding to position 79 of the MRP-1 gene (Accession No:
AF022830) an A, at a position corresponding to position 88 of the
MRP-1 gene (Accession No: AF022830) a C, at a position
corresponding to position 249 of the MRP-1 gene (Accession No:
AF022830) a G, at a position corresponding to position 95 of the
MRP-1 gene (Accession No: AF022831) a C, at a position
corresponding to position 259 of the MRP-1 gene (Accession No:
AF022831) a G, at a position corresponding to position 57998 of the
MRP-1 gene (GI No: 7209451) a T, at a position corresponding to
position 57853 of the MRP-1 gene (GI No: 7209451) a T, at a
position corresponding to position 53282 of the MRP-1 gene (GI No:
7209451) a G, at a position corresponding to position 137710 of the
MRP-1 gene (Accession No: AC026452) a G, at a position
corresponding to position 137667 of the MRP-1 gene (Accession No:
AC026452) a T, at a position corresponding to position 137647 of
the MRP-1 gene (Accession No: AC026452) a T, at a position
corresponding to position 27159 of the MRP-1 gene (Accession No:
AC003026) a C, at a position corresponding to position 27258 of the
MRP-1 gene (Accession No: AC003026) an A, at a position
corresponding to position 34206 to 34207 of the MRP-1 gene
(Accession No: AC003026) a deletion, at a position corresponding to
position 34215 of the MRP-1 gene (Accession No: AC003026) a C, at a
position corresponding to position 55156/55157 of the MRP-1 gene
(Accession No: AC003026) a insertion, at a position corresponding
to position 55472 of the MRP-1 gene (Accession No: AC003026) a C,
at a position corresponding to position 14008 of the MRP-1 gene
(Accession No: U91318) an A, at a position corresponding to
position 150727 of the MRP-1 gene (Accession No: AC025277) an A, at
a position corresponding to position 17970 of the MRP-1 gene
(Accession No: U91318) a deletion, at a position corresponding to
position 18195 of the MRP-1 gene (Accession No: U91318) an A, at a
position corresponding to position 21133 of the MRP-1 gene
(Accession No: U91318) an A, at a position corresponding to
position 34218 of the MRP-1 gene (Accession No: AC003026) an A, at
a position corresponding to position 18067 of the MRP-1 gene
(Accession No: U91318) a T, at a position corresponding to position
440 of the MRP-1 gene (Accession No: U07050) a T, at a position
corresponding to position 1625 of the MRP-1 gene (Accession No:
U07050) an A, at a position corresponding to position 17900 of the
MRP-1 gene (Accession No: U91318) a T, at a position corresponding
to position 38646 of the MRP-1 gene (Accession No: AC026452) a C,
at a position corresponding to position 33551 of the MRP-1 gene
(Accession No: AC025277) an A, at a position corresponding to
position 51798 of the MRP-1 gene (Accession No: 3582311) an G, at a
position corresponding to position 37971 of the MRP-1 gene
(Accession No: 7363401) an A, at a position corresponding to
position 50892 of the MRP-1 gene (Accession No: 3582311) an A, at a
position corresponding to position 55296 of the MRP-1 gene
(Accession No: 2815549) an A, at a position corresponding to
position 55132 of the MRP-1 gene (Accession No: 2815549) an A, at a
position corresponding to position 55114 of the MRP-1 gene
(Accession No: 2815549) an G, at a position corresponding to
position 55112 of the MRP-1 gene (Accession No: 2815549) an G, at a
position corresponding to position 109 to 122 of the MRP-1 gene
(Accession No: 4826837) deletions, at a position corresponding to
position 76 to 78 of the MRP-1 gene (Accession No: 4826837)
deletions, at a position corresponding to position 73 to 78 of the
MRP-1 gene (Accession No: 4826837) deletions, at a position
corresponding to position 70 to 78 of the MRP-1 gene (Accession No:
4826837) deletions, at a position corresponding to position 67 to
78 of the MRP-1 gene (Accession No: 4826837) deletions, at a
position corresponding to position 58 to 78 of the MRP-1 gene
(Accession No: 4826837) deletions, at a position corresponding to
position 20097 to 20099 of the MRP-1 gene (Accession No: 2815549)
deletions, at a position corresponding to position 60357 of the
MRP-1 gene (Accession No: 7209451) a T, at a position corresponding
to position 61786 of the MRP-1 gene (Accession No: 7209451) an A,
at a position corresponding to position 76437/76438 of the MRP-1
gene (Accession No: 7209451) an insertion or at a position
corresponding to position 39541 of the MRP-1 gene (Accession No:
7209451) an A; [0025] (e) a polynucleotide encoding an MRP-1
polypeptide or fragment thereof, wherein said polypeptide comprises
an amino acid substitution at position 329, 433 or 723 of the MRP-1
polypeptide (Accession No: P33527) or 73 or 989 of the MRP-1
polypeptide (Accession No: GI 2828206); and [0026] (f) a
polynucleotide encoding an MRP-1 polypeptide or fragment thereof,
wherein said polypeptide comprises an amino acid substitution of
Phe to Cys at position 329, Arg to Ser at position 433 or Arg to
Gln at position 723 of the MRP-1 polypeptide (Accession No: P33527)
or Thr to Ile at position 73 or Ala to Thr at position 989 of the
MRP-1 polypeptide (Accession No: GI 2828206).
[0027] In the context of the present invention the term
"polynucleotides" or the term "polypeptides" refers to different
variants of a polynucleotide or polypeptide. Said variants comprise
a reference or wild type sequence of the polynucleotides or
polypeptides of the invention as well as variants which differ
therefrom in structure or composition. Reference or wild type
sequences for the polynucleotides are Accession No: U07050,
AF022828, AF022829, AF022830, AF022831, AC026452, AC003026, U91318,
AC025277 or GI No: 7209451. Reference or wild type sequence for the
polypeptides of the invention is Accession No: P33527. The
differences in structure or composition usually occur by way of
nucleotide or amino acid substitution(s), addition(s) and/or
deletion(s). Preferred deletions in accordance with the invention
are a GGTA deletion at a position corresponding to position 1720 to
1723 of the MRP-1 gene (Accession No: U07050), an AT deletion at a
position corresponding to position 34206 to 34207 of the MRP-1 gene
(Accession No: AC003026) or a T deletion at a position
corresponding to position 17970 of the MRP-1 gene (Accession No:
U91318), preferred insertions are a TCCTTCC insertion at a position
corresponding to position 437/438 of the MRP-1 gene (Accession No:
U07050), a TGGGGC insertion at a position corresponding to position
55156/55157 of the MRP-1 gene (Accession No: AC003026) or a T
insertion at a position corresponding to position 926/927 of the
MRP-1 gene (Accession No: U07050). Preferably, said nucleotide
substitution(s), addition(s) or deletion(s) comprised by the
present invention result(s) in one or more changes of the
corresponding amino acid(s) of the polypeptides of the invention.
The variant polynucleotides and polypeptides also comprise
fragments of said polynucleotides or polypeptides of the invention.
The polynucleotides and polypeptides as well as the aforementioned
fragments thereof of the present invention are characterized as
being associated with a MRP-1 dysfunction or dysregulation
comprising, e.g., insufficient and/or altered drug uptake. Said
dysfunctions or dysregulations referred to in the present invention
cause a disease or disorder or a prevalence for said disease or
disorder. Preferably, as will be discussed below in detail, said
disease is cancer or diseases related to multidrug resistance or
any other disease caused by a dysfunction or dysregulation due to a
polynucleotide or polypeptides of the invention, also referred to
as MRP-1 gene associated diseases in the following.
[0028] The term "hybridizing" as used herein refers to
polynucleotides which are capable of hybridizing to the
polynucleotides of the invention or parts thereof which are
associated with a MRP-1 dysfunction or dysregulation. Thus, said
hybridizing polynucleotides are also associated with said
dysfunctions and dysregulations. Preferably, said polynucleotides
capable of hybridizing to the polynucleotides of the invention or
parts thereof which are associated with MRP-1 dysfunctions or
dysregulations are at least 70%, at least 80%, at least 95% or at
least 100% identical to the polynucleotides of the invention or
parts thereof which are associated with MRP-1 dysfunctions or
dysregulations. Therefore, said polynucleotides may be useful as
probes in Northern or Southern Blot analysis of RNA or DNA
preparations, respectively, or can be used as oligonucleotide
primers in PCR analysis dependent on their respective size. Also
comprised by the invention are hybridizing polynucleotides which
are useful for analysing DNA-Protein interactions via, e.g.,
electrophoretic mobility shift analysis (EMSA). Preferably, said
hybridizing polynucleotides comprise at least 10, more preferably
at least 15 nucleotides in length while a hybridizing
polynucleotide of the present invention to be used as a probe
preferably comprises at least 100, more preferably at least 200, or
most preferably at least 500 nucleotides in length.
[0029] It is well known in the art how to perform hybridization
experiments with nucleic acid molecules, i.e. the person skilled in
the art knows what hybridization conditions s/he has to use in
accordance with the present invention. Such hybridization
conditions are referred to in standard text books such as Molecular
Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989)
N.Y. Preferred in accordance with the present inventions are
polynucleotides which are capable of hybridizing to the
polynucleotides of the invention or parts thereof which are
associated with a MRP-1 dysfunction or dysregulation under
stringent hybridization conditions, i.e. which do not cross
hybridize to unrelated polynucleotides such as polynucleotides
encoding a polypeptide different from the MRP-1 polypeptides of the
invention.
[0030] The term "corresponding" as used herein means that a
position is not only determined by the number of the preceding
nucleotides and amino acids, respectively. The position of a given
nucleotide or amino acid in accordance with the present invention
which may be deleted, substituted or comprise one or more
additional nucleotide(s) may vary due to deletions or additional
nucleotides or amino acids elsewhere in the gene or the
polypeptide. Thus, under a "corresponding position" in accordance
with the present invention it is to be understood that nucleotides
or amino acids may differ in the indicated number but may still
have similar neighboring nucleotides or amino acids. Said
nucleotides or amino acids which may be exchanged, deleted or
comprise additional nucleotides or amino acids are also comprised
by the term "corresponding position". Said nucleotides or amino
acids may for instance together with their neighbors form sequences
which may be involved in the regulation of gene expression,
stability of the corresponding RNA or RNA editing, as well as
encode functional domains or motifs of the protein of the
invention.
[0031] By, e.g., "position 1720 to 1723" it is meant that said
polynucleotide comprises one or more deleted nucleotides which are
deleted between positions 1720 and position 1723 of the
corresponding wild type version of said polynucleotide. The same
applies mutatis mutandis to all other position numbers referred to
in the above embodiment which are drafted in the same format.
[0032] By, e.g., "position 437/438" it is meant that said
polynucleotide comprises one or more additional nucleotide(s) which
are inserted between positions 437 and position 438 of the
corresponding wild type version of said polynucleotide. The same
applies mutatis mutandis to all other position numbers referred to
in the above embodiment which are drafted in the same format, i.e.
two consecutive position numbers separated by a slash (/).
[0033] In accordance with the present invention, the mode and
population distribution of genetic variations in the MRP-1 gene has
been analyzed by sequence analysis of relevant regions of the human
said gene from many different individuals. It is a well known fact
that genomic DNA of individuals, which harbor the individual
genetic makeup of all genes, including the MRP-1 gene, can easily
be purified from individual blood samples. These individual DNA
samples are then used for the analysis of the sequence composition
of the alleles of the MRP-1 gene that are, present in the
individual which provided the blood sample. The sequence analysis
was carried out by PCR amplification of relevant regions of said
genes, subsequent purification of the PCR products, followed by
automated DNA sequencing with established methods (e.g. ABI
dyeterminator cycle sequencing).
[0034] One important parameter that had to be considered in the
attempt to determine the individual genotypes and identify novel
variants of the MRP-1 gene by direct DNA-sequencing of PCR-products
from human blood genomic DNA is the fact that each human harbors
(usually, with very few abnormal exceptions) two gene copies of
each autosomal gene (diploidy). Because of that, great care had to
be taken in the evaluation of the sequences to be able to identify
unambiguously not only homozygous sequence variations but also
heterozygous variations. The details of the different steps in the
identification and characterization of novel polymorphisms in the
MRP-1 gene (homozygous and heterozygous) are described in the
Examples below.
[0035] Over the past 20 years, genetic heterogeneity has been
increasingly recognized as a significant source of variation in
drug response. Many scientific communications (Meyer, Ann. Rev.
Pharmacol. Toxicol. 37 (1997), 269-296 and West, J. Clin.
Pharmacol. 37 (1997), 635-648) have clearly shown that some drugs
work better or may even be highly toxic in some patients than in
others and that these variations in patient's responses to drugs
can be related to molecular basis. This "pharmacogenomic" concept
spots correlations between responses to drugs and genetic profiles
of patient's (Marshall, Nature Biotechnology, 15 (1997), 954-957;
Marshall, Nature Biotechnology, 15 (1997), 1249-1252). In this
context of population variability with regard to drug therapy,
pharmacogenomics has been proposed as a tool useful in the
identification and selection of patients which can respond to a
particular drug without side effects. This identification/selection
can be based upon molecular diagnosis of genetic polymorphisms by
genotyping DNA from leukocytes in the blood of patient, for
example, and characterization of disease (Bertz, Clin.
Pharmacokinet. 32 (1997), 210-256; Engel, J. Chromatogra. B.
Biomed. Appl. 678 (1996), 93-103). For the founders of health care,
such as health maintenance organizations in the US and government
public health services in many European countries, this
pharmacogenomics approach can represent a way of both improving
health care and reducing overheads because there is a large cost to
unnecessary drugs, ineffective drugs and drugs with side
effects.
[0036] The mutations in the variant genes of the invention sometime
result in amino acid deletion(s), insertion(s) and in particular in
substitution(s) either alone or in combination. It is of course
also possible to genetically engineer such mutations in wild type
genes or other mutant forms. Methods for introducing such
modifications in the DNA sequence of said genes are well known to
the person skilled in the art; see, e.g., Sambrook, Molecular
Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989)
N.Y.
[0037] For the investigation of the nature of the alterations in
the amino acid sequence of the polypeptides of the invention may be
used such as BRASMOL that are obtainable from the Internet.
Furthermore, folding simulations and computer redesign of
structural motifs can be performed using other appropriate computer
programs (Olszewski, Proteins 25 (1996), 286-299; Hoffman, Comput.
Appl. Biosci. 11 (1995), 675-679). Computers can be used for the
conformational and energetic analysis of detailed protein models
(Monge, J. Mol. Biol. 247 (1995), 995-1012; Renouf, Adv. Exp. Med.
Biol. 376 (1995), 37-45). These analysis can be used for the
identification of the influence of a particular mutation on binding
and/or transport of drugs.
[0038] Usually, said amino acid deletion, addition or substitution
in the amino acid sequence of the protein encoded by the
polynucleotide of the invention is due to one or more nucleotide
substitution, insertion or deletion, or any combinations thereof.
Preferably said nucleotide substitution, insertion or deletion may
result in an amino acid substitution of F to C at position
corresponding to position 329 of the MRP-1 polypeptide (Accession
No: P33527), R to S at position corresponding to position 433 of
the MRP-1 polypeptide (Accession No: P33527) or R to Q at position
corresponding to position 723 of the MRP-1 polypeptide (Accession
No: P33527). The polypeptides of encoded by the polynucleotides of
the invention have altered biological or immunological properties
due to the mutations referred to in accordance with the present
invention. Examples for said altered properties are stability of
the polypeptides which may be effected or an altered substrate
specificity or an altered transport activity characterized by,
e.g., insufficiencies in drug transport or a complete loss of the
capability of transporting drugs.
[0039] The mutations in the MRP-1 gene detected in accordance with
the present invention are listed in Table 2. The methods of the
mutation analysis followed standard protocols and are described in
detail in the Examples. In general such methods are to be used in
accordance with the present invention for evaluating the phenotypic
spectrum as well as the overlapping clinical characteristics of
diseases or conditions related to dysfunctions or dysregulations
and diseases related to impaired drug transport. Advantageously,
the characterization of said mutants may form the basis of the
development of improved drugs, such as drugs which are used in
therapy of diseases related to multidrug resistance such as in
cancer therapy. Said methods encompass for example haplotype
analysis, single-strand conformation polymorphism analysis (SSCA),
PCR and direct sequencing. On the basis of thorough clinical
characterization of many patients the phenotypes can then be
correlated to these mutations as well as to mutations that had been
described earlier, for example in Jounaidi, Biochem Biophys Res
Commun, 221, pp. 466-470, 1996.
[0040] Also comprised by the polynucleotides referred to in the
present invention are polynucleotides which comprise at least two
of the polynucleotides specified hereinabove, i.e. polynucleotides
having a nucleotide sequence which contains at least two of the
mutations comprised by the above polynucleotides or listed in Table
2 below. This allows the study of synergistic effects of said
mutations in the MRP-1 gene and/or a polypeptide encoded by said
polynucleotide on the pharmacological profile of drugs in patients
who bear such mutant forms of the gene or similar mutant forms that
can be mimicked by the above described proteins. It is expected
that the analysis of said synergistic effects provides deeper
insights into the onset of MRP-1 dysfunctions or dysregulations or
diseases related to altered drug transport as described supra. From
said deeper insight the development of diagnostic and
pharmaceutical compositions related to MRP-1 dysfunctions or
dysregulations or diseases related to altered drug transport will
greatly benefit.
[0041] As is evident to the person skilled in the art, the genetic
knowledge deduced from the present invention can now be used to
exactly and reliably characterize the genotype of a patient.
Advantageously, diseases or a prevalence for a disease which are
associated with MRP-1 dysfunction or dysregulation, such as cancer
or other multidrug resistance related diseases referred to herein
can be predicted and preventive or therapeutical measures can be
applied accordingly. Moreover in accordance with the foregoing, in
cases where a given drug takes an unusual effect, a suitable
individual therapy can be designed based on the knowledge of the
individual genetic makeup of a subject with respect to the
polynucleotides of the invention and improved therapeutics can be
developed as will be further discussed below.
[0042] In general, the MRP-1 "status", defined by the expression
level and activity of the MRP-1 protein, can be not only altered in
many disease or disorders including cancer (see above), but can
also be variable in normal tissue, due to genetic
variations/polymorphisms. The identification of polymorphisms
associated with altered MRP-1 expression and/or activity is
important for the prediction of drug uptake and subsequently for
the prediction of therapy outcome, including side effects of
medications. Therefore, analysis of MRP-1 variations indicative of
MRP-1 function, is a valuable tool for therapy with drugs, which
are substrates of MRP-1 and has, thanks to the present invention,
now become possible.
[0043] Finally, the polynucleotides and polypeptides referred to in
accordance with the present invention are also useful as forensic
markers, which improve the identification of subjects which have
been murdered or killed by, for example a crime of violence or any
other violence and can not be identified by the well known
conventional forensic methods. The application of forensic methods
based on the detection of the polymorphisms comprised by the
polynucleotides of this invention in the genome of a subject are
particularly well suited in cases where a (dead) body is disfigured
in a severe manner such as identification by other body
characteristics such as the features of the face is not possible.
This is the case, for example, for corpses found in water which are
usually entirely disfigured. Advantageously, methods which are
based on the provision of the polynucleotides of the invention
merely require a minimal amount of tissue or cells in order to be
carried out. Said tissues or cells may be blood droplets, hair
roots, epidermal scales, saliva droplets, sperms etc. Since only
such a minimal amount of tissue or cells is required for the
identification of a subject, the polymorphism comprised by the
polynucleotides of this invention can also be used as forensic
markers in order to proof someone guilty for a crime, such as a
violation or a ravishment. Moreover, the polymorphisms comprised by
the polynucleotides of this invention can be used to proof
paternity. In accordance with the forensic methods referred herein
the presence or absence of the polynucleotides of the invention is
determined and compared with a reference sample which is
unambiguously derived from the subject to be identified. The
forensic methods which require detection of the presence or absence
of the polynucleotides of this invention in a sample of a subject
the polymorphisms comprised by the polynucleotides of this
invention can be for example PCR-based techniques which are
particularly well suited in cases where only minimal amount of
tissue or cells is available as forensic samples. On the other
hand, where enough tissue or cells is available, hybridization
based techniques may be performed in order to detect the presence
or absence of a polynucleotide of this invention. These techniques
are well known by the person skilled in the art and can be adopted
to the individual purposes referred to herein without further ado.
In conclusion, thanks to the present invention forensic means which
allow improved and reliable predictions as regards the
aforementioned aspects are now available.
[0044] In line with the foregoing, preferably, the polynucleotide
of the present invention is associated with a disease selected from
the group of cancer diseases or multidrug resistance related
diseases.
[0045] The term "cancer" used herein is very well known and
characterized in the art. Several variants of cancer exist and are
comprised by said term as meant in accordance with the invention.
For a detailed list of symptoms which are indicative for cancer it
is referred to text book knowledge, e.g. Pschyrembel. More
preferably, said cancer disease is kidney cancer, such as renal
cell carcinoma (RCC). The meaning of renal cancer is explicitly
disclosed in Example 4.
[0046] In a further embodiment the present invention relates to a
polynucleotide which is DNA or RNA.
[0047] The polynucleotide of the invention may be, e.g., DNA, cDNA,
genomic DNA, RNA or synthetically produced DNA or RNA or a
recombinantly produced chimeric nucleic acid molecule comprising
any of those polynucleotides either alone or in combination.
Preferably said polynucleotide is part of a vector, particularly
plasmids, cosmids, viruses and bacteriophages used conventionally
in genetic engineering that comprise a polynucleotide of the
invention. Such vectors may comprise further genes such as marker
genes which allow for the selection of said vector in a suitable
host cell and under suitable conditions.
[0048] The invention furthermore relates to a gene comprising the
polynucleotide of the invention.
[0049] It is well known in the art that genes comprise structural
elements which encode an amino acid sequence as well as regulatory
elements which are involved in the regulation of the expression of
said genes. Structural elements are represented by exons which may
either encode an amino acid sequence or which may encode for RNA
which is not encoding an amino acid sequence but is nevertheless
involved in RNA function, e.g. by regulating the stability of the
RNA or the nuclear export of the RNA. Regulatory elements of a gene
may comprise promoter elements or enhancer elements both of which
could be involved in transcriptional control of gene expression. It
is very well known in the art that a promoter is to be found
upstream of the structural elements of a gene. Regulatory elements
such as enhancer elements, however, can be found distributed over
the entire locus of a gene. Said elements could be reside, e.g., in
introns, regions of genomic DNA which separate the exons of a gene.
Promoter or enhancer elements correspond to polynucleotide
fragments which are capable of attracting or binding polypeptides
involved in the regulation of the gene comprising said promoter or
enhancer elements. For example, polypeptides involved in regulation
of said gene comprise the so called transcription factors.
[0050] Said introns may comprise further regulatory elements which
are required for proper gene expression. Introns are usually
transcribed together with the exons of a gene resulting in a
nascent RNA transcript which contains both, exon and intron
sequences. The intron encoded RNA sequences are usually removed by
a process known as RNA splicing. However, said process also
requires regulatory sequences present on a RNA transcript said
regulatory sequences may be encoded by the introns.
[0051] In addition, besides their function in transcriptional
control and control of proper RNA processing and/or stability,
regulatory elements of a gene could be also involved in the control
of genetic stability of a gene locus. Said elements control, e.g.,
recombination events or serve to maintain a certain structure of
the DNA or the arrangement of DNA in a chromosome.
[0052] Therefore, single nucleotide polymorphisms can occur in
exons of a gene which encode an amino acid sequence as discussed
supra as well as in regulatory regions which are involved in the
above discussed process. The analysis of the nucleotide sequence of
a gene locus in its entirety including, e.g., introns is in light
of the above desirable. The polymorphisms comprised by the
polynucleotides of the present invention can influence the
expression level of MRP-1 protein via mechanisms involving enhanced
or reduced transcription of the MRP-1 gene, stabilization of the
gene's RNA transcripts and alteration of the processing of the
primary RNA transcripts.
[0053] Therefore, in a furthermore preferred embodiment of the gene
of the invention a nucleotide deletion, addition and/or
substitution results in altered expression of the variant gene
compared to the corresponding wild type gene.
[0054] In another embodiment the present invention relates to a
vector comprising the polynucleotide of the invention or the gene
of the invention.
[0055] Said vector may be, for example, a phage, plasmid, viral or
retroviral vector. Retroviral vectors may be replication competent
or replication defective. In the latter case, viral propagation
generally will occur only in complementing host/cells.
[0056] The polynucleotides or genes of the invention may be joined
to a vector containing selectable markers for propagation in a
host. Generally, a plasmid: vector is introduced in a precipitate
such as a calcium phosphate precipitate, or in a complex with a
charged lipid or in carbon-based clusters. Should the vector be a
virus, it may be packaged in vitro using an appropriate packaging
cell line prior to application to host cells.
[0057] In a more preferred embodiment of the vector of the
invention the polynucleotide is operatively linked to expression
control sequences allowing expression in prokaryotic or eukaryotic
cells or isolated fractions thereof.
[0058] Expression of said polynucleotide comprises transcription of
the polynucleotide, preferably into a translatable mRNA. Regulatory
elements ensuring expression in eukaryotic cells, preferably
mammalian cells, are well known to those skilled in the art. They
usually comprise regulatory sequences ensuring initiation of
transcription and optionally poly-A signals ensuring termination of
transcription and stabilization of the transcript. Additional
regulatory elements may include transcriptional as well as
translational enhancers. Possible regulatory elements permitting
expression in prokaryotic host cells comprise, e.g., the lac, trp
or tac promoter in E. coli, and examples for regulatory elements
permitting expression in eukaryotic host cells are the AOX1 or GAL1
promoter in yeast or the CMV-, SV40-, RSV-promoter (Rous sarcoma
virus), CMV-enhancer, SV40-enhancer or a globin intron in mammalian
and other animal cells. Beside elements which are responsible for
the initiation of transcription such regulatory elements may also
comprise transcription termination signals, such as the SV40-poly-A
site or the tk-poly-A site, downstream of the polynucleotide. In
this context, suitable expression vectors are known in the art such
as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pCDM8,
pRdCMV, pcDNA1, pcDNA3 (In-vitrogene), pSPORT1 (GIBCO BRL).
Preferably, said vector is an expression vector and/or a gene
transfer or targeting vector. Expression vectors derived from
viruses such as retroviruses, vaccinia virus, adeno-associated
virus, herpes viruses, or bovine papilloma virus, may be used for
delivery of the polynucleotides or vector of the invention into
targeted cell population. Methods which are well known to those
skilled in the art can be used to construct recombinant viral
vectors; see, for example, the techniques described in Sambrook,
Molecular Cloning A Laboratory Manual, Cold Spring Harbor
Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular
Biology, Green Publishing Associates and Wiley Interscience, N.Y.
(1994). Alternatively, the polynucleotides and vectors of the
invention can be reconstituted into liposomes for delivery to
target cells.
[0059] The term "isolated fractions thereof refers to fractions of
eukaryotic or prokaryotic cells or tissues which are capable of
transcribing or transcribing and translating RNA from the vector of
the invention. Said fractions comprise proteins which are required
for transcription of RNA or transcription of RNA and translation of
said RNA into a polypeptide. Said isolated fractions may be, e.g.,
nuclear and cytoplasmic fractions of eukaryotic cells such as of
reticulocytes.
[0060] The present invention furthermore relates to a host cell
genetically engineered with the polynucleotide of the invention,
the gene of the invention or the vector of the invention. Said host
cell may be a prokaryotic or eukaryotic cell; see supra. The
polynucleotide or vector of the invention which is present in the
host cell may either be integrated into the genome of the host cell
or it may be maintained extrachromosomally. In this respect, it is
also to be understood that the recombinant DNA molecule of the
invention can be used for "gene targeting" and/or "gene
replacement", for restoring a mutant gene or for creating a mutant
gene via homologous recombination; see for example Mouellic, Proc.
Natl. Acad. Sci. USA, 87 (1990), 4712-4716; Joyner, Gene Targeting,
A Practical Approach, Oxford University Press.
[0061] The host cell can be any prokaryotic or eukaryotic cell,
such as a bacterial, insect, fungal, plant, animal, mammalian or,
preferably, human cell. Preferred fungal cells are, for example,
those of the genus Saccharomyces, in particular those of the
species S. cerevisiae. The term "prokaryotic" is meant to include
all bacteria which can be transformed or transfected with a
polynucleotide for the expression of a variant polypeptide of the
invention. Prokaryotic hosts may include gram negative as well as
gram positive bacteria such as, for example, E. coli, S.
typhimurium, Serratia marcescens and Bacillus subtilis. A
polynucleotide coding for a mutant form of variant polypeptides of
the invention can be used to transform or transfect the host using
any of the techniques commonly known to those of ordinary skill in
the art. Methods for preparing fused, operably linked genes and
expressing them in bacteria or animal cells are well-known in the
art (Sambrook, supra). The genetic constructs and methods described
therein can be utilized for expression of variant polypeptides of
the invention in, e.g., prokaryotic hosts. In general, expression
vectors containing promoter sequences which facilitate the
efficient transcription of the inserted polynucleotide are used in
connection with the host. The expression vector typically contains
an origin of replication, a promoter, and a terminator, as well as
specific genes which are capable of providing phenotypic selection
of the transformed cells. The transformed prokaryotic hosts can be
grown in fermentors and cultured according to techniques known in
the art to achieve optimal cell growth. The proteins of the
invention can then be isolated from the grown medium, cellular
lysates, or cellular membrane fractions. The isolation and
purification of the microbially or otherwise expressed polypeptides
of the invention may be by any conventional means such as, for
example, preparative chromatographic separations and immunological
separations such as those involving the use of monoclonal or
polyclonal antibodies.
[0062] Thus, in a further embodiment the invention relates to a
method for producing a molecular variant MRP-1 polypeptide or
fragment thereof comprising culturing the above described host
cell; and recovering said protein or fragment from the culture.
[0063] In another embodiment the present invention relates to a
method for producing cells capable of expressing a molecular
variant MRP-1 polypeptide comprising genetically engineering cells
with the polynucleotide of the invention, the gene of the invention
or the vector of the invention.
[0064] The cells obtainable by the method of the invention can be
used, for example, to test drugs according to the methods described
in D. L. Spector, R. D. Goldman, L. A. Leinwand, Cells, a Lab
manual, CSH Press 1998. Furthermore, the cells can be used to study
known drugs and unknown derivatives thereof for their ability to
complement the deficiency caused by mutations in the MRP-1 gene.
For these embodiments the host cells preferably lack a wild type
allele, preferably both alleles of the MRP-1 gene and/or have at
least one mutated from thereof. Ideally, the gene comprising an
allele as comprised by the polynucleotides of the invention could
be introduced into the wild type locus by homologous replacement.
Alternatively, strong overexpression of a mutated allele over the
normal allele and comparison with a recombinant cell line
overexpressing the normal allele at a similar level may be used as
a screening and analysis system. The cells obtainable by the
above-described method may also be used for the screening methods
referred to herein below.
[0065] Furthermore, the invention relates to a polypeptide or
fragment thereof encoded by the polynucleotide of the invention,
the gene of the invention or obtainable by the method described
above or from cells produced by the method described above. In this
context it is also understood that the variant polypeptide of the
invention can be further modified by conventional methods known in
the art. By providing said variant proteins according to the
present invention it is also possible to determine the portions
relevant for their biological activity or inhibition of the same.
The terms "polypeptide" and "protein" as used herein are
exchangeable. Moreover, what is comprised by said terms is standard
textbook knowledge.
[0066] The present invention furthermore relates to an antibody
which binds specifically to the polypeptide of the invention.
[0067] Advantageously, the antibody specifically recognizes or
binds art epitope containing one or more amino acid substitution(s)
as defined above. Antibodies against the variant polypeptides of
the invention can be prepared by well known methods using a
purified protein according to the invention or a (synthetic)
fragment derived therefrom as an antigen. Monoclonal antibodies car
be prepared, for example, by the techniques as originally described
in Kdhler and Milstein, Nature 256 (1975), 495, and Galfre, Meth.
Enzymol. 73 (1981), 3, which comprise the fusion of mouse myeloma
cells to spleen cells derived from immunized mammals. In a
preferred embodiment of the invention, said antibody is a
monoclonal antibody, a polyclonal antibody, a single chain
antibody, human or humanized antibody, primatized, chimerized or
fragment thereof that specifically binds said peptide or
polypeptide also including bispecific antibody, synthetic antibody,
antibody fragment, such as Fab, Fv or scFv fragments etc., or a
chemically modified derivative of any of these. Furthermore,
antibodies or fragments thereof to the aforementioned polypeptides
can be obtained by using methods which are described, e.g., in
Harlow and Lane "Antibodies, A Laboratory Manual", CSH Press, Cold
Spring Harbor, 1988. These antibodies can be used, for example, for
the immunoprecipitation and immunolocalization of the variant
polypeptides of the invention as well as for the monitoring of the
presence of said variant polypeptides, for example, in recombinant
organisms, and for the identification of compounds interacting with
the proteins according to the invention. For example, surface
plasmon resonance as employed in the BIAcore system can be used to
increase the efficiency of phage antibodies which bind to an
epitope of the protein of the invention (Schier, Human Antibodies
Hybridomas 7 (1996), 97-105; Malmborg, J. Immunol. Methods 183
(1995), 7-13).
[0068] In a preferred embodiment the antibody of the present
invention specifically recognizes an epitope containing one or more
amino acid substitution(s) resulting from a nucleotide exchange as
defined supra.
[0069] Antibodies which specifically recognize modified amino acids
such as phospho-TyrOsine residues are well known in the art.
Similarly, in accordance with the present invention antibodies
which specifically recognize even a single amino acid exchange in
an epitope may be generated by the well known methods described
supra. In light of the foregoing, in a more preferred embodiment
the antibody of the present invention is monoclonal or
polyclonal.
[0070] The invention also relates to a transgenic non-human animal
comprising at least one polynucleotide of the invention, the gene
of the invention or the vector of the invention as described
supra.
[0071] The present invention also encompasses a method for the
production of a transgenic non-human animal comprising introduction
of a polynucleotide or vector of the invention into a germ cell, an
embryonic cell, stem cell or an egg or a cell derived therefrom.
The non-human animal can be used in accordance with the method of
the invention described below and may be a non-transgenic healthy
animal, or may have a disease or disorder, preferably a disease
caused by at least one mutation in the gene of the invention. Such
transgenic animals are well suited for, e.g., pharmacological
studies of drugs in connection with variant forms of the above
described variant polypeptides since these polypeptides or at least
their functional domains are conserved between species in higher
eukaryotes, particularly in mammals. Production of transgenic
embryos and screening of those can be performed, e.g., as described
by A. L. Joyner Ed., Gene Targeting, A Practical Approach (1993),
Oxford University Press. The DNA of the embryos can be analyzed
using, e.g., Southern blots with an appropriate probe or based on
PCR techniques.
[0072] A transgenic non-human animal in accordance with the
invention may be a transgenic mouse, rat, hamster, dog, monkey,
rabbit, pig, frog, nematode such as Caenorhabditis elegans,
fruitfly such as Drosophila melanogaster or fish such as torpedo
fish or zebrafish comprising a polynucleotide or vector of the
invention or obtained by the method described above, preferably
wherein said polynucleotide or vector is stably integrated into the
genome of said non-human animal, preferably such that the presence
of said polynucleotide or vector leads to the expression of the
variant polypeptide of the invention. It may comprise one or
several copies of the same or different polynucleotides or genes of
the invention. This animal has numerous utilities, including as a
research model for cardiovascular research and therefore, presents
a novel and valuable animal in the development of therapies,
treatment, etc. for diseases caused by cardiovascular diseases.
Accordingly, in this instance, the mammal is preferably a
laboratory animal such as a mouse or rat.
[0073] Thus, in a preferred embodiment the transgenic non-human
animal of the invention is a mouse, a rat or a zebrafish.
[0074] Numerous reports revealed that said animals are particularly
well suited as model organisms for the investigation of the drug
metabolism and its deficiencies or cancer.
[0075] Advantageously, transgenic animals can be easily created
using said model organisms, due to the availability of various
suitable techniques well known in the art.
[0076] The invention also relates to a solid support comprising one
or a plurality of the polynucleotide, the gene, the vector, the
polypeptide, the antibody or the host cell of the invention in
immobilized form.
[0077] The term "solid support" as used herein refers to a flexible
or non-flexible support that is suitable for carrying said
immobilized targets. Said solid support may be homogenous or
inhomogeneous. For example, said solid support may consist of
different materials having the same or different properties with
respect to flexibility and immobilization, for instance, or said
solid support may consist of one material exhibiting a plurality of
properties also comprising flexibility and immobilization
properties. Said solid support may comprise glass-, polypropylene-
or silicon-chips, membranes oligonucleotide-conjugated beads or
bead arrays.
[0078] The term "immobilized" means that the molecular species of
interest is fixed to a solid support, preferably covalently linked
thereto. This covalent linkage can be achieved by different means
depending on the molecular nature of the molecular species.
Moreover, the molecular species may be also fixed on the solid
support by electrostatic forces, hydrophobic or hydrophilic
interactions or Van-der-Waals forces. The above described
physico-chemical interactions typically occur in interactions
between molecules. For example, biotinylated polypeptides may be
fixed on a avidin-coated solid support due to interactions of the
above described types. Further, polypeptides such as antibodies,
may be fixed on an antibody coated solid support. Moreover, the
immobilization is dependent on the chemical properties of the solid
support. For example, the nucleic acid molecules can be immobilized
on a membrane by standard techniques such as UV-crosslinking or
heat.
[0079] In a preferred embodiment of the invention said solid
support is a membrane, a glass- or poylpropylene- or silicon-chip,
are membranes oligonucleotide-conjugated beads or a bead array,
which is assembled on an optical filter substrate.
[0080] Moreover, the present invention relates to an in vitro
method for identifying a polymorphism said method comprising the
steps of: [0081] (a) isolating a polynucleotide or the gene of the
invention from a plurality of subgroups of individuals, wherein one
subgroup has no prevalence for a MRP-1 associated disease and at
least one or more further subgroup(s) do have prevalence for a
MRP-1 associated disease; and [0082] (b) identifying a polymorphism
by comparing the nucleic acid sequence of said polynucleotide or
said gene of said one subgroup having no prevalence for a MRP-1
associated disease with said at least one or more further
subgroup(s) having a prevalence for a MRP-1 associated disease.
[0083] The term "prevalence" as used herein means that individuals
are be susceptible for one or more disease(s) which are associated
with MRP-1 dysfunction or dysregulation or could already have one
or more of said disease(s). Thereby, one MRP-1 associated disease
can be used to determine the susceptibility for another MRP-1
associated disease, e.g. altered drug transport may be indicative
for a prevalence for, e.g. cancer. Moreover, symptoms which are
indicative for a prevalence for developing said diseases are very
well known in the art and have been sufficiently described in
standard textbooks such as Pschyrembel.
[0084] Advantageously, polymorphisms according to the present
invention which are associated with MRP-1 dysfunction or
dysregulation or one or more disease(s) based thereon should be
enriched in subgroups of individuals which have a prevalence for
said diseases versus subgroups which have no prevalence for said
diseases. Thus, the above described method allows the rapid and
reliable detection of polymorphism which are indicative for one or
more MRP-1 associated disease(s) or a susceptibility therefor.
Advantageously, due to the phenotypic preselection a large number
of individuals having no prevalence might be screened for
polymorphisms in general. Thereby, a reference sequences comprising
polymorphisms which do not correlate to one or more MRP-1
associated disease(s) can be obtained. Based on said reference
sequences it is possible to efficiently and reliably determine the
relevant polymorphisms.
[0085] In a further embodiment the present invention relates to a
method for identifying and obtaining a pro-drug or a drug capable
of modulating the activity of a molecular variant of a MRP-1
polypeptide comprising the steps of: [0086] (a) contacting the
polypeptide, the solid support of the invention, a cell expressing
a molecular variant gene comprising a polynucleotide of the
invention, the gene or the vector of the invention in the presence
of components capable of providing a detectable signal in response
to drug activity with a compound to be screened for pro-drug or
drug activity; and [0087] (b) detecting the presence or absence of
a signal or increase or decrease of a signal generated from the
pro-drug or the drug activity, wherein the absence, presence,
increase or decrease of the signal is indicative for a putative
prodrug or drug.
[0088] The term "compound" in a method of the invention includes a
single substance or a plurality of substances which may or may not
be identical.
[0089] Said compound(s) may be chemically synthesized or produced
via microbial fermentation but can also be comprised in, for
example, samples, e.g., cell extracts from, e.g., plants, animals
or microorganisms. Furthermore, said compounds may be known in the
art but hitherto not known to be useful as an inhibitor,
respectively. The plurality of compounds may be, e.g., added to the
culture medium or injected into a cell or non-human animal of the
invention.
[0090] If a sample containing (a) compound(s) is identified in the
method of the invention, then it is either possible to isolate the
compound from the original sample identified as containing the
compound, in question or one can further subdivide the original
sample, for example, if it consists of a plurality of different
compounds, so as to reduce the number of different substances per
sample and repeat the method with the subdivisions of the original
sample. It can then be determined whether said sample or compound
displays the desired properties, for example, by the methods
described herein or in the literature (Spector et al., Cells
manual; see supra). Depending on the complexity of the samples, the
steps described above can be performed several times, preferably
until the sample identified according to the method of the
invention only comprises a limited number of or only one
substance(s). Preferably said sample comprises substances of
similar chemical and/or physical properties, and most preferably
said substances are identical. The methods of the present invention
can be easily performed and designed by the person skilled in the
art, for example in accordance with other cell based assays
described in the prior art or by using and modifying the methods as
described herein. Furthermore, the person skilled in the art will
readily recognize which further compounds may be used in order to
perform the methods of the invention, for example, enzymes, if
necessary, that convert a certain compound into a precursor. Such
adaptation of the method of the invention is well within the skill
of the person skilled in the art and can be performed without undue
experimentation.
[0091] Compounds which can be used in accordance with the present
invention include peptides, proteins, nucleic acids, antibodies,
small organic compounds, ligands, peptidomimetics, PNAs and the
like. Said compounds may act as agonists or antagonists of the
invention. Said compounds can also be functional derivatives or
analogues of known drugs. Methods for the preparation of chemical
derivatives and analogues are well known to those skilled in the
art and are described in, for example, Beilstein, Handbook of
Organic Chemistry, Springer edition New York Inc., 175 Fifth
Avenue, New York, N.Y. 10010 U.S.A. and Organic Synthesis, Wiley,
New York, USA. Furthermore, said derivatives and analogues can be
tested for their effects according to methods known in the art or
as described. Furthermore, peptide mimetics and/or computer aided
design of appropriate drug derivatives and analogues can be used,
for example, according to the methods described below. Such analogs
comprise molecules may have as the basis structure of known MRP-1
substrates and/or inhibitors and/or modulators; see infra.
[0092] Appropriate computer programs can be used for the
identification of interactive sites of a putative inhibitor and the
polypeptides of the invention by computer assistant searches for
complementary structural motifs (Fassina, Immunomethods 5 (1994),
114-120). Further appropriate computer systems for the computer
aided design of protein and peptides are described in the prior
art, for example, in Berry, Biochem: Sac Trans. 22 (1994),
1033-1036; Wodak, Ann. N.Y. Acad, Sci. 501 (1987), 1-13; PabO,
Biochemistry 25 (1986), 5987-5991. The results obtained from the
above-described computer analysis can be used in combination with
the method of the invention for, e.g., optimizing known inhibitors,
analogs, antagonists or agonists. Appropriate peptidomimetics and
other inhibitors can also be identified by the synthesis of
peptidomimetic combinatorial libraries through successive chemical
modification and testing the resulting compounds, e.g., according
to the methods described herein. Methods for the generation and use
of peptidomimetic combinatorial libraries are described in the
prior art, for example in Ostresh, Methods in Enzymology 267
(1996), 220-234 and Dorner, Bioorg. Med. Chem. 4 (1996), 709-715.
Furthermore, the three-dimensional and/or crystallographic
structure of said compounds and the polypeptides of the invention
can be used for the design of peptidomimetic drugs (Rose,
Biochemistry 35 (1996), 12933-12944; Rutenber, Bioorg. Med. Chem. 4
(1996), 1545-1558). It is very well known how to obtain said
compounds, e.g. by chemical or biochemical standard techniques.
Thus, also comprised by the method of the invention are means of
making or producing said compounds. In summary, the present
invention provides methods for identifying and obtaining compounds
which can be used in specific doses for the treatment of specific
forms of MRP-1 associated diseases, e.g. dysfunctions or
dysregulations of the drug transport such as cancer or multidrug
resistance.
[0093] The above definitions apply mutatis mutandis to all of the
methods described in the following.
[0094] In a further embodiment the present invention relates to a
method for identifying and obtaining an inhibitor of the activity
of a molecular variant of a MRP-1 polypeptide comprising the steps
of: [0095] (a) contacting the protein, the solid support of the
invention or a cell expressing a molecular variant gene comprising
a polynucleotide or the gene or the vector of the invention in the
presence of components capable of providing a detectable signal in
response to drug activity with a compound to be screened for
inhibiting activity; and [0096] (b) detecting the presence or
absence of a signal or increase or decrease of a signal generated
from the inhibiting activity, wherein the absence or decrease of
the signal is indicative for a putative inhibitor.
[0097] In a preferred embodiment of the method of the invention
said cell is a cell, obtained by the method of the invention or can
be obtained from the transgenic non-human animal as described
supra.
[0098] In a still further embodiment the present invention relates
to a method of identifying and obtaining a pro-drug or drug capable
of modulating the activity of a molecular variant of a MRP-1
polypeptide comprising the steps of: [0099] (a) contacting the host
cell, the cell obtained by the method of the invention, the
polypeptide or the solid support of the invention with the first
molecule known to be bound by a MRP-1 polypeptide to form a first
complex of said polypeptide and said first molecule; [0100] (b)
contacting said first complex with a compound to be screened, and
[0101] (c) measuring whether said compound displaces said first
molecule from said first complex.
[0102] Advantageously, in said method said measuring step comprises
measuring the formation of a second complex of said protein and
said inhibitor candidate. Preferably, said measuring step comprises
measuring the amount of said first molecule that is not bound to
said protein.
[0103] In a particularly preferred embodiment of the
above-described method of said first molecule is a agonist or
antagonist or a substrate and/or a inhibitor and/or a modulator of
the polypeptide of the invention, e.g., with a radioactive or
fluorescent label.
[0104] In a still another embodiment the present invention relates
to a method of identifying and obtaining an inhibitor capable of
modulating the activity of a molecular variant of a MRP-1
polypeptide comprising the steps of: [0105] (a) contacting the host
cell or the cell obtained by the method of the invention, the
protein or the solid support of the invention with the first
molecule known to be bound by the MRP-1 polypeptide to form a first
complex of said protein and said first molecule; [0106] (b)
contacting said first complex with a compound to be screened, and
[0107] (c) measuring whether said compound displaces said first
molecule from said first complex.
[0108] In a preferred embodiment of the method of the invention
said measuring step comprises measuring the formation of a second
complex of said protein and said compound.
[0109] In another preferred embodiment of the method of the
invention said measuring step comprises measuring the amount of
said first molecule that is not bound to said protein.
[0110] In a more preferred embodiment of the method of the
invention said first molecule is labeled.
[0111] The invention furthermore relates to a method for the
production of a pharmaceutical composition comprising the steps of
the method as described supra; and the further step of formulating
the compound identified and obtained or a derivative thereof in a
pharmaceutically acceptable form.
[0112] The therapeutically useful compounds identified according to
the methods of the invention can be formulated and administered to
a patient as discussed above. For uses and therapeutic doses
determined to be appropriate by one skilled in the art and for
definitions of the term "pharmaceutical composition" see infra.
[0113] Furthermore, the present invention encompasses a method for
the preparation of a pharmaceutical composition comprising the
steps of the above-described methods; and formulating a drug or
pro-drug in the form suitable for therapeutic application and
preventing or ameliorating the disorder of the subject diagnosed in
the method of the invention.
[0114] Drugs or pro-drugs after their in vivo administration are
metabolized in order to be eliminated either by excretion or by
metabolism to one or more active or inactive metabolites (Meyer, J.
Pharmacokinet. Biopharm. 24 (1996), 449-459). Thus, rather than
using the actual compound or inhibitor identified and obtained in
accordance with the methods of the present invention a
corresponding formulation as a pro-drug can be used which is
converted into its active in the patient. Precautionary measures
that may be taken for the application of pro-drugs and drugs are
described in the literature; see, for review, Ozama, J. Toxicol.
Sci. 21 (1996), 323-329). In a preferred embodiment of the method
of the present invention said drug or prodrug is a derivative of a
medicament as defined hereinafter.
[0115] The present invention also relates to a method of diagnosing
a disorder related to the presence of a molecular variant of the
MRP-1 gene or susceptibility to such a disorder comprising
determining the presence of a polynucleotide or the gene of the
invention in a sample from a subject.
[0116] In accordance with this embodiment of the present invention,
the method of testing the status of a disorder or susceptibility to
such a disorder can be effected by using a polynucleotide gene or
nucleic acid of the invention, e.g., in the form of a Southern or
Northern blot or in situ analysis. Said nucleic acid sequence may
hybridize to a coding region of either of the genes or to a
non-coding region, e.g. intron. In the case that a complementary
sequence is employed in the method of the invention, said nucleic
acid molecule can again be used in Northern blots. Additionally,
said testing can be done in conjunction with an actual blocking,
e.g., of the transcription of the gene and thus is expected to have
therapeutic relevance. Furthermore, a primer or oligonucleotide can
also be used for hybridizing to one of the above mentioned MRP-1
gene or corresponding mRNAs. The nucleic acids used for
hybridization can, of course, be conveniently labeled by
incorporating or attaching, e.g., a radioactive or other marker.
Such markers are well known in the art. The labeling of said
nucleic acid molecules can be effected by conventional methods.
[0117] Additionally, the presence or expression of variant MRP-1
gene can be monitored by using a primer pair that specifically
hybridizes to either of the corresponding nucleic acid sequences
and by carrying out a PCR reaction according to standard
procedures.
[0118] Specific hybridization of the above mentioned probes or
primers preferably occurs at stringent hybridization conditions.
The term "stringent hybridization conditions" is well known in the
art; see, for example, Sambrook et al., "Molecular Cloning, A
Laboratory Manual" second ed., CSH Press, Cold Spring Harbor, 1989;
"Nucleic Acid Hybridisation, A Practical Approach", Hames and
Higgins eds., IRL Press, Oxford, 1985. Furthermore, the mRNA, cRNA,
cDNA or genomic DNA obtained from the subject may be sequenced to
identify mutations which may be characteristic fingerprints of
mutations in the polynucleotide or the gene of the invention. The
present invention further comprises methods wherein such a
fingerprint may be generated by RFLPs of DNA or RNA obtained from
the subject, optionally the DNA or RNA may be amplified prior to
analysis, the methods of which are well known in the art. RNA
fingerprints may be performed by, for example, digesting an RNA
sample obtained from the subject with a suitable RNA-Enzyme, for
example RNase T.sub.1, RNase T.sub.2 or the like or a ribozyme and,
for example, electrophoretically separating and detecting the RNA
fragments as described above. Further modifications of the
above-mentioned embodiment of the invention can be easily devised
by the person skilled in the art, without any undue experimentation
from this disclosure; see, e.g., the examples. An additional
embodiment of the present invention relates to a method wherein
said determination is effected by employing an antibody of the
invention or fragment thereof. The antibody used in the method of
the invention may be labeled with detectable tags such as a
histidine flags or a biotin molecule.
[0119] The invention relates to a method of diagnosing a disorder
related to the presence of a molecular variant of a MRP-1 gene or
susceptibility to such a disorder comprising determining the
presence of a polypeptide or the antibody of the invention in a
sample from a subject.
[0120] In a preferred embodiment of the above described method said
disorder is a cancer disease or a disease related to multidrug
resistance.
[0121] In a preferred embodiment of the present invention, the
above described method is comprising PCR, ligase chain reaction,
restriction digestion, direct sequencing, nucleic acid
amplification techniques, hybridization techniques or immunoassays.
Said techniques are very well known in the art.
[0122] Moreover, the invention relates to a method of detection of
the polynucleotide or the gene of the invention in a sample
comprising the steps of: [0123] (a) contacting the solid support
described supra with the sample under conditions allowing
interaction of the polynucleotide or the gene of the invention with
the immobilized targets on a solid support and; [0124] (b)
determining the binding of said polynucleotide or said gene to said
immobilized targets on a solid support.
[0125] The invention also relates to an in vitro method for
diagnosing a disease comprising the steps of the method described
supra, wherein binding of said polynucleotide or gene to said
immobilized targets on said solid support is indicative for the
presence or the absence of said disease or a prevalence for said
disease.
[0126] The invention furthermore relates to a diagnostic
composition comprising the polynucleotide, the gene, the vector,
the polypeptide or the antibody of the invention.
[0127] In addition, the invention relates to a pharmaceutical
composition comprising the polynucleotide, the gene, the vector,
the polypeptide or the antibody of the invention. These
pharmaceutical compositions comprising, e.g., the antibody may
conveniently be administered by any of the routes conventionally
used for drug administration, for instance, orally, topically,
parenterally or by inhalation. Acceptable salts comprise acetate,
methylester, HCl, sulfate, chloride and the like. The compounds may
be administered in conventional dosage forms prepared by combining
the drugs with standard pharmaceutical carriers according to
conventional procedures. These procedures may involve mixing,
granulating and compressing or dissolving the ingredients as
appropriate to the desired preparation. It will be appreciated that
the form and character of the pharmaceutically acceptable character
or diluent is dictated by the amount of active ingredient with
which it is to be combined, the route of administration and other
well-known variables. The carrier(s) must be "acceptable" in the
sense of being compatible with the other ingredients of the
formulation and not deleterious to the recipient thereof. The
pharmaceutical carrier employed may be, for example, either a solid
or liquid. Exemplary of solid carriers are lactose, terra alba,
sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate,
stearic acid and the like. Exemplary of liquid carriers are
phosphate buffered saline solution, syrup, oil such as peanut oil
and olive oil, water, emulsions, various types of wetting agents,
sterile solutions and the like. Similarly, the carrier or diluent
may include time delay material well known to the art, such as
glyceryl mono-stearate or glyceryl distearate alone or with a
wax.
[0128] The dosage regimen will be determined by the attending
physician and other clinical factors; preferably in accordance with
any one of the above described methods. As is well known in the
medical arts, dosages for any one patient depends upon many
factors, including the patient's size, body surface area, age, the
particular compound to be administered, sex, time and route of
administration, general health, and other drugs being administered
concurrently. Progress can be monitored by periodic assessment.
[0129] Furthermore, the use of pharmaceutical compositions which
comprise antisense-oligonucleotides which specifically hybridize to
RNA encoding mutated versions of the polynucleotide or gene
according to the invention or which comprise antibodies
specifically recognizing a mutated polypeptide of the invention but
not or not substantially the functional wild-type form is
conceivable in cases in which the concentration of the mutated form
in the cells should be reduced.
[0130] Thanks to the present invention the particular drug
selection, dosage regimen and corresponding patients to be treated
can be determined in accordance with the present invention. The
dosing recommendations will be indicated in product labeling by
allowing the prescriber to anticipate dose adjustments depending on
the considered patient group, with information that avoids
prescribing the wrong drug to the wrong patients at the wrong
dose.
[0131] In another embodiment the present invention relates to the
use of the polynucleotide, the gene, the vector, the polypeptide
the polynucleotides having at a position corresponding to position
926 of the MRP-1 gene (Accession No: U07050) a T insertion, at a
position corresponding to position 79 of the MRP-1 gene (Accession
No: AF022830) an A or at a position corresponding to position
137647 of the MRP-1 gene (Accession No: AC026452) a T, or at a
position corresponding to position 150727 of the MRP-1 gene
(Accession No: AC025277) an A, or the antibody of the invention for
the preparation of a diagnostic composition for diagnosing a
disease. A gene encoding a functional and expressible polypeptide
of the invention can be introduced into the cells which in turn
produce the protein of interest. Gene therapy, which is based on
introducing therapeutic genes into coils by ex-vivo or in-vivo
techniques is one of the most important applications of gene
transfer. Suitable vectors and methods for in-vitro or in-vivo gene
therapy are described in the literature and are known to the person
skilled in the art; see, e.g., Giordano, Nature Medicine 2 (1996),
534-539; Schaper, Circ. Res. 79 (1996), 911-919; Anderson, Science
256 (1992), 808-813; Isner, Lancet 348 (1996), 370-374; Muhlhauser,
Circ. Res. 77 (1995), 1077-1086; Wang, Nature Medicine 2 (1996),
714-716; WO94/29469; WO97/00957 or Schaper, Current Opinion in
Biotechnology 7 (1996), 635-640, and references cited therein. The
gene may be designed for direct introduction or for introduction
via liposomes, or viral vectors (e.g. adenoviral, retroviral) into
the cell. Preferably, said cell is a germ line cell, embryonic
cell, or egg cell or derived therefrom, most preferably said cell
is a stem cell.
[0132] As is evident from the above, it is preferred that in the
use of the invention the nucleic acid sequence is operatively
linked to regulatory elements allowing for the expression and/or
targeting of the polypeptides of the invention to specific cells.
Suitable gene delivery systems that can be employed in accordance
with the invention may include liposomes, receptor-mediated
delivery systems, naked DNA, and viral vectors such as herpes
viruses, retroviruses, adenoviruses, and adeno-associated viruses,
among others. Delivery of nucleic acids to a specific site in the
body for gene therapy may also be accomplished using a biolistic
delivery system, such as that described by Williams (Proc. Natl.
Acad. Sci. USA 88 (1991), 2726-2729). Standard methods for
transfecting cells with recombinant DNA are well known to those
skilled in the art of molecular biology, see, e.g., WO 94/29469;
see also supra. Gene therapy may be carried out by directly
administering the recombinant DNA molecule or vector of the
invention to a patient or by transfecting cells with the
polynucleotide or vector of the invention ex vivo and infusing the
transfected cells into the patient.
[0133] In a further embodiment the present invention relates to the
use of the polynucleotide, the gene, the vector, the polypeptide
the polynucleotides having at a position corresponding to position
926 of the MRP-1 gene (Accession No: U07050) a T insertion, at a
position corresponding to position 79 of the MRP-1 gene (Accession
No: AF022830) an A or at a position corresponding to position
137647 of the MRP-1 gene (Accession No: AC026452) a T, or at a
position corresponding to position 150727 of the MRP-1 gene
(Accession No: AC025277) an A, or the antibody of the invention for
the preparation of a pharmaceutical composition for treating a
disease.
[0134] In a more preferred embodiment of the use of the present
invention said disease is cancer or a disease related to multidrug
resistance.
[0135] Finally, the present invention relates to a diagnostic kit
for detection of a single nucleotide polymorphism comprising the
polynucleotide, the gene, the vector, the polypeptide, the
antibody, the host cell, the transgenic non-human animal or the
solid support of the invention.
The kit of the invention may contain further ingredients such as
selection markers and components for selective media suitable for
the generation of transgenic cells and animals. The kit of the
invention can be used for carrying out a method of the invention
and could be, inter alia, employed in a variety of applications,
e.g., in the diagnostic field or as research tool. The parts of the
kit of the invention can be packaged individually in vials or other
appropriate means depending on the respective ingredient or in
combination in suitable containers or multicontainer units.
Manufacture of the kit follows preferably standard procedures which
are known to the person skilled in the art.
[0136] The kit may be used for methods for detecting expression of
a mutant form of the polypeptides, genes or polynucleotides in
accordance with any one of the above described methods of the
invention, employing, for example, immunoassay techniques such as
radioimmunoassay or enzyme immunoassay or preferably nucleic acid
hybridization and/or amplification techniques such as those
described herein before and in the Examples as well as
pharmacokinetic studies when using non-human transgenic animals of
the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0137] The figures illustrate the invention:
[0138] FIG. 1: The figure shows, where the novel MRP-1 SNP's are
located on the gene and the protein, respectively. The top panel
shows a schematic of exons for MRP-1 and the position of SNPs and
the lower panel depicts the ectodomains, transmembrane domains and
intracellualr domains of MRP-1.
[0139] FIG. 2A-2D: FIGS. 2A and 2B illustrate the correlation
between MRP-1 transport activity and intracellular carcinogen
concentrations (panel A depicts low intracellular carcinogen
concentrations and panel B depicts high intracellular carcinogen
concentrations) and cancer risk. FIGS. 2C and 2D illustrate the
correlation between MRP-1 transport activity and intracellular drug
concentrations (panel C depicts low intracellular drug
concentrations and panel D depicts high intracellular drug
concentrations), therapy outcome and side effects.
[0140] FIG. 3A-3B: FIGS. 3A and 3B represent the correlation of the
genotype (wt/wt: 1, see left side of graph; wt/mut and mut/mut:2,
see right side of graph) with MRP-1 mRNA content in duodenal
biopsies from healthy volunteers derived from two independent
experiments, before (FIG. 3A) and after (FIG. 3B} application of
rifampicin. The p-value of the statistical evaluation
(Kruskai-Wallis-Test), which result in a genotype/phenotype
correlation is p=0.086. The p-value of the pairedT-test
(p<0.001) demonstrates, that rifampicin has no effect on MRP-1
mRNA expression. Thus, the differences in the MRP-1 mRNA content
are based on interindividual differences. The statistical analyses
were performed using the computer program SPSS 10.0 (SPSS, Chicago,
USA). The invention will now be described by reference to the
following biological Examples which are merely illustrative and are
not constructed as a limitation of the scope of the present
invention.
EXAMPLE 1
Isolation of Genomic DNA from Human Blood, Generation and
Purification of MRP-1 Fragments
[0141] Genomic DNA was obtained by standard ion exchange
chromatography techniques (Quiagen kits for isolation of genomic
DNA from blood). Specific oligonucleotide primers, 2 for each
fragment, were applied to obtain defined DNA fragments by
polymerase chain reaction (PCR) containing specific parts of the
MRP-1 gene. These specific oligonucleotide primers were designed to
bind to sequences upstream and downstream of various exons of the
gene. The resulting DNA fragments were to encode not only exon
sequences, but also some intron sequences at the exon-intron
boundaries. Such intronic sequences adjacent to the exons are known
to be important for correct splicing and subsequent expression of
the mRNA, which encodes for the respective protein. Oligonucleotide
primer pairs that were optimized for each of the PCR fragments,
synthesized and purified by affinity chromatography (OPC
cartridges). The primer sequences for the amplification of the
single fragments are listed in Table 1. Polymerase chain reactions
for the single MRP-1 gene fragments, were performed under
conditions, that were optimized for each of these fragments. These
MRP-1 gene fragments cover the respective exons, as well as
regulatory regions, like promoter, 5'-UTR and 3-UTR (see Table 1).
PCRs were carried out for all fragments in a reaction volume of 50
.mu.l. 40 ng DNA template was added to standard PCR buffer
containing 1.5 mM MgCl2 (Qiagen, Hilden), 200 .mu.M dNTP's (Roth,
Karlsruhe), 0.4 .mu.M (conditions A and C) or 1.6 .mu.M (condition
B) of each primer (Metabion, Munich), 10 .mu.l Q-Solution
(condition C; Qiagen, Hilden), 4 .mu.l DMSO (condition B) and 1 U
Taq polymerase (Qiagen, Hilden). All PCRs (conditions A and C) were
performed on a Perkin Elmer thermocycler (model 9700) with an
initial denaturation step of 2 min at 94.degree. C. and 34
amplification cycles of denaturation at 94.degree. C. for 45 sec,
primer annealing at 62.degree. C. for 45 sec, and 1 min for
72.degree. C. followed by a final extension of 72.degree. C. for 10
min. In the case of condition B the PCR reaction was performed with
an initial denaturation step of 3 min at 96.degree. C. and 35
amplification cycles of denaturation at 96.degree. C. for 45 sec,
primer annealing at 62.degree. C. for 30 sec, and 1 min for
72.degree. C. followed by a final extension of 72.degree. C. for 10
min.
[0142] The optimized PCR-conditions and the resulting size of the
desired and obtained fragments are listed in Table 1. The defined
DNA fragments containing specific parts of the human MRP-1 gene
were processed to remove nonincorporated nucleotides and buffer
components that otherwise interfere with the subsequent
determination of the individual MRP-1 genotype by direct DNA
sequencing. For this purification, standard ion exchange
chromatography techniques were used (Quiagen kits for PCR fragment
purification). For all of the fragments, sufficient yields of
purified fragments, suitable for direct DNA sequence analyses, were
obtained.
EXAMPLE 2
Identification of Different MRP-1 Gene Alleles by Sequence
Determination in Various Individuals
[0143] For sequence analysis of relevant regions of the human MRP-1
gene from 24 different individuals, PCR amplification of the
relevant fragments of this gene was carried out (see Table 1) and
the purified PCR products subsequently sequenced with established
methods (ABI dyeterminator cycle sequencing). A very important
parameter that was needed to consider using this approach was that
each normal human individual harbors two copies of this gene.
Because of this diploidy (of autosomal genes; the MRP-1 gene is an
autosomal gene on chromosome 16), great care had to be taken in the
evaluation of the sequences to be able to identify unambiguously
not only homozygous sequence variations but also heterozygous
variations.
[0144] For the initial evaluation of gene variations in the human
population, sequence analyses of the relevant regions of the MRP-1
gene were carried out from the genomic DNA from 24 different
individuals. This number of individual samples was then extended
for a screening for all the MRP-1 gene fragments, in which SNP's
could be identified. The sequences were inspected for the
occurrence of DNA sequences that were deviant from the published
sequences of the MRP-1 gene. These reference sequences are
considered as "wildtype" sequences in all of this work. Because
population genetics enables a calculation of the expected frequency
of homozygous vs. heterozygous alleles of a defined gene
(Hardy-Weinberg distribution, using the formulas p=(2.times.A
A+1.times.Aa)/2N and p+q=1:AA=number of probands homozygous for the
wt-allele, Aa=number of heterozygotes, N=size of the sample test,
p=frequency of the wt-allele, q=frequency of the mut-allele,
q.sup.2=frequency of the genotype homozygous for the mut-allele),
it was possible to confirm the predicted (using these formulas)
distribution of homozygous vs. heterozygous alleles and deviations
with the experimental findings (see Table 2). This serves as
internal control and confirmation that a detected sequence
deviation indeed represents a novel allele.
[0145] In total 42 new and still unpublished polymorphisms could be
found in the MRP-1 gene. The localisation of these novel SNP's in
the MRP-1 gene and in the MRP-1 protein, respectively, is shown in
FIG. 1. 6 of all these new polymorphisms could be identified only
in renal cell carcinoma (RCC) samples (see also example 4). The
following table gives an overview over all different types of novel
MRP-1 polymorphisms, which have been identified in the initial
screen (24 control samples, example 2), as well as in the extended
screen, that includes clinical samples (70 RCC samples, see example
4):
TABLE-US-00001 Total number of SNP location newly found- SNP's
comments Promoter: 11 2 SNP's in RCC samples only Introns: 20 2
SNP's in RCC samples only Exons: total 10 silent 7 1 SNP in RCC
samples only amino acid 3 R723Q (splicing variant region,
substitution first ATP binding domain) R433S (cytoplasmic domain)
F329C (transmembrane domain no. 6; in RCC samples only) 3'-UTR
1
[0146] In regard to the 42 newly found SNP's, the different types
of polymorphisms that were detected, as well as their distribution
over the MRP-1 gene and the possible meaning of the new SNP's are
described in more detail below. The exact positions and further
details of the novel alleles, including the exact novel sequence
and sequence deviation, and the homozygous vs. heterozygous
distribution of the respective allele in the population are listed
in Table 2. The expected frequency for homozygotes of the variant
allele were calculated on the basis of the Hardy-Weinberg
distribution (formulas see above). The deviant base in the sequence
is bold and underlined.
[0147] The polymorphisms newly found in the MRP-1 gene might have
an effect either on the function of the MRP-1 polypeptide or its
expression or translation. The promoter polymorphisms may
especially affect the transcription level, while the SNP which was
identified in the 3'-UTR might have an effect on the stability of
the respective mRNA. Because the amino acid substitutions F329C,
R433S and R723Q are localized in specific functional domains of the
MRP-1 polypeptide (see above in the table), an effect of these
SNP's on folding, activity or substrate specificity of the
respective domains is conceivable. The single nucleotide
polymorphisms resulting in silent mutations may effect interaction
with a tRNA during translation of mRNA encoded by a gene comprising
said single nucleotide polymorphisms. The polymorphisms, which
could be found in the introns of the MRP-1 gene might have an
effect on splicing of MRP-1 transcripts containing said single
nucleotide polymorphisms.
[0148] The described single nucleotide polymorphisms are useful as
e.g. diagnostic markers since they could be correlated with
phenotypes resulting thereof, such as cancer, like kidney cancer.
Furthermore the single nucleotide polymorphisms in MRP-1 may cause
unsufficient and/or altered drug uptake, transport or
elimination.
EXAMPLE 3
Methods for Specific Detection and Diagnosis of MRP-1 Alleles
[0149] Methods to detect the various MRP-1 alleles that have been
identified utilize the principle that specific sequence differences
can be translated into reagents for allele differentiation. These
reagents provide the necessary backbone for the development of
diagnostic tests. Examples for such reagents include--but are not
limited to--oligonucleotides that deviate from the wildtype MRP-1
sequence in the newly identified base substitution. Frequently, the
principles of diagnostic tests for the determination of the
individual MRP-1 gene status include--but are not limited
to--differences in the hybridization efficiencies of such reagents
to the various. MRP-1 alleles. In addition, differences in efficacy
of such reagents in, or as different substrates for, enzymatic
reactions, e.g. ligases or polymerases or restriction enzymes can
be applied. The principles of these are well known to experts of
the field. Examples are PCR- and LCR techniques,
Chip-hybridizations or MALDI-TOF analyses. Such techniques are
described in the prior art, e.g., PCR technique: Newton, (1994)
PCR, BIOS Scientific Publishers, Oxford; LCR-technique: Shimer,
Ligase chain reaction. Methods Mol. Biol. 46 (1995), 269-278; Chip
hybridization: Ramsay, DNA chips: State-of-the art. Nature
Biotechnology 16 (1998), 40-44; and MALDI-TOF analysis: Ross, High
level multiplex genotyping by MALDI-TOF mass spectrometry, Nature
Biotechnology 16 (1998), 1347-1351. Other test principles are based
on the application of reagents that specifically recognize the
MRP-1 variant as translated expressed protein. Examples are
allele-specific antibodies, peptides, substrate analogs,
inhibitors, or other substances which bind to (and in some
instances may also modify the action of) the various MRP-1 protein
forms that are encoded by the new MRP-1 alleles. The examples that
are presented here, to demonstrate the principles of diagnostic
tests with reagents derived from the novel nucleotide substitutions
defined in this application, are based on PCR-methods. It is
obvious that, applying the described specific reagents, any of the
other methods will also work for the differentiation of MRP-1
alleles.
EXAMPLE 4
Distribution of MRP-1 Single Nucleotide Polymorphisms in Kidney
Cancer Samples
[0150] To identify potential direct correlations of MRP-1
polymorphisms with clinical relevant phenotypes in humans, totally
70 renal cell carcinoma (RCC) samples were subjected to the
determination of MRP-1 polymorphisms as described in example 2.
Kidney cancer is the third most frequent urological tumor,
accounting in the United States for 28.000 cases in the year 1995
and approximately 11.000 deads each year in the US (Wingo et al.
1995, CA Cancer J Clin 45 (1): 8-30). One of the major risk factors
for sporadic RCC are somatic mutations in the VHL tumor suppressor
gene (Levine 1996, Radiol Clin North Am 34: 947-964; Linehan et al.
1995, JAMA 273: 564-570). The incidence of kidney cancer increases
continuously by 2 to 4% per year in the United States and other
industrialized countries (Chow et al. 1999, JAMA 281 (17):
1628-1631). These data support, that environmental factors, i.e.
exposure to carcinogens, diuretic and antihypertensive drugs,
tobacco smoke and dietary constituents may be involved in the
occurrence of RCC (Schlehofer et al. 1996, Int. J. Cancer 66:
723-726; Heath et al. 1997, Am. J. Epidemiol 145 (7): 607-613).
[0151] As excretory organs the kidneys are committed to the
detoxification and excretion of carcinogens and metabolites. It is
feasible to assume that factors or genes that play a role in the
defense of kidney cells against dietary and environmental toxins or
metabolites may influence the individual susceptibility towards
RCC. Consequently, genetic polymorphisms in xenobiotic-metabolizing
enzymes have been reported to modify RCC risk in the Caucasian
population (Longuemaux et al. 1999, Cancer Res. 59: 2903-2908). Due
to its role in detoxification, the gene for the human multidrug
resistance-associated protein (MRP-1) may be another interesting
candidate. For the evaluation, if some of the newly found MRP-1
single nucleotide polymorphisms are overrepresented and
underrepresented in these kidney cancer samples, respectively, the
allele distribution was determined. The allele, as well as the
genotype frequencies for all new MRP-1 polymorphisms distributed on
the kidney cancer samples and in comparison to that distributed on
control samples are listed in the following table.
TABLE-US-00002 Frequency in % Homozygotes Sample Frequency in %
Homozygotes mutant (expected SNP collection Wt-allele Mut-allele
heterozygotes mutant Hardy Weinberg) T124667C Controls 62.5 37.5 50
12.5 14.1 (intron 1) RCC G1884A Controls 93.3 6.7 13.3 0 0.5
(Prom1/exon 1) RCC 1720- Controls 87.5 12.5 25 0 1.5 1723delGGT A
RCC 83.6 16.4 23.4 4.7 2.7 (Prom 2) C1163T Controls 91.3 8.7 17.4 0
0.7 (Prom 3) RCC 84.5 15.5 27.7 1.7 2.4 926insT Controls 82.4 17.6
11.8 11.8 3.1 (Prom 3) RCC 62.9 37.1 51.6 11.3 13.8 437insTCCT
Controls 97.6 2.4 4.8 0 0.1 TCC (Prom 4) RCC 96.3 3.7 7.4 0 0.1
A381G Controls 72.7 27.3 36.4 9.1 7.4 (Prom 5) RCC 61.5 38.5 50.8
13.1 14.8 G233A Controls 84.8 15.2 30.4 0 2.3 (Prom 5) RCC 77.9
22.1 34.4 4.9 4.9 C189A Controls 95.7 4.3 8.7 0 0.2 (Prom 5) RCC
G39508A Controls 93.5 6.5 13.04 0 0.4 (intron 2) RCC 92.7 7.3 11.3
1.6 0.5 C174T Controls 95.8 4.2 8.3 0 0.2 (intron 6) RCC 100 0 0 0
0 C248A Controls 79.2 20.8 25 8.3 4.3 (intron 7) RCC 80 20 40 0 4
C258G Controls 70.8 29.2 33.3 12.5 8.5 (intron 7) RCC 71.8 28.2
45.5 5.5 7.9 G79A Controls 93.7 6.3 12.5 0 0.4 (exon 8, RCC 96.3
3.7 7.5 0 0.1 Pro to Pro) T88C Controls 72.9 27.1 37.5 8.3 7.3
(exon 8, RCC 71.3 28.7 42.6 7.4 8.2 Val to Val) T249G RCC 99.3 0.7
1.5 0 0.01 (exon 8, (only in Phe329Cys) these samples) *T95C
Controls 71.7 28.3 39.1 8.7 7.9 (exon 9, RCC 73.1 26.9 44.8 4.5 7.2
Asn to Asn) *A259G Controls 71.7 28.3 39.1 8.7 7.9 (intron 9) RCC
73.9 26.1 43.3 4.5 6.8 -- G57998T Controls 96.9 3.1 6.3 0 0.1 (exon
10, RCC 99.3 0.7 1.5 0 0.01 Arg433Ser) C57853T Controls 97.9 2.1
4.2 0 0.1 (intron 10) RCC 97.1 2.9 5.8 0 0.1 C53282G Controls 77.1
22.9 37.5 4.2 5.3 (intron 11) RCC 73.8 26.2 46.2 3.1 6.8 *A137710G
Controls 79.2 20.8 33.3 4.2 4.4 (intron 12) RCC 81.5 18.5 29.6 3.7
3.4 *C137667T Controls 79.2 20.8 33.3 4.2 4.4 (exon 13, RCC 81.5
18.5 29.6 3.7 3.4 Leu to Leu) C137647T Controls 85.4 14.6 29.2 0
2.1 (exon 13, RCC 94.4 5.6 7.4 1.9 0.3 Tyr to Tyr) *G27258A
Controls 95.8 4.2 8.3 0 0.2 (exon 17, RCC 96.2 3.8 7.7 0 0.2
Arg723Gln) *34207delAT Controls 95.8 4.2 8.3 0 0.2 (intron 18) RCC
96.3 3.7 7.4 0 0.1 G34215C Controls 84.8 15.2 30.4 0 2.3 (intron
18) RCC 84.3 15.7 25.7 2.9 2.5 55156insTG Controls 75 25 0 25 6.3
GGC RCC 77.6 22.4 0 22.4 5.03 (intron 21) T55472C Controls 83.3
16.7 8.3 12.5 2.8 (intron 22) RCC 78.6 21.4 10.7 16.1 4.6 G14008A
Controls 80.4 19.6 39.1 0 3.8 (exon 28, RCC 73.3 26.7 44.2 4.7 7.2
Ser to Ser) -- G150727A Controls 66.7 33.3 50 8.3 10.9 (intron 28)
RCC 55 45 44.3 22.9 20.3 17970delT Controls 75 25 41.7 4.2 6.3
(intron 29) RCC 75.7 24.3 34.3 7.2 5.9 G18195A Controls 73.3 26.7
40 6.7 7.1 (intron 30) RCC 80.4 19.6 21.7 8.7 3.8 G21133A Controls
97.9 2.1 4.2 0 0.1 (3' flanking RCC 95.7 4.3 8.7 0 0.2 region)
G38646C Controls 73.3 26.7 53.3 0 7.1 (Prom 1) RCC G34218A RCC 96.3
3.7 7.4 0 0.1 (intron 18) (only in these samples) C18067T RCC 98.9
1.1 2.2 0 0.02 (exon 30, (only in Ala to Ala) these samples) C440T
RCC 99.3 0.7 1.5 0 0.01 (Prom 5) (only in these samples) C1625A RCC
96.9 3.1 6.3 0 0.1 (prom 2) (only in these samples) C17900T RCC
97.9 2.1 4.3 0 0.1 (intron 29) (only in these samples)
[0152] Three pairs of linked polymorphisms are listed in this
table, whereas each SNP is marked by an asterisks. In regard to
their under- and overrepresentation in the RCC samples in
comparison to the control samples, respectively, all of the new
single nucleotide polymorphisms are of great interest, because they
represent genetic variety in humans, which may serve as potential
targets for diagnosis and therapy and as risk factors for kidney
cancer. Some examples: in contrast to the control samples the
mutant alleles of 4 promoter SNP's found in the MRP-1 gene (C1163T
(Prom 3), 926insT (Prom 3), A381G (Prom 5) and G233A (Prom 5)) are
overrepresented in the RCC sample group. Likewise some of the new
intron SNP's, like G150727A (intron 28) and T55472C (intron 22), as
well as the silent mutation G14008A (exon 28, Ser to Ser) show
allele distributions, which point to correlation with kidney
cancer. In addition, especially the 6 SNP's, which could be only
detected in the RCC samples may have an impact for the diagnosis
and therapy of kidney cancer.
EXAMPLE 5
Statistical Analyses of Correlations Between MRP-1 Single
Nucleotide Polymorphisms and Renal Cell Carcinoma (RCC)
[0153] Statistical evaluations were performed in regard to the
presence of SNP's in RCC samples compared to their frequencies in a
control population. For this purpose, 70 RCC samples and 24 control
samples were compared. Statistical analysis was performed using the
computer program SPSS 10.0 (SPSS, Chicago, USA). This evaluation
results in statistically significant correlations of definite SNP's
with the existence of renal cell carcinoma (RCC).
[0154] The p-values of the statistical evaluation (Chi-Qu ad
rat-Test), which result in genotype/phenotype correlations are:
TABLE-US-00003 Controls vs. gene SNP RCC, p-value MRP-1 926insT
(Promoter) 0.005 G79A (exon 8) 0.063 C137647T (exon 13) 0.039
EXAMPLE 6
Effects of Kidney Cancer Associated MRP-1 Polymorphisms on Drug
Transport Activity and Pharmacology
[0155] As excretory organs the kidneys are committed to the
detoxification and excretion of watersoluble carcinogens and
metabolites. Therefore, factors or genes that influence the
individual susceptibility towards kidney cancer are related to the
defense capacity of kidney cells against dietary and environmental
toxins or metabolites (Epidauros MDR-1 risk factor patent). Among
these factors, the gene for the P-glycoprotein (Pgp), which
transports toxic substances, has been shown to confer a significant
risk factor for kidney cancer, such as for RCC, if it is present in
an allelic version that corresponds to low transport activity
(Epidauros MDR-1 risk factor patent). The multidrug
resistance-associated protein 1 (MRP-1) is, like MDR-1 expressed in
the renal tubular cells of the kidney and extrude different classes
of substances in an ATP dependent manner from the inside to the
outside of plasma membranes within these cells. The physiological
role of this energy-dependent export mechanism in the kidney is the
protection of cells. The fact that, like MDR-1 SNP's, also
polymorphisms in the MRP-1 gene (which has a very similar function)
confer significantly increased risk to develop kidney cancer, such
as RCC (see tables in examples 2, 4 and the results of the
statistical evaluation in example 5, respectively), indicates the
underlying molecular mechanism to be the same for the functional
polymorphisms in MDR-1 as well as in MRP-1: altered and/or reduced
transport capacities lead to increased exposure of renal cells to
carcinogenic, toxic and/or nontoxic substances, which is
responsible for the increased risk to develop malignant changes in
tubular cells. Beside the Promoter SNP 926insT, which shows a
statistically significant correlation with RCC (p=0.005), also the
following MRP-1 promoter SNP's C1163T, A381G and G233A, which are
overrepresented in RCC are good candidates for such risk
factors.
[0156] Variable transport capacities of MRP-1-variants play a role
not only in influencing the individual risk of developing kidney
cancer, such as RCC, but such variations will also affect
individual pharmacological responses to medications. For example,
the expression of MRP-1 correlates with therapy outcome in cancer
therapy: Higher MRP-1 activity leads to a resistance of the cell
against MRP-1 substrates. This multidrug resistance could be shown
for numerous MRP-1 substrates. Therefore, MRP-1 polymorphisms,
especially those with functional importance, even up to a degree
that associated with increased risk for kidney cancer, such as RCC
due to a decreased capacity of tubular cells to clear damaging
agents, are important for predicting clearance and uptake of MRP-1
substrates, or drugs whose metabolites are MRP-1 substrates (see
FIGS. 2 A-D).
EXAMPLE 7
Correlation of MRP-1 Polymorphisms with MRP-1 Expression and Side
Effects During Therapy with MRP-1 Substrates
[0157] Functional polymorphisms in the MRP-1 gene (see tables in
examples 2 and 4) affect the transport activity and subsequently
the levels of drugs which are substrates of MRP-1. Increased levels
of such drugs can lead to side effects whereas decreased levels may
result in subtherapeutical drug levels that lead to therapy
failure. Three different patient collectives, two show side effects
during drug therapy and one for which the MRP-1 mRNA levels had
been defined, were analyzed to determine whether MRP-1
polymorphisms correlate with transporter activity and subsequently
with alterations in drug activities and side effects. Statistical
evaluations were performed in regard to the presence of SNP's in
these collectives with side effects during drug therapy and
increased/decreased mRNA levels compared to their frequencies in
control samples. For this purpose, the 3 collectives (collective 1:
samples with nephrotoxicities after cisplatin therapy; collective
2: liver and kidney side effects; collective 3: samples with
defined high or low MRP-1 mRNA levels) were screened for all MRP-1
gene fragments, in which the new SNP's could be detected. For those
of the newly identified MRP-1 SNP's which are overrepresented or
underrepresented, the allele distribution was determined. As an
example, the allele and genotype frequencies for one MRP-1
polymorphism are listed in the following table for collective 2 and
compared to control samples:
TABLE-US-00004 Frequency in % Homozygotes Sample Frequency in %
Homozygotes mutant (expected SNP collection Wt-allele allele
heterozygotes mutant Hardy Weinberg) G150727A Controls 66.7 33.3 50
8.3 10.9 (intron 28) Collective 2 50 50 14.3 42.9 25
[0158] In contrast to control samples the mutant allele (150727A)
of one SNP found in the MRP-1 gene (G150727A, intron 28) is
overrepresented in the samples of collective 2. Statistical
evaluations were performed in regard to the presence of this SNP in
samples with liver and kidney side effects (collective 2) compared
to their frequencies in a control population. The statistical
analysis was performed using the computer program SPSS 10.0 (SPSS,
Chicago, USA). This evaluation results in a statistically
significant correlation of a definite SNP with liver and kidney
side effects. The genotype/phenotype correlation is confirmed by
the p-value of the statistical evaluation (Chi-Quadrat-Test):
TABLE-US-00005 Controls vs. liver and kidney side effects, gene SNP
p-value MRP-1 G150727A (intron 28) 0.044
[0159] Furthermore, a correlation of MRP-1 gene variants and mRNA
expression of MRP-1 could be found for two new MRP-1 SNP's (T95C,
exon 9, Asn to Asn and A259G, intron 9). These are linked SNP's
(see also table in example 4). As shown in FIG. 3 (Diagram A and
B), the mutant allele correlates with decreased MRP-1 mRNA
expression. Thus, the analysis of these functional important SNP's
is of high diagnostic/prognostic value, because it allows the
prediction of therapy outcome and side effects, and of expression
levels of MRP-1.
EXAMPLE 8
MRP1 Genotypes in Patients Suffering from Drug-Induced Hepatic
Toxicity
[0160] MRP1 genotypes were investigated in patients suffering from
drug-induced hepatic toxicity (n=7) and healthy controls (n=95).
Pearson chi-square was calculated from contingency tables to test
the equality of proportions between patients and controls. When
appropriate Fisher's Exact Test was applied. The level of
significance was set to p=0.05. Statistical analysis was performed
using SPSS 10.1 (SPSS, Chicago, USA). The level of significance was
set to p=0.05.
[0161] Three SNPs (T>C.sub.95, A>G.sub.259, and
C>G.sub.53282, I were found to be associated with the occurrence
of liver toxicity. The frequency of homozyguosly mutant genotypes
was statistically significant elevated as summarized in the
following table.
Frequency Distribution of MRP1 Genotypes
TABLE-US-00006 [0162] SNP Controls [%] Controls [%] Wt >
mut.sub.position AccNo.sup.1 SeqID N wt/wt wt/m m/m N wt/wt wt/m
m/m P.sup.2 T > C.sub.95 AF022831 171 7 47.8 44.6 7.6 92 85.7
14.3 0.035 A > G.sub.259 AF022831 177 7 47.8 44.6 7.6 92 85.7
14.3 0.035 C > G.sub.53282 GI:7209451 195 6 55.3 40.4 4.3 94
85.3 16.7 0.05 .sup.1Accession Number of reterence sequence (wt
allele) .sup.2P value of statistical test wt/wt homozygous
wildtypes wt/m heterozygots m/m homozygous mutants
[0163] Two of these SNPs are linked (T>C.sub.95 and
A>G.sub.259) and have been demonstrated (example 7) to correlate
with decreased MRP1 expression. It can be concluded that a reduced
hepatic MRP1 expression leads to a decreased capacity of
hepatocytes to transport toxic substrates with the consequence of
an elevated risk to hepatocellular damage. Thus, SNPs in the MRP1
can explain interindividual variations in the susceptibility to
adverse drug events (ADEs) and are important diagnostic markers to
predict the individual risk of patients in order to prevent
patients from ADEs by e.g. dosage adjustments or switching to other
medications.
EXAMPLE 9
MRP1 Genotypes in Patients Suffering from Renal Carcinoma (RCC)
[0164] MRP1 genotypes were investigated in patients suffering from
renal carcinoma (RCC) and healthy controls. Pearson chi-square was
calculated from contingency tables to test the equality of
proportions between RCC and controls. When appropriate Fisher's
Exact Test was applied. The level of significance was set to
p=0.05. Statistical analysis was performed using SPSS 10.1 (SPSS,
Chicago, USA). Pearson chi-square was calculated to test the
equality of proportions. The level of significance was set to
p=0.05. Three SNPs have been already described to be correlated
with RCC in example 5. Additionally, the nucleotide substitution
A>G.sub.381 was found to be statistically significant associated
with RCC and T>C.sub.124667 tended to be associated with renal
carcinoma confirming further the important role of MRP1 for
pharmacology and toxicology of drugs.
Frequency Distribution of MRP1 Genotypes
TABLE-US-00007 [0165] SNP Seq Patients [%] ID Controls[%] wt >
mut.sub.position AccNo.sup.1 ID N wt/wt wt/m m/m N wt/wt wt/m m/m
P.sup.2 T > C.sub.124667 AC026452 075 33 45.5 51.5 3.0 90 57.8
31.1 11.1 0.075 A > G.sub.381 U07050 111 59 35.6 52.5 11.9 88
53.6 32.1 14.3 0.027 .sup.1Accession Numoer of reference sequence
(wt allele) .sup.2P value of statistical test wt/wt homozygous
wildtypes wt/m heterozygots m/m homozygous mutants
TABLE-US-00008 TABLE 1 Primers for the amplification of fragments
of the MRP1 gene Primer PCR fragment sequence (5' to PCR Fragment
name PCR primer position 3' orientation) condition size Accession
number AC026452 ExonI/Prom 1 38590-38608 MRP1-P1f GTA GGG GGC TCC
GTT CAC G B 880 bp 124576-124600 MRP1-E1r2 CCT GGA AGG TTG TTT TTA
CAG ACG G Accession number U07050 Promoter 1359-1377 MRP1-P2f TGG
AGA CTG GCG CCG TCT G C 408 bp fragment 2 1767-1746 MRP1-P2r AAG
GAC AGT ATC CGT CAC CAG G Promoter 830-851 MRP1-P3f CAT GGG GTT GTG
AGG ATT GCA C A 590 bp Fragment 3 1423-1401 MRP1-P3r TGA GAT TCA
AAC CCG TGA GCA GC Promoter 351-374 MRP1-P4f CTT AGA AAC TCA TTC
ACC CTT GGG A 550 bp fragment 4 902-881 MRP1-P4r GTG ACA AGG CTT
CCT AAG GCT G Promoter 144-170 MRP1-P5f GAT TAA CAT CTG CCA TCT TAC
CAT A 321 bp fragment 5 AAG 465-445 MRP1-P5r CCT CCC CCC AAT CAA
AGG ACC GI number 7209451 Exon 2 39769-39789 MRP1-E2f1 AGC TGG TTT
CAT GCT CCA GGC A 374 bp 39416-39440 MRP1-E2r1 CTA GAA GAA GGA ACT
TAG GGT CAA C Accession number AF022825 Exon 3 24-44 MRP1-E3f TTC
CAG GGC GGT CTG TTG TAG A 233 bp 257-235 MRP1-E3r ATT ACT TTT GGT
CTC CAC TGA GC Accession number AF022826 Exon 4 68-90 MRP1-E4f2 AAA
ACC CAA CAA CTC CTG TCT TG A 230 bp 297-278 MRP1-E4r GCA TCT TTC
CCT CCG GGT CC Accession number AF022827 Exon 5 35-55 MRP1-E5f1 ACC
CAG CCC CAG AAT GTG ATC A 206 bp 240-219 MRP1-E5r2 GCA CAC ACA CTC
ATT TGT GGT C Accession number AF022828 Exon 6 4-26 MRP1-E6f GAG
CAG CTG ACT ACT TGC TAA GC A 209 bp 212-190 MRP1-E6r1 CAT TCA TTC
ATT CAC TCC CCA CC Accession number AF022829 Exon 7 17-41 MRP1-E7f
CTG TCA TTG ACT CTC ATT GCC TAA C A 279 bp 295-275 MRP1-E7r1 AGT
AAC AGG CAG CAC TGC CAG Accession number AF022830 Exon 8 29-49
MRP1-E8f ATC TCT GGC AGA CCC CAC AAC A 336 bp 364-341 MRP1-E8r1 AAC
TGA AAG ATC AAA GCC AAG GAG Accession number AF022831 Exon 9 26-47
MRP1-E9f CCC CAC GTG TCA CAA GTC ATT C A 322 bp 347-328 MRP1-E9r
TGG GCT GGA AAT CCC CAC GC GI number 7209451 Exon 10 58203-58184
MRP1-E10f1 GGG AGG AGG AGA GAT CTG CG A 413 bp 57791-57810
MRP1-E10r1 TGA ACC ACA GCC GGA ACT GC GI number 7209451 Exon 11
53578-53559 MRP1-E11f GGA TGG ATC AAC CGG GGA AG A 353 bp
53226-53248 MRP1-E11r TCA GAA TCC CAG ATA TGC AGC CG GI number
7209451 Exon 12 22183-22204 MRP1-E12f1 TGT TGA GTG ATG GGC TGA TCC
C A 344 bp 22526-22499 MRP1-E12r CCT TTT AAA AAT ATT CAG GTA CGC
AGA G Accession number AC003026 Exon 13 11927-11949 MRP1-E13f CAC
TGC TCC TAG GAT GAT GAC TC A 312 bp 12238-12218 MRP1-E13r GAG TGT
GAT CTA GAG GCT GCG Exon 14 15397-15419 MRP1-E14f GGG GAA ACC CTT
GAA AGT TAA CC A 264 bp 15660-15638 MRP1-E14r CAG CCA AGG GAA AGA
AAT GCA AG Exon 15 20044-20063 MRP1-E15f ATG CCT AGC GCC ATT CGT GC
A 285 bp 20328-20309 MRP1-E15r GGG AGC ACG GTG GGA ATT CG Exon 16
23040-23063 MRP1-E16f GAA GGA ATG TTG AGG CCT TCA GTG A 402 bp
23441-23418 MRP1-E16r GAA AAG AGA CGT TGC TGC TTT CGC Exon 17
27108-27128 MRP1-E17f AAG TGA GGC CCT CCT AGC AGG C 372 bp
27479-27458 MRP1-E17r TGA TAG CAG CAG ACT CAC AGC C Exon 18
30588-30607 MRP1-E18f ACA CTC GGC CTG CTT CTA CG A 326 bp
30913-30892 MRP1-E18r AAG GAC TCC TAA AGG GGA CAC G Exon 19
34085-34105 MRP1-E19f GCT CCT GGA TGC TGT TAT CGC A 430 bp
34514-34495 MRP1-E19r2 TGG CTG GTG GCA ACC TCA AAG Accession number
AC003026 Exon 20 46405-46427 MR-E20f2 CCC TTG GTT TTA GCA TCT GCC
TC A 239 bp 46643-46621 MR-E20r GGG CTG AGG CCT TTT TTT GTT CC Exon
21 50449-50471 MRP1-E21f TGT GTG CAT GTG GAA ACA CTC CG A 368 bp
50816-50792 MRP1-E21r GAC AGG TGA GTT AAC ATA GAC AAG G Accession
number AC003026 Exon 22 55116-55134 MRP1-E22f TGC TGG TGA AGC CCC
CGA C A 402 bp 55517-55497 MRP1-E22r GTT TGG GGT CCC ACA AAA CGC
Exon 23 58530-58548 MRP1-E23f3 CTC CCT GCA GTG CCT GGT C A 474 bp
59003-58983 MRP1-E23r3 CCA CAC TGG GGA CAT GGT AAG Exon 24
65670-65688 MRP1-E24f1 AGG GCA GCC CGG CTC TAA C A 444 bp
66113-66093 MRP1-E24r GCC GGG GTT TGG CTT TAT ACC Accession number
U91318 Exon 25 4270-4292 MRP1-E25f CTC TCT CTG GAA TTA CTG CGG AG A
385 bp 4654-4634 MRP1-E25r CTG CTC CTC AAA CTC CGT ACC Exon 26
5371-5393 MRP1-E26f GAA AGT CAA GTA CGC CCG CTT AC A 242 bp
5612-5593 MRP1-E26r AGG TGC ACA GGA TAG GGT CC Exon 27 11200-11220
MRP1-E27f CTG AGA GGG TGC TCT GTA TCG A 545 bp 11744-11721
MRP1-E27r CAC TTC TGC AAG TTG TAT GCG CTC Exon 28 13844-13863
MR-E28f GAG AGG GCT GTC GAG TTG GG C 349 bp 14192-14170 MR-E28r TCA
GTG CAA TCA TAG GGC TTG CC Accession number U91318 Exon 29
16017-16036 MR-E29f CCA GAA GTC CTT AGG TCG CC A 317 bp 16333-16311
MR-E29r CTT CAA ACA CCC CTA CCG AGA TG Exon 30 17859-17880 MR-E30f
GGA CAT GCT TTC CTG GTC AAG C A 430 bp 18288-18268 MR-E30r GGG CTG
TCA CTA GGG ATA AGG Exon 31, 20650-20670 MR-E31f GCA ACC AGC TGG
AAG GTA CTG A 592 bp (incl. 3'-UTR) 21241-21219 MR-E31r CAG AAG TCT
GGC TGC CAA AAC TC
[0166] Conditions for the Different PCR Fragments:
[0167] PCRs were carried out for all fragments in a reaction volume
of 50 ul. 40 ng DNA template was added to standard PCR buffer
containing 1.5 mM MgCl2 (Qiagen, Hilden), 2000 dNTP's (Roth,
Karlsruhe), 0.4 .mu.M (conditions A and C) or 1.6 .mu.M (condition
B) of each primer (Metabion, Munich), 10 .mu.l Q-Solution
(condition C; Qiagen, Hilden), 4 .mu.l DMSO (condition B) and 1 U
Taq polymerase (Qiagen, Hilden). All PCRs (conditions A and C) were
performed on a Perkin Elmer thermocycler (model 9700) with an
initial denaturation step of 2 min at 94.degree. C. and 34
amplification cycles of denaturation at 94.degree. C. for 45 sec,
primer annealing at 62.degree. C. for 45 sec, and 1 min for
72.degree. C. followed by a final extension of 72.degree. C. for 10
min. In the case of condition B the PCR reaction was performed with
an initial denaturation step of 3 min at 96.degree. C. and 35
amplification cycles of denaturation at 96.degree. C. for 45 sec,
primer annealing at 62.degree. C. for 30 sec, and 1 min for
72.degree. C. followed by a final extension of 72.degree. C. for 10
min.
TABLE-US-00009 TABLE 2 New SNP's in the gene for MRP1 Position of
PCR fragment the name variation wt-sequence wt/mut- and/or
mut-sequence Accession number AC026452 wt/mut: Exon 1/Prom 1 124667
f: GCGTGCCCAGTCCTGGGGTTT f: GCGTGCCCAGT/CCCTGGGGTTT (intron 1) (SNP
34) (SEQ ID No: 071) (SEQ ID No: 073) r: AAACCCCAGGACTGGGCACGC f:
AAACCCCAGGA/GCTGGGCACGC (SEQ ID No: 072) (SEQ ID No: 074) mut/mut:
f: GCGTGCCCAGCCCTGGGGTTT (SEQ ID No: 075) r: AAACCCCAGGGCTGGGCACGC
(SEQ ID No: 076) Accession number U07050 wt/mut: Exon 1/Prom 1 1884
(SNP f: AGCCTTGGAGGATCTGGGGTG f: AGCCTTGGAGG/AATCTGGGGTG 33) (SEQ
ID No: 077) (SEQ ID No: 079) r: CACCCCAGATCCTCCAAGGCT r:
CACCCCAGATC/TCTCCAAGGCT (SEQ ID No: 078) (SEQ ID No: 080) mut/mut:
f: AGCCTTGGAGAATCTGGGGTG (SEQ ID No: 081) f: CACCCCAGATTCTCCAAGGCT
(SEQ ID No: 082) wt/mut: Promoter 1720-1723 f:
ACTCCAGGCAGGTAGGGGGCTCCG f: ACTCCAGGCAGGTA/delGGTAGGGGGCTCC
fragment 2 del GGTA (SEQ ID No: 083) G (SEQ ID No: 085) (SNP 25) r:
CGGAGCCCCCTACCTGCCTGGAGT r: CGGAGCCCCCTACC/delTACCTGCCTGGAG (SEQ ID
No: 084) T (SEQ ID No: 086) mut/mut: f: ACTCCAGGCAdelGGTAGGGGGCTCCG
(SEQ ID No: 087) r: CGGAGCCCCCdelTACCTGCCTGGAGT (SEQ ID No: 088)
Accession number U07050 wt/mut: Promoter 1163 f:
TGTGATCGGCCCGCCTCGGCT (SEQ ID f: TGTGATCGGCC/TCGCCTCGGCT fragment 3
(SNP22) No: 089) (SEQ ID No: 091) r: AGCCGAGGCGGGCCGATCACA (SEQ r:
AGCCGAGGCGG/AGCCGATCACA ID No: 090) (SEQ ID No: 092) mut/mut: f:
TGTGATCGGCTCGCCTCGGCT (SEQ ID No: 093) r: AGCCGAGGCGAGCCGATCACA
(SEQ ID No: 094) wt/mut: Promoter 926 (SNP f: TTAATTTTTTTATTATTATTT
t: TTAATTTTTTT/insTATTATTATTT fragment 3 21) (SEQ ID No: 095) (SEQ
ID No: 097) r: AAATAATAATAAAAAAATTAA r: AAATAATAATA/insAAAAAAATTAA
(SEQ ID No: 096) (SEQ ID No: 098) mut/mut: f:
TTAATTTTTTTinsTATTATTATTT (SEQ ID No: 099) r:
AAATAATAATinsAAAAAAAATTAA (SEQ ID No: 100) wt/mut: Promoter 437
(SNP f: TTCCTCCTTCCCTCGCTAGGT f: TTCCTCCTTCC/insTCCTTCCCTCGCTAGGT
fragment 4 31) (SEQ ID No: 101) (SEQ ID No: 103) r:
ACCTAGCGAGGGAAGGAGGAA rACCTAGCGAGG/insAGGAAGGGAAGGAGGA (SEQ ID No:
102) A (SEQ ID No: 104) mut/mut: f: TTCCTCCTTCCTCCTTCCCTCGCTAGGT
(SEQ ID No: 105) ACCTAGCGAGGGAAGGAGGAAGGAGGAA (SEQ ID No: 106)
Accession number U07050 wt/mut: Promoter 381 (SNP f:
TGGGGGACCCAGGCCAATAAA f: TGGGGGACCCA/GGGCCAATAAA fragment 5 20/30)
(SEQ ID No: 107) (SEQ ID No: 109) r: TTTATTGGCCTGGGTCCCCCA r:
TTTATTGGCCT/CGGGTCCCCCA (SEQ ID No: 108) (SEQ ID No: 110) mut/mut:
f: TGGGGGACCCGGGCCAATAAA (SEQ ID No: 111) r: TTTATTGGCCCGGGTCCCCCA
(SEQ ID No: 112) wt/mut: Promoter 233 (SNP f: AAGAGIAGCAGTTTTATCTTG
f: AAGAGTAGCAG/ATTTTATCTTG fragment 5 19) (SEQ ID No: 113) (SEQ ID
No: 115) r: CAAGATAAAACTGCTACTCTT r: CAAGATAAAAC/TTGCTACTCTT (SEQ
ID No: 114) (SEQ ID No: 116) mut/mut: f: AAGAGTAGCAATTTTATCTTG (SEQ
ID No: 117) r: CAAGATAAAATTGCTACTCTT (SEQ ID No: 118) wt/mut:
Promoter 189 (SNP f: AAAAAAATCCCAATCCAAAAA f:
AAAAAAATCCC/AAATCCAAAAA fragment 5 35) (SEQ ID No: 119) (SEQ ID No:
121) r: TTTTTGGATTGGGATTTTTTT r: TTTTTGGATTG/TGGATTTTTTT (SEQ ID
No: 120) (SEQ ID No: 122) mut/mut: f: AAAAAAATCCAAATCCAAAAA (SEQ ID
No: 123) r: TTTTTGGATTTGGATTTTTTT (SEQ ID No: 124) GI number
7209451 wt/mut: Exon 2 (intron 2) 39508 (SNP f:
GTTTCGTTGTGGGGGGTGGGA f: GTTTCGTTGTG/AGGGGGTGGGA 1) (SEQ ID No:
125) (SEQ ID No: 127) r: TCCCACCCCCCACAACGAAAC r:
TCCCACCCCCC/TACAACGAAAC (SEQ ID No: 126) (SEQ ID No: 128) mut/mut:
f: GTTTCGTTGTAGGGGGTGGGA (SEQ ID No: 129) r: TCCCACCCCCTACAACGAAAC
(SEQ ID No: 130) Accession number AF022828 wt/mut: Exon 6 (intron
6) 174 (SNP f: CCAGGCCCCCCAGACCTCAGG f: CCAGGCCCCCC/TAGACCTCAGG 10)
(SEQ ID No: 131) (SEQ ID No: 133) r: CCTGAGGTCTGGGGGGCCTGG (SEQ ID
r. CCTGAGGTCTG/AGGGGGCCTGG No: 132) (SEQ ID No: 134) mut/mut: f:
CCAGGCCCCCTAGACCTCAGG (SEQ ID No: 135) r: CCTGAGGTCTAGGGGGCCTGG
(SEQ ID No: 136) Accession number AF022829 wt/mut: Exon 7 (intron
7) 248 (SNP 2) f: CCTTTCCACTCCTGTGGCCTC f: CCTTTCCACTC/ACTGTGGCCTC
(SEQ ID No: 137) (SEQ ID No: 139) r: GAGGCCACAGGAGTGGAAAGG r:
GAGGCCACAGG/TAGTGGAAAGG (SEQ ID No: 138) (SEQ ID No: 140) mut/mut:
f: CCTTTCCACTACTGTGGCCTC (SEQ ID No: 141) nGAGGCCACAGTAGTGGAAAGG
(SEQ ID No: 142) wt/mut: Exon 7 (intron 7) 258 (SNP 3) f:
CCTGTGGCCTCAATCCAGGAT f: CCTGTGGCCTC/GAATCCAGGAT (SEQ ID No: 143)
(SEQ ID No: 145) r: ATCCTGGATTGAGGCCACAGG r:
ATCCTGGATTG/CAGGCCACAGG (SEQ ID No: 144) (SEQ ID No: 146) mut/mut:
f: CCTGTGGCCTGAATCCAGGAT (SEQ ID No: 147) r: ATCCTGGATTCAGGCCACAGG
(SEQ ID No: 148) Accession number AF022830 wt/mut: Exon 8 79 (SNP
4) f: CCAGGCAGCCGGTGAAGGTTG f: CCAGGCAGCCG/AGTGAAGGTTG (SEQ ID No:
149) (SEQ ID No: 151) r: CAACCTTCACCGGCTGCCTGG r:
CAACCTTCACC/TGGCTGCCTGG (SEQ ID No: 150) (SEQ ID No: 152) mut/mut:
f: CCAGGCAGCCAGTGAAGGTTG (SEQ ID No: 153) r: CAACCTTCACTGGCTGCCTGG
(SEQ ID No: 154) Accession number AF022830 wt/mut: Exon 8 88 (SNP
5) f. CGGTGAAGGTTGTGTACTCCT f: CGGTGAAGGTT/CGTGTACTCCT (SEQ ID No:
155) (SEQ ID No: 157) r: AGGAGTACACAACCTTCACCG r:
AGGAGTACACA/GACCTTCACCG (SEQ ID No: 156) (SEQ ID No: 158) mut/mut:
f: CGGTGAAGGTCGTGTACTCCT (SEQ ID No: 159) r: AGGAGTACACGACCTTCACCG
(SEQ ID No: 160) wt/mut: Exon 8 249 (SNP f: CTCATGAGCTTCTTCTTCAAG
f: CTCATGAGCTT/GCTTCTTCAAG 37) (SEQ ID No: 161) (SEQ ID No: 163)
(only in RCC r: CTTGAAGAAGAAGCTCATGAG r. CTTGAAGAAGA/CAGCTCATGAG
samples) (SEQ ID No: 162) (SEQ ID No: 164) mut/mut: f:
CTCATGAGCTGCTTCTTCAAG (SEQ ID No: 165) r: CTTGAAGAAGCAGCTCATGAG
(SEQ ID No: 166) Accession number AF022831 wt/mut: Exon 9 95 (SNP
6) f: AGTTCGTGAATGACACGAAGG f: AGTTCGTGAAT/CGACACGAAGG (SEQ ID No:
167) (SEQ ID No: 169) r: CCTTCGTGTCATTCACGAACT r:
CCTTCGTGTCA/GTTCACGAACT (SEQ ID No: 168) (SEQ ID No: 170) mut/mut:
f: AGTTCGTGAACGACACGAAGG (SEQ ID No: 171) r: CCTTCGTGTCGTTCACGAACT
(SEQ ID No: 172) wt/mut: Exon 9 (intron 9) 259 (SNP 7) f:
AAGGTAGGGGACGCTGTGCCA f: AAGGTAGGGGA/GCGCTGTGCCA (SEQ ID No: 173)
(SEQ ID No: 175) r: TGGCACAGCGTCCCCTACCTT r:
TGGCACAGCGT/CCCCCTACCTT (SEQ ID No: 174) (SEQ ID No: 176) mut/mut:
f: AAGGTAGGGGGCGCTGTGCCA (SEQ ID No: 177) r: TGGCACAGCGCCCCCTACCTT
(SEQ ID No: 178) GI number 7209451 wt/mut: Exon 10 57998 (SNP f:
ACGCTCAGAGGTTCATGGACT f: ACGCTCAGAGG/TTTCATGGACT 11) (SEQ ID No:
179) (SEQ ID No: 181) r: AGTCCATGAACCTCTGAGCGT r:
AGTCCATGAAC/ACTCTGAGCGT (SEQ ID No: 180) (SEQ ID No: 182)
mut/mut: f: ACGCTCAGAGTTTCATGGACT (SEQ ID No: 183) r:
AGTCCATGAAACTCTGAGCGT (SEQ ID No: 184) wt/mut: Exon 10 (intron
57853 (SNP f. GGCAGTGGGCCGAGGGAGTGG f: GGCAGTGGGCC/TGAGGGAGTGG 10)
8) (SEQ ID No: 185) (SEQ ID No: 187) r: CCACTCCCTCGGCCCACTGCC r:
CCACTCCCTCG/AGCCCACTGCC (SEQ ID No: 186) (SEQ ID No: 188) mut/mut:
f: GGCAGTGGGCTGAGGGAGTGG (SEQ ID No: 189) r: CCACTCCCTCAGCCCACTGCC
(SEQ ID No: 190) wt/mut: Exon 11 (intron 53282 (SNP f:
GCCAGTTGGACTCACTTGGGG f: GCCAGTTGGAC/GTCACTTGGGG 11) 12) (SEQ ID
No: 191) (SEQ ID No: 193) r: CCCCAAGTGAGTCCAACTGGC r:
CCCCAAGTGAG/CTCCAACTGGC (SEQ ID No: 192) (SEQ ID No: 194) mut/mut:
f: GCCAGTTGGAGTCACTTGGGG (SEQ ID No: 195) r: CCCCAAGTGACTCCAACTGGC
(SEQ ID No: 196) Accession number AC026452 wt/mut: Exon 13 (intron
137710 f: ACTCTCACTCAGGGCACAGCA f: ACTCTCACTCA/GGGGCACAGCA 12) (SNP
26) (SEQ ID No: 197) (SEQ ID No: 199) r: TGCTGTGCCCTGAGTGAGAGT r:
TGCTGTGCCCT/CGAGTGAGAGT (SEQ ID No: 198) (SEQ ID No: 200) mut/mut:
f: AGTCTCACTCGGGGCACAGCA (SEQ ID No: 201) r: TGCTGTGCCCCGAGTGAGAGT
(SEQ ID No: 202) Accession number AC026452 wt/mut: Exon 13 137667
(SNP f: GCAGGTGGCCCTGTGCACATT f: GCAGGTGGCCC/TTGTGCACATT 13) (SEQ
ID No: 203) (SEQ ID No: 205) r: AATGTGCACAGGGCCACCTGC r:
AATGTGCACAG/AGGCCACCTGC (SEQ ID No: 204) (SEQ ID No: 206) mut/mut:
f: GCAGGTGGCCTTGTGCACATT (SEQ ID No: 207) r: AATGTGCACAAGGCCACCTGC
(SEQ ID No: 208) wt/mut: Exon 13 137647 (SNP f:
TTGCCGTCTACGTGACCATTG f: TTGCCGTCTAC/TGTGACCATTG 14) (SEQ ID No:
209) (SEQ ID No: 211) r: CAATGGTCACGTAGACGGCAA r:
CAATGGTCACG/ATAGACGGCAA (SEQ ID No: 210) (SEQ ID No: 212) mut/mut:
f: TTGCCGTCTATGTGACCATTG (SEQ ID No: 213) r: CAATGGTCACATAGACGGCAA
(SEQ ID No: 214) Accession number AC003026 wt/mut: Exon 17 (intron
27159 (SNP: f: TCGTTGATCAGATCTGTCTGT f: TCGTTGATCAG/CATCTGTCTGT 16)
mr-v-024) (SEQ ID No: 215) (SEQ ID No: 217) r:
ACAGACAGATCTGATCAACGA r: ACAGACAGATC/GTGATCAACGA (SEQ ID No: 216)
(SEQ ID No: 218) mut/mut: f: TCGTTGATCACATCTGTCTGT (SEQ ID No: 219)
r: ACAGACAGATGTGATCAACGA (SEQ ID No: 220) wt/mut: Exon 17 27258
(SNP f: GATTCTCTCCGAGAAAACATC f: GATTCTCTCCG/AAGAAAACATC 9) (SEQ ID
No: 221) (SEQ ID No: 223) r: GATGTTTTCTCGGAGAGAATC r:
GATGTTTTCIC/TGGAGAGAAIC (SEQ ID No: 222) (SEQ ID No: 224) mut/mut:
f: GATTCTCTCCAAGAAAACATC (SEQ ID No: 225) r. GATGTTTTCTTGGAGAGAATC
(SEQ ID No: 226) Accession number AC003026 wt/mut: Exon 19 (intron
34206/34207 f: AGTCTCACACATGTGCACTCAC (SEQ f:
AGTCTCACACAT/delATGTGCACTCAC 18) (SNP 18) ID No: 227) (SEQ ID No:
229) r: GTGAGTGCACATGTGTGAGACT (SEQ r: GTGAGTGCACAT/delATGTGTGAGACT
ID No: 228) (SEQ ID No: 230) mut/mut: f: AGTCTCACACdelATGTGCACTCAC
(SEQ ID No: 231) r: GTGAGTGCACdelATGTGTGAGACT (SEQ ID No: 232)
wt/mut: Exon 19 (intron 34215 (SNP f: CATGTGCACTGACGTGGCCGG f:
CATGTGCACTG/CACGTGGCCGG 18) 17) (SEQ ID No: 233) (SEQ ID No: 235)
r: CCGGCCACGTCAGTGCACATG r: CCGGCCACGTC/GAGTGCACATG (SEQ ID No:
234) (SEQ ID No: 236) mut/mut: f: CATGTGCACTCACGTGGCCGG (SEQ ID No:
237) r. CCGGCCACGTGAGTGCACATG (SEQ ID No: 238) wt/mut: Exon 22
(intron 55156 (SNP f: GGGGCTGGGGCTGGGTGCGTG f:
GGGGCTGGGGC/insTGGGGCTGGGTGCGTG 21) 28) (SEQ ID No: 239) (SEQ ID
NO: 241) r. CACGCACCCAGCCCCAGCCCC r:
CACGCACCCAG/insGCCCCACCCCAGCCCC (SEQ ID No: 240) (SEQ ID No: 242)
mut/mut: f: GGGGCTGGGGCinsTGGGGCTGGGTGCGTG (SEQ ID No: 243) r:
CACGCACCCAinsGCCCCAGCCCCAGCCCC (SEQ ID No: 244) Accession number
AC003026 wt/mut: Exon 22 (intron 55472 (SNP f.
TGTCTAATTATAGAAATGGAT f: TGTCTAATTAT/CAGAAATGGAT 22) 27) (SEQ ID
No: 245) (SEQ ID No: 247) r: ATCCATTTCTATAATTAGACA r:
ATCCATTTCTA/GTAATTAGACA (SEQ ID No: 246) (SEQ ID No: 248) mut/mut:
f: TGTCTAATTACAGAAATGGAT (SEQ ID No: 249) r: ATCCATTTCTGTAATTAGACA
(SEQ ID No: 250) Accession number U91318 wt/mut: Exon 28 14008 (SNP
f. CTGGGAAGTCGTCCCTGACCC f: CTGGGAAGTCG/ATCCCTGACCC 23) (SEQ ID No:
251) (SEQ ID No: 253) r: GGGTCAGGGACGACTTCCCAG r:
GGGTCAGGGAC/TGACTTCCCAG (SEQ ID No: 252) (SEQ ID No: 254) mut/mut:
f. CTGGGAAGTCATCCCTGACCC (SEQ ID No: 255) r: GGGTCAGGGATGACTTCCCAG
(SEQ ID No: 256) Accession number AC025277 wt/mut: Exon 29 (intron
150727 f: CCATGTCAGCGTGACACAGGT f: CCATGTCAGCG/ATGACACAGGT 28) (SNP
24) (SEQ ID No: 257) (SEQ ID No: 259) r: ACCTGTGTCACGCTGACATGG r:
ACCTGTGTCAC/TGCTGACATGG (SEQ ID No: 258) (SEQ ID No: 260) mut/mut:
f: CCATGTCAGCATGACACAGGT (SEQ ID No: 261) r: ACCTGTGTCATGCTGACATGG
(SEQ ID No: 262) Accession number U91318 wt/mut: Exon 30 (intron
17970 (SNP f: CTGGTTTTTTTCTTCCGGTCA f: CTGGTTTTTTT/delTCTTCCGGTCA
29) 15) (SEQ ID No: 263) (SEQ ID No: 265) r: TGACCGGAAGAAAAAAACCAG
r: TGACCGGAAGA/delAAAAAAACCAG (SEQ ID No: 264) (SEQ ID No: 266)
mut/mut: f: CTGGTTTTTTdelTCTTCCGGTCA (SEQ ID No: 267) r:
TGACCGGAAGdelAAAAAAACCAG (SEQ ID No: 268) Accession number U91318
wt/mut: Exon 30 (intron 18195 (SNP f: CACTGGCACAGTGGCCTCTAG (SEQ f:
CACTGGCACAG/ATGGCCTCTAG (SEQ ID No: 30) 16) ID No: 269) 271) r:
CTAGAGGCCACTGTGCCAGTG r: CTAGAGGCCAC/TTGTGCCAGTG (SEQ ID No: 270)
(SEQ ID No: 272) mut/mut: f: CACTGGCACAATGGCCTCTAG (SEQ ID No: 273)
r: CTAGAGGCCATTGTGCCAGTG (SEQ ID No: 274) wt/mut: Exon 31 (3' 21133
(SNP f: CCCAAAACACGCACACCCTGC f: CCCAAAACACG/ACACACCCTGC flanking
region) 29) (SEQ ID No: 275) (SEQ ID No: 277) r:
GCAGGGTGTGCGTGTTTTGGG r: GCAGGGTGTGC/TGTGTTTTGGG (SEQ ID No: 276)
(SEQ ID No: 278) mut/mut: f: CCCAAAACACACACACCCTGC (SEQ ID No: 279)
r: GCAGGGTGTGTGTGTTTTGGG (SEQ ID No: 280) Accession number AC003026
wt/mut: Exon 19 (intron 34218 (SNP f: GTGCACTCACGTGGCCGGGTG f:
GTGCACTCACG/ATGGCCGGGTG 18) 38) (SEQ ID No: 281) (SEQ ID No: 283)
(only in RCC r: CACCCGGCCACGTGAGTGCAC r: CACCCGGCCAC/TGTGAGTGCAC
samples) (SEQ ID No: 282) (SEQ ID No: 284) mut/mut: f:
GTGCACTCACATGGCCGGGTG (SEQ ID No: 285) r: CACCCGGCCATGTGAGTGCAC
(SEQ ID No: 286) Accession number U91318 wt/mut: Exon 30 18067 (SNP
f: CCACGGCAGCCGTGGACCTGG f: CCACGGCAGCC/TGTGGACCTGG 39) (SEQ ID No:
287) (SEQ ID No: 289) (only in r: CCAGGTCCACGGCTGCCGTGG r:
CCAGGTCCACG/AGCTGCCGTGG RCC (SEQ ID No: 288) (SEQ ID No: 290)
samples) mut/mut: f: CCACGGCAGCTGTGGACCTGG (SEQ ID No: 291) r:
CCAGGTCCACAGCTGCCGTGG (SEQ ID No: 292) Accession number
U07050 wt/mut: Promoter 440 (SNP f: CTCCTTCCCTCGCTAGGTCCT f:
CTCCTTCCCTC/TGCTAGGTCCT fragment 5 40) (SEQ ID No: 293) (SEQ ID No:
295) (only in r: AGGACCTAGCGAGGGAAGGAG r: AGGACCTAGCG/AAGGGAAGGAG
RCC (SEQ ID No: 294) (SEQ ID No: 296) samples) mut/mut: f:
CTCCTTCCCTTGCTAGGTCCT (SEQ ID No: 297) r: AGGACCTAGCAGGGAAGGAG (SEQ
ID No: 298) wt/mut: Promoter 1625 (SNP f: GGGAATCACTCAACCTCTCTG f:
GGGAATCACTC/AAACCTCTCTG fragment 2 41) (SEQ ID No: 299) (SEQ ID No:
301) (only in r: CAGAGAGGTTGAGTGATTCCC r: CAGAGAGGTTG/TAGTGATTCCC
RCC (SEQ ID No: 300) (SEQ ID No: 302) samples) mut/mut: f:
GGGAATCACTAAACCTCTCTG (SEQ ID No: 303) r: CAGAGAGGTTTAGTGATTCCC
(SEQ ID No: 304) Accession number U91318 wt/mut: Exon 30 (intron
17900 (SNP f: TGTCTCCTTTCGCTTCTCCCA f: TGTCCTTTC/TGCTTCTCCCA 29)
42) (SEQ ID No: 305) (SEQ ID No: 307) (only in r:
TGGGAGAAGCGAAAGGAGACA r: TGGGAGAAGCG/AAAAGGAGACA RCC (SEQ ID No:
306) (SEQ ID No: 308) samples) mut/mut: f: TGTCTCCTTTTGCTTCTCCCA
(SEQ ID No: 309) r: TGGGAGAAGCAAAAGGAGACA (SEQ ID No: 310)
Accession number AC26452 wt/mut: Promoter 38646 (SNP f:
CCTTAAACAGGATTTGAAAAG f: CCTTAAACAGG/CATTTGAAAAG fragment 1 32)
(SEQ ID No: 311) (SEQ ID No: 313) r: CTTTCAAATCCTGTTTAAGG r:
CTTTTCAAATC/GCTGTTTAAGG (SEQ ID No: 312) (SEQ ID No: 314) mut/mut:
f: CCTTAMCAGCATTTGAAAAG (SEQ ID No: 315) r: CTTTTCAAATGCTGTTTAAGG
(SEQ ID No: 316) Accession number AC025277 wt/mut: Exon 5 (intron
5) 33551 (SNP f: TGTGACCACAGATGAGTGTGT f: TGTGACCACAG/AATGAGTGTGT
36) (SEQ ID No: 317) (SEQ ID No: 319) r: ACACACTCATCTGTGGTCACA r:
ACACACTCATC/TTGTGGTCACA (SEQ ID No: 318) (SEQ ID No: 320) mut/mut:
r: TGTGACCACAAATGAGTGTGT (SEQ ID No: 321) r: ACACACTCATTTGTGGTCACA
(SEQ ID No: 322)
TABLE-US-00010 TABLE 3 New SNP's in the gene for WIRP1 Seq Site SNP
Var. Pos. GI no Acc no ID Forward.sup.1 P3 mrys546 a > g 51798
3582311 329 TAACCAGGTTgT TGATCCTC P1 mryp282 g > a 37971 7363401
333 TGGGGTGGGGa TGGCGCGGGG P1 mryp877 g > a 50892 3582311 337
TGGGCACGCGa CCCCCCACGCA E22 mryo336 g > a 55296 2815549 341
CCATGTGTCCa CGCTGGCTTC I21 mryo172 g > a 55132 2815549 345
TGAAGCCCCCa ACCTTGTGGG I21 mryo154 a > g 55114 2815549 349
TGGGTGGCACg GTGCTGGTGA I21 mryo152 a > g 55112 2815549 353
GCTGGGTGGCg CAGTGCTGGT P1 mryp522 delCCCG 109 to 122 4826837 357
GGCCCGATCAC CCGCCC CCGCCGCCG GGTG P1 mryp491 delGCC 76 to 78
4826837 361 TCCCTGC[GCC].sub.13 AGCGCTAGCG P1 mryp489
del[GCC].sub.2 73 to 78 4826837 365 TCCCTGC[GCC].sub.12 AGCGCTAGCG
P1 mryp486 del[GCC].sub.3 70 to 78 4826837 369 TCCCTGC[GCC].sub.11
AGCGCTAGCG P1 mryp483 del[GCC].sub.4 67 to 78 4826837 373
TCCCTGC[GCC].sub.10 AGCGCTAGCG P1 mryp474 del[GCC].sub.7 58 to 78
4826837 377 TCCCTGC[GCC].sub.7 AGCGCTAGCG I14 mrzl154 delAA 20097
2815549 to 20098 381 TCAAGCAGAGA GAGAGTGTT E9 mrzr176 c > t
60357 7209451 385 CTGGGGCCTTt GTGTCATTCA I7 mrzs129 g > a 61786
7209451 389 ACACAAGGAGa TGAAGCCGTT 16 mrzu272 insC 76437/76438
7209451 393 CAGGCCCCCCc AGACCTCAGG E2 mrzy349 g > a 39541
7209451 397 TACAGTTTTGa T TTTGTTGAG Seq Seq Seq Site SNP ID
Reverse.sup.1 ID IUB_Forward ID IUB_Reverse P3 mrys546 330
GAGGATCAAcA 331 TAACCAGGTTrT 332 GAGGATCAAyA ACCJGGTTA TGATCCTC
ACCTGGTTA P1 mryp282 334 CCCCGCGCCAt 335 TGGGGTGGGGr 336
CCCCGCGCCAy CCCCACCCCA TGGCGCGGGG CCCCACCCCA P1 mryp877 338
TGCGTGGGGG 339 TGGGCACGCGr 340 TGCGTGGGGG GyCGCGTGCCCA CCCCCCACGCA
GyCGCGTGCCCA E22 mryo336 342 GAAGCCAGCGt 343 CCATGTGTCCrC 344
GAAGCCAGCGy GGACACATGG IGCTGGCTTC GGACACATGG I21 mryo172 346
CCCACAAGGTtG 347 TGAAGCCCCCrA 348 CCCACAAGGTy GGGGCTTCA ICCTTGTGGG
GGGGGCTTCA I21 mryo154 350 TCACCAGCACc 351 iTGGGTGGCACr 352
GTGCCACCCA GTGCCACCCA IGTGCTGGTGA I21 mryo152 354 ACCAAGCACTG 355
GCTGGGTGGCr 356 ACCAAGCACTG cGCCACCCAGC CAGTGCTGGT yGCCACCCAGC P1
mryp522 358 CGGCGGCGGG 359 GGCCCGATCAn 360 CGGCGGCGGG TGATCGGGCC
CCCGCCGCCG nTGATCGGGCC P1 mryp491 362 CGCTAGCGT 363
TCCCTGC[GCC].sub.13 364 CGCTAGCGCTn [GGC].sub.13GCAGGGA nAGCGCTAGCG
[GGC].sub.13GCAGGGA P1 mryp489 366 CGCTAGCGCT 367
TCCCTGC[GCC].sub.1 368 CGCTAGCGCTn [GGC].sub.12GCAGGGA nAGCGCTAGCG
[GGC].sub.12GCAGGGA P1 mryp486 370 CGCTAGCGCT 371
TCCCTGC[GCC].sub.11 372 CGCTAGCGCTn [GGC].sub.11GCAGGGA nAGCGCTAGCG
[GGC].sub.11GCAGGGA P1 mryp483 374 CGCTAGCGCT[G 375
TCCCTGC[GCC].sub.10 376 CGCTAGCGCTn GC].sub.10GCAGGGA nAGCGCTAGCG
GGC].sub.10GCAGGGA P1 mryp474 378 CGCTAGCGCT 379 TCCCTGC[GCC].sub.7
380 CGCTAGCGCTn [GGC].sub.7GCAGGGA nAGCGCTAGCG [GGC].sub.7GGGA I14
mrzl154 382 AAGACTCTCTCT 383 TCAAGCAGAGn 384 AACACTCTCTnC CTGCTTGA
AGAGAGTGTT TCTGCTTGA E9 mrzr176 386 TGAATGACACaA 387 CTGGGGCCTTy
388 TGAATGACACrA AGGCCCCAG GTGTCATTCA AGGCCCCAG I7 mrzs129 390
AACGGCTTCAtC 391 ACACAAGGAGrT 392 AACGGCTTCAy TCCTTGTGT GAAGCCGTT
CTCCTTGTGT 16 mrzu272 394 CCTGAGGTCTg 395 CAGGCCCCCCn 396
CCTGAGGTCTn GGGGGGCCTG AGACCTCAGG GGGGGGCCTG E2 mrzy349 398
CTCAACAAAAtC 399 TACAGTTTTGrT 400 CTCAACAAAAyC AAAACTGTA TTTGTTGAG
AAAACTGTA .sup.1Brackets depict repeats. Numbers indicate how often
the sequence in brackets is repeated.
TABLE-US-00011 TABLE 4 AAexchange ProtAccNo SeqID Protein mut SeqID
Protein T73I GI: 2828206 401 TPLNKiKTALG 402 TPLNKxKTALG A989T GI:
2828206 403 CNHVStLASNY 404 CNHVSxLASNY
Sequence CWU 1
1
406119DNAArtificial SequenceDescription of Artificial Sequence
Primer 1gtagggggct ccgttcacg 19225DNAArtificial SequenceDescription
of Artificial Sequence Primer 2cctggaaggt tgtttttaca gacgg
25319DNAArtificial SequenceDescription of Artificial Sequence
Primer 3tggagactgg cgccgtctg 19422DNAArtificial SequenceDescription
of Artificial Sequence Primer 4aaggacagta tccgtcacca gg
22522DNAArtificial SequenceDescription of Artificial Sequence
Primer 5catggggttg tgaggattgc ac 22623DNAArtificial
SequenceDescription of Artificial Sequence Primer 6tgagattcaa
acccgtgagc agc 23724DNAArtificial SequenceDescription of Artificial
Sequence Primer 7cttagaaact cattcaccct tggg 24822DNAArtificial
SequenceDescription of Artificial Sequence Primer 8gtgacaaggc
ttcctaaggc tg 22927DNAArtificial SequenceDescription of Artificial
Sequence Primer 9gattaacatc tgccatctta ccataag 271021DNAArtificial
SequenceDescription of Artificial Sequence Primer 10cctcccccca
atcaaaggac c 211121DNAArtificial SequenceDescription of Artificial
Sequence Primer 11agctggtttc atgctccagg c 211225DNAArtificial
SequenceDescription of Artificial Sequence Primer 12ctagaagaag
gaacttaggg tcaac 251321DNAArtificial SequenceDescription of
Artificial Sequence Primer 13ttccagggcg gtctgttgta g
211423DNAArtificial SequenceDescription of Artificial Sequence
Primer 14attacttttg gtctccactg agc 231523DNAArtificial
SequenceDescription of Artificial Sequence Primer 15aaaacccaac
aactcctgtc ttg 231620DNAArtificial SequenceDescription of
Artificial Sequence Primer 16gcatctttcc ctccgggtcc
201721DNAArtificial SequenceDescription of Artificial Sequence
Primer 17acccagcccc agaatgtgat c 211822DNAArtificial
SequenceDescription of Artificial Sequence Primer 18gcacacacac
tcatttgtgg tc 221923DNAArtificial SequenceDescription of Artificial
Sequence Primer 19gagcagctga ctacttgcta agc 232023DNAArtificial
SequenceDescription of Artificial Sequence Primer 20cattcattca
ttcactcccc acc 232125DNAArtificial SequenceDescription of
Artificial Sequence Primer 21ctgtcattga ctctcattgc ctaac
252221DNAArtificial SequenceDescription of Artificial Sequence
Primer 22agtaacaggc agcactgcca g 212321DNAArtificial
SequenceDescription of Artificial Sequence Primer 23atctctggca
gaccccacaa c 212424DNAArtificial SequenceDescription of Artificial
Sequence Primer 24aactgaaaga tcaaagccaa ggag 242522DNAArtificial
SequenceDescription of Artificial Sequence Primer 25ccccacgtgt
cacaagtcat tc 222620DNAArtificial SequenceDescription of Artificial
Sequence Primer 26tgggctggaa atccccacgc 202720DNAArtificial
SequenceDescription of Artificial Sequence Primer 27gggaggagga
gagatctgcg 202820DNAArtificial SequenceDescription of Artificial
Sequence Primer 28tgaaccacag ccggaactgc 202920DNAArtificial
SequenceDescription of Artificial Sequence Primer 29ggatggatca
accggggaag 203023DNAArtificial SequenceDescription of Artificial
Sequence Primer 30tcagaatccc agatatgcag ccg 233122DNAArtificial
SequenceDescription of Artificial Sequence Primer 31tgttgagtga
tgggctgatc cc 223228DNAArtificial SequenceDescription of Artificial
Sequence Primer 32ccttttaaaa atattcaggt acgcagag
283323DNAArtificial SequenceDescription of Artificial Sequence
Primer 33cactgctcct aggatgatga ctc 233421DNAArtificial
SequenceDescription of Artificial Sequence Primer 34gagtgtgatc
tagaggctgc g 213523DNAArtificial SequenceDescription of Artificial
Sequence Primer 35ggggaaaccc ttgaaagtta acc 233623DNAArtificial
SequenceDescription of Artificial Sequence Primer 36cagccaaggg
aaagaaatgc aag 233720DNAArtificial SequenceDescription of
Artificial Sequence Primer 37atgcctagcg ccattcgtgc
203820DNAArtificial SequenceDescription of Artificial Sequence
Primer 38gggagcacgg tgggaattcg 203924DNAArtificial
SequenceDescription of Artificial Sequence Primer 39gaaggaatgt
tgaggccttc agtg 244024DNAArtificial SequenceDescription of
Artificial Sequence Primer 40gaaaagagac gttgctgctt tcgc
244121DNAArtificial SequenceDescription of Artificial Sequence
Primer 41aagtgaggcc ctcctagcag g 214222DNAArtificial
SequenceDescription of Artificial Sequence Primer 42tgatagcagc
agactcacag cc 224320DNAArtificial SequenceDescription of Artificial
Sequence Primer 43acactcggcc tgcttctacg 204422DNAArtificial
SequenceDescription of Artificial Sequence Primer 44aaggactcct
aaaggggaca cg 224521DNAArtificial SequenceDescription of Artificial
Sequence Primer 45gctcctggat gctgttatcg c 214621DNAArtificial
SequenceDescription of Artificial Sequence Primer 46tggctggtgg
caacctcaaa g 214723DNAArtificial SequenceDescription of Artificial
Sequence Primer 47cccttggttt tagcatctgc ctc 234823DNAArtificial
SequenceDescription of Artificial Sequence Primer 48gggctgaggc
ctttttttgt tcc 234923DNAArtificial SequenceDescription of
Artificial Sequence Primer 49tgtgtgcatg tggaaacact ccg
235025DNAArtificial SequenceDescription of Artificial Sequence
Primer 50gacaggtgag ttaacataga caagg 255119DNAArtificial
SequenceDescription of Artificial Sequence Primer 51tgctggtgaa
gcccccgac 195221DNAArtificial SequenceDescription of Artificial
Sequence Primer 52gtttggggtc ccacaaaacg c 215319DNAArtificial
SequenceDescription of Artificial Sequence Primer 53ctccctgcag
tgcctggtc 195421DNAArtificial SequenceDescription of Artificial
Sequence Primer 54ccacactggg gacatggtaa g 215519DNAArtificial
SequenceDescription of Artificial Sequence Primer 55agggcagccc
ggctctaac 195621DNAArtificial SequenceDescription of Artificial
Sequence Primer 56gccggggttt ggctttatac c 215723DNAArtificial
SequenceDescription of Artificial Sequence Primer 57ctctctctgg
aattactgcg gag 235821DNAArtificial SequenceDescription of
Artificial Sequence Primer 58ctgctcctca aactccgtac c
215923DNAArtificial SequenceDescription of Artificial Sequence
Primer 59gaaagtcaag tacgcccgct tac 236020DNAArtificial
SequenceDescription of Artificial Sequence Primer 60aggtgcacag
gatagggtcc 206121DNAArtificial SequenceDescription of Artificial
Sequence Primer 61ctgagagggt gctctgtatc g 216224DNAArtificial
SequenceDescription of Artificial Sequence Primer 62cacttctgca
agttgtatgc gctc 246320DNAArtificial SequenceDescription of
Artificial Sequence Primer 63gagagggctg tcgagttggg
206423DNAArtificial SequenceDescription of Artificial Sequence
Primer 64tcagtgcaat catagggctt gcc 236520DNAArtificial
SequenceDescription of Artificial Sequence Primer 65ccagaagtcc
ttaggtcgcc 206623DNAArtificial SequenceDescription of Artificial
Sequence Primer 66cttcaaacac ccctaccgag atg 236722DNAArtificial
SequenceDescription of Artificial Sequence Primer 67ggacatgctt
tcctggtcaa gc 226821DNAArtificial SequenceDescription of Artificial
Sequence Primer 68gggctgtcac tagggataag g 216921DNAArtificial
SequenceDescription of Artificial Sequence Primer 69gcaaccagct
ggaaggtact g 217023DNAArtificial SequenceDescription of Artificial
Sequence Primer 70cagaagtctg gctgccaaaa ctc 237121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 71gcgtgcccag tcctggggtt t 217221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 72aaaccccagg actgggcacg c 217321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 73gcgtgcccag ycctggggtt t 217421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 74aaaccccagg rctgggcacg c 217521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75gcgtgcccag ccctggggtt t 217621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 76aaaccccagg gctgggcacg c 217721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 77agccttggag gatctggggt g 217821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 78caccccagat cctccaaggc t 217921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 79agccttggag ratctggggt g 218021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 80caccccagat yctccaaggc t 218121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 81agccttggag aatctggggt g 218221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 82caccccagat tctccaaggc t 218324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 83actccaggca ggtagggggc tccg 248424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 84cggagccccc tacctgcctg gagt 248524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 85actccaggca ggtagggggc tccg 248624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 86cggagccccc tacctgcctg gagt 248720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 87actccaggca gggggctccg 208820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 88cggagccccc tgcctggagt 208921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 89tgtgatcggc ccgcctcggc t 219021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 90agccgaggcg ggccgatcac a 219121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 91tgtgatcggc ycgcctcggc t 219221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 92agccgaggcg rgccgatcac a 219321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 93tgtgatcggc tcgcctcggc t 219421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 94agccgaggcg agccgatcac a 219521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 95ttaatttttt tattattatt t 219621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 96aaataataat aaaaaaatta a 219722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 97ttaatttttt ttattattat tt 229822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 98aaataataat aaaaaaaatt aa 229922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 99ttaatttttt ttattattat tt 2210022DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 100aaataataat aaaaaaaatt aa 2210121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 101ttcctccttc cctcgctagg t 2110221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 102acctagcgag ggaaggagga a 2110328DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 103ttcctccttc ctccttccct cgctaggt
2810428DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 104acctagcgag gaggaaggga aggaggaa
2810528DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 105ttcctccttc ctccttccct cgctaggt
2810628DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 106acctagcgag ggaaggagga aggaggaa
2810721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 107tgggggaccc aggccaataa a
2110821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 108tttattggcc tgggtccccc a
2110921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 109tgggggaccc rggccaataa a
2111021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 110tttattggcc ygggtccccc a
2111121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 111tgggggaccc gggccaataa a
2111221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 112tttattggcc cgggtccccc a
2111321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 113aagagtagca gttttatctt g
2111421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 114caagataaaa ctgctactct t
2111521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 115aagagtagca rttttatctt g
2111621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 116caagataaaa ytgctactct t
2111721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic
oligonucleotide 117aagagtagca attttatctt g 2111821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 118caagataaaa ttgctactct t 2111921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 119aaaaaaatcc caatccaaaa a 2112021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 120tttttggatt gggatttttt t 2112121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 121aaaaaaatcc maatccaaaa a 2112221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 122tttttggatt kggatttttt t 2112321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 123aaaaaaatcc aaatccaaaa a 2112421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 124tttttggatt tggatttttt t 2112521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 125gtttcgttgt ggggggtggg a 2112621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 126tcccaccccc cacaacgaaa c 2112721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 127gtttcgttgt rgggggtggg a 2112821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 128tcccaccccc yacaacgaaa c 2112921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 129gtttcgttgt agggggtggg a 2113021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 130tcccaccccc tacaacgaaa c 2113121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 131ccaggccccc cagacctcag g 2113221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 132cctgaggtct ggggggcctg g 2113321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 133ccaggccccc yagacctcag g 2113421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 134cctgaggtct rgggggcctg g 2113521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 135ccaggccccc tagacctcag g 2113621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 136cctgaggtct agggggcctg g 2113721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 137cctttccact cctgtggcct c 2113821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 138gaggccacag gagtggaaag g 2113921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 139cctttccact mctgtggcct c 2114021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 140gaggccacag kagtggaaag g 2114121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 141cctttccact actgtggcct c 2114221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 142gaggccacag tagtggaaag g 2114321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 143cctgtggcct caatccagga t 2114421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 144atcctggatt gaggccacag g 2114521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 145cctgtggcct saatccagga t 2114621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 146atcctggatt saggccacag g 2114721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 147cctgtggcct gaatccagga t 2114821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 148atcctggatt caggccacag g 2114921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 149ccaggcagcc ggtgaaggtt g 2115021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 150caaccttcac cggctgcctg g 2115121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 151ccaggcagcc rgtgaaggtt g 2115221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 152caaccttcac yggctgcctg g 2115321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 153ccaggcagcc agtgaaggtt g 2115421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 154caaccttcac tggctgcctg g 2115521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 155cggtgaaggt tgtgtactcc t 2115621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 156aggagtacac aaccttcacc g 2115721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 157cggtgaaggt ygtgtactcc t 2115821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 158aggagtacac raccttcacc g 2115921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 159cggtgaaggt cgtgtactcc t 2116021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 160aggagtacac gaccttcacc g 2116121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 161ctcatgagct tcttcttcaa g 2116221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 162cttgaagaag aagctcatga g 2116321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 163ctcatgagct kcttcttcaa g 2116421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 164cttgaagaag magctcatga g 2116521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 165ctcatgagct gcttcttcaa g 2116621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 166cttgaagaag cagctcatga g 2116721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 167agttcgtgaa tgacacgaag g 2116821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 168ccttcgtgtc attcacgaac t 2116921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 169agttcgtgaa ygacacgaag g 2117021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 170ccttcgtgtc rttcacgaac t 2117121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 171agttcgtgaa cgacacgaag g 2117221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 172ccttcgtgtc gttcacgaac t 2117321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 173aaggtagggg acgctgtgcc a 2117421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 174tggcacagcg tcccctacct t 2117521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 175aaggtagggg rcgctgtgcc a 2117621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 176tggcacagcg ycccctacct t 2117721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 177aaggtagggg gcgctgtgcc a 2117821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 178tggcacagcg ccccctacct t 2117921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 179acgctcagag gttcatggac t 2118021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 180agtccatgaa cctctgagcg t 2118121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 181acgctcagag kttcatggac t 2118221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 182agtccatgaa mctctgagcg t 2118321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 183acgctcagag tttcatggac t 2118421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 184agtccatgaa actctgagcg t 2118521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 185ggcagtgggc cgagggagtg g 2118621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 186ccactccctc ggcccactgc c 2118721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 187ggcagtgggc ygagggagtg g 2118821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 188ccactccctc rgcccactgc c 2118921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 189ggcagtgggc tgagggagtg g 2119021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 190ccactccctc agcccactgc c 2119121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 191gccagttgga ctcacttggg g 2119221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 192ccccaagtga gtccaactgg c 2119321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 193gccagttgga stcacttggg g 2119421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 194ccccaagtga stccaactgg c 2119521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 195gccagttgga gtcacttggg g 2119621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 196ccccaagtga ctccaactgg c 2119721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 197actctcactc agggcacagc a 2119821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 198tgctgtgccc tgagtgagag t 2119921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 199actctcactc rgggcacagc a 2120021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 200tgctgtgccc ygagtgagag t 2120121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 201actctcactc ggggcacagc a 2120221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 202tgctgtgccc cgagtgagag t 2120321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 203gcaggtggcc ctgtgcacat t 2120421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 204aatgtgcaca gggccacctg c 2120521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 205gcaggtggcc ytgtgcacat t 2120621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 206aatgtgcaca rggccacctg c 2120721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 207gcaggtggcc ttgtgcacat t 2120821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 208aatgtgcaca aggccacctg c 2120921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 209ttgccgtcta cgtgaccatt g 2121021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 210caatggtcac gtagacggca a 2121121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 211ttgccgtcta ygtgaccatt g 2121221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 212caatggtcac rtagacggca a 2121321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 213ttgccgtcta tgtgaccatt g 2121421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 214caatggtcac atagacggca a 2121521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 215tcgttgatca gatctgtctg t 2121621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 216acagacagat ctgatcaacg a 2121721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 217tcgttgatca satctgtctg t
2121821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 218acagacagat stgatcaacg a
2121921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 219tcgttgatca catctgtctg t
2122021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 220acagacagat gtgatcaacg a
2122121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 221gattctctcc gagaaaacat c
2122221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 222gatgttttct cggagagaat c
2122321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 223gattctctcc ragaaaacat c
2122421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 224gatgttttct yggagagaat c
2122521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 225gattctctcc aagaaaacat c
2122621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 226gatgttttct tggagagaat c
2122722DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 227agtctcacac atgtgcactc ac
2222822DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 228gtgagtgcac atgtgtgaga ct
2222922DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 229agtctcacac atgtgcactc ac
2223022DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 230gtgagtgcac atgtgtgaga ct
2223120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 231agtctcacac gtgcactcac
2023220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 232gtgagtgcac gtgtgagact
2023321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 233catgtgcact gacgtggccg g
2123421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 234ccggccacgt cagtgcacat g
2123521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 235catgtgcact sacgtggccg g
2123621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 236ccggccacgt sagtgcacat g
2123721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 237catgtgcact cacgtggccg g
2123821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 238ccggccacgt gagtgcacat g
2123921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 239ggggctgggg ctgggtgcgt g
2124021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 240cacgcaccca gccccagccc c
2124127DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 241ggggctgggg ctggggctgg gtgcgtg
2724227DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 242cacgcaccca ggccccaccc cagcccc
2724327DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 243ggggctgggg ctggggctgg gtgcgtg
2724427DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 244cacgcaccca gccccagccc cagcccc
2724521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 245tgtctaatta tagaaatgga t
2124621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 246atccatttct ataattagac a
2124721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 247tgtctaatta yagaaatgga t
2124821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 248atccatttct rtaattagac a
2124921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 249tgtctaatta cagaaatgga t
2125021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 250atccatttct gtaattagac a
2125121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 251ctgggaagtc gtccctgacc c
2125221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 252gggtcaggga cgacttccca g
2125321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 253ctgggaagtc rtccctgacc c
2125421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 254gggtcaggga ygacttccca g
2125521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 255ctgggaagtc atccctgacc c
2125621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 256gggtcaggga tgacttccca g
2125721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 257ccatgtcagc gtgacacagg t
2125821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 258acctgtgtca cgctgacatg g
2125921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 259ccatgtcagc rtgacacagg t
2126021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 260acctgtgtca ygctgacatg g
2126121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 261ccatgtcagc atgacacagg t
2126221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 262acctgtgtca tgctgacatg g
2126321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 263ctggtttttt tcttccggtc a
2126421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 264tgaccggaag aaaaaaacca g
2126521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 265ctggtttttt tcttccggtc a
2126621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 266tgaccggaag aaaaaaacca g
2126720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 267ctggtttttt cttccggtca
2026820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 268tgaccggaag aaaaaaccag
2026921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 269cactggcaca gtggcctcta g
2127021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 270ctagaggcca ctgtgccagt g
2127121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 271cactggcaca rtggcctcta g
2127221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 272ctagaggcca ytgtgccagt g
2127321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 273cactggcaca atggcctcta g
2127421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 274ctagaggcca ttgtgccagt g
2127521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 275cccaaaacac gcacaccctg c
2127621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 276gcagggtgtg cgtgttttgg g
2127721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 277cccaaaacac rcacaccctg c
2127821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 278gcagggtgtg ygtgttttgg g
2127921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 279cccaaaacac acacaccctg c
2128021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 280gcagggtgtg tgtgttttgg g
2128121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 281gtgcactcac gtggccgggt g
2128221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 282cacccggcca cgtgagtgca c
2128321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 283gtgcactcac rtggccgggt g
2128421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 284cacccggcca ygtgagtgca c
2128521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 285gtgcactcac atggccgggt g
2128621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 286cacccggcca tgtgagtgca c
2128721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 287ccacggcagc cgtggacctg g
2128821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 288ccaggtccac ggctgccgtg g
2128921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 289ccacggcagc ygtggacctg g
2129021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 290ccaggtccac rgctgccgtg g
2129121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 291ccacggcagc tgtggacctg g
2129221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 292ccaggtccac agctgccgtg g
2129321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 293ctccttccct cgctaggtcc t
2129421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 294aggacctagc gagggaagga g
2129521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 295ctccttccct ygctaggtcc t
2129621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 296aggacctagc ragggaagga g
2129721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 297ctccttccct tgctaggtcc t
2129821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 298aggacctagc aagggaagga g
2129921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 299gggaatcact caacctctct g
2130021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 300cagagaggtt gagtgattcc c
2130121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 301gggaatcact maacctctct g
2130221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 302cagagaggtt kagtgattcc c
2130321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 303gggaatcact aaacctctct g
2130421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 304cagagaggtt tagtgattcc c
2130521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 305tgtctccttt cgcttctccc a
2130621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 306tgggagaagc gaaaggagac a
2130721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 307tgtctccttt ygcttctccc a
2130821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 308tgggagaagc raaaggagac a
2130921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 309tgtctccttt tgcttctccc a
2131021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 310tgggagaagc aaaaggagac a
2131121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 311ccttaaacag gatttgaaaa g
2131221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 312cttttcaaat cctgtttaag g
2131321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 313ccttaaacag satttgaaaa g
2131421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 314cttttcaaat sctgtttaag g
2131521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 315ccttaaacag catttgaaaa g
2131621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 316cttttcaaat gctgtttaag g
2131721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 317tgtgaccaca gatgagtgtg t
2131821DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 318acacactcat
ctgtggtcac a 2131921DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 319tgtgaccaca ratgagtgtg t
2132021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 320acacactcat ytgtggtcac a
2132121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 321tgtgaccaca aatgagtgtg t
2132221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 322acacactcat ttgtggtcac a
2132321DNAArtificial SequenceDescription of Artificial Sequence
sequence of G57998T (exon 10, Arg433Ser) 323ac gct cag agt ttc atg
gac t 21Ala Gln Ser Phe Met Asp1 53246PRTArtificial
SequenceDescription of Artificial Sequence sequence of G57998T
(exon 10, Arg433Ser) 324Ala Gln Ser Phe Met Asp1
532521DNAArtificial SequenceDescription of Artificial Sequence
sequence of G27258A (exon 17, Arg723Gln) 325gat tct ctc caa gaa aac
atc 21Asp Ser Leu Gln Glu Asn Ile1 53267PRTArtificial
SequenceDescription of Artificial Sequence sequence of G27258A
(exon 17, Arg723Gln) 326Asp Ser Leu Gln Glu Asn Ile1
532721DNAArtificial SequenceDescription of Artificial Sequence
sequence of T249G (exon 8, Phe329Cys) 327ctc atg agc tgc ttc ttc
aag 21Leu Met Ser Cys Phe Phe Lys1 53287PRTArtificial
SequenceDescription of Artificial Sequence sequence of T249G (exon
8, Phe329Cys) 328Leu Met Ser Cys Phe Phe Lys1 532920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 329taaccaggtt gttgatcctc 2033020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 330gaggatcaac aacctggtta 2033120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 331taaccaggtt rttgatcctc 2033220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 332gaggatcaay aacctggtta 2033321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 333tggggtgggg atggcgcggg g 2133421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 334ccccgcgcca tccccacccc a 2133521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 335tggggtgggg rtggcgcggg g 2133621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 336ccccgcgcca yccccacccc a 2133722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 337tgggcacgcg accccccacg ca 2233822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 338tgcgtggggg gtcgcgtgcc ca 2233922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 339tgggcacgcg rccccccacg ca 2234022DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 340tgcgtggggg gycgcgtgcc ca 2234121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 341ccatgtgtcc acgctggctt c 2134221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 342gaagccagcg tggacacatg g 2134321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 343ccatgtgtcc rcgctggctt c 2134421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 344gaagccagcg yggacacatg g 2134521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 345tgaagccccc aaccttgtgg g 2134621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 346cccacaaggt tgggggcttc a 2134721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 347tgaagccccc raccttgtgg g 2134821DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 348cccacaaggt ygggggcttc a 2134921DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 349tgggtggcac ggtgctggtg a 2135021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 350tcaccagcac cgtgccaccc a 2135121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 351tgggtggcac rgtgctggtg a 2135221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 352tcaccagcac ygtgccaccc a 2135321DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 353gctgggtggc gcagtgctgg t 2135422DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 354accaagcact gcgccaccca gc 2235521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 355gctgggtggc rcagtgctgg t 2135622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 356accaagcact gygccaccca gc 2235720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 357ggcccgatca cccgccgccg 2035820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 358cggcggcggg tgatcgggcc 2035934DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 359ggcccgatca cccgccgccc ggtgcccgcc gccg
3436034DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 360cggcggcggg cagcgggcgg cgggtgatcg ggcc
3436156DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 361tccctgcgcc gccgccgccg ccgccgccgc
cgccgccgcc gccgccagcg ctagcg 5636256DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 362cgctagcgct ggcggcggcg gcggcggcgg cggcggcggc
ggcggcggcg caggga 5636359DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 363tccctgcgcc
gccgccgccg ccgccgccgc cgccgccgcc gccgccgcca gcgctagcg
5936459DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 364cgctagcgct ggcggcggcg gcggcggcgg
cggcggcggc ggcggcggcg gcgcaggga 5936553DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 365tccctgcgcc gccgccgccg ccgccgccgc cgccgccgcc
gccagcgcta gcg 5336653DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 366cgctagcgct
ggcggcggcg gcggcggcgg cggcggcggc ggcggcgcag gga
5336759DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 367tccctgcgcc gccgccgccg ccgccgccgc
cgccgccgcc gccgccgcca gcgctagcg 5936859DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 368cgctagcgct ggcggcggcg gcggcggcgg cggcggcggc
ggcggcggcg gcgcaggga 5936950DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 369tccctgcgcc
gccgccgccg ccgccgccgc cgccgccgcc agcgctagcg 5037050DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 370cgctagcgct ggcggcggcg gcggcggcgg cggcggcggc
ggcgcaggga 5037159DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 371tccctgcgcc gccgccgccg
ccgccgccgc cgccgccgcc gccgccgcca gcgctagcg 5937259DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 372cgctagcgct ggcggcggcg gcggcggcgg cggcggcggc
ggcggcggcg gcgcaggga 5937347DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 373tccctgcgcc
gccgccgccg ccgccgccgc cgccgccagc gctagcg 4737447DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 374cgctagcgct ggcggcggcg gcggcggcgg cggcggcggc
gcaggga 4737559DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 375tccctgcgcc gccgccgccg
ccgccgccgc cgccgccgcc gccgccgcca gcgctagcg 5937659DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 376cgctagcgct ggcggcggcg gcggcggcgg cggcggcggc
ggcggcggcg gcgcaggga 5937738DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 377tccctgcgcc
gccgccgccg ccgccgccag cgctagcg 3837838DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 378cgctagcgct ggcggcggcg gcggcggcgg cgcaggga
3837959DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 379tccctgcgcc gccgccgccg ccgccgccgc
cgccgccgcc gccgccgcca gcgctagcg 5938059DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 380cgctagcgct ggcggcggcg gcggcggcgg cggcggcggc
ggcggcggcg gcgcaggga 5938120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 381tcaagcagag
agagagtgtt 2038220DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 382aacactctct ctctgcttga
2038322DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 383tcaagcagag aaagagagtg tt
2238422DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 384aacactctct ttctctgctt ga
2238521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 385ctggggcctt tgtgtcattc a
2138621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 386tgaatgacac aaaggcccca g
2138721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 387ctggggcctt ygtgtcattc a
2138821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 388tgaatgacac raaggcccca g
2138921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 389acacaaggag atgaagccgt t
2139021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 390aacggcttca tctccttgtg t
2139121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 391acacaaggag rtgaagccgt t
2139221DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 392aacggcttca yctccttgtg t
2139321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 393caggcccccc cagacctcag g
2139421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 394cctgaggtct gggggggcct g
2139521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 395caggcccccc cagacctcag g
2139621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 396cctgaggtct gggggggcct g
2139721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 397tacagttttg attttgttga g
2139821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 398ctcaacaaaa tcaaaactgt a
2139921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 399tacagttttg rttttgttga g
2140021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 400ctcaacaaaa ycaaaactgt a
2140111PRTArtificial SequenceDecsription of Artificial Sequence
Illustrative peptide 401Thr Pro Leu Asn Lys Ile Lys Thr Ala Leu
Gly1 5 1040211PRTArtificial SequenceDecsription of Artificial
Sequence Illustrative peptide 402Thr Pro Leu Asn Lys Xaa Lys Thr
Ala Leu Gly1 5 1040311PRTArtificial SequenceDecsription of
Artificial Sequence Illustrative peptide 403Cys Asn His Val Ser Thr
Leu Ala Ser Asn Tyr1 5 1040411PRTArtificial SequenceDecsription of
Artificial Sequence Illustrative peptide 404Cys Asn His Val Ser Xaa
Leu Ala Ser Asn Tyr1 5 1040515DNAArtificial SequenceDecsription of
Artificial Sequence Synthetic oligonucleotide 405cccgccgccc gggtg
1540614PRTArtificial SequenceDescription of Artificial Sequence
Illustrative transport family signature motif 406Leu Ser Ser Gly
Gly Gln Xaa Xaa Xaa Arg Xaa Xaa Xaa Ala1 5 10
* * * * *