U.S. patent application number 14/229706 was filed with the patent office on 2014-12-25 for method to quantify sirnas, mirnas and polymorphic mirnas.
This patent application is currently assigned to APPLIED BIOSYSTEMS, LLC. The applicant listed for this patent is APPLIED BIOSYSTEMS, LLC. Invention is credited to Caifu Chen, Karl J. Guegler, Ruoying TAN.
Application Number | 20140377748 14/229706 |
Document ID | / |
Family ID | 37772526 |
Filed Date | 2014-12-25 |
United States Patent
Application |
20140377748 |
Kind Code |
A1 |
TAN; Ruoying ; et
al. |
December 25, 2014 |
Method to Quantify siRNAs, miRNAs and Polymorphic miRNAs
Abstract
The present teachings provide methods, compositions, and kits
for quantifying target polynucleotides. In some embodiments, a
reverse stem-loop ligation probe is ligated to the 3' end of a
target polynucleotide, using a ligase that can ligate the 3' end of
RNA to the 5' end of DNA using a DNA template, such as T4 DNA
ligase. Following digestion to form an elongated target
polynucleotide with a liberated end, a reverse transcription
reaction can be performed, followed by a PCR. In some embodiments,
the methods of the present teachings can discriminate between
polymorphic polynucleotides that vary by as little as one
nucleotide.
Inventors: |
TAN; Ruoying; (Palo Alto,
CA) ; Chen; Caifu; (Palo Alto, CA) ; Guegler;
Karl J.; (Menlo Park, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
APPLIED BIOSYSTEMS, LLC |
Carlsbad |
CA |
US |
|
|
Assignee: |
APPLIED BIOSYSTEMS, LLC
Carlsbad
CA
|
Family ID: |
37772526 |
Appl. No.: |
14/229706 |
Filed: |
March 28, 2014 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
13456835 |
Apr 26, 2012 |
8710208 |
|
|
14229706 |
|
|
|
|
13015332 |
Jan 27, 2011 |
8187815 |
|
|
13456835 |
|
|
|
|
11467125 |
Aug 24, 2006 |
|
|
|
13015332 |
|
|
|
|
60711480 |
Aug 24, 2005 |
|
|
|
60750302 |
Dec 13, 2005 |
|
|
|
60783311 |
Mar 16, 2006 |
|
|
|
Current U.S.
Class: |
435/6.11 |
Current CPC
Class: |
C12Q 1/6851 20130101;
C12Q 1/6851 20130101; C12Q 2525/301 20130101; C12Q 1/6855 20130101;
C12Q 2525/207 20130101; C12Q 2537/143 20130101; C12Q 2525/207
20130101; C12Q 1/6851 20130101; C12Q 2521/501 20130101 |
Class at
Publication: |
435/6.11 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method of amplifying a target polynucleotide, the method
comprising: forming a first reaction complex comprising a reverse
stem-loop ligation probe hybridized to the target polynucleotide,
wherein the reverse stem-loop ligation probe comprises a loop, a
stem, and a 3' target-specific portion; ligating the reverse
stem-loop ligation probe to the target polynucleotide to form an
elongated target polynucleotide; removing the hybridized 3'
target-specific portion from the elongated target polynucleotide to
form an elongated target polynucleotide with a liberated end;
forming a second reaction complex comprising a reverse primer
hybridized to the liberated end of the elongated target
polynucleotide; extending the reverse primer to form a first
strand, wherein the first strand is hybridized to the elongated
target polynucleotide to form a double stranded complex; and,
amplifying the double stranded complex.
2. The method according to claim 1 wherein the reverse stem-loop
ligation probe comprises at least one uracil residue, wherein the
removing comprises enzymatic degradation of the uracil.
3. The method according to claim 1 wherein the target
polynucleotide is an RNA molecule, wherein the reverse stem-loop
ligation probe is a DNA molecule, and wherein the ligase is T4 DNA
ligase.
4. The method according to claim 1 wherein the liberated end of the
elongated target polynucleotide corresponds to the loop of the
reverse stem-loop ligation probe.
5. The method according to claim 1 wherein the amplifying comprises
a PCR, wherein the PCR comprises a forward primer, and wherein the
forward primer comprises a target specific portion and a 5'
tail.
6. The method according to claim 1 wherein the amplifying is a
real-time PCR.
7. The method according to claim 6 wherein the real-time PCR
comprises a nucleic acid detector probe, wherein the nucleic acid
detector probe comprises a sequence complementary to the stem of
the reverse stem-loop ligation probe, or comprises a sequence
complementary to the complement of the stem of the reverse
stem-loop ligation probe.
8. The method according to claim 7 wherein the nucleic acid
detector probe further comprises a sequence complementary to the
target polynucleotide, or comprises a sequence complementary to the
complement of the target polynucleotide.
9. The method according to claim 7 wherein the detector probe is a
5' nuclease cleavable probe.
10. The method according to claim 1 wherein the 3' target-specific
portion of the reverse stem-loop ligation probe comprises an
extension blocker.
11. The method according to claim 10 wherein the extension blocker
is an amine group.
12. A kit for amplifying at least three target polynucleotides, the
kit comprising, at least three species of reverse stem-loop
ligation probes, wherein the at least three species of reverse
stem-loop ligation probes vary from each other in the sequence of
the 3' target-specific portion, wherein the at least three species
of reverse stem-loop ligation probes vary from each other in the
sequence of their stem, and wherein the at least three species of
reverse stem-loop ligation probes vary from each other in the
sequence of their loop.
13. The kit according to claim 12, wherein the at least three
species of reverse stem-loop ligation probes comprise an extension
blocker, a degradable nucleotide, or both an extension blocker and
a degradable nucleotide.
14. The kit-according to claim 12 further comprising a reverse
transcriptase.
15. The kit according to claim 12 further comprising a
polymerase.
16. The kit according to claim 12 further comprising a reverse
primer, a forward primer, and a detector probe.
17-23. (canceled)
24. A reaction composition comprising at least three species of
reverse stem-loop ligation probes, wherein the at least three
species of reverse stem-loop ligation probes vary from each other
in the sequence of the 3' target-specific portion, wherein the at
least three species of reverse stem-loop, ligation probes vary from
each other in the sequence of their stem, and wherein the at least
three species reverse stem-loop ligation probes vary from each
other in the sequence of their loop.
25. The reaction composition according to claim 24 wherein the at
least three species of reverse stem-loop ligation probes each
comprise an extension blocker, a degradable nucleotide, or both an
extension blocker and a degradable nucleotide.
26. The reaction composition according to claim 24 wherein the 3'
target-specific portion comprises the extension blocker, and
wherein the stem comprises the degradable nucleotide.
27. The reaction composition according to claim 24 wherein the 3'
target-specific portion of each of the at least three species of
reverse stem-loop ligation probes is complementary to an
ShRNA-derived siRNA.
28-31. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation application of U.S.
patent application Ser. No. 13/456,835, filed Apr. 26, 2012, now
U.S. Pat. No. 8,710,208, which is a divisional application of U.S.
patent application Ser. No. 13/015,332, filed Jan. 27, 2011, now
U.S. Pat. No. 8,187,815, which is a continuation application of
U.S. patent application Ser. No. 11/467,125, filed Aug. 24, 2006,
now abandoned, which claims a priority benefit under 35 U.S.C.
.sctn.119(e) from U.S. Patent Application No. 60/711,480 filed Aug.
24, 2005, U.S. Patent Application No. 60/750,302, filed Dec. 13,
2005, and U.S. Patent Application No. 60/783,311, filed Mar. 16,
2006, all of which are incorporated herein by reference in their
entirety.
FIELD
[0002] The present teachings relate to methods, compositions, and
kits for amplifying, identifying, and quantifying polymorphic
target polynucleotides.
INTRODUCTION
[0003] In 1998, Andrew Fire and Craig Mello discovered that
injection of double-stranded RNA (dsRNA) into Caenorhabditis
elegans could initiate a potent sequence-specific degradation of
cytoplasmic mRNAs (Fire, et al., 1998, Nature, 391, 806-811). In
mammalian cells, RNA interference (RNAi) can be triggered by a
variety of dsRNA or dsRNA-domain-containing molecules that are
processed by the endoribonuclease Drosha and Dicer. Dicer is also
responsible for the processing of foreign dsRNA or
dsRNA-domain-containing molecules into small duplex RNAs termed
small interfering RNAs (siRNAs). One strand (anti sense strand) of
the siRNA is incorporated into a ribonucleoprotein complex to form
the RNA-induced silencing complex (RISC) that can mediate RNA
silencing (Bartel, 2004 Cell (2004), 116, 281-297).
[0004] Two broad categories of RNA interferences (RNAi) effective
molecules have been developed: (1) synthetic siRNA duplexes formed
from two complementary but independent strands; and (2)
vector-expressed short hairpin (sh)RNA that is processed into siRNA
in vivo. The primary advantage in the use of synthetic siRNAs is
the ability to control the amount of siRNA, which may minimize the
possibility of nonspecific effects, but the key disadvantage of
synthetic siRNA is the transient nature of the silencing effect.
The key advantage of shRNA resides in the ability to express these
transcripts from plasmid or viral-based expression vector
continuously. Both synthetic dsRNAs and shRNAs have been widely
used in investigation gene function and are being developed as
therapeutic agents (Dykxhoorn, et al., 2003, Nature Review
Molecular Cell Biology (2003), 4, 457-467, and Dorsett and Tuschl
2004, Nature Reviews Drug Discovery (2004), 3, 318-329).
[0005] shRNAs driven by polymerase III promoters have been
predominantly investigated as an alternative strategy to stably
suppress gene expression (Zheng, et al., 2003, Proc. Natl. Acad.
Sci. USA 101, 135-140; Shirane, et al., 2003, Nature Genet (2004),
36, 190-196; and Sen, et al., 2004, Nature Genet 36, 183-189).
Since the position at which Dicer RNase III cleaves a hairpin of
shRNA is not well defined and transcriptional termination can be
ambiguous, a shRNA expression may generate multiple siRNA species
(see FIG. 1, Dorsett and Tuschl, 2004). Quantification of
shRNA-derived siRNAs will provide useful information for the
designing of shRNA constructs and for the development of
shRNA-based RNAi therapeutics. Pre-miRNA may also be ambiguously
processed by Dicer into multiple miRNA species (polymorphic miRMA)
in vivo, identification of polymorphic miRNAs would provide
insights for miRNA study.
[0006] Approaches to quantify miRNAs and other short target
polynucleotides have been described in U.S. Non-Provisional
application Ser. No. 10/947,460, and Ser. No. 11/142,720 to Chen et
al.
SUMMARY
[0007] In some embodiments, the present teachings provide a method
of amplifying a target polynucleotide, the method comprising;
forming a first reaction complex comprising a reverse stem-loop
ligation probe hybridized to the target polynucleotide, wherein the
reverse stem-loop ligation probe comprises a loop, a stem, and a 3'
target-specific portion; ligating the reverse stem-loop ligation
probe to the target polynucleotide to form an elongated target
polynucleotide; removing the hybridized 3' target-specific portion
from the elongated target polynucleotide to form an elongated
target polynucleotide with a liberated end; forming a second
reaction complex comprising a reverse primer hybridized to the
liberated end of the elongated target polynucleotide; extending the
reverse primer to form a first strand, wherein the first strand is
hybridized to the elongated target polynucleotide to form a double
stranded complex; and, amplifying the double stranded complex.
[0008] In some embodiments, the present teachings provide a
reaction composition comprising at least three species of reverse
stem-loop ligation probes, wherein the at least three species of
reverse stem-loop ligation probes vary from each other in the
sequence of the 3' target-specific portion, wherein the at least
three species of reverse stem-loop ligation probes vary from each
other in the sequence of their stem, and wherein the at least three
species reverse stem-loop ligation probes vary from each other in
the sequence of their loop.
[0009] The present teachings provide additional methods, reaction
compositions, and kits, some employing reverse stem-loop primers as
well as reverse stem-loop ligation probes.
DRAWINGS
[0010] FIG. 1 depicts one reverse stem-loop primer in accordance
with some embodiments of the present teachings.
[0011] FIG. 2 depicts one reverse stem-loop ligation probe in
accordance with some embodiments of the present teachings.
[0012] FIG. 3 depicts one work-flow for performing a multiplexed
reverse transcription reaction with a plurality of reverse
stem-loop primers to query a plurality of polymorphic
polynucleotides in accordance with some embodiments of the present
teachings.
[0013] FIG. 4 depicts one work-flow for performing a multiplexed
ligation reaction with a plurality of reverse stem-loop ligation
probes to query a plurality of polymorphic polynucleotides in
accordance with some embodiments of the present teachings.
[0014] FIG. 5 depicts one reaction scheme for performing ligation
reaction with a reverse stem-loop ligation probe to query a target
polynucleotide in accordance with some embodiments of the present
teachings.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0015] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not intended to limit the scope of the
current teachings. In this application, the use of the singular
includes the plural unless specifically stated otherwise. Also, the
use of "comprise", "contain", and "include", or modifications of
those root words, for example but not limited to, "comprises",
"contained", and "including", are not intended to be limiting. The
term and/or means that the terms before and after can be taken
together or separately. For illustration purposes, but not as a
limitation, "X and/or Y" can mean "X" or "Y" or "X and Y".
[0016] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the described
subject matter in any way. All literature and similar materials
cited in this application, including, patents, patent applications,
articles, books, treatises, and internet web pages are expressly
incorporated by reference in their entirety for any purpose. In the
event that one or more of the incorporated literature and similar
defines or uses a term in such a way that it contradicts that
term's definition in this application, this application controls.
While the present teachings are described in conjunction with
various embodiments, it is not intended that the present teachings
be limited to such embodiments. On the contrary, the present
teachings encompass various alternatives, modifications, and
equivalents, as will be appreciated by those of skill in the
art.
[0017] In some embodiments, the present teachings provide a novel
ligation-based PCR assay for querying polymorphic polynucleotides,
for example each species of shRNA-derived siRNAs. In some
embodiments, we have applied the assays provided by the present
teachings to discover and quantify polymorphic miRNAs whose 3'end
is different from that of mature miRNA in Sanger's data base. One
aspect of the complexity of nucleic acid biology inside a typical
cell results from the observation that each shRNA expressed may
generate multiple siRNA species. This can result from, for example,
ambiguous transcription termination by poly III, and/or ambiguous
cleavage by Dicer. Thus, a plurality of polymorphic polynucleotides
arise from a single shRNA.
[0018] Thus, in one aspect the present teachings provide for novel
RT primer and ligation probe designs that can selectively
discriminate between a plurality of different polymorphic target
polynucleotides. These target polynucleotides can differ only
slightly in their 3' end, by as little as a single nucleotide. For
example, FIG. 1 depicts a design for a reverse stem-loop primer
according to some embodiments of the present teachings. Here, the
reverse stem-loop primer (1) comprises a 3' target-specific portion
(4), a stem (3), and a loop (2). The 3' end of the reverse
stem-loop primer is shown containing a free 3'OH group, thus
allowing its extension by an enzyme such as a polymerase, reverse
transcriptase, etc.
[0019] In some embodiments, for example when a plurality of
different polymorphic polynucleotides are to be queried in a single
sample, the different regions of the reverse stem-loop primer can
be encoded as follows: The 3' target-specific portion is
complementary to a particular polymorphic target polynucleotide;
the stem encodes a detector probe binding site, or complement to a
detector probe binding site, which is unique to a particular
polymorphic target polynucleotide; and the loop encodes a reverse
primer binding site, or complement to a reverse primer binding
site, which is unique to a particular polymorphic target
polynucleotide. Thus, in a scenario for example where three
polymorphic target polynucleotides are to be queried in a single
reverse transcription reaction mixture, there are three different
species of reverse stem-loop primers. The first species of reverse
stem-loop primer for querying the first target polynucleotide
contains a 3' target-specific portion (A), a stem (B), and a loop
(C). The second reverse stem-loop primer for querying the second
target polynucleotide contains a 3' target-specific portion (N), a
stem (0), and a loop (P). The third reverse stem-loop primer for
querying the third target polynucleotide contains a 3'
target-specific portion (X), a stem (Y), and a loop (Z).
[0020] FIG. 2 depicts a design for a reverse stem-loop ligation
probe according to some embodiments of the present teachings. Here,
the reverse stem-loop ligation probe (5) comprises a 3'
target-specific portion (8), a stem (7), and a loop (5). The 3' end
of the reverse stem-loop ligation probe is shown containing a 3'NH2
group, thus preventing its extension by an enzyme such as a
polymerase, reverse transcriptase, etc. As used herein, the
functionality imparted by the NH2 group is generally referred to as
an extension blocker. The 5' end of the reverse stem-loop ligation
probe is shown containing a PO4 group, thus allowing its ligation
to the 3' end of a target polynucleotide. The reverse stem-loop
ligation probe can also comprise a degradable nucleotide, such as
uracil, which can be degraded with uracil-N-glycosylase (UNG). Of
course, analogous to the design logic discussed above for a
collection of three reverse stem-loop primers, so too can the three
regions of a stem-loop ligation probe uniquely encode a particular
target polynucleotide.
[0021] FIG. 3 depicts one workflow overview according to some
embodiments of the present teachings. Here, a multiplexed reverse
transcription (RT) reaction is performed on a plurality of
polymorphic target polynucleotides in an RT reaction mixture.
Following the multiplexed RT, the resulting reaction products can
be divided into a plurality of lower plex (for example,
single-plex) decoding PCR reactions such as TaqMan 5' nuclease PCR.
Focusing on the components of one of the PCRs in a microtitre
plate, such a PCR can comprise a reverse primer that was encoded by
the loop of a particular reverse stem-loop primer. This PCR further
contains a forward primer that is unique for a particular target
polynucleotide. This PCR further contains a detector probe, such as
a TaqMan 5' nuclease probe, which can be encoded by the stem of the
reverse stem-loop primer. Different PCRs in the microtitre plate
can contain different collections of reverse primer, forward
primer, and detector probe, thus allowing for the decoding of a
single target polynucleotide in each of a plurality of separate
PCRs.
[0022] Analogous to the work-flow logic discussed above in FIG. 3
for a collection of three reverse stem-loop primers, so too a
multiplexed ligation reaction employing reverse stem-loop ligation
probes can be decoded with a plurality of lower plex (for example
single-plex) PCRs. Here in the context of a ligation approach, the
multiplexed ligation reaction is followed by a digestion phase
prior to the RT reaction. The digestion phase is employed to remove
the target-specific portion of the reverse-stem loop ligation probe
by attacking degradable nucleotides, thereby allowing hybridization
of a reverse primer. Any number of approaches for digestion can be
employed. For example, in some embodiments the stem and/or the 3'
target-specific portion and/or loop of the reverse stem-loop
ligation probe can contain uracil residues as the degradable
nucleotides, thus allowing for digesting with uracil-N-glycosylase
(UNG). As another example, in some embodiments the stem and/or 3'
target-specific portion and/or loop of the reverse stem-loop
ligation probe contains RNA residues as the degradable nucleotides,
thus allowing for digesting with base such as NaOH.
[0023] FIG. 5 depicts one reaction according to some embodiments of
the present teachings. Here, the reverse stem-loop ligation probe
design discussed in FIG. 2, can be employed in a work-flow design
as discussed in FIG. 4. A target polynucleotide (9) is hybridized
with a reverse stem-loop ligation probe (10) containing a 3'
target-specific portion (13), a stem (12), and a loop (11). (Of
course, as discussed in FIG. 2, a plurality of different reverse
stem-loop ligation probes can be employed to query a plurality of
different target polynucleotides). Following a ligation phase (14),
the target polynucleotide is ligated with the reverse stem-loop
ligation probe to form a reaction product (15).
[0024] One aspect of this approach is the target polynucleotides,
which can vary only slightly from one another in their sequence,
can be discriminated by using correspondingly different ligation
probes which themselves have slightly varying 3' target-specific
portions. The discrimination is provided by the fidelity of ligase
enzyme to ligate when a complete Watson-Crick complementary match
exists, but to refrain from ligating when mismatches exist. This
fidelity of ligation can achieve single nucleotide discrimination.
Here, when mismatches exist between the nucleotides of 3' end of
the target polynucleotide and the corresponding nucleotides in the
3' target-specific portion of the reverse stem-loop ligation probe,
ligation of the target polynucleotide to the reverse stem-loop
ligation probe fails to occur. In the absence of such ligation,
subsequent PCR amplification does not occur.
[0025] Following the ligation phase (14), a digestion phase (16)
can then be performed. Digestion can remove the 3' target-specific
portion and the stem of the reverse stem-loop ligation probe due to
the presence of degradable nucleotides, thus resulting in an
elongated target polynucleotide with a liberated end (17). A
hybridization reaction (18) can then be performed, where a reverse
primer (19) hybridizes to the liberated end of the an elongated
target polynucleotide with a liberated end (17). (Of course, in
some embodiments the 5' end of this reverse primer can hybridize to
the final 3'-most nucleotides of the liberated end, as well as any
of a small number of nucleotides upstream from the 3'-most
nucleotides). This reverse primer, as discussed in FIGS. 1 and 2,
can be encoded in the loop of the reverse stem-loop ligation probe,
and can be unique to a particular target polynucleotide. Thus, when
the reverse primer (19) is present in one well of a microtitre
plate, but not present in a different well of the microtitre plate,
a decoding PCR can be performed that selectively amplifies a
desired target polynucleotide from the multiplexed ligation
reaction. Such a PCR (21) can comprise the reverse primer (19), a
forward primer (24), and a detector probe (23), such as for example
a 5' nuclease TaqMan probe. The forward primer can contain a 3'
target-specific portion (24) and a 5' tail (26). The tail of the
forward primer can comprise a zipcode, allowing for the detection
of the resulting PCR amplicon on a microarray, as further discussed
below.
[0026] In some embodiments, the reverse stem-loop ligation probe is
first phosphorylated, for example with T4 polynucleotide kinase, to
add phosphate to the 5' sites, and then the phosphorylated reverse
stem-loop ligation probe is ligated with the 3'-end of the target
polynucleotide miRNA. In some embodiments, the dT residues in the
down strand of the stem are replaced with dU residues. UNG
digestion can be performed to degrade the dU residues in the stem
region to destabilize the stem-loop structure. In some embodiments,
the UNG treatment may be omitted, and the un-ligated reverse
stem-loop ligation probe dissociated from its hybridized target by
heat.
[0027] To validate the ability of the ligation-based assay to
discriminate different species of shRNA-derived siRNA whose only
difference is at the 3'-end, we synthesized a series of RNAs to
mimic the putative anti sense strands of Sh1 shRNA-derived siRNAs
designed and specific assays for each RNA species. The sequences of
oligos used in the assay are provided in Table 5. We used these
assays to quantify each RNA species in a series of concentrations,
and the results showed that these assays can efficiently and
linearly quantify these RNA targets. To demonstrate the specificity
of the assay in RNA quantification, we have quantified each RNA
target with assays designed for individual RNA targeta. These data
indicate that each particular assay can selectively quantify the
desired particular RNA target. If the assay is not matched with a
target, the detecting efficiency is dramatically decreased.
[0028] After demonstrating the specificity, effectiveness and
linearity of the ligation-based assay in the quantitation of siRNA,
we applied the assay to quantify siRNAs in cell lines transfected
with the plasmid expressing Sh1 shRNA. Total RNA samples isolated
from untransfected cells (negative control) and from cells
transfected with plasmids expressing Sh1-shRNA were obtained. The
data from these experiments were processed as copy number of each
anti sense stand of siRNA derived from shiRNA in each cell by using
synthetic Sh1-AS RNA as standards and based on the assumption that
each cell contains about 30 pg of total RNA. By using the
ligation-based assay, Sh1 shRNA-derived siRNAs are detectable in
total RNA isolated from cells transfected with plasmid expressing
Sh1 shRNA, but are not detectable in total RNA isolated from
untransfected cells (negative control). These results indicate that
siRNA is derived from expressed Sh1 shRNA. For Sh1 shRNA
expression, m0 anti sense strand (with 2 dUs at the 3'-end) is the
major product in vivo. Concordance between Sh1 shRNA derived-siRNA
copy number and the level of target gene expression was observed in
cells transfected with plasmid expressing Sh1 shRNA. There results
demonstrate that the ligation-based assay can accurately detect the
copy number of shRNA-derived siRNAs in transfected cells, and the
ligation-based assay correlates with in vivo functional assay.
[0029] Since shRNA can be ambiguously processed by Dicer into
multiple siRNA species in vivo, we hypothesize that pre-miRNA may
also be processed by Dicer into multiple miRNA species in vivo. To
test our hypothesis, we designed assays specific for several
putative polymorphic miRNAs. Sequences of the oligos used in the
assay are provided in Table 5. We detected the presence of these
putative polymorphic miRNA in total RNA samples isolated from human
brain tumor tissues (38N, 3H) and human brain normal tissues
(A4124, 4330). The summarized results show that both human mir-137
miRNA and human mir-100 miRNA are polymorphic. The major species of
human mir-137 is m2 species, which is two nucleotides less than
mature mir-137 (m0) at 3'end, the major species of human mir-100 is
m1 species, which is one nucleotide less than mature mir-100 (m0)
at 3'end.
[0030] It will be appreciated that the ability to quantity
polymorphic polynucleotides provided by the present teachings can
be practiced in the context of optimizing reverse transcription and
amplification reactions as known to those skilled in the art. For
example, it is known that PCR may be optimized by altering times
and temperatures for annealing, polymerization, and denaturing, as
well as changing the buffers, salts, and other reagents in the
reaction composition. Descriptions of amplification optimization
can be found in, among other places, James G. Wetmur, "Nucleic Acid
Hybrids, Formation and Structure," in Molecular Biology and
Biotechnology, pp. 605-8, (Robert A. Meyers ed., 1995); McPherson,
particularly in Chapter 4; Rapley; and Protocols & Applications
Guide, rev. September 4, Promega.
[0031] In some embodiments, the present teachings contemplate
single-tube RT-PCR approaches, and discussed for example in Mohamed
et al., (2004) Journal of Clinical Virology, 30:150-156.
[0032] In some embodiments, the reverse transcription products of
the present teachings can be amplified in a multiplexed
pre-amplifying PCR followed by a plurality of lower-plex decoding
PCRs, as described for example in WO2004/051218 to Andersen and
Ruff, U.S. Pat. No. 6,605,451 to Xtrana, and U.S. Non-Provisional
application Ser. No. 11/090,830 to Andersen et al., and U.S.
Non-Provisional application Ser. No. 11,090,468 to Lao et al., As
used herein, the term "pre-amplifying" refers to a process wherein
a multiplexed PCR is performed, followed by a plurality of
lower-plex decoding PCRs. Typically the primers employed in the
multiplexed PCR correspond to the primers employed in the plurality
of lower-plex decoding PCRs.
[0033] In some embodiments, the methods of the present teachings
can employ recently developed techniques that take advantage of the
sensitivity, specificity, and dynamic range of quantitative
real-time PCR for the quantitation micro RNAs (see for example U.S.
Non-Provisional application Ser. No. 10/881,362 to Brandis et al.,
Ser. No. 10/944,153 to Lao et al., Ser. No. 10/947,460 to Chen et
al., and Ser. No. 11/142,720 to Chen et al.). Further illustrations
of the various relationships between 3' target-specific portion,
stem, and loop, and the encoding of a corresponding detector probe,
can be found described for example in U.S. Non-Provisional patent
application Ser. No. 10/947,460 to Chen et al., and Ser. No.
11/142,720 to Chen et al.).
[0034] In some embodiments, the identification of the amplified
target polynucleotide can employ a detector probe. Such detector
probes comprise refers to a molecule used in an amplification
reaction, typically for quantitative or real-time PCR analysis, as
well as end-point analysis. Such detector probes can be used to
monitor the amplification of the target miRNA and/or control
nucleic acids such as endogenous control small nucleic acids and/or
synthetic internal controls. In some embodiments, detector probes
present in an amplification reaction are suitable for monitoring
the amount of amplicon(s) produced as a function of time. Such
detector probes include, but are not limited to, the 5'-exonuclease
assay (TaqMan.RTM. probes described herein (see also U.S. Pat. No.
5,538,848) various stem-loop molecular beacons (see e.g., U.S. Pat.
Nos. 6,103,476 and 5,925,517 and Tyagi and Kramer, 1996, Nature
Biotechnology 14:303-308), stemless or linear beacons (see, e.g.,
WO 99/21881), PNA Molecular Beacons.TM. (see, e.g., U.S. Pat. Nos.
6,355,421 and 6,593,091), linear PNA beacons (see, e.g., Kubista et
al., 2001, SPIE 4264:53-58), non-FRET probes (see, e.g., U.S. Pat.
No. 6,150,097), Sunrise.RTM./Amplifluor.RTM. probes (U.S. Pat. No.
6,548,250), stem-loop and duplex Scorpion.TM. probes (Solinas et
al., 2001, Nucleic Acids Research 29:E96 and U.S. Pat. No.
6,589,743), bulge loop probes (U.S. Pat. No. 6,590,091), pseudo
knot probes (U.S. Pat. No. 6,589,250), cyclicons (U.S. Pat. No.
6,383,752), MGB Eclipse.TM. probe (Epoch Biosciences), hairpin
probes (U.S. Pat. No. 6,596,490), peptide nucleic acid (PNA)
light-up probes, self-assembled nanoparticle probes, and
ferrocene-modified probes described, for example, in U.S. Pat. No.
6,485,901; Mhlanga et al., 2001, Methods 25:463-471; Whitcombe et
al., 1999, Nature Biotechnology. 17:804-807; Isacsson et al., 2000,
Molecular Cell Probes. 14:321-328; Svanvik et al., 2000, Anal
Biochem. 281:26-35; Wolffs et al., 2001, Biotechniques 766:769-771;
Tsourkas et al., 2002, Nucleic Acids Research. 30:4208-4215;
Riccelli et al., 2002, Nucleic Acids Research 30:4088-4093; Zhang
et al., 2002 Shanghai. 34:329-332; Maxwell et al., 2002, J. Am.
Chem. Soc. 124:9606-9612; Broude et al., 2002, Trends Biotechnol.
20:249-56; Huang et al., 2002, Chem Res. Toxicol. 15:118-126; and
Yu et al., 2001, J. Am. Chem. Soc 14:11155-11161. Detector probes
can also comprise quenchers, including without limitation black
hole quenchers (Biosearch), Iowa Black (IDT), QSY quencher
(Molecular Probes), and Dabsyl and Dabcel sulfonate/carboxylate
Quenchers (Epoch). Detector probes can also comprise two probes,
wherein for example a fluor is on one probe, and a quencher is on
the other probe, wherein hybridization of the two probes together
on a target quenches the signal, or wherein hybridization on the
target alters the signal signature via a change in fluorescence.
Illustrative detector probes comprising two probes wherein one
molecule is an L-DNA and the other molecule is a PNA can be found
in U.S. Non-Provisional patent application Ser. No. 11/172,280 to
Lao et al., Detector probes can also comprise sulfonate derivatives
of fluorescenin dyes with SO3 instead of the carboxylate group,
phosphoramidite forms of fluorescein, phosphoramidite forms of CY 5
(commercially available for example from Amersham). In some
embodiments, intercalating labels are used such as ethidium
bromide, SYBR.RTM. Green I (Molecular Probes), and PicoGreen.RTM.
(Molecular Probes), thereby allowing visualization in real-time, or
end point, of an amplification product in the absence of a detector
probe. In some embodiments, real-time visualization can comprise
both an intercalating detector probe and a sequence-based detector
probe can be employed. In some embodiments, the detector probe is
at least partially quenched when not hybridized to a complementary
sequence in the amplification reaction, and is at least partially
unquenched when hybridized to a complementary sequence in the
amplification reaction. In some embodiments, probes can further
comprise various modifications such as a minor groove binder (see
for example U.S. Pat. No. 6,486,308) to further provide desirable
thermodynamic characteristics. In some embodiments, detector probes
can correspond to identifying portions or identifying portion
complements, also referred to as zip-codes. Descriptions of
identifying portions can be found in, among other places, U.S. Pat.
No. 6,309,829 (referred to as "tag segment" therein); U.S. Pat. No.
6,451,525 (referred to as "tag segment" therein); U.S. Pat. No.
6,309,829 (referred to as "tag segment" therein); U.S. Pat. No.
5,981,176 (referred to as "grid oligonucleotides" therein); U.S.
Pat. No. 5,935,793 (referred to as "identifier tags" therein); and
PCT Publication No. WO 01/92579 (referred to as "addressable
support-specific sequences" therein).
[0035] The primers and probes of the present teachings can contain
conventional nucleotides, as well as any of a variety of analogs.
For example, the term "nucleotide", as used herein, refers to a
compound comprising a nucleotide base linked to the C-1' carbon of
a sugar, such as ribose, arabinose, xylose, and pyranose, and sugar
analogs thereof. The term nucleotide also encompasses nucleotide
analogs. The sugar may be substituted or unsubstituted. Substituted
ribose sugars include, but are not limited to, those riboses in
which one or more of the carbon atoms, for example the 2'-carbon
atom, is substituted with one or more of the same or different Cl,
F, --R, --OR, --NR.sub.2 or halogen groups, where each R is
independently H, C.sub.1-C.sub.6 alkyl or C.sub.5-C.sub.14 aryl.
Exemplary riboses include, but are not limited to,
2'-(C1-C6)alkoxyribose, 2'-(C5-C14)aryloxyribose,
2',3'-didehydroribose, 2'-deoxy-3'-haloribose,
2'-deoxy-3'-fluororibose, 2'-deoxy-3'-chlororibose,
2'-deoxy-3'-aminoribose, 2'-deoxy-3'-(C1-C6)alkylribose,
2'-deoxy-3'-(C1-C6)alkoxyribose and
2'-deoxy-3'-(C5-C14)aryloxyribose, ribose, 2'-deoxyribose,
2',3'-dideoxyribose, 2'-haloribose, 2'-fluororibose,
2'-chlororibose, and 2'-alkylribose, e.g., 2'-O-methyl,
4'-.alpha.-anomeric nucleotides, 1'-.alpha.-anomeric nucleotides,
2'-4'- and 3'-4'-linked and other "locked" or "LNA", bicyclic sugar
modifications (see, e.g., PCT published application nos. WO
98/22489, WO 98/39352, and WO 99/14226). Exemplary LNA sugar
analogs within a polynucleotide include, but are not limited to,
the structures:
##STR00001##
where B is any nucleotide base.
[0036] Modifications at the 2'- or 3'-position of ribose include,
but are not limited to, hydrogen, hydroxy, methoxy, ethoxy,
allyloxy, isopropoxy, butoxy, isobutoxy, methoxyethyl, alkoxy,
phenoxy, azido, amino, alkylamino, fluoro, chloro and bromo.
Nucleotides include, but are not limited to, the natural D optical
isomer, as well as the L optical isomer forms (see, e.g., Garbesi
(1993) Nucl. Acids Res. 21:4159-65; Fujimori (1990) J. Amer. Chem.
Soc. 112:7435; Urata, (1993) Nucleic Acids Symposium Ser. No.
29:69-70). When the nucleotide base is purine, e.g. A or G, the
ribose sugar is attached to the N.sup.9-position of the nucleotide
base. When the nucleotide base is pyrimidine, e.g. C, T or U, the
pentose sugar is attached to the N.sup.1-position of the nucleotide
base, except for pseudouridines, in which the pentose sugar is
attached to the C5 position of the uracil nucleotide base (see,
e.g., Kornberg and Baker, (1992) DNA Replication, 2.sup.nd Ed.,
Freeman, San Francisco, Calif.).
[0037] One or more of the pentose carbons of a nucleotide may be
substituted with a phosphate ester having the formula:
##STR00002##
where .alpha. is an integer from 0 to 4. In certain embodiments, a
is 2 and the phosphate ester is attached to the 3'- or 5'-carbon of
the pentose. In certain embodiments, the nucleotides are those in
which the nucleotide base is a purine, a 7-deazapurine, a
pyrimidine, or an analog thereof. "Nucleotide 5'-triphosphate"
refers to a nucleotide with a triphosphate ester group at the 5'
position, and are sometimes denoted as "NTP", or "dNTP" and "ddNTP"
to particularly point out the structural features of the ribose
sugar. The triphosphate ester group may include sulfur
substitutions for the various oxygens, e.g. .alpha.-thio-nucleotide
5'-triphosphates. For a review of nucleotide chemistry, see:
Shabarova, Z. and Bogdanov, A. Advanced Organic Chemistry of
Nucleic Acids, VCH, New York, 1994.
[0038] Other terms as used herein will harbor meaning based on the
context, and can be further understood in light of the
understanding of one of skill in the art of molecular biology.
Illustrative teachings describing the state of the art can be
found, for example, in Sambrook et al., Molecular Cloning, 3rd
Edition.
[0039] In some embodiments, the present teachings can also be
applied where the reverse stem-loop probes comprise a library of
degenerate molecules. For example, such a degenerate library can
comprise a collection of reverse stem-loop ligation probes which
vary in their 3' target-specific portion, and contain all possible
combinations of sequence in the 3' target-specific portion. Of
course, such a degenerate likely can also be employed with a
reverse stem-loop primer.
[0040] In some embodiments, the present teachings can also be
applied for multi-plexed microarray detection. For example,
following RT, a multiplexed PCR can be performed. This PCR can
comprise a fluorescently labeled primer, thus allowing the results
of the multiplexed PCR to be analyzed on a microarray. Illustrative
teaching of making and using labeled primers can be found, for
example, in U.S. Pat. No. 6,200,748 to Smith et al., In some
embodiments, the PCR can comprise a tailed primer, for example a
tailed forward primer, where the tail of each forward primer
contains a unique sequence (a zip-code sequence) that uniquely
identifies a particular target polynucleotide. Thus, microarrays
comprising complementary zip-code sequences can be used to read-out
such PCR products. Illustrative teachings of detecting labeled
reaction products containing zipcode sequences on complementary
zipcode microarrays can be found, for example, in U.S. Pat. No.
6,852,487 to Barany et al.,
[0041] Thus, in some embodiments the present teachings provide a
method of amplifying a target polynucleotide, the method
comprising; forming a first reaction complex comprising a reverse
stem-loop ligation probe hybridized to the target polynucleotide,
wherein the reverse stem-loop ligation probe comprises a loop, a
stem, and a 3' target-specific portion; ligating the reverse
stem-loop ligation probe to the target polynucleotide to form an
elongated target polynucleotide; removing the hybridized 3'
target-specific portion from the elongated target polynucleotide to
form an elongated target polynucleotide with a liberated end;
forming a second reaction complex comprising a reverse primer
hybridized to the liberated end of the elongated target
polynucleotide; extending the reverse primer to form a first
strand, wherein the first strand is hybridized to the elongated
target polynucleotide to form a double stranded complex; and,
amplifying the double stranded complex.
[0042] In some embodiments, the reverse stem-loop ligation probe
comprises at least one uracil residue, wherein the removing
comprises enzymatic degradation of the uracil. In some embodiments,
target polynucleotide is an RNA molecule, wherein the reverse
stem-loop ligation probe is a DNA molecule, and wherein the ligase
is T4 DNA ligase. In some embodiments, the liberated end of the
elongated target polynucleotide corresponds to the loop of the
reverse stem-loop ligation probe. In some embodiments, the
amplifying comprises a PCR, wherein the PCR comprises a forward
primer, and wherein the forward primer comprises a target-specific
portion and a 5' tail. In some embodiments, the amplifying is a
real-time PCR. In some embodiments, the real-time PCR comprises a
nucleic acid detector probe, wherein the nucleic acid detector
probe comprises a sequence complementary to the stem of the reverse
stem-loop ligation probe, or comprises a sequence complementary to
the complement of the stem of the reverse stem-loop ligation probe.
In some embodiments, the nucleic acid detector probe further
comprises a sequence complementary to the target polynucleotide, or
comprises a sequence complementary to the complement of the target
polynucleotide. In some embodiments, the detector probe is a 5'
nuclease cleavable probe. In some embodiments, the 3'
target-specific portion of the reverse stem-loop ligation probe
comprises an extension blocker. In some embodiments, the extension
blocker is an amine group.
[0043] The present teachings also provide reaction compositions.
The reaction compositions provided by the present teachings can be
employed in the methods of the present teachings. For example, when
three species of reverse stem-loop ligation probes are employed to
query three different target polynucleotides, each of the three
species of reverse stem-loop ligation probes can vary in their
loop, stem, and 3' target-specific portion. However, in some
embodiments, the methods of the present teachings can be employed
with a collection of reverse stem-loop ligation probes which vary
only in their 3' target-specific portions, and contain the same, or
closely similar, stems and/or loops. Such approaches can allow a
single universal reverse primer to query a variety of different
elongated target polynucleotides. The use of such universal reverse
primers is discussed, for example, in Chen et al., U.S.
Non-Provisional application Ser. No. 10/947,460, and Ser. No.
11/142,720 to Chen et al.
[0044] In some embodiments the present teachings provide a reaction
composition comprising at least three species of reverse stem-loop
ligation probes, wherein the at least three species of reverse
stem-loop ligation probes vary from each other in the sequence of
the 3' target-specific portion, wherein the at least three species
of reverse stem-loop ligation probes vary from each other in the
sequence of their stem, and wherein the at least three species of
reverse stem-loop ligation probes vary from each other in the
sequence of their loop. In some embodiments, the at least three
species of reverse stem-loop ligation probes each comprise an
extension blocker, a degradable nucleotide, or both an extension
blocker and a degradable nucleotide. In some embodiments, the 3'
target-specific portion comprises the extension blocker, and the
stem comprises the degradable nucleotide. In some embodiments, the
3' target-specific portion of each of the at least three species of
reverse stem-loop ligation probes is complementary to an
ShRNA-derived siRNA. In some embodiments, the reaction composition
can comprise at least four reverse stem-loop ligation probes, at
least five reverse stem-loop ligation probes, at least ten reverse
stem-loop ligation probes, at least fifty reverse stem-loop
ligation probes, at least one-hundred reverse stem-loop ligation
probes, at least two hundred reverse stem-loop ligation probes,
between four and one-hundred reverse stem-loop ligation probes,
between four and two-hundred reverse stem-loop ligation probes, or
between four and three-hundred reverse stem-loop ligation
probes.
[0045] In some embodiments, the present teachings provide a
reaction composition comprising at least three species of reverse
stem-loop primers, wherein the at least three species of reverse
stem-loop primers vary from each other in the sequence of the 3'
target-specific portion, wherein the at least three species of
reverse stem-loop primers vary from each other in the sequence of
their stem, and wherein the at least three species of reverse
stem-loop primers vary from each other in the sequence of their
loop. In some embodiments, the at least three species of reverse
stem-loop primers each comprise a degradable nucleotide. In some
embodiments, the stem comprises the degradable nucleotide. In some
embodiments, the 3' target-specific portion of each of the at least
three species of reverse stem-loop ligation probes is complementary
to an ShRNA-derived siRNA.
Certain Exemplary Kits
[0046] The instant teachings also provide kits designed to expedite
performing certain of the disclosed methods. Kits may serve to
expedite the performance of certain disclosed methods by assembling
two or more components required for carrying out the methods. In
certain embodiments, kits contain components in pre-measured unit
amounts to minimize the need for measurements by end-users. In some
embodiments, kits include instructions for performing one or more
of the disclosed methods. Preferably, the kit components are
optimized to operate in conjunction with one another.
[0047] Thus, in some embodiments the present teachings provide a
kit for amplifying at least three target polynucleotides, the kit
comprising at least three species of reverse stem-loop ligation
probes, wherein the at least three species of reverse stem-loop
ligation probes vary from each other in the sequence of the 3'
target-specific portion, wherein the at least three species of
reverse stem-loop ligation probes vary from each other in the
sequence of their stem, and wherein the at least three species of
reverse stem-loop ligation probes vary from each other in the
sequence of their loop. In some embodiments, the at least three
species of reverse stem-loop ligation probes comprise an extension
blocker, a degradable nucleotide, or both an extension blocker and
a degradable nucleotide. In some embodiments, the kit further
comprises a reverse transcriptase. In some embodiments, the kit
further comprises a polymerase. In some embodiments the kit further
comprises a reverse primer, a forward primer, and a detector
probe.
[0048] In some embodiments, the present teachings provide a kit for
amplifying at least two different target polynucleotides in a
family of target polynucleotides, wherein the at least two
different target polynucleotides in the family of target
polynucleotides vary in no more than two nucleotides in the last
nucleotides at their 3' end regions, the kit comprising at least
two species of reverse stem-loop ligation probes, wherein the two
species of reverse stem-loop ligation probes vary from each other
in their 3' target-specific portions. In some embodiments, the at
least two species of reverse stem-loop ligation probes vary from
each other in the sequence of the 3' target-specific portion,
wherein the at least two species of reverse stem-loop ligation
probes vary from each other in the sequence of their stem, and
wherein the at least two species of reverse stem-loop ligation
probes vary from each other in the sequence of their loop. In some
embodiments, the at least two species of reverse stem-loop ligation
probes comprise an extension blocker, a degradable nucleotide, or
both an extension blocker and a degradable nucleotide. In some
embodiments the kit further comprises a reverse transcriptase. In
some embodiments the kit further comprises a polymerase. In some
embodiments, the kit further comprises a reverse primer, a forward
primer, and a detector probe. In some embodiments the family of
target polynucleotides are ShRNA-derived siRNAs.
Example
TABLE-US-00001 [0049] TABLE 1 1. Ligation/kinase Items Stock
Reaction Volume (uL) RNA sample 3x (12 1x (4 2.50 ng/ul) ng/ul)
reverse stem-loop 150 nm 50 nm 2.50 ligation probe Ligation
Reaction Mix T4 polynucleotide 10 U/uL 0.5 U/uL 0.375 kinase (10
U/uL, NEB, M0201L) T4 DNA ligase 2000 U/uL 50 U/uL 0.188 (2000
U/uL, NEB, M0202M) T4 DNA Ligase buffer 10 x 1 x 0.750 (NEB,
B02025) AB RNase Inhibitor 20 U/uL 0.5 U/uL 0.188 (P/N: N8080119)
H2O 1.000 Total 7.50
Incubate at 16.degree. C. 130 min, 37.degree. C. 160 min, 4.degree.
C. on hold.
TABLE-US-00002 TABLE 2 2. Digestion Items Stock (u/ul) Mixture
Reaction Volume (ul) UNG (NEB, M0280L) 2 0.4 0.1 0.1 AB RNase
Inhibitor 20 0.5 0.125 (P/N: N8080119) T4 DNA Ligase buffer 10 1
0.25 (NEB, B02025) H20 2.025 Total 2.50
Add 2.5 ul of UNG mix to 7.5 ul of ligation mix, 37.degree. C. 160
min, 4.degree. C. on hold.
TABLE-US-00003 TABLE 3 3. RT Items Stock [1x] Volume (uL) RT primer
5 um 1 um 3.00 Ligation-digestion 3 x 1 x 5.00 Product RT Enzyme
Mix dNTPs with dTTP 25 mM each 0.25 mM each 0.150 (P/N: 8080261)
MultiScribe Reverse 50 x 3.33 x 1.000 Transcriptase (P/N: 4319983)
10X RT Buffer 10 x 1 x 1.500 (P/N: 4319981) AB RNase Inhibitor 20
U/uL 0.25 U/uL 0.188 (P/N: N8080119) Nuclease-free dH2O 4.163 Total
15.00
Incubate at 45.degree. C. for 45 min, 85.degree. C./5 min,
4.degree. C. on hold
TABLE-US-00004 TABLE 4 4. PCR Items Stock [1x] Volume (uL) RT
products 15 x 1 x 2.00 2X TaqMan Master Mix, No UNG 2 x 1 x 15.00
(P/N: 4324018) 10X Ppi mixture 10 x 1 x 3.00 Nuclease-free dH2O
10.00 Total 30.00
Transfer 10 ul to each well in 384-well plate, duplicate. Cycling
at 95.degree. C./10 min, [95.degree. C./15 sec, 60.degree. C./60
sec].times.40 cycles. Use FAM as reporter, at 7900HT.
TABLE-US-00005 TABLE 5 ID Sequence Reverse stem- Sh1AS-m2_L6
GACGCAAAGGAAGAGTGGGAGCGTGC(dU)(dU)C loop ligation
(dU)(dU)CC(dU)(dU)(dU)GCGTCGCGGAG(NH2) probe [SEQ ID NO: 1]
Sh1AS-m1_L6 CCAGGCAAGAAGCCGCCAACCTCTCG(dU)(dU)C
C(dU)(dU)C(dU)(dU)GCCTGGAGCGGA(NH2) [SEQ ID NO: 2] Sh1AS-m0_L6
GAGGCAAGGAAGTGGCGGTAGCTGGC(dU)(dU)A
C(dU)(dU)CC(dU)(dU)GCCTCAAGCGG(NH2) [SEQ ID NO: 3] Sh1AS-p1_L6
GACAACGAGACACCTGCGAGTGACCC(dU)(dU)G
(dU)G(dU)C(dU)CG(dU)TGTCAAAGCG(NH2) [SEQ ID NO: 4] Sh1AS-p2_L6
GACGGCAAGGAGGTCCGCACTCTCCG(dU)(dU)C
C(dU)CC(dU)(dU)GCCGTCAAAAGC(NH2) [SEQ ID NO: 5] Forward primer
Sh1AS-m2_F CGCGCTCTTCGTCGCTG [SEQ ID NO: 6] Sh1AS-m1_F
CGCGCTCTTCGTCGCTG [SEQ ID NO: 7] Sh1AS-m0_F CGCGCTCTTCGTCGCTG [SEQ
ID NO: 8] Sh1AS-p1_F CGCGCTCTTCGTCGCTG [SEQ ID NO: 9] Sh1AS-p2_F
CGCGCTCTTCGTCGCTG [SEQ ID NO: 10] Reverse PCR Sh1AS-m2_LR
GCACGCTCCCACTCTTC [SEQ ID NO: 11] primer Sh1AS-m1_LR
GAGAGGTTGGCGGCT [SEQ ID NO: 12] Sh1AS-m0_LR CAGCTACCGCCACTTC [SEQ
ID NO: 13] Sh1AS-p1_LR GGGTCACTCGCAGGTG [SEQ ID NO: 14] Sh1AS-p2_LR
GAGAGTGCGGACCTCC [SEQ ID NO: 15] TaqMan probe Sh1AS-m2_T
(6-FAM)CTTTGCGTCGCGGAGA(MGB) [SEQ ID NO: 16] Sh1AS-m1_T
(6-FAM)CTTGCCTGGAGCGGAGA(MGB) [SEQ ID NO: 17] Sh1AS-m0_T
(6-FAM)TTGCCTCAAGCGGAGAC(MGB) [SEQ ID NO: 18] Sh1AS-p1_T
(6-FAM)TCGTTGTCAAAGCGGAG(MGB) [SEQ ID NO: 19] Sh1AS-p2_T
(6-FAM)TGCCGTCAAAAGC(MGB) [SEQ ID NO: 20] RT primer Sh1AS-m2_RT
GCACGCTCCCACTCTTC [SEQ ID NO: 21] Sh1AS-m1_RT GAGAGGTTGGCGGCTT [SEQ
ID NO: 22] Sh1AS-m0_RT GCCAGCTACCGCCACT [SEQ ID NO: 23] Sh1AS-p1_RT
GGGTCACTCGCAGGTGT [SEQ ID NO: 24] Sh1AS-p2_RT CGGAGAGTGCGGACCTC
[SEQ ID NO: 25] Reverse stem- has-mir-137-m2_L5
GCACTGATGGCAGACCGATCCTTGGTTGCA(dU) loop ligation
(dU)(dU)C(dU)GCCA(dU)CAG(dU)GCACGCG(NH2) probe [SEQ ID NO: 26]
has-mir-137-m1_L5 TTACCGACGTCAGAGCCCAGTCTAATCGCA(dU)
(dU)(dU)C(dU)GACG(dU)CGG(dU)AATACGC(NH2) [SEQ ID NO: 27]
has-mir-137-m0_L5 GGACCCATGTCAGACCTCACACACTACCTG(dU)
(dU)(dU)C(dU)GACA(dU)GGG(dU)CCCTACG(NH2) [SEQ ID NO: 28]
has-mir-137-p1_L5 GGACTGATCGCAGAGAGCAAGCAGTTCACT(dU)
(dU)(dU)C(dU)GCGA(dU)CAG(dU)CCACTAC(NH2) [SEQ ID NO: 29]
has-mir-137-p2_L5 GCAGCGATCTCAGAGGCTCGTGATCATGAA(dU)
(dU)(dU)C(dU)GAGA(dU)CGC(dU)GCGACTA(NH2) [SEQ ID NO: 30]
has-mir-100-m2_L5 GGACTGATGGCAGACGGATCGTTGGTTGCT(dU)
(dU)(dU)C(dU)GCCA(dU)CAG(dU)CCCAAGT(NH2) [SEQ ID NO: 31]
has-mir-100-m1_L5 TTACGGACGTCAGAGCCCAGTCTAATCGCA(dU)
(dU)(dU)C(dU)GACG(dU)CCG(dU)AAACAAG(NH2) [SEQ ID NO: 32]
has-mir-100_m0_L5 TTAGGCAGGTCAGACATCGTACCCTACCAG(dU)
(dU)(dU)C(dU)GACC(dU)GCC(dU)AACACAA(NH2) [SEQ ID NO: 33]
has-mir-100-p1_L5 GGACTGATCGCAGAGAGCAAGCAGTACTCT(dU)
(dU)(dU)C(dU)GCGA(dU)CAG(dU)CCCCACA(NH2) [SEQ ID NO: 34]
has-mir-100-p2_L5 GCAGTGACCTCAGAGGGAGCTGATCATGAA(dU)
(dU)(dU)C(dU)GAGG(dU)CAC(dU)GCACCAC(NH2) [SEQ ID NO: 35] Forward
primer has-mir-137-m2_F GCTCCGCTATTGCTTAAGAATACGC [SEQ ID NO: 36]
has-mir-137-m1_F GCTCCGCTATTGCTTAAGAATACGC [SEQ ID NO: 37]
has-mir-137-m0_F GCTCCGCTATTGCTTAAGAATACGC [SEQ ID NO: 38]
has-mir-137-p1_F GCTCCGCTATTGCTTAAGAATACGC [SEQ ID NO: 39]
has-mir-137-p2_F GCTCCGCTATTGCTTAAGAATACGC [SEQ ID NO: 40]
has-mir-100-m2_F GCCGAACCCGTAGATCCGAA [SEQ ID NO: 41]
has-mir-100-m1_F GCCGAACCCGTAGATCCGAA [SEQ ID NO: 42]
has-mir-100_m0_F GCCGAACCCGTAGATCCGAA [SEQ ID NO: 43]
has-mir-100-p1_F GCCGAACCCGTAGATCCGAA [SEQ ID NO: 44]
has-mir-100-p2_F GCCGAACCCGTAGATCCGAA [SEQ ID NO: 45] TaqMan probe
has-mir-137-m2_T (6-FAM)TGCCATCAGTGCACG(MGB) [SEQ ID NO: 46]
has-mir-137-m1_T (6-FAM)TGACGTCGGTAATACG(MGB) [SEQ ID NO: 47]
has-mir-137-m0_T (6-FAM)TGACATGGGTCCCTACG(MGB) [SEQ ID NO: 48]
has-mir-137-p1_T (6-FAM)TGCGATCAGTCCACTAC(MGB) [SEQ ID NO: 49]
has-mir-137-p2_T (6-FAM)TGAGATCGCTGCGACTA(MGB) [SEQ ID NO: 50]
has-mir-100-m2_T (6-FAM)TGCCATCAGTCCCAAGT(MGB) [SEQ ID NO: 51]
has-mir-100-m1_T (6-FAM)TGACGTCCGTAAACAA(MGB) [SEQ ID NO: 52]
has-mir-100_m0_T (6-FAM)TGACCTGCCTAACACAA(MGB) [SEQ ID NO: 53]
has-mir-100-p1_T (6-FAM)TGCGATCAGTCCCCACA(MGB) [SEQ ID NO: 54]
has-mir-100-p2_T (6-FAM)TGAGGTCACTGCACCAC(MGB) [SEQ ID NO: 55] RT
primer/PCR has-mir-137-m2_R TGCAACCAAGGATCGGTC [SEQ ID NO: 56]
reverse primer has-mir-137-m1_R TGCGATTAGACTGGGCTC [SEQ ID NO: 57]
has-mir-137-m0_R CAGGTAGTGTGTGAGGTC [SEQ ID NO: 58]
has-mir-137-p1_R AGTGAACTGCTTGCTCTC [SEQ ID NO: 59]
has-mir-137-p2_R TTCATGATCACGAGCCTC [SEQ ID NO: 60]
has-mir-100-m2_R AGCAACCAACGATCCGTC [SEQ ID NO: 61]
has-mir-100-m1_R TGCGATTAGACTGGGCTC [SEQ ID NO: 62]
has-mir-100_m0_R CTGGTAGGGTACGATGTC [SEQ ID NO: 63]
has-mir-100-p1_R AGAGTACTGCTTGCTCTC [SEQ ID NO: 64]
has-mir-100-p2_R TTCATGATCAGCTCCCTC [SEQ ID NO: 65]
[0050] Although the disclosed teachings have been described with
reference to various applications, methods, and kits, it will be
appreciated that various changes and modifications may be made
without departing from the teachings herein. The foregoing examples
are provided to better illustrate the present teachings and are not
intended to limit the scope of the teachings herein. Certain
aspects of the present teachings may be further understood in light
of the following claims.
Sequence CWU 1
1
65147DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic probe 1gacgcaaagg aagagtggga gcgtgcuucu uccuuugcgt
cgcggag 47247DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic probe 2ccaggcaaga agccgccaac ctctcguucc
uucuugcctg gagcgga 47347DNAArtificial SequenceDescription of
Combined DNA/RNA Molecule Synthetic probe 3gaggcaagga agtggcggta
gctggcuuac uuccuugcct caagcgg 47447DNAArtificial
SequenceDescription of Combined DNA/RNA Molecule Synthetic probe
4gacaacgaga cacctgcgag tgacccuugu gucucgutgt caaagcg
47547DNAArtificial SequenceDescription of Combined DNA/RNA Molecule
Synthetic probe 5gacggcaagg aggtccgcac tctccguucc uccuugccgt
caaaagc 47617DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 6cgcgctcttc gtcgctg 17717DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7cgcgctcttc gtcgctg 17817DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 8cgcgctcttc gtcgctg
17917DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9cgcgctcttc gtcgctg 171017DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10cgcgctcttc gtcgctg 171117DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 11gcacgctccc actcttc
171215DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12gagaggttgg cggct 151316DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13cagctaccgc cacttc 161416DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 14gggtcactcg caggtg
161516DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15gagagtgcgg acctcc 161616DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
16ctttgcgtcg cggaga 161717DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 17cttgcctgga gcggaga
171817DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 18ttgcctcaag cggagac 171917DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
19tcgttgtcaa agcggag 172013DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 20tgccgtcaaa agc
132117DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 21gcacgctccc actcttc 172216DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22gagaggttgg cggctt 162316DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 23gccagctacc gccact
162417DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 24gggtcactcg caggtgt 172517DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25cggagagtgc ggacctc 172651DNAArtificial SequenceDescription of
Combined DNA/RNA Molecule Synthetic probe 26gcactgatgg cagaccgatc
cttggttgca uuucugccau cagugcacgc g 512751DNAArtificial
SequenceDescription of Combined DNA/RNA Molecule Synthetic probe
27ttaccgacgt cagagcccag tctaatcgca uuucugacgu cgguaatacg c
512851DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic probe 28ggacccatgt cagacctcac acactacctg
uuucugacau ggguccctac g 512951DNAArtificial SequenceDescription of
Combined DNA/RNA Molecule Synthetic probe 29ggactgatcg cagagagcaa
gcagttcact uuucugcgau caguccacta c 513051DNAArtificial
SequenceDescription of Combined DNA/RNA Molecule Synthetic probe
30gcagcgatct cagaggctcg tgatcatgaa uuucugagau cgcugcgact a
513151DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic probe 31ggactgatgg cagacggatc gttggttgct
uuucugccau cagucccaag t 513251DNAArtificial SequenceDescription of
Combined DNA/RNA Molecule Synthetic probe 32ttacggacgt cagagcccag
tctaatcgca uuucugacgu ccguaaacaa g 513351DNAArtificial
SequenceDescription of Combined DNA/RNA Molecule Synthetic probe
33ttaggcaggt cagacatcgt accctaccag uuucugaccu gccuaacaca a
513451DNAArtificial SequenceDescription of Combined DNA/RNA
Molecule Synthetic probe 34ggactgatcg cagagagcaa gcagtactct
uuucugcgau caguccccac a 513551DNAArtificial SequenceDescription of
Combined DNA/RNA Molecule Synthetic probe 35gcagtgacct cagagggagc
tgatcatgaa uuucugaggu cacugcacca c 513625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
36gctccgctat tgcttaagaa tacgc 253725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
37gctccgctat tgcttaagaa tacgc 253825DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
38gctccgctat tgcttaagaa tacgc 253925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
39gctccgctat tgcttaagaa tacgc 254025DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40gctccgctat tgcttaagaa tacgc 254120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
41gccgaacccg tagatccgaa 204220DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 42gccgaacccg tagatccgaa
204320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 43gccgaacccg tagatccgaa 204420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
44gccgaacccg tagatccgaa 204520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 45gccgaacccg tagatccgaa
204615DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 46tgccatcagt gcacg 154716DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
47tgacgtcggt aatacg 164817DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 48tgacatgggt ccctacg
174917DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 49tgcgatcagt ccactac 175017DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
50tgagatcgct gcgacta 175117DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 51tgccatcagt cccaagt
175216DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 52tgacgtccgt aaacaa 165317DNAArtificial
SequenceDescription of Artificial Sequence Synthetic probe
53tgacctgcct aacacaa 175417DNAArtificial SequenceDescription of
Artificial Sequence Synthetic probe 54tgcgatcagt ccccaca
175517DNAArtificial SequenceDescription of Artificial Sequence
Synthetic probe 55tgaggtcact gcaccac 175618DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
56tgcaaccaag gatcggtc 185718DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 57tgcgattaga ctgggctc
185818DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 58caggtagtgt gtgaggtc 185918DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
59agtgaactgc ttgctctc 186018DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 60ttcatgatca cgagcctc
186118DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 61agcaaccaac gatccgtc 186218DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
62tgcgattaga ctgggctc 186318DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 63ctggtagggt acgatgtc
186418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 64agagtactgc ttgctctc 186518DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
65ttcatgatca gctccctc 18
* * * * *