Methods and Compositions for Improved Digestion of Milk Oligosaccharides

Abstract

Pre-biotic compositions containing oligosaccharides and probiotic compositions useful for treatment of a subject are provided herein. Also provided are methods for administering probiotic or pre-biotic compositions.

Description

CROSS-REFERENCES TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Appl. No. 61/836,046, filed Jun. 17, 2013, the disclosure of which is incorporated by reference in its entirety.

BACKGROUND OF THE INVENTION

[0003] In addition to essential nutrients such as lactose lipids and proteins, human milk contains a large concentration of oligosaccharides. Human milk oligosaccharides (HMO) are complex and diverse molecules. These molecules are composed of glucose (Glc), galactose (Gal), N-acetylglucosamine (GlcNAc), and often contain fucose (Fuc) and/or N-acetylneuraminic acid (NeuAc), linked via several glycosidic bonds. The simplest oligosaccharides in human milk are trisaccharides where lactose can be sialylated to form sialyllactose, or fucosylated to form fucosyllactose. More complex HMO are also based on a lactose core that is conjugated with repeats of lacto-N-biose I (Gal.beta.1-3GlcNAc; LNB; type-1 chain) or N-acetyllactosamine (Gal.beta.1-4GlcNAc; type-2 chain), producing molecules with a degree of polymerization larger than 4 (Bode et al. (2012) Adv. Nutr. 3:383 S). These core structures can be modified by fucose and sialic acid residues via different linkages (De Leoz et al. (2012) J. Proteome Res. 11:4662). Although a large number of different HMO structures have been determined, a few isomers can represent up to 70% of the total molecules.

[0004] Remarkably, the energetic value of HMO for the infant is minimal. HMO are resistant to enzymatic hydrolysis from intestinal brush border membrane and pancreatic juices, and therefore the majority of these molecules transit the intestinal tract reaching the colon in intact form. During their transit HMO are believed to prevent pathoge colonization, by serving as decoy binding sites for epithelial glycans (Newburg et al. (2005) Annu Rev. Nutr. 25:37).

[0005] Human milk oligosaccharides (HMO) influence the composition of the intestinal microbiota in the first years of life. While the microbial community in breast-fed infants is largely dominated by the genus Bifidobacterium, formula-fed infants show increased bacterial diversity (Roger et al. (2010) Microbiol. 156:3329; Yatsunenko et al. (2012) Nature 486:222). This indicates that both pro- and antimicrobial elements in breast-milk account for these differences. A conceptual basis for co-evolution between bifidobacteria and milk glycans is supported by recent definition of the molecular mechanisms by which these microbes catabolize HMO. In Bifidobacterium longum subsp. infantis (B. infantis) ATCC 15697, these mechanisms include oligosaccharide transporters and intracellular glycosyl hydrolases (GH) such as fucosidases, hexosaminidases and sialidases (Gamido et al. (2012) Adv. Nutr. 3:415 S).

BRIEF SUMMARY OF THE INVENTION

[0006] Provided herein are methods for promoting growth of beneficial gut bacteria and/or increasing oligosaccharide consumption in an individual, comprising administering to the individual a composition comprising a bacterium that expresses heterologous alpha-fucosidase, thereby promoting growth of beneficial gut bacteria in the individual. In some embodiments, the heterologous alpha-fucosidase is GH-29. In some embodiments, the heterologous alpha-fucosidase is GH-95. In some embodiments, the bacterium is not Bifidobacterium longum subsp. infantis (B. infantis), or B. bifidum.

[0007] In some cases, the bacteria further expresses a second heterologous alpha-fucosidase. The second alpha-fucosidase can be GH-95 or GH-29. In some embodiments, the bacterium is selected from the group consisting of Lactobacillus and Bifidobacterium. In some embodiments, the Lactobacillus is selected from the group consisting of L. casei, L. paracasei, and L. rhamnosus. The Bifidobacterium can be selected from the group consisting of B. adolescentis, B. catenulatum, B. pseudocatenulatum, B. dentium, B. longum, and B. breve. In some embodiments, the bacterium is Bifidobacterium breve (B. breve).

[0008] In some embodiments, the method further comprises administering an oligosaccharide, e.g., an exogenous oligosaccharide. The oligosaccharide can be administered at the same time (e.g., in the same composition) or at a different time from the bacteria. The oligosaccharide can be a fucosylated oligosaccharide. In some embodiments, the composition comprises a milk oligosaccharide, a fucosylated milk oligosaccharide, or a human milk oligosaccharide. In some embodiments, the composition does not include an oligosaccharide containing an N-glycolylneuraminic acid residue.

[0009] In some embodiments, the oligosaccharide is selected from the group consisting of: an oligosaccharide consisting of 3 Hexose (Hex) moieties and 6 N-acetyl hexosamine (HexNAc) moieties; an oligosaccharide consisting of 4 Hex moieties and 3 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties and 4 HexNAc moieties; an oligosaccharide consisting of 6 Hex moieties and 2 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties, 4 HexNAc moieties and 1 fucose (Fuc) moiety; an oligosaccharide consisting of 4 Hex moieties and 4 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties and 5 HexNAc moieties; an oligosaccharide consisting of 4 Hex moieties, 4 HexNAc moieties, and 1 Fuc moiety; an oligosaccharide consisting of 5 Hex moieties and 4 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties, 5 HexNAc moieties, and 1 Fuc moiety; an oligosaccharide consisting of 4 Hex moieties and 5 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties and 6 HexNAc moieties; an oligosaccharide consisting of 5 Hex moieties, 4 HexNAc moieties, and 1 Fuc moiety; an oligosaccharide consisting of 4 Hex moieties, 5 HexNAc moieties, and 1 Fuc moiety; and an oligosaccharide consisting of 3 Hex moieties, 6 HexNAc moieties, and 1 Fuc moiety.

[0010] Further provided are compositions comprising a beneficial gut bacterial strain that expresses a heterologous alpha-fucosidase. In some embodiments, the alpha-fucosidase is GH-29 or GH-95. In some embodiments, the bacterial strain is not Bifidobacterium longum subsp. infantis (B. infantis) or B. bifidum. In some embodiments, the composition further comprising at least one oligosaccharide, such as a fucosylated oligosaccharide, a milk oligosaccharide, or a human milk oligosaccharide. In some cases the beneficial gut bacterial strain expresses at least two heterologous alpha-fucosidases. For example, the beneficial gut bacterial strain can express both GH-29 and GH-95.

[0011] In some embodiments, the composition includes a beneficial gut bacterial strain selected from the group consisting of Lactobacillus and Bifidobacterium. The Lactobacillus can be selected from the group consisting of L. casei, L. paracasei, and L. rhamnosus. The Bifidobacterium can be selected from the group consisting of B. adolescentis, B. catenulatum, B. pseudocatenulatum, B. dentium, B. longum, and B. breve. In some embodiments, the beneficial gut bacterial strain is Bifidobacterium breve (B. breve).

[0012] In some embodiments, the composition does not include an oligosaccharide containing an N-glycolylneuraminic acid residue. In some embodiments, the at least one oligosaccharide includes a milk oligosaccharide, a fucosylated oligosaccharide, or a human milk oligosaccharide.

[0013] In some embodiments, the at least one milk oligosaccharide is selected from the group consisting of: an oligosaccharide consisting of 3 Hexose (Hex) moieties and 6 N-acetyl hexosamine (HexNAc) moieties; an oligosaccharide consisting of 4 Hex moieties and 3 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties and 4 HexNAc moieties; an oligosaccharide consisting of 6 Hex moieties and 2 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties, 4 HexNAc moieties and 1 fucose (Fuc) moiety; an oligosaccharide consisting of 4 Hex moieties and 4 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties and 5 HexNAc moieties; an oligosaccharide consisting of 4 Hex moieties, 4 HexNAc moieties, and 1 Fuc moiety; an oligosaccharide consisting of 5 Hex moieties and 4 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties, 5 HexNAc moieties, and 1 Fuc moiety; an oligosaccharide consisting of 4 Hex moieties and 5 HexNAc moieties; an oligosaccharide consisting of 3 Hex moieties and 6 HexNAc moieties; an oligosaccharide consisting of 5 Hex moieties, 4 HexNAc moieties, and 1 Fuc moiety; an oligosaccharide consisting of 4 Hex moieties, 5 HexNAc moieties, and 1 Fuc moiety; and an oligosaccharide consisting of 3 Hex moieties, 6 HexNAc moieties, and 1 Fuc moiety.

[0014] Also provided are compositions comprising beneficial gut bacteria, wherein the bacteria express more than one heterologous alpha-fucosidase, the composition further comprising at least one oligosaccharide. In some embodiments, the bacteria are not Bifidobacterium longum subsp. infantis (B. infantis), or B. bifidum. In some embodiments, the more than one alpha-fucosidase includes GH-29. In some embodiments, the more than one alpha-fucosidase further includes GH-95. In some embodiments, the at least one oligosaccharide includes a fucosylated oligosaccharide. In some embodiments, the at least one oligosaccharide includes a milk oligosaccharide. In some embodiments, the at least one oligosaccharide includes a human milk oligosaccharide or a fucosylated human milk oligosaccharide.

[0015] In some embodiments, the beneficial gut bacteria are a strain selected from the group consisting of Lactobacillus and Bifidobacterium. The Lactobacillus can be selected from the group consisting of L. casei, L. paracasei, and L. rhamnosus. The Bifidobacterium can be selected from the group consisting of B. adolescentis, B. catenulatum, B. pseudocatenulatum, B. dentium, B. longum, and B. breve. In some cases, the beneficial gut bacterial strain is Bifidobacterium breve (B. breve).

[0016] Further provided are methods of administering any of the foregoing compositions. Fore example, in some embodiments, a method of promoting growth of beneficial gut bacteria and/or increasing oligosaccharide consumption in an individual, comprising administering any of the foregoing compositions to the individual. In some embodiments, administration is oral. In some embodiments, administration is rectal.

[0017] In addition, provided herein are methods for isolating a beneficial strain of Bifidobacterium. In some embodiments, the method comprises: screening a population of Bifidobacterium for presence of a nucleic acid sequence encoding GH-29 or GH-95 alpha-fucosidase; detecting the presence or absence of the nucleic acid encoding GH-29 or GH-95 alpha-fucosidase; and selecting a Bifidobacterium strain where the presence of the GH-29 or GH-95 nucleic acid is detected, thereby isolating a beneficial strain of Bifidobacterium. In some embodiments, the method comprises: screening a population of Bifidobacterium for presence of GH-29 or GH-95 alpha-fucosidase polypeptide; detecting the presence or absence of the GH-29 or GH-95 alpha-fucosidase polypeptide; and selecting a Bifidobacterium strain where the presence of the GH-29 or GH-95 polypeptide is detected, thereby isolating a beneficial strain of Bifidobacterium.

[0018] Also provided are methods of making a beneficial strain of Bifidobacterium comprising: transfecting a Bifidobacterium with an expression cassette comprising a heterologous polynucleotide encoding GH-29 or GH-95 operably linked to a promoter; and selecting for and isolating Bifidobacterium containing the expression cassette. In some cases, the Bifidobacterium is not a strain of Bifidobacterium longum subsp. infantis (B. infantis), or B. bifidum. In some cases, the Bifidobacterium is a strain of Bifidobacterium breve (B. breve).

[0019] Further provided are methods for promoting growth of beneficial gut bacteria in an individual, comprising administering to the individual a composition comprising a bacterium that expresses a first heterologous alpha-fucosidase and a second heterologous alpha-fucosidase, thereby promoting growth of beneficial gut bacteria in the individual. In some embodiments, the first or second alpha-fucosidase is GH-29. In other cases, the first or second alpha-fucosidase is GH-95. In some embodiments, the first alpha-fucosidase is GH-29 and the second alpha-fucosidase is GH-95.

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1. Evolutionary relationship of B. breve strains used in the study. The tree is drawn to scale, with branch lengths in the same units (number of base substitutions per site) as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary history was inferred using the Minimum Evolution method, followed by 1000 bootstrap replicates.

[0021] FIG. 2. Phylogenetic relationship of homologous fucosidase Blon.sub.--0248 in B. breve strains. The tree is drawn to scale, with branch lengths in the same units (number of amino acid substitutions per site) as those of the evolutionary distances used to infer the phylogenetic tree The evolutionary history was inferred using the Minimum Evolution method, followed by 1000 bootstrap replicates.

[0022] FIG. 3. Growth of B. breve on HMO. B. breve isolates were inoculated on semi-synthetic MRS medium supplemented with 2% w/v HMO (A) and 2FL (B). B. infantis ATCC 15697 and B. breve ATCC 15700 were included as high and low growth controls respectively. Fermentations were carried out in triplicate.

[0023] FIG. 4. Glycoprofiling of the HMO consumption by selected B. breve strains. (A) Total utilization of HMO. Consumption is calculated as the percent difference in HMO between the start and the end of exponential phase. (B) Glycoprofiles of the consumption of neutral non-fucosylated HMO by seven B. breve strains. B. infantis ATCC 15697 was included as positive control.

[0024] FIG. 5. Glycoprofiling of the consumption of fucosylated and acidic HMO by select B. breve strains. Consumption of eight fucosylated HMO (A), and eleven sialylated HMO (B) was calculated. B. infantis ATCC 15697 was included as positive control. HMO consumption is represented as the percent difference in HMO between the start and the end of exponential phase.

[0025] FIG. 6. Fold in change expression for genes encoding .alpha.-fucosidases from GH families 95 and 29 in B. breve SC95, during mid-exponential growth on HMO and 2FL. Growth on lactose was used as a control.

[0026] FIG. 7. Temporal glycoprofile of the consumption of select neutral and acidic HMO by Bifidobacterium breve SC95 at different stages in the exponential phase.

DETAILED DESCRIPTION

I. Introduction

[0027] Provided herein are strains of beneficial gut bacteria that express one or more glycohydrolases capable of hydrolyzing a human milk oligosaccharide, or structurally similar oligosaccharides. In some embodiments, the gut bacteria are genetically engineered, and express one or more heterologous polypeptides. In some embodiments, the gut bacteria express at least one heterologoud glycohydrolase as described herein.

[0028] The present results show that certain glycohdrolases increase growth of beneficial gut bacteria on a human milk oligosaccharide (HMO) substrate. In some embodiments, alpha-fucosidases of the GH-29 family are associated with growth on HMO. In some embodiments, alpha-fucosidases of the GH-95 family are associated with growth on HMO. In some embodiments, bacteria that express multiple alpha-fucosidases (e.g., a GH-29 alpha-fucosidase and a GH-95 alpha-fucosidase) are capable of growing on human milk oligosaccharide, or structurally similar oligosaccharides.

[0029] The present results show that bacteria that express GH-29, express GH-95, or express multiple alpha-fucosidases (e.g., a GH-29 alpha-fucosidase and a GH-95 alpha-fucosidase), either endogenously or heterologously, can establish a beneficial microbiome in the gut of an individual to which HMO have been administered (e.g., a breastmilk-fed infant, or a human ingesting HMO). Alternatively, or in addition, administering HMO to a subject can be used to select for the establishment of a beneficial microbiome in the gut by selecting for beneficial bacteria that express GH-29, express GH-95, or express multiple alpha-fucosidases (e.g., a GH-29 alpha-fucosidase and a GH-95 alpha-fucosidase) in comparison to other microorganisms. Moreover, administering compositions of beneficial bacteria that express (e.g., heterologously) one or more of the glycohydrolases described herein, the composition further including a human milk oligosaccharide, can provide a therapeutic for, e.g. establishing a beneficial gut microbiome in a subject and selecting against for the growth of the beneficial gut bacteria in comparison to other microorganisms.

[0030] Disclosed herein is isolation of a representative number of strains of Bifidobacterium, and characterization of the molecular mechanisms for their consumption of milk oligosaccharides. Bifidobacterium breve, B. infantis, B. longum subsp. longum (B. longum), and B. bifidum are the species most frequently detected in breast-fed infant feces (Avershina et al. (2013) Appl. And Env. Microbiol. 79:497; Roger et al. (2010) Microbiol. 156:3329). In general, B. breve and B. infantis are more exclusively found in infants, and B. longum and B. bifidum are found in both infants and adults. While several strains of B. bifidum and B. infantis grow vigorously on HMO in vitro, this phenotype has been largely unexplored for larger numbers of B. breve and B. longum subsp. longum isolates. Only one strain of B. breve, ATCC 15700, was shown to utilize lacto-N-tetraose (LNT) primarily, contrasting with the versatility in HMO species consumption observed by B. infantis (Asakuma et al. (2011) J. Biol. Chem. 286:34583; LoCasio et al. (2007) J. Agric. Food Chem. 55:8914).

II. Definitions

[0031] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. See, e.g., Lackie, DICTIONARY OF CELL AND MOLECULAR BIOLOGY, Elsevier (4th ed. 2007); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, N.Y. 1989); Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention.

[0032] The term "glycohydrolase" as used herein refers to an enzyme that catalyzes the hydrolysis of glycosides. Similarly, the term "alpha-fucosidase" as used herein refers to a glycohydrolase that is specific for, or substantially specific for, alpha-fucosides. Alpha-fucosidases include those enzymes found in glycoside hydrolase family 29 (GH-29) and glycoside hydrolase family 95 (GH-95). Exemplary glycohydrolases include SEQ ID NOs: 1-6, polypeptides encoded by SEQ ID NOs: 7-12, or polypeptides or nucleic acids substantially identical, or substantially similar, thereto.

[0033] As used herein, the term "oligosaccharide" refers to polymeric carbohydrates that contain 3 to 20 monosaccharides covalently linked through glycosidic bonds. In some embodiments, the oligosaccharides are purified from human milk, bovine milk, or the milk of any other suitable mammal. In some cases, the oligosaccharides are purified from whey, cheese, or other dairy products, e.g., purified away from oligosaccharide-degrading enzymes in milk, whey, cheese, or other dairy products. Purified oligosaccharides can be further modified as described herein. Alternatively, the oligosaccharides can be synthesized or partially synthesized (e.g., synthesized from a purified oligosaccharide starting material) as described herein. Compositions described herein can include a mixture of oligosaccharides that have been purified, partially synthesized, or synthesized.

[0034] The term human milk oligosaccharide (HMO) can refer to a number of complex oligosaccharides found in human milk, or oligosaccharides that are structurally similar to, or structurally identical to oligosaccharides found in human milk. Consequently, HMO need not be derived from human milk or human milk products and can be partially synthesized, synthesized de novo, or derived from the milk of another organism. HMO compositions can include mixtures of oligosaccharides that have been purified, partially synthesized, or synthesized. HMO compositions further include chemically modified oligosaccharides found in human milk, or oligosaccharides that are structurally similar to, or structurally identical to oligosaccharides found in human milk as described herein. Human milk oligosaccharides can, in some embodiments, include fucosyl oligosaccharides.

[0035] Among the monomers of milk oligosaccharides are D-glucose (Glc), D-galactose (Gal), N-acetylglucosamine (GlcNAC), L-fucose (Fuc), and sialic acid [N-acetylneuraminic acid (NeuAc)]. Elongation may be achieved by attachment of GlcNAc residues linked in .beta.1-3 or .beta.1-4 linkage to a Gal residue followed by further addition of Gal in a .beta.-1-3 or .beta.-1-4 bond. Most HMOs carry lactose at their reducing end. From these monomers, a large number of core structures may be formed. Further variations may occur due to the attachment of lactosamine, Fuc, and/or NeuAc. See, e.g., Kunz, C. et al., Annual. Rev. Nutri., 20:699-722 (2000) for a further description of HMOs. Human milk oligosaccharides can also be found in, or purified from, the milk of other mammals, provided that they are identical or substantially identical to the human milk oligosaccharides.

[0036] Hexose (Hex) represents a residue of glucose or galactose or mannose.

[0037] Fucose (Fuc) represents a residue of Deoxyhexose.

[0038] HexNAc represents a residue of N-acetylglucosamine or N-acetylgalactosamine.

[0039] NeuAc represents a residue of N-acetyl neuraminic acid (sialic acid).

[0040] The term "Bifidobacterium" and its synonyms refer to a genus of anaerobic bacteria having beneficial properties for humans. Bifidobacteria is one of the major genera of bacteria that make up the gut flora, the bacteria that reside in the gastrointestinal tract and have health benefits for their hosts. See, e.g., Guarner F and Malagelada J R. Lancet (2003) 361, 512-519, for a further description of Bifidobacterium in the normal gut flora.

[0041] The term "beneficial gut bacteria" or the like refers to live microorganisms that reside in the gut or can be introduced into the gut of an individual and confer a health benefit on the host. In some cases, the beneficial gut bacteria can aid in the digestion of carbohydrates, proteins, or fatty acids that are not efficiently digested, or not digested at all, by the host. In some cases, the beneficial gut bacteria generate metabolites that are beneficial to the host such as fatty acids, vitamins, or modulators of the immune system. In some cases, the beneficial gut bacteria inhibit the growth of pathogenic bacteria in the gut.

[0042] Exemplary embodiments of beneficial gut bacteria include lactobacilli (e.g., L. casei, L. paracasei, and L. rhamnosus) and bifidobacteria (e.g., B. adolescentis, B. catenulatum, B. pseudocatenulatum, B. dentium, B. bifidum, B. longum, B. infantis, and B. breve). Exemplary embodiments of beneficial gut bacteria further include, but are not limited to, the foregoing lactobacilli and bifidobacteria that express an alpha-fucosidase such as GH-29, or an alpha-fucosidase such as GH-95. In some cases, the beneficial gut bacteria further include, but are not limited to, the foregoing bifidobacteria and bifidobacteria that express at least two alpha-fucosidases. For example, beneficial gut bacteria further include, but are not limited to, Lactobacilli and Bifidobacteria that express GH-29 and GH-95.

[0043] A "prebiotic" or "prebiotic nutrient" is generally a non-digestible food ingredient that beneficially affects a host when ingested by selectively stimulating the growth and/or the activity of one or a limited number of bacteria in the gastrointestinal tract, e.g., beneficial gut bacteria. As used herein, the term "prebiotic" refers to the above described non-digestible food ingredients in their non-naturally occurring states, e.g., after purification, chemical or enzymatic synthesis as opposed to, for instance, in whole human milk. Pre-biotics can be administered separately from beneficial gut bacteria, or in conjunction with beneficial gut bacteria. As used herein, "in conjunction with" refers to at the same time as, substantially the same time as, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 45, or 60 minutes before or after, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 hours before or after, or about 1 or 2 days before or after the administration of gut bacteria.

[0044] A "probiotic" refers to beneficial gut bacteria that when administered in adequate amounts confer a health benefit on the host.

[0045] An "expression cassette" refers to a nucleic acid construct, which when introduced into a host cell (e.g., a microorganism, such as a Bifidobacterium or a Lactobacillus), results in transcription and/or translation of a RNA or polypeptide, respectively. An expression cassette typically includes a sequence to be expressed, and sequences necessary for expression of the sequence to be expressed. The sequence to be expressed can be a coding sequence or a non-coding sequence (e.g., an inhibitory sequence). The sequence to be expressed is generally operably linked to a promoter. The promoter can be a heterologous promoter or a promoter that is derived from the host plant. Generally, an expression cassette is inserted into an expression vector to be introduced into a host cell. The expression vector can be viral or non-viral.

[0046] "Recombinant" refers to a human manipulated polynucleotide or a copy or complement of a human manipulated polynucleotide. For instance, a recombinant expression cassette comprising a promoter operably linked to a second polynucleotide may include a promoter that is heterologous to the second polynucleotide as the result of human manipulation (e.g., by methods described in Sambrook et al., Molecular Cloning--A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., (1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)). A recombinant expression cassette may comprise polynucleotides combined in such a way that the polynucleotides are extremely unlikely to be found in nature. For instance, human manipulated restriction sites or plasmid vector sequences may flank or separate the promoter from the second polynucleotide. One of skill will recognize that polynucleotides can be manipulated in many ways and are not limited to the examples above. A recombinant protein is one that is expressed from a recombinant polynucleotide, and recombinant cells, tissues, and organisms are those that comprise recombinant sequences (polynucleotide and/or polypeptide).

[0047] A polynucleotide sequence is "heterologous to" an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form. For example, a promoter operably linked to a heterologous coding sequence refers to a coding sequence from a species different from that from which the promoter was derived, or, if from the same species, a coding sequence which is different from naturally-occurring variants.

[0048] The term "exogenous," in reference to a polypeptide or polynucleotide, refers to polypeptide or polynucleotide which is introduced into a cell or organism (e.g., a microorganism, such as a Bifidobacterium or a Lactobacillus) by any means other than by mating.

[0049] The term "transgenic," e.g., a transgenic microorganism, such as a transgenic Bifidobacterium or Lactobacillus, refers to a recombinantly modified organism with at least one introduced genetic element. The term is typically used in a positive sense, so that the specified gene is expressed in the transgenic organism. However, a transgenic organism can be transgenic for an inhibitory nucleic acid, i.e., a sequence encoding an inhibitory nucleic acid is introduced. The introduced polynucleotide can be from the same species or a different species, can be endogenous or exogenous to the organism, can include a non-native or mutant sequence, or can include a non-coding sequence.

[0050] In the case of both expression of transgenes and inhibition of endogenous genes (e.g., by antisense, or sense suppression) one of skill will recognize that a polynucleotide sequence need not be identical and can be "substantially identical" to a sequence of the gene from which it was derived.

[0051] The term "promoter" refers to regions or sequence located upstream and/or downstream from the start of transcription and which are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A "bacterial promoter" is a promoter capable of initiating transcription in bacterial cells (e.g., Bifidobacterium or Lactobacillus). In some cases, a bacterial promoter can originally derive from the same species of microorganism into which it is introduced. In other cases, a bacterial promoter may derived from another species of bacteria or from another organism (e.g., a viral, fungal, plant, animal, or mammalian promoter) that is capable of initiating transcription in bacterial cells.

[0052] A "constitutive promoter" refers to a promoter that is capable of initiating transcription under nearly all conditions, whereas an "inducible promoter" initiates transcription under specific conditions such as the presence of an inducer (e.g., allolactose, arabinose, tryptophan, IPTG) or a signal (e.g., heat, cold, low phosphate,). In some embodiments, a promoter is inducible if the transcription levels initiated by the promoter under a specific cellular condition are at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 50-fold, 100-fold, 500-fold, 1000-fold higher or more as compared to the transcription levels initiated by the promoter in the absence of that condition.

[0053] The term "express," "expresses," "expressing," or the like, as in "a bacterium that expresses" refers to a bacterium that has polynucleotide encoding a specific gene (e.g., a glycohydrolase such as an alpha-fucosidase, including GH-29 or GH-95) that is capable of being expressed. In some cases, the gene can express constitutively. In other cases, the gene can be expressed only under certain conditions (e.g., it is inducible).

[0054] The term "modulate" as in to "modulate a gene" or "modulate expression" of a gene refers to increasing or decreasing the expression, activity, or stability of a gene. For example, a gene may be modulated by increasing or decreasing the amount of RNA that is transcribed from the gene or altering the rate of such transcription. Decreased expression may include expression that is reduced by 5%, 10%, 15%, 20%, 25%, 30%, 50%, 75%, 80%, 90%, 95%, 99% or more. Increased expression, or over expression, includes expression that is increased by 1%, 1.5%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 17%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more. In some cases expression may be increased by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 50-fold, 100-fold, 500-fold, 1000-fold higher. Expression may be modulated in a constitutive or inducible manner as provided herein.

[0055] Two nucleic acid sequences or polypeptides are said to be "identical" if the sequence of nucleotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below. The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. When percentage of sequence identity is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acids residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers & Miller, Computer Applic. Biol. Sci. 4:11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA).

[0056] The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 25% sequence identity. Alternatively, percent identity can be any integer from at least 25% to 100% (e.g., at least 25%, 26%, 27%, 28%, . . . , 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%), preferably calculated with BLAST using standard parameters, as described below. One of skill will recognize that these values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning and the like. Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 40%. Percent identity of polypeptides can be any integer from at least 40% to 100% (e.g., at least 40%, 41%, 42%, 43%, . . . , 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%). In some embodiments, substantially identical polypeptide share at least 70%, 75%, 80%, 85%, 90%, 95%, or 99%.

[0057] Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, aspartic acid-glutamic acid, and asparagine-glutamine.

[0058] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.

[0059] A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Unless otherwise indicated, the comparison window extends the entire length of a reference sequence. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection.

[0060] One example of a useful algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 11, the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.

[0061] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.

[0062] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence.

[0063] As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art.

[0064] The following six groups each contain amino acids that are conservative substitutions for one another:

1) Alanine (A), Serine (S), Threonine (T);

[0065] 2) Aspartic acid (D), Glutamic acid (E);

3) Asparagine (N), Glutamine (Q);

4) Arginine (R), Lysine (K);

5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and

6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

[0066] (see, e.g., Creighton, Proteins (1984)).

[0067] An indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.

III. Glycohydrolases

Alpha-Fucosidases

[0068] Described herein are alpha-fucosidases (e.g., GH-29 or GH-95 family glycohydrolases) that are capable of hydrolyzing components of human milk oligosaccharides, and other saccharides of similar structure. The GH-95 and GH-29 alpha-fucosidases play a role in degrading .alpha.-1,2- and .alpha.-1,3/4-fucosylated milk oligosaccharides, respectively, and also glycoconjugates, in the gut of host organisms. The glycohydrolases can be expressed in bacteria (e.g., beneficial gut bacteria) and confer the ability of the bacteria to hydrolyze components of oligosaccharides (e.g., milk oligosaccharides, or human milk oligosaccharides). In some cases, the glycohydrolases can thus confer the ability of the bacteria to utilize oligosaccharides (e.g., milk oligosaccharides, or human milk oligosaccharides) as a carbon and/or nitrogen source. In some cases, this can provide a selective advantage as compared to other microorganisms present.

[0069] Alpha-fucosidases hydrolize fucosides to fucose. See, e.g., Levvy, G. A. and McAllan, A. Mammalian fucosidases. 2. alpha-L-Fucosidase. Biochem. J. 80 (1961) 435-439. Glycohydrolases of the GH-29 family are exo-acting alpha-fucosidases found in archaea, bacteria, and eukarya. In some cases, the GH-29 alpha-fucosidases herein are of bacterial origin. However, in other cases, they can be of from an organism of any phylogenetic kingdom as long as they can be expressed in a beneficial gut bacteria.

[0070] In some embodiments, GH-29 alpha-fucosidases (E.C. number 3.2.1.51) described herein can specifically release .alpha.-1,3- and .alpha.-1,4-linked fucosyl residues from 3-fucosyllactose, various Lewis blood group substances (a, b, x, and y types), and lacto-N-fucopentaose II and III. In some cases, GH-29 alpha-fucosidases described herein can cleave fucose from LNFPIII (.alpha.1-3). In some cases, GH-29 alpha-fucosidases described herein do not show activity on small oligosaccharides (2FL and 3FL), glycoconjugates containing .alpha.-1,2-fucosyl residue, or on synthetic .alpha.-fucoside (p-nitrophenyl-.alpha.-1-fucoside). In some cases, the GH-29 alpha-fucosidases described herein exhibit a greater activity against longer-chain fucosylated oligosaccharides. GH-29 alpha-fucosidases described herein can confer the ability of gut bacteria to utilize, e.g. oligosaccharides, milk oligosaccharides, human milk oligosaccharides, fucosyl oligosaccharides, 3-fucosyllactose, or lacto-N-fucopentaose II as a carbon source (e.g., as a sole carbon source).

[0071] Exemplary GH-29 alpha-fucosidases include a fucosidase domain. In some cases, the GH-29 alpha-fucosidases include additional domains such as a carbohydrate binding domain. In some cases, exemplary fucosidases can also include a FIVAR domain, and/or a transmembrane domain. Consequently, in some cases, the GH-29 alpha-fucosidases, can be expressed (e.g., heterologously expressed) as fragment polypeptides such that the catalytic activity and growth on HMO phenotype are preserved, but non-essential domains or fragments are removed or replaced. The essential features of GH-29 alpha-fucosidases are known in the art and are described in, e.g. Ashida et al., Glycobiology, 19(9), 1010-17 (2009); and Sela et al., Applied and Enviromental Microbiology, 78, 795-803 (2012).

[0072] Similarly, GH-95 glycohydrolases are 1,2-alpha-L-fucosidases which hydrolyze Fuca1-2Gal linkages at the non-reducing end of an oligosaccharide. In some cases, a GH-95 glycohydrolase as used herein cannot hydrolyze the fucoysl linkage when the Gal residue is further modified. In some cases, the GH-95 glycohydrolases provided herein are predicted to cleave .alpha.1-2, .alpha.1-3, 2FL, 3FL, and Fuca1-2Gal substrates. GH-95 alpha-fucosidases described herein can confer the ability of gut bacteria to utilize, e.g. oligosaccharides, milk oligosaccharides, human milk oligosaccharides, or fucosyl oligosaccharides as a carbon source (e.g., as a sole carbon source).

[0073] Exemplary GH-95 alpha-fucosidases can include an N-terminal domain, a catalytic domain and/or an Ig-like domain. Consequently, in some cases, the GH-95 alpha-fucosidases, are expressed (e.g., heterologously expressed) as fragment polypeptides such that the catalytic activity and growth on HMO phenotype are preserved, but non-essential domains or fragments are removed or replaced. The essential features of GH-95 alpha-fucosidases are known in the art and are described in, e.g., Katayama, et al., Journal of Bioscience and Bioengineering, 99(5), 457-65 (2005); and Sela et al., Applied and Enviromental Microbiology, 78, 795-803 (2012).

[0074] Provided herein are bacterial alpha-fucosidase polypeptides (e.g., any of GH-29: SEQ ID NOs: 1-4 or GH-95: SEQ ID NOs: 5 or 6) and polynucleotides encoding such polypeptides (e.g., any of SEQ ID NOs: 7-10, and 11 or 12 respectively).

[0075] Also described herein are polypeptides substantially identical to the sequences exemplified herein, polynucleotides and expression cassettes encoding such alpha-fucosidase polypeptides or a mutation or fragment thereof, and vectors or other constructs for alpha-fucosidase polypeptide expression in a microorganism (e.g., a Bifidobacterium or a Lactobacillus). Also described herein are polypeptides which are substantially similar to the exemplified sequences (e.g., SEQ ID NOs: 1-6). Polypeptides which are "substantially similar" share sequences as noted above except that residue positions which are not identical may differ by conservative amino acid changes.

[0076] Polynucleotides that selectively hybridize to, and/or are substantially identical to, one of SEQ ID NOs: 7-12 are also provided herein. The phrase "selectively (or specifically) hybridizes to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g., total cellular or library DNA or RNA). Polynucleotides that selectively hybridize to any one of SEQ ID NOs: 7-12 can be of any length, e.g., at least 10, 15, 20, 25, 30, 50, 100, 200 500 or more nucleotides or having fewer than 500, 200, 100, or 50 nucleotides, etc.

Other Glycohydrolases

[0077] Provided herein are other glycohydrolases that are capable of hydrolyzing components of human milk oligosaccharides, and other saccharides of similar structure. The glycohydrolases can be expressed in bacteria (e.g., beneficial gut bacteria) and confer the ability of the bacteria to hydrolyze components of human milk oligosaccharides and other saccharides of similar structure. In some cases, the glycohydrolases can thus confer the ability of the bacteria to utilize the human milk oligosaccharides as a carbon and/or nitrogen source. In some cases, this can provide a selective advantage as compared to other microorganisms present.

[0078] For example, bacteria expressing glycohydrolases capable of hydrolyzing components of human milk oligosaccharides can grow more quickly, or become a larger portion of the microbiome in the gut of a subject that is consuming human milk oligosaccharides, as compared to bacteria that do not express such glycohydrolases. In some embodiments, this selective advantage can be utilized by providing glycohydrolases capable of hydrolyzing components of human milk oligosaccharides to bacteria known or suspected of being beneficial. In other cases, bacteria known or suspected of being beneficial can be assayed to determine their glycohydrolases and thus an pre-biotic composition or formulation can be applied to select for the beneficial bacteria.

[0079] Glycohydrolases described herein include alpha-sialidases, beta-galactosidases, beta-hexosaminidases, and alpha-fucosidases. Alpha-sialidases (EC:3.2.1.18 COG4409) are enzymes which catalyze the hydrolysis of alpha-(2->3)-, alpha-(2->6)-, alpha-(2->8)-glycosidic linkages of terminal sialic acid residues in oligosaccharides, glycoproteins, glycolipids, colominic acid, and synthetic substrates. Members of this family contain multiple BNR (bacterial neuraminidase repeat) repeats or Asp-boxes. The repeats are short, however the repeats are never found closer than 40 residues together suggesting that the repeat is structurally longer. These repeats are found in a variety of non-homologous proteins, including bacterial ribonucleases, sulphite oxidases, reelin, netrins, sialidases, neuraminidases, some lipoprotein receptors, and a variety of glycosyl hydrolases. See, e.g., Schauer, R. Sialic acids. Adv. Carbohydr. Chem. Biochem. 40 (1982) 131-234.

[0080] Beta-galactosidase (EC: 3.2.1.23 COG1874) catalyzes hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides. This class comprises a widespread group of enzymes that hydrolyze the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. A classification system for glycosyl hydrolases, based on sequence similarity, has led to the definition of 85 different families. See, e.g., Kuby, S. A. and Lardy, H. A. Purification and kinetics of beta-D-galactosidase from Escherichia coli, strain K-12. J. Am. Chem. Soc. 75 (1953) 890-896.

[0081] N-acetyl-beta-hexosaminidase (EC:3.2.1.52 COG3525) catalyzes the hydrolysis of terminal non-reducing N-acetyl-D-hexosamine residues in N-acetyl-beta-D-hexosaminides. This class comprises a widespread group of enzymes that hydrolyze the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. See, e.g., Isolation of beta-N-acetylhexosaminidase, beta-N-acetylglucosaminidase, and beta-N-acetylgalactosaminidase from calf brain. Biochemistry. 6 (1967) 2775-82.

IV. Beneficial Gut Bacteria

[0082] As described herein, beneficial gut bacteria include those that reside in the gut of an individual or can be introduced into the gut of an individual (e.g., are capable of growth in the gut without pathogenesis) and confer a health benefit. In some embodiments, the beneficial gut bacteria express an alpha-fucosidase, such as GH-29. In other embodiments, the beneficial gut bacteria express a GH-95 alpha-fucosidase. In some cases, the beneficial bacteria express at least two alpha-fucosidases, such as a GH-29 and a GH-95 alpha-fucosidase. The alpha-fucosidases can be endogenous glycohydrolases, i.e., the glycohydrolases occur naturally in the strain. In other cases, at least one (e.g., 1, 2, 3, or 4) of the alpha-fucosidases are heterologous. In some cases, the heterologous gene is introduced as a recombinant expression cassette, and the beneficial gut bacteria is transgenic. In other cases, the heterologous gene is introduced by a natural process, such as bacterial mating, and the beneficial gut bacteria expresses a heterologous gene and yet the bacteria is not transgenic.

[0083] In general, beneficial gut bacteria are selected from species that are normally found in the gut of a human infant, a breast-fed human infant, a formula-fed human infant (e.g., a milk, soy, or corn based formula), an adolescent, an adult, or a cow or other animal. Beneficial gut bacteria are selected from species of bacteria that do not cause pathogenesis in the host organism. In some embodiments, the beneficial gut bacteria are selected from species of bacteria that are only opportunistically pathogenic in cases of immune-deficiency or autoimmune disease. Beneficial gut bacteria include lactobacilli and bifidobacteria.

[0084] In some embodiments, the beneficial gut bacteria can metabolize carbohydrates that cannot be digested by the host, such as one or more oligosaccharides (e.g., milk oligosaccharides, or human milk oligosaccharides). For example, the beneficial gut bacteria can express a GH-29 alpha-fucosidase, a GH-95 alpha-fucosidase, or multiple alpha-fucosidases (e.g., a GH-29 and a GH-95 alpha-fucosidase) and thus be capable of digesting one or more oligosaccharides (e.g., milk oligosaccharides, or human milk oligosaccharides). In some embodiments, the beneficial gut bacteria can generate metabolites that serve as nutrients for the host, serve an immunomodulatory function (e.g., reduce inflammation or stimulate mucosal epithelium), or signal the enteric nervous system. In still other embodiments, the beneficial gut bacteria regulate epithelial cell turnover, promote epithelial restitution, and/or reorganize tight junctions in the gut epithelium.

[0085] In some cases, the beneficial bacteria produce a conjugated linoleic acid or convert a conjugated linoleic acid. Conjugated linoleic acids are a family of linoleic acid isomers. Conjugated linoleic acids can be converted to linoleic acid or alpha-L-linoleic acid by bacterial strains in the gut. Inability of the gut microbiome to convert conjugated linoleic acids has been associated with digestive diseases, gluten sensitivity and/or dysbiosis. Dysbiosis is associated with inflammatory bowel disease and chronic fatigue syndrome. Described herein are methods of providing a gut microbiome (or a component thereof) to a subject in need thereof that is capable of producing or converting a conjugated linoliec acid.

V. Oligosaccharides

[0086] In some embodiments, GH-29 and/or GH-95 expressing bacteria as described herein are formulated with or administrated in conjunction with an oligosaccharide. Oligosaccharides described herein include human milk oligosaccharides (HMO) and oligosaccharides of a similar structure. In some embodiments, the oligosaccharides include those that are not digestible, or not substantially digestible, in a human gut without the aid of beneficial gut bacteria. Oligosaccharides herein include galacto-oligosaccharides (GOS) and oligosaccharides derived from a mammal such as a cow, a goat, a sheep, a horse, a buffalo, or a yak. In some embodiments, oligosaccharide containing compositions are adminstered to a subject in order to select for the growth and/or colonization of beneficial bacteria in the gut.

[0087] Human milk oligosaccharides (HMO) include, e.g., those described in U.S. Pat. No. 8,197,872. Human milk oligosaccharide compositions include compositions containing one or more of the following: Lacto-N-Tetraose, Lacto-N-Neotetraose, Lacto-N-Fucopentaose I, Lacto-N-Fucopentaose II, Lacto-N-Fucopentaose III, Lacto-N-Fucopentaose V, Lacto-N-Hexaose, Para-Lacto-N-Hexaose, Lacto-N-Neohexaose, Para-Lacto-N-Neohexaose, Monofucosyllacto-N-Hexaose II, Isomeric Fucosylated Lacto-N-Hexaose (1), Monofucosyllacto-N-Hexaose, Isomeric Fucosylated Lacto-N-Hexaose (3), Isomeric Fucosylated Lacto-N-Hexaose (2), Difucosyl-Para-Lacto-N-Neohexaose, Difucosyl-Para-Lacto-N-Hexaose, Difucosyllacto-N-Hexaose, Lacto-N-Neoocataose, Para-Lacto-N-Octanose, Iso-Lacto-N-Octaose, Lacto-N-Octaose, Monofucosyllacto-Nneoocataose, Monofucosyllacto-N-Ocataose, Difucosyllacto-N-Octaose I, Difucosyllacto-N-Octaose II, Difucosyllacto-N-Neoocataose II, Difucosyllacto-N-Neoocataose I, Lacto-N-Decaose, Trifucosyllacto-N-Neooctaose, Trifucosyllacto-N-Octaose, and Trifucosyl-Iso-Lacto-N-Octaose. In some cases, HMO compositions can contain at least two or more of the foregoing oligosaccharides (e.g., 3, 4, 5, 6, 7, 8, 9, or more).

[0088] The HMOs described herein can be derived using any of a number of sources and methods known to those of skill in the art. For example, HMOs can be purified from human milk using methods known in the art. One such method for extraction of oligosaccharides from pooled milk entails the centrifugation of milk at 5,000.times.g for 30 minutes at 4.degree. C. and fat removal. Ethanol can then be added to precipitate proteins. After centrifugation to sediment precipitated protein, the resulting solvent can be collected and dried by rotary evaporation. The resulting material can be adjusted to the appropriate pH (e.g., 6.8) with, for example, a phosphate buffer, and .beta.-galactosidase can be added. After incubation, the solution can be extracted with chloroform-methanol, and the aqueous layer collected. Monosaccharides and disaccharides can removed by selective adsorption of HMOs using solid phase extraction with graphitized nonporous carbon cartridges. The retained oligosaccharides can be eluted with, e.g., water-acetonitrile (60:40) with 0.01% trifluoroacetic acid. (See, e.g., Ward et al., Appl. Environ. Microbiol. (2006), 72: 4497-4499; Gnoth et al., J. Biol. Chem. (2001), 276:34363-34370; Redmond and Packer, Carbohydr. Res., (1999), 319:74-79.) Individual HMOs can be further separated using methods known in the art such as capillary electrophoresis, HPLC (e.g., high-performance anion-exchange chromatography with pulsed amperometric detection; HPAEC-PAD), and thin layer chromatography. See, e.g., Splechtna et al., J. Agricultural and Food Chemistry (2006), 54: 4999-5006.

[0089] Alternatively, enzymatic methods can be used to synthesize the HMOs described herein. In general, any oligosaccharide biosynthetic enzyme or catabolic enzyme (with the reaction running in reverse) that converts a substrate into any of the HMO oligosaccharides (or their intermediates) may be used. For example, prebiotic galacto-oligosaccharides have been synthesized from lactose using the .beta.-galactosidase from L. reuteri (See, Splechtna et al., J. Agricultural and Food Chemistry (2006), 54: 4999-5006). The reaction employed is known as transgalactosylation, whereby the enzyme .beta.-galactosidase hydrolyzes lactose, and, instead of transferring the galactose unit to the hydroxyl group of water, the enzyme transfers galactose to another carbohydrate to result in oligosaccharides with a higher degree of polymerization (Vandamme and Soetaert, FEMS Microbiol. Rev. (1995), 16:163-186). The transgalactosylation reaction can proceed intermolecularly or intramolecularly. Intramolecular or direct galactosyl transfer to D-glucose yields regioisomers of lactose. Through intermolecular transgalactosylation di-, tri-, and tetra saccharides and eventually higher oligosaccharides specific to Bifidobacteria are produced. A related method utilizes the .beta.-galactosidase of Bifidobacterium bifidum NCIMB 41171 to synthesize prebiotic galacto-oligosaccharides (See, Tzortzis et al., Appl. Micro. and Biotech. (2005), 68:412-416).

[0090] Another approach to the synthesis of the carbohydrates of the invention that combines elements of the methods outlined above entails the chemical or enzymatic synthesis of or isolation of oligosaccharide backbones containing Lacto-N-biose, or Lacto-N-tretrose from non-human mammalian milk sources (e.g., cows, sheep, buffalo, goat, horse, yak, etc.) and enzymatically adding Lacto-N-biose, Fucose and Sialic Acid units as necessary to arrive at the HMO. For this purpose, a variety of bifidobacterial carbohydrate modifying enzymes, such as those disclosed in PCT Publication WO 2008/033520 can be utilized. Examples of such oligosaccharide modifying enzymes include sialidases, silate O-Acetylesterases, N-Acetylneuraminate lyases, N-acetyl-beta-hexosaminidase, beta-galactosidases, N-acetylmannosamine-6-phosphate 2-epimerases, alpha-L-fucosidases, and fucose dissimilation pathway proteins, among others, which may be used to catalyze a biosynthetic reaction under the appropriate conditions.

[0091] Alternatively, conventional chemical methods may be used for the de novo organic synthesis of or conversion of pre-existing oligosaccharides into the HMO oligosaccharides described herein. See, e.g., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th Edition.

[0092] Galacto-oligosaccharide (GOS) compositions include, e.g., those described in U.S. Pat. No. 8,425,930. GOS are naturally occurring in human milk, however, commercial GOS preparations are often produced by enzymatic treatment of lactose with .beta.-galactosidases from different sources such as fungi, yeast and/or bacteria, yielding a mixture of oligomers with varied chain lengths (Angus, F., Smart, S, and Shortt, C. 2005. In Probiotic Dairy Products ed. Tamine, A. pp. 120-137. Oxford: Blackwell Publishing). Thus, the basic structure of GOS includes a lactose core at the reducing end which is elongated typically with up to six galactose residues. GOS structural diversity dependents on the enzyme used in the trans-galactosylation reaction, and the experimental conditions such as pH and temperature (Dumortier, V., et al. 1990. Carbohydr Res 201:115-23.).

[0093] In some embodiments, GOS compositions herein include those with a relatively high degree of polymerization (DP). The "DP" of a GOS refers to the total number of sugar monomer units that are part of a particular oligosaccharide. For example, a tetra GOS has a DP of 4, having 3 galactose moieties and one glucose moiety. In some cases, the GOS compositions include a GOS that has been enriched for DP 4-5 galacto-oligosaccharides, a GOS that has been enriched for DP 6-8 galacto-oligosaccharides, and a GOS that has been enriched for DP 3 galacto-oligosaccharides. Exemplary levels of enrichment can include GOS that contains at least 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the particular DP galacto-oligosaccharides by weight. Other exemplary levels of enrichment can include GOS that contains at least 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the particular galacto-oligosaccharides of a particular DP or higher by weight. In some cases, the enriched GOS compositions have less than 10% or less than 5% of sugar monomers (e.g., galactose) and optionally less than 10% or less than 5% of dimeric galacto-oligosaccharides. In some embodiments, the enriched compositions of the invention also have less than 10% or less than 5% of trimeric (DP3) galacto-oligosaccharides. In some cases, the GOS compositions contain a mixed population of galacto-oligosaccharides, for example a composition containing a mix of galacto-oligosaccharides of DP 3, 4, 5, 6, 7, 8, 9, or 10, or other combinations thereof. Methods of purifying or preparing GOS compositions are known in the art (see, e.g., U.S. Pat. No. 8,425,930).

VI. Formulations

[0094] In general, any food or beverage that can be consumed by human infants or adults or animals may be used to make formulations containing the probiotic compositions described herein (e.g., compositions containing a bacteria expressing a GH-29 alpha-fucosidase, a GH-95 alpha-fucosidase, or expressing multiple alpha-fucosidases such as GH-29 and GH-95 fucosidases). Preferable foods include those with a semi-liquid consistency to allow easy and uniform dispersal of the prebiotic or probiotic compositions described herein. Accordingly, such food items include, without limitation, dairy-based products such as cheese, cottage cheese, yogurt, and ice cream. Fruits and vegetables targeted for infants/toddlers, such as apple sauce or strained peas and carrots (e.g., those from Gerber Products Company; Fremont, Mich.) are also suitable for use in the present invention. Both infant cereals such as rice- or oat-based cereals (e.g., Gerber) and adult cereals such as Musilix may also be suitable for use in this invention. In addition to foods targeted for human consumption, animal feeds may also be supplemented with the prebiotic and probiotic compositions of the invention.

[0095] Alternatively, the prebiotic and probiotic compositions of the invention may be used to supplement a beverage. Examples of such beverages include, without limitation, infant formula, follow-on formula, toddler's beverage, milk, fermented milk, fruit juice, fruit-based drinks, and sports drinks Many infant and toddler formulas are known in the art and are commercially available, including, for example, Carnation Good Start (Nestle Nutrition Division; Glendale, Calif.) and Nutrish A/B produced by Mayfield Dairy Farms (Athens, Term.). Other examples of infant or baby formula include those disclosed in U.S. Pat. No. 5,902,617. Other beneficial formulations of the compositions of the present invention include the supplementation of animal milks, such as cow's milk, which are normally lacking in HMOs.

[0096] Alternatively, the prebiotic and probiotic compositions of the present invention can be formulated into pills or tablets or encapsulated in capsules, such as gelatin capsules. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, microcrystalline cellulose, gelatin, colloidal silicon dioxide, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers. Lozenge or candy forms can comprise the compositions in a flavor, e.g., sucrose, as well as pastilles comprising the compositions in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art. The inventive prebiotic or probiotic formulations can also contain conventional food supplement fillers and extenders such as, for example, rice flour.

[0097] In some embodiments, the prebiotic or probiotic composition can further comprise a non-human protein, non-human lipid, non-human carbohydrate, or other non-human component. For example, in some embodiments, the compositions of the invention comprise a bovine (or other non-human) milk protein, a soy protein, betalactoglobulin, whey, soybean oil or starch.

[0098] Alternatively, the prebiotic and probiotic compositions of the present invention can be administered to the subject in a manner that administers the composition to the gut, but bypass the oral cavity (e.g., the mouth or esophagus) or the stomach. For example, the compositions can be administered rectally, directly to the colon, or directly to the small intestine. In some cases, the method may include techniques to deliver the composition to the colon without delivering the composition to the small intestine.

[0099] The dosages of the prebiotic and probiotic compositions of the present invention can be varied depending upon the requirements of the individual and will take into account factors such as age (infant versus adult), weight, and reasons for the need for administration of or selection for beneficial gut bacteria (e.g., antibiotic therapy, chemotherapy, disease, or age). The amount administered to an individual, in the context of the present invention should be sufficient to establish colonization of the gut with beneficial bacteria over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that may accompany the administration of a prebiotic or probiotic composition of the present invention. The dosage range, effective as a food supplement and for reestablishing beneficial bacteria in the intestinal tract, ranges from about 1 micrograms/L to about 25 grams/L. A further advantageous range is about 100 micrograms/L to about 15 grams/L. Another useful range is 1 gram/L to 10 grams/L. In one embodiment, a concentration of 8 grams/L is preferred. (See, e.g., Knol et al., J. Pediatric Gastro. and Nutr. (2005) 40:36-42.) When used, Bifidobacteria may be included in the formulations of the invention in an amount of 10.sup.6 to 10.sup.12 colony forming units (CFU). A further advantageous range is 10.sup.8 to 10.sup.12 CFU. In one advantageous embodiment, 10.sup.10 CFU of Bifidobacteria may be included in the formulations of the invention.

[0100] It will be appreciated that it may be advantageous for some applications to include other pre-biotic factors in the formulations of the present invention. Such additional components may include, but are not limited to, fructooligosaccharides such as Raftilose (Rhone-Poulenc, Cranbury, N.J.), inulin (Imperial Holly Corp., Sugar Land, Tex.), and Nutraflora (Golden Technologies, Westminister, Colo.), as well as xylooligosaccharides, galactooligosaccharides, soyoligosaccharides, lactulose/lactitol, among others.

[0101] The present invention includes methods of making any of the above-described compositions. For example, the invention provides for methods of combining at least one or more oligosaccharides described herein with a non-human protein, non-human lipid, non-human carbohydrate, or other non-human component to produce a synthetic prebiotic or probiotic food. For example, in some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of the oligosaccharides described herein are combined with a non-human protein, non-human lipid, non-human carbohydrate, or other non-human component. In some embodiments, at least one or more oligosaccharide of the present invention are combined with a bovine (or other non-human) milk protein, a soy protein, beta-lactoglobulin, whey, soybean oil or starch.

VII. Examples

Introduction

[0102] Human milk contains a high concentration of complex oligosaccharides that influence the composition of the intestinal microbiota in breast-fed infants. Select species such as Bifidobacterium longum subsp. infantis and B. bifidum can utilize human milk oligosaccharides (HMO) in vitro as the sole carbon source, while B. longum subsp. longum and B. breve are less adapted to these substrates. We sought to examine the adaptations of a more representative number of B. breve strains to human milk oligosaccharides. For this purpose, a number of B. breve isolates from breast-fed infant feces were characterized for the presence of different glycosyl hydrolases that participate in HMO utilization, as well as by their ability to grow on HMO or specific HMO species such as lacto-N-tetraose (LNT) and fucosyllactose. All B. breve strains showed a vigorous growth on lacto-N-tetraose and lacto-N-neotetraose (LNnT), and in general growth on total HMO was moderate for most of the strains, with several strain differences. Growth and consumption of fucosylated HMO was strain-dependent, primarily in isolates possessing a Glycosyl Hydrolase family 29 .alpha.-fucosidase. Glycoprofiling of the spent supernatant after HMO fermentation by select strains revealed that all B. breve can utilize sialylated HMO to a certain extent, especially sialyl-lacto-N-tetraose. Interestingly, this oligosaccharide was depleted before neutral lacto-N-tetraose by strain SC95. The present results indicate that the HMO consumption phenotype in B. breve is variable. Specific strains, however, display adaptations to substrates including fucosylated and sialylated HMO. The present results provide a rationale for the predominance of this species in breast-fed infant feces, and a more accurate picture of the ecology of the developing infant intestinal microbiota.

Example 1

Isolation and Identification of Bifidobacterium from Breast-Fed Infant Feces

Materials and Methods

[0103] Subjects.

[0104] Fecal samples were collected from 40 exclusively breast-fed term infants at 3 and 4 months of age. None of the infants enrolled in this study had received antibiotic treatment, infant-formula or solid food. Parents transferred their infant fecal samples into sterile plastic tubes and were instructed to immediately store the samples in -20.degree. C. until transported by study personnel. Fecal samples were transported on dry ice and stored at -80.degree. C. before processing.

[0105] Microbial Isolations.

[0106] For isolation of Bifidobacterium, 100 mg of each fecal sample was taken aseptically, transferred to a sterile tube, diluted tenfold with 1% peptone water (Becton Dickinson, Sparks, Md.), and homogenized by vortexing. Ten-fold dilutions were prepared with 1% peptone water and inoculated on modified BSM agar (mBSM). Modified BSM agar was prepared by supplementing de Man Rogosa Sharpe (MRS) media (Becton Dickinson, Sparks, Md.) with 15 g/L agar, 500 mg/L L-cysteine-HCl, 100 mg/L mupirocin, 25 mg/L kanamycin, 4.28 mg/L polymixin B, 25 mg/L iodoacetate, 20 mg/L nalidixic acid and 25 mg/mL of 2,3,5-triphenyltetrazoliumclhoride (Sigma). The plates were incubated for 48 h at 37.degree. C. in an anaerobic chamber (Coy Laboratory Products, Grass Lake, Mich.), in an atmosphere containing 5% carbon dioxide, 5% hydrogen, and 90% nitrogen. Resulting colonies were streaked onto mBSM agar, and after two passages they were grown in MRS broth supplemented with 0.05% L-cysteine-HCl and stored at -80.degree. C. in 25% glycerol. Prior to each assay all bacteria strains were subcultured twice in MRS broth supplemented with 0.05% L-cysteine-HCl and incubated at 37.degree. C. for 18 h in an anaerobic chamber.

[0107] Additional B. breve strains were obtained from the Japanese Collection of Microorganism (RIKEN BioResource Center, Japan), the American Type Culture Collection (Manassas, Va.), and the University of California-Davis Viticulture and Enology Culture Collection (Table 1).

TABLE-US-00001 TABLE 1 List of Bifidobacterium strains used in this study. Additional strain Code Species information.sup.a Source UCC2003 B. breve O'Connell et al., 2011 Infant nursing stool ATCC15700 B. breve JCM1192; DSM20213 Infant feces ATCC15698 B. breve JCM1273; DSM20091 Infant feces ATCC15701 B. breve JCM7016 Infant feces JCM7017 B. breve Human feces JCM7019 B. breve Infant feces JCM7020 B. breve Infant feces S-17c B. breve Roy et al. 1996 Infant feces S-46 B. breve Roy et al. 1996 Infant feces SC81 B. breve This study Infant feces SC95 B. breve This study Infant feces SC139 B. breve This study Infant feces SC154 B. breve This study Infant feces SC500 B. breve This study Infant feces SC506 B. breve This study Infant feces SC508 B. breve This study Infant feces SC522 B. breve This study Infant feces SC559 B. breve This study Infant feces SC567 B. breve This study Infant feces SC568 B. breve This study Infant feces SC573 B. breve This study Infant feces SC580 B. breve This study Infant feces SC670 B. breve This study Infant feces KA179 B. breve This study Infant feces ATCC15697 B. longum subsp. JCM1222; DSM20088 Infant feces infantis JCM 10602 B. animalis subsp. DSMZ 10140 Dairy lactis product .sup.aThe original strain numbers are also noted, if known. JCM, Japan Collection of Microorganisms, ATCC, American Type Culture Collection; DSMZ, German Collection of Microorganisms and Cell Culture.

[0108] Identification of Bifidobacteria by 16S rDNA Sequencing.

[0109] Genomic DNA was obtained from 1 ml of each culture, and centrifuged for 5 min at 2000.times.g. The bacterial pellet was resuspended and incubated for 30 min at 37.degree. C. with enzymatic lysis buffer 20 mM Tris-Cl pH 8.0, 2 mM sodium EDTA, 1.2% Triton X-100, and 40 mg/ml lysozyme (Sigma, Mo.). After enzymatic lysis, bacterial DNA was isolated from the samples using the DNeasy tissue kit (Qiagen, Valencia, Calif.) according to the manufacturer instructions. DNA quality and yield was checked using a Nanodrop spectrophotometer (Wilmington, Del.); the DNA was then stored at -20.degree. C. until further use. To identify the isolates at species level, the 16S rDNA gene was amplified by PCR using the universal primers 27F 5'-AGAGTTTGATCCTGGCTCAG and 1492R 5'-TACGGTTACCTTGTTACGA on an Applied Biosystems 2720m Thermal Cycler (Applied Biosystems, Mountain View, Calif.). One .mu.l of extracted DNA was added to 50 .mu.l reaction mixture containing 50 pmol of primers, 500 mM of each dNTP, 0.1 vol of 10.times.PCR buffer, 2.5 mM MgCl2, and 1 U AmpliTaq gold polymerase (Applied Biosystems). Amplification mixtures were subjected to 4 min of denaturation at 94.degree. C., 30 cycles of 94.degree. C. for 30 s, 55.degree. C. for 40 s, and 72.degree. C. for 1 min 30 s, followed by a final extension period of 7 min at 72.degree. C. The resulting amplicons were separated on a 1% agarose gel, followed by GelRed staining (Phenix Research Products, Candler, N.C.), and purification using a QIAquick PCR Purification Kit (Qiagen, Valencia, Calif.). Sequencing was performed on an ABI 3730 Capillary Electrophoresis Genetic Analyzer using BigDye Terminator chemistries at the University of California Davis DNA Sequencing Facility. The sequences were analyzed using BioEdit 7.0 (available at the website at mbio.ncsu.edu/BioEdit/BioEdit.html), and checked by nucleotide-nucleotide BLAST comparison at the NCBI database for species identification.

[0110] Multilocus Sequence Typing (MLST) of Strains.

[0111] MLST analysis of B. breve isolates targeted intragenic regions of seven housekeeping genes clpC, purF, gyrB, fusA, Iles, rplB, rpoB. The PCR reaction was prepared as above and cycling conditions were optimized for every primer set (Table 2). The reaction included an initial denaturation at 95.degree. C. for 4 min, followed by 35 cycles of 95.degree. C. for 30 s, annealing at 60-67.degree. C. for 30 s, elongation at 72.degree. C. for 60 s, final extension at 72.degree. C. for 7 min, and holding at 4.degree. C. The PCR products were separated and sequenced as above.

TABLE-US-00002 TABLE 2 MLST genes and primers. Expected Amplicon Anneling size Temp. PCR primer (5'-3')*.sup.,a (bp) (.degree. C.) GAG TAC CGC AAG TAC ATC GAG 748 63 CAT CCT CAT CGT CGA ACA GGA AC CAT TCG AAC TCC GAC ACC GA 977 62 GTG GGG TAG TCG CCG TTG AGC TGC ACG CBG GCG GCA AGT TCG 811 66 GTT GCC GAG CTT GGT CTT GGT CTG ATC GGC ATC ATG GCY CAC ATY GAT 784 66 CCA GCA TCG GCT GMA CRC CCT T ATC CCG CGY TAC CAG ACS ATG 789 66 CGG TGT CGA CGT AGT CGG CG GGA CAA GGA CGG CRT SCC SGC CAA 498 67 ACG ACC RCC GTG CGG GTG RTC GAC GGC GAG CTG ATC CAG AAC CA 1057 62 GCA TCC TCG TAG TTG TAS CC *Upper sequence, forward primer; Lower sequence, reverse primer. .sup.aIn the primer sequence R indicates (A/G), S (C/G), Y (C/T).

[0112] Sequencing data for all loci was edited using BioEdit 7.0 and aligned using CLUSTAL W. Phylogenetic analysis and concatenations of the sequenced loci were performed using the Molecular Evolutionary Genetic Analysis (MEGA) software version 5 (megasoftware.net). Descriptive evolutionary analysis including mol % G+C content, number of polymorphic sites, nucleotide diversity it/site, average number of nucleotide differences k were calculated using DnaSP version 5.10 (Table 3). Allelic sequences were assigned (see Cai et al. (2007) Microbiol. 153:2655) (Table 4). A minimum evolution tree of the concatenated loci was calculated using MEGA 5.0 (FIG. 1).

TABLE-US-00003 TABLE 3 Descriptive evolutionary analysis of MLST data. Fragment polymor- Alle analyzed G + C phic frequen- Gene (bp)* (mol %) sites cies .pi. k clpC 678 (0.25) 61.97 14 8 0.00404 2.739 purF 855 (0.56) 62.33 65 11 0.01308 11.18116 gyrB 688 (0.33) 60.17 14 12 0.00335 2.30435 fusA 753 (0.35) 60.35 14 8 0.00319 2.4058 Iles 743 (0.22) 61.51 41 12 0.0148 10.78986 rplB 428 (0.51) 64.75 8 5 0.00273 1.16667 rpoB 965 (0.27) 62.89 16 11 0.00353 3.4058 *Percentage of the gene is given in parenthesis. .pi. = mean pairwise nucleotide difference per site. k = mean pairwise nucleotide difference per sequence.

TABLE-US-00004 TABLE 4 Allelic profiles of 24 B. breve strains analyzed by MLST. Allele Strains ST.sup.a clpC purF gyrB fusA Iles rplB rpoB UCC2003 1 1 1 1 1 1 1 1 ATCC15700 2 1 2 2 1 2 2 2 ATCC15698 3 1 3 3 1 3 3 3 ATCC15701 4 2 4 4 1 4 3 4 JCM7017 4 2 4 4 1 4 3 4 JCM7019 5 3 5 5 7 5 3 5 JCM7020 6 4 6 5 8 6 3 6 S-17c 7 1 7 6 1 4 3 2 S-46 8 2 4 4 1 4 3 7 SC81 9 5 8 7 2 7 3 8 SC95 10 6 9 8 1 3 3 3 SC139 11 7 3 8 1 8 3 4 SC154 12 2 1 8 1 3 3 1 SC500 13 1 10 3 2 3 4 9 SC506 14 6 9 8 3 3 1 3 SC508 15 1 1 9 1 9 5 2 SC522 9 5 8 7 2 7 3 8 SC559 16 1 1 10 1 10 3 10 SC567 17 1 11 8 6 11 3 1 SC568 10 6 9 8 1 3 3 3 SC573 18 2 4 11 1 3 3 3 SC580 9 5 8 7 2 7 3 8 SC670 19 1 1 12 5 11 3 11 KA179 20 8 3 8 4 12 3 9 .sup.aST Indicates specific sequence type.

Results

[0113] Around 500 isolates were identified by 16S rDNA sequencing, and a total of 461 isolates were identified as Bifidobacterium. Seven species of bifidobacteria were detected, and the species longum, which includes subspecies longum and infantis, was found to be more represented, followed by B. breve with 77 strains (Table 5).

TABLE-US-00005 TABLE 5 Distribution of isolates of bifidobacteria from breast-fed infants identified by 16S DNA. Number of isolates Species identified B. longum/B. infantis 297 B. breve 77 B. pseudocatenulatum 45 B. bifidum 22 B. dentium 8 B. adolescentis 7 B. animalis 5

[0114] We further investigated the identity of the B. breve isolates at the strain level by MLST (Deletoile et al. (2010) Res Microbiol. 161:82). The analysis also included nine strains from culture collections (Table 1). A total of 172 single nucleotide polymorphisms (SNPs) were found in seven loci, and they generated between 8 rplB and 65 purF polymorphic sites (Table 3). Twenty different allelic profiles were identified in the 86 B. breve isolates analyzed (Table 4). Some strains isolated from the unrelated infants in the study shared similar profiles, and we conservatively considered them as different strains. This resulted in a library of 24 strains of B. breve (Table 1), for which a consensus phylogenetic tree of the concatenated MLST data is shown in FIG. 1.

Example 2

Characterization of Glycosyl Hydrolases from Isolated Strains

Materials and Methods

[0115] In order to study the potential adaptations of the B. breve isolates for growth on HMO, we first determined the presence of three key GH classes required to cleave HMO into its constituent monosaccharides. .beta.-galactosidase activity was not observed because it is widespread in the Bifidobacterium genus. .alpha.-fucosidases (Blon.sub.--2336, Blon.sub.--2335, Blon.sub.--0248/0426, Blon.sub.--0346), .alpha.-sialidases (Blon.sub.--2348, Blon.sub.--0646), and .beta.-hexosaminidase Blon.sub.--0459 protein sequences identified in the genome of B infantis ATCC 15697 were aligned with homolgous sequences from the GeneBank database (Accession numbers showed in Table 6) using Bioedit 7.0 and degenerated primers were designed to amplify conserved regions (Table 7). To differentiate between Blon.sub.--0248 and Blon.sub.--0426, strains positive for fucosidase Blon.sub.--0248/0426 were also amplified with the primers designed to amplify the complete gene in B. infantis ATCC 15697 (Table 7). PCR reactions were prepared as above with 200 pmol of primers. Cycling conditions were optimized for every primer set (Table 7), and consisted of an initial denaturation at 95.degree. C. for 4 min, followed by 35 cycles of 95.degree. C. for 30 s, annealing at 45-55.degree. C. for 30 s, elongation at 72.degree. C. for 60 s, final extension at 72.degree. C. for 7 min; and holding at 4.degree. C. The resulting amplicons were separated and sequenced as above. B. infantis ATCC 15697 and B. animalis JCM 10602 were used as positive and negative control strains, respectively.

TABLE-US-00006 TABLE 6 Genebank accession numbers for glycosyl hydrolase. Glycosyl hydrolase name Protein sequences accession numbers Blon_2335 YP_002323771.1; ZP_06596922.1; ZP_03742645.1; ZP_03167824.1; NP_241708.1; ZP_03474775.1; YP_003010680.1; ZP_04552485.1; ZP_07812017.1 Blon_2336 YP_002323772.1; WP_003795385.1; WP_007588699.1; YP_001297867.1; WP_006775425.1; YP_003822597.1; WP_008706707.1; WP_009776262.1 Blon_0248/0426 YP_002321754.1; ZP_08285605.1; ZP_08026776.1; ZP_06607921.1; ZP_06184004.1; YP_002533924.1; ZP_05989289.1; ZP_02477566.1; YP_001851141.1; ZP_03212758.1; ZP_05280631.1 Blon_0346 YP_002321848.1; ZP_02040503.1; ZP_02079496.1; ZP_08131039.1; ZP_05718978.1; YP_004456548.1; P_003242853.1;YP_002547035.1 Blon_2348 YP_002323784.1; WP_003818390.1; ACH92844.1; WP_003796112.1; ACH92824.1; BAD66680.2 Blon_0646 YP_002322131.1; YP_007554019.1 Blon_0459 YP_002321953.1., YP_007555353.1

TABLE-US-00007 TABLE 7 Glycosyl hydrolase gene and qPCR primers. Expected amplicon Anneling size Temp. Primer name Primer sequence (5'-3').sup.a (bp) (.degree. C.) Blon_2335F GARATGAAYTAYTGGATG 960 56.degree. C. Blon_2335R TTNCCRTCDATYTGRAANGGNGG Blon_2336F AARCAYCAYGAYGGNTTYTG 600 55.degree. C. Blon_2336R ACYTCNGCNGGRTACCA Blon_0248/0426F TAYGCNGARTGGTAY 210 45.degree. C. Blon_0248/0426R TCRTGRTGYTTNGTNGT Blon_0346F YTNGAYTTYCAYACNWS 740 48.degree. C. Blon_0346R TCRTGRTGYTTNGTNGT Blon_2348F ATHACNGCNGAYATHAC 250 45.degree. C. Blon_2348R TCNACNACYTTRTTYTCRTC Blon_0646F CCACCAGACATGGAACAGTG 220 60.degree. C. Blon_0646R AAATCGCCGAAGGTGATATG Blon_0459F CCCCACCCTCGACTGGCTCA 510 62.degree. C. Blon_459R CTTCGAGGTGGCACAGG 0248WF ACCAACAACCAGCAACCAAT 135 56.degree. C. 0248WR ATCGAATACGGCACCTTCAG 0426WF ACCAACAACCAGCAACCAAT 135 56.degree. C. 0426WR GACCGCCTTCATGGATAAGA RNP-F AACCTGATGATCGGACGACG 182 60.degree. C. RNP-R GGCAAACTGCTCATCCAACG 60.degree. C. GH29-F GGACTGAAGTTCGGCGTGTA 160 60.degree. C. GH29-R TCGTTGTCCTCCTCCGAGAT 60.degree. C. GH95-F CGCGGACTACCGCAGATATT 163 60.degree. C. GH95-R ATCGAACATTGCCTCTGCCA 60.degree. C. .sup.aIn the primer sequence R indicates (A/G), W (A/T), S (C/G), Y (C/T), H (A/C/T), D (A/G/T), N (A/C/G/T).

Results

[0116] The genome of B. breve UCC2003 (O'Connell et al. (2011) PNAS 108:11217) contains an .alpha.-fucosidase, an .alpha.-sialidase and a .beta.-hexosaminidase with significant homology to cognate enzymes in B. infantis ATCC 15697. No homology was found to the same glycosyl hydrolases in B. bifidum genomes. Based on this, we used degenerate primers to look for genes encoding these GH in the assembled B. breve strains (Table 8). All of the B. breve strains possessed a gene homologous to .beta.-hexosaminidase Blon.sub.--0459 in B. infantis (Gamido et al. (2012) Mol Cell Proteomics 11:775), an .alpha.-fucosidase similar to Blon.sub.--2335 in B. infantis ATCC 15697 (Sela et al. (2012) Appl. Env. Microbiol. 78:795) and all strains excepting JCM 7020 possessed an .alpha.-sialidase, related to Blon.sub.--0646 in B. infantis (Sela et al. (2011) J. Biol. Chem. 286:11909). Moreover, five strains possessed a second .alpha.-fucosidase, homolog to locus tag Blon.sub.--0248 in B. infantis ATCC 15697 (Sela et al. (2012) Appl. Env. Microbiol. 78:795) that belongs to GH family 29 (Table 8 and FIG. 2).

TABLE-US-00008 TABLE 8 Presence of glycosyl hydrolases and growth in different HMO by B. breve strains Glycosyl hydrolases.sup.a .alpha.-fucosidase .alpha.-sialidase .beta.-hexosaminidase Bacterial growth Strain GH95 GH29 GH33 GH20 HMO.sup.b LNT LNnT 2FL 3FL 3SL 6SL UCC2003 + - + + + +++ +++ - + - - ATCC15700 + - + + + +++ +++ - - - - ATCC15698 + - + + ++ +++ +++ - - - - ATCC15701 + - + + +++ +++ +++ - - - - JCM7017 + - + + ++ +++ +++ - - - - JCM7019 + - + + ++ +++ +++ + + - - JCM7020 + + - + ++ +++ +++ - - - - S-17c + - + + + +++ +++ - + - - S-46 + - + + ++ +++ +++ - + - - SC81 + - + + ++ +++ +++ - - - - SC95 + + + + +++ +++ +++ +++ + - - SC139 + - + + ++ +++ +++ - - - - SC154 + + + + +++ +++ +++ - - - - SC500 + - + + ++ +++ +++ - - - - SC506 + + + + ++ +++ +++ - - - - SC508 + - + + + +++ +++ - - - - SC522 + - + + ++ +++ +++ - + - - SC559 + - + + ++ +++ +++ - - - - SC567 + - + + ++ +++ +++ - - - - SC568 + + + + ++ +++ +++ +++ + - - SC573 + - + + + +++ +++ - + - - SC580 + - + + ++ +++ +++ - + - - SC670 + - + + + +++ +++ - - - - KA179 + - + + ++ +++ +++ + - + + ATCC15697 + + + + +++ +++ +++ +++ +++ +++ +++ JCM10602 - - - - - - - - - - - .sup.aPositive amplification + indicates that the sequence of the PCR product is >55% homologous at the aminoacid level to the respective GH gene in B. infantis ATCC15697. .sup.bLevel of growth was classified as Negative -: OD <0.200; Low +: OD 0.200-0.550; Moderate ++: OD 0.550-0.750; High +++: OD >0.750

Example 3

Characterization of the Growth of Isolated Strains on Human Milk Oligosaccharides

Materials and Methods

[0117] The 24 B. breve strains in Table 1 were tested for growth in the presence of seven different substrates: HMO (Ward et al. (2006) Appl. Env. Microbiol. 72:4497), LNT, lacto-N-neotetraose (LNnT), 2'-fucosyllactose (2FL), 3'-fucosyllactose (3FL) (Glycom, Denmark), 3'-sialyllactose (3SL), and 6'-sialyllactose (6SL) (GenChem. Inc. Korean). B. infantis ATCC 15697, and B. animalis JCM 10602 were included as positive and negative control for growth in HMO, respectively. Two .mu.l of each resulting overnight culture was used to inoculate 200 .mu.l of modified MRS (mMRS) medium supplemented with 2% (w/v) of each sterile-filtered substrate as the sole carbohydrate source, and another 2 .mu.l inoculated into mMRS without added sugar. The media was supplemented with 0.05% (w/v) L-cysteine, and in all the cases the cultures in the wells of the microliter plates were covered with 30 .mu.l of sterile mineral oil to avoid evaporation. The incubations were carried out at 37.degree. C. in an anaerobic chamber (Coy Laboratory Products, Grass Lake, Mich.). Cell growth was monitored in real time by assessing optical density (OD) at 600 nm using a BioTek PowerWave 340 plate reader (BioTek, Winoosky, Vt.) every 30 min preceded by 15 seconds shaking at variable speed. Two biological replicates and three technical replicates each were performed for every studied strain. Maximum ODs and growth rates were calculated and expressed as the mean of all replicates with the respective standard deviation. These calculations were performed as described in Breidt et al. (1994) J. Rapid Meth. Autom. Microbiol. 3:59) The OD obtained for each strain grown on the different substrates, was compared with the OD obtained in the absence of sugar source. This difference in OD (.DELTA.OD) was used as a parameter to evaluate the strain's ability for growing on the different substrates.

Results

[0118] Growth behavior on HMO and maximum OD values obtained were parameters to classify this panel in three groups (Table 8).

[0119] In general, a moderate growth on HMO was witnessed for all the strains (Table 8 and Table 9), with some strain level differences (Table 8). Interestingly, three strains (SC95, SC154 and ATCC 15701) exhibited remarkable growth on HMO compared to the type strain B. breve ATCC 15700, but still lower overall growth and growth rate relative to B. infantis ATCC 15697 (FIG. 3A and Table 9).

TABLE-US-00009 TABLE 9 Kinetic analysis of bacterial growth in 2% HMO. Kinetic parameters in 2% HMO Growth rate Lag time Generation Max. OD Strain (1/h) SD (h) SD time (h) SD (600 nm) SD UCC2003 6.70E-02 .+-.7.55E-03 3.070 .+-.0.132 4.531 .+-.0.543 0.524 .+-.0.055 ATCC15700 6.16E-02 .+-.1.12E-02 5.420 .+-.0.042 5.007 .+-.1.001 0.538 .+-.0.025 ATCC15698 7.98E-02 .+-.2.14E-03 4.260 .+-.0.118 3.772 .+-.0.102 0.656 .+-.0.065 ATCC15701 5.77E-02 .+-.2.22E-03 2.445 .+-.0.881 5.225 .+-.0.206 0.779 .+-.0.040 JCM7017 7.19E-02 .+-.4.50E-03 5.549 .+-.0.096 4.199 .+-.0.257 0.656 .+-.0.021 JCM7019 9.94E-02 .+-.4.55E-03 7.653 .+-.0.310 3.033 .+-.0.135 0.655 .+-.0.014 JCM7020 8.51E-02 .+-.2.08E-03 4.016 .+-.0.083 3.538 .+-.0.087 0.661 .+-.0.015 S-17c 7.26E-02 .+-.7.21E-03 6.161 .+-.0.237 4.170 .+-.0.398 0.540 .+-.0.013 S-46 8.36E-02 .+-.9.27E-03 4.413 .+-.0.073 3.627 .+-.0.378 0.71 .+-.0.033 SC81 1.07E-01 .+-.4.81E-03 6.331 .+-.0.108 2.825 .+-.0.129 0.715 .+-.0.033 SC95 1.20E-01 .+-.6.43E-03 4.655 .+-.0.047 2.523 .+-.0.131 0.859 .+-.0.029 SC139 9.41E-02 .+-.9.16E-03 5.390 .+-.0.204 3.219 .+-.0.297 0.667 .+-.0.015 SC154 7.54E-02 .+-.5.22E-03 6.295 .+-.0.166 4.007 .+-.0.281 0.768 .+-.0.031 SC500 5.24E-02 .+-.3.65E-03 13.512 .+-.0.362 5.759 .+-.0.404 0.558 .+-.0.026 SC506 5.92E-02 .+-.2.66E-03 3.806 .+-.0.050 5.088 .+-.0.222 0.731 .+-.0.0007 SC508 4.26E-02 .+-.2.37E-03 5.157 .+-.0.070 7.086 .+-.0.390 0.277 .+-.0.054 SC522 4.88E-02 .+-.1.14E-02 1.050 .+-.0.223 6.439 .+-.1.715 0.698 .+-.0.047 SC559 6.26E-02 .+-.1.27E-03 6.311 .+-.0.137 4.807 .+-.0.098 0.612 .+-.0.0015 SC567 5.76E-02 .+-.5.49E-03 9.953 .+-.0.765 5.256 .+-.0.529 0.567 .+-.0.042 SC568 6.26E-02 .+-.2.91E-03 6.216 .+-.0.524 4.815 .+-.0.220 0.680 .+-.0.034 SC573 3.31E-02 .+-.3.45E-03 3.419 .+-.0.123 9.168 .+-.0.933 0.306 .+-.0.014 SC580 6.34E-02 .+-.3.82E-03 2.045 .+-.0.204 4.762 .+-.0.284 0.727 .+-.0.028 SC670 3.38E-02 .+-.5.98E-03 9.886 .+-.0.234 9.083 .+-.1.505 0.332 .+-.0.054 KA179 1.13E-01 .+-.2.83E-03 6.990 .+-.1.144 2.673 .+-.0.066 0.606 .+-.0.038 ATCC15697 2.07E-01 .+-.3.29E-03 3.930 .+-.0.051 1.452 .+-.0.022 1.295 .+-.0.015 JCM10602 1.10E-02 .+-.1.45E-03 14.919 .+-.2.389 27.578 .+-.3.368 0.180 .+-.0.025

[0120] All B. breve strains grew on LNT and LNnT to high cell densities and at levels comparable to B. infantis ATCC 15697 (Table 8). Interestingly, a few strains were able to grow on fucosylated HMO (FIG. 3B and Table 8). The isolates SC95 and SC568 grew well on 2FL, to a similar extent than B. infantis ATCC 15697. Using 3FL as the sole carbon source, only the strains SC95 and JCM 7019 showed growth (Table 8). Finally, growth on 3SL and 6SL was only observed for one strain (Table 8).

Example 4

Glycoprofiling and Gene Expression Analysis of Isolated Strains

Materials and Methods

[0121] Glycoprofiling.

[0122] Bacterial cultures in mMRS with 2% HMO were collected at the end of the exponential phase and centrifuged at 12000.times.g for 30 min. In the case of B. breve SC95, the samples were collected at three different points in the growth curve, approximately OD.sub.600nm=0.2, 0.5 and 0.8. At least two biological replicates were performed in triplicate. Supernatants were filtered using a multiscreen 96-well filtration plate 0.22 .mu.m (Millipore, Billerica, Mass.) prior to storage at -80.degree. C. Remaining oligosaccharides were recovered from the supernatants (25 .mu.l) and reduced to their alditol forms with 1M NaBH.sub.4 at 65.degree. C. for 1.5 h. Each replicate was desalted by solid-phase extraction on graphitized carbon cartridges. Salts were removed with 6 mL of deionized water and oligosaccharides were eluted with 20% acetonitrile in water (v/v) and with 40% acetonitrile in 0.01% trifluoroacetic acid (v/v). SPE fractions were combined and dried under vacuum. Samples were reconstituted in 100 .mu.l of deionized water and diluted 50-fold for LC-MS analysis.

[0123] An Agilent high performance liquid chromatography chip time of flight (HPLC-Chip/TOF) mass spectrometer equipped with a capillary pump for sample loading and a nano pump for chromatographic separation was used for HMO analysis. Separation was performed on a microfluidic chip equipped with an enrichment and nano-LC analytical column, both packed with porous graphitized carbon. Briefly, HMO were separated by a 65 min gradient using a binary solvent system consisting of 3% acetonitrile/water in 0.1% formic acid (v/v) solvent A and 90% acetonitrile/water in 0.1% formic acid (v/v) solvent B. HMO were analyzed in positive ion mode, with a mass range between 300-2000 m/z. Agilent's Masshunter software version B.03.01 was used for data acquisition and data analysis.

[0124] HMO monosaccharide composition was determined using accurate mass within .+-.20 ppm mass error of theoretically calculated masses. Specific structures were assigned to HMO peaks by matching the reproducible retention time to that reported in annotated HMO libraries. Percent consumption was calculated using a label-free method, employing the un-inoculated HMO pool as an external standard. Total HMO consumption was calculated with respect to the un-inoculated control by normalizing the summed abundance of all identified oligosaccharide spectra in ion counts in the bacterial supernatant to that of the control using the following equation:

[ 1 - ( i = 1 n API bacteria sample i = 1 n API un-incoluated control ) ] .times. 100 ##EQU00001##

where API is absolute peak intensity and n is the number of identified HMO. The consumption of individual HMO species was quantitated in the same manner, in which the absolute peak intensity of a specific HMO structure was normalized to the peak intensity of the corresponding structure in the un-inoculated control.

[0125] Gene Expression Analysis.

[0126] The full nucleotide sequences of the genes encoding a GH95 and a GH29 .alpha.-fucosidase in the strain B. breve SC95 generated were used to design qPCR primers using the primer-BLAST tool at NCBI (Table 7). For relative quantification, the rnpA gene protein component of ribonuclease P complex was used. B. breve SC95 was grown as described above in mMRS supplemented with either 2% lactose, 2% HMO or 2% 2FL in a microplate reader, and cultures were taken at mid-exponential phase OD 0.6-1.0. Samples were immediately pelleted at 12000.times.g for 1 min and stored in RNA later Ambion. RNA extraction, cDNA conversion and qPCR were performed (Gamido et al. (2012) Anaerobe 18:430).

Results

[0127] Based on their growth kinetic parameters and ability to utilize certain glycans, six strains of B. breve were selected to examine the consumption of 22 different oligosaccharides during growth on total HMO. This included strains SC95, SC154, SC568, SC580, ATCC15701, and JCM7019, as well as B. infantis ATCC 15697 and B. breve ATCC 15700 as positive and negative controls respectively. The supernatant was collected at the end of the exponential phase during growth on HMO, and remaining oligosaccharides were purified and reduced, and later detected and quantified by nano HPLC/CHIP TOF MS. Specific oligosaccharide and isomers were identified using two oligosaccharide structures libraries (Wu et al. (2011) J. Proteome Res. 10:856; Wu et al. (2010) J. Proteome Res. 9:4138). The oligosaccharides quantified include the most abundant neutral and sialylated HMO, and Table 10 shows their names, masses, chemical structure, and degree of polymerization (DP).

[0128] Among the six strains selected, total consumption of HMO ranged between 23 and 42%. These values are lower compared to B. infantis ATCC 15697 (64% consumption) but clearly higher than B. breve ATCC 15700 (FIG. 4A). FIG. 4B shows the consumption of neutral non-fucosylated HMO in more detail. We observed that for the B. breve strains the consumption patterns were similar. All strains were able to deplete LNT/LNnT from the culture media to a high extent. Among three major hexaoses found in HMO, a preference for lacto-N-neohexaose (LNnH) was observed, over lacto-N-hexaose (LNH) and para-lacto-N-hexaose (p-LNH).

[0129] In general, the ability of B. breve to metabolize fucosylated HMO was lower compared to B. infantis, which showed high consumption levels for all the HMO tested (FIG. 5A). However, strains SC95, SC154 and SC568 showed a significant consumption of monofucosylated 2FL and LNFPII and difucosylated DFpLNHII and DFLNH-A HMO (FIG. 5A). Interestingly, even though 2FL cannot support the growth in vitro of strain SC154 (Table 8), this strain utilizes larger fucosylated HMO.

[0130] We observed that growth on fucosylated HMO was more prominent in strains which possessed an additional GH29 .alpha.-fucosidase (FIG. 5A and Table 8). We evaluated the relative gene expression of this gene in strain SC95. Growth on 2FL as the sole carbon source up-regulated 40-fold the expression of the GH29 fucosidase gene (FIG. 6). The expression of a GH95 fucosidase was not altered by growth on 2FL, suggesting that the presence of the GH29 fucosidase gene endows these strains with the ability to consume fucosylated oligosaccharides. In contrast, growth on total HMO did not affect the expression of these genes.

[0131] Acidic HMO represents approximately 15% of total HMO. We thus screened the consumption of eleven sialylated HMO in the spent supernatants of the listed strains during growth on total HMO (FIG. 5B). The levels of consumption were very similar among the strains tested, and comparable to B. infantis. In particular LSTb (sialyl-LNT b), sialyl-lacto-N-hexaose and mass 4121a/4121b were preferentially utilized by B. breve (FIG. 5B).

[0132] Finally, to elucidate possible substrate preferences in a B. breve strain with high HMO consumption, we monitored the consumption of nine representative oligosaccharides at different points during the fermentation of HMO by strain SC95 (FIG. 7). These HMO correspond to neutral and acid HMO that were consumed at levels higher than 40%. Remarkably, glycoprofiling of early exponential growth revealed that acidic HMO disappeared from the media first, together with LNnH. In contrast, LNT was metabolized first during the mid-exponential phase, and is majorly depleted at the end of the growth on HMO. We also observed that, while monofucosylated HMOs 2FL and LNFP II are depleted from the media at the mid-exponential phase and not later, difucosylated HMO appear to be steadily consumed during the three growth points (FIG. 7).

SUMMARY AND CONCLUSION

[0133] B. breve is one of the most representative species of bifidobacteria found in the infant intestinal microbiota. In order to determine whether free HMO contribute to the persistence of B. breve in the infant intestinal microbiota, we evaluated in detail the adaptations of a significant number of strains of B. breve to HMO.

[0134] The dominance of B. breve in this community has been supported by several studies, especially in breast-fed infants, where this species together with B. longum and B. infantis can largely outnumber other microorganisms. Breast milk itself is another habitat for this species, which, in addition to the vaginal and fecal microbiota of the mother, contribute to intestinal colonization of the infant. Some strains of this species are currently studied by their probiotic properties, for example in the production of conjugated linoleic acid or important immunomodulatory activities.

[0135] Since the predominance of bifidobacteria in breast-fed infants can be attributed in part to bioactive agents in milk such as HMO, the utilization of these substrates in vitro and in vivo is an important reflection of the adaptations of intestinal microorganisms to the environmental conditions prevalent in the infant gut. HMO utilization has only been shown for the type strain of B. breve ATCC 15700 (JCM 1192), and results indicate that this microorganism has a limited ability to consume HMO, almost exclusively LNT. Here we have expanded these observations and concluded that several infant-associated strains of B. breve can readily utilize HMO, consuming significantly larger amounts of total HMO compared to the type strain ATCC 15700. The HMO consumption in B. breve is however moderate by comparison to B. infantis ATCC 15697.

[0136] Mass spectrometry-based analysis of the HMO remaining after growth provides a detailed representation of the preferences of these strains for different oligosaccharide subsets present in the HMO pool. For example, all strains showed a vigorous growth on LNT and LNnT as a sole carbon source, and the molecular mass representing both oligosaccharide species (709) was the most consumed in pooled HMO. The utilization of LNnT is interesting since this oligosaccharide is not readily fermented by all species of Bifidobacterium found in the infant gut. Moreover growth on LNnT was shown to enable B. infantis to outcompete Bacteroides fragilis in a mouse model.

[0137] HMO with mass 1074 Da represent approximately 10% of the total HMO, and includes three neutral isomers, LNH, LNnH and p-LNH (Table 10). Interestingly, LNnH is the most abundant of the three isomers and it was selectively cleared from the growth media compared to the other two isomers. This indicates structure-based preferences in HMO consumption in B. breve (FIG. 4B and Table 10).

[0138] Strain-dependent differences were more evident in growth of B. breve on fucosylated HMO. Fucosidase activity has not been described previously in B. breve, and while all the strains studied possessed a gene encoding a GH95 .alpha.-fucosidase, we observed that the presence of a second .alpha.-fucosidase from GH29 in isolates SC95, SC568 and SC 154 correlated with their consistent growth and consumption of fucosylated HMO (FIG. 5A and Table 8). Some strains with this additional GH29 .alpha.-fucosidase did not, however, grow on 2FL and 3FL. These smaller HMO are imported by different transport mechanisms. For example, in B. infantis, 2FL and larger fucosylated HMO are likely imported by different solute binding proteins.

[0139] Remarkably, all B. breve strains consume pooled acidic HMO to a significant extent, and an .alpha.-sialidase was identified. All strains glycoprofiled showed a preferential consumption of select acidic HMO such as LSTb and S-LNH, but not smaller HMO, which might additionally explain why growth on 3SL and 6SL was negligible (Table 8).

[0140] The present results indicate that the mechanisms of HMO consumption in B. breve are very similar to B. infantis, with a preference to import intact oligosaccharides followed by intracellular degradation, rather than the extracellular degradation observed by B. bifidum. For example, B. breve strain ATCC 15700 can quickly deplete LNT from the spent media and the absence of intermediate monosaccharides indicates that this strain imports this substrate. Moreover, the GH genes identified in this study lacked signal peptides, indicating intracellular localization. Finally, the sequences obtained are homologous to previously characterized enzymes in B. infantis, including .beta.-hexosaminidases Blon.sub.--0459, two .alpha.-fucosidases Blon.sub.--2335 and Blon.sub.--0248 and an .alpha.-sialidase Blon.sub.--0646, indicating a common origin.

[0141] The present results provide a rationale for the predominance of B. breve in the infant intestinal microbiota, improving our understanding about the ecology of this unique environment. The genetic variation of these strains and the strain-dependent character of the HMO utilization are factors to consider in probiotic and prebiotic studies. Better characterization of the diversity and physiology of beneficial strains of bifidobacteria, and more selective substrates that allow their implantation in the intestine, can be used to design selective synbiotic preparations.

TABLE-US-00010 VIII. Informal sequence listing GH-29, Bifidobacterium longum subsp. infantis (B. infantis), Blon_0248, Genbank Accession YP_002321754 (AfcB); SEQ ID NO: 1: 1 mvlfmanpqr pkmyekfvhd tpewfkgagl gifahwgsys vpawaepiga lgtfddpvyw 61 nthcpyaewy wntmsikgsp aaehqkevyg dmpyedfidm wkaeafdpad madlfaraga 121 ryfvpttkhh egitlwkapd ndgwntvdrg phrdlvkefa damrdkglkf gvyyssgldw 181 hkepnmpilg dgeygpqsed yarymyshvm dlideyqpsi lwgdidvpki seedndfsva 241 rlfehyydvv pdgvvndrwg lthwdfrtve yeqgkelmgk gmwemtrgig ysfgynqmed 301 adsymtgpea vklladvvsm ggn111digp daagripelq rqclegmadw mdvnspsihd 361 vepvpeasps gegdgepwvr wtgdgksvya vvdaagrvpl riaadavdad savtlggsav 421 avdadgdvlt advpasevag pqvvhfvrr GH-29, Bifidobacterium longum subsp. infantis (B. infantis), Blon_0426, Genbank Accession YP_002321924 (AfcB); SEQ ID NO: 2: 1 mvlfmanpqr pkmyekfvhd tpewfkgagl gifahwgsys vpawaepiga lgtfddpvyw 61 nthcpyaewy wntmsikgsp aaehqkevyg dmpyedfidm wkaeafdpad madlfaraga 121 ryfvpttkhh egitlwkapd ndgwntvdrg phrdlvkefa damrdkglkf gvyyssgldw 181 hkepnmpilg dgeygpqsed yarymyshvm dlideyqpsi lwgdidvpki seedndfsva 241 rlfehyydvv pdgvvndrwg lthwdfrtve yeqgkelmgk gmwemtrgig ysfgynqmed 301 adsymtgpea vklladvvsm ggn111digp daagripelq rqclegmadw mdvnspsihd 361 vepvpeasps gegdgepwvr wtgdgksvya vvdaagrvpl ridagavdvd satilgggnv 421 vveadgdmlt veipatdvag pqvvrfarh GH-29, Bifidobacterium breve (B. breve) SC95, (AfcB); SEQ ID NO: 3: 1 mvlfmanpqr pkmyekfvhd tpewfkgagl gifahwgsys vpawaepiga lgtfddpvyw 61 nthcpyaewy wntmsikgsp aaehqkevyg dmpyedfidm wkaeafdpad madlfaraga 121 ryfvpttkhh egitlwkapd ndgwntvdrg phrdlvkefa damrdkglkf gvyyssgldw 181 hkepnmpilg dgeygpqsed yarymyshvm dlidkyqpsi lwgdidvpki seedndfsva 241 rlfehyydvv pdgvvndrwg lthwdfrtve yeqgkelmgk gmwemtrgig ysfgynqmed 301 adsymtgpea vklladvvsm ggn111digp daagripelq rqclegmadw myvnspsihd 361 vepvpeasps gegdgepwvr wtgdgksvya vvdaagrvpl riaadavdad savtlggsav 421 avdadgdvlt advpasevag pqvvhfvrr* GH-29, Bifidobacterium bifidum, Genbank Accession BAH80310.1 (AfcB); SEQ ID NO: 4: 1 mlhtasrgcs rswlrrltal iaysalafva 1pnvavaadp meyldvsfgg tfaadtyttg 61 gdevakgpvt khgsiptkld gggitlaggt ngvtftstas fsesgkvnkg fraemeyrtt 121 qtpsnlatlf samgnifvra ngsnleygfs tnpsgstwnd ytksvtlpsn nvkhiiqlty 181 1pgadgaast lqlsvdgvag etatsaagel aaysdsvgnk fgigyevnpa sgaasrglag 241 dvfrarvads dapweildas qllhvnfngt fsgtsytaas geqmlgslvs rsanpsisns 301 avtlgggtag fdftptdftl gdneaitrpl vaelrftptq tgdnqtlfga ggnlflryes 361 nklvfgastk sgdnwtdhki esaaatgaeh vvsvayvpnk agtgaklvmr vdggdaqtkd 421 itglaylnss ikgkvgfgnd vhtdalsrgf vgslseirla etsanfttne fklvysqvsc 481 dtsgikeant fdvepaecea alktklsklr ptegqadyid wgqigflhyg intyynqewg 541 hgnedpsrin ptgldtdqwa ksfadggfkm imvtvkhhdg felydsrynt ehdwantava 601 krtgekdlfr kivasakkyg lkvgiyyspa dsymerkgvw gnnsarvert iptivenddr 661 agkvasgklp tfkykatdyg aymlnqlyel lteygdisev wfdgaqgnta gtehydygvf 721 yemirrlqpq aiqanaayda rwvgnedgwa rqtewspqaa yndgvdkvsl kpgqmapdgk 781 lgsmssvlse irsgaanqlh wypaevdakn rpgwfyrasq spasvaevvk yyeqstgrns 841 qyllnvppsd tgkladadaa glkglgeela rrygtdlalg ksatvaasan dtavaapklt 901 dgsklssdka vgntptytid lgstvavdav kisedvrnag qqiesatlqg rvngtwtnla 961 tmttvgqqrd lrftsqnida irlvvnssrg pvrlsrlevf hteseiqtga rayyidptaq 1021 tagdgftkdk pmtsieqlhd vtvapgsvif vkagteltgd favfgygtkd epitvttyge 1081 sdkattasfd gmtagltlkq alkalgkdda gwvvadsata pasrvyvpqd eisvhaqssq 1141 nsgaeaaral dgdsstswhs qyspttasap hwvtldlgks renvayfdyl aridgnnnga 1201 akdyevyvsd dpndfgapva sgtlknvayt qrikltpkng ryvkfviktd ysgsnfgsaa 1261 emnvellpta veedkvatpq kptvdddadt ytipdiegvv ykvdgkvlaa gsvvnvgded 1321 vtvtvtaepa dgyrfpdgvt spvtyeltft kkggekppte vnkdklhati tkaqaidrsa 1381 ytdeslkvld dklaaalkvy dddkvsqddv daaeaalsaa idalktkptt pggegekpge 1441 gekpgdgnkp gdgkkpgdvi aktgastmgv vfaalamvag avvtleakrk snr GH-95, Bifidobacterium longum subsp. infantis (B. infantis), Blon_2335, Genbank Accession YP_002323771.1 (AfcA); SEQ ID NO: 5: 1 mkltfdgiss hweegipfgn grmgavlcse pdadvlylnd dtlwsgypha etspltpeiv 61 akarqassrg dyvsatriiq datqrekdeq iyepfgtaci rysseagerk hvkrsldlar 121 alagesfrlg aadvhvdawc sapddllvye msssapvdas vsvtgtflkq trissgsdsd 181 arqativvmg qmpglnvgsl ahvtdnpwed erdgigmaya gafsltvtgg eitviddvlq 241 csgvtglslr frslsgfkgs aeqperdmtv ladrlgetia awpsdsraml drhvadyrrf 301 fdrvgvrlgp andddeevpf aeilrskedt phrletlsea mfdfgrylli sssrphtqps 361 nlqgiwnhkd fpnwysaytt niniemnywm tgpcalkeli eplvamnrel lepghdaaga 421 ilgcggsavf hnvdiwrral pangeptwaf wpfgqawmcr nlfdeylfnq desylasiwp 481 imrdsarfcm dflsdtehgl apapatspen yfvvdgetia vahtsentta ivrnllddli 541 haaqtmpdld dgdkalvrea estraklaav rvgsdgrile wndelveadp hhrhlshlye 601 lhpgagitan tprleeaark slevrgddgs gwsivwrmim warlrdaeha eriigmflrp 661 veadaetdll gggvyasgmc ahppfqidgn lgfpaalaem lvqshdgmvr ilpalpedwh 721 egsfhglrar gglsvdaswt ddaieytlrc tkpatitliv dgtdatqvrl spdepfkglv 781 rr GH-95, Bifidobacterium bifidum, Genbank Accession AAQ72464.1 (AfcA); SEQ ID NO: 6: 1 mkhramssrl mplvascatv gmllaglpvs avavgttraa asdassstta titpsadttl 61 qtwtseknss maskpyigtl qgpsqgvfge kfestdaadt tdlktglltf dlsaydhapd 121 satfemtylg yrgnptatdt dtikvtpvdt tvctnnatdc ganvatgatk pkfsindssf 181 vaeskpfeyg ttvytgdait vvpantkkvt vdvteivrqq faegkkvitl avgetkktev 241 rfassegtts lngatadmap kltvsystkd dlkpsadttl qawaseknek kntaayvgal 301 qpegdygdfg ekfkstdvhd vtdakmglmt fdlsdytaap ehsiltltyl gyagadktat 361 atdkvkvvav dtsrctgtap cdtnnatwan rpdfevtdtt ktatshafay gskkysdgmt 421 vesgnakkvl ldvsdvikae fakfsagate kkitlalgel nksdmrfgsk evtsltgate 481 amqptlsvtk kpkaytlsie gptkvkyqkg eafdkaglvv katstadgtv ktltegnged 541 nytidtsafd sasigvypvt vkynkdpeia asfnayvias vedggdgdts kddwlwykqp 601 asqtdatata ggnygnpdnn rwqqttlpfg ngkiggtvwg evsrervtfn eetlwtggpg 661 sstsynggnn etkgqngatl ralnkqlang aetvnpgnit ggenaaeqgn ylnwgdiyld 721 ygfndttvte yrrdlnlskg kadvtfkhdg vtytreyfas npdnvmvarl taskagklnf 781 nvsmptntny sktgetttvk gdtltvkgal gnngllynsq ikvvldngeg tlsegsdgas 841 lkvsdakavt lyiaaatdyk qkypsyrtge taaevntrva kvvqdaankg ytavkkahid 901 dhsaiydrvk idlgqsghss dgavatdall kayqrgsatt aqkreletiv ykygryltig 961 ssrensqlps nlqgiwsvta gdnahgntpw gsdfhmnvnl qmnywptysa nmgelaepli 1021 eyveglvkpg rvtakvyaga ettnpettpi gegegymaht entaygwtap gqsfswgwsp 1081 aavpwilqnv yeayeysgdp alldrvyall keeshfyvny mlhkagsssg drlttgvays 1141 peqgplgtdg ntyesslvwq mlndaieaak akgdpdglvg nttdcsadnw akndsgnftd 1201 ananrswsca ksllkpievg dsgqikewyf egalgkkkdg stisgyqadn qhrhmshllg 1261 lfpgdlitid nseymdaakt slryrcfkgn vlqsntgwai gqrinswart gdgnttyqlv 1321 elqlknamya nlfdyhapfq idgnfgntsg vdemllqsns tftdtagkky vnytnilpal 1381 pdawaggsys glvargnftv gttwkngkat evrltsnkgk qaavkitagg aqnyevkngd 1441 tavnakvvtn adgasllvfd ttagttytit kkasanvpvt gvtvtganta tagdtvtlta 1501 tvapanatdk svtwstsdaa vatvnangvv ttkkagkvti tatsngdktk fgsieitvsa 1561 atvpvtsvtv agdaamtvdg eqtltatvap atatdktvtw kssdatvatv dangkvvakk 1621 agevtitata ggvsgtlkit vsdkaptvip vqsvtvtgkq elvegasttl tatvapadat 1681 dktvtwkssd esvatvdkdg vvtakkagtv titataggvs gtlhitvtak pvetvpvtsv 1741 evtveagttv svgktlqata tvkpgnatnk kvtwkssdes iatvdangvi takkagkvvi 1801 tatstdgtdk sgsveitvvd etkptpdhks vkadtgdvta gktgtvtepk dvagwksrsi 1861 ikqgklgkae iadgtivyaa gdktgddsfv vqytmadgtv idvtysvtvk aaetgkndgd 1921 gkgdgvaktg aavgalaglg lmllavgvsv vmirrkhsa GH-29, Bifidobacterium longum subsp. infantis (B. infantis), Blon_0248, derived from Genbank Accession NC_011593, (AfcB); SEQ ID NO: 7: 1 atggtgttgt tcatggccaa tccacagcgt cccaagatgt atgagaagtt cgtgcacgat 61 acacccgaat ggttcaaggg cgccggtctc ggcatcttcg cccactgggg ttcgtattcg 121 gtgccggcat gggcggagcc gatcggtgcg cttggcacct ttgacgatcc ggtgtactgg 181 aacacccact gcccgtatgc ggaatggtat tggaacacga tgagcatcaa gggctcgccg 241 gcggccgagc atcagaagga agtctacggt gacatgccgt atgaggactt catcgacatg 301 tggaaggccg aggcgttcga ccccgcggac atggccgacc tgttcgcacg cgccggtgcc 361 cggtacttcg tgccgaccac gaagcatcac gaaggcatca cgctgtggaa ggcccccgac 421 aacgatgggt ggaataccgt ggaccgtggt ccgcatcgcg atctggtcaa ggaattcgcc 481 gacgccatgc gcgacaaggg actgaagttc ggcgtgtact actcctcggg cctcgactgg 541 cacaaggagc ccaacatgcc gattctcggc gacggggaat acgggccgca gagcgaggac 601 tacgcccgct atatgtactc gcatgtgatg gacctcatcg acgaatacca gccgtccatc 661 ctgtggggag atatcgacgt gccgaagatc tcggaggagg acaacgattt cagcgtggcc 721 cgactgttcg agcattacta cgacgtggtg ccggatggtg tggtcaacga ccgctggggc 781 ctgacccatt gggacttccg caccgtcgaa tacgaacagg gcaaggagct catgggcaag 841 ggcatgtggg agatgacccg aggcatcggc tactccttcg gctacaacca gatggaggac 901 gccgactcct acatgaccgg tccggaggcg gtgaagttgc tcgccgacgt ggtctccatg 961 ggcggcaacc tgctgctcga catcggcccc gacgccgccg gacgcatccc cgaactgcag 1021 cgtcagtgcc tcgagggcat ggccgactgg atggacgtga actcgccgag tatccatgat 1081 gtcgaaccgg tgccggaagc ctcgccttcc ggagaggggg acggcgagcc atgggtccgt 1141 tggaccggag acggcaagag cgtctatgcc gtcgtcgatg ctgcgggcag ggttccgctg 1201 cgcatcgccg ccgatgctgt ggacgcggat tccgccgtga cgcttggcgg atccgcagtc

1261 gccgtggacg ccgacggcga cgtgctgacc gccgatgttc cggcctcgga agtggcgggg 1321 ccgcaggtcg tgcacttcgt ccgtcgctga GH-29, Bifidobacterium longum subsp. infantis (B. infantis), Blon_0426, derived from Genbank Accession NC_011593, (AfcB); SEQ ID NO: 8: 1 atggtgttgt tcatggccaa tccacagcgt cccaagatgt atgagaagtt cgtgcacgat 61 acacccgaat ggttcaaggg cgccggtctc ggcatcttcg cccactgggg ttcgtattcg 121 gtgccggcat gggcggagcc gatcggtgcg cttggcacct ttgacgatcc ggtgtactgg 181 aacacccact gcccgtatgc ggaatggtat tggaacacga tgagcatcaa gggctcgccg 241 gcggccgagc atcagaagga agtctacggt gacatgccgt atgaggactt catcgacatg 301 tggaaggccg aggcgttcga ccccgcggac atggccgacc tgttcgcacg cgccggtgcc 361 cggtacttcg tgccgaccac gaagcatcac gaaggcatca cgctgtggaa ggcccccgac 421 aacgatgggt ggaataccgt ggaccgtggt ccgcatcgcg atctggtcaa ggaattcgcc 481 gacgccatgc gcgacaaggg actgaagttc ggcgtgtact actcctcggg cctcgactgg 541 cacaaggagc ccaacatgcc gattctcggc gacggggaat acgggccgca gagcgaggac 601 tacgcccgct atatgtactc gcatgtgatg gacctcatcg acgaatacca gccgtccatc 661 ctgtggggag atatcgacgt gccgaagatc tcggaggagg acaacgattt cagcgtggcc 721 cgactgttcg agcattacta cgacgtggtg ccggatggtg tggtcaacga ccgctggggc 781 ctgacccatt gggacttccg caccgtcgaa tacgaacagg gcaaggagct catgggcaag 841 ggcatgtggg agatgacccg aggcatcggc tactccttcg gctacaacca gatggaggac 901 gccgactcct acatgaccgg tccggaggcg gtgaagttgc tcgccgacgt ggtctccatg 961 ggcggcaacc tgctgctcga catcggcccc gacgccgccg gacgcatccc cgaactgcag 1021 cgtcagtgcc tcgagggcat ggccgactgg atggacgtga actcgccgag tatccatgat 1081 gtcgaaccgg tgccggaagc ctcgccttcc ggagaggggg acggcgagcc atgggttcgt 1141 tggaccggag acggcaagag cgtctatgcc gtcgtcgatg ctgcgggcag ggttccgctg 1201 cgcatagatg cgggtgcggt cgatgtggat tccgcaacca ttcttggcgg tggcaacgtt 1261 gtcgtggagg cggacggcga tatgctgacc gtggagattc ccgcgacaga cgtcgccggc 1321 cctcaggtcg tgcgttttgc tcgacactaa GH-29, Bifidobacterium breve SC95, (AfcB), SEQ ID NO: 9: 1 atggtgctgt tcatggccaa tccgcagcgt cccaagatgt atgagaagtt cgtgcacgat 61 acacccgaat ggttcaaggg cgccggtctc ggcatcttcg cccactgggg ttcgtattcg 121 gtgccggcat gggcggagcc gatcggtgcg cttggcacct ttgacgatcc ggtgtactgg 181 aacacccact gcccgtatgc ggaatggtat tggaacacga tgagcatcaa gggctcgccg 241 gcggccgagc atcagaagga agtctacggt gacatgccgt atgaggactt catcgacatg 301 tggaaggccg aggcgttcga ccccgcggac atggccgacc tgttcgcacg cgccggtgcc 361 cggtacttcg tgccgaccac gaagcatcac gaaggcatca cgctgtggaa ggcccccgac 421 aacgatgggt ggaataccgt ggaccgtggt ccgcatcgcg atctggtcaa ggaattcgcc 481 gacgccatgc gcgacaaggg actgaagttc ggcgtgtact actcctcggg cctcgactgg 541 cacaaggagc ccaacatgcc gattctcggc gacggggaat acgggccgca gagcgaggac 601 tacgcccgct atatgtactc gcatgtgatg gacctcatcg acaaatacca gccgtccatc 661 ctgtggggag atatcgacgt gccgaagatc tcggaggagg acaacgattt cagtgtggcc 721 cgactgttcg agcattacta tgacgtggtg ccggatggtg tggtcaacga ccgctggggc 781 ctgacccatt gggacttccg caccgtcgaa tacgaacagg gcaaggagct catgggcaag 841 ggcatgtggg agatgacccg aggcatcggc tactccttcg gctacaacca gatggaggac 901 gccgactcct acatgaccgg tccggaggcg gtgaagttgc tcgccgacgt ggtctccatg 961 ggcggcaacc tgctgctcga catcggcccc gacgccgccg gacgcatccc cgaactgcag 1021 cgtcagtgcc tcgagggcat ggccgactgg atgtacgtga actcgccgag tatccatgat 1081 gtcgaaccgg tgccggaagc ctcgccttcc ggagaggggg acggcgagcc atgggtccgt 1141 tggaccggag acggcaagag cgtctatgcc gtcgtcgatg ctgcgggcag ggttccgctg 1201 cgcatcgccg ccgatgctgt ggacgcggat tccgccgtga cgcttggcgg atccgcagtc 1261 gccgtggacg ccgacggcga cgtgctgacc gccgatgttc cggcctcgga agtggcgggg 1321 ccgcaggtcg tgcacttcgt ccgtcgctga GH-29, Bifidobacterium bifidum, Genbank Accession, AB474964.1 (AfcB); SEQ ID NO: 10: 1 atgctacaca cagcatcaag aggatgctcg cgttcgtggc tgcgcagact caccgcattg 61 atagcggtct cggcgctcgc gttcgtggca ttgccgaacg tcgcggtggc ggcggatccg 121 atggaatacc tcgatgtgtc gttcggcggc acgttcgctg cagacaccta caccacaggt 181 ggcgacgagg tggcgaaggg ccccgtgacc aagcacggca gcataccgac caagcttgac 241 ggcggcggca tcaccctcgc tggcggcacc aacggcgtga cattcacctc gaccgcgagc 301 ttcagcgaga gtgggaaggt gaacaaggga ttccgcgccg aaatggagta ccgtacgacg 361 cagacgccca gcaacctcgc cacattgttc tccgccatgg gcaacatctt cgtgcgggcg 421 aacggcagca acctcgaata cggcttctcc acgaaccctt ccggcagtac atggaacgac 481 tacacaaagt ccgtgacgct gccttccaac aatgtgaagc acatcatcca gctgacatat 541 ctgccgggag ccgacggcgc tgcctcgacg ttgcagttgt cggtggatgg cgtggccggc 601 gagaccgcca cctccgcggc cggcgagctc gcggccgtca gcgattccgt cgggaacaag 661 ttcgggatcg gctacgaggt gaaccccgct tccggcgcgg cgagccgcgg tcttgccggt 721 gacgtgttcc gcgcgcgtgt cgccgattcg gacgccccgt gggagattct tgacgcatcc 781 cagctgctgc atgtcaattt caacggcacg ttcagcggca cctcatatac cgcggcgagc 841 ggcgagcaga tgctgggctc gctggtgtcg cgctcggcca atccgtccat ctcgaactcc 901 gccgtcacgc tgggcggcgg cacggccgga ttcgatttca cgcccacgga cttcaccctc 961 ggtgacaacg aggccatcac ccgcccgctg gtcgcggagc tgcgcttcac cccgacgcag 1021 accggcgaca accagaccct gttcggcgcg ggcggcaacc tgttcctgcg ctacgagtcg 1081 aacaagctcg tgttcggcgc ctccaccaag tccggcgata attggaccga ccacaagatc 1141 gagtccgcgg ccgccacggg tgcggagcac gtcgtgtcgg tggcgtacgt gcccaataag 1201 gccggcaccg gcgcgaagct tgtcatgcgc gtggatggcg gcgacgccca gaccaaggac 1261 atcactggtc tggcttacct gaattcgagc atcaagggca aggtcggctt cggcaacgac 1321 gtgcataccg acgcgctcag ccgcggcttc gtcggctcgc tgagcgagat ccgcctggcc 1381 gaaacctccg cgaacttcac caccaacgaa ttcaagctgg tctactctca ggtcagctgc 1441 gacacgtcgg gcatcaagga ggcgaatacc ttcgacgtgg agcccgccga gtgcgaggcc 1501 gcgcttaaga ccaagctgtc caagctgcgt ccgaccgaag ggcaggccga ctacatcgac 1561 tggggtcaga tcggattcct ccattacggc atcaacacgt actacaacca ggagtggggt 1621 cacggtaacg aggatccctc ccgcatcaac ccgaccggcc tcgacaccga ccagtgggcg 1681 aagtccttcg ccgacggtgg cttcaagatg atcatggtga cggtcaagca ccatgacggt 1741 ttcgagctgt acgactcgcg gtacaacacc gagcacgact gggcaaacac cgccgtcgcc 1801 aagcgcacgg gggagaagga cctgttccgc aagattgtcg cctcggcgaa gaaatacggc 1861 ctgaaggtcg gcatctacta ttcgccggcc gattcctaca tggagaggaa gggcgtctgg 1921 ggcaacaact ccgcacgcgt cgagcgcacg atccccacgc tggtggagaa cgacgaccgc 1981 gccggcaagg tggcttccgg caaactgccc acgttcaagt acaaggccac ggattacggc 2041 gcctacatgc tcaaccagct ctatgagctg ctgactgagt acggcgacat ctccgaggtc 2101 tggttcgacg gtgcccaagg caacaccgca ggcactgagc attacgacta tggcgtgttc 2161 tacgagatga tccgccggct tcagccccag gcaattcagg ccaacgccgc atacgatgcc 2221 cgatgggtgg gcaacgagga cggctgggcc cgtcagaccg agtggagccc gcaggcggca 2281 tacaacgacg gcgtggacaa ggtgtcgctc aagcctggcc agatggcccc cgacggtaag 2341 cttggcagca tgtcgagcgt gctgtccgag atccgcagcg gcgccgccaa ccagctgcac 2401 tggtatccgg ccgaagtcga cgccaagaac cggcccggat ggttctaccg tgccagccaa 2461 tcgccggcgt ccgtagccga agtcgtgaag tactacgagc agtccacggg acgcaactcg 2521 cagtatctgc tgaacgtccc accgtccgat accggcaagc tcgccgatgc ggatgccgcg 2581 ggacttaagg ggctgggcga ggagctcgcc cgacgctacg gcaccgatct tgccctgggc 2641 aagagcgcga ccgtcgccgc gtccgcgaac gacactgcgg tagcggcccc gaagctgacc 2701 gacggttcga agctctcctc cgacaaggcc gtgggcaata cgccgacgta caccatcgat 2761 ctgggcagca ctgtcgccgt ggatgcagtg aagatctccg aggacgtgcg caatgccggc 2821 cagcagatcg aaagcgccac tctgcaggga cgagtcaatg gaacatggac gaatctggcg 2881 actatgacga cggtcgggca gcagcgcgac cttcgcttca cgtcccagaa catcgatgcc 2941 atccgtctgg tggtcaactc ctcccgcggt ccggtgcgtc tgagccgtct tgaggtgttc 3001 cacaccgaat ccgagattca gaccggcgcc cgcgcctact acatcgatcc gacggcgcag 3061 accgcgggag atggattcac gaaggacaag cccatgacgt cgatcgagca gctgcacgat 3121 gtgaccgtcg cgccaggctc cgtgatcttc gtcaaggcgg gcaccgagct gaccggggac 3181 ttcgccgtct tcggctacgg caccaaggac gagcccatca ccgtgacgac atacggcgaa 3241 agcgacaaag ccaccaccgc gagcttcgac ggcatgaccg ccgggctgac gctgaagcag 3301 gcgctgaagg cgctcggcaa ggacgacgcc ggctgggtcg tggccgattc cgccactgca 3361 ccggcctccc gcgtgtatgt cccgcaggat gagatcagcg tgcacgccca gtcgtcgcag 3421 aactccggcg cagaggcggc gagggcgctc gacggcgact cgtcgacgag ctggcactcc 3481 cagtacagcc cgaccaccgc gtctgctccg cattgggtga ctctcgatct cggcaaatcg 3541 cgtgagaacg tcgcctactt cgactacctc gcccgtatcg acggcaacaa taacggtgcc 3601 gccaaggatt acgaggtgta tgtctccgac gatcccaacg attttggagc ccctgtggcc 3661 tcgggcacgt tgaagaacgt cgcctacacg cagcgcatca agctgacccc caagaacgga 3721 cggtacgtca agttcgtcat caagaccgat tattccggat cgaacttcgg ctccgcggcg 3781 gaaatgaatg tcgagttgct gcccacggcc gtagaggagg acaaggtcgc caccccgcag 3841 aagccgacag tggacgatga tgccgataca tacaccatcc ccgacatcga gggagtcgtg 3901 tacaaggtcg acggcaaggt gttggccgct ggttccgtag tgaacgtggg cgatgaggac 3961 gtgaccgtca cggtcaccgc cgagcccgcc gacggatacc gcttcccgga tggtgtgacg 4021 tccccagtca cgtatgagct gacgttcacc aagaagggtg gcgagaagcc tccgaccgaa 4081 gtcaacaagg acaagctgca cgccacgatc accaaggctc aggcgatcga ccgttccgcc 4141 tatacggacg agtcgctcaa ggtgcttgat gacaagctcg ccgcagcgct caaggtctat 4201 gacgatgaca aggtgagcca ggatgatgtc gatgccgccg aggcggctct gtctgcggcg 4261 atcgacgcgc tgaagaccaa gccgacgacc cccggcggtg aaggtgagaa gcctggtgaa 4321 ggtgaaaagc ccggtgacgg caacaagccc ggtgacggca agaagcccgg cgacgtgatc 4381 gcaaagaccg gcgcctccac aatgggcgtt gtcttcgctg cactcgcgat ggtagcgggt 4441 gcggtcgtga cgcttgaagc caagcgtaag tccaaccggt aa

GH-95, Bifidobacterium longum subsp. infantis (B. infantis), Blon_2335, derived from Genbank Accession NC_011593 (AfcA); SEQ ID NO: 11: 1 ctacctgcgg acaagcccct tgaacggctc gtcgggagac agtcggacct gcgtcgcgtc 61 ggtgccatcg acgatcaggg tgatcgtcgc gggcttcgtg cagcgcagcg tgtattcgat 121 ggcgtcgtcc gtccaggagg cgtccaccga aaggcctccc ctggcgcgca ggccatggaa 181 gctgccttca tgccaatcct cgggcaacgc gggcaggatg cgcaccatgc cgtcatgact 241 ctggacgagc atctccgcca gagccgcggg gaagcccaga ttgccgtcga tctggaatgg 301 gggatgcgcg cacatgccgc tggcatacac gccgccgcca agcagatcgg tttcggcgtc 361 ggcttcgacc gggcggagga acatgccgat gatgcgttcg gcgtgctcag cgtcccgcag 421 acgcgcccac atgatcatgc gccacacgat gctccagccg gaaccgtcgt cgccacgcac 481 ttcgagggac ttcctggcgg cctcctccag acgcggggtg ttcgcggtga tgcctgcgcc 541 cggatgcagt tcgtacaggt gggacaggtg acggtgatgc ggatccgcct cgacgagttc 601 atcgttccat tcgagaatcc tgccatcgga tcccacgcgg acagccgcca gcttcgcgcg 661 ggtggattcc gcctcccgca ccaaggcctt gtcgccgtca tccaggtcgg gcatggtttg 721 cgccgcgtgg atcagatcat cgagcagatt gcgcacgatg gccgtggtgt tttcgctggt 781 gtgggcgacg gcgatcgttt cgccgtccac gacgaagtag ttttccggcg atgtcgccgg 841 agccggggcc agaccgtgtt ccgtatccga cagaaaatcc atgcagaatc gcgcgctgtc 901 ccgcatgatc ggccagatgg aagccagata cgactcatcc tggttgaaca ggtactcatc 961 gaacaggttc cggcacatcc acgcctggcc gaacggccag aacgcccacg tcggctctcc 1021 gttcgccggc agcgccctgc gccagatatc gacattgtgg aagaccgcgg aaccaccgca 1081 tccgaggatg gcgccggccg catcatgccc cggttccagc agctccctgt tcatggcgac 1141 gagcggttcg atgagctcct tgagggcgca tgggccggtc atccaatagt tcatctcgat 1201 gttgatgttc gtcgtgtagg cgctatacca gttcgggaag tccttatggt tccagattcc 1261 ctgcagattc gacggctggg tatgcggcct ggacgaggag atcagcaggt atcggccgaa 1321 atcgaacatc gcctcggaga gcgtctccag acggtgcggc gtatcctcct tggagcgcag 1381 gatctcggcg aacggcacct cctcatcgtc gtcatgggcc gggccgagac gcacgccgac 1441 ccggtcgaag aaccggcggt agtcggcgac gtgacggtca agcatcgccc gcgaatcgga 1501 cggccatgcg gcgatggtct cgcccagccg atcggcgagc accgtcatgt cccgctccgg 1561 ctgttcggcg cttcccttga acccgctcag gctgcggaac cgaagcgaca agccggtgac 1621 gcccgagcac tgcagaacat catcgatcac cgtgatctcg ccgcccgtga cggtgaggga 1681 gaaggcgccg gcatacgcca tcccgatgcc gtcccgttcg tcctcccatg gattatcggt 1741 gacatgggcc aatgatccga cattgagtcc gggcatctgc cccatgacga cgagggtggc 1801 ctggcgcgca tcggaatcag accccgacga tatccgggtc tgcttgagaa aagtgccggt 1861 gacgctcacg ctcgcatcga ccggcgcgct cgacgacatc tcatacacca gcagatcatc 1921 gggagcgctg caccatgcgt cgacatggac gtcggcggcg cccagccgga acgattcgcc 1981 ggcgagggcc ctggcgaggt ccaggctgcg cttcacatgc ttccgttcgc cggcctccga 2041 cgagtaccgg atgcaagccg tgccgaacgg ctcgtatatc tgctcgtcct tctcccgctg 2101 cgtggcgtcc tggatgatcc gcgtggccga cacgtaatcg ccgcgagacg acgcctgacg 2161 ggctttggcc acgatttcgg gcgtcaacgg cgaggtctcc gcatgcggat agcccgacca 2221 gagggtgtcg tcgttgaggt acagcacatc cgcgtccggt tcggagcaca ggaccgcccc 2281 catgcgaccg ttgccgaacg ggattccttc ctcccaatgc gaagaaatcc catcgaaagt 2341 gagtttcat GH-95, Bifidobacterium bifidum, Genbank Accession AY303700, (AfcA); SEQ ID NO: 12: 1 aacggtatcc agggactctc tgagagctgt ggttccaatt gaagacacaa gtcgccgacg 61 gacttgattc ttttagtaaa caatgtatat attaatatga accggcaaag ctgctggctg 121 tcctatagga gaaagaacca aatatgaaac atagagcgat gtcatcgcgt ctgatgccac 181 tggtggcgtc ctgcgcgacg gtcggcatgc tgctggccgg actacctgtg tcggccgtcg 241 cggtcggcac gacgagagcg gcagcgtccg acgcctcgtc ctccaccaca gcaaccatca 301 ccccctccgc cgataccacg ttgcagacat ggacgagcga gaagaattcc tcaatggcgt 361 ccaagccgta catcggcaca ctgcaagggc cctcgcaagg cgtgttcggc gagaagttcg 421 agtccacgga tgccgcggac accaccgatc tgaagaccgg cctgctgacg ttcgacctga 481 gcgcctacga ccatgccccc gattccgcaa cgttcgagat gacgtacctc ggctaccgcg 541 gcaacccgac ggccaccgac accgacacca tcaaggtgac ccccgtcgac accaccgtgt 601 gcaccaataa cgccacagac tgcggcgcga atgtcgcgac cggcgcgacc aagccgaagt 661 tcagcatcaa cgactcctca ttcgtcgccg agtccaagcc gttcgagtac ggtacgacgg 721 tttacacggg cgacgccatc accgtggttc ccgccaatac caagaaggtc accgtagatg 781 tgaccgaaat cgtgcgccag cagttcgccg aaggcaagaa ggtcatcacc ctggccgtgg 841 gcgagaccaa gaagaccgag gttcgtttcg ccagttccga aggcacgacg tccctgaacg 901 gcgcgaccgc agacatggct ccgaagctga ccgtttccgt gtccaccaag gacgatctca 961 agccctccgc cgacaccacg ttgcaggcat gggccagcga gaagaacgag aagaagaaca 1021 ctgcggccta tgtcggcgcg ctgcagccgg aaggcgatta cggcgacttc ggtgagaagt 1081 tcaagtccac cgacgtccac gatgtcacag acgccaagat gggtctgatg acgttcgacc 1141 tgtccgatta caccgcggcg cccgagcact ccatcctcac cttgacgtat ctgggctacg 1201 ccggtgcaga caagaccgcc acggccaccg ataaggtcaa ggtggtcgct gttgacacgt 1261 cgcggtgcac cggcaccgct ccctgcgaca ccaacaatgc cacgtgggcg aaccgcccgg 1321 acttcgaggt gaccgatacc acgaagaccg cgacgtccca tgcgttcgct tatggatcta 1381 agaagtattc cgatggcatg accgtcgaat cgggcaacgc caagaaggtc ctgctcgacg 1441 tgtccgatgt catcaaggca gagttcgcca agttcagcgc cggcgccacc gagaagaaga 1501 tcacgctggc cctgggcgag ctcaacaagt ccgacatgcg tttcggcagc aaggaagtca 1561 cctcgctgac cggcgccacc gaagccatgc agccgacctt gtccgtcacc aagaagccga 1621 aggcatacac gctgagcatc gaaggcccga ccaaggtcaa gtaccagaag ggcgaggcgt 1681 tcgacaaggc cggactcgtg gtcaaggcca ccagcacggc tgacggcacg gtcaagacgc 1741 tgaccgaagg caacggtgag gataactaca ccatcgacac cagcgctttc gatagtgcca 1801 gcatcggcgt ataccctgtt accgtgaagt acaacaagga ccccgaaatc gccgcttcgt 1861 tcaacgccta tgtcatcgcc agtgtcgagg acggcggaga cggcgacacc agcaaagacg 1921 actggctgtg gtacaagcag cccgcgtcgc agaccgacgc caccgccacc gccggcggca 1981 attacggcaa ccccgacaac aaccgttggc agcagaccac cttgccgttc ggcaacggca 2041 agatcggcgg caccgtctgg ggcgaggtca gccgtgaacg cgtcaccttc aacgaggaga 2101 cgctgtggac cggcggcccc ggatcctcga ccagctacaa cggcggcaac aacgagacca 2161 agggtcagaa cggcgccacg ctgcgcgcgc tcaacaagca gctcgcgaac ggcgccgaga 2221 cggtcaatcc cggcaacctg accggcggcg agaacgcggc cgagcagggc aactacctga 2281 actggggcga catctacctc gactacgggt tcaacgatac gaccgtcacc gaataccgcc 2341 gcgacctgaa cctgagcaag ggcaaggccg acgtcacgtt caagcatgac ggcgtcacct 2401 acacgcgcga atacttcgcg tcgaaccccg acaatgtcat ggtcgcccgc ctcacggcca 2461 gcaaagccgg caagctgaac ttcaacgtca gcatgccgac caacacgaac tactccaaga 2521 ccggcgaaac cacgacggtc aagggtgaca cgctcaccgt caagggcgct ctcggcaaca 2581 acggcctgct gtacaactcg cagatcaagg tcgtcctcga caacggtgag ggcacgctct 2641 ccgaaggctc cgacggcgct tcgctgaagg tctccgacgc gaaggcggtc acgctgtaca 2701 tcgccgccgc gacggactac aagcagaagt atccgtccta ccgcaccggc gaaaccgccg 2761 ccgaggtgaa cacccgcgtc gccaaggtcg tgcaggacgc cgccaacaag ggctacaccg 2821 ccgtcaagaa agcgcacatc gacgatcatt ccgccatcta cgaccgcgtg aagatcgatt 2881 tgggccagtc cggccacagc tccgacggcg ccgtcgccac cgacgcgctg ctcaaggcgt 2941 accagagagg ctccgcaacc accgcgcaga agcgcgagct ggagacgctg gtgtacaagt 3001 acggccgcta cttgaccatc ggctcctccc gtgagaacag ccagctgccc agcaacctgc 3061 agggcatctg gtcggtcacc gcgggcgaca acgcccacgg caacacgcct tggggctccg 3121 acttccacat gaacgtgaac ctccagatga actactggcc gacctattcg gccaacatgg 3181 gagagctcgc cgagccgctc atcgagtatg tggagggtct ggtcaagccc ggccgtgtga 3241 ccgccaaggt ctacgcgggc gcggagacga cgaaccccga gaccacgccg atcggcgagg 3301 gcgagggcta catggcccac accgagaaca ccgcctacgg ctggaccgca cccggtcaat 3361 cgttctcgtg gggttggagc ccggccgccg tgccgtggat cctgcagaac gtgtacgagg 3421 cgtacgagta ctccggcgac cctgccctgc ttgatcgcgt gtacgcgctg ctcaaggagg 3481 aatcgcactt ctacgtcaac tacatgctgc acaaggccgg ctccagctcc ggtgaccgcc 3541 tgactaccgg cgtcgcgtac tcgcccgaac agggcccgct gggcaccgac ggcaacacgt 3601 acgagagctc gctcgtgtgg cagatgctca acgacgccat cgaggcggcc aaggccaagg 3661 gagatccgga cggtctggtc ggcaatacca ccgactgctc ggccgacaac tgggccaaga 3721 atgacagcgg caacttcacc gatgcgaacg ccaaccgttc ctggagctgc gccaagagcc 3781 tgctcaagcc gatcgaggtc ggcgactccg gccagatcaa ggaatggtac ttcgaaggtg 3841 cgctcggcaa gaagaaggat ggatccacca tcagcggcta ccaggcggac aaccagcacc 3901 gtcacatgtc ccacctgctc ggactgttcc ccggtgattt gatcaccatc gacaactccg 3961 agtacatgga tgcggccaag acctcgctga ggtaccgctg cttcaagggc aacgtgctgc 4021 agtccaacac cggctgggcc attggccagc gcatcaattc gtgggctcgc accggcgacg 4081 gcaacaccac gtaccagctg gtcgagctgc agctcaagaa cgcgatgtat gcaaacctgt 4141 tcgattacca tgcgccgttc cagatcgacg gcaacttcgg caacacctcc ggtgtcgacg 4201 aaatgctgct gcagtccaac tccaccttca ccgacaccgc cggcaagaag tacgtgaact 4261 acacgaacat cctgcccgcc ctgcccgatg cctgggcggg cggctcggtg agcggcctcg 4321 tggcccgcgg caacttcacc gtcggcacga catggaagaa cggcaaggcc accgaagtca 4381 ggctgacctc caacaagggc aagcaggcgg ccgtcaagat caccgccggc ggcgcccaga 4441 actacgaggt caagaacggt gacaccgccg tgaacgccaa ggtcgtgacc aacgcggacg 4501 gcgcctcgct gctcgtgttc gataccaccg caggcaccac gtacacgatc acgaagaagg 4561 cgagcgccaa cgtgcccgtc accggcgtga ccgtgaccgg cgccaacacc gccaccgcag 4621 gcgacaccgt cactcttacg gctaccgtcg ccccggccaa tgcgaccgac aagtccgtca 4681 cctggtcgac ctccgacgcc gccgtagcta cggtcaacgc caacggcgtg gtgaccacga 4741 agaaggccgg caaggtgacc atcaccgcca cgtcgaacgg cgacaagacg aagttcggtt 4801 ccatcgagat caccgtctcc gccgcgaccg tgcccgtcac cagcgtcacc gttgccggcg 4861 acgccgcgat gaccgtcgat ggagagcaga ccctgacggc gaccgtcgcc ccggccactg 4921 cgaccgacaa gacggtcacg tggaagtcct ccgacgccac tgtggcgacg gttgacgcca

4981 acggcaaggt cgtcgcgaag aaggccggcg aagtgacgat caccgccacg gccggtggcg 5041 tgtccggcac gctgaagatc acggtgagcg acaaggcccc gaccgtcatc ccggtccagt 5101 ccgtgaccgt gacaggcaag caggagctcg tcgaaggcgc ctccacgacc ctgacggcga 5161 ccgtcgcccc ggctgacgcg accgacaaga cggttacgtg gaagtcgagc gacgagtccg 5221 tcgccacggt cgacaaggac ggcgtcgtga ccgccaagaa ggccggcacg gtgaccatca 5281 ccgccacggc cggtggcgtg tccggcacgc tccacatcac cgtgacggcc aagcccgtcg 5341 agaccgtccc cgtcaccagc gtggaggtca ccgtcgaggc cggcaccacc gtctccgtcg 5401 gcaagacact ccaggccacc gcgaccgtca agcccggcaa cgccaccaac aagaaggtga 5461 cgtggaagtc gagcgacgaa tccatcgcga cggtcgacgc caacggcgtc atcaccgcga 5521 agaaggccgg caaggtcgtc atcacggcca cctcgaccga cggcacggac aagtccggca 5581 gcgtcgagat caccgtcgtg gatgagacca agccgacgcc cgaccacaag tccgtcaagg 5641 ccgataccgg cgacgtgacc gccggcaaga ccggtacggt caccgagccg aaggacgtgg 5701 cgggctggaa gagccgctcc atcatcaagc aaggcaagct cggcaaggcc gaaatcgccg 5761 acggcacgct cgtgtatgcg gccggcgaca agaccggtga cgacagcttc gtcgtgcagt 5821 acacgatggc cgacggcacg gtcatcgacg tgacctacag cgtcacggtc aaggccgccg 5881 aaaccggcaa gaacgacggc gacggcaagg gcgacggtgt cgcgaagacc ggcgccgccg 5941 tcggcgcgct cgccggcctc ggcttgatgc tgctcgccgt cggagtgagc gtggtgatga 6001 ttcgccgcaa gcactccgcc tgatccccag tcagaccggc cagtcgtgac cggtcggcct 6061 gactgactct ttctccaccg tcccccgtcg gataaacccc ggcgggggac ggtggcttgt

[0142] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, patent applications, and database entries cited herein are hereby incorporated by reference in their entireties for all purposes.

Sequence CWU 1

1

521449PRTBifidobacterium longumBifidobacterium longum subspecies infantis (B. infantis) strain ATCC 15697 = JCM 1222 = DSM 20088 alpha-L-fucosidase, glycoside hydrolase family 29 (GH29), afcB, Blon_0248 1Met Val Leu Phe Met Ala Asn Pro Gln Arg Pro Lys Met Tyr Glu Lys1 5 10 15 Phe Val His Asp Thr Pro Glu Trp Phe Lys Gly Ala Gly Leu Gly Ile 20 25 30 Phe Ala His Trp Gly Ser Tyr Ser Val Pro Ala Trp Ala Glu Pro Ile 35 40 45 Gly Ala Leu Gly Thr Phe Asp Asp Pro Val Tyr Trp Asn Thr His Cys 50 55 60 Pro Tyr Ala Glu Trp Tyr Trp Asn Thr Met Ser Ile Lys Gly Ser Pro65 70 75 80 Ala Ala Glu His Gln Lys Glu Val Tyr Gly Asp Met Pro Tyr Glu Asp 85 90 95 Phe Ile Asp Met Trp Lys Ala Glu Ala Phe Asp Pro Ala Asp Met Ala 100 105 110 Asp Leu Phe Ala Arg Ala Gly Ala Arg Tyr Phe Val Pro Thr Thr Lys 115 120 125 His His Glu Gly Ile Thr Leu Trp Lys Ala Pro Asp Asn Asp Gly Trp 130 135 140 Asn Thr Val Asp Arg Gly Pro His Arg Asp Leu Val Lys Glu Phe Ala145 150 155 160 Asp Ala Met Arg Asp Lys Gly Leu Lys Phe Gly Val Tyr Tyr Ser Ser 165 170 175 Gly Leu Asp Trp His Lys Glu Pro Asn Met Pro Ile Leu Gly Asp Gly 180 185 190 Glu Tyr Gly Pro Gln Ser Glu Asp Tyr Ala Arg Tyr Met Tyr Ser His 195 200 205 Val Met Asp Leu Ile Asp Glu Tyr Gln Pro Ser Ile Leu Trp Gly Asp 210 215 220 Ile Asp Val Pro Lys Ile Ser Glu Glu Asp Asn Asp Phe Ser Val Ala225 230 235 240 Arg Leu Phe Glu His Tyr Tyr Asp Val Val Pro Asp Gly Val Val Asn 245 250 255 Asp Arg Trp Gly Leu Thr His Trp Asp Phe Arg Thr Val Glu Tyr Glu 260 265 270 Gln Gly Lys Glu Leu Met Gly Lys Gly Met Trp Glu Met Thr Arg Gly 275 280 285 Ile Gly Tyr Ser Phe Gly Tyr Asn Gln Met Glu Asp Ala Asp Ser Tyr 290 295 300 Met Thr Gly Pro Glu Ala Val Lys Leu Leu Ala Asp Val Val Ser Met305 310 315 320 Gly Gly Asn Leu Leu Leu Asp Ile Gly Pro Asp Ala Ala Gly Arg Ile 325 330 335 Pro Glu Leu Gln Arg Gln Cys Leu Glu Gly Met Ala Asp Trp Met Asp 340 345 350 Val Asn Ser Pro Ser Ile His Asp Val Glu Pro Val Pro Glu Ala Ser 355 360 365 Pro Ser Gly Glu Gly Asp Gly Glu Pro Trp Val Arg Trp Thr Gly Asp 370 375 380 Gly Lys Ser Val Tyr Ala Val Val Asp Ala Ala Gly Arg Val Pro Leu385 390 395 400 Arg Ile Ala Ala Asp Ala Val Asp Ala Asp Ser Ala Val Thr Leu Gly 405 410 415 Gly Ser Ala Val Ala Val Asp Ala Asp Gly Asp Val Leu Thr Ala Asp 420 425 430 Val Pro Ala Ser Glu Val Ala Gly Pro Gln Val Val His Phe Val Arg 435 440 445 Arg 2449PRTBifidobacterium longumBifidobacterium longum subspecies infantis (B. infantis) strain ATCC 15697 = JCM 1222 = DSM 20088 alpha-L-fucosidase, glycoside hydrolase family 29 (GH29), afcB, Blon_0426 2Met Val Leu Phe Met Ala Asn Pro Gln Arg Pro Lys Met Tyr Glu Lys1 5 10 15 Phe Val His Asp Thr Pro Glu Trp Phe Lys Gly Ala Gly Leu Gly Ile 20 25 30 Phe Ala His Trp Gly Ser Tyr Ser Val Pro Ala Trp Ala Glu Pro Ile 35 40 45 Gly Ala Leu Gly Thr Phe Asp Asp Pro Val Tyr Trp Asn Thr His Cys 50 55 60 Pro Tyr Ala Glu Trp Tyr Trp Asn Thr Met Ser Ile Lys Gly Ser Pro65 70 75 80 Ala Ala Glu His Gln Lys Glu Val Tyr Gly Asp Met Pro Tyr Glu Asp 85 90 95 Phe Ile Asp Met Trp Lys Ala Glu Ala Phe Asp Pro Ala Asp Met Ala 100 105 110 Asp Leu Phe Ala Arg Ala Gly Ala Arg Tyr Phe Val Pro Thr Thr Lys 115 120 125 His His Glu Gly Ile Thr Leu Trp Lys Ala Pro Asp Asn Asp Gly Trp 130 135 140 Asn Thr Val Asp Arg Gly Pro His Arg Asp Leu Val Lys Glu Phe Ala145 150 155 160 Asp Ala Met Arg Asp Lys Gly Leu Lys Phe Gly Val Tyr Tyr Ser Ser 165 170 175 Gly Leu Asp Trp His Lys Glu Pro Asn Met Pro Ile Leu Gly Asp Gly 180 185 190 Glu Tyr Gly Pro Gln Ser Glu Asp Tyr Ala Arg Tyr Met Tyr Ser His 195 200 205 Val Met Asp Leu Ile Asp Glu Tyr Gln Pro Ser Ile Leu Trp Gly Asp 210 215 220 Ile Asp Val Pro Lys Ile Ser Glu Glu Asp Asn Asp Phe Ser Val Ala225 230 235 240 Arg Leu Phe Glu His Tyr Tyr Asp Val Val Pro Asp Gly Val Val Asn 245 250 255 Asp Arg Trp Gly Leu Thr His Trp Asp Phe Arg Thr Val Glu Tyr Glu 260 265 270 Gln Gly Lys Glu Leu Met Gly Lys Gly Met Trp Glu Met Thr Arg Gly 275 280 285 Ile Gly Tyr Ser Phe Gly Tyr Asn Gln Met Glu Asp Ala Asp Ser Tyr 290 295 300 Met Thr Gly Pro Glu Ala Val Lys Leu Leu Ala Asp Val Val Ser Met305 310 315 320 Gly Gly Asn Leu Leu Leu Asp Ile Gly Pro Asp Ala Ala Gly Arg Ile 325 330 335 Pro Glu Leu Gln Arg Gln Cys Leu Glu Gly Met Ala Asp Trp Met Asp 340 345 350 Val Asn Ser Pro Ser Ile His Asp Val Glu Pro Val Pro Glu Ala Ser 355 360 365 Pro Ser Gly Glu Gly Asp Gly Glu Pro Trp Val Arg Trp Thr Gly Asp 370 375 380 Gly Lys Ser Val Tyr Ala Val Val Asp Ala Ala Gly Arg Val Pro Leu385 390 395 400 Arg Ile Asp Ala Gly Ala Val Asp Val Asp Ser Ala Thr Ile Leu Gly 405 410 415 Gly Gly Asn Val Val Val Glu Ala Asp Gly Asp Met Leu Thr Val Glu 420 425 430 Ile Pro Ala Thr Asp Val Ala Gly Pro Gln Val Val Arg Phe Ala Arg 435 440 445 His 3449PRTBifidobacterium breveBifidobacterium breve strain SC95 glycoside hydrolase family 29 (GH29), afcB 3Met Val Leu Phe Met Ala Asn Pro Gln Arg Pro Lys Met Tyr Glu Lys1 5 10 15 Phe Val His Asp Thr Pro Glu Trp Phe Lys Gly Ala Gly Leu Gly Ile 20 25 30 Phe Ala His Trp Gly Ser Tyr Ser Val Pro Ala Trp Ala Glu Pro Ile 35 40 45 Gly Ala Leu Gly Thr Phe Asp Asp Pro Val Tyr Trp Asn Thr His Cys 50 55 60 Pro Tyr Ala Glu Trp Tyr Trp Asn Thr Met Ser Ile Lys Gly Ser Pro65 70 75 80 Ala Ala Glu His Gln Lys Glu Val Tyr Gly Asp Met Pro Tyr Glu Asp 85 90 95 Phe Ile Asp Met Trp Lys Ala Glu Ala Phe Asp Pro Ala Asp Met Ala 100 105 110 Asp Leu Phe Ala Arg Ala Gly Ala Arg Tyr Phe Val Pro Thr Thr Lys 115 120 125 His His Glu Gly Ile Thr Leu Trp Lys Ala Pro Asp Asn Asp Gly Trp 130 135 140 Asn Thr Val Asp Arg Gly Pro His Arg Asp Leu Val Lys Glu Phe Ala145 150 155 160 Asp Ala Met Arg Asp Lys Gly Leu Lys Phe Gly Val Tyr Tyr Ser Ser 165 170 175 Gly Leu Asp Trp His Lys Glu Pro Asn Met Pro Ile Leu Gly Asp Gly 180 185 190 Glu Tyr Gly Pro Gln Ser Glu Asp Tyr Ala Arg Tyr Met Tyr Ser His 195 200 205 Val Met Asp Leu Ile Asp Lys Tyr Gln Pro Ser Ile Leu Trp Gly Asp 210 215 220 Ile Asp Val Pro Lys Ile Ser Glu Glu Asp Asn Asp Phe Ser Val Ala225 230 235 240 Arg Leu Phe Glu His Tyr Tyr Asp Val Val Pro Asp Gly Val Val Asn 245 250 255 Asp Arg Trp Gly Leu Thr His Trp Asp Phe Arg Thr Val Glu Tyr Glu 260 265 270 Gln Gly Lys Glu Leu Met Gly Lys Gly Met Trp Glu Met Thr Arg Gly 275 280 285 Ile Gly Tyr Ser Phe Gly Tyr Asn Gln Met Glu Asp Ala Asp Ser Tyr 290 295 300 Met Thr Gly Pro Glu Ala Val Lys Leu Leu Ala Asp Val Val Ser Met305 310 315 320 Gly Gly Asn Leu Leu Leu Asp Ile Gly Pro Asp Ala Ala Gly Arg Ile 325 330 335 Pro Glu Leu Gln Arg Gln Cys Leu Glu Gly Met Ala Asp Trp Met Tyr 340 345 350 Val Asn Ser Pro Ser Ile His Asp Val Glu Pro Val Pro Glu Ala Ser 355 360 365 Pro Ser Gly Glu Gly Asp Gly Glu Pro Trp Val Arg Trp Thr Gly Asp 370 375 380 Gly Lys Ser Val Tyr Ala Val Val Asp Ala Ala Gly Arg Val Pro Leu385 390 395 400 Arg Ile Ala Ala Asp Ala Val Asp Ala Asp Ser Ala Val Thr Leu Gly 405 410 415 Gly Ser Ala Val Ala Val Asp Ala Asp Gly Asp Val Leu Thr Ala Asp 420 425 430 Val Pro Ala Ser Glu Val Ala Gly Pro Gln Val Val His Phe Val Arg 435 440 445 Arg 41493PRTBifidobacterium bifidumBifidobacterium bifidum strain JCM 1254 alpha-L-fucosidase, glycoside hydrolase family 29 (GH29), afcB 4Met Leu His Thr Ala Ser Arg Gly Cys Ser Arg Ser Trp Leu Arg Arg1 5 10 15 Leu Thr Ala Leu Ile Ala Val Ser Ala Leu Ala Phe Val Ala Leu Pro 20 25 30 Asn Val Ala Val Ala Ala Asp Pro Met Glu Tyr Leu Asp Val Ser Phe 35 40 45 Gly Gly Thr Phe Ala Ala Asp Thr Tyr Thr Thr Gly Gly Asp Glu Val 50 55 60 Ala Lys Gly Pro Val Thr Lys His Gly Ser Ile Pro Thr Lys Leu Asp65 70 75 80 Gly Gly Gly Ile Thr Leu Ala Gly Gly Thr Asn Gly Val Thr Phe Thr 85 90 95 Ser Thr Ala Ser Phe Ser Glu Ser Gly Lys Val Asn Lys Gly Phe Arg 100 105 110 Ala Glu Met Glu Tyr Arg Thr Thr Gln Thr Pro Ser Asn Leu Ala Thr 115 120 125 Leu Phe Ser Ala Met Gly Asn Ile Phe Val Arg Ala Asn Gly Ser Asn 130 135 140 Leu Glu Tyr Gly Phe Ser Thr Asn Pro Ser Gly Ser Thr Trp Asn Asp145 150 155 160 Tyr Thr Lys Ser Val Thr Leu Pro Ser Asn Asn Val Lys His Ile Ile 165 170 175 Gln Leu Thr Tyr Leu Pro Gly Ala Asp Gly Ala Ala Ser Thr Leu Gln 180 185 190 Leu Ser Val Asp Gly Val Ala Gly Glu Thr Ala Thr Ser Ala Ala Gly 195 200 205 Glu Leu Ala Ala Val Ser Asp Ser Val Gly Asn Lys Phe Gly Ile Gly 210 215 220 Tyr Glu Val Asn Pro Ala Ser Gly Ala Ala Ser Arg Gly Leu Ala Gly225 230 235 240 Asp Val Phe Arg Ala Arg Val Ala Asp Ser Asp Ala Pro Trp Glu Ile 245 250 255 Leu Asp Ala Ser Gln Leu Leu His Val Asn Phe Asn Gly Thr Phe Ser 260 265 270 Gly Thr Ser Tyr Thr Ala Ala Ser Gly Glu Gln Met Leu Gly Ser Leu 275 280 285 Val Ser Arg Ser Ala Asn Pro Ser Ile Ser Asn Ser Ala Val Thr Leu 290 295 300 Gly Gly Gly Thr Ala Gly Phe Asp Phe Thr Pro Thr Asp Phe Thr Leu305 310 315 320 Gly Asp Asn Glu Ala Ile Thr Arg Pro Leu Val Ala Glu Leu Arg Phe 325 330 335 Thr Pro Thr Gln Thr Gly Asp Asn Gln Thr Leu Phe Gly Ala Gly Gly 340 345 350 Asn Leu Phe Leu Arg Tyr Glu Ser Asn Lys Leu Val Phe Gly Ala Ser 355 360 365 Thr Lys Ser Gly Asp Asn Trp Thr Asp His Lys Ile Glu Ser Ala Ala 370 375 380 Ala Thr Gly Ala Glu His Val Val Ser Val Ala Tyr Val Pro Asn Lys385 390 395 400 Ala Gly Thr Gly Ala Lys Leu Val Met Arg Val Asp Gly Gly Asp Ala 405 410 415 Gln Thr Lys Asp Ile Thr Gly Leu Ala Tyr Leu Asn Ser Ser Ile Lys 420 425 430 Gly Lys Val Gly Phe Gly Asn Asp Val His Thr Asp Ala Leu Ser Arg 435 440 445 Gly Phe Val Gly Ser Leu Ser Glu Ile Arg Leu Ala Glu Thr Ser Ala 450 455 460 Asn Phe Thr Thr Asn Glu Phe Lys Leu Val Tyr Ser Gln Val Ser Cys465 470 475 480 Asp Thr Ser Gly Ile Lys Glu Ala Asn Thr Phe Asp Val Glu Pro Ala 485 490 495 Glu Cys Glu Ala Ala Leu Lys Thr Lys Leu Ser Lys Leu Arg Pro Thr 500 505 510 Glu Gly Gln Ala Asp Tyr Ile Asp Trp Gly Gln Ile Gly Phe Leu His 515 520 525 Tyr Gly Ile Asn Thr Tyr Tyr Asn Gln Glu Trp Gly His Gly Asn Glu 530 535 540 Asp Pro Ser Arg Ile Asn Pro Thr Gly Leu Asp Thr Asp Gln Trp Ala545 550 555 560 Lys Ser Phe Ala Asp Gly Gly Phe Lys Met Ile Met Val Thr Val Lys 565 570 575 His His Asp Gly Phe Glu Leu Tyr Asp Ser Arg Tyr Asn Thr Glu His 580 585 590 Asp Trp Ala Asn Thr Ala Val Ala Lys Arg Thr Gly Glu Lys Asp Leu 595 600 605 Phe Arg Lys Ile Val Ala Ser Ala Lys Lys Tyr Gly Leu Lys Val Gly 610 615 620 Ile Tyr Tyr Ser Pro Ala Asp Ser Tyr Met Glu Arg Lys Gly Val Trp625 630 635 640 Gly Asn Asn Ser Ala Arg Val Glu Arg Thr Ile Pro Thr Leu Val Glu 645 650 655 Asn Asp Asp Arg Ala Gly Lys Val Ala Ser Gly Lys Leu Pro Thr Phe 660 665 670 Lys Tyr Lys Ala Thr Asp Tyr Gly Ala Tyr Met Leu Asn Gln Leu Tyr 675 680 685 Glu Leu Leu Thr Glu Tyr Gly Asp Ile Ser Glu Val Trp Phe Asp Gly 690 695 700 Ala Gln Gly Asn Thr Ala Gly Thr Glu His Tyr Asp Tyr Gly Val Phe705 710 715 720 Tyr Glu Met Ile Arg Arg Leu Gln Pro Gln Ala Ile Gln Ala Asn Ala 725 730 735 Ala Tyr Asp Ala Arg Trp Val Gly Asn Glu Asp Gly Trp Ala Arg Gln 740 745 750 Thr Glu Trp Ser Pro Gln Ala Ala Tyr Asn Asp Gly Val Asp Lys Val 755 760 765 Ser Leu Lys Pro Gly Gln Met Ala Pro Asp Gly Lys Leu Gly Ser Met 770 775 780 Ser Ser Val Leu Ser Glu Ile Arg Ser Gly Ala Ala Asn Gln Leu His785 790 795 800 Trp Tyr Pro Ala Glu Val Asp Ala Lys Asn Arg Pro Gly Trp Phe Tyr 805 810 815 Arg Ala Ser Gln Ser Pro Ala Ser Val Ala Glu Val Val Lys Tyr Tyr 820 825 830 Glu Gln Ser Thr Gly Arg Asn Ser Gln Tyr Leu Leu Asn Val Pro Pro 835 840 845 Ser Asp Thr Gly Lys Leu Ala Asp Ala Asp Ala Ala Gly Leu Lys Gly 850 855 860 Leu Gly Glu Glu Leu Ala Arg Arg Tyr Gly Thr Asp Leu Ala Leu Gly865

870 875 880 Lys Ser Ala Thr Val Ala Ala Ser Ala Asn Asp Thr Ala Val Ala Ala 885 890 895 Pro Lys Leu Thr Asp Gly Ser Lys Leu Ser Ser Asp Lys Ala Val Gly 900 905 910 Asn Thr Pro Thr Tyr Thr Ile Asp Leu Gly Ser Thr Val Ala Val Asp 915 920 925 Ala Val Lys Ile Ser Glu Asp Val Arg Asn Ala Gly Gln Gln Ile Glu 930 935 940 Ser Ala Thr Leu Gln Gly Arg Val Asn Gly Thr Trp Thr Asn Leu Ala945 950 955 960 Thr Met Thr Thr Val Gly Gln Gln Arg Asp Leu Arg Phe Thr Ser Gln 965 970 975 Asn Ile Asp Ala Ile Arg Leu Val Val Asn Ser Ser Arg Gly Pro Val 980 985 990 Arg Leu Ser Arg Leu Glu Val Phe His Thr Glu Ser Glu Ile Gln Thr 995 1000 1005 Gly Ala Arg Ala Tyr Tyr Ile Asp Pro Thr Ala Gln Thr Ala Gly Asp 1010 1015 1020 Gly Phe Thr Lys Asp Lys Pro Met Thr Ser Ile Glu Gln Leu His Asp1025 1030 1035 1040Val Thr Val Ala Pro Gly Ser Val Ile Phe Val Lys Ala Gly Thr Glu 1045 1050 1055 Leu Thr Gly Asp Phe Ala Val Phe Gly Tyr Gly Thr Lys Asp Glu Pro 1060 1065 1070 Ile Thr Val Thr Thr Tyr Gly Glu Ser Asp Lys Ala Thr Thr Ala Ser 1075 1080 1085 Phe Asp Gly Met Thr Ala Gly Leu Thr Leu Lys Gln Ala Leu Lys Ala 1090 1095 1100 Leu Gly Lys Asp Asp Ala Gly Trp Val Val Ala Asp Ser Ala Thr Ala1105 1110 1115 1120Pro Ala Ser Arg Val Tyr Val Pro Gln Asp Glu Ile Ser Val His Ala 1125 1130 1135 Gln Ser Ser Gln Asn Ser Gly Ala Glu Ala Ala Arg Ala Leu Asp Gly 1140 1145 1150 Asp Ser Ser Thr Ser Trp His Ser Gln Tyr Ser Pro Thr Thr Ala Ser 1155 1160 1165 Ala Pro His Trp Val Thr Leu Asp Leu Gly Lys Ser Arg Glu Asn Val 1170 1175 1180 Ala Tyr Phe Asp Tyr Leu Ala Arg Ile Asp Gly Asn Asn Asn Gly Ala1185 1190 1195 1200Ala Lys Asp Tyr Glu Val Tyr Val Ser Asp Asp Pro Asn Asp Phe Gly 1205 1210 1215 Ala Pro Val Ala Ser Gly Thr Leu Lys Asn Val Ala Tyr Thr Gln Arg 1220 1225 1230 Ile Lys Leu Thr Pro Lys Asn Gly Arg Tyr Val Lys Phe Val Ile Lys 1235 1240 1245 Thr Asp Tyr Ser Gly Ser Asn Phe Gly Ser Ala Ala Glu Met Asn Val 1250 1255 1260 Glu Leu Leu Pro Thr Ala Val Glu Glu Asp Lys Val Ala Thr Pro Gln1265 1270 1275 1280Lys Pro Thr Val Asp Asp Asp Ala Asp Thr Tyr Thr Ile Pro Asp Ile 1285 1290 1295 Glu Gly Val Val Tyr Lys Val Asp Gly Lys Val Leu Ala Ala Gly Ser 1300 1305 1310 Val Val Asn Val Gly Asp Glu Asp Val Thr Val Thr Val Thr Ala Glu 1315 1320 1325 Pro Ala Asp Gly Tyr Arg Phe Pro Asp Gly Val Thr Ser Pro Val Thr 1330 1335 1340 Tyr Glu Leu Thr Phe Thr Lys Lys Gly Gly Glu Lys Pro Pro Thr Glu1345 1350 1355 1360Val Asn Lys Asp Lys Leu His Ala Thr Ile Thr Lys Ala Gln Ala Ile 1365 1370 1375 Asp Arg Ser Ala Tyr Thr Asp Glu Ser Leu Lys Val Leu Asp Asp Lys 1380 1385 1390 Leu Ala Ala Ala Leu Lys Val Tyr Asp Asp Asp Lys Val Ser Gln Asp 1395 1400 1405 Asp Val Asp Ala Ala Glu Ala Ala Leu Ser Ala Ala Ile Asp Ala Leu 1410 1415 1420 Lys Thr Lys Pro Thr Thr Pro Gly Gly Glu Gly Glu Lys Pro Gly Glu1425 1430 1435 1440Gly Glu Lys Pro Gly Asp Gly Asn Lys Pro Gly Asp Gly Lys Lys Pro 1445 1450 1455 Gly Asp Val Ile Ala Lys Thr Gly Ala Ser Thr Met Gly Val Val Phe 1460 1465 1470 Ala Ala Leu Ala Met Val Ala Gly Ala Val Val Thr Leu Glu Ala Lys 1475 1480 1485 Arg Lys Ser Asn Arg 1490 5782PRTBifidobacterium longumBifidobacterium longum subspecies infantis (B. infantis) strain ATCC 15697 = JCM 1222 = DSM 20088 glycoside hydrolase family 95 (GH95), afcA, hypothetical protein Blon_2335 5Met Lys Leu Thr Phe Asp Gly Ile Ser Ser His Trp Glu Glu Gly Ile1 5 10 15 Pro Phe Gly Asn Gly Arg Met Gly Ala Val Leu Cys Ser Glu Pro Asp 20 25 30 Ala Asp Val Leu Tyr Leu Asn Asp Asp Thr Leu Trp Ser Gly Tyr Pro 35 40 45 His Ala Glu Thr Ser Pro Leu Thr Pro Glu Ile Val Ala Lys Ala Arg 50 55 60 Gln Ala Ser Ser Arg Gly Asp Tyr Val Ser Ala Thr Arg Ile Ile Gln65 70 75 80 Asp Ala Thr Gln Arg Glu Lys Asp Glu Gln Ile Tyr Glu Pro Phe Gly 85 90 95 Thr Ala Cys Ile Arg Tyr Ser Ser Glu Ala Gly Glu Arg Lys His Val 100 105 110 Lys Arg Ser Leu Asp Leu Ala Arg Ala Leu Ala Gly Glu Ser Phe Arg 115 120 125 Leu Gly Ala Ala Asp Val His Val Asp Ala Trp Cys Ser Ala Pro Asp 130 135 140 Asp Leu Leu Val Tyr Glu Met Ser Ser Ser Ala Pro Val Asp Ala Ser145 150 155 160 Val Ser Val Thr Gly Thr Phe Leu Lys Gln Thr Arg Ile Ser Ser Gly 165 170 175 Ser Asp Ser Asp Ala Arg Gln Ala Thr Leu Val Val Met Gly Gln Met 180 185 190 Pro Gly Leu Asn Val Gly Ser Leu Ala His Val Thr Asp Asn Pro Trp 195 200 205 Glu Asp Glu Arg Asp Gly Ile Gly Met Ala Tyr Ala Gly Ala Phe Ser 210 215 220 Leu Thr Val Thr Gly Gly Glu Ile Thr Val Ile Asp Asp Val Leu Gln225 230 235 240 Cys Ser Gly Val Thr Gly Leu Ser Leu Arg Phe Arg Ser Leu Ser Gly 245 250 255 Phe Lys Gly Ser Ala Glu Gln Pro Glu Arg Asp Met Thr Val Leu Ala 260 265 270 Asp Arg Leu Gly Glu Thr Ile Ala Ala Trp Pro Ser Asp Ser Arg Ala 275 280 285 Met Leu Asp Arg His Val Ala Asp Tyr Arg Arg Phe Phe Asp Arg Val 290 295 300 Gly Val Arg Leu Gly Pro Ala His Asp Asp Asp Glu Glu Val Pro Phe305 310 315 320 Ala Glu Ile Leu Arg Ser Lys Glu Asp Thr Pro His Arg Leu Glu Thr 325 330 335 Leu Ser Glu Ala Met Phe Asp Phe Gly Arg Tyr Leu Leu Ile Ser Ser 340 345 350 Ser Arg Pro His Thr Gln Pro Ser Asn Leu Gln Gly Ile Trp Asn His 355 360 365 Lys Asp Phe Pro Asn Trp Tyr Ser Ala Tyr Thr Thr Asn Ile Asn Ile 370 375 380 Glu Met Asn Tyr Trp Met Thr Gly Pro Cys Ala Leu Lys Glu Leu Ile385 390 395 400 Glu Pro Leu Val Ala Met Asn Arg Glu Leu Leu Glu Pro Gly His Asp 405 410 415 Ala Ala Gly Ala Ile Leu Gly Cys Gly Gly Ser Ala Val Phe His Asn 420 425 430 Val Asp Ile Trp Arg Arg Ala Leu Pro Ala Asn Gly Glu Pro Thr Trp 435 440 445 Ala Phe Trp Pro Phe Gly Gln Ala Trp Met Cys Arg Asn Leu Phe Asp 450 455 460 Glu Tyr Leu Phe Asn Gln Asp Glu Ser Tyr Leu Ala Ser Ile Trp Pro465 470 475 480 Ile Met Arg Asp Ser Ala Arg Phe Cys Met Asp Phe Leu Ser Asp Thr 485 490 495 Glu His Gly Leu Ala Pro Ala Pro Ala Thr Ser Pro Glu Asn Tyr Phe 500 505 510 Val Val Asp Gly Glu Thr Ile Ala Val Ala His Thr Ser Glu Asn Thr 515 520 525 Thr Ala Ile Val Arg Asn Leu Leu Asp Asp Leu Ile His Ala Ala Gln 530 535 540 Thr Met Pro Asp Leu Asp Asp Gly Asp Lys Ala Leu Val Arg Glu Ala545 550 555 560 Glu Ser Thr Arg Ala Lys Leu Ala Ala Val Arg Val Gly Ser Asp Gly 565 570 575 Arg Ile Leu Glu Trp Asn Asp Glu Leu Val Glu Ala Asp Pro His His 580 585 590 Arg His Leu Ser His Leu Tyr Glu Leu His Pro Gly Ala Gly Ile Thr 595 600 605 Ala Asn Thr Pro Arg Leu Glu Glu Ala Ala Arg Lys Ser Leu Glu Val 610 615 620 Arg Gly Asp Asp Gly Ser Gly Trp Ser Ile Val Trp Arg Met Ile Met625 630 635 640 Trp Ala Arg Leu Arg Asp Ala Glu His Ala Glu Arg Ile Ile Gly Met 645 650 655 Phe Leu Arg Pro Val Glu Ala Asp Ala Glu Thr Asp Leu Leu Gly Gly 660 665 670 Gly Val Tyr Ala Ser Gly Met Cys Ala His Pro Pro Phe Gln Ile Asp 675 680 685 Gly Asn Leu Gly Phe Pro Ala Ala Leu Ala Glu Met Leu Val Gln Ser 690 695 700 His Asp Gly Met Val Arg Ile Leu Pro Ala Leu Pro Glu Asp Trp His705 710 715 720 Glu Gly Ser Phe His Gly Leu Arg Ala Arg Gly Gly Leu Ser Val Asp 725 730 735 Ala Ser Trp Thr Asp Asp Ala Ile Glu Tyr Thr Leu Arg Cys Thr Lys 740 745 750 Pro Ala Thr Ile Thr Leu Ile Val Asp Gly Thr Asp Ala Thr Gln Val 755 760 765 Arg Leu Ser Pro Asp Glu Pro Phe Lys Gly Leu Val Arg Arg 770 775 780 61959PRTBifidobacterium bifidumBifidobacterium bifidum strain JCM 1254 alpha-fucosidase, glycoside hydrolase family 95 (GH95), afcA 6Met Lys His Arg Ala Met Ser Ser Arg Leu Met Pro Leu Val Ala Ser1 5 10 15 Cys Ala Thr Val Gly Met Leu Leu Ala Gly Leu Pro Val Ser Ala Val 20 25 30 Ala Val Gly Thr Thr Arg Ala Ala Ala Ser Asp Ala Ser Ser Ser Thr 35 40 45 Thr Ala Thr Ile Thr Pro Ser Ala Asp Thr Thr Leu Gln Thr Trp Thr 50 55 60 Ser Glu Lys Asn Ser Ser Met Ala Ser Lys Pro Tyr Ile Gly Thr Leu65 70 75 80 Gln Gly Pro Ser Gln Gly Val Phe Gly Glu Lys Phe Glu Ser Thr Asp 85 90 95 Ala Ala Asp Thr Thr Asp Leu Lys Thr Gly Leu Leu Thr Phe Asp Leu 100 105 110 Ser Ala Tyr Asp His Ala Pro Asp Ser Ala Thr Phe Glu Met Thr Tyr 115 120 125 Leu Gly Tyr Arg Gly Asn Pro Thr Ala Thr Asp Thr Asp Thr Ile Lys 130 135 140 Val Thr Pro Val Asp Thr Thr Val Cys Thr Asn Asn Ala Thr Asp Cys145 150 155 160 Gly Ala Asn Val Ala Thr Gly Ala Thr Lys Pro Lys Phe Ser Ile Asn 165 170 175 Asp Ser Ser Phe Val Ala Glu Ser Lys Pro Phe Glu Tyr Gly Thr Thr 180 185 190 Val Tyr Thr Gly Asp Ala Ile Thr Val Val Pro Ala Asn Thr Lys Lys 195 200 205 Val Thr Val Asp Val Thr Glu Ile Val Arg Gln Gln Phe Ala Glu Gly 210 215 220 Lys Lys Val Ile Thr Leu Ala Val Gly Glu Thr Lys Lys Thr Glu Val225 230 235 240 Arg Phe Ala Ser Ser Glu Gly Thr Thr Ser Leu Asn Gly Ala Thr Ala 245 250 255 Asp Met Ala Pro Lys Leu Thr Val Ser Val Ser Thr Lys Asp Asp Leu 260 265 270 Lys Pro Ser Ala Asp Thr Thr Leu Gln Ala Trp Ala Ser Glu Lys Asn 275 280 285 Glu Lys Lys Asn Thr Ala Ala Tyr Val Gly Ala Leu Gln Pro Glu Gly 290 295 300 Asp Tyr Gly Asp Phe Gly Glu Lys Phe Lys Ser Thr Asp Val His Asp305 310 315 320 Val Thr Asp Ala Lys Met Gly Leu Met Thr Phe Asp Leu Ser Asp Tyr 325 330 335 Thr Ala Ala Pro Glu His Ser Ile Leu Thr Leu Thr Tyr Leu Gly Tyr 340 345 350 Ala Gly Ala Asp Lys Thr Ala Thr Ala Thr Asp Lys Val Lys Val Val 355 360 365 Ala Val Asp Thr Ser Arg Cys Thr Gly Thr Ala Pro Cys Asp Thr Asn 370 375 380 Asn Ala Thr Trp Ala Asn Arg Pro Asp Phe Glu Val Thr Asp Thr Thr385 390 395 400 Lys Thr Ala Thr Ser His Ala Phe Ala Tyr Gly Ser Lys Lys Tyr Ser 405 410 415 Asp Gly Met Thr Val Glu Ser Gly Asn Ala Lys Lys Val Leu Leu Asp 420 425 430 Val Ser Asp Val Ile Lys Ala Glu Phe Ala Lys Phe Ser Ala Gly Ala 435 440 445 Thr Glu Lys Lys Ile Thr Leu Ala Leu Gly Glu Leu Asn Lys Ser Asp 450 455 460 Met Arg Phe Gly Ser Lys Glu Val Thr Ser Leu Thr Gly Ala Thr Glu465 470 475 480 Ala Met Gln Pro Thr Leu Ser Val Thr Lys Lys Pro Lys Ala Tyr Thr 485 490 495 Leu Ser Ile Glu Gly Pro Thr Lys Val Lys Tyr Gln Lys Gly Glu Ala 500 505 510 Phe Asp Lys Ala Gly Leu Val Val Lys Ala Thr Ser Thr Ala Asp Gly 515 520 525 Thr Val Lys Thr Leu Thr Glu Gly Asn Gly Glu Asp Asn Tyr Thr Ile 530 535 540 Asp Thr Ser Ala Phe Asp Ser Ala Ser Ile Gly Val Tyr Pro Val Thr545 550 555 560 Val Lys Tyr Asn Lys Asp Pro Glu Ile Ala Ala Ser Phe Asn Ala Tyr 565 570 575 Val Ile Ala Ser Val Glu Asp Gly Gly Asp Gly Asp Thr Ser Lys Asp 580 585 590 Asp Trp Leu Trp Tyr Lys Gln Pro Ala Ser Gln Thr Asp Ala Thr Ala 595 600 605 Thr Ala Gly Gly Asn Tyr Gly Asn Pro Asp Asn Asn Arg Trp Gln Gln 610 615 620 Thr Thr Leu Pro Phe Gly Asn Gly Lys Ile Gly Gly Thr Val Trp Gly625 630 635 640 Glu Val Ser Arg Glu Arg Val Thr Phe Asn Glu Glu Thr Leu Trp Thr 645 650 655 Gly Gly Pro Gly Ser Ser Thr Ser Tyr Asn Gly Gly Asn Asn Glu Thr 660 665 670 Lys Gly Gln Asn Gly Ala Thr Leu Arg Ala Leu Asn Lys Gln Leu Ala 675 680 685 Asn Gly Ala Glu Thr Val Asn Pro Gly Asn Leu Thr Gly Gly Glu Asn 690 695 700 Ala Ala Glu Gln Gly Asn Tyr Leu Asn Trp Gly Asp Ile Tyr Leu Asp705 710 715 720 Tyr Gly Phe Asn Asp Thr Thr Val Thr Glu Tyr Arg Arg Asp Leu Asn 725 730 735 Leu Ser Lys Gly Lys Ala Asp Val Thr Phe Lys His Asp Gly Val Thr 740 745 750 Tyr Thr Arg Glu Tyr Phe Ala Ser Asn Pro Asp Asn Val Met Val Ala 755 760 765 Arg Leu Thr Ala Ser Lys Ala Gly Lys Leu Asn Phe Asn Val Ser Met 770 775 780 Pro Thr Asn Thr Asn Tyr Ser Lys Thr Gly Glu Thr Thr Thr Val Lys785 790 795 800 Gly Asp Thr Leu Thr Val Lys Gly Ala Leu Gly Asn Asn Gly Leu Leu 805 810 815 Tyr Asn Ser Gln Ile Lys Val Val Leu Asp Asn Gly Glu Gly Thr Leu 820 825 830 Ser Glu Gly Ser Asp Gly Ala Ser Leu Lys Val Ser Asp Ala Lys Ala 835 840 845 Val Thr Leu Tyr Ile Ala Ala Ala Thr Asp Tyr Lys Gln Lys Tyr Pro 850 855 860 Ser Tyr Arg Thr Gly Glu

Thr Ala Ala Glu Val Asn Thr Arg Val Ala865 870 875 880 Lys Val Val Gln Asp Ala Ala Asn Lys Gly Tyr Thr Ala Val Lys Lys 885 890 895 Ala His Ile Asp Asp His Ser Ala Ile Tyr Asp Arg Val Lys Ile Asp 900 905 910 Leu Gly Gln Ser Gly His Ser Ser Asp Gly Ala Val Ala Thr Asp Ala 915 920 925 Leu Leu Lys Ala Tyr Gln Arg Gly Ser Ala Thr Thr Ala Gln Lys Arg 930 935 940 Glu Leu Glu Thr Leu Val Tyr Lys Tyr Gly Arg Tyr Leu Thr Ile Gly945 950 955 960 Ser Ser Arg Glu Asn Ser Gln Leu Pro Ser Asn Leu Gln Gly Ile Trp 965 970 975 Ser Val Thr Ala Gly Asp Asn Ala His Gly Asn Thr Pro Trp Gly Ser 980 985 990 Asp Phe His Met Asn Val Asn Leu Gln Met Asn Tyr Trp Pro Thr Tyr 995 1000 1005 Ser Ala Asn Met Gly Glu Leu Ala Glu Pro Leu Ile Glu Tyr Val Glu 1010 1015 1020 Gly Leu Val Lys Pro Gly Arg Val Thr Ala Lys Val Tyr Ala Gly Ala1025 1030 1035 1040Glu Thr Thr Asn Pro Glu Thr Thr Pro Ile Gly Glu Gly Glu Gly Tyr 1045 1050 1055 Met Ala His Thr Glu Asn Thr Ala Tyr Gly Trp Thr Ala Pro Gly Gln 1060 1065 1070 Ser Phe Ser Trp Gly Trp Ser Pro Ala Ala Val Pro Trp Ile Leu Gln 1075 1080 1085 Asn Val Tyr Glu Ala Tyr Glu Tyr Ser Gly Asp Pro Ala Leu Leu Asp 1090 1095 1100 Arg Val Tyr Ala Leu Leu Lys Glu Glu Ser His Phe Tyr Val Asn Tyr1105 1110 1115 1120Met Leu His Lys Ala Gly Ser Ser Ser Gly Asp Arg Leu Thr Thr Gly 1125 1130 1135 Val Ala Tyr Ser Pro Glu Gln Gly Pro Leu Gly Thr Asp Gly Asn Thr 1140 1145 1150 Tyr Glu Ser Ser Leu Val Trp Gln Met Leu Asn Asp Ala Ile Glu Ala 1155 1160 1165 Ala Lys Ala Lys Gly Asp Pro Asp Gly Leu Val Gly Asn Thr Thr Asp 1170 1175 1180 Cys Ser Ala Asp Asn Trp Ala Lys Asn Asp Ser Gly Asn Phe Thr Asp1185 1190 1195 1200Ala Asn Ala Asn Arg Ser Trp Ser Cys Ala Lys Ser Leu Leu Lys Pro 1205 1210 1215 Ile Glu Val Gly Asp Ser Gly Gln Ile Lys Glu Trp Tyr Phe Glu Gly 1220 1225 1230 Ala Leu Gly Lys Lys Lys Asp Gly Ser Thr Ile Ser Gly Tyr Gln Ala 1235 1240 1245 Asp Asn Gln His Arg His Met Ser His Leu Leu Gly Leu Phe Pro Gly 1250 1255 1260 Asp Leu Ile Thr Ile Asp Asn Ser Glu Tyr Met Asp Ala Ala Lys Thr1265 1270 1275 1280Ser Leu Arg Tyr Arg Cys Phe Lys Gly Asn Val Leu Gln Ser Asn Thr 1285 1290 1295 Gly Trp Ala Ile Gly Gln Arg Ile Asn Ser Trp Ala Arg Thr Gly Asp 1300 1305 1310 Gly Asn Thr Thr Tyr Gln Leu Val Glu Leu Gln Leu Lys Asn Ala Met 1315 1320 1325 Tyr Ala Asn Leu Phe Asp Tyr His Ala Pro Phe Gln Ile Asp Gly Asn 1330 1335 1340 Phe Gly Asn Thr Ser Gly Val Asp Glu Met Leu Leu Gln Ser Asn Ser1345 1350 1355 1360Thr Phe Thr Asp Thr Ala Gly Lys Lys Tyr Val Asn Tyr Thr Asn Ile 1365 1370 1375 Leu Pro Ala Leu Pro Asp Ala Trp Ala Gly Gly Ser Val Ser Gly Leu 1380 1385 1390 Val Ala Arg Gly Asn Phe Thr Val Gly Thr Thr Trp Lys Asn Gly Lys 1395 1400 1405 Ala Thr Glu Val Arg Leu Thr Ser Asn Lys Gly Lys Gln Ala Ala Val 1410 1415 1420 Lys Ile Thr Ala Gly Gly Ala Gln Asn Tyr Glu Val Lys Asn Gly Asp1425 1430 1435 1440Thr Ala Val Asn Ala Lys Val Val Thr Asn Ala Asp Gly Ala Ser Leu 1445 1450 1455 Leu Val Phe Asp Thr Thr Ala Gly Thr Thr Tyr Thr Ile Thr Lys Lys 1460 1465 1470 Ala Ser Ala Asn Val Pro Val Thr Gly Val Thr Val Thr Gly Ala Asn 1475 1480 1485 Thr Ala Thr Ala Gly Asp Thr Val Thr Leu Thr Ala Thr Val Ala Pro 1490 1495 1500 Ala Asn Ala Thr Asp Lys Ser Val Thr Trp Ser Thr Ser Asp Ala Ala1505 1510 1515 1520Val Ala Thr Val Asn Ala Asn Gly Val Val Thr Thr Lys Lys Ala Gly 1525 1530 1535 Lys Val Thr Ile Thr Ala Thr Ser Asn Gly Asp Lys Thr Lys Phe Gly 1540 1545 1550 Ser Ile Glu Ile Thr Val Ser Ala Ala Thr Val Pro Val Thr Ser Val 1555 1560 1565 Thr Val Ala Gly Asp Ala Ala Met Thr Val Asp Gly Glu Gln Thr Leu 1570 1575 1580 Thr Ala Thr Val Ala Pro Ala Thr Ala Thr Asp Lys Thr Val Thr Trp1585 1590 1595 1600Lys Ser Ser Asp Ala Thr Val Ala Thr Val Asp Ala Asn Gly Lys Val 1605 1610 1615 Val Ala Lys Lys Ala Gly Glu Val Thr Ile Thr Ala Thr Ala Gly Gly 1620 1625 1630 Val Ser Gly Thr Leu Lys Ile Thr Val Ser Asp Lys Ala Pro Thr Val 1635 1640 1645 Ile Pro Val Gln Ser Val Thr Val Thr Gly Lys Gln Glu Leu Val Glu 1650 1655 1660 Gly Ala Ser Thr Thr Leu Thr Ala Thr Val Ala Pro Ala Asp Ala Thr1665 1670 1675 1680Asp Lys Thr Val Thr Trp Lys Ser Ser Asp Glu Ser Val Ala Thr Val 1685 1690 1695 Asp Lys Asp Gly Val Val Thr Ala Lys Lys Ala Gly Thr Val Thr Ile 1700 1705 1710 Thr Ala Thr Ala Gly Gly Val Ser Gly Thr Leu His Ile Thr Val Thr 1715 1720 1725 Ala Lys Pro Val Glu Thr Val Pro Val Thr Ser Val Glu Val Thr Val 1730 1735 1740 Glu Ala Gly Thr Thr Val Ser Val Gly Lys Thr Leu Gln Ala Thr Ala1745 1750 1755 1760Thr Val Lys Pro Gly Asn Ala Thr Asn Lys Lys Val Thr Trp Lys Ser 1765 1770 1775 Ser Asp Glu Ser Ile Ala Thr Val Asp Ala Asn Gly Val Ile Thr Ala 1780 1785 1790 Lys Lys Ala Gly Lys Val Val Ile Thr Ala Thr Ser Thr Asp Gly Thr 1795 1800 1805 Asp Lys Ser Gly Ser Val Glu Ile Thr Val Val Asp Glu Thr Lys Pro 1810 1815 1820 Thr Pro Asp His Lys Ser Val Lys Ala Asp Thr Gly Asp Val Thr Ala1825 1830 1835 1840Gly Lys Thr Gly Thr Val Thr Glu Pro Lys Asp Val Ala Gly Trp Lys 1845 1850 1855 Ser Arg Ser Ile Ile Lys Gln Gly Lys Leu Gly Lys Ala Glu Ile Ala 1860 1865 1870 Asp Gly Thr Leu Val Tyr Ala Ala Gly Asp Lys Thr Gly Asp Asp Ser 1875 1880 1885 Phe Val Val Gln Tyr Thr Met Ala Asp Gly Thr Val Ile Asp Val Thr 1890 1895 1900 Tyr Ser Val Thr Val Lys Ala Ala Glu Thr Gly Lys Asn Asp Gly Asp1905 1910 1915 1920Gly Lys Gly Asp Gly Val Ala Lys Thr Gly Ala Ala Val Gly Ala Leu 1925 1930 1935 Ala Gly Leu Gly Leu Met Leu Leu Ala Val Gly Val Ser Val Val Met 1940 1945 1950 Ile Arg Arg Lys His Ser Ala 1955 71350DNABifidobacterium longumBifidobacterium longum subspecies infantis (B. infantis) strain ATCC 15697 = JCM 1222 = DSM 20088 glycoside hydrolase family 29 (GH29), afcB, Blon_0248 7atggtgttgt tcatggccaa tccacagcgt cccaagatgt atgagaagtt cgtgcacgat 60acacccgaat ggttcaaggg cgccggtctc ggcatcttcg cccactgggg ttcgtattcg 120gtgccggcat gggcggagcc gatcggtgcg cttggcacct ttgacgatcc ggtgtactgg 180aacacccact gcccgtatgc ggaatggtat tggaacacga tgagcatcaa gggctcgccg 240gcggccgagc atcagaagga agtctacggt gacatgccgt atgaggactt catcgacatg 300tggaaggccg aggcgttcga ccccgcggac atggccgacc tgttcgcacg cgccggtgcc 360cggtacttcg tgccgaccac gaagcatcac gaaggcatca cgctgtggaa ggcccccgac 420aacgatgggt ggaataccgt ggaccgtggt ccgcatcgcg atctggtcaa ggaattcgcc 480gacgccatgc gcgacaaggg actgaagttc ggcgtgtact actcctcggg cctcgactgg 540cacaaggagc ccaacatgcc gattctcggc gacggggaat acgggccgca gagcgaggac 600tacgcccgct atatgtactc gcatgtgatg gacctcatcg acgaatacca gccgtccatc 660ctgtggggag atatcgacgt gccgaagatc tcggaggagg acaacgattt cagcgtggcc 720cgactgttcg agcattacta cgacgtggtg ccggatggtg tggtcaacga ccgctggggc 780ctgacccatt gggacttccg caccgtcgaa tacgaacagg gcaaggagct catgggcaag 840ggcatgtggg agatgacccg aggcatcggc tactccttcg gctacaacca gatggaggac 900gccgactcct acatgaccgg tccggaggcg gtgaagttgc tcgccgacgt ggtctccatg 960ggcggcaacc tgctgctcga catcggcccc gacgccgccg gacgcatccc cgaactgcag 1020cgtcagtgcc tcgagggcat ggccgactgg atggacgtga actcgccgag tatccatgat 1080gtcgaaccgg tgccggaagc ctcgccttcc ggagaggggg acggcgagcc atgggtccgt 1140tggaccggag acggcaagag cgtctatgcc gtcgtcgatg ctgcgggcag ggttccgctg 1200cgcatcgccg ccgatgctgt ggacgcggat tccgccgtga cgcttggcgg atccgcagtc 1260gccgtggacg ccgacggcga cgtgctgacc gccgatgttc cggcctcgga agtggcgggg 1320ccgcaggtcg tgcacttcgt ccgtcgctga 135081350DNABifidobacterium longumBifidobacterium longum subspecies infantis (B. infantis) strain ATCC 15697 = JCM 1222 = DSM 20088 glycoside hydrolase family 29 (GH29), afcB, Blon_0426 8atggtgttgt tcatggccaa tccacagcgt cccaagatgt atgagaagtt cgtgcacgat 60acacccgaat ggttcaaggg cgccggtctc ggcatcttcg cccactgggg ttcgtattcg 120gtgccggcat gggcggagcc gatcggtgcg cttggcacct ttgacgatcc ggtgtactgg 180aacacccact gcccgtatgc ggaatggtat tggaacacga tgagcatcaa gggctcgccg 240gcggccgagc atcagaagga agtctacggt gacatgccgt atgaggactt catcgacatg 300tggaaggccg aggcgttcga ccccgcggac atggccgacc tgttcgcacg cgccggtgcc 360cggtacttcg tgccgaccac gaagcatcac gaaggcatca cgctgtggaa ggcccccgac 420aacgatgggt ggaataccgt ggaccgtggt ccgcatcgcg atctggtcaa ggaattcgcc 480gacgccatgc gcgacaaggg actgaagttc ggcgtgtact actcctcggg cctcgactgg 540cacaaggagc ccaacatgcc gattctcggc gacggggaat acgggccgca gagcgaggac 600tacgcccgct atatgtactc gcatgtgatg gacctcatcg acgaatacca gccgtccatc 660ctgtggggag atatcgacgt gccgaagatc tcggaggagg acaacgattt cagcgtggcc 720cgactgttcg agcattacta cgacgtggtg ccggatggtg tggtcaacga ccgctggggc 780ctgacccatt gggacttccg caccgtcgaa tacgaacagg gcaaggagct catgggcaag 840ggcatgtggg agatgacccg aggcatcggc tactccttcg gctacaacca gatggaggac 900gccgactcct acatgaccgg tccggaggcg gtgaagttgc tcgccgacgt ggtctccatg 960ggcggcaacc tgctgctcga catcggcccc gacgccgccg gacgcatccc cgaactgcag 1020cgtcagtgcc tcgagggcat ggccgactgg atggacgtga actcgccgag tatccatgat 1080gtcgaaccgg tgccggaagc ctcgccttcc ggagaggggg acggcgagcc atgggttcgt 1140tggaccggag acggcaagag cgtctatgcc gtcgtcgatg ctgcgggcag ggttccgctg 1200cgcatagatg cgggtgcggt cgatgtggat tccgcaacca ttcttggcgg tggcaacgtt 1260gtcgtggagg cggacggcga tatgctgacc gtggagattc ccgcgacaga cgtcgccggc 1320cctcaggtcg tgcgttttgc tcgacactaa 135091350DNABifidobacterium breveBifidobacterium breve strain SC95 glycoside hydrolase family 29 (GH29), afcB 9atggtgctgt tcatggccaa tccgcagcgt cccaagatgt atgagaagtt cgtgcacgat 60acacccgaat ggttcaaggg cgccggtctc ggcatcttcg cccactgggg ttcgtattcg 120gtgccggcat gggcggagcc gatcggtgcg cttggcacct ttgacgatcc ggtgtactgg 180aacacccact gcccgtatgc ggaatggtat tggaacacga tgagcatcaa gggctcgccg 240gcggccgagc atcagaagga agtctacggt gacatgccgt atgaggactt catcgacatg 300tggaaggccg aggcgttcga ccccgcggac atggccgacc tgttcgcacg cgccggtgcc 360cggtacttcg tgccgaccac gaagcatcac gaaggcatca cgctgtggaa ggcccccgac 420aacgatgggt ggaataccgt ggaccgtggt ccgcatcgcg atctggtcaa ggaattcgcc 480gacgccatgc gcgacaaggg actgaagttc ggcgtgtact actcctcggg cctcgactgg 540cacaaggagc ccaacatgcc gattctcggc gacggggaat acgggccgca gagcgaggac 600tacgcccgct atatgtactc gcatgtgatg gacctcatcg acaaatacca gccgtccatc 660ctgtggggag atatcgacgt gccgaagatc tcggaggagg acaacgattt cagtgtggcc 720cgactgttcg agcattacta tgacgtggtg ccggatggtg tggtcaacga ccgctggggc 780ctgacccatt gggacttccg caccgtcgaa tacgaacagg gcaaggagct catgggcaag 840ggcatgtggg agatgacccg aggcatcggc tactccttcg gctacaacca gatggaggac 900gccgactcct acatgaccgg tccggaggcg gtgaagttgc tcgccgacgt ggtctccatg 960ggcggcaacc tgctgctcga catcggcccc gacgccgccg gacgcatccc cgaactgcag 1020cgtcagtgcc tcgagggcat ggccgactgg atgtacgtga actcgccgag tatccatgat 1080gtcgaaccgg tgccggaagc ctcgccttcc ggagaggggg acggcgagcc atgggtccgt 1140tggaccggag acggcaagag cgtctatgcc gtcgtcgatg ctgcgggcag ggttccgctg 1200cgcatcgccg ccgatgctgt ggacgcggat tccgccgtga cgcttggcgg atccgcagtc 1260gccgtggacg ccgacggcga cgtgctgacc gccgatgttc cggcctcgga agtggcgggg 1320ccgcaggtcg tgcacttcgt ccgtcgctga 1350104482DNABifidobacterium bifidumBifidobacterium bifidum strain JCM 1254 alpha-L-fucosidase, glycoside hydrolase family 29 (GH29), afcB 10atgctacaca cagcatcaag aggatgctcg cgttcgtggc tgcgcagact caccgcattg 60atagcggtct cggcgctcgc gttcgtggca ttgccgaacg tcgcggtggc ggcggatccg 120atggaatacc tcgatgtgtc gttcggcggc acgttcgctg cagacaccta caccacaggt 180ggcgacgagg tggcgaaggg ccccgtgacc aagcacggca gcataccgac caagcttgac 240ggcggcggca tcaccctcgc tggcggcacc aacggcgtga cattcacctc gaccgcgagc 300ttcagcgaga gtgggaaggt gaacaaggga ttccgcgccg aaatggagta ccgtacgacg 360cagacgccca gcaacctcgc cacattgttc tccgccatgg gcaacatctt cgtgcgggcg 420aacggcagca acctcgaata cggcttctcc acgaaccctt ccggcagtac atggaacgac 480tacacaaagt ccgtgacgct gccttccaac aatgtgaagc acatcatcca gctgacatat 540ctgccgggag ccgacggcgc tgcctcgacg ttgcagttgt cggtggatgg cgtggccggc 600gagaccgcca cctccgcggc cggcgagctc gcggccgtca gcgattccgt cgggaacaag 660ttcgggatcg gctacgaggt gaaccccgct tccggcgcgg cgagccgcgg tcttgccggt 720gacgtgttcc gcgcgcgtgt cgccgattcg gacgccccgt gggagattct tgacgcatcc 780cagctgctgc atgtcaattt caacggcacg ttcagcggca cctcatatac cgcggcgagc 840ggcgagcaga tgctgggctc gctggtgtcg cgctcggcca atccgtccat ctcgaactcc 900gccgtcacgc tgggcggcgg cacggccgga ttcgatttca cgcccacgga cttcaccctc 960ggtgacaacg aggccatcac ccgcccgctg gtcgcggagc tgcgcttcac cccgacgcag 1020accggcgaca accagaccct gttcggcgcg ggcggcaacc tgttcctgcg ctacgagtcg 1080aacaagctcg tgttcggcgc ctccaccaag tccggcgata attggaccga ccacaagatc 1140gagtccgcgg ccgccacggg tgcggagcac gtcgtgtcgg tggcgtacgt gcccaataag 1200gccggcaccg gcgcgaagct tgtcatgcgc gtggatggcg gcgacgccca gaccaaggac 1260atcactggtc tggcttacct gaattcgagc atcaagggca aggtcggctt cggcaacgac 1320gtgcataccg acgcgctcag ccgcggcttc gtcggctcgc tgagcgagat ccgcctggcc 1380gaaacctccg cgaacttcac caccaacgaa ttcaagctgg tctactctca ggtcagctgc 1440gacacgtcgg gcatcaagga ggcgaatacc ttcgacgtgg agcccgccga gtgcgaggcc 1500gcgcttaaga ccaagctgtc caagctgcgt ccgaccgaag ggcaggccga ctacatcgac 1560tggggtcaga tcggattcct ccattacggc atcaacacgt actacaacca ggagtggggt 1620cacggtaacg aggatccctc ccgcatcaac ccgaccggcc tcgacaccga ccagtgggcg 1680aagtccttcg ccgacggtgg cttcaagatg atcatggtga cggtcaagca ccatgacggt 1740ttcgagctgt acgactcgcg gtacaacacc gagcacgact gggcaaacac cgccgtcgcc 1800aagcgcacgg gggagaagga cctgttccgc aagattgtcg cctcggcgaa gaaatacggc 1860ctgaaggtcg gcatctacta ttcgccggcc gattcctaca tggagaggaa gggcgtctgg 1920ggcaacaact ccgcacgcgt cgagcgcacg atccccacgc tggtggagaa cgacgaccgc 1980gccggcaagg tggcttccgg caaactgccc acgttcaagt acaaggccac ggattacggc 2040gcctacatgc tcaaccagct ctatgagctg ctgactgagt acggcgacat ctccgaggtc 2100tggttcgacg gtgcccaagg caacaccgca ggcactgagc attacgacta tggcgtgttc 2160tacgagatga tccgccggct tcagccccag gcaattcagg ccaacgccgc atacgatgcc 2220cgatgggtgg gcaacgagga cggctgggcc cgtcagaccg agtggagccc gcaggcggca 2280tacaacgacg gcgtggacaa ggtgtcgctc aagcctggcc agatggcccc cgacggtaag 2340cttggcagca tgtcgagcgt gctgtccgag atccgcagcg gcgccgccaa ccagctgcac 2400tggtatccgg ccgaagtcga cgccaagaac cggcccggat ggttctaccg tgccagccaa 2460tcgccggcgt ccgtagccga agtcgtgaag tactacgagc agtccacggg acgcaactcg 2520cagtatctgc tgaacgtccc accgtccgat accggcaagc tcgccgatgc ggatgccgcg 2580ggacttaagg ggctgggcga ggagctcgcc cgacgctacg gcaccgatct tgccctgggc 2640aagagcgcga ccgtcgccgc gtccgcgaac gacactgcgg tagcggcccc gaagctgacc 2700gacggttcga agctctcctc cgacaaggcc gtgggcaata cgccgacgta caccatcgat 2760ctgggcagca ctgtcgccgt ggatgcagtg aagatctccg aggacgtgcg caatgccggc 2820cagcagatcg aaagcgccac tctgcaggga cgagtcaatg gaacatggac gaatctggcg 2880actatgacga cggtcgggca gcagcgcgac cttcgcttca cgtcccagaa catcgatgcc 2940atccgtctgg tggtcaactc ctcccgcggt ccggtgcgtc tgagccgtct tgaggtgttc 3000cacaccgaat ccgagattca gaccggcgcc cgcgcctact acatcgatcc gacggcgcag 3060accgcgggag atggattcac gaaggacaag cccatgacgt cgatcgagca gctgcacgat 3120gtgaccgtcg cgccaggctc cgtgatcttc gtcaaggcgg gcaccgagct gaccggggac 3180ttcgccgtct tcggctacgg caccaaggac gagcccatca ccgtgacgac atacggcgaa

3240agcgacaaag ccaccaccgc gagcttcgac ggcatgaccg ccgggctgac gctgaagcag 3300gcgctgaagg cgctcggcaa ggacgacgcc ggctgggtcg tggccgattc cgccactgca 3360ccggcctccc gcgtgtatgt cccgcaggat gagatcagcg tgcacgccca gtcgtcgcag 3420aactccggcg cagaggcggc gagggcgctc gacggcgact cgtcgacgag ctggcactcc 3480cagtacagcc cgaccaccgc gtctgctccg cattgggtga ctctcgatct cggcaaatcg 3540cgtgagaacg tcgcctactt cgactacctc gcccgtatcg acggcaacaa taacggtgcc 3600gccaaggatt acgaggtgta tgtctccgac gatcccaacg attttggagc ccctgtggcc 3660tcgggcacgt tgaagaacgt cgcctacacg cagcgcatca agctgacccc caagaacgga 3720cggtacgtca agttcgtcat caagaccgat tattccggat cgaacttcgg ctccgcggcg 3780gaaatgaatg tcgagttgct gcccacggcc gtagaggagg acaaggtcgc caccccgcag 3840aagccgacag tggacgatga tgccgataca tacaccatcc ccgacatcga gggagtcgtg 3900tacaaggtcg acggcaaggt gttggccgct ggttccgtag tgaacgtggg cgatgaggac 3960gtgaccgtca cggtcaccgc cgagcccgcc gacggatacc gcttcccgga tggtgtgacg 4020tccccagtca cgtatgagct gacgttcacc aagaagggtg gcgagaagcc tccgaccgaa 4080gtcaacaagg acaagctgca cgccacgatc accaaggctc aggcgatcga ccgttccgcc 4140tatacggacg agtcgctcaa ggtgcttgat gacaagctcg ccgcagcgct caaggtctat 4200gacgatgaca aggtgagcca ggatgatgtc gatgccgccg aggcggctct gtctgcggcg 4260atcgacgcgc tgaagaccaa gccgacgacc cccggcggtg aaggtgagaa gcctggtgaa 4320ggtgaaaagc ccggtgacgg caacaagccc ggtgacggca agaagcccgg cgacgtgatc 4380gcaaagaccg gcgcctccac aatgggcgtt gtcttcgctg cactcgcgat ggtagcgggt 4440gcggtcgtga cgcttgaagc caagcgtaag tccaaccggt aa 4482112349DNABifidobacterium longumBifidobacterium longum subspecies infantis (B. infantis) strain ATCC 15697 = JCM 1222 = DSM 20088 glycoside hydrolase family 95 (GH95), afcA, Blon_2335 11ctacctgcgg acaagcccct tgaacggctc gtcgggagac agtcggacct gcgtcgcgtc 60ggtgccatcg acgatcaggg tgatcgtcgc gggcttcgtg cagcgcagcg tgtattcgat 120ggcgtcgtcc gtccaggagg cgtccaccga aaggcctccc ctggcgcgca ggccatggaa 180gctgccttca tgccaatcct cgggcaacgc gggcaggatg cgcaccatgc cgtcatgact 240ctggacgagc atctccgcca gagccgcggg gaagcccaga ttgccgtcga tctggaatgg 300gggatgcgcg cacatgccgc tggcatacac gccgccgcca agcagatcgg tttcggcgtc 360ggcttcgacc gggcggagga acatgccgat gatgcgttcg gcgtgctcag cgtcccgcag 420acgcgcccac atgatcatgc gccacacgat gctccagccg gaaccgtcgt cgccacgcac 480ttcgagggac ttcctggcgg cctcctccag acgcggggtg ttcgcggtga tgcctgcgcc 540cggatgcagt tcgtacaggt gggacaggtg acggtgatgc ggatccgcct cgacgagttc 600atcgttccat tcgagaatcc tgccatcgga tcccacgcgg acagccgcca gcttcgcgcg 660ggtggattcc gcctcccgca ccaaggcctt gtcgccgtca tccaggtcgg gcatggtttg 720cgccgcgtgg atcagatcat cgagcagatt gcgcacgatg gccgtggtgt tttcgctggt 780gtgggcgacg gcgatcgttt cgccgtccac gacgaagtag ttttccggcg atgtcgccgg 840agccggggcc agaccgtgtt ccgtatccga cagaaaatcc atgcagaatc gcgcgctgtc 900ccgcatgatc ggccagatgg aagccagata cgactcatcc tggttgaaca ggtactcatc 960gaacaggttc cggcacatcc acgcctggcc gaacggccag aacgcccacg tcggctctcc 1020gttcgccggc agcgccctgc gccagatatc gacattgtgg aagaccgcgg aaccaccgca 1080tccgaggatg gcgccggccg catcatgccc cggttccagc agctccctgt tcatggcgac 1140gagcggttcg atgagctcct tgagggcgca tgggccggtc atccaatagt tcatctcgat 1200gttgatgttc gtcgtgtagg cgctatacca gttcgggaag tccttatggt tccagattcc 1260ctgcagattc gacggctggg tatgcggcct ggacgaggag atcagcaggt atcggccgaa 1320atcgaacatc gcctcggaga gcgtctccag acggtgcggc gtatcctcct tggagcgcag 1380gatctcggcg aacggcacct cctcatcgtc gtcatgggcc gggccgagac gcacgccgac 1440ccggtcgaag aaccggcggt agtcggcgac gtgacggtca agcatcgccc gcgaatcgga 1500cggccatgcg gcgatggtct cgcccagccg atcggcgagc accgtcatgt cccgctccgg 1560ctgttcggcg cttcccttga acccgctcag gctgcggaac cgaagcgaca agccggtgac 1620gcccgagcac tgcagaacat catcgatcac cgtgatctcg ccgcccgtga cggtgaggga 1680gaaggcgccg gcatacgcca tcccgatgcc gtcccgttcg tcctcccatg gattatcggt 1740gacatgggcc aatgatccga cattgagtcc gggcatctgc cccatgacga cgagggtggc 1800ctggcgcgca tcggaatcag accccgacga tatccgggtc tgcttgagaa aagtgccggt 1860gacgctcacg ctcgcatcga ccggcgcgct cgacgacatc tcatacacca gcagatcatc 1920gggagcgctg caccatgcgt cgacatggac gtcggcggcg cccagccgga acgattcgcc 1980ggcgagggcc ctggcgaggt ccaggctgcg cttcacatgc ttccgttcgc cggcctccga 2040cgagtaccgg atgcaagccg tgccgaacgg ctcgtatatc tgctcgtcct tctcccgctg 2100cgtggcgtcc tggatgatcc gcgtggccga cacgtaatcg ccgcgagacg acgcctgacg 2160ggctttggcc acgatttcgg gcgtcaacgg cgaggtctcc gcatgcggat agcccgacca 2220gagggtgtcg tcgttgaggt acagcacatc cgcgtccggt tcggagcaca ggaccgcccc 2280catgcgaccg ttgccgaacg ggattccttc ctcccaatgc gaagaaatcc catcgaaagt 2340gagtttcat 2349126120DNABifidobacterium bifidumBifidobacterium bifidum strain JCM 1254 alpha-fucosidase, glycoside hydrolase family 95 (GH95), afcA 12aacggtatcc agggactctc tgagagctgt ggttccaatt gaagacacaa gtcgccgacg 60gacttgattc ttttagtaaa caatgtatat attaatatga accggcaaag ctgctggctg 120tcctatagga gaaagaacca aatatgaaac atagagcgat gtcatcgcgt ctgatgccac 180tggtggcgtc ctgcgcgacg gtcggcatgc tgctggccgg actacctgtg tcggccgtcg 240cggtcggcac gacgagagcg gcagcgtccg acgcctcgtc ctccaccaca gcaaccatca 300ccccctccgc cgataccacg ttgcagacat ggacgagcga gaagaattcc tcaatggcgt 360ccaagccgta catcggcaca ctgcaagggc cctcgcaagg cgtgttcggc gagaagttcg 420agtccacgga tgccgcggac accaccgatc tgaagaccgg cctgctgacg ttcgacctga 480gcgcctacga ccatgccccc gattccgcaa cgttcgagat gacgtacctc ggctaccgcg 540gcaacccgac ggccaccgac accgacacca tcaaggtgac ccccgtcgac accaccgtgt 600gcaccaataa cgccacagac tgcggcgcga atgtcgcgac cggcgcgacc aagccgaagt 660tcagcatcaa cgactcctca ttcgtcgccg agtccaagcc gttcgagtac ggtacgacgg 720tttacacggg cgacgccatc accgtggttc ccgccaatac caagaaggtc accgtagatg 780tgaccgaaat cgtgcgccag cagttcgccg aaggcaagaa ggtcatcacc ctggccgtgg 840gcgagaccaa gaagaccgag gttcgtttcg ccagttccga aggcacgacg tccctgaacg 900gcgcgaccgc agacatggct ccgaagctga ccgtttccgt gtccaccaag gacgatctca 960agccctccgc cgacaccacg ttgcaggcat gggccagcga gaagaacgag aagaagaaca 1020ctgcggccta tgtcggcgcg ctgcagccgg aaggcgatta cggcgacttc ggtgagaagt 1080tcaagtccac cgacgtccac gatgtcacag acgccaagat gggtctgatg acgttcgacc 1140tgtccgatta caccgcggcg cccgagcact ccatcctcac cttgacgtat ctgggctacg 1200ccggtgcaga caagaccgcc acggccaccg ataaggtcaa ggtggtcgct gttgacacgt 1260cgcggtgcac cggcaccgct ccctgcgaca ccaacaatgc cacgtgggcg aaccgcccgg 1320acttcgaggt gaccgatacc acgaagaccg cgacgtccca tgcgttcgct tatggatcta 1380agaagtattc cgatggcatg accgtcgaat cgggcaacgc caagaaggtc ctgctcgacg 1440tgtccgatgt catcaaggca gagttcgcca agttcagcgc cggcgccacc gagaagaaga 1500tcacgctggc cctgggcgag ctcaacaagt ccgacatgcg tttcggcagc aaggaagtca 1560cctcgctgac cggcgccacc gaagccatgc agccgacctt gtccgtcacc aagaagccga 1620aggcatacac gctgagcatc gaaggcccga ccaaggtcaa gtaccagaag ggcgaggcgt 1680tcgacaaggc cggactcgtg gtcaaggcca ccagcacggc tgacggcacg gtcaagacgc 1740tgaccgaagg caacggtgag gataactaca ccatcgacac cagcgctttc gatagtgcca 1800gcatcggcgt ataccctgtt accgtgaagt acaacaagga ccccgaaatc gccgcttcgt 1860tcaacgccta tgtcatcgcc agtgtcgagg acggcggaga cggcgacacc agcaaagacg 1920actggctgtg gtacaagcag cccgcgtcgc agaccgacgc caccgccacc gccggcggca 1980attacggcaa ccccgacaac aaccgttggc agcagaccac cttgccgttc ggcaacggca 2040agatcggcgg caccgtctgg ggcgaggtca gccgtgaacg cgtcaccttc aacgaggaga 2100cgctgtggac cggcggcccc ggatcctcga ccagctacaa cggcggcaac aacgagacca 2160agggtcagaa cggcgccacg ctgcgcgcgc tcaacaagca gctcgcgaac ggcgccgaga 2220cggtcaatcc cggcaacctg accggcggcg agaacgcggc cgagcagggc aactacctga 2280actggggcga catctacctc gactacgggt tcaacgatac gaccgtcacc gaataccgcc 2340gcgacctgaa cctgagcaag ggcaaggccg acgtcacgtt caagcatgac ggcgtcacct 2400acacgcgcga atacttcgcg tcgaaccccg acaatgtcat ggtcgcccgc ctcacggcca 2460gcaaagccgg caagctgaac ttcaacgtca gcatgccgac caacacgaac tactccaaga 2520ccggcgaaac cacgacggtc aagggtgaca cgctcaccgt caagggcgct ctcggcaaca 2580acggcctgct gtacaactcg cagatcaagg tcgtcctcga caacggtgag ggcacgctct 2640ccgaaggctc cgacggcgct tcgctgaagg tctccgacgc gaaggcggtc acgctgtaca 2700tcgccgccgc gacggactac aagcagaagt atccgtccta ccgcaccggc gaaaccgccg 2760ccgaggtgaa cacccgcgtc gccaaggtcg tgcaggacgc cgccaacaag ggctacaccg 2820ccgtcaagaa agcgcacatc gacgatcatt ccgccatcta cgaccgcgtg aagatcgatt 2880tgggccagtc cggccacagc tccgacggcg ccgtcgccac cgacgcgctg ctcaaggcgt 2940accagagagg ctccgcaacc accgcgcaga agcgcgagct ggagacgctg gtgtacaagt 3000acggccgcta cttgaccatc ggctcctccc gtgagaacag ccagctgccc agcaacctgc 3060agggcatctg gtcggtcacc gcgggcgaca acgcccacgg caacacgcct tggggctccg 3120acttccacat gaacgtgaac ctccagatga actactggcc gacctattcg gccaacatgg 3180gagagctcgc cgagccgctc atcgagtatg tggagggtct ggtcaagccc ggccgtgtga 3240ccgccaaggt ctacgcgggc gcggagacga cgaaccccga gaccacgccg atcggcgagg 3300gcgagggcta catggcccac accgagaaca ccgcctacgg ctggaccgca cccggtcaat 3360cgttctcgtg gggttggagc ccggccgccg tgccgtggat cctgcagaac gtgtacgagg 3420cgtacgagta ctccggcgac cctgccctgc ttgatcgcgt gtacgcgctg ctcaaggagg 3480aatcgcactt ctacgtcaac tacatgctgc acaaggccgg ctccagctcc ggtgaccgcc 3540tgactaccgg cgtcgcgtac tcgcccgaac agggcccgct gggcaccgac ggcaacacgt 3600acgagagctc gctcgtgtgg cagatgctca acgacgccat cgaggcggcc aaggccaagg 3660gagatccgga cggtctggtc ggcaatacca ccgactgctc ggccgacaac tgggccaaga 3720atgacagcgg caacttcacc gatgcgaacg ccaaccgttc ctggagctgc gccaagagcc 3780tgctcaagcc gatcgaggtc ggcgactccg gccagatcaa ggaatggtac ttcgaaggtg 3840cgctcggcaa gaagaaggat ggatccacca tcagcggcta ccaggcggac aaccagcacc 3900gtcacatgtc ccacctgctc ggactgttcc ccggtgattt gatcaccatc gacaactccg 3960agtacatgga tgcggccaag acctcgctga ggtaccgctg cttcaagggc aacgtgctgc 4020agtccaacac cggctgggcc attggccagc gcatcaattc gtgggctcgc accggcgacg 4080gcaacaccac gtaccagctg gtcgagctgc agctcaagaa cgcgatgtat gcaaacctgt 4140tcgattacca tgcgccgttc cagatcgacg gcaacttcgg caacacctcc ggtgtcgacg 4200aaatgctgct gcagtccaac tccaccttca ccgacaccgc cggcaagaag tacgtgaact 4260acacgaacat cctgcccgcc ctgcccgatg cctgggcggg cggctcggtg agcggcctcg 4320tggcccgcgg caacttcacc gtcggcacga catggaagaa cggcaaggcc accgaagtca 4380ggctgacctc caacaagggc aagcaggcgg ccgtcaagat caccgccggc ggcgcccaga 4440actacgaggt caagaacggt gacaccgccg tgaacgccaa ggtcgtgacc aacgcggacg 4500gcgcctcgct gctcgtgttc gataccaccg caggcaccac gtacacgatc acgaagaagg 4560cgagcgccaa cgtgcccgtc accggcgtga ccgtgaccgg cgccaacacc gccaccgcag 4620gcgacaccgt cactcttacg gctaccgtcg ccccggccaa tgcgaccgac aagtccgtca 4680cctggtcgac ctccgacgcc gccgtagcta cggtcaacgc caacggcgtg gtgaccacga 4740agaaggccgg caaggtgacc atcaccgcca cgtcgaacgg cgacaagacg aagttcggtt 4800ccatcgagat caccgtctcc gccgcgaccg tgcccgtcac cagcgtcacc gttgccggcg 4860acgccgcgat gaccgtcgat ggagagcaga ccctgacggc gaccgtcgcc ccggccactg 4920cgaccgacaa gacggtcacg tggaagtcct ccgacgccac tgtggcgacg gttgacgcca 4980acggcaaggt cgtcgcgaag aaggccggcg aagtgacgat caccgccacg gccggtggcg 5040tgtccggcac gctgaagatc acggtgagcg acaaggcccc gaccgtcatc ccggtccagt 5100ccgtgaccgt gacaggcaag caggagctcg tcgaaggcgc ctccacgacc ctgacggcga 5160ccgtcgcccc ggctgacgcg accgacaaga cggttacgtg gaagtcgagc gacgagtccg 5220tcgccacggt cgacaaggac ggcgtcgtga ccgccaagaa ggccggcacg gtgaccatca 5280ccgccacggc cggtggcgtg tccggcacgc tccacatcac cgtgacggcc aagcccgtcg 5340agaccgtccc cgtcaccagc gtggaggtca ccgtcgaggc cggcaccacc gtctccgtcg 5400gcaagacact ccaggccacc gcgaccgtca agcccggcaa cgccaccaac aagaaggtga 5460cgtggaagtc gagcgacgaa tccatcgcga cggtcgacgc caacggcgtc atcaccgcga 5520agaaggccgg caaggtcgtc atcacggcca cctcgaccga cggcacggac aagtccggca 5580gcgtcgagat caccgtcgtg gatgagacca agccgacgcc cgaccacaag tccgtcaagg 5640ccgataccgg cgacgtgacc gccggcaaga ccggtacggt caccgagccg aaggacgtgg 5700cgggctggaa gagccgctcc atcatcaagc aaggcaagct cggcaaggcc gaaatcgccg 5760acggcacgct cgtgtatgcg gccggcgaca agaccggtga cgacagcttc gtcgtgcagt 5820acacgatggc cgacggcacg gtcatcgacg tgacctacag cgtcacggtc aaggccgccg 5880aaaccggcaa gaacgacggc gacggcaagg gcgacggtgt cgcgaagacc ggcgccgccg 5940tcggcgcgct cgccggcctc ggcttgatgc tgctcgccgt cggagtgagc gtggtgatga 6000ttcgccgcaa gcactccgcc tgatccccag tcagaccggc cagtcgtgac cggtcggcct 6060gactgactct ttctccaccg tcccccgtcg gataaacccc ggcgggggac ggtggcttgt 61201320DNAArtificial Sequencesynthetic 16SrDNA universal PCR amplification primer 27F 13agagtttgat cctggctcag 201419DNAArtificial Sequencesynthetic 16SrDNA universal PCR amplification primer 1492R 14tacggttacc ttgttacga 191521DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR forward primer 15gagtaccgca agtacatcga g 211623DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR reverse primer 16catcctcatc gtcgaacagg aac 231720DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR forward primer 17cattcgaact ccgacaccga 201818DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR reverse primer 18gtggggtagt cgccgttg 181924DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR forward primer 19agctgcacgc bggcggcaag ttcg 242024DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR reverse primer 20gttgccgagc ttggtcttgg tctg 242124DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR forward primer 21atcggcatca tggcycacat ygat 242222DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR reverse primer 22ccagcatcgg ctgmacrccc tt 222321DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR forward primer 23atcccgcgyt accagacsat g 212420DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR reverse primer 24cggtgtcgac gtagtcggcg 202524DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR forward primer 25ggacaaggac ggcrtsccsg ccaa 242624DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR reverse primer 26acgaccrccg tgcgggtgrt cgac 242720DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR forward primer 27ggcgagctga tccagaacca 202820DNAArtificial Sequencesynthetic multilocus sequence typing (MLST) PCR reverse primer 28gcatcctcgt agttgtascc 202918DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_2335F 29garatgaayt aytggatg 183023DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_2335R 30ttnccrtcda tytgraangg ngg 233120DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_2336F 31aarcaycayg ayggnttytg 203217DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_2336R 32acytcngcng grtacca 173315DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_0248/0426F 33taygcngart ggtay 153417DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_0248/0426R 34tcrtgrtgyt tngtngt 173517DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_0346F 35ytngayttyc ayacnws 173617DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_0346R 36tcrtgrtgyt tngtngt 173717DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_2348F 37athacngcng ayathac 173820DNAArtificial Sequencesynthetic qPCR degenerate amplification primer Blon_2348R 38tcnacnacyt trttytcrtc 203920DNAArtificial Sequencesynthetic qPCR amplification primer Blon_0646F 39ccaccagaca tggaacagtg 204020DNAArtificial Sequencesynthetic qPCR amplification primer Blon_0646R 40aaatcgccga aggtgatatg 204120DNAArtificial Sequencesynthetic qPCR amplification primer Blon_0459F 41ccccaccctc gactggctca 204217DNAArtificial Sequencesynthetic qPCR amplification primer Blon_459R 42cttcgaggtg gcacagg 174320DNAArtificial Sequencesynthetic qPCR amplification primer 0248WF 43accaacaacc agcaaccaat 204420DNAArtificial Sequencesynthetic qPCR amplification primer 0248WR 44atcgaatacg gcaccttcag 204520DNAArtificial Sequencesynthetic qPCR amplification primer 0426WF 45accaacaacc agcaaccaat 204620DNAArtificial Sequencesynthetic qPCR amplification primer 0426WR 46gaccgccttc atggataaga 204720DNAArtificial Sequencesynthetic qPCR amplification primer RNP-F 47aacctgatga tcggacgacg 204820DNAArtificial Sequencesynthetic qPCR amplification primer RNP-R 48ggcaaactgc tcatccaacg 204920DNAArtificial Sequencesynthetic qPCR amplification primer GH29-F

49ggactgaagt tcggcgtgta 205020DNAArtificial Sequencesynthetic qPCR amplification primer GH29-R 50tcgttgtcct cctccgagat 205120DNAArtificial Sequencesynthetic qPCR amplification primer GH95-F 51cgcggactac cgcagatatt 205220DNAArtificial Sequencesynthetic qPCR amplification primer GH95-R 52atcgaacatt gcctctgcca 20

Claims

1. A method for promoting growth of beneficial gut bacteria in an individual, comprising administering to the individual a composition comprising a bacterium that expresses at least one alpha-fucosidase, thereby promoting growth of beneficial gut bacteria in the individual.

2. The method of claim 1, wherein the bacterium is not Bifidobacterium longum subsp. infantis (B. infantis), or B. bifidum.

3. The method of claim 1, wherein the bacterium further expresses a second alpha-fucosidase.

4. (canceled)

5. The method of claim 1, wherein the at least one alpha-fucosidase is heterologous.

6. The method of claim 1, wherein the bacterium is selected from the group consisting of Lactobacillus and Bifidobacterium.

7. The method of claim 6, wherein the Lactobacillus is selected from the group consisting of L. casei, L. paracasei, and L. rhamnosus.

8. The method of claim 6, wherein the Bifidobacterium is selected from the group consisting of B. adolescentis, B. catenulatum, B. pseudocatenulatum, B. dentium, B. longum, and B. breve.

9. The method of claim 1, wherein the bacterium is Bifidobacterium breve (B. breve).

10. The method of claim 1, wherein the composition further comprises an oligosaccharide.

11. The method of claim 10, wherein the oligosaccharide is a fucosylated oligosaccharide.

12. The method of claim 10, wherein the oligosaccharide is a milk oligosaccharide.

13. The method of claim 10, wherein the oligosaccharide is a human milk oligosaccharide (HMO).

14. The method of claim 10, wherein the composition does not include an oligosaccharide containing an N-glycolylneuraminic acid residue.

15. (canceled)

16. A composition comprising a beneficial gut bacterial strain that expresses at least one alpha-fucosidase, the composition further comprising at least one oligosaccharide.

17. The composition of claim 16, wherein the bacterial strain is not Bifidobacterium longum subsp. infantis (B. infantis) or B. bifidum.

18. The composition of claim 16, wherein the beneficial gut bacterial strain expresses at least two alpha-fucosidases.

19. The composition of claim 16, wherein the beneficial gut bacterial strain expresses a GH-29 family or GH-95 family alpha-fucosidase.

20. The composition of claim 16, wherein the beneficial gut bacterial strain is selected from the group consisting of Lactobacillus and Bifidobacterium.

21. The composition of claim 20, wherein the Lactobacillus is selected from the group consisting of L. casei, L. paracasei, and L. rhamnosus.

22. The composition of claim 20, wherein the Bifidobacterium is selected from the group consisting of B. adolescentis, B. catenulatum, B. pseudocatenulatum, B. dentium, B. longum, and B. breve.

23-44. (canceled)

45. A method of making a beneficial bacterial strain of Bifidobacterium or Lactobacillus comprising: transfecting a Bifidobacterium or Lactobacillus with an expression cassette comprising a polynucleotide encoding GH-29 or GH-95 operably linked to a promoter; and selecting for and isolating Bifidobacterium or Lactobacillus containing the expression cassette.

46. (canceled)

47. The method of claim 45, wherein the Bifidobacterium is a strain of Bifidobacterium breve (B. breve).

48. The method of claim 45, wherein the Bifidobacterium does not express endogenous GH-29 or GH-95.

49. The method of claim 1, wherein the at least one alpha-fucosidase includes a GH-29 family alpha-fucosidase.

50. The method of claim 1, wherein the at least one alpha-fucosidase includes a GH-95 family alpha-fucosidase.

51. The composition of claim 16, wherein the oligosaccharide comprises 7-10 saccharides.

52. The composition of claim 16, wherein the at least one alpha-fucosidase is heterologous.

53. The composition of claim 16, wherein the at least one alpha-fucosidase includes a GH-29 family alpha-fucosidase.

54. The composition of claim 16, wherein the at least one alpha-fucosidase includes a GH-95 family alpha-fucosidase.

55. The composition of claim 16, wherein the composition is in dried form.

56. The composition of claim 16, wherein the composition is formulated in a food or beverage.

57. The composition of claim 16, wherein the oligosaccharide is a fucosylated oligosaccharide.

58. The composition of claim 16, wherein the oligosaccharide comprises sialic acid or N-acetyl hexosamine.

59. The composition of claim 16, wherein the composition does not include an oligosaccharide containing an N-glycolylneuraminic acid.

60. The composition of claim 16, wherein the oligosaccharide is a milk oligosaccharide.

61. The composition of claim 16, wherein the oligosaccharide is galactooligosaccharide.

62. The composition of claim 16, further comprising a food grade excipient or filler.

63. The composition of claim 16, further comprising a pharmaceutically compatible carrier.

64. The composition of claim 16, wherein the composition includes a GH-29 family alpha-fucosidase and a GH-95 family alpha-fucosidase.

65. A food composition comprising a beneficial gut bacterial strain that expresses at least one alpha-fucosidase, the food composition further comprising a fucosylated oligosaccharide with at least 7-10 saccharide residues.

66. The food composition of claim 65, wherein the food composition further comprises milk protein.

67. The food composition of claim 65, wherein the food composition is an infant cereal.