U.S. patent application number 14/486124 was filed with the patent office on 2015-01-01 for screening for anti-cancer compounds using netrin-1 activity.
The applicant listed for this patent is Centre Leon Berard, CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE. Invention is credited to Agnes Bernet, Julien Fitamant, Patrick Mehlen.
Application Number | 20150004159 14/486124 |
Document ID | / |
Family ID | 38051332 |
Filed Date | 2015-01-01 |
United States Patent
Application |
20150004159 |
Kind Code |
A1 |
Mehlen; Patrick ; et
al. |
January 1, 2015 |
SCREENING FOR ANTI-CANCER COMPOUNDS USING NETRIN-1 ACTIVITY
Abstract
The subject matter of the present invention relates to an in
vitro method for the screening of anti-cancer compounds based on
the capacity for these compound to interact with netrin-1 receptor
and/or to inhibit the dimerization of the intracellular domain of
the netrin-1 receptor expressed in tumor cells. The invention also
relates to a method for predicting the presence of metastatic or
aggressive cancer, or for determining the efficiency of an
anti-cancer treatment based on the measuring of the expression
level of netrin-1. The invention further comprises kits and
compounds as a medicament for the treatment of cancer such as
metastatic breast cancer, related to the overexpression of netrin-1
by the tumor cells.
Inventors: |
Mehlen; Patrick; (Serezin du
Rhone, FR) ; Bernet; Agnes; (Genas, FR) ;
Fitamant; Julien; (Lyon, FR) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE
Centre Leon Berard |
Paris
Lyon |
|
FR
FR |
|
|
Family ID: |
38051332 |
Appl. No.: |
14/486124 |
Filed: |
September 15, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12224384 |
Aug 26, 2008 |
|
|
|
PCT/EP2007/051920 |
Feb 28, 2007 |
|
|
|
14486124 |
|
|
|
|
60776926 |
Feb 28, 2006 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
424/145.1; 424/156.1; 424/158.1; 424/174.1 |
Current CPC
Class: |
C12Q 1/18 20130101; G01N
2800/52 20130101; C07K 16/22 20130101; C07K 2317/732 20130101; G01N
2333/475 20130101; G01N 33/574 20130101; C07K 2317/76 20130101;
A61P 43/00 20180101; A61P 35/00 20180101; C07K 16/2863 20130101;
G01N 2500/02 20130101 |
Class at
Publication: |
424/133.1 ;
424/145.1; 424/156.1; 424/158.1; 424/174.1 |
International
Class: |
C07K 16/28 20060101
C07K016/28; C07K 16/22 20060101 C07K016/22 |
Claims
1.-38. (canceled)
39. A method of treatment for inducing the apoptosis or the cell
death of tumor cells which has acquired the selective advantage to
escape netrin-1 dependence receptors induced apoptosis by elevated
netrin-1 level, in a patient having such tumor cells, comprising
administering to said patient an effective amount of a monoclonal
or polyclonal antibody directed specifically against netrin-1, a
netrin-1 receptor or an extracellular domain of a netrin-1
receptor, which antibody specifically inhibits the interaction
between the netrin-1 and a netrin-1 receptor and/or the
dimerization or multimerization of a netrin-1 receptor or of the
intracellular domain of a netrin-1 receptor.
40. The method of claim 39, comprising the step of identifying a
patient suffering from a cancer having tumoral cells expressing or
overexpressing netrin 1.
41. The method of claim 39, wherein the antibody is a chimeric
antibody or a humanized antibody.
42. The method of claim 39, comprising administering to said
patient an effective amount of a monoclonal or polyclonal antibody
directed specifically against netrin-1.
43. The method of claim 42, wherein the antibody is a chimeric
antibody or a humanized antibody.
44. The method of claim 39, wherein the netrin-1 receptor is
Deleted in Colorectal Cancer (DCC).
45. The method of claim 39, wherein the netrin-1 receptor is
UNC5H.
46. The method of claim 45, wherein the netrin-1 receptor UNC5H is
selected from the group consisting of UNC5H1, UNC5H2 and
UNC5H3.
47. The method of claim 39, wherein the netrin-1 receptor is
neogenin.
48. The method of claim 39, wherein the netrin-1 receptor is
adenosine A2b.
49. The method of claim 39, for the prevention or the treatment of
cancer in mammals, including man, wherein the cancer has tumoral
cells expressing said netrin-1 receptor and expressing or
overexpressing netrin-1.
50. The method of claim 39, wherein said cancer is a metastatic or
an aggressive cancer.
51. The method of claim 39, wherein said cancer is selected from
the group consisting of breast cancer, colorectal cancer, lung
cancer, neuroblastoma, glioma, acute myeloid leukemia, sarcoma,
melanoma, ovarian adenocarcinoma, renal adenocarcinoma pancreatic
adenocarcinoma, uterus adenocarcinoma, stomach adenocarcinoma,
kidney adenocarcinoma and rectal adenocarcinoma.
52. The method of claim 39, wherein the primary tumor cells of said
cancer express or overexpress netrin-1.
53. The method of claim 39, wherein said cancer is breast
cancer.
54. The method of claim 39, wherein said cancer is colorectal
cancer.
55. A method of anti-cancer treatment for inducing the apoptosis or
the cell death of tumor cells expressing or overexpressing
netrin-1, in a patient having such tumor cells, comprising
administering to said patient an effective amount of a monoclonal
or polyclonal antibody directed specifically against netrin-1, a
netrin-1 receptor or an extracellular domain of a netrin-1
receptor, which antibody specifically inhibits the interaction
between the netrin-1 and a netrin-1 receptor and/or the
dimerization or multimerization of a netrin-1 receptor or of the
intracellular domain of a netrin-1 receptor.
56. The method of claim 55, comprising identifying a patient having
a metastatic or an aggressive cancer which has a netrin-1
expression level increased by a ratio superior to 2 with respect to
a non-metastatic or non-aggressive reference biopsy.
57. The method of claim 56, wherein the ratio is superior to 3.
58. The method of claim 56, wherein the ratio is superior to 4.
59. The method of claim 56, wherein the ratio is superior to 5.
Description
[0001] The subject matter of the present invention relates to an in
vitro method for the screening of anti-cancer compounds based on
the capacity for these compound to interact with netrin-1 and/or to
inhibit the dimerization of the intracellular domain of the
netrin-1 receptor expressed in tumor cells. The invention also
relates to a method for predicting the presence of metastatic
cancer, or for determining the efficiency of an anti-cancer
treatment based on the measuring of the expression level of
netrin-1. The invention further comprises kits and compounds as a
medicament for the treatment of metastatic cancer such as breast
cancer, related to the overexpression of netrin-1 by the tumor
cells.
[0002] Netrin-1, a diffusible laminin-related protein, has been
shown to play a major role in the control of neuronal navigation
during the development of the nervous system .sup.31, by
interacting with its main receptors, DCC (Deleted in Colorectal
Cancer) .sup.1, 2, 3 and UNC5H .sup.4, 5. However, more recently,
netrin-1 has emerged as a completely different molecule that
regulates cell survival. Indeed, the netrin-1 receptors DCC and
UNC5H, --i.e., UNC5H1, UNC5H2, and UNC5H3-- belong to the so-called
dependence receptor family .sup.6, 7. Dependence receptors form a
group of receptors that share the ability to induce cell death when
expressed in settings in which their ligand is not available
.sup.44. Such receptors, which also include RET .sup.8,
.beta.-integrins .sup.9, Patched .sup.10, neogenin.sup.11,
p75.sup.NTR 12 and the androgen receptor .sup.40, share the
functional property of inducing cell death when disengaged from
their ligands, while the presence of their ligand blocks this
pro-apoptotic activity. Such receptors thus create cellular states
of dependence on their respective ligands .sup.13, 14.
[0003] This dependence effect has been suggested to act as a
mechanism for eliminating tumor cells that would develop in
settings of ligand unavailability: proliferation of tumor cells in
a cell environment with constant and limited ligand presence or
migration of metastatic tumor cells towards tissues where the
ligand is not expressed. A selective advantage for a tumor cell
would then be to lose the pro-apoptotic activity of its dependence
receptors. It was predicted from genetic screens that the C.
elegans netrin-1--UNC6--interacted with UNC40 and with UNC5
.sup.42. Four orthologues of UNC5 were identified in mammals:
UNC5H1, H2, H3, H4 and UNC40 was found to be the orthologue of the
vertebrate DCC (Deleted in Colorectal Cancer) .sup.39. Along this
line, DCC was proposed in the early 1990s to be a tumor suppressor
gene, whose expression is lost in the vast majority of human
cancers .sup.15, 16. This hypothesis also fits with the recent
observation that UNC5H genes are down-regulated in the vast
majority of colorectal tumors, hence suggesting that the loss of
UNC5H genes represents a selective advantage for tumor development
.sup.17. Interestingly, in mice, both inactivation of UNC5H3 and
overexpression of netrin-1 in the gastro-intestinal tract are
associated with intestinal tumor progression .sup.18, 19, hence
demonstrating per se that the loss of netrin-1 dependence receptors
in the human pathology is a causal factor for tumor progression.
However, although an initial series of reports supported the fact
that DCC acted as a tumor suppressor (for a review see .sup.29),
doubts have arisen, mainly because of the rarity of point mutations
in the DCC coding sequence and because of the lack of tumor
predisposition in DCC hemizygous mice .sup.41.
[0004] However, the model described above predicts that both loss
of the netrin-1 receptors and gain of ligand expression--i.e.,
autocrine expression--should be observed in human cancers, as they
should represent similar selective advantages. This question is
important not only for basic knowledge, but is crucial for therapy:
indeed, inhibiting the extracellular interaction between netrin-1
dependence receptors and netrin-1 could represent an appealing
strategy to trigger tumor regression.
[0005] It is particular desirable to provide simple and consistent
means for identifying and characterizing new compounds which can be
used for the treatment of cancer.
[0006] Surprisingly, the inventors have first demonstrated that,
rather than losing netrin-1 dependence receptors, the majority of
metastatic breast tumors show increased netrin-1 expression, a
trait that may be used in therapy to trigger death of metastatic
tumor.
[0007] If the pro-apoptotic signaling of DCC and/or UNC5H is
beginning to be documented, an important question in this
death/life signature dictated by DCC, UNC5H and more generally by
the other known dependence receptors, is how does the presence of
the ligand inhibit their pro-apoptotic activity .sup.50.
[0008] In a second time, the inventors have analyzed whether
netrin-1 induced DCC and/or UNC5H multimerization could be the
critical step that inhibits DCC and/or UNC5H pro-apoptotic
activity. Surprisingly, they have demonstrated that netrin-1
receptor, such as DCC and/or UNC5H multimerizes in response to
netrin-1, a process sufficient to inhibit apoptosis.
[0009] In a first aspect, the present invention is directed to an
in vitro method for selecting a compound for the prevention or the
treatment of cancer, wherein said method comprises the following
steps of:
a) having a medium containing netrin-1, or a fragment thereof, and
a netrin-1 receptor, or a fragment thereof, wherein: [0010] said
netrin-1, or a fragment thereof, and said netrin-1 receptor, or a
fragment thereof, is able to specifically interact together to form
a binding pair, and/or [0011] said netrin-1, or a fragment thereof,
is able to induce the dimerization or multimerization of said
netrin-1 receptor, or a fragment thereof, particularly the
intracellular domain of said netrin-1 receptor, b) contacting said
medium with the compound to be tested; c) measuring the inhibition
of the interaction between netrin-1, or a fragment thereof, and
said netrin-1 receptor, or a fragment thereof, and/or [0012]
determine whether said compound inhibit the dimerization or
multimerization of said netrin-1 receptor, or a fragment thereof,
particularly the dimerization of the intracellular domain of said
netrin-1 receptor, and d) selecting said compound if: [0013] the
measuring in step c) demonstrates a significantly inhibition of the
interaction between netrin-1, or a fragment thereof, and netrin-1
receptor, or a fragment thereof, in presence of said compound,
and/or [0014] the determination in step c) demonstrates a
significantly inhibition of the dimerization or multimerization of
said netrin-1 receptor, or a fragment thereof, in presence of said
compound, particularly the dimerization of the intracellular domain
of said netrin-1 receptor.
[0015] By the terms interaction between netrin-1 and its netrin-1
receptor, it is intended to designate in the present application
the interaction which result to the selective advantage for tumor
cells to escape netrin-1 dependence receptors induced apoptosis,
preferably due to elevated netrin-1 level.
[0016] So, the inhibition of this interaction can be obtained for
example by the complete or partial inhibition of the binding of
netrin-1 to its receptor, notably in presence of a competitive
ligand (such as an antibody which is directed to this extracellular
membrane domain of said netrin-1 receptor), or in presence of a
compound able to form a specific complex with the netrin-1 (such as
a soluble extracellular membrane domain of its netrin-1 receptor,
or part thereof).
[0017] In a preferred embodiment, the method according to the
present invention is characterized in that said cancer to be
prevent or treated is a cancer wherein tumoral cells express or
overexpress netrin-1.
[0018] In another preferred embodiment, the method according to the
present invention is characterized in that said cancer to be
prevent or treated is selected from the group consisting of breast
cancer, colorectal cancer, lung cancer, neuroblastoma, glioma,
acute myeloid leukemia, sarcoma, melanoma, ovarian adenocarcinoma,
renal adenocarcinoma pancreatic adenocarcinoma, uterus
adenocarcinoma, stomac adenocarcinoma, kidney adenocarcinoma and
rectal adenocarcinoma.
[0019] In another preferred embodiment, the method according to the
present invention is characterized in that said cancer to be
prevent or treated is a metastatic or an aggressive cancer.
[0020] In the method according to the invention, said netrin-1
receptor is preferably selected from the group of DCC, UNC5H
(particularly UNC5H1, UNC5H2 and UNC5H3), neogenin and the
adenosine A2b, more preferably selected from the group of DCC,
UNC5H1, UNC5H2 and UNC5H3.
[0021] In another preferred embodiment, the method according to the
present invention is characterized in that at step a):
[0022] said netrin-1 receptor fragment comprises or is the
extracellular domain of the netrin-1 receptor, or part thereof able
to interact with netrin-1; and/or
[0023] said netrin-1 receptor fragment comprises or is the
intracellular domain of the netrin-1 receptor, or part thereof able
to dimerize or multimerize in presence of netrin-1.
[0024] In another preferred embodiment, the method according to the
present invention is characterized in that said netrin-1 or/and
said netrin-1 receptor are from mammal, particularly from mouse,
rat or human.
[0025] In a particular aspect of the method of the present
invention, at step a) said netrin-1 is from chicken.
[0026] In another preferred embodiment, the method according to the
present invention is characterized in that said netrin-1 or/and
said netrin-1 receptor and/or the compound to be tested is labelled
by a marker able to be directly or indirectly measured.
[0027] In another preferred embodiment, the method according to the
present invention is characterized in that at step c):
[0028] the measure of the inhibition of the interaction between
netrin-1, or a fragment thereof, and said netrin-1 receptor, or a
fragment thereof, is carried out by immunoassay (particularly by
ELISA or by Immunoradiometric Assay (IRMA)), by Scintillation
Proximity Assay (SPA) or by Fluorescence Resonance Energy Transfer
(FRET); and/or
[0029] the dimerization or multimerization, or its inhibition, of
said netrin-1 receptor, or fragment thereof, particularly the
intracellular domain, is carried out by immunoprecipitation or
FRET.
[0030] In another particular preferred embodiment, the method
according to the present invention is characterized in that at step
a) said medium contains cells which express at their surface
membrane an endogenous or a recombinant netrin-1 receptor,
particularly a recombinant extracellular domain of said netrin-1
receptor.
[0031] In a preferred embodiment, said recombinant netrin-1
receptor also comprises the intracellular domain of said netrin-1
receptor.
[0032] In another particular preferred embodiment, the method
according to the present invention is characterized in that at step
a) said medium contains tumoral cells, preferably metastatic
tumoral cells, which express endogenously said netrin-1 receptor at
their membrane surface and which express or overexpress netrin-1,
and wherein at step c) the inhibition of the interaction between
netrin-1 and its netrin-1 receptor in presence of the compound to
be tested, is measured by the apoptosis or cells death induced by
the presence of the compound to be tested, preferably analysed
using the trypan blue staining method as indicated in the examples
below.
[0033] In a preferred embodiment said tumoral cells are selected
from the group consisting of 4T1 cells, CAL51 cells, T47D cells,
SKBR7 cells, IMR32 cells, GL26 cells and H358 cells, notably CAL51
cell lines, such as CAL51-36 cell line, which are much more
susceptible to cell death in response to the presence of
DCC-EC-Fc.
[0034] The present invention is also directed to an in vitro method
for selecting a compound for the prevention or the treatment of
cancer, wherein said method comprises the following steps of
a) having a medium containing a mammal cell expressing an
endogenous or a recombinant netrin-1 receptor, or a fragment
thereof comprising at least its intracellular domain, preferably a
tumor cell, more preferably a cell presenting dimerization or
multimerization of its netrin-1 receptor intracellular domain or a
cell wherein its netrin-1 receptor intracellular domain is able to
dimerize or multimere in presence of netrin-1; b) contacting said
medium with the compound to be tested, optionally the medium
further containing netrin-1, or a fragment thereof able to interact
with the extracellular domain of the netrin-1 receptor, c)
determine whether the dimerization or multimerization of said
netrin-1 receptor intracellular domain is inhibited in presence of
said compound to be tested; d) optionally, determine (for example
by the blue trypan method) whether the presence of the compound to
be tested induces the cell death of said mammal cell; and e)
selecting said compound if the determination in step c)
demonstrates a significantly inhibition of the dimerization or
multimerization of the intracellular domain of said netrin-1
receptor and/or if the determination in step d) demonstrates the
cell death of said mammal cell.
[0035] In a second aspect, the present invention is directed to an
in vitro method for predicting the presence of a metastatic cancer
or an aggressive cancer (such as neuroblastome) in a patient having
a primary tumor from a biopsy of said patient containing primary
tumors cells, said method comprising the following step of:
[0036] (a) measuring of the netrin-1 expression level in said
biopsy.
[0037] In a preferred embodiment, the method for predicting
according to the present invention is characterized in that at step
a) wherein an increase of the netrin-1 expression level in said
biopsy, compared with expression of netrin-1 in non-metastatic
primary tumor biopsies or in non-aggressive cancer biopsies is
significant of the presence of a metastatic cancer or an aggressive
cancer.
[0038] In a more preferred embodiment, the method for predicting
according to the present invention is characterized in that a ratio
superior to 2, preferably to 2.5, to 3, to 3.5, to 4, to 4.5 and to
5, between netrin-1 expression in the biopsy to be tested and in
the non-metastatic or non-aggressive reference biopsy is
significant of the presence of a metastatic or an aggressive
cancer.
[0039] In a third aspect, the present invention is directed to an
method for determining in vitro the efficiency of an anti-cancer
treatment for a patient or for selecting patients who responds to a
specific anti-cancer treatment, said method comprising the
following step of:
[0040] (a) obtaining a primary tumor biopsy of said treated
patient; and
[0041] (b) measuring of the netrin-1 expression level in said
biopsy,
wherein the efficiency of said anti-cancer treatment is correlated
with the decrease of the amount of the netrin-1 expression level
measured in said biopsy, or wherein the selected patients who
respond to a specific anti-cancer treatment are patients where the
amount of the netrin-1 expression level measured in their biopsy
has been decreased after said specific treatment.
[0042] In a preferred embodiment, the method for determining in
vitro the efficiency of an anti-cancer treatment for a patient or
for selecting patients who responds to a specific anti-cancer
treatment, is characterized in that said cancer induced an
overexpression of netrin-1 and/or is a metastatic or an aggressive
cancer.
[0043] In a preferred embodiment, the method for prediction or for
determining in vitro the efficiency of an anti-cancer treatment for
a patient is characterized in that the measured netrin-1 expression
product is the RNA encoding netrin-1, particularly measured by a
quantitative real time reverse PCR method, or in that the
expression level of netrin-1 which is measured is the measure of
the netrin-1 protein level, particularly by a method using specific
antibodies able to specifically recognize said netrin-1
protein.
[0044] In a preferred embodiment, the method for prediction or for
determining in vitro the efficiency of an anti-cancer treatment for
a patient is characterized in that the primary tumor is a primary
tumor of a cancer selected from the group consisting of breast
cancer, colorectal cancer, lung cancer, neuroblastoma, glioma,
acute myeloid leukemia, sarcoma, melanoma, ovarian adenocarcinoma,
renal adenocarcinoma pancreatic adenocarcinoma, uterus
adenocarcinoma, stomac adenocarcinoma, kidney adenocarcinoma and
rectal adenocarcinoma.
[0045] In another aspect, the present invention is directed to a
kit for the selection of a compound for the prevention or the
treatment of cancer, wherein said kit comprises: [0046] a netrin-1
receptor protein, or a fragment thereof able to specifically
interact with the netrin-1 protein to form a binding pair,
preferably recombinant protein; and [0047] netrin-1 protein, or a
fragment thereof able to specifically interact with said netrin-1
receptor protein to form a binding pair, preferably recombinant
protein.
[0048] Said netrin-1 receptor being also preferably selected from
the group of DCC, UNC5H (particularly UNC5H1, UNC5H2 and UNC5H3),
neogenin and the adenosine A2b, more preferably selected from the
group of DCC, UNC5H1, UNC5H2 and UNC5H3, more preferably from
mammal such as from mouse, rat or human.
[0049] In a preferred embodiment, said kit comprises: [0050]
tumoral cells which express netrin-1 receptor and which express or
overexpress netrin-1, particularly cells from metastatic tumoral
cell line, preferably selected from the group consisting of 4T1
cells, CAL51 cells, T47D cells, SKBR7 cells, IMR32 cells, GL26
cells and H358 cells, notably CAL51 cell lines, such as CAL51-36
cell line, which are much more susceptible to cell death in
response to the presence of DCC-EC-Fc.
[0051] In another aspect, the present invention comprises a
compound selected from the group consisting of: [0052] a compound
comprising an extracellular domain of netrin-1 receptor or fragment
thereof able to specifically inhibit the interaction between the
netrin-1 and said netrin-1 receptor, and/or able to inhibit the
dimerization or multimerization of said netrin-1 receptor, or a
fragment thereof, particularly to inhibit the intracellular domain
of said netrin-1 receptor, and [0053] a monoclonal or polyclonal
antibody directed specifically against netrin-1 or netrin-1
receptor, particularly directed to the extracellular domain of said
netrin-1 receptor or to the netrin-1 fragment able to interact with
the extracellular domain of said netrin-1 receptor, as a
medicament.
[0054] The amino acid sequence of human netrin-1 or human netrin
receptor such as UNC5H1, UNC5H2 and UNC5H3 (Unc-5 homolog 1, 2 and
3 equivalent to Unc-5 homolog A, B and C) are well known by the
skilled man. Example of these amino acid sequences with the
localization of their particular domain can be found in Genbank
under the accession number AAD09221 or NP.sub.--004813 for human
netrin-1, NP.sub.--588610 for human netrin receptor Unc-5 homolog
1, Q8IZJ1 for netrin receptor Unc-5 homolog 2 and 095185 for Unc-5
homolog 3.
[0055] Preferably, in the compounds of the present invention, said
extracellular domain of netrin-1 receptor or fragment thereof is
selected from the group of DCC, UNC5H (particularly UNC5H1, UNC5H2
and UNC5H3), neogenin and the adenosine A2b, more preferably
selected from the group of DCC, UNC5H1, UNC5H2 and UNC5H3, more
preferably from mammal such as from mouse, rat or human.
[0056] In a more preferred embodiment, said compound according to
the present invention comprises an extracellular domain of netrin-1
receptor from DCC, preferably said compound is DCC-EC-Fc or
DCC-5Fbn.
[0057] In another aspect, the present invention pertains to the use
of the level of netrin-1 expression as a marker for the
identification of metastatic cancer in a patient, preferably of
metastatic breast or colorectal cancer, the most preferred being
the metastatic breast cancer.
[0058] In another aspect, the present invention pertains to a
method of treatment for inducing the apoptosis or the cell death of
tumor cells which have acquired the selective advantage to escape
netrin-1 dependence receptors induced apoptosis, preferably by
elevated netrin-1 level, in a patient comprising administering a
compound able to inhibit the interaction between netrin-1 and its
netrin-1 receptor, a compound able to inhibit the dimerization or
the multimerization of the netrin-1 receptor, a compound according
to the present invention, or selected by the method of the present
invention, in said patient in need thereof.
[0059] In another aspect, the present invention pertains to a
method for the prevention or for the treatment of cancer in a
patient comprising administering a compound according to the
present invention, or selected by the method of the present
invention, in said patient in need thereof.
[0060] The present invention also comprises the use of a compound
according to the present invention, or selected by the method of
the present invention, for the manufacture of a medicament for the
prevention or the treatment of cancer in mammals, including man.
Preferably said cancer is a metastatic or an aggressive cancer.
[0061] More preferably, in the method of treatment or in the use of
a compound according to the present invention, said cancer is
selected from the group consisting of breast cancer, colorectal
cancer, lung cancer, neuroblastoma, glioma, acute myeloid leukemia,
sarcoma, melanoma, ovarian adenocarcinoma, renal adenocarcinoma
pancreatic adenocarcinoma, uterus adenocarcinoma, stomac
adenocarcinoma, kidney adenocarcinoma and rectal
adenocarcinoma.
[0062] More preferably, in the method of treatment or in the use of
a compound according to the present invention, the primary tumor
cells of said cancer express or overexpress netrin-1.
[0063] The term "antibody" as used herein refers to immunoglobulin
molecules and immunologically active portions of immunoglobulin
molecules, i.e., molecules that contain an antigen binding site
which specifically binds (immunoreacts with) the netrin-1 protein
or its receptor.
[0064] The term "antibody" comprises monoclonal or polyclonal
antibodies but also chimeric or humanized antibodies.
[0065] An isolated netrin-1 protein or netrin-1 receptor protein,
or a specific fragment thereof can be used as an immunogen to
generate antibodies that bind such protein using standard
techniques for polyclonal and monoclonal antibody preparation. It
may be also possible to use any fragment of these protein which
contains at least one antigenic determinant may be used to generate
these specific antibodies.
[0066] A protein immunogen typically is used to prepare antibodies
by immunizing a suitable subject, (e.g., rabbit, goat, mouse or
other mammal) with the immunogen. An appropriate immunogenic
preparation can contain said protein, or fragment thereof, and
further can include an adjuvant, such as Freund's complete or
incomplete adjuvant, or similar immunostimulatory agent.
[0067] Thus, antibody for use in accordance with the invention
include either polyclonal, monoclonal chimeric or humanized
antibodies. antibodies able to selectively bind, or which
selectively bind to an epitope-containing a polypeptide comprising
a contiguous span of at least 8 to 10 amino acids of an amino acid
sequence of the netrin-1 protein or its receptor.
[0068] A preferred agent for detecting and quantifying mRNA or cDNA
encoding netrin-1 protein, is a labeled nucleic acid probe or
primers able to hybridize this mRNA or cDNA. The nucleic acid probe
can be an oligonucleotide of at least 10, 15, 30, 50 or 100
nucleotides in length and sufficient to specifically hybridize
under stringent conditions to the mRNA or cDNA. The nucleic acid
primer can be an oligonucleotide of at least 10, 15 or 20
nucleotides in length and sufficient to specifically hybridize
under stringent conditions to the mRNA or cDNA, or complementary
sequence thereof.
[0069] A preferred agent for detecting and quantifying the netrin-1
protein, is an antibody able to bind specifically to this protein,
preferably an antibody with a detectable label. Antibodies can be
polyclonal, or more preferably, monoclonal. An intact antibody, or
a fragment thereof (e.g., Fab or F(ab')2) can be used. The term
"labeled", with regard to the probe or antibody, is intended to
encompass direct labeling of the probe or antibody by coupling
(i.e., physically linking) a detectable substance to the probe or
antibody, as well as indirect labeling of the probe or antibody by
reactivity with another reagent that is directly labeled. Examples
of indirect labeling include detection of a primary antibody using
a fluorescently labeled secondary antibody and end-labeling of a
DNA probe with biotin such that it can be detected with
fluorescently labeled streptavidin.
[0070] For example, in vitro techniques for detection of candidate
mRNA include Northern hybridizations and in situ hybridizations. In
vitro techniques for detection of the candidate protein include
enzyme linked immunosorbent assays (ELISAs), Western blots,
immunoprecipitation and immunofluorescence. In vitro techniques for
detection of candidate cDNA include Southern hybridizations.
[0071] When the invention encompasses kits for quantifying the
level of netrin-1 protein, the kit can comprise a labeled compound
or agent capable of quantifying these proteins. Said agents can be
packaged in a suitable container. The kit can further comprise
instructions for using the kit to quantify the level of the
netrin-1 protein or of the netrin-1 transcript.
[0072] In certain embodiments of the method of the present
invention, the determination of the netrin-1 transcripts involves
the use of a probe/primer in a polymerase chain reaction (PCR),
such as anchor PCR or RACE PCR, or, alternatively, in a ligation
chain reaction (LCR) (see, e.g., Landegran et al., 1988, Science
241:23-1080; and Nakazawa et al., 1994, Proc. Natl. Acad. Sci. USA,
91:360-364), or alternatively quantitative real time RT-PCR This
method can include the steps of collecting a sample of cells from a
patient, isolating nucleic acid (e.g. mRNA) from the cells of the
sample, optionally transforming mRNA into corresponding cDNA,
contacting the nucleic acid sample with one or more primers which
specifically hybridize to the netrin-1 or mRNA or their
corresponding cDNA under conditions such that hybridization and
amplification of the netrin-1 mRNA or cDNA occurs, and quantifying
the presence of the amplification products. It is anticipated that
PCR and/or LCR may be desirable to use as an amplification step in
conjunction with any of the techniques used for quantifying nucleic
acid detecting.
[0073] The methods described herein may be performed, for example,
by utilizing pre-packaged diagnostic kits comprising at least one
probe nucleic acid or set of primer or antibody reagent described
herein, which may be conveniently used, e.g., in clinical settings
to follow-up or diagnose patients.
[0074] Finally, the present invention is related to the use of
antisense or iRNA (interfering RNA) oligonucleotides specific of
the nucleic acid encoding netrin-1 protein for the manufacture of a
medicament intended to prevent or to treat metastatic or aggressive
cancer, preferably said cancer is selected from the group
consisting of breast cancer, colorectal cancer, lung cancer,
neuroblastoma, glioma, acute myeloid leukemia, sarcoma, melanoma,
ovarian adenocarcinoma, renal adenocarcinoma pancreatic
adenocarcinoma, uterus adenocarcinoma, stomac adenocarcinoma,
kidney adenocarcinoma and rectal adenocarcinoma.
[0075] Interfering RNA (iRNA) is a phenomenon in which a double
stranded RNA (dsRNA) specifically suppresses the expression of a
gene bearing its complementary sequence. iRNA has since become a
useful research tool for many organisms. Although the mechanism by
which dsRNA suppresses gene expression is not entirely understood,
experimental data provide important insights. This technology has
great potential as a tool to study gene function in mammalian cells
and may lead to the development of pharmacological agents based
upon siRNA (small interfering RNA).
[0076] When administered to a patient, a compound of the present
invention is preferably administered as component of a composition
that optionally comprises a pharmaceutically acceptable vehicle.
The composition can be administered orally, or by any other
convenient route, and may be administered together with another
biologically active agent. Administration can be systemic or local.
Various delivery systems are known, e.g., encapsulation in
liposomes, microparticles, microcapsules, capsules, etc., and can
be used to administer the selected compound of the present
invention or pharmaceutically acceptable salts thereof.
[0077] Methods of administration include but are not limited to
intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, intranasal, epidural, oral, sublingual, intranasal,
intracerebral, intravaginal, transdermal, rectally, by inhalation,
or topically. The mode of administration is left to the discretion
of the practitioner. In most instances, administration will result
in the release of the compound into the bloodstream or directly in
the primary tumor.
[0078] Compositions comprising the compound according to the
invention or selected by the methods according to the present
invention, form also part of the present invention. These
compositions can additionally comprise a suitable amount of a
pharmaceutically acceptable vehicle so as to provide the form for
proper administration to the patient. The term "pharmaceutically
acceptable" means approved by a regulatory agency or listed by a
national or a recognized pharmacopeia for use in animals, mammals,
and more particularly in humans. The term "vehicle" refers to a
diluent, adjuvant, excipient, or carrier with which a compound of
the invention is administered. Such pharmaceutical vehicles can be
liquids, such as water and oils, including those of petroleum,
animal, vegetable or synthetic origin, such as peanut oil, soybean
oil, mineral oil, sesame oil and the like. The pharmaceutical
vehicles can be saline, gelatin, starch and the like. In addition,
auxiliary, stabilizing, thickening, lubricating and coloring agents
may be used. Saline solutions and aqueous dextrose and glycerol
solutions can also be employed as liquid vehicles, particularly for
injectable solutions. Suitable pharmaceutical vehicles also include
excipients such as starch, glucose, lactose, sucrose, gelatin,
sodium stearate, glycerol monostearate, sodium chloride, dried skim
milk, glycerol, propylene, glycol, water and the like. Test
compound compositions, if desired, can also contain minor amounts
of wetting or emulsifying agents, or pH buffering agents. The
compositions of the invention can take the form of solutions,
suspensions, emulsion, tablets, pills, pellets, capsules, capsules
containing liquids, powders, sustained-release formulations,
suppositories, emulsions, aerosols, sprays, suspensions, or any
other form suitable for use. Said composition is generally
formulated in accordance with routine procedures as a
pharmaceutical composition adapted to human beings for oral
administration or for intravenous administration. The amount of the
active compound or a that will be effective in the treatment can be
determined by standard clinical techniques. In addition, in vitro
or in vivo assays may optionally be employed to help identify
optimal dosage ranges. The precise dose to be employed will also
depend on the route of administration, and the seriousness of the
disease, and should be decided according to the judgment of the
practitioner and each patient's circumstances. However, suitable
dosage ranges for oral, intranasal, intradermal or intravenous
administration are generally about 0.01 milligram to about 75
milligrams per kilogram body weight per day, more preferably about
0.5 milligram to 5 milligrams per kilogram body weight per day.
[0079] It is to be understood that while the invention has been
described in conjunction with the above embodiments, that the
foregoing description and the following examples are intended to
illustrate and not limit the scope of the invention. Other aspects,
advantages and modifications within the scope of the invention will
be apparent to those skilled in the art to which the invention
pertains.
FIGURE LEGENDS
[0080] FIGS. 1A and 1B: Netrin-1 is over-expressed in human
metastatic breast tumors
[0081] FIG. 1A: Expression profile of netrin-1 examined with
quantitative real time reverse transcription PCR. Q-RT PCR was
performed using total RNA extracted from 15 metastatic (solid bar)
and 15 non-metastatic (open bar) primary tumor biopsies with
specific human netrin-1 primers .sup.26 and an primers
corresponding to the human TBP gene (TATA Binding Protein). TBP was
used as a control here, as it shows a weak variability at the mRNA
level between normal and breast tumoral tissues, as described in
.sup.25. Netrin-1 expression is given as the ratio between netrin-1
expression in each sample and the average of netrin-1 expression in
the non-metastatic samples.
[0082] FIG. 1B: Q-RT-PCR was performed using total RNA extracted
from 67NR and 4T1 mouse cell lines with specific mouse netrin-1
primers and the mouse gene RPLP0 as standard.
[0083] FIGS. 2A-2D: Forced expression of netrin-1 in 67NR mouse
cell line leads to metastasis development
[0084] FIGS. 2A and 2B: Mock transfected 67NR cells or 67NR cells
stably transfected with netrin-1 (67NR-net) were submitted to
netrin-1 expression analysis. FIG. 2A, RT-PCR using specific
chicken netrin-1 primers was performed using total RNA extracted
from 67NR-net1 and 67NR-mock. FIG. 2B, Western blot using anti-myc
(chick netrin-1) or anti-netrin1 antibodies was performed.
[0085] FIG. 2C: Photomicrographs of the two 67NR-net1 and 67NR-net2
clones compared to parental 67NR and to 4T1 cell line.
[0086] FIG. 2D: Metastatic 4T1 cells, two control cell clones
bearing puromycine resistance (67NR1 and 67NR2) and two netrin-1
expressing cell clones (67NRnet1 and 67NRnet2) were injected in fat
pad of 16 mice (4 mice per cell type) and metastasis was analyzed
in the lung environment. Representative photomicrographs of
under-pleural and intra-parenchymatous nodules after injection of
the respective cell clones (4T1, 67NR1, 67NRnet1, 67NRnet2). IPL:
intra-parenchymatous lesion, UPL: under-pleural lesions.
[0087] FIGS. 3A-3D: Induction of mouse metastatic cell death by
inhibiting the netrin-1/receptor interaction
[0088] FIG. 3A: Scheme representing netrin-1 and its receptors, DCC
and UNC5H.
[0089] FIGS. 3B, 3C, 3D: Quantitative analysis of cell death in
67NR and 4T1 cells using either DCC-EC-Fc and non specific
IL3-EC-Fc as a control (FIG. 3B), at different concentration (FIG.
3C) or the more restricted DCC-5Fbn domain (FIG. 3D) as a
competitor for netrin-1/receptor interaction. Cell death was
quantified either by the trypan blue exclusion assay (FIGS. 3B, 3D)
or by caspase activity assay (FIG. 3C). Standard deviations are
indicated (n=3).
[0090] FIGS. 4A and 4B: Induction of human metastatic cell death by
inhibiting netrin-1/receptor interaction
[0091] FIG. 4A: quantitative measurement of CAL51 cell death
treated with different concentration of DCC-EC-Fc by the trypan
blue exclusion assay.
[0092] FIG. 4B: Quantitative analysis of cell death monitored by
trypan blue exclusion in the CAL51 parental cell line or in the
clonal cell line CAL51-36, treated or not with the DCC-EC-Fc
competitor in culture media.
[0093] FIG. 5: Netrin-1 is over-expressed in human metastatic
breast tumors
[0094] Expression profile of netrin-1 examined with quantitative
real time reverse transcription PCR. Q-RT PCR was performed using
total RNA extracted from 51 tumor biopsies. They were obtained from
patient with tumors localized to the breast (N0, empty bar); with
only axillary node involvement (N+, gray bar) and with distant
metastases at diagnosis (M+, solid bar). Specific human netrin-1
primers .sup.39 and primers corresponding to the human PBGD gene
(TATA Binding Protein) were used. PBGD was used as a reference
here, as it shows a weak variability at the mRNA level between
normal and breast tumoral tissues, as described in .sup.38. The
other reference TBP was also used with similar results (not shown).
Netrin-1 expression is given as the ratio between netrin-1
expression in each sample and the average of netrin-1 expression in
the NO samples. A non parametric statistical significance test
(Mann-Whitney) was used, the p value is indicated.
[0095] FIGS. 6A-6C: Induction of metastatic cell death by
inhibiting the netrin-1/receptor interaction
[0096] FIG. 6A: DCC-EC-Fc displaces DCC/netrin-1 and
UNC5H2/netrin-1 interaction. ELISA assay with DCC-EC-Fc (top panel)
or UNC5H2-EC-Fc (bottom panel) coated, and quantification of bound
netrin-1 using anti-netrin-1 antibody in the presence of increasing
concentration of DCC-EC-Fc.
[0097] FIGS. 6B and 6C: Quantitative analysis of cell death in 67NR
and 4T1 cells using either DCC-EC-Fc and non specific IL3-EC-Fc as
a control. Cell death was quantified either by the trypan blue
exclusion assay (FIG. 6B), or by caspase activity assay (FIG. 6C).
Standard deviations are indicated (n=3).
[0098] FIGS. 7A-7C: Inhibition of metastasis formation in mice by
DCC-5Fbn treatment
[0099] FIG. 7A: Quantitative analysis of cell death in 67NR and 4T1
cells treated with DCC-5Fbn. MTT assay was performed on 67NR or 4T1
cells after treatment with increasing doses of DCC-5Fbn (.mu.g/ml).
Percentage of cell survival is presented. Standard deviations are
indicated (n=3).
[0100] FIGS. 7B and 7C: 4T1-luc cells were i.v. injected in BALB/c
mice at day 0 and PBS or DCC-5Fbn were injected every two days,
once i.v., once i.p. starting at day 0. After 13 days, metastasis
development was studied by luminescence recording (FIGS. 7B, 7C) or
by examination of lungs under a scope.
[0101] FIG. 7B: A representative image of luminescence recording of
PBS treated (right) or DCC-5Fbn treated (left) mice.
[0102] FIG. 7C: Quantification of the luminescent signal measured
by the NightOwLB system. The number of photon/pixel/sec was
quantified in each animal and an index of luminescent signal is
given at the ratio between the average photon/mouse in PBS treated
mice to the average signal detected in DCC-5Fbn treated mice. Two
independent experiments are presented (20 mice were analyzed in
experiment 1, 8 mice in the experiment 2).
[0103] A representative macroscopic photograph of a lung from PBS
treated mice or from DCC-5Fbn treated mice has been made (not
shown) can be demonstrated in the lung from PBS treated mice.
[0104] FIGS. 8A and 8B: Effect of DCC-5Fbn on netrin-1 expressing
human cancer breast cell lines
[0105] FIG. 8A: Expression of netrin-1 examined by Q-RT PCR using
total RNA extracted from 48 different breast tumor cell lines.
Netrin-1 expression is given as the ratio between netrin-1
expression and the housekeeping gene HMBS expression
(Hydroxymethylbilane synthase) in each sample. TBP was also used as
a control here and give similar results. The two cell lines that
have been selected for their high level of netrin-1 are indicated
by stars.
[0106] FIG. 8B: Cell death induction by DCC-5Fbn in SKBR7 and T47D
cell lines. Cell death was quantified either by MIT assay as
described in FIG. 4A (right panel) or by caspase activity
measurement as described in FIG. 3D (left panel). Standard
deviations are indicated (n=3).
[0107] FIGS. 9A and 9B: Human neuroblastoma
[0108] FIG. 9A: Netrin-1 is a marker of aggressiveness in human
neuroblastoma. Expression profile of netrin-1 examined with
quantitative real time reverse transcription PCR Q-RT PCR was
performed using total RNA extracted from 101 stage 4 or 4s
neuroblastoma biopsies. Tumors were either stage 4 diagnosed in
patient who were less than one year old (4<1 year) or stage 4
diagnosed in patient who were more than one year old (4>1 year).
It can be noted that bad prognosis cancers (stage 4>1 year) show
a significant over-expression of netrin-1. Student t tests were
used and the p values are indicated.
[0109] FIG. 9B: IMR32 cells that endogenously produce netrin-1 were
treated or not with DCC-5Fbn or as a control ILR3 (the
interleukin-3 receptor ectodomain) and were analyzed for cell death
either by measuring caspase activity (top) or by measuring cell
survival via a MTT assay (down). Note that while IL3R has no effect
on the death of IMR32 cells, DCC-5Fbn induces a significant IMR32
cell death. Standard deviations are indicated (n=3).
[0110] FIGS. 10A and 10B: Glioma
[0111] FIG. 10A: Netrin-1 is overexpressed in a large fraction of
glioma. Expression profile of netrin-1 examined with quantitative
real time reverse transcription PCR. Q-RT PCR was performed using
total RNA extracted from stage II and stage III oligodendroglioma
and stage IV glioblastoma biopsies and was compared to normal human
brain.
[0112] FIG. 10B: GL26 cells that endogenously produce netrin-1 (not
shown) were treated or not with DCC-5Fbn in the presence or not of
an excess amount of recombinant netrin-1 and were analyzed for cell
death either by measuring caspase activity (top) or by measuring
cell survival via a MTT assay (down). Note that DCC-5Fbn induces a
significant GL26 cell death and that this effect is fully inhibited
by addition of netrin-1, thus demonstrating that the DCC-5Fbn
effect is directly related to inhibition of endogenous netrin-1.
Standard deviations are indicated (n=3).
[0113] FIGS. 11A-11C: Lung cancer
[0114] FIG. 11A: Netrin-1 is overexpressed in a sizeable fraction
of human lung cancer. Expression profile of netrin-1 examined with
quantitative real time reverse transcription PCR. Q-RT PCR was
performed using total RNA extracted from lung cancer biopsies and
was compared to normal tissue.
[0115] FIG. 11B: H358 and H460, two NSCLC cell lines, were further
used for cell death assays. H358 cells that endogenously express
netrin-1 and H460 cells that fail to show detectable netrin-1
expression were treated or not with DCC-5Fbn in the presence or not
of an excess amount of recombinant netrin-1 and were analyzed for
cell death either by measuring caspase activity (top) or by
measuring cell survival via a MTT assay (down). Note that DCC-5Fbn
induces a significant H358 cell death but fails to show an effect
on H460 cells. Moreover the death effect observed in H358 cells is
fully inhibited by addition of netrin-1. Together with the fact
that H460 cells are not sensitive to DCC-5Fbn, these data support
that netrin-1 expressing lung tumor cells undergo apoptosis in
response to DCC-5Fbn. Standard deviations are indicated (n=3).
[0116] FIG. 11C: DCC-5Fbn inhibits xenografted H358 tumor growth in
nude mice. Five-week-old (20-22 g body weight) female athymic nu/nu
mice were obtained from Charles River. The mice were housed in
sterilized filter-topped cages and maintained in a pathogen-free
animal facility. H358 cells were implanted by s.c. injection of
510.sup.6 cells in 200 .mu.L of PBS into the left flank of the
mice. When tumors were established, PBS or 20 .mu.g of DCC-5Fbn
were administered into the tumor (i.t) everyday (duration of
treatment is indicated by arrows). Tumor sizes were measured by a
caliper during 41 days. The tumor volume was calculated with the
formula v=(0.5*(length*width.sup.2)).+-.SE,*) on 6 mice treated
with DCC-5Fbn and 4 mice treated with PBS. Note that while PBS
treated tumors were shown to grow, DCC-5Fbn treated tumors showed a
massive regression.
[0117] FIGS. 12A and 12B: Netrin-1 mediates DCC and UNC5H2
multimerization
[0118] FIG. 12A: DCC multimerization in the presence of netrin-1 in
HEK293T cells. Lysates of HEK293T cells transiently transfected
with HA-DCC and/or c-myc-DCC expressing constructs together or not
with netrin-1 expressing construct were subjected to myc pull-down
(IP .alpha.-myc). DCC-HA presence was revealed with an anti-HA
antibody.
[0119] FIG. 12B: UNC5H2 dimerization in the presence of netrin-1 in
HEK293T cells. Cell transfection and cell lysate preparation were
done as in (A) but with HA-Unc5H2 and/or FlagM2-UNC5H2 expressing
constructs. Cell lysates were subjected to FlagM2 pull-down (IP
.alpha.-Flag). HA-UNC5H2 presence was revealed with an anti-HA
antibody. Total: Western blot on lysate before pull-down.
[0120] FIGS. 13A and 13B: Validation of the chemically-inducible
system for UNC5H2 dimerization
[0121] FIG. 13A: Schematic representation of Fv2e-UNC5H2 fusion
constructions showing the two constructs (one tagged HA, the other
one tagged c-myc) used to validate the artificial dimerization
system.
[0122] FIG. 13B: Lysates of HEK293T cells transiently transfected
with Fv2E-UNC5H2 tagged HA or c-myc with or without the
dimerization drug (AP20187) were subjected to c-myc pull-down (IP
.alpha.-myc). Total: Western blot on lysate before pull-down.
HA-Fv2E-UNC5H2 presence was revealed with anti-HA antibody.
[0123] FIGS. 14A-14C: Forced DCC dimerization blocks its
proapoptotic activity
[0124] FIG. 14A: DCC-induced cell death is inhibited by
dimerization induced by AP20187, as measured by trypan blue
exclusion. HEK293T cells were transfected with mock plasmid
(Cont.), Fv2E (Fv), Fv2E-DCC-IC (Fv-DCC) with or without AP20187
(AP). In all conditions, cells were also transfected with the
surface marker pKk. Transfected cells expressing the marker were
magnetically labeled with MACSelect Microbeads and separated using
a MACS Separator and Separation Columns. Trypan blue exclusion was
assayed on these purified cells.
[0125] FIG. 14B: UNC5H2-induced cell death is inhibited by
dimerization induced by AP20187, as measured by trypan blue
exclusion as in (A). Cells were transfected with pMACSKk and Fv2E
(Fv), Fv2E-UNC5H2-IC (Fv-UNC5H2) with or without AP20187 (AP).
[0126] FIG. 14C: UNC5H2-induced caspase activation is inhibited by
dimerization induced by AP20187, as measured by relative caspase-3
activity. HEK293T cells were transfected with mock vector pCMV
(Cont.), Fv2E (Fv), Fv2E-UNC5H2-IC (Fv-UNC5H2) with or without
AP20187 (AP). Index of relative caspase activity is presented as
the ratio between the caspase activity of the sample and that
measured in HEK293T cells transfected with pCMV. Standard
deviations are indicated (n=3).
[0127] FIGS. 15A-15C: The recombinant soluble fifth fibronectin
domain of DCC (DCC-5Fbn) inhibits netrin-1-induced
DCC-multimerization
[0128] FIG. 15A: Affinity curve of netrin-1 on DCC-5Fbn measured by
ELISA test shows that DCC-5Fbn is able to bind netrin-1. DCC-5Fbn
(100 ng) or IL3-R (600 ng) was coated and increasing doses of
netrin-1 were added (0 to 800 ng). The IL3 values were subtracted
to the DCC-5Fbn values. The approximate Kd of DCC-5Fbn/netrin-1 was
estimated at 5 nM.
[0129] FIG. 15B: Competition assay. As in (A) but the complete
extracellular domain of DCC (DCC-EC, 125 ng) was coated instead of
DCC-5Fbn and netrin-1 was added (50 ng) in the presence of either
DCC-5Fbn (625 ng) or the complete DCC-EC (125 ng). Note that
DCC-5Fbn fails to compete with DCC/netrin-1 interaction.
[0130] FIG. 15C: Netrin-1-induced DCC multimerization is inhibited
by DCC-5Fbn. Lysates of HEK293T cells transiently transfected with
HA-DCC and/or c-myc-DCC expressing constructs with or without
netrin-1 (300 ng/mL) and/or DCC-5Fbn (900 ng/mL) were subjected to
HA pull-down (IP .alpha.-HA). c-myc-DCC presence was revealed with
anti-c-myc antibody. Total: Western blot on lysate before
pull-down.
[0131] FIGS. 16A and 16B: DCC-5Fbn antagonizes netrin-1-blocking
effects on DCC-induced cell death
[0132] FIG. 16A: HEK293T cells were transiently transfected with a
mock (Cont.) or a full length DCC construct and incubated or not
with netrin-1 (300 ng/ml) and/or DCC-5Fbn (800 ng/mL). Cell death
was assessed by trypan blue staining.
[0133] FIG. 16B: Metastatic breast cancer cells 4T1 were cultured
in the presence (+DCC-5Fbn) or absence (-DCC-5Fbn) of DCC-5Fbn (300
ng/mL) for 24 hours and cell death was also measured by trypan blue
exclusion assay. Standard deviations are indicated (n=3).
EXAMPLE 1
Materials and Methods
Cell Line, Cell Cultures, Transfection Procedure, Reagents and
Immunoblots:
[0134] 4T1 and 67NR cells were a kind gift from F. Miller (Detroit,
Mich., USA). Cal51, MCF7, MDA-MB231, 453, 361, 157, SK-BR3, CAMA-1,
T47D were cultured using standard procedure. Human breast cell
lines listed in FIG. 8B and more specifically T47D and SKB7 cell
lines were obtained from D. Bimbaun. 67NR cells were stably
transfected using the lipofectamine reagent (Invitrogen) and
puromycine (Sigma) selection. Transient transfections of Human
Embryonic Kidney 293T cells (HEK293T) were performed as previously
described .sup.10 according to a modified calcium phosphate
procedure or using Lipofectamine according to the manufacturer's
instructions (Invitrogen). The breast cancer 4T1 cell line was
described previously .sup.20. 4T1-luc cells were obtained by stable
transfection of a CMV-luciferase vector bearing hygromycine
resistance. Clones were selected by luminescence intensity using
the luminoskan Ascent Station (Labsystems). Immunoblots were
performed as described previously .sup.6 using anti-c-myc (Sigma;
1/200) anti-FlagM2 (Sigma, 1/200) or anti-HA (Sigma; 1/500). The
artificial dimerizing agent AP20187 was from Ariad Pharmaceuticals.
The complete extracellular domain of DCC (DCC-EC), DCC-EC-Fc were
obtained from R&D system and Netrin-1 from Apotech corp. For
cell death analysis, caspase activity measurement and
immunoprecipitation, AP20187 was used at a final concentration of
10 nM and netrin-1 was used at a final concentration of 300
ng/mL.
Human Breast Tumors Samples:
[0135] 51 human breast cancer samples were provided by the tumor
bank of the Centre Leon Berard. Fresh tissue of the tumor was
obtained during breast surgery prior any systemic therapy and
snap-frozen in liquid nitrogen.
Site Directed Mutagenesis and Plasmid Constructs:
[0136] PGNET-1 pCMV and pGNET-1 encoding chick netrin-1 were was
previously described .sup.6. pKk was described .sup.22. The
dominant negative mutants for DCC (pCR-DCC-IC-D1290N) and for UNC5H
(pCR-UNC5H2-IC-D412N) have been previously described .sup.6, 27, 7.
HA-DCC was obtained by introducing a HA tag in the template
pCMV-DCC .sup.6 by QuikChange site-directed mutagenesis system
(Stratagene) using the following primers: DCC-HA F:
5'-CACAGGCTCAGCCTMATCCATATGATGTACCGGATTATGCATA ACATGTATTTCTGAATG-3'
(SEQ ID NO:1); DCC-HA R: 5'-CATTCAGAAA
TACATGTTATGCATAATCCGGTACATCATATGGATAAAAGGCTGAGCCTGTG-3' (SEQ ID
NO:2).
[0137] c-myc-DCC was also obtained by introducing a c-myc tag in
the template pCMV-DCC by QuikChange using the following primers:
DCC-myc F: 5'-CACAGGCTCAGCCTTTGAGCAGAAGTTGATAAGTGAGGAAGATCTGTAACATG
TATTTCTGAATG-3' (SEQ ID NO:3). DCC-myc R: 5'-CATTCAGAAATACATGTTAC
AGATCTTCCTCACTTCTCAACTTCTGCTCAAAGGCTGAGCCTGTG-3' (SEQ ID NO:4).
[0138] HA-Fv2E encoding expression vector (in pC4M) from the Argent
Regulated Homodimerization kit is from Ariad Pharmaceuticals. From
this plasmid, the HA-Fv2E-DCC-IC plasmid was constructed. A PCR
fragment of the intracellular domain of DCC (1122-1447) was
obtained with the primers: F
5'-TATGTCGACCGACGCTCTTCAGCCCAGCAGAGA-3' (SEQ ID NO:5) and R
5'-TATGAATTCTTAGTCGAGTGCGTAGTCTGGTACGTCGTACGGATAAAAGGCTGA
GCCTGTGATGGCATTAAG-3' (SEQ ID NO:6).
[0139] The reverse primer fused to the HA tag to C-terminal end of
DCC. The PCR fragment was subcloned in HA-Fv2E by SalI and EcoRI
restriction digestion. The c-myc-Fv2E-DCC-IC was obtained using the
QuikChange site-directed mutagenesis system (Stratagen) with
pC4M-Fv2E-DCC-IC-HA as template and the following primers: primer
F: 5'-CTTAATGCCATCACAGGCTCAGCCTTTGAACAGAAACTCATCTCTGAAGAGGAT
CTGTAAGAATTCATAAAGGGCAAT-3' (SEQ ID NO:7) and primer R:
5'-ATTGCCCTTTATGAATTCTTACAGATCCTMTCAGAGATGAGTTTCTGTTCAAAG
GCTGAGCCTGTGATGGCATTAAG-3' (SEQ ID NO:8).
[0140] HA-UNC5H2 (in pcDNA3.1) has already been described .sup.7
the constructs encoding FlagM2-UNC5H2 was generated by cloning in
p3xFlag-CMVTM-7.1 (Sigma) the NotI-EcoRI PCR fragment derived from
HA-UNC5H2 as template and the following primers: primer F
5'-GCGCGGCCGCAGGGCCCGGAGCGGG-3' (SEQ ID NO:9) and primer R
5'-CGGAATTCTCAGCAATCGCCATCAGTGGTC-3' (SEQ ID NO:10).
[0141] HA-Fv2E-UNC5H2-IC- and c-myc-Fv2E-UNC5H2-IC in pC4M were
generated by PCR amplification of the UNC5H2 intracellular domain
using the following primers: UNC5H2-HA F
5'-CGGTCGACGTGTACCGGAGAAACTGC-3' (SEQ ID NO:11) and UNC5H2-HA R
5'-GCGAATTCTCATGCATAATCCGGCACATCATACGGATAGC AATCGCCATCAGTGGTC-3'
(SEQ ID NO:12), and UNC5H2-myc F 5'-CGGTCGACGTGTACCGGAGAAACTGC-3'
(SEQ ID NO:13) and UNC5H2-myc R
5'-GCGAATTCTCACAGATCCTCTTCTGAGATGAGITTTTTGTTCGCAATCGCCATCA
GTGGTC-3' (SEQ ID NO:14) respectively. The PCR fragments were
cloned in HA-Fv2E by SalI and EcoRI restriction digestion.
[0142] The cDNA encoding the HA-Fv2E-UNC5H2-IC and
c-myc-Fv2E-UNC5H2-IC fusion proteins were then subcloned in
pcDNA3.1-TOPO by PCR using the following primers: Fv2E F
5'-CCACCATGGGGAGTAGCA-3' (SEQ ID NO:15) and UNC5H2-HA R
5'-TCATGCATAATCCGGCACATCATACGGATAGCAATCGCCATCAGTGGTC-3' (SEQ ID
NO:16), and Fv2E F 5'-CCACCATGGGGAGTAGCA-3' (SEQ ID NO:15) and
UNC5H2-myc R 5'-TCACAGATCCTCTTCTGAGATGAGTTTTTGTTCGCAATC
GCCATCAGTGGTC-3' (SEQ ID NO:17) respectively and HA-Fv2E-UNC5H2-IC
and c-myc-Fv2E-UNC5H2-IC in pC4M as respective templates.
[0143] Ps974-DCC-5Fbn allowing bacterial expression of the fifth
fibronectin type III domain of DCC was obtained by inserting a
Pst1/BamH1 DNA fragment generated by PCR using pDCC-CMV-S as a
template.
DCC-5Fbn Production:
[0144] DCC-5Fbn production was performed using a standard
procedure. Briefly, BL21 cells were forced to express DCC-5Fbn in
response to imidazole and the BL21 lysate was subjected to affinity
chromatography using Flag-agarose (Sigma).
Immunoprecipitation:
[0145] Coimmunoprecipitations were carried out on HEK293T cells
transfected with various tagged constructs as described previously
.sup.27 Briefly, HEK293T cells were lysed in 50 mM HEPES pH 7.6,
125 mM NaCl, 5 mM EDTA and 0.1% NP-40 in the presence of protease
inhibitor, and further incubated with anti-HA (Sigma), anti-c-myc
antibody (Sigma), anti-FlagM2 (Sigma) and protein-A Sepharose
(Sigma). Washes were done in 50 mM HEPES pH 7.6, 125 mM NaCl, 5 mM
EDTA.
Binding Assay and ELISA Competition Assay:
[0146] DCC-5Fbn (100 ng) or IL3-R (R&D systems, 600 ng) was
coated on maxisorp plate (Nunc) and increasing doses of netrin-1
(Apotech) were added (0 to 800 ng) for binding assay. DCC-EC
(R&D systems, 125 ng) was coated on maxisorp plate for ELISA
competition assay. Netrin-1-FlagM2 (50 ng) and competitor DCC-EC
(125 ng) or DCC-5Fbn (625 ng) were then added simultaneously. After
washes, for both binding assay or ELISA competition assay, residual
netrin-1-FlagM2 still fixed, was revealed with an anti-FlagM2
antibody (Sigma).
DCC/Netrin-1 ELISA Assays:
[0147] DCC-EC-Fc (1.25 ng/ml) or UNC5H2-EC-Fc (0.5 ng/ml) was
adsorbed on 96-well maxisorp plate (Nunc) according to manufacturer
instruction. Hag-tagged Netrin-1 (0.5 ng/ml) was then added
together with increased concentrations of DCC-EC-Fc. After a 1 hour
incubation, plates were extensively washed and bound netrin-1 was
detected by immunolabeling using an anti-flagM2 antibody (Sigma)
and a HRP-goat-anti-mouse (Jackson). Colorimetric measurement was
performed on the multilabel Victor station (Wall ac).
Cell Death Assays:
[0148] 67NR, 4T1, CAL51, T47D and SKBR7 were grown in serum-poor
medium and were treated (or not) with DCC-EC-Fc or DCC-5Fbn for 24
hours. Cell death was analysed using trypan blue staining
procedures as described previously .sup.6. The extent of cell death
is presented as the percentage of trypan blue-positive cells in the
different cell populations. To select transfected cells, cells were
co-transfected with the surface marker pKk and the plasmid encoding
genes of interest. Transfected cells expressing the marker were
magnetically labeled with MACSelect Microbeads and separated using
a MACS Separator and Separation Columns (Miltenyi Biotec). Trypan
blue exclusion was assayed on these purified cells. Cell survival
was also measured by MTT assay using Vybrant MTT assay kit
(Molecular Probes) according to the manufacturer procedures.
Caspase Activity Measurement:
[0149] Relative Caspase activity was determined by flow cytometric
analysis as follows: 210.sup.5 treated cells were harvested, washed
once in 1 ml PBS, and resuspended in 200 .mu.l staining solution
containing FITC-VAD-fmk (CaspACE, Promega). After incubation for 60
min at 37.degree. C., cells were washed in 1 ml PBS and resuspended
in 200 .mu.l PBS for flow cytometry analysis. Stained cells were
counted using a FACS Calibur (Becton Dickinson) and CellQuest
analysis software with excitation and emission settings of 488 nm
and 525-550 nm (filter FL1), respectively. Caspase-3 activity was
measured by using the Caspase-3 assay from BioVision. Caspase
activity is presented as the ratio between the caspase activity of
the sample and that measured in HEK293T cells transfected with
pCMV. For cell death analysis and caspase activity measurement,
AP20187 or/and netrin-1 or/and DCC-5Fbn were added in cell culture
medium 20 hours and 1 hour before collecting cells.
Quantitative RT-PCR:
[0150] To assay netrin-1 expression in human breast tumors, total
RNA was extracted from biopsies of patients undergoing surgery for
breast cancer using Nucleospin RNAII kit (Macherey-Nagel) and 1
.mu.g was reverse-transcribed using the iScript cDNA Synthesis kit
(BioRad). Real-time quantitative RT-PCR was performed on a
LightCycler 2.0 apparatus (Roche) using the Light Cycler FastStart
DNA Master SYBERGreen I kit (Roche). Reaction conditions for all
optimal amplification, as well as primer selection of netrin-1,
were determined as already described .sup.18. The ubiquitously
expressed human PBGD, TBP and mouse RPLP0 genes showing the less
variability in expression between normal and breast tumoral tissues
.sup.25 28 were used as internal controls. The following primers
were used:
TABLE-US-00001 PBGD: FOR: (SEQ ID NO: 18)
5'-CTGGAGTTCAGGAGTATTCGGGG-3', REV: (SEQ ID NO: 19)
5'-CAGATCCAAGATGTCCTGGTCCTT-3'; TBP: FOR: (SEQ ID NO: 20)
5'-CACGAACCACGGCACTGATT-3', REV: (SEQ ID NO: 21)
5'-TTTTCTTGCTGCCAGTCTGGAC 3'; Human netrin-1-NTN1: FOR: (SEQ ID NO:
22) 5'-TGCAAGAAGGACTATGCCGTC-3', REV: (SEQ ID NO: 23)
5'-GCTCGTGCCCTGCTTATACAC-3'; UNC5B: FOR: (SEQ ID NO: 24)
5'-TGCAGGAGAACCTCATGGTC-3', REV: (SEQ ID NO: 25)
5'-GGGCTGGAGGATTACTGGTG-3'; DCC: FOR: (SEQ ID NO: 26)
5'-AGCCAATGGGAAAATTACTGCTTAC-3', REV: (SEQ ID NO: 27)
5'-AGGTTGAGATCCATGATTTGATGAG-3'; UNC5C: FOR: (SEQ ID NO: 28)
5'-GCAAATTGCTGGCTAAATATCAGGAA-3', REV: (SEQ ID NO: 29)
5-GCTCCACTGTGTTCAGGCTAAATCTT-3'.
Mice, Intravenous and Mammary Gland Injections, Measurement of
Metastasis Development
[0151] Syngenic mice model. Female BALB/cByJ mice of 8-11 weeks of
age from Jackson Laboratory were used for surgery. For mammary
gland injection of 67NR cells, mice were anesthetized with
2,2,2-tribromoethanol and 10.sup.6 cells in 50 .mu.l PBS were
injected into the mammary gland and mice were sacrificed when the
tumor exceeded 1.5 cm and caused impediment to the movement of the
animal. For intravenous injection, 10.sup.5 tumor 4T1-luc cells in
150 .mu.l PBS were injected into a tail vein and mice were either
sacrificed at day 13-15 (after 4T1 cells injection) or at day 20-23
(after 67NR cells injection) or analyzed using luminescence
recording. When animals were sacrificed, lungs were removed,
weighed and compared to the whole weight of the animal, and
metastatic nodules counted.
Xenograft in Nude Mice:
[0152] Five-week-old (20-22 g body weight) female athymic nu/nu
mice were obtained from Charles River. The mice were housed in
sterilized filter-topped cages and maintained in a pathogen-free
animal facility. Human breast cancer cell lines (SKBR7, T47D and
H358) were implanted by s.c. injection of 510.sup.6 cells in 200
.mu.L of PBS into the left flank of the mice. When tumors were
established (5 weeks for T47D, 2 weeks for SKBR7 and 5 days for
H358), PBS or 20 .mu.g of DCC-5Fbn were administered into the tumor
(i.t.) everyday during 14 days. Tumor sizes were measured by a
caliper. The tumor volume was calculated with the formula
v=0.5*(length*width.sup.2).
Tumor Analysis:
[0153] 4 .mu.m-thick lung sections were prepared and stained with
hematoxylin-eosin-saffron. Histological classification and grading
of neoplastic lesions was performed in a blinded fashion and
according to standard procedures. For in vivo imaging of metastasis
using 4T1-luc cells, the light resulting from the bioluminescent
oxidation of the intra-peritonaly injected endotoxin-free luciferin
(Promega) (120 mg/kg bodyweight) was detected and quantified (10
minutes after injection) with a NightOWL LB 981 NC 100 system from
Berthold Technologies, using an anaesthesia system with gaseous
isoflurane from TEM SEGA.
EXAMPLE 2
Netrin-1 Dictates Metastasis of Breast Tumor by Inhibiting
Apoptosis
[0154] We first analysed netrin-1 and its dependence
receptors--i.e., DCC and UNC5H expression by Q-RT-PCR in a panel of
30 breast primary tumors, 15 of which were without known metastatic
evolution, and 15 that were metastatic at diagnosis. While DCC was
barely detectable and UNC5H failed to show significant change
between the two types of tumors, netrin-1 appeared to be
significantly more expressed in metastatic breast tumors than in
non-metastatic breast tumors (FIG. 1A).
[0155] 60% of tested metastatic breast tumors showed an
over-expression of netrin-1 (range from 1.4 to 9.6 fold,
p<0.015) (Table 1).
TABLE-US-00002 TABLE 1 The percentage of samples showing a netrin-1
expression higher than the average expression in non-metastatic
biopsies is indicated, as is the range of the over-expression. n =
15 metastasis non metastasis % of breast tumors that over-express
netrin-1 60 33 Range of over-expression of netrin-1 1.4-9.6
1.6-2.9
[0156] In mice, Miller and colleagues developed a powerful model to
study the biology of metastatic versus non-metastatic tumors: from
a single primary mammary tumor that occurred naturally in a BALB/c
mouse, a series of cell lines were obtained that showed different
metastatic potentials when injected into syngenic mice. In
particular, while 67NR cells form primary mammary tumors but no
metastasis, 4T1 cells form primary tumors and metastasis,
especially in the lung, the bone marrow and the liver .sup.20.
Interestingly, while netrin-1 failed to be detected in 67NR cells,
netrin-1 was highly expressed in 4T1 cells (FIG. 1B).
[0157] To assay whether the metastatic potential of 4T1 cells,
compared to that of 67NR cells, was related to netrin-1 expression,
67NR cells were forced to stably express netrin-1. Mock transfected
67NR cells or 67NR-net cells that express netrin-1 (FIGS. 2A, 2B)
were injected in mammary gland or i.v. and metastasis was monitored
by anatomo-pathology examination of lungs. Both cell lines failed
to form metastasis when injected in fat pad, suggesting that the
presence of netrin-1 in 67NR is not sufficient to allow lung
metastasis formation from the primary site. However, when cells
were injected i.v., a significant increase of metastasis in the
lungs was detected in the netrin-1 expressing 67NR (FIG. 2C).
[0158] See Table 2 showing the number of under-pleural (metastasis
outside the lung) and intra-parenchymatous nodules (metastasis in
the lung).
TABLE-US-00003 TABLE 2 Intra parenchymatous under-pleural lesions
Lesions (lung metastasis) Number of Number of Number of mice
injected lung noduled per Number of nodules per with clone:
Affected lung (range) lung affected lung (range) 67NR1 3 0-5 0 0
67NR2 2 0-2 0 0 67NR-net1 3 0-5 1 0-4 67NR-net2 1 0-3 2 1-2
[0159] Thus, netrin-1 expression appears to be a crucial event that
supports metastasis formation, probably by favoring tumor cells
after intravation.
[0160] Because netrin-1 appears to be sufficient for the metastatic
potential of 67NR cells after intravation and because netrin-1 was
shown to inhibit netrin-1 dependence receptors-induced cell death
.sup.6, 7, 18, we next investigated whether autocrine production of
netrin-1 provides a selective advantage to 4T1 cells by inhibiting
DCC/UNC5H-induced cell death in these cells. A domain located in
the N-terminus of netrin-1 (the so-called laminin-VI domain)
interacts with both DCC and UNC5H receptors (FIG. 3A; .sup.21), so
that a soluble extracellular domain of DCC (DCC-EC-Fc) can inhibit
both DCC/netrin-1 and UNC5H/netrin-1 interaction (not shown).
DCC-EC-Fc was then added to a culture of 4T1 cells and cell death
was monitored either by a trypan blue exclusion assay (FIG. 3B) or
by measuring caspase activity (FIG. 3C). As shown in FIG. 3C,
addition of the competing protein in the culture medium triggers
death of 4T1 cells in a dose-dependent manner. Moreover, this
effect is specific, as DCC-EC-Fc had no effect on 67NR cell death
and IL3R-EC-Fc (the extracellular domain of IL3 receptor) failed to
bigger 4T1 cell death (FIGS. 3B, 3C). This effect is due to
netrin-1 inhibition, as addition of an excess amount of netrin-1,
together with DCC-EC-Fc inhibited the pro-apoptotic activity of
DCC-EC-Fc on 4T1 cells (not shown). To restrict the competition to
a smaller domain, we produced the fifth fibronectin type III domain
of DCC, which is known to interact with netrin-1 .sup.21. Addition
of this domain--DCC-5Fbn--had a similar pro-apoptotic activity on
4T1 cells (FIG. 3D). Thus, while netrin-1 appears to confer
metastatic potential to tumor cells in mice, these netrin-1
expressing metastatic tumor cells can be engaged toward apoptosis
by inhibition of the netrin-1/receptors interaction.
[0161] To further analyse whether this holds true in human breast
tumor cells, netrin-1 expression was analysed in a panel of human
metastatic breast cancer cell lines (see Table 3).
TABLE-US-00004 TABLE 3 Netrin-1 Human breast transcriptional
carcinoma cell line expression DCC-EC-Fc sensitivity MDA-MB 157
++++ +/- MCF-7 ++++ -- CAMA- 1 +++ -- SKBR3 ++ ND SAV-NUDE ++ ND
Ca151 ++ +++ MDA-MB231 + ++ MDA-MB453 + + T47D -- ND T47D* ++ ++
*Carried out on another T47D cell line
[0162] Table 3 showing the different human metastatic breast cell
lines analysed for the netrin-1 expression by Q-RT PCR as in FIGS.
1A, 1B, and their sensitivity to DCC-EC-Fc by measurement of cell
death by trypan blue exclusion. The relative amount of netrin-1
expression and DCC-EC-Fc sensitivity are indicated by (+), while
the absence of these criteria is indicated by (-). In some cell
lines the DCC-EC-Fc has not been determined (ND).
[0163] As expected, netrin-1 is expressed in a large number of
metastatic cell lines and some of them undergo apoptosis when
cultured in the presence of DCC-EC-Fc. As an example, CAL51 cells
underwent apoptosis in a dose-dependent manner in response to
DCC-Ec-Fc. As above, addition of netrin-1 in excess reverts the
effect of DCC-EC-Fc, supporting the view that the competing
proteins kill these human cell lines by inhibiting the
netrin-1/netrin-1 receptors interaction. Moreover, a clonal
selection from CAL51 cells allowed the establishment of a CAL51-36
cell line, that is much more susceptible to cell death in response
to DCC-EC-Fc (FIG. 4B). Because the DCC-EC-Fc or DCC-5Fbn may
consequently represent good tools to trigger selective apoptosis of
human metastatic tumors cells.
[0164] Here we show that netrin-1 expression may be considered as a
marker of breast tumor dissemination. More than half of the breast
tumors with metastasis propensity showed elevated netrin-1
expression. Both the mice model described above and the data
obtained on human breast cancer cell lines support the view that
this elevated netrin-1 level is a selective advantage acquired by
the cancer cell to escape netrin-1-dependence receptors induced
apoptosis and, consequently, to survive independently of netrin-1
availability. From a mechanistic point of view, this autocrine
expression of netrin-1 inhibits cell death induced by UNC5H.
Indeed, DCC was barely detectable in the two groups--metastatic and
non metastatic--of breast cancers studied, hence suggesting that
DCC is either down-regulated early during breast tumorigenesis or
is only weakly expressed in breast tissue. Moreover, inhibition of
UNC5H-induced apoptosis by co-expression of a dominant negative
mutant form of the UNC5H pro-apoptotic activity inhibits CAL51 cell
death in response to DCC-EC-Fc (not shown). This may fit with the
recent observation that part of UNC5H2 pro-apoptotic activity
passes through the activation of the serine/threonine DAPK .sup.22
a protein involved in metastasis regulation .sup.23.
[0165] These observations not only provide evidence for the
importance of the ligand/dependence receptor pair in the regulation
of tumor development, but also enlighten a new therapeutic
strategy. Indeed, as of today, there is no efficient treatment for
patients with metastatic breast cancer, a lack of treatment that
leads to the death of 400,000 women worldwide per year .sup.24.
Here we propose that a treatment based on inhibition of the
interaction between netrin-1 and its dependence receptors could
positively affect half of the patients suffering from metastatic
breast cancer. These treatments could include chemical drugs,
monoclonal antibodies or the DCC-5Fbn protein presented here.
Whether this should be considered as a strategy preventing
metastasis formation, which would imply a long-term preventive
treatment on women diagnosed with primary breast cancer, or as a
strategy that could be used to induce metastasis regression remains
to be shown. Future clinical trials should also answer this
point.
[0166] Here we describe that, unlike human non-metastatic breast
tumors, the majority of metastatic breast cancers shows an
over-expression of netrin-1. In a mice model, we demonstrate that
in non-metastatic mammary tumor cells, forced expression of
netrin-1 is associated with metastasis in the lungs. Moreover, mice
or human metastatic tumor cell lines, that were shown to highly
express netrin-1, undergo apoptosis when the netrin-1/receptors
interaction is inhibited by a competing protein. Thus, netrin-1 is
a marker for human metastatic cancer such as metastatic breast and
inhibition of the netrin-1/receptors interaction represents a
therapeutic approach to induce metastatic cell death.
EXAMPLE 3
Restoration of the Netrin-1 Dependence Receptors Pathway Triggers
Apoptosis in Metastatic Breast Tumors
[0167] Netrin-1 and its dependence receptors--i.e., DCC, UNC5H2,
UNC5H3 expression were analysed by Q-RT-PCR in a panel of 51 breast
tumors. It includes patients whose tumors were either localized to
the breast (NO, 16 patients), had nodal involvement (N+, 19
patients) or had distant metastatic disease at the time of
diagnosis (M+, 16 patients). While DCC was barely detectable and
UNC5H expression failed to display significant changes between the
different types of tumors (not shown), netrin-1 is significantly
more expressed in N+ tumors than in NO tumors (median: 1.8 versus
0.5, p=007) with a range of netrin-1 expression higher in N+ tumors
(FIG. 5 and Table 4).
TABLE-US-00005 TABLE 4 The percentage of samples showing a netrin-1
expression higher than the average expression in N0 biopsies, 5
fold higher or 15 fold higher is indicated, as is the range of the
over-expression. N0 N+ M+ Localised Nodal Distant to breast
involvement metastasis n = 51 (n = 16) (n = 19) (n = 16) % of
breast tumors that over- 31 73.7 93.7 express netrin-1 % of breast
More than 0 31.5 62.5 tumors that 5 fold over-express More that 0 0
37.5 netrin-1 15 fold Range of over-expression of 0.02-4.6
0.03-12.8 0.6-111.7 Netrin-1
[0168] 31.5% of the N+ tumors show at least a 5 fold increase in
netrin-1 expression while no such increase was detected in any
tested NO tumors (FIG. 5 and Table 4). An even more striking
difference is observed when comparing netrin-1 expression in M+
versus NO tumors (median: 7.8 versus 0.5, p<0.0001). Along this
line 62.5% of M+ tumors show at least a 5 fold increase in netrin-1
expression. A significant difference in netrin-1 expression also
exists between N+ and M+ tumors (median: 1.8 versus 7.8, p=009).
Moreover, netrin-1 overexpression is higher in M+ tumors than in N+
tumors, as 37.5% of M+ tumors display more than a 15 fold increase
in netrin-1 level, while such an increase is not detected in N+
tumors (FIG. 5 and Table 4). Thus, netrin-1 up-regulation is a
marker of nodal involvement and distant metastatic disease in human
breast cancer.
[0169] In mice, Miller and colleagues developed a powerful model to
study the biology of metastatic versus non-metastatic tumors: from
a single primary mammary tumor that occurred naturally in a BALB/c
mouse, a series of cell lines were obtained that showed different
metastatic potentials when injected into syngenic mice. In
particular, while 67NR cells form primary mammary tumors but no
metastasis, 4T1 cells form primary tumors and metastasis,
especially in the lung, the liver and the bone marrow .sup.20.
Interestingly, while netrin-1 failed to be detected in 67NR cells,
netrin-1 was highly expressed in 4T1 cells (FIG. 1B).
[0170] To first assay whether the metastatic potential of 4T1
cells, compared to that of 67NR cells, was related to netrin-1
expression, 67NR cells were forced to stably express netrin-1. Mock
transfected 67NR cells or 67NR cells that express netrin-1 (FIGS.
2A and 2B) were injected into mammary glands and metastasis was
monitored by anatomo-pathological examination. Both cell lines
failed to efficiently form metastasis in liver or in lungs when
injected in mice fat pads (19 mice were injected with netrin-1
expressing 67NR cells and only two suspicions of micro-metastases,
one in the lung and one in the liver were detected) (Table 5).
TABLE-US-00006 TABLE 5 Lungs and liver metastasis of fat
pad-injected 67NR versus netrin-1 expressing cells. One control
cell clone bearing puromycine resistance (67NR-mock), one netrin-1
expressing cell clone (67NRnetl) and one polyclonal population of
netrin-1 stably transfected 67NR (67NR-net1-polyclonal) were
injected in fat pad of mice and metastasis was analyzed in the lung
or liver environment. Cells Mice Primary injected (n) tumors
Metastasis Comment 67NR-mock 9 9 0 67NR-netl 7 7 0 Suspicion of 1
micrometastase in liver 67NR-net1 12 12 0 Suspicion of polyclonal 1
micrometastase in lung
[0171] Thus, netrin-1 expression in tumor cells is not sufficient
to enable metastasis formation from the primary site.
[0172] Because netrin-1 was shown to inhibit netrin-1 dependence
receptors-induced cell death .sup.6, 7, 18, we next investigated
whether the autocrine production of netrin-1 detected in metastatic
4T1 cells confers a selective advantage to these cells, by
inhibiting DCC/UNC5H-induced cell death. To assay this, we looked
for a compound that may titrate netrin-1. It was reported that a
domain located in the N-terminus of netrin-1 (the so-called
laminin-VI domain) interacts with both DCC and UNC5H receptors
(FIG. 3A; .sup.21). We show that a soluble extracellular domain of
DCC (DCC-EC-Fc) can inhibit both DCC/netrin-1 and UNC5H2/netrin-1
interaction, as measured by ELISA assay (FIG. 6A). DCC-EC-Fc was
then added to a culture of 4T1 cells and cell death was monitored,
either by a trypan blue exclusion assay (FIGS. 3B and 6B) or by
measuring caspase activity by flow cytometry (FIGS. 3C and 6C). As
shown in FIGS. 3B, 3C, 6B and 6C addition of the competing protein
in the culture medium triggers death of 4T1 cells in a
dose-dependent manner. This effect is specific, as DCC-EC-Fc had no
effect on 67NR cell death (FIGS. 3B, 3C, 6B and 6C) and IL3R-EC-Fc
(the extracellular domain of the IL3 receptor) failed to trigger
4T1 cell death (FIG. 3D). Thus, 4T1 cells survive through autocrine
production of netrin-1, which blocks netrin-1 receptors-induced
cell death.
[0173] Because the complete extracellular domain of DCC appears as
only of modest interest for use in vivo and in therapy (DCC-EC-Fc
is about 1100 amino-acid large), we looked for an alternative
polypeptide from the DCC extracellular domain, which could trigger
apoptosis in 4T1 cells. We consequently produced the fifth
fibronectin type III domain of DCC, DCC-5Fbn, which is known to
interact with netrin-1 .sup.21 (FIG. 3A). Interestingly, this 100
amino-acid protein does not interfere with the binding of
DCC/netrin-1 or UNC5H/netrin-1, but affects the ability of netrin-1
to trigger multimerization of these receptors (see Example 4). As
DCC and UNC5H multimerization is a pre-requisite for the netrin-1
inhibitory activity on DCC/UNC5H-induced cell death, the addition
of DCC-5Fbn triggers apoptosis in DCC-expressing cells cultured in
the presence of netrin-1 .sup.22 and triggers death of both 4T1
(FIG. 7A).
[0174] We next investigated whether the cell death effect observed
in vitro may be extended in vivo. To do so, 4T1 cells were stably
transfected with a luciferase-based vector and 4T1-luc cells were
intravenously (i.v.) injected into syngenic BALB/c mice. Mice were
then intraperitonealy (i.p.) and i.v injected (1 injection every
two days, once i.v., once i.p.) from day 0 to day 13 with either
PBS buffer or Flag-tagged-DCC-5Fbn (1.25 .mu.g/mouse g/injection).
Metastasis formation was then analyzed using luminescence
recording. As shown in FIGS. 7B and 7C, when i.v. injected, 4T1-luc
cells efficiently colonize lungs. On the opposite, mice treated
with DCC-5Fbn show a dramatic reduction of lung metastasis (FIGS.
7B and 7C). This inhibition of metastasis formation was then
confirmed by anatomo-pathological examination of lungs, (not shown,
see Table 6).
TABLE-US-00007 TABLE 6 Total number of lung metastatic nodules in
individual mice were counted under a dissection scope in the two
treated populations (+PBS, +DCC-5Fbn) Average of Metastatis Range
of metastasis Treatment Mice (n) per mouse per mouse PBS 10 42.4
0-75 DCC-5Fbn 10 2.6 0-6
[0175] Similar results were obtained when we performed daily i.p.
injection of GST-tagged-DCC-5Fbn instead of Flag-tagged-DCC-5Fbn
and GST-FADD instead of PBS (not shown). Thus, in mice, the
inhibition by DCC-5Fbn of the pro-survival activity conferred by
netrin-1 autocrine expression is associated with metastasis
prevention.
[0176] The acquired survival advantage through netrin-1 autocrine
expression is not restricted to murine tumor cells, as it is
detected in human breast cancer cell lines. Indeed, netrin-1 was
shown to be expressed in a sizeable fraction of human breast cancer
lines (FIG. 8A) and addition of DCC-EC-Fc or DCC-5Fbn to naturally
netrin-1 expressing human breast adenocarcinoma T47D or SKBR7 cell
cultures triggers cell death induction measured either by caspase-3
activity assay or MTT assay (FIG. 8B and not shown). This effect is
due to netrin-1 inhibition, as addition of an excess amount of
netrin-1, inhibited the pro-apoptotic activity of
DCC-EC-Fc/DCC-5Fbn (not shown). To monitor the anti-tumor effect of
DCC-5Fbn, xenografts of T47D cells were implanted in nude mice.
When tumors reached a palpable size, mice were daily treated with
either PBS or DCC-5Fbn and tumor volume was determined for 18 days.
Similarly to the data obtained in the syngenic model above,
DCC-5Fbn fully inhibits tumor growth (Table 7).
TABLE-US-00008 TABLE 7 showing the number and behavior of
xenografted T47D tumors that have been treated either with PBS or
DCC-5Fbn. The number of tumors that has grown in size more than 40%
and the number of tumors that has a reduced size (more than 30%)
are indicated Number of Tumor growth Tumor regression Treatment
mice (>40%) (>30%) PBS 4 3 0 DCC-5Fbn 5 0 3
[0177] Here we show that netrin-1 expression may be considered as a
marker of breast tumor ability to disseminate. Most of the breast
tumors with metastasis propensity showed elevated netrin-1
expression. Both the data obtained on human/mice breast cancer cell
lines and the syngenic/human xenograft mice models described above
and support the view that this elevated netrin-1 level is a
selective advantage acquired by the cancer cell to escape
netrin-1-dependence receptors induced apoptosis and, consequently,
to survive independently of netrin-1 availability. From a
mechanistic point of view, in the human pathology, this autocrine
expression of netrin-1 probably inhibits UNC5H-induced cell death.
Indeed, DCC was barely detectable in the different groups (N0, N+,
M+) of breast cancers studied, hence suggesting that DCC is either
down-regulated early during breast tumorigenesis or is only weakly
expressed in breast tissue. Moreover, inhibition of UNC5H-induced
apoptosis by co-expression of a dominant negative mutant form of
the UNC5H pro-apoptotic activity inhibits human breast cancer cell
death in response to DCC-EC-Fc (not shown).
[0178] Thus, as predicted by the dependence receptor model, we have
now shown that a tumor cell can escape dependence receptor
dependency in at least three manners. First, expression of the
dependence receptor can be down-regulated, as extensively described
for DCC and more recently for UNC5H .sup.15, 17, 19, 29. Second,
the downstream death signalling can be shut down. Along this line,
we have recently shown that UNC5H2 pro-apoptotic activity relies on
the binding of UNC5H2 to the serine/threonine DAPK .sup.22, a
protein that was demonstrated to be involved in metastasis
regulation and down-regulated in human malignancy .sup.23.
Similarly, a recent report by Stupack and colleagues shows that, in
the case of some integrins that act as dependence receptors,
caspase-8, which triggers the cell death mediated by these
integrins, is crucial for neuroblastoma metastasis .sup.30. Here we
show that a third selective advantage for the tumor cell is the
self-production of the dependency ligand. One intriguing question
remains as to why breast tumors with metastatic propensity seem to
have preferably selected netrin-1 self-production rather than
receptor loss, while colorectal tumors have mostly selected loss of
the receptors rather than gain of netrin-1 expression--indeed, only
7% of colorectal cancers show an increase of netrin-1 expression
.sup.18. A possible explanation is that netrin-1 expression not
only confers a gain in survival to the migrating cells, but also
possibly a gain in the non-apoptotic/positive signalling of
netrin-1 receptors. Along this line, it is important to note that
netrin-1 was originally described as a guidance cue .sup.31, which,
even though completely unproven, could play a role in the tropism
of metastatic cells. Other proposed roles of netrin-1 include
adhesion and morphogenesis regulation .sup.32-34, both mechanisms
that may be of importance for metastasis development. Similarly,
netrin-1 was recently proposed to play a role during embryonic
angiogenesis and even though conflicting results have been
published .sup.36-38, we cannot at this stage discard the role of
netrin-1 as an angiogenic factor that somehow could favor
metastasis development at the secondary site. However, the gain of
"positive" signalling by netrin-1 autocrine expression is probably
not sufficient per se to promote metastasis, as forced expression
of netrin-1 in non-metastatic cells failed to be associated with
metastasis formation.
[0179] These observations not only provide evidence for the
importance of ligand/dependence receptors pairs in the regulation
of tumor development, but also enlighten a new therapeutic
strategy. Indeed, as of today, there is no efficient treatment for
patients with metastatic breast cancer, a lack of treatment that
leads to the death of 400,000 women worldwide per year .sup.24.
Here we propose that a treatment based on inhibition of the
interaction between netrin-1 and its dependence receptors could
positively affect a large fractions of the patients suffering from
metastatic cancer, such as breast cancer--i.e. patients who would
shown high netrin-1 expression in primary tumors--. These
treatments could include chemical drugs, monoclonal antibodies or
the DCC-5Fbn protein presented here.
EXAMPLE 4
Netrin-1 Expression and Inhibition of Netrin-1 Activity in Other
Human Tumors
[0180] A) Netrin-1 is a marker of aggressiveness in human
neuroblastoma (see FIG. 9A, its legend and table 8) and inhibiting
netrin-1 activity promotes neuroblastoma cell death (see FIG. 10B
and its legend).
TABLE-US-00009 TABLE 8 26 neuroblastoma cell lines (either obtained
directly from patient tumors at Centre Leon Berard (CLB-X) or
classic neuroblastoma cell lines (IMR32, SHEP, SHSY or SKNAS)) were
tested as in (a) for netrin-1 expression by Q-RT-PCR. Netrin-1
level is indicated as (-) no netrin-1, (+, ++, +++) low to high
netrin-1 level. It can be noted that a significant fraction of cell
lines have high expression of netrin-1. Cell line netrin-1 CLB-BAB
-- CLB-BAC -- CLB-BAR -- CLB-BARREC -- CLB-BEL + CLB-BOULT ++
CLB-BER2 -- CLB-BERLUD -- CLB-CAR -- CLB-ESP -/+ CLB-GAR -- CLB-GHE
MO -- CLB-GHE PCT -- CLB-HUT +++ CLB-MAR MO -/+ CLB-MAR LT +
CLB-PEC -- CLB-REM +++ CLB-SED + CLB-TRA -- CLB-VOL ++++ IGRN91 -/+
IMR32 +++ SHEP -/+ SHSY 5Y -/+ SKNAS ++++
B) Netrin-1 is overexpressed in a large fraction of glioma (see
FIG. 10A and its legend) and inhibition of netrin-1 activity
promotes glioma cell death (see FIG. 10B and its legend). C)
Netrin-1 is overexpressed in human lung cancer (see FIG. 11A, its
legend and table 9) and inhibition of netrin-1 activity promotes
lung cancer cell death and prevents lung cancer development (see
FIGS. 12C and 12D and their legends).
TABLE-US-00010 TABLE 9 Lung cancer cell lines either derived from
small-cell-lung cancer (SCLC) or non-small-cell-lung cancer (NSCLC)
were tested as in (a) for netrin-1 expression by Q-RT-PCR. Netrin-1
level is indicated as (-) no netrin-1, (+, ++) (low to high
netrin-1 level. It can be noted that a significant fraction of cell
lines have high expression of netrin-1. Cell line netrin-1 NSCLC
A549 + H322 ++ H358 ++ H460 - H1299 + SCLC H69 - H146 + H196 -
D) Netrin-1 expression in other human tumors.
[0181] Expression of netrin-1 examined by Q-RT PCR using total RNA
extracted from different human tumors as in FIGS. 10A-10B, 11A-11C,
12A-12B. The table 10 indicates (n) the number of tumors tested and
the percentage of tumors showing an overexpression of netrin-1 in
each pathology.
TABLE-US-00011 TABLE 10 over expression Cancers n of netrin-1 Renal
adenocarcinoma 5 40% Amite myeloid leukaemia 55 62% Sarcoma 10 30%
Melanoma 6 50% Ovarian adenocarcinoma 14 93%* Pancreatic
adenocarcinoma 7 57% Uterus adenocarcinoma 42 19% Stomac
adenocarcinoma 27 26% Kidney adenocarcinoma 20 50% Rectal
adenocarcinoma 18 17% *100% of the 7 metastatic samples
EXAMPLE 5
[0182] To analyze whether DCC was under its monomeric form unless
netrin-1 was present, we transiently co-expressed an HA-tagged
full-length DCC together with c-myc-tagged full-length DCC in
HEK293T cells. Immunoprecipitation was then performed using an
anti-c-myc antibody and as shown in FIG. 12A, despite a good
expression of both HA and c-myc tagged-DCC, HA-DCC was only
modestly included in the c-myc-DCC pull-down in absence of ligand,
suggesting that DCC, was mainly present as a monomer when expressed
in HEK293T in the absence of netrin-1. In the same experimental
conditions, when netrin-1 was added to the culture medium (not
shown and FIG. 15C) or when a netrin-1 expression construct was
co-expressed with the DCC-expressing constructs (FIG. 11A), HA-DCC
was clearly included in the c-myc DCC pull-down, hence
demonstrating that netrin-1 triggers dimerization or
multimerization of DCC. This result is in agreement with data from
Tessier-Lavigne and colleagues who first reported netrin-1-induced
multimerization .sup.46, even though in our culture and
immunoprecipitation conditions, DCC displays a modest albeit
detectable level of multimerization in the absence of netrin-1.
This constitutive, low multimerization level could either be
attributed to the low affinity of DCC receptors for themselves in
the absence of ligand or to the system used, which is based on
forced expression of high levels of transmembrane receptors.
[0183] We then investigated whether the other UNC5H netrin-1
receptors share a similar behaviour. HEK293T cells were transiently
transfected with an HA-tagged full-length UNC5H2 together with
Flag-tagged full-length UNC5H2 in the presence or absence of
netrin-1. Immunoprecipitation was then performed using an
anti-FlagM2 antibody. As shown in FIG. 11B, the presence of
netrin-1 triggers an efficient immunoprecipitation of HA-UNC5H2
with Flag-UNC5H2. Thus, while in the absence of netrin-1, DCC and
UNC5H2 are mainly under monomeric forms, both DCC and UNC5H2 show
an increased propensity to multimerize in the presence of
netrin-1.
[0184] To determine whether netrin-1-induced multimerization is the
crucial step for inhibiting DCC/UNC5H2 pro-apoptotic cell death, we
developed a chimeric system in which protein dimerization can be
induced by a chemical agent. This system was successfully used to
show both the role of caspase-8 dimerization in caspase-8
activation .sup.49 and the importance of p75ntr-multimerization in
p75ntr pro-apoptotic activity.sup.48. This system is derived from
the ability of the Fk1012 compound to cross-dimerize the FkBP
motif. DCC and UNC5H2 intracellular domains were fused in their
N-terminus to derived Fv2e FkBP motives and dimerization was
induced using the AP20187 chemical compound (FIG. 13A). We first
analyzed whether the developed system recapitulates
netrin-1-induced multimerization of the UNC5H2 intracellular
domain. HEK293T cells were co-transfected with an HA-tagged
Fv2e-UNC5H2-IC together with c-myc-tagged Fv2e-UNC5H2-IC and
co-immunoprecipitations were performed using an anti-c-myc
antibody. As shown in FIG. 13B, without addition of AP20187,
HA-Fv2e-UNC5H2-IC was barely detectable in the c-myc-Fv2e-UNC5H2-IC
pull-down, hence supporting that Fv2e-UNC5H2-IC is expressed in
HEK293T cells mainly as a monomer. As expected, addition of AP20187
led to the efficient pull-down of HA-Fv2e-UNC5H2-IC with
c-myc-Fv2e-UNC5H2-IC. Similar results were obtained with
Fv2e-DCC-IC (not shown). Thus, this dimerization system
recapitulates dimerization of the intracellular domain of the
netrin-1 receptors DCC and UNC5H2.
[0185] Because this chemically-inducible DCC/UNC5H2 dimerization
system appears to work adequately to mimic netrin-1-induced
DCC/UNC5H2 multimerization, we then assessed whether the
dimerization of DCC/UNC5H2 was sufficient to inhibit DCC/UNC5H2
pro-apoptotic activity. HEK293T cells were forced to express
Fv2e-DCC-IC in the presence or absence of AP20187 and cell death
was assessed by trypan blue staining, as previously described, to
measure DCC-induced cell death .sup.6, 27. As shown in FIG. 14A,
expression of Fv2e-DCC-IC was associated with increased cell death
compared to expression of the Fv2e motives without the DCC-IC
fusion. Interestingly, when AP20187 was added, cell death induced
by Fv2e-DCC-IC was dramatically reduced (FIG. 14A). Similarly,
while Fv2e-UNC5H2-IC triggers cell death (FIG. 14B) or caspase
activation (FIG. 14C) when expressed in HEK293T in the absence of
AP20187, the addition of the dimerizing drug is sufficient to
reduce significantly Fv2e-UNC5H2-IC-induced cell death (FIG. 14B)
or caspase activation (FIG. 14C). Thus, while monomeric DCC-IC and
UNC5H2-IC are pro-apoptotic, the multimeric forms of DCC-IC or
UNC5H2-IC no longer display pro-apoptotic activity. Therefore, the
ability of netrin-1 to inhibit DCC/UNC5H2-pro-apoptotic activity is
intrinsically linked to the ability of netrin-1 to multimerize DCC
or UNC5H2, as this multimerization process is sufficient to shut
down DCC and UNC5H2 pro-apoptotic activity.
[0186] A tempting model would be that the monomeric form of DCC or
UNC5H2 has a spatial conformation that is easily subjected to the
initial caspase cleavage of the receptor's intracellular domain. On
the opposite, presence of the ligand would lead to multimerization
of the intracellular domain, which somehow becomes less accessible
to caspase cleavage. Along this line, Arakawa and colleagues have
shown that the caspase cleavage of UNC5H2 is inhibited by netrin-1
presence .sup.47. Yet, because of technical limitations, we have
failed to detect DCC or UNC5H2 cleavage in cells forced to express
the Fv2e fusion proteins. An alternative model to the cleavage
inhibition would be that netrin-1-induced receptor multimerization
triggers a survival signal, that somehow inhibits a constitutive
pro-apoptotic activity of DCC or UNC5H2 related to constitutive
caspase cleavage. However, we failed to show that the known
positive signalling pathways activated by DCC upon netrin-1 binding
are involved in the inhibitory activity of netrin-1 on DCC
pro-apoptotic activity. For example, netrin-1 induces DCC-mediated
activation of ERK-1/2 .sup.3, kinases known to display an
anti-apoptotic effect. However, classic inhibitors of the ERK-1/2
pathway, while affecting netrin-1-induced ERK-1/2 phosphorylation,
failed to block the netrin-1-inhibitory effect on DCC pro-apoptotic
activity (Forcet and Mehlen, unpublished). Thus, it is probable
that netrin-1-induced DCC multimerization affects DCC intracellular
accessibility. However, it remains to be demonstrated whether this
is a matter of simple stochiometry, or whether the bringing closer
of the extracellular domains induces a change of conformation
within the intracellular compartments.
[0187] If the mechanisms underlying netrin-1-induced receptor
multimerization are yet to be described, the observation that
netrin-1-induced DCC/UNC5H2 multimerization is sufficient to
inhibit DCC/UNC5H2-induced cell death may represent an interesting
tool to turn on DCC or UNC5H pro-apoptotic activity in vivo, in
tumors in which netrin-1 is expressed in an autocrine manner.
Indeed, we have demonstrated that netrin-1 overexpression in mice
gut is associated with intestinal tumor development because of
apoptosis inhibition .sup.18 and we have recently observed that
netrin-1 is overexpressed in the majority of human metastatic
breast cancers. Moreover, the mechanism of netrin-1 overexpression
appears to be an acquired selective advantage of metastatic tumor
cells for survival in settings of environmental absence of netrin-1
(see examples 2 and 3). Thus, to inhibit DCC/UNC5H dimerization
would putatively represent an interesting way to trigger tumor cell
apoptosis.
[0188] Along this line, the fifth fibronectin domain of DCC has
been shown to be a domain of interaction with netrin-1 (FIG. 15A
and .sup.21), even though conflicting data have also been reported
.sup.43. We thus first assessed whether a recombinant soluble fifth
fibronectin domain of DCC (DCC-5Fbn) could bind to recombinant
netrin-1. ELISA assay demonstrates that DCC-5Fbn specifically binds
to netrin-1, as opposed to the extracellular domain of an unrelated
receptor, IL3-R (FIG. 15A). The approximate Kd for
DCC-5Fbn/netrin-1 was roughly estimated at 5 nM, in keeping with
the order of magnitude of the described DCC/netrin-1 Kd. We next
investigated whether this domain was sufficient to displace
DCC/netrin-1 interaction. As shown in FIG. 15B, using an ELISA
assay in which the extracellular domain of DCC was coated and
netrin-1/DCC interaction was detected by netrin-1 immunoreactivity,
we observed that, while as a positive control the complete
extracellular domain of DCC (DCC-EC) was sufficient to displace
DCC/netrin-1 interaction, DCC-5Fbn failed to interfere. Thus,
DCC-5Fbn interacts with netrin-1 but is not sufficient to inhibit
DCC/netrin-1 interaction. We next investigated whether DCC-5Fbn
could influence DCC multimerization. We performed
co-immunoprecipitation in HEK293T transiently transfected with
HA-tagged full-length DCC together with c-myc-tagged full-length
DCC in the presence or absence of netrin-1. As also described in
FIG. 1A, presence of netrin-1 triggers the immunoprecipitation of
HA-DCC with c-myc-DCC, demonstrating netrin-1-induced DCC
multimerization (FIG. 15C). However, when the cells incubated with
netrin-1 were also simultaneously treated with DCC-5Fbn, the
HA-DCC/c-myc-DCC interaction returns to netrin-1 non-treated
levels. Thus, DCC-5Fbn interacts with netrin-1 in a region
responsible for the netrin-1-mediated coming closer of two or more
DCC molecules and is able to inhibit netrin-1-induced
DCC-multimerization.
[0189] We then tested whether DCC-5Fbn could consequently trigger
netrin-1 receptors-induced cell death. To this purpose, HEK293T
cells were forced to express DCC in the presence or absence of
netrin-1, with or without DCC-5Fbn, and cell death was determined
by trypan blue exclusion assay (FIG. 16A). As shown in FIG. 16A,
while DCC triggers apoptosis in the absence of netrin-1, a
pro-apoptotic activity blocked by the presence of netrin-1, the
presence of DCC-5Fbn is sufficient to block the inhibitory activity
of netrin-1, thus leading to DCC-induced cell death. Because the
HEK293T cell system uses ectopic expression of netrin-1, we next
tested DCC-5Fbn in a more biologically relevant model. We recently
demonstrated that compared to non-metastatic breast cancers, the
majority of human metastatic breast cancers overexpresses netrin-1.
We have also shown that titrating overexpressed netrin-1 triggers
tumor cell apoptosis in vitro and metastasis inhibition in mice
(see Examples 2 and 3). Many breast tumor cell lines appear to
express netrin-1 and we have shown that titrating netrin-1 in mice
breast carcinoma 4T1 cells triggers apoptosis (see Examples 2 and
3). As shown in FIG. 16B, addition of DCC-5Fbn to a 4T1 cell
culture is associated with increased cell death.
[0190] Taken together, we have shown here that the multimerization
of the dependence receptors DCC and UNC5H is a sufficient mechanism
to block their pro-apoptotic activity. Interestingly, this
inhibitory mechanism appears to mirror what is observed with death
receptors. Indeed, it is known that TNFr or Fas requires
trimerization to induce apoptosis .sup.45. This intrinsic
difference may therefore represent an added-value for therapeutic
strategies using dependence receptors. Indeed, the search of
therapeutic molecules in the past has mainly led to hits that act
on the inhibition of cellular processes--e.g., kinases inhibitors,
IAP inhibitors--rather than activators. As a consequence,
inhibition of netrin-1 receptors multimerization via the use of
recombinant DCC-5Fbn or via any compound screened to interfere with
receptor multimerization appears as a tempting strategy for the
treatment of cancers in which netrin-1 autocrine expression has
been acquired.
[0191] Here, we show that netrin-1 triggers the multimerization of
both DCC and UNC5H receptors. By using a system in which
dimerization is chemically-induced, we demonstrate that
multimerization of the intracellular domain of netrin-1 receptors,
such as DCC and UNC5H2, is the critical step to inhibit their
pro-apoptotic activity. We therefore propose a model in which
monomeric netrin-1-dependence receptors are pro-apoptotic, while
their multimerization, induced by netrin-1, abolishes their
pro-apoptotic activity. Using this property, we propose the use of
a recombinant specific domain of the DCC extracellular region that
(i) interacts with netrin-1 and (ii) inhibits netrin-1-induced
multimerization, in order to trigger apoptosis of tumor cells.
REFERENCES
[0192] 1. Serafini, T. et al. Netrin-1 is required for commissural
axon guidance in the developing vertebrate nervous system. Cell 87,
1001-14 (1996). [0193] 2. Keino-Masu, K. et al. Deleted in
Colorectal Cancer (DCC) encodes a netrin receptor. Cell 87, 175-85
(1996). [0194] 3. Forcet, C. et al. Netrin-1-mediated axon
outgrowth requires deleted in colorectal cancer-dependent MAPK
activation. Nature 417, 443-7 (2002). [0195] 4. Ackerman, S. L. et
al. The mouse rostral cerebellar malformation gene encodes an
UNC-5-like protein. Nature 386, 838-42 (1997). [0196] 5. Hong, K.
et al. A ligand-gated association between cytoplasmic domains of
UNC5 and DCC family receptors converts netrin-induced growth cone
attraction to repulsion. Cell 97, 927-41 (1999). [0197] 6. Mehlen,
P. et al. The DCC gene product induces apoptosis by a mechanism
requiring receptor proteolysis. Nature 395, 801-4 (1998). [0198] 7.
Llambi, F., Causeret, F., Bloch-Gallego, E. & Mehlen, P.
Netrin-1 acts as a survival factor via its receptors UNC5H and DCC.
Embo J 20, 2715-22 (2001). [0199] 8. Bordeaux, M. C. et al. The RET
proto-oncogene induces apoptosis: a novel mechanism for
Hirschsprung disease. Embo J 19, 4056-63 (2000). [0200] 9. Stupack,
D. G., Puente, X. S., Boutsaboualoy, S., Storgard, C. M. &
Cheresh, D. A. Apoptosis of adherent cells by recruitment of
caspase-8 to unligated integrins. J Cell Biol 155, 459-70 (2001).
[0201] 10. Thibert, C. et al. Inhibition of neuroepithelial
patched-induced apoptosis by sonic hedgehog. Science 301, 843-6
(2003). [0202] 11. Matsunaga, E. et al. RGM and its receptor
neogenin regulate neuronal survival. Nat Cell Biol 6, 749-55
(2004). [0203] 12. Rabizadeh, S. et al. Induction of apoptosis by
the low-affinity NGF receptor. Science 261, 345-8 (1993). [0204]
13. Mehlen, P. & Thibert, C. Dependence receptors: between life
and death. Cell Mol Life Sci 61, 1854-66 (2004). [0205] 14.
Bredesen, D. E., Mehlen, P. & Rabizadeh, S. Receptors that
mediate cellular dependence. Cell Death Differ 12, 1031-43 (2005).
[0206] 15. Fearon, E. R. et al. Identification of a chromosome 18q
gene that is altered in colorectal cancers. Science 247, 49-56
(1990). [0207] 16. Kinzler, K. W. & Vogelstein, B. Lessons from
hereditary colorectal cancer. Cell 87, 159-70 (1996). [0208] 17.
Thiebault, K. et al. The netrin-1 receptors UNC5H are putative
tumor suppressors controlling cell death commitment. Proc Natl Acad
Sci USA 100, 4173-4178 (2003). [0209] 18. Mazelin, L. at al.
Netrin-1 controls colorectal tumorigenesis by regulating apoptosis.
Nature 431, 80-4 (2004). [0210] 19. Bernet, A. et al. The netrin-1
receptor UNC5H3 is a tumor suppressor in colorectal malignancies.
submitted (2007). [0211] 20. Aslakson, C. J. & Miller, F. R.
Selective events in the metastatic process defined by analysis of
the sequential dissemination of subpopulations of a mouse mammary
tumor. Cancer Res 52, 1399-405 (1992). [0212] 21. Geisbrecht, B.
V., Dowd, K. A., Barfield, R. W., Longo, P. A. & Leahy, D. J.
Netrin binds discrete subdomains of DCC and UNC5 and mediates
interactions between DCC and heparin. J Biol Chem 278, 32561-8
(2003). [0213] 22. Llambi, F. et al. The dependence receptor UNC5H2
mediates apoptosis through DAP-kinase. Embo J 24, 1192-201 (2005).
[0214] 23. Inbal, B. et al. DAP kinase links the control of
apoptosis to metastasis. Nature 390, 180-4 (1997). [0215] 24.
Andre, F. et al. Breast cancer with synchronous metastases: trends
in survival during a 14-year period. J Clin Oncol 22, 3302-8
(2004). [0216] 25. de Cremoux, P. et al. Inter-laboratory quality
control for hormone-dependent gene expression in human breast
tumors using real-time reverse transcription-polymerase chain
reaction. Endocr Relat Cancer 11, 489-95 (2004). [0217] 26. Latil,
A. et al. Quantification of expression of netrins, slits and their
receptors in human prostate tumors. Int J Cancer 103, 306-15
(2003). [0218] 27. Forcet, C., Ye, X., Granger, L., Corset, V.,
Shin, H., Bredesen, D. E. and Mehlen, P. (2001) The dependence
receptor DCC (deleted in colorectal cancer) defines an alternative
mechanism for caspase activation. Proc Natl Acad Sci USA, 98,
3416-3421. [0219] 28. de Kok, J. B. et al. Normalization of gene
expression measurements in tumor tissues: comparison of 13
endogenous control genes. Lab Invest 85, 154-9 (2005). [0220] 29.
Mehlen, P. & Fearon, E. R. Role of the dependence receptor DCC
in colorectal cancer pathogenesis. J Clin Oncol 22, 3420-8 (2004).
[0221] 30. Stupack, D. G. et al. Potentiation of neuroblastoma
metastasis by loss of caspase-8. Nature 439, 95-9 (2006). [0222]
31. Serafini, T. et al. The netrins define a family of axon
outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell
78, 409-24 (1994). [0223] 32. Yebra, M. et al. Recognition of the
neural chemoattractant Netrin-1 by integrins alpha6beta4 and
alpha3beta1 regulates epithelial cell adhesion and migration. Dev
Cell 5, 695-707 (2003). [0224] 33. Srinivasan, K., Strickland, P.,
Valdes, A., Shin, G. C. & Hinck, L. Netrin-1/neogenin
interaction stabilizes multipotent progenitor cap cells during
mammary gland morphogenesis. Dev Cell 4, 371-82 (2003). [0225] 34.
Liu, Y. et al. Novel role for Netrins in regulating epithelial
behavior during lung branching morphogenesis. Curr Biol 14, 897-905
(2004). [0226] 35. Park, K. W. et al. The axonal attractant
Netrin-1 is an angiogenic factor. Proc Natl Acad Sci USA 101,
16210-5 (2004). [0227] 36. Lu, X. et al. The netrin receptor UNC5B
mediates guidance events controlling morphogenesis of the vascular
system. Nature 432, 179-86 (2004). [0228] 37. Nguyen, A. & Cai,
H. Netrin-1 induces angiogenesis via a DCC-dependent ERK1/2-eNOS
feed-forward mechanism. Proc Natl Acad Sci USA 103, 6530-5 (2006).
[0229] 38. Wilson, B. D. et al. Netrins Promote Developmental and
Therapeutic Angiogenesis. Science (2006). [0230] 39. Chan, S. S.,
Zheng, H., Su, M. W., Wilk, R., Killeen, M. T., Hedgecock, E. M.
and Culotti, J. G. (1996) UNC-40, a C. elegans homolog of DCC
(Deleted in Colorectal Cancer), is required in motile cells
responding to UNC-6 netrin cues. Cell, 87, 187-195. [0231] 40.
Ellerby, L. M., Hackam, A. S., Propp, S. S., Ellerby, H. M.,
Rabizadeh, S., Cashman,
[0232] N. R., Trifiro, M. A., Pinsky, L., Wellington, C. L.,
Salvesen, G. S., Hayden, M. R. and Bredesen, D. E. (1999) Kennedy's
disease: caspase cleavage of the androgen receptor is a crucial
event in cytotoxicity. J Neurochem, 72, 185-195. [0233] 41. Fazeli,
A., Dickinson, S. L., Hermiston, M. L., Tighe, R. V., Steen, R. G.,
Small, C. G., Stoeckli, E. T., Keino-Masu, K, Masu, M., Rayburn,
H., Simons, J., Bronson, R. T., Gordon, J. I., Tessier-Lavigne, M.
and Weinberg, R. A. (1997) Phenotype of mice lacking functional
Deleted in colorectal cancer (Dcc) gene. Nature, 386, 796-804.
[0234] 42. Hedgecock, E. M., Culotti, J. G. and Hall, D. H. (1990)
The unc-5, unc-6, and unc-40 genes guide circumferential migrations
of pioneer axons and mesodermal cells on the epidermis in C.
elegans. Neuron, 4, 61-85. [0235] 43. Kruger, R. P., Lee, J., Li,
W. and Guan, K. L. (2004) Mapping netrin receptor binding reveals
domains of Unc5 regulating its tyrosine phosphorylation. J
Neurosci, 24, 10826-10834. [0236] 44. Mehlen, P. and Bredesen, D.
E. (2004) The dependence receptor hypothesis. Apoptosis, 9, 37-49.
[0237] 45. Muppidi, J. R., Tschopp, J. and Siegel, R. M. (2004)
Life and death decisions: secondary complexes and lipid rafts in
TNF receptor family signal transduction. Immunity, 21, 461-465.
[0238] 46. Stein, E., Zou, Y., Poo, M. and Tessier-Lavigne, M.
(2001) Binding of DCC by netrin-1 to mediate axon guidance
independent of adenosine A2B receptor activation. Science, 291,
1976-4982. [0239] 47. Tanikawa, C., Matsuda, K., Fukuda, S.,
Nakamura, Y. and Arakawa, H. (2003) p 53RDL1 regulates
p53-dependent apoptosis. Nat Cell Biol, 5, 216-223. [0240] 48.
Wang, J. J., Rabizadeh, S., Tasinato, A., Sperandio, S., Ye, X.,
Green, M., Assa-Munt, N., Spencer, D. and Bredesen, D. E. (2000)
Dimerization-dependent block of the proapoptotic effect of
p75(NTR). J Neurosci Res, 60, 587-593. [0241] 49. Yang, X., Chang,
H. Y. and Baltimore, D. (1998) Autoproteolytic activation of
pro-caspases by oligomerization. Mol Cell, 1, 319-325. [0242] 50.
Mehlen P. and C. Furne (2005) Netrin-1: when a neuronal guidance
cue turns out to be a regulator of tumorigenesis. Cell Mol Life
Sci. 62:2599-616.
Sequence CWU 1
1
29162DNAArtificial sequencePrimer used for introducing a HA tag in
the template pCMV-DCC 1cacaggctca gccttttatc catatgatgt accggattat
gcataacatg tatttctgaa 60tg 62262DNAArtificial sequencePrimer used
for introducing a HA tag in the template pCMV-DCC 2cattcagaaa
tacatgttat gcataatccg gtacatcata tggataaaag gctgagcctg 60tg
62365DNAArtificial sequencePrimer used for introducing a c-myc tag
in the template pCMV-DCC 3cacaggctca gcctttgagc agaagttgat
aagtgaggaa gatctgtaac atgtatttct 60gaatg 65465DNAArtificial
sequencePrimer used for introducing a c-myc tag in the template
pCMV-DCC 4cattcagaaa tacatgttac agatcttcct cacttctcaa cttctgctca
aaggctgagc 60ctgtg 65533DNAArtificial sequencePrimer used for
obtaining a PCR fragment of the intracellular domain of DCC
(1122-1447) 5tatgtcgacc gacgctcttc agcccagcag aga
33672DNAArtificial sequencePrimer used for obtaining a PCR fragment
of the intracellular domain of DCC (1122-1447) 6tatgaattct
tagtcgagtg cgtagtctgg tacgtcgtac ggataaaagg ctgagcctgt 60gatggcatta
ag 72778DNAArtificial sequencePrimer used for obtaining
c-myc-Fv2E-DCC-IC 7cttaatgcca tcacaggctc agcctttgaa cagaaactca
tctctgaaga ggatctgtaa 60gaattcataa agggcaat 78878DNAArtificial
sequencePrimer used for obtaining c-myc-Fv2E-DCC-IC 8attgcccttt
atgaattctt acagatcctc ttcagagatg agtttctgtt caaaggctga 60gcctgtgatg
gcattaag 78925DNAArtificial sequencePrimer used for the constructs
encoding FlagM2-UNC5H2 9gcgcggccgc agggcccgga gcggg
251030DNAArtificial sequencePrimer used for the constructs encoding
FlagM2-UNC5H2 10cggaattctc agcaatcgcc atcagtggtc
301126DNAArtificial sequencePrimer used for generating by PCR
amplification of the UNC5H2-HA intracellular domain 11cggtcgacgt
gtaccggaga aactgc 261257DNAArtificial sequencePrimer used for
generating by PCR amplification of the UNC5H2-HA intracellular
domain 12gcgaattctc atgcataatc cggcacatca tacggatagc aatcgccatc
agtggtc 571326DNAArtificial sequencePrimer used for generating by
PCR amplification of the UNC5H2-myc intracellular domain
13cggtcgacgt gtaccggaga aactgc 261460DNAArtificial sequencePrimer
used for generating by PCR amplification of the UNC5H2-myc
intracellular domain 14gcgaattctc acagatcctc ttctgagatg agtttttgtt
cgcaatcgcc atcagtggtc 601518DNAArtificial sequenceFv2E forward
primer 15ccaccatggg gagtagca 181649DNAArtificial sequenceUNC5H2-HA
reverse primer 16tcatgcataa tccggcacat catacggata gcaatcgcca
tcagtggtc 491752DNAArtificial sequenceUNC5H2-myc reverse primer
17tcacagatcc tcttctgaga tgagtttttg ttcgcaatcg ccatcagtgg tc
521823DNAArtificial sequencePrimer used for expressed human PBGD as
internal control 18ctggagttca ggagtattcg ggg 231924DNAArtificial
sequencePrimer used for expressed human PBGD as internal control
19cagatccaag atgtcctggt cctt 242020DNAArtificial sequencePrimer
used for expressed human TBP as internal control 20cacgaaccac
ggcactgatt 202122DNAArtificial sequencePrimer used for expressed
human TBP as internal control 21ttttcttgct gccagtctgg ac
222221DNAArtificial sequencePrimer used for expressed human
netrin-1-NTN1 as internal control 22tgcaagaagg actatgccgt c
212321DNAArtificial sequencePrimer used for expressed human human
netrin- 1-NTN1 as internal control 23gctcgtgccc tgcttataca c
212420DNAArtificial sequencePrimer used for expressed human UNC5B
as internal control 24tgcaggagaa cctcatggtc 202520DNAArtificial
sequencePrimer used for expressed human UNC5B as internal control
25gggctggagg attactggtg 202625DNAArtificial sequencePrimer used for
expressed human DCC as internal control 26agccaatggg aaaattactg
cttac 252725DNAArtificial sequencePrimer used for expressed human
DCC as internal control 27aggttgagat ccatgatttg atgag
252826DNAArtificial sequencePrimer used for expressed human UNC5C
as internal control 28gcaaattgct ggctaaatat caggaa
262926DNAArtificial sequencePrimer used for expressed human UNC5C
as internal control 29gctccactgt gttcaggcta aatctt 26
* * * * *