U.S. patent application number 14/368508 was filed with the patent office on 2015-01-08 for human arginase and site-directed pegylated human arginase and the use thereof.
The applicant listed for this patent is BIO-CANCER TREATMENT INTERNATIONAL LTD. (SHANGHAI). Invention is credited to Li Chen, Ning Man Cheng.
Application Number | 20150010522 14/368508 |
Document ID | / |
Family ID | 48675657 |
Filed Date | 2015-01-08 |
United States Patent
Application |
20150010522 |
Kind Code |
A1 |
Cheng; Ning Man ; et
al. |
January 8, 2015 |
Human arginase and site-directed pegylated human arginase and the
use thereof
Abstract
The present invention provides a site-directed mutated arginase
and the preparation method thereof, and the use of said
site-directed mutated arginase in preparing a medicament for
treating an arginase-related disease. The present invention also
provides a site-directed pegylated arginase and the preparation
method thereof, and the use of said pegylated arginase in preparing
a medicament for treating an arginase-related disease.
Inventors: |
Cheng; Ning Man; (Hong Kong,
HK) ; Chen; Li; (Hong Kong, HK) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BIO-CANCER TREATMENT INTERNATIONAL LTD. (SHANGHAI) |
Shanghai |
|
CN |
|
|
Family ID: |
48675657 |
Appl. No.: |
14/368508 |
Filed: |
December 23, 2012 |
PCT Filed: |
December 23, 2012 |
PCT NO: |
PCT/CN2012/087240 |
371 Date: |
August 27, 2014 |
Current U.S.
Class: |
424/94.3 ;
435/188 |
Current CPC
Class: |
C12N 9/96 20130101; A61K
38/00 20130101; A61K 38/50 20130101; A61P 7/00 20180101; A61P 35/04
20180101; A61P 35/00 20180101; C12N 9/78 20130101; A61P 43/00
20180101; C12Y 305/03001 20130101; A61P 35/02 20180101 |
Class at
Publication: |
424/94.3 ;
435/188 |
International
Class: |
C12N 9/78 20060101
C12N009/78; C12N 9/96 20060101 C12N009/96 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 27, 2011 |
CN |
201110445965.8 |
Mar 16, 2012 |
CN |
201210069605.7 |
Claims
1. (canceled)
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. A pegylated arginase, wherein said arginase is human arginase I;
the pegylation of said arginase is site-specific and any one or two
of the cysteines at positions 45, 168 and 303 of amino acid
sequence of SEQ ID NO:1 is/are pegylated; said site-specific
pegylation is achieved by site-directed mutation of cysteine to
other amino acid at any one or two of said cysteine positions which
is/are not to be pegylated, and followed by site-specific
pegylation of mutant arginase at the cysteine residue; wherein in
said arginase, (1) any one or two of the cysteines at positions 45,
168 and 303 of said SEQ ID NO:1 is/are mutated to alanine; or (2)
substitution, deletion, insertion, addition or inversion of one or
more amino acids is introduced in said SEQ ID NO:1; wherein said
arginase has activity.
7. (canceled)
8. The pegylated arginase of claim 6, wherein any one of said
cysteines at positions 45, 168 and 303 of said SEQ ID NO:1 is
mutated to alanine.
9. The pegylated arginase of claim 6, wherein said arginase is
conjugated with polyethylene glycol (PEG): said PEG has an average
molecular weight of 20K, 30K or 40K.
10. The pegylated arginase of claim 6, wherein said arginase has a
half-life of at least 0.5 day.
11. (canceled)
12. (canceled)
13. A pharmaceutical composition for treating an arginase-related
disease comprising said pegylated arginase of claim 6.
14. A method for treating an arginase-related disease, comprising
administrating said pegylated arginase of claim 6.
15. The pegylated arginase of claim 6, wherein said cysteine at
position 303 of said SEQ ID NO:1 is mutated to alanine.
16. The pegylated arginase of claim 15, wherein the site-specific
pegylation is carried out at Cys45 and Cys168; said PEG has an
average molecular weight of 20K or 30K.
17. The pegylated arginase of claim 6, wherein said cysteines at
positions 45 and 303 of said SEQ ID NO:1 are mutated to
alanine.
18. The pegylated arginase of claim 17, wherein the site-specific
pegylation is carried out at Cys168; said PEG has an average
molecular weight of 40K.
19. The pegylated arginase of claim 6, wherein said cysteines at
positions 168 and 303 of said SEQ ID NO:1 are mutated to
alanine.
20. The pegylated arginase of claim 19, wherein the site-specific
pegylation is carried out at Cys45; said PEG has an average
molecular weight of 40K.
21. The pegylated arginase of claim 6, wherein said site-specific
pegylation is cysteine-specific and carried out at the cysteine
residue; said cysteine-specific pegylation is achieved by
covalently linking polyethylene glycol with the thiol group of
cysteines on said arginase by methoxy polyethylene glycol
maleimide.
22. The pegylated arginase of claim 6, wherein the purity of said
pegylated arginase is above 70%.
23. The pharmaceutical composition of claim 13, wherein said
disease is selected from hyperargininemia and arginine-dependent
hyperplasia or tumor.
24. The method of claim 14 wherein said disease is selected from
hyperargininemia and arginine-dependent hyperplasia or tumor.
Description
[0001] This application claims priorities from the Chinese Patent
Application No. 201110445965.8, filed on Dec. 27, 2011, entitled
"Human arginase and pegylated human arginase and the use thereof",
and from the Chinese Patent Application No. 201210069605.7, filed
on Mar. 16, 2012, entitled "Human arginase and site-directed
pegylated human arginase and the use thereof", which are
incorporated herein by reference in their entirety.
REFERENCE TO SEQUENCE LISTING
[0002] The hard copy of the sequence listing submitted herewith and
the corresponding computer readable form are both incorporated
herein by reference in their entireties.
FIELD OF INVENTION
[0003] The present invention provides an arginase, the preparation
method thereof and the use thereof in the treatment of
arginase-related diseases. Specifically, the present invention
provides a site-directed mutated arginase, the preparation method
thereof and the use thereof in the treatment of arginase-related
diseases. The present invention also provides a site-directed
pegylated arginase, the preparation method thereof and the use
thereof.
BACKGROUND OF THE INVENTION
[0004] Arginine is an important amino acid in mammals including
human, which is involved in various physiological processes,
including cell proliferation and growth. For example, arginine is
an immediate precursor for the synthesis of the potential signal
molecule nitric oxide (NO). NO functions as a neurotransmitter, a
muscle relaxant or a vasodilator. The biosynthesis of NO involves
nitric oxide synthase catalyzed Ca.sup.++ and NADPH-dependent
reactions. Another function of arginine is as a precursor for
polyamine, spermidine or spermine and participates in different
physiological processes.
[0005] Studies showed that when arginine is less than 8 .mu.M,
cancer cells undergo irreversible death (Srorr & Burton, 1974,
The effects of arginine deficiency on lymphoma cells. Br. J. Cancer
30, 50). By studying the effect on cell growth, it was found that
upon removal of arginine, the normal cells in the cell cycle G0
phase would enter a resting state and remain viable for several
weeks without significant damage; when the concentration of
arginine returned to normal level, the cells would return to normal
cell cycle. However certain tumor cells would proceed from the `R`
point of the cell cycle G1 phase to S phase at deprivation of
arginine, and undergo apoptosis soon. The apoptosis of tumor cells
as a result of arginine deficiency is irreversible. Therefore,
scientists began to consider treating cancers by controlling the
level of arginine in the body, especially for auxotrophic tumors
such as liver cancer and melanoma. This approach has now been used
to study the inhibition of various tumors.
[0006] Arginase is the enzyme catalyzing the hydrolysis of
L-arginine to ornithine and urea. In general, arginase is expressed
in liver, kidney and testis of the urea-producing animals (mammals,
elasmobranchs, amphibians, and turtles) as one of the enzymes in
the urea cycle. Arginase catalyzes the final step of the urea
recycle pathway in mammals, converting arginine to ornithine and
urea. In most mammals, the family of arginase includes arginase I
and arginase II. Arginase I is mainly expressed in the liver cells,
and arginase II is mainly expressed in the kidney and
erythrocytes.
[0007] There are two methods to produce arginase; of which one is
to separate it from the arginase producing organism, and the other
is through recombinant genetic engineering techniques. The latter
has its advantages. For example, experiments have showed that a
great amount of arginase could be produced by E. coli. However,
there may be technical problems to produce arginase through
recombinant genetic engineering techniques, such as low enzyme
activity or poor stability and short half-life in vivo, limiting
its application in clinical practice.
[0008] U.S. Pat No. 7,951,366B2 disclosed a pharmaceutical
composition and method for the treatment of human malignant tumor
by arginine depletion using recombinant human arginase I with
his-tag, wherein the arginase is modified by covalently conjugating
with polyethylene glycol of molecular weight of 5,000 (MW 5,000) at
the N-terminal or the amine group on the surface of the arginase.
The modified human arginase had an increased stability with a
half-life of 3 days in human serum.
[0009] US20100247508A1 disclosed a modified human arginase with
his-tag, wherein the 168 and 303 cysteines are replaced with
serines and the arginase is pegylated with polyethylene glycol of a
molecular weight of 20 KDa. Like the recombinant human arginase I
disclosed in U.S. Pat. No. 7,951,366B2, an additional peptide
fragment, His-tag is included in the amino acid sequence of the
arginase. The drug regulatory agencies in most countries do not
recommend the use of these peptide fragments. For example, China
State Food and Drug Administration indicates in the "Technical
Quidelines on the Quality Control of Recombinant DNA Product for
Human Use" that additional peptide fragments such as His-tag
introduced for the purpose of simplifying the production process
should be removed as far as possible from the final product.
[0010] WO 2011/008495A2 disclosed a site-directed modified
arginase, in which the three cysteines were retained and another
cysteine residue is introduced substituting the third amino acid
residue of the N-terminus, and then pegylated with methoxy
polyethylene glycol maleimide of molecular weight of 20 KDa. Since
the said human arginase still carries the original three cysteine
residues, its pegylation product is prone to heterogeneous and low
in yield, which also adds difficulties for purification.
[0011] The present technical field has the need for a better
arginase or derivatives thereof, for the treatment of arginine
related diseases or disorders.
SUMMARY OF THE INVENTION
[0012] The present invention provides an isolated and substantially
pure arginase. Arginase is the enzyme in the final step of the urea
recycle pathway in the synthesis of urea in mammals, converting
arginine to ornithine and urea. In most mammals, the family of
arginase includes arginase I and arginase II. Studies on arginase I
of various origins showed that arginase I of different origins have
a lot of conserved regions and active sites, though their sequence
may be different. As reported by Haraguchi, Y., etc., 1987, Proc.
Natl. Acad. Sci. 84, 412-415, wild-type human arginase I has an
amino acid sequence of SEQ ID NO.1, which comprises three cysteines
at amino acid position 45, 168 and 303. The wild-type human
arginase I has a nucleic acid sequence of SEQ ID NO. 2.
[0013] In the present invention, the term "isolated" refers to a
non-natural form. The term "substantial pure" means that the
product may comprise other components derived from production or
protein modification, yet such other components are substantially
not present or only present in a small ratio.
[0014] In the present invention, the description on the location of
amino acid site is commonly used by the skilled in the art. For
example, the phrase "in position 45 of the sequence of SEQ ID NO.x"
or "Cys (cysteine) in position 45 of the sequence of SEQ ID NO.x"
or "Cys45" all refers to the 45.sup.th amino acid residue in the
amino sequence or the cysteine in position 45.
[0015] In one aspect, the present invention provides a mutant
arginase, which is a human arginase I comprising [0016] (1) an
amino acid sequence of SEQ ID NO:1, wherein any one, two or three
of the cysteines at positions 45, 168 and 303 is/are mutated, or
[0017] (2) an amino acid sequence wherein substitution, deletion,
insertion, addition or inversion of one or more amino acids is
introduced in the amino acid sequence defined in (1),
[0018] and which has arginase activity.
[0019] In one aspect, the cysteines in the arginase of the present
invention are mutated to non-polar amino acids. According to the
properties of their side chain, the amino acids can be classified
as polar or non-polar amino acids. Amino acids having side chains
being uncharged or weakly polarized are called non-polar amino
acids, such as, glycine, alanine, valine, leucine, isoleucine,
methionine, phenylalanine, tryptophan and proline.
[0020] In one aspect, the cysteines in the arginase of the present
invention are independently mutated to glycine, alanine, valine,
leucine, isoleucine, methionine, phenylalanine, tryptophan or
proline. Preferably, the cysteines are independently mutated to
alanine. The present invention has unexpectedly found that the
enzymatic activity of human arginase I is significantly increased
when the cysteine, which is a non-ionic polar amino acid is mutated
to a non-polar amino acid (such as alanine). One of the possible
reasons is the binding between the mutant arginase and the
substrate is enhanced.
[0021] In one aspect, one of the cysteines at positions 45, 168 and
303 of the arginase of the present invention is mutated. In a
further aspect of the present invention, cysteine at position 303
is mutated. Preferably, said cysteine is mutated to glycine,
alanine, valine, leucine, isoleucine, methionine, phenylalanine,
tryptophan or proline; and more preferably, said cysteine is
mutated to alanine.
[0022] In one aspect, any two of the cysteines at positions 45, 168
and 303 of the arginase of the present invention are mutated. In a
further aspect of the present invention, cysteines at positions 45
and 303 are mutated. Preferably, said cysteines are mutated to
glycine, alanine, valine, leucine, isoleucine, methionine,
phenylalanine, tryptophan or proline; and more preferably, said
cysteins are mutated to alanine. In one aspect, cysteines at
positions 168 and 303 of the amino acid sequence of SEQ ID NO. 1 in
the arginase of the present invention are mutated. Preferably, said
cysteines are mutated to glycine, alanine, valine, leucine,
isoleucine, methionine, phenylalanine, tryptophan or proline; and
more preferably, said cysteines are mutated to alanine. In one
aspect, cysteines at positions 45 and 303 of the amino acid
sequence of SEQ ID NO. 1 in the arginase of the present invention
are mutated. Preferably, said cysteines are mutated to glycine,
alanine, valine, leucine, isoleucine, methionine, phenylalanine,
tryptophan or proline; and more preferably, said cysteines are
mutated to alanine.
[0023] In one aspect, cysteines at positions 45, 168 and 303 of the
amino acid sequence of SEQ ID NO. 1 in the arginase of the present
invention are mutated. Preferably, said cysteines are mutated to
glycine, alanine, valine, leucine, isoleucine, methionine,
phenylalanine, tryptophan or proline; and more preferably, said
cysteines are mutated to alanine.
[0024] The arginase of the present invention has higher enzymatic
activity than the wild-type arginase. The arginase of present
invention generally has a specific activity of at least about 500
U/mg; preferably, the activity is at least about 700 U/mg; and more
preferably, the activity is at least about 800 U/mg. Arginase of
the present invention generally has higher enzymatic activity than
the wild-type arginase.
[0025] In one aspect of the present invention, the arginase has a
nucleotide sequence of SEQ ID NO. 2, wherein at least one codon for
amino acid residue cysteine at position 45, 168 and 303 of the
amino acid sequence of SEQ ID NO.1 is substituted. Preferably, one,
two or three of the codons for cysteine is/are substituted. Amino
acids are encoded by polynucleotides. A three-nucleotide codon in a
messenger RNA defines a single amino acid. In one aspect of the
present invention, the nucleotide substitution is the codon TGT
substituted by a codon encoding for glycine, alanine, valine,
leucine, isoleucine, methionine, phenylalanine, tryptophan or
proline. Preferably, the codon TGT is substituted by a codon
encoding for alanine.
[0026] In one aspect of the present invention, said codons encoding
for alanine is GCT, GCC, GCA, GCG, and preferably is GCT.
[0027] In one aspect, the present invention provides a method for
preparing the arginase mentioned above, including expressing the
gene of the arginase or mutant arginase in a host which is able to
express the protein. The preparation method for the arginase of
present invention generally includes the following major steps.
Desired genes or nucleotide fragments are obtained by PCR or
synthetic method. The DNA fragment with the desired gene is linked
with a vector, such as a plasmid, phage or virus, which can
replicate independently and has a selection marker to form
recombinant DNA molecules. The ligation of DNA fragments into a
vector is mainly through homopolymer tails, cohesive ends,
blunt-end or artificial linker. Recombinant DNA has to be
introduced into the host cell in order to be multiplied and
expressed. According to the different properties of the vectors,
transfection, transformation, transduction are carried out so that
the recombinant DNA molecules are introduced into a host cell and
multiplied. Suitable genetic engineering hosts are well known in
the art, which include Escherichia coli, yeast, insect cells and
the like.
[0028] The present invention also provides an isolated and
substantially pure pegylated arginase, characterized in that the
pegylation is site-specific. In said pegylated arginase,
polyethylene glycol molecule is covalently linked with the
specified amino acid residues of the arginase to achieve the
site-specific pegylation. In the present invention, each of the
arginase is linked with at least one polyethylene glycol molecule
to form the pegylated arginase.
[0029] In one aspect of the present invention, the arginase in said
pegylated arginase is the mutant arginase as previously
defined.
[0030] In one aspect, the present invention provides a pegylated
arginase, wherein the arginase is a human arginase I which
comprises [0031] (1) an amino acid sequence of SEQ ID NO:1, wherein
any one or two of cysteines at positions 45, 168 and 303 is/are
mutated, or [0032] (2) an amino acid sequence wherein substitution,
deletion, insertion, addition or inversion of one or more amino
acids is introduced in the amino acid sequence defined in (1),
[0033] and which has arginase activity.
[0034] In one aspect, the cysteines in the pegylated arginase of
the present invention are independently mutated to non-polar amino
acid. The structures of the 20 amino acids are different due to the
difference of their side chain. Amino acids having side groups
being uncharged or weakly polarized belong to non-polar amino
acids, such as, glycine, alanine, valine, leucine, isoleucine,
methionine, phenylalanine, tryptophan and proline.
[0035] In one aspect of the invention, the pegylated arginase I
does not comprise a tag sequence for use in the purification, such
as a His-tag sequence added at the C or N terminus. His-tag fusion
protein is the most common means of protein expression, which has
the advantage of easy for purification and without significant
effect to the activity of the protein. Protein expression products
either in soluble form or in inclusion body could be purified by
immobilized metal ion affinity chromatography. On the other hand,
because of the potential immunogenicity property, China State Food
and Drug Administration indicates in the "Technical Quidelines on
the Quality Control of Recombinant DNA Product for Human Use" that
additional peptide fragments such as His-tag introduced for the
purpose of simplifying the production process should be removed as
far as possible from the final product.
[0036] In the present invention, the pegylation of the arginase can
be achieved by chemical modification, said modification can be
carried out by using a polyethylene glycol derivative with a
coupling agent (also referred to as a pegylation reagent) to
covalently link a polyethylene glycol molecule with a group on the
arginase. Said chemical modification can be specific, i.e.
conjugate PEG molecules with a specific group on the arginase by
using coupling reagents with specific binding activities.
Site-directed pegylation conforms to the following principles: (1)
modification of the protein active site should be avoided as far as
possible to prevent its negative effect on protein activity; and
(2) the entire process should be as simple as possible to be
controllable. Common polyethylene glycol molecule has a hydroxyl
group at each end thereof. A methoxy polyethylene glycol (mPEG) is
a polyethylene glycol blocked in one end with a methoxy group. The
most commonly studied pegylation reagents used in the modification
of peptides or proteins are derivatives of methoxy polyethylene
glycol (mPEG). One of the common pegylation method is to covalently
link polyethylene glycols or pegylation reagents with
.epsilon.-NH.sub.2 of surface lysine or N-terminal .alpha.-NH.sub.2
of the protein, such as methoxy polyethylene glycol succinimidyl
butyrate (mPEG-SBA), mPEG-succinimidyl propionate (mPEG-SPA),
mPEG-succinimidyl succinate (mPEG-SS), mPEG-succinimidyl carbonate
(mPEG-SC), mPEG-Succinimidyl Glutarate (mPEG-SG),
mPEG-N-hydroxyl-succinimide (mPEG-NHS), mPEG-tresylate and
mPEG-aldehyde. Another common pegylation method is to selectively
use of polyethylene glycols or pegylation reagents which can
specifically conjugated with the thiol group of proteins, such as
mPEG-maleimide, mPEG-ortho-pyridyl-disulphide, mPEG-vinylsulfone
and mPEG-iodoacetamide to modify the thiol group of peptides or
proteins. Since the number of thiol groups in proteins or peptides
is relative small, it is generally easy to achieve a homogeneous
pegylation product.
[0037] Human arginase has three cysteine residues located at
positions 45, 168 and 303 of the amino acid sequence. In one aspect
of the present invention, said pegylated arginase has site-specific
pegylation at one or two said cysteine positions.
[0038] In one aspect of the present invention, said site-specific
pegylation is achieved by site-directed mutagenesis of the cysteine
of the arginase and followed by site-specific pegylation of mutant
arginase at cysteine residue. In a further aspect of the present
invention, said cysteine-specific pegylation is achieved by
covalently linking PEG with the thiol group of cysteine on the
arginase by methoxy polyethylene glycol -maleimide.
[0039] In one aspect of the present invention, said site-specific
pegylation is achieved by site-directed mutagenesis of cysteine to
other amino acid at one or two cysteine positions which is/are not
to be pegylated, and preferably mutated to alanine, glycine,
valine, leucine, isoleucine, methionine, phenylalanine, tryptophan
or proline; and more preferably, said cysteine(s) is/are mutated to
alanine.
[0040] The selection of molecular weight of the PEG should make a
comprehensive consideration of the bio-activity and the
pharmacokinetics properties. Studies showed that the acting time of
the modified protein drugs in the body is correlated with the
numbers and molecule weight of PEG conjugated. The PEG used for the
present invention has a molecule weight ranging from 5K to 40K,
linear or branched. The PEG used for the present invention can be
PEG derivatives used in the technical field. The PEG used for the
present invention is not limited to certain specified types. In one
aspect of the present invention, the average molecular weight of
the PEG molecule covalently linked with the arginase is about 20K,
30K, or 40K. Pegylated proteins can be administrated by intravenous
injection. The average molecular weight of the polyethylene glycol
may affect the serum half-life thereof. Studies found that renal
clearance of PEG depends on its glomerular filtration rate. The
glomeruli can allow proteins with molecular weight smaller than 70
KDa or PEGs with molecular weight smaller than 30 KDa to be
filtered. The Effect of molecular weight of PEG on the half-life
and activity of the bound protein is usually unpredictable, which
is in general closely related with the molecular weight of protein,
mode of action, active site, and PEG-binding site of protein.
[0041] In one aspect of the present invention, the pegylated
arginase is site-directed pegylated at positions 45 and 168 of
amino acid sequence of SEQ ID NO:1, and preferably, said
site-directed pegylation is achieved by mutagenesis of the cysteine
at position 303 of the arginase; and the average molecular weight
of the PEG is about 20K or 30K. Preferably the said cysteine is
mutated to alanine, glycine, valine, leucine, isoleucine,
methionine, phenylalanine, tryptophan or proline; and more
preferably, said cysteine is mutated to alanine,
[0042] In one aspect of the present invention, the pegylated
arginase is site-directed pegylated at position 168 of amino acid
sequence of SEQ ID NO:1; and preferably, said site-directed
pegylation is achieved by mutagenesis of the cysteines at positions
45 and 303 of the arginase, and the average molecular weight of the
PEG is about 40K. Preferably the said cysteines are mutated to
alanine, glycine, valine, leucine, isoleucine, methionine,
phenylalanine, tryptophan or proline; and more preferably, the said
cysteines are mutated to alanine,
[0043] In one aspect of the present invention, the pegylated
arginase is site-directed pegylated at position 45 of amino acid
sequence of SEQ ID NO:1; and preferably, said site-directed
pegylation is achieved by mutagenesis of the cysteine at positions
168 and 303 of the arginase, and the average molecular weight of
the PEG is about 40K. Preferably the said cysteines are mutated to
alanine, glycine, valine, leucine, isoleucine, methionine,
phenylalanine, tryptophan or proline; and more preferably, said
cysteines are mutated to alanine,
[0044] The present invention provides a pegylated arginase having a
purity of more than 70%; preferably, the purity is more than 80%;
and more preferably, the purity is more than 90%. In the present
invention, the term "purity of pegylated arginase" means the
percentage of the pegylated arginase (i.e., arginase covalently
linked with PEG) in the total arginase (arginase covalently linked
with PEG, arginase not covalently linked with PEG and polymeric
pegylated arginase). Generally, the product needs further
purification because it contains arginase not covalently linked
with PEG and polymeric pegylated arginase. Commonly used means of
purification technique are known in the art, including the cation
exchange chromatography, etc.
[0045] The pegylated arginase of the present invention has a
half-life of at least 0.5 day; preferably, said arginase has a
half-life of at least 2.5 days; and more preferably, said arginase
has a half-life of at least 3.5 days in the blood or serum. The
half-life of the arginase can be measured with the known and
commonly used method in the art. There is certain relationship
between the data measured for the half-life of arginase in the
blood or serum and the animal model used. The half-life data
obtained in an animal with higher metabolic rate (e.g., rat) is
generally shorter than that of with lower metabolic rate (e.g.,
human).
[0046] The present invention provides a method for preparing a
pegylated arginase, wherein the pegylation is site-specific. In the
pegylated arginase of the present invention, the PEG molecule is
conjugated with the specific group on the arginase to achieve the
site-specific pegylation. In the pegylated arginase of the present
invention, each arginase molecule is linked with at least one PEG
molecule to form the pegylated arginase.
[0047] In the present invention, site-directed pegylation is
achieved by chemical modification, wherein said modification is
carried out by covalently conjugating PEG molecules with the groups
on the arginase in the presence of coupling reagent. Said chemical
modification can be specific, that is, the PEG molecule only
conjugates with specific amino acid residue of the arginase using
reagents that bind with specific group.
[0048] The present invention also provides the application/use of
the arginase or the pegylated arginase mentioned above or the
pharmaceutical composition containing the same in treating an
arginase-related disease. Said arginase related diseases known in
the field include conditions/disease/disorders related with
arginine level in the body of mammals. Such
conditions/disease/disorders include hyperargininemia. Due to
arginase deficiency, the arginine in the body of a subject can not
be degraded into urea and participate in the ornithine metabolism
cycle, so that the blood arginine level can be 7 to 10 times higher
than normal blood value, at the same time the arginine level in the
cerebrospinal fluid and urine and urea excretion of creatinine are
also increased. Moreover, said conditions/disease/disorders include
arginine-dependent hyperplasia or tumor. By studying the effect on
cell growth, it was found that upon removal of arginine, the normal
cells in the cell cycle G0 phase would enter a resting state and
remain viable for several weeks without significant damage; when
the concentration of arginine returned to normal level, the cells
would return to normal cell cycle. Cells in proliferation or
tumors, however, would proceed past the `R` point of the cell cycle
G1 phase to enter S phase at the deprivation of arginine, and
undergo apoptosis soon. The apoptosis of hyperplasia cells or tumor
cells as a result of arginine deficiency is irreversible.
Therefore, scientists began to consider treating hyperplasia or
tumor by controlling the level of arginine in the body.
[0049] The present invention also provides a pharmaceutical
composition, wherein the active ingredient of the said
pharmaceutical composition of the present invention is the arginase
or the pegylated arginase as described above. The formulation of
said pharmaceutical composition can be in the form of solid,
solutions, emulsions, dispersions, micelles, liposomes, wherein the
formulation contains one or more of the human arginase or pegylated
arginase of the present invention as active ingredient and admixed
with organic or inorganic carrier or excipient suitable for
parenteral applications. Furthermore, adjuvants, stabilizers,
thickeners, coloring agents and perfumes can be included. One or
more isolated and substantially pure human arginases or pegylated
arginases of the present invention are comprised as active
ingredient in a sufficient amount to produce the desired effect on
the conditions or diseases. The pharmaceutical compositions may be
formulated in forms suitable for oral administration, such as
tablets, pills, lozenges, hydration or oil based suspensions,
dispersed powders or granules, emulsions, hard or soft capsules, or
syrups. Formulations for oral administration may be encapsulated in
accordance with techniques known in the art to slow down the
decomposition and absorption in the gastrointestinal tract, thereby
providing sustained effects for a longer time. The formulation may
also be a sterile injectable solution or suspension form. The said
suspension can be prepared according to methods known in the art by
using dispersing or wetting agents and suspending agents.
[0050] The pharmaceutical composition of the present invention can
be further formulated into a solid, liquid, suspension, micelle or
liposome form. In one aspect of the present invention, the
pharmaceutical composition is formulated into an oral or injectable
form.
BRIEF DESCRIPTION OF THE DRAWINGS
[0051] FIG. 1 shows the nucleotide sequence of wide type arginase
I.
[0052] FIG. 2 shows SDS-polyacrylamide gel electrophoresis analysis
of human arginase I under reducing condition.
[0053] FIG. 3 shows the expression of human arginase by High
Pressure Liquid Chromatography analysis.
[0054] FIG. 4 shows the test results of wild type and mutant
arginase I with reducing and non-reducing SDS-polyacrylamide gel
electrophresis.
[0055] FIG. 5 shows SDS-polyacrylamide gel electrophoresis analysis
of purified mutant arginase I (rhArgI-A303, rhArgI-A168/303 and
rhArgI-A45/303) under reducing and non-reducing conditions.
[0056] FIG. 6 shows SDS-polyacrylamide gel electrophoresis analysis
of purified mutant arginase I (rhArgI-A45/168 and
rhArgI-A45/168/303) under reducing and non-reducing conditions.
[0057] FIG. 6a shows non-reducing SDS-polyacrylamide gel
electrophoresis analysis of purified mutant arginase I
(rhArgI-A45/168 and rhArgI-A45/168/303).
[0058] FIG. 6b shows reducing SDS-polyacrylamide gel
electrophoresis analysis of purified mutant arginase I
(rhArgI-A45/168 and rhArgI-A45/168/303).
[0059] FIG. 7 shows non-reducing SDS-polyacrylamide gel
electrophoresis analysis of pegylated human arginase I.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION
[0060] This invention will be further illustrated using the
embodiments described below. It should be understood that although
these embodiments illustrate the preferred embodiments of the
present invention, they are only given by ways of illustrated
samples. With reference to the above description and embodiments,
the skilled in the art can determine the essential characteristics
of the invention, change and modify the invention in various ways
in adaptation to other uses and conditions without deviating from
the spirit and scope of the invention. Therefore, other than those
shown and described herein, according to the foregoing, any
changes/modifications made to this invention will be apparent to
the skilled in the art and these modifications are also intended to
form part of the scope of the appended claims.
EXAMPLE 1
Expression and Construction of His-tag-Free Recombinant Human
Arginase I Plasmid pET30a (+)-rharginase-V
[0061] Human arginase I gene sequence was published in 1987
(Haraguchi. Y. et al., 1987, Proc. Natl. Acad. Sci, 84, 412-415).
Human arginase gene was amplified by Polymerase Chain Reaction
(PCR) using human liver 5' stretch plus cDNA library (clontech) as
template and primers ARG-V (+) and ARG-V (-) designed according to
the aforesaid arginase I sequence. Primer ARG-V (+) contains an
NdeI restriction endonuclease site, and and ARG-V (-) primer
contains a XhoI restriction endonuclease site. Using common
laboratory techniques of molecular biology, human arginase I PCR
product was obtained and confirmed by argarose gel electrophoresis.
The above amplified human arginase I PCR product and commercially
available expression vector pET30a (+) were digested with
restriction endonucleases, NdeI and XhoI (Promega) separately at
37.degree. C. for 1.5 h. The digested fragments were ligated
overnight at 16.degree. C. by T4 DNA ligase, and the resulting
ligated recombinant plasmid was transformed into DH5.alpha. E. coli
competent cells. The transformed cells were selected by plating and
culturing on a kanamycin (30 .mu.g/ml) containing LB agar plate.
Plasmids containing the correct insert were identified by
restriction endonuclease digest assay. The correct recombinant
human arginase I expression plasmid, hereafter known as pET30a
(+)-rharginase-V, was analyzed by sequencing to ensure the correct
sequence and insertion of human arginase I gene. The insert size is
969 base pair in length. As shown in FIG. 1, it has a nucleotide
sequence of SEQ ID No. 2.
TABLE-US-00001 ARG-V(+): 5' GGAATTCCATATGAGCGCCAAGTCCAGAACCATAG 3'
NdeI ARG-V(-): 5' CCGCTCGAGTTATTACTTAGGTGGGTTAAGGTAGTCAATAGG 3'
XhoI
EXAMPLE 2
Expression of His-tag-Free Recombinant Human Arginase I Plasmid DNA
pET30a (+)-rharginase-V and Purification of Target Protein
[0062] One-hundred .mu.l of competent BL21(DE3) cells were thawed
on ice. One .mu.l of pET30a (+)-V recombinant plasmid was added to
the competent cells and incubated on ice for 30 min. The mixture
was then heat shock treated in a 42.degree. C. water bath for 90s
followed by a further incubation on ice for 2 min. Five-hundred
.mu.l of LB broth was added to the transformed cells and
shake-cultured at 37.degree. C., 150 rpm for 1 h. After incubation,
2000 of the transformed cell suspension was plated and spread on a
kanamycin LB agar plate, which is then incubated upside-down in a
37.degree. C. incubator for 16 h.
[0063] Single colony transformed with recombinant plasmid was
selected, transferred into 25 ml of LB broth and shake-cultured at
37.degree. C., 150 rpm until the optical density 600 nm (OD600 nm)
reaching 0.6-0.8. A final concentration of 0.2 mM IPTG was added to
the culture to induce target protein expression for 3 h. Target
protein expression of the selected clones was analyzed using
SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The clones with
the higher protein expression were stored in glycerol stock as
engineered bacteria.
[0064] The engineered bacteria cells were fed-batch cultured in a
15 L fermentor. When OD600 nm reaches 12-13, a final concentration
of 0.2 mM IPTG was added into the culture to induce target protein
expression for 3-4 h. Induced bacteria cells were collected and
lysed. The cell lysate was centrifuged and the supernatant was
collected for subsequent target protein separation and
purification.
[0065] Target protein purification was performed using CM cation
liquid chromatography. Tris-HCl was used to equibrate the column
prior to sample loading. The lysate supernatant of bacterial cell
was loaded into the column, followed by washing with three column
volumes of equilibration buffer to remove weakly associated or
non-specifically bound impurities. When the reading of UV280 nm
stabilized, the target protein was eluted using an elution buffer
containing Tris-HCl and NaCl. The protein peaks eluted from the
column were collected and analyzed by SDS-PAGE and High Pressure
Liquid Chromatography (HPLC).
[0066] Experimental results were illustrated in FIGS. 2 and 3.
[0067] FIG. 2 shows the result of SDS-PAGE analysis of human
arginase I expression level. The samples in each lane are as
follow:
[0068] 1. protein molecular weight standard; 2. bacterial lysate
supernatant; 3. purified His-tag-free human arginase I; 4. CM
cation exchange column flow through.
[0069] FIG. 3 shows the result of HPLC analysis of purified human
arginase I.
[0070] As shown in FIGS. 2 and 3, the purity of arginase obtained
via the above chromatography procedure is more than 90%.
EXAMPLES 3
Site-Directed Mutagenesis of Human Arginase I (rhArgI)
[0071] Site-directed mutations were introduced at positions 45, 168
and 303 of amino acid sequence of human arginase I using
QuickChange site-directed mutagenesis kit (Stratagene). Recombinant
plasmid pET30a-rharginase I-V containing wild type human arginase
was used as template. Codons that encode for cysteine (TGT) at
positions 45, 168 and 303 were independently mutated to codons that
encode for alanine (GCT), resulting in single, double or
triple-site mutations. The primers intended to introduce the
replacement codon GCT at positions 45, 168, and 303 of human
arginase I are shown as below:
TABLE-US-00002 ARG-m45(+): 5'
GAGAAACTTAAAGAACAAGAGGCTGATGTGAAGGATTATGGGG 3' ARG-m45(-): 5'
CCCCATAATCCTTCACATCAGCCTCTTGTTCTTTAAGTTTCTC 3' ARG-m168(+): 5'
GATTCTCCTGGGTGACTCCCGCTATATCTGCCAAGGATATTG 3' ARG-m168(-): 5'
CAATATCCTTGGCAGATATAGCGGGAGTCACCCAGGAGAATC 3' ARG-m303(+): 5'
GTTGCAATAACCTTGGCTGCTTTCGGACTTGCTCGGG 3' ARG-m303(-): 5'
CCCGAGCAAGTCCGAAAGCAGCCAAGGTTATTGCAAC 3'
[0072] PCR was conducted in accordance with the instruction
provided in the mutagenesis kit. Non-mutated parental DNA template
was digested with restriction endonuclease DpnI. The mutated
plasmids were then transformed into competent cells and confirmed
by sequencing. Clones that were transformed with the mutant
arginase plasmid containing the mutation of cysteine encoding codon
(TGT) to alanine encoding codon (GCT) were selected and expanded in
LB broth culture. Target mutant plasmids were isolated using Wizard
Plus mini prep kit.
[0073] Mutant human arginase I with single cysteine to alanine
mutation at amino acid position 303, 168 or 45 was represented as
rhArgI-A303, rhArgI-A168 or rhArgI-A45 respectively. Mutant human
arginase I with double cysteine to alanine mutations at amino acid
positions 168 and 303, at amino acid positions 45 and 303 and at
amino acid positions 45 and 168 were represented as
rhArgI-A168/303, rhArgI-A45/303 and rhArgI-A45/168 respectively.
Mutant human arginase I with three cysteine to alanine mutations at
amino acid positions 45, 168 and 303 was represented as
rhArgI-A45/168/303. Plasmids containing the above arginase mutant
inserts were represented as pET30a(+)-rhArgI-A303,
pET30a(+)-rhArgI-A168, pET30a(+)-rhArgI-A45,
pET30a(+)-rhArgI-A168/303, pET30a(+)-rhArgI-A45/303,
pET30a(+)-rhArgI-A45/168 or pET30a(+)-rhArgI-A45/168/303.
[0074] One-hundred .mu.l of competent BL21(DE3) cells were thawed
on ice. One .mu. of the mutant construct was added to the BL21(DE3)
competent cells and incubated on ice for 30 min. The mixture was
then heat shock treated at 42.degree. C. for 90 s, followed by a
further incubation on ice for 2 min. Five-hundred .mu.l of LB broth
was added to the transformed cells and shake-cultured at 37.degree.
C., 150 rpm for 1 h. After incubation, 2000 of the transformed cell
suspension was plated and spread on a kanamycin LB agar plate and
incubated upside-down at 37.degree. C. for 16 h.
[0075] Single colony transformed with recombinant plasmid was
selected, transferred into 25 ml of LB broth, and shake-cultured at
37.degree. C., 150 rpm, until the optical density at 600 nm
(OD600nm) reaching 0.6-0.8. A final concentration of 0.2mM IPTG was
added to the culture to induce target protein expression for 3 h.
Target protein expression in the selected clones was analyzed using
SDS-PAGE. The clones with higher protein expression were stored in
glycerol stock as engineered bacteria.
EXAMPLE 4
Expression and Protein Purification of Site Specific Mutated
Arginase I
[0076] Engineered E. coli cells transformed with mutant arginase I
(rhArgI) plasmids (pET30a(+)-rhArgI-A303, pET30a(+)-rhArgI-A168,
pET30a(+)-rhArgI-A45, pET30a(+)-rhArgI-A168/303,
pET30a(+)-rhArgI-A45/303, pET30a(+)-rhArgI-A45/168 or
pET30a(+)-rhArgI-A45/168/303) were fed-batch cultured in a 15L
fermentor. When OD600 nm reached 12-13, a final concentration of
0.2 mM IPTG was added to the culture to induce target protein
expression for 3-4 h. The bacterial cells were collected and lysed.
The cell lysate was centrifuged and the supernatant was collected
for subsequent protein isolation and purification.
[0077] Target protein purification was performed using CM cation
exchange column. Tris-HCl was used to equilibrate the column prior
to sample loading. The lysate supernatant of bacterial cells was
loaded into the column, followed by washing with three times column
volume of equilibration buffer to remove weakly associated or
non-specifically bound impurities. When the reading of UV280 nm
stabilized, target protein was eluted using an elution buffer
containing Tris-HCl and NaCl. The protein peaks eluted from the
column were collected to obtain mutant arginase I rhArgI-A303,
rhArgI-A168, rhArgI-A45, rhArgI-A168/303, rhArgI-A45/303,
rhArgI-A45/168 and rhArgI-A45/168/303.
[0078] Purity of the collected protein samples was analyzed by
SDS-PAGE and HPLC. Using the above chromatography procedure, the
purity of arginase was determined to be more than 90%.
EXAMPLE 5
Activity of Site-Specific Mutant Arginase I (rhArgI)
[0079] The activity of arginase was determined by a
spectrophotometric assay coupled with urease and glutamate
dehydrogenase, which is shown by schematic diagram below. NADPH has
optimal absorbance at the wavelength of 340 nm. When NADPH is
oxidised to NADP+, the absorbance at 340 nm decrease. The activity
of arginase can be correlated and determined by monitoring the
decrease in absorbance at 340 nm together with the molar extinction
coefficient of NADPH (.DELTA.E340=6220 M.sup.-1 cm.sup.-1).
##STR00001##
[0080] One Unit (U) of arginase activity was defined as the release
of 1 .mu.mol urea under the condition of 30.degree. C., pH 8.3.
[0081] Specific activity of arginase was calculated using the
following equation:
Specific
activity(U/mg)=[(.DELTA.A/.DELTA.t).times.(1/.epsilon.).times.1-
0.sup.6.times.(1/2)]/[E]
[0082] .DELTA.A=Differences in absorbance at 340 nm
[0083] .epsilon.=NADPH Michaelis-Menten constant(Km) (6220
M.sup.-1cm.sup.-1)
[0084] [E]=enzyme concentration in the reaction mixture (mg/mL)
[0085] Using the above assay, the specific activity of various
mutant arginase I (rhArgI-A303, rhArgI-A168/303, rhArgI-A45/303,
rhArgI-A45/168 and rhArgI-A45/168/303) were determined to be
747.+-.63 U/mg, 814.+-.91 U/mg, 786.+-.58 U/mg, 782.+-.19 U/mg, and
759.+-.68 U/mg respectively. The specific activity of wild type
human arginase I was determined to be 491.+-.42 U/mg, demonstrating
a significant increase of arginase activity after the non-polar
nonionic amino acid cysteines at positions 168/303, 45/303, 45/168
and 45/168/303 were mutated to non-polar amino acid alanines.
EXAMPLE 6
SDS-PAGE Analysis of Wild Type and Mutant Arginase I (rhArgI)
[0086] The polyacrylamide gel was prepared using traditional
method. Samples were treated under reducing (i.e.
.beta.-mecaptoethanol was included in the sample loading buffer to
destroy inter and intra molecular disulfide bonds) or non-reducing
condition prior to analysis to decipher the intramolecular
disulfide bridge formation of wild type and various mutant arginase
I using 12% polyacrylamide gel electrophoresis (FIG. 4, 5, 6A,
6B).
[0087] FIG. 4 shows the result of SDS-PAGE analysis of wild type
arginase I after treatment under reducing and non-reducing
conditions. The samples in the lanes are as follow: Lane 1 and 3:
bacterial cell lysate supernatant; Lane 2: purified His-tag-free
arginase (non-reducing); M: protein molecular weight standard; Lane
4: purified His-tag-free human arginase I (reducing).
[0088] FIG. 5 shows the result of SDS-PAGE analysis of purified
mutant arginase I (rhArgI-A303, rhArgI-A168/303 and rhArgI-A45/303)
under reducing and non-reducing conditions. The samples in each
lane are as follow: Lane 1: mutant arginase I, rhArgI-A303
(non-reducing); Lane 2: mutant arginase I, rhArgI-A168/303
(non-reducing); Lane 3: mutant arginase I, rhArgI-A45/303
(non-reducing); M: protein molecular weight standard; Lane 4:
mutant arginase I, rhArgI-A303 (reducing); Lane 5: mutant arginase
I, rhArgI-A168/303 (reducing); Lane 6: mutant arginase I,
rhArgI-A45/303 (reducing).
[0089] FIG. 6a shows the result of SDS-PAGE analysis of purified
mutant arginase I (rhArgI-A45/168 and rhArgI-A45/168/303) under
non-reducing condition. The samples in each lane are as follow: M:
protein molecular weight standard; Lane 1: mutant arginase I,
rhArgI-A45/168/303; Lane 2: mutant arginase I, rhArgI-A45/168.
[0090] FIG. 6b shows the result of SDS-PAGE analysis of purified
mutant arginase I (rhArgI-A45/168 and rhArgI-A45/168/303) under
reducing condition. The samples in each lane are as follow: M:
protein molecular weight standard; Lane 1: mutant arginase I,
rhArgI-A45/168/303; Lane 2: mutant arginase I, rhArgI-A45/168.
[0091] As revealed from the SDS-PAGE analysis of arginase I under
reducing and non-reducing conditions, wild type human arginase I
have other conformations under the stated experimental conditions
of this invention. Under such condition, when cysteine at position
303 was mutated to alanine, other conformations were also present.
However, when either two (rhArgI-A168/303, rhArgI-A45/303, or
rhArgI-A45/168) or all of the three cysteine residues at amino acid
positions 45, 168 and 303 were mutated to alanine, only one
conformation was detected under non-reducing condition (FIG. 5 and
FIG. 6 A). Not limited by any known theories, the inventor believes
the presence of multiple conformations for wild type human arginase
I at non-reducing SDS-PAGE is probably due to intramolecular
disulfide bond formation that is contributed by cysteines 45, 168
and 303 under certain conditions. When only cysteine 303 was
mutated to alanine, such conformation of arginase I mutant could
also be detected by SDS-PAGE under non-reducing condition possibly
due to the formation of intramolecular disulfide bonds between
unmutated cysteines 45 and 168. When either two or all of the three
cysteine residues at positions 45, 168 and 303 were mutated
(rhArgI-A168/303, rhArgI-A45/303, rhArgI-A45/168 or
rhArgI-A45/168/303) all possibilities of disulfide bond formation
will be abolished, resulting in only one conformation being
detected in the SDS-PAGE analysis.
EXAMPLE 7
Site-Directed Pegylation of Mutated Arginase I (rhArgI) and
Purification of Pegylated Protein
[0092] Site-specific arginase I mutants (rhArgI-A303,
rhArgI-A168/303 or rhArgI-A45/303) were mixed separately with
methoxy polyethylene glycol maleimide in a molar ratio range of
1:5-1:10 in 20 mM PBS buffer (pH 7.0), wherein said methoxy
polyethylene glycol maleimide has a molecular weight of 20K, 30K or
40K respectively. The 40K methoxy polyethylene glycol maleimide was
Y-shape branched, consisting of two polyethylene glycol chains. The
pegylation reaction was carried out at room temperature for 2-4 h.
At the end of the reaction, the end products were stored in a
4.degree. C. refrigerator.
[0093] Site-specific pegylated human arginase I was isolated and
purified using Macro SP matrix cation exchange column to remove
residual unreacted proteins and PEGs. Phosphate buffer and NaCl
(1M) containing phosphate buffer were used as equilibration and
elution buffer respectively. Prior to sample loading, pegylated
protein samples were diluted with distilled water until the sample
electric conductivity is identical to that of the equilibration
buffer; and column was equilibrated with five times column volume
of equilibration buffer. After sample loading, the column was
further washed with five times column volume of equilibration
buffer and eluted with 35% elution buffer. The eluant containing
protein peaks were collected and desalted using G25 column. Target
proteins were collected and analyzed by SDS-PAGE as shown in FIG.
7.
[0094] A303-M20K(2): Site-directed mutated arginase I (rhArgI-A303)
was reacted with methoxy polyethylene glycol maleimide-20 kDa
(mPEG-MAL-20K). The site-directed pegylated human arginase I was
purified by Macrocap SP matrix cation exchange column. The
percentage of the pegylated human arginase I conjugated with two 20
kDa mPEG-MAL molecules (referred to A303-M20K(2)) at cysteines 45
and 168 accounts for more than 70% of the total reaction
product.
[0095] A303-M30K(2): Site-directed mutated arginase I (rhArgI-A303)
was reacted with methoxy polyethylene glycol maleimide-30 kDa
(mPEG-MAL-30K). The site-directed pegylated human arginase I was
purified by Macrocap SP matrix cation exchange column. The
percentage of the pegylated human arginase I conjugated with two 30
kDa mPEG-MAL molecules (referred to A303-M30K(2)) at cysteines 45
and 168 accounts for more than 70% of the total reaction
product.
[0096] A168/303-Y40K: Site-specific mutated arginase I
(rhArgI-A168/303) was reacted with Y-shape branched polyethylene
glycol maleimide 40K (Y-MAL-40K). Pegylated human arginase I was
purified by Macrocap SP matrix cation exchange column. The
pegylated arginase I protein conjugated with one PEG chain
Y-MAL-40K at cysteine 45 (A168/303-Y40K) accounts more than 85% of
the total reaction products.
[0097] A45/303-Y40K: Site-specific mutated arginase I
(rhArgI-A45/303) was reacted with Y-shape branched polyethylene
glycol maleimide 40K (Y-MAL-40K). Pegylated human arginase I was
purified by Macrocap SP matrix cation exchange column. The
pegylated arginase I protein conjugated with one PEG chain
Y-MAL-40K at cysteine 168 (A45/303-Y40K) accounts for more than 85%
of the total reaction products.
[0098] Using the coupled spectrophotometric assay previously
described, the activity of different pegylated human arginase I was
measured and determined by changes in absorbance of NADPH. Test
results showed that the pegylated products preserved the arginase
activity, wherein the specific activities of A303-M20K(2),
A303-M30K(2), A168/303-Y40K and A45/303-Y40K were all higher than
400 U/mg, ranging 400-800 U/mg.
EXAMPLE 7
In-Vivo Pharmacokinetic Analysis of Site-Directed Pegylated Human
Arginase I
[0099] Pharmacokinetics profiles of different pegylated human
arginase I were evaluated after single intravenous administration
to Sprague Dawley rats at a dosage of 3 mg/kg. These studies were
conducted by Pharmalegacy Laboratories Limited (Shanghai). Blood
samples were collected pre-dose, 2 min, 1 h, 4 h, 24 h, 72 h, 120
h, 168 h and 240 h after dosing for serum arginase and arginine
analysis. Approximately 0.4 mL of blood samples were collected at
each time-point from orbital vein after anesthesia by isoflurane
and transferred to a 2-mL centrifuge tube. Samples were placed at
room temperature for 30 min until centrifugation at 4,000 g for 15
min at 4.degree. C.
[0100] Serum concentrations of arginase I were determined by a
quantitative sandwich enzyme immunoassay with kits provided by
Shanghai ExCell Biology, Inc. Anti-human arginase I monoclonal
antibody was coated on the surface of the wells of the ELISA plate.
Samples or protein standards of human arginase I were added
separately into the wells of the ELISA plate (1000 well), which was
then covered with sealer tape and incubated at 37.degree. C. for 90
min to allow immunocomplex formation between monoclonal antibody
and human arginase I. After incubation, the plate was washed five
times and rabbit anti-human arginase I polyclonal antibodies (1000
well) was added to the wells. It was covered with sealer tape again
and further incubated at 37.degree. C. for 60 min. After the second
incubation, the plate was washed again for five times,
HRP-conjugated goat anti-rabbit IgG (1000 well) was added to each
well and co-incubated for 30 min. After another five times washing,
chromogenic substrate was added into the wells and incubated in the
dark for 10-15 min. Stop solution was added to each well and mixed
well. The optical density at 450 nm was measured within 10 min
after adding the stop solution. The standard curve was generated
using quadratic fit method for regression equation and the arginase
I concentration of each samples was calculated using the measured
OD value. The PK parameters were derived using WinnoLin with a
non-compartmental assay method. The half-life (T.sub.1/2) values of
various forms of site-specific pegylated human arginase I,
A303-M20K(2), A303-M30K(2), A168/303-Y40K and A45/303-Y40K were
determined to be 28.0.+-.4.5, 28.4.+-.8.4, 27.2.+-.3.8, and
15.1.+-.0.6 h respectively.
TABLE-US-00003 TABLE 1 The pharmacokinetic parameters (average .+-.
standard deviation; n = 6) of single dose administration of
pegylated human arginase I in rat. T.sub.1/2 C.sub.max AUC.sub.last
AUC.sub.INF (h) (.mu.g/mL) (h*.mu.g/mL) (h*.mu.g/mL) A303- 28.0
.+-. 4.5 41.5 .+-. 9.5 1603.5 .+-. 187.5 1614.5 .+-. 188.6 M20K(2)
A303- 28.4 .+-. 8.4 32.4 .+-. 3.1 1113.6 .+-. 116.8 1192.9 .+-.
121.2 M30K(2) A168/303- 27.2 .+-. 3.8 45.2 .+-. 5.1 2077.5 .+-.
160.6 2083.9 .+-. 163.3 Y40K A45/303- 15.1 .+-. 0.6 105.2 .+-. 66.9
548.1 .+-. 50.3 564.5 .+-. 50.8 Y40K
[0101] This invention uses site-directed mutagenesis to modify
either one, or two or all of the three cysteine residues at
positions 45, 168 and 303 of human arginase I, wherein said
modification is conducted by replacement of the codon encoding for
cysteine to other amino acids, particularly, alanine, to obtain
human arginase with higher specific activity. In addition, the
present invention provides a novel site-directed pegylated human
arginase, which does not contain any potentially immunogenic
his-tag protein sequence. Said pegylated human arginase was
pegylated by conjugating 20, 30 or 40 kDa polyethylene glycol
maleimide respectively to cysteine residue 45, 168 or 303. The
pegylated human arginase produced in this way has a reduced
glomerular filtration rate. Furthermore, the pegylation site of the
arginase in conjugation with PEG was definite and the pegylation
product is more homogenous and easier for purification, favorable
for quality control of mass production. The pegylated arginase
provided in the present invention has a significantly increased
half-life in mammals, which can be as long as 15-28 h in sera of
rats.
[0102] Unless otherwise stated, the practice of this invention
involves the use of common techniques that are employed in
biotechnology, organic chemistry, or inorganic chemistry, etc.
Apparently, other than the description and embodiments mentioned
above, there are other means can be used to implement the present
invention. Any changes or modifications under the scope of this
invention will be apparent to the skilled in the art. According to
the teachings of the present invention, many changes and
modifications are possible and are hence classified under the
coverage of this invention. The patents mentioned in this article,
their applications and scientific papers are all incorporated into
this article.
Sequence CWU 1
1
21322PRTHomo sapiens 1Met Ser Ala Lys Ser Arg Thr Ile Gly Ile Ile
Gly Ala Pro Phe Ser 1 5 10 15 Lys Gly Gln Pro Arg Gly Gly Val Glu
Glu Gly Pro Thr Val Leu Arg 20 25 30 Lys Ala Gly Leu Leu Glu Lys
Leu Lys Glu Gln Glu Cys Asp Val Lys 35 40 45 Asp Tyr Gly Asp Leu
Pro Phe Ala Asp Ile Pro Asn Asp Ser Pro Phe 50 55 60 Gln Ile Val
Lys Asn Pro Arg Ser Val Gly Lys Ala Ser Glu Gln Leu 65 70 75 80 Ala
Gly Lys Val Ala Glu Val Lys Lys Asn Gly Arg Ile Ser Leu Val 85 90
95 Leu Gly Gly Asp His Ser Leu Ala Ile Gly Ser Ile Ser Gly His Ala
100 105 110 Arg Val His Pro Asp Leu Gly Val Ile Trp Val Asp Ala His
Thr Asp 115 120 125 Ile Asn Thr Pro Leu Thr Thr Thr Ser Gly Asn Leu
His Gly Gln Pro 130 135 140 Val Ser Phe Leu Leu Lys Glu Leu Lys Gly
Lys Ile Pro Asp Val Pro 145 150 155 160 Gly Phe Ser Trp Val Thr Pro
Cys Ile Ser Ala Lys Asp Ile Val Tyr 165 170 175 Ile Gly Leu Arg Asp
Val Asp Pro Gly Glu His Tyr Ile Leu Lys Thr 180 185 190 Leu Gly Ile
Lys Tyr Phe Ser Met Thr Glu Val Asp Arg Leu Gly Ile 195 200 205 Gly
Lys Val Met Glu Glu Thr Leu Ser Tyr Leu Leu Gly Arg Lys Lys 210 215
220 Arg Pro Ile His Leu Ser Phe Asp Val Asp Gly Leu Asp Pro Ser Phe
225 230 235 240 Thr Pro Ala Thr Gly Thr Pro Val Val Gly Gly Leu Thr
Tyr Arg Glu 245 250 255 Gly Leu Tyr Ile Thr Glu Glu Ile Tyr Lys Thr
Gly Leu Leu Ser Gly 260 265 270 Leu Asp Ile Met Glu Val Asn Pro Ser
Leu Gly Lys Thr Pro Glu Glu 275 280 285 Val Thr Arg Thr Val Asn Thr
Ala Val Ala Ile Thr Leu Ala Cys Phe 290 295 300 Gly Leu Ala Arg Glu
Gly Asn His Lys Pro Ile Asp Tyr Leu Asn Pro 305 310 315 320 Pro Lys
2969DNAHomo sapiens 2atgagcgcca agtccagaac catagggatt attggagctc
ctttctcaaa gggacagcca 60cgaggagggg tggaagaagg ccctacagta ttgagaaagg
ctggtctgct tgagaaactt 120aaagaacaag agtgtgatgt gaaggattat
ggggacctgc cctttgctga catccctaat 180gacagtccct ttcaaattgt
gaagaatcca aggtctgtgg gaaaagcaag cgagcagctg 240gctggcaagg
tggcagaagt caagaagaac ggaagaatca gcctggtgct gggcggagac
300cacagtttgg caattggaag catctctggc catgccaggg tccaccctga
tcttggagtc 360atctgggtgg atgctcacac tgatatcaac actccactga
caaccacaag tggaaacttg 420catggacaac ctgtatcttt cctcctgaag
gaactaaaag gaaagattcc cgatgtgcca 480ggattctcct gggtgactcc
ctgtatatct gccaaggata ttgtgtatat tggcttgaga 540gacgtggacc
ctggggaaca ctacattttg aaaactctag gcattaaata cttttcaatg
600actgaagtgg acagactagg aattggcaag gtgatggaag aaacactcag
ctatctacta 660ggaagaaaga aaaggccaat tcatctaagt tttgatgttg
acggactgga cccatctttc 720acaccagcta ctggcacacc agtcgtggga
ggtctgacat acagagaagg tctctacatc 780acagaagaaa tctacaaaac
agggctactc tcaggattag atataatgga agtgaaccca 840tccctgggga
agacaccaga agaagtaact cgaacagtga acacagcagt tgcaataacc
900ttggcttgtt tcggacttgc tcgggagggt aatcacaagc ctattgacta
ccttaaccca 960cctaagtaa 969
* * * * *